Stem Cell Research 41 (2019) 101590

Contents lists available at ScienceDirect

Stem Cell Research

journal homepage: www.elsevier.com/locate/scr

Lab Resource: Stem Cell Line

Generation of hiPSC line TCIERi001-A from normal human epidermal T

keratinocytes
⁎
Rupendra Shresthaa,b, Yao-Tseng Wenb, Rong-Kung Tsaia,b,
a
Institute of Medical Sciences, Tzu Chi University, Hualien 970, Taiwan
b
Institute of Eye Research, Hualien Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation, Hualien 970, Taiwan

A B S T R A C T

Human induced pluripotent stem cell (hiPSC) line TCIERi001-A was generated from normal human epidermal keratinocytes (NHEK) primary cell line with the
nonintegrating system using Sendai reprogramming kit. Sendai particles were used to deliver the defined transcription factors that included three vector prepara-
tions, such as polycistronic KLF4–OCT3/4–SOX2, cMYC, and KLF4.

Resource table Ethical approval Normal Human Epidermal Keratinocytes (NHEK) adult,
single donor (PromoCell GmbH, Heidelberg, Germany,
cat. No. C-12003).
Unique stem cell line i- TCIERi001-A
dentifier
Alternative name(s) of IER-EK1 1. Resource utility
stem cell line
Institution Institute of Eye Research, Hualien Tzu Chi Hospital, hiPSCs derived from normal epidermal keratinocytes was used to
Hualien, Taiwan generate the ectodermal derivatives, such as retinal organoids and
Contact information of Rupendra Shrestha, dph.rupendra@gmail.com
retinal pigment epithelium as a source of therapeutic cells.
distributor Yao-Tseng Wen, ytw193@gmail.com
Rong-Kung Tsai, rktsai@tzuchi.com.tw
Type of cell line Induced Pluripotent Stem Cells 2. Resource details
Origin Human
Additional origin info Age: Adult
Normal human epidermal keratinocytes (NHEK) primary cell line
Sex: Female
Ethnicity if known: N/A
was purchased from PromoCell GmbH (cat. No. 12003) and maintained
Cell source Epidermal keratinocytes in EpiLife medium containing human keratinocytes growth supplement
Clonality Clonal (HKGS). Non-integrative reprogramming system was performed using
Method of reprogram- CytoTune™-iPS 2.0 Sendai reprogramming kit (Invitrogen, commercially available CytoTune™-iPS 2.0 Sendai reprogramming kit.
ming Carlsbad, CA, USA, cat. No. A16517)
The system contains Sendai virus particles to deliver defined tran-
Genetic modification NO
Type of modification N/A scription factors into cells that contain three vector preparations, such
Associated disease N/A as polycistronic KLF4–OCT3/4–SOX2, cMYC, and KLF4. The experi-
Gene/locus N/A mental timeline for the generation of hiPSCs from epidermal kerati-
Method of modification N/A
nocytes is illustrated in Fig. 1A. Morphologically identical round hiPSC
Name of transgene or r- N/A
esistance
colonies (Fig. 1B, scale bar 200 μm) with tightly packed cells were
Inducible/constitutive s- N/A observed within 10–12 days. Immunofluorescence analysis of colonies
ystem demonstrated the expression of pluripotency markers such as OCT4,
Date archived/stock da- April 2017 SOX2, SSEA4, NANOG, and TRA1-60 (Fig. 1B, scale bar 200 μm). Fur-
te
ther, counting of immunofluorescence positive cells showed 94.9% of
Cell line repository/ba- https://hpscreg.eu/cell-line/TCIERi001-A
nk OCT4, 94.6% of SOX2, 95.8% of NANOG, 94.7% of SSEA4, and 94.9%
of TRA1-60 expression in TCIERi001-A (Fig. 1C, supplementary
Table 1). Also, the relative expression normalized with β-actin (ACTB)

⁎
Corresponding author at: Institute of Medical Sciences, Tzu Chi University, Hualien 970, Taiwan.
E-mail address: rktsai@tzuchi.com.tw (R.-K. Tsai).

https://doi.org/10.1016/j.scr.2019.101590
Received 20 May 2019; Received in revised form 10 September 2019; Accepted 17 September 2019
Available online 15 October 2019
1873-5061/ © 2019 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/BY-NC-ND/4.0/).
R. Shrestha, et al. Stem Cell Research 41 (2019) 101590

Fig. 1. Charcaterization of TCIERi001-A line.

for pluripotency-associated endogenous genes, such as OCT4, SOX2,
and NANOG were confirmed using quantitative PCR (Fig. 1E). hiPSC
line was negative at passage 10 for Sendai viral vector (SeV) and
transgenes expression (KOS, KLF4, cMYC) confirmed by RT-PCR
(Fig. 1D). In vitro differentiation of hiPSCs into embryoid body (EB)
(Fig. 1G, scale bar 200 μm) was used as a standard functional assay
alternative to teratoma assay to assess the ability of hiPSC to form an
amalgam of developmental germ layers. Immunohistochemical analysis
also revealed the expression of markers for mesoderm (BRACHYURY),
endoderm (GATA4) and ectoderm (NESTIN) (Fig. 1G, scale bar
150 μm). Chromosomal analysis of hiPSC at passage 4 showed the
normal diploid karyotype (46,XX) (Fig. 1F) and investigation of copy
number variations (CNV) demonstrated the normal genomic integrity
(Fig. 1H). Absence of mycoplasma contamination of the hiPSC at
passage 4 and epidermal keratinocytes was confirmed by RT-PCR
(supplementary Fig. 1). Also, short tandem repeat (STR) analysis with
all 16 loci tested confirmed the same number of repeats identical be-
tween hiPSCs and parental NHEK cell line. Furthermore, hiPSC-derived
EBs were tested for the differentiation potential to form ectodermal
derivatives and successfully generated the retinal organoids (BRN3A/
AP2α), and retinal cells, such as retinal pigment epithelium cells
(OCCLUDIN) and retinal ganglion cells (BRN3A/TUBB3) (Fig. 1I, scale
bar 200 μm).

2
R. Shrestha, et al. Stem Cell Research 41 (2019) 101590

Table 1
Characterization and validation.
Classification Test Result Data

Morphology Photography Normal Fig. 1

panel B
Phenotype Qualitative analysis Positive for pluripotency markers: OCT4, NANOG, SOX2, SSEA4, Fig. 1
(immunocytochemistry) TRA-1-60 panel B
Quantitative analysis (immunofluorescence Percentage of cell positive for pluripotency markers: TCIERi001-A: Fig. 1
counting and RT-PCR) OCT4, 94.9%; SOX2, 94.6%; NANOG, 95.8%; SSEA4, 94.7%; TRA1- panel C and E
60, 94.9% supplementary Table 1
Expression of pluripotency genes: OCT4, SOX2, and NANOG
Genotype Karyotype (G-banding) and resolution 46XX, Resolution 400 Fig. 1
Normal panel F
Identity Microsatellite PCR (mPCR) OR STR analysis Not performed N/A
16 sites tested, all matched available with authors
Mutation analysis (if Sequencing Not performed N/A
applicable) Southern Blot OR WGS Not performed N/A
Microbiology and virology Mycoplasma Mycoplasma testing by real-time PCR: negative supplementary Fig. 1
Differentiation potential Embryoid body formation and directed Expression of germ layer markers (endoderm: GATA4, Mesoderm: Fig. 1
differentiation BRACHYURY, Ectoderm: NESTIN) Panel G and I
Expression of retinal cell markers (BRN3A, AP2α, TUBB3,
OCCLUDIN)
Donor screening (optional) HIV 1 + 2 Hepatitis B, Hepatitis C Not performed N/A
Genotype additional info Blood group genotyping Not performed N/A
(optional) HLA tissue typing Not performed N/A

Table 2
Reagents details.
Antibodies used for immunocytochemistry
Antibody Dilution Company Cat # and RRID

Pluripotency markers
Pluripotency markers
Pluripotency markers
Pluripotency markers
Pluripotency markers
Differentiation markers
Differentiation markers
Differentiation markers
Differentiation markers
Differentiation markers
Differentiation markers
Differentiation markers
Secondary antibodies
Secondary antibodies
Secondary antibodies
Secondary antibodies
Secondary antibodies
Secondary antibodies
Primers
Sendai virus&&&(RT-PCR)
Sendai virus&&&(RT-PCR)
Sendai virus&&&(RT-PCR)
Sendai virus&&&(RT-PCR)
House-keeping gene&&&(RT-
PCR)
Pluripotency marker (qPCR)
Pluripotency marker (qPCR)
Pluripotency marker (qPCR)
House-keeping gene (qPCR)
Goat anti-OCT4 1:200 Abcam Cat# ab27985, RRID: AB_776898
Mouse Alexa Fluor® 647 anti-SOX2 Antibody 1:200 BioLegend Cat# 656108, RRID:AB_2563681
Rabbit anti-NANOG 1:200 Millipore Cat# AB9220, RRID:AB_570613
Mouse anti-SSEA4 1:300 Millipore Cat# MAB4304, RRID:AB_177629
Mouse anti-TRA-1-60 1:100 Thermo Fisher Scientific Cat# 41-1000, RRID:AB_2533494
Rabbit anti-Brachyury 1:200 Abcam Cat# ab20680, RRID:AB_727024
Rabbit anti-GATA4 1:200 Millipore Cat# AB4132, RRID:AB_2108750
Rabbit anti-Nestin 1:100 Sigma-Aldrich Cat# N5413, RRID:AB_1841032
Rabbit anti-Occludin 1:200 Abcam Cat# ab31721, RRID:AB_881773
Mouse anti-AP2α 1:50 Thermo Fisher Scientific Cat# MA1-872, RRID:AB_2199412
Rabbit anti-TUBB3 1:1000 Covance Research Products Inc Cat# PRB-435P-100, RRID:AB_291637
Mouse anti-Brn3a 1:20 Millipore Cat# MAB1585, RRID:AB_94166
Donkey anti-Goat IgG (H + L) Cross-Adsorbed Secondary 1:500 Thermo Fisher Scientific Cat# A-11055, RRID:AB_2534102
Antibody, Alexa Fluor 488
Donkey anti-Goat IgG (H + L) Cross-Adsorbed Secondary 1:500 Thermo Fisher Scientific Cat# A-21432, RRID:AB_2535853
Antibody, Alexa Fluor 555
Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed 1:500 Thermo Fisher Scientific Cat# A-21202, RRID:AB_141607
Secondary Antibody, Alexa Fluor 488
Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed 1:500 Thermo Fisher Scientific Cat# A-31570, RRID:AB_2536180
Secondary Antibody, Alexa Fluor 555
Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed 1:500 Thermo Fisher Scientific Cat# A-21206, RRID:AB_2535792
Secondary Antibody, Alexa Fluor 488
Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed 1:500 Thermo Fisher Scientific Cat# A-31572, RRID:AB_162543
Secondary Antibody, Alexa Fluor 555
Target Forward/reverse primers (5′−3′)
SeV GGATCACTAGGTGATATCGAGCACCAGACAAGAGTTTAAGAGATATGTATC
KOS ATGCACCGCTACGACGTGAGCGCACCTTGACAATCCTGATGTGG
KLF4 TTCCTGCATGCCAGAGGAGCCCAATGTATCGAAGGTGCTCAA
cMYC TAACTGACTAGCAGGCTTGTCGTCCACATACAGTCCTGGATGATGATG
GAPDH ACCACAGTCCATGCCATCACTCCACCACCCTGTTGCTGTA
OCT4 CAGTGCCCGAAACCCACACGGAGACCCAGCAGCCTCA
SOX2 GGGAAATGGGAGGGGTGCAAAAGAGGTTGCGTGAGTGTGGATGGGATTGGTG
NANOG GAGAAGGCCTCAGCACCTACATTGTTCCAGGTCTGGTTGC
ACTB AGAGCTACGAGCTGCCTGACAGCACTGTGTTGGCGTACAG

3. Materials and methods
3.1. Keratinocytes culture and iPSC generation
NHEK primary cell line was purchased from PromoCell GmbH
(Heidelberg, Germany) and maintained in type I collagen (Invitrogen,
USA) precoated plates containing EpiLife medium (Invitrogen, USA)
supplemented with HKGS (Invitrogen, USA). Keratinocytes were re-
programmed using CytoTune-iPS 2.0 Sendai reprogramming kit as de-
scribed previously (Shrestha et al., 2019). For the reprogramming

3
R. Shrestha, et al.
experiment, 5 × 104 cells were seeded in the precoated 6-well plates
containing EpiLife medium without antibiotics. Once, 30–40% con-
fluency was achieved with small clusters of 5–6 keratinocytes; the cells
were transduced with a cocktail of three vector preparations at an MOI
of 4:4:2, KLF4–OCT3/4–SOX2:cMYC:KLF4 in the prewarmed EpiLife
medium. After 24 h post infection, the cells were washed with 1X
Dulbecco's PBS (-Ca2+/Mg2+) (Gibco, USA) and fed with fresh EpiLife
medium. At day 7, the cells were passaged with TrypLE (Gibco, USA)
and 2 × 104 cells/well were seeded onto rhVTN-N (Gibco, USA)-coated
plates in EpiLife medium. Next day onward, the cells were fed daily
with chemically defined E8 medium (Gibco, USA) containing 10 μM Y-
27632 (Merck Millipore, USA) in feeder-free condition. At approxi-
mately 10–12 days, hiPSC colonies were manually picked and dis-
sociated using 0.5 mM EDTA (Invitrogen, USA). These dissociated cells
were clonally expanded on freshly prepared vitronectin-coated plates.
Further, hiPSCs were expanded at the split ratio of 1:6 every 5–6 days.
The cells were cultured in standard growth conditions at 37 °C in a 5%
CO2 incubator.
3.2. In vitro formation of embryoid bodies and trilineage differentiation
hiPSC colonies were dissociated into small clumps using 0.5 mM
EDTA and cultured in suspension with chemically defined E8 medium
containing 10 μM Y-27632 in ultralow adhesion 6-well plates (Corning,
Lowell, MA, USA). On the following day, the cells clumped to form EBs-
like hiPSC aggregates. The EBs were maintained in suspension for 10
days. After that, Cryosection of EBs were performed as described pre-
viously (Shrestha et al., 2019) and immunofluorescence staining was
done to examine the expression of three germ layer markers.
3.3. Differentiation of hiPSC-derived EBs to ectodermal derivatives
Differentiation into ectodermal derivatives was performed as de-
scribed previously (Shrestha et al., 2019), EBs were differentiated into
morphologically identical optic cups (OCs) and/or bipotent retinal
progenitor cells (BRPCs). These cells were cultured in a suspension
containing retinal differentiation medium (RDM) to form organoids.
Further, OCs were used for the generation of retinal neurons, and
BRPCs with centrally pigmented cells were harvested to produce RPE
cells (Table 1).
3.4. Immunofluorescence analysis
Cells were fixed with 4% paraformaldehyde for 30 min at RT, wa-
shed twice and incubated in blocking buffer (1.5% BSA, 0.05% gelatin,
0.25% Triton X 100, 0.025% Tween 20) for 45 min at RT. The cells were
then treated with primary antibodies (diluted in 1.5% BSA) at 4 °C for
overnight. Next day, the cells were washed and then treated with Alexa
Fluor-conjugated secondary antibodies (diluted in 1.5% BSA) for 1 h in
the dark at RT. Again, the cells were washed and counterstained with
DAPI (Sigma, St. Louis, MO, USA). A final wash was performed,
mounted with DPX (Sigma, St. Louis, MO, USA) and coverslipped.
Fluorescence images were acquired using an A1+ confocal microscope
(Nikon). Antibodies that were used are listed in Table 2 (see reagent
details).
3.5. RT-PCR analysis for SeV vectors
Total RNA was extracted from hiPSCs at passage 10 using PureLink
Mini kit (Invitrogen, CA, USA) according to manufacturer re-
commended protocol. Then, cDNA was synthesized from 1 μg RNA
using iScript cDNA synthesis kit (Bio-Rad, USA). Then, cDNA was am-
plified with OnePCR reaction mixture (GeneDirex), and SeV-specific
primers. Standard RT-PCR was performed on the Mastercycler Gradient
96 Thermocycler (Eppendorf Scientific) following optimized PCR
Stem Cell Research 41 (2019) 101590
conditions of 35 cycles: 94 °C × 30 s for denaturation, 55 °C × 30 s for
annealing and 72 °C × 30 s for extension. The detection of transgenes
expression was analyzed using agarose gel electrophoresis. NHEK cells
transfected with Sendai viral vector for 6 days was used as positive
control.
3.6. Quantitative real-time polymerase chain reaction (qPCR)
cDNA was synthesized using iScript cDNA synthesis kit (Bio-Rad,
USA) and amplified for qPCR with an Fast SYBR™ Green Master Mix
(Applied Biosystems, Thermo Fisher Scientific) and primers for plur-
ipotency genes as listed in Table 2 (see reagent details). The qPCR was
performed with a QuantStudio 3 (Applied Biosystems, Thermo Fisher
Scientific). ACTB was used to normalize the relative expression of
pluripotency genes and compared the expression level with iPS 98A10.
3.7. Karyotype
Brifiely, hiPSCs from passage 4 were cultured for overnight and
arrested in a metaphase using Colcemid as described previously
(Shrestha et al., 2019). Further, 12 metaphase were analyzed at 400
band resolution using a standard G-banded karyotyping.
3.8. Digital PCR pluri test
Genomic DNA was extracted from hiPSC in duplicate using a
QIAamp DNA mini kit (QIAGEN GmbH, Germany) according to the
manufacturer's recommended protocol. Then, samples were sent to
Stem Genomics—Bio-incubateur Cyborg—IRMB—Hôpital Saint Eloi,
France to detect the copy number variations in hiPSCs. The test is based
on the principle of using target-specific 24 probes in the chromosome.
3.9. Mycoplasma test
DNA samples were sent to Department of Laboratory Medicine,
Hualien Tzu Chi Hospital. Real-Time PCR was performed to detect 16S
rRNA gene using standard laboratory developed test (LDT).
3.10. Short tandem repeat (STR) analysis
DNA of both parental keratinocytes and hiPSCs were sent to
GenePhile Bioscience Co., Ltd. Taipei, Taiwan for STR analysis. Loci
tested were D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01,
D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, AMEL,
D5S818, and FGA.
Declaration of Competing Interest
The authors have no conflicts of interest to declare.
Acknowledgment
This research was funded by the Buddhist Tzu Chi Medical
Foundation (Hualien, Taiwan) under research grant TCMMP104-05-01.
Supplementary materials
Supplementary material associated with this article can be found, in
the online version, at doi:10.1016/j.scr.2019.101590.
References
Shrestha, R., Wen, Y.-T., Ding, D.-C., Tsai, R.-K., 2019. Aberrant hiPSCs-Derived from
human keratinocytes differentiates into 3D retinal organoids that acquire mature
photoreceptors. Cells 8, E36. https://doi.org/10.3390/cells8010036.