Appl Microbiol Biotechnol (2009) 82:1143–1156
DOI 10.1007/s00253-009-1909-8
APPLIED MICROBIAL AND CELL PHYSIOLOGY
The role of oxygen in yeast metabolism
during high cell density brewery fermentations
P. J. Verbelen & S. M. G. Saerens & S. E. Van Mulders &
F. Delvaux & F. R. Delvaux
Received: 11 December 2008 / Revised: 3 February 2009 / Accepted: 3 February 2009 / Published online: 5 March 2009
# Springer-Verlag 2009
Abstract The volumetric productivity of the beer fermen-
tation process can be increased by using a higher pitching
rate (i.e., higher inoculum size). However, the decreased
yeast net growth observed in these high cell density
fermentations can have a negative impact on the physio-
logical stability throughout subsequent yeast generations.
The use of different oxygen conditions (wort aeration, wort
oxygenation, yeast preoxygenation) was investigated to
improve the growth yield during high cell density fermen-
tations and yeast metabolic and physiological parameters
were assessed systematically. Together with a higher extent
of growth (dependent on the applied oxygen conditions),
the fermentation power and the formation of unsaturated
fatty acids were also affected. Wort oxygenation had a
significant decreasing effect on the formation of esters,
which was caused by a decreased expression of the alcohol
acetyl transferase gene ATF1, compared with the other
conditions. Lower glycogen and trehalose levels at the end
of fermentation were observed in case of the high cell
density fermentations with oxygenated wort and the
P. J. Verbelen (*) : S. M. G. Saerens : S. E. Van Mulders :
F. Delvaux : F. R. Delvaux
Centre for Malting and Brewing Science,
Faculty of Bioscience Engineering,
Katholieke Universiteit Leuven,
Kasteelpark Arenberg 22, Box 2463, 3001 Heverlee, Belgium
e-mail: Pieter.Verbelen@biw.kuleuven.be
S. M. G. Saerens
Laboratory of Molecular Cell Biology (VIB),
Department of Molecular Microbiology,
Institute of Botany and Microbiology,
Katholieke Universiteit Leuven,
Kasteelpark Arenberg 31,
3001 Heverlee, Belgium
reference fermentation. The expression levels of BAP2
(encoding the branched chain amino acid permease), ERG1
(encoding squalene epoxidase), and the stress responsive
gene HSP12 were predominantly influenced by the high
cell concentrations, while OLE1 (encoding the fatty acid
desaturase) and the oxidative stress responsive genes SOD1
and CTT1 were mainly affected by the oxygen availability
per cell. These results demonstrate that optimisation of high
cell density fermentations could be achieved by improving
the oxygen conditions, without drastically affecting the
physiological condition of the yeast and beer quality.
Keywords Fermentation . Brewer’s yeast .
Yeast physiology . Stress response . Oxygen .
Flavour compounds
Introduction
In the traditional production of lager beer, the fermentation
process is the most time-consuming step, which takes about
1–2 weeks before entering the maturation period. Therefore,
an important objective of modern fermentation science and
technology is to reduce the fermentation time while
producing an end product of similar quality and thus
allowing great time and money savings. To improve the
volumetric productivity of the beer fermentation process, a
promising strategy may be the enhancement of the amount of
suspended yeast cells in a batch fermentor (i.e., increasing
“the pitching rate”; Okabe et al. 1992; Verbelen et al. 2008).
Previous research on high cell density (HCD) fermenta-
tions revealed that the fermentation time could be signifi-
cantly reduced (Okabe et al. 1992; Edelen et al. 1996; Erten
et al. 2007; Verbelen et al. 2008). Despite the observation
of a slightly higher stress response during fermentations
1144
pitched with higher yeast concentrations, Verbelen et al.
(2009a) concluded that the yeast physiological condition
was only moderately affected by high cell densities.
However, to ensure the reuse and quality of the resulting
yeast slurry after fermentation, adequate yeast growth must
be ensured. Higher cell concentrations in the initial phase of
the fermentations result in a lower build-up of unsaturated
fatty acids per cell, which causes a decreased yeast net
growth (Verbelen et al. 2009a). It is hypothesised that
oxygen availability is decreased when high concentrations
of yeast cells are present (Edelen et al. 1996). Therefore, an
optimisation of the oxygen supply could improve the
sustainability of HCD fermentations.
The major role of oxygen in brewery fermentations is to
promote the biosynthesis of unsaturated fatty acids (UFA)
and sterol, which are required for adequate yeast growth
during fermentation (Boulton and Quain 2001). In tradi-
tional brewing, yeast is cropped after fermentation and
stored for reuse in subsequent fermentations. Cropped yeast
cells contain insufficient sterols and UFA and therefore
oxygen supplementation is needed to ensure optimal
fermentation performance (Moonjai et al. 2002). Sterols
and UFA regulate the membrane fluidity and permeability.
They also influence the activity of membrane-bound
enzymes and affect the response to stress (Swan and
Watson 1998; Chatterjee et al. 2000; Jones et al. 2005). If
oxygen becomes limiting, the sterol content decreases
through yeast growth and below a threshold of 0.1% (w/w)
no further growth is possible (Aries and Kirsop 1977).
Regarding critical UFA levels, Casey et al. (1984) and Ohno
and Takahashi (1986) found UFA levels between 4.8 and
7.6 mg/g at the end of fermentation.
Normally, oxygen is provided through wort aeration or
oxygenation prior to pitching. This technique, however, has
several drawbacks, such as over-aeration or under-aeration,
leading to inconsistent fermentations. To avoid these short-
comings, yeast can be oxygenated in a controlled process
before fermentation, thereby removing the requirement for
subsequent wort oxygenation (Masschelein et al. 1995;
Boulton et al. 2000; Depraetere et al. 2003).
Paradoxical to the need of oxygen for lipid biosynthesis,
oxygen can cause yeast degeneration through the formation
of highly reactive oxygen species (ROS; O2·−, H2O2, OH·).
ROS can attack cellular compounds (DNA, lipids, sugar,
and proteins) and can lead to cell death. To protect against
oxidative damage, cells possess defense mechanisms,
including enzymes, such as peroxidases, catalases, and
superoxide dismutases, and antioxidants such as glutathione
and vitamins. Genes such as SOD1, SOD2, CTT1, CTA1,
GSH1, GLR1, GRX1, and GRX2 are involved in the
oxidative stress response (Gibson et al. 2008). Different
transcription factors have been involved in the regulation of
gene expression under oxidative stress. Msn2/4 are tran-
Appl Microbiol Biotechnol (2009) 82:1143–1156
scription factors of the general stress response, which bind
with the STRE (CCCCT) sequence (Martinez-Pastor et al.
1996). Msn2/4 are negatively regulated by the cyclic
adenosine monophosphate–protein kinase A (cAMP-PKA)
pathway (Smith et al. 1998). STRE sequences have been
identified in promoter sections of many stress-induced genes,
such as heat shock protein (HSP) genes (e.g., HSP12 and
HSP104), CTT1, and genes that contribute to the synthesis
(TPS1, TPS2, TPS3, and TSL1) and degradation (NTH1,
NTH2) of trehalose (Winderickx et al. 1996; Zähringer et al.
1997). Furthermore, Yap1 is a specific transcription factor,
which can bind to the antioxidant response element
(TGACTCA) sequence (Estruch 2000).
In this study, different oxygenation conditions were
applied to HCD fermentations to investigate the role of
oxygen on yeast physiology and metabolism in these
fermentation types. Because it is believed that the oxygen
availability is limited in high cell density worts, the
application of preoxygenated yeast was also investigated.
Specific gene expression and physiological parameters
were monitored predominantly in the first hours of
fermentation because this period determines the further
course of fermentation. These results are crucial in
elucidating the physiological behavior of yeast in high
cell density populations and for the application of HCD
fermentations in the brewing industry.
Materials and methods
Yeast strain and medium
The study was carried out with an industrial lager brewing
strain of Saccharomyces cerevisiae (pastorianus;
CMBSPV09; Katholieke Universiteit Leuven, Centre for
Malting and Brewing Science, Heverlee, Belgium),
obtained from a brewery yeast storage vessel.
Sterile all-malt hopped wort with an extract content of
15°P (gram extract per 100 g wort; 53% maltose, 33%
maltotriose, 9% glucose, 4% sucrose) and with a free amino
nitrogen (FAN) content of 291 ppm was made in a pilot
brewery. After centrifugation (3,000 rpm, 3 min), the wort
was decantated. This wort had a reduced fatty acid content
(0.1 ppm C16:0, 2.6 ppm C16:1, 0.6 ppm C18:0, 2.9 ppm
C18:1, 1.6 ppm C18:2, and 0.2 ppm C18:3) and was used
throughout the study.
Fermentation conditions and sampling
Yeast preoxygenation was performed at 20°C in a mem-
brane loop reactor, according to Depraetere et al. (2003).
Yeast slurries (3 l; 75–80% moisture) were circulated at
750 ml/min during 5 h. Oxygen was delivered to the slurry
Appl Microbiol Biotechnol (2009) 82:1143–1156
via the membrane sparger to obtain an oxygen concentra-
tion of 8 mg/l in the slurry. Maltose (3%) was added to the
yeast solution prior to preoxygenation.
Five different experimental conditions were examined in
this study (Table 1). The worts were sparged with air, oxygen
or nitrogen, for 10 min before pitching. Four different
oxygenation conditions were applied to HCD fermentations
(pitching rate 80×106 cells/ml): (1) non-preoxygenated yeast
with aerated wort (A/NP), (2) non-preoxygenated yeast with
oxygenated wort (O/NP), (3) preoxygenated yeast with
oxygen-depleted wort (N/PR), (4) preoxygenated yeast
with aerated wort (A/PR). In addition, a reference
fermentation (REF; pitching rate 20×106 cells/ml, non-
preoxygenated yeast with wort aeration) was taken along.
The dissolved oxygen concentration of each medium was
measured with an oxygen sensor (Oxi 340/SET, WTW,
Weinheim, Germany). The concentration and viability of the
yeast slurries were determined by flow cytometry (Yeast-
Cyte, BioDETECT AS, Oslo, Norway) before the required
amount was pitched in the wort. All fermentations were
carried out in duplicate, in tall tubes (75 cm tall, 8 cm
internal diameter), containing 1.8 l sterile 15°P wort
medium. The fermentations were performed at 15°C and
were monitored frequently by withdrawing samples through
a narrow sampling tube (15 cm from the bottom) with the
aid of N2 overpressure. Samples were cooled directly on ice
and the yeast and fermenting wort were separated by
centrifugation (2,800 rpm, 3 min, 2°C). Fermentations were
stopped at around 80% apparent degree of fermentation
(ADF) and the tubes were cooled down at 2°C for 24 h to
sediment the yeast. The supernatant of the tube (beer) was
collected and the remaining slurry was resuspended in 1 l cold
sterile water, after which samples were taken to characterise
the cropped yeast.
Fermentation analysis
Before centrifugation, the number and the viability of
suspended yeast cells was counted by flow cytometry
(YeastCyte, BioDETECT AS, Oslo, Norway). Dead cells
were stained in-line with 1% (v/v) propidium iodide in
phosphate-buffered saline (70355, Sigma).
Table 1 Properties of the five
Test condition Sparging gas
different experimental
conditions
A/NP Air
O/NP Oxygen
N/PR Nitrogen
A/PR Air
REF Air
1145
The specific gravity of the fermenting medium was
measured with a handheld density meter (DMA 35N, Anton
Paar, Graz, Austria), but the final extract and alcohol
content were measured with the DMA 4500 density
analyzer and Alcolyser Plus (Anton Paar, Graz, Austria).
FAN was determined by a ninhydrin-based method,
according to the standard method as defined by the
European Brewery Convention (EBC-Analytica 1998).
Volatile compound concentrations were determined by
headspace gas chromatography. The vials were analysed
with a calibrated Autosystem XL gas chromatograph with a
headspace autosampler (HS40; Perkin Elmer, Wellesley,
MA, USA), equipped with a Chrompack-Wax 52 CB
column (length 50 m; 0.32-mm internal diameter; layer
thickness 1.2 μm; Varian, Palo Alto, CA, USA) and a flame
ionization detector (FID) and an electron capture detector.
Analyses were carried out in duplicate and the results were
analysed with Perkin Elmer Turbochrom Navigator soft-
ware and were recalculated to 5% (v/v) ethanol.
Yeast physiology
Fatty acid analysis
Total fatty acids [palmitic acid (C16:0), palmitoleic acid
(C16:1), stearic acid (C18:0), oleic acid (C18:1), and
linoleic acid (C18:2)] of frozen yeast pellets were extracted
following the procedure of Moonjai et al. (2002). Gas
chromatography was done with a calibrated Varian 300
analyzer (Varian, Palo Alto, Ca, USA) equipped with a 30-
m length, 0.32-mm internal diameter, 0.25-μm film
thickness, Alltech Heliflex AT-225 capillary column (All-
tech Associated, Inc., Deerfield, IL, USA) and a FID
(Verbelen et al. 2009a). Fatty acid concentrations were
calculated as mg/g cell dry weight (CDW). The fatty
acid analysis of each fermentation sample was done in
duplicate.
Glycogen and trehalose analysis
The quantification of glycogen and trehalose was per-
formed simultaneously following the method of Neves
Oxygen concentration Pitching yeast Pitching rate
in the wort (ppm) (cells per milliliter)
7.8 Non-preoxygenated 80×106
51.8 Non-preoxygenated 80×106
0.8 Preoxygenated 80×106
7.8 Preoxygenated 80×106
7.8 Non-preoxygenated 20×106
1146 Appl Microbiol Biotechnol (2009) 82:1143–1156

et al. (1991) with some changes. Yeast samples were
washed three times with cold distilled water. Afterwards,
the yeast suspension was filtered over a membrane filter
(pore size 0.45 μm) and 25–50 mg (wet weight) of cell
pellet was weighed and immediately stored at −80°C. The
extraction of glycogen and trehalose, the enzymatic
breakdown with α-amyloglucosidase (500 units/mg; Roche
Diagnostics, Indianapolis, IN, USA) and trehalase
(2,100 units/ml; E-TREH, Megazyme, Wicklow, Ireland),
and measurement of final glucose concentrations were
performed as described elsewhere (Verbelen et al. 2009a).
The results are expressed as percent of wet weight (ww).
Glycogen and trehalose analysis of each sample was done
in triplicate.
Quantitative PCR
The expression levels of specific genes (Table 2) were
determined using quantitative polymerase chain reaction
(qPCR). Samples were collected from the tall tubes after 1
and 4.5 h and at an ADF of 35% and 50% (exponential
phase), cooled on ice, and centrifuged at 3,000 rpm for
3 min. The pellets were washed two times with cold sterile
RNase-free water and 150×106 pelleted cells were then
frozen at −80°C. RNA extraction, reverse transcription, and
making the reaction mix was performed as described before
(Verbelen et al. 2009a). The PCR program used on the ABI
Prism 7500 instrument (Applied Biosystems) consisted of
an initial denaturation of 10 min at 95°C, amplification by
40 cycles of 15 s at 95°C, and 1 min at 58°C. The primers
were designed to anneal close to the 3’-end of each gene.
The PCR primers were all designed with the Primer
Express software (Applied Biosystems, Cheshire, UK)
according to the Applied Biosystems guidelines. Primer
sequences used for qPCR analysis are given in Table 2. The
specificity of the primers was tested using conventional
PCR and the melting curves of the amplified product. The
gene for 18S rRNA (RDN18) was used as the reference
gene. The expression levels were determined using the ABI
Prism 7500 System Gene Quantification Software (Applied
Biosystems) through quantification of Sybr Green fluores-
cence. A standard curve of each gene was constructed with
genomic DNA of CMBSPV09. The expression levels of the
different genes were normalised with respect to 18S
expression levels and are means of two independent
fermentation samples, each consisting of three replicates
of the PCR reaction.
Results
The impact of oxygen on yeast metabolism in HCD
fermentations was evaluated, using a normal-fermenting
moderately flocculating industrial lager brewery yeast strain
(CMBSPV09) selected from a previous study (Verbelen et
al. 2008).
Fermentation characteristics
The progress of the fermentations with different pitching
rates is depicted in Fig. 1. The time required to reach an
ADF of 80% was approximately 270 h for the REF with an
inoculum size of 20×106 viable cells/ml and between 50
and 70 h for the HCD fermentations. The A/NP condition
had the longest HCD fermentation time of approximately
70 h, followed by the conditions with preoxygenated yeast
(N/PR 58 h; A/PR 52 h). The fastest fermentation rate was
observed in the case of the O/NP condition (46 h). In
general, the higher pitching rate had a larger impact on the
fermentation rate than the oxygen conditions.
In Fig. 2a, the net growth pattern (maximal cell count
minus the initial inoculum size) of the different conditions
are shown. The lowest net growth was obtained in the case
of the A/NP condition, which was 28% lower than N/PR,
40% lower than REF, 45% lower than A/PR, and 60%

Table 2 Genes, their products, and primer sequences of those used for qPCR analysis (from 5′ to 3′)

Gene Product Forward primer sequence Reverse primer sequence

RDN18 18S ribosomal RNA CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCT

HSP12 12-kDa heat shock protein AGGTAGAAAAGGATTCGGTGAAAA TGTATTCCTTACCTTGTTCAGCGTAT
CTT1 Cytosolic catalase T GTCAGGCTCCCACCCTGAT TTTTCGCCATTTTGCAATTG
SOD1 Cu/Zn superoxide dismutase TGATCAAGCTTATCGGTCCTACCT GCCGGCGTGGATAACG
ERG1 Squalene epoxidase TCCAAAGAGGTGGCGATTG CTTTGGCAAGACACCAGACAGA
OLE1 Δ9 fatty acid desaturase TCAAATGCCGCTCAAAATGTC AGCAGAGTTCTTACTTTCCTTGATAACA
ATF1 Alcohol acetyltransferase GTACGAGGAGGATTACCA ATG ATCTCGGTGACAAC
BAP2 Branched-chain amino acid permease TGGTTGGCCTTTTACTTCGGA TTCGTCCTCTTGTCTCATTAG
ILV2 Acetohydroxy acid synthase TGAACAATGAAGAGCAAGGTATGG GTGGGAATAACGATGTTCGTAGAA
ILV5 Acetohydroxy acid reductoisomerase ACGGTGAAAGAGGTTGTTTA CCGATCAATGGGTATAGAGA
Appl Microbiol Biotechnol (2009) 82:1143–1156 1147

With respect to the flavour compounds (Table 3), the

concentrations of higher alcohols are positively influenced
by the pitching rate (Edelen et al. 1996; Verbelen et al. 2008).
However, no large differences were found between the
different oxygen conditions applied to the HCD fermentations.
The lowest concentration of the ethyl acetate ester, which
has a solvent-like flavour and a threshold of 30 ppm, was
found in the O/NP condition, which was 31% lower than the
highest concentrations found in the reference fermentation.
Maximum concentrations of isoamyl acetate (banana-like
flavour, threshold 1.2 ppm) were found in N/PR and A/PR.
Less isoamyl acetate (30%) was found in O/NP, compared

Fig. 1 Decrease of sugar density (n=2; expressed as °P) as a function

of time (filled circles = non-preoxygenated yeast, aerated wort (A/NP);
empty circles = non-preoxygenated yeast, oxygenated wort (O/NP);
filled triangles = preoxygenated yeast, deaerated wort (N/PR); empty
triangles = preoxygenated yeast, aerated wort (A/PR); filled
squares = reference (REF)). In the box, the decrease of density of
the different HCD fermentations is enlarged to emphasize the subtle
differences between them

lower than the O/NP condition. Hence, the oxygen

conditions had a significant impact on the extent of yeast
growth in the HCD fermentations. These results were
confirmed when the total biomass (which was the sum of
the yeast in suspension and the flocculated yeast formed
during fermentation) was measured at the end of fermen-
tation (results not shown).
The viability of the yeast population was monitored
during fermentation (results not shown) and remained
similar for the different fermentations. When the total
biomass was characterised at the end of the fermentation,
the cell viability was also measured (Fig. 2b). The HCD
fermentations showed similar viabilities at the end of
fermentation, but the REF condition showed a slightly
decreased percentage of living cells. This indicates that the
long duration of fermentation had a negative influence on
the yeast viability but that yeast viability remained at an
acceptable level in all fermentations.
The total FAN uptake levels were 68% enhanced when
higher than normal pitching rates were used (Fig. 2c). The
highest FAN uptake was found in the O/NP fermentation
condition and was 15% higher than the other HCD
fermentations, which were not significantly different.
Table 3 shows the results of the beer analysis for pH and
aroma compounds in the fermentations performed. Despite
the large differences in net growth, the observed yields of

ethanol were identical Yp=s ¼ 0:565
0:008%ðv=vÞ  P .
The pH of the beer was inversely correlated with the extent
Fig. 2 a Net growth (maximal cell count minus the initial pitching
of net growth and FAN uptake in the HCD fermentations.
rate) patterns (in 106 cells/ml; n=2), b cell viability (in % living cells;
The highest final pH was found in the REF fermentation n=2) of the total yeast populations after fermentation, and c FAN
condition. uptake (in ppm; n=2) of the different fermentations
1148 Appl Microbiol Biotechnol (2009) 82:1143–1156

Table 3 Final alcohol, pH, and

aroma concentrations in the Oxygen conditions
different fermentations
performed A/NPa O/NPa N/PRa A/PRa REFa

Alcohol (% v/v) 6.62±0.02 6.72±0.06 6.46±0.03 6.72±0.01 6.73±0.01

pH 4.28±0.01 4.16±0.01 4.25±0.01 4.22±0.01 4.51±0.03
Flavour profile
Acetaldehyde (ppm) 4.96±0.02 2.57±0.24 7.00±0.80 4.25±0.19 7.48±1.46
DMS (ppb) 15.0±0.4 11.7±0.5 11.4±0.7 12.6±0.3 16.8±0.4
Higher alcohols (ppm)
Propanol 11.4±0.2 13.0±0.2 12.1±0.2 11.8±1.0 11.1±0.1
Isobutanol 8.59±0.12 8.64±0.22 8.27±0.03 7.80±0.67 6.66±0.10
Isoamyl alcohol 54.9±0.9 58.9±0.3 57.9±1.0 56.6±2.5 44.5±0.6
Total higher alcohols 74.9±1.2 80.6±0.7 78.3±1.2 76.2±4.3 62.3±0.8
Esters (ppm)
Values of all the flavour com- Ethyl acetate 24.9±0.5 19.2±0.5 22.8±0.1 21.6±0.6 27.9±0.5
pounds have been recalculated
based on the normal ethanol Isoamyl acetate 1.30±0.03 1.12±0.06 1.44±0.02 1.38±0.04 1.19±0.06
percentage in lager beers (=5% Ethyl caproate 0.17±0.01 0.12±0.01 0.18±0.01 0.15±0.00 0.16±0.01
v/v) Total esters 26.4±0.6 20.5±0.6 24.4±0.1 23.2±0.6 29.3±0.6
a
These different conditions are Diacetyl (ppb) 528±2 334±7 626±6 538±10 60.9±16.8
described in Table 1.

with the highest level found (N/PR). As can be noticed,
isoamyl acetate was inversely correlated with the oxygen
availability per cell. Concerning ethyl caproate (apple-like
flavour, threshold 0.2 ppm), the lowest concentration was
also measured in the O/NP condition. In contrast with ethyl
acetate, isoamyl acetate and ethyl caproate were not
negatively affected by the applied high pitching rate.
Slightly higher DMS concentrations were observed in
the REF condition, which is in correspondence with earlier
results (Verbelen et al. 2008). The acetaldehyde concen-
trations at the end of fermentation showed no direct trend
with the applied conditions.
The total diacetyl (diacetyl + α-acetolactate) levels in
HCD fermentations were drastically increased compared to
the reference fermentation, which was also observed in
earlier studies (Okabe et al. 1992; Verbelen et al. 2009a).
Diacetyl can cause a buttery off-flavour above its threshold
of 80 ppb. Surprisingly, the total diacetyl level of the O/NP
condition was significantly lower during (results not
shown) and after fermentation than the other HCD
fermentations. It was expected that the higher uptake levels
of FAN in this fermentation condition (Fig. 2c) should
enhance the formation of α-acetolactate, thereby resulting
in higher levels of total diacetyl.
Yeast physiological parameters
Fatty acid profiles
In Fig. 3, the fatty acid profiles of the yeast populations are
shown for the five conditions in the course of the first part
of the fermentation. Since the wort was centrifuged, the
levels of exogenous lipids were reduced compared with a
normal wort. Hence, the increase in UFA content of the
yeast in the beginning of the fermentation was due to
biosynthesis and not to assimilation. The increase of the
unsaturated fatty acid C16:1 and C18:1 content was
strongly influenced by the pitching rate and the oxygen
conditions. In case of the A/NP condition, the sum of the
concentrations of C16:1 and C18:1 increased from 5.03 mg/
g CDW to 8.33 mg/g CDW in 4.5 h. With respect to the O/
NP fermentation, the UFA content increased from 6.33 to
13.36 mg/g CDW in 4.5 h. During preoxygenation, the
levels of UFA increased by 53% (results not shown).
Without wort aeration (N/PR), no build-up of C16:1 and
C18:1 was observed during fermentation; the level of these
UFAs was at its maximum (8.06 mg/g CDW) in the
beginning of fermentation. With wort aeration (A/PR), a
further build-up of UFA during the aerobic phase of the
fermentation was observed (from 8.16 mg/g CDW to
9.49 mg/g CDW in the first 2.5 h). Although the same
oxygen levels were supplemented to the wort, the reference
fermentation was characterised by a much higher formation
of C16:1 and C18:1 (from 5.68 mg/g CDW to 14.39 mg/g
CDW in 2.5 h) in comparison with A/NP and A/PR. In the
following anaerobic phase of the fermentation, the newly
synthesised membrane lipids were distributed over mother
and daughter cells until the UFA content dropped to a
growth limiting concentration (Casey et al. 1984). Indeed, a
higher maximum level of UFA in the HCD fermentations
was consistent with a higher yeast net growth (Figs. 2a
and 3). The final UFA levels towards the end of fermentation
Appl Microbiol Biotechnol (2009) 82:1143–1156 1149

Fig. 3 Fatty acid profiles

(in mg/g cell dry weight
(CDW)) as a function of time
(n=2). a Non-preoxygenated
yeast, aerated wort (A/NP);
b Non-preoxygenated yeast,
oxygenated wort (O/NP);
c Preoxygenated yeast,
deaerated wort (N/PR);
d Preoxygenated yeast, aerated
wort (A/PR); e Reference
(REF). Fatty acids: filled
circles = C16:0, empty
circles = C16:1, filled
triangles = C18:0, empty
triangles = C18:1, and filled
squares = C18:2

in case of O/NP were significantly higher than in the other
conditions (Fig. 3b), suggesting that in this condition other
nutrients (e.g., fermentable carbohydrates) were limiting at
that point.
Glycogen and trehalose content
The general trend of glycogen during brewery fermentation
consists of a first intense initial period of breakdown,
followed by accumulation in the exponential phase (Boulton
2000). The REF fermentation followed this trend (Fig. 4a).
When the pitching rate increased, this typical profile was
more leveled out: the initial breakdown after 4.5-h fermenta-
tion was less intense, compared with the reference fermen-
tation (Fig. 4a, white bars) and no significant differences
were found between the HCD fermentations with different
oxygen conditions. After fermentation, the glycogen content
was measured again (Fig. 4a, grey bars). As can be seen, the
lowest glycogen levels were found in case of the REF
fermentation and this level was 21% lower than O/NP, 38%
lower than N/PR, 41% lower than A/PR, and 45% lower
than A/NP. Despite a similar glycogen level reached during
exponential phase (results not shown), the low final concen-
trations in the reference fermentation were caused by a
prolonged stationary phase.
Initially (4.5 h after pitching), trehalose levels were
minimal and no significant differences were found between
the various fermentations (Fig. 4b, white bars). Afterwards,
the disaccharide accumulated towards the end of fermenta-
tion, which corresponds with the literature (Majara et al.
1996). In Fig. 4b (grey bars), the trehalose level of the total
yeast population after fermentation is depicted. A/NP
reached the highest trehalose level (1.84% ww). N/PR and
A/PR had similar final trehalose values (average 1.55%
ww) and were significantly higher (24%) than O/NP and
REF (average 1.25% ww).
1150
Fig. 4 Glycogen (a) and trehalose contents (b) (in % of wet weight)
of the yeast suspensions 4.5 h after pitching (white bars) and of the
total yeast populations after the different conducted fermentations
(grey bars; n=3)
Gene expression analysis
At four time points in the fermentation (1 h, 4.5 h, and time
points corresponding to an ADF of 35% and 50%), yeast
samples were taken and expression of HSP12, CTT1, SOD1,
OLE1, ERG1, ATF1, BAP2, ILV2, and ILV5 was monitored
by qPCR (Fig. 5).
As can be seen from Fig. 5a, the expression level of
HSP12 was low in the initial lag phase but increased during
exponential phase. Higher expression levels of HSP12 were
observed in the yeast cells from the HCD conditions,
although no significant differences in HSP12 expression are
observed between the different applied oxygen conditions
in the HCD fermentations. HSP12 has been evaluated for
the use as a molecular marker for stress resistance (Ivorra et
al. 1999).
In Fig. 5b, CTT1 expression is depicted. CTT1 encodes
the cytosolic catalase T, which catalyses the breakdown of
hydrogen peroxide to oxygen and water. CTT1 is associated
with the oxidative stress response, through the transcription
factors Yap1 and Skn7, and the general stress response
(STRE dependent; Estruch 2000). In general, the CTT1
expression peaked in the lag phase. The highest expression
levels were found in case of the O/NP condition 1 h after
pitching, followed by the REF fermentations 4.5 h after
Appl Microbiol Biotechnol (2009) 82:1143–1156
pitching. The lowest expression level in the lag phase was
found in case of N/PR. The A/NP fermentation had a
similar peak value.
Superoxide dismutase, encoded by SOD1 and SOD2,
catalyses the conversion of the superoxide anion to oxygen
and hydrogen peroxide (Van Loon et al. 1986) and are both
associated with the oxidative stress response (Herrero et al.
2008). In the O/NP condition, SOD1 gene expression
increased drastically in the first hour after pitching
(Fig. 5c). The REF fermentation possessed the second
highest peak value after 4.5 h. This suggests that the
response of oxygen in case of the reference fermentation
came a bit later than in the HCD fermentations. In case of
the A/NP, A/PR, and N/PR fermentations, the expression of
SOD1 remained low.
The expression of OLE1, which encodes the oxygen
dependent fatty acid desaturase, was very high throughout
the whole experiment (Fig. 5d), although maximum levels
were found after 4.5 h. The highest peak was observed in
N/PR, which is in accordance with the fact that OLE1 is
known as a hypoxic gene (Zitomer et al. 1997; Kwast et al.
1998). The second highest level of expression was found in
the REF condition, which was similar to the A/NP and A/
PR fermentations. A low relative level of expression was
found in case of the O/NP fermentation condition. No direct
correlation could therefore be found between the formation
of UFA and expression of OLE1 (Fig. 3 vs. 5c).
ERG1 (squalene epoxidase) catalyses the oxygen-
dependent epoxidation of squalene to 2,3-oxidosqualene
and plays an essential role in the ergosterol biosynthesis
pathway. Surprisingly, expression of ERG1, which is
induced with increased oxygen availability and upon sterol
limitation (Jahnke and Klein 1983; M’Baya and Karst
1987), was drastically increased after a few hours after
pitching in the REF condition (Fig. 5e). However, after
4.5 h, the medium was already depleted of oxygen in the
REF fermentation (results not shown). On the other hand,
only small differences were observed in the different HCD
fermentations. Therefore, no direct connection existed
between ERG1 and oxygen availability in this study.
ATF1 encodes the alcohol acetyl transferase, an impor-
tant enzyme in the synthesis of ethyl acetate and isoamyl
acetate. ATF1 transcription is a limiting factor in the
synthesis of these esters (Verstrepen et al. 2003b; Saerens
et al. 2008). In this study, the expression profile of this gene
was similar with that of OLE1 (Fig. 5d vs. f). However, the
highest peak value was found in the REF fermentation 4.5 h
after pitching and not in N/PR, as was the case with OLE1.
The lowest expression peak level was found in the O/NP
condition. The ethyl acetate and isoamyl acetate concen-
trations were indeed lower in this fermentation condition.
The high ATF1 expression in the REF fermentation was
accompanied with significant higher concentrations ethyl
Appl Microbiol Biotechnol (2009) 82:1143–1156 1151

a 1.4 b 0.14
1.2 0.12

Expression relative to RDN18

Expression relative to RDN18

1.0 0.10

0.8 0.08

0.6 0.06

0.4 0.04

0.2 0.02

0.0 0.00
1h 4.5 h 35% 50% 1h 4.5 h 35% 50%

c 1.0 d 2.5
0.9
Expression relative to RDN18

Expression relative to RDN18

0.8 2.0

0.7
0.6 1.5

0.5

0.4 1.0
0.3

0.2 0.5
0.1
0.0 0.0
1h 4.5 h 35% 50% 1h 4.5 h 35% 50%

e 1.2 f 0.040

0.035
1.0
Expression relative to RDN18
Expression relative to RDN18

0.030
0.8
0.025

0.6 0.020

0.015
0.4
0.010
0.2
0.005

0.0 0.000
1h 4.5 h 35% 50% 1h 4.5 h 35% 50%

g 0.050 h 0.45
0.045 0.40
Expression relative to RDN18

0.040 0.35
0.035
0.30
0.030
ILV2/ILV5

0.25
0.025
0.20
0.020
0.15
0.015

0.010 0.10

0.005 0.05

0.000 0.00
1h 4.5 h 35% 50% 1h 4.5 h 35% 50%

Fig. 5 Expression profiles (n=4) of the genes HSP12 (a), CTT1 (b),
SOD1 (c), OLE1 (d), ERG1 (e), ATF1 (f), and BAP2 (g) and the ratio
of ILV2 and ILV5 expression at four fermentation points: (1) 1 h after
pitching, (2) 4.5 h after pitching, (3) when 35% ADF, and (4) 50%
ADF (exponential phase) was reached. (White bars) Non-
preoxygenated yeast, aerated wort (A/NP); (light grey bars)
non-preoxygenated yeast, oxygenated wort (O/NP); (dark grey bars)
preoxygenated yeast, deaerated wort (N/PR); (black bars) preoxy-
genated yeast, aerated wort (A/PR); (striped bars) reference (REF).
The expression levels are expressed relative to that of the housekeep-
ing gene RDN18
1152
acetate but not isoamyl acetate, confirming that other
factors (e.g., substrate availability) than ATF1 expression
also play an important role in the synthesis of esters
(Verstrepen et al. 2003a). In the exponential phase, the
expression levels of ATF1 decreased to low levels (Fig. 5f),
which confirms the outcome of other studies (Shen et al.
2003; Rautio et al. 2007; Saerens et al. 2008).
In addition, the expression of BAP2 was monitored
because the branched chain amino acid permease plays an
important role in the assimilation of important amino acids
(Grauslund et al. 1995) and in the production of higher
alcohols (Kodama et al. 2001). Surprisingly, BAP2 was
only highly expressed at 1 h after pitching (Fig. 5g). The
expression levels in the yeast cells of the REF fermentation
and of the O/NP fermentation were remarkably higher than
in the other fermentation conditions. The higher expression
of BAP2 in O/NP was accompanied by a higher FAN
uptake from the medium (Fig. 2c) but did not result in a
significant higher total production of isobutanol and
isoamyl alcohol (Table 3).
To investigate the role of ILV2 (encoding α-acetohydroxy
acid synthase) and ILV5 (encoding α-acetohydroxy acid
reductoisomerase) in the metabolism of diacetyl, their
expression levels were monitored (Fig. 5h). α-Acetolactate
is an overflow product between the reactions mediated by
Ilv2 and Ilv5 (Villanueba et al. 1990). Therefore, the ratio
ILV2/ILV5 was calculated from the expression data and is
depicted in Fig. 5h. This ratio was high in the beginning of
fermentation and decreased to a minimum. However, no
significant differences were found between the various
fermentation conditions. Therefore, no correlation was found
between the observed differences in the amount of total
diacetyl (Table 3) and the ILV2/ILV5 ratio (Fig. 5h).
Discussion
Higher initial cell concentrations increase the fermentation
speed, which creates a big economical advantage for the
breweries. However, to ensure the physiological stability of
the yeast populations, an adequate yeast growth is needed,
which could be accomplished by optimisation of the
oxygen conditions. Therefore, the purpose of this study
was to determine the impact of HCD fermentations with
different oxygen conditions on yeast fermentation perfor-
mance and beer quality.
Impact of HCD fermentations with different oxygen
conditions on fermentation performance and beer
characteristics
Adequate yeast growth is of critical importance for the
quality of the resulting beer and the stability of the yeast
Appl Microbiol Biotechnol (2009) 82:1143–1156
slurry that often is reused in subsequent fermentations. It
can be assumed that low growth rates will eventually lead
to older yeast populations, compared with normal pitched
wort, in which the yeast population increases two to three
times. Aged yeast cells are often associated with decreased
fermentation capacity, changed morphology, altered floccu-
lation patterns, and extended generation times (Barker and
Smart 1996; Powell et al. 2003). Improving the oxygen
conditions can result in a significant enhancement of yeast
growth during HCD fermentations for the production of
beer. From this study, it can be concluded that higher
oxygen levels are needed in the wort, pitched with high
yeast concentrations, to obtain a similar net growth
compared with a normal pitched fermentation. This sug-
gests that oxygen is a critical growth limiting factor in HCD
fermentations. To circumvent the problems associated with
wort aeration, the use of yeast preoxygenation was also
investigated in this study. During this process, the yeast
population is treated with oxygen in a low-nutrient
environment, stimulating the build-up of essential mem-
brane lipids. Therefore, the need of wort oxygenation or
aeration is abolished (Boulton et al. 2000). However, our
results show that yeast preoxygenation alone cannot
stimulate the same growth rate in HCD fermentations
compared with the reference fermentation. On the other
hand, yeast preoxygenation together with wort aeration
prior to HCD fermentation gives satisfying results. The fact
that high oxygen levels in HCD fermentation do not lead to
similar relative yeast growth (ratio of maximum cell count
and applied pitching rate) compared with the reference
conditions suggests that still other growth limiting factors
exist in HCD fermentations.
Acetate ester levels have previously been reported to be
negatively influenced by higher pitching rates (Suihko et al.
1993; Edelen et al. 1996; Verbelen et al. 2008) and by
higher levels of oxygen in the wort (Verstrepen et al.
2003a). In this study, it is confirmed that the production of
higher alcohols is stimulated and the ester ethyl acetate is
repressed by higher pitching rates (Verbelen et al. 2008).
Moreover, adding high levels of oxygen to the wort has a
negative impact on the synthesis of ethyl acetate, isoamyl
acetate, and ethyl caproate, which make up the consumer-
appreciated fruitiness of a lager beer. From that point of
view, preoxygenation seems to have a benefit against the
other conditions, for having the highest isoamyl acetate
levels, which has the highest flavour impact (ratio of
concentration and threshold).
The total diacetyl content is drastically higher in the
HCD fermentations, but wort oxygenation seems to have a
reductive effect on total diacetyl. As the chemical decar-
boxylation is the rate-limiting step in the metabolism of
diacetyl (Yamauchi et al. 1995), the higher residual
amounts in many accelerated fermentation systems can be
Appl Microbiol Biotechnol (2009) 82:1143–1156
explained by the short residence times (Okabe et al. 1992;
Willaert and Nedovic 2006; Verbelen et al. 2008). There-
fore, efficient strategies are needed to decrease the diacetyl
content in those beers (Willaert 2007).
Impact of HCD fermentations with different oxygen
conditions on yeast physiology
Varying the oxygen conditions of HCD fermentations has a
distinct effect on the resulting glycogen and trehalose
concentrations. Adding high amounts of oxygen to wort,
prior to HCD fermentations, decreases glycogen and to a
lesser extent also trehalose in the resulting yeast slurry.
Glycogen is an important physiological parameter because
it fuels the lipid synthesis in the early events of fermenta-
tion (Quain 1988). However, in the HCD fermentation with
wort oxygenation, similar peak levels of UFA are produced,
compared with the reference fermentation (Fig. 3b, e), while a
higher breakdown of glycogen occurs in the aerobic phase of
the reference fermentation. As exogenous carbohydrates are
already being taken up in the early hours of HCD
fermentations, a reason for the higher breakdown of glycogen
in the reference fermentation could be that both exogenous
and endogenous carbon sources are used for the build-up of
essential lipids in HCD fermentation. It can be hypothesised
that HCD fermentations can cope better with their glycogen
pool than a normal fermentation and that the lower build-up
of glycogen seen in the exponential phase of HCD
fermentations with wort oxygenation is caused by the high
growth rate, compared with the other HCD fermentations.
The response to stressful conditions during fermentation
in yeast depends on the activation of signal transduction
pathways, which result in transcriptional change and
synthesis of protective molecules. The expression levels
of the stress gene HSP12 and the accumulation of trehalose
in this study confirm the earlier reports by Verbelen et al.
(2009a) that the HCD yeast populations trigger a stress
response. However, between the different HCD fermenta-
tions, no significant differences were found in HSP12
expression, suggesting that this gene is not triggered by
high oxygen levels. The observed accumulation of the
stress protectant trehalose during the fermentations is most
likely a response to nutrient limitation and/or ethanol
toxicity (Boulton 2000). The trehalose level was only
different in the case of the HCD fermentation condition
with wort oxygenation. Higher trehalose levels are believed
to ensure yeast viability during the starvation period after
fermentation is completed and also during the fermentation
itself, which may lead to a reduction in fermentation time
(Guldfeldt and Arneborg 1998). As a consequence, lower
trehalose concentrations in the cropped slurry, could make
the yeast vulnerable to stresses associated with a new
fermentation.
1153
Monitoring the expression of oxidative stress related
genes SOD1 and CTT1 shows that SOD1 is predominantly
expressed in the early phase of the fermentations. Both
SOD1 and CTT1 are highly expressed when high oxygen
concentrations are added to the wort, which suggests that
the yeast populations respond to the high oxygen levels.
Other studies also report an induction of genes involved in
oxidative stress response during the period of aeration
(Higgins et al. 2003; Pérez-Torrado et al. 2009). Higher
expression levels of SOD1 and CTT1 do not necessarily
imply that yeast cells are exposed to oxidative stress. It is
the balance between ROS production and cell defenses that
determines the degree of oxidative stress (Jamieson 1998).
In this study, high expression levels of SOD1 and CTT1 do
not result in lower viabilities in the HCD yeast populations
with oxygenated wort and therefore we conclude that the
balance is in favor of the defense mechanisms. However,
ROS have been described as an important factor in aging of
yeast cells (Powell et al. 2000), influencing the life span of
yeast cells (Van Zandycke et al. 2002), and prolonged
exposure to these ROS could eventually result in an
inability to prevent cellular damage and cell death due to
an increase in oxidant production, a decline in antioxidant
defense mechanisms, or a decline in the efficiency of repair
mechanisms (Sohal and Weindruch 1996). Serial repitching
with excessive oxygen levels could have a negative
influence on the yeast and eventually lead to an accelerated
loss of viability in comparison with normal wort. Therefore,
optimum oxygen levels for high cell density fermentations
are therefore necessary, through the application of preox-
ygenation or moderate concentrations of oxygen in the
wort. In a recent study, performed by Verbelen et al.
(2009b), expression of stress responsive genes was moni-
tored during preoxygenation. These authors suggest that
yeast cells acquire a stress response during preoxygenation,
making them more resistant against the stressful conditions
during the subsequent fermentation. The observation that
expression levels of CTT1 and SOD1 and build-up of UFA
in the reference fermentation are higher compared with the
HCD fermentations with aerated wort indicates that oxygen
availability to the yeast cell is better in these fermentations
and that oxygen addition to yeast cells in HCD fermenta-
tions has to be improved.
Besides UFA, sterols are also formed in the beginning of
fermentation, when oxygen is available, through the action
of Erg1. We found only high expression of ERG1 in the
reference fermentation, when the medium is already
depleted of oxygen, suggesting that ERG1 expression is
not a determining factor in build-up of sterols.
OLE1 and ATF1 gene expression shows similar profiles
and similar oxygen dependence. This is in accordance with
the literature (Fuji et al. 1997; Fujiwara et al. 1998), in
which ATF1 transcription is found to be co-regulated by the
1154
same mechanism as the OLE1 gene and are both repressed
by oxygen and unsaturated fatty acids, though by a different
regulation pathway. High levels of expression are found in
case of preoxygenated yeast in anaerobic wort and low
levels in case of oxygenated wort, in accordance with the
fact that these are co-regulated hypoxic genes (Zitomer et al.
1997; Fujiwara et al. 1998). From the results of this study, it
also became clear that OLE1 gene expression is not
correlated with the amount of UFA formed. Several reasons
could be mentioned. First of all, OLE1 gene expression was
very high during the whole experiment even in the case of
oxygenated wort. Therefore, transcript levels of OLE1 are
not the rate limiting step in the formation of UFA, but the
need for molecular oxygen in the desaturation reaction
could be the limiting factor. Kajiwara et al. (2000) observed
only an increase of 7% of C18:1 when using an OLE1-
overexpressing strain. Secondly, OLE1 gene expression has
been shown to be dependent on several regulatory
sequences, such as STRE, O2R, fatty acid response
element, and low oxygen response element (Nakagawa et
al. 2001; Vasconcelles et al. 2001; Martin et al. 2006). The
expression of OLE1 is therefore difficult to interpret. In
contrast, ATF1 transcription levels correlated well with the
resulting concentrations of ethyl acetate, but other factors,
such as growth and thus acyl-CoA availability, probably
played an important role as well.
High expression levels of BAP2 in the reference
fermentation and in the HCD fermentations with wort
oxygenation suggest that uptake of branched chain amino
acids was enhanced in these conditions. However, we found
no correlation with the total uptake of FAN in the reference
fermentation (probably because the yeast concentration was
lower) nor in a higher production of higher alcohols in both
conditions.
In the initial phase of the fermentations, a relative
change in the expression of ILV2 and ILV5 occurred that
might promote accumulation of α-acetolactate, the precur-
sor for diacetyl. However, no differences in ILV2/ILV5
expression ratio are observed between the different fermen-
tations and thus no correlation with the final total diacetyl
content exists. It can be suggested that other factors, such as
yeast growth, enzymatic activity, and substrate composi-
tion, which are known to play a role in the diacetyl
metabolism, determine the extent of total diacetyl in this
experiment.
Taken together, this work provides evidence that
optimisation of the oxygen conditions prior to HCD
fermentation can efficiently increase the performance and
stability of these fermentations. Both wort oxygenation and
yeast preoxygenation with wort aeration give a high net
growth, ensuring the sustainability of HCD fermentations.
From a yeast physiological (higher glycogen and trehalose
content, less response to oxidative stress) and beer quality
Appl Microbiol Biotechnol (2009) 82:1143–1156
(less repression of ester synthesis) point of view, yeast
preoxygenation in combination with aeration seems to be
more advantageous, provided that efficient strategies are
adopted to decrease the diacetyl content. However, more
experimental work is needed to prove the physiological
stability of HCD populations in subsequent generations and
the technological feasibility at commercial scale.
Acknowledgements The authors wish to thank Stefan Van Loy for
the excellent help with the experiments. Financial support from the
Institute for the Promotion of Innovation through Science and
Technology in Flanders (IWT-Vlaanderen) is acknowledged.
References
Aries V, Kirsop BH (1977) Sterol synthesis in relation to growth and
fermentation by brewing inoculated at different concentrations. J
Inst Brew 83:220–223
Barker MG, Smart KA (1996) Morphological changes associated with
the cellular aging of a brewing strain. J Am Soc Brew Chem
54:121–126
Boulton C (2000) Trehalose, glycogen and sterol. In: Smart KA (ed)
Brewing yeast fermentation performance, 1st edn. Blackwell
Science, Oxford, pp 10–19
Boulton C, Quain D (2001) Brewing yeast and fermentation. Black-
well Science, Oxford
Boulton C, Clutterbuck V, Durnin S (2000) Yeast oxygenation and
storage. In: Smart KA (ed) Brewing yeast fermentation perfor-
mance, 1st edn. Blackwell Science, Oxford, pp 140–151
Casey GP, Magnus CA, Ingledew WM (1984) High-gravity brewing:
effects on nutrition on yeast composition, fermentative ability
and alcohol production. Appl Environ Microbiol 48:639–646
Chatterjee MT, Khalawan SA, Curran BPG (2000) Cellular lipid
composition influences stress activation of the yeast general
stress response element (STRE). Microbiology 146:877–884
Depraetere SA, Winderickx J, Delvaux FR (2003) Evaluation of the
oxygen requirement of lager and ale yeast strains by preoxyge-
nation. MBAA TQ 40:283–289
Edelen CL, Miller JL, Patino H (1996) Effects of yeast pitch rates on
fermentation performance and beer quality. MBAA TQ 33:30–32
Erten H, Tanguler H, Cakiroz H (2007) The effect of pitching rate on
fermentation and flavour compounds in high gravity brewing. J
Inst Brew 113:75–79
Estruch F (2000) Stress-controlled transcription factors, stress-induced
genes and stress tolerance in budding yeast. FEMS Microbiol
Rev 24:469–486
European Brewery Convention (1998) Analytica-EBC. Fachverlag
Hans Carl, Nürnberg
Fuji T, Kobayashi O, Yoshimoto H, Furukawa S, Tamai Y (1997)
Effect of aeration and unsaturated fatty acids on expression of the
Saccharomyces cerevisiae alcohol acetyltransferase gene. Appl
Environ Microbiol 63:910–915
Fujiwara D, Yoshimoto H, Sone H, Harashima S, Tamai Y (1998)
Transcriptional co-regulation of Saccharomyces cerevisiae alco-
hol acetyl transferase gene ATF1 and Δ-9 fatty acid desaturase
gene OLE1 by unsaturated fatty acids. Yeast 14:711–721
Gibson BR, Lawrence SJ, Boulton CA, Box WG, Graham NS,
Linforth RST, Smart KA (2008) The oxidative stress response of
a lager brewing yeast strain during industrial propagation and
fermentation. FEMS Yeast Res 8:574–585
Appl Microbiol Biotechnol (2009) 82:1143–1156
Grauslund M, Didion T, Kielland-Brandt MC, Andersen HA (1995)
BAP2, a gene encoding a permease for branched-chain amino
acids in Saccharomyces cerevisiae. Biochim Biophys Acta
1269:275–280
Guldfeldt LU, Arneborg N (1998) The effect of yeast trehalose
content at pitching on fermentation performance during brewery
fermentations. J Inst Brew 104:37–39
Herrero E, Ros J, Bellí G, Cabiscol E (2008) Redox control and
oxidative stress in yeast cells. Biochim Biophys Acta 1780:1217–
1235
Higgins VJ, Beckhouse AG, Oliver AD, Rogers P, Dawes IW (2003)
Yeast genome-wide expression analysis identifies a strong
ergosterol and oxidative stress response during the initial stages
of an industrial lager fermentation. Appl Environ Microbiol
69:4777–4787
Ivorra C, Perez-Ortin JE, del Olmo M (1999) An inverse correlation
between stress resistance and stuck fermentations in wine yeasts.
Biotechnol Bioeng 64:698–708
Jahnke L, Klein HP (1983) Oxygen requirements for formation and
activity of the squalene epoxidase in Saccharomyces cerevisiae. J
Bacteriol 155:488–492
Jamieson DJ (1998) Oxidative stress responses of the yeast Saccha-
romyces cerevisiae. Yeast 14:1511–1527
Jones DL, Petty J, Hoyle DC, Hayes A, Oliver SG, Riba-Garcia I,
Gaskell SJ, Stateva L (2005) Genome-wide analysis of the effects
of heat shock on a Saccharomyces cerevisiae mutant with a
constitutively activated cAMP-dependent pathway. Comp Funct
Genom 5:419–431
Kajiwara S, Aritomi T, Suga K, Ohtaguchi K, Kobayashi O (2000)
Overexpression of the OLE1 gene enhances ethanol fermentation
by Saccharomyces cerevisiae. Appl Microbiol Biotechnol
53:568–574
Kodama Y, Omura F, Miyajima K, Ashikari T (2001) Control of
higher alcohol production by manipulation of the BAP2 gene in
brewing yeast. J Am Soc Brew Chem 59:157–162
Kwast KE, Burke PV, Poyton RO (1998) Oxygen sensing and the
transcriptional regulation of oxygen-responsive genes in yeast. J
Exp Biol 201:1177–1195
Majara N, O’Connor-Cox ESC, Axcell BC (1996) Trehalose—a stress
protectant and stress indicator compound for yeast exposed to
adverse conditions. J Am Soc Brew Chem 54:221–227
Martin CE, Oh C-S, Jiang Y (2006) Regulation of long chain
unsaturated fatty acid synthesis in yeast. Biochim Biophys Acta
1771:271–285
Martinez-Pastor MT, Marchler G, Schüller C, Marchler-Bauer A, Ruis
H, Estruch F (1996) The Saccharomyces cerevisiae zinc finger
proteins Msn2p and Msn4p are required for transcriptional
induction through the stress-response element (STRE). EMBO J
15:2227–2235
Masschelein CA, Andries M, Franken F, Van de Winkel L, Van
Beveren PC (1995) The membrane loop concept: a new
approach for optimal oxygen transfer into high cell density
pitching yeast suspensions. In: Proceedings of the European
Brewery Convention (Brussels), 25th edn. IRL Press, Oxford,
pp 377–386
M’Baya B, Karst F (1987) In vitro assay of squalene epoxidase of
Saccharomyces cerevisiae. Biochim Biophys Res Commun
147:556–564
Moonjai N, Verstrepen KJ, Delvaux FR, Derdelinckx G, Verachtert H
(2002) The effect of linoleic acid supplementation of cropped
yeast on its subsequent fermentation performance and acetate
esters. J Inst Brew 108:227–235
Nakagawa Y, Sugioka S, Kaneko Y, Harashima S (2001) O2R, a novel
regulatory element mediating Rox1p independent O2 and
unsaturated fatty acid repression of OLE1 in Saccharomyces
cerevisiae. J Bacteriol 183:745–751
1155
Neves MJ, Jorge JA, François JM, Terenzi HF (1991) Effects of heat
shock on the level of trehalose and glycogen, and on the
induction of thermotolerance in Neurospora crassa. FEBS Lett
283:19–22
Ohno T, Takahashi R (1986) Role of wort aeration in the brewing
process. Part 1: oxygen uptake and biosynthesis of lipid by the
final yeast. J Inst Brew 92:84–87
Okabe M, Katoh M, Furugoori F, Yoshida M, Mitsui S (1992) Growth
and fermentation characteristics of bottom brewer’s yeast under
mechanical stirring. J Ferment Bioeng 73:148–152
Pérez-Torrado R, Gómez-Pastor R, Larsson C, Matallana E (2009)
Fermentative capacity of dry active wine yeast requires a specific
oxidative stress response during industrial biomass growth. Appl
Microbiol Biotechnol 81:951–960 doi:10.1007/s00253-008-
1722-9
Powell CD, Van Zandycke SM, Quain D, Smart KA (2000)
Replicative ageing and senescence in Saccharomyces cerevisiae
and the impact in brewing fermentations. Microbiology
146:1023–1034
Powell CD, Quain D, Smart KA (2003) The impact of brewing yeast
cell age on fermentation performance, attenuation and floccula-
tion. FEMS Yeast Res 3:149–157
Quain DE (1988) Studies on yeast physiology—impact on fermenta-
tion performance and product quality. J Inst Brew 95:315–323
Rautio JJ, Huuskonen A, Vuokko H, Vidgren V, Londesborough J
(2007) Monitoring yeast physiology during very high gravity
wort fermentations by frequent analysis of gene expression. Yeast
24:741–760
Saerens SMG, Verbelen PJ, Vanbeneden N, Thevelein JM, Delvaux
FR (2008) Monitoring the influence of high-gravity brewing and
fermentation temperature on flavour formation by analysis of
gene expression levels in brewing yeast. Appl Microbiol
Biotechnol 80:1039–1051 doi:10.1007/s00253-008-1645-5
Shen H-Y, Moonjai N, Verstrepen KJ, Delvaux F, Delvaux FR (2003)
Immobilization of Saccharomyces cerevisiae induces changes in
the gene expression levels of HSP12, SSA3 and ATF1 during beer
fermentation. J Am Soc Brew Chem 61:175–181
Smith A, Ward MP, Garrett S (1998) Yeast PKA represses Msn2p/
Msn4p-dependent gene expression to regulate growth, stress
response and glycogen accumulation. EMBO J 17:3556–3564
Sohal RS, Weindruch R (1996) Oxidative stress, caloric restriction,
and aging. Science 273:59–63
Suihko M-L, Vilpola A, Linko M (1993) Pitching rate in high gravity
brewing. J Inst Brew 99:341–346
Swan TM, Watson K (1998) Stress tolerance in a yeast sterol
auxotroph: role of ergosterol, heat shock proteins and trehalose.
FEMS Microbiol Lett 169:191–197
Van Loon APGM, Pesold-Hurt B, Schatz G (1986) A mutant lacking
mitochondrial manganese-superoxide dismutase is hypersensitive
to oxygen. Proc Natl Acad Sci USA 83:3820–3824
Van Zandycke SM, Sohier PJ, Smart KA (2002) The impact of
catalase expression on the replicative lifespan of Saccharomyces
cerevisiae. Mech Age Dev 123:365–373
Vasconcelles MJ, Jiang Y, McDaid K, Gilooly L, Wretzel S, Porter
DL, Martin CE, Goldberg MA (2001) Identification and
characterization of a low oxygen response element (LORE)
involved in the hypoxic induction of a family of S. cerevisiae
genes: implication for the conservation of oxygen sensing in
eukaryotes. J Biol Chem 276:14374–14384
Verbelen PJ, Van Mulders S, Saison D, Van Laere S, Delvaux F,
Delvaux FR (2008) Characteristics of high cell density fermenta-
tions with different lager yeast strains. J Inst Brew 114:127–133
Verbelen PJ, Dekoninck TML, Saerens SMG, Van Mulders SE,
Thevelein JM, Delvaux FR (2009a) Impact of pitching rate on
yeast fermentation performance and beer flavour. Appl Microbiol
Biotechnol 82:155–167 doi:10.1007/s00253-008-1779-5
1156
Verbelen PJ, Depraetere SA, Winderickx J, Delvaux FR, Delvaux F
(2009b) The influence of yeast preoxygenation prior to brewery
fermentation on yeast metabolism and the oxidative stress response.
FEMS Yeast Res 9:226–239 doi:10.1111/j.1567-1364.2008.00476.x
Verstrepen KJ, Derdelinckx G, Dufour J-P, Winderickx J, Thevelein
JM, Pretorius IS, Delvaux FR (2003a) Flavor-active esters:
adding fruitiness to beer. J Biosci Bioeng 96:110–118
Verstrepen KJ, Van Laere SDM, Vanderhaegen BMP, Derdelinckx G,
Dufour J-P, Pretorius IS, Winderickx J, Thevelein JM, Delvaux FR
(2003b) Expression levels of the yeast alcohol acetyltransferase
genes ATF1, Lg-ATF1, and ATF2 control the formation of a broad
range of volatile esters. Appl Environ Microbiol 69:5228–5237
Villanueba KD, Goossens E, Masschelein CA (1990) Subthreshold vicinal
diketone levels in lager brewing yeast fermentations by means of
ILV5 gene amplification. J Am Soc Brew Chem 48:111–114
Willaert R (2007) The beer brewing process: wort production and beer
fermentation. In: Huie YH (ed) Handbook of food products
manufacturing, 1st edn. Wiley, New Jersey, pp 443–506
Appl Microbiol Biotechnol (2009) 82:1143–1156
Willaert R, Nedovic VA (2006) Primary beer fermentation by
immobilised yeast—a review on flavour formation and control
strategies. J Chem Technol Biotechnol 81:1353–1367
Winderickx J, De Winde JH, Crauwels M, Hino A, Hohmann S, Van
Dijck P, Thevelein JM (1996) Regulation of genes encoding
subunits of the trehalose synthase complex in Saccharomyces
cerevisiae: novel variations of STRE-mediated transcriptional
control? Mol Gen Genet 252:470–482
Yamauchi Y, Okamoto T, Murayama H, Kajino K, Amikura T, Hiratsu
H, Nagara A, Kamiya T, Inoue T (1995) Rapid maturation of
beer using an immobilized yeast bioreactor. 1. Heat conversion of
α-acetolactate. J Biotechnol 38:101–108
Zähringer H, Burgert M, Holzer H, Nwaka S (1997) Neutral
trehalase Nth1p of Saccharomyces cerevisiae encoded by the
NTH1 gene is a multiple stress responsive protein. FEBS Lett
412:615–620
Zitomer RS, Carrico P, Deckert J (1997) Regulation of hypoxic gene
expression in yeast. Kidney Int 51:507–513