Sei sulla pagina 1di 5
MANIPAL UNIVERSITY MANIPAL INSTITUTE OF TECHNOLOGY DEPARTMENT OF BIOTECHNOLOGY II semester END SEMESTER EXAMINATION –

MANIPAL UNIVERSITY MANIPAL INSTITUTE OF TECHNOLOGY DEPARTMENT OF BIOTECHNOLOGY II semester END SEMESTER EXAMINATION May, 2015

DEPARTMENT OF BIOTECHNOLOGY II semester END SEMESTER EXAMINATION – May, 2015 BIO 1001 - BIOLOGY FOR

BIO 1001 - BIOLOGY FOR ENGINEERS

1a

1

b

Reg No

May, 2015 BIO 1001 - BIOLOGY FOR ENGINEERS 1 a 1 b Reg No TIME: 3hrs

TIME: 3hrs

Answer all FIVE questions

MARKS: 50

a 1 b Reg No TIME: 3hrs Answer all FIVE questions MARKS: 50 A message was

A message was received from a group of researchers, who were looking for the

probability of existence of alien life forms on Mars.

form and the cell membrane of that life form is depict ed in the figure.

conditions

the

They found an unusual life

a. What

need

to

exist

in

Mars

to

make

illustrated life form possible?

b. A student requested to send this life form to earth, but the

request was rejected stating that this life form is not possible to survive on

earth. Why have they told like that?

possible to survive on earth. Why have they told like that? Label and 2 between the

Label

and 2 between the active site and substrate in the figure shown here.

the

interactions

1

Lungs are involved in maintaining the blood pH by expelling CO 2 that hemoglobin carries to it. The acid- base balance buffering activity in body allows blood pH to be in the normal range of 7.3 to 7.4. How is this level disturbed when the acidity or alkalinity of blood gets disturbed out of the normal range? Explain with suitable equations.

1 The ancient Roman civilization used lead piping to supply water . It is believed that the reason for the

1c

1

1

2

2

d downfall of this great civilization was due to lead poisoning. Lead is a neurotoxin. How does the concentration of lead increase in the body? (Refer to the periodic table on last page)

1e

1f

Glucose is the only ingredient in glycogen, starch and cellulose. Identify which of them is taken as the energy storage compound in mammals and explain why?

Glycolysis is the first energy providing cycle in all the organisms, in which glucose is converted to pyruvic acid. The first step in glycolysis is

Glucose

to pyruvic acid. The first step in glycolysis is Glucose Glucose 6 phosphate ∆ G= +4

Glucose 6 phosphate ∆G= +4 kcal/mol

1

1

According to bioenergetics, this reaction should not happen. How it happens in any organism?

1g

2a

2

b

2c

1 g 2 a 2 b 2 c Ribonuclease is an enzyme involved in the cutting

Ribonuclease is an enzyme involved in the cutting of RNA. The figure shows action

of the

bonds and cuts the RNA strand. Answer

the

the

enzyme on RNA as it breaks the

following

questions

using

information

enzyme:

given

about ribonuclease

a) Would

the

enzyme

function

if

water molecule is not allowed in the active site? Explain how?

b) If Lysine

is substituted instead of

arginine in position 2, explain the effect on the enzyme activity.

is substituted

in position 2, explain

the effect on the enzyme activity.(Note:

Refer to chart of amino acids in question

3d)

instead of arginine

c) If aspartic

acid

In sheep, furred tail (F) results from an allele that is dominant over an allele for furless tail (f). A female with furred tail is mated with furless tailed male. The female then gives birth to a single lamb with furless tail. From this single offspring, is it possible to determine the genotypes of the two parents? If so, what are their genotypes? If not, why? Answer the questions after studying the following pedigree chart:

What is the most probable mode of inheritance? Justify.

What is the genotype of individual I- 2, II- 3, III- 3, and

What is the genotype of individual I- 2, II- 3, III- 3, and a. b. IV-4?

a.

b.

IV-4?

c.

What is the genotype of the individual shown as a question

mark? Note: Use notation „A‟ for dominant allele; „a‟ for recessive allele. Also when a heterozygous genotype in the only possibility use symbol Aaand when genotype can be heterozygous or

homozygous dominant use symbol A-The alleles coding for eye color (B or b) - either black or blue and body shape (L or l) - either long or short are present on the same chromosome but separated by 15cM. The traits for black eye color and long body shape are dominant. What fraction of the progeny would be having the phenotype blue eyes and long body, from the cross of a double recessive individual and a double heterozygous individual?

2 The physical appearance of a trait is called as:

d

2e

a) Morphology b) Phenotype c)Genotype d)Homology

What is the alternate form of a gene called?

2

2

4

2

1

1

a) Recessive gene b) Alternate gene c) Allele d) Chromosome

3a

3 The cell does not expend energy on proofreading the transcription process. Why is it that the cell,

b which carries out DNA replication with three steps of proofreading to reduce the error margin but not carry out RNA proofreading?

If the DNA of an organism has 20% of thymine, then calculate the percentage of guanine.

1

1

3c

3 c

The

phosphate

energy

for

groups

forming

phosphodiester

bonds

from the

incoming nucleotides.

is

obtained

by

cleaving

1

Consider

a

hypothetical

situation, where the beta and gamma phosphates are labelled in an incoming nucleotide. Will the resulting DNA chain show any radioactivity? Explain with proper reasoning.

3

d

Given is a stretch of single stranded DNA sequence which encodes for a protein. Write sequence of the amino acid chain encoded by the given DNA

sequence. The

resulting

protein

works

as

4

transmembrane

protein and

a

part

a of the protein

traverses the phospholipid bilayer as is illustrated in

the figure below. State which amino acids in this protein will be present in area 1, 2 and 3? Use inputs of amino acid structures illustrated below:

DNA sequence (shaded region is the promoter)
DNA sequence (shaded region is the promoter)

DNA sequence (shaded region is the promoter)

 
1
1
2
2
3
3
 
 

3 TCTGACGAGGCGTACGCGCCGGGCTTTCACCCGCGCCACCACCGCGACGACAAATACATT 5

 
 
 

3e

A novel drug has been introduced in the market that blocks RNA dependent DNA. This drug has no effect on the negative and positive single stranded RNA viruses. Considering only this activity of the drug, does it have any side effect on the human host? Answer with suitable explanation. In rats, a gene 1,440 base pairs (bp) long codes for an enzyme made up of 192 amino acids. Discuss this apparent discrepancy. How long would the initial and final mRNA transcripts be?

1

3f

2

4a

The diagram below represents the bone arrangements in the front limbs of

2

three

 

different species of mammals. These species have evolved from the

same ancestor. What can you comment about the habitat (type of environment) in which these

same ancestor. What can you comment about the habitat (type of environment) in which these species developed?

4

Describe any two examples of bioinspiration that you can imbibe from nature.

 

3

b

4c

5a

Design a flowchart for the hierarchy followed in biology from the molecular level to the biosphere level. Describe interactions at each level. Transposons are also called as “jumping gene s. Does a transposition event cause increase in transposon copies in the genome? What are the effects of transposition event on the organism?

3

2

5

E.coli cells are growing in a medium containing lactose without glucose. Indicate how each of the

2

b

following changes or conditions would influence the expression of lac operon. Copy the table in your answer sheet and use tick mark ( ) at appropriate place with valid justification

of lac operon. Copy the table in your answer sheet and use tick mark ( )
 

Condition

 

Expression of lac operon

 

Reason

 
 

Increased

Decreased

No change in the expression

 

expression

expression

A mutation completely inactivated β- galactosidase gene

       

Addition of high concentration of

       

glucose

 

A

mutation that prevents the

       

binding of activator protein to site near lac promoter

A

mutation that prevents the

       

dissociation of the lac repressor

from the operator

 

5c

In the course of military recruitment, all subjects are tested for the sickle cell trait.

 

2

a. Why were those individuals, who did not display any symptoms for the disease, get tested for the appearance of the trait?

b. Why sickle cell anemia is autosomal recessive? Explain at the molecular level.

 

5

A researcher isolates a gene coding for protein X from human cell and using a vector inserts it into a

4

d

prokaryotic bacterial cell. Assuming that the experiment is carried out under conditions that positively eliminate any possibility of mutation, explain the following observations:

a) The resulting amino acid chain from the prokaryotic cell does not function like protein X and is longer in amino acid number than that observed in the protein X. Justify your reasoning.

b) Some bacterial cells do not produce the protein of interest, however they survive the screening stage with an antibiotic. How?

5e

a)

Deadly diseases like small pox have been completely eradicated in the human population using vaccines. What is the basic principle by which vaccines produce an effective defensive response

2

b)

in human beings? Vibrio ordalii is a bacterium that causes vibriosis in fishes kept in aquarium. Can we develop an

effective

suitable reasoning.

vaccine

against

Vibrio

ordalii in a jawless fish kept in an aquarium? Explain with

an effective suitable reasoning. vaccine against Vibrio ordalii in a jawless fish kept in an aquarium?