Journal of

Taxa
ISSN OPEN ACCESS
0974-7907 (Online)

Threatened
0974-7893 (Print)

March 2014
www.threatenedtaxa.org
Vol. 6 | No. 3
Date of Publication: 26 March 2014 (Online & Print)
Pages: 5513–5592
DOI: 10.11609/JoTT.26mar14.5513-5592
 ISSN: 0974-7907 (Online), 0974-7893 (Print)

Published by Typeset and printed at

Wildlife Information Liaison Development Society Zoo Outreach Organization

96, Kumudham Nagar, Vilankurichi Road, Coimbatore, Tamil Nadu 641035, India
Ph: +91 422 2665298, 2665101, 2665450; Fax: +91 422 2665472
Email: threatenedtaxa@gmail.com, articlesubmission@threatenedtaxa.org
www.threatenedtaxa.org

EDITORS
Founder & Chief Editor
Dr. Sanjay Molur, Coimbatore, India
Managing Editor
Mr. B. Ravichandran, Coimbatore, India
Associate Editors
Dr. B.A. Daniel, Coimbatore, India
Dr. Manju Siliwal, Dehra Dun, India
Dr. Meena Venkataraman, Mumbai, India
Ms. Priyanka Iyer, Coimbatore, India
Editorial Advisors
Ms. Sally Walker, Coimbatore, India
Dr. Robert C. Lacy, Minnesota, USA
Dr. Russel Mittermeier, Virginia, USA
Dr. Thomas Husband, Rhode Island, USA
Dr. Jacob V. Cheeran, Thrissur, India
Prof. Dr. Mewa Singh, Mysuru, India
Dr. Ulrich Streicher, Oudomsouk, Laos
Mr. Stephen D. Nash, Stony Brook, USA
Dr. Fred Pluthero, Toronto, Canada
Dr. Martin Fisher, Cambridge, UK
Dr. Ulf Gärdenfors, Uppsala, Sweden
Dr. John Fellowes, Hong Kong
Dr. Philip S. Miller, Minnesota, USA
Prof. Dr. Mirco Solé, Brazil
Editorial Board / Subject Editors / Reviewers
Albert G. Orr, Griffith University, Nathan, Australia
Alexander Ereskovsky, IMBE, Marseille, France
Aniruddha Belsare, Columbia MO 65203, USA
Anjana Silva, Rajarata University of Sri Lanka, Saliyapura, Sri Lanka
Annemarie Ohler, Muséum national d’Histoire naturelle, Paris, France
Ansie Dippenaar-Schoeman, University of Pretoria, Queenswood, South Africa
Aparna Watve, Pune, Maharashtra, India
Arun K. Pandey, University of Delhi, Delhi, India
Arun Kanagavel, WILD, Coimbatore, Tamil Nadu, India
Arun P. Singh, Rain Forest Research Institute (ICFRE), Jorhat India
Ashish D. Tiple, Vidyabharati College, Seloo, Wardha, Maharashtra, India
A. Biju Kumar, University of Kerala, Thiruvananthapuram, Kerala, India
A.K. Sreekala, JNTBGRI, Palode, Thiruvananthapuram, Kerala, India
B. Ramesha, Kerala Agricultural University, Kasaragod District, Kerala, India
B. Ravi Prasad Rao, Sri Krishnadevaraya University, Anantpur, India.
B. Shivaraju, Bengaluru, Karnataka, India
B.A. Daniel, Zoo Outreach Organization, Coimbatore 641035, Tamil Nadu, India
B.C. Suman, University of Horticulture and Forestry, Solan, India
B.S. Kholia, Botanical Survey of India, Gangtok, Sikkim, India
Bakhtiar Effendi Yahya, Universiti Malaysia Sabah, Sabah, Malaysia
Basudev Tripathy, Zoological Survey of India, New Alipore, India
Bhargavi Srinivasulu, Osmania University, Hyderabad, India
Brett C. Ratcliffe, University of Nebraska, Lincoln, USA
Brian Fisher, California Academy of Sciences, USA
Bulganin Mitra, Zoological Survey of India, New Alipore, West Bangal, India
C. Raghunathan, Zoological Survey of India, Andaman and Nicobar Islands
C. Srinivasulu, Osmania University, Hyderabad, India
Carl Ferraris, Smithsonian Institution, Portland, USA
Cecília Kierulff, Victorville , California
Chris Bowden, Royal Society for the Protection of Birds, Sandy, UK
Christoph Kueffer, Institute of Integrative Biology, Zürich, Switzerland
Christoph Schwitzer, University of the West of England, Clifton, Bristol, BS8 3HA
Cleofas Cervancia, Univ. of Philippines Los Baños College Laguna, Philippines
Colin Groves, Australian National University, Canberra, Australia
Crawford Prentice, Nature Management Services, Jalan, Malaysia
D.B. Bastawade, Maharashtra, India
D.J. Bhat, Retd. Professor, Goa University, Goa, India
Dale R. Calder, Royal Ontaro Museum, Toronto, Ontario, Canada
Daniel Brito, Federal University of Goiás, Goiânia, Brazil
Davor Zanella, University of Zagreb, Zagreb, Croatia
Deepak Apte, Bombay Natural Hisotry Society, Mumbai, India.
Dhananjai Mohan, Vasant Vihar, Dehradun, India
Dietmar Zinner, German Primate Center, Göttingen, Germany
Dilip Chetry, Gibbon Conservation Centre, Mariani, Jorhat, Assam, India
Dipankar Ghose, WWF-India, Max Muller Marg, New Delhi, INDIA
E. Vivekanandan, Central Marine Fisheries Research Institute, Chennai, India
Eduard Vives, Museu de Ciències Naturals de Barcelona, Terrassa, Spain
Erin Wessling, Max Planck Institute for Evolutionary Anthropology, Germany
F.B. Vincent Florens, University of Mauritius, Mauritius
Ferdinando Boero, Università del Salento, Lecce, Italy
Francesco Dal Grande, Senckenberg Gesellschaft für Naturforschung, Frankfurt
G.K. Srivastava, Gomti Nagar, Lucknow, Uttar Pradesh, India
G. Umapathy, Centre for Cellular and Molecular Biology, Hyderabad, India
George Mathew, Kerala Forest Research Institute, Peechi, India
Gernot Vogel, Heidelberg, Germany
Giovanni Amori, CNR - Institute of Ecosystem Studies, Rome, Italy
Gombobaatar Sundev, Professor of Ornithology, Ulaanbaatar, Mongolia
Gowri Mallapur, Madras Crocodile Bank Trust, Chennai, Tamil Nadu, India
H. Raghuram, The American College, Madurai, Tamil Nadu, India
H.C. Nagaveni, Institute of Wood Science and Technology, Bengaluru, India
Heidi S. Riddle, Riddle’s Elephant and Wildlife Sanctuary, Arkansas, USA
Hem Sagar Baral, Charles Sturt University, NSW Australia
Hemant V. Ghate, Modern College, Pune, India
Heok Hee Ng, National University of Singapore, Science Drive, Singapore
Hilloljyoti Singha, Assam University, Silchar, Silchar, Assam, India
Honnavalli N. Kumara, SACON, Anaikatty P.O., Coimbatore, Tamil Nadu, India
Hui Xiao, Chinese Academy of Sciences, Chaoyang, China
Ian J. Kitching, Natural History Museum, Cromwell Road, UK
Ian Redmond, UNEP Convention on Migratory Species, Lansdown, UK
Indraneil Das, Sarawak, Malaysia
J. Jerald Wilson, King Abdulaziz University, Jeddah, Saudi Arabia
J.A. Johnson, Wildlife Institute of India, Dehra Dun, India
J.D. Marcus Knight, Velachery, Chennai, Tamil Nadu, India
J.W. Duckworth, IUCN SSC, Bath, UK
Jack Tordoff, Critical Ecosystem Partnership Fund, Arlington, USA
James Young, Hong Kong Lepidopterists’ Society, Hong Kong
Jayshree Vencatesan, Care Earth Trust, , Chennai, Tamil Nadu, India
Jeff McNeely, IUCN, Gland, Switzerland
Jesse Leland, Southern Cross University, New South Wales, Australia
Jigme Tshelthrim Wangyal, District Forest Office, Trashigang, Bhutan
Jill Pruetz, Iowa State University, Ames, USA
John C. Morse, Clemson University, Long Hall, Clemson, USA
John Veron, Coral Reef Foundation, Townsville, Australia
Josin Tharian, St. John’s College, Anchal, Kerala, India
Julian Finn, Sciences, Museum Victoria, Melbourne, Australia
Justus Joshua, Green Future Foundation, Udaipur, Rajasthan, India
K. Karthigeyan, Botanical Survey of India, India
K. Praveen Karanth, Indian Institute of Science, Bengaluru, Karnataka, India
K. Ravikumar, FRLHT, Bengaluru, Karnataka, India
K.A. Subramanian, Zoological Survey of India, New Alipore, Kolkata, India
K.G. Sivaramakrishnan, Madras Christian College, Chennai, Tamil Nadu, India
K.K. Vass, Chicago, USA
K.P. Dinesh, Zoological Survey of India, Chennai, Tamil Nadu, India
K.R. Sridhar, Mangalore University, Mangalore, Karnataka, India

continued on the back inside cover

Front cover page: Philippine Crocodile Crocodylus mindorensis. Artwork by Pitchandikulam Forest Consultants. See Hinlo et al. 5513–5533
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533

Article
Population genetics implications for the conservation of the
Philippine Crocodile Crocodylus mindorensis Schmidt, 1935
(Crocodylia: Crocodylidae) ISSN
Online 0974–7907
Ma. Rheyda P. Hinlo 1, John A.G. Tabora 2, Carolyn A. Bailey 3, Steve Trewick 4, Print 0974–7893
Glenn Rebong 5, Merlijn van Weerd 6, Cayetano C. Pomares 7, Shannon E. Engberg 8,
OPEN ACCESS
Rick A. Brenneman 9 & Edward E. Louis, Jr.10
1
Institute for Applied Ecology, University of Canberra, ACT, 2601, Australia
2,7
Department of Biological Sciences, University of Southern Mindanao, Kabacan, North Cotabato, 9407 Philippines
3,8,9,10
Grewcock Center for Conservation and Research, Omaha’s Henry Doorly Zoo and Aquarium, 3701 South 10th
Street, Omaha, NE 68107, USA
4
Phoenix Group Evolutionary Ecology and Genetics, Massey University, Palmerston North, 4442 New Zealand.
5
Palawan Wildlife Rescue and Conservation Center, National Road, Barangay Irawan, Puerto Princessa City, Philippines.
6
Institute of Environmental Sciences, Leiden University, PO Box 9518, 2300 RA Leiden, the Netherlands; Mabuwaya
Foundation, Isabela State University Garita, Cabagan 3328, Isabela, Philippines.
1
rei_vet@yahoo.com, 2 johnariestabora@yahoo.com; 4 s.trewick@massey.ac.nz, 5 pwrcc.denr@gmail.com,
6
merlijnvanweerd@yahoo.com, 7 cayetanop@gmail.com, 8 genetics@omahazoo.com; 9 brenne3@yahoo.com;
10
edlo@omahazoo.com (corresponding author)

Abstract: Limited information is available on the Philippine Crocodile, Crocodylus mindorensis, concerning levels of genetic diversity either
relative to other crocodilian species or among populations of the species itself. With only two known extant populations of C. mindorensis
remaining, potentially low levels of genetic diversity are a conservation concern. Here, we evaluated 619 putative Philippine Crocodiles using
a suite of 11 microsatellite markers, and compared them to four other crocodilian species sample sets. The two remaining populations from
the island of Luzon and the island of Mindanao, representing the extremes of the former species’ distribution, appear to be differentiated
as a result of genetic drift rather than selection. Both extant populations demonstrate lower genetic diversity and effective population sizes
relative to other studied crocodilian species. The 57 C. mindorensis and C. porosus, Saltwater Crocodile, hybrids identified earlier from the
Palawan Wildlife Rescue and Conservation Center were revalidated with a suite of 20 microsatellite loci; however, the timing of the event
and the prevalence of hybridization in the species had yet to be fully determined. We defined the hybrids as one first cross from a C. porosus
female and a C. mindorensis male and 56 C. mindorensis backcross individuals. This hybridization event appears to be confined to the PWRCC
collection.

Keywords: Crocodylus, hybrid detection, microsatellites, Philippine crocodile, population genetics.

DOI: http://dx.doi.org/10.11609/JoTT.o3384.5513-33 | ZooBank: urn:lsid:zoobank.org:pub:4D6790B4-A8B5-4205-9C23-F1F6900B0904

Editor: Llewellyn D. Densmore, Texas Tech University, Lubbock, USA. Date of publication: 26 March 2014 (online & print)

Manuscript details: Ms # o3384 | Received 11 October 2012 | Final received 28 September 2013 | Finally accepted 15 February 2014

Citation: Hinlo, M.R.P., J.A.G. Tabora, C.A. Bailey, S. Trewick, G. Rebong, M. van Weerd, C.C. Pomares, S.E. Engberg, R.A. Brenneman & E.E. Louis, Jr. (2014). Popula-
tion genetics implications for the conservation of the Philippine Crocodile Crocodylus mindorensis Schmidt, 1935 (Crocodylia: Crocodylidae). Journal of Threatened
Taxa 6(3): 5513–5533; http://dx.doi.org/10.11609/JoTT.o3384.5513-33

Copyright: © Hinlo et al. 2014. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium, reproduction and
distribution by providing adequate credit to the authors and the source of publication.

Funding: Omaha’s Henry Doorly Zoo and Aquarium, the Crocodile Specialist Group (CSG) Student Research Fund, New Zealand Agency for International Develop-
ment postgraduate research fund, and Curt Harbsmeier, Law Offices of Harbsmeier DeZayas, LLP.

Competing Interest: The authors declare no competing interests.

For Author Contribution, Author Details, Acknowledgements and

Filipino Abstract: See end of the article.

5513
Population genetics implications of Philippine Crocodile Hinlo et al.

INTRODUCTION
The application of genetics in conservation efforts
has increased dramatically over the past decades.
Molecular genetic methodology has been used to
address taxonomic issues, assess genetic variability and
inbreeding, track gene flow and detect hybridization, all
in an effort to conserve genetically healthy populations
and aid in the identification of ecologically significant
units (Fleischer 1998). The use of nuclear DNA (nucDNA)
and mitochondrial DNA (mtDNA) sequence data in
crocodilian research has increased our understanding
of genetic variability (Flint et al. 2000; Ray et al. 2004;
Russello et al. 2007), hybridization (FitzSimmons et al.
2002; Ray et al. 2004; Cedeño-Vásquez et al. 2008),
differences between individuals (Farias et al. 2004),
populations (Vasconcelos et al. 2006, 2008) and species
(Li et al. 2007; Gatesy & Amato 2008; Meganathan &
Dubey 2009; Meganathan et al. 2010). Microsatellites
have been used to investigate population structure and
gene flow in wild populations of Morelet’s Crocodile
Crocodylus moreletii Duméril & Bibron, 1851 (Dever &
Densmore 2001; Dever et al. 2002), American Alligator
Alligator mississippiensis Daudin, 1802 (Glenn et al.
1998; Davis et al. 2002) and Black Caiman Melanosuchus
niger Spix, 1825 (de Thoisy et al. 2006). Microsatellites
have also been useful in parentage analysis in Saltwater
Crocodiles C. porosus Schneider, 1801 (Isberg et al.
2004), in determining and maintaining genetic variability
in crocodiles bred for the leather trade (Flint et al. 2000;
FitzSimmons et al. 2002) and to build the scaffolding for
a genetic linkage map (Miles et al. 2009a).
Limited information exists concerning the Philippine
Crocodile, C. mindorensis, and its comparative status
with other crocodilian species. The Philippine Crocodile
is a species of special concern and has already been the
focus of a breeding program for many years (Banks 2005).
A combination of hunting for commercial exploitation,
extirpation because of fear, overfishing of prey, habitat
loss and habitat fragmentation have severely diminished
the range of this species and reduced the remaining
populations to critical levels (van Weerd & van der Ploeg
2003). Fifteen years ago, the wild populations were
estimated to contain less than 100 mature individuals
(Ross 1998). The most recent Crocodile Specialist Group
(CSG) status update assesses the populations of C.
mindorensis in the wild to consist of less than 250 adults
(van Weerd 2010). As a result, the Philippine Crocodile
is currently listed as Critically Endangered A1c, C2a in
the IUCN Red List (Crocodile Specialist Group 1996).
Silliman University in Dumaguete City, Philippines,
in 1980, initiated the first captive breeding of the
Philippine Crocodile for conservation purposes. In 1987,
the Department of Environment and Natural Resources
(DENR), in a collaboration substantially funded by the
Japanese International Cooperation Agency, established
the Crocodile Farming Institute (CFI). The CFI is now
known as the Palawan Wildlife Rescue and Conservation
Center (PWRCC) in Puerto Princessa City, Philippines, and
operates under the Protected Areas and Wildlife Bureau
(PAWB). The purpose of the facility was to conserve
the two species of crocodiles found in the Philippines,
the Saltwater Crocodile and the Philippine Crocodile
(Sumiller 2000; Banks 2005). Both Silliman University
and PWRCC succeeded in breeding C. mindorensis, and
many of the resulting captive-bred stock have been
sent to zoos in the Philippines and other countries via
breeding loan agreements (Banks 2005). However,
PWRCC temporarily discontinued captive breeding in
2001 due to financial constraints, limited space and
ambiguities in the captive stock pedigrees (Rebong &
Sumiller 2003; Banks 2005).
Philippine Crocodile reintroductions into suitable
habitats have been planned by the Philippine Crocodile
National Recovery Team (PCNRT; Banks 2005). A
successful in situ Philippine Crocodile conservation
program is in progress in the San Mariano municipality
in Isabela Province (van Weerd & van der Ploeg 2003;
van der Ploeg et al. 2011a,b,c). The Mabuwaya
Foundation began a headstart program in 2005 where
wild-born Philippine Crocodiles were captured, captive
raised (i.e., headstarted) then released after two years

Abbreviations: ABI - Applied Biosystems, Inc.; bp - base pairs; CFI - Crocodile Farming Institute; CI - confidence interval; CSG - IUCN/SSC
Crocodile Specialist Group; DENR - Department of Environment and Natural Resources; DNA - deoxyribonucleic acid; FIS - within population
fixation index; FST - between population fixation index; He - expected heterozygosity; Ho - observed heterozygosity; I - Shannon Information
index; IUCN - International Union for the Conservation of Nature; LD - linkage disequilibrium; MSA - Microsatellite Analyzer; mtDNA -
mitochondrial DNA; N - census size; N - average number of individuals genotyped per locus; Na - mean number of alleles; Ne - effective
population size; Nea - effective number of alleles; Neb - number of effective breeders; nucDNA - nuclear DNA; PAWB - Protected Areas and
Wildlife Bureau; PCA - Principal Coordinates Analysis; PCNRT - Philippine Crocodile National Recovery Team; PCR - polymerase chain reaction;
PWRCC - Palawan Wildlife Rescue and Conservation Center; SSC - Species Survival Commission; tI - transformed Shannon entropy index;
tHe - transformed expected heterozygosity index; tHo - transformed observed heterozygosity index; tUHe - transformed unbiased expected
heterozygosity index; UHe - unbiased expected heterozygosity; WGA - whole genome amplification

5514 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533

Population genetics implications of Philippine Crocodile Hinlo et al.
thus increasing juvenile survival rates (van de Ven et
al. 2009). In 2010, 50 PWRCC captive-bred Philippine
Crocodiles were released into a lake in the Divilacan
municipality, geographically separated from the wild
Isabela crocodile population. This release served as a
pilot project to assess the adaptability of captive-bred
Philippine Crocodiles under wild conditions (van Weerd
& General 2003; van Weerd et al. 2010).
Recent systematics studies identified hybrids
between C. mindorensis and C. porosus at PWRCC from
the analyses of both mtDNA (D-loop and ND4) and
nucDNA (C-mos) gene sequences (Louis & Brenneman
2008; Tabora et al. 2012). These studies validated
previous concerns regarding reintroduction candidate
purity, thus warranting forensic diagnoses prior to
release. Using data generated from microsatellite
loci derived from crocodilian genomes by Miles et al.
(2009b,c) and this study, we address three questions
regarding the Philippine Crocodile: (1) how does the
genetic diversity in C. mindorensis compare to other
crocodilian species, (2) what are the population genetic
inferences of the two populations in the current range
distribution, and (3) to what extent has hybridization
occurred between C. mindorensis and C. porosus.
MATERIALS AND METHODS
Sample collection
Tissue samples were collected from a total of 619
Philippine Crocodiles from 1999−2009. Once crocodiles
were safely restrained, scute samples were obtained by
cleaning the area with 70% isopropyl alcohol and cutting
with a scalpel/razor blade. The samples were stored
in 1.8ml NUNC® tubes containing a room temperature
tissue preservative (Seutin et al. 1991). The majority
of the Philippine Crocodile samples were collected
from the captive population maintained at the PWRCC;
the rest from Davao City Crocodile Park on Mindanao,
Calauit Game Refuge and Wildlife Sanctuary on Palawan,
Table 1. Primer sequences (5’ to 3’) with dye label, optimized annealing temperatures and microsatellite locus information including
observed number of alleles detected (k), and size range in 527 C. mindorensis.
Locus Primer Sequence
F: GCACACATTCTCTGAGTAAAAAACC
HEX
4HDZ27
R: GGCACTGGTAGGCTTTGAAAT
F: GACAGTGTGGIGGGTGC
FAM
4HDZ35
R:TGCTGGCTGCTTGGGAC
F: ATGAGTCAGGTGGCAGGTTC
FAM
4HDZ391
R: CATAAATACACTTTTGAGCAGCAG
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533
Valera Square Mini Zoo in the Abra Province, Silliman
University in Dumaguete City and individuals exported
to the Gladys Porter Zoo in Brownsville, TX. Tissue
samples from wild C. mindorensis were collected from
the two extant populations in the Philippines: the
San Mariano region in Isabela Province on Luzon and
from the Liguasan (Ligawasan, Liguwasan) Marsh on
Mindanao. These are two regions of the Philippine
archipelago where indigenous cultural traditions offered
some degree of protection to the Philippine Crocodile
(van der Ploeg & van Weerd 2004; Mangansakan 2008;
Pimentel et al. 2008). A single wild sample was collected
on Dalupiri Island in the province of Cagayan north of
Luzon. A list of the study areas, site descriptions and
number of crocodiles sampled from each location are
described in Tabora et al. (2012). Samples from C.
niloticus Laurenti, 1768 (n = 12), C. acutus Cuvier, 1807
(n = 11), C. siamensis Schneider, 1801 (n = 12) and C.
porosus (n = 37) were obtained from the Yale Peabody
Museum of Natural History collection and from the
St. Augustine Crocodile Farm for comparison to C.
mindorensis.
DNA extraction
Genomic DNA from the great majority of the tissue
samples was extracted and amplified using a whole
genome amplification kit (WGA; Illustra TempliPhi®,
GE Healthcare, Piscataway, NJ). The WGA yielded
an average of 500ng of DNA per µL and all products
were diluted to 50ng/µL. DNA from the remaining C.
mindorensis tissue samples were extracted using a
standard phenol/chloroform/isoamyl alcohol extraction
method as described in Sambrook et al. (1989).
Microsatellite amplification
A subset of the sampled species was screened with
an initial 31 microsatellite loci (Miles et al. 2009b,c)
discovered in the C. porosus genome. A locus was
eliminated from the comparative study if it failed to
amplify in any one species or was monomorphic in at
Annealing Temp
Repeat motif k Size range Gen Bank accession No.
(ºC)
(CA)17 64 6 147–163 GU812903
(CA)8CG(CA)14 62 3 193–199 GU812904
(GT)12 60 4 133–143 GU812905
5515
Population genetics implications of Philippine Crocodile Hinlo et al.
least two species. Microsatellite loci 4HDZ27, 4HDZ35
and 4HDZ391 were discovered in the C. mindorensis
genome following the general protocol of Moraga-
Amador et al. (2001) at Omaha’s Henry Doorly Zoo and
Aquarium’s Center for Conservation and Research (Table
1).
PCR amplifications were performed in MBA Satellite
0.2G thermal cyclers (Thermo Fisher Scientific, Inc.,
Waltham, MA) in final reaction volumes of 25µL and
containing 20−50 ng of DNA template. Final amplification
conditions consisted of 12.5 pmol unlabeled reverse
primer, 12.5 pmol fluorescently labeled forward primer,
1.5 mM MgCl2, 200 µM each dNTP, and 0.5 units of Taq
DNA polymerase (Promega; Madison, WI). One of two
PCR thermal cycling methods were used depending on
the microsatellite locus amplified. Stratified touchdown
programs were used for three loci: TD55 for CpP4116
and TD65 for CpP302 and CpP2516 as described in
Miles et al. (2009b). Standard PCR profile parameters
for all other markers used in this study were: 34 cycles
of 950C for 30s, a primer-specific annealing temperature
for 45s, and 720C for 45s, and a final extension step of
720C for 10 min. Optimum annealing temperatures
were determined as follows: 58°C for CpP305, CpP801
and CpP4004; 600C for CpP1708, CpP3008 and
4HDZ391; 620C for 4HDZ35; and 640C for 4HDZ27. PCR
products were visualized to verify amplification on 2%
agarose gels stained with ethidium bromide. For the
comparison between C. mindorensis and C. porosus
and hybridization analysis CpP305, CpP1708, CpP2516,
CpP3008, CpP4004 and CpP4116 were amplified with
the above standard conditions. An additional 12 loci
were found to be informative for these analyses. The
stratified touchdown programs TD55 for CpP3313 and
CpP4301 and TD65 for CpP4311 were used as described
in Miles et al. (2009b). The following loci were amplified
with standard PCR as described above at the following
annealing temperatures: 560C for CpP208 and CpP1610;
580C for CpP80 and CpP3601; 600C for CpP405, CpP1002
and CpP3220; and 620C for CpP203 and CpP610. Allele
sizes were determined by separation of the PCR products
via POP 4 capillary buffer electrophoresed on ABI 3100/
ABI 3130xl Genetic Analyzers (Applied Biosystems,
Inc., Foster City, CA). Fragment length genotypes were
assigned by GeneScan using GeneScan™ 500XL ROX™
size standard in the GeneMapper software version 4.0.
Data analysis
MICRO-CHECKER (Van Oosterhaut et al. 2004) and
Microsatellite Analyzer (MSA; Dieringer & Schlötterer
2003) were used to analyze the data set for genotyping
5516
and typographical errors. Null allele frequencies were
estimated using CERVUS 2.0 (Marshall et al. 1998; Slate
et al. 2000). Excessive frequencies of null alleles can
bias the data interpretation by either overestimating
homozygosity or underestimating heterozygosity (Callen
et al. 1993; Hoffman & Amos 2005). Loci with high
null allele frequency estimates (nf>0.2) were removed
from further analysis (Chapuis & Estoup 2007). The
population genetic parameters: observed (Ho), expected
(He), and unbiased expected heterozygosity (UHe),
mean number of alleles (Na), effective number of alleles
(Ne), Shannon Information index (I; Shannon 1948), and
the within population fixation index (FIS) were estimated
using GenAlEx 6.41 (Peakall & Smouse 2006). The
Shannon entropy index was transformed by Diversity of
Order 1 = exponential of I (Jost 2009). Heterozygosity
estimates were transformed by Diversity of Order 2 =
1/ (1-He) (Jost 2008). The between population fixation
index (FST) with significance was estimated with FSTAT
4.3 (Goudet 1995, 2001). For intraspecific diversity
study, we neglected the captive populations because (1)
the collections do not represent true populations; (2)
the sample sizes for most were too small; and (3) hybrids
had been previously discovered in PWRCC and thus we
expect that C. porosus alleles would be present in the
population inflating estimates reflecting intraspecific
genetic diversity.
Effective population sizes were estimated with the
linkage disequilibrium (LD) method using LDNe 1.31
(Waples & Do 2008) that corrects for small sample sizes
bias (Waples 2006), an advantage over NeEstimator
(Peel et al. 2004). The LD method is grounded on the
principal that the loss of genetic variation is intensified
by an increase in linkage disequilibrium. Testing allelic
associations among multiple loci allows inbreeding
estimation in the effective population size. Waples
& Do (2008) determined that estimates of effective
population size may become slightly less accurate but
more precise as alleles with lower allele frequencies are
included in the estimation. LDNe estimates effective
population sizes excluding allele frequencies below the
critical values of 0.05, 0.02, and 0.01 to assess the effects
of rare alleles in the data. The ratio of the effective
population size to the census size (Ne/N) can be used to
predict inbreeding and genetic variation loss in wildlife
populations (Frankham 1995).
Since it is possible that the two extant C. mindorensis
populations, being from the northern and southern
extremes of the distribution, might exhibit detectable
selection, we tested for selection using both Lositran
(Beaumont & Nichols 1996; Antao et al. 2008)
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533
Population genetics implications of Philippine Crocodile Hinlo et al.
and BayeScan 2.0 (Foll & Gaggiotti 2008). Lositran
implements an FST outlier method to identify loci likely
under selection whereas BayeScan employs a maximum
likelihood posterior probability. Relevance of the
BayeScan posterior probabilities were interpreted with
Jeffreys’ scale of evidence (Jeffreys 1961). Considering
that the extant populations are small, all within-
population dyads were tested for relatedness (Queller
& Goodnight 1989) using SPAGeDi (Hardy & Vekemans
2002) and compared to a simulation of 10,000 individuals
of known pedigree relationships (Queller & Goodnight
1989).
Crocodylus porosus x C. mindorensis hybridization
was identified in Tabora et al. (2012) where 57 captive
crocodiles expected to be C. mindorensis by breeding
records had inherited mtDNA haplotypes and nucDNA
C-mos diagnostic sites found in C. porosus. We
examined the microsatellite loci screened for the species
diversity comparison to identify markers that would be
informative in comparing the two species of crocodiles
found in the Philippines. Eight additional loci found to
be monomorphic in C. mindorensis and polymorphic
in C. porosus for diagnostic alleles not present in the
genotype data of C. mindorensis populations and
collections exclusive of PWRCC (CpP2516, CpP208,
CpP405, CpP610, CpP1002, CpP3601, CpP4301,
and CpP4311) were included to test for evidence of
hybridization. We generated multilocus data on 619 C.
mindorensis from both wild populations and the captive
collections comprising a great majority of the freshwater
crocodiles in the Philippines and 37 C. porosus from
samples collected in Republic of Palau (RP) by Russello
et al. (2007).
Population structure was inferred using STRUCTURE
v2.1 (Pritchard et al. 2000; Falush et al. 2003) to
determine the differentiation between the northern
and southern C. mindorensis populations and to test
for potential hybridization in the populations with
C. porosus. The program uses a Bayesian clustering
based method to determine whether the two extant
populations could be identified by genetic clustering and
to determine if populations harboring allelic structure
demonstrated genetic admixture of the parental species
clusters. STRUCTURE attempts to identify population
subsets that maximize Hardy Weinberg expectations
and minimize LD from multilocus genotypes (Pritchard
et al. 2000). We chose the ancestry model, correlated
allele frequencies, different FST values assumed for each
subpopulation, a uniform prior for alpha (max: 10, SD
for updating: 0.025), constant lambda value of 1, prior
FST mean (0.01) and standard deviation (0.05). We set
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533
the range to consider 1−11 genetic clusters as Evanno
et al. (2005) suggests estimating over a range of at least
three clusters more than sampling locations. The burnin
period was set at 105 repetitions followed by 106 MCMC
repetitions for 20 iterations of the Gibbs sampler for
each K value. Occasionally STRUCTURE overestimates
the optimal K value; hence, Evanno et al. (2005)
developed an ad hoc test statistic ∆K to evaluate the
output files in addition to approximating the asymptote
of the posterior probability curve. At K-max, we applied
a conservative threshold of q≥0.05 to the membership
coefficient (q-value) of the cluster attributed to the
introgressing species to identify hybrids (Hapke et al.
2011).
In addition, we used the Principal Coordinates
Analysis (PCoA) in GenAlEx v6.41 to detect shifts in
multilocus genotype groupings that might indicate
individual affinity drifting away from expected parental
groups. We charted the first two axes of inertia using
genetic distance as the criteria with the covariance
standardized method of calculation.
RESULTS
Eleven informative microsatellite loci amplified and
were used to generate the data set from the two wild-
sampled C. mindorensis populations and the samples
of C. acutus, C. niloticus, C. porosus and C. siamensis.
The average number of alleles ranged from 3.7 in the
C. mindorensis samples from the population of Liguasan
Marsh to six in C. niloticus. The number of effective alleles
ranged from 2.159 in the C. mindorensis of Isabela to
3.847 in C. niloticus. The observed heterozygosity ranged
from 0.408 in samples from the Isabela population to
0.630 in C. porosus and expected heterozygosity ranged
from 0.423 in the Isabela population to 0.663 in C.
niloticus (Table 2). Regardless of the estimate or index,
the two extant C. mindorensis populations ranked lowest
in genetic diversity compared to the sample collections
of C. acutus, C. niloticus, C. porosus and C. siamensis.
F-statistics measuring within population fixation or
inbreeding (FIS) ranged from -0.149 to 0.160 but were
not significant. Population fixation indices (FST) and their
significances are presented in Table 3.
Twenty loci were found to be informative for
intraspecific evaluation and to compare C. mindorensis
with C. porosus. Analysis of the estimated effective
population sizes of the Isabela and Liguasan Marsh
populations showed that those populations have much
lower effective population sizes than the population of
5517
Population genetics implications of Philippine Crocodile Hinlo et al.

Table 2. Average number of individuals genotyped per locus (N), average number of alleles per locus (Na), number of effective alleles
(Nea), Shannon entropy index (I), observed heterozygosity (Ho), expected heterozygosity (He), unbiased expected heterozygosities (UHe),
within population fixation index (FIS), the transformed Shannon entropy index, observed heterozygosity, expected and unbiased expected
heterozygosities into an index of genetic diversity (tI, tHo, tHe and tUHe, respectively) for the two extant populations of C. mindorensis
(Isabela and Liguasan), C. niloticus, C. siamensis, C. acutus, and C. porosus derived from genotype data generated from a suite of 11
microsatellite loci.

Population N Na Nea I Ho He UHe FIS tI tHo tHe tUHe

Isabela Mean 84.000 3.900 2.159 0.751 0.408 0.423 0.425 0.055 2.119 1.689 1.739 1.739

SE 0.558 0.900 0.384 0.170 0.101 0.082 0.083 0.129

Liguasan Mean 14.000 3.700 2.317 0.841 0.457 0.446 0.462 -0.004 2.319 1.842 1.805 1.859

SE 0.000 0.920 0.499 0.181 0.085 0.070 0.073 0.088

C. niloticus Mean 12.000 6.000 3.847 1.407 0.583 0.663 0.691 0.198 4.084 2.398 2.967 3.236

SE 0.000 0.856 0.616 0.170 0.104 0.064 0.066 0.108

C. siamensis Mean 11.000 4.700 2.982 1.101 0.609 0.539 0.565 -0.149 3.007 2.558 2.169 2.299

SE 0.000 0.803 0.529 0.202 0.095 0.086 0.090 0.048

C. acutus Mean 10.800 4.600 3.428 1.104 0.473 0.543 0.569 0.160 3.020 1.808 2.188 2.320

SE 0.133 1.147 0.955 0.231 0.109 0.097 0.101 0.094

C. porosus Mean 36.700 5.300 3.388 1.229 0.630 0.635 0.644 0.000 3.418 2.703 2.740 2.809

SE 0.213 1.342 0.721 0.155 0.055 0.044 0.044 0.069

Table 3 Fixation indices between populations (FST) below the diagonal (blue cells) with significance (after Bonferroni correction) above
(orange cells).

Isabela Liguasan C. niloticus C. siamensis C. acutus C. porosus

Isabela 0.001 0.001 0.001 0.001 0.001

Liguasan 0.408 0.001 0.001 0.001 0.001

C. niloticus 0.449 0.363 0.001 0.001 0.001

C. siamensis 0.512 0.451 0.339 0.001 0.001

C. acutus 0.482 0.447 0.279 0.402 0.001

C. porosus 0.425 0.382 0.297 0.362 0.351

Table 4 Effective population sizes estimated with LDNe (Waples & Do C. porosus from Republic of Palau using the more precise
2008) considering three thresholds for lowest allele frequency used
in estimation and the corresponding harmonic mean of the sample
0.01 rare allele threshold (Table 4). The SPAGeDi dyad
size, the number of effective breeders (Neb) in the population and analysis revealed overall relatedness within the Isabela
95% confidence intervals (CI) for those estimations. Philippine Crocodile population to be slightly more than
Lowest Allele Frequency Used 0.05 0.02 0.01 what might be expected from matings of unrelated
Isabela (C. mindorensis)
individuals (Fig. 1A). This trend was not detected,
Harmonic Mean Sample Size 100.5 100.3 100.3
though, in the Liguasan Marsh population (Fig. 1B).
Estimated Neb^ 2.2 2.7 4.8
The population of Saltwater Crocodiles showed little
relatedness differing from the simulation of unrelated
95% CIs for Neb^ 1.7−2.8 2.1−3.3 3.5−7.3
individuals (Fig. 2).
Liguasan Marsh (C. mindorensis)
Both Lositran and BayeScan identified two outlier
Harmonic Mean Sample Size 14 14 14
loci as potentially linked to genes that might be under
Estimated Neb^ 21.3 7.9 7.9
some degree of selection. However, the two approaches
95% CIs for Neb^ 6.5−Infinite 3−20.2 3−20.2
agreed on only one locus (CpP801). Lositran found
RP (C. porosus)
CpP801 to be a significant FST outlier whereas BayeScan
Harmonic Mean Sample Size 36.7 36.7 36.7
found it “barely worth mentioning” using the Jeffreys’
Estimated Neb^ 13.2 16.1 22.6 scale of evidence (data not shown). The sequences
95% CIs for Neb^ 10.8−16.2 13.4−19.4 18.8−27.6 flanking the CpP801 repeat motif were submitted to the

5518 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533

Population genetics implications of Philippine Crocodile Hinlo et al.

Crocodylus mindorensis - Isabela Population

0.4

0.35
Parent-Offspring
0.3

0.25 Full Sibling

Frequency

0.2 Half Sibling

0.15 Unrelated

0.1 Population

0.05

0
-1 -0.8 -0.6 -0.4 -0.2 0 0.2 0.4 0.6 0.8
a Relationship Coefficients

Crocodylus mindorensis - Liguasan Marsh Populaion

0.4

0.35

0.3 Parent-Offspring

0.25 Full Sibling

Frequency

0.2 Half Sibling

0.15 Unrelated
0.1 Population
0.05

0
-0.9 -0.7 -0.5 -0.3 -0.1 0.1 0.3 0.5 0.7 0.9
b Relationship Coefficients

Figure 1. Relationship coefficient distirubtions of the two extant Crocodylus mindorensis populations from a - Isabela and b - Liguasan Marsh
overlayed on a simulation of 10,000 individuals of known relationships by pedigree verification (Queller & Goodnight 1989).

Crocodylus porosus - Republic of Palau

0.4

0.35

0.3 Parent-Offspring

0.25 Full Sibling

Frequency

0.2 Half Sibling

0.15 Unrelated
0.1
Population
0.05

0
Relationship Coefficients

Figure 2. Relationship coefficient distirubtions of the Crocodylus porosus population from the Republic of Palau overlayed on a simulation of
10,000 individuals of known relationships by pedigree verification (Queller & Goodnight 1989).

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533 5519

Population genetics implications of Philippine Crocodile Hinlo et al.

C. mindorensis and C. porosus q-values above the noise threshold of 0.05 in the cluster
1200 represented by C. porosus (Fig. 4, see also Appendix 1).
1000 The PCoA suggested the same C. mindorensis individuals
800 as previously identified with affinity to the C. porosus
Delta K

600 sample set (Fig. 5). The PCoA also identified individuals
400 in the Isabela population that appear to group with the
200
southern populations; a phenomenon which cannot be
verified with records or observations. The PWRCC bred
0
1 2 3 4 5 6 7 8 9 10 11 crocodiles reintroduced in Isabela were not included as
-5000 K Clusters Isabela members in this study.
-10000
Avg In P|d

-15000
DISCUSSION AND CONCLUSIONS
-20000

-25000 Previous studies have estimated genetic diversity

-30000
Figure 3. Evanno et al.’s (2005) ΔK and chart of the average logarithm
of the probablity of the data for K-max, K = 3, for seven populations
of C. mindorensis and one population of C. porosus.
BLASTn algorithm (http://blast.ncbi.nlm.nih.gov/Blast.
cgi?PROGRAM=blastn&BLAST_SPEC=WGS&BLAST_
PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch) to
search for potential candidate genes that might be under
selection. Minimal sequence fragments ranging 25−50
bp in length were found in other species but no long
sequence homologies and none of the queries returned
candidates common to both flanking regions. Two short
sequences were found in multiple species although
corresponding to different genes. They were also found
on multiple chromosomes in a single species indicating
that these two sequences were both conserved and
duplicated in the genome.
From the STRUCTURE analysis, K=3 was found to
be the optimal number of clusters represented in the
data by Evanno et al.’s (2005) ΔK (Fig. 3). These clusters
represent the Isabela C. mindorensis population, the
Liguasan Marsh C. mindorensis population and the
Republic of Palau C. porosus population. At K-max,
a total of 59 putative C. mindorensis individuals had
in crocodilian species but making direct comparisons
was difficult since the same marker systems were not
applied across each study. Here, we used the same
microsatellite loci to compare the genetic diversity of C.
mindorensis to C. acutus, C. niloticus, C. porosus and C.
siamensis. The heterozygosity estimates from our data
for C. acutus, C. niloticus, C. porosus and C. siamensis
fall within the ranges of estimates previously reported
for captive purebred C. siamensis, Ho = 0.42±0.17
(FitzSimmons et al. 2002), farmed C. porosus, Ho =
0.59 (Isberg et al. 2004) and in wild populations of C.
niloticus, He = 0.27–0.61 (Hekkala et al. 2010) and Ho =
0.51 (Bishop et al. 2009), C. moreletti, Ho = 0.49 (Dever
et al. 2002) and Melanosuchus niger, Ho = 0.47–0.70
(de Thoisy et al. 2006). We found that genetic diversity
measures for C. mindorensis were lower compared to C.
acutus, C. niloticus, C. porosus and C. siamensis, whether
using traditional FST and heterozygosity measures or by
transforming such measures into diversity indices.
The LDNe analysis of the effective population sizes
allows the interpretation at three levels dictated by
thresholds for rare alleles in the data. Considering the
lowest accepted frequency for rare alleles to be 0.01, the
estimates of effective breeders were 4.8 (95% CI: 3.5−7.3)
in Isabela, 7.9 (95% CI: 3.0−20.2) in Liguasan Marsh and
22.6 (95% CI: 18.8−27.6) in the collection of C. porosus

 
Figure 4. STRUCTURE bar graph of seven C. mindorensis populations and one C. porosus population at K-max, K = 3 clusters.
1 PWRCC, 2 Davao City Crocodile Park, 3 Silliman University, 4 Calauit Game Preserve and Wildlife Sanctuary, 5 Isabela Province, 6 Liguasan
Marsh, 7 Valera Square Mini Zoo in Abra Province, 8 Republic of Palau (C. porosus).

5520 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533

Population genetics implications of Philippine Crocodile Hinlo et al.

Principal Coordinates

PWRCC
Davao
Caluit
Coord. 2

Liguasan
Silliman
Isabella
Abra
C. porasus

Coord. 1
Figure 5. Principal Coordinate Analysis (PCoA) of the Crocodylus mindorensis populations sampled in the Philippines and the C. porosus
population in Republic of Palau indicating the southern populations, the group of PWRCC C. mindorensis individuals with C. porosus
introgression (red diamond cluster towards the C. porosus cluster) and the northern populations including individuals sampled in Isabela that
were introduced from PWRCC (blue squares over the red diamond background).

from RP. In 2008, the minimum census of the Isabela
population was 86 individual crocodiles comprised of 10
adults, 41 sub-adults/juveniles and 35 hatchlings with
six nests in four distinct localities (van Weerd 2010 and
van Weerd unpublished data). The Philippine Crocodile
population in Liguasan Marsh remains poorly known but
was estimated in 2008 to include at least 258 individuals
in all age classes (Pomares et al. 2008). This estimate
is based on interviews with the local inhabitants of
the marsh, which in all likelihood contain multiple
sightings of individual animals. The ratios of effective
breeders to the estimated population sizes were
determined to be 0.06 in Isabela and 0.03 in Liguasan
Marsh. These estimates hover about the 0.05 ratio
threshold which Frankham (1995) considers quite low,
and is, when compared to recent studies in Steelhead
Trout (Oncorhynchus mykiss, Araki et al. 2007) and the
European Common Frog (Rana temporaria, Schmeller
& Merila 2007), 0.10–0.40 and 0.23–1.67, respectively.
We did find evidence for increasing relatedness in the
small isolated Isabela population. This estimate would
be expected as hatchlings were sampled from the nests.
We did not find excessive FIS values, but could expect
those to rise in future generations if mating among
related individuals becomes commonplace due to the
small effective population sizes.
With only two extant populations of C. mindorensis
known to remain today, it is imperative to evaluate the
similarity or differences between the two. Biogeographic
differences might exist since the Isabela population exists
in the northern extreme of the distribution whereas the
Liguasan Marsh population is found in the southern
extreme. One might expect that if the populations were
highly differentiated, molecular testing could detect
a genetic selection signature associated with some
of the neutral markers. We did find positive results
using two testing methods, but for only one of the 11
loci. We searched the repeat motif flanking sequences
against sequences stored in the BLASTn database, but
we did not identify a potential candidate gene. In fact,
in both flanking regions, small fragments (25−50 bp)
were highly conserved among species and duplicated
within genomes. With one method identifying this locus
as a significant FST outlier and the other as marginal,
we suggest that this locus is not under selection but a
false positive in both tests. False positives can be the
result of hierarchical structure perhaps created from
the pooling of samples from four distinct breeding areas
in the San Mariano area of the Isabela region (Excoffier
et al. 2009). Likewise, the data set or the number of
remaining Philippine Crocodiles in the wild may simply
be too small to detect selection (Hohenlohe et al. 2010).
Regardless, we cannot suggest that evidence was found
to support selection that might be differentiating the
populations. If the two populations differed greatly, then
the populations might require separate management.
However, the populations differ only slightly, which
we assume may simply be caused by genetic drift thus
mixing may reestablish or maximize genetic diversity
supporting positive genetic health of the species.

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533 5521

Population genetics implications of Philippine Crocodile Hinlo et al.

Tabora et al. (2012) identified a total of 57 putative

hybrids in that study. From the STRUCTURE analysis of
the same set of samples, we identified 59 individuals
with genotypic proportions exceeding a background
noise level (q>0.05) in the cluster generated by the C.
porosus samples (Appendix 1). The PCoA analysis also
identified the same individuals to be closer to the C.
porosus grouping than C. mindorensis below the nominal
q-value threshold. Only two individuals approached
the q = 0.50 genotypic proportions expected of an F1
individual (PWc005, q = 0.512; PWb097, q = 0.409).

The former, PWc005, possesses both a C. porosus
D-loop haplotype and the C. porosus C-mos diagnostic
characters. We consider this individual to be an F1 from
a C. mindorensis male and a C. porosus female. The latter,
PWb097, possesses the C. porosus D-loop haplotype yet
is homozygous for the C. mindorensis C-mos diagnostic
sites. We consider this individual to be a C. mindorensis
backcross falling in the upper tail of the backcross
q-distribution. Two individuals from Abra (K7895 and
K7897) exceeded the conservative 0.05 q-threshold for
background noise though did not possess C. porosus
D-loop or C-mos markers. We accept these to be C.
mindorensis with slightly higher background noise than
the conservative threshold we imposed in our criteria.
The remaining 55 fell in a q-distribution around 0.25 (avg
q = 0.253±0.067) which approximates the proportion
of introgressed genes expected to be retained in the
first backcross generation. Thus, we suggest one first
generation hybrid cross and 56 backcross individuals
only in the PWRCC-sampled group.
The morphological identification of hybrids, and
particularly among the hybrids in this study, proves to be
problematic. Hybrid detection through morphological
characteristics is not always effective because hybrids
can express mosaics of phenotypes (Campton 1987) due
to incomplete penetrance or partial dominance of the
diagnostic character. Hybrids in the PWRCC population
were undetected since all express the post occipital
scutes indicative of C. mindorensis (Image 1A). This
suggests a single gene effect where the allele conferring
the diagnostic scutes expressed in C. mindorensis
is dominant over the allele fixed in C. porosus that
suppresses the expression of that phenotype (Image 1B).
Had F1 inter se mating occurred, one would expect that
one fourth of the offspring should have inherited both
C. porosus C-mos alleles and one fourth should express
the absence of post occipital scutes. Neither scenario
was detected in the data. Considering the multilocus
allele frequency distributions, there is no indication that
F1 inter se mating has occurred since the average of
© Rick Brenneman
Image 1. a - Crocodylus mindorensis head showing post occipital
scutes (encircled); b - C. porosus head showing lack of post occipital
scutes.
the q-distribution of an F2 generation would be higher
(closer to 0.50). Backcrossing to C. mindorensis would
ensure at least one C. mindorensis allele at all loci which
is exactly what the data shows. This comprehensive
genetic testing identifies hybrids in the collection that
can be separated out of the gene pool before a hybrid
swarm is created that could have a detrimental effect on
the conservation management of the species (Allendorf
et al. 2001). The removal of suspected hybrids could
protect the genetic integrity of the species, especially
if used as reintroduction candidates or to augment the
genetic diversity of the wild populations (Rhymer &
Simberloff 1996).
The two distantly isolated extant populations of C.
mindorensis, Isabela and Liguasan Marsh, present several
concerns for long-term conservation management.
Both show less genetic diversity than what has been
detected in other crocodilian species in this and previous
studies. Both populations have low effective population
sizes and low effective population size to census ratios.
The recent systematics study (Tabora et al. 2012) did
not indicate branch lengths that would suggest more
than population level differentiation. There is no

5522 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533

Population genetics implications of Philippine Crocodile Hinlo et al.

Appendix 1. Inferred ancestry of individuals: K 1 corresponds to northern C. mindorensis population ancestry, K 2 corresponds to C. porosus,
K 3 corresponds to southern C. mindorensis population ancestry. Bold font indicates individuals exceeding the background noise threshold
(0.05) in column K 2 inferring hybridization. Merging with information from Appendix 1 (Tabora et al. 2012), italicized font indicates
individuals with C. porosus D-loop haplotypes and those with asterisks* were heterozygous for C. porosus diagnostic sites in the C-mos gene.
Populations: 1) PWRCC, 2) Davao City Crocodile Park, 3) Silliman University, 4) Calauit Game Preserve and Wildlife Sanctuary, 5) Isabela
Province, 6) Liguasan Marsh, 7) Valera Square Mini Zoo in Abra Province, 8) Republic of Palau C. porosus.

Sample No. ID Population K1 K2 K3 Sample No. ID Population K1 K2 K3

1 PwW001 1 0.006 0.001 0.992 41 PWb041 1 0.007 0.001 0.992

2 PWc002 1 0.004 0.001 0.995 42 PWb042 1 0.008 0.001 0.991

3 PWc003 1 0.007 0.001 0.992 43 PWb043 1 0.004 0.001 0.995

4 PWc004 1 0.004 0.001 0.995 44 PWb044 1 0.005 0.001 0.994

5 PWc005* 1 0.022 0.512 0.466 45 PWb045 1 0.004 0.001 0.995

6 PWc006 1 0.328 0.002 0.669 46 PWb046 1 0.006 0.001 0.993

7 PWc007 1 0.004 0.001 0.995 47 PWb047 1 0.005 0.001 0.994

8 PWc008 1 0.003 0.001 0.996 48 PWb048 1 0.003 0.001 0.996

9 PWc009 1 0.018 0.001 0.981 49 PWb049 1 0.006 0.001 0.993

10 PWc010 1 0.011 0.001 0.988 50 PWb050 1 0.003 0.001 0.996

11 PWc011 1 0.003 0.013 0.983 51 PWb051 1 0.008 0.001 0.991

12 PWc012 1 0.003 0.001 0.996 52 PWb052 1 0.009 0.001 0.99

13 PWc013 1 0.004 0.001 0.995 53 PWb053 1 0.003 0.001 0.996

14 PWx014 1 0.004 0.001 0.995 54 PWb054 1 0.048 0.002 0.951

15 PWc015 1 0.030 0.016 0.954 55 PWb055 1 0.003 0.001 0.996

16 PWc016 1 0.003 0.008 0.988 56 PWb056 1 0.005 0.001 0.994

17 PWc017 1 0.003 0.001 0.996 57 PWb057 1 0.003 0.001 0.996

18 PWc018 1 0.003 0.001 0.996 58 PWb058 1 0.004 0.001 0.995

19 PWc019 1 0.003 0.001 0.996 59 PWb059 1 0.010 0.001 0.989

20 PWb028 1 0.003 0.009 0.988 60 PWb060 1 0.004 0.001 0.995

21 PWc021 1 0.003 0.001 0.996 61 PWb061 1 0.004 0.001 0.995

22 PWc022 1 0.011 0.001 0.988 62 PWb062 1 0.003 0.001 0.996

23 PWc023 1 0.003 0.001 0.996 63 PWb063 1 0.004 0.001 0.995

24 PWc024 1 0.004 0.001 0.995 64 PWb064 1 0.006 0.001 0.993

25 PWc025 1 0.005 0.001 0.994 65 PWb065 1 0.003 0.001 0.996

26 PWc026 1 0.054 0.002 0.944 66 PWb066 1 0.006 0.001 0.993

27 PWb027 1 0.004 0.001 0.995 67 PWb067* 1 0.053 0.277 0.669

28 PWc020 1 0.003 0.001 0.996 68 PWb068 1 0.007 0.001 0.992

29 PWb029 1 0.004 0.001 0.995 69 PWb069 1 0.003 0.001 0.996

30 PWb030 1 0.004 0.001 0.995 70 PWb070 1 0.005 0.001 0.993

31 PWb031 1 0.003 0.001 0.996 71 PWb071* 1 0.005 0.147 0.848

32 PWb032 1 0.004 0.001 0.995 72 PWb072 1 0.004 0.001 0.995

33 PWb033 1 0.004 0.001 0.995 73 PWb073 1 0.004 0.001 0.995

34 PWb034 1 0.004 0.001 0.995 74 PWb074 1 0.003 0.001 0.995

35 PWb035 1 0.005 0.007 0.988 75 PWb075 1 0.019 0.001 0.979

36 PWb036 1 0.009 0.001 0.99 76 PWb076 1 0.005 0.001 0.994

37 PWb037 1 0.005 0.001 0.994 77 PWb077 1 0.008 0.001 0.991

38 PWb038 1 0.003 0.001 0.996 78 PWb078 1 0.005 0.001 0.994

39 PWb039 1 0.004 0.001 0.995 79 PWb079 1 0.004 0.002 0.995

40 PWb040 1 0.003 0.001 0.996 80 PWb080 1 0.005 0.001 0.994

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533 5523

Population genetics implications of Philippine Crocodile Hinlo et al.

Sample No. ID Population K1 K2 K3 Sample No. ID Population K1 K2 K3

81 PWb081 1 0.004 0.001 0.995 126 PWb126 1 0.005 0.001 0.994

82 PWb082 1 0.056 0.002 0.942 127 PWb127 1 0.003 0.001 0.996

83 PWb083 1 0.009 0.001 0.990 128 PWb128 1 0.006 0.002 0.992

84 PWb084 1 0.009 0.001 0.990 129 PWb129 1 0.006 0.001 0.993

85 PWb085 1 0.008 0.001 0.991 130 PWb130 1 0.003 0.002 0.995

86 PWb086 1 0.004 0.001 0.995 131 PWb131 1 0.024 0.003 0.973

87 PWb087 1 0.004 0.001 0.995 132 PWb132 1 0.004 0.001 0.995

88 PWb088 1 0.006 0.002 0.993 133 PWb133 1 0.004 0.001 0.995

89 PWb089 1 0.006 0.002 0.993 134 PWb134 1 0.009 0.001 0.990

90 PWb090 1 0.011 0.248 0.741 135 PWb135 1 0.011 0.001 0.988

91 PWb091 1 0.006 0.017 0.977 136 PWb136 1 0.007 0.002 0.992

92 PWb092 1 0.013 0.001 0.986 137 PWb137 1 0.011 0.001 0.988

93 PWb093 1 0.023 0.001 0.976 138 PWb138 1 0.009 0.001 0.990

94 PWb094 1 0.003 0.096 0.901 139 PWb139 1 0.012 0.114 0.874

95 PWb095 1 0.007 0.018 0.976 140 PWb140 1 0.033 0.002 0.965

96 PWb096 1 0.006 0.001 0.993 141 PWb141 1 0.003 0.001 0.995

97 PWb097 1 0.018 0.409 0.572 142 PWb142 1 0.004 0.001 0.995

98 PWb098 1 0.004 0.001 0.995 143 PWb143 1 0.007 0.001 0.992

99 PWb099 1 0.005 0.001 0.994 144 PWb144 1 0.004 0.001 0.995

100 PWb100 1 0.005 0.001 0.994 145 PWb145 1 0.037 0.001 0.962

101 PWb101 1 0.012 0.001 0.987 146 PWb146 1 0.003 0.001 0.996

102 PWb102 1 0.003 0.001 0.996 147 PWb147 1 0.003 0.001 0.996

103 PWb103 1 0.006 0.001 0.993 148 PWb148 1 0.008 0.001 0.991

104 PWb104 1 0.011 0.001 0.988 149 PWb149 1 0.005 0.001 0.994

105 PWb105 1 0.003 0.001 0.995 150 PWb150 1 0.004 0.001 0.995

106 PWb106 1 0.006 0.001 0.993 151 PWb151 1 0.004 0.001 0.995

107 PWb107 1 0.008 0.001 0.991 152 PWb152 1 0.003 0.001 0.996

108 PWb108 1 0.003 0.001 0.996 153 PWb153 1 0.003 0.001 0.996

109 PWb109 1 0.018 0.001 0.981 154 PWb154 1 0.005 0.001 0.994

110 PWb110 1 0.014 0.003 0.983 155 PWb155 1 0.004 0.001 0.995

111 PWb111 1 0.004 0.001 0.995 156 PWb156 1 0.007 0.001 0.992

112 PWb112 1 0.072 0.002 0.926 157 PWb157 1 0.006 0.001 0.992

113 PWb113 1 0.003 0.001 0.996 158 PWb158 1 0.005 0.001 0.994

114 PWb114 1 0.003 0.001 0.996 159 PWb159 1 0.004 0.001 0.995

115 PWb115 1 0.004 0.001 0.995 160 PWb160 1 0.007 0.001 0.992

116 PWb116 1 0.003 0.001 0.996 161 PWb161 1 0.009 0.001 0.990

117 PWb117 1 0.004 0.001 0.995 162 PWb162 1 0.015 0.001 0.984

118 PWb118 1 0.008 0.002 0.990 163 PWb163 1 0.100 0.239 0.660

119 PWb119 1 0.008 0.001 0.991 164 PWb164 1 0.004 0.001 0.995

120 PWb120* 1 0.016 0.372 0.612 165 PWb165 1 0.003 0.001 0.996

121 PWb121 1 0.023 0.001 0.976 166 PWb166 1 0.031 0.002 0.967

122 PWb122 1 0.005 0.002 0.993 167 PWb167 1 0.003 0.001 0.996

123 PWb123 1 0.007 0.001 0.992 168 PWb168 1 0.004 0.001 0.995

124 PWb124 1 0.054 0.002 0.944 169 PWb169 1 0.026 0.002 0.973

125 PWb125 1 0.069 0.002 0.930 170 PWb170 1 0.009 0.001 0.990

5524 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533

Population genetics implications of Philippine Crocodile Hinlo et al.

Sample No. ID Population K1 K2 K3 Sample No. ID Population K1 K2 K3

171 PWb171 1 0.020 0.003 0.977 216 PWb216 1 0.004 0.001 0.995

172 PWb172 1 0.006 0.002 0.992 217 PWb217 1 0.003 0.001 0.996

173 PWb173 1 0.004 0.001 0.995 218 PWb218 1 0.004 0.001 0.995

174 PWb174 1 0.004 0.001 0.995 219 PWb219 1 0.006 0.001 0.993

175 PWb175 1 0.004 0.001 0.995 220 PWb220 1 0.015 0.001 0.984

176 PWb176 1 0.003 0.001 0.996 221 PWb221 1 0.005 0.010 0.985

177 PWb177 1 0.007 0.001 0.992 222 PWb222 1 0.022 0.002 0.976

178 PWb178 1 0.005 0.001 0.994 223 PWb223 1 0.016 0.001 0.983

179 PWb179 1 0.004 0.207 0.789 224 PWb224 1 0.004 0.001 0.995

180 PWb180 1 0.006 0.001 0.992 225 PWb225 1 0.007 0.001 0.992

181 PWb181 1 0.004 0.001 0.994 226 PWb226 1 0.004 0.001 0.995

182 PWb182 1 0.006 0.001 0.993 227 PWb227 1 0.003 0.001 0.996

183 PWb183 1 0.003 0.002 0.995 228 PWb228 1 0.003 0.001 0.996

184 PWb184 1 0.014 0.001 0.984 229 PWb229 1 0.004 0.001 0.995

185 PWb185* 1 0.011 0.277 0.712 230 PWb230 1 0.003 0.001 0.995

186 PWb186 1 0.021 0.001 0.978 231 PWb231 1 0.004 0.001 0.995

187 PWb187 1 0.102 0.002 0.897 232 PWb232 1 0.003 0.001 0.996

188 PWb188 1 0.025 0.001 0.974 233 PWb233 1 0.004 0.001 0.995

189 PWb189 1 0.003 0.290 0.707 234 PWb234 1 0.004 0.001 0.995

190 PWb190 1 0.005 0.001 0.993 235 PWb235 1 0.011 0.001 0.988

191 PWb191 1 0.143 0.002 0.855 236 PWb236 1 0.011 0.001 0.988

192 PWb192 1 0.003 0.001 0.996 237 PWb237 1 0.007 0.001 0.992

193 PWb193 1 0.042 0.002 0.956 238 PWb238 1 0.003 0.001 0.996

194 PWb194 1 0.006 0.001 0.993 239 PWb239 1 0.003 0.001 0.996

195 PWb195 1 0.006 0.001 0.993 240 PWb240 1 0.004 0.001 0.995

196 PWb196 1 0.004 0.001 0.995 241 PWb241 1 0.005 0.001 0.994

197 PWb197 1 0.004 0.001 0.995 242 PWb242 1 0.003 0.001 0.996

198 PWb198 1 0.007 0.001 0.992 243 PWb243 1 0.004 0.001 0.995

199 PWb199 1 0.003 0.001 0.996 244 PWb244 1 0.006 0.001 0.993

200 PWb200 1 0.004 0.001 0.995 245 PWb245 1 0.003 0.001 0.996

201 PWb201 1 0.006 0.001 0.993 246 PWb246 1 0.005 0.001 0.994

202 PWb202 1 0.007 0.001 0.992 247 PWc247 1 0.009 0.001 0.99

203 PWb203 1 0.007 0.001 0.992 248 PWc248 1 0.003 0.001 0.996

204 PWb204 1 0.015 0.001 0.984 249 PWc249 1 0.004 0.001 0.995

205 PWb205 1 0.004 0.001 0.995 250 PWc250 1 0.044 0.002 0.954

206 PWb206 1 0.003 0.001 0.996 251 PWc251 1 0.003 0.001 0.996

207 PWb207 1 0.009 0.001 0.990 252 PWc252 1 0.009 0.001 0.99

208 PWb208 1 0.003 0.001 0.996 253 PWc253 1 0.003 0.006 0.991

209 PWb209 1 0.003 0.001 0.996 254 PWx254 1 0.003 0.017 0.98

210 PWb210 1 0.004 0.001 0.995 255 PW255 1 0.005 0.246 0.75

211 PWb211 1 0.014 0.001 0.985 256 PWc256 1 0.003 0.001 0.996

212 PWb212 1 0.003 0.001 0.996 257 PWb257* 1 0.008 0.296 0.697

213 PWb213 1 0.003 0.001 0.996 258 PWc258 1 0.003 0.001 0.996

214 PWb214* 1 0.005 0.310 0.686 259 PWb259 1 0.005 0.001 0.994

215 PWb215* 1 0.004 0.279 0.717 260 PWb260 1 0.005 0.196 0.798

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533 5525

Population genetics implications of Philippine Crocodile Hinlo et al.

Sample No. ID Population K1 K2 K3 Sample No. ID Population K1 K2 K3

261 PWb261* 1 0.008 0.275 0.717 306 PWb306 1 0.182 0.291 0.526

262 PWb262* 1 0.007 0.271 0.723 307 PWb308 1 0.006 0.002 0.992

263 PWb263 1 0.008 0.285 0.707 308 PWb309* 1 0.006 0.211 0.783

264 PWx264 1 0.004 0.001 0.995 309 PWb310 1 0.003 0.001 0.996

265 PWb265* 1 0.003 0.254 0.743 310 PWb311 1 0.004 0.237 0.759

266 PWb266 1 0.006 0.315 0.679 311 PWb312 1 0.165 0.195 0.640

267 PWc267 1 0.003 0.001 0.996 312 PWb313 1 0.022 0.033 0.945

268 PWb268* 1 0.010 0.199 0.791 313 PWb314 1 0.003 0.002 0.995

269 PWx269 1 0.006 0.001 0.993 314 PWb315* 1 0.016 0.248 0.735

270 PWb270 1 0.012 0.304 0.683 315 PWb316 1 0.006 0.001 0.993

271 PWb271 1 0.003 0.001 0.996 316 PWc317 1 0.003 0.001 0.996

272 PWc272 1 0.007 0.001 0.991 317 PWb318 1 0.004 0.256 0.740

273 PWb273 1 0.004 0.001 0.995 318 PWc319 1 0.029 0.001 0.970

274 PWb274 1 0.002 0.001 0.997 319 PWb320* 1 0.007 0.256 0.737

275 PWb275* 1 0.006 0.166 0.828 320 PWc321 1 0.004 0.001 0.995

276 PWb276 1 0.003 0.001 0.996 321 PWb322* 1 0.010 0.301 0.689

277 PWc277 1 0.004 0.001 0.995 322 PWb323 1 0.010 0.001 0.989

278 PWb278* 1 0.008 0.274 0.718 323 PWb324 1 0.003 0.001 0.996

279 PWb279 1 0.088 0.272 0.640 324 PWb325 1 0.003 0.001 0.996

280 PWb280 1 0.004 0.001 0.995 325 PWb326 1 0.003 0.001 0.996

281 PWb281 1 0.007 0.002 0.991 326 PWc327 1 0.003 0.001 0.996

282 PWb282* 1 0.003 0.292 0.705 327 PWb328 1 0.003 0.001 0.996

283 PWb283* 1 0.005 0.344 0.651 328 PWb329 1 0.029 0.001 0.970

284 PWb284 1 0.005 0.155 0.839 329 PWb330 1 0.038 0.002 0.961

285 PWc285 1 0.004 0.001 0.995 330 PWb331 1 0.003 0.001 0.996

286 PWc286 1 0.003 0.001 0.996 331 PWb332 1 0.006 0.001 0.993

287 PWb287* 1 0.020 0.328 0.652 332 PWb333 1 0.004 0.001 0.995

288 PWb288 1 0.003 0.001 0.996 333 PWb334 1 0.003 0.001 0.996

289 PWb289* 1 0.010 0.386 0.604 334 PWb335 1 0.003 0.001 0.996

290 PWb290 1 0.007 0.001 0.992 335 PWb336 1 0.005 0.001 0.994

291 PWb291 1 0.441 0.001 0.558 336 PWb337 1 0.007 0.001 0.992

292 PWb292 1 0.142 0.321 0.537 337 PWb338 1 0.026 0.001 0.972

293 PWc293 1 0.020 0.002 0.979 338 PWb339 1 0.006 0.001 0.993

294 PWb294 1 0.382 0.002 0.616 339 PWb340 1 0.004 0.001 0.995

295 PWb295 1 0.012 0.002 0.987 340 PWb341 1 0.011 0.001 0.988

296 PWb296 1 0.003 0.001 0.996 341 PWb342 1 0.003 0.001 0.996

297 PWb297 1 0.003 0.002 0.995 342 PWb343 1 0.005 0.001 0.994

298 PWb298* 1 0.003 0.177 0.819 343 PWb344 1 0.005 0.001 0.993

299 PWb299 1 0.005 0.211 0.783 344 PWb345 1 0.003 0.001 0.996

300 PWb300 1 0.113 0.298 0.589 345 PWb346 1 0.004 0.001 0.995

301 PWc301 1 0.044 0.001 0.955 346 PWb347 1 0.004 0.001 0.995

302 PWx302 1 0.012 0.001 0.987 347 PWb348 1 0.030 0.002 0.969

303 PWb303* 1 0.004 0.160 0.836 348 PWb349 1 0.010 0.001 0.989

304 PWb304* 1 0.004 0.224 0.773 349 PWb350 1 0.006 0.001 0.993

305 PWb305 1 0.010 0.001 0.989 350 PWb351 1 0.004 0.001 0.995

5526 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533

Population genetics implications of Philippine Crocodile Hinlo et al.

Sample No. ID Population K1 K2 K3 Sample No. ID Population K1 K2 K3

351 PWb352 1 0.003 0.001 0.996 396 PWc397 1 0.003 0.001 0.996

352 PWb353 1 0.034 0.001 0.965 397 PWc398 1 0.003 0.001 0.996

353 PWb354* 1 0.004 0.202 0.793 398 PWc399 1 0.003 0.001 0.996

354 PWb355* 1 0.014 0.167 0.819 399 PWc400 1 0.003 0.001 0.996

355 PWb356 1 0.017 0.001 0.982 400 PWc401 1 0.004 0.001 0.995

356 PWb357 1 0.005 0.001 0.994 401 PWc402 1 0.003 0.001 0.996

357 PWb358 1 0.015 0.001 0.984 402 PWc403 1 0.003 0.001 0.996

358 PWb359 1 0.002 0.002 0.996 403 PWc404 1 0.008 0.001 0.99

359 PWb360 1 0.003 0.001 0.996 404 PWc405 1 0.004 0.010 0.985

360 PWb361 1 0.009 0.001 0.990 405 PWc406 1 0.004 0.001 0.994

361 PWb362 1 0.003 0.001 0.996 406 PWw407 1 0.005 0.001 0.994

362 PWb363 1 0.003 0.009 0.988 407 PWx408 1 0.004 0.001 0.995

363 PWb364 1 0.065 0.001 0.934 408 PWc409 1 0.015 0.001 0.984

364 PWb365 1 0.006 0.001 0.993 409 PWc410 1 0.005 0.001 0.994

365 PWb366 1 0.004 0.001 0.995 410 PWc411 1 0.014 0.001 0.984

366 PWb367 1 0.007 0.350 0.642 411 PWc412 1 0.004 0.001 0.995

367 PWb368 1 0.005 0.001 0.994 412 PWc413 1 0.004 0.001 0.995

368 PWb369 1 0.004 0.001 0.995 413 PWc414 1 0.013 0.002 0.985

369 PWb370 1 0.004 0.001 0.995 414 PWc415 1 0.003 0.001 0.996

370 PWb371 1 0.005 0.001 0.994 415 PWc416 1 0.008 0.001 0.991

371 PWb372 1 0.003 0.001 0.996 416 PWc417 1 0.005 0.002 0.994

372 PWb373 1 0.005 0.001 0.994 417 PWc418 1 0.003 0.001 0.996

373 PWb374 1 0.012 0.001 0.987 418 PWc419 1 0.010 0.001 0.989

374 PWb375 1 0.004 0.001 0.995 419 PWc420 1 0.004 0.001 0.995

375 PWb376 1 0.041 0.002 0.957 420 PWc421 1 0.005 0.002 0.993

376 PWb377 1 0.004 0.001 0.995 421 PWc422 1 0.003 0.001 0.996

377 PWb378 1 0.007 0.001 0.992 422 PWc423 1 0.033 0.003 0.964

378 PWb379 1 0.005 0.001 0.994 423 PWw424 1 0.003 0.001 0.996

379 PWb380 1 0.003 0.001 0.996 424 PWc425 1 0.003 0.001 0.995

380 PWb381 1 0.004 0.001 0.995 425 PWc426 1 0.003 0.001 0.996

381 PWb382 1 0.008 0.001 0.991 426 PWc427 1 0.011 0.001 0.988

382 PWc383 1 0.003 0.001 0.996 427 PWc428 1 0.009 0.001 0.990

383 PWc384 1 0.020 0.001 0.979 428 PWc429 1 0.003 0.001 0.996

384 PWc385 1 0.003 0.009 0.989 429 PWc430 1 0.003 0.001 0.996

385 PWc386 1 0.002 0.001 0.997 430 PWc431 1 0.003 0.001 0.996

386 PWc387 1 0.003 0.001 0.996 431 PWc432 1 0.003 0.001 0.996

387 PWc388 1 0.003 0.001 0.996 432 PWc433 1 0.004 0.001 0.995

388 PWc389 1 0.016 0.001 0.983 433 PWc434 1 0.011 0.002 0.987

389 PWc390 1 0.003 0.001 0.996 434 PWc435 1 0.007 0.002 0.991

390 PWc391 1 0.003 0.001 0.996 435 PWc436 1 0.003 0.001 0.995

391 PWc392 1 0.004 0.001 0.995 436 PWc437 1 0.007 0.002 0.992

392 PWc393 1 0.004 0.001 0.995 437 PWc438 1 0.009 0.002 0.990

393 PWc394 1 0.003 0.001 0.996 438 PWc439 1 0.018 0.025 0.957

394 PWc395 1 0.003 0.001 0.996 439 PWc440 1 0.003 0.001 0.995

395 PWc396 1 0.003 0.001 0.996 440 PWc441 1 0.011 0.001 0.987

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533 5527

Population genetics implications of Philippine Crocodile Hinlo et al.

Sample No. ID Population K1 K2 K3 Sample No. ID Population K1 K2 K3

441 PWb442 1 0.007 0.001 0.992 486 SU015 3 0.108 0.001 0.891

442 PWb443 1 0.013 0.001 0.986 487 SU016 3 0.464 0.001 0.534

443 PWb444 1 0.003 0.001 0.996 488 K7903 3 0.283 0.002 0.715

444 PWb445 1 0.140 0.294 0.566 489 K7904 3 0.462 0.001 0.537

445 PWb446 1 0.006 0.237 0.757 490 K7905 3 0.096 0.001 0.903

446 PWb447 1 0.020 0.165 0.816 491 K7906 3 0.037 0.002 0.961

447 PWb448 1 0.003 0.001 0.996 492 K7907 3 0.388 0.002 0.610

448 PWb449 1 0.003 0.001 0.996 493 K7908 3 0.330 0.002 0.668

449 PWb450 1 0.003 0.001 0.996 494 K7909 4 0.017 0.001 0.982

450 PWb451 1 0.038 0.002 0.960 495 K7910 4 0.017 0.001 0.982

451 PWb452 1 0.005 0.001 0.994 496 K7911 4 0.050 0.001 0.949

452 PWb453 1 0.003 0.001 0.996 497 K7912 5 0.786 0.011 0.203

453 PWb454 1 0.003 0.001 0.995 498 IS001 5 0.074 0.002 0.924

454 PWb456 1 0.022 0.231 0.747 499 IS1232 5 0.996 0.001 0.003

455 PWb455 1 0.023 0.142 0.836 500 IS1234 5 0.995 0.001 0.004

456 PWb457 1 0.004 0.001 0.995 501 IS1235 5 0.995 0.001 0.004

457 PWb458 1 0.011 0.001 0.988 502 IS1236 5 0.995 0.001 0.003

458 PWb459 1 0.004 0.001 0.995 503 IS1237 5 0.995 0.001 0.004

459 PWb460* 1 0.047 0.359 0.594 504 IS1238 5 0.906 0.001 0.092

460 PWb461 1 0.005 0.001 0.994 505 IS1239 5 0.996 0.001 0.003

461 K7898 1 0.004 0.001 0.995 506 IS1240 5 0.996 0.001 0.003

462 K7899 1 0.026 0.001 0.973 507 IS1241 5 0.995 0.001 0.004

463 K7900* 1 0.007 0.343 0.649 508 IS1242 5 0.569 0.002 0.429

464 K7901* 1 0.023 0.294 0.683 509 IS1244 5 0.890 0.001 0.109

465 K7902* 1 0.006 0.297 0.697 510 IS1245 5 0.993 0.001 0.006

466 DCc001 2 0.004 0.001 0.995 511 IS1246 5 0.995 0.001 0.004

467 DCc002 2 0.054 0.004 0.942 512 IS1247 5 0.993 0.001 0.006

468 DCc003 2 0.007 0.007 0.986 513 IS1248 5 0.995 0.001 0.004

469 DCc004 2 0.013 0.001 0.986 514 IS1249 5 0.995 0.001 0.004

470 DCc005 2 0.003 0.001 0.996 515 IS1250 5 0.995 0.001 0.003

471 DCc006 2 0.012 0.005 0.983 516 IS1251 5 0.995 0.001 0.004

472 DCc007 2 0.003 0.001 0.996 517 IS1252 5 0.995 0.001 0.004

473 DCc008 2 0.003 0.001 0.996 518 IS1253 5 0.996 0.001 0.003

474 SU001 3 0.086 0.001 0.912 519 IS1254 5 0.995 0.001 0.004

475 SU002 3 0.014 0.001 0.985 520 IS1255 5 0.994 0.001 0.005

476 SU003 3 0.013 0.001 0.985 521 IS1256 5 0.848 0.001 0.151

477 SU004 3 0.013 0.001 0.986 522 IS1257 5 0.996 0.001 0.003

478 SU005 3 0.006 0.001 0.993 523 IS1258 5 0.996 0.001 0.003

479 SU006 3 0.092 0.001 0.907 524 IS1259 5 0.924 0.001 0.075

480 SU007 3 0.026 0.001 0.973 525 IS1260 5 0.996 0.001 0.003

481 SU008 3 0.008 0.001 0.991 526 IS1272 5 0.991 0.001 0.007

482 SU009 3 0.087 0.001 0.911 527 IS1273 5 0.995 0.001 0.004

483 SU012 3 0.005 0.001 0.994 528 IS1274 5 0.995 0.001 0.004

484 SU013 3 0.052 0.001 0.947 529 IS1275 5 0.996 0.001 0.003

485 SU014 3 0.081 0.001 0.918 530 IS1276 5 0.993 0.001 0.006

5228 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533

Population genetics implications of Philippine Crocodile Hinlo et al.

Sample No. ID Population K1 K2 K3 Sample No. ID Population K1 K2 K3

531 IS1277 5 0.993 0.001 0.006 576 IS1324 5 0.995 0.001 0.003

532 IS1278 5 0.996 0.001 0.003 577 IS1326 5 0.994 0.001 0.005

533 IS1279 5 0.995 0.001 0.004 578 IS1327 5 0.988 0.001 0.011

534 IS1280 5 0.996 0.001 0.003 579 IS1328 5 0.994 0.001 0.005

535 IS1281 5 0.995 0.001 0.004 580 IS1329 5 0.972 0.001 0.027

536 IS1282 5 0.995 0.001 0.004 581 IS1330 5 0.995 0.001 0.004

537 IS1283 5 0.995 0.001 0.004 582 IS1331 5 0.996 0.001 0.003

538 IS1284 5 0.996 0.001 0.003 583 IS1332 5 0.995 0.001 0.004

539 IS1285 5 0.996 0.001 0.003 584 IS1337 5 0.929 0.001 0.069

540 IS1286 5 0.996 0.001 0.003 585 K7876 5 0.995 0.001 0.004

541 IS1287 5 0.995 0.001 0.004 586 K7878 5 0.994 0.001 0.005

542 IS1288 5 0.672 0.001 0.327 587 K7879 5 0.995 0.001 0.004

543 IS1289 5 0.995 0.001 0.004 588 K7880 5 0.995 0.001 0.004

544 IS1290 5 0.995 0.001 0.004 589 K7881 5 0.995 0.001 0.004

545 IS1291 5 0.995 0.001 0.004 590 K7882 5 0.995 0.001 0.004

546 IS1292 5 0.995 0.001 0.004 591 K7883 5 0.971 0.003 0.026

547 IS1293 5 0.995 0.001 0.004 592 K7884 5 0.996 0.001 0.003

548 IS1294 5 0.995 0.001 0.004 593 K7885 5 0.992 0.001 0.007

549 IS1295 5 0.996 0.001 0.003 594 K7886 5 0.971 0.003 0.026

550 IS1296 5 0.995 0.001 0.004 595 K7887 5 0.994 0.001 0.005

551 IS1297 5 0.994 0.001 0.005 596 K7888 5 0.995 0.001 0.004

552 IS1298 5 0.996 0.001 0.003 597 K7889 5 0.920 0.001 0.079

553 IS1299 5 0.992 0.001 0.007 598 K7890 5 0.996 0.001 0.003

554 IS1300 5 0.995 0.001 0.004 599 K7891 5 0.996 0.001 0.003

555 IS1301 5 0.996 0.001 0.003 600 K7892 5 0.995 0.001 0.004

556 IS1302 5 0.953 0.002 0.045 601 K7893 5 0.962 0.009 0.029

557 IS1303 5 0.996 0.001 0.003 602 BU001 6 0.006 0.001 0.993

558 IS1304 5 0.995 0.001 0.004 603 LM001 6 0.008 0.002 0.990

559 IS1305 5 0.994 0.001 0.005 604 LM002 6 0.003 0.001 0.996

560 IS1306 5 0.995 0.001 0.004 605 LM003 6 0.003 0.001 0.996

561 IS1307 5 0.996 0.001 0.003 606 LM004 6 0.003 0.001 0.996

562 IS1308 5 0.994 0.001 0.005 607 LM005 6 0.003 0.001 0.996

563 IS1309 5 0.893 0.001 0.106 608 LM006 6 0.007 0.001 0.992

564 IS1311 5 0.995 0.001 0.004 609 LM007 6 0.003 0.001 0.996

565 IS1312 5 0.996 0.001 0.003 610 LM008 6 0.003 0.001 0.996

566 IS1314 5 0.986 0.010 0.003 611 LM009 6 0.007 0.001 0.992

567 IS1315 5 0.989 0.001 0.009 612 LM010 6 0.010 0.002 0.988

568 IS1316 5 0.994 0.001 0.005 613 LM011 6 0.015 0.002 0.983

569 IS1317 5 0.995 0.001 0.004 614 LM012 6 0.004 0.001 0.995

570 IS1318 5 0.995 0.001 0.004 615 LM013 6 0.011 0.002 0.988

571 IS1319 5 0.994 0.001 0.005 616 K7894 7 0.993 0.003 0.004

572 IS1320 5 0.991 0.001 0.008 617 K7895 7 0.905 0.086 0.010

573 IS1321 5 0.995 0.001 0.004 618 K7896 7 0.968 0.028 0.004

574 IS1322 5 0.995 0.001 0.003 619 K7897 7 0.904 0.082 0.014

575 IS1323 5 0.995 0.001 0.004 620 YPM14723 8 0.002 0.997 0.001

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533 5529

Population genetics implications of Philippine Crocodile Hinlo et al.

Sample No. ID Population K1 K2 K3 indication of selection being a differentiating factor but

621 YPM14724 8 0.001 0.998 0.001
the distance and isolation would be expected to drive
622 YPM14725 8 0.001 0.997 0.001
genetic drift. Slightly elevated relatedness estimates
suggest that future generations within both populations
623 YPM14726 8 0.002 0.996 0.002
could face unavoidable mating of related individuals
624 YPM14727 8 0.002 0.995 0.002
and the potential consequences of inbreeding. Genetic
625 YPM14728 8 0.001 0.998 0.001
augmentation should be considered to offset these
626 YPM14729 8 0.001 0.998 0.001 potential problems, whether by reintroduction from
627 YPM14730 8 0.001 0.998 0.001 captive populations or by translocation between the
628 YPM14731 8 0.004 0.994 0.002 populations. The most difficult constraint for successful
629 YPM14732 8 0.001 0.998 0.001 conservation is securing the necessary funding to engage
630 YPM14733 8 0.004 0.993 0.004 and monitor the programs. Whether genetic mixing
631 YPM14734 8 0.001 0.997 0.001 between the two extant populations, augmentation from
632 YPM14736 8 0.001 0.994 0.005
captive collections, or reintroduction of headstarted or
633 YPM14737 8 0.001 0.998 0.001
captive born candidates is decided upon, funding will be
crucial to monitor the success of the effort and protect
634 YPM14738 8 0.001 0.997 0.001
remaining habitats for the future of the species.
635 YPM14739 8 0.001 0.998 0.001

636 YPM14740 8 0.002 0.997 0.001

637 YPM14742 8 0.001 0.998 0.001 REFERENCES

638 YPM14743 8 0.002 0.997 0.001

639 YPM14744 8 0.002 0.997 0.001 Allendorf, F.W., R.F. Leary, P. Spruell & J.K. Wenburg (2001). The
problems with hybrids: setting conservation guidelines. Trends in
640 YPM14745 8 0.001 0.998 0.001
Ecology & Evolution 16(11): 613−619; http://dx.doi.org/10.1016/
641 YPM14746 8 0.002 0.997 0.001 S0169-5347(01)02290-X
Antao, T., A. Lopez, R.J. Lopez, A. Beja-Pereira & G. Luikart (2008).
642 YPM14747 8 0.001 0.997 0.001
LOSITAN: A workbench to detect molecular adaptations on a
643 YPM14748 8 0.001 0.998 0.001 Fst-outlier method. BMC Bioinformatics 9: 323; http://dx.doi.
org/10.1186/1471-2105-9-323
644 YPM14749 8 0.001 0.998 0.001
Araki, H., R.S. Waples, W.R. Ardren, B. Cooper & M.S. Blouin (2007).
645 YPM14750 8 0.002 0.997 0.001 Effective population size of steelhead trout: influence of variance in
reproductive success, hatchery programs, and genetic compensation
646 YPM14751 8 0.002 0.997 0.001
between life-history forms. Molecular Ecology 16: 953−966; http://
647 YPM14752 8 0.001 0.997 0.001 dx.doi.org/10.1111/j.1365-294X.2006.03206.x
Banks, C. (2005). National recovery plan for the Philippine Crocodile,
648 YPM14753 8 0.001 0.998 0.001
Crocodylus mindorensis, 2nd Edition. 2005−2008. Department of
649 YPM14754 8 0.002 0.997 0.001 Environment and Natural Resources - Protected Areas and Wildlife
650 YPM14755 8 0.001 0.998 0.001
Bureau (DENR-PAWB), Diliman, Quezon City, Philippines, and
the Royal Melbourne Zoological Gardens, Parkville, Melbourne,
651 YPM14756 8 0.002 0.997 0.001 Australia, 58pp.
652 YPM14719 8 0.001 0.997 0.001 Beaumont, M.A. & R.A. Nichols (1996). Evaluating loci for use in the
genetic analysis of population structure. Proceedings of the Royal
653 YPM14720 8 0.001 0.997 0.001 Society of London B 263: 1619−1626; http://dx.doi.org/10.1098/
654 YPM14721 8 0.001 0.997 0.001 rspb.1996.0237
Bishop, J.M., A.J. Leslie, S.L. Bourquin & C O’Ryan (2009).
655 YPM14722 8 0.001 0.998 0.001 Reduced effective population of the Nile Crocodile (Crocodylus
656 YPM14757 8 0.002 0.996 0.002 niloticus). Biological Conservation 142: 2335−2341; http://dx.doi.
org/10.1016/j.biocon.2009.05.016
Callen, D.F., A.D. Thompson, Y. Shen, H.A. Phillips, R.I. Richards, J.C.
Mulley & G.R. Sutherland (1993). Incidence and origin of “null”
alleles in the (AC)n microsatellite markers. American Journal of
Human Genetics 52: 922−927.
Campton, D.E. (1987). Natural hybridization and introgression in
fishes: methods of detection and genetic interpretations, pp. 161–
192. In: Ryman, N. & F. Utter (eds.). Population Genetics and Fishery
Management. Blackburn Press, Caldwell, New Jersey, 488pp.
Cedeño-Vásquez, J.R., D. Rodriguez, S. Calmé, J.P. Ross, L.D. Densmore,
III & J.B. Thorbjarnarson (2008). Hybridization between Crocodylus
acutus and Crocodylus moreletii in the Yucatan Peninsula: I. evidence
from Mitochondrial DNA and morphology. Journal of Experimental
Zoology 309A: 661−673; http://dx.doi.org/10.1002/jez.473

5530 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533

Population genetics implications of Philippine Crocodile Hinlo et al.
Chapuis, M.-P. & A. Estoup (2007). Microsatellite null alleles and
estimation of population differentiation. Molecular Biology and
Evolution 24(3): 621−631; http://dx.doi.org/10.1093/molbev/
msl191
Crocodile Specialist Group (1996). Crocodylus mindorensis. In: IUCN
2013. IUCN Red List of Threatened Species. Version 2013.2. <www.
iucnredlist.org>. Downloaded on 12 February 2014.
Davis, L., T. Glenn, D. Strickland, L. Guillette, R. Elsey, W. Rhodes,
H.C. Dessauer & R.H. Sawyer (2002). Microsatellite DNA analyses
support an east-west phylogeographic split of American alligator
populations. Journal of Experimental Zoology 294: 352−372; http://
dx.doi.org/10.1002/jez.10189
de Thoisy, B., T. Hrbek, I.P. Farias, W.R. Vasconcelos & A. Lavergne
(2006). Genetic structure, population dynamics and conservation
of black caiman (Melanosuchus niger). Biological Conservation 133:
474−482; http://dx.doi.org/10.1016/j.biocon.2006.07.009
Dever, J. & L. Densmore (2001). Microsatellites in Morelet’s Crocodile
(Crocodylus moreletii) and their utility in addressing crocodilian
population genetics questions. Journal of Herpetology 35(3):
541−544.
Dever, J., R. Strauss, T. Rainwater, S. McMurry & L. Densmore
(2002). Genetic diversity, population subdivision, and gene flow
in Morelet’s Crocodile (Crocodylus moreletii) from Belize, Central
America. Copeia 4: 1078−1091.
Dieringer, D. & C. Schlötterer (2003). MICROSATELLITE ANALYSER
(MSA): A platform independent analysis tool for large microsatellite
data sets. Molecular Ecology Notes 3: 167−169; http://dx.doi.
org/10.1046/j.1471-8286.2003.00351.x
Evanno, G., S. Regnaut & J. Goudet (2005). Detecting the number
of clusters of individuals using the software STRUCTURE: a
simulation study. Molecular Ecology 14: 2611−2620; http://dx.doi.
org/10.1111/j.1365-294X.2005.02553.x
Excoffier, L., T. Hofer & M. Foll (2009). Detecting loci under selection
in a hierarchically structured population. Heredity 103: 286−298;
http://dx.doi.org/10.1038/hdy.2009.74
Falush, D., M. Stephens & J.K. Pritchard (2003). Inference of
population structure using multilocus genotype data: linked loci and
correlated allele frequencies. Genetics 164: 1567−1587.
Farias, I.P., R. Da Silveira, B. de Thoisy, L.A. Monjelo, J. Thorbjarnarson
& T. Hrbek (2004). Genetic diversity and population structure of
Amazonian crocodilians. Animal Conservation 7: 265−272; http://
dx.doi.org/10.1017/S136794300400143X
FitzSimmons, N., J. Buchan, P. Lam, G. Polet, T. Hung, N. Thang & J.
Gratten (2002). Identification of pure bred Crocodylus siamensis for
reintroduction in Vietnam. Journal of Experimental Zoology 294:
373−381; http://dx.doi.org/10.1002/jez.10201
Fleischer, R. (1998). Genetics and avian conservation, pp. 29–47. In:
Marzluff, J.M. & R. Sallabanks (eds.). Avian Conservation: Research
and Management. Island Press, Covelo, CA, 512pp.
Flint, N., F. van der Bank & J Grobler (2000). A lack of genetic variation
in commercially-bred Nile Crocodiles (Crocodylus niloticus) in the
north-west province of South Africa. Water SA 26: 105−110.
Foll, M. & O.E. Gaggiotti (2008). A genome scan method to identify
selected loci appropriate for both dominant and codominant
markers: A Bayesian perspective. Genetics 180: 977−993; http://
dx.doi.org/10.1534/genetics.108.092221
Frankham, R. (1995). Effective population size / adult population size
ratios in wildlife: a review. Genetical Research 66: 95−107; http://
dx.doi.org/10.1017/S0016672300034455
Gatesy, J. & G. Amato (2008). The rapid accumulation of consistent
molecular support for intergeneric crocodilian relationships.
Molecular Phylogenetics and Evolution 48: 1232−1237; http://
dx.doi.org/10.1016/j.ympev.2008.02.009
Glenn, T., H. Dessauer & M. Braun (1998). Characterization of
microsatellite DNA loci in American alligators. Copeia 1998:
591−602.
Goudet, J. (1995). FSTAT (Version 1.2): A computer program to
calculate F-statistics. J Heredity 86: 485−486.
Goudet, J. (2001). FSTAT, a program to estimate and test gene diversities
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533
and fixation indices, version 2.9.3. Available at <http://www2.unil.
ch/popgen/softwares/fstat.htm>. Accessed on 12 February 2014.
Hapke, A., M. Gligor, S.J. Rakotondranary, D. Rosenkranz & O. Zupke
(2011). Hybridization of mouse lemurs: different patterns under
different conditions. BMC Evolutionary Biology 2011 11: 297; http://
dx.doi.org/10.1186/1471-2148-11-297
Hardy, O.J. & X. Vekemans (2002). SPAGeDi: A versatile computer
program to analyse spatial genetic structure at the individual or
population levels. Molecular Ecology Notes 2: 618−620; http://
dx.doi.org/10.1046/j.1471-8286.2002.00305.x
Hekkala, E.R., G. Amato, R. DeSalle & M.J. Blum (2010). Molecular
assessment of population differentiation and individual assignment
potential of Nile Crocodile (Crocodylus niloticus) populations.
Conservation Genetics 11: 1435−1443; http://dx.doi.org/10.1007/
s10592-009-9970-5
Hoffman, J.I. & W. Amos (2005). Microsatellite genotyping errors:
detection approaches, common sources and consequences for
parental exclusion. Molecular Ecology 14: 599−612; http://dx.doi.
org/10.1111/j.1365-294X.2004.02419.x
Hohenlohe, P.A., P.C. Phillips & W.A. Cresko (2010). Using population
genomics to detect selection in natural populations: key concepts
and methodological considerations. International Journal of Plant
Science 171: 1059−1071; http://dx.doi.org/10.1086/656306
Isberg, S., Y. Chen, S. Barker, C. & Moran (2004). Analysis of
microsatellites and parentage testing in Saltwater Crocodiles.
Journal of Heredity 95(5): 445−449; http://dx.doi.org/10.1093/
jhered/esh067
Jeffreys, H. (1961). The Theory of Probability (3rd Edition). Oxford,
432pp.
Jost, L. (2008). Gst and its relatives do not measure differentiation.
Molecular Ecology 17: 4015−4026; http://dx.di.org/10.1111/j.1365-
294X.2008.03887.x
Jost, L. (2009). Mismeasuring biological diversity: Response to
Hoffman and Hoffman (2008). Ecological Economics 68: 925−928.
http://dx.doi.org/10.1016/j.ecolecon.2008.10.015
Li, Y., X. Wu, P. Yan, & G. Amato (2007). The complete mitochondrial
genome of Saltwater Crocodiles (Crocodylus porosus) and phylogeny
of crocodilians. Journal of Genetics and Genomics 34(2): 119−128.
http://dx.doi.org/10.1016/S1673-8527(07)60013-7
Louis, E.E., Jr. & R.A. Brenneman (2008). Philippine Crocodile
systematics and population genetics: a preliminary report, pp.
123−127. In: Alba, E.D.V., M.L. Lagartija & C.A. Ross (eds.). National
Museum Papers Vol. 14 - 2007 Edition, Special Issue: Proceedings of
the Forum on Crocodiles in the Philippines. National Museum of the
Philippines, Manila, Philippines, iv+244pp.
Mangansakan, D.G., II. (2008). Crocodile symbolism in Maguindanaon
culture, pp. 133−139. In: Alba, E.D.V., M.L. Lagartija & C.A. Ross
(eds.). National Museum Papers Vol. 14 - 2007 Edition, Special Issue:
Proceedings of the Forum on Crocodiles in the Philippines. National
Museum of the Philippines, Manila, Philippines, iv+244pp.
Marshall, T.C., J. Slate, L.E.B. Kruuk & J. Pemberton (1998).
Statistical confidence, for likelihood-based paternity inference in
natural populations. Molecular Ecology 7: 639−655; http://dx.doi.
org/10.1046/j.1365-294x.1998.00374.x
Meganathan, P.R. & B. Dubey (2009). Molecular identification
of crocodile species using novel primers for forensic analysis.
Conservation Genetics 10: 767−770; http://dx.doi.org/10.1007/
s10592-008-9658-2
Meganathan, P.R., B. Dubey, M.A. Blatzer, D.A. Ray & I. Haque (2010).
Molecular phylogenetic analysis of the genus Crocodylus (Eusuchis,
Crocodilia, Crocodylidae) and the taxonomic position of Crocodylus
porosus. Molecular Phylogenetics and Evolution 57: 393−402;
http://dx.doi.org/10.1016/j.ympev.2010.06.011
Miles, L.G., S.R. Isberg, T.C. Glenn, S.L. Lance, P. Dalzell, P.C. Thompson
& C. Moran (2009a). A genetic linkage map for the Saltwater
Crocodile (Crocodylus porosus). BMC Genomics 10: 339; http://
dx.doi.org/10.1186/1471-2164-10-339
Miles, L.G., S.R. Isberg, C. Moran, C. Hagen & T.C. Glenn (2009b).
253 Novel polymorphic microsatellites for the Saltwater Crocodile
5531
Population genetics implications of Philippine Crocodile Hinlo et al.
(Crocodylus porosus). Conservation Genetics 10: 963−980; http://
dx.doi.org/10.1007/s10592-008-9600-7
Miles, L.G., S.L. Lance, S.R. Isberg, C. Moran & T.C. Glenn (2009c).
Cross-species amplification of microsatellites in crocodilians:
assessment and applications for the future. Conservation Genetics
10: 935–954; http://dx.doi.org/10.1007/s10592-008-9601-6
Moraga-Amador, D., B.A. Farmerie, D. Brazeau & G. Clark (2001).
Tools for Developing Molecular Marker: Interdisciplinary Center
for Biotechnology Research Laboratory Manual. The University of
Florida, Gainesville, 71pp.
Peakall, R. & P.E. Smouse (2006). GENALEX 6: genetic analysis in Excel.
Population genetic software for teaching and research. Molecular
Ecology Notes 6: 288−295. http://dx.doi.org/10.1111/j.1471-
8286.2005.01155.x
Peel, D., J.R. Ovenden, & S.L. Peel (2004). Ne Estimator: software
for estimating effective population size. Version 1.3. Queensland
Government, Department of Primary Industries and Fisheries,
Brisbane.
Pimentel, J.L., C.C. Pomares & J.A.G. Tabora (2008). Local attitudes
and sightings of crocodiles in Ligawasan Marsh and its tributaries:
a survey, pp. 190−196. In: Alba, E.D.V., M.L. Lagartija & C.A. Ross
(eds.). National Museum Papers Vol. 14 - 2007 Edition, Special Issue:
Proceedings of the Forum on Crocodiles in the Philippines. National
Museum of the Philippines, Manila, Philippines, iv+244pp.
Pomares, C.C., J.A.G. Tabora, C.B. Sanchez, J.L. Pimentel, M.P.
Pomares & C.M. Escalera (2008). Ligawasan Marsh wild crocodile:
Status of Crocodylus mindorensis, pp. 203–218. In: Crocodiles.
Proceedings of the 19th Working Meeting of the Crocodile Specialist
Group, IUCN - The World Conservation Union, Gland, Switzerland
and Cambridge UK, xxiv+490pp.
Pritchard, J.K., M. Stephens & P. Donnelly (2000). Inference of
population structure using multilocus genotype data. Genetics 155:
945−959.
Queller, D.C. & K.F. Goodnight (1989). Estimating relatedness using
genetic markers. Evolution 43(2): 258−275.
Ray, D.A., J.A. Dever, S.G. Platt, T.R. Rainwater, A.G. Finger, S.T.
McMurry, M.A. Batzer, B. Barr, P.J. Stafford, J. McKnight &
L.D. Densmore (2004). Low levels of nucleotide diversity in
Crocodylus moreletii and evidence of hybridization with C. acutus.
Conservation Genetics 5: 449−462. http://dx.doi.org/10.1023/
B:COGE.0000041024.96928.fe
Rebong, G.G. & R.Q. Sumiller (2003). Captive breeding of C.
mindorensis at PWRCC. In: Lazaro, R.C. (ed.). Proceedings of the
Philippine Crocodile Crocodylus mindorensis conservation workshop.
Northern Sierra Madre Natural Park Conservation Project, Cabagan,
Philippines.
Rhymer, J.M. & D. Simberloff (1996). Extinction by hybridization.
Annual Review of Ecology and Systematics 27: 83−109; http://
dx.doi.org/10.1146/annurev.ecolsys.27.1.83
Ross, J.P. (1998). Philippine Crocodile (Crocodylus mindorensis),
pp. 49−50. In: Thorbjarnarson, J., H. Messel, F.W. King & J.P. Ross
(eds.) Crocodiles: An Action Plan for their Conservation. IUCN/SSC
Crocodile Specialist Group, Gainesville, FL, vii+136pp.
Russello, M.A., P. Brazalaitis, J. Gratten, G.J. Watkins-Colwell, A.
Caccone (2007). Molecular assessment of the genetic integrity,
distinctiveness and phylogeographic context of the Saltwater
Crocodile (Crocodylus porosus) on Palau. Conservation Genetics 8:
777−787; http://dx.doi.org/10.1007/s10592-006-9225-7
Sambrook, J., E. Fritch & T. Maniatus (eds.) (1989). Extraction with
phenol:chloroform, pp. E.3−E.4. In: Molecular Cloning: A Laboratory
Manual Vol. 3 (2nd edition). Cold Spring Harbor Press, New York,
xxxii+380pp.
Schmeller, D.S. & J. Merila (2007). Demographic and genetic estimates
of effective population and breeding size in the amphibian Rana
temporaria. Conservation Biology 21: 142−151; http://dx.doi.
org/10.1111/j.1523-1739.2006.00554.x
Seutin, G., B.N. White & P.T. Boag (1991). Preservation of avian blood
and tissue samples for DNA analyses. Canadian Journal of Zoology
69: 82−90; http://dx.doi.org/10.1139/z91-013
5532 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533
Shannon, C.E. (1948). A mathematical theory of communication. The
Bell System Technical Journal 27: 379−423, 623−656; http://dx.doi.
org/10.1002/j.1538-7305.1948.tb01338.x
Slate, J., T. Marshall & J. Pemberton (2000). A retrospective
assessment of the accuracy of the paternity inference program
CERVUS. Molecular Ecology 9: 801−808; http://dx.doi.org/10.1046/
j.1365-294x.2000.00930.x
Sumiller, R. (2000). Captive breeding of Crocodylus mindorensis and
Crocodylus porosus at the Crocodile Farming Institute. CFI Research
Bulletin 1: 3−8.
Tabora, J.A., M.R. Hinlo, R. Lei, C. Pomares, G. Rebong, M. van Weerd,
S. Engberg, R.A. Brenneman & E.E. Louis, Jr. (2012). Detection of
Crocodylus mindorensis x Crocodylus porosus (Crocodylidae) hybrids
in a Philippine Crocodile systematics analysis. Zootaxa 3560: 1-31.
van Oosterhaut, C., W.F. Hutchinson & D.P. Willis (2004). MICRO-
CHECKER: Software for identifying and correcting genotyping errors
in microsatellite data. Molecular Ecology Notes 4: 535−538; http://
dx.doi.org/10.1111/j.1471-8286.2004.00684.x
van de Ven, W.A.C., J.P. Guerrero, D.G. Rodriguez, S.P. Telan, M.G.
Balbas, B.A. Tarun, M. van Weerd, J. van der Ploeg, Z. Wijtten, F.E.
Lindeyer & H.H. de Iongh (2009). Effectiveness of head-starting to
bolster Philippine Crocodile Crocodylus mindorensis populations in
San Mariano municipality, Luzon, Philippines. Conservation Evidence
6: 111−116.
van der Ploeg, J. & M. van Weerd (2004). Devolution of natural
resource management and Philippine Crocodile conservation: The
case of San Mariano, Isabela. Philippine Studies 52(3): 345−382.
van der Ploeg, J., R. Arano & M. van Weerd (2011a). What local people
think about crocodiles: Challenging environmental policy narratives
in the Philippines. The Journal of Environment & Development 20
(3): 303−328; http://dx.doi.org/10.1177/1070496511416743
van der Ploeg, J., M. Cauilan-Cureg, M. van Weerd & W. de Groot
(2011b). Assessing the effectiveness of environmental education:
mobilizing public support for Philippine Crocodile conservation.
Conservation Letters 4(4): 313−323; http://dx.doi.org/10.1111/
j.1755-263X.2011.00181.x
van der Ploeg, J., M. Cauilan-Cureg, M. van Weerd & G.A. Persoon
(2011c). ‘Why must we protect crocodiles?’ Explaining the value of
the Philippine Crocodile to rural communities. Journal of Integrative
Environmental Sciences 8 (4): 1−12; http://dx.doi.org/10.1080/194
3815X.2011.610804
van Weerd, M. & J. van der Ploeg (2003). A new future for the
Philippine Crocodile, Crocodylus mindorensis. Sylvatrop 13(1&2):
31−50.
van Weerd, M. & A. General (2003). Conserving the Philippine
Crocodile in the Northern Sierra Madre: the results of three years
of research and conservation action, pp. 17–33. In: van der Ploeg, J.,
E.C. Bernado & A.B. Masipiquena (eds.) The Sierra Madre Mountain
Range: global relevance, local realities. Papers presented the 4th
regional conference on environment and development. Cagayan
Valley Program on Environment & Development, ISU, Cabagan,
Isabela, Philippines.
van Weerd, M. (2010). Philippine Crocodile Crocodylus mindorensis,
pp. 71–78. In: Manolis, C. & C. Stevenson (eds.). Crocodiles. Status
Survey and Conservation Action Plan. IUCN SSC Crocodile Specialist
Group, Darwin, Australia, 143pp.
van Weerd, M., J. Guerrero, M.G. Balbas, S. Telan, W. van de Ven,
D. Rodriquez, A.B. Masipiqueña, J. van der Ploeg, R. Antolin, G.
Rebong & H.H. de Iongh (2010). Reintroduction of captive-bred
Philippine Crocodiles. Oryx 44 (1): 13; http://dx.doi.org/10.1017/
S0030605309990974
Waples, R.S. (2006). A bias correction for estimates of effective
population size based on linkage disequilibrium at unlinked gene
loci. Conservation Genetics 7: 167–184; http://dx.doi.org/10.1007/
s10592-005-9100-y
Vasconcelos, W.R., T. Hrbek, R. Da Silveira, B. de Thoisy, B. Marioni &
I.P. Farias (2006). Population genetic analysis of Caiman crocodilus
(Linaeus, 1758) from South America. Genetics and Molecular Biology
2: 220−230; http://dx.doi.org/10.1590/S1415-47572006000200006
Population genetics implications of Philippine Crocodile Hinlo et al.

Vasconcelos, W.R., T. Hrbek, R. Da Silveira, B. de Thoisy, L.A.A.D.S.

Ruffeil & I.P. Farias (2008). Phylogeographic and conservation
genetic analysis of the Black Caiman (Melanosuchus niger). Journal
of Experimental Zoology 309A: 600−613; http://dx.doi.org/10.1002/
jez.452
Waples, R.S. & C. Do (2008). LdNe: A program for estimating effective
population size from data on linkage disequilibrium. Molecular
Ecology Resources 8: 753–756; http://dx.doi.org/10.1111/j.1755-
0998.2007.02061.x

Threatened Taxa

Filipino Abstract: Limitado lamang ang kaalaman na mayroon ukol sa Philippine Crocodile (Crocodylus mindorensis), lalo na sa antas o lebel
ng genetic diversity na mayroon ito kumpara sa iba pang uri ng buwaya o kahit mismo sa iba’t-ibang populasyon ng Philippine crocodile
sa bansa. Sa kasalukuyan, dalawang likas na populasyon na lamang ng Philippine crocodile ang matatagpuan sa ilang, at ang potensyal ng
mababang antas ng genetic diversity na maaring matagpuan sa mga natitirang populasyon nito ay nagdudulot ng pangamba sa kanilang
pangmatagalang kabutihan. Sa artikulong ito, aming sinuri ang 619 na Philippine Crocodile gamit ang labing-isang microsatellite markers at
inihambing ang mga ito sa apat na pangkat na impormasyon mula sa ibang uri o species ng buwaya. Ang pagkakaibang genetiko ng dala-
wang natitirang populasyon mula sa isla ng Luzon at Mindanao na kumakatawan sa sukdulang distribusyon ng buwayang ito sa Pilipinas, ay
waring dulot ng genetic drift at hindi seleksyon. Aming natuklasan na ang dalawang natitirang populasyon sa ilang ng Philippine Crocodile
ay may mas mababang genetic diversity at effective population sizes kumpara sa ibang uri ng buwaya. Ang 57 hybrid na buwaya na natag-
puan sa isang naunang pag-aaral ay muling napatotohanan na hybrid nga sa pag-aaral na ito gamit ang dalawampung microsatellite loci.
Ganoon pa man, ang panahon na nangyari ang hybridization at kung gaano ito kalawak sa populasyon ng Philippine crocodile ay kailangan
pa ng pagsisiyasat. Sa artikulong ito, aming minumungkahi na ang 57 hybrids na natagpuan ay binubuo ng isang unang henerasyon na
supling ng lalaking C. mindorensis at babaeng C. porosus, at ang natitirang 56 na hybrid ay mga backcross na buwaya. Ang hybridization na
natagpuan ay waring limitado lamang sa koleksyon ng Palawan Wildlife Rescue & Conservation Centre (PWRCC).

Author Contribution: Ma. Rheyda Hinlo was involved with the data generation and sample collection in the Philippines and was involved in every step. John A. G. Tabora
was also involved with data generation especially the sequence data. Carolyn A. Bailey was involved with the sample acquisition from the outgroup crocodile samples,
and generated the data on these samples. Steve Trewick, Glenn Rebong, Merlijn van Weerd, and Cayetano Pomares, provided overall project expertise of the Philippines
and direction and academic rigour to the overall project for the participating student authors, and participated significantly in the final drafts of the manuscript. Shannon
Engberg provided supervision and direction to the overall data generation and of the study. Dr. Brenneman was responsible for developing the collaborations with the
Republic of the Philippines Department of Natural Resources’ Protected Areas and Wildlife Bureau, the Palawan Wildlife Rescue and Conservation Center, corporate and
private owners of the Crocodylus mindorensis individuals and archived samples, and for the collection of the C. porosus samples on Mindanao. He selected and performed
the genetic analyses of the microsatellite data, the interpretations of the results, and wrote the majority of the manuscript. Edward Louis organized the collection of the
majority of the outgroup crocodile samples, and was primary supervisor in the project overall design and the overall organization of the manuscript, including the revisions.

Author Details: Ma. Rheyda P. Hinlo is a Filipino veterinarian who holds a MSc Degree in Conservation Biology from Massey University, New Zealand, is a member of the
IUCN Crocodile Specialist Group. Hinlo is the National Project Coordinator for Protected Areas & Wildlife Bureau, Philippines and is currently a PhD candidate in Applied
Ecology at the University of Canberra, Australia. John A. G. Tabora is an assistant professor in the Department of Biological Sciences at the University of Southern Mindanao.
Carolyn A. Bailey is a laboratory technician for the Conservation Genetics Department of Omaha’s Henry Doorly Zoo and Aquarium. Steve Trewick is an evolutionist with a
special interest in speciation and the way biotas assemble. He teaches and researches in evolutionary ecology, biogeography and systematics and is co-leader of the Phoenix
groups at Massey University evolves.massey.ac.nz. Glenn Rebong is the Director of the Palawan Wildlife Rescue and Conservation Center. Merlijn van Weerd is a Wildlife
Biologist from the Netherlands who has been working in the Philippines since 1999. He is connected to the Institute of Environmental Sciences of Leiden University where
he conducts research on patterns of biodiversity distributions in the Philippines, and on the ecology and conservation of the Philippine crocodile. In 2003 he co-founded
the Mabuwaya Foundation, of which he currently is the director. Mabuwaya implements a community-based conservation program for the Philippine crocodile, and in
addition studies and conserves other endemic wildlife of northern Luzon. Cayetano C. Pomares is the Vice President for Research, Development and Extentsion at the
University of Southern Mindanao. Shannon E. Engberg is the Conservation Genetics Research and Administration Manager for the Conservation Genetics Department of
Omaha’s Henry Doorly Zoo and Aquarium. Rick Brenneman served as Conservation Geneticist at Omaha’s Henry Doorly Zoo and Aquarium (2002–2013) during the time
of this study. His population genetic, field and taxonomic studies included not only the Philippine crocodile but also seven of the nine giraffe subspecies in Africa and 29
endangered lemur species and two tortoise species in Madagascar. He is now a Research Associate with the Giraffe Conservation Foundation. Edward E. Louis, Jr. is the
Director of the Conservation Genetics Department of Omaha’s Henry Doorly Zoo and Aquarium.

Acknowledgements: We would like to thank Rainier Manalo, the late Charles Ross of Silliman University, and Sonny Dizon of Davao Crocodile Park who contributed captive
Philippine Crocodile tissue samples that were used in this study. We thank Medel Silvosa, Renato Cornel, Ernesto Conate, Amado Mulig, Salvador Guion, Ronnie Sumiller,
Fernando Paliza, William Tabinas, Alberto Guinto and Renato Sumiller who assisted with the sample collection at PWRCC. We thank Willem van de Ven, Bernard Tarun,
Sammy Telan, Dominic Rodriguez and Jessie Guerrero of Mabuwaya Foundation who assisted in procurement of samples from Isabela. Funding for tissue collection
and whole genome amplification kits were provided by grants from the Crocodile Specialist Group (CSG) Student Research Fund, New Zealand Agency for International
Development postgraduate research fund, and Curt Harbsmeier, Law Offices of Harbsmeier DeZayas, LLP. Assistance with the necessary prior informed consents, gratuities,
transport and CITES permits and letters of support were provided by the Natural Resources Development Corporation, Restituta Antolin and DENR Region II, Director
Theresa Mundita Lim, Josefina de Leon and staff of the DENR-PAWB Wildlife Management Office, along with the United States Fish & Wildlife Service. Chris Banks and
Tom Dacey of the CSG provided contacts and information on Philippine crocodiles and funding opportunities. We would like to thank PWRCC, Silliman University, Davao
City Crocodile Park, Calauit Game Reserve, the Valera Square Mini Zoo in Abra, Omaha’s Henry Doorly Zoo and Aquarium, and Colette Adams and the Gladys Porter Zoo in
Brownsville, Texas, for the collection of Crocodylus mindorensis samples. We appreciate the field work by Moamar, collecting samples in Liguasan Marsh. We thank the St.
Augustine Alligator Farm Zoological Park, St. Augustine, Florida, Peter Brazaitis and Yale Peabody Museum of Natural History, New Haven, Connecticut for donating samples
of the other species for this study. We also like to acknowledge Lisa Kimmel for graphic support. We appreciate the technical support of Omaha’s Henry Doorly Zoo and
Aquarium (OHDZA) Genetics Department, technicians Gary Shore and Susie M. McGuire, along with two OHDZA docents, George Emodi and Paula Hinger, for their expertise
in DNA isolation and assistance in running countless PCR reactions.

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5513–5533 5533

 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5534–5543
Article

On the status of Snow Leopard Panthera uncia (Schreber,

1775) in Annapurna, Nepal
ISSN Som B. Ale 1, Bikram Shrestha 2 & Rodney Jackson 3
Online 0974–7907
Print 0974–7893
1
Biological Sciences, University of Illinois-Chicago, 845 West Taylor Street, Chicago, IL 60607, USA
OPEN ACCESS
2
Snow Leopard Conservancy-Nepal program, NTNC/ACAP HQ, Hariyo Kharka, Pokhara, Nepal
1,3
Snow Leopard Conservancy, 18030 Comstock Avenue, Sonoma, CA 95476, USA
1
sale1@uic.edu (corresponding author), 2 bikramone@gmail.com, 3 rodjackson@mountain.org

Abstract: We conducted a status-survey on Snow Leopard Panthera uncia and its main prey, the Blue Sheep Pseudois nayaur, in the
Mustang District of Nepal’s Annapurna Conservation Area, in 2010 and 2011. Sign transects, covering a total linear distance of 19.4km,
revealed an average density of 5.8 signs per kilometer, which compares with those from other Snow Leopard range countries. This also
roughly corresponded with the minimum number of three adult Snow Leopards we obtained from nine remote cameras, deployed to
monitor areas of c. 75km2 in extent. We obtained 42 pictures of Snow Leopards during nine capture events. We conclude that Mustang
harbors at least three adult Snow Leopards, and probably more, along with a healthy Blue Sheep population (a total of 528 individuals,
along 37.6km of Snow Leopard transect lines). We suggest that people-wildlife conflicts exist but that the local people tolerate Snow
Leopards based on their Buddhist socio-religious values.

Keywords: Annapurna, Blue Sheep, Buddhism, camera-trapping, Himalayas, Mustang, sign-survey, Snow Leopard.

DOI: http://dx.doi.org/10.11609/JoTT.o3635.5534-43| ZooBank: urn:lsid:zoobank.org:pub:CAB76A86-19AA-4B22-ACE2-EEEF27ACBA8A

Editor: Hem Sagar Baral, Zoological Society of London - Nepal Office, Kathmandu, Nepal. Date of publication: 26 March 2014 (online & print)

Manuscript details: Ms # o3635 | Received 24 May 2013 | Final received 17 March 2014 | Finally accepted 19 March 2014

Citation: Ale, S.B., B. Shrestha & R. Jackson (2014). On the status of Snow Leopard Panthera uncia (Schreber, 1775) in Annapurna, Nepal. Journal of Threatened
Taxa 6(3): 5534–5543; http://dx.doi.org/10.11609/JoTT.o3635.5534-43

Copyright: © Ale et al. 2014. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium, reproduction and
distribution by providing adequate credit to the authors and the source of publication.

Funding: The major funding for this research came from Snow Leopard Conservancy (SLC-Nepal program) and RSG/Booster grant (Snow Leopards Corridor Project),
while other supports (e.g., logistic) came from National Trust for Nature Conservation and CzechGlobe (Global Change Research Center AS CR).

Competing Interest: The authors declare no competing interests.

Author Contribution: All authors have equal contributions in designing and undertaking the field work and data-collection, and writing the manuscript.

Author Details: Som Ale has been working for Snow Leopard research, education and conservation in Nepal since 1993, first as the professional staff of the National
Trust for Nature Conservation, and now as the regional conservation director of the Snow Leopard Conservancy. He teaches at the University of Illinois at Chicago,
USA. Bikram Shrestha completed his M.Sc. in 2003 from Tribhuvan University of Nepal. Since his graduation, he has been actively involved in Snow Leopard and
other wildlife research in the mountains of Nepal. He teaches wildlife biology at the Institute of Forestry, Pokhara Campus, Nepal. Rodney Jackson is the founding
director of the Snow Leopard Conservancy, the US-based nonprofit, established in 2000. He was also the first biologist to radio-collar and embarked on the classic
study on Snow Leopard ecology and behavior in remote Dolpo District in Nepal.

Acknowledgements: We thank National Trust for Nature Conservation (Nepal), Snow Leopard Conservancy (US), CzechGlobe-Global Change Research Center AS
CR, and Rufford Foundation, for supporting the field work. We thank Lalu Gurung, Pema Tsering, and Ghurmi Gurung, for their assistance in data-collection and
camera-trapping, Charleen Gavette for helping to construct the map, and personnel of the Annapurna Conservation Area Project in Pokhara, Jomsom and Lo-
Manthang for logistic and other support.

5534
Snow Leopard in Annapurna Ale et al.
INTRODUCTION AND OBJECTIVES
The endangered Snow Leopards Panthera uncia
inhabit some of the world’s most rugged landscape,
exemplified by the Himalaya, where they prefer steep,
rugged terrain well broken by cliffs, ridges, gullies and
rocky outcrops (Schaller 1977; Jackson & Ahlborn 1989).
Annapurna Conservation Area, a part of Nepal Himalaya,
dominated by some of the world’s tallest mountains,
supports a significant proportion of Nepal’s Snow
Leopards estimated at 350–500 individuals (Jackson &
Ahlborn 1990). A large portion of this lies within Mustang
District covering c. 47% of the Annapurna Conservation
Area (7,629km2) (NTNC 2008). Snow Leopards have
been reported from the adjoining districts, Manang (Oli
1994) to the east and Dolpo (Jackson & Alhborn 1990)
to the west, but little is known about the population
in Mustang except for anecdotal accounts of livestock
losses allegedly killed by this large feline.
We explored different areas in Mustang to record
the presence and current conservation status of Snow
Leopards, under a joint collaboration between the
Snow Leopard Conservancy (USA) and the National
Trust for Nature Conservation, Nepal’s largest non-
governmental environmental organization that manages
the Annapurna Conservation Area. The vast and rugged
land of Mustang may be one of the strategic locations
where Snow Leopards from eastern and western Nepal
may interbreed over time and thereby maintain their
metapopulation structure. Alternately sundrenched and
snow-driven, whipped and scoured by ceaseless wind,
Mustang has been drained by the Kali Gandaki River
which had cut the world’s deepest gorge between the
Annapurna (8090m) and Dhaulagiri (8167m) massifs.
Our specific questions in this study were: How does
the abundance of Snow Leopard signs in Mustang
compare to those reported elsewhere? Does the Snow
Leopard have any socio-religious significance to the local
people? Besides Snow Leopards and their more visible
prey, the Blue Sheep Pseudois naur, Mustang also harbors
the Grey Wolf Canis lupus, Lynx Lynx lynx isabellinus,
and other ungulates like the nearly-threatened Tibetan
Argali Sheep Ovis ammon hodgsonii and the Tibetan
Gazelle Procapra picticaudata, but the latter species
are mostly confined to the northern rim along the Tibet
(China) border. Mustang is not only diverse in its large
mammal fauna but also represents a culturally vibrant
region. Sparsely inhabited by over 15,000 people,
Mustang supports close to 100,000 livestock (yak, cattle,
horse, mules, sheep, and goats). The region annually
receives about 30,000 international trekkers within its
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5534–5543
lower reaches. Closed to foreign visitors until 1991,
Mustang, acquired an aura of mystery (NTNC 2008). In
the 1950s and 1960s it served as a base for the Tibetan
freedom fighters or Khampa who were engaged in a
futile struggle against the Chinese presence in Tibet. As
recently as 2007, previously unknown Buddhist and pre-
Buddhist religious texts and wall paintings dating from
the 15th century have been found in series of man-made
caves carved onto sheer unconsolidated sandstone cliffs.
These indicate Mustang served as a center for Buddhism
and Bon religion for many centuries. In this study, we
examined socio-religious values of Snow Leopard, and
suggest their conservation implications.
STUDY AREA AND METHODS
We explored remote valleys in Mustang in 2010 (one
survey) and 2011 (two surveys). Two study sites included
Lower Mustang [i.e., the upper reaches of Thini, Jomsom
(district headquarters), Lubra, and Muktinath], and
Upper Mustang (the rugged terrain around Chhuksang,
Chaile, and Somar) [Fig. 1].
Snow Leopard sign survey and habitat
characterization: To detect Snow Leopard sign, we
trekked across the region extensively, visiting all locations
with suitable terrain and habitat where we judged Snow
Leopards and their prey may occur, and established the
transects employing the techniques of the Snow Leopard
Information Management System (Jackson & Hunter
1996). This is a method commonly used for monitoring
Snow Leopards which is low in cost and has minimal
impact on the species being studied (see Schaller 1977;
Schaller 1998; Wilson & Delahay 2001; Wolf & Ale 2009).
With the help of 1:50,000 topographic maps, we located
ridgelines, narrow valleys, trails and cliff-edges, used
most frequently by Snow Leopards to move about their
home range (Jackson & Hunter 1996). We randomly
selected 27 of these sites for ground surveys in which we
walked along sign transects of various lengths to record
sign known or presumed to have been left by Snow
Leopards. We concentrated on elevations between
3,000m and 5,500m, which comprise a zone of dry alpine
and subalpine steppe or semi steppe vegetation, the
preferred vegetation cover type used by Snow Leopard.
Forests are sparsely distributed largely because of
the strong rain-shadow effect of the Annapurna and
Dhaulagiri ranges (Stainton 1972; Dobremez 1976). The
primary vegetation types are Blue Pine Pinus wallichiana
and West Himalayan Fir Abies spectabilis forests at
lower elevations on moist slopes, Juniper Juniperus
5535
Snow Leopard in Annapurna Ale et al.

Figure 1. Mustang study area in the Annapurna Conservation Area, Nepal.

indica woodland or scrub at mid-elevations, and alpine
meadows or barren snowfields and rock with scattered
grasses and sedges at higher elevations. We covered
19,400.4m of linear distance (27 transects, mean length
718.5m, range=400-1000 m, SE=33.8).
We ran the transects during autumn (7–16 November)
of 2010, and spring (1–10 May) and summer (12–27 July)
of 2011, judged as the most appropriate times of year to
detect sign. Each season, we ran the transect only once.
In autumn 2010, we concentrated in Lower Mustang
and in spring 2011 in Upper Mustang. We revisited all
transects in both study sites in the summer 2011. We
located and characterized sign left by Snow Leopards,
including feces (scats), footprints (pugmarks), scrapes,
scent (spray) marks, and boulders and rocks used by
Snow Leopards to cheek-rub and deposit their scent
(often located at or near active scrape sites). This is
known as “transect method” in which we recorded Snow
Leopard signs along pre-selected transects (see Fox et al.
1991; Mallon 1991; Jackson & Hunter 1996). In addition
to searching for leopard sign along transects (transect
method), we also recorded the signs opportunistically
encountered while traversing from one alpine valley
to another for undertaking sign transect or to observe
prey species (Blue Sheep). Snow Leopard signs
encountered under this more wide-ranging “incidental
detection method” provided a useful comparison to
information gathered along sign transects. For each
sign encountered, we recorded the date and location;
the latter was determined using Garmin eTrex Venture
global positioning system receivers (average 20-m
accuracy; Garmin International Inc., Olathe, Kansas). We
also characterized the following habitat variables within
a 50m radius of each sign site: elevation, slope, aspect,
habitat ruggedness, and habitat type. For each 1,000m
of transect length, we randomly selected four to six sites
where we characterized available habitat for a total of
209 plots in Upper Mustang and 139 in Lower Mustang.
To avoid spatial autocorrelation and pseudo-replication,
we considered all sign found within 50m distance of each
other during the same year to represent a single site.
Prey (Blue Sheep) survey: While searching Snow

5536 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5534–5543

Snow Leopard in Annapurna Ale et al.
Leopard sign during autumn 2010 and spring and summer
of 2011, we also surveyed Blue Sheep, Snow Leopard’s
main local prey, opportunistically, to understand its
population structure and composition. We counted all
individuals of a Blue Sheep herd whenever we sighted
one, and classified them into young (less than a year),
yearling (1–2 years), adult female and male (over 2 years)
(Schaller 1977). Some individuals obviously could not
be identified because they were too far or hid behind a
bush or boulder. We further classified male Blue Sheep
into young male (2–5 years) and old male (over 5 years).
Interviews and livestock depredation survey: We
obtained socio-religious information through individual
and focus-group interviews of local villagers especially
herders. We randomly picked ten major villages out of
the 20 settlements in two study areas to assess Snow
Leopards depredation, the region’s only large predator
of significance in this regard. We interviewed all
households in each village, and obtained information on
livestock herd size and mortality over the past 12 months.
We lumped livestock mortality into two categories for
our study purpose: that attributed to Snow Leopards
and the number of losses from all other sources, notably
disease and accidents). We interviewed key informants
(e.g., elderly herders, village leaders) to document their
perceptions toward Snow Leopards and other wildlife.
Key-informant interviews were not structured, while we
used structured- or semi-structured-questionnaires for
the household-surveys.
Remote-camera survey: In 2011, we deployed
remotely triggered cameras to document and estimate
the minimum number of Snow Leopards present in
areas surveyed. Camera trapping is being increasingly
deployed in monitoring of rare and shy wildlife (Karanth
& Nichols 1998; Jackson et al. 2006). We located
suitable camera-trap sites along high, well-defined and
narrow ridgelines or valley bottoms at or immediately
adjacent to frequently scent-sprayed rocks and scrapes
(Fig. 1; Jackson et al. 2006). In all we deployed nine
remotely-triggered cameras (Bushnell and ScoutGuard
passive infrared detector) in Lower Mustang valley,
from 20 October to 25 December 2011. One camera
was stolen and another malfunctioned, so that only
seven cameras were fully operable during the 58-
day survey-period. Lower Mustang was selected for
cameras-trapping instead of Upper Mustang because
of its incidences of heavy livestock depredation by
Snow Leopard, accessibility, and well-defined travel
corridors where remote cameras could be installed to
achieve a more consistent photo capture success. We
selected three strategic watersheds for locating nine
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5534–5543
cameras: Four cameras were placed in the Vrapsa-Namu
drainage (28.760960N & 083.801310E), three in Lubra
(28.786470N & 083.809040E), and two in the Muktinath
area (28.808500N & 083.873550E) (see Fig. 1 for camera-
location sites, 1 to 9). Ideally, we would have preferred
to deploy our small number of cameras at a density
of at least one camera per ca. 25km2 - judged to be
the minimum home range size of a female adult Snow
Leopard: Jackson 1996). However, we were unable to
do so due to gaps in coverage due to inaccessibility, large
patches of unsuitable or poor habitat, and the large area
that needed to be surveyed within a relatively short time
period (three months). Each station had one camera-
trap placed at a distance of 2–3 m from the anticipated
travel path (Jackson et al. 2006). The camera-traps were
checked approximately every 12–15 days, and batteries
changed if necessary.
RESULTS AND DISCUSSION
Scrapes and scats represented the most frequently
detected sign type (89%), with few pugmarks or scent
sprays being detected least often. Total sign abundance
along all transects was 5.8 per km (3.7 scrapes/km, Table
1a). The likelihood of encountering signs was highest in
spring (10.2 signs/km) and lowest in summer (2.1 signs/
km). Our incidental method of sign search revealed
77 signs in 35 full days of searching (7–16 November
2010, 1–10 May 2011, and 12–27 July 2011). Except for
pugmarks, the proportions of other sign types that we
encountered along the transects were similar to signs
encountered during opportunistic surveys (Table 1b).
Snow Leopard sign density in Mustang may be
comparable to that reported from Mt. Everest (4.5 all
signs/km, 3.2 scrapes/km: Ale 2007). The sign density
was much lower in Rolwaling in eastern Nepal (3.2
all sign/km, <1 scrape/km: Ale et al. 2010). Genetic
sampling in Mt. Everest revealed four resident cats
(Lovari et al. 2009) during the same time period, while
Snow Leopards were apparently transient in Rolwaling in
the Gaurishankar region (Ale et al. 2010). An unpublished
report based on genotyping (Karmacharya et al. 2012)
confirmed the presence of three individuals in Rolwaling.
The Langu Valley, a rugged area with very sparse human
habitation in western Nepal, with an estimated density
of 8–10 cats/100km2 (based on 4.5 year radio-telemetry
study), revealed 36 signs (all types) per km (Jackson
1996). While sign abundance in Mustang is much lower
than that recorded in Dolpo, it is more frequent than
Ladakh, India (2.6 scrapes/km, with 1 cat/100km2: Fox
5537
Snow Leopard in Annapurna Ale et al.

Table 1a. Snow Leopard sign abundance in Mustang, Annapurna

Total Sign
Length Sign Scrape/
Transect Feces Pugmark Scrape Spray Hair Total sign/ sites/
(km) sites km
km km
Season

Autumn 9 7.2 19 10 33 4 66 9.2 46 6.4 4.6

Spring 15 11 15 6 90 1 112 10.2 38 3.5 8.2

Summer 27 19.4 22 3 16     41 2.1 23 1.2 0.8

Total 37.6 56 19 139 4 1 219 5.8 107 2.8 3.7

Study area

Lower Mustang 3 24.4 45 15 56 4 1 121 5.0 77 3.2 2.3

Upper Mustang 18 13.2 11 4 83     98 7.4 30 2.3 6.3

Total 37.6 56 19 139 4 1 219 5.8 107 2.8 3.7

Table 1b. Snow Leopard signs encountered using transect method A non-invasive genetics study by Janecka et al. (2008)
and incidental method
in Mongolia determined that up to 60% of all scats
Transect method Incidental method considered to have been deposited by Snow Leopard in
Sign Types Number Freq. Number Freq.
fact belonged to Red Fox Vulpes vulpes.
However, sign density may offer an index of relative
Feces 56 25.6 14 18.2
abundance of Snow Leopards for comparing different
Pugmark 19 8.7 12 15.6
areas, provided that they have comparable topographies.
Scrape 139 63.5 49 63.6
It may be useful for monitoring abundance trends
Spray 4 1.8 2 2.6
in the same location over time, as long as these are
Hair 1 0.5 0 0.0 supplemented by other methods, for instance, remote
Total 219 100 77 100 cameras (e.g., McCarthy et al. 2008) or genetic sampling
(e.g., Janecka et al. 2008, 2011). It has been suggested
that index values can be used to estimate population size
et al. 1991) or northern Pakistan (2.4 all sign, with 1.2-2 by calibrating them with estimates derived from parallel
cats/100km2: Hussain 2003). Mustang has many broad methods (Wilson & Delahay 2001). The guesstimate
ridges and wide U-shaped valleys, making it difficult to of Snow Leopard numbers based on sign abundance
detect Snow Leopard signs. As noted, Snow Leopards to date follows Jackson & Hunter (1996): 20 signs per
prefer sharp-ridges at least in the Himalayas (Jackson kilometer could indicate 10 individuals per 100km2, a
1996). While comparing different areas, the selection crude, quick and easy-to-use method, which to date has
of sign-transects, and corresponding signs per unit been useful in conservation planning in countries where
transect length, may bias our perceptions of Snow resources are scarce. Caughley (1977, p. 12) observed
Leopard distribution and abundance. For instance, in that “The majority of ecological problems can be tackled
Ladakh, Snow Leopard signs were much more abundant with the help of indices of density, absolute estimates
along sharp ridges and river confluence (Fox et al. 1991; of density being unnecessary luxuries.” It is widely
Mallon 1991), but in Qinghai (China) Snow Leopards recognized that determining absolute densities of most
marked the bases of hills flanking broad valleys where large mammals is a complex and often controversial
its travel routes were less well defined, thus making it undertaking, with direct counts being impractical, and
difficult to locate their sign along transects (Schaller et therefore researchers must often rely upon indirect
al. 1988). evidence, such as tracks, scats or densities.
Scrapes and scent (or spray) marks are considered We found the likelihood of encountering Snow
as the most reliable determinants of the Snow Leopard Leopard sign in Mustang was greatest in spring (10.2
presence and abundance, while feces and pugmarks signs per km) and least in summer (1.2 signs per km),
are less so. The former category of signs is expensive suggesting that Snow Leopards move to higher sites
to produce, bio-economically speaking, while the that are more rugged and precipitous, and, therefore,
latter may be less expensive (cf. Schaller 1977, 1998). inaccessible to humans in summer as pressures from

5538 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5534–5543

Snow Leopard in Annapurna Ale et al.

livestock grazing and human presence intensify at
lower elevations. It may be that Snow Leopard sign
was obliterated by livestock in summer and hence the
subsequent finding of lower sign abundance in summer
than in autumn, but our conjecture that Snow Leopards
and Blue Sheep may have moved higher up in summer
were reported from elsewhere (e.g., Jackson 1996; Oli
& Rogers 1996). In any case, further study is required
to validate this claim. No difference in sign density
was noted between Lower and Upper Mustang (Table
1b), although the latter appears to offer much better
habitat for this carnivore. The much higher scrape
densities in Upper Mustang than in Lower Mustang
may reflect differential terrain conditions between the
two study sites: the scrapes and other signs were more
visible along barren ridgelines which dominate in Upper
Mustang compared to the relatively more vegetated
ridges in Lower Mustang.
Our opportunistic survey on blue sheep population
structure and composition revealed the overall average
group size 12.6 (SE=1.6, range = 1-43, n=42) [Table 2a].
This was comparable to that reported by Oli (1996)
two decades earlier in the adjoining district of Manang
(mean group size in Manang, 15.6, SE=1.3, n=176)].
That we obviously missed many herds, in particular
all-male groups, is evident from the male-to-female
ratio (which was much lower than 1). Group size was
comparatively larger in Lower Mustang than in Upper
Mustang - probably a reflection of differences in terms
of terrain-ruggedness and quality of habitat. Upper
Mustang revealed 30% bare ground compared to Lower
Mustang (21%) from our habitat sampling plots (Upper
Mustang, 209 plots; Lower Mustang 139). That Upper
Mustang had a lower young-to-old male ratio than Lower
Mustang may be because the region is less productive
(Table 2b), an observation in line with Schaller‘s (1977)
opinion that productive grasslands would be expected
to have a higher proportion of young males while the
opposite would be the case with the ungulate population
occupying degraded grasslands (i.e., rangelands with
less vegetative cover or biomass). However, to our
knowledge, this hypothesis is yet to be rigorously tested.
The kid-to-female ratio of Blue Sheep in Mustang is
within the expected normal range (0.6, Table 2b). The
proportion of females seen with a lamb at the end of the
birthing season is often used as a proxy for birth rates
in ungulates (e.g., Elk Cervus elaphus L.: Eberhardt et
al. 1996; White-eared Kob Kobus kob leucotis A. Smith:
Fryxell 1987; Moose Alces alces L.: Laurian et al. 2000;
Himalayan Tahr Hemitragus jemlahicus: Scahller 1977;
Ale 2007; Lovari et al. 2009). This provides a quick,
easy-to-use method to assess the overall reproductive
status of ungulates, at least in open habitats where they
can be more easily observed and classified according to
age group. A normal range for kid-to-female ratio for
ungulates is considered c. 0.6 for stable populations and
c. 0.7 for a growing population.
Despite the barren landscape with its patchy
vegetation, Mustang appears to support a healthy
blue sheep population (e.g., reasonable kid-to-female
ratio, robust physical conditions) and a relatively sound
number of Snow Leopards (see below). The local people’s
benevolent attitudes toward wildlife, together with
Annapurna Conservation Area Project’s conservation
actions since the early 1990s, may be credited for this.
Part of the reason why Snow Leopards have been thriving
and will hopefully continue to do so could possibly be
attributed due to area’s harsh climate, remoteness and
rugged terrain which discourage visitation by outsiders.
In 2007 members of a National Geographic team and

Table 2a. Blue Sheep structure and composition in Mustang, Annapurna

Total Male Female Yearling Kid Unidentified Young male Old male Sample Group size (SE)

A. Season

Autumn 2010 149 32 63 16 35 3 16 16 11 13.54 (SE=2.4)

Spring 2011 292 95 78 32 43 44 43 41 25 11.68 (SE=2)

Summer 2011 87 0 22 10 12 43 NA 0 6 14.5 (SE=6.31)

Total 528 127 163 58 90 90 0 0 42 12.57 (SE=1.57)

B. Study area

Lower Mustang 419 102 120 44 68 85 48 43 30 13.97 (SE=1.95)

Upper Mustang 109 25 43 14 22 5 11 14 12 9 (SE=2.13)

Total 528 127 163 58 90 90 59 57 42 12.57 (se=1.57)

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5534–5543 5539

Snow Leopard in Annapurna Ale et al.

Table 2b. Blue Sheep structure and composition in Mustang, Park in India. An indication that our camera locations
Annapurna
and/or site set-up parameters were not ideal is the
Ratio of -- large number of false images (e.g., moving vegetation)
Kid-female
Yearling- Male- Young-old and photos of non-targeted species such as livestock,
female female male
birds, and other mammals (a total of 26,661) [Table
A. Season
3]. However, unlike survey by Jackson et al.(2006)
Autumn 2010 0.56 0.25 0.51 1
in Hemis, our objective was simply to determine the
Spring 2011 0.55 0.41 1.22 1.05 minimum number of Snow Leopards in selected sites as
Summer 2011 0.55 0.45 0.00 NA the basis for formulating the framework for consecutive
Total 0.55 0.36 0.78 NA year monitoring. To assist in this, we involved local
school students belonging to the Snow Leopard Scouts
B. Study area initiative, along with herders (who served as local guides
Lower Mustang 0.57 0.37 0.85 1.12 given their knowledge of the terrain as well as wildlife).
Upper Mustang 0.51 0.33 0.58 0.79
We used pelage patterning, specifically spots on
Overall 0.55 0.36 0.78 1.04
the flanks, dorsal surface of the tail, and on forehead
to identify individual Snow Leopards (see Jackson et
al. 2006). Neither cubs nor juveniles were captured
their local guides explored the area from Chhuksang and by the remote-cameras during these surveys, although
Ghami to the more remote Lo-Manthang and discovered they have been digitally captured subsequently. Three
a series of several centuries old caves carved into the individuals were documented in 2011 (Images 1–3).
sheer cliffs. One of the caves was christened “the Snow We could not allocate 10 images to known individuals
Leopard cave” since this elusive species’ footprints were in three different events. We conclude that our study
found inside. site in Lower Mustang (an area of ca. 75km2) supported
Our sign surveys revealed only two sets of pugmarks a minimum of three adult Snow Leopards during the
belonging to two adult Snow Leopards in the entire period of observation.
region in 2010 and 2011, but exhaustive interviews with Key-person interviews revealed that local people
local herders suggested the existence of at least three had a positive attitude toward the Blue Sheep but mixed
adult Snow Leopards - one occurring singly, and two in feelings toward the Snow Leopard. In high altitude
pair. settlements elsewhere in Nepal, the act of appeasing
We obtained a total of 42 pictures of Snow Leopards the Snow Leopard in ceremonies has been a traditional
during nine capture events resulting in a capture success social norm. For example, Khumbu, Mount Everest and
of 2.3 individuals per 100 trap nights in 2011 (Table 3). Rolwaling areas contain ‘beyuls’ [the fabled Shangri-la
Jackson et al. (2006) reported 66 and 49 capture events or Shambala], valleys that locals consider are hidden
(capture success 8.9 and 5.6 per 100 trap-nights) in two from evil forces and protected by mountain Gods (Ale
consecutive years of 2003 and 2004 in Hemis National et al. 2010). Should a person with ill intentions try to

Table 3. 2011 results of camera-traps in Annapurna

Trapping effort Images

Camera station (trap nights) Total Full Partial Non-target False Capture events

Vrapsa SLC31 58 NA NA NA 147 103 NA

Namu SLC32 60 NA NA NA 297 7301 NA

Namu SLC33 60 19 2 17 38 10353 3

Lubra SLC35 58 NA NA NA 4 6923 NA

Lubra SLC22 58 4 3 1 16 16 2

Muktinath SLC20 53 17 14 3 43 1753 3

Muktinath SLC19 53 2 0 2 234 212 1

TOTAL 400 42 19 23 779 26661 9

Per 100 trap nights 10.5 4.75 5.75 194.75 6665 2.25

5540 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5534–5543

Snow Leopard in Annapurna Ale et al.
Images 1a,b. The images from Lubra station (dorsal side of tail
on 12.viii.2011, Image 1a) and Namu station (dorsal side of tail
on 21.x.2011, Image 1b) belonged to the same individual: Snow
Leopard 1.
reach a beyul, it is believed he or she will be attacked
and driven away by the Snow Leopard at the mountain
pass entrance. No clear written accounts exist to affirm
whether Mustang is a beyul or not, but legend has it that
the 8th century Buddhist saint ‘Padma Sambhava’, on his
way to Tibet, stopped in Muktinath (a salvation valley
for Hindu people at the elevation of 3,710m - and also
a religious site for Buddhists), meditated and blessed
this sacred place. Legend further states that Yogi battled
and defeated the local demon while travelling through
Ghemi on his way to Lo-Manthang, the medieval
capital of the ancient Kingdom of Lo. At the demon’s
demise, its intestines fell out and this is said to have led
to construction of the longest prayer-wall in northern
Nepal.
Local inhabitants showed mixed feelings toward Snow
Leopard for good reasons: livestock-rearing, although
declining, still represents a significant socio-economic
activity in Mustang, and Snow Leopards often prey upon
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5534–5543
Image 2. Two different Individuals from Namu station. The facial
view on 21.x.2011, Image 2a, of the same individual as in Image
1b: Snow Leopard 1. The facial view on 12.vi.2011 of a different
individual, Image 2b: Snow Leopard 2.
domestic animals. As elsewhere (Mt. Everest region, for
instance, see Ale et al. 2007) with increasing number
of youths seeking employment in the more lucrative
trekking and other businesses, the resulting labor
shortage is adversely affecting current livestock herding
and guarding practices. The interviews with herders in
10 selected settlements (Table 4) revealed that losses
to Snow Leopard ranged from none to as high as 6.6%
of livestock holdings in 2010 and 2011. Yet, villagers in
settlements like Lubra suffering large livestock mortality
to Snow Leopard (5.6% of total stock per annum) are
still willing to tolerate the presence of Snow Leopards,
albeit uneasily. Another widely known legend states
that the Bon-Po and Buddhist deities, disguised as Snow
Leopard, are believed to travel from one settlement to
another guarding the village’s domain from demons
and natural calamities. So killing a Snow Leopard may
also mean harming the community’s ancestral spirits.
Although 3.3% of all livestock losses were attributed to
5541
Snow Leopard in Annapurna Ale et al.

Snow Leopard depredation, many more animals (16%

of total) died from other causes. The rate of livestock
mortality in Mustang is similar to that has been reported
from other parts of Snow Leopard range (see Jackson et
al. 2010).
We conclude that Mustang offers good quality,
protected habitat for the endangered Snow Leopard, and
may also serve as a strategic corridor enabling leopards
to disperse through this portion of the Himalayan and
trans-Himalayan ranges. However, a detailed, systematic
corridor assessment is needed to identify suitable Snow
Leopard-corridors across the Himalaya of Nepal where
conservation interventions could be best mounted. By
mapping seasonal livestock movements, collecting other
biological and physical variables (in addition to Snow
Leopard sign data), and analyzing DNA from scats, hair
and kills, it may be possible to develop an agent-based
corridor model that reasonably predicts how Snow
Leopards move across the landscape and respond to
various management options.

REFERENCES

Image 3. Images captured in Muktinath in two separate instances -
one on 24.xi.2011 (Image 3a) and another on 28.x.2011 (Image 3b) -
were of the same individual: Snow Leopard 3. These stations were
approx. 200m apart from one another.
Ale, S.B. (2007). Ecology of the Snow Leopard and the Himalayan
tahr in Sagarmatha (Mt. Everest) National Park, Nepal. PhD Thesis.
Department of Biological Sciences, University of Illinois at Chicago,
Chicago, 181pp.
Ale, S.B., K. Thapa, R.M. Jackson & J.L.D. Smith (2010). The fate of
Snow Leopards in and around Mt. Everest. CATnews 53: 19–21.
Ale, S.B., P. Yonzon & K. Thapa (2007). Recovery of Snow Leopard Uncia
uncia in Sagarmatha (Mount Everest) National Park, Nepal. Oryx

Table 4. Livestock mortality by Snow Leopard in Mustang in 2010 and 2011

Loss to
Livestock Type     Livestock mortality by   Total   
leopard 
Sheep/ Horse/ Snow Other
Village Household Cattle Yak Total % % mortality % per family
goat Donkey Leopard causes
Lubra 14 388 43 15 17 520 29 6 28 5.4 57 11 2.1

Khinga 29 1012 135 33 19 1199 0 0 612 51.0 612 51 0

Jharkot 45 373 215 55 66 709 5 1 43 6.1 48 6.8 0.1

Purang 20 0 62 12 15 89 0 0 3 3.4 3 3.4 0

Ranipauwa 27 21 118 43 28 210 1 1 14 6.7 15 7.1 0

Jong 30 744 92 37 12 885 17 2 55 6.2 72 8.1 0.6

Putak 12 112 35 17 10 174 3 2 5 2.9 8 4.6 0.3

Tanbe 34 1267 50 26 31 1374 40 3 106 7.7 146 11 1.2

Chhuksang 27 588 174 39 31 832 55 7 75 9.0 130 16 2

Tetang 37 2203 11 58 31 2303 126 6 389 17 515 22 3.4

Total 275 6708 935 335 260 8295 276 3 1330 16.0 1606 19 1.3

5542 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5534–5543

Snow Leopard in Annapurna Ale et al.
41(01): 89-92; http://dx.doi.org/10.1017/S0030605307001585
Caughley, G. (1977). Analysis of Vertebrate Populations. Brisbane:
John Wiley & Son, 234pp.
Dobremez, J.F. (1976). Le Nepal: Ecologie et Biogeographie. Editions
du Centre National de la Recherche Scientifique, Paris, 356pp.
Eberhardt, L.E., L.L. Eberhardt, B.L. Tiller & L.L. Cadwell (1996). Growth
of an isolated elk population. Journal of Wildlife Management 60(2):
369–373.
Fox, J.L., S.P. Sinha, R.S. Chundawat & P.K. Das (1991). Status of the
Snow Leopard in northern India. Biological Conservation 55(3):
283–298; http://dx.doi.org/10.1016/0006-3207(91)90033-6
Fryxell, J.M. (1987). Food limitation and demography of a migratory
antelope, the white-eared kob. Oecologia 72(1): 83–91; http://
dx.doi.org/10.1007/BF00385049
Hussain, S. (2003). The status of the Snow Leopard in Pakistan and
its conflict with local farmers. Oryx 37(01): 26–33; http://dx.doi.
org/10.1017/S0030605303000085
Jackson, R. (1996). Home range, movements and habitat use of Snow
Leopard in Nepal, PhD Thesis. University of London, UK, 233pp.
Jackson, R. & D.O. Hunter (1996). Snow Leopard Survey and
Conservation Handbook. International Snow Leopard Trust and U. S.
National Biological Service, 154pp.
Jackson, R. & G. Ahlborn (1989). Snow Leopards (Panthera uncia) in
Nepal - home range and movements. National Geographic Research
and Exploration 5: 161–75.
Jackson, R. & G. Ahlborn (1990). The role of protected areas in Nepal
in maintaining viable population of Snow Leopards. International
Pedigree Book of Snow Leopard 6: 51–69.
Jackson, R., J.D. Roe, R. Wangchuk & D.O. Hunter (2006). Estimating
Snow Leopard population abundance using photography and
capture-recapture techniques. Wildlife Society Bulletin 34(3): 772–
781; http://dx.doi.org/10.2193/0091-7648(2006)34[772:ESLPAU]2
.0.CO;2
Jackson, R.M., C. Mishra, T.M. McCarthy & S.B. Ale (2010). Snow
Leopards: conflict and conservation, pp. 417–430. In: David, W.M.
& J.L. Andrew (eds). The Biology and Conservation of Wild Felids.
Oxford University Press.
Janečka, J.E., B. Munkhtsog, R.M. Jackson, G. Naranbaatar, D. Mallon
& W.J. Murphy (2011). Comparison of noninvasive genetic and
camera-trapping techniques for surveying Snow Leopards. Journal
of Mammalogy 92(4): 771–783; http://dx.doi.org/10.1644/10-
MAMM-A-036.1
Janečka, J.E., R. Jackson, Z. Yuguang, L. Diqiang, B. Munkhtsog, V.
Buckley-Beason & W.J. Murphy (2008). Population monitoring
of Snow Leopards using noninvasive collection of scat samples: a
pilot study. Animal Conservation 11(5): 401–411; http://dx.doi.
org/10.1111/j.1469-1795.2008.00195.x
Karanth, K.U. & J.D. Nichols (1998). Estimation of tiger densities in India
using photographic captures and recaptures. Ecology 79(8): 2852–
2862; http://dx.doi.org/10.1890/0012-9658(1998)079[2852:EOTDII
]2.0.CO;2
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5534–5543
Karmacharya, D., J. Janecka, S.B. Ale, J. Shakya, P. Joshi, S. Manandhar,
S. Shrestha, C. Kansakar & A. Awasthi (2012). Genetic based
population survey of Snow Leopard (Pantheria uncia) in Annapurna
Conservation and Rolwaling areas of Nepal. Final Report Submitted
to Snow Leopard Conservation Grants, Snow Leopard Network.
http://www.snowleopardnetwork.org /GrantFinalReports/
KarmacharyaFinal11.pdf
Laurian, C., J.P. Ouellet, R. Courtois, L. Breton & S. St Onge (2000).
Effects of intensive harvesting on moose reproduction.  Journal of
Applied Ecology 37(3): 515–531; http://dx.doi.org/10.1046/j.1365-
2664.2000.00520.x
Lovari, S., R. Boesi, I. Minder, M. Mucci, E. Randi, A. Dematteis &
S.B. Ale (2009). Restoring a keystone predator may endanger a
prey species in a human-altered ecosystem: the return of the Snow
Leopard to Sagarmatha National Park. Animal Conservation 12(6):
559–570; http://dx.doi.org/10.1111/j.1469-1795.2009.00285.x
Mallon, D.P. (1991). Status and conservation of large mammals in
Ladakh. Biological Conservation 56(1): 101–119; http://dx.doi.
org/10.1016/0006-3207(91)90092-N
McCarthy, K.M., M. Ma, T.K. Fuller, T.M. McCarthy & K. Jumabay
(2008). Assessing estimators of Snow Leopard abundance.
Journal of Wildlife Management 72(8): 1826–1833; http://dx.doi.
org/10.2193/2008-040
NTNC (2008). Sustainble Develeopment Plan of Mustang. NTNC/
GoN/UNEP Kathmandu, Nepal. Unpub. Report. http://www.rrcap.
ait.asia/nsds/uploadedfiles/file/sa/np/mnmt/document/sd_
masterplan_Mustang.pdf
Oli, M.K. (1994). Snow Leopards and Blue Sheep in Nepal: Densities
and predator-prey ratio. Journal of Mammalogy 75(4): 998–1004;
http://dx.doi.org/10.2307/1382482
Oli, M.K. & M.E. Rogers (1996). Group size and population composition
of Blue Sheep in Nepal. Journal of Wildlife Management 60: 797–
801. 
Schaller, G.B. (1977). Mountain Monarchs: Wild Sheep and Goats of
the Himalaya. Chicago: University of Chicago Press, 425pp.
Schaller, G.B. (1998). Wildlife of The Tibetan Steppe. The University
Chicago Press, Chicago, 373pp.
Schaller, G.B., R. Junrang & Q. Mingjiang (1988). Status of the
Snow Leopard in Qinghai and Gansu provinces, China. Biological
Conservation 45(3): 179–194; http://dx.doi.org/10.1016/0006-
3207(88)90138-3
Stainton, J.D.A. (1972). Forests of Nepal. John Murray, London, 174pp.
Wilson, G.J. & R.J. Delahay (2001). A review of methods used to
estimate the abundance of terrestrial carnivores using field signs
and observation. Wildlife Research 28(2): 151–164; http://dx.doi.
org/10.1071/WR00033
Wolf, M. & S.B. Ale (2009). Signs at the top: habitat features influencing
Snow Leopard Uncia uncia activity in Sagarmatha National Park,
Nepal. Journal of Mammalogy 90(3): 604–611; http://dx.doi.
org/10.1644/08-MAMM-A-002R1.1
Threatened Taxa
5543
 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5544–5552
Communication

Morphological and molecular identification of acridid

grasshoppers (Acrididae: Orthoptera) from Poonch division,
ISSN
Azad Jammu Kashmir, Pakistan
Online 0974–7907
Print 0974–7893 Naila Nazir 1, Khalid Mehmood 2, Muhammad Ashfaq 3 & Junaid Rahim 4
OPEN ACCESS Department of Entomology, University of Poonch, Rawalakot, Azad Jammu Kashmir 12350, Pakistan
1,2,4

3
Biodiversity Institute of Ontario, University of Guelph, Ontario, Canada, N1G 2W1
1
nzbsc_127@yahoo.com (corresponding author),2 kmmaldial@yahoo.com,3 muhammadashfaq@hotmail.com,
4
junaidrahim47@yahoo.com

Abstract: The present study was conducted to resolve conflicts in the identification of grasshopper species of the family Acrididae (Orthoptera)
on the basis of morphology and DNA barcoding. Grasshoppers representing 26 species of the family Acrididae were collected from different
habitats and host plants from Poonch division of Azad Jammu Kashmir, Pakistan. Specimens were identified taxonomically and DNA sequenced
for the cytochrome c oxidase (COI) barcode region. Barcodes of 19 morphological species were successfully obtained and the sequence data
was used to separate species by Neighbor-Joining cluster analysis. Barcode data successfully discriminated 18 species, while two: Patanga
japonica (Bolivar, 1898) and P. succincta (Johannson, 1763) could not be distinguished since they shared the barcode sequence and clustered
together on the Neighbor-Joining (NJ) tree. Morphologically, specimens of Shirakiacris shirakii (Bolívar, 1914) were identified as one species,
but barcode data revealed that in addition to Shirakiacris shirakii (Bolívar, 1914) two other species of the genus Shirakiacris are present in
the region. Similarly, on the basis of morphological characters two species were indentified in subfamily Catantopinae, Catantops erubescens
(Walker, 1870) and Xenocatantops brachycerus (Willemse, 1932), but barcode data suggest the presence of an additional Catantops species
in the region. These findings show the usefulness of barcode data in discriminating grasshopper species and indicate that such data can be
reliably used for developing reference libraries for species identification via sequence matches.

Keywords: Acrididae, COI, DNA barcoding, Kashmir, morphological identification.

DOI: http://dx.doi.org/10.11609/JoTT.o3507.5544-52| ZooBank: urn:lsid:zoobank.org:pub:32A15DA6-57FD-422D-9655-A467AA4E40B0

Editor: R.K. Avasthi, Rohtak University, Haryana, India. Date of publication: 26 March 2014 (online & print)

Manuscript details: Ms # o3507 | Received 29 January 2013 | Final received 15 March 2014 | Finally accepted 18 March 2014

Citation: Nazir, N., K. Mehmood, M. Ashfaq & J. Rahim (2014). Morphological and molecular identification of acridid grasshoppers (Acrididae: Orthoptera) from
Poonch division, Azad Jammu Kashmir, Pakistan. Journal of Threatened Taxa 6(3): 5544–5552; http://dx.doi.org/10.11609/JoTT.o3507.5544-52

Copyright: © Nazir et al. 2014. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium, reproduction and
distribution by providing adequate credit to the authors and the source of publication.

Funding: Sequence analysis was made possible by a grant from Genome Canada and the Ontario Genomics Institute in support of the International Barcode of Life
Project. Financial support was also provided by Higher Education Commission Pakistan by grant HEC No. 20-1403/R& D/09.

Competing Interest: The authors declare no competing interests.

Author Contribution and Details: Naila Nazir - The principle author, it was her MSc (Hons.) research work. Now she is working as a lecturer. Khalid Mahmood
- chairman and supervisor during the study. He is an orthopterist and currently working on some genera of Acrididae. Muhammad Ashfaq - co-supervisor, he
was working as foreign professor in NIBGE Faislabad, Pakistan. His research interests are molecular biology and DNA barcoding of arthropods. He contributed in
planning, carrying out the study and analyzing the sequence data. Junaid Rahim - assisted during the research in all aspects.

Acknowledgements: First author is greatly thankful to Insect Molecular Lab NIBGE (National Institute of Biotechnology and Genetic Engineering) Faislabad for
providing me research facilities all those people (Sleem Akhter, Maryum Masood, Romana Ifthkar) there assisted me during my work. I would like to offer great
sense of gratitude towards Biodiversity Institute of Ontario, University of Guelph, Canada for providing me facilities for DNA barcoding. My sincere thanks Prof.
Dr. M. Rafique Khan for support, Prof Dr. M. Rahim Khan, Miss Ansa Tamkeen, Mr. Abdul Ghaffar, Shumila Arif, Munazza Khurshid for their assistance during my
research work. I am greatly indebted to Mr Junaid Rahim for all sort of assistance during my research work and moral support. Support from Dr. Paul Hebert,
Scientific Director of iBOL is acknowledged.

   
 

5544
Morphological and molecular identification of grasshoppers Nazir et al.

INTRODUCTION (Colgan 1991; Chapco & Litzenberger 2003; Rowell &

Grasshoppers are the most prevalent pests in all
sorts of vegetation in pastures and grasslands. Family
Acrididae encompasses the short-horned grasshoppers
and locusts, phytophagous insects that are widely
distributed throughout the world and considered ruinous
in the arid zone (Watts et al. 1982). Taxonomists generally
use morphological identification for studies used to plan
control strategies, but this method of identification has
several limitations (Scotland et al. 2003). Cryptic species
(sibling species) may be incorrectly identified due to
phenotypic malleability. Morphologically enigmatic taxa
are common in many groups neglected by this approach
(Jarman & Elliott 2000). Morphological keys are often
limited to particular life stages, limiting the effectiveness
of identification. Finally, a high level of proficiency is
required to use the keys to avoid misdiagnoses. This has
led to the use of molecular data to resolve cryptic species
(Xiao et al. 2010). In micro genomic identification,
system differences among DNA sequences are used to
identify the different organisms (Wilson 1995). In fact
these sequences are genetic barcodes enclosed in each
cell. The barcode region, a 658-bp nucleotide fragment
of mitochondrial COI has been accepted by scientists
for identification of animal species (Hebert et al. 2003).
The use of short standardized gene regions as internal
Flook 2004). Several researchers have used DNA data
in phylogenetic analysis to identify grasshopper species
(Chapco & Litzenberger 2002; Mukha et al. 2001; Song
& Wenzel (2007) Ketmaier et al. 2010). Use of DNA data
has also been used in combination with morphological
data to establish species relationships (Brust 2008).
Keeping in view the economic importance of
grasshoppers and their damage to crops in Azad
Kashmir, a need for correct identification of this group
of pests has emerged. Azad Jammu & Kashmir lies
between 73–750N and of 33–360E and comprises an
area of 5,134m2 (13,297km2) (Fig. 1). Poonch division
of Azad Jammu Kashmir comprises an area of 2,792km2.
Its topography is mainly hilly, climatic conditions and
floristic composition significantly varies from place to
place. Administratively, this division consists of four
districts, Bagh, Poonch, Sudhnoti, and Haveli. A survey
was conducted to identify grasshopper species of family
Acrididae from Poonch division. Major contributions
to the Acrididae fauna of Kashmir have been provided
by some entomologists like Kirby (1914), Fletcher
(1919), Mahmood (1995), Mahmood & Yousaf (1999),
Mahmood & Yousaf (2000); Mahmood et al. (2002);
N
W E

species tag to recognize the species is an accurate, S

reliable, and rapid method. Due to copious benefits

in identification, DNA barcoding is getting considerable
concentration in the field of science (Hebert et al. 2004).
The basic scientific advantage of DNA barcoding is fast
and digital species identification at any life stage or
piece of an organism, and the simplification of species
explorations (Janzen et al. 2005). The selected DNA
sequence precisely separates the species on the basis
of interspecific and intraspecific variations (Matz &
Nielsen 2005). Barcoding has helped in resolving cryptic
species complexes (Burns et al. 2007; Deng et al. 2012)
and performing ecological studies on various animal
phyla (Valentini et al. 2009). The generated data is also
being used to construct barcode reference libraries for
identification of unknowns by matching sequences with
the known species (Guralnick & Hill 2009; Janzen et al.
2009). A combination of molecular and morphological
data can produce reliable data sets to be used in
barcode libraries (Emery et al. 2009). Use of PCR as a
tool to amplify and sequence genes and then exploit the
nucleotide data for phylogenetic analysis and develop
evolutionary relationships among grasshopper species Figure 1. Map of Azad Kashmir illustrated Poonch division with
has previously been practiced by a number of researchers highlighted collection localities

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5544–5552 5545

Morphological and molecular identification of grasshoppers Nazir et al.

Table 1. Characteristics of collection localities of study area cyanide and stretched out on the stretching board with
District Locality Altitude(ft) Latitude Longitude the help of standard entomological pins (No. 16–40).
Rawalakot 5393 33.80N 73.80E
The specimens were dried, examined with the use of
a Leica MZ6 microscope and identified using keys (Bie-
Hajeera 3167 33.60N 73.30E
Bienko & Mischenko (1951), Drish (1961), Ritchie (1982),
Jandali 6785 33.30N 73.30E
Poonch and Mason (1973), Suhail (1994), Mahmood (1995). The
Banjosa 6212 33.0 N
0
73.90E
terminology of Kirby (1914) and Bie-Benko & Mischenko
Tolipeer 8800 33.00N 73.90E
(1951) were used in this identification process. The
Abbaspur 4261 33.6 N 73.00E specimens of each identified species were confirmed
0

Mang 4842 33.20N 73.90E from (Eades et al. 2011).

Plundari 4000 33.2 N
0
73.90E
Sudhnoti
Baloch 5304 33.80N 73.00E Sequencing/ DNA barcoding
Trarkhel 5600 33.9 N
0
73.7 E
0 Morphologically identified grasshopper specimens
Khautta 5189 33.60N 74.50E were transferred to the Insect Molecular Biology
Degwar 5000 33.1 N
0
74.40E
Lab, National Institute for Biotechnology and Genetic
Engineering (NIBGE), Faisalabad for DNA barcoding
Hajipeer 8221 33.50N 74.90E
for their identification at the molecular level. The
Haveli Kalamola 8207 33.30N 74.00E
specimens were processed following standard DNA
Aliabad 8606 33.8 N
0
73.10E
barcoding protocols as outlined previously (Hebert
Bedori 12229 33.00N 74.90E
et al. 2003). In brief, labeled specimens were arrayed
Lasdana 8069 33.5 N 73.40E in a 96-well PCR plate fashion to correspond with the
0

Bagh City 6000 33.80N
Bagh Dherkot 5657 34.6 N
0
Dhulli 6082 33.60N
Mahmood & Rizwan (2002); Mahmood & Shah (2003)
Mahmood et al. (2004); Reshi & Azim (2008); Azim &
Reshi (2010) but nobody has made any effort to identify
them on a molecular level either by DNA barcoding or
by using any other marker. To remove identification
conflicts among 26 morphological species of the family
Acrididae from Poonch, and to add species sequences to
the international barcode reference library, studies were
performed to identify the grasshoppers morphologically
and by DNA barcoding. Nevertheless, our knowledge
of the grasshopper fauna of Azad Jammu Kashmir is
still insufficient, particularly of species living in natural
habitats and being commonly distributed over small
areas.
73.50E location of tissue samples in the plates. Specimen
73.30E data on field identification, taxonomic identification,
73.30E identifier, voucher type, collectors, collection date,
province, region, locality, latitude, longitude and
elevation was entered on a spreadsheet. Specimen data
and images were uploaded to the Barcode of Life Data
System (BOLD) (www.boldsystems.org) hosted by the
Biodiversity Institute of Ontario, University of Guelph,
Canada. Tissue sampling was performed by removing a
small part of the insect’s leg and transferring it into the
labeled 96 well PCR plate in the corresponding well. Six
copies of each species were used for molecular studies.
DNA isolation
A small part of the leg from individual grasshoppers
was transferred to the PCR plate and genomic DNA was
extracted following protocols described by Ivanova et al.
(2006) at the Canadian Centre for DNA Barcoding within
the Biodiversity Institute of Ontario.

PCR amplification and sequencing

MATERIAL AND METHODS
The collection of grasshoppers was carried out
from the maximum floristic composition and cultivated
crops like rice, maize, soybean, etc. A detailed survey
of grasshoppers from the 19 localities of the study area
(Table 1) from the year 2010–2011 and the collections
were carried out with the help of a sweep net (24 inches
diameter). The collected specimens were killed by
Amplification of the COI-5′ (barcode) was
performed with primer pair LCO1490_t1/ HCO2198_t1
(TGTAAAACGACGGCCAGTGGTCAACAAATCATAAAGATATTGG /
CAGGAAACAGCTATGACTAAACTTCAGGGTGACCAAAAAATCA)
following the PCR conditions; 940C (1 min), five cycles of
940C (40 s), 450C (40 s), 72°C (1 min); 35 cycles of 940C
(40 s), 510C (40 s), 720C (1 min) and final extension of
720C (5 min). PCRs were carried out in 12.5µL reactions
containing standard PCR ingredients and 2µL of DNA

5546 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5544–5552

Morphological and molecular identification of grasshoppers Nazir et al.
template. PCR products were analyzed on 2% agarose
E-gel® 96 system (Invitrogen Inc.). Amplicons were
sequenced bidirectionally using the BigDye Terminator
Cycle Sequencing Kit (Applied Biosystems) on an Applied
Biosystems 3730XL DNA Analyzer. Sequences were
assembled, aligned and edited using CodonCode Aligner
(CodonCode Corporation, USA). Obtained barcode
sequences were edited and analyzed and uploaded to
the BOLD for further analysis and storage. Specimens
used for tissue sampling were saved as voucher
specimens for future reference.
Sequence data analysis
Sequence similarity analysis to determine the
matching species in the DNA/barcode databases were
performed by using “Blast” and “Identification Request”
tools of the NCBI and BOLD. Currently barcodes of
3008 specimens representing 421 Acridid species are
readily available on BOLD for sequence comparisons.
ClustalW nucleotide sequence alignments (Thompson
et al. 1994) were performed using MEGA V5 (Tamura
et al. 2011) under default parameters. Patterns of
sequence divergence among taxa were visualized
using the neighbor-joining method (Thompson et al.
1994). Evolutionary distances were computed using
the maximum composite likelihood method based upon
the units of the number of base substitutions per site
after all positions containing gaps and missing data were
eliminated from the dataset (Complete deletion model).
To perform pairwise distance analysis and to generate
distance histograms and distance ranks we used an
online version of Automatic Barcode Gap Discovery
(ABGD) (Puillandre et al. 2012).
RESULTS
Morphological identification and distribution of acridid
species in Poonch
Details of the specimen collection habitats and their
host plants are outlined in Table 2. The studies resulted in
the morphological identification of 26 species under 15
genera of nine subfamilies of the family Acrididae (Table
2). Among subfamily Oedipodinae species of the genus
Gastrimargus were found to be abundant at a higher
altitude while Sphingonotus longipennis (Saussure,
1884), Aiolopus thalassinus tumulus (Fabricius, 1798),
Trilophidia japonica (Sassure, 1888), Trilophidia turpis
(Walker, 1870) were not abundant; only a few specimens
of these species were collected during the survey. The
species of genus Acrida of subfamily Acridinae were found
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5544–5552
to be abundant in areas of higher elevation while their
population declined in lower elevations. Spathosternum
parsiniferum parsiniferum (Walker, 1871) of subfamily
Spathosterninae was found to be abundant at higher
elevations while the species of genus Hieroglyphus,
Hieroglyphus nigroreplatus (Bolivar, 1912), Hieroglyphus
banian (Fabricius, 1798), Hieroglyphus concolar (Walker,
1870) and Hieroglyphus oryzivorus (Carl, 1916) were
found on rice crops abundantly. Their population was
restricted to lower elevations. While the species of
subfamily Oxyinae particularly genus Oxya was recorded
to be most abundant throughout the surveyed area,
among them Oxya fuscovittata (Marschall, 1836)
and O. hyla hyla (Serville, 1831) were most abundant
over all sorts of vegetation. Subfamily Calliptaminae
with the single species Acorypha glucopsis (Walker,
1870) was recorded as abundant at higher elevations.
Eyprepocnemidinae also with the species Shirakiacris
shirakii (Bolívar, 1914) and according to barcode
results two more species (morphologically identified as
Shirakiacris shirakii (Bolívar, 1914) but barcode results
showed them to be different species under the same
genus were found to be abundant at higher altitudes.
The species of subfamily Catantopinae Pachyacris vinosa
(Walker, 1870) was found to be very rich in higher
altitudes and moderately in lower areas, while the
population of Paraconophyma kashmiricum (Mischenko,
1950) was restricted only to the higher elevations of the
surveyed area. The population of Catantops erubescens
(Walker, 1870) and Xenocatantops brachycerus were not
very plentiful but recorded from some higher areas from
grasses, while Catantops innatobalis (Walker, 1871) was
very rare with only a single specimen collected. Species
of subfamily Cyrtacanthacridinae Patanga succincta
(Johannson, 1763) and Patanga japonica (Bolivar, 1898)
were most abundant in the surveyed area.
Barcode analysis
DNA barcodes of 85 specimens of 21 species were
successfully sequenced and the size of the barcode was
uniform among all the species producing successful
barcodes. The sequences have either been allocated
GenBank accession numbers or have been submitted
to the European Molecular Biology Laboratory
(EMBL)/ (DDBJ)/Gene Bank databases for assignment
of accessions. We performed identity analysis of the
species based on barcode sequence matches with
those of other species already deposited in the Barcode
of Life Data System (BOLD) and National Center for
Biotechnology Information (NCBI) databases. From the
database searches we found that only one species,
5547
Morphological and molecular identification of grasshoppers Nazir et al.

100 100
82 82 Acrida
Acrida turrita (6) turrita (6)
100 100
72 72
Aiolopus thalassinus
Aiolopustamulus
thalassinus
(4) tamulus (4)
100 100
65 Sphingonotus longipennis (5)
Sphingonotus longipennis (5)
65
100 Gastrimargus africanus africanus (1)
39
100
100 Gastrimargus africanus africanus (1)
39 Gastrimargus
100 africanus sulphureus (4)
100 Gastrimargus africanus sulphureus (4)
42 Acorypha
100 galucopsis (3)
42 100 Acorypha galucopsis (3)
31 Spathosternum
100 parsiniferum (2)
31 99 Spathosternum parsiniferum (2)
100 Oxya99hyla hyla (5)
100
100 Oxya Oxya hyla hyla
fuscovittata (6) (5)
100
100
Oxya fuscovittata
Hieroglyphus concolor(6)
(6)
92 100
84 Hieroglyphus
Hieroglyphus oryzivorus (1) concolor (6)
92 100
73 Hieroglyphus banian (6)oryzivorus (1)
Hieroglyphus
84 100 100
73 Hieroglyphus nigroreplatus
Hieroglyphus banian(7)
(6)
100
100
85 Patanga japonica/succincta (8)
100 Hieroglyphus nigroreplatus (7)
Pachyacris
100 vinosa (4)
85 100 Patanga japonica/succincta (8)
71 100 Shirakiacris
100 sp1 (3)
100 Pachyacris vinosa (4)
Shirakiacris
100 shirakii (1)
100
48
71 100 Shirakiacris
Shirakiacris sp2sp1
(3)
(3)
100100
Shirakiacris
Catantops erubescens (3) shirakii (1)
99 100
100
48 100 Catantops innatobalis (3) Shirakiacris sp2 (3)
100 100
99
Catantops
Xenocatantops erubescens (3)
brachycerus
(5) 100
100 Catantops innatobalis (3)
100
0.02
Xenocatantops brachycerus
(5)

0.02

  64 MAORT089-10| P. japonica
18 MAORT086-10| P. succincta

  21 20 MAORT090-10| P. japonica
64 MAORT089-10| P. japonica
MAORT082-10|P. succincta
18
18 MAORT086-10| P. succincta
MAORT084-10|P. succincta
43
20
21 MAORT088-10|P. succincta MAORT090-10| P. japonica

MAORT087-10|P. succincta MAORT082-10|P. succincta

18
MAORT081-10|P. succincta MAORT084-10|P. succincta
43
MAORT088-10|P. succincta
0.0005 MAORT087-10|P. succincta

MAORT081-10|P. succincta
Figure 2. DNA barcode-based neighbor joining cluster analysis of species belonging to family Acrididae collected from Poonch. The tree is
based on 85 sequences derived from 22 species. Bootstrap values (500 replicates) are shown above the branches. The tree is drawn to scale,
with branch lengths in the same units as those used to infer the phylogenetic tree. Tree nodes are collapsed for each species. Numbers
0.0005 distances were computed using the K2P
in brackets next to each species names represent the number of individuals analyzed. Sequence
method and are shown as in base substitutions per site. All positions containing gaps and missing data were eliminated using pairwise
deletion option. Analyses were conducted in MEGA5. Sub-tree in a box indicates branching pattern of two species, Patanga Japonica and P.
succincta which show no pattern of genetic difference in the COI barcode region.

Aiolopus thalassinus tumulus (Fabricius, 1798) shared Africa. Barcodes of none of the other species from our
the barcode with conspecifics from Kenya and South studies matched with those from any other country in

5548 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5544–5552

Morphological and molecular identification of grasshoppers Nazir et al.
Table. 2 Morphologically identified species and their hosts
Subfamily Species
Gastrimargus africanus africanus
(Saussure, 1888)
Gastrimargus africanus sulphureus
(Bie- Bienko, 1951)
Oedipodinae Aiolopus thalassinus tamulus
(Fabricius, 1798)
Trilophidia japonica (Saussure, 1888)
Trilophidia turpis (Walker, 1870)
Sphingonotus longipennis (Saussure,
1884)
Acrida turrita (Linne, 1758)
Acridinae
Acrida gigantea (Herbst, 1786)
Spathosternum parsiniferum
Spathosterninae
parsiniferum (Walker, 1871)
Hieroglyphus nigrorepletus (Bolivar,
1912)
Hieroglyphus banian (Fabricius, 1798)
Hemiacridinae
Hieroglyphus concolor (Walker, 1870)
Hieroglyphus oryzivorus (Carl, 1916)
Oxya fuscovittata (Marschall, 1836)
Oxyinae
Oxya hyla hyla (Serville, 1831)
Oxya hyla intricata (Stål, 1861)
Oxyina bidentata (Willemse, 1925)
Acorypha glaucopsis (Walker, 1870)
Calliptaminae
Eyprepocnemidinae Shirakiacris shirakii (Bolívar, 1914)
Catantopinae
Pachyacris vinosa (Walker, 1870)
Paraconophyma kashmirica
(Mishchenko, 1950)
Catantops erubescens (Walker, 1870)
Xenocatantops brachycerus
(Willemse, 1932)
Catantops innatobalis (Walker, 1871)
Patanga succincta (Johannson, 1763)
Cyrtacanthacridinae
Patanga japonica (Bolivar, 1898)
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5544–5552
Habitat description and host plants
Kalamola in grassy meadows, 8 males, 1 female, 13.ix.2010; 3 females,
04.ix.2010; Khautta on grasses 1 male, 03.x.2010; Trarkhel on maize 3 males,
24.vii.2010; Jandali on maize, 1 female, 08.x.2010.
Kalamola on grasses 3 males, 3 females, 13.x.2010; 1 female, 18.ix.2010;
Banjosa on grasses 2 males, 4 females, 06.viii.2010; Khautta on grasses 1
male, 1 female, 23.ix.2010; Trarkhel on shrubs 3 males, 1 female, 12.xi.2010.
Hajipeer, 5 males, 4 females, 23.ix.2011
Hajipeer on wild herbs, 6 males, 23.ix.2011; Hajeera on cultivated plant nursery,
3 females, 4 males, 02.ix.2010
Hajipeer on wild herbs, 5 males, 4 females, 23.ix.2011
Hajipeer on grassy meadows, 6 females, 5 males, 23.ix.2011
Rawalakot on grasses, soybean and maize fields, 3 females, 20.x.2010;
1 male, 24.x.2010; Hajeera on rice field and grasses, 4 females, 1 male,
24.x.2010; 2 females, 1 male, 20.x.2010.
Mang on grasses, 4 females, 24.x.2010; Plundari on maize fields and grasses,
3 females, 4 males, 24.x.2010; Rawalakot on soybean field 1 female, 6 males,
25.x.2010.
Degwar on grasses, 1 female, 06.vii.2010; 1 female, 3 males, 20.ix.2010; 2
females, 20.ix.2011; 1 male, 04.ix.2011; 1 male,, 19.ix.2011; 1 male, 20.ix.2011;
1 male, 3 females, 23.ix.2011. Khautta on maize fields and grasses, 1 female,
05.viii.2011; 1 female, 04.viii.2011
Hajeera on rice fields, 4 females, 6 males, 30.ix.2010
Hajeera on rice fields, 5 males, 7 females, 20.x.2010
Hajeera on rice fields, 5 females, 7 males, 09.ix.2010
Hajeera on rice fields, 5 males, 6 females, 20.x.2010
Rawalakot on grasses and soybean fields, 20 females, 5 males, 19.viii.2010;
Banjosa on wild shrubs, 9 females, 2 males, 14.viii.2010; Tolipeer on wild
grasses, 6 females, 04.ix.2010; Jandali on maize field and grasses, 17 females,
14 males, 16.viii.2010
Hajeera on grasses and rice fields, 32 females, 2 males, 20.x.2010; Baloch on
grasses 12 females, 07.viii.2011.
Hajeera on rice fields and grasses, 3 females, 7 males, 20.x.2010.
Rawalakot on grasses and maize field, 3 females, 4 males, 19.viii.2010.
Degwar on wild grasses and herbs, 4 females, 20.ix.2009; 1 female, 04.ix.2010;
2 females, 06.ix.2010; 1 female, 19.ix.2010; 3 males, 04.viii.2010 (N. Nazir)
Rawalakot on grasses and maize fields, 2 females, 3 males, 19.viii.2010; Khautta
on grasses and plant nursery, 2 females, 23.viii.2010; 3 males, 03.iii.2010;
Degwar on wild plants and grasses, 3 females, 22.viii.2010; 2 males, 03.viii.2010
(N. Nazir)
Degwar on wild grasses and herbs, 2 females, 01.x.2010; 1 female,, 06.vii.2010;
1 female, 09.x.2010; 2 males, 10.x.2010; Khautta on maize fields and grasses,
3 females, 10.x.2010; Abbaspur on maize fields, plants nursery and grasses, 2
females, 08.ix.2010 (N. Nazir)
Degwar on grasses and wild herbs, 3 females, 19.vii.2010; 2 males, 21.vii.2011;
Kalamola on wild grasses and herbs, 3 males, 15.ix.2011; 4 females, 13.ix.2010;
Bedori on grazing meadows, wild grasses, 2 females, 19.vii.2010; Aliabad on
grasses, 2 females, 12.viii.2010 (N. Nazir)
Khautta on grasses and maize fields, 2 females, 4 males, 07.vii.2010; 4 females,
20.vii.2010 (N. Nazir)
Hajipeer on wild flower plants, 3 females, 2 males, 23.ix.2011; Halan Shumali on
wild plants, 1 female, 5 males, 23.ix.2011; Bagh on grasses, 2 females, 1 male,
23.ix.2011 (N. Nazir)
Khautta on wild flowers and grasses, 4 females, 6 males, 07.vii.2010 (N. Nazir)
Rawalakot on grasses and soybean field, 3 females, 2 males, 03.ix.2010;
Bagh on grasses 4 females, 23.ix.2011; Trarkhel on maize fields, 2 females, 1
male, 16.x.2010; Jandali on dry residues of maize plants, 6 females, 4 males,
18.x.2010 (N. Nazir)
Rawalakot 4 females, 1 male, 03.ix.2010; Trarkhel 5 females, 3 males, 16.x.2010.
(N. Nazir).
5549
Morphological and molecular identification of grasshoppers Nazir et al.

663 with strong bootstrap support (Fig. 2). Pachyacris vinosa

596 lies on the same branch as on the Patanga succincta
nbr

530 (Johannson, 1763) and Patanga japonica (Bolivar,

464 1898) while according to Orthoptera Specie File (OTS)
397 Patanga succincta (Johannson, 1763) and Patanga
331 japonica (Bolivar, 1898) are under the subfamily
265 Cyrtacanthacridinae (Kirby, 1902) and Pachyacris vinosa
198 (Walker, 1870) under the subfamily Catantopinae Bie-
132 Bienko & Mischenko (1951). According to barcoding
66 results both of them share the same genus and subfamily
which supports Bie-Bienko & Mischenko (1951) who
kept Pachyacris vinosa (Walker, 1870), Patanga succincta
0.00
0.01
0.02
0.04
0.05
0.06
0.07
0.09
0.10
0.11
0.12
0.14
0.15
0.16
0.17
0.19
0.20
0.21
0.22
0.24
Dist. value (Johannson, 1763) and Patanga japonica (Bolivar, 1898)
(A) Histogram of intraspecific distances
under the same subfamily Catantopinae.
40 The distance data and the groups produced by
no. groups

38
36 Recursive Partition
Initial Partition
recursive and initial partitions generated by ABGD are
34
32 presented in Fig. 3A and 3B. In the dataset 18 species
30
28 are represented by two or more than two specimens.
26
24
The distributions of distances show a gap between the
22
20
intraspecific and the interspecific distances (Fig. 3A).
18 The partitions analysis shows the presence of 19 groups
16
14 by recursive partition at a divergence level of 2.15% in
12
10 the dataset (Fig. 3B).
8
6
4
2
0.0010

0.0017

0.0028

0.0046

0.0077

0.0129

0.0215

0.0359

0.0599

0.1000

0 DISCUSSIONS
Prior Intraspecific divergence (P)
(B) Partition analysis.
The variability in the genus Gastrimargus was found
Figure 3. Pairwise distance divergence analysis of Acridid
grasshopper species as performed by ABGD. in two subspecies and when they were barcoded their
sequence data show a considerable variation among
the two morpho subspecies. Some of the species were
BOLD or NCBI databases. collected from a very low altitude to very higher altitudes
Cluster analysis of the barcode data showed that 18 showing a wide range of distribution. In the present
of the 21 species included in the dataset formed distinct study 26 species of family Acrididae were identified and
and non-overlapping monophyletic clusters (Fig. 2). subjected to DNA barcoding made comparisons with
Tree nodes for each morphological species with multiple the nucleotide data among species and phylogenetic
specimens were collapsed which appear as vertical lines analysis performed. Out of 26 species, barcoding results
or triangles in the tree indicating the level of intraspecific of 21 species were obtained. The remaining five species
divergence. Two species, Patanga japonica (Bolivar, either did not yield amplification or the sequences
1898) and Patanga succincta (Johannson, 1763) shared were not of good quality/were contaminated. Among
the same cluster on the dendrogram. The subtree these sequenced species morphologically identified two
(Fig. 2A) indicates the minor genetic distances among same subspecies of genus Gastrimargus shown in the
the specimens of these two species but with no clear phylogenetic tree represents a lot of variation which
pattern of species grouping. Specimens of the species, requires further taxonomic expertise to resolve this
Eyprepocnemis shiriaki produced three separate clusters confusion. Similarly, two species of genus Patanga also
with significant bootstrap support (100%) indicating that require taxonomic expertise and it is in the process of
the species is a complex of at least three species (Fig. 2). removal by the taxonomist first author and co-authors.
The species Gastrimargus africanus is represented by Nucleotide data of the gene sequenced in these
two subspecies, G. africanus africanus (Saussure, 1888) studies did not match perfectly with any of the other
and Gastrimargus africanus sulphureus (Bie- Bienko grasshopper species in the Gene Bank. Similarly, there
1951). Both the subspecies made monophyletic clusters were significant nucleotide variations among all the

5550 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5544–5552

Morphological and molecular identification of grasshoppers Nazir et al.
sequenced genes of the 18 species. The DNA barcode
region of COI (COI-5′) showed significant nucleotide
differences among grasshopper species and came out as
a promising region to be used for grasshopper species
identification. The phylogenetic analysis based on the
barcode region of COI also provided better relationships
among various grasshopper species. DNA barcoding
is a new phenomenon and is not only being used to
identify species but is also being used to study species
relationships and to investigate genetic diversities
among insect populations (Mondal et al. 1999;
Hajibabaei et al. 2006; Emery et al. 2009; Ashfaq et al.
2011). In conclusion, the use of nucleotide data from
the barcode region of COI supported the grasshoppers,
identifications and phylogenetic relationships performed
on the basis of morphological characters. The nucleotide
data, however, could not be used to make comparisons
with other such sequences in the gene bank databases
as sequences from the same region of COI were not
available in the gene bank. This shows the limitation of
the use of DNA data for species identification. Sequences
produced from the grasshopper species in the current
studies and their submission in the gene bank database
will be a good addition to the sequence database as well
as to the barcode reference library.
REFERENCES
Ashfaq, M., J. Ara, A.R. Noor, P.D.N. Hebert & S. Mansoor (2011).
Molecular phylogenetic analysis of a scale insect (Drosicha
mangiferae; Hemiptera: Monophlebidae) infesting mango orchards
in Pakistan. European Journal of Entomology 108(4): 553–559.
Azim, M.N. & S.A. Reshi (2010). Taxonomic notes on the tribe Acridini
Latreille (Acridinae: Acrididae: Orthoptera) of Kashmir, India. Acta
Zoológica Mexicana (nueva serie) 26(1): 219–222.
Bie-Bienko, G.Y. & L.L. Mischenko (1951). Locust and Grasshoppers of
USSR and Adjacent Countries. Pt I & II, Monson, Jerusalem, 691pp.
Brust, L.M. (2008). Taxonomy and distribution of Acridid grasshoppers
in Nebraska and effect of temperature and immersion on grassland
pests. PhD Thesis, University of Nebraska.
Burns, J.M., D.H. Janzen, M. Hajibabaei, W. Hallwachs, P.D.N. Hebert
(2007). DNA barcodes of closely related (but morphologically and
ecologically distinct) species of skipper butterflies (Hesperiidae) can
differ by only one to three nucleotides. Journal of the Lepidopterists
Society 61: 138–153.
Chapco, W. & G. Litzenberger (2002). A molecular phylogenetic study
of two relict species of melanopline grasshoppers. Genome 45(2):
313–318; http://dx.doi.org/10.1139/g01-156
Chapco, W. & G. Litzenberger (2003). A molecular phylogenetic
analysis of the grasshopper genus Melanoplus Stål (Orthoptera:
Acrididae) - an update. Journal of Orthoptera Research 11(1): 1–9;
http://dx.doi.org/10.1665/1082-6467(2002)011[0001:AMPAOT]2.
0.CO;2
Colgan, D.J. (1991). Phylogenetic studies of acridoid grasshoppers
comparing 2n2- and 4-base recognizing endonucleases. Journal
of Evolutionary Biology 4(4): 575–591; http://dx.doi.org/10.1046/
j.1420-9101.1991.4040575.x
Deng, J., F. Yu, T.X. Zhang, H.Y. Hu, C.D. Zhu, S.A. Wu & Y.Z. Zhang (2012).
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5544–5552
DNA barcoding of six Ceroplastes species (Hemiptera: Coccoidea:
Coccidae) from China. Molecular Ecology Resources 12(5): 791–796;
http://dx.doi.org/10.1111/j.1755-0998.2012.03152.x
Drish, V.M. (1961). A preliminary revision of the families and
subfamilies of Acridoidae (Orthoptera: Insecta). Bulletin of British
Museum (Natural History) Entomology 10: 351–419.
Eades, D.C., D. Otte, M.M. Cigliano & H. Braun (2011). Orthoptera
Species File. Version 5.0/5.0. [may 2013]. <http://Orthoptera.
SpeciesFile.org>.
Emery, V.J., L.J. Eckert & G. Christopher (2009). Combining DNA
barcoding and morphological analysis to identify specialist floral
parasites (Lepidoptera: Coleophoridae: Momphinae: Mompha).
Molecular ecology Resource 9(s1): 217–223; http://dx.doi.
org/10.1111/j.1755-0998.2009.02647.x
Fletcher, J.B. (1919). Annotated list of Indian crop pest. Report of
Proceedings of 3rd Entomological Meeting, Pusa, 1: 306pp.
Guralnick, R. & A. Hill (2009). Biodiversity informatics: automated
approaches for documenting global biodiversity patterns
and processes. Bioinformatics 25(4): 421–428; http://dx.doi.
org/10.1093/bioinformatics/btn659
Hajibabaei, M., D.H. Janzen, J.M. Burns, W. Hallwachs & P.D.N. Hebert
(2006). DNA barcodes distinguish species of tropical Lepidoptera.
Proceedings of National Academy of Science 103(4): 968–971;
http://dx.doi.org/10.1073/pnas.0510466103
Hebert, P.D.N., A. Cywinska, S.L. Ball & J.R. deWaard (2003). Biological
identifications through DNA barcodes. Proceedings of Royal Society,
London, B. 270(1512): 313–321; http://dx.doi.org/10.1098/
rspb.2002.2218
Hebert, P.D.N., M.Y. Stoeckle, T.S. Zemlak & C.N. Francis (2004).
Identification of birds through DNA barcodes. PLoS Biology 2: 1657–
1663.
Ivanova, N.V., J.R. deWaard, P.D.N. Hebert (2006). An inexpensive,
automation-friendly protocol for recovering high-quality
DNA. Molecular Ecology Notes 6(4): 998–1002; http://dx.doi.
org/10.1111/j.1471-8286.2006.01428.x
Janzen, D.H., M. Hajibabaei, J.M. Burns, W. Hallwachs, E. Remigio
& P.D.N. Hebert (2005). Wedding biodiversity inventory of a large
and complex Lepidoptera fauna with DNA barcoding. Philosophical
Transactions of Royal Society B: Biological Sciences 360(1462):
1835–1845; http://dx.doi.org/10.1098/rstb.2005.1715
Janzen, D.H., W. Hallwachs, P. Blandin, J.M. Burns, J.M. Cadiou,
I. Chacon, T. Dapkey, A.R. Deans, M.E. Epstein, B. Espinoza, J.G.
Franclemont, W.A. Haber, M. Hajibabaei, J.P.W. Hall, P.D.N. Hebert,
I.D. Gauld, D.J. Harvey, A. Hausmann, I.J. Kitching, D. Lafontaine,
J.F. Landry, C. Lemaire, J.Y. Miller, J.S. Miller, L. Miller, S.E. Miller,
J. Montero, E. Munroe, S.R. Green, S. Ratnasingham, J.E. Rawlins,
R.K. Robbins, J.J. Rodriguez, R. Rougerie, M.J. Sharkey, M.A. Smith,
M.A. Solis, J.B. Sullivan, P. Thiaucourt, D.B. Wahl, S.J. Weller, J.B.
Whitfield, K.R. Willmott, D.M. Wood, N.E. Woodley & A.J. Wilson
(2009). Integration of DNA barcoding into an ongoing inventory of
complex tropical biodiversity. Molecular Ecology Resources 9: 1–26;
http://dx.doi.org/10.1111/j.1755-0998.2009.02628.x
Jarman, S.N. & N.G. Elliott (2000). DNA evidence for morphological
and cryptic Cenozoic speciations in the Anaspididae, ‘living fossils’
from the Triassic. Journal of Evolution Biology 13(4): 624–633;
http://dx.doi.org/10.1046/j.1420-9101.2000.00207.x
Ketmaier, V., H. Stuckas, J. Hempel, I. Landeck, M. Tobler, M. Plath
& R. Tiedemann (2010). Genetic and morphological divergence
among Gravel Bank Grasshoppers, Chorthippus pullus (Acrididae),
from contrasting environments. Organism Diversity and Evolution
10(5): 381–395; http://dx.doi.org/10.1007/s13127-010-0031-1
Kirby, W.F. (1914). Orthoptera (Acrididae). Fauna of British India
including Ceylon and Burma. Taylor and Francis, London, 276pp.
Mahmood, K. (1995). Taxonomic studies of Acridoidea (Orthoptera) of
Azad Jammu and Kashmir. PhD Thesis. Department of Entomology,
University of Agriculture Faisalabad, Pakistan.
Mahmood, K. & M. Yousaf (1999). New records of Oedipodinae
(Acrididae: Orthoptera) from Azad Jammu and Kashmir with the
description of a new species. Journal of Orthoptera Research 3:
5551
Morphological and molecular identification of grasshoppers Nazir et al.
271–275.
Mahmood, K. & M. Yousaf (2000). Taxonomic studies on
Pyrgomorphidae and Catantopinae (Acridiodea; Orthoptera) from
Azad Jammu and Kashmir. Pakistan Journal of Biological Sciences
3(11): 1914–1916.
Mahmood, K. & U. Rizwan (2002). Grasshoppers species composition
and distribution pattern in District Poonch, Azad Jammu and
Kashmir, Pakistan (conference paper).
Mahmood, K., Y. Mohammad & K. Abdul (2002). Taxonomic study of
some Catantopinae (Acrididae: Orthoptera) from Azad Jammu and
Kashmir. Pakistan Journal of Zoology 34(3): 233–237.
Mahmood, K. & W. Shah (2003). New records of Eyprepocnemidinae
(Acrididae: Orthoptera) from Azad Jammu and Kashmir. Pakistan
Journal of Arid Agriculture 6(1): 25–27.
Mahmood, K., K. Abbas & W.H. Shah (2004). A Preliminary Study of
grasshoppers (Acrididae: Orthoptera) of Baltistan, Azad Jammu &
Kashmir, Pakistan. Pakistan Journal of Zoology 36(1): 21–25.
Mason, J.B. (1973). A revision of the genera Hieroglyphus Krauss,
Parahieroglyphus Carl and Hieroglyphodes Uvarov (Orthoptera:
Acridiodea). Bulletin of British Museum (Natural History)
Entomology 28(7): 509–560.
Matz, M.V. & R. Nielsen (2005). A likelihood ratio test for species
membership based on DNA sequence data. Philosophical
Transactions of Royal Society B: Biological Sciences 360(1462):
1969–1974; http://dx.doi.org/10.1098/rstb.2005.1728
Mondal, S.K., A.K. Hazra & S.K. Tandon (1999). Studies on taxonomy,
biology and ecology of grasshoppers infesting field crops and
vegetables with notes on nymphal taxonomy of some species in
West Bengal. Records of the Zoological Survey of India. Occasional
Paper 173: 1–178.
Mukha, D., W.M. Brian & C. Schal (2001). Evolution and phylogenetic
information content of the ribosomal DNA repeat unit in the
Blattodea (Insecta). Journal of Insect Biochemistry and Molecular
Biology 32(9): 951–960; http://dx.doi.org/10.1016/S0965-
1748(01)00164-3
Puillandre, N., A. Lambert, S. Brouillet & G. Achaz (2012). ABGD,
automated barcode gap discovery for primary species delimitation.
Molecular Ecology 21(8): 1864–1877; http://dx.doi.org/10.1111/
j.1365-294X.2011.05239.x
Reshi, S.A. & N. Azim (2008). Studies on some aspects of biodiversity
of Cyrtacanthacridini (Orthoptera: Acrididae) of Kashmir, Himalayas.
Annals of Plant Protection Sciences 16(2): 393-395
5552 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5544–5552
Ritchie, J. (1982). A taxonomic Revision of the genus Gastrimargus
Saussure (Orthoptera: Acrididae). Bulletin of British Museum
(Natural History) Entomology 44: 293–329.
Rowell, C.H.F. & P.K. Flook (2004). A dated molecular phylogeny of the
Proctolabinae (Orthoptera, Acrididae), especially the Lithoscirtae,
and the evolution of their adaptive traits and present biogeography.
Journal of Orthoptera Research 13(1): 35–56; http://dx.doi.
org/10.1665/1082-6467(2004)013[0035:ADMPOT]2.0.CO;2
Scotland, R.W., R.G. Olmstead & J.R. Bennett (2003). Phylogeny
reconstruction: The role of morphology. Systematic Biology 52(4):
539–548.
Song, H. & J.W. Wenzel (2007). Phylogeny of bird-grasshopper
subfamily Cyrtacanthacridinae (Orthoptera: Acrididae) and the
evolution of locust phase polyphenism. Cladistics 24(4): 515–542;
http://dx.doi.org/10.1111/j.1096-0031.2007.00190.x
Suhail, A. (1994). Taxonomic studies on Acridoidea (Orthoptera)
of Pakistan. PhD Thesis. Department of Agriculture Entomology,
University of Agriculture Faisalabad, Pakistan, 343pp.
Tamura K., D. Peterson, N. Peterson, G. Stecher, M. Nei & S. Kumar
(2011). MEGA5: Molecular evolutionary genetics analysis using
maximum likelihood, evolutionary distance, and maximum
parsimony methods. Molecular Biology Evolution 28(10): 2731–
2739; http://dx.doi.org/10.1093/molbev/msr121
Thompson, J.D., D.G. Higgins & T.J. Gibson (1994). ClustalW: improving
the sensitivity of progressive multiple sequence alignment through
sequence weighting, position-specific gap penalties and weight
matrix choice. Nucleic Acids Research 22(22): 4673–4680; http://
dx.doi.org/10.1093/nar/22.22.4673
Valentini, A., F. Pompanon & P. Taberlet (2009). DNA barcoding for
ecologists. Trends in Ecology and Evolution 24(2): 110–117; http://
dx.doi.org/10.1016/j.tree.2008.09.011
Watts, J.G., E.W. Huddleston & J.C. Owens (1982). Rangeland
entomology. Annual Review of Entomology 27: 283–311; http://
dx.doi.org/10.1146/annurev.en.27.010182.001435
Wilson, K.H. (1995). Molecular biology as a tool for taxonomy. Clinical
Infectious Diseases 20: 192–208.
Xiao, J.H., N.H. Wang, Y.W. Li, R.W. Murphy, D.G. Wan, L.M. Niu,
H.Y. Hu, Y.G. Fu & D.W. Huang (2010). Molecular approaches to
identify cryptic species and polymorphic species within a complex
of community of Fig Wasps. PLoS ONE 5: e15067; http://dx.doi.
org/10.1371/journal.pone.0015067
Threatened Taxa
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5553–5557

Short Communication
New species of genus Hersilia Audouin, 1826 (Araneae:
Hersiliidae) from India
G.B. Pravalikha 1, Chelmala Srinivasulu 2 & Bhargavi Srinivasulu 3 ISSN
Online 0974–7907
Print 0974–7893
1,2,3
Wildlife Biology & Taxonomy Lab, Department of Zoology, University College of Science, Osmania University,
Hyderabad, Andhra Pradesh 500007, India OPEN ACCESS
2,3
Systematics, Ecology & Conservation Laboratory, Zoo Outreach Organization (ZOO), 96 Kumudham Nagar,
Vilankurichi Road, Coimbatore, Tamil Nadu 641035, India
3
Biodiversity Research and Conservation Society, G4 MRK Towers, Swarnadhamanagar, Old Bowenpally, Secunderabad,
Andhra Pradesh 500011, India
1
prava.gunti@gmail.com, 2 hyd2masawa@gmail.com (corresponding author), 3 bharisrini@gmail.com

Abstract: A new species of the genus Hersilia Audouin, 1826, Hersilia
aadi sp. nov. is described from Andhra Pradesh, India with notes on the
species known from India. The new species differs from its congeners
based on having large palpal patella in males; and having two closely
adjoining circular, small median genital openings and, long and curved
copulatory duct in females.
Keywords: Andhra Pradesh, Arachnida, Hersilia aadi sp. nov., Hersilia
savignyi species group, new species, Osmania University.
Abbreviations: AER - anterior eye row; ALE - anterior lateral eye; AME -
anterior median eye; bs - basal segment of posterior lateral spinnerets;
CD - copulatory duct; d - dorsal; DMP - dorsal muscular pits; FD -
fertilization duct; fe - femur; MOQ - median ocular quadrangle; mt -
metatarsus; OUNHM - Osmania University Natural History Museum;
p - prolateral; PER - posterior eye row; PLE - posterior lateral eye;
PLS - posterior lateral spinnerets; PME - posterior median eye; Pmt
- promarginal teeth; r - retrolateral; Rmt - retromarginal teeth; SP -
spermatheca; SR - seminal receptacle; Ti - tibia; ts - terminal segment
of posterior lateral spinnerets; TBL - total body length (carapace +
abdomen); VMP - ventral muscular pits; vs. - versus; WA - anterior
width of the MOQ; WP - posterior width of the MOQ.
The family Hersiliidae Thorell, 1870 comprises
conspicuously long-legged, medium-sized spiders
distinguished by extremely long posterior lateral
spinnerets. The hersilid spiders are commonly found on
tree trunks, and are known as bark spiders or two-tailed
spiders. They are easily recognized by long stretched
legs, raised clypeus and bi-articulation of legs I, II and
IV. The family Hersiliidae consists of 15 genera and 176
species distributed worldwide (Platnick 2013) (excluding
nomina dubia); the majority of the species occurs mainly
in the Afro-tropical region. The genus Hersilia Audouin,
1826 of family Hersiliidae is the largest and most widely
distributed ranging from Oriental to Afrotropical regions
(Baehr & Baehr 1993; Foord 2008).
Until recently, the genus Hersilia was known only
by four species, namely, H. savignyi Lucas, 1836, H.
sumatrana Thorell, 1890, H. striata Wang & Yin, 1985

DOI: http://dx.doi.org/10.11609/JoTT.o3723.5553-7 | ZooBank: urn:lsid:zoobank.org:pub:984E1289-B579-4078-BEA5-7AA96D222C9C

Editor: Manju Siliwal, WILD, Coimbatore, India. Date of publication: 26 March 2014 (online & print)

Manuscript details: Ms # o3723 | Received 22 July 2013 | Final received 21 February 2013 | Finally accepted 01 March 2014

Citation: Pravalikha, G.B., C. Srinivasulu & B. Srinivasulu (2014). New species of genus Hersilia Audouin, 1826 (Araneae: Hersiliidae) from India. Journal of Threatened
Taxa 6(3): 5553–5557; http://dx.doi.org/10.11609/JoTT.o3723.5553-7

Copyright: © Pravalikha et al. 2014. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium, reproduction
and distribution by providing adequate credit to the authors and the source of publication.

Funding: The study was supported by grants from Department of Biotechnology, Government of India and University Grants Commission, New Delhi

Competing Interest: The authors declare no competing interests.

Acknowledgements: We thank the Head, Department of Zoology, Osmania University, Hyderabad, for providing necessary facilities; Shri. A.V. Joseph IFS, Chief
Conservator of Forests (Wildlife), Andhra Pradesh Forest Department for encouragement. We acknowledge UGC, New Delhi; DBT, New Delhi and UGC-DRS-SAP III,
Deparment of Zoology, Osamania University for research grants.

5553
Hersilia aadi sp. nov. Pravalikha et al.

and H. tibialis Baehr & Baehr, 1993, from India. Two new
species, namely, H. orvakalensis Javed et al. 2010 (from
Orvakal Village, Kurnool District, Andhra Pradesh) and H.
longivulva Sen et al. 2010 (Jalpaiguri, West Bengal), were
described recently. H. orvakalensis Javed et al. 2010 was
recorded in semi urban gardens in peninsular India,
while H. longivulva (Sen et al. 2010) was recorded from
Jalpaiguri in the forested tracts near Darjeeling, West
Bengal. Very little is known about their natural history
excepting that they are arboreal forest dwellers (Javed &
Tampal 2010). They are assumed to have evolved from
ground-dwelling hersilids (Baehr & Baehr 1993; Rheims
& Brescovit 2004). This paper gives the description of
the new species of genus Hersilia from Andhra Pradesh,
India.
Material and Methods
A total of 13 specimens of Hersilia sp. nov. (six
males, seven females) was collected between 2010 and
2012 from the Osmania University campus (17025’N &
78031’E), Hyderabad, Andhra Pradesh, India. Specimens
were photographed with a Fujifilm super-macro digital
camera in live condition, while photos of the preserved
material were taken with a Sony Cybershot digital
camera mounted on the eyepiece of a Lawrence and
Mayo stereo zoom microscope. Line diagrams were
drawn using camera lucida mounted on an Olympus
stereo zoom binocular microscope.
All measurements presented are in millimeters,
following Rheims & Brescovit (2004) and Foord (2008).
having lateral eyes on distinct tubercles. However, it
differs from the genus Murricia by the region between
PME & PLE being not tuberculated, having oval to
elongated shape of abdomen, four pairs of DMP, longer
legs and PLS (Chen 2007).
Type species: Hersilia caudata (Audouin, 1826)
Distribution: Ranges from Oriental to Afrotropical
regions (Baehr & Baehr 1993; Foord 2008).
Hersilia aadi sp. nov.
(Images 1–2 & Fig. 1)
urn:lsid:zoobank.org:act:250CF397-7A3D-48CC-A4D8-C4D9921380EA
Type material: Holotype: OUNHM.ART.ARA.2011.13,
male, 21.vi.2011, Osmania University campus (17025’N
& 78031’E), Andhra Pradesh, India, coll. Bhargavi
Srinivasulu and C. Srinivasulu. Paratype: OUNHM.
ART.ARA.2011.14, female, same data as holotype.
Other material: 10.v.2011, five males (OUNHM.
ART. ARA.2011.15-19) and six females (OUNHM.ART.
a b c

Only minor colour corrections were made to the pictures.

The epigyne was dissected and immersed in 50% NaOH
solution (Barrion & Litsinger 1995) for 24 hours to study
the internal structures. The terminology used in the
current paper partly follows Baehr & Baehr (1993),
Rheims & Brescovit (2004), and Foord (2008). The
d e f
specimens are deposited in the collection of the Natural
History Museum of Osmania University, Hyderabad.

Taxonomy
Family Hersiliidae Thorell, 1870
Genus Hersilia Audouin, 1826
Hersilia Audouin, 1826: 317; Lucas, 1869: 1; Simon,
1893: 440; Smithers, 1945: 1; Benoit 1967: 1; Baehr &
Baehr, 1993: 3; Levy, 2003: 1; Rheims & Brescovit, 2004:
1; Foord & Dippenaar-Schoeman, 2006: 8; Chen, 2007:
13; Javed et al., 2010: 41.
The genus Hersilia was established by Audouin in
1826 based on H. caudata (see Pocock 1900).
Diagnosis: The genus Hersilia resembles the genus
Murricia in having bi-articulation on legs I, II and IV, and
g h i j
Image 1a–j. Hersilia aadi sp. nov., holotype male (OUNHM.ART.
ARA.2011.13).
a - carapace, dorsal view; b - cephalothorax, ventral view;
c - chelicerae, ventral view, showing three promarginal teeth and
six retromarginal teeth (with an additional teeth in second row); d
- ocular region; e - abdomen dorsal view; f - abdomen ventral view;
g - ocular region lateral view; h - right pedipalp ventral view; i - right
pedipalp retrolateral view; j - right pedipalp prolateral view.
Photo credits: a–g - G.B. Pravalikha; h–j - C. Srinivasulu.
Scale a,b,d,e,h-j (1mm); f,g (0.5mm).

5554 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5553–5557

Hersilia aadi sp. nov. Pravalikha et al.

ARA.2011.20-25), Osmania University campus (17025’N

& 78031’E), Hyderabad, Andhra Pradesh, India, coll.
Bhargavi Srinivasulu and C. Srinivasulu.
Diagnosis: Hersilia aadi sp. nov. belongs to the
Hersilia savignyi species group which includes H. asiatica,
H. striata, H. montana, and H. taiwanensis based on the
presence of truncated palpal tibia. Hersilia aadi sp. nov.
differs from these species in having a large male palpal
patella, leg I distinctly longer than II in males, long
and curved copulatory duct, and two closely adjoining
circular, small median genital openings in the female
vulva (Table 1 & 2). The male palp resembles that of H.
asiatica with the presence of large conical cymbium and

© C. Srinivasulu
excavate tegular apophysis, but differs in having circular
embolus and pointed almond shaped tegular apophysis.
Description: Male (Holotype, Images 1a–j, 2, Fig.
1a–c.) Habitus: Medium-sized (TBL 5.90mm), two-tailed
Image 2. Hersilia aadi sp. nov., live habitus image of male spider with four DMP and long PLS. Colour: Carapace
pale yellow, dark brown laterally; clypeus pale, white
anteriorly. Sternum heart-shaped with white mottling.
Legs pale yellow with dark brown bands. Abdomen

Table1. Character matrix depicting major characteristics of spiders of the H. savignyi species group (Male) including H. aadi sp. nov.

Characteristics H. aadi sp. nov. H. asiatica H. striata H. taiwanensis H. montana

Pmt-3 Pmt-3 Pmt-3 Pmt-3 Pmt-3
Chelicerae (Pmt, Rmt (L,R))
Rmt-7,6 Rmt-7,8 Rmt-6,7 Rmt-8,9 Rmt-6,7
Total Body Length 5.90 5.78 7.20 4.81 4.50
(carapace + abdomen) (2.67 + 3.23) (2.40 + 3.38) (3.0 + 4.20) (2.18 + 2.63) (2.10 + 2.40)
Leg formula 1243 1243 1243 1243 1243
Leg measurement I 35.38 28.96 50.42 29.12 22.81
II 30.88 26.93 40.89 26.86 22.51
III 9.02 7.66 14.34 7.66 6.68
IV 26.27 22.74 35.63 21.99 18.38
Palp 3.61 3.24 4.59 3.01 2.93
4.83 4.81 8.63 4.88 4.05
PLS total (bs+ ts)
0.83 + 4.0 0.83 + 3.98 1.05 + 7.58 0.98 + 3.90 0.90 + 3.15

Table 2. Character matrix depicting major characteristics of spiders of the H. savignyi species group (Female) including H. aadi sp. nov.

Characteristics H. aadi sp. nov. H. asiatica H. striata H. taiwanensis H. montana

Pmt-3 Pmt-3 Pmt-3 Pmt-3 Pmt-3
Chelicerae (Pmt, Rmt (L,R))
Rmt-8,6 Rmt-10,9 Rmt-7,8 Rmt-8,9 Rmt-7,8
MOQ L 0.57 0.70 0.76 0.60 0.54
PA 0.68 0.66 0.76 0.60 0.54
PW 0.52 0.58 0.72 0.58 0.54
Total Body Length 6.39 5.63 10.05 6.08 4.88
(carapace + abdomen) (2.92 + 3.47) (2.48 + 3.15) (3.30 + 6.75) (2.33 + 3.75) (2.10 + 2.78)
Leg formula 2143 2143 1243 2143 2143
Leg measurement I 26.87 18.99 37.14 19.44 15.68
II 27.03 19.96 34.81 19.51 16.37
III 9.73 7.21 11.64 6.61 5.78
IV 23.92 17.12 31.13 16.82 14.79
Palp 4.32 3.38 5.71 3.46 2.93
6.35 5.93 10.20 5.03 4.13
PLS total (bs+ ts)
1.02 + 5.33 1.13 + 4.80 1.50 + 8.70 1.05 + 3.98 0.90 + 3.23

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5553–5557 5555

Hersilia aadi sp. nov. Pravalikha et al.
Figure 1 a–c. Hersilia aadi sp. nov., line diagram of the palp (right) of
holotype male (OUNHM.ART.ARA.2011.13):
a - ventral view; b - retrolateral view; c - prolateral view (EM -
Embolus; CY - Cymbium; MA - Median apophysis)
pale yellow with dark borders anteriorly; dark mid
longitudinal band; abdomen broad at middle, V-shaped
at the apex, pale border around dorsal muscular pits;
dorsum, lateral and posterior borders of abdomen with
scattered, conspicuous, dark-coloured, flat leaf- like
hairs; ventrum mottled white. Carapace: Rounded, as
long as wide, 2.67 long, 2.56 wide (length/width =
1.04); furnished with short hairs, some flat leaf- like
hairs between AMEs and behind ocular region; fovea
longitudinal with radial striae; ocular region raised,
concave behind PER, AER and PER recurved, lateral
eyes situated on distinct tubercles; clypeus slightly
raised, furnished with long hairs; chelicerae small, 0.92
long, distal part with long hairs, Pmt with three robust,
triangular teeth (the 1st very small, the 3rd the biggest)
and Rmt with seven on the left and six minute teeth
on the right side. Maxilla 0.42 long, 0.31 wide (length/
width = 1.35); labium 0.28 long, 0.44 wide (length/width
= 0.63); sternum 1.30 long, 1.47 wide (length/width =
0.88). Eyes: Small; lateral eyes situated on the tubercle;
AME, PME and PLE black, while ALE white; MOQ 0.58
long, 0.66 WA, 0.50 WP. Eye sizes and inter distances:
AME > PLE > PME > ALE (0.26, 0.18, 0.16, 0.08) and
AME-AME 0.14, AME-ALE 0.15, PME-PME 0.18, PME-PLE
0.21, ALE-PLE 0.13; AER 1.12, PER 1.28; AME, largest;
ALE, smallest. Legs: Leg I longest, leg III smallest. Leg
formula 1243; lengths of legs [total length (femur +
patella + tibia + metatarsus + tarsus)]: I = 35.38 (8.73
+ 1.23 + 10.53 + 13.84 + 1.05); II = 30.88 (7.52 + 1.11
+ 8.96 + 12.28 + 1.01); III = 9.02 (2.73 + 0.74 + 2.15 +
2.54 + 0.86); IV = 26.27 (6.65 + 0.98 + 6.98 + 10.72 +
0.94); metatarsus of legs I, II and IV is biarticulate; leg
spination: I (fe 3p,3d,2r; ti 2p,4d,2r,2v; mt 1p,2d,1r,1v);
II (fe 3p,3d,3r; ti 3p,2d,2r,2v; mt 1p); III (fe 2p,1r; ti
1p,3d,1r; mt 2p,2d,2r,1v); IV (fe 2p,4d,2r,1v; ti 3p,3d,2r;
5556 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5553–5557
a b
c d
e f
Image 3 a–f. Hersilia aadi sp. nov., paratype female (OUNHM.ART.
ARA.2011.14) (scale: 0.5mm).
a - live habitus image of female; b - abdomen ventral view showing
epigynum on habitus; c - epigynum ventral view; d - epigynum
dorsal view; e - epigynum ventral view line diagram (VSp - Ventral
Spermatheca; GO - Genital opening); f - epigynum dorsal view line
diagram (DSp - Dorsal Spermatheca; CD - Copulatory Duct;
GO - Genital opening; VSp - Ventral Spermatheca).
Photo credits: a - Bhargavi Srinivasulu; b–d - G.B. Pravalikha.
mt 1p,2d,1r). Abdomen: Longer than wide, 3.23 long,
2.51 wide (length/width = 1.28). Dorsally with four pairs
of DMP, all pairs of DMP dissimilar in size, the second
pair, the largest and fourth pair smallest. VMP arranged
in a V shape. PLS 4.83 long (bs 0.83, ts 4.00), longer than
the length of abdomen; posterior lateral spinnerets with
no or faint annulation; spigots on the median border
of the PLS dense and elongate. Pedipalp [total length
(femur+patella+tibia+tarsus)]: 3.61 (1.37 + 0.52 + 0.53 +
1.19). Tibia short, as long as patella; patella truncated,
dorsal ridge of the patella triangular and lacks spinose
ridges. Cymbium conical with short and stout spines,
embolus dark circular, tegular apophysis curved, narrow
and apically brush-like.
Description of female (Paratype, O U N H M .
ART. ARA.2011.14, Images 3a–f))
Habitus: Medium-sized (TBL 6.39mm), two-tailed
spider with four DMP and long PLS. Carapace: As male,
except for size. Rounded, as long as wide, 2.92 long,
2.98 wide (length/width = 0.97); chelicerae small, 0.96
long, Pmt with three robust, triangular teeth and Rmt
Hersilia aadi sp. nov. Pravalikha et al.
with eight on left and six minute teeth on the right
side. Maxilla 0.59 long, 0.52 wide (length/width = 1.13);
labium 0.43 long, 0.56 wide (length/width = 0.76);
sternum 1.43 long, 1.65 wide (length/width = 0.86).
Eyes: MOQ 0.57 long, 0.68 WA, 0.52 WP. Eye sizes and
inter distances: AME > PLE > PME > ALE (0.22, 0.17,
0.15, 0.08) and AME-AME 0.24, AME-ALE 0.17, PME-
PME 0.22, PME-PLE 0.18, ALE-PLE 0.15; AER 1.18, PER
1.22; AME, largest; ALE, smallest. Legs: Leg II longest,
leg III smallest. Leg formula 2143; lengths of legs [total
length (femur + patella + tibia + meta tarsus + tarsus)]: I
= 26.87 (7.38 + 1.34 + 6.83 + 9.12 + 1.22); II = 27.03 (7.03
+ 1.39 + 6.99 + 10.44 + 1.18); III = 9.73 (3.17 + 0.84 + 2.09
+ 2.52 + 1.11); IV = 23.92 (6.47 + 1.11 + 5.64 + 9.61 +
1.09; palp [total length (femur + patella + tibia + tarsus)]
= 4.32 (1.35 + 0.73 + 0.86 + 1.38); metatarsus of legs I,
II and IV is bi-articulate; leg spination: I (fe 4p,3d,3r; ti
2p,3d,2r,1v; mt 1d,1r); II (fe 3p,2d,3r; ti 3p,2d,2r; mt 1p);
III (fe 3p,2d,2r,1v; ti 2d,1r; mt 1p,1d); IV (fe 3p,3d,2r; ti
2p,2d,1r; mt 2p,2d,2r). Abdomen: Almost as wide as
long, 3.47 long, 3.26 wide (length/width = 1.06). Dorsally
with four pairs of DMP, all pairs of DMP dissimilar in size,
the second pair the largest and fourth pair smallest.
VMP arranged in a V shape. PLS 6.35 long (bs 1.02, ts
5.33), nearly double the length of abdomen; posterior
lateral spinnerets with no or faint annulation; spigots
on the median border of the PLS dense and elongate.
Epigyne: Epigyne weakly sclerotized, two pairs of
spermathecae, ventral spermathecae small oval-shaped
with long curved copulatory duct, dorsal spremathecae
large elliptical-shaped; two copulatory openings; ventral
spermathecae visible through tegument.
Etymology
The specific epithet is a noun in apposition taken
from the Sanskrit word ‘aadi’ meaning ‘first’.
Distribution
Presently known only from the type locality, Osmania
University campus (17025’N & 78031’E), Hyderabad,
Andhra Pradesh, India.
Natural History
The type specimens were collected on the bark of
the Azadirachta indica and Polyalthia cerasoides trees
in the Osmania University campus, Hyderabad. Many
specimens of the new species described in this paper
have been observed in the Osmania University Campus
and other urban gardens. As opined by Javed & Tampal
(2010), we feel that the species diversity in the family
Hersilidae is under-represented and future research will
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5553–5557
result in discovery of new species.
References
Audouin, V. (1826). Explication sommaire des planches d’arachnides
de l’Egypte et de la Syrie publiées. In: Description de l’Egypte,
Histoire Naturelle, Paris: 404, illustrations t 7, f 8. (this description is
also quoted as published in 1825 and 1827).
Baehr, M. & B. Baehr (1993). The Hersiliidae of the Oriental Region
including New Guinea. Taxonomy, phylogeny, zoogeography
(Arachnida, Araneae). Spixiana (Suppl.) 19: 1–96.
Barrion, A.T. & J.A. Litsinger (1995). Riceland Spiders of South and
Southeast Asia. CAB International, Wallingford, UK, xix+700pp.
Benoit, P.L.G. (1967). Révision des espèces africaines du genre Hersilia
Sav. et Aud. (Aran.-Hersiliidae). Revue de Zoologie et de Botanique
africaines 76: 1–36.
Chen, S.H. (2007). Spiders of the genus Hersilia from Taiwan (Araneae:
Hersiliidae). Zoological Studies 46: 12–25.
Foord, S.H. & A.S. Dippenaar-Schoeman (2006). A revision of the
Afrotropical species of Hersilia Audouin (Araneae: Hersiliidae).
Zootaxa 1347: 1–92.
Foord, S.H. (2008). Cladistic analysis of the Afrotropical Hersiliidae
(Arachnida, Araneae) with the first record of Murricia and the
description of a new genus from Madagascar. Journal of Afrotropical
Zoology 4: 111–142.
Javed, S.M.M., S.H. Foord & F. Tampal (2010). A new species of
Hersilia Audouin, 1826 (Araneae: Hersiliidae) from India, with notes
on its natural history. Zootaxa 2613: 40–50.
Javed, S.M.M. & F. Tampal (2010). Spiders of the genus Murricia Simon,
1882 (Araneae: Hersiliidae) from India. Acta Zoologica Lituanica
20(2): 88–97; http://dx.doi.org/10.2478/v10043-010-0012-9
Levy, G. (2003). Spiders of the families Anyphaenidae, Hahniidae,
Ctenidae, Zoridae, and Hersiliidae (Araneae) from Israel. Israel
Journal of Zoology 49(1): 1–31; http://dx.doi.org/10.1560/X05J-
T0MU-UL4A-8RLQ
Lucas, H. (1836). Observations sur les Araneae du genre Hersilia et
description de deux especes nouvelles appurtenant a ce genre.
Guerin’s Magazine Zoology 6: 1–11.
Lucas, H. (1869). Quelques remarques sur les articles additionnels
observés dans les palpes des Actinopus, les pattes des Hersilia et
description d’une nouvelle espèce d’aranéide appartenant à cette
dernière coupe générique. Revue Magasin de Zoologie 2: 160–170.
Platnick, N.I. (2013). The World Spider Catalog. Version 13.5. American
Museum of Natural History. Available from: http://research.amnh.
org/iz/spiders/catalog/HERSILIIDAE.html. (Accessed 17 June 2013)
Pocock, R.I. (1900). The Fauna of British India, Including Ceylon and
Burma. Arachnida. Taylor and Francis, London, 279pp.
Rheims, C.A. & A.D. Brescovit (2004). Revision and cladistic analysis of
the spider family Hersiliidae (Arachnida, Araneae) with emphasis on
Neotropical and Nearctic species. Insect Systematics and Evolution
35(2): 189–239; http://dx.doi.org/10.1163/187631204788912355
Sen, S., S. Saha & D. Raychaudhuri (2010). Two tailed spiders (Araneae:
Hersilidae) from the reserve forests of North Bengal, India. Munis
Entomology and Zoology 5(suppl.): 1168–1175.
Simon, E. (1893). Histoire naturelle das araignées. Paris, I, 257–488pp.
Smithers, R.H.N. (1945). The Hersiliidae (Araneae) of South Africa.
Transactions of the Royal Society of South Africa 31(1): 1–18; http://
dx.doi.org/10.1080/00359194509520547
Thorell, T. (1870). On European spiders. Nova Acta Regiae Societatis
Scientiarum Upsaliensis 7: 109–242.
Thorell, T. (1890). Studi sui ragni Malesi e Papuani. IV, 1. Annali del
Museo civico di storia naturale di Genova 28: 1–419.
Wang, J.F. & C.M. Yin (1985). Two new species of spiders of the genus
Hersilia from China (Araneae: Hersiliidae). Acta Zootaxonomica
Sinica 10: 45–49.
Threatened Taxa
5557
 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5558–5561
Short Communication

A new species of the genus Tylorida Simon, 1894 (Araneae:

Tetragnathidae) from a rocky outcrop in the northern Western Ghats,
India
ISSN
Online 0974–7907
Print 0974–7893
Siddharth Kulkarni

OPEN ACCESS Zoology Department, Yashavantrao Chavan Institute of Science, Satara, Maharashtra 415001, India
sskspider@gmail.com

Abstract: A new species Tylorida sataraensis sp. nov. is described from
the northern Western Ghats based on female only. Its behaviour of
holding under water in response to disturbance is discussed.
Keywords: New species, Satara, Tylorida, Western Ghats.
Abbreviations: AME - Anterior median eyes; CD - Copulatory duct; FD
- Fertilization duct; MOA - Median ocular area; ZSI - Zoological Survey
of India.
are specialized habitats accommodating a rich diversity
of flora and fauna and a site for active speciation.
Geomorphologically, these belong to the category of
high level ferricretes in the northern Western Ghats. The
maximum altitude of the plateau is 1200m, and these
are surrounded by hill slopes which drop to a valley at
about 800m.

The genus Tylorida is, represented by nine species
worldwide, of which two species T. culta (Cambridge,
1869) and T. ventralis (Thorell, 1877) are reported from
India and Sri Lanka. T. ventralis has a wide distribution
that extends from India to Taiwan, Japan and New
Guinea while T. culta is limited to India and Sri Lanka
(Platnick 2013). The genus is recognized by the presence
of smooth trichobothria on femur IV, and by copulatory
and fertilization ducts running parallel before entering
the spermathecae (Alvarez-Padilla & Hormiga 2011).
The dorsum is slightly raised distally in T. ventralis to
which Tikader (1982, fig. 169) refers as ‘indistinct caudal
tubercle,’ but is absent in T. culta.
Rocky outcrops are basalt/ferricrete rocks exposed
landform ranging from cliffs, inselbergs, and to rocky
hills (Porembski & Barthlott et al. 2000). These were
recently reviewed by Watve (2013) stating that these
Methods
The present area of study is a group of rocky plateaus
in Chalkewadi region (17.570N & 73.830E) in Satara
District, Maharashtra (Fig. 1). Spiders were collected
from the webs constructed over streams flowing along
the slopes of plateaus and studied under Olympus
(MSZ-B) stereomicroscope. All the lengths are in
millimeters. Epigyne were dissected and cleared in 10%
warm KOH for 25 minutes before drawing. All specimens
are deposited at the Western Regional Station, Zoological
Survey of India, Pune.
Tylorida sataraensis sp. nov.
(Images 1–5, Figs. 2–4)
urn:lsid:zoobank.org:act:A477CA6F-7EDF-4FED-AF3A-396AAF37D1BA
Specimens examined: Holotype: ZSI-WRC-Ar/439,
06.iii.2013, female, Chalkewadi, coll. S. Kulkarni.

DOI: http://dx.doi.org/10.11609/JoTT.o3606.5558-61 | ZooBank: urn:lsid:zoobank.org:pub:7CDB5A97-C7DB-452F-9BB8-0C5A9F071E9F

Editor: Manju Siliwal, WILD, Coimbatore, India. Date of publication: 26 March 2014 (online & print)

Manuscript details: Ms # o3606 | Received 01 May 2013 | Final received 08 March 2014 | Finally accepted 12 March 2014

Citation: Kulkarni, S. (2014). A new species of the genus Tylorida Simon, 1894 (Araneae: Tetragnathidae) from a rocky outcrop in the northern Western Ghats,
India. Journal of Threatened Taxa 6(3): 5558–5561; http://dx.doi.org/10.11609/JoTT.o3606.5558-61

Copyright: © Kulkarni 2014. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium, reproduction and
distribution by providing adequate credit to the authors and the source of publication.

Funding: Research seed money from Yashavantrao Chavan Institute of Science, Satara.

Competing Interest: The authors declare no competing interests.

Acknowledgements: My sincere thanks to Dr. Fernando Alvarez-Padilla for taking personal interest in guiding me all about Tylorida; Dr. Aparna Watve for the initial
encouragement to study spiders from rocky outcrops; Dr. Hemant Ghate and Dr. Akio Tanikawa for helpful discussions.

5558
Tylorida sataraensis sp. nov. Kulkarni
Figure 1. Location of type-locality in Maharashtra
Figure 3. Epigyne dorsal
Figure 2. Habitus, dorsal Figure 4. Epigyne ventral
Paratypes: ZSI-WRC-Ar/440, 12.i.2012, four, females,
Chalkewadi, coll. S. Kulkarni & A. Sargar (single accession
number for all paratypes).
Diagnosis: The new species can be distinguished
from all other Tylorida species by the narrow tip at
the apex of the spermatheca (fig. 3) (which is absent
in all other Tylorida species). It closely resembles T.
ventralis (Thorell, 1877), but can be distinguished by the
absence of silver striations, the caudal tubercle and the
epigynal plate not quadrangular (see Tanikawa 2007,
fig. 798); epigynal atrium is arch shaped (Image 4, fig.4);
spermatheca with a bulbous head facing inwards but
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5558–5561
© Siddharth Kulkarni
Image 1. Tylorida sataraensis sp. nov. female holotype - Habitus
© Siddharth Kulkarni
Image 2. Ocular region
globular and bending outwards in T. ventralis (see Jäger
& Praxaysombath 2009, fig.29); CD not overlapping FD
but run adjacently (fig. 3) (similar arrangement seen in
T. cylindrata (Wang, 1991)); two diffuse broad yellowish
line on the mid-dorsum not present in T. ventralis.
Description: Holotype. A female having a total
length of 10.1; carapace 3.66 long, 2.63 wide; abdomen
6.79 long, 4.04 wide. Other material: Total. 9.9–11.7;
carapace 3.34-3.89 long, 2.60–3.12 wide; abdomen
6.57–7.92 long; 3.96–4.30 wide. Cephalic region and
margins of thoracic region deep brown; faint yellow
middle longitudinal line on cephalic part and is higher
than thoracic in lateral view. Thoracic groove Y-shaped
(Image 1). Median ocular area forms square and sides
of each eye encircled by black patch. Clypeus about 1½
times diameter of AME. Lateral eyes placed on two slight
tubercles (Image 2). Labium semicircular; endites longer
than wide margined black with tips bent outwards,
both brown with yellowish edges. Legs yellow with
5559
Tylorida sataraensis sp. nov. Kulkarni
© Siddharth Kulkarni
Image 3. Chelicera
© Siddharth Kulkarni
Image 5. Epigyne ventral
some blackish patches. Leg I about six times the length
of carapace (Leg I - 21mm) and Leg III (smallest) - 9.6
mm. Ventral side of coxa IV provided with a black line at
proximal half. Coxa II with black patch ventro-laterally.
Trochanter with a few soft setae at distal edge ventrally.
Femora IV thin and paler ventrally provided with
trichobothria in proximal half. Sternum greenish-brown;
roughly heart shaped, edges folded at coxae and covered
with a few long setae rising even above maxillae when
seen laterally. Chelicerae with three promarginal and
four retro marginal denticles; fang with fine serrations
on ventral side (Image 3). Abdomen slightly less than
twice of the carapace. Oval and posteriorly flattened in
5560 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5558–5561
© Siddharth Kulkarni
Image 4. Epigynal plate
© Siddharth Kulkarni
Image 6. Habitat at Chalkewadi, Satara (type locality)
lateral view; slightly overlapping cephalothorax. Venter
black (pigment) margined by thick yellow lines covered
sparsely by whitish pubescence. Epigynal plate flat;
ventrally brown with black margins and resembling
typical tree shaped structure (Image 4). Genital openings
in shallow depression located slightly above base of
tree shape (Image 5). Cuticle appreciably sclerotized
as compared to walls of spermathecae which are very
weakly sclerotized. CD and FD with many closely spaced
coils forming a slant S-shape (and its reflection) at each
respective side (fig. 3).
Male: Unknown.
Distribution: India: Satara, Chalkewadi.
Etymology
The species name is derived from the name of the
district Satara, of type locality.
Tylorida sataraensis sp. nov. Kulkarni
Discussion
The spiders build their orb-webs just above the
course of streams running through the boulders (Image
6) on the high altitude rocky plateaus. These spiders are
generally seen in their webs but when disturbed, they
drop into the water leaving a dragline and cling to a rock
surface at a depth of an inch below the surface of water
waiting till the disturbances are halted. Observation of
16 specimens showed a maximum time of 14 minutes
of being underwater. I could not photograph this in the
field, but put a live specimen in a water filled transparent
container with a stone immersed in it. When capped
and overturned, the spider clung to the substratum and
I observed bubbles forming along the dorsal abdomen,
continuous with book lung openings. Similar field
observations were reported by Gravely (1915, p. 537) in
Orsinome marmorea Pocock, 1901, but, could not study
it in detail.
Orsinome marmorea has been reported only once
(Gravely, 1921) after its description by the author
and with insufficient characters to make any reliable
identification. Similar is the case with the remainder
of two Indian species O. armata Pocock, 1901 and O.
listeri Gravely, 1921. Since, Orsinome has been recently
placed as a phylogenetic sister to Tylorida (Alvarez-
Padilla & Hormiga 2011) it means that these genera are
closely related. This also agrees with the morphological
closeness and may have mixed species; thus indicating
that both groups need revision.
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5558–5561
References
Alvarez-Padilla, F. & G. Hormiga (2011). Morphological and
phylogenetic atlas of the orb-weaving spider family Tetragnathidae
(Araneae: Araneoidea). Zoological Journal of Linnean Society 162(4):
713–879.; http://dx.doi.org/10.1111/j.1096-3642.2011.00692.x
Cambridge, O.P. (1869). Cambridge, O.P.-. (1869b). Catalogue of a
collection of Ceylon Araneida lately received from Mr J. Nietner,
with descriptions of new species and characters of a new genus.
I. Journal ofLinnean Society London (Zoology) 10: 373–397.
Gravely, F.H. (1915). Notes on Habits of Indian Insects Myriapods and
Arachnids.Records of the Indian Museum XI: 483–539.
Gravely, F.H. (1921). Some Indian spiders of the family Tetragnathidae.
Records of the Indian Museum 22: 423–459.
Jäger, P. & B. Praxaysombath (2009). Spiders of Laos: New species
and new records (Arachnida: Araneae). Acta Arachnologica 58(1):
27–51.
Porembski, S. & W. Barthlott (eds.) (2000). Inselbergs- Biotic Diversity
of Isolated Rock Outcrops in Tropical and Temperate regions.
Ecological studies - 146. Springer. Heidelberg, 524pp.
Platnick, N.I. (2013). The world spider catalog, version 13.5. American
Museum of Natural History, online at: http://research.amnh.org/iz/
spiders/catalog http://dx.doi.org/10.5531/db.iz.0001
Pocock, R.I. (1901). Descriptions of some new species of spiders from
British India. Journal of the Bombay Natural History Society 13:
478–498.
Tanikawa, A. (2007). An Identification Guide to the Japanese Spiders
of the Families Araneidae, Nephilidae and Tetragnathidae.
Arachnological Society of Japan, 121pp.
Thorell, T. (1877). StudisuiRagniMalesi e Papuani. I. Ragni di
Selebesraccoltinel 1874 dal Dott. O. Beccari. Annali Del MuseoCivico
Di StoriaNaturaleGenova 10: 341–637.
Tikader, B.K. (1982). The Fauna of India. Spiders: Araneae. 2(1).
Zoological Survey of India, 293pp.
Watve, A. (2013). Status review of rocky plateaus in the northern
Western Ghats and Konkan region of Maharashtra, India with
recommendations for conservation and management. Journal of
Threatened Taxa 5(5): 3935–3962; http://dx.doi.org/10.11609/
JoTT.o3372.3935-62
Threatened Taxa
5561
 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5562–5568
Short Communication

New records of opisthobranchs from Lakshadweep, India

(Mollusca: Heterobranchia)
ISSN Deepak Apte 1 & Vishal Bhave 2
Online 0974–7907
Print 0974–7893
1,2
Bombay Natural History Society, Hornbill House, Mumbai, Maharashtra 400001, India
OPEN ACCESS
1
spiderconch@gmail.com (corresponding author), 2 vishalbhave@gmail.com

Abstract: All India Coordinated Project on Taxonomy (AICOPTAX), an
initiative of Ministry of Environment and Forests allowed the authors
to study opisthobranch fauna of the west coast of India. During the
present study, nine species of opisthobranchs are reported for the first
time from Lakshadweep of which six are new records to India.
Keywords: AICOPTAX, Heterobranchia, Lakshadweep, Mollusca, opis-
thobranch.
A careful literature search has revealed about 127
species of opistobranchs reported untill 2008 on the
western coast of India by various authors. However,
since 2008 after the systematic work undertaken by
the authors several new records have been established
(Apte 2009, 2012; Apte et al. 2010; Apte & Salahuddin
2011; Bhave & Apte 2011, 2013). The present study was
undertaken through the All India Coordinated Project
on Taxonomy - Mollusca supported by Ministry of
Environment and Forests, Government of India.
The past work on opisthobranchs of the western coast
of India was by Gardiner (1903), Winckworth (1946a,b),
Hornell (1909b), Gideon et al. (1957), Narayanan (1968,
1969, 1971a,b), Menon et al. (1970), Rao & Kumari
(1973); Rao et al. (1974); Balani & Patel (1994), and
Jagtap (2009). Gosliner (1995) and Jensen (1992)
reviewed the family Elysidae (now Plakobranchidae)
from the Indo-Pacific region. Rudman (1983) studied
Chromodoris aspersa colour group.
Materials and Methods
Intertidal survey was done using snorkelling to collect
the specimens. Direct search under dead coral boulders
and shallow pools during low tides was conducted
particularly on the eastern side reef. Digital images
were taken of live specimens; specimens were stored
in 90% ethyl alcohol after studying the morphological
characters for DNA sequencing without relaxing them.
The specimens are deposited in the Bombay Natural
History Society (BNHS) collections.
Study site and duration: Field collections were
carried out for two weeks in December 2009 and April
2010 at Minicoy (8016’N & 7303’E) and Kavaratti (10033’N
& 72036’E), Lakshadweep Archipelago (Fig. 1).
Results and Discussion
During the two week survey, nine species were
recorded belonging to eight families (Table 1). Apte
(2009) reported 60 species of opisthobranchs from
Lakshadweep of which 52 were new records to
Lakshadweep and 40 new records to India. During
the present work an additional nine new records were
established for Lakshadweep of which six are new for
India. This clearly reflects the fact that opisthobranch

DOI: http://dx.doi.org/10.11609/JoTT.o3487.5562-8 | ZooBank: urn:lsid:zoobank.org:pub:5DE10A7E-5F26-45BE-AF0B-31976F62789A

Editor: C. Raghunathan, Zoological Survey of India, Port Blair, India. Date of publication: 26 March 2014 (online & print)

Manuscript details: Ms # o3487 | Received 15 January 2013 | Final received 09 December 2014 | Finally accepted 20 February 2014

Citation: Deepak Apte & Vishal Bhave (2014). New records of opisthobranchs from Lakshadweep, India (Mollusca: Heterobranchia). Journal of Threatened Taxa
6(3): 5562–5568; http://dx.doi.org/10.11609/JoTT.o3487.5562-8

Copyright: © Apte & Bhave 2014. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium, reproduction
and distribution by providing adequate credit to the authors and the source of publication.

Funding: Ministry of Environment and Forests, Government of India.

Competing Interest: The authors declare no competing interests.

Acknowledgements: Authors are thankful to MoEF for providing financial support through AICOPTAX. Dr. J.R. Bhatt provided constant encouragement. Dept. of
Environment and Forests, Lakshadweep Administration has been always supportive. Salahuddin V.K assisted during the field work.

5562
New records of opisthobranchs from Lakshadweep Apte & Bhave

Table 1 New records of opisthobranch from Lakshadweep

New record to New record

Family Species
Lakshadweep to India
Sohgenia
1 Limapontiidae √ √
palauensis
2 Plakobranchidae Elysia rufescens √ √
Pleurobranchus
3 Pleurobranchidae √ √
forskalii
Gymnodoris
4 Gymnodorididae √ √
okinawae
Chromodoris
5 Chromodorididae √ √
aspersa
Sclerodoris
6 Discodorididae √ -
apiculata
7 Dorididae Doris granulosa √ -

8 Bornellidae Bornella stellifer √ -

Phidiana
9 Facelinidae √ √
semidecora
9 6

such events are not uncommon.

Figure 1. Survey locations in the Lakshadweep (map not up to the

scale)   Details of newly recorded species
Kingdom: Animalia
Phylum: Mollusca
fauna need much more attention. Class: Gastropoda
December 2, 2009 was an exceptional day due to Subclass: Heterobranchia
the presence of very high density of species like Elysia Infra-class: Opisthobranchia Milne-Edwards, 1848
tomentosa, Gymnodoris okinawae and Polybranchia Order: Sacoglossa Ihering, 1876
orientalis at Kavaratti. Almost invariably, egg cases Family: Limapontiidae
of E. tomentosa were seen in close proximity of egg 1. Sohgenia palauensis Hamatani, 1991
cases of P. orientalis. Similar observations were made India: Kavaratti, Lakshadweep.
on 23 October 2007 where Gymnodoris ceylonica Global Distribution: Tropical Indo-West and North-
timed their appearance with the congregation of the West Pacific (Rudman 2002), Palau (Hamatani 1991),
benthic form of Stylocheilus longicauda [previously Indonesia (Nudipixel database), Tanzania, Papua New
known as Stylocheilus striatus (Quoy & Gaimard, 1932)] Guinea, Guam, Japan (Gosliner et al. 2008) and Marshall
(Yonow 2012) on which they were seen feeding. Large Islands (http://www.gastropods.com).
congregations of Haminoea cymbalum were observed
for three winter seasons on 4 December 2005, 29
January 2007 and 3 February 2008; which were breeding
congregation. Large numbers of Flabellina bicolor were
seen on 1 March 2009 and Dolabrifera dolabrifera on
9 December 2007. Similar observations were made by
Yonow (2012) in La Réunion on February 2007 where
H. cymbalum were seen at a density of 100 individual/
m2. Walter (1890) observed large congregation of
Haminoea hydatis and Aplysia punctata at Plymouth.
Carefoot (1987) in the review paper on the biology of
Aplysia states that not all such aggregations are strictly
© Deepak Apte

for breeding, it is possible to happen due to successful

settlement or even when a large number of individuals
eat all available food and start moving towards new
sources. Though there is no pattern in such occurrences, Image 1. Sohgenia palauensis

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5562–5568 5563

New records of opisthobranchs from Lakshadweep Apte & Bhave

Size: Single specimen. 8mm (BNHS-opistho-083).
Descriptive features: It is a small sea slug and rarely
found, primarily due to its cryptic nature. The body is
flattened with transparent cerata. Brownish-red dots
are clearly visible on the cerata which are bulbous
at the tips. The body is deep green in colour. Animal
autotomizes cerata if disturbed (Image 1).
Status: Rare.
Family: Plakobranchidae
2. Elysia rufescens (Pease, 1871)
India: Kavaratti, Lakshadweep.
Global Distribution: Myanmar, Guam, Indonesia
(Nudipixel), Australia, Tahiti, Hawaii, Reunion Island,
Christmas Island, South Africa, Philippines, Samoa and
Japan (Gosliner et al. 2008)
Size: Three specimens ranging between 20–40 mm
(BNHS-opistho-90).
Descriptive features: During the survey, the species
was found along with Elysia tomentosa. It is common
in shallow exposed reef areas. The body is profusely
mottled with white scattered acran olive green
background. Edge of the parade has red band. Egg case
is white in colour. The species has rarely been reported
from western part of Indian Ocean (Gosliner 1987)
(Image 2).
Status: Uncommon.
Philippines, Guam, Tanzania, New Guinea and Japan
(Gosliner et al. 2008).
Size: Five specimens ranging between 20–72 mm
(BNHS-opistho-580).
Descriptive features: It is a large sea slug and seen
under coral boulders. It can also be seen moving on
the sand floor. The surface is highly tuberculate. Each
tubercle at the base is encircled by a bluish-violet colored
ring. The species, however, show a wide range of colour
variations. One of the specimens collected is deep
reddish-orange and has no coloured rings at the base of
tubercles. Both the colour forms are illustrated to show
the colour variation seen in this species. Rhinophores
have a fine rib like pattern. The foot is fleshy, muscular
and large (Images 3 and 4).
Status: Seasonally common.
Order: Nudibranchia Cuvier, 1817
Family: Gymnodorididae

Order: Pleurobranchomorpha Schmekel, 1985

Family: Pleurobranchidae
3. Pleurobranchus forskalii (Rüppell & Leuckart, 1831)
India: Kavaratti, Lakshadweep.
Global Distribution: Red Sea, Fiji, Australia, Indonesia,
© Deepak Apte
© Deepak Apte

© Deepak Apte

Image 2. Elysia rufescens Image 3 & 4. Pleurobranchus forskalii

5564 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5562–5568

New records of opisthobranchs from Lakshadweep Apte & Bhave
© Deepak Apte
Image 5. Gymnodoris okinawae
4. Gymnodoris okinawae Baba, 1936
India: Kavaratti, Lakshadweep.
Global Distribution: Reunion, Aldabra, South Africa,
Tanzania, Papua New Guinea, Philippines, Midway Atoll,
Hawaii and Japan (Gosliner et al. 2008).
Size: Eight specimens ranging between 30–35 mm
(BNHS-opistho-065).
Descriptive features: This species seems to have
timed their appearance with those of Elysia tomentosa.
Almost every specimen was seen with whole Elysia in
its stomach (Image 4). On 2 December 2009, one of the
author, Deepak Apte counted and measured size of over
800 individuals in a small area of about 100m2. At the
same time we counted Elysia tomentosa with average
density of 90 individuals per m2. The congregation
though was short-lived and both Gymnodoris and Elysia
disappeared within a span of three days. Colour is light
yellow spotted with white and orange. Body also has
a scattered network of orange and white lines. Eight
gills are clearly visible and form a complete circlet.
Rhinophores are short and have 18–20 lamellae (Image
5).
Status: Seasonally common.
Family: Chromodorididae
5. Chromodoris aspersa (Gould, 1852)
India: Kavaratti, Lakshadweep.
Global Distribution: Indo Pacific from East Africa,
Aldabra, Reunion Island, Seychelles, Papua New Guinea,
Australia, Philippines, Marshall Islands, Japan and Hawaii
(Gosliner et al. 2008).
Size: Five specimens measuring 16–33 mm (BNHS-
opistho-087).
Descriptive features: A mid-sized chromodorid and
rarely seen. It is white in colour with deep violet spots
on the body. Posterior end of foot is long, pointed and
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5562–5568
© Deepak Apte
Image 6. Chromodoris aspersa
spotted with violet spots. Gills are translucent white and
eight in number. Rhinophores are deep orange in colour
and have 16–18 lamellae (Image 6).
Status: Uncommon.
Family: Discodorididae
6. Sclerodoris apiculata (Alder & Hancock, 1864)
India: Kavaratti, Lakshadweep, Tamil Nadu and
Andhra Pradesh. The species is described from Waltair,
Andhra Pradesh as Doris apiculata by Alder & Hancock.
It was last recorded from Tamil Nadu in 1932 by C.H.
O’Donoghue as Halgerda apiculata.
Global Distribution: Western Indian Ocean of South
Africa, Madagascar, Saudi Arabia, Tanzania, Australia,
Papua New Guinea and Japan (Gosliner et al. 2008).
Size: One specimen measuring 50mm (BNHS-
opistho-061).
Descriptive features: Mantle of the species is like
sponge on which it is found. Surface has deep pits.
Mantle also has small tubercles which have white
papillae. Larger tubercles have secondary papillae as
well. Colour is yellow. Gills are bushy and light yellow
in colour. Rhinophores has stout and dark yellow ochre.
Foot margin is lined by distinct brownish-black line
(Image 7).
Status: Rare.
Family: Dorididae
7. Doris granulosa (Pease, 1860)
India: Kavaratti, Lakshadweep and Ratnagiri
(Maharashtra). It was originally described as Doriopsis
granulosa by Pease, 1860 from Sandwich Islands.
Global Distribution: Western India Ocean
(Madagascar, Seychelles, Reunion); Western Pacific,
5565
New records of opisthobranchs from Lakshadweep Apte & Bhave

© Deepak Apte
© Deepak Apte
Image 8. Doris granulosa

Image 7. Sclerodoris apiculata

Central Pacific, Marshall Islands and Hawaii.

Size: One specimen measuring 22mm (BNHS-
opistho-879).
Descriptive features: Mantle of the animal bears
small and rounded tubercles. Arrangement of gills is
diagnostic in this species. Gills are arranged across
the back in transverse line. Colour is dark yellow.
Rhinophores are dark ochre yellow (Image 8).
Status: Rare.

Family: Bornellidae
8. Bornella stellifer (A. Adams & Reeve, 1848)
India: Kavaratti and Agatti, Lakshadweep; Ratnagiri,
Revdanda (Maharashtra) and Gulf of Kutch (Gujarat).
Global Distribution: Australia, Hawaii, Thailand,
South Africa, Madagascar, Papua New Guinea, New
Caledonia, Japan, Singapore, Malaysia, Indonesia,
Taiwan, American Samoa, South China Sea, Korea, East
Africa, Philippines, Tahiti, Hong Kong and Marshal Is
(Pola et al. 2009).
Size: Three specimens. 25–29 mm (BNHS-
opistho-00637).
Descriptive features: A small sea slug found under
coral boulders. Oral tentacles are paired and finger like.
Gills are placed at the base of each cerata. Rhinophores
are present on long stalks and surrounded by long
filamentous papillae. It feeds on hydroids. The color is
deep reddish-brown with white patches. Tips of cerata
and papillae have an apical red band (Image 9).
Status: Rare at Lakshadweep but common in Gujarat
and Maharashtra.
Remark: Specimens from Gujarat (Apte et al.
2010) and Lakshadweep varies significantly in
© Deepak Apte
Image 9. Bornella stellifer
external morphology. The DNA based study was thus
undertaken to confirm the identity of the species found
in Lakshadweep. The studies confirmed it as Borrnella
stelifer. Pola et al. (2009) did a revision of family
Bornellidae and present findings confer with the same.
DNA sequences for CoI, 16s and H3 are deposited with
gene bank under GenBank accession number KF601556-
KF601558 (16S.sqn  637 KF601556, COI.sqn  637
KF601557, H3.sqn 637 KF601558).
Family: Facelinidae
9. Phidiana semidecora (Pease, 1860)
India: Kavaratti, Lakshadweep.
Global Distribution: Hawaii (Pease 1860) and Sagami
Bay, Japan (Baba 1949, 1965).
Size: One specimen measuring 10 mm (BNHS-
opistho-880).

5566 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5562–5568

New records of opisthobranchs from Lakshadweep Apte & Bhave
© Deepak Apte
Image 10. Phidiana semidecora
Descriptive features: It is a small slug. It shows a
close resemblance with P. anulifera. However, red lines
as seen in P. anulifera are absent in this species. The
mantle is translucent white and scattered with white
and red spots. Foot is translucent white and heavily
spotted with white. Rhinophores are annulated with
3-4 annulations with upper half opaque white. Oral
tentacles are banded with opaque white and translucent
red arranged in alternate manner with opaque red band
at the base and at the center. Cerata are arranged in
four clusters. Few cerata in each cluster are bulbous at
the tip with an opaque white band just below the tip
(Image 10).
Status: Rare.
In conclusion it can be said that the AICOPTAX
initiative of Government of India has allowed
strengthening taxonomic work on molluscs in general
and opisthobranchs in particular. Previously, the
authors reported 88 new records of opisthobranchs to
Lakshadweep, Maharashtra and Gujarat which include
61 new records to India (Apte 2009; Apte et al. 2010;
Bhave & Apte 2011). The range extension of nine more
species of opisthbranchs to Lakshadweep only reinforces
the fact that more intensive surveys are essential as
they can add more species to this archipelago. Diversity
of cryptic opisthobranchs is virtually undocumented
from these islands. Thus, targeted surveys of hydroid,
bryozoan and sponge associated crypic opisthobranch
may reveal new records and can be an important area
of future studies.
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5562–5568
References
Apte, D. & V.K. Salahuddin (2011). Record of Hexabranchus sanguineus
(Rüppell & Leuckart, 1828) from Lakshadweep Archipelago, India.
Journal of the Bombay Natural History Society 107(3): 261–262.
Apte, D. (2009). Opisthobranch fauna of Lakshadweep Islands, India
with 52 new records to Lakshadweep and 40 new records to India.
Part 1. Journal of the Bombay Natural History Society 106(2): 162–
175.
Apte, D. (2012). Field Guide to the Marine Life of India. Published by
Animesh Apte, 504pp.
Apte, D., V. Bhave & D. Parasharya (2010). An annotated and illustrated
checklist of the Opisthobranch fauna of Gulf of Kutch, Gujarat, India
with 21 new records for Gujarat and 15 new records for India. Part 1.
Journal of the Bombay Natural History Society 107(1): 14–23.
Balani, M.C. & B. Patel (1994). Occurrence of Elysia grandifolia
(Mollusca, Gastropoda), and its radionuclide content from Tarapur
Coastal Waters, West Coast of India. Indian Journal of Marine
Sciences 23(1): 61–63.
Bhave, V. & D. Apte (2011). Illustrated checklist of Opisthobranch
fauna of Ratnagiri, Maharashtra, India with 8 new records to India.
Journal of the Bombay Natural History Society 108(3): 172–182.
Bhave, V. & D. Apte (2013). Current Status of Indian Opisthobranch
Fauna: Chapter 5. Ecology and Conservation of Tropical Marine
Faunal Communities. Springer-Verlag Berlin Heidelberg, 17pp (In
Press).
Carefoot, T.H. (1987). Aplysia: its biology and ecology. Oceanography
and Marine Biology 25: 167.
Gardiner, J.S. (1903). The Fauna and Geography of the Maldives
and Laccadive Archipelagoes - Vol 2. Cambridge University Press,
1080pp.
Gideon, P.W., P.K.B. Menon, S.R.V. Rao & K.V. Jose (1957). On the
marine fauna of the Gulf of Kutch: A preliminary survey. Journal of
the Bombay Natural History Society 54(3): 690–706.
Gosliner, T.M. (1987). Nudibranchs of Southern Africa. A Guide to
Opisthobranh Molluscs of Southern Africa. Sea Challengers & Jeff
Hamann, Monterey & El Cajon, California, 136pp.
Gosliner, T.M. (1995). The genus Thuridilla (Opisthobranchia: Elysiidae)
from the tropical Indo-Pacific, with a revision of the phylogeny and
systematics of the Elysiidae. Proceedings of the California Academy
of Sciences 49(1): 1–54.
Gosliner, T.M., D.W. Behrens & A. Valdes (2008). Indo-Pacific
Nudibranchs and Sea Slugs: A Field Guide to The World’s Most
Diverse Fauna. Sea Challengers Natural History Books and the
California Academy of Sciences, 426pp.
Hamatani, I. (1991). Sohgenia palauensis n. gen. & sp., a new
ascoglossan opisthobranch from the Palau Islands collected by the
R/V Sohgen-Maru. The Venus, The Japanese Journal of Malacology
50(2): 85–92.
Hornell, J. (1909b). A note on the presence of symbiotic algae in the
integuments of nudibranchs of the genus Melibe, pp. 145–148.
In: Report to the government of Baroda on the marine zoology of
Okhamandal 1.
Jagtap, T.G. (2009). Elysia bangtawaensis Swennen (Nudibranch) from
the mangrove habitat of Mandovi Estuary, Goa (central west coast)
India. Current Science 96(1): 30–33.
Jensen, K.R. (1992). Anatomy of some Indo-Pacific Elysiidae
(Opisthobranchia: Sacoglossa = Ascoglossa), with a discussion of the
generic division and phylogeny. Journal of Molluscan Studies 58(3):
257–296; http://dx.doi.org/10.1093/mollus/58.3.257 

Menon, P.K.B., A.K. Dutta & D.D. Gupta (1970). On the marine fauna
of the Gulf of Kutch - Part II. Journal of the Bombay Natural History
Society 58(2): 475–494.
Narayanan, K.R. (1968). On three opisthobranchs from the south-
west coast of India. Journal of the Marine Biological Association of
India 10(2): 377–380.
Narayanan, K.R. (1969). On the opisthobranchiate fauna of the Gulf of
Kutch. Proceedings of the Symposium on Mollusca held at Cochin
from January 12 to 16, 1968, Symposium Series 3 (1): 189-213; figs.
5567
New records of opisthobranchs from Lakshadweep Apte & Bhave
1-20. Marine Biological Association of India, Mandapam Camp,
India.
Narayanan, K.R. (1971a). On two doridacean nudibranchs (Mollusca:
Gastropoda), from the Gulf of Kutch, new to the Indian coast.
Journal of the Bombay Natural History Society 68(1): 280–281.
Narayanan, K.R. (1971b). On a species of the genus Berthellina
(Opisthobranchia: Notaspidea) of the Gulf of Kutch. Journal of the
Marine Biological Association of India 12(1–2): 210–212.
Nudipixel (2011). http://www.nudipixel.net/
Pola, M., W.B. Rudman & T.M. Gosliner (2009). Systematics and
preliminary phylogeny of Bornellidae (Mollusca: Nudibranchia:
Dendronotina) based on morphological characters with description
of four new species. Zootaxa 1975: 1–57.
Rao, K.V. & L.K. Kumari (1973). On a new species of Dendrodoris
ehrenberg from Goa: Mollusca-Nudibranchiata. Journal of the
Marine Biological Association of India 15(1): 242–250.
Rao, K.V., P. Sivadas & L.K. Kumari (1974). On three rare doridiform
nudibranch molluscs from Kavaratti Lagoon, Laccadive Islands.
Journal of the Marine Biological Association of India 16 (1): 113–125.
Rudman, W.B. (1983). The Chrormodorididae (Opisthobranchia:
Mollusca) of the Indo-West Pacific: Chrornodoris splendida.
5568 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5562–5568
C. aspersa and Hypselodoris placida colour groups. Zoological
Journal of the Linnean Society 78: 105–173; http://dx.doi.
org/10.1111/j.1096-3642.1983.tb00864.x
Rudman, W.B. (2002). Sohgenia palauensis Hamatani, 1991. [In] Sea
Slug Forum. Australian Museum, Sydney. Available from http://
www.seaslugforum.net/factsheet/sohgpala
Walter G. (1890). A Complete list of the opisthobranchiate mollusca
found at Plymouth; with further observations on their morphology,
colours, and natural history. Journal of the Marine Biological
Association of the United Kingdom (New Series), 1, pp. 399-457.
http://dx.doi.org/10.1017/S0025315400057878
Winckworth, H.C. (1946a). Glossodoris from Bombay. Proceedings of
the Malacological Society of London 26(6): 155–160.
Winckworth, H.C. (1946b). A new Goniodoris from Bombay.
Proceedings of the Malacological Society of London 27(2): 59–61.
Yonow N. (2012). Opisthobranchs from the western Indian Ocean, with
descriptions of two new species and ten new records (Mollusca,
Gastropoda). ZooKeys 197: 1–129.
http://www.gastropods.com/9/Shell_50629.shtml accessed on 10th
Sept 2013
Threatened Taxa
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5569–5573

Short Communication
On the occurrence of the Fishing Cat Prionailurus viverrinus
Bennet, 1833 (Carnivora: Felidae) in coastal Kerala, India
Ranjini Janardhanan 1, Shomita Mukherjee 2, P.V. Karunakaran 3 & Ramana Athreya 4 ISSN
Online 0974–7907
Print 0974–7893
1,2,3
Sálim Ali Centre for Ornithology and Natural History (SACON), Anaikatty Post, Coimbatore, Tamil Nadu 641108,
India OPEN ACCESS
4
Indian Institute of Science Education and Research (IISER), 900, NCL Innovation Park, Dr Homi Bhabha Road, Pune,
Maharashtra 411008, India
1
jranjini@gmail.com, 2 shomitam@gmail.com (corresponding author), 3 karunakaran.pv@gmail.com,
4
rathreya@iiserpune.ac.in

Abstract: The Fishing Cat Prionailurus viverrinus is classified as Endangered
in the IUCN Red List and yet its distribution range within India is not
resolved. In spite of its potential habitat being present in coastal Kerala,
there are only a few, unsubstantiated records of the cat. Moreover, its
occurrence in Sri Lanka strengthens the possibility of its presence (historical
or current population) in southern India, including Kerala. This survey was
conducted to assess the occurrence of the Fishing Cat in coastal Kerala
through personal informal interviews with local people and molecular
analysis of scats. The study failed to find any evidence of the occurrence
of Fishing Cat in the coastal areas of Kerala. We discuss two possibilities
- one, of the species existing earlier but driven to extinction in recent
decades, due to high levels of land conversion through anthropogenic
activities in these areas and the other of the Fishing Cat having never
occurred in coastal Kerala. A speculative reasoning for its absence from
the region could be related to the difference in salinity levels between the
eastern and western coasts of India which has already been documented.
Moreover, fewer freshwater sources merge into the sea in coastal areas
of Kerala as compared to the eastern coast of India. This could limit the
distribution of the Fishing Cat. The argument was also supported by the
lack of any authentic report till date or of local names for the Fishing Cat
in the region.
Keywords: Coastal Kerala, distribution, Fishing Cat, scat analysis.
Abbreviations: DNA - Deoxyribonucleic Acid; GADM - Global
Administrative areas; IUCN - International Union for the Conservation of
Nature; PCR - Polymerase Chain Reaction
This study was undertaken to evaluate
unauthenticated records of the presence of the Fishing
Cat Prionailurus viverrinus (Bennett, 1833) along
coastal Kerala, which could help establish the link to its
distribution in Sri Lanka. Owing to the severity of threats
to its habitat and its depleting population, the Fishing Cat
is included in Schedule I of the Indian Wildlife (Protection)
Act (Anonymous 1972) and listed as Endangered in the
2010 assessment of the IUCN Red List of Threatened
Species (Mukherjee et al. 2010a). This medium-sized cat
is one among the 15 species of cats in India (Nowell &
Jackson 1996), and weighs 6–16 kg (Sunquist & Sunquist
2002). Wetlands such as mangroves, rivers, ponds and
canals are potential habitats for this cat.
The Fishing Cat is discontinuously distributed in Asia
and occurs in India, Pakistan (Sindh), Nepal, Bangladesh,
Sri Lanka, Thailand, Cambodia and Java (Pocock 1939;
Cutter 2009; Cutter & Cutter 2009). India and Sri Lanka
are strongholds for the Fishing Cat. There is no authentic

DOI: http://dx.doi.org/10.11609/JoTT.o3780.5569-73 | ZooBank: urn:lsid:zoobank.org:pub:5235A640-A54E-49C0-B754-8212EDDFA331

Editor: P.O. Nameer, Kerala Agricultural University, Thrissur, India Date of publication: 26 March 2014 (online & print)

Manuscript details: Ms # o3780 | Received 28 September 2013 | Final received 14 March 2014 | Finally accepted 15 March 2014

Citation: Janardhanan, R., S. Mukherjee, P.V. Karunakaran & R. Athreya (2014). On the occurrence of the Fishing Cat Prionailurus viverrinus Bennet, 1833 (Carnivora:
Felidae) in coastal Kerala, India. Journal of Threatened Taxa 6(3): 5569–5573; http://dx.doi.org/10.11609/JoTT.o3780.5569-73

Copyright: © Janardhanan et al. 2014. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium, reproduc-
tion and distribution by providing adequate credit to the authors and the source of publication.

Funding: The project was funded by Panthera Corporation, New York for field work and The Indian
Institute for Science Education and Research (IISER), Pune for laboratory space, equipment and chemicals.

Competing Interest: The authors declare no competing interests.

Acknowledgements: This study emanates from a larger study supported by Panthera Corporation, New York. We thank Director, SACON for facilitating and sup-
porting the work. We thank IISER, Pune for laboratory space and chemicals, the Forests and wildlife Department of Kerala for permits, logistic help and discussions;
Mahatma Gandhi University, School of Environmental Sciences, Kottayam and IISER, Trivandrum for accommodation in their guest houses. We thank M. Ravi, our
driver during the field survey. Several people we interacted with, provided information on locations of sites, especially Ajay, Ayyapan, Chacko, Charan, Christopher,
Prasanth, Rajeevan, Subramany and Toms for providing information and accompanying us to various sites. We also thank Ginson, Subin and Thangappan for in-
formation on the wild cats they had seen. We are grateful to Hema for facilitating accommodation at Trivandrum. We thank Mansi, Gouri and many others in the
laboratory at IISER, Pune for helping us through stressful troubleshooting as well as making our stay and work enjoyable. We are grateful to Velumani and Prachi
who helped enormously with troubleshooting as well as with ordering and suggesting various DNA extraction kits when we needed them urgently. We thank the
editor and reviewers of the manuscript for their comments.

5569
Fishing Cat in coastal Kerala Janardhanan et al.

report from peninsular Malaysia and its distribution

in Laos and Sumatra is disputed (Duckworth et al.
1999, 2009). Within India, the Fishing Cat is primarily
distributed in the eastern parts (West Bengal, Assam,
Orissa, parts of Andhra Pradesh) and along the foothills
of the Himalaya in the Terai tract (Pocock 1939; Sunquist
& Sunquist 2002). There are records from Keoladeo
Ghana National Park, Bharatpur (Nowell & Jackson 1996;
Sunquist & Sunquist 2002; Mukherjee et al. 2012) and
Areas surveyed
one recent camera trap record from Ranthambhore Tiger
Reserve (Sadhu & Reddy 2013). Since the distribution of
this cat continues into Sri Lanka, it is expected to occur
in southern India. Despite the presence of wetlands
and mangroves along the western coast, the occurrence
of the Fishing Cat in this region is contentious (Prater
1971; Sunquist & Sunquist 2002; Menon 2003). Some
authors have speculated a recent extirpation of the
species from this region due to habitat loss (Karanth
1986; Nowell & Jackson 1996; Sunquist & Sunquist 2002;
Kumara & Singh 2007). On the other hand, there are  
recent, though unsubstantiated, reports of the Fishing 0 50 100 km
Cat from Kannur, Kumarakom Mangroves and Periyar
Tiger Reserve in Kerala (http://wild-cat.org/viverrinus/
fishing-cat/index.htm?pv-distribution.htm, accessed on Figure 1. Map showing the areas surveyed in Kerala
20th August 2013; http://www.periyartigerreserve.org/ The inset shows the map of India with Kerala state highlighted. The
name of the districts is mentioned in the map and the points in red are
check_list/mammals.pdf, accessed on 14th March 2014). the localities studied during the survey.
Pocock (1939) questions the validity of the Malabar Source: Data extracted from GADM version 1.0
Coast (which in the 1930s would include almost the
entire western coast of India) as the locality of the type
specimen of the species. He remarks that this could be Table 1. Places surveyed where habitat observations were made and
an assumption since the donor submitted a specimen of scat samples were collected
a langur from the Western Ghats along with the Fishing District Locality Habitat type
Cat specimen, though notes on the specimen mention Mangroves, aquaculture
Ezhom in Pazhyangadi
farm, paddy fields
the locality as just ‘India’. The record from Periyar Tiger
Aquaculture farm,
Reserve too is not substantiated with photographic or Chempallikunde
abandoned paddy fields
genetic evidence and so remains speculative. Vegetation dominated
Kannur
One scenario suggests that the species was present Ramapuram East and West by Typha sp., degraded
mangroves
in this region historically and at present occurs in small
Pappinissery in Chungam,
populations, in danger of extinction, or has already been Relatively intact mangroves,
Mayyil Panchayat,
aquaculture farms
Koduvally in Thalassery
extirpated from this region. Alternatively, the possibility
Kozhikode
of the cat having never occurred here also cannot be and Kadalundi
Mangrove islands
(degraded)
rejected. Solving this is important, not just to enable Malappuram
conservation of this Endangered (Mukherjee et al. Kottayam Neelamperoor
Paddy field and vegetation
dominated by Typha sp.
2010a) cat but also to trace its historical dispersal into Tall grass, abandoned paddy
Kavalam
Sri Lanka. fields
Given the background, the present survey was Boothapandi Kayal Temple pond

undertaken to evaluate Fishing Cat distribution in this Alleppey Thankankary

Tall grass, abandoned paddy
fields
region. We surveyed potential habitats in coastal Kerala
Kanjoor Tall grass and trees
for Fishing Cat through scat collection and assignment
Judge 6000 East Paddy fields and canals
of scats to species using molecular tools. We also
Kollam Ashramam Highly disturbed mangroves
interviewed local inhabitants for information on the

5570 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5569–5573

Fishing Cat in coastal Kerala Janardhanan et al.
Fishing Cat and its potential habitat in the locality.
Method: The survey localities were initially selected
based on the presence of relatively intact mangrove
patches and earlier unauthenticated records of the
species. The survey lasted for a week (20–27 January
2013) and several localities under five districts were
visited (Table 1, Fig. 1). Upon reaching a locality, we
contacted naturalists, research institutes and forest
department personnel who could provide us with
information on possible records of the cat or of potential
habitats (wetlands, mangroves and marshy areas).
We also interacted with people in the locality for any
information on small cats in the area. A few people
whom we interviewed claimed to have seen ‘wild’ cats
and they were asked to describe the cat through its tail
length (e.g., was the tail long or short?), body size (would
the size compare with house cat or dog?), height of the
cat, length of legs, coat pattern and any other behaviour
if observed.
Scat collection and analysis: Based on information
obtained on habitats, we visited specific localities for
sample collection. We followed existing paths to survey
an area. All scats encountered were collected since
visual assignment to predators is difficult given that
several small carnivores coexist in an area. Scats were
collected in separate vials. Special care was taken while
collecting, to avoid contact with bare hands in order
to prevent contamination across scats. Very old and
degraded (disintegrated and without the smooth outer
coating) scats were not collected.
Scats samples were carried to the laboratory where
alcohol was added to preserve DNA for further analysis.
Faecal DNA was extracted using commercially available
extraction kits from QIAGEN (QIAAmp) and scats were
assigned to the predator species by using the felid
specific primer for the 16s rRNA region and a restriction
digestion with Hae III, Ase I and Dpn I, following
Mukherjee et al. (2010b).
Results: We visited five districts, Kannur, Kozhikode,
Kottayam, Alleppey and Kollam (Table 1). All localities
visited were severely disturbed with higher levels of
disturbance in southern Kerala.
The local people interviewed in places we visited
could not provide any information on Fishing Cat
presence. Moreover, there was no local name for the
species. The descriptions by locals of cats they had
sighted matched either the Jungle Cat or Rusty-spotted
Cat (Image 3). There was one past unconfirmed record
of a Fishing Cat in the 1990s that was rescued from a
well near Parassinikadavu Snake Park in Kannur District.
The cat was held in captivity at the Snake Park until it
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5569–5573
died in 1993. Subsequently, the skin of the cat was kept
at the Snake Park until a fire left no trace of it. There are
no further details available nor is there any photographic
evidence and the record remains unauthenticated. We
also contacted the person (P.C. Rajeevan) who claimed
to have seen a Fishing Cat near Parassinikadavu temple,
Kannur in 2009 (http://wild-cat.org/viverrinus/fishing-
cat/index.htm?pv-distribution.htm, accessed on 20
August 2013). He told us that he assumed it was a
Fishing Cat as he saw it swimming across the river. The
record by Jafer Palot (http://wild-cat.org/viverrinus/
fishing-cat/index.htm?pv-distribution.htm., accessed on
20 August 2013) is not supplemented with photographic
evidence.
Scat analysis: We collected 51 scats from all the
sites visited (Image 1). Of these, 14 were positive for
felids. Restriction digestions were carried out on 10
scats. Four scats had insufficient predator DNA after
amplification with felid primers and were not included
in the restriction digestions. We could identify six jungle
cats and two house cats from the restriction digestion
profiles (Image 2). Restriction profiles of PCR products
from two scats did not give clear results and were
classified as unknown. No scat was assigned to Fishing
Cat.
Discussion: Our survey for Fishing Cat in the coastal
areas of Kerala did not suggest the current existence of a
population in the region. Interviews with people in the
survey sites, observations on the habitat and assignment
of scats to predators using molecular tools failed to
provide any authentic indication of its presence.
The local people were familiar with other cats present
in the region such as the Jungle Cat, Leopard Cat and
Rusty-spotted Cat and could describe them well. They
© Ranjini Janardhanan
Image 1. Scats along an aquaculture farm in Kannur. Laboratory
analysis of scats from here assigned them to Jungle Cat.
5571
Fishing Cat in coastal Kerala Janardhanan et al.
Image 2. Restriction digestion (RFLP) profiles of three enzymes
HaeIII, AseI and DpnI. The amplified product of the 16srRNA gene of
the mitochondrial DNA is 210 base pairs long. Any result that shows
a smaller band indicates digestion has taken place and the amplicon
is cut. Here HaeIII has cut the amplicon but AseI and DpnI have not.
This profile matches that of a house cat. MtDNA of different species
of cats show different profiles with these three enzymes thus aiding
identification. © Ranjini Janardhanan
even have local names for these cats. However, there
seemed to be no local name for the Fishing Cat unlike in
other areas of the country where Fishing Cats are seen
(Tiasa Adhya pers. comm. 2013). The cat is fairly large
and at 6-16 kg body mass (Sunquist & Sunquist 2002), is
much larger than the Jungle Cat (average body mass 5kg),
Leopard Cat (average body mass 3kg) and Rusty Spotted
Cat (average body mass <2kg) (Pocock 1939; Sunquist &
Sunquist 2002). If it did occur along human dominated
coastal Kerala, it would perhaps not go unnoticed, given
its size. Additionally, during scat collection we did not
come across any site that had large depositions of scat,
behaviour peculiar to the Fishing Cat seen across its
distribution range in India (Mukherjee et al. 2012).
The results were surprising as coastal areas in Kerala
are rich in water bodies, mangroves and marshes that
are similar to the habitat of the Fishing Cat elsewhere.
From our results we cannot conclude if Fishing Cats have
only relatively recently been extirpated from this region
or had never occurred along coastal Kerala.
We met Mr P.C. Rajeevan, one of the two people
who claim to have seen the Fishing Cat in Kannur District
in 2009. He clarified that he assumed it was a Fishing
Cat because it was swimming across the Ramapuram
River. Dr. Jafer Palot was the other person who claims to
have seen the cat twice in Kannur, one was the captive
individual in the Parassinikadavu Snake Park sometime
in the early 1990s, of which there is no photographic
5572 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5569–5573
© Ranjini Janardhanan
Image 3. A local showing a patch opposite his house in Alleppey
where a wild cat visits regularly. He said the cat comes to catch
fish but the description he gave of the cat (big ears and long legs)
matched the Jungle Cat.
or genetic evidence and the other sighting was of an
adult at the Chemballikundu mangroves in 1995. He
based this identification on the individual he saw at the
Snake Park. Since both records are unsubstantiated it is
prudent to treat them with caution owing to the several
instances of misidentification of Leopard Cats and house
cats as Fishing Cats, even by experts (Duckworth et al.
2009, Shomita Mukherjee pers. obs. 2009, 2010, 2014).
Furthermore, the state of the mangroves is believed to
have improved since the formation of the Kerala Coastal
Zone Management Authority in 1998 (http://www.
envfor.nic.in/legis/crz/1001.html, accessed on 21st
August 2013). Despite this, in our current survey we
found the mangroves to be in a devastated condition.
Hence, it is reasonable to accept that in the 1990s when
these sightings were made, the habitat was in a worse
state. From our present observations we reason that it
would not be feasible for the Fishing Cat to survive in
such small fragments of highly polluted mangroves.
One possibility could be that the species was present
here earlier and could have recently been extirpated as
suggested by Karanth (1986) and Kumara & Singh (2007).
Our observations on the present state of potential habitat
of the species reveal alarming levels of disturbance due
to anthropogenic activities. These habitats are either
completely destroyed for civil constructions, or have
undergone severe land conversion. Many mangrove
patches have been converted to coconut grooves, paddy
fields or aquaculture farms. Some aquaculture farms
are abandoned but retain water in them. The wetlands,
canals, marshes and mangroves that we visited were all
deeply fragmented into small patches of less than 1km2
area and polluted with waste from neighbouring urban
sprawls (Images 4 & 5). With such severe disturbance
Fishing Cat in coastal Kerala Janardhanan et al.
© Ranjini Janardhanan
© Ranjini Janardhanan
Image 4. Abandoned aquaculture Image 5. Canal in Alleppey. The
farm in Kannur District. Originally canals were not just polluted and
this was a mangrove patch. clogged but there were no large
fish in them that could sustain a
12–15 kg cat.
and fragmentation it is unlikely that the Fishing Cat
could currently survive in these patches. Moreover,
the backwater canals seem to be devoid of any large
fish that could sustain a population of a medium-sized
felid. However, in eastern and northern India the Fishing
Cat occurs around human habitations (Mukherjee et al.
2012). Furthermore, in rural West Bengal, locals farm
large fish in their home ponds and this perhaps aids the
persistence of the Fishing Cat. Another threat for all
small wild felids that we perceived during this study was
that local people were not receptive to the presence of
small cats as they predate on their poultry. An example
is a case from Alleppey where a female Rusty Spotted
Cat was trapped and killed, and its litter though adopted
by local people, did not survive.
The second argument would be that the species
never occurred in this region. This is puzzling especially
since their dispersal into Sri Lanka could only have
occurred through southern India. It is possible that this
happened through southeastern India (Andhra Pradesh/
Tamil Nadu).
We hypothesize that the higher salinity levels along
the western coast as compared to the eastern coast
(Shankar & Shetye 2001) could be a factor preventing
Fishing Cats from colonising the western coast of India.
Further, the extent of area under wetlands is higher along
the eastern coast as compared to the western coast of
India. A reason for lower salinity in the eastern coast is
also partly due to a larger area under river-fed wetlands
when compared with the western coast (Selvam 2003).
Though conjectural, salinity being the limiting factor
for Fishing Cat distribution along the western coast of
India can be tested through niche models. Yet there is
a possibility of Fishing Cat presence in inland areas with
fresh water sources especially along the Western Ghats
and the absence of records from this region is confusing.
We conclude that given our observations on the
condition of the wetlands, water bodies, mangroves
and canals along coastal Kerala and discussions with
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5569–5573
locals, it is unlikely that the Fishing Cat currently occurs
in the region. This was supported by results from the
scat sampling done in this region. We also hypothesise
that the Fishing Cat perhaps never occurred along the
western coast of India due to higher salinity levels as
compared to the eastern coast. However, this needs to
be tested through further analysis using niche models.
References
Anonymous (1972). The Wild Life Protection Act, 1972. Professional
Book Publishers, New Delhi.
Cutter, P. (2009). Report on Camera Trapping and Conservation
Status Assessment of Fishing Cats at Khao Sam Roi Yod National
Park, Thailand and Surrounding Areas. Fishing Cat Research and
Conservation Project, Occasional Report #5, 10pp.
Cutter, P. & P. Cutter (2009). Recent sightings of Fishing Cats in Thailand.
Cat News 51: 26–27.
Duckworth, J.W, C.R. Shepherd, G. Semiadi, P. Schauenberg, J.
Sanderson, S.I. Roberton, T.G. O’brien, T. Maddox, M. Linkie, J.
Holden & N.W. Brickle (2009). Does the Fishing Cat inhabit Sumatra?
Cat News 51: 04–09
Duckworth, J.W., R.E. Salter & K. Khounboline (1999). Status Report on
Wildlife in Lao PDR. IUCN, Vientiane, Lao PDR, 275pp.
Karanth, K.U. (1986). Status of wild life and habitat conservation
in Karnataka. Journal of Bombay Natural History Society 83
(Supplement): 166–179
Kumara, H.N. & M. Singh (2007). Small carnivores of Karnataka:
distribution and sight records. Journal of the Bombay Natural History
Society 104: 155–162
Menon, V. (2003). A Field Guide to Indian Mammals. Dorling Kindersley
(India) Pvt. Ltd. and Penguin Book India (P) Ltd., New Delhi, 201pp.
Mukherjee, S., J. Sanderson, W. Duckworth, R. Melisch, J. Khan, A.
Wilting, S. Sunarto & J.G. Howard (2010a). Prionailurus viverrinus.
In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.2.
<www.iucnredlist.org>. Downloaded on 26 April 2012.
Mukherjee, S., C.N. Ashalakshmi, C. Home & U. Ramakrishnan
(2010b). A PCR-RFLP technique to identify Indian felids and canids
from scats. BioMed Central Research Notes 3: 159; http://dx.doi.
org/10.1186/1756-0500-3-159
Mukherjee, S., T. Adhya, P. Thatte & U. Ramakrishnan (2012). Survey
of the Fishing Cat Prionailurus viverrinus Bennett, 1833 (Carnivora:
Felidae) and some aspects impacting its conservation in India. Journal
of Threatened Taxa 4(14): 3355–3361; http://dx.doi.org/10.11609/
JoTT.o3199.3355-61
Nowell, K. & P. Jackson (eds.) (1996). Wild Cats, Status Survey and
Conservation Action Plan. IUCN, Gland Switzerland, 382pp.
Prater, S.H. (1971). The Book of Indian Animals - 4th Impression. Bombay
Natural History Society, Bombay, and Oxford University Press,
Mumbai, 324pp.
Pocock, R.I. (1939). The fauna of British India, including Ceylon and
Burma. Mammalia 1: Primates and Carnivora. (In part). 2nd Edition.
(Reprint edition, 1985 NewDelhi: Today and Tomorrow’s Printers and
Publishers). Chicago: University of Chicago Press.
Sadhu, A. & G.V. Reddy (2013). First evidence of Fishing Cat in the
Ranthambhore Tiger Reserve, Rajasthan, India. Cat News 58: 36–37.
Selvam, V. (2003). Environmental classification of mangrove wetlands of
India. Current Science 84(6): 757–765
Shankar, D. & S.R. Shetye (2001). Why is the mean sea level along the
Indian coast higher in the Bay of Bengal than in the Arabian sea?
Geophysical Research Letters 28: 563–565.
Sunquist, M.E. & F.C. Sunquist (2002). Wild Cats of the World University
Chicago Press, Chicago, 452pp.
Threatened Taxa
5573
 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5574–5579
Short Communication

Coprological prevalence of gastrointestinal parasites in

carnivores and small mammals at Dhaka zoo, Bangladesh
ISSN M.M. Rokib ur Raja 1, Anita Rani Dey 2, Nurjahan Begum 3, Uzzal Kumar Kundu 4
Online 0974–7907
Print 0974–7893 & Faishal Al Ashad 5

OPEN ACCESS 1,2,3,4

Department of Parasitology, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh 2202,
Bangladesh.
5
Department of Youth Development, Ministry of Youth and Sports, Chadpur 3600, Bangladesh
1
rakib.raja@gmail.com, 2 anitadey.dpp.vet@gmail.com (corresponding author), 3 nurjahanpara@yahoo.com,
4
dvmuzzal2010@gmail.com, 5 drfaishal@yahoo.com

Abstract: A study on the coprological prevalence of gastrointestinal
parasites using 94 faecal samples from different carnivores (n=32)
and small mammals (n=15) was undertaken from January to May
2012 at Dhaka Zoo. The overall prevalence of parasitic infection
was 78.72%, with a prevalence of 51.06% for helminths and 27.66%
for protozoa. The identified parasites included—Toxascaris leonina
(9.57%), Balantidium coli (25.53%) Spirometra sp. (10.64%), Toxocara
cati (12.76%), Hook worm (4.26%), unidentified strongyles (3.19%),
Trichuris sp. (7.45%), Coccidia sp. (2.12%), Capillaria sp. (1.06%),
Trichostrongylus sp. (1.06%), and Physaloptera sp. (1.06%). Mixed
infection was observed in Indian Lion (Toxascaris leonina and
Spirometra sp.), Royal Bengal Tiger (Balantidium coli and Toxocara
cati ), Spotted Hyena (Balantidium coli and hook worm), Leopard
(Balantidium coli and Spirometra sp.), Rhesus Macaque (Trichuris sp.
and Coccidia sp.), Pig-tailed Macaque (Balantidium coli and Trichuris
sp.), Hamadryas Baboon (Balantidium coli and Trichuris sp.), Golden
Mangabey (Trichuris sp., Balantidium coli and unidentified strongyles),
Large Indian Civet (Balantidium coli and unidentified strongyles), Torior
Dog (Balantidium coli and Physaloptera), Rabbit (Balantidium coli and
Hook worm), Hanuman Langur (Balantidium coli and Capillaria sp.).
Due to the high prevalence of gastrointestinal parasites, the present
study suggests to apply control measures against these parasites in
order to safeguard the health of housed wild animals, especially in
case of threatened species.
Keywords: Carnivores, coprology, gastrointestinal parasites,
prevalence, small mammals.
Zoological gardens exhibit wild animals for aesthetic,
educational and conservation purposes (Varadharajan &
Pythal 1999). The main aim of zoological gardens is to
preserve rare and endangered species. Parasitic diseases
constitute one of the major problems and causes of
mortality in these animals (Rao & Acharjyo 1984). In
nature, wild animals range accross large areas and have
consequently a low genetic resistance against parasitic
infections because of low exposure. When herds of
these wild animals are kept in a relatively small space
in zoological gardens, the problem of various parasitic
infections can aggravate and pose a serious threat to
endangered species, occasionally causing sudden and
unexpected local declines in abundance (Muoria et al.
2005). The occurrence of parasites in animals housed in
zoos varies according to the husbandry practices, disease
prophylaxis and treatment administered. Inadequate
information on diseases and parasites of zoo animals
is a major limiting factor in adopting prophylactic
measures in zoological gardens. Investigations regarding
endoparasitic fauna are important for the study of the
prevalence, geographical distribution, systematics and
biology of parasites (Zasityte & Grikienciene 2002).

DOI: http://dx.doi.org/10.11609/JoTT.o3569.5574-9 | ZooBank: urn:lsid:zoobank.org:pub:E6451C8F-244E-46C3-ABEA-DFD7455A4362

Editor: Ulrike Streicher, Wildlife Veterinarian / Wildlife Management Consultant, Danang, Vietnam. Date of publication: 26 March 2014 (online & print)

Manuscript details: Ms # o3569 | Received 27 March 2013 | Final received 16 March 2014 | Finally accepted 17 March 2014

Citation: Raja, M.M.R.U., A.R. Dey, N. Begum, U.K. Kundu & F.A. Ashad (2014). Coprological prevalence of gastrointestinal parasites in carnivores and small mam-
mals at Dhaka zoo, Bangladesh. Journal of Threatened Taxa 6(3): 5574–5579; http://dx.doi.org/10.11609/JoTT.o3569.5574-9

Copyright: © Raja et al. 2014. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium, reproduction and
distribution by providing adequate credit to the authors and the source of publication.

Funding: Department of Parasitology provided fund for this research.

Competing Interest: The authors declare no competing interests.

Acknowledgements: We thank the respected teachers in the Department of Parasitology and also the authority of the Dhaka Zoo.

5574
Gastrointestinal parasites in Dhaka Zoo Raja et al.

Over the years, research on gastro-intestinal
parasites has been carried out on Common Mole, Cane
Rat, Gorilla, birds in captivity (e.g., Chaunha et al. 1973),
reptiles, ungulates and many zoo animals across the
globe (e.g., Kumar et al. 2005; Singh et al. 2006).
A regular program of gastrointestinal parasite
surveillance and control measures like effective
treatment and proper prophylaxis based on correct
diagnosis would certainly improve the health situation
in zoo animals.
Considering these facts, the present study was
undertaken to identify the gastrointestinal parasites and
determine their prevalence based on morphometry and
count of developmental stages in faecal samples from
carnivores and small mammals of Dhaka Zoo.
Materials and Methods
This study was conducted at Dhaka Zoo from January
to May 2012. The zoo houses many native and non
native animals and wildlife.
Selection of animals: The study included the
carnivores, non human primates and several small
mammal species. Ninety-four samples were collected
of which 70 were from carnivores including Indian
Lion (24), Tiger (20), Hyena (4), Asiatic Black Bear (4),
Dingo Dog (2), Ratel (2), Fox (2), Fishing Cat (2), Leopard
(4), Binturong (2), Large Indian Civet (2), Torior Dog
(2), 18 from non human primates including Rhesus
Macaque (2), Pig-tailed Macaque (2), Hanuman Langur
(2), Hamadryas Baboon (2), Vervet Monkey (2), Olive
Baboon (4), Hoolock Gibbon (2), Golden Mangabey
(2), and Guinea Pig (2), Rabbit (2) and Indian-crested
Porcupine (2).
Collection and preservation of samples: Individual
faecal samples were collected with the help of each
animal’s caretakers in the early morning. After collection
the faecal sample was placed in a polythene bag
containing 10% formalin. Then the opening edge of the
bag was tightly tied with ribbon to avoid contamination
and each sample was marked according to species.
Coprological examination: Samples were examined
at the laboratory of the Department of Parasitology,
Bangladesh Agricultural University, Mymensingh. The
sample was processed for microscopic examination. The
ova, cysts, oocysts and larvae of different parasites were
tentatively identified according to the morphology and
then quantitative estimation was done by applying the
Morphological measurements of ova and cysts: The
egg or cyst or oocysts were finally identified based on
measurements (length and width) by using a micrometer
as described by Cable (1965).
Results
Overall prevalence of gastrointestinal parasites:
The overall prevalence of parasitic infection was 78.72%
(74/94), of which 51.06 % (48) were helminthic and
27.66% (26) were protozoan infections (Fig. 1). The
identified parasites included protozoa (Balantidium coli,
Coccidia sp.), helminths (Toxascaris leonina, Spirometra
sp., Toxocara cati, Hook Worm, Trichuris sp., Capillaria
sp., unidentified strongyles, Trichostrongylus sp. and
Physaloptera sp.). The results indicated that helminthic
infections were more common than protozoan infections
in carnivores and small mammals.
The prevalence and intensity of different
gastrointestinal parasites: Prevalence of identified
parasites was—9.57% for Toxascaris leonina, 25.53%
for Balantidium coli, 10.64% for Spirometra sp., 12.76%
for Toxocara cati, 4.26% for Hook worm, 3.19% for
unidentified strongyles, 7,45% for Trichuris sp., 2.12%
for Coccidia sp., 1.06% for Capillaria sp., 1.06% for
Trichostrongylus sp. and 1.06% for Physaloptera sp. (Table
2). The mean of OPG, CPG, and EPG was calculated for
all the animal species and the ranges are shown in Table
1. The highest EPG was found in Leopard for Spirometra
sp. as 6200. The intensity in EPG of other parasites was
1500 for Toxascaris leonina, 800 for Coccidia sp., 500 for
Trichostrongylus sp., 400 for Capillaria sp. and 400 for
Trichuris sp.
Prevalence of mixed infection: Mixed infection was
observed in 12 species including Indian Lion (Toxascaris
leonina and Spirometra sp.), Royal Bengal Tiger
(Balantidium coli and Toxocara cati), Spotted Hyena
(Balantidium coli and Hook Worm), Leopard (Balantidium
Prevalance (%)
Prevalance (%)
90
90
78.72
78.72
80
80
70
70
60
60 51.06
51.06
50
50
40
40
27.66
27.66
30
30
20
20

Stoll’s ova dilution technique and McMaster technique 10

10

to determine eggs per gram (EPG), cysts per gram (CPG) 00

Protozoa Helminths Total
and oocysts per gram (OPG) of faeces as described by Protozoa Helminths Total
Figure 1. Overall prevalence of parasitic infection in carnivore and
Soulsby (1982). small mammals at Dhaka Zoo.

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5574–5579 5575

Gastrointestinal parasites in Dhaka Zoo Raja et al.

Table 1. Prevalence and intensity of ova/cyst/oocysts of different parasites in different animals at Dhaka Zoo
Intensity of infection(EPG
No. of positive case Prevalence /CPG)/(OPG)
Common Name Name of the parasite
(No. of sample) (%)
Ranges

Toxascaris leonina 9(24) 37.5 1200-1500

Indian Lion Spirometra sp. 5(24) 20.83 800-1000

Balantidium coli 3(24) 12.5 300-400

Toxocara cati 12(20) 60 1200-1400

Royal Bengal Tiger
Balantidium coli 3(20) 15 300-400

Hook worm 1(2) 50 600-800

Spotted Hyena
Balantidium coli 1(2) 50 300-400

Balantidium coli 1(2) 50 600-800

Striped Hyena
Hook worm 2(2) 100 800

Asiatic Black Bear Balantidium coli 1(4) 25 300-400

Dingo Dog Spirometra sp. 1(2) 50 800-1000

Rattle Balantidium coli 1(2) 50 600-800

Bengal Fox Balantidium coli 2(2) 100 600-800

Fishing Cat Nil 0(2) 0 -

Balantidium coli 2(4) 50 600-800

Leopard
Spirometra sp. 4(4) 100 4800-6200

Indian-crested Porcupine Nil 0(2) 0 -

Guinea Pig Nil 0(2) 0 -

Trichuris sp. 2(2) 100 300-400

Rhesus Monkey
Coccidia 1(2) 50 600-800

Pig-tailed Macaque Trichuris sp. 1(2) 50 300-400

Balantidium coli 1(2) 50 300-400

Hanuman Langur
Capillaria sp. 1(2) 50 300-400

Trichuris sp. 2(2) 100 600-800

Hamadryas Baboon
Balantidium coli 1(2) 50 300-400

Balantidium coli 2(2) 100 300-400

Rabbit Hook worm 1(2) 50 400

Coccidia 1(2) 50 600-800

Vervet Monkey Nil 0(2) 0 -

Bingturong Nil 0(2) 0 -

Trichostrongylus sp. 1(4) 50 500

Olive Baboon
Balantidium coli 1(4) 50 600-800

Balantidium coli 1(2) 50 800-1000

Hoolock Gibbon
Trichuris sp. 1(2) 50 400

Trichuris sp. 1(2) 50 400

Golden Mangabey Balantidium coli 1(2) 50 800-1000

Unidentified strongyles 1(2) 50 300

Stomach worm 2(2) 100 300

Large Indian Civet
Balantidium coli 1(2) 50 800-1000

Balantidium coli 2(2) 100 600-800

Torior Dog
Physaloptera sp. 1(2) 50 300

5576 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5574–5579

Gastrointestinal parasites in Dhaka Zoo Raja et al.

coli and Spirometra sp.), Rhesus Macaque (Trichuris sp. Table 2. Prevalence of parasites in different animals at Dhaka zoo
and Coccidia sp.), Pig-tailed Macaque (Balantidium coli Types of No. of Prevalence
Name of the parasites
and Trichuris sp.), Hamadryas Baboon (Balantidium coli parasites positive case (%)
and Trichuris sp.), Golden Mangabey (Balantidium coli, Balantidium coli 24 25.53
Protozoa
unidentified strongyles and Trichuris sp.), Large Indian Coccidia 02 2.12
Civet (Balantidium coli and unidentified strongyles), Toxocara cati 12 12.77
Torior Dog (Balantidium coli and Physaloptera sp.), Capillaria sp. 01 1.06
Rabbit (Balantidium coli and hook worm), Hanuman Trichuris sp. 07 7.45
Langur( Balantidium coli and Capillaria sp.) (Table 3).
Toxascaris leonina 09 9.57
Sizes of eggs and cysts of different gastrointestinal Nematode
Hook worm 04 4.26
parasites in different animals: The sizes (length by
Unidentified Strongyles 03 3.19
width) in µm of eggs, cysts and oocysts of different
Trichostrongylus sp. 01 1.06
gastrointestinal parasites were measured (Table 4,
Images 1–6). Physaloptera sp. 01 1.06

Cestode Spirometra sp. 10 10.64

Discussion
In this study we found 78.72% of the faceal samples
infected with parasites. This result is similar to the Table 3. Prevalence of mixed infection

earlier report of Corden et al. (2008) and Opara et al. Name of the parasites No. of case
Prevalence
(%)
(2010) who revealed 72.5% respectively 76.6% positive
Balantidium coli and Toxocara cati 05 5.31
cases. Higher prevalences were found by Mutani et
Balantidium coli and Unidentified
al. (2003), who reported 88.7% postitive samples from strongyles
01 1.06

Barbados. In contrary much lower prevalences were Balantidium coli and hook worm 02 2.12
found by Stuart et al. (1990), who only found 48% of Balantidium coli and Spirometra sp. 02 2.12
the animals were infected with parasites in Costa Rica. Balantidium coli and Trichuris sp. 02 2.12
However, both these studies are conducted on primates,
Balantidium coli and Capillaria sp. 01 1.06
do not include carnivores and small mammals and are
Toxascaris leonina and Spirometra sp. 01 1.06
furthermore conducted on free ranging animals and not
Balantidium coli and Physaloptera sp. 01 1.06
in a captive setting. But they illustrate that both higher
Trichuris sp. and Coccidia 01 1.06
and lower prevalences of parasite infections can be
Balantidium coli and unidentified
found even in free ranging animals. strongyles and Trichuris sp.
01 1.06
The prevalence of helminthic infection (52.06%) was
found higher than protozoan infection (27.66%). In this
the present study differs from the report of Parasani Table 4. The size of ova/cysts/oocysts of different parasites
et al. (2001) who revealed 68.8% animals positive for Name of the parasites Size of ova/cyst/larvae/oocyst(µm)
helminthic infections and 18.8% for protozoan infections Toxascaris leonina 72.5 x 43.5
in Rajkot Municipal Corporation Zoo. Both studies were Spirometra sp 58 x 29
conducted in a captive setting and included a variety of
Toxocara cati 72.5 x 72.5,
animal groups. The difference in findings demonstrates
Unidentified strongyles 72.5 x 43.5
that even under a similar setup, parasite prevalences
Trichostrongylus sp., 72.5x43.5
might still be very different due to different geographic
Physaloptera sp. 45x30
conditions, management practices, animal food sources
and other influences. In non human primates, the Trichuris sp. 58 x 29

isolated parasities included Trichuris sp., Balantidium coli Coccidian oocysts 43.5 x 29

and unidentified strongyles, with Balantidium coli having
the highest prevalence. Trichuris sp. has often been
recorded in primates (Mutani et al. 2003; Kimberley et
al. 2004; Corden et al. 2008; Lim et al. 2008; Singh et al.
2009) and Balantidium coli has been previously reported
by Leveck et al. (2007).
In this study, Royal Bengal Tigers were found to be
Balantidium coli 43.5 x 29
infected with Toxocara cati. The occurrence of T. cati in
this species has already been reported by Fagiolini et al.
(2010) and Gonzalez et al. (2007). Lion were infected
with Toxascaris leonina, Spirometra sp. and Balantidium

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5574–5579 5577

Gastrointestinal parasites in Dhaka Zoo Raja et al.

Image 1. Egg of Toxascaris leonina of Lion Image 2. Egg of Toxocara cati of Tiger (720X) Image 3. Egg of Trichuris sp. of Rhesus
(720X) Macaque (720X)

Image 4. Cyst of Balantidium coli of Image 5. Egg of Capillaria sp. of Common Image 6. Egg of Spirometra sp. of Indian
Hamadryads Baboon (720X) Langur(720X) Lion (720X)

coli. This supports the findings of Fagiolini et al. (2010),
who revealed Toxascaris leonina in lion. Spirometra
is on the other hand a new report for captive lions in
Bangladesh as to date this parasite has only been
reported in wild lions, where it was found to be the
most common parasite (Barutzki et al. 1985, Ghoshal et
al. 1988, Tang et al. 1988, Muller-Graf 1995). However
comparatively lower prevalence was recorded as 7.1%
by Lim et al. (2008). The occurrence of Spirometra in
this study might be due to the feeding management and
the availability of intermediate hosts in the environment.
Two intermediate hosts are required to complete the
life cycle of Spirometra sp.; crustaceans are the first
intermediate host and snakes, birds and mammals are
second intermediate host (Soulsby 1982). The presence
of Spirometra sp. in the lion of Dhaka Zoo might be
due to ingestion of contaminated beef with infective
secondary stage of larvae.
In the present study, mixed infection was observed
in 12 species. Mixed parasite infections in zoo animals
was recorded by Kanungo et al. (2010) and Mutani et al.
(2003) found that 58.5% of all monkeys examined had
at least three parasite species and only 34.0% had one
and two parasite species. This suggests that there is a
fairly high rate of transmission of the parasites observed
between individuals either because of the monkeys’
gregarious nature or because of suitable environmental
conditions (Mutani et al. 2003). It has to be kept in mind
however, that Mutani’s study was conducted in free
ranging monkeys and hence could be expected to be
even lower than in a captive setting.
The finding of mixed infection in this study therefore
is not surprising and might be due to the presence of
all animals of different ages in the same cages, feeding
management, insufficient cleaning and improper
disposal of faeces.
Conclusion
Gastrointestinal parasites were prevalent in animals
of this zoo. Better management practices and adequate
prophylactic measures are important strategies to
control gastrointestinal parasites. Further, long term
epidemiological studies of parasitic infections are
essential to understand infection routes and to prevent
the possible recurrence of infections in captive animals
at the zoo. Such studies will provide a clear concept

5578 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5574–5579

Gastrointestinal parasites in Dhaka Zoo Raja et al.
regarding parasitic infection of the captive animals
at Dhaka Zoo and will help to develop appropriate
preventive and therapeutic measures against parasitic
infection in zoo animals.
References
Barutzki, D., M.A. Hasslinger, K. Schmid & Wiesner (1985).
Situationsanalysez um Endoparasitenbefallbe i Zootieren. T ierarzt-
liche Umschau 40: 953–961.
Cable, M.R. (1965). An illustrated Laboratory Manual of Parasitology.
5th Edition. Burgress Publishing Company Minneapolis, USA, 5–6pp.
Chaunha, P.P.S., B. Bhatia, G.S. Arora, R.D. Agrawal & S.S. Ahluwalia
(1973). A preliminary survey of parasitic infections among mammals
and birds at Lucknow and Delhi Zoo. Indian Journal of Animal
Science 43(2): 163–168.
Corden, P., G.H. Prados, A. Romero, M.S. Sanchez, M. Pontes, A.
Osuna & M.J. Rosales (2008). Intestinal parasitism in the animals
of the zoological garden ‘‘Pen˜a Escrita’’ (Almun˜ecar, Spain).
Veterinary Parasitology 156: 302–309.
Fagiolini, M., P.L. Riccardo, L. Piero, C. Paolo, M. Riccardo, C. Claudia,
F. Riccardo & P. Stefania (2010). Gastrointestinal parasites in
mammals of two Italian zoological gardens. Journal of Zoo and
Wildlife Medicine 41(4): 662–670.
Ghoshal, S.B., U.K. Garg, K.S. Misaraulia & P.C. Jain (1988). Helminth
parasites in zoo animals of Kamla Nehru Park, Indore (MP). Livestock
Adviser 13: 34–36.
Gonzalez, P., E. Carbonell, V. Urios & V.V. Rozhnov (2007). Coprology
of Panthera tigris altaica and Felis bengalensis euptilurus from the
Russian Far East. The Journal of Parasitology 93(4): 948–950.
Hendrix, M. & Robinson (2006). Diagnostic Parasitology for Veterinary
Technicians - 3rd Edition. Mosby Elsevier, St. Louis, Missouri, 103:
18–50.
Kanungo, S., A. Das, G.M. Das & Shakif-ul-Azam (2010). Prevalence
of gastro-intestinal helminthiasis in captive deer of Bangladesh.
Wayamba Journal of Animal Science 2: 42–45.
Kimberley, A.P., E.H. Meghan, W.G. Brian & Y. Mirtha (2004). Survey
of the gastrointestinal parasites of the primate community at
Tambopata National Reserve, Peru. Journal of Zoology 264: 149–
151.
Kumar, A., L.D. Singla, G.S. Singla, Aulakh & J. Singh (2005).
Management of piperazine resistance toxocariosis with ivermectin
in lion (Panthera leo). Journal of Parasitic Diseases 29(2): 156–160
Leveck, B., P.G.T. Dorny, F. Vercammen & J. Vereronysse (2007).
Gastrointestinal protozoa in non- human primates of four zoological
gardens in Belgium. Veterinary Parasitology 148: 236–246.
Lim, Y.A.L., R. Ngui, J. Shukri, M. Rohela & N.H.R. Mat (2008).
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5574–5579
Intestinal parasites in various animals at a zoo in Malaysia. Veterinary
Parasitology 157: 154–159.
Muller-Graf, C.D. (1995). A coprological survey of intestinal parasites
of wild lions (Panthera leo) in the Serengeti and the Ngorongoro
Crater. The Journal of Parasitology 81(5): 812–814.
Muoria, P.K., P. Muruthi, D. Rubenstein, N.O. Oguge & E. Munene
(2005). Cross-sectional survey of gastro-intestinal parasites of
Grevy’s Zebras in southern Samburu, Kenya. African Journal of
Ecology 43: 392–395.
Mutani, A., R. Kamara & B. Gabriel (2003). A preliminary investigation
on the gastrointestinal helminths of the Barbados Green Monkey,
Cercopithecus aethiops sabaeus. Journal of the Institute of Tropical
Medicine of São Paulo 45(4): 193–195.
Opara, M.N., C.T. Osuji & J.A. Opara (2010). Gastrointestinal
parasitism in captive animals at the zoological garden, Nekede
Owerri, southeast Nigeria. Report and Opinion 2(5): 21–28.
Parasani, H.R., R.R. Momin, M.G. Maradin & S. Veer (2001). A survey
of gastrointestinal parasites of captive animals at Rajkot Munipical
Corporation Zoo, Rajkot, Gujarat. Zoo’s Print Journal 16(10): 604–
606; http://dx.doi.org/10.11609/JoTT.ZPJ.16.10.604-6
Rao, A.T. & L.N. Acharjyo (1984). Diagnosis and classification of
common hoofed wild life in North America. Mid American Agriculture
Research in Veron, Wl 53593. www.midamericaagresearch.net /
document/ wildlife%20monograph.
Singh, P., L.D. Singla, M.P. Gupta, S. Sharma, & D.R. Sharma (2009).
Epidemiology and chemotherapy of parasitic infections in wild
omnivores in the Mechendra Choudhury Zoological park, Chhat
Bir, Punjab. Journal of Threatened Texa 1(1): 62–64; http://dx.doi.
org/10.11609/JoTT.o1767a.62-4
Singh, P., M.P. Gupta, L.D. Singla, N. Singh, & D.R. Sharma (2006).
Prevalence and chemotherapy of gastrointestinal helminth infections
in wild omnivores in the Mechendra Choudhury Zoological park,
Chhat Bir, Punjab. Journal of Veterinary Parasitology 20: 17–24.
Soulsby, E.J.L. (1982). Helminths, Arthopods and Protozoa of
Domesticated Animals - 7th Edition. Bailliere and Tindal, London,
766–771pp.
Stuart, M.D., L.L. Greenspan, K.E. Glander & M.R. Clark (1990). A
coprological survey of parasites of wild mantled Mowling Monkeys
(Alouatta paplliata palliate). Journal of Wildlife Disease 26: 547–
549.
Tang, L.Z., J.L. Jin & K. Tan (1988). Investigation of helminths in
carnivorous animals in Lanzhou Wuquan Zoo. Chinese Journal of
Veterinary Science and Technology 12: 20–21.
Varadharajan, A. & C. Pythal (1999). A preliminary investigation
on the parasites of wild animals at the zoological garden,
Thiruvananthaparam Kerala. Zoos Print Journal 14(12): 159–164;
http://dx.doi.org/10.11609/JoTT.ZPJ.14.12.159-64
Zasityte, R. & T. Grikienciene (2002). Some data in endoparasites of
common mole in Lithnani. Act Zoological Lituanica 4(12): 403
Threatened Taxa
5579
 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5580–5582
Note

Beddome’s Coralsnake Rediscovery of Beddome’s Coralsnake

Calliophis beddomei Smith, 1943,
is a front-fanged venomous
ISSN snake endemic to the hills of
Online 0974–7907 southern India—the Eastern and
Print 0974–7893
the Western Ghats (Smith 1943;
OPEN ACCESS Whitaker & Captain 2004; Castoe
et al. 2007). This species was
originally described based on two specimens - the
holotype: BMNH 1946.1.17.99 (formerly 74.4.29.49)
in the Natural History Museum, London collected by
Lt. Col. Richard Henry Beddome (1830–1911) from
Shevaroy Hills at 1219m, a disjunct isolated massif
in the southern Eastern Ghats, and the paratype:
ZSIC 13559 in the Zoological Survey of India, Kolkata,
from Koppa, in the central Western Ghats. Three
more non-types are known from Shevaroys and
Mudumalai, Nilgiris, all collected by Beddome and
currently at the California Academy of Sciences
Herpetology Museum, USA (http:// www.calcademy.
org accessed on 16 November 2013 CAS 17262, 17264
and 17266). This species was listed as Data Deficient
in the latest published IUCN conservation status
assessment of Indian reptiles (Srinivasulu et al. 2013).
Although formally named as a new species only in
1943, this species was collected in the 19th century
by Col. Beddome. Since Beddome’s days, this species
has not been found (Wall 1919, Daniels & Ishwar
1994; Ganesh et al. 2013). In this note, a recently
rediscovered topotypic specimen is illustrated and
described to enhance our understanding of the
species’ diagnosis and intraspecific variation.
Calliophis beddomei Smith, 1943 from the
type locality
S.R. Ganesh 1 & Eric Ramanujam 2
1
Chennai Snake Park, Rajbhavan Post, Chennai, Tamil Nadu 600022, India
2
Pitchandikulam Bioresource Centre / Forest Consultants,
Auroville, Tamil Nadu, India
1
snakeranglerr@gmail.com (corresponding author),
2
ericramanujamowl@yahoo.com
Calliophis beddomei Smith, 1943
Material examined: CSPT/S-82 [Chennai Snake Park
Trust], from Yercaud (11047.15’N & 78011.35’E; 1305m
elevation), Shevaroy Hills, Salem District, Tamil Nadu
State, India (Image 1).
Description
Measurements in mm: head length 9.95; head width
6.85; head depth 4.75; eye diameter (horizontal) 1.05;
eye to snout distance 3.75; nostril to snout distance
1.40; eye to nostril distance 2.10; interorbital distance
4.10; internarial distance 3.45; eye to lip distance 1.35;
body width 8.90; tail width at the base 5.40; snout to
vent length 520; tail length 65.
Scalation: rostral barely visible from above, higher
than broad, subequal to internasal; internasals trapezoid,
narrow anteriorly, broader posteriorly; prefrontals
larger than internasals, frontal and supraoculars, but
smaller than parietals; parietals, large, lung shaped;
supralabials 7/7, 3rd in contact with prefrontal; 3rd and 4th
entering orbit, 5th touching postocular; temporals 1/1,
much larger, in contact with supralabial and parietal;
infralabials much elongate and narrow, 6/7; mental

DOI: http://dx.doi.org/10.11609/JoTT.o3639.5580-2 | ZooBank: urn:lsid:zoobank.org:pub:FDF57987-1DCC-4188-AEE3-0F54D345FB8A

Editor: Eric Smith, University of Texas, Arlington, USA. Date of publication: 26 March 2014 (online & print)

Manuscript details: Ms # o3639 | Received 24 May 2013 | Final received 08 March 2014 | Finally accepted 14 March 2014

Citation: Ganesh, S.R. & E. Ramanujam (2014). Rediscovery of Beddome’s Coralsnake Calliophis beddomei Smith, 1943 from the type locality. Journal of Threatened
Taxa 6(3): 5580–5582; http://dx.doi.org/10.11609/JoTT.o3639.5580-2

Copyright: © Ganesh & Ramanujam 2014. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium, repro-
duction and distribution by providing adequate credit to the authors and the source of publication.

Funding: None.

Competing Interest: The authors declare no competing interests.

Acknowledgements: We thank our respective organizations for supporting our research activities. SRG thanks Drs. Colin MacCarthy and Gernot Vogel for photo-
graph of the holotype and S.R. Chandramouli for photograph of the paratype.

5580
Rediscovery of Beddome’s Coralsnake Ganesh & Ramanujam

b c

Image 1. (a) Calliophis beddomei non type CSPT/S-82; insets showing closeup of lateral view of head, midbody
and ventral view of tail; (b) holotype BMNH 1946.1.17.99 (Photo: ColinMcCarthy); (c) paratype ZSIC 13559 (Photo:
S.R. Chandramouli).

larger than infralabial, triangular; genials evident,
anterior and posterior pairs subequal; dorsal scale row
formula 13-13-13 (at one head length after neck, middle
of body, and at one head length anterior to anal shield,
respectively); scales smooth, without any apical pits;
ventral scales 212, not strongly angulate laterally; anal
scales 2; subcaudal scales 34 pairs + terminal scale tip.
Colouration in formalin: dorsum greyish sooty black,
with 76 pairs of darker, jet black spots, each ca. 3mm
diameter; along scale rows 2, 3, 4 and 10, 11, 12; a dark
black broken vertebral stripe on scale row 7; narrower
elongated spots, 3 pairs on tail, across rows 1-2 and 5-6;
venter anteriorly yellowish-white with light rosy tinge;
venter scarlet red from the first 1/5th of the body till

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5580–5582 5581

Rediscovery of Beddome’s Coralsnake Ganesh & Ramanujam
the anal scale; subcaudals whitish medially flanked by
scarlet red on both the sides.
Comparisons: Calliophis beddomei can be diagnosed
from sympatric congeners by the following combination
of characters (only opposing suite of character states
listed)—from C. bibroni (Jan, 1858): no preocular; one
postocular; body with distinct alternate red and black
bands allover except in very old / large individuals;
C. melanurus (Shaw, 1802): six supralabials, dorsum
yellowish-brown; venter orange; subcaudals bluish; C.
nigrescens Günther, 1862 complex: preocular in contact
with nasal; ventrals 234–251, subcaudals 32–44; body
dorsally with—five black stripes on a reddish-brown
background (C. n. pentalineatus Beddome, 1871), with
broken stripes or a series of black spots on a nacreous
purple body that are not distinct (C. n. concinnus
Beddome, 1863), with sooty black body and feeble black
stripes (C. n. khandallensis Wall, 1913); C. castoe Smith,
Ogale, Deepak & Giri, 2012: head width distinctly larger
than body width; unpatterned rich brown dorsum;
a distinct orange-yellow collar; subcaudals reddish-
orange; ventrals 240–254; subcaudals 45–53 pairs.
In the original description, C. beddomei was
mentioned as “whitish below” (Smith 1943, also
repeated in Deepak et al. 2010). Our examination
shows that this species has a reddish ventral colour. The
whitish ventral colour mentioned by Smith (1943) might
arguably be a preservation artifact where the red might
have faded to pale white after decades of preservation.
Coral snakes are among the most speciose elapids
in South Asia and are the most poorly-known, as
evidenced by recent new descriptions, rediscoveries
and range extensions (Gowrishankar & Ganesh 2009;
Deepak et al. 2010; Smith et al. 2008, 2012). That C.
beddomei had not been sighted for over a century,
in any of its known localities, despite field surveys
suggests that it is rare. Additionally, its taxonomy had
also remained rather confused till recently. Calliophis
beddomei was previously considered as C. nigrescens,
which again is a species complex, containing allopatric
5582 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5580–5582
and morphologically diagnosable population south of
Palghat Gap, bearing the name Callophis pentalineatus
Beddome, 1871. The recently described C. castoe was
also once considered as C. nigrescens. Such situations
call for further reassessments of C. nigrecsens complex
(also see Smith et al. 2012). As for C. beddomei, more
surveys in the Western and the Eastern Ghats are
needed to better document its distribution.
References
Castoe, T.A., E.N. Smith, R.F. Brown & C.L. Parkinson (2007). Higher-
level phylogeny of Asian and American coralsnakes, their placement
within the Elapidae (Squamata: Serpentes), and the systematic
affinities of the enigmatic Asian coralsnake Hemibungarus
calligaster (Wiegmann, 1834). Zoological Journal of the Linnaean
Society of London 151: 809–831.
Deepak, V., S. Harikrishnan, K. Vasudevan, & E.N. Smith (2010).
Redescription of Bibron’s Coralsnake, Calliophis bibroni Jan
1858 with notes and new records from south of the Palghat and
Shencottah gaps of the Western Ghats, India. Hamadryad 35(1):
1–10.
Daniels, R.J.R. & N.M. Ishwar (1994). Rarity and the herpetofauna of
the southern Eastern Ghats, India. Cobra 16: 2–14.
Ganesh, S.R., S.R.Chandramouli, R. Sreekar & P. Gowrishankar
(2013). Reptiles of the central Western Ghats - a reappraisal and
revised checklist, with emphasis on the Agumbe plateau. Russian
Journal of Herpetology 20(3): 181–189.
Gowrishankar, P. & S.R. Ganesh (2009). Sighting record and range
extension of Calliophis (=Callophis) bibroni (Jan, 1858) (Reptilia:
Squamata: Serpentes: Elapidae). The Herpetological Bulletin 108:
10–13.
Smith, M.A. (1943). Fauna of British India, including Ceylon and
Burma. Vol - III Serpentes. Taylor and Francis publications, London,
583pp.
Smith, E.N., K. Manamendra-Arachchi & R. Somaweera (2008). A new
species of coralsnake of the genus Calliophis (Squamata: Elapidae)
from the Central Province of Sri Lanka. Zootaxa 1847: 19–33.
Smith, E.N., H. Ogale, V. Deepak & V.B. Giri (2012). A new species of
coralsnake of the genus Calliophis (Squamata: Elapidae) from the
west coast of peninsular India Zootaxa 3437: 51–68.
Srinivasulu, C., B. Srinivasulu, V. Deepak & A. Das (2013). Calliophis
beddomei. In: IUCN 2013. IUCN Red List of Threatened Species.
Version 2013.2. <www.iucnredlist.org>. Downloaded on 18 March
2014.
Wall, F. (1919). Notes on a collection of snakes made in the Nilgiri hills
and the adjacent Wynaad. Journal of the Bombay Natural History
Society 26: 552–584.
Whitaker, R. & A. Captain (2004). Snakes of India - The Field Guide.
Draco Books, Chengalpet, South India, 481pp.
Threatened Taxa
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5583–5584

A sight record of Rhesus Macaque Macaca
mulatta (Primates: Cercopithecidae) in
Karnataka, India
Raghunath R. Belur 1 & Sugandhi Gadadhar 2
1,2
41-A, Cunningham Apts, 5 Edward Road, Vasanthnagar, Bengaluru, Karnataka
560052, India
1
ranabelur@gmail.com (corresponding author), 2 sugandhi.g@gmail.com
India is home to eight species of macaques
(Pragatheesh 2011) with Rhesus Macaque Macaca
mulatta and Bonnet Macaque Macaca radiata being the
most common. Rhesus Macaques are the most widely
distributed macaques in India (Fooden 2000). Its status
is assessed as ‘Least Concern’ by the IUCN Red List of
Threatened Species (Timmins et al. 2008) due to its wide
distribution.
Within India, the Bonnet Macaque is predominantly
found in southern India (Kumar et al. 2011) while the
Rhesus Macaque is found in northern, central and
northeastern India as well as Central and Southeast Asia
(Kumar et al. 2011). Initial studies revealed the southern
limits of the distribution of the Rhesus Macaque to be
the Godavari River with some records of the species
from Hyderabad, 160km south of the river Godavari
(Fooden 2000). More recent studies show the southern
limits of the distribution boundary to reach the south of
river Krishna and north of the Eastern Ghats (Kumar et
al. 2011). However, there is no recorded documentation
of the Rhesus Macaque being found in the State of
Karnataka (Fooden et al. 1981; Kumara et al. 2010;
Kumar et al. 2011; Srivastava 2013).
On 02 July 2013, during a field visit to Chincholi
Wildlife Sanctuary, Gulbarga District, Karnataka, we were
Note
travelling on state highway 149 that
traverses through the Sanctuary.
This is the road from Chandapur to
Shadipur. It was around 15:50hr ISSN
and we had just passed a board with Online 0974–7907
Print 0974–7893
directions to the Mandi Basavanna
OPEN ACCESS
camp (approximately 17.449823N
& 77.518124E, Fig. 1).
We sighted a group of Rhesus Macaques on the main
road (Images 1–3). The group was very shy and left the
road as we approached it. We were able to photograph
two individuals. We could count seven adults and two
infants. We waited at the same spot for some time
(approximately 20 minutes). However, the macaques
did not come out into the open. On our return journey
one hour later, we came back to the same spot at
around 17:20hr and saw a Rhesus Macaque group on
the road. As we approached them, they walked away
into the undergrowth. We then walked up to the Mandi
Basavanna camp which was approximately 500m from
the main road. We spotted two Rhesus Macaques near
the camp site.
Chincholi Wildlife Sanctuary has been notified
recently as Karnataka’s 21st Wildlife Sanctuary. The
sanctuary comprises predominantly dry deciduous
forests.
The current sighting indicates the presence of Rhesus
Macaques in Karnataka that was previously not found
(Kumara et al. 2010; Kumar et al. 2011). There have
been reports of Rhesus Macaques in the neighboring
states of Andhra Pradesh and Maharashtra. The closest
recorded sightings of the Rhesus Macaques are from just
100km away in Hyderabad, Medak and Mahbubnagar
(Kumar et al. 2011; Srivastava 2013) in Andhra Pradesh.
Their presence at Chincholi Wildlife Sanctuary could be

DOI: http://dx.doi.org/10.11609/JoTT.o3755.5583-4 | ZooBank: urn:lsid:zoobank.org:pub:011D56AA-914C-48A3-9B25-A72867C5205D

Editor: Mewa Singh, Mysore University, Mysuru, India. Date of publication: 26 March 2014 (online & print)

Manuscript details: Ms # o3755 | Received 26 August 2013 | Final received 05 March 2014 | Finally accepted 09 March 2014

Citation: Belur, R.R. & S. Gadadhar (2014). A sight record of Rhesus Macaque Macaca mulatta (Primates: Cercopithecidae) in Karnataka, India. Journal of Threatened
Taxa 6(3): 5583–5584; http://dx.doi.org/10.11609/JoTT.o3755.5583-4

Copyright: © Belur & Gadadhar 2014. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium, reproduction
and distribution by providing adequate credit to the authors and the source of publication.

Funding: None.

Competing Interest: The authors declare no competing interests.

Acknowledgements: The authors would like to thank the Forest Department at Chincholi Wildlife Sanctuary. We would also like to thank S. Karthikeyan and H.N.
Kumara for their guidance and for reviewing the note.

5583
Rhesus Macaque in Karnataka Belur & Gadadhar
Figure 1. The sighting location (yellow pin mark) of the Rhesus Macaque at Chincholi Wildlife
Sanctuary, Gulbarga District, Karnataka.
© Rana & Sugandhi
Image 3. Rhesus Macaque on a tree at Chincholi Wildlife Sanctuary,
Karnataka
due to a natural extension of the geographical boundary
for the Rhesus Macaques (Fooden et al. 1981), or the
population could have been introduced artificially in
5584 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5583–5584
© Rana & Sugandhi
Image 1. Rhesus Macaque crossing the
road as we approached the group.
© Rana & Sugandhi
Image 2. Rhesus Macaque crossing the
road as we approached the group
these or nearby areas (Koyama & Shekar 1981; Kumar
et al. 2011).
References
Fooden, J. (2000). Systematic review of the Rhesus Macaque, Macaca
mulatta (Zimmermann, 1780). Fieldiana Zoologica 96: 1–180.
Fooden, J., A. Mahabal & S.S. Saha (1981). Redefinition of Rhesus
Macaque-Bonnet Macaque boundary in peninsular India. Journal of
the Bombay Natural History Society 78: 463–474.
Koyama, N. & P.B. Shekar (1981). Geographic distribution of the
rhesus and bonnet monkeys in westcentral India. Journal of the
Bombay Natural History Society 78: 240–255.
Kumar, R., S. Radhakrishna & A. Sinha (2011). Of Least Concern?
Range Extension by Rhesus Macaques (Macaca mulatta) Threatens
Long-Term Survival of Bonnet Macaques (M. radiata) in Peninsular
India. International Journal of Primatology 32(4): 945−959; http://
dx.doi.org/10.1007/s10764-011-9514-y
Kumara, H.N., S. Kumar & M. Singh (2010). Of how much concern are
the ‘least concern’ species? Distribution and conservation status
of Bonnet Macaques, Rhesus Macaques and Hanuman Langurs in
Karnataka, India. Primates 51: 37–42; http://dx.doi.org/10.1007/
s10329-009-0168-8
Pragatheesh, A. (2011). Effect of human feeding on the road mortality
of Rhesus Macaques on National Highway - 7 routed along Pench
Tiger Reserve, Madhya Pradesh, India. Journal of Threatened Taxa
3(4): 1656–1662; http://dx.doi.org/10.11609/JoTT.o2669.1656-62
Srivastava, A.(2013). Rhesus Macaque, pp. 134–147. In: Johnsingh,
A.J.T. & N. Manjrekar (eds.). Mammals of South Asia - Volume 1.
Universities Press (India) Pvt Ltd, Hyderabad, lvii+614pp.
Timmins, R.J., M. Richardson, A. Chhangani & L. Yongcheng (2008).
Macaca mulatta. In: IUCN 2013. IUCN Red List of Threatened
Species. Version 2013.2. <www.iucnredlist.org>. Downloaded on 01
March 2014.
Threatened Taxa
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5585–5589

Note
Further additions to the Odonata and then preserved in 70%
(Insecta) fauna of Goa, India alcohol. The collected specimens
were identified using standard
Parag Rangnekar 1 & Rohan Naik 2 field guides (Fraser 1933, 1934, ISSN
1936; Subramanian 2005). The Online 0974–7907
1
Building 4, S-3, Technopark, Chogm Road, Alto-Porvorim, Goa 403001, India Print 0974–7893
2
S-1, C-1, Sarthak Garden, Above Powermax Gym, Dhavali-Ponda, Goa 403401,
specimen are maintained with the
India corresponding author for further OPEN ACCESS
1
paragrangnekar@yahoo.com (Corresponding author),
2
rahutherebel@gmail.com investigations and will be deposited
in a recognised repository in the future
Of the species documented during the survey, 13
The first peer reviewed work on the odonate fauna for species are new records for the state. Of these, five
the State of Goa was by Prasad (1995) wherein 22 species species are endemic to the Western Ghats. A detailed,
were reported. The Fauna of Goa: State Fauna Series systematic account of the species is given below:
(Kulkarni & Talmale 2008) by Zoological Survey of India
added another 17 species to the list by Prasad, thereby Suborder: Anisoptera
increasing the tally to 39. Rangnekar et al. (2010) further Family: Aeshnidae
added 34 species to the State list. Recently, Subramanian 1. Gynacantha dravida Lieftinck, 1960
et al. (2013) described Idionyx gomantakensis, a species Material examined: 1 male, 9.v.2012, coll. Rohan Naik
new to science collected from Collem, Goa based on Distribution: Painguinim, Kapileshwari (Canacona)
samples collected by the authors. Thus, a total of 74 Comment: The species was observed along forest
species were so far known from the State. In the present paths under dense forest canopy with very little sunlight.
communication we report an additional 13 species from The species was found active during overcast conditions.
the State of Goa.
The authors surveyed varied habitats in the State Family: Gomphidae
of Goa from August 2011 to July 2012, especially forest 2. Gomphidia kodaguensis Fraser, 1923
habitats to document the odonate diversity. The Material examined: 1 male, 18.v.2012, coll. Parag
surveyed sites are listed in Table 1. Rangnekar
Individual specimens were photo-documented from Distribution: Mainapi (Sanguem), Collem and Dabhal
various angles and these images were cross-checked with (Dharbandhora)
identification manuals for identification (Images 1–13). Comments: The species is seen in flight from March
Collection and killing was avoided for species which could to June along forest streams and rivers. This record
be visually identified. For difficult species, specimens extends its distribution northwards into the northern
were collected using sweep nets, kept in paper envelopes Western Ghats.

DOI: http://dx.doi.org/10.11609/JoTT.o3641.5585-9 | ZooBank: urn:lsid:zoobank.org:pub:B7D366DA-1374-49D4-A673-B9A918FDC14F

Editor: K.A. Subramanian, Zoological Survey of India, Kolkata, India. Date of publication: 26 March 2014 (online & print)

Manuscript details: Ms # o3641 | Received 26 May 2013 | Final received 15 February 2014 | Finally accepted 29 February 2014

Citation: Rangnekar, P. & R. Naik (2014). Further additions to the Odonata (Insecta) fauna of Goa, India. Journal of Threatened Taxa 6(3): 5585–5589; http://dx.doi.
org/10.11609/JoTT.o3641.5585-9

Copyright: © Rangnekar & Naik 2014. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium, reproduction
and distribution by providing adequate credit to the authors and the source of publication.

Funding: Department of Science, Technology & Environment, Government of Goa

Competing Interest: The authors declare no competing interests.

Acknowledgements: We thank the Mineral Foundation of Goa for providing logistic and departmental support and the Department of Science & Technology,
Government of Goa for providing financial support to carry out the study. Thanks are due to the Department of Forests for issuing permission to collect specimen
throughout the state (Letter No. 2-WL-Perm/NP-2007-11-FD/5951 dt. 09-01.2012). We acknowledge the guidance provided by Dr. K.A. Subramanian throughout
the study period. Special mention of Mr. Sridhar Halali & Mandar Gaude for assistance during field visits and we also acknowledge the support of all our friends
and well-wishers.

5585
Additions to the Odonata of Goa Rangnekar & Naik

Table 1. Survey locations

Location Taluka District Habitat Location Taluka District Habitat

South South
1 Savari Sanguem Perennial hill stream 22 Raitale Salcette Lake
Goa Goa
South Hill stream with Stream with
2 Ambeghat Sanguem North
Goa cascade 23 Pernem Pernem adjoining paddy
Goa
South Fast flowing, canopy fields
3 Collem Dharbandhora
Goa laden river North
24 Madkai Ponda Lake
South Streams through Goa
4 Vichundrem Sanguem
Goa paddy fields South
25 Kaskond Dharbandhora Hill stream
South Streams through Goa
5 Jakem Sanguem
Goa paddy fields South
26 Satpal Dharbandhora Hill streams
Seasonal stagnant Goa
North
6 Pachmi Ponda water body at the South
Goa 27 Fulamol Canacona Hill stream
base of a hill Goa
North Perennial lake and South
7 Karmali Tiswadi 28 Dabhel Canacona Hill stream
Goa nearby paddy fields Goa
South South Stream with paddy
8 Shivde Dharbandhora Hill stream 29 Painguinim Canacona
Goa Goa fields
North South
9 Nirankal Ponda Slow flowing stream 30 Sonauli Dharbandhora Hill stream
Goa Goa
South South
10 Dapodem Sanguem Paddy fields 31 Mainapi Sanguem Hill stream
Goa Goa
North South
11 Mayem Bicholim Lake 32 Ponsuli Sanguem Hill stream
Goa Goa
South Fast flowing hill North
12 Dudhsagar Dharbandhora 33 Ganjem Ponda River
Goa stream Goa
South North
13 Sacorda Dharbandhora Hill stream 34 Opa Ponda River
Goa Goa
North North
14 Hivre Sattari Hill stream 35 Kodar Ponda River
Goa Goa
North North
15 Charavane Sattari Hill stream 36 Keri Ponda Hill stream
Goa Goa
South North
16 Tambdi-Surla Dharbandhora Hill stream 37 Bhironda Sattari River
Goa Goa
South South
17 Barabhoomi Dharbandhora Hill stream 38 Macazana Salcette Lake
Goa Goa
North North Stream with paddy
18 Vante Sattari River 39 Kapileshwari Ponda
Goa Goa fields
North North
19 Vaiguinim Sattari Hill stream 40 Mapusa Bardez Stagnant drains
Goa Goa
South South
20 Panshi Dharbandhora River 41 Tulshimol Canacona Pond
Goa Goa
South
21 Curtorim Salcette Lake
Goa

3. Merogomphus longistigma (Fraser, 1922)
Material examined: 1 male, 1 female, 23.ix.2011, coll.
Parag Rangnekar & Rohan Naik
Distribution: Vichundre (Sanguem)
Comments: The species was observed during the
monsoons. The species has a habit of perching on low
vegetation along streams. This record extends its
distribution northwards into the northern Western
Ghats.
4. Megalogomphus hannyngtoni (Fraser, 1923)
Material examined: None. Sighted on 18.v.2012
Distribution: Mainapi (Sanguem) streams and rivers. The species does not prefer open
Comment: The individual was identified based on
images from various angles since efforts to collect a
specimen were in vain. The species is seen in flight
from March to June along forest streams and rivers.
This record extends its distribution northwards into the
northern Western Ghats.
Family: Libellulidae
5. Onychothemis testacea (Ris, 1912)
Material examined: 1 male, 11.v.2012, coll. Parag
Rangnekar & Rohan Naik
Distribution: Sonauli (Dharbandhora)
Comments: The species was observed during the
summer season in the month of March along forest
areas like the Gomphids and keeps to shady places in the
river with overhanging vegetation, where a number of

5586 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5585–5589

Additions to the Odonata of Goa Rangnekar & Naik
individuals of both sexes can be sighted.
6. Urothemis signata (Rambur, 1842)
Material examined: None
Distribution: Karmali (Tiswadi), Mapusa (Bardez),
Curtorim (Salcette)
Comment: The individuals were identified based on
images and hence collection was not necessary. This
species prefers open tanks and lakes with reed-beds.
7. Zygonyx iris malabarica Fraser, 1926
Material examined: 1 male, 11.v.2012, coll. Parag
Rangnekar & Rohan Naik
Distribution: Doodhsagar, Collem (Dharbandhora),
Mainapi (Sanguem)
Comments: The species is seen hovering along forest
streams. Very rarely can one see an individual perched.
The species can be easily identified in flight by the
metallic colours and the characteristic yellowish spot on
the 7th abdominal segment.
Family: Macromiidae
8. Epophthalmia vittata Burmeister, 1839
Material examined: 1 male, 4.x.2011, coll. Rohan Naik
Distribution: Karmali (Tiswadi), Curtorim (Salcette),
Satpal (Dharbandhora), Collem (Sanguem)
Comments: The species is a strong flier and is seen
patrolling along the banks of large water tanks and lakes.
The species is sighted in forest habitats as well. Very
rarely can one sight an individual perched.
Suborder: Zygoptera
Family: Coenagrionidae
9. Archibasis oscillans (Selys, 1877)
Material examined: 1 male, 10.v.2012, coll. Rohan
Naik
Distribution: Paiguinim (Canacona)
Comments: The species was sighted among the reeds
around water tanks. The pale body color and the shape
of the pterostigma separate it from other genus of the
Marsh Darts such as Pseudagrion.
10. Ceriagrion rubiae Laidlaw, 1916
Material examined: 1 male, 2.ii.2012, coll. Rohan Naik
Distribution: Panshi (Ponda), Satpal (Dharbandhora)
Comments: This species was sighted in a variety of
habitats, especially near the ephemeral lateritic pools.
11. Pseudagrion rubriceps Selys, 1876
Material examined: 1 male, 1 female, 24.i.2012, coll.
Rohan Naik
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5585–5589
Distribution: Mhadei (Sattari), Ganje (Ponda), Dabhal
(Dharbandhora), Satpal (Dharbandhora), Pernem
Comments: The species was sighted along streams
and rivers mostly in groups.
Family: Platystictidae
12. Protosticta sanguinostigma Fraser, 1922
Material examined: Four males, 25.iv.2012, 9.v.2012,
11.v.2012, 28.v.2012, coll. Parag Rangnekar, Rohan Naik
& Shridhar Halali
Distribution: Collem, Dabhal (Dharbandhora),
Mainapi, Savari (Sanguem)
Comments: The species can be differentiated from
other of its genus by its blood-red pterostigma. The
species is in flight from the beginning of the monsoons
till the end of the monsoons after which the sightings
seem to decrease. This record extends its distribution
northwards into the northern Western Ghats.
Family: Protoneuridae
13. Caconeura ramburi (Fraser, 1922)
Material examined: 2 males, 28.v.2012, coll. Parag
Rangnekar
Distribution: Collem (Dharbandhora), Mainapi
(Sanguem)
Comments: The species is best sighted along small hill
streams with good forest cover. The species is sighted
during pre-monsoons and more commonly during the
monsoons.
Discussion
With the addition of 13 new records for the State, the
tally of odonate diversity stands at 87. Of these five are
endemic to the Western Ghats. The study also adds one
family Macromiidae not reported earlier from the State.
Compared to the known diversity of Odonates from
Peninsular India, which is around 200, the present species
count is surely an underestimate. We strongly believe
that sustained and co-ordinated efforts are necessary for
documenting the odonate diversity of the state. This is
possible through networking between the government
and researchers for which the department of forest can
act as the nodal agency. Further, since odonates are
indicator species, it is necessary that other than diversity,
abundance studies and long-term monitoring need to be
taken up for major water bodies in the state.
References
Fraser, F.C. (1933). The Fauna of British India including Ceylon and
Burma. Odonata Vol. I. Taylor and Francis Ltd., London, 423pp
Fraser, F.C. (1934). The Fauna of British India including Ceylon and
5587
Additions to the Odonata of Goa Rangnekar & Naik

© Parag Rangnekar

© Parag Rangnekar
Image 1. Caconeura ramburi Image 2. Ceriagrion rubiae

© Parag Rangnekar
© Parag Rangnekar

Image 3. Pseudagrion rubriceps Image 4. Protosticta sanguinostigma - Female

© Parag Rangnekar
© Parag Rangnekar

Image 5. Protosticta sanguinostigma - Male Image 6. Gynacantha dravida

Burma. Odonata Vol. II. Taylor and Francis Ltd., London, 398pp
Fraser, F.C. (1936). The Fauna of British India including Ceylon and
Burma. Odonata Vol. III. Taylor and Francis Ltd., London, 461pp
Kulkarni P.P. & S.S. Talmale (2008). Insecta: Odonata. Fauna of Goa,
State Fauna Series, Zoological Survey of India 16: 173–194
Prasad, M. (1995). On a collection of odonata from Goa. Fraseria (N.S.)
2(1/2): 7–8.
Rangnekar P., M. Borkar & O. Dharwadkar (2010). Additions to the
Odonata (Insecta) of Goa. Journal of Threatened Taxa 2(4): 805–
814; http://dx.doi.org/10.11609/JoTT.o2286.805-14
Subramanian, K.A. (2005). Dragonflies and Damselflies of Peninsular
India - A Field Guide—1st Edition. Madhav Gadgil. Published under
the Project Lifescape Series. Indian Academy of Sciences, Banglore,
118pp.

5588 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5585–5589

Additions to the Odonata of Goa Rangnekar & Naik

© Parag Rangnekar
© Parag Rangnekar
Image 7. Merogomphus longistigma Image 8. Megalogomphus hanningtonii

© Parag Rangnekar

© Parag Rangnekar
Image 9. Onycothemis testacea

Image 10. Urothemis signata

© Parag Rangnekar

© Parag Rangnekar

Image 11. Zygonix iris

Image 11. Zygonix iris

Subramanian K.A., P. Rangnekar & R. Naik (2013). Idionyx (Odonata:

Corduliidae) of the Western Ghats with a description of a new
species. Zootaxa 3652(2): 277–288.
© Parag Rangnekar

Threatened Taxa

Image 13. Gomphidia koduguensis

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5585–5589 5589

 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5590–5592
Response
Lecanidae is one of the largest
and most speciose families of Indian
Rotifera (Sharma 1996, 1998). Our
ISSN recent evaluation of Lecanidae
Online 0974–7907 diversity in India (Sharma & Sharma
Print 0974–7893
2014) highlighted various dubious
OPEN ACCESS lecanid reports in several routine
rotifer faunal surveys without any
voucher specimens to warrant any validation, while
the fuzzy descriptions of new Lecane species from
this country and the lack of deposition of their type
specimens aggravated taxonomic discrepancies. A
compilation of rotifers by Dhanapathi (2000) relying on
misidentifications and poor illustrations of the taxon
added to such anomalies. This trend has continued
unabated in a report on Lecanidae from Andhra Pradesh
by Siddiqi & Karuthapandi (2013). This communication
attempts to review the said report with emphasis on
misidentifications, nomenclature discrepancies and
validity of different species to warrant rectification of
anomalous reports and provide a list of valid species
from the state.
This validation of Lecane spp. reported by Siddiqi &
Karuthapandi (2013) from Andhra Pradesh is undertaken
as a part our ongoing work on ‘Monograph of Indian
Freshwater Rotifera’. Our comments are based on the
said published report vis-à-vis our own examination
of Lecanidae collections from different parts of India
including those from Andhra Pradesh. The present
remarks are supplemented with micro-photographs
taken with Leica DM 1000 stereomicroscope fitted with
Leica DM 295 image analyzer.
Of the different new records from Andhra Pradesh
(Siddiqi & Karuthapandi 2013, Images 1–6): Lecane
aculeata, L. haliclysta, L. furcata, L. pawlowskii, L.
pyriformis and L. ruttneri; all except L. pyriformis are
misidentifications. Lecane bidentata, described by
Dhanapathi (1976) from Andhra Pradesh without
deposited type, was categorized as species inquirenda by
DOI: http://dx.doi.org/10.11609/JoTT.o3876.5590-2
Date of publication: 26 March 2014 (online & print)
Manuscript details: Ms # o3876 | Received 03 December 2013
Citation: B.K. Sharma & Sumita Sharma (2014). Remarks on ‘A report on
Lecanidae (Rotifera: Monogononta) from Andhra Pradesh, India’: misiden-
tifications and status. Journal of Threatened Taxa 6(3): 5590–5592; http://
dx.doi.org/10.11609/JoTT.o3876.5590-2
Copyright: © Sharma & Sharma 2014. Creative Commons Attribution 3.0
Unported License. JoTT allows unrestricted use of this article in any medium,
reproduction and distribution by providing adequate credit to the authors
and the source of publication.
5590
Remarks on ‘A report on Lecanidae (Rotifera:
Monogononta) from Andhra Pradesh, India’:
misidentifications and status
B.K. Sharma 1 & Sumita Sharma 2
1,2
Freshwater Biology Laboratory, Department of Zoology, North-Eastern Hill
University, Permanent Campus, Shillong, Meghalaya 793022, India
1
probksharma@gmail.com (corresponding author), 2 sumitasharma.nehu@gmail.com
Segers (1995, 2007) and Jersabek & Leitner (2013); it has
been placed on the B-list of the “List of available names”
(Segers et al. 2012) and as such suggested for removal
from zoological nomenclature (http://89.26.108.66/
LAN_CandidatePart-Rotifera-2012-03-22.pdf). Lecane
donnerianus Dhanapathi, 1976, described from this
state, has been synonymized (Segers 1995) with L.
ungulata. The unwarranted listing of these taxa as valid
species has been continued by Siddiqi & Karuthapandi
(2013). In addition, our remarks on status of various
species are summarized in Table 1.
In light of the above remarks, we conclude 22 valid
Lecane species known from Andhra Pradesh instead of
33 and 26 species listed by Siddiqi & Karuthapandi (2013)
and Karuthapandi et al. (2013), respectively. These are:
1. Lecane arcula Harring, 1914
2. Lecane bulla (Gosse, 1851)
3. Lecane closterocerca (Schmarda, 1859)
4. Lecane curvicornis (Murray 1913)
5. Lecane eswari Dhanapathi, 1976
6. Lecane furcata (Murray, 1913)
7. Lecane hamata (Stokes, 1896)
8. Lecane hastata (Murray, 1913)
9. Lecane hornemanni (Ehrenberg, 1881)
10. Lecane inopinata Harring & Myers, 1926
11. Lecane leontina (Turner, 1892)
12. Lecane luna (O. F Muller, 1776)
13. Lecane lunaris (Ehrenberg, 1832)
14. Lecane obtusa (Murray, 1913)
15. Lecane papuana (Murray, 1913)
16. Lecane pyriformis (Daday, 1905)
17. Lecane quadridentata (Ehrenberg, 1832)
18. Lecane stenroosi (Meissner, 1908)
19. Lecane tenuiseta Harring, 1914
20. Lecane tryphema Harring & Myers, 1926
21. Lecane ungulata (Gosse, 1887)
22. Lecane unguitata (Fadeev, 1925)
Lecanidae of Andhra Pradesh is less species-rich
than that documented from several other states of India
(Sharma & Sharma 2014). This misleading generalization
is attributed to the fact that Rotifer fauna of this state
Response: Remarks on ‘A report on lecanidae...’ Sharma & Sharma

Table 1. Remarks on misidentifications and taxonomic status

Species Remarks

1 Lecane acronycha Harring & Myers, 1926
2 Lecane aculeata (Jakubski, 1912)
3 Lecane batillifer (Murray, 1913)
4 Lecane bidentata Dhanapathi, 1976
5 Lecane vasishti Sharma, 1980
6 Lecane donnerianus Dhanapathi, 1976
7 Lecane furcata (Murray, 1913)
8 Lecane haliclysta Harring & Myers, 1926
9 Lecane lauterborni (Hauer, 1924)
10 Lecane pawlowskii Wulfert, 1966
11 Lecane ohioensis (Herrick, 1885)
12 Lecane ploenensis Voigt, 1902
13 Lecane ruttneri (Hauer, 1938)
= L. curvicornis (Murray, 1913). Not a synonym of L. acanthinula (Hauer, 1938) (Figs. 1–2)
Misspelled as ‘aculeate’ in the list and it is a misidentification. Siddiqi & Karuthapandi (2013, Image 1)
referred to L. arcula Harring, 1914 (Fig. 3) which distinctly differs from L aculeata (Fig. 4) in size of its
antero-lateral spines.
Questionable record warranting validation; never reported from Andhra Pradesh by Dhanapathi (1976)
as erroneously listed by Siddiqi & Karuthapandi (2013). This interesting Australasian species is so far
observed (Fig. 5) from India only from its northeast region (Sharma & Sharma 2014)
species inquirenda (Segers 1995, 2007; Jersabek & Leitner 2013); definitely not even distantly related to
and not a synonym of L. batillifer (Murray, 1913)
Misspelled as ‘vasisthi’ - a distinct species (Sharma & Sharma 2014) so far known only from its ‘type
locality’ in West Bengal (Figs. 6–7); not a synonym L. crepida Harring, 1914 (Fig. 8) and it differs distinctly
from the same.
= L. ungulata (Gosse, 1887); not a synonym of L. donneri Chengalath & Mulamoottil, 1974
A misidentification; Siddiqi & Karuthapandi (2013, Image 5) apparently showed L. lunaris (Fig. 9) and it
differed distinctly from L. furcata (Fig. 10)
A misidentification; Siddiqi & Karuthapandi (2013, Image 5) apparently referred to L. tenuiseta Harring,
1914 (Fig. 11)
Reported by Dhanapathi (1976) from Andhra Pradesh. It is a case of misidentification (refer: Segers &
Savatenalinton 2010; Sharma & Sharma 2014)
A misidentification and misspelled as ‘Walfert’; Siddiqi & Karuthapandi (2013, Image 3) appeared to refer
to a partly contracted L. closterocerca (Fig. 12). Lecane pawlowskii - an Indian endemic (Figs. 13–15) is
known till date from Gujarat (type-locality) and West Bengal (Sharma & Sharma 2014).
A distinct species and not a synonym of L. obtusa (Murray, 1913)
Misspelled as ‘ploensis’); not a syn. of L. pideis (Harring & Myers, 1926) (apparently misspelled) which itself
not any valid species
A misidentification as Siddiqi & Karuthapandi (2013, Image 4) apparently showed L. hornemanni (Fig. 16)

14 Lecane tethis (Harring & Myers, 1926) = L. furcata (Murray, 1913); not a synonym of L. tenuiseta Harring, 1914

15 Lecane stichoclysta Segers, 1993 Never reported from Andhra Pradesh by Dhanapathi (1976) and not known till date from India

16 Lecane styrax (Harring & Myers, 1926) A distinct species, not a synonym of Lecane stichoclysta Segers, 1993

       
Figures 1–2. Lecane acanthinula (Hauer) Figure 3. Lecane arcula Figure 4. Lecane Figure 5. Lecane batillifer
Harring aculeata (Jakubski) Hauer

is yet partly explored. Of the documented species, L. References

eswari merits biogeographic interest as this erstwhile
Indian endemic is a Paleotropical species (Sharma &
Sharma 2009, 2014; Segers & Savatenalinton 2010)
Dhanapathi, M.V.S.S.S. (1976). Rotifers from Andhra Pradesh, India
- III. Family Lecanidae including two new species. Hydrobiologia
48(1): 9–16.
Dhanapathi, M.V.S.S.S. (2000). Taxonomic notes on the Rotifers from
India (from 1889–2000). Indian Association of Aquatic Biologists
(IAAB), publication No. 10. Hyderabad, 1–180pp.
Jersabek, C.D. & M.F. Leitner (2013). The Rotifer World Catalog. World

Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5590–5592 5591

Response: Remarks on ‘A report on lecanidae...’ Sharma & Sharma

       
Figures 6–7. Lecane vasishti Sharma Figure 8. Lecane crepida Figure 9. Lecane lunaris Figure 10. Lecane furcata
Harring (Ehrenberg) (Murray)

       
Figure 11. Lecane Figure 12. Lecane Figures 13–15. Lecane pawlowski Wulfert (after Figure 16. Lecane
tenuiseta Harring, 1914 closterocerca Wulfert, 1966) hornemanni (Ehrenberg)
(Schmarda)

Wide Web electronic publication <http://www.rotifera.
hausdernatur.at/> accessed on 03.12.2013.
Karuthapandi, M., D.V. Rao & X. Innocent (2013). Freshwater rotifers
of Andhra Pradesh- checklist. International Journal for Life Sciences
and Educational Research 1(1): 1–13
Segers, H. (1995). Rotifera 2: The Lecanidae (Monogononta). In:
Dumont H.J. & T. Nogrady (eds.). Guides to Identification of
Microinvertebrates of the Continental Waters of the World. SPB
Academic Publishing bv. Amsterdam, Netherlands, 226pp.
Segers, H. (2007). Annotated checklist of the rotifers (Phylum Rotifera),
with notes on nomenclature, taxonomy and distribution. Zootaxa
1564: 1–104.
Segers, H. & S. Savatenalinton (2010). A critical re-revaluation of the
Lecanidae (Rotifera: Monogononta) of Thailand, with description of a
new species. International Review of Hydrobiology 95: 343–351.
Segers, H., W.H. de Smet, C. Fischer, D. Fontaneto, E. Michaloudi, R. L.
Wallace & C.D. Jersabek (2012). Towards a list of available names in
zoology, partim Phylum Rotifera. Zootaxa 3179: 61–68.
Sharma, B.K. (1996). Biodiversity of freshwater rotifera India - a status
report. Proceedings of the Zoological Society 49(2): 73–85.
Sharma, B.K. (1998). Faunal diversity in India: Rotifera, pp. 57–70. In:
Alfred, J.R.B., A.K. Das & A.K. Sanyal (eds.). Faunal Diversity of India.
ENVIS Centre, Zoological Survey of India, Calcutta.
Sharma, B.K. & S. Sharma (2009). Biodiversity and distribution of
freshwater rotifers (Rotifera, Eurotatoria) of Tamil Nadu. Records of
the Zoological Survey of India 109(3): 41–60.
Sharma, B.K. & S. Sharma (2014). Northeast India: an important
region with a rich biodiversity of Rotifera. International Review of
Hydrobiology 99: 20–37; http://dx.doi.org/10.1002/iroh.201301701
Siddiqi, S.Z. & M. Karuthapandi (2013). A report on Lecanidae
(Rotifera: Monogononta) from Andhra Pradesh, India, including
six new distribution records with notes on their contemporary
taxonomic nomenclature. Journal of Threatened Taxa 5(11): 4556–
4561; http://dx.doi.org/10.11609/JoTT.o3095.4556-61
Threatened Taxa

5592 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 March 2014 | 6(3): 5590–5592

K.S. Anoop Das, Mampad College, Malappuram District, Kerala, India
K.S. Gopi Sundar, International Crane Foundation, Baraboo, USA
K.S. Negi, NBPGR, Nainital District, Uttarakhand, India
K.V. Dheeraj, Karnatak University, Dharwad, Karnataka, India
K.V. Gururaja, Indian Institute of Science, Bengaluru, Karanataka, India
Kailash Chandra, Zoological Survey of India, Jabalpur, Madhya Pradesh, India
Kalpana Pai, University of Pune, Pune, India
Karan Bahadur Shah, Natural History Museum, Tribhuvan University, India
Kareen Schnabel, NIWA, Wellington, New Zealand
Karin Schwartz, George Mason University, Fairfax, Virginia.
Kashinath Bhattacharya, Visva-Bharati University, West Bengal, India
Kevin Smith, IUCN, Cambridge, UK
Klaus Ruetzler, Smithsonian Institution, Washington, DC
Kristin Leus, Copenhagen Zoo, Annuntiatenstraat, Merksem, Belgium
Krushnamegh Kunte, Harvard University, Cambridge, USA
Kumaran Sathasivam, Marine Mammal Conservation Network of India, India
L.J. Mendis Wickramasinghe, Herpetological Foundation of Sri Lanka, Sri Lanka
Lala A.K. Singh, Bhubaneswar, Orissa, India
Laxman Prasad Poudyal, Shivapuri Nagarjun National Park, Nepal
Lukas Rüber, Department of Vertebrates, Natural History Museum, Switzerland
M K Janarthanam, Goa University, Goa, India
M. Afzal Khan, Department of Zoology, Aligarh Muslim University, Aligarh, India
M.K. Vasudeva Rao, Shiv Ranjani Housing Society, Pune, Maharashtra, India
Madhava Meegaskumbura, University of Peradeniya, Sri Lanka
Mandar Datar, Agharkar Research Institute, Pune, Maharashtra, India
Mandar S. Paingankar, IISER, Pune, Maharashtra, India
Manju Siliwal, WILD, Coimbatore, Tamil Nadu, India
Martin B.D. Stiewe, The Natural History Museum, UK
Meena Venkataraman, Mumbai, India
Merlin Franco, Curtin University, Malaysia
Mewa Singh, Mysore University, Mysore, India
Mohammad Hayat, Aligarh Muslim University, Aligarh, India
Monsoon Jyoti Gogoi, Bokakhat, Assam, India
Muhamed Jafer Palot, Zoological Survey of India, Kozhikode, Kerala, India
N.A. Aravind Madhyastha, ATREE, Jakkur PO, Bangalore, India
N.P. Balakrishnan, Ret. Joint Director, BSI, Coimbatore, India
Nancy van der Poorten, Toronto, Canada
Neelesh Dahanukar, IISER, Pune, Maharashtra, India
Nishith Dharaiya, HNG University, Patan, Gujarat, India
Nita Shah, Wildlife Institute of India, Dehra Dun, India
P. Lakshminarasimhan, Botanical Survey of India, Howrah, India
P. Venkateswara Prasanna, Botanical Survey of India, Andhra Pradesh, India
P. Venu, Botanical Survey of India, Howrah, India
P.M. Sureshan, Zoological Survey of India, Kozhikode, Kerala, India
P.O. Nameer, Kerala Agricultural University, Thrissur, Kerala, India
P.S. Easa, Kerala Forest Research Institute, Peechi, India
Pankaj Kumar, Kadoorie Farm and Botanic Garden Corporation, Hong Kong
Partha Pratim Bhattacharjee, Tripura University, Suryamaninagar, India
Payal Molur, Coimbatore, Tamil Nadu, India
Peter Smetacek, Butterfly Research Centre, Bhimtal, India
Priya Davidar, Pondicherry University, Kalapet, Puducherry, India
A.J. Solomon Raju, Andhra University, Visakhapatnam, India
N.D. Paria, Department of Botany, University of Calcutta, West Bengal, India
Purnendu Roy, Gabriel’s Wharf, London, UK
R. Mohanraju, Department of Ocean Studies & Marine Biology, Port Blair, India
R. Ramanibai, Guindy Campus, Chennai, Tamil Nadu, India
R. Suresh Kumar, Wildlife Institute of India, Dehra Dun, India
R. Varatharajan, Manipur University, Imphal, Manipur, India
R.K. Verma, Tropical Forest Research Institute, Jabalpur, India
R.M. Sharma, (Retd.) Scientist, Zoological Survey of India, Pune, India
Journal of Threatened Taxa is indexed/abstracted
in Bibliography of Systematic Mycology, Biological
Abstracts, BIOSIS Previews, CAB Abstracts, EBSCO,
Google Scholar, Index Copernicus, Index Fungorum,
JournalSeek, National Academy of Agricultural Sci-
ences, NewJour, OCLC WorldCat, Stanford Univer-
sity Libraries, Virtual Library of Biology, Zoological
Records.
NAAS rating (India) 4.72
R. Ramasubbu, Gandhigram Rural University, Dindigul, Tamil Nadu, India
Ragnar Kinzelbach, University of Rostock, Rostock, Germany
Rajah Jayapal, SACON, Coimbatore, Tamil Nadu, India
Rajan Amin, The Zoological Society of London, London, England
Rajeev Raghavan, St. Albert’s College, Kochi, Kerala, India
Rajiv S. Kalsi, M.L.N. College, Yamuna Nagar, Haryana, India
Raju Vyas, Vishwamitri River Project, Vadodara, India
Rauf Ali, Foundation for Ecological Research, Vazhakulam, Pondicherry, India
Renee M. Borges, Indian Institute of Science, Bengaluru, Karnataka, India
Reuven Yosef, International Birding & Research Centre, Eilat, Israel
Richard Corlett, Xishuangbanna Tropical Botanical Garden, Chinese Academy of
Sciences,Menglun, Mengla, Yunnan, China
Richard Gallon, llandudno, North Wales, LL30 1UP
Richard Kiprono Mibey, Vice Chancellor, Moi University, Eldoret, Kenya
Robert D Sluka, Chiltern Gateway Project, A Rocha UK, 18-19 Avenue Rd,
Southall, Middlesex UB1 3BL, United Kingdom
Rohan Pethiyagoda, Australian Museum, Australia
Rory Dow, National Museum of natural History Naturalis, The Netherlands
S. Ajmal Khan, Annamalai University, Parangipettai, India
S. Arularasan, Annamalai University, Parangipettai, India
S. Bhupathy, SACON, Coimbatore, Tamil Nadu, India
S. Chellappa, Universidade Federal do Rio Grande do Norte, Natal, RN, Brazil
S. Jayakumar, Pondicherry University, Puducherry, India
S.K. Srivastava, Botanical Survey of India, Dehradun, Uttarakhand, India
S.R. Ganesh, Chennai Snake Park, Chennai, Tamil Nadu, India
Sanjay Molur, WILD, Coimbatore, Tamil Nadu, India
Sanjay Sondhi, TITLI TRUST, Kalpavriksh, Dehradun, India
Seema Bhat, Independent Consultant, New Delhi, India
Sekar Raju, Xi’an Jiaotong-Liverpool University, Suzhou, China
Sery Ernest Gibedele Bi, Université de Cocody Abidjan, Côte d’Ivoire
Shomita Mukherjee, SACON, Coimbatore, Tamil Nadu, India
Shonil Bhagwat, Open University and University of Oxford, UK
Shrikant Jadhav, Zoological Survey of India, Akurdi, Pune, Maharashtra, India
Siby Philip, Nirmalagiri College, Nirmalagiri, Kannur, Kerala, India
Stephen D. Nash, Scientific Illustrator, State University of New York, NY, USA
Sushil K. Dutta, Indian Institute of Science, Bengaluru, Karnataka, India
Swapna Prabhu, Bombay Natural History Society, Mumbai, Maharashtra, India
Late Dr. T.C. Narendran, (Retired) Professor, University of Calicut, Kerala, India
Tadashi Kawai, Wakkanai Fisheries Research Institute, Hokkaido, Japan
Topiltzin Contreras MacBeath, Universidad Autónoma del estado de Morelos,
México
Tulsi Subedi, Kathmandu, Nepal
Ulrike Streicher, Wildlife Veterinarian, Danang, Vietnam
Unmesh Katwate, Bombay Natural History Society, Mumbai, Maharashtra, India
Utpal Smart, University of Texas at Arlington, TX 76019-0498, USA
V. Gokula, National College, Tiruchirappalli, Tamil Nadu, India
V. Irudayaraj, St. Xavier’s College, Palayamkottai, Tamil Nadu, India
V S. Ramachandran, Bharathiar University, Coimbatore, Tamil Nadu, India
V. Santharam, Rishi Valley Education Centre, Chittoor Dt., Andhra Pradesh, India
V.B. Hosagoudar, TBGRI, Palode, Kerala, India
V.C. Soni, Saurashtra University, Maharashtra, India
Vatsavaya S. Raju, Kakatiay University, Warangal, Andhra Pradesh, India
Vibhu Prakash, Bombay Natural History Society, Mumbai, Maharashtra, India
Victor Gapud, University of the Philippines Los Banos, Laguna, Philippines
W. Vishwanath, Manipur University, Imphal, India
English Editors
Mrs. Mira Bhojwani, Pune, India
Dr. Fred Pluthero, Toronto, Canada
Mr. P. Ilangovan, Chennai, India
Print copies of the Journal are available at cost.
Write to the Managing Editor, JoTT, c/o Wildlife
Information Liaison Development,
96, Kumudham Nagar, Vilankurichi Road,
Coimbatore, Tamil Nadu 641035, India
threatenedtaxa@gmail.com
 OPEN ACCESS All articles published in the Journal of Threatened Taxa are registered under Cre-
ative Commons Attribution 3.0 Unported License unless otherwise mentioned. JoTT
allows unrestricted use of articles in any medium, reproduction and distribution by
providing adequate credit to the authors and the source of publication.

ISSN: 0974-7907 (Online), 0974-7893 (Print)

March 2014 | Vol. 6 | No. 3 | Pages: 5513–5592
Date of Publication: 26 March 2014 (Online & Print)
DOI: 10.11609/JoTT.26mar14.5513-5592

Articles New records of opisthobranchs from Lakshadweep,

Population genetics implications for the conservation
of the Philippine Crocodile Crocodylus mindorensis
Schmidt, 1935 (Crocodylia: Crocodylidae)
-- Ma. Rheyda P. Hinlo, John A.G. Tabora, Carolyn
A. Bailey, Steve Trewick, Glenn Rebong, Merlijn van
Weerd, Cayetano C. Pomares, Shannon E. Engberg,
Rick A. Brenneman & Edward E. Louis, Jr. Pp. 5513–
5533
On the status of Snow Leopard Panthera uncia
(Schreber, 1775) in Annapurna, Nepal
-- Som B. Ale, Bikram Shrestha & Rodney Jackson,
Pp. 5534–5543
India (Mollusca: Heterobranchia)
-- Deepak Apte & Vishal Bhave, Pp. 5562–5568
On the occurrence of the Fishing Cat Prionailurus
viverrinus Bennet, 1833 (Carnivora: Felidae) in coastal
Kerala, India
-- Ranjini Janardhanan, Shomita Mukherjee,
P.V. Karunakaran & Ramana Athreya, Pp. 5569–5573
Coprological prevalence of gastrointestinal parasites
in carnivores and small mammals at Dhaka zoo,
Bangladesh
-- M.M. Rokib ur Raja, Anita Rani Dey, Nurjahan Begum,
Uzzal Kumar Kundu & Faishal Al Ashad, Pp. 5574–5579

Comunication Notes

Morphological and molecular identification of acridid Rediscovery of Beddome’s Coralsnake Calliophis

grasshoppers (Acrididae: Orthoptera) from Poonch
division, Azad Jammu Kashmir, Pakistan
-- Naila Nazir, Khalid Mehmood, Muhammad Ashfaq &
Junaid Rahim, Pp. 5544–5552
Short Comunications
beddomei Smith, 1943 from the type locality
-- S.R. Ganesh & Eric Ramanujam, Pp. 5580–5582
A sight record of Rhesus Macaque Macaca mulatta
(Primates: Cercopithecidae) in Karnataka, India
-- Raghunath R. Belur & Sugandhi Gadadhar, Pp. 5583–
5584

New species of genus Hersilia Audouin, 1826 Further additions to the Odonata (Insecta) fauna of
(Araneae: Hersiliidae) from India Goa, India
-- G.B. Pravalikha, Chelmala Srinivasulu & Bhargavi -- Parag Rangnekar & Rohan Naik, Pp. 5585–5589
Srinivasulu, Pp. 5553–5557

A new species of the genus Tylorida Simon, 1894 Response

(Araneae: Tetragnathidae) from a rocky outcrop in the
northern Western Ghats, India
-- Siddharth Kulkarni, Pp. 5558–5561
Remarks on ‘A report on Lecanidae (Rotifera:
Monogononta) from Andhra Pradesh, India’:
misidentifications and status
-- B.K. Sharma & Sumita Sharma, Pp. 5590–5592

Threatened Taxa