Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
Adalberto Merighi
Laura Lossi Editors
Immuno-
cytochemistry
and Related
Techniques
NEUROMETHODS
Series Editor
Wolfgang Walz
University of Saskatchewan
Saskatoon, SK, Canada
Edited by
DOI 10.1007/978-1-4939-2313-7
Experimental life sciences have two basic foundations: concepts and tools. The Neuromethods
series focuses on the tools and techniques unique to the investigation of the nervous system
and excitable cells. It will not, however, shortchange the concept side of things as care has
been taken to integrate these tools within the context of the concepts and questions under
investigation. In this way, the series is unique in that it not only collects protocols but also
includes theoretical background information and critiques which led to the methods and
their development. Thus it gives the reader a better understanding of the origin of the
techniques and their potential future development. The Neuromethods publishing program
strikes a balance between recent and exciting developments like those concerning new ani-
mal models of disease, imaging, in vivo methods, and more established techniques, includ-
ing, for example, immunocytochemistry and electrophysiological technologies. New
trainees in neurosciences still need a sound footing in these older methods in order to apply
a critical approach to their results.
Under the guidance of its founders, Alan Boulton and Glen Baker, the Neuromethods
series has been a success since its first volume published through Humana Press in 1985. The
series continues to flourish through many changes over the years. It is now published under
the umbrella of Springer Protocols. While methods involving brain research have changed a
lot since the series started, the publishing environment and technology have changed even
more radically. Neuromethods has the distinct layout and style of the Springer Protocols
program, designed specifically for readability and ease of reference in a laboratory setting.
The careful application of methods is potentially the most important step in the process
of scientific inquiry. In the past, new methodologies led the way in developing new disci-
plines in the biological and medical sciences. For example, Physiology emerged out of
Anatomy in the nineteenth century by harnessing new methods based on the newly discov-
ered phenomenon of electricity. Nowadays, the relationships between disciplines and meth-
ods are more complex. Methods are now widely shared between disciplines and research
areas. New developments in electronic publishing make it possible for scientists that
encounter new methods to quickly find sources of information electronically. The design of
individual volumes and chapters in this series takes this new access technology into account.
Springer Protocols makes it possible to download single protocols separately. In addition,
Springer makes its print-on-demand technology available globally. A print copy can there-
fore be acquired quickly and for a competitive price anywhere in the world.
v
Preface
Immunocytochemistry was first established in the seventies of the last century and immediately
dominated the scene of neuroscience to a point that the concept of a new chemical neuro-
anatomy of the brain has at that time fascinated the whole community of neurobiologists.
The application of immunocytochemical techniques to the study of nervous tissue and
organs had initially to face a series of technical problems that made it a very demanding
procedure for obtaining successful immunostaining in combination with adequate struc-
tural preservation, particularly at the electron microscope level.
Almost half a century thereafter, the new frontier of immunocytochemistry applied to
the study of the brain lies in its successful combination with other neural tracing techniques
and its application to different animal models, not only in vivo but also in other experimen-
tal contexts such as those offered by slice studies.
Immunocytochemistry and Related Techniques is a collection of protocols for the immuno-
cytochemical analysis of neurons and neural networks where emphasis is given not only to the
immunostaining protocol per se but also to its possible ameliorations in qualitative and quan-
titative terms, and to the possibility of employing immunocytochemical labeling as a part of a
more comprehensive approach to understand the structure and function of the brain.
This book, from its initial conception, had obviously to be limited in the choice of sub-
jects, but we believe it represents a valuable and readily reproducible collection of estab-
lished and emerging techniques. Such a collection is preceded by a general introductory
chapter (Chap. 1) that recalls the history of immunocytochemistry, its basic principles, and
its application to the study of neuronal complexity. The methods presented include immu-
nocytochemical localization at light and electronic levels, biochemical characterization, and
functional analysis in vivo or ex vivo by novel types of microscopy, as well as protocols for
development and production of genetic probes. Although this book is primarily devoted to
approaches for analysis of the mammalian brain, a few nonmammalian species are also taken
into consideration to demonstrate the importance of alternative animal models in a more
comprehensive analysis of central and peripheral neurons.
As a general indication to the readers, the book is divided into five parts.
Part I (Chaps. 2–4) is focused on the application of immunocytochemical techniques
to the study of nonmammalian brains, specifically Drosophila (Chap. 2), Octopus (Chap.
3), and Zebrafish (Chap. 4). These contributions primarily describe a series of modifica-
tions to the currently used “mammalian-based” protocols and/or their combination with
genetic labeling techniques and provide also precious information on species-specific anti-
bodies, useful database, and fundamentals of the anatomy of these brains.
Part II (Chaps. 5–8) takes into consideration the contribution of immunocytochemis-
try to current research on cell proliferation and adult neurogenesis by first discussing the
choice of the panels of markers so far available for the identification of differentiating neu-
rons at different stages of development (Chap. 5) and in the course of adult neurogenesis
(Chap. 6). In this context, Chap. 7 not only describes the protocols to label proliferating
cells by DNA incorporation of tritiated thymidine or its analogues but also presents an in-
depth critical revision on the methodological problems linked to this type of approach.
vii
viii Preface
Finally, Chap. 8 describes a novel flow cytometry procedure as a tool for reliable quantifica-
tion of data that is an interesting alternative to time-consuming histology/stereology.
Part III (Chaps. 9–13) describes the application of immunocytochemical techniques to
the study of other very important areas of current research in the neurosciences such as
apoptosis/autophagy (Chap. 9), Alzheimer’s disease (Chap. 10), amyotrophic lateral scle-
rosis (Chap. 11), microglia (Chap. 12), and the blood–brain barrier (Chap. 13).
Part IV (Chap. 14–19) initially deals with the problem of quantification of immunocy-
tochemical data at light (Chap. 14) and electron microscopic (Chap. 15) levels. Then it
describes a series of combined techniques in which immunocytochemistry is used together
with tract-tracing techniques and electrophysiology (Chaps. 16 and 17) or genetic engi-
neering procedures (Chaps. 18 and 19) in the study of live neurons.
Part V (Chaps. 20–23) is devoted to some recently introduced methods to best exploit
the potential of immunocytochemistry in the study of the brain. These include array tomog-
raphy (Chap. 20), super-resolution fluorescence microscopy (Chap. 21), the use of quan-
tum dots (Chap. 22), and the production of protein-patterned substrates (Chap. 23).
All scientists who have excellently contributed to this book have a direct experience in
the techniques that they have described. We are very much indebted to all of them for their
time, the high standards of their contributions, and for successful effort in emphasizing the
more common pitfalls in the protocols that they have presented in this book as well as the
hints to reduce the possibility of failure for beginners.
The collection of contributions that forms this book is surely not exhaustive of the wide
range of immunocytochemical approaches that today can be employed in the study of the
complexity of the nervous system. Yet it is intended for a large audience of scientists, includ-
ing histologists, biochemists, cellular and molecular biologists, and electrophysiologists that
are currently active in the field or are willing to enter the exciting area of neuroscience research.
As the two of us have been the first to benefit from such an excellent assemblage of infor-
mation, we are confident that readers too will find this book very useful for their future work.
Series Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . vii
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
ix
x Contents
xi
xii Contributors
MARTIN HEUBL • INSERM UMR-S 839, Institut du Fer a Moulin, Université Pierre
et Marie Curie, Paris, France
CASPER C. HOOGENRAAD • Cell Biology, Faculty of Science, Utrecht University, Utrecht,
The Netherlands
STEPHANIE M. HUGHES • Department of Biochemistry Brain Health Research Centre,
Otago School of Medical Sciences, University of Otago, Dunedin, New Zealand
LUKAS C. KAPITEIN • Cell Biology, Faculty of Science, Utrecht University, Utrecht,
The Netherlands
OLGA KIRIK • Laboratory of Functional Morphology of the Central and Peripheral Nervous
System, Department of General and Specific Morphology, Institute of Experimental
Medicine of the North-West Branch of the Russian Academy of Medical Science,
St. Petersburg, Russian Federation
THOMAS KNÖPFEL • Optogenetics and Circuit Neurosciences, Division of Brain Sciences,
Imperial College London, London, UK
DMITRII E. KORZHEVSKII • Laboratory of Functional Morphology of the Central
and Peripheral Nervous System, Department of General and Specific Morphology,
Faculty of Dentistry and Medical Technologies, Institute of Experimental Medicine
of the North-West Branch of the Russian Academy of Medical Science, St. Petersburg,
Russian Federation
MAX LARSSON • Department of Clinical and Experimental Medicine, Linköping University,
Linköping, Sweden
SABINE LÉVI • INSERM UMR-S 839, Institut du Fer a Moulin, Université Pierre et Marie
Curie, Paris, France
LAURA LOSSI • Department of Veterinary Sciences, University of Torino, Grugliasco, Torino, Italy;
National Institute of Neuroscience, University of Turin, Turin, Italy
JEAN-PIERRE LOUBOUTIN • Department of Pathology, Anatomy and Cell Biology,
Thomas Jefferson University, Philadelphia, PA, USA; Section of Anatomy, Department
of Basic Medical Sciences, University of the West Indies, Kingston, Jamaica
JESSICA RUIVO MAXIMINO • Neuroregeneration Center, Department of Neurology,
University of São Paulo School of Medicine, São Paulo, Brazil
ADALBERTO MERIGHI • Department of Veterinary Sciences, University of Torino, Grugliasco,
Torino, Italy; National Institute of Neuroscience, University of Turin, Turin, Italy
MARINA MIKHAYLOVA • Cell Biology, Faculty of Science, Utrecht University, Utrecht,
The Netherlands
NOBUHIKO MIYASAKA • RIKEN Brain Science Institute, Saitama, Japan
TAISUKE MIYAZAKI • Department of Anatomy, Hokkaido University School of Medicine,
Sapporo, Japan
MANFRED J. OSWALD • Department of Physiology Brain Health Research Centre,
Otago School of Medical Sciences, University of Otago, Dunedin, New Zealand
GIOVANNA PONTE • Associazione Cephalopod Research “CephRes”, Naples, Italy
PASKO RAKIC • Department of Neurobiology, Kavli Institute for Neuroscience,
Yale University School of Medicine, New Haven, CT, USA
BRAD R. ROCCO • Department of Psychiatry, University of Pittsburgh School of Medicine,
Pittsburgh, PA, USA
ANIKA SAUL • Department of Psychiatry and Psychotherapy, University Medical Center (UMG),
Georg-August-University, Göttingen, Germany
ARMIN SCHNEIDER • SYGNIS Bioscience, Heidelberg, Germany
Contributors xiii
Abstract
After more than 70 years from its initial development, immunocytochemistry (ICC) has become a
fundamental technique in the study of the nervous system. After a brief excursus along the history of the
different techniques that led to substantial amelioration of the original indirect immunofluorescence proto-
col, we discuss here the main advantages and disadvantages of the individual techniques for the study of
central and peripheral neurons, in parallel with standardization, quantification, and reaction bias. Particular
attention is given to immunofluorescence and its novel developments that allow high-resolution imaging at
the light microscope level. The possibility of combining ICC with other fundamental techniques for analysis
of neuronal circuitry such as neurotracing, electrophysiology, and molecular biology is also discussed, as
well as a series of approaches for correlative light and electron microscopic studies.
The emerging picture is that ICC still represents an invaluable tool for histological and cytological
analysis of neural complexity.
1.1 Basic Concepts A series of techniques that are today applied to study the localization
and Definitions and distribution of biologically relevant molecules into cells and
tissues is based on the antigen–antibody reaction, a specific
chemical interaction between antibodies,1 a class of proteins pro-
duced by B-lymphocytes and plasma cells, and antigens (from
ANTIbody GENerator), i.e., any substance which provokes an
adaptive response during a so-called immune reaction.
Antibodies are large Y-shaped immunoglobulins containing—
at each tip of the Y—a paratope that is specific for one particular
epitope (or antigenic determinant) on an antigen, allowing these
1
The term was coined by Paul Ehrlich at the end of the nineteenth century
when he developed in his side-chain theory to explain the immune response.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_1, © Springer Science+Business Media New York 2015
1
2 Adalberto Merighi and Laura Lossi
2
Albeit the terms fluorochrome and fluorophore are often used as synonyms,
we will use fluorochrome to indicate a fluorescent dye or protein used either
directly as a specimen stain or conjugated to a biologically active substance to
make a fluorophore (fluorescent probe).
4 Adalberto Merighi and Laura Lossi
Although the basic principles of ICC are relatively simple and can
be universally applied, the complexity of the nervous system and,
in some cases, its structural peculiarities on the one hand made
necessary the development of specific protocols for successful
immunolabeling and, on the other hand, limited the application of
certain techniques, particularly as far as the study of central neu-
rons is concerned.
2.1 Some Basic A basic ICC protocol requires a series of preparatory steps: all these
Principles steps have a more or less significant detrimental effect on the pres-
ervation of tissue antigenicity, morphology, or ultrastructure.
Therefore, the final outcome of an ICC reaction is always a com-
promise between the need to retain enough antigen in tissue and
avoid its denaturation and the formation of a molecular barrier that
prevents the antigen–antibody reaction to occur and the need to
maintain a good histological and ultrastructural—if required—
preservation, to gain reliable topological information about
antigen(s) under study.
From this point of view, it is convenient to consider embed-
ding as a pivotal step, as it allows dividing ICC protocols into
three main groups: non-embedding, pre-embedding, and post-
embedding procedures (Table 1). This type of classification obvi-
ously refers primarily to the temporal relationship between the
embedding and the immunolocalization step.
Non-embedding techniques have widespread application in
light microscopic ICC and can be used directly to stain cultures
(isolated neurons or organotypic), whole-mount preparations
(e.g., neurons of the gut plexuses, whole embryos or larvae in
invertebrates, etc.), or cryoprotected tissues that are then observed
directly (after having been cleared if necessary) or frozen and sec-
tioned with a freezing microtome or cryostat. Cryosections for
light microscopy (LM) offer several advantages such as maximal
retention of antigenicity, good morphology, and ease of prepara-
tion. For these reasons, they are widely employed for studies of
both the central (CNS) and peripheral nervous system (PNS).
The preparation of ultrathin cryosections (cryoultramicrotomy)
for transmission electron microscopy (EM) offers a number of
advantages such as highest sensitivity, the possibility of using
osmium tetroxide as a counterstain after immunolabeling, and the
study of, e.g., the intracellular pathways of neuropeptide secretion
[37, 38]. However its high cost and technical difficulties have
greatly limited its diffusion. In addition, only very small areas of
6 Adalberto Merighi and Laura Lossi
Table 1
Didactic subdivision of immunocytochemistry protocols based on the timing of the embedding step
related to the antigen–antibody reaction
tissue are available for examination under the TEM, and this, in
practical terms, circumscribes its usefulness to the field of subcel-
lular cytology [32].
Pre-embedding ICC at the LM level has a limited use, as it is
mainly employed in whole-mount preparations of, e.g., retina
[39], enteric neurons [40, 41], or blood vessels [42] in adults and
mammalian embryos, or the entire adult organism in lower verte-
brates, e.g., zebrafish [43], or invertebrates, e.g., Drosophila [44].
Exceptions are encountered when one requires sectioning in a spe-
cific plane rather than studying the entire body/organ to obtain
additional information on the localization of the immunolabeling,
e.g., to study the layer distribution of cell processes in the immu-
nostained retina. One of the main disadvantages in this latter situ-
ation is that not all markers that can be used to tag the
antigen–antibody reaction are capable of surviving the embedding
procedure in paraffin or plastic resins. This is significantly the case
for most fluorochromes that can be used in IMF (see below).
Pre-embedding ICC at the LM level is often used as an initial
step for a subsequent TEM observation by taking advantage of the
electron-dense nature of the DAB precipitate (pre-embedding EM
ICC) [45].
Primarily referring to EM labeling procedures (but not only), the
main advantages of pre-embedding ICC can be summarized as fol-
lows: large areas of tissue may be immunostained and examined, the
same material can be used for LM and EM (see Sect. 4), and the sen-
sitivity of the method is very high and allows the detection of poorly
concentrated antigens [46]. On the other hand, its major disadvan-
tages are poor penetration of immunoreactants into the tissue so that
Immunocytochemistry in Nervous System 7
2.2 The Preparatory With the exception of some protocols employing, e.g., cryoultra-
Steps microtomy, fixation is an obligatory initial step for all ICC proce-
dures particularly when dealing with a delicate tissue such as the
2.2.1 Fixation,
nervous tissue. Describing the general principles of fixation in ICC
Embedding,
and their application to the study of CNS/PNS is beyond the
and Heath-Induced
scope of this commentary. Readers will find very useful methods in
Epitope Retrieval (HIER)
recent books [53, 54] and reviews [36, 55–57].
Ultimately, the choice of fixatives is today restricted to those
based on aldehydes that offer a good compromise between their
cross-linking capabilities and rapidity of cell/tissue penetration.
Such an outcome is also intimately connected with the develop-
ment of effective heath-induced epitope retrieval (HIER) proto-
cols that allow effective unmasking of a wide number of antigens
(epitopes) in paraformaldehyde- (and other aldehyde-) fixed tis-
sues (see below).
HIER is today widely employed in routine LM ICC, and the
use of this procedure has become very important not only in basic
neuroscience research [58] but also and even more fundamental in
(diagnostic) neuropathology [59, 60].
8 Adalberto Merighi and Laura Lossi
Table 2
Examples of fixatives to be used for ultrastructural immunocytochemistry in the nervous system
2.3 ICC Protocols Figure 1 depicts in a simplified manner the principles of enzyme
and Markers and fluorescence immunocytochemical procedures.
As regarding the type of immunocytochemical reaction(s) and,
2.3.1 LM ICC
consequently, the marker(s) to be used in labeling procedures, a
knowledge of the evolution of ICC applied to the nervous system is
of some help in understanding today’s options and choices. At the
beginning, because of the superior morphology provided by FFPE
tissues, the HRP-based immunoenzyme techniques became the first
choice for most research and clinical studies, as they were free of the
limitations of the earlier fluorescence antibody methods. Today, the
use of FFPE tissues and HRP-based methods has been drastically
reduced (particularly in basic neurobiology laboratories) for several
reasons, among which: (1) the development of the so-called “sec-
ond-generation” fluorochromes, of a series of very stable fluorescent
dyes, and of genetically encoded FRPs and (2) the introduction of
multi-photon or dual-photon confocal microscopy (CM) and devel-
opment of fluorescence deconvolution algorithms.
Table 4 summarizes the array of choices of LM methodologies
that are today available to researchers, along with comments on
usefulness of each procedure for neuroscience.
Table 3
Embedding media for light and electron immunocytochemistry
Table 4
Protocols for light microscopic immunocytochemistry
Table 4
(continued)
Fig. 2 List of some of the most widely employed fluorochromes in FM with indication of their peaks of
excitation and emission. On the right are indicated the main lines of emission of a mercury lamp (ML) and four
common laser sources. According to the wavelength of emitted light, lasers can be indicated as UV lasers
(350 nm), violet lasers (407 nm), blue lasers (488 nm), and red lasers (635 nm). 7-AAD 7-aminoactinomycin D,
APC allophycocyanin, CFP cyan fluorescent protein, Em emission (nm), Ex excitation (nm), EYFP enhanced
yellow fluorescent protein, FM fluorescence microscopy, FRP fluorescent reporter protein, GFP green fluores-
cent protein, IMF immunofluorescence, mito mitochondrion/mitochondrial, ML mercury lamp, RFP red
fluorescent protein, Venus variant of YFP, YFP yellow fluorescent protein
Immunocytochemistry in Nervous System 15
Fig. 3 Schematic drawings of the types of fluorescence microscopies that can be employed in ICC procedures.
For simplicity, a microscopic setup of the inverted type has been represented together with the use of an oil-
immersion objective, but in most cases it is possible to use a conventional upright microscope and other types
of objectives providing that they have a sufficient NA. The colors of the different types of lights are those of the
visible spectrum. A: In conventional wide-field FM, all fluorochromes falling under the excitation beam become
fluorescent independently from the plane of focus (a) and are subsequently bleached after exposure to the
excitation light (b). The out-of-focus excited fluorochromes contribute to image blurring and reduce the image
resolution. B: In confocal FM, blurring is reduced and resolution increased by the use of a pinhole that reduces
the diameter of the light spot that illuminates the sample. Only those fluorochromes that fall within the small
aperture of the pinhole are thus excited. To cover the entire surface of the sample, the laser beam moves along
a scanning pattern of parallel lines in the X–Y plane (a: LSCM) or along a pattern generated by a spinning disk
(b: SDCM). The approximate theoretical lateral (X–Y axes) and axial (Z-axis) resolutions of confocal microscopy
Immunocytochemistry in Nervous System 17
Fig. 3 (continued) are in the order of 180–250 nm and 500–700 nm, respectively. The resolvable volume (VX-Y-Z)
is 10–23 μ3 × 10-3. C–H: Types of SMLM that can be used in ICC detection. C: PALM is based upon the use of
photoactivatable fluorochromes, i.e., a group of fluorochromes that are inactive—and thus cannot be excited
even if illuminated with excitation light of the correct wavelength (a)—unless activated by prior illumination
with near-ultraviolet light (b), a process referred to as photoactivation. Activated fluorochromes can then be
excited normally (c) and undergo subsequent bleaching (d). D: dSTORM is based on the use of conventional
fluorochromes that under concurrent excitation with red and green light rapidly pass from an OFF non-fluores-
cent state to the ON fluorescence emission (a–b), a process also referred to as blinking. PALM/STORM have
the highest lateral resolution among SMLMs, an excellent axial resolution (about 140 nm) that, however, is
usually confined to the evanescent wave field near the sample bottom. These techniques rely on repeated
image acquisition and have an acquisition time in a range from 10 s to 10 min. Among their main advantages
there is the possibility of obtaining single-molecule data in live cell imaging with multicolor fluorescence and
thus to employ RFPs as fluorophores. Among their disadvantages there is the long time required for data
acquisition, especially in 3D, and the possibility to employ a relatively small number of fluorochromes for imag-
ing. F: STED is based on the use of two concentric sources of light: the excitation light at center and the deple-
tion light at periphery of the field of illumination. The approximate theoretical lateral and axial resolutions of
STED are in the order of 60 and 700 nm, respectively. The resolvable volume is 1.3 μ3 × 10−3. The acquisition
time is in the order of 5 min. The main advantage is a combination of a threefold higher lateral resolution with
the same axial resolution of confocal microscopy. It should be noted that deconvolution approaches can further
improve STED resolution. Therefore it is an ideal technique for high-resolution 3D studies. In addition it can be
employed in multicolor labeling experiments. Its main drawback is the need of relatively high-intensity laser
sources for irradiation. G: TIRFM allows a selective excitation of fluorochromes lying inside the evanescent
wave of the TIR light. The physics below this type of SMLM only allows its use in cultured cells in a monolayer.
H: SIM uses a structured illumination pattern with multiple orientations to obtain images that are decoded to
obtain a high-resolution image in the order of 100–130 nm in the X–Y axes and 250–340 nm in the Z-axis,
with a corresponding resolvable volume of 1.3–3 μ3 x 10−3. These figures place SIM between PALM/STORM
and STED in terms of resolution capability. The main advantage of SIM is the possibility to use it with any type
of fluorochrome. This explains the relatively wide range of resolution values given above as they are function
of the wavelength of the light emitted by individual fluorochromes, with higher resolution when fluorochromes
emitting in the blue region of the visible spectrum are employed (~460 nm). Among the advantages of SIM is
also the very fast acquisition time (around 1 min) that makes it ideal for rapid 3D imaging. Among its disad-
vantages are the need of high-intensity lasers and the possibility to employ it only for imaging of fixed samples
(but this—strictly speaking—does not apply to ICC). Note that data on resolution are only indicative as the
setup quality (e.g., objective NA, quality of the camera, mechanical drift, quality of the glassware), the type and
features of samples to be imaged (e.g., variations in medium refractive index, fluorophore type), and statistical
selection bias have influences on image quality and the final resolution. dSTORM direct STORM, FM fluores-
cence microscopy, GSDIM ground-state depletion and single-molecule return, INC light incident light, LSCM
laser-scanning confocal microscopy, SDCM spinning-disk confocal microscopy, SMLM single-molecule local-
ization microscopy, PALM photoactivated localization microscopy, REF light refracted light, SIM structured
illumination microscopy, STED stimulated emission depletion microscopy, STORM stochastic optical reconstruc-
tion microscopy, TIR light total internal reflection light, TIRFM total internal reflection fluorescence microscopy
18 Adalberto Merighi and Laura Lossi
2.3.2 EM ICC EM ICC obviously relies on the possibility of tagging the site of an
antigen–antibody reaction with an electron-dense marker. Initial
studies were carried out with a series of enzymatic markers (acid
phosphatase, glucose oxidase, cytochromes) that today have simply
an historical value. The only enzymatic marker to survive time was
HRP, still in use in pre-embedding EM ICC. Also particulate
markers (colloidal gold, ferritin, iron–dextran complexes) under-
went a remarkable evolution, and today colloidal gold has remained
almost alone in the list of currently used probes. Colloidal gold is
highly electron dense, has an easily recognizable spherical/oval
shape, and can be acquired in different sizes (5–20 nm for TEM)
and adsorbed onto a number of macromolecules, among which are
included antibodies. Immunogold labeling procedures are today
well-standardized techniques that can be employed for single and
multiple immunolabeling at the ultrastructural level [48, 50]. The
new frontier of EM ICC gold-labeled probes lies in the use of ultr-
asmall gold particles that can also be employed for correlative LM/
EM studies. As an example, the pre-embedding FluoroNanogold™
technique that we have recently described in detail [80] has
emerged as a valuable approach for the detection of many neuro-
transmitters and receptors in CNS, resulting in an excellent method
that combines several advantages of the pre- and post-embedding
procedures, and allows for a precise correlation of anatomical dis-
tributional observations at the light microscope with subcellular
localization TEM studies [81–86].
Important developments of the immunogold-based methods
have also been derived from its combination with freeze-fracture in
the study, e.g., of receptor [87] and gap-junction [88, 89] distri-
bution. As we will discuss below, the combination with Golgi
impregnation, pre-embedding HRP ICC and tracing, intracellular
dye filling, enzyme methods, and molecular biology techniques has
been very useful for correlative LM/EM analysis.
2.4 Standardization, The issues of standardization of ICC reactions and their quantification
Quantification, are today more important than in the past, when the majority of ICC
and Reaction Bias: studies were based on merely qualitative localizations. From a practi-
How Far Are We? cal point of view, one of the most difficult issues in the standardiza-
tion of ICC is the adverse influence of fixatives upon antigenicity, as
well as the great variations in fixation/processing procedures. This is,
of course, particularly relevant in diagnostic neuropathology (that is
mainly based of FFPE material) and has been emphasized as a critical
Immunocytochemistry in Nervous System 19
3
John William Strutt, third Baron Rayleigh, 1842–1919
Immunocytochemistry in Nervous System 25
5.2 High- Recent advances in detectors, motorization, and digital image pro-
Resolution FM cessing have made possible the routine collection of 2D and 3D
data for biological samples also in conventional FM. Therefore, by
using specific algorithms for digital imaging processing, it is possi-
ble to obtain high-resolution images free of PSF. As PSF is inher-
ent to each microscope system, it has to be calculated for each
point of the sample imaged. This information is required for most
deconvolution algorithms because it describes the way in which the
objective distorts the image during acquisition, as accuracy and
quality of PSF are essential to ensure the correct performance of
any deconvolution algorithm. It is noteworthy to mention that
noise, incorrect estimates of aberrations, and incorrect scaling of
the PSF may all cause major artifacts in the restored image [155].
A series of novel FM not only benefits from mathematical res-
toration of PSF but also exploits the possibility of controlling fluo-
rochrome activity and sequentially sampling different subsets of
clearly resolved individual fluorochromes.
In photoactivated localization microscopy (PALM), target pro-
teins are labeled with photoactivatable fluorochromes which are
non-fluorescent (Fig. 3Ca) until activated by near-UV light of low
intensity (Fig. 3Cb). Under these conditions, only one protein per
diffraction-limited region (~250 nm) is activated, with a resolution
in the order of 25 nm [157]. Each individual protein is then excited
(Fig. 3Cc) and imaged so that the center of each molecular PSF
indicates its location [158]. Serial cycles of activation and excitation
are repeated until all fluorochromes are bleached (Fig. 3Cd). Since
individual fluorophores are imaged, one can count their number
and computationally assemble their locations into a composite,
high-resolution image. Examples of PALM application in neurobi-
ology studies can be found in [159–161].
Stochastic optical reconstruction microscopy (STORM) and
direct STORM (dSTORM), also referred to as ground-state deple-
tion and single-molecule return (GSDIM), use fluorochromes that
reversibly cycle between fluorescent (ON) and dark (OFF) states
upon exposure to light of specific wavelengths [158, 162–164].
STORM-based ICC (Fig. 3D) relies on the proximity of two
fluorochromes attached to an antibody in a specific ratio and at a
specific distance (Fig. 3E), whereas dSTORM (Fig. 3E) employs a
26 Adalberto Merighi and Laura Lossi
6 Conclusion
References
1. Coons AH, Creech HJ, Jones RN (1941) antigen-antibody complex (horseradish
Immunological properties of an antibody peroxidase-anti-horseradish peroxidase) and
containing a fluorescent group. Proc Soc Exp its use in identification of spirochetes.
Biol Med 47:200–202 J Histochem Cytochem 18:315–333
2. Ehrlich P (1877) Beiträge zur kenntniss der 11. Mason DY, Sammons R (1978) Alkaline
anilinfärbungen und ihre verwendung in der phosphatase and peroxidase for double immu-
mikroskopischen. Technik Arch Mikr Anat noenzymatic labelling of cellular constituents.
13:263–277 J Clin Pathol 31:454–460
3. Marrack JR (1934) Nature of antibodies. 12. Cordell JL, Falini B, Erber WN et al (1984)
Nature 133:292–293 Immunoenzymatic labeling of monoclonal
4. Marrack JR (1934) Derived antigens as a antibodies using immune complexes of
means of studying the relation of specific alkaline phosphatase and monoclonal anti-
combination to chemical structure: (section alkaline phosphatase (APAAP complexes).
of therapeutics and pharmacology). Proc R J Histochem Cytochem 32:219–229
Soc Med 27:1063–1065 13. Singer SJ (1959) Preparation of an elec-
5. Coons AH, Kaplan MH (1950) Localization of tron dense antibody conjugate. Nature 183:
antigen in tissue cells; improvements in a 1523–1524
method for the detection of antigen by means 14. Moriarty GC, Moriarty CM, Sternberger LA
of fluorescent antibody. J Exp Med 91:1–13 (1973) Ultrastructural immunocytochemistry
6. Avrameas S, Uriel J (1966) Method of with unlabelled antibodies and the peroxidase-
antigen and antibody labelling with enzymes antiperoxidase complex. A technique more
and its immunodiffusion application. C R sensitive than radioimmunoassay. J Histochem
Acad Sci Hebd Seances Acad Sci D 262: Cytochem 21:825–836
2543–2545 15. Faulk WP, Taylor GM (1971) An immuno-
7. Nakane PK, Pierce GB Jr (1966) colloid method for the electron microscope.
Enzyme-labeled antibodies: preparation Immunochemistry 8:1081–1083
and application for the localization of anti- 16. Roth J (1982) The preparation of protein
gens. J Histochem Cytochem 14:929–931 A-gold complexes with 3 nm and 15 nm gold
8. Nakane PK, Pierce GB (1967) Enzyme particles and their use in labelling multiple
labeled antibodies for the light and electron antigens on ultrathin sections. Histochem J
microscopic localization of tissue antigens. 14:791–801
J Cell Biol 33:307–318 17. Roth J (1982) The protein A-gold (pAg)
9. Nakane PK (1968) Simultaneous localisation technique - a qualitative and quantitative
of multiple tissue antigens using the approach for antigen localization on thin sec-
peroxidase-labelled antibody method: a study tions. In: Bullock GR, Petrusz P (eds)
on pituitary glands of the rat. J Histochem Techniques in immunohistochemistry, 1st
Cytochem 16:557–560 edn. Academic, New York, pp 107–134
10. Sternberger LA, Hardy PJJ, Cucculis JJ 18. Huang SN, Minassian H, More JD (1976)
et al (1970) The unlabeled antibody- Application of immunofluorescent staining
enzyme method of immunohisto-chemistry. on paraffin sections improved by trypsin
Preparation and properties of soluble digestion. Lab Invest 35:383–390
Immunocytochemistry in Nervous System 29
19. Hsu SM, Raine L (1981) Protein A, 33. Ottersen OP (1987) Postembedding light- and
avidin, and biotin in immunohistochemistry. electron microscopic immunocytochemistry of
J Histochem Cytochem 29:1349–1353 amino acids: description of a new model system
20. Hsu SM, Raine L, Fanger H (1981) Use of allowing identical conditions for specificity
avidin-biotin-peroxidase complex (ABC) in testing and tissue processing. Exp Brain Res
immunoperoxidase techniques. A comparison 69:167–174
between ABC and unlabeled antibody (PAP) 34. Ottersen OP (1989) Quantitative electron
procedures. J Histochem Cytochem 29: microscopic immunocytochemistry of neuro-
577–587 active amino acids. Anat Embryol 180:1–15
21. Hsu SM, Raine L (1982) Versatility of biotin- 35. Ottersen OP, Störm-Mathisen J (1986)
labeled lectins and avidin-biotin- peroxidase Excitatory amino acids pathways in the brain.
complex for localization of carbohydrate in In: Ben Ari Y, Schwarcz R (eds) Excitatory
tissue sections. J Histochem Cytochem 30: amino acids and epilepsy. Plenum, New York,
157–161 pp 263–284
22. Hsu SM, Raine L, Fanger H (1981) The use 36. Bergersen LH, Storm-Mathisen J, Gundersen
of antiavidin antibody and avidin-biotin- V (2008) Immunogold quantification of
peroxidase complex in immunoperoxidase amino acids and proteins in complex subcel-
technics. Am J Clin Pathol 75:816–821 lular compartments. Nat Protoc 3:144–152
23. Schwyzer R (1980) Structure and function in 37. Celio MR, Keller GA, Bloom FE (1986)
neuropeptides. Proc R Soc Lond B Biol Sci Immunoelectronmicroscopy of neural anti-
210:5–20 gens on ultrathin frozen sections. J Histochem
24. Boer GJ, Swaab DF, Uylings HB et al (1980) Cytochem 34:491–500
Neuropeptides in rat brain development. 38. Gulik-Krzywicki T (1994) Electron
Prog Brain Res 53:207–227 microscopy of cryofixed biological specimens.
25. Polak JM, Van Noorden S (1986) Immuno- Biol Cell 80:161–163
cytochemistry, modern methods and applica- 39. Colbert SH, Mack AF, Fernald RD (1995) A
tions, 2nd edn. John Wright and Sons, Bristol novel, rapid flat-mounting technique for
26. Hökfelt T, Johansson O, Goldstein M (1984) visualizing antibody labeling in the retina.
Chemical anatomy of the brain. Science J Neurosci Methods 62:179–183
225:1326–1334 40. Costa M, Brookes SJ, Steele PA et al (1996)
27. Hökfelt T, Johansson O, Ljungdahl A et al Neurochemical classification of myenteric
(1980) Peptidergic neurones. Nature neurons in the guinea-pig ileum. Neuroscience
284:515–521 75:949–967
28. Hökfelt T (1986) Chemical neurotransmis- 41. Mitsui R (2009) Characterisation of calcito-
sion as seen from the histochemical side, In: nin gene-related peptide-immunoreactive
Panula P, Päivärinta H, Soinila S (eds) neurons in the myenteric plexus of rat colon.
Neurohistochemistry: modern methods and Cell Tissue Res 337:37–43
application. Alan R. Liss, New York, pp 42. Wharton J, Gulbenkian S, Mulderry PK et al
331–353 (1986) Capsaicin induces a depletion of calci-
29. Merighi A (2002) Costorage and coexistence tonin gene-related peptide (CGRP)-
of neuropeptides in the mammalian CNS. immunoreactive nerves in the cardiovascular
Prog Neurobiol 66:161–190 system of the guinea pig and rat. J Auton
30. Merighi A (2009) Neuropeptides and coexis- Nerv Syst 16:289–309
tence. In: Squire LR (ed) Encyclopedia of 43. Doodnath R, Dervan A, Wride MA et al
neuroscience. Academic Press, Oxford, (2010) Zebrafish: an exciting model for inves-
pp 843–849 tigating the spatio-temporal pattern of enteric
31. Gulbenkian S, Merighi A, Wharton J et al nervous system development. Pediatr Surg
(1986) Ultrastructural evidence for the coex- Int 26:1217–1221
istence of calcitonin gene- related peptide and 44. Saina M, Benton R (2013) Visualizing
substance P in secretory vesicles of peripheral olfactory receptor expression and localization
nerves in the guinea pig. J Neurocytol 15: in Drosophila. Methods Mol Biol 1003:
535–542 211–228
32. Merighi A, Polak JM, Fumagalli G et al 45. Priestley JV, Alvarez FJ, Averill S (1992)
(1989) Ultrastructural localisation of neuro- Pre-embedding electron microscopic immu-
peptides and GABA in the rat dorsal horn: a nocytochemistry. In: Polak JM, Priestley JV
comparison of different immunogold label- (eds) Electron microscopic immunocyto-
ling techniques. J Histochem Cytochem 37: chemistry. Oxford University Press, Oxford,
529–540 pp 89–121
30 Adalberto Merighi and Laura Lossi
46. Ribeiro-Da-Silva A, Priestley JV, Cuello AC 59. Sherriff FE, Bridges LR, Jackson P (1994)
(1993) Pre-embedding ultrastructural Microwave antigen retrieval of beta-amyloid
immunocytochemistry. In: Cuello AC (ed) precursor protein immunoreactivity.
Immunohistochemistry, 2nd edn. Wiley, Neuroreport 5:1085–1088
Chichester, pp 181–228 60. Christensen DZ, Bayer TA, Wirths O (2009)
47. Merighi A (1992) Post-embedding electron Formic acid is essential for immunohistochem-
microscopic immunocytochemistry. In: Polak ical detection of aggregated intraneuronal
JM, Priestley JV (eds) Electron microscopic Abeta peptides in mouse models of Alzheimer’s
immunocytochemistry. Oxford University disease. Brain Res 1301:116–125
Press, London, pp 51–87 61. Ottersen OP, Störm-Mathisen J (1984)
48. Merighi A, Polak JM (1993) Post-embedding Glutamate- and GABA-containing neurons in
immunogold staining. In: Cuello AC (ed) the mouse and rat brain as demonstrated with
Immunohistochemistry, 2nd edn. Wiley, a new immunocytochemical technique.
London, New York, pp 229–264 J Comp Neurol 229:374–392
49. Aimar P, Lossi L, Merighi A (1997) 62. Ottersen OP, Bramham CR (1988)
Immunogold labeling for transmission elec- Quantitative electron microscopic immuno-
tron microscopy: exploring new frontiers. cytochemistry of excitatory amino acids. In:
Cell Vision 4:394–407 Cavalheiro EA, Lehmann J, Turski L (eds)
50. Aimar P, Lossi L, Merighi A (2002) Frontiers in excitatory amino acids research.
Immunocytochemical labeling methods and Alan R Liss, New York, pp 93–100
related techniques for ultrastructural analysis 63. Maxwell DJ, Ottersen OP, Störm-Mathisen J
of neuronal connectivity. In: Merighi A, (1995) Synaptic organization of excitatory
Carmignoto G (eds) Cellular and molecular and inhibitory boutons associated with spinal
methods in neuroscience research. Springer, neurons which project through the dorsal col-
New York, pp 161–180 umns of the cat. Brain Res 676:103–112
51. Frotscher M, Nitsch R, Linke R et al (1992) 64. Merighi A, Polak JM, Theodosis DT (1991)
Identification of neuronal connections by Ultrastructural visualization of glutamate and
means of electron microscopic immunocy- aspartate immunoreactivities in the rat dorsal
tochemistry. Arzneimittelforschung 42: horn with special reference to the co-
184–189 localization of glutamate, substance P and cal-
52. Osamura RY, Itoh Y, Matsuno A (2000) citonin gene-related peptide. Neuroscience
Applications of plastic embedding to electron 40:67–80
microscopic immunocytochemistry and in 65. Mason TE, Phifer RF, Spicer SS et al (1969)
situ hybridization in observations of produc- An immunoglobulin-enzyme bridge method
tion and secretion of peptide hormones. for localizing tissue antigens. J Histochem
J Histochem Cytochem 48:885–891 Cytochem 17:563–569
53. Johnson D (2007) Handbook of neurochem- 66. Chilosi M, Lestani M, Pedron S et al (1994)
istry and molecular neurobiology. Springer, A rapid immunostaining method for frozen
New York sections. Biotech Histochem 69:235–239
54. Burry RW (2010) Immunocytochemistry: a 67. Sabattini E, Bisgaard K, Ascani S et al (1998)
practical guide for biomedical research. The EnVision++ system: a new immunohisto-
Springer, New York chemical method for diagnostics and research.
55. Saper CB (2009) A guide to the perplexed on Critical comparison with the APAAP,
the specificity of antibodies. J Histochem ChemMate, CSA, LABC, and SABC tech-
Cytochem 57:1–5 niques. J Clin Pathol 51:506–511
56. Fritschy JM (2008) Is my antibody-staining 68. Gross AJ, Sizer IW (1959) The oxidation of
specific? How to deal with pitfalls of tyramine, tyrosine, and related compounds by
immunohistochemistry. Eur J Neurosci 28: peroxidase. J Biol Chem 234:1611–1614
2365–2370 69. Bobrow MN, Harris TD, Shaughnessy KJ
57. Hofman FM, Taylor CR (2013) et al (1989) Catalyzed reporter deposition, a
Immunohistochemistry. Curr Protoc novel method of signal amplification.
Immunol 103:21.4.1–21.4.26 Application to immunoassays. J Immunol
58. Fritschy JM, Weinmann O, Wenzel A et al Methods 125:279–285
(1998) Synapse-specific localization of 70. Adams JC (1992) Biotin amplification of bio-
NMDA and GABA(A) receptor subunits tin and horseradish peroxidase signals in his-
revealed by antigen-retrieval immunohisto- tochemical stains. J Histochem Cytochem
chemistry. J Comp Neurol 390:194–210 40:1457–1463
Immunocytochemistry in Nervous System 31
Nerve Society. J Peripher Nerv Syst 15: identified Renshaw cells in rat lumbar spinal
79–92. cord. Brain Res Bull 54:669–674
95. Grunewald A, Lax NZ, Rocha MC et al. 107. Valtschanoff JG, Weinberg RJ, Rustioni A
(2014) Quantitative quadruple-label immu- (1992) NADPH diaphorase in the spinal cord
nofluorescence of mitochondrial and cyto- of rats. J Comp Neurol 321:209–222
plasmic proteins in single neurons from 108. Berezhnaya LA (2005) NADPH-diaphorase-
human midbrain tissue. J Neurosci Methods. positive cells in the thalamic nuclei and inter-
http://dx.doi.org/10.1016/j.jneumeth. nal capsule in humans. Neurosci Behav
2014.05.026 Physiol 35:273–279
96. Mutch SA, Gadd JC, Fujimoto BS et al 109. Aimar P, Pasti L, Carmignoto G et al (1998)
(2011) Determining the number of specific Nitric oxide-producing islet cells modulate
proteins in cellular compartments by quanti- the release of sensory neuropeptides in the
tative microscopy. Nat Protoc 6:1953–1968 rat substantia gelatinosa. J Neurosci 18:
97. Ficarra E, Di CS, Acquaviva A et al (2011) 10375–10388
Automated segmentation of cells with IHC 110. Lukas JR, Aigner M, Denk M et al (1998)
membrane staining. IEEE Trans Biomed Eng Carbocyanine postmortem neuronal tracing.
58:1421–1429 Influence of different parameters on tracing dis-
98. Zehntner SP, Chakravarty MM, Bolovan RJ tance and combination with immunocytochem-
et al (2008) Synergistic tissue counterstaining istry. J Histochem Cytochem 46:901–910
and image segmentation techniques for 111. Deng JB, Yu DM, Li MS (2006) Formation
accurate, quantitative immunohistochemistry. of the entorhino-hippocampal pathway: a
J Histochem Cytochem 56:873–880 tracing study in vitro and in vivo. Neurosci
99. Liu T, Li G, Nie J et al (2008) An automated Bull 22:305–314
method for cell detection in zebrafish. 112. Deng JB, Yu DM, Wu P et al (2007) The
Neuroinformatics 6:5–21 tracing study of developing entorhino-
100. Lopez C, Lejeune M, Salvado MT et al hippocampal pathway. Int J Dev Neurosci 25:
(2008) Automated quantification of nuclear 251–258
immunohistochemical markers with different 113. Lossi L, Mioletti S, Aimar P, Bruno R,
complexity. Histochem Cell Biol 129: Merighi A (2002) In vivo analysis of cell pro-
379–387 liferation and apoptosis in the CNS. In:
101. Tolivia J, Navarro A, del VE et al (2006) Merighi A, Carmignoto G (eds) Cellular and
Application of Photoshop and Scion Image molecular methods in neuroscience research.
analysis to quantification of signals in histo- Springer, New York, pp 235–258
chemistry, immunocytochemistry and hybrid- 114. Taylor SR, Badurek S, Dileone RJ et al.
ocytochemistry. Anal Quant Cytol Histol (2014) GABAergic and glutamatergic effer-
28:43–53 ents of the mouse ventral tegmental area.
102. Jaskolski F, Mulle C, Manzoni OJ (2005) An J Comp Neurol
automated method to quantify and visualize 115. Yavuzoglu A, Schofield BR, Wenstrup JJ
colocalized fluorescent signals. J Neurosci (2011) Circuitry underlying spectrotempo-
Methods 146:42–49 ral integration in the auditory midbrain.
103. Somogyi P (1990) Synaptic connections of J Neurosci 31:14424–14435
neurones identified by Golgi impregnation: 116. Catapano LA, Magavi SS, Macklis JD (2008)
characterization by immunocytochemical, Neuroanatomical tracing of neuronal projec-
enzyme histochemical, and degeneration tions with Fluoro-Gold. Methods Mol Biol
methods. J Electron Microsc Tech 15: 438:353–359
332–351 117. Rodriguez-Contreras A, Liu XB, DeBello
104. Ferrer I, Genis D, Davalos A et al (1994) The WM (2005) Axodendritic contacts onto cal-
Purkinje cell in olivopontocerebellar atrophy. cium/calmodulin-dependent protein kinase
A Golgi and immunocytochemical study. type II-expressing neurons in the barn owl
Neuropathol Appl Neurobiol 20:38–46 auditory space map. J Neurosci 25:
105. McCoy ES, Taylor-Blake B, Zylka MJ (2012) 5611–5622
CGRPalpha-expressing sensory neurons 118. Deller T, Naumann T, Frotscher M (2000)
respond to stimuli that evoke sensations of Retrograde and anterograde tracing com-
pain and itch. PLoS One 7:e36355 bined with transmitter identification and elec-
106. Carr PA, Liu M, Zaruba RA (2001) Enzyme tron microscopy. J Neurosci Methods 103:
histochemical profile of immunohistochemically 117–126
Immunocytochemistry in Nervous System 33
119. Ciriello J, Caverson MM, McMurray JC et al 132. Chen TW, Wardill TJ, Sun Y et al (2013)
(2013) Co-localization of hypocretin-1 and Ultrasensitive fluorescent proteins for imag-
leucine-enkephalin in hypothalamic neurons ing neuronal activity. Nature 499:295–300
projecting to the nucleus of the solitary tract 133. Akemann W, Mutoh H, Perron A et al (2010)
and their effect on arterial pressure. Imaging brain electric signals with genetically
Neuroscience 250:599–613 targeted voltage-sensitive fluorescent pro-
120. Zhang Y, Kerman IA, Laque A et al (2011) teins. Nat Methods 7:643–649
Leptin-receptor-expressing neurons in the 134. Lundby A, Mutoh H, Dimitrov D et al (2008)
dorsomedial hypothalamus and median pre- Engineering of a genetically encodable fluo-
optic area regulate sympathetic brown adipose rescent voltage sensor exploiting fast Ci-VSP
tissue circuits. J Neurosci 31:1873–1884 voltage-sensing movements. PLoS One
121. Rakic P (2002) Neurogenesis in adult pri- 3:e2514
mates. Prog Brain Res 138(3–14):3–14 135. Perron A, Mutoh H, Launey T et al (2009)
122. Rakic P (2002) Adult neurogenesis in Red-shifted voltage-sensitive fluorescent pro-
mammals: an identity crisis. J Neurosci 22: teins. Chem Biol 16:1268–1277
614–618 136. Mancuso JJ, Kim J, Lee S et al (2011)
123. Rakic P (2002) Neurogenesis in adult primate Optogenetic probing of functional brain cir-
neocortex: an evaluation of the evidence. Nat cuitry. Exp Physiol 96:26–33
Rev Neurosci 3:65–71 137. Packer AM, Roska B, Hausser M (2013)
124. von Bohlen und HO (2011) Immuno- Targeting neurons and photons for optoge-
histological markers for proliferative events, netics. Nat Neurosci 16:805–815
gliogenesis, and neurogenesis within the 138. Williams SC, Deisseroth K (2013)
adult hippocampus. Cell Tissue Res 345: Optogenetics. Proc Natl Acad Sci U S A 110:
1–19 16287
125. Merighi A, Bardoni R, Salio C et al (2008) 139. Nicholls SB, Chu J, Abbruzzese G et al
Presynaptic functional trkB receptors mediate (2011) Mechanism of a genetically encoded
the release of excitatory neurotransmitters dark-to-bright reporter for caspase activity.
from primary afferent terminals in lamina II J Biol Chem 286:24977–24986
(substantia gelatinosa) of postnatal rat spinal 140. Zhang J, Wang X, Cui W et al (2013)
cord. Dev Neurobiol 68:457–475 Visualization of caspase-3-like activity in cells
126. Pasti L, Volterra A, Pozzan T et al (1997) using a genetically encoded fluorescent
Intracellular calcium oscillations in astrocytes: biosensor activated by protein cleavage. Nat
a highly plastic, bidirectional form of commu- Commun 4:2157
nication between neurons and astrocytes in 141. Muller-Reichert T, Verkade P (2012)
situ. J Neurosci 17:7817–7830 Introduction to correlative light and electron
127. Carmignoto G (2001) Dynamic signaling microscopy. Methods Cell Biol 111:17–29
between astrocytes and neurons. Annu Rev 142. Brown E, Mantell J, Carter D et al (2009)
Physiol 63:795–813 Studying intracellular transport using high-
128. Crivat G, Taraska JW (2012) Imaging pro- pressure freezing and Correlative Light
teins inside cells with fluorescent tags. Trends Electron Microscopy. Semin Cell Dev Biol
Biotechnol 30:8–16 20:910–919
129. Arai Y, Nagai T (2013) Extensive use of 143. Verkade P (2008) Moving EM: the Rapid
FRET in biological imaging. Microscopy Transfer System as a new tool for correlative
(Oxf) 62:419–428 light and electron microscopy and high
130. Merighi A, Alasia S, Gambino G, Lossi L throughput for high-pressure freezing.
(2012) Confocal imaging of organotypic brain J Microsc 230:317–328
slices for real time analysis of cell death. In: 144. McDonald KL, Morphew M, Verkade P et al
Méndez-Vilas A (ed) Current microscopy con- (2007) Recent advances in high-pressure
tributions to advances in science and technol- freezing: equipment- and specimen-loading
ogy. Formatex Research Center, Badajoz, Spain methods. Methods Mol Biol 369:143–173
131. Hsu YY, Liu YN, Lu WW et al (2009) 145. Jahn KA, Barton DA, Kobayashi K et al
Visualizing and quantifying the differential (2012) Correlative microscopy: providing
cleavages of the eukaryotic translation initia- new understanding in the biomedical and
tion factors eIF4GI and eIF4GII in the plant sciences. Micron 43:565–582
enterovirus-infected cell. Biotechnol Bioeng 146. Sandell JH, Masland RH (1988)
104:1142–1152 Photoconversion of some fluorescent markers
34 Adalberto Merighi and Laura Lossi
175. Bethge P, Chereau R, Avignone E et al (2013) tosis of dense-core granules containing tis-
Two-photon excitation STED microscopy in sue plasminogen activator in developing
two colors in acute brain slices. Biophys hippocampal neurons. J Neurosci 25:
J 104:778–785 3095–3106
176. Takasaki KT, Ding JB, Sabatini BL (2013) 182. Scalettar BA, Rosa P, Taverna E et al (2002)
Live-cell superresolution imaging by pulsed Neuronal calcium sensor-1 binds to regulated
STED two-photon excitation microscopy. secretory organelles and functions in basal
Biophys J 104:770–777 and stimulated exocytosis in PC12 cells. J Cell
177. Lv C, Gould TJ, Bewersdorf J et al (2012) Sci 115:2399–2412
High-resolution optical imaging of zebrafish 183. Fiolka R, Shao L, Rego EH et al (2012)
larval ribbon synapse protein RIBEYE, RIM2, Time-lapse two-color 3D imaging of live cells
and CaV 1.4 by stimulation emission depletion with doubled resolution using structured illu-
microscopy. Microsc Microanal 18:745–752 mination. Proc Natl Acad Sci U S A 109:
178. Willig KI, Nagerl UV (2012) Stimulated 5311–5315
emission depletion (STED) imaging of den- 184. Schouten M, De Luca GM, Alatriste Gonzalez
dritic spines in living hippocampal slices. Cold DK et al (2014) Imaging dendritic spines of
Spring Harb Protoc 2012: db rat primary hippocampal neurons using struc-
179. Martin-Fernandez ML, Tynan CJ, Webb SE tured illumination microscopy. J Vis Exp 10
(2013) A ‘pocket guide’ to total internal 185. Xu D, Jiang T, Li A et al (2013) Fast optical
reflection fluorescence. J Microsc 252:16–22 sectioning obtained by structured illumina-
180. Wu Y, Gu Y, Morphew MK et al (2012) All tion microscopy using a digital mirror device.
three components of the neuronal SNARE J Biomed Opt 18:060503
complex contribute to secretory vesicle dock- 186. Dal MM, Difato F, Beltramo R et al (2010)
ing. J Cell Biol 198:323–330 Simultaneous two-photon imaging and
181. Silverman MA, Johnson S, Gurkins D et al photo-stimulation with structured light illu-
(2005) Mechanisms of transport and exocy- mination. Opt Express 18:18720–18731
Part I
Abstract
Immunofluorescence (IF) and genetic fluorescent labeling have become standard techniques to study the
anatomy, function, and development of the Drosophila nervous system. This chapter provides an introduc-
tion into these techniques and is aimed to the novice in the field. Besides standard protocols for staining
in whole mounts and vibratome sections, we give background information on useful antibodies and fly
lines and provide guidelines on how to present IF data. We also introduce into the use of neuronal land-
marks as a tool for precise and detailed anatomical descriptions.
Key words Antibodies, Fluorescent proteins, Neuroanatomy, Brain, Ventral ganglion, Drosophila
melanogaster, Drosophila larva
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_2, © Springer Science+Business Media New York 2015
39
40 Mareike Selcho and Christian Wegener
● Petri dishes.
● Microscope slides and coverslips.
● Nail polish.
● Set of micropipettes.
● 24-well plates.
● Shaker/nutator.
● Vibratome.
● Magnetic heater/stirrer
● Low-melting agarose.
● Mesh basket.
● Benchtop centrifuge.
2.2.2 Object Slides Carefully wash an object slide with water and then 70 % ethanol
with Spacer and let it dry. Cut a reinforcement ring into two halves, and stick
them some distance apart onto the object slide wearing gloves
as shown in Fig. 1a. The reinforcement ring acts as a spacer that
Fig. 1 Useful tools for dissection and immunostaining. (a) Conventional reinforcement rings are glued to an
object slide or coverslip and serve as cheap and easy-to-use spacers to prevent the tissue from squeezing by
the coverslip. (b) A custom-sharpened Dumont #5 forceps. The rather thick shanks and the rather blunt tip
prevent easy deformation, give stability when holding small tissues, and allow re-sharpening the tip easily.
Note the tight grip at the tip. (c) Petri dishes of different diameters filled with a silicon polymer without (left)
and with (right) added charcoal. (d) Mesh baskets can be made from cut plastic tubes of appropriate size
which are closed on one side with fine nylon mesh (e.g., as used for offset-printing; see insert) and are useful
to wash tissue or vibratome sections in a well plate
Fluorescent Labeling in the Fly Brain 43
2.3 Sources Commercial suppliers only rarely offer specific antibodies against
of Primary Antibodies Drosophila or other insect antigens. Thus, if not directed against
typical markers such as GFP, polyclonal primary antibodies have
typically to be requested from other researchers or produced by
oneself (for most of us that means: place an order with a company).
The unwritten rule (and in some cases even requested by journals)
is that once published, all antisera should be freely shared in rea-
sonable amounts. Often, an aliquot of a widely used polyclonal
antibody can be obtained from a lab colleague. This is convenient,
but it does not hurt to inform the original producer if this antibody
is going to be a major tool in your research project. If you use the
antibody in a publication, make sure that the original producer
obtains the well-deserved credit by acknowledging the original
source and citing the original paper describing the antibody
production.
Many of the widely used monoclonal hybridoma antibodies
(mAbs) produced by various groups in the 1980ies are available
at the Developmental Study Hybridoma Bank (DSHB) at the
University of Iowa (http://dshb.biology.uiowa.edu/). Currently,
215 different mAbs can be ordered. The DSHB also has generated
mouse mAbs against GFP. The antibodies come for a very fair price
and can be ordered as supernatant, concentrate, or ascites. For
normal IF staining, the supernatant has in our hand always worked
well, typically at dilutions of 1:30–1:100. If higher antibody con-
centrations in a small volume are needed, then the concentrate
(10x higher concentration) or ascites (antibody concentrations in
the range of mg/mL are possible) are recommended. If large
amounts of antibody are needed and your lab has the possibility to
grow hybridoma cells, then we recommend ordering the respective
hybridoma cell line from DSHB. The DSHB also keeps several cell
lines from the Würzburg Hybridoma Library produced by Alois
Hofbauer and Erich Buchner (see 23). These and other cell lines
(or mAbs) from the Würzburg Hybridoma Library can also be
directly ordered by contacting MS or CW.
44 Mareike Selcho and Christian Wegener
3 Methods
3.2 Indirect IF We here describe two “standard” protocols for indirect whole-
Staining of Peptides mount staining of the Drosophila CNS that in a more or less similar
and Proteins in Whole fashion are used by many fly labs. The paraformaldehyde protocol
Mounts is feasible for most immunostaining procedures, while the glutaral-
dehyde protocol (after 24) is needed in some specific cases, e.g., if
the antibody was produced against a small glutaraldehyde-coupled
antigen (see Note 6). Glutaraldehyde reacts especially well with
amino groups and fixes rapidly but shows a slower tissue penetra-
tion. The main disadvantage of glutaraldehyde in immunostaining
is its ability to destroy the epitopes of antibodies by cross-linking.
On the other hand, some antibodies are specifically produced
against glutaraldehyde-coupled antigens such as small transmitter
Fluorescent Labeling in the Fly Brain 45
3.2.2 Glutaraldehyde Prefix with opened cuticle (larvae)/opened head (adult brain) for
Protocol (See Note 21) 5 min in freshly prepared fixative solution on ice under the fume
hood. Prepare the CNS from the prefixed animal (see Note 22) in
Tris–HCl. Then, transfer all tissue to a microcentrifuge (see Note 5)
tube and fix for 40 min (larval CNS) or 2 h (adult CNS) in 0.5 mL
fixative at room temperature. Wash the specimens four times
10 min each in 300–500 μL Tris–HCl SMB (0.05 M Tris–HCl
0.45 % SMB). Incubate tissue for 30 min at room temperature in
1 mL 0.3 % sodium borohydride in Tris–HCl SMB (see Note 23)
to unmask antigens and reduce the glutaraldehyde linkages. Wash
again four times 10 min each in 300–500 μL Tris–HCl SMB; then
wash twice 10 min each in 300–500 μL Tris–HCl SMB TX.
Block unspecific binding sites for 1½ h in 300–500 μL 10 %
normal serum in Tris–HCl SMB TX and incubate specimens at
least 2 nights at 4 °C in 200–500 μL blocking solution containing
the primary antibodies. After completing the incubation in pri-
mary antibodies, wash six times 10 min each with 300–500 μL
Tris–HCl TX and then incubate tissues for 2 nights at 4 °C with
200–500 μL of 5 % normal serum solution containing the second-
ary antibodies. From this step on, keep tubes covered to avoid
photo-bleaching of the fluorochrome.
Wash five times 10 min each in 300–500 μL Tris–HCl TX and
then twice 10 min each in 300–500 μL Tris–HCl, and mount in
80 % glycerol in Tris–HCl or other mounting medium as described
for the formaldehyde protocol.
3.4 Determination For normal IF staining, it is best to use antibodies in limited excess
of the Optimal of the epitopes. That way, all epitopes can be marked and thus
Concentration optimum labeling intensity is reached, while background labeling
of Antibodies is kept low. With increasing concentration beyond a limited excess,
the specific labeling cannot increase, but unspecific background
staining usually becomes more intense since the antibodies now
start to bind to unspecific low-affinity epitopes. Thus, simply incu-
bating with a high concentration of primary and also secondary
antibody is unlikely to produce good staining. On the other hand,
if the antibody concentration is below the excess concentration,
then specific labeling intensity goes down with often only small
effect on background labeling intensity. So, if you don’t know the
working concentration for your antibodies and you want a good
staining, the optimal antibody concentration should be determined
by a simplified checkerboard titration as follows.
Incubate the tissue of interest in parallel with increasing
dilutions of primary antiserum (a good start for polyclonal antisera
is 1:200: 1:200–1:1,000–1:2,000–1:4,000–1:8,000; for mAbs
from supernatant, we recommend to use ten times lower dilutions
as described); wash and incubate with secondary antiserum at the
dilution recommended by the supplier. If staining intensity is not
decreasing and weakly stained structures (e.g., neurite arboriza-
tions) do not disappear at the highest primary antibody dilution,
repeat the incubation in the primary antibody solution using
1:8,000 as the starting dilution. If staining intensity is still increas-
ing and new details are becoming visible at the lower primary anti-
body dilutions, repeat the incubation in the primary antibody
solution starting with a 1:200 dilution but going down in diluting
the antibody.
Afterward, determine the dilution at which all details are still
clearly labeled and for which the next dilution step shows a marked
decrease in staining intensity. Then use a 2× higher concentration
than that determined, and repeat the incubation in the primary
antibody solution, but this time vary the concentration of the fluo-
rescently labeled secondary antibody (most often it is enough to
test 1:500–1:1,000–1:2,000). See Note 24.
48 Mareike Selcho and Christian Wegener
3.5 Testing Labeling In perhaps most cases, the specificity of the antibody you are going
Specificity to use has already been characterized by others. To quickly check
whether this is the case, the Journal of Comparative Neurology
keeps a useful data bank comprising work published in this journal
( http://onlinelibrar y.wiley.com/journal/10.1002/(ISSN)
1096-9861/homepage/jcn_antibody_database.htm). If the speci-
ficity of your antibody has already been specified in detail in
Drosophila, giving the appropriate citation should be fine. However,
if your antibody is new, or has never been used in the fruit fly
before, its specificity needs to be tested.
The “gold standard” is to perform a staining in a negative con-
trol, i.e., in a mutant or deficiency fly that does not express the
antigen (see Note 25). Fortunately, that is quite often possible in
Drosophila. If not, pre-absorption tests are a first and rather simple
step to assess specificity as follows.
Incubate the working solution of the antibody in PBS over-
night at 4 °C in test tubes on a shaker with increasing amounts
(e.g., 2.5/25/250 μg/mL) of the antigen (see Note 26) and then
use this mixture for IF staining. If the immunostaining is abolished
after pre-absorption, this indicates that the antiserum only contains
antibodies directed against epitopes of the antigen used for immu-
nization. However, as one or several of these epitopes may also
occur in other proteins, pre-absorption does not “proof” specificity
for only the antigen used for immunization. This is also the case if
a polyclonal antiserum is immunopurified against a given antigen.
If a polyclonal antiserum is cross-reacting with different
proteins/peptides carrying the same epitope, it often can be useful
to pre-adsorb the antiserum as described above against the cross-
reacting protein that—besides the shared cross-reacting epitope—
is structurally different. This is possible since polyclonal antisera
contain different antibody populations directed against (slightly)
different epitopes. Therefore, ideally even after pre-adsorption
against a shared epitope, the antiserum will still recognize the anti-
gen of interest but now with increased specificity.
Sometimes, polyclonal antisera produce considerable unspe-
cific background staining which can impair the detection of small
or weak specific IF signals. In these cases, it is often helpful to pre-
absorb the antiserum against an unrelated tissue (e.g., imaginal
disks, muscles) before staining the nervous system. Since antisera
are typically used in surplus of their optimal concentration, the
antibody dilutions can be reused for further staining which
then often becomes “crisper” simply because the minor unspecific
antibody populations decrease in concentration. If intended for
reuse, 0.02 % NaN3 should be added to the antibody solution as
preservative (see Note 14).
Fluorescent Labeling in the Fly Brain 49
3.6 Counter- The small thickness of the fly brain (around 200 μm) offers the
balancing Light nice advantage to analyze complete brains in whole-mount prepa-
Absorption rations by single-photon confocal microscopy. Nevertheless, when
and Bleaching scanning through the brain from top to bottom, both the excita-
in Confocal tion laser light and the emitted fluorescence are increasingly scat-
Microscopy tered and absorbed. Thus in a stack projection, a cell closer to the
objective will appear more strongly stained than a cell farther away
from the objective if both cells show identical staining intensity.
A further problem occurring in single-photon confocal microscopy
is the increasing bleaching of the fluorochromes throughout the
scanning process (see Note 27). In contrast to multiphoton excita-
tion, this bleaching also affects structures that are outside of
the focus or scanned z-area as the laser beam passes through the
whole specimen. Turning back to the example of cells closer or
more distant to the objective with similar staining intensity, scan-
ning from top to bottom will not only lead to increasing light
scattering/absorption but also to increasing bleaching. The net
effect will be that the more distant cell appears even more weakly
stained than the cell close to the objective. To counterbalance these
effects, it is helpful to scan from bottom to top (upright micro-
scope) or top to bottom (inverse microscope) and to gradually
decrease detector sensitivity or—if available—increase the control-
lable laser attenuator.
3.7 Analysis There are many different software, commercial and open-source,
Software that can be used for IF image processing (e.g., ImageJ, Fiji,
Photoshop, Amira, Volocity, etc.). In most cases all you need is a
program able to assemble a projection of the stacks of interest (for
confocal microscopy) and to manipulate contrast and brightness.
Nearly all image processing programs have the capability to fulfill
the latter operations. ImageJ is a freely available program able
to display, edit, analyze, and process images (http://rsbweb.nih.
gov/ij/ see 25) which, in addition, is able to import and assemble
different stack formats (e.g., for Leica, Olympus, or Zeiss confocal
microscopes). ImageJ comes with plug-ins to perform different
biological image analyses. Fiji (http://fiji.sc/Fiji; see 26), another
freely available software, is based on ImageJ with additional core
functionality. Fiji is maybe somewhat more user-friendly as it has
most plug-ins automatically integrated and performs automatic
updates. Since many researchers all over the world take advantage
of ImageJ and Fiji, the list of plug-ins to analyze your confocal data
is enormous. From 3D Viewer to cell body counter or vesicle
tracker, most helpful plug-ins already exist and are (relatively) easy
to handle.
Table 1
Selection of useful GF markers for the GAL4-UAS system
4 Typical/Anticipated Results
4.1 Staining For a precise anatomical description of neurons labeled via antibodies
of Neuropil and Tracts or by genetically encoded fluorescent markers, characteristic land-
as Landmarks marks are needed. Landmark labeling is also essential as a reference
for Anatomical to compute individual stainings into a “standard brain.”
Descriptions
52 Mareike Selcho and Christian Wegener
Fig. 2 Landmark staining in the adult and larval CNS. (a–d) Frontal view of an adult central brain and sog
labeled via nc82 antibody. (a) Anterior part of the brain. The antennal lobes (al) and vertical lobes of the mush-
room bodies (mb) are visible. (b, c) Anteromedial and posteromedial parts of the adult central brain. The ellip-
soid body (eb) is a landmark for the anteromedial brain region, while the fan-shaped body (fb) of the central
complex marks more posterior regions of the medial brain. (d) The posterior end of the adult brain comprises
the calyces (ca) of the mushroom bodies and the protocerebral bridge (pb) of the central complex. (e, h) Frontal
view of a larval central brain and sog labeled via choline acetyltransferase (ChAT) and Fasciclin II (Fas) antibod-
ies. (e) Anterior landmarks are the lateral appendices (la) and the antennal lobes (al). (f) The medial lobes (mL)
and peduncles (pd) of the mushroom bodies run from medial to posterior parts of the brain. (g, h) Posterior
regions include the calyces (ca) and medial appendices (ma) of the mushroom bodies and the dorsoposterior
commissure (DPC). (i–l) Dorsal–ventral sections of a larval abdominal ganglion labeled via ChAT and Fas.
(i) Most dorsal region of the larval VNC showing the Fas-positive transverse projections (TP1; arrow). (j–l) The
longitudinal fascicles project from anterior to posterior and allow a description of the dorsal to ventral and
medial to lateral position. Landgraf and colleagues [50] named the Fas-positive fascicles according to their
dorsoventral and mediolateral position (D dorsal, V ventral, L lateral, M medial). See also [44, 48–51, 54, 55]
and www.virtualflybrain.org and http://flybrain-ndb.iam.u-tokyo.ac.jp/. Scale bars: 50 μm
4.2 How to Present Even in times in which the size of neuroanatomical figures appears
IF Data to be inversely correlated with journal impact factor, it is worth to
follow some good old and simple rules:
● Do not show only the cell of interest, but also some surround-
ing so it is possible to understand where within the brain the
cell is situated.
● Insert a scale bar and give its dimension in the figure legend.
● For confocal pictures, mention in the figure legend whether
this is a single optical slice or a stack. If it is a stack, it is good
to mention how thick it is (μm in the z-axis); otherwise it is
impossible to judge whether two stainings overlap or are just
staggered one below the other.
● In case of expression patterns by a driver line (Gal4, LexA, QF,
etc.): show an overview picture at least in the supplementary
material to indicate the specificity of that line.
● In case of double/triple staining, show each channel separately
and then merged.
One issue that also deserves attention is the false coloring of
staining in figures shown in papers or at conferences. Everyone
appreciates the beauty of a nicely arborizing colored neuron, but in
fact differences in staining intensity are much easier to distinguish
(and also to print!) if the staining is depicted in gray scale. While
single staining is thus best shown in gray scale, color becomes
necessary in multiple staining. IF staining is usually captured by a
sensitive monochromatic camera, and then a false color is applied.
As old-world primates, humans with their trichromatic vision are
usually very good to see in the green and red range. Presenting a
double staining in green and red thus has the advantage that both
Fluorescent Labeling in the Fly Brain 55
Fig. 3 How scientists with dichromacy see false-colored double staining. (a) Dorsal view of a larval CNS
IF-stained against myoinhibitory peptide (a1, b1) and prohormone convertase 2 promotor-driven GFP (A2). The
peptide staining (PS) is false-colored in magenta (a1) or red (b1); GFP staining (PC2S) is false-colored in green
(a2). a1 and a2 are merged in (a3), leading to the color white at spots of co-localized staining. (a4) simulates
how a3 appears with protanope (red cones absent) vision. While the colors appear different, PS and PC2s can
still be well separated. The same can be said for deuteranope vision (green cones absent, not shown). b1 and
a2 are merged in (b2), leading to the color yellow at spots of co-localized staining. Unlike for the pair magenta/
green, the red/green double staining appears as only one staining both in deuteranope (b3) and protanope (b4)
vision. Scale bars = 50 μm. The simulations have been created by VisCheck (http://vischeck.com/), a useful
program to test color figures prior to publication
21. The most critical point is the fast and effective fixation of your
tissue. Therefore it might be helpful to test different concen-
trations of glutaraldehyde. But be aware that a high amount of
fixative might lead to a weak penetration of your antibodies,
which can be partly counterbalanced by a higher concentration
of Triton® X-100.
22. It is possible that some transmitters are rather quickly released.
In that case, we recommend preparing the tissue in fixative on
ice if you have the possibility to remove the developing vapor
by an exhauster/ventilation system.
23. The solution has to be prepared freshly each time. Make sure it
bubbles, as otherwise the sodium borohydride (NaBH4) will
become unreactive with time. Therefore, buy only a small
amount of NaBH4 and store appropriately.
24. Checking secondary antibody concentration is recommended
to be carried out at least once for each secondary antibody of a
given company. That way, money can be saved since the rec-
ommended working dilution is often very generously given.
25. Not to be confused with point mutations that “only” function-
ally eliminate the molecule of interest, while still leaving the
epitope intact.
26. For peptides, a concentration from 10−7 to 10−4 M is typically
used.
27. This is largely circumvented by multiphoton microscopy, as the
fluorochromes are only (fully) excited in the focal point.
28. XFP fluorescence is prone to bleaching and sensitive to pH.
Therefore, make sure you keep the samples absolutely dark,
avoid even small concentrations of alcohols in your solutions
and mounting medium, and make sure the pH of the mount-
ing medium is around 7.2. Even though under optimal
conditions XFP fluorescence is stable for some weeks, it is rec-
ommended to analyze the preparations as soon as possible.
29. Cameleons are originally designed as FRET-based calcium
sensors and carry two XFPs per molecule which likely increases
staining intensity.
30. If you do an IF staining against XFPs, make sure the secondary
antibody carries a fluorochrome that matches the XFP fluores-
cence (e.g., Alexa-Fluor® 488 and GFP) to intensify the auto-
fluorescence and to avoid cross talk with other secondary
antibodies in double staining.
31. More detailed information on this is provided by Okabe and
Ito (http://jfly.iam.u-tokyo.ac.jp/color/).
60 Mareike Selcho and Christian Wegener
Acknowledgment
References
1. Coons AH, Creech HJ, Jones RN et al (1942) mutants unable to synthesize serotonin.
The demonstration of pneumococcal antigen J Neurosci 6:1482–1491
in tissues by the use of fluorescent antibody. 11. Jan YN, Jan LY (1982) Genetic and immuno-
J Immunol 45:159–170 logical studies of the nervous system of
2. Livett BG (1978) Immunohistochemical local- Drosophila melanogaster. Neuropharmacology
ization of nervous system-specific proteins and of insects. Ciba foundation symposium 88.
peptides. Int Rev Cytol S7:53–235 Pitman, London, pp 221–239
3. Hökfelt T, Johansson O, Ljungdahl A et al 12. Pages M, Jimenez F, Ferrus A et al (1983)
(1980) Peptidergic neurons. Nature 284: Enkephalin-like immunoreactivity in Drosophila
515–521 melanogaster. Neuropeptides 4:87–98
4. Nässel DR (1996) Advances in the immunocy- 13. Fujita SC (1988) Use of hybridoma libraries in
tochemical localization of neuroactive sub- the study of the genetics and development of
stances in the insect nervous system. J Neurosci Drosophila. Annu Rev Entomol 33:1–15
Methods 69:3–23 14. Nässel DR, Ekström P (1997) Detection of
5. Storm-Mathisen J, Leknes A, Bore A et al neuropeptides by immunocytochemistry.
(1983) 1st visualization of glutamate and Methods Mol Biol 72:71–101
GABA in neurons by immunocytochemistry. 15. Eckert M, Ude J (1983) Immunocytochemical
Nature 301:517–520 techniques for the identification of peptidergic
6. Eckert M, Gersch M, Wagner M (1971) neurons. Functional neuroanatomy. Springer,
Immunologische Untersuchungen des neuro- Berlin, pp 268–301
endokrinen Systems von Insekten. II. Nachweis 16. Wu JS, Luo L (2006) A protocol for dissecting
von Gewebeantigenen des Gehirns und der Drosophila melanogaster brains for live
Corpora cardiaca von Periplaneta americana imaging or immunostaining. Nat Protoc 1:
mit fluorescein- und peroxydasemarkierten 2110–2115
Antikörpern. Zool Jb Physiol 76:29–35 17. Daul AL, Komori H, Lee C-Y (2010) Immu-
7. Eckert M (1973) Immunologische Untersu- nofluorescent staining of Drosophila larval
chungen des neuroendokrinen Systems von brain tissue. Cold Spring Harb Protoc 2010:
Insekten. III. Immunochemische Markierung pdb.prot5460
des neuroendokrinen Systems von Periplaneta 18. Helfrich-Förster C (2007) Immunohistoche-
americana durch Fraktionierung von gegen mistry in Drosophila. Sections and whole
Retrocerebralkomplexextrakten gewonnenen mounts. Methods Mol Biol 362:533–547
Antiseren. Zool Jb Physiol 77:50–59 19. Ostrovsky A, Cachero S, Jefferis G (2010)
8. Desai L, Adams R, Pothier L et al (1972) Clonal analysis of olfaction in Drosophila:
Immunofluorescent labeling of chromosomes immunochemistry and imaging of fly brains.
with antisera to histones and histone fractions. Cold Spring Harb Protoc 2013:342–346, pdb.
Exp Cell Res 70:468–471 prot071720
9. White K (1986) Neuropeptide-FMRFamide- 20. Hsiao H, Johnston RJ, Jukam D et al (2012)
like immunoreactivity in Drosophila: develop- Dissection and immunohistochemistry of lar-
ment and distribution. J Comp Neurol 247: val, pupal and adult Drosophila retinas. J Vis
430–438 Exp 69:e4347
10. Valles AM, White K (1986) Development of 21. Feng Y, Ueda A, Wu C-F (2004) A modified
serotonin-containing neurons in Drosophila minimal hemolymph-like solution, HL3.1, for
Fluorescent Labeling in the Fly Brain 61
51. Vömel M, Wegener C (2008) Neuroarchitecture 59. Zhang YQ, Rodesch CK, Broadie K (2002)
of aminergic systems in the larval ventral gan- Living synaptic vesicle marker: synaptotagmin-
glion of Drosophila melanogaster. PLoS One GFP. Genesis 34:142–145
3:e1848 60. Estes PS, Ho GL, Narayanan R et al (2000)
52. Nassif C, Noveen A, Hartenstein V (2003) Synaptic localization and restricted diffusion of
Early development of the Drosophila brain: a Drosophila neuronal synaptobrevin-green
III. The pattern of neuropile founder tracts fluorescent protein chimera in vivo. J Neuro-
during the larval period. J Comp Neurol genet 13:233–255
455:417–434 61. Rolls MM, Satoh D, Clyne PJ et al (2007)
53. Ito K (2003) Cautionary observations on pre- Polarity and intracellular compartmentaliza-
paring and interpreting brain images using tion of Drosophila neurons. Neural Dev 2:7
molecular biology-based staining techniques. 62. Schmid A, Hallermann S, Kittel RJ et al (2008)
Microsc Res Tech 62:170–186 Activity-dependent site-specific changes of
54. Milyaev N, Osumi-Sutherland D, Reeve S et al glutamate receptor composition in vivo. Nat
(2012) The virtual fly brain browser and query Neurosci 11:659–666
interface. Bioinformatics 28:411–415 63. Owald D, Fouquet W, Schmidt M et al (2010)
55. Selcho M, Pauls D, el Jundi B et al (2012) The A Syd-1 homologue regulates pre- and post-
role of octopamine and tyramine in Drosophila synaptic maturation in Drosophila. J Cell Biol
larval locomotion. J Comp Neurol 520: 188:565–579
3764–3785 64. Nicolaï LJJ, Ramaekers A, Raemaekers T et al
56. Pfeiffer BD, Ngo T-TB, Hibbard KL et al (2010) Genetically encoded dendritic marker
(2010) Refinement of tools for targeted sheds light on neuronal connectivity in
gene expression in Drosophila. Genetics 186: Drosophila. Proc Natl Acad Sci U S A 107:
735–755 20553–20558
57. Ritzenthaler S, Suzuki E, Chiba A (2000) 65. Wang J, Ma X, Yang JS et al (2004) Transmem-
Postsynaptic filopodia in muscle cells interact brane/juxtamembrane domain-dependent Dscam
with innervating motoneuron axons. Nat distribution and function during mushroom body
Neurosci 3:1012–1017 neuronal morphogenesis. Neuron 43:663–672
58. Robertson K, Mergliano J, Minden JS (2003) 66. Leiss F, Koper E, Hein I et al (2009)
Dissecting Drosophila embryonic brain devel- Characterization of dendritic spines in the
opment using photoactivated gene expression. Drosophila central nervous system. Dev Neuro-
Dev Biol 260:124–137 biol 69:221–234
Chapter 3
Abstract
Here we present two protocols developed to investigate the spatial distribution and relationship of neuro-
active substances in the nervous tissues of cephalopod molluscs. The protocols are designed for frozen and
vibratome sections of the Octopus vulgaris brain, but are easily transferable to other cephalopod species and
tissues, and are also specifically designed to detect small molecules such as monoamines. One of the two
protocols has been adjusted to process paraformaldehyde-fixed tissues, while the second is designed for
tissues that require glutaraldehyde fixation.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_3, © Springer Science+Business Media New York 2015
63
64 Giovanna Ponte and Graziano Fiorito
In order to explore how much was added over the last 30 years,
we carried out a short pilot survey of published research involving
cephalopods linked to the molecules listed in Messenger’s account.
The survey was based on full original papers (not reviews or
abstracts) indexed by Web of Science and PubMed and published
between 1996 and August 2012. The query returned 316 papers
focusing, for example, on acetylcholine, dopamine, serotonin (5-
HT), GABA, and glutamate. It is noteworthy to report that the
use of these search criteria did not originate any study published on
OA after 1996. Each record was then annotated to count the num-
ber of papers for each of the molecules considered [37].
1.1 Immuno- Several studies accounting for the presence and/or role of differ-
histochemistry ent molecules in cephalopods published over the last 20 years [37]
and Cephalopods are based on immunohistochemistry.
Although the working principle for immunohistochemistry
existed since the 1930s, it is only in the 1941 that the first study
using this approach appeared [38].
Despite this long-standing use in science, it is only after more
than 40 years of the original study [38] that immunohistochemis-
try was applied to study the distribution of the 5-HT in the brain
of octopus [39].
Table 1 summarizes the most representative studies that uti-
lized an immunohistochemical approach in different species of
cephalopods. The works included herein have been published after
the monumental review by Messenger [31], with the sole excep-
tion of a study on 5-HT [39]. The chronological account utilized
in Table 1 is preferred to other sorting criteria, since it is out of the
aims of this chapter to review such information and to provide an
overview of the distribution of different modulators and other pro-
teins studied in different tissues in several cephalopod species. The
table only serves as an annotated index of the available literature.
Despite the studies carried out in recent years, a precise local-
ization of modulators and small molecules within the brain of
cephalopod species is still missing. In this chapter, we present two
different protocols developed to investigate the spatial distribution
and relationship of neuroactive substances in the nervous tissues of
cephalopods. These are designed for frozen and vibratome sections
of Octopus vulgaris brain but may be applied with little variations
to other species/tissues and are also specifically designed to detect
small molecules such as monoamines.
One of the two protocols presented here has been adjusted to
process paraformaldehyde-fixed tissues while the second for tissues
that require glutaraldehyde fixation since the primary antibodies
utilized are developed with immunogens obtained by coupling
small molecules (e.g., neurotransmitters) with carrier proteins (for
details see 40). The techniques described herein are based on those
Table 1
Chronological overview of studies carried out on cephalopods that have utilized immunohistochemical methods (not exhaustive list)
Fixatives and
Species Samples Antibodies Conjugation Methods processing Refs.
Octopus vulgaris Brain Anti-serotonin (p) BTG or BSA with PAP PFA 4 %; PF [39]
FA
Alloteuthis subulata, Skin Anti-l-glutamate (p) BSA with GA PAP 1 % PFA and 1 % [48]
Loligo vulgaris, Anti-serotonin (p) BSA with PFA GA; WM
Lolliguncula brevis
Octopus vulgaris Brain Anti-FMRF-amide (p) ABC; FLUO Bouin; PF [49]
Anti-GnRH (p)a
Anti-mammalian
GnRH (m)
Sepia officinalis Brain Anti-rat neuronal NOS (p)b OVA ABC Bouin; PF [50]
Anti-NMDAR1 (p)
Anti-NMDAR2/3 (p)
Anti-rat neuronal NOS (p)c KLH
Octopus vulgaris Optic lobes Anti-galanin (p) ABC; FLUO PFA 4 % and 0.2 % [51]
Anti-5-HT (p) PA; CT
Sepia officinalis Brain Anti-rat neuronal NOS (p)b OVA ABC Bouin; PF [52]
Sepia officinalis Brain, fin Anti-FMRF-amide (p) ABC; FLUO PFA 4 %; CT [53]
Anti-glutamate (m)
Idiosepius Hatchlings, Anti-acetylated ABC; FLUO PFA 4 % or Bouin; [54]
paradoxus juveniles, α-tubulin (m) WMe and PF
adults
Octopus vulgaris Ovary, oviducts, Anti-estradiol-17B ABC; FLUO PFA 4 % or PFA 4 % [55]
hepatopancreas receptor (p) with 0.5 % GA; CT
and PF
(continued)
Table 1
(continued)
Fixatives and
Species Samples Antibodies Conjugation Methods processing Refs.
Sepia officinalis Optic lobes Anti-FMRF-amide (p) ABC PFA 4 %; (ND) [56]
Sepia officinalis Central heart Anti-5-HT (p) PAP PFA 4 %; PF [57]
Octopus vulgaris CNS, heart, Anti-ovGnRH (p) FLUO PFA 4 %; CT [58]
oviducal gland,
oviduct
Sepia officinalis Ink gland Anti-DA (p) PAP 5 % GA with 1 % [59]
SMB; CT
Sepia officinalis Brain Anti-mammalian NKA A (p) HSA FLUO PFA 4 %; CT [41]
Anti-5-HT (m) BSA
Octopus vulgaris Brain Anti-calretinin (p)d PAP Bouin; PF [60]
Idiosepius notoides Brain Anti-FMRF-amide (ND) FLUO PFA 4 %; VT [61]
Loligo opalescens, Embryos, hatchlings Anti-tubuline FLUO PFA 4 % or ice-cold [62]
Octopus Anti-FMRF-amide methanol; WM and
vulgaris, Anti-5-HT (ND)
Octopus Anti-SCP (m)f
rubescens Anti-LHRHg
Anti-TGnRH (p)h
Octopus vulgaris Eyes, optic lobes Anti-cChAT (p)i ABC PFA 4 % and 0.2 % [63]
PA; CT
Loligo vulgaris, Embryos, hatchlings, Anti-acetylated FLUO PFA 4 %; VT [64]
Sepia officinalis, brain of adults α-tubulin (m)
Argonauta Anti-F-actin (ND) phalloidin Alexa Fluor 488
argo, Idiosepius Anti-FMRF-amide (p)
notoides,
Euprymna scolopes
Octopus vulgaris Optic lobes Anti-NMDAR 2A and FLUO Bouin; PF [65]
anti-NMDAR 2B (p)
Anti-oct-GnRH (p)
Sepia officinalis Brain Anti-oct-GnRH (p) PAP; FLUO Bouin; PF [66]
Sepia officinalis Brain Anti-oxytocin BSA FLUO PFA 4 %; CT [67]
Anti-Arg8-vasopressin BSA
Euprymna scolopes Juvenile Anti-C3 (p) j OVA FLUO PFA 4 %; WM and [68]
(ND)
Sepia officinalis Embryos Anti-acetylated α-tubulin (m) ABC 3.7 % PFA; WM [69]
Anti-TH (m)
Idiosepius notoides Embryos, brain of adults Anti-5-HT (p) FLUO PFA 4 %; WM and VT [70]
Anti-acetylated α-tubulin (m)
Loligo vulgaris, Embryos, hatchlings Anti-Na+/K+-ATPase α1 (p)k FLUO Bouin; PF [71]
Sepia officinalis
Octopus vulgaris, Embryos, hatchlings Anti-5-HT (p) FLUO PFA 4 %; VT [72]
Argonauta Anti-FMRF-amide (p)
hians Anti-acetylated α-tubulin (m)
Idiosepius notoides, Embryos, hatchlings, Anti-VD1/RPD2 α1-peptide FLUO PFA 4 %; WM and VT [73]
Euprymna adults (p)l
scolopes, Anti-acetylated α-tubulin (m)
Sepioteuthis
australis, Loligo
vulgaris,
Octopus vulgaris
Octopus vulgaris Brain Anti-cChAT (p)i ABC PFA 4 % and 0.2 % PA; CT [74]
n
Sepia pharaonis Optic lobes Anti-NR2A (p) PAP 4 % PFA and 5 % GA; CT [75]
(continued)
Table 1
(continued)
Fixatives and
Species Samples Antibodies Conjugation Methods processing Refs.
3 Procedures
3.1.2 Immunostaining All passages are carried out at room temperature unless otherwise
stated.
First Day
Prepare a humidified chamber or a Falcon BioDish with filter paper
and place slides inside. Allow sections to equilibrate at room tem-
perature at least 1 h, then outline specimens with a PapPen, and
allow drying. Wash sections with PBST 3 times for 10 min each
and incubate with blocking solution for 90 min, followed by over-
night incubation at 4 °C in primary antibodies diluted at optimal
titer with antibody diluent solution (see Note 3) in humid
atmosphere.
Second Day
Wash sections with PBST 6 times for 10 min each and incubate
with the secondary antibodies 1:250 in PBST for 90 min. Protect
slides from light from this step on. Wash sections with PBST three
times for 10 min each and then incubate with DAPI working solu-
tion for 15 min. Finally, wash sections with PBST six times for
10 min each and mount slides with Fluoromount™. Once mounted
remember to seal each slide with nail polish.
3.2.2 Immunostaining All passages are carried out at room temperature unless otherwise
stated.
First Day
Wash free-floating sections in Tris–HCl-SMB for 15 min and treat
them for 10 min with the bleaching solution. Then wash with Tris–
HCl-SMB-Triton® for 10 min and incubate in blocking solution
overnight at 4 °C with gentle shaking.
Second Day
Remove the blocking solution and incubate with primary antibodies
diluted at optimal titer in diluent solution for 3 days at 4 °C with
gentle shaking. See Note 3.
Sixth Day
Remove the primary antibody and wash six times for 20 min each
in Tris–HCl-Triton®. Then incubate with secondary antibody
diluted at optimal titer in diluent solution overnight at 4 °C with
gentle shaking. See Note 3.
Seventh Day
Remove the secondary antibody solution and wash 6 times for
20 min each in Tris–HCl-Triton®. Incubate with DAPI working
solution for 30 min, and wash extensively 6 × 20 min each using
Tris–HCl- Triton®. See Note 8.
Mount the slices on Superfrost™ Plus slides, cover with
Fluoromount™, and seal slides with nail polish.
4 Typical/Anticipated Results
References
1. Huffard CL (2013) Cephalopod neurobiology: 10. Nixon M, Young JZ (2003) The brains and
an introduction for biologists working in other lives of Cephalopods. Oxford University,
model systems. Invert Neurosci 13:11–18 New York, 392 p
2. Borrelli L., Fiorito G (2008) Behavioral analy- 11. Young JZ (1971) The anatomy of the nervous
sis of learning and memory in cephalopods. In: system of Octopus vulgaris. Oxford University
Byrne JJ (Editor-in-Chief) Learning and mem- Press, London, 690 p
ory: a comprehensive reference. Academic, 12. Fiorito G, Scotto P (1992) Observational
Oxford, pp 605–627 learning in Octopus vulgaris. Science
3. Hochner B (2012) An embodied view of octo- 256:545–547
pus neurobiology. Curr Biol 22:R887–R892 13. Edelman DB, Seth AK (2009) Animal con-
4. Clarke MR (1988) Evolution of recent cepha- sciousness: a synthetic approach. Trends
lopods—a brief review. In: Clarke MR, Neurosci 32:476–484
Trueman ER (eds) The Mollusca. Paleontology 14. Laschi C, Cianchetti M, Mazzolai B et al
and neontology of cephalopods. Academic, (2012) Soft robot arm inspired by the octo-
San Diego, pp 331–340 pus. Adv Robot 26:709–727
5. Grasso FW, Basil JA (2009) The evolution of 15. Fiorito G, Affuso A, Anderson DB et al (2014)
flexible behavioral repertoires in cephalopod Cephalopods in neuroscience: regulations,
molluscs. Brain Behav Evol 74:231–245 research and the 3Rs. Invert Neurosci
6. Brown ER, Piscopo S (2013) Synaptic plastic- 14:13–36
ity in cephalopods; more than just learning and 16. Smith JA, Andrews PLR, Hawkins P et al
memory? Invert Neurosci 13:35–44 (2013) Cephalopod research and EU directive
7. Borrelli L (2007) Testing the contribution of 2010/63/EU: requirements, impacts and
relative brain size and learning capabilities on ethical review. J Exp Mar Biol Ecol
the evolution of Octopus vulgaris and other 447:31–45
cephalopods [dissertation]. Stazione Zoologica 17. Catterall WA, Raman IM, Robinson HPC et al
Anton Dohrn, Napoli, Italy; Open University, (2012) The Hodgkin-Huxley Heritage: from
London, UK, 451 p channels to circuits. J Neurosci
8. Packard A (1972) Cephalopods and fish: the 32:14064–14073
limits of convergence. Biol Rev 47:241–307 18. Vandenberg JI, Waxman SG (2012) Hodgkin
9. Young JZ (1963) The number and sizes of and Huxley and the basis for electrical signal-
nerve cells in Octopus. Proc Zool Soc Lond ling: a remarkable legacy still going strong. J
140:229–254 Physiol 590:2569–2570
Immunocytochemistry in Octopus Brain 77
19. Forsythe ID, Wu CL, Borst JGG (2013) Size 36. Kime DE, Messenger JB (1990) Monoamines
matters: formation and function of giant syn- in the cephalopod CNS—an HPLC analysis.
apses. J Physiol 591:3123 Comp Biochem Physiol C Pharmacol Toxicol
20. Schwiening CJ (2012) A brief historical per- Endocrinol 96:49–57
spective: Hodgkin and Huxley. J Physiol 37. Ponte G, Dröscher A, Fiorito G (2013)
590:2571–2575 Fostering cephalopod biology research: past
21. Young JZ (1995) Multiple matrices in the and current trends and topics. Invert Neurosci
memory system of Octopus. In: Abbott JN, 13:1–9
Williamson R, Maddock L (eds) Cephalopod 38. Coons AH, Creech HJ, Jones RN (1941)
neurobiology. Oxford University Press, Immunological properties of an antibody con-
Oxford, pp 431–443 taining a fluorescent group. Exp Biol Med
22. Young JZ (1991) Computation in the learning 47:200–202
system of cephalopods. Biol Bull 180:200–208 39. Uemura T, Yamashita T, Haga C et al (1987)
23. Hochner B, Shomrat T, Fiorito G (2006) The Localization of serotonin-immunoreactivity in
octopus: a model for a comparative analysis of the central nervous system of Octopus vulgaris by
the evolution of learning and memory mecha- immunohistochemistry. Brain Res 406:73–86
nisms. Biol Bull 210:308–317 40. Huisman H, Wynveen P, Setter PW (2010)
24. Altman JS (1971) Control of accept and reject Studies on the immune response and prepara-
reflexes in the octopus. Nature 229:204–206 tion of antibodies against a large panel of con-
25. Sumbre G, Fiorito G, Flash T et al (2006) jugated neurotransmitters and biogenic
Octopuses use a human-like strategy to con- amines: specific polyclonal antibody response
trol precise point-to-point arm movements. and tolerance. J Neurochem 112:829–841
Curr Biol 16:767–772 41. Boyer C, Maubert E, Charnay Y et al (2007)
26. Sumbre G, Fiorito G, Flash T et al (2005) Distribution of neurokinin A-like and sero-
Motor control of flexible octopus arms. Nature tonin immunoreactivities within the vertical
433:595–596 lobe complex in Sepia officinalis. Brain Res
1133:53–66
27. Sumbre G, Gutfreund Y, Fiorito G et al (2001)
Control of octopus arm extension by a periph- 42. Kononenko NL, Wolfenberg H, Pfluger HJ
eral motor program. Science 293:1845–1848 (2009) Tyramine as an independent transmit-
ter and a precursor of octopamine in the
28. Sanders GD (1975) The cephalopods. In: Locust central nervous system: an immunocy-
Corning WC, Dyal JA, Willows AOD (eds) tochemical study. J Comp Neurol
Invertebrate learning. Cephalopods and echi- 512:433–452
noderms. Plenum, New York, NY, pp 1–101
43. Grimaldi AM, Agnisola C, Fiorito G (2007)
29. Hochner B, Brown ER, Langella M et al Using ultrasound to estimate brain size in the
(2003) A learning and memory area in the cephalopod Octopus vulgaris Cuvier in vivo.
octopus brain manifests a vertebrate-like long- Brain Res 1183:66–73
term potentiation. J Neurophysiol
90:3547–3554 44. Ponte G, Fiorito G, Edelman D (2010)
Distribution of GABAergic neuronal popula-
30. Gray EG, Young JZ (1964) Electron micros- tions in the nervous system of Octopus vul-
copy of synaptic structure of octopus brain. J garis: an immunofluorescence study. Annual
Cell Biol 21:87–103 meeting society for neuroscience San Diego,
31. Messenger JB (1996) Neurotransmitters of USA, 17–21 Nov 2010
cephalopods. Invert Neurosci 2:95–114 45. Ponte G, Edelman D, Fiorito G (2011) Anti-
32. Messenger JB (1979) The nervous system of Hrp epitope in Octopus vulgaris neural tissue:
Loligo IV. The peduncle and olfactory lobes. the first among lophtrochozoans. J Shellfish
Phil Trans R Soc Lond B 285:275–309 Res 30:1018
33. Ponte G (2012) Distribution and preliminary 46. Hobbs MJ, Young JZ (1973) Cephalopod cer-
functional analysis of some modulators in the ebellum. Brain Res 55:424–430
cephalopod mollusc Octopus vulgaris [disserta- 47. Messenger JB, Tansey EM (1979) Aminergic
tion]. Università della Calabria, Italy; Stazione fluorescence in the cephalopod cerebellum. J
Zoologica Anton Dohrn, Napoli, Italy, 110 p Physiol 287:7–8
34. Tansey EM (1979) Neurotransmitters in the 48. Messenger JB, Cornwell CJ, Reed CM (1997)
cephalopod brain. Comp Biochem Physiol C l-glutamate and serotonin are endogenous in
Pharmacol Toxicol Endocrinol 64:173–182 squid chromatophore nerves. J Exp Biol
35. Tansey EM (1978) A histochemical study of 200:3043–3054
the cephalopod brain [dissertation]. University 49. Di Cosmo A, Di Cristo C (1998)
of Sheffield, UK, 169 p Neuropeptidergic control of the optic gland of
78 Giovanna Ponte and Graziano Fiorito
Octopus vulgaris: FMRF-amide and GnRH 60. Altobelli GG, Cimini V (2007) Calretinin dis-
immunoreactivity. J Comp Neurol 398:1–12 tribution in the octopus brain: an immunohis-
50. Palumbo A, Di Cosmo A, Poli A et al (1999) tochemical and in situ hybridization
A calcium/calmodulin-dependent nitric oxide histochemical analysis. Brain Res 1132:71–77
synthase, NMDAR2/3 receptor subunits, and 61. Wollesen T, Loesel R, Wanninger A (2008)
glutamate in the CNS of the cuttlefish Sepia FMRFamide-like immunoreactivity in the cen-
officinalis: localization in specific neural path- tral nervous system of the cephalopod mollusc,
ways controlling the inking system. J Idiosepius notoides. Acta Biol Hung
Neurochem 73:1254–1263 59:111–116
51. Suzuki H, Yamamoto T, Inenaga M et al 62. Mackie GO (2008) Immunostaining of
(2000) Galanin-immunoreactive neuronal sys- peripheral nerves and other tissues in whole
tem and colocalization with serotonin in the mount preparations from hatchling cephalo-
optic lobe and peduncle complex of the octo- pods. Tissue Cell 40:21–29
pus (Octopus vulgaris). Brain Res 63. D'Este L, Kimura S, Casini A et al (2008) First
865:168–176 visualization of cholinergic cells and fibers by
52. Di Cosmo A, Di Cristo C, Palumbo A et al immunohistochemistry for choline acetyltrans-
(2000) Nitric oxide synthase (NOS) in the ferase of the common type in the optic lobe
brain of the cephalopod Sepia officinalis. J and peduncle complex of Octopus vulgaris. J
Comp Neurol 428:411–427 Comp Neurol 509:566–579
53. Loi PK, Tublitz NJ (2000) Roles of glutamate 64. Wollesen T, Loesel R, Wanninger A (2009)
and FMRFamide-related peptides at the chro- Pygmy squids and giant brains: mapping the
matophore neuromuscular junction in the complex cephalopod CNS by phalloidin stain-
cuttlefish, Sepia officinalis. J Comp Neurol ing of vibratome sections and whole-mount
420:499–511 preparations. J Neurosci Methods 179:63–67
54. Shigeno S, Yamamoto M (2002) Organization 65. Di Cristo C, De Lisa E, Di Cosmo A (2009)
of the nervous system in the pygmy cuttlefish, Control of GnRH expression in the olfactory
Idiosepius paradoxus Ortmann (Idiosepiidae, lobe of Octopus vulgaris. Peptides
Cephalopoda). J Morphol 254:65–80 30:538–544
55. Di Cosmo A, Di Cristo C, Paolucci M (2002) 66. Di Cristo C, De Lisa E, Di Cosmo A (2009)
A estradiol-17 beta receptor in the reproduc- GnRH in the brain and ovary of Sepia officina-
tive system of the female of Octopus vulgaris: lis. Peptides 30:531–537
characterization and immunolocalization. Mol 67. Bardou I, Maubert E, Leprince J et al (2009)
Reprod Dev 61:367–375 Distribution of oxytocin-like and vasopressin-
56. Chrachri A, Williamson R (2003) Modulation like immunoreactivities within the central ner-
of spontaneous and evoked EPSCs and IPSCs vous system of the cuttlefish, Sepia officinalis.
in optic lobe neurons of cuttlefish Sepia offici- Cell Tissue Res 336:249–266
nalis by the neuropeptide FMRF-amide. Eur J 68. Castillo MG, Goodson MS, McFall-Ngai M
Neurosci 17:526–536 (2009) Identification and molecular character-
57. Lehr T, Schipp R (2004) Serotonergic regula- ization of a complement C3 molecule in a
tion of the central heart auricles of Sepia offici- lophotrochozoan, the Hawaiian bobtail squid
nalis L. (Mollusca, Cephalopoda). Comp Euprymna scolopes. Dev Comp Immunol
Biochem Physiol A Mol Integr Physiol 33:69–76
138:69–77 69. Baratte S, Bonnaud L (2009) Evidence of early
58. Iwakoshi-Ukena E, Ukena K, Takuwa-Kuroda nervous differentiation and early catechol-
K et al (2004) Expression and distribution of aminergic sensory system during Sepia offici-
octopus gonadotropin-releasing hormone in nalis embryogenesis. J Comp Neurol
the central nervous system and peripheral 517:539–549
organs of the octopus (Octopus vulgaris) by in 70. Wollesen T, Degnan BM, Wanninger A (2010)
situ hybridization and immunohistochemistry. Expression of serotonin (5-HT) during CNS
J Comp Neurol 477:310–323 development of the cephalopod mollusk,
59. Fiore G, Poli A, Di Cosmo A et al (2004) Idiosepius notoides. Cell Tissue Res
Dopamine in the ink defence system of Sepia 342:161–178
officinalis: biosynthesis, vesicular compartmen- 71. Hu MY, Sucre E, Charmantier-Daures M et al
tation in mature ink gland cells, nitric oxide (2010) Localization of ion-regulatory epithe-
(NO)/cGMP-induced depletion and fate in lia in embryos and hatchlings of two cephalo-
secreted ink. Biochem J 378:785–791 pods. Cell Tissue Res 339:571–583
Immunocytochemistry in Octopus Brain 79
72. Wollesen T, Sukhsangchan C, Seixas P et al mate receptors in the optic lobe of cuttlefish,
(2012) Analysis of neurotransmitter distribu- Sepia pharaonis. J Exp Mar Biol Ecol
tion in brain development of benthic and 447:86–92
pelagic octopod cephalopods. J Morphol 76. Kobayashi S, Takayama C, Ikeda Y (2013)
273:776–790 Distribution of glutamic acid decarboxylase
73. Wollesen T, Nishiguchi MK, Seixas P et al immunoreactivity within the brain of oval
(2012) The VD1/RPD2 alpha 1-neuropep- squid Sepioteuthis lessoniana. Aquat Biol
tide is highly expressed in the brain of cephalo- 19:97–109
pod mollusks. Cell Tissue Res 348:439–452 77. Burbach JP, Grant P, Hellemons AJCG et al
74. Casini A, Vaccaro R, D'Este L et al (2012) (2014) Differential expression of the FMRF
Immunolocalization of choline acetyltransfer- gene in adult and hatchling stellate ganglia of
ase of common type in the central brain mass the squid Loligo pealei. Biol Open 3:50–58
of Octopus vulgaris. Eur J Histochem 78. Sakaue Y, Bellier JP, Kimura S et al (2014)
56:215–222 Immunohistochemical localization of two
75. Lee YH, Chang YC, Yan HY et al (2013) Early types of choline acetyltransferase in neurons
visual experience of background contrast and sensory cells of the octopus arm. Brain
affects the expression of NMDA-like gluta- Struct Funct 219:323–341
Chapter 4
Abstract
Understanding how the brain processes information requires detailed knowledge on a wiring diagram of
its underlying neuronal circuits. Zebrafish is a fascinating model vertebrate for connectivity mapping of the
brain because this organism is amenable to genetic techniques, is transparent during early larval stages, and
has a small brain in terms of physical size and number of neurons. Here we detail a protocol for genetic
sparse labeling and immunofluorescence detection of neurons in zebrafish larvae. The method consists of
microinjection of Gal4/UAS constructs into fertilized eggs, screening of larvae carrying a few labeled
neurons, and immunohistochemistry of whole-mount brains. This protocol facilitates high-resolution
imaging of individual neurons, which will be useful for deciphering wiring diagrams in the zebrafish brain.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_4, © Springer Science+Business Media New York 2015
81
82 Nobuhiko Miyasaka et al.
3 Procedures
3.1 Microinjection Pull glass capillaries with a standard micropipette puller. Break the
tip of the micropipette using a pair of forceps under a dissection
microscope. Generally, ~5 μm tip gives a good result. Sharpen the
tip with a micropipette grinder. Prepare several pipettes and store
them on dental wax laid in a plastic Petri dish. Backfill a micropi-
pette with a microinjection solution containing Gal4 driver and
UAS reporter constructs by using a Microloader tip. The microin-
jection solution should be spun in a microcentrifuge for 1 min to
remove any particulates before loading.
Collect recently fertilized eggs (Fig. 1b), which are produced
by natural spawning, every 10 or 15 min after the light has come
on in the morning. Transfer the embryos into grooves of the
microinjection plate (Fig. 1c) with a plastic Pasteur pipette and
remove as much water as possible, but keep them moist during
injection (Fig. 1d). Approximately 60 embryos can be lined up as
one injection batch. Keep the rest of embryos in a Petri dish at
18 °C in an incubator for later use. See Note 4.
Orient the embryos with a shortened Microloader tip so that
the blastomere is perpendicular to the tip of micropipette (Fig. 1e).
Make a discharge pressure by pushing the syringe plunger to ensure
that the micropipette is not blocked. A small drop should appear at
the tip of micropipette, but if not, simply dipping the tip in water
may remove the blockage.
86 Nobuhiko Miyasaka et al.
Fig. 1 Microinjection of zebrafish embryos. (a) A typical setup for microinjection. (b) Recently fertilized eggs.
The insets show early (left) and late (right) phases of one-cell-stage embryos. (c) Microinjection plate: an
acrylic plate with V-shaped grooves for holding embryos. (d) One-cell-stage embryos are arrayed in the
grooves for microinjection. Scale bar, 2 mm. (e) DNA constructs are injected into an embryo by penetrating the
blastomere with the micropipette through the chorion. Scale bar, 200 μm
3.3 Immuno- Anesthetize larvae in 0.016 % tricaine and then fix in 10 % formalin
histochemistry in PBS (~3.7 % formaldehyde) (see Note 10) for 1–2 h at RT with
of Whole-Mount gentle agitation on a rocking platform. After fixation, wash the
Brains larvae in PBSTw for 3 × 5 min, and store at 4 °C. It is recom-
mended to move on to the next step within a week after fixation
because the larvae become more fragile with time.
Dissect out brains of the fixed larvae with fine forceps on a
silicone-coated base of glass Petri dish filled with PBSTw. Expect
some training to be necessary before brains are obtained without
damage. Store in PBSTw at 4 °C until use.
Immerse brains in PBDTx overnight at 4 °C and treat with
10 % NGS in PBDTx for 1–3 h at RT or overnight at 4 °C to block
nonspecific binding sites, and then incubate with primary antibod-
ies diluted in 5 % NGS/PBDTx for 3–7 days at 4 °C. See Note 11.
Transfer brains into a mesh-bottomed insert (Netwell) of
12-well plate filled with PBDTx (Fig. 2a).
Wash the brains thoroughly over a day in PBDTx with gentle
agitation at RT. The actual length for each wash is not critical, but
change the buffer at least five times by transferring the Netwell
insert from one well to the next (Fig. 2a).
Treat with fluorescent dye-conjugated secondary antibodies
diluted in 5 % NGS/PBDTx for 1–3 days at 4 °C. From this step
forward, samples should be protected from light. Wash as above in
PBDTx, and store in PBSTw at 4 °C.
88 Nobuhiko Miyasaka et al.
Fig. 2 Washing and mounting of brains. (a) Immunostained brains are washed in mesh-bottomed inserts of
12-well plates on a rocking platform. The inset shows top and bottom views of the insert. (b) An immunos-
tained brain is mounted in LMP agarose on a glass coverslip for confocal imaging. (c) The brain embedded in
LMP agarose. Scale bar, 2 mm. The inset is a closeup dorsal view of the brain. Anterior is to the top
3.4 Mounting Transfer an immunostained brain onto a glass coverslip and remove
of Brains for Confocal as much liquid as possible with a small piece of filter paper (Fig. 2b).
Imaging Overlay the brain with 2 % LMP agarose, orient it quickly with a
pair of forceps to the desired direction, and leave the brain at RT
until the agarose solidifies (Fig. 2b, c).
Perform three-dimensional imaging of a ROI through confo-
cal microscopy. It is important to optimize imaging conditions by
test experiments, including laser power, detector sensitivity, pixel
size, magnification, and distance of individual sections along z-axis.
After imaging, pipette a droplet of PBSTw onto the agarose,
carefully remove the brain from the agarose with forceps, and store
in PBSTw at 4 °C. Repeat this process, mounting each brain indi-
vidually and imaging it.
Fluorescence Techniques in Zebrafish 89
4 Typical/Anticipated Results
Fig. 3 Visualization of olfactory bulb neurons at single-cell resolution. A whole-mount brain carrying a single-
labeled neuron in the olfactory bulb is stained with anti-GFP (a; green in b) and anti-SV2 (magenta in b) anti-
bodies. Confocal Z-stack images of the forebrain are shown in dorsal view with anterior to the top. OB olfactory
bulb, Tel telencephalon, rHb right habenula. Scale bar, 30 μm
90 Nobuhiko Miyasaka et al.
References
1. Lichtman JW, Sanes JR (2008) Ome sweet ome: essential functions in the development of the
what can the genome tell us about the connec- zebrafish, Danio rerio. Development 123:1–36
tome? Curr Opin Neurobiol 18:346–353 11. Driever W, Solnica-Krezel L, Schieret AF et al
2. White JG, Southgate JG, Thomson E et al (1996) A genetic screen for mutations affect-
(1986) The structure of the nervous system of ing embryogenesis in zebrafish. Development
the nematode Caenorhabditis elegans. Philos 123:37–46
Trans R Soc Lond B Biol Sci 314:1–340 12. Nasevicius A, Ekker SC (2000) Effective tar-
3. Varshney LR, Chen BL, Paniagua E et al geted gene ‘knockdown’ in zebrafish. Nat
(2011) Structural properties of the Genet 26:216–220
Caenorhabditis elegans neuronal network. 13. Asakawa K, Kawakami K (2008) Targeted
PLoS Comput Biol 7:e1001066 gene expression by the Gal4-UAS system in
4. Chklovskii DB, Vitaladevuni S, Scheffer LK zebrafish. Dev Growth Differ 50:391–399
(2010) Semi-automated reconstruction of 14. Mosimann C, Zon LI (2011) Advanced
neural circuits using electron microscopy. Curr zebrafish transgenesis with Tol2 and applica-
Opin Neurobiol 20:667–675 tion for Cre/lox recombination experiments.
5. Helmstaedter M (2013) Cellular-resolution Methods Cell Biol 104:173–194
connectomics: challenges of dense neural circuit 15. Kawakami K, Takeda H, Kawakami N et al
reconstruction. Nat Methods 10:501–507 (2004) A transposon-mediated gene trap
6. Ramón y Cajal S (1995) Histology of the ner- approach identifies developmentally regulated
vous system of man and vertebrates. Oxford genes in zebrafish. Dev Cell 7:133–144
University Press, New York, NY (trans: 16. Asakawa K, Suster ML, Mizusawa K et al
Swanson N., Swanson L.W.) (2008) Genetic dissection of neural circuits by
7. Cowan WM (1998) The emergence of mod- Tol2 transposon-mediated Gal4 gene and
ern neuroanatomy and developmental neuro- enhancer trapping in zebrafish. Proc Natl Acad
biology. Neuron 20:413–426 Sci U S A 105:1255–1260
8. Luo L, Callaway EM, Svoboda K (2008) 17. Koide T, Miyasaka N, Morimoto K et al (2009)
Genetic dissection of neural circuits. Neuron Olfactory neural circuitry for attraction to
57:634–660 amino acids revealed by transposon-mediated
9. Friedrich RW, Jacobson GA, Zhu P (2010) gene trap approach in zebrafish. Proc Natl
Circuit neuroscience in zebrafish. Curr Biol Acad Sci U S A 106:9884–9889
20:R371–R381 18. Hisano Y, Ota S, Kawahara A (2014) Genome
10. Haffter P, Granato M, Brand M et al (1996) editing using artificial site-specific nucleases in
The identification of genes with unique and zebrafish. Dev Growth Differ 56:26–33
92 Nobuhiko Miyasaka et al.
19. Schmid B, Haass C (2013) Genomic editing brain centers: genetic visualization of secondary
opens new avenues for zebrafish as a model for olfactory pathways in zebrafish. J Neurosci 29:
neurodegeneration. J Neurochem 127:461–470 4756–4767
20. Norton W, Bally-Cuif L (2010) Adult zebraf- 25. Tay TL, Ronneberger O, Ryu S et al (2011)
ish as a model organism for behavioural genet- Comprehensive catecholaminergic projectome
ics. BMC Neurosci 11:90 analysis reveals single-neuron integration of
21. Guo S, Wagle M, Mathur P (2012) Toward zebrafish ascending and descending dopami-
molecular genetic dissection of neural circuits nergic systems. Nat Commun 2:171
for emotional and motivational behaviors. Dev 26. Miyasaka N, Arganda-Carreras I, Wakisaka
Neurobiol 72:358–365 N et al (2014) Olfactory projectome in the
22. Kalueff AV, Gebhardt M, Stewart AM et al zebrafish forebrain revealed by genetic
(2013) Towards a comprehensive catalog of single-neuron labelling. Nat Commun 5:
zebrafish behavior 1.0 and beyond. Zebrafish 3639
10:70–86 27. Moriyoshi K, Richards LJ, Akazawa C et al
23. Sato T, Hamaoka T, Aizawa H et al (2007) (1996) Labeling neural cells using adenoviral
Genetic single-cell mosaic analysis implicates gene transfer of membrane-targeted
ephrinB2 reverse signaling in projections from GFP. Neuron 16:255–260
the posterior tectum to the hindbrain in 28. Apolloni A, Prior IA, Lindsay M et al (2000)
zebrafish. J Neurosci 27:5271–5279 H-ras but not K-ras traffics to the plasma
24. Miyasaka N, Morimoto K, Tsubokawa T et al membrane through the exocytic pathway. Mol
(2009) From the olfactory bulb to higher Cell Biol 20:2475–2487
Part II
Immunocytochemical Phenotype
of Differentiating Neurons
Andrea Diana and Antonio Carai
Abstract
Immunohistochemistry techniques have been extensively used to identify and colocalize several proteins in
neuronal specimens. A challenging task is the specific labeling of neuroepithelial-deriving cells in the course
of neurogenesis. On the basis of the time-dependent expression of several molecular signals named as early,
intermediate, or late markers, neuroscientists can compose a coherent frame of sequential or overlapping
neuronal phenotypes. Starting from brain sections or brain-derived culture systems, this chapter describes
an immunofluorescence multi-labeling protocol which, by exploiting the concurrent labeling of antigens
of interest by means of an appropriate panel of antibodies, can help define several classes of neuronal cells
which appear during the course of neuronal development.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_5, © Springer Science+Business Media New York 2015
95
96 Andrea Diana and Antonio Carai
Table 1
Neuronal phenotypes versus marker expressions
Phenotype
Progenitor
Markers neuroepithelial cells Neuroblasts Mature neurons
Early Neurofilament proteins NFP NFP
(NFP)
Cytoskeletal proteins Microtubule-associated MAP2 MAP2
protein-2 (MAP2)
βIII-tubulin βIII-tubulin βIII-tubulin
Doublecortin (DCX) DCX DCX
α-Internexin α-Internexin α-Internexin
Tau Vimentin Vimentin
(non-phosphorylated)
Vimentin
Intermediate NFP NFP
Cytoskeletal proteins/ Neuron-specific NSE
enzyme enolase (NSE)
Late Neuronal nuclear
antigen (NeuN)
Nuclear-/synaptic-related Synaptophysin
proteins Chromogranin A (CgA)
Neurochemical Phenotype of Nerve Cells 97
3 Procedures
4 Typical/Anticipated Results
Fig. 1 Reproduced and adapted from Neurobiology of Disease, 2005, with permission from Elsevier, Oxford, UK
Fig. 2 Reproduced and adapted from PLoS One, 2014, with permission from Elsevier, Oxford, UK
Neurochemical Phenotype of Nerve Cells 103
Fig. 3 Reproduced and adapted from Brain Research, 2012, with permission from Elsevier, Oxford, UK
Fig. 4 Reproduced and adapted from Brain Research, 2012, with permission from Springer
Fig. 5 Reproduced and adapted from Anatomy & Cell Biology, with permission from Lee, Won Bok, Seoul, Korea
Acknowledgments
The authors wish to thank Dr. Samantha Cipollina for her revising
assistance of the manuscript.
References
1. Sarnat HB (2013) Clinical neuropathology 3. Fritschy J-M (2008) Is my antibody-staining
practice guide 5–2013: markers of neuronal specific? How to deal with pitfalls of immuno-
maturation. Clin Neuropathol 32:340–369 histochemistry. Eur J Neurosci 28:2365–2370
2. Lorincz A, Nusser Z (2008) Specificity of immu- 4. Louis SA, Reynolds BA (2009) Neurosphere and
noreactions: the importance of testing specificity neural colony-forming cell assays. In: Doering
in each method. J Neurosci 28:9083–9086 LC (ed) Protocols for neural cell culture, 4th
Neurochemical Phenotype of Nerve Cells 107
Abstract
Adult neurogenesis is the capability of certain brain areas to generate new neurons which integrate into
already established neuronal circuits within the adult brain. In most mammals, adult neurogenesis mainly
occurs in the olfactory bulb and the hippocampal formation. Adult neurogenesis is thought to consist of
several developmental stages that are characterized by morphological distinct cells, and these cells are
known to express different markers. These markers and their application for immunohistochemical detec-
tion of the specific cell populations are introduced and discussed. Since estimation of the numbers of
stained cells is mainly done in brain sections, methods for the quantification of the labeled cells are also
highlighted.
1.1 General It has been believed for a long time that neurogenesis, i.e., the
Considerations generation of neurons in the central and peripheral nervous sys-
tem, only occurred during brain development and did not take
place during adulthood. The pioneering studies by Altman and
Das provided the first evidence that new neurons can also be gen-
erated in the adult mammalian brain [1, 2]. After several decades
of strong excitement about these discoveries, it is nowadays widely
accepted that adult neurogenesis is a restricted phenomenon that
occurs in just a few areas of the brain with significant interspecies
differences. Among these areas, a distinct region of the subven-
tricular zone (SVZ) has attracted much interest and was therefore
extensively investigated in the past years. In rodents and other
mammals, newly born cells in SVZ can migrate to the olfactory
bulb through the rostral migratory stream (RMS; Fig. 1a) and
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_6, © Springer Science+Business Media New York 2015
109
110 Oliver von Bohlen und Halbach
Fig. 1 (a) Neurogenesis in the adult mammalian brain is mainly seen in the sub-
ventricular zone (SVZ) and in the hippocampal formation. The newly generated
cells from the SVZ migrate through the rostral migratory stream (RMS) to reach
their final destination within the olfactory bulb (OB). (b) Within the adult hippo-
campus, the progenitor cells (red) are located in the subgranular zone (SGZ) of
the dentate gyrus. These cells proliferate and migrate into the granular layer of
the DG, and, later, the newly formed cells extend their dendrites toward the
molecular (Mol) layer of the DG (green). (c) At different stages of adult neurogen-
esis in the DG, different specific molecules are expressed by the newly formed
cell and serve as specific markers for cell subpopulations during the course of
their differentiation
Immunocytochemical Detection of Adult Neurogenesis 111
1.2 Immunohisto A wide number of molecules are expressed during the course of
chemical Markers adult neurogenesis and can be used as markers of cells undergoing
of Adult Neurogenesis proliferation. The most popular will be discussed below. These
markers are, in general, cell cycle markers. Therefore they allow
1.2.1 Markers
staining individual cells that were in the process of cell division.
for Proliferative Events
The protein Ki-67 is expressed in all phases of the cell cycle
except at the resting phase and at the beginning of the G1 phase.
Because of its short half-life of about 1 h, it is rarely detectable in
cells in the G0 phase [13].
112 Oliver von Bohlen und Halbach
1.2.2 Markers for Early At early stages of adult neurogenesis, the cells are immunopositive
Steps of Adult for the glial fibrillary acidic protein (GFAP). Eventually, these early
Neurogenesis cells can give rise to either new neurons or glial cells. Thus, some
of the early cells that could develop into neurons originate from
cells that have astrocytic properties and express GFAP [17]. As
GFAP is also a marker for mature astrocytes, the interpretation of
GFAP immunostaining has to be carried out very carefully.
Further early markers of neurogenesis are nestin (an interme-
diate filament protein), SRY-related HMG-box gene 2 (Sox-2),
musashi-1 (MSI-1), and paired box gene 6 (Pax-6). These markers
are also often coexpressed by GFAP-positive cells, but coexpres-
sion has also been found with markers of cells at later stages of
adult neurogenesis [12]. Thus, although these markers can be used
to examine adult neurogenesis more specifically than cell cycle
markers, their neuronal specificity is not absolute: young cells that
could eventually develop a glial phenotype are, in fact, more or less
positive for these markers at early stages.
1.2.3 Markers for Later T-box brain gene 2 (Tbr2) and the basic helix-loop-helix protein
Steps of Adult NeuroD (Fig. 1c) are markers for later steps of adult neurogenesis.
Neurogenesis Both show some overlap with the expression of Pax-6 but also with
that of other markers like the polysialylated embryonic form of the
neural cell adhesion molecule (PSA-NCAM) and doublecortin
(DCX). Based on this and other observations, it is thought that
Tbr2 is downregulated as cells become committed to the neuronal
lineage and exit the mitotic cycle [18] and that NeuroD represents
Immunocytochemical Detection of Adult Neurogenesis 113
2 Equipment and Materials
2.1 Solutions ●● 10 mM sodium citrate buffer: Dissolve 2.94 g trisodium citrate
and General Reagents (dihydrate) in 1,000 mL distilled water. Adjust pH to 6.0 with
1 N HCl.
●● Phosphate buffered saline (PBS) 1×: Add 8 g NaCl and 0.2 g
KCl and 1.44 g Na2HPO4 to 800 mL of distilled water. Adjust
pH to 7.4 with HCl and then add distilled water to a total
volume of 1,000 mL.
●● 4 % paraformaldehyde (PFA) in PBS: Pour 100 mL PBS into a
conical flask containing 4 g of PFA. Cover the flask with
Parafilm™ and transfer it to a fume hood. Place the flask on top
of a hot plate/stirrer and heat with moderate stirring. The
solution should warm up until it turns from being cloudy to
clear (remaining cloudiness may be removed by adding a drop
of 5 M NaOH). When the PFA has dissolved, switch off heat-
ing but leave to stir for further 10 min. Allow cooling and
transfer to a 4 °C refrigerator.
2.3 Immunostaining ●● Primary antibodies against DCX (e.g., Santa Cruz Biotechnology,
Inc., Dallas, Texas), NeuroD (e.g., Santa Cruz Biotechnology,
Inc.), and PH3 (e.g., Santa Cruz Biotechnology, Inc.).
●● Biotinylated secondary antibodies.
114 Oliver von Bohlen und Halbach
3 Procedures
3.1 Perfusion To obtain a rapid and good fixation of the tissue, animals have to
of the Brain and Serial be perfused. Perfusion also offers the advantage of getting rid of
Sectioning the erythrocytes that are autofluorescent and can interfere with
proper visualization of fluorescent tags. Perfusion is carried out
with an automated peristaltic pump that allows a continuous flow
of the solutions: PBS for flushing the blood out of the circulation
and PFA as a fixative. After deep anesthesia or direct euthanasia,
the left ventricle is cannulated and the right atrium is cut to allow
drainage of blood and solutions. The perfusion is then started by
Immunocytochemical Detection of Adult Neurogenesis 115
3.2 Staining Serial sections are ordinately mounted onto gelatin-coated slides in
order to obtain three series throughout the hippocampal forma-
tion. The first series will be then used for PH3, the second for
NeuroD, and the third for DCX immunohistochemistry. After
mounting on slides, sections are dried overnight. On the next day,
they are rinsed for 5 min in distilled water and subjected to micro-
wave antigen retrieval. For antigen retrieval, the slides are placed in
the microwavable vessel, containing 10 mM citrate buffer pH 6.0.
The vessel is placed inside the microwave and boiled for 20 min.
Thereafter, the vessel is removed and slices are cooled with cold tap
water for 10 min. Sections are then rinsed twice for 5 min each
with PBS. Now the three series could be treated differently accord-
ing to the primary antibody used in the immunostaining
procedure.
3.2.1 PH3 Sections are transferred into the primary antibody diluent solution
Immunostaining I for 60 min. They are then incubated in the anti-PH3 rabbit poly-
clonal antibody diluted 1:200 in the same solution for 120 min.
Next, they are rinsed three times for 5 min each in PBS. Sections
are now incubated with Cy3-conjugated goat anti-rabbit IgGs
diluted 1:200 in the second antibody diluent solution I for 60 min.
Sections are rinsed three times for 5 min each in PBS. After this
step, they are incubated in DAPI (1:10,000 in PBS for nuclear
counterstaining) for 5 min. After rinsing in distilled water, the sec-
tions are coverslipped using a fluorescence-free mounting medium.
3.2.2 NeuroD Sections are treated for 30 min with 0.4 % Triton X-100 in PBS
Immunostaining and rinsed for 5 min with PBS. They are then transferred into the
primary antibody diluent solution II for 48 h. Thereafter, they are
rinsed for 5 min with PBS, and, in a next step, sections are incu-
bated with the goat polyclonal anti-NeuroD antibody diluted
1:100 in the primary antibody diluent solution II for 120 min at
4 °C. Sections are then rinsed three times for 5 min each in
PBS. Next, they are incubated with biotinylated anti-goat IgGs
diluted 1:100 in the secondary antibody diluent solution II for
116 Oliver von Bohlen und Halbach
90 min. After this incubation, sections are rinsed three times for
5 min each in PBS, followed by Cy3-conjugated streptavidin
1:2,000 in PBS for 90 min, and then by 3 rinses of 5 min each in
PBS. DAPI counterstaining and mounting is carried out as in
Sect. 3.2.1.
3.2.3 DCX Sections are treated for 30 min with 0.4 % Triton X-100 (in PBS)
Immunostaining and rinsed for 5 min with PBS. After this initial step, they are trans-
ferred into the primary antibody diluent solution II for 60 min.
Thereafter, they are rinsed for 5 min with PBS. Sections are then
incubated in the goat polyclonal anti-DCX antibody diluted 1:100 in
the primary antibody diluent solution II for 48 h at 4 °C. Sections
are then rinsed three times for 5 min each in PBS. In the next step,
sections are incubated with biotinylated anti-goat IgGs diluted
1:200 in the secondary antibody diluent solution II for 120 min.
Thereafter, sections are rinsed three times for 5 min each in PBS and
then incubated with Cy3-conjugated streptavidin 1:2,000 in PBS
for 120 min. After rinsing three times for 5 min each in PBS, they
are counterstained with DAPI and mounted as in Sect. 3.2.1.
3.3 Cell Counting When serial sections are available, it is possible to determine the
total number of stained cells within the brain area under study.
Another possibility is to determine the density of the stained cells
instead of their absolute number. In this later case, the number of
stained cells within a two-dimensional region of interest (ROI)
inside the brain area under study is counted. However, it should be
kept in mind that stained cells may not be uniformly distributed, as
it is often the case of neurogenic cells in DG that are frequently
clustered together, rather than homogenously scattered within the
tissue. Counting the stained cells throughout the whole brain area
under study might be an approach that circumvents the problems
of an accurate quantitation associated with clustering. An obvious
disadvantage of this approach is that it is highly time consuming,
since all stained cells throughout all serial sections have to be
counted. However, counting all stained cells may be advantageous
as one gets their true numbers and not an indirect estimate.
Unfortunately, there are several problems by just counting the
stained cells either in case densities of cells or their absolute num-
bers are calculated:
1. During tissue sectioning, some cells may be cut into two or
(less frequently) more segments that are present at the section
surface in different sections [24].
2. Tissue shrinkage may occur.
3. The volume of the analyzed brain area as well as the size of
individual cells may vary between different experimental
groups, e.g., when different ages are analyzed and/or the
effect of a pharmacological treatment is studied.
Immunocytochemical Detection of Adult Neurogenesis 117
Fig. 2 (a) Five objects (A–E) are located within a three-dimensional space. The
four sections (S1–S4) cut through the tissue are indicated by the horizontal lines
and the objects are represented as circles/ovals. A and B as well as C, D, and E
have the same sizes. Objects A and B have a higher height than the section
thickness, whereas objects C, D, and E have a smaller height than the section
thickness. Due to the different sizes of the objects (“particles”) and their distribu-
tion within the tissue, the particles are cut, and thus the sum of the number of
profiles (P) counted is not equivalent to the total number of particles. (b) An
example of phosphohistone H3 (PH3)-labeled cells in the dentate gyrus (in red).
DAPI (in blue) was used for counterstaining. (c) An example of NeuroD-positive
cells in the dentate gyrus (in red). DAPI (in blue) was used for counterstaining. (d)
An example of a staining using a marker of late stages of adult neurogenesis,
showing doublecortin (DCX)-positive cells in the dentate gyrus (in red). DAPI (in
blue) was used for counterstaining
When counting cells, it is indeed not cells that are counted but
their profiles, i.e., a part of a stained cell that is contained within a
histological section [25]. Thus, in the worst case, a cell might be
thicker than section thickness, and thus several profiles of the same
cell can be detected in adjacent sections (Fig. 2a). A solution to this
problem is the use of sections thicker than the estimated cell height.
The problem of tissue shrinkage can be overcome by introduc-
ing a shrinkage factor. To determine this factor, section thickness
should be measured immediately after cutting and then after
embedding (post-processing thickness). Both measures can be
obtained by measuring section thickness in the z-axis.
118 Oliver von Bohlen und Halbach
N = n ´ (t / (t + H ) ) or N / n = t / (t + H )
where:
N is an estimate of the number of objects whose central points
lie within the sampled portions of the region of interest (ROI) in
one or multiple sections.
n is the counted number of object segments in the sampled
portions of that ROI.
t is the (mean) thickness of the section(s) in which n is counted.
H is the mean height of the objects, measured perpendicular to
the plane of section [27].
A further possibility is the use of stereological methods [24]
such as the optical disector. Stereological methods allow a highly
precise and unbiased estimate of the true number of objects. In the
case of the optical disector, a two-step process is required that
Immunocytochemical Detection of Adult Neurogenesis 119
V ref = t ´ a ´ Sum p
In a next step, the volume density (NV) is determined using the
optical disector. For that purpose, it is recommended to use 40× or
100× objectives with a high numerical aperture that allows focus-
ing through the section. The disector is randomly applied on the
sampled sections throughout the length of a brain area of interest,
e.g., a brain nucleus. Stained cells are counted if they fall within the
measuring volume of the disector as long as they were not overlap-
ping the two forbidden lines on the grid [34]. Sampling can be
done with a software system controlling the microscope-mounted
camera and the z-axis drive of the microscope. First, the number of
stained objects (Q) is calculated. In a second step, the neuronal
density is calculated:
( )
N v = Sum Q / Sum Pi / V dis
Q is the number of neurons counted within the sampling vol-
ume (Vdis), which is determined by multiplying the area of the sam-
pling frame by the distance between the two optical grids. Pi is the
number of disectors applied. In a final step, the total number of
stained cells within the brain area is estimated:
N abs = (N v ) ´ (V ref )
Advantages of the stereological approaches include that they
are theoretically unbiased and that no assumptions have to be made
concerning the size, shape, or orientation of the particles, and at the
least, the optical disector is highly efficient [30]. Disadvantages
include that these methods require thick sections, which may hinder
120 Oliver von Bohlen und Halbach
several antibodies to fully penetrate the tissue and that some special
equipment such as a sensitive z-axis encoder is needed [30]. Detailed
protocols that describe step by step the methodology for the deter-
mination of cell numbers in a three-dimensional tissue are, e.g.,
provided by Williams and colleagues [35].
4 Notes and Troubleshooting
Acknowledgments
References
1. Altman J, Das GD (1965) Autoradiographic gyrus during the life span of the rhesus mon-
and histological evidence of postnatal hippo- key. J Neurosci 8:2729–2747
campal neurogenesis in rats. J Comp Neurol 9. Gould E, Reeves AJ, Fallah M et al (1999)
124:319–335 Hippocampal neurogenesis in adult Old World
2. Altman J, Das GD (1967) Postnatal neurogen- primates. Proc Natl Acad Sci U S A 96:
esis in the guinea-pig. Nature 214:1098–1101 5263–5267
3. Luskin MB (1993) Restricted proliferation and 10. Eriksson PS, Perfilieva E, Bjork-Eriksson T
migration of postnatally generated neurons et al (1998) Neurogenesis in the adult human
derived from the forebrain subventricular zone. hippocampus. Nat Med 4:1313–1317
Neuron 11:173–189 11. Kempermann G (2011) Seven principles in the
4. Belluzzi O, Benedusi M, Ackman J et al (2003) regulation of adult neurogenesis. Eur J
Electrophysiological differentiation of new Neurosci 33:1018–1024
neurons in the olfactory bulb. J Neurosci 12. von Bohlen Und Halbach O (2011)
23:10411–10418 Immunohistological markers for proliferative
5. Carlen M, Cassidy RM, Brismar H et al (2002) events, gliogenesis, and neurogenesis within
Functional integration of adult-born neurons. the adult hippocampus. Cell Tissue Res 345:
Curr Biol 12:606–608 1–19
6. Kempermann G, Kuhn HG, Gage FH (1997) 13. Zacchetti A, Van Garderen E, Teske E et al
More hippocampal neurons in adult mice liv- (2003) Validation of the use of proliferation
ing in an enriched environment. Nature markers in canine neoplastic and non-neoplastic
386:493–495 tissues: comparison of KI-67 and proliferating
7. Kuhn HG, Dickinson-Anson H, Gage FH cell nuclear antigen (PCNA) expression versus
(1996) Neurogenesis in the dentate gyrus of in vivo bromodeoxyuridine labelling by immu-
the adult rat: age-related decrease of neuro- nohistochemistry. APMIS 111:430–438
nal progenitor proliferation. J Neurosci 14. Linden MD, Torres FX, Kubus J et al (1992)
16:2027–2033 Clinical application of morphologic and immu-
8. Eckenhoff MF, Rakic P (1988) Nature and fate nocytochemical assessments of cell prolifera-
of proliferative cells in the hippocampal dentate tion. Am J Clin Pathol 97:S4–S13
122 Oliver von Bohlen und Halbach
15. Taupin P (2007) BrdU immunohistochemistry 25. Gundersen HJ, Bendtsen TF, Korbo L et al
for studying adult neurogenesis: paradigms, (1988) Some new, simple and efficient stereo-
pitfalls, limitations, and validation. Brain Res logical methods and their use in pathological
Rev 53:198–214 research and diagnosis. APMIS 96:379–394
16. Lucassen PJ, Stumpel MW, Wang Q et al 26. Cruz-Orive LM (1999) Precision of Cavalieri
(2010) Decreased numbers of progenitor cells sections and slices with local errors. J Microsc
but no response to antidepressant drugs in the 193:182–198
hippocampus of elderly depressed patients. 27. Hedreen JC (1998) Lost caps in histological
Neuropharmacology 58:940–949 counting methods. Anat Rec 250:366–372
17. Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla 28. Clarke PG (1992) How inaccurate is the
A (1997) Cellular composition and three- Abercrombie correction factor for cell counts?
dimensional organization of the subventricular Trends Neurosci 15:211–212
germinal zone in the adult mammalian brain. 29. Schober A, Peterziel H, Von Bartheld CS et al
J Neurosci 17:5046–5061 (2007) GDNF applied to the MPTP-lesioned
18. Hodge RD, Kowalczyk TD, Wolf SA et al nigrostriatal system requires TGF-beta for its
(2008) Intermediate progenitors in adult hip- neuroprotective action. Neurobiol Dis 25:
pocampal neurogenesis: Tbr2 expression and 378–391
coordinate regulation of neuronal output. 30. von Bartheld C (2002) Counting particles in
J Neurosci 28:3707–3717 tissue sections: choices of methods and impor-
19. Lee JE, Hollenberg SM, Snider L et al (1995) tance of calibration to minimize biases. Histol
Conversion of Xenopus ectoderm into neurons Histopathol 17:639–648
by NeuroD, a basic helix-loop-helix protein. 31. Vallieres L, Campbell IL, Gage FH et al (2002)
Science 268:836–844 Reduced hippocampal neurogenesis in adult
20. Tamimi R, Steingrimsson E, Copeland NG transgenic mice with chronic astrocytic produc-
et al (1996) The NEUROD gene maps to tion of interleukin-6. J Neurosci 22:486–492
human chromosome 2q32 and mouse chro- 32. Abercrombie M (1946) Estimation of nuclear
mosome 2. Genomics 34:418–421 population from microtome sections. Anat Rec
21. Couillard-Despres S, Winner B, Schaubeck S 94:239–247
et al (2005) Doublecortin expression levels in 33. West MJ (1999) Stereological methods for
adult brain reflect neurogenesis. Eur J Neurosci estimating the total number of neurons and
21:1–14 synapses: issues of precision and bias. Trends
22. Couillard-Despres S, Winner B, Karl C et al Neurosci 22:51–61
(2006) Targeted transgene expression in neu- 34. Abusaad I, Mackay D, Zhao J et al (1999)
ronal precursors: watching young neurons in Stereological estimation of the total number of
the old brain. Eur J Neurosci 24:1535–1545 neurons in the murine hippocampus using the
23. Peterson DA, Dickinson-Anson HA, Leppert optical disector. J Comp Neurol 408:560–566
JT et al (1999) Central neuronal loss and 35. Williams RW, von Bartheld CS, Rosen GD
behavioral impairment in mice lacking neu- (2003) Counting cells in sectioned material: a
rotrophin receptor p75. J Comp Neurol suite of techniques, tools, and tips. Curr Protoc
404:1–20 Neurosci Chapter 1: Unit 1 11
24. Hedreen JC (1998) What was wrong with the 36. Sholl DA (1953) Dendritic organization in the
Abercrombie and empirical cell counting meth- neurons of the visual and motor cortices of the
ods? A review. Anat Rec 250:373–380 cat. J Anat 87:387–406
Chapter 7
Abstract
Tritiated thymidine ([3H]dT) and its analogs bromodeoxyuridine (BrdU), iododeoxyuridine (IdU),
chlorodeoxyuridine (CldU), and ethynyl deoxyuridine (EdU) are used extensively to study neuronal time
of origin and pattern of migration. Here, we discuss the advantages and pitfalls of identifying dividing cells
with these markers and emphasize that they simply indicate DNA synthesis. Thus, in addition to dividing
cells, they can label cells that are undergoing DNA repair and/or cell death. As foreign molecules in the
DNA, these markers can affect the kinetics of cell proliferation and also have unpredictable functional
consequences. We review general protocols and present evidence, based on our own studies in nonhuman
primates, that cell proliferation, as indicated by cell numbers and/or their survival, as well as the localiza-
tion of migrating cells, may be affected by the labeling method itself. We show that measurements made
using [3H]dT labeling are more accurate than those using BrdU, perhaps because [3H]dT is less toxic.
Thus, utmost caution should be exercised when interpreting the results obtained by using thymidine ana-
logs as possible indicators of the number of mitotic divisions, patterns of migration, final positions, and
ultimate fate of cells.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_7, © Springer Science+Business Media New York 2015
123
124 Alvaro Duque and Pasko Rakic
1.1 Historical For many decades, [3H]dT autoradiography was the method of
Perspective choice in studies of cell birth dating, proliferation, migration, and fate
in the developing brain [2–8]. However, because of its radioactivity,
which requires special handling and involves the lengthy process of
developing the autoradiographs (approximately 3–12 weeks), pres-
ent studies are usually performed with halogenated thymidine
analogs of which BrdU is the most common [1, 9]. Although the
desire for faster and easier methods and the avoidance of radioac-
tivity were important motivations for the search of alternatives to
[3H]dT autoradiography, perhaps equally important was the desire
to improve the extent of detectability of labeled cells in the tissue
sections. [3H]dT autoradiography is limited to detecting cells only
to a few microns deep from the surface of the section due to at least
two factors: (1) the emulsion’s ability to detect electrons (which
usually is done effectively to only a few microns on the section
surface) and (2) the half distance of the β-particle which is only
~1 μm [10–12]. In contrast, immunohistochemistry allows detec-
tion of the halogenated thymidine analogs in a couple of days and
throughout 50 μm-thick sections, which is especially useful in the
evaluation of total cell numbers using stereological techniques.
However, in quantitative studies involving the timing of the cell
cycle phases, number of cell divisions, and/or amount of cell pro-
liferation, [3H]dT autoradiography is advantageous because it is
stoichiometric. That is, in the case of [3H]dT, the intensity of
labeling is directly proportional to the amount of [3H]dT incor-
poration into a cell, which in turn is a function of the dynamics of
the cell cycle. Intensity of labeling is expressed and measured in
terms of the number of silver grains overlaying the labeled nucleus
[4, 5, 13]. BrdU, IdU, and CldU immunohistochemistry is not
Thymidine Analogs and Proliferation in CNS 125
3
H O H O H O
H C H C C C
NH NH NH
H H
N N N
HO O HO O HO O
O O O
OH OH OH
Thymidine Tritated-Thymidine Ethynyl Deoxyuridine
T [3H]dT EdU
2’-Deoxythymidine 2’-Deoxythymidine 5-Ethynyl-2’-deoxyuridine
C10H14N2O5 C10H14N2O5 C11H12N2O5
MW: 242.23 MW: 242.23 MW: 252.22
O O O
Cl Br I
NH NH NH
N N N
HO O HO O HO O
O O O
OH OH OH
Chlorodeoxyuridine Bromodeoxyuridine Iododeoxyuridine
CldU BrdU IdU
5-Chloro-2’-deoxyuridine 5-Bromo-2’-deoxyuridine 5-Iodo-2’-deoxyuridine
C9H11ClN2O5 C9H11BrN2O5 C9H11IN2O5
MW: 262.65 MW: 307.10 MW: 354.10
Fig. 1 Thymidine and its analogs. Under each of the chemical structures, the
abbreviation used for the compound is shown followed by its short chemical
name, empirical formula using Hill notation, and molecular weight (MW, g/mol).
The site of substitution for the different compounds is indicated with black back-
ground. The only difference between [3H]dT and the normal endogenous nucleo-
side T is an extra neutron in one H atom. In all other thymidine analogs, the
methyl group is substituted for something else; this changes the chemical struc-
ture of the compound and affects its properties
Thymidine Analogs and Proliferation in CNS 127
3 Procedures
3.1 Preparation, In general, IdU, CldU, and EdU are prepared, dosed, and admin-
Dosage, and istered in a manner consistent with what would be done if BrdU
Administration was the marker used. To a great extent, initially, experimenters
of BrdU, IdU, CldU, employed the approach of straightforward substitution in which
and EdU identical amounts of one or another thymidine analog would be
used. Later, experimenters have favored the use of equimolar solu-
tions. The reason is that the actual amount of marker available to
cells in the S phase should be the same; and, therefore, if one
marker is substituted for another, the population of cells marked
should, in principle, be identical. Without equimolar delivery, esti-
mates of cell numbers produce distorted results [26, 27].
In any case, a good amount of trial and error is necessary in
order to customize these markers for particular applications. We
also recommend that a range of doses be tested to determine the
optimal minimum concentration at which results can be obtained.
This not only lowers the amount and cost of chemicals, but, impor-
tantly, it lowers the overall toxic effect the compounds have on the
Thymidine Analogs and Proliferation in CNS 129
3.1.1 Preparation In terms of dosage, the range (mostly used in BrdU cases) is very
and Dosage ample from just a few mg per Kg/BW to about 600 mg per Kg/
BW. A very common dosage for BrdU is 50 mg per Kg/BW, dis-
solved in sterile 0.9 % NaCl (to which we and many others add
0.007 M NaOH) and which is administered at 20 mg/mL
(65 mM). Hence, to achieve the 50 mg per Kg/BW, the solution
is injected at 2.5 mL/Kg BW. To accelerate and assure that all the
BrdU is dissolved, sonication with gentle heating (e.g., 37 °C) can
be used.
Dosages for IdU, CldU, and EdU can be prepared identically
or equimolar. To achieve 65 mM of IdU, one needs 23 mg/mL
(i.e., 57.5 mg/kg BW), for CldU 17 mg/mL (i.e., 42.5 mg/kg
BW), and for EdU 16.4 mg/mL (i.e., 41 mg/kg BW). This way,
injections can also be delivered at 2.5 mL/Kg BW. In general,
both IdU and CldU are less soluble than BrdU, and, therefore, it
may take them longer to dissolve. To accelerate the process, stronger
agitation and/or sonication may be needed. Also, some experiment-
ers prefer to dissolve these at fewer mg per mL (e.g., 5–10 mg/mL).
If this is the case, experimenters need to compensate injection
amounts accordingly.
EdU can be prepared in water, alcohol, PB, PBS, or aqueous
buffers. At 50 mg/Kg BW, fluorescence intensity of individual
nuclei has been reported to be high (hence, easy to detect), while
lower doses have produced similar numbers of labeled cells but
with lower fluorescence intensity [19].
At about 200 mg per Kg/BW, BrdU has been found to label a
maximum number of cells in the dentate gyrus of the rat [28], and
at higher doses (400–600 mg/kg; mouse), BrdU causes an increase
in the duration of the S phase and mitosis, making the cell cycle 5 h
longer than normal with the additive effects of cell death and retar-
dation of the cell cycle causing a 15 % deficit of Purkinje cells in the
postnatal cerebellum without interfering with cell differentiation
[29]. Similar effects have been reported in the neocortex [30]
where BrdU prolonged the duration of mitosis, did not block cell
division, and also caused cell death. Similar toxic effects for other
thymidine analogs are expected.
3.2 Perfusion, Tissue Particular protocols for the development and visualization of
Processing, BrdU, IdU, CldU, and EdU and the combination of these with
and Immuno- diverse cellular markers can be found in a host of published works
histochemistry from our own as well as many other labs [1, 19, 27, 31]. The fol-
lowing descriptions are very general, and the reader is encouraged
to consult published protocols for the particular applications
intended. Different preparations have their own advantages and
limitations. Access to cells is very different if they are in culture or
in tissue. Tissue is also different depending on maturity. Hence,
the requirements to prepare and process cultured cells, brain
embryonic tissue, or brain adult tissue are not the same, even if
they are of the same species. The amount of neuropil changes with
time and so does the expression of phenotypic markers. In conse-
quence, the localization or not of a marker, the intensity with
which it can be observed, and even the thickness at which tissue
can be cut and manipulated are very different at different develop-
mental ages. The experimenter therefore needs to take into account
all these parameters in the design and execution of his/her particu-
lar experiment.
3.2.1 Perfusion Methods for perfusions and processing of animal brains for any
thymidine analog labeling are basically identical to those used for
any other normal immunohistochemical processes. Any changes
depend mostly on the need of the investigator to perform addi-
tional procedures. In general, animals are first deeply anesthe-
tized and transcardially perfused with PBS and, for work involving
just light microscopy, followed by a solution of 4 % PFA in PBS.
A solution including glutaraldehyde is necessary if electron
microscopy work is to be performed.
3.2.2 Tissue Cutting Typically, sections are cut at a thickness ranging from about 5 to
100 μm depending on the needs of the investigator. Thinner sec-
tions may favor penetration of antibodies and ease of immuno-
fluorescence labeling, while thicker sections may be necessary for
Thymidine Analogs and Proliferation in CNS 131
3.2.3 Histo- It is known in the field that detection of the same epitope can vary
and Immunochemistry among antibodies, therefore, affecting the results in terms of
amount and intensity of what is detected. This is also the case with
BrdU [32] and likely with other thymidine analogs. Hence, it is
important that for comparison of results the protocols used be, if
not completely identical, at least as close as possible and that immu-
nolabeling from experiment to experiment be done using the same
combinations of antibodies and the same procedures.
Because most antibodies, but not all, against BrdU also detect
IdU [15], the choice of antibodies is crucial to avoid confounding
results. For instance, to study the rate of progression through the
cell cycle of human glioma cells, Shibui et al. [33] used Br-3, a
monoclonal antibody that recognizes only BrdU, and IU-4, an
antibody that recognizes both IdU and BrdU. This way, and using
sequential staining, they could comparatively distinguish between
the two labels. First, using the immunoperoxidase method to
develop staining with the Br-3 antibody and then using the alkaline
phosphatase-anti-alkaline phosphatase method to develop staining
with the IU-4 antibody, they established the duration of the S
phase in these cells to be from 8 to 13 h.
At present, likely the most common application for the thy-
midine analogs is in studies in which chronology of cell birth-
dates is combined with phenotypic expression via multiple
labeling visualized with different color fluorescent tags. Vega and
Peterson [27] pioneered the systemic administration of IdU and
CldU with specific detection by immunofluorescence so that they
can be clearly discriminated without detectable antibody cross-
reactivity using antibodies raised against BrdU. In our laboratory,
we use methods similar to those described in that original paper,
although many variations can be found throughout the literature.
In general, the first step in developing tissue for the visualization
of any halogenated thymidine analog is DNA denaturation, a step
necessary for the antibody to be able to access the epitope. The
tissue is first rinsed several times in either PBS or TBS and then
treated with 2.0 N HCl for 5–30 min at 37 °C. This is followed
by further rinsing (3–5 × 5 min in PBS or TBS). The tissue can then
be blocked and permeabilized in a solution of 5 % donkey (or
goat, or a combination of both) serum in PBS or TBS containing
0.25–0.5 % Triton® X-100 or a similar detergent such as Tween® 20.
132 Alvaro Duque and Pasko Rakic
The goal is to block with a serum of the species host in which the
secondary antibody was raised. Sections are incubated free float-
ing (12–24 h at 4 °C) in the blocking solution containing the
primary antibodies against the thymidine analogs used. At this
step, additional primary antibodies can be used for the identifica-
tion of, for instance, glia or particular types of neurons. A couple
of antibodies used by many laboratories are the mouse anti-BrdU
(1:500, Becton, Dickinson) which detects IdU and the rat anti-
BrdU (1:250, Accurate) which detects CldU (see Figs. 2 and 3).
Of course, both antibodies would also detect BrdU.
The secondary antibody used to develop CldU can be a bioti-
nylated one so that signal amplification can be done. The biotinyl-
ated secondary can be detected by subsequent incubation with
streptavidin conjugated to the fluorophore of choice. Conveniently,
conjugated secondary antibodies raised against the appropriate pri-
mary host can be obtained from a variety of different companies; in
our experience, we obtain very good results with secondary anti-
bodies from Jackson ImmunoResearch Laboratories and also from
Molecular Probes. Secondary antibodies can be used at different
Fig. 2 Formation of the mouse cerebral cortex. (a) Green cells labeled by in utero electroporation of a plasmid
expressing green fluorescent protein (GFP), done at E11.5. The dam was subsequently injected with a single
pulse of BrdU (50 mg/Kg BW) at E12.5 and sacrificed at E13.5. BrdU was detected using rat anti-BrdU (1:400,
Accurate) visualized with a secondary antibody conjugated to Alexa 594 (red, 1:1,000; Invitrogen). The tissue
is counterstained with DAPI (blue) to label all nuclei. (b) A different experiment in which CldU (injected at E11.5)
was detected with a rat anti-BrdU primary antibody (1:250; Accurate) and visualized by immunofluorescence
with a red-conjugated secondary antibody and IdU (injected at E16.5) was detected with a mouse anti-BrdU
primary antibody (1:100; BD bioscience) and visualized by immunofluorescence with a green-conjugated
secondary antibody. Cux1 (blue) staining was done to label upper layer neurons. In this case the mouse was
sacrificed at P0. Dashed lines indicate approximate borders between different laminae. The earlier (red)-born
cells destined for deeper cortical layers are clearly distinct from the later (green)-born cells that migrate to
upper layers. LV lateral ventricle, VZ-SVZ ventricular-subventricular zone, CP cortical plate, MZ marginal zone,
E ectoderm, L2-3 cortical layers 2-3, L4-6 cortical layers 4-6, SP subplate, IZ intermediate zone. Both images
are courtesy of Dr. Brian Rash, Rakic lab. See [49]
Thymidine Analogs and Proliferation in CNS 133
Fig. 3 (a) Hippocampus from a rat sacrificed at P5 that received equimolar injections of IdU (visualized with a
red-conjugated secondary antibody) at E14.5 followed by an injection of CldU (visualized with a green-
conjugated secondary antibody) at E16.5 (dosages and tissue processing as described in the text, primary
antibodies as described for Fig. 2). Earlier-born cells (red) are clearly dissociated from later-born (green) cells
(b). CA1, CA1 field of the hippocampus; CA3, CA3 field of the hippocampus; DG, dentate gyrus. Courtesy of Dr.
Albert Ayoub (Rakic lab)
Fig. 4 BrdU (a) versus [3H]dT (b) in the somatosensory cortex of the macaque monkey. Each animal received a
single injection of either marker at E55. In (a), BrdU is visualized with DAB (brown), and the tissue is counter-
stained with thionine. In (b), [3H]dT is visualized with silver, and the tissue is counterstained with aqueous
toluidine blue. Both photos were taken at about the same rostrocaudal and lamina level. (c) Illustrates the
distribution of labeled neurons across layers from pia (top) to white matter (WM, bottom). The number of
labeled neurons was greater in [3H]dT- than in BrdU-injected animals. In addition, BrdU-labeled neurons were
more widely distributed. This was consistent in different cortical areas. For further information, see [1]
5 Conclusion
Acknowledgments
We thank Drs. Albert Ayoub and Brian Rash for providing images
and for useful discussion on the protocols used in their research.
We also thank Ms. Mariamma Pappy for useful discussion. This
work was supported by a grant from NIH NINDS.
References
1. Duque A, Rakic P (2011) Different effects of 14. Nowakowski RS, Hayes NL (2000) New neu-
bromodeoxyuridine and [3H]thymidine incor- rons: extraordinary evidence or extraordinary
poration into DNA on cell proliferation, posi- conclusion? Science 288:771
tion, and fate. J Neurosci 31:15205–15217 15. Magavi SS, Macklis JD (2002) Identification of
2. Angevine JB Jr (1965) Time of neuron origin in newborn cells by BrdU labeling and immuno-
the hippocampal region. An autoradiographic cytochemistry in vivo. Meth Mol Biol 198:
study in the mouse. Exp Neurol S2:1–70 283–290
3. Rakic P (1974) Neurons in rhesus monkey 16. Kornack DR, Rakic P (2001) Cell proliferation
visual cortex: systematic relation between time without neurogenesis in adult primate neocor-
of origin and eventual disposition. Science 183: tex. Science 294:2127–2130
425–427 17. Magavi SS, Leavitt BR, Macklis JD (2000)
4. Rakic P (2002) Adult neurogenesis in mam- Induction of neurogenesis in the neocortex of
mals: an identity crisis. J Neurosci 22:614–618 adult mice. Nature 405:951–955
5. Rakic P (2002) Neurogenesis in adult primate 18. Breunig JJ, Arellano JI, Macklis JD et al (2007)
neocortex: an evaluation of the evidence. Nat Everything that glitters isn’t gold: a critical
Rev Neurosci 3:65–71 review of postnatal neural precursor analyses.
6. Rakic P, Sidman RL (1968) Supravital DNA Cell Stem Cell 1:612–627
synthesis in developing human and mouse 19. Chehrehasa F, Meedeniya AC, Dwyer P et al
brain. J Neuropathol Exp Neurol 27:246–276 (2009) EdU, a new thymidine analogue for
7. Schlessinger AR, Cowan WM, Gottlieb DI labelling proliferating cells in the nervous sys-
(1975) An autoradiographic study of the time of tem. J Neurosci Meth 177:122–130
origin and the pattern of granule cell migration 20. Tang X, Falls DL, Li X et al (2007) Antigen-
in the dentate gyrus of the rat. J Comp Neurol retrieval procedure for bromodeoxyuridine
159:149–175 immunolabeling with concurrent labeling of
8. Sidman RL, Miale IL, Feder N (1959) Cell nuclear DNA and antigens damaged by HCl
proliferation and migration in the primitive pretreatment. J Neurosci 27:5837–5844
ependymal zone: an autoradiographic study of 21. Hammers HJ, Schlenke P (2001) Ultraviolet-
histogenesis in the nervous system. Exp Neurol induced detection of halogenated pyrimidines
1:322–333 (UVID). Curr Protoc Cytom Chapter 7: Unit
9. Taupin P (2007) BrdU immunohistochemistry 7 15
for studying adult neurogenesis: paradigms, 22. Salic A, Mitchison TJ (2015) A chemical
pitfalls, limitations, and validation. Brain Res method for fast and sensitive detection of DNA
Rev 53:198–214 synthesis in vivo. Proc Natl Acad Sci U S A
10. Bisconte JC (1979) Kinetics analysis of cellular 105:2415–2420
populations by means of the quantitative radio- 23. Hsu TL, Hanson SR, Kishikawa K et al
autography. Int Rev Cytol 57:75–126 (2007) Alkynyl sugar analogs for the label-
11. Rogers AW (1973) Techniques of autoradiog- ing and visualization of glycoconjugates in
raphy. Elsevier, Amsterdam cells. Proc Natl Acad Sci U S A 104:
12. Sidman RL (1970) Autoradiographic methods 2614–2619
and principles for study of the nervous system 24. Sawa M, Hsu TL, Itoh T et al (2006)
with thymidine-H3. Springer, New York, NY, Glycoproteomic probes for fluorescent imag-
pp 252–274 ing of fucosylated glycans in vivo. Proc Natl
13. Nowakowski RS, Rakic P (1974) Clearance Acad Sci U S A 103:12371–12376
rate of exogenous 3H-thymidine from the 25. Tornoe CW, Christensen C, Meldal M (2002)
plasma of pregnant rhesus monkeys. Cell Tissue Peptidotriazoles on solid phase: [1,2,3]-tri-
Kinet 7:189–194 azoles by regiospecific copper(i)-catalyzed
Thymidine Analogs and Proliferation in CNS 139
1,3-dipolar cycloadditions of terminal alkynes 38. Ehmann UK, Williams JR, Nagle WA et al
to azides. J Org Chem 67:3057–3064 (1975) Perturbations in cell cycle progression
26. Maslov AY, Barone TA, Plunkett RJ et al from radioactive DNA precursors. Nature 258:
(2004) Neural stem cell detection, character- 633–636
ization, and age-related changes in the sub- 39. Kolb B, Pedersen B, Ballermann M et al
ventricular zone of mice. J Neurosci 24: (1999) Embryonic and postnatal injections of
1726–1733 bromodeoxyuridine produce age-dependent
27. Vega CJ, Peterson DA (2005) Stem cell prolif- morphological and behavioral abnormalities.
erative history in tissue revealed by temporal J Neurosci 19:2337–2346
halogenated thymidine analog discrimination. 40. Kuwagata M, Ogawa T, Nagata T et al (2007)
Nat Methods 2:167–169 The evaluation of early embryonic neurogenesis
28. Cameron HA, McKay RD (2001) Adult neu- after exposure to the genotoxic agent 5-bromo-
rogenesis produces a large pool of new granule 2′-deoxyuridine in mice. Neurotoxicology 28:
cells in the dentate gyrus. J Comp Neurol 435: 780–789
406–417 41. Sekerkova G, Ilijic E, Mugnaini E (2004)
29. Bannigan J, Langman J (1979) The cellular Bromodeoxyuridine administered during neu-
effect of 5-bromodeoxyuridine on the mam- rogenesis of the projection neurons causes
malian embryo. J Embryol Exp Morphol 50: cerebellar defects in rat. J Comp Neurol 470:
123–135 221–239
30. Webster W, Shimada M, Langman J (1973) 42. Nowakowski RS, Lewin SB, Miller MW (1989)
Effect of fluorodeoxyuridine, colcemid, and Bromodeoxyuridine immunohistochemical
bromodeoxyuridine on developing neocortex determination of the lengths of the cell cycle
of the mouse. Am J Anat 137:67–85 and the DNA-synthetic phase for an anatomi-
31. Kornack DR, Rakic P (1998) Changes in cell- cally defined population. J Neurocytol 18:
cycle kinetics during the development and evo- 311–318
lution of primate neocortex. Proc Natl Acad Sci 43. Burns KA, Ayoub AE, Breunig JJ et al (2007)
U S A 95:1242–1246 Nestin-CreER mice reveal DNA synthesis by
32. Leuner B, Glasper ER, Gould E (2009) nonapoptotic neurons following cerebral isch-
Thymidine analog methods for studies of adult emia hypoxia. Cereb Cortex 17:2585–2592
neurogenesis are not equally sensitive. J Comp 44. Kuan CY, Schloemer AJ, Lu AG et al (2004)
Neurol 517:123–133 Hypoxia-ischemia induces DNA synthesis
33. Shibui S, Hoshino T, Vanderlaan M et al without cell proliferation in dying neurons
(1989) Double labeling with iodo- and bromo- in adult rodent brain. J Neurosci 24:
deoxyuridine for cell kinetics studies. J 10763–10772
Histochem Cytochem 37:1007–1011 45. Yang Y, Geldmacher DS, Herrup K (2001)
34. Gratzner HG (1982) Monoclonal antibody to DNA replication precedes neuronal cell death in
5-bromo- and 5-iododeoxyuridine: a new Alzheimer’s disease. J Neurosci 21:2661–2668
reagent for detection of DNA replication. 46. Brockman RW, Anderson EP (1963)
Science 218:474–475 Biochemistry of cancer (metabolic aspects).
35. Imamura F, Ayoub AE, Rakic P et al (2011) Annu Rev Biochem 32:463–512
Timing of neurogenesis is a determinant of 47. Hitchings G, Elion G (1967) Mechanisms of
olfactory circuitry. Nat Neurosci 14:331–337 action of purine and pyrimidine analogs. In:
36. del Rio JA, Soriano E (1989) Immuno- Brodsky I, Kahn S, Moyer J et al (eds) Cancer
cytochemical detection of 5′-bromodeoxyuri- chemotherapy I. Grune and Stratton,
dine incorporation in the central nervous New York, NY, p 26
system of the mouse. Brain Res Dev Brain Res 48. Roy-Burman P (1970) Analogues of nucleic
49:311–317 acid components. Springer, New York, NY
37. Miller MW, Nowakowski RS (1988) Use of 49. Rash BG, Lim HD, Breunig JJ, Vaccarino FM
bromodeoxyuridine-immunohistochemistry to (2011) FGF signaling expands embryonic
examine the proliferation, migration and time cortical surface area by regulating Notch-
of origin of cells in the central nervous system. dependent neurogenesis. J Neurosci 31:
Brain Res 457:44–52 15604–15617
Chapter 8
Abstract
The following chapter describes a method for quantifying neurogenesis in the hippocampus of rodents.
In contrast to stereological methods which are the gold standard for quantifying neurogenesis, our method
uses flow cytometry. This method is considerably faster and less laborious but lacks the exact topological
information that stereology provides. The method can, for example, be applied in cases where a number
of experimental conditions or drug concentrations should be compared quantitatively in vivo. After having
obtained the optimal condition, one can do stereological counting in this sample to obtain additional
detail information.
We describe the method and show an exemplary quantification from a running experiment.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_8, © Springer Science+Business Media New York 2015
141
142 Armin Schneider
● Staining buffer.
● Dulbecco’s phosphate-buffered saline(DPBS)/3 % fetal calf
serum (FCS)/0.09 % NaN3: Prepare fresh before use.
2 Procedures
2.1 Positive Controls: Running exercise is the most effective and reliable method to stim-
Running ulate hippocampal neurogenesis in rodents [7–11, 59]. This para-
digm is therefore an excellent positive control for other experimental
conditions under study. One easy paradigm is to give animals access
to a running wheel over 3 weeks. Rodents will use the wheel over-
night and run kilometers.
2.2 Positive Controls: The antidepressant fluoxetine has been shown in many experi-
Fluoxetine ments to stimulate neurogenesis [36, 60–63]. The effects are how-
ever not as strong as running exercise and more parameters need to
be observed. We have used doses of 18 mg/kg body weight/day
in the drinking water. To reach that dose, assuming an intake of
2.5 mL water/day/mouse, 500 mg fluoxetine is dissolved in 2.3 L
drinking water. Water is exchanged twice per week. If possible,
drinking volumes should be monitored.
2.3 BrdU Treatment Different patterns of BrdU application have been used in the litera-
ture. We use a 5-day regimen with a twice daily subcutaneous (s.c.)
application of 50 mg/kg BrdU. In an alternative regimen, mice are
treated with BrdU at a dose of 75 mg/kg bodyweight four times/
day. Animals are subjected to analysis of neurogenesis 3 weeks after
the last BrdU dose.
mouse hippocampus
dounce for 12 hubs in 0.32 M sucrose (750 µL)
discard
discard
+750 µL 4% formaline
discard
discard
ultracentrifugation
discard
nuclear pellet
resuspended in
1mL staining buffer
Fig. 1 Flowchart of the purification protocol. Figure is reproduced from [57] with permission from the Journal
of Neurochemistry
2.5 Immuno- BrdU-labeled nuclei are stained with the APC-BrdU flow cytome-
cytochemistry try kit. Nuclei are permeabilized and refixed with buffers contained
in the kit. Nuclei are then treated with DNAse I (300 mg/mL)
for 45 min at 37 °C, washed with BD perm/wash buffer, and
incubated with an APC-conjugated anti-BrdU antibody and/or
146 Armin Schneider
2.6 Flow Cytometry We perform flow cytometry using the FACSCaliburTM system.
Datasets including 150,000 7-AAD positive events are acquired.
Gates are set on forward scatter (FSC) and side scatter (SSC)
parameters, and the nuclear fraction is gated based on 7-AAD fluo-
rescence (FL-3). Analyses are based on the Alexa-Fluor® 488 and
APC fluorescence. For the BrdU signal, a cutoff value was defined
by analysis of controls that had not received BrdU.
2.7 Statistical Results should be evaluated using the correct statistical approaches.
Analysis Statistical software packages that can be used for these and other
analyses include GraphPad Prism (http://www.graphpad.com/
scientific-software/prism/), SigmaStat (http://www.sigmaplot.com/
products/sigmaplot/sigmastat.php), IBM SPSS Statistics (http://
www-01.ibm.com/software/analytics/spss/products/statistics/),
NCSS (http://www.ncss.com/), JMP (http://www.jmp.com/),
orSTATISTICA(http://www.statsoft.com/Products/STATISTICA-
Features/Overview). Figure 2 shows the results of flow cytometric
analysis of mouse hippocampal nuclei positive for 7-AAD.
a control b exercise
104
4
10
NeuN (Alexa Fluor® 488)
3
10
R4 R4
102
2
10
101
1
10
R5 R5
0
0
10
10
0
10 101 102 103 104 100 101 102 103 104
BrdU (APC) BrdU (APC)
c
1400
BrdU/NeuN ++
*
1200 BrdU + 1068
positive events / 100000
1000
800
577
600
400
*
213
200
61
0
control exercise
Fig. 2 Flow cytometry-based analysis of hippocampal nuclei positive for 7-AAD signals (7-AAD gating not
shown) of mice that underwent running exercise (b) in comparison to control animals (a). Nuclei were previ-
ously also gated on forward scatter (FSC) and side scatter (SSC) parameters (not shown). Male C57BL/6 mice
(n = 7 per group) were treated with BrdU on 5 consecutive days, twice a day with 50 mg BrdU/kg body weight.
Nuclei were analyzed 3 weeks after the first day of BrdU application. (c) The number of BrdU-positive/NeuN-
positive nuclei (gate R4) and the total number of BrdU-positive nuclei (gates R4 and R5) are shown as bar
graphs (means ± SEM). Figure is reproduced from [57] with permission from the Journal of Neurochemistry
148 Armin Schneider
References
and NMDA receptor activation. J Neurosci 17: 32. Sahay A, Scobie KN, Hill AS et al (2011)
2492–2498 Increasing adult hippocampal neurogenesis is
18. Gould E, Tanapat P (1999) Stress and hippo- sufficient to improve pattern separation. Nature
campal neurogenesis. Biol Psychiatry 46: 472:466–470
1472–1479 33. Eisch AJ, Petrik D (2012) Depression and hip-
19. Joels M, Karst H, Krugers HJ et al (2007) pocampal neurogenesis: a road to remission?
Chronic stress: implications for neuronal mor- Science 338:72–75
phology, function and neurogenesis. Front 34. Gass P, Henn FA (2009) Is there a role for neu-
Neuroendocrinol 28:72–96 rogenesis in depression? Biol Psychiatry 66:
20. Mirescu C, Gould E (2006) Stress and adult 3–4
neurogenesis. Hippocampus 16:233–238 35. Jacobs BL, van Praag H, Gage FH (2000)
21. Guzman-Marin R, Suntsova N, Methippara M Adult brain neurogenesis and psychiatry: a
et al (2005) Sleep deprivation suppresses neu- novel theory of depression. Mol Psychiatry 5:
rogenesis in the adult hippocampus of rats. Eur 262–269
J Neurosci 22:2111–2116 36. Li Y, Luikart BW, Birnbaum S et al (2008)
22. Guzman-Marin R, Bashir T, Suntsova N et al TrkB regulates hippocampal neurogenesis and
(2007) Hippocampal neurogenesis is reduced governs sensitivity to antidepressive treatment.
by sleep fragmentation in the adult rat. Neuro- Neuron 59:399–412
science 148:325–333 37. Perera TD, Coplan JD, Lisanby SH et al (2007)
23. Hairston IS, Little MT, Scanlon MD et al Antidepressant-induced neurogenesis in the
(2005) Sleep restriction suppresses neurogen- hippocampus of adult nonhuman primates. J
esis induced by hippocampus-dependent learn- Neurosci 27:4894–4901
ing. J Neurophysiol 94:4224–4233 38. Sahay A, Hen R (2007) Adult hippocampal
24. Mirescu C, Peters JD, Noiman L et al (2006) neurogenesis in depression. Nat Neurosci 10:
Sleep deprivation inhibits adult neurogenesis in 1110–1115
the hippocampus by elevating glucocorticoids. 39. Snyder JS, Soumier A, Brewer M et al (2011)
Proc Natl Acad Sci U S A 103:19170–19175 Adult hippocampal neurogenesis buffers stress
25. Mueller A, Meerlo P, McGinty D et al (2013) responses and depressive behaviour. Nature
Sleep and adult neurogenesis: implications for 476:458–461
cognition and mood. Curr Top Behav Neurosci. 40. Vollmayr B, Mahlstedt MM, Henn FA (2007)
(Springer Berlin Heidelberg), 251:1–31 Neurogenesis and depression: what animal
26. Novati A, Hulshof HJ, Koolhaas JM (2011) models tell us about the link. Eur Arch
Chronic sleep restriction causes a decrease in Psychiatry Clin Neurosci 257:300–303
hippocampal volume in adolescent rats, which 41. Campos AC, Ortega Z, Palazuelos J et al (2013)
is not explained by changes in glucocorticoid The anxiolytic effect of cannabidiol on chroni-
levels or neurogenesis. Neuroscience 190: cally stressed mice depends on hippocampal
145–155 neurogenesis: involvement of the endocannabi-
27. Clelland CD, Choi M, Romberg C et al (2009) noid system. Int J Neuropsychopharmacol
A functional role for adult hippocampal neuro- 16:1407–1419
genesis in spatial pattern separation. Science 42. Kheirbek MA, Klemenhagen KC, Sahay A et al
325:210–213 (2012) Neurogenesis and generalization: a new
28. Deng W, Saxe MD, Gallina IS (2009) Adult- approach to stratify and treat anxiety disorders.
born hippocampal dentate granule cells Nat Neurosci 15:1613–1620
undergoing maturation modulate learning 43. Revest JM, Dupret D, Koehl M et al (2009)
and memory in the brain. J Neurosci 29: Adult hippocampal neurogenesis is involved in
13532–13542 anxiety-related behaviors. Mol Psychiatry 14:
29. Tronel S, Fabre A, Charrier V et al (2010) 959–967
Spatial learning sculpts the dendritic arbor of 44. Dranovsky A, Hen R (2007) DISC1 puts the
adult-born hippocampal neurons. Proc Natl brakes on neurogenesis. Cell 130:981–983
Acad Sci U S A 107:7963–7968 45. Ming GL, Song H (2009) DISC1 partners
30. Kitamura T, Saitoh Y, Takashima N et al (2009) with GSK3beta in neurogenesis. Cell 136:
Adult neurogenesis modulates the 990–992
hippocampus-dependent period of associative 46. Ouchi Y, Banno Y, Shimizu Y et al (2013)
fear memory. Cell 139:814–827 Reduced adult hippocampal neurogenesis and
31. Aimone JB, Deng W, Gage FH (2011) working memory deficits in the Dgcr8-deficient
Resolving new memories: a critical look at the mouse model of 22q11.2 deletion-associated
dentate gyrus, adult neurogenesis, and pattern schizophrenia can be rescued by IGF2. J
separation. Neuron 70:589–596 Neurosci 33:9408–9419
150 Armin Schneider
47. Spalding KL, Bhardwaj RD, Buchholz BA measure adult neurogenesis in the brain.
(2005) Retrospective birth dating of cells in J Neurochem 119:165–175
humans. Cell 122:133–143 58. Schneider A, Spoelgen R, Meyer A (2011)
48. Spalding KL, Bergmann O, Alkass K et al Methods of quantitative determination of neu-
(2013) Dynamics of hippocampal neurogenesis rogenesis in vivo. WO Patent 2,011,066,987
in adult humans. Cell 153:1219–1227 59. Brown J, Cooper-Kuhn CM, Kempermann G
49. Kuhn HG, Cooper-Kuhn CM (2007) Bromo- et al (2003) Enriched environment and physi-
deoxyuridine and the detection of neurogenesis. cal activity stimulate hippocampal but not
Curr Pharm Biotechnol 8:127–131 olfactory bulb neurogenesis. Eur J Neurosci
50. del Rio JA, Soriano E (1989) Immuno- 17:2042–2046
cytochemical detection of 5′-bromodeoxyuridine 60. Encinas JM, Vaahtokari A, Enikolopov G
incorporation in the central nervous system of (2006) Fluoxetine targets early progenitor cells
the mouse. Brain Res Dev Brain Res 49: in the adult brain. Proc Natl Acad Sci U S A
311–317 103:8233–82385
51. Elias H (1967) Stereology. Science 156: 61. Kohl Z, Winner B, Ubhi K et al (2012)
1137–1140 Fluoxetine rescues impaired hippocampal neu-
rogenesis in a transgenic A53T synuclein
52. Dewey GC, Elias H, Appel KR (1966)
mouse model. Eur J Neurosci 35:10–19
Stereology of the renal corpuscles of desert and
swamp deermice. Nephron 3:352–365 62. Malberg JE, Eisch AJ, Nestler EJ et al (2000)
Chronic antidepressant treatment increases
53. Underwood EE (1969) Stereology, or the neurogenesis in adult rat hippocampus.
quantitative evaluation of microstructures. J J Neurosci 20:9104–9110
Microsc 89:161–180
63. Santarelli L, Saxe M, Gross C et al (2003)
54. Mouton PR (2002) Principles and practices Requirement of hippocampal neurogenesis for
of unbiased stereology: an introduction for the behavioral effects of antidepressants.
bioscientists. Johns Hopkins University Press, Science 301:805–809
Baltimore
64. Clark PJ, Kohman RA, Miller DS et al (2011)
55. West MJ (2012) Basic stereology for biologists Genetic influences on exercise-induced adult
and neuroscientists. Cold Spring Harbor hippocampal neurogenesis across 12 divergent
Laboratory Press, Cold Spring Harbor, mouse strains. Genes Brain Behav 10:345–353
New York 65. Hodes GE, Hill-Smith TE, Suckow RF et al
56. Mouton PR (2013) Neurostereology: unbiased (2010) Sex-specific effects of chronic fluox-
stereology of neural systems. Wiley, New York etine treatment on neuroplasticity and pharma-
57. Spoelgen R, Meyer A, Moraru A et al (2011) cokinetics in mice. J Pharmacol Exp Ther
A novel flow cytometry‐based technique to 332:266–273
Part III
Abstract
In this chapter, we discuss several immunohistochemical methods to monitor apoptosis and autophagy in
two models, the cultured rat neuroblastoma cells and the developing rat cerebellum.
Apoptosis and autophagy have been implicated in many physiological and pathological processes.
Apoptotic cell death is characterized by membrane blebbing and nuclear chromatin condensation/fragme
ntation, alteration of cytoskeleton components and cytoplasmic organelles, and formation of membrane-
enveloped apoptotic bodies that are rapidly phagocytosed by macrophages. Autophagy is a sequential set
of events including double membrane formation and elongation, vesicle maturation, and finally delivery of
the targeted materials to the lysosome. Platinum compounds can induce different apoptotic pathways in
neural cell cultures and alter the normal balance between the formation and degradation of cellular pro-
teins. These compounds also affect cell death by apoptosis and autophagy in the proliferating and differ-
entiating cells of rat cerebellum in vivo.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_9, © Springer Science+Business Media New York 2015
153
154 Maria Grazia Bottone et al.
1.2 Apoptosis The term apoptosis is currently used to identify a particular type of
programmed cell death (PCD) regulated by several well-recognized
genes. Cells destined to die activate, in a coordinated manner, a
series of enzymes that implement an orderly and efficient degrada-
tion of their DNA, nuclear and cytoskeletal proteins, and, in gen-
eral, all cellular components. Apoptotic death occurs both in
physiological and pathological or adaptive situations with the ulti-
mate goal of removing cells that are no longer useful or have been
somehow damaged.
Under physiological conditions, apoptosis occurs during
embryogenesis, ensuring proper tissue remodeling through the
Apoptosis and Autophagy in Neural Cells 155
1.3 Autophagy The term autophagy refers to a self-digestion process that takes
place by means of lysosomal degradation. Autophagy is activated
in response to various stress stimuli such as fasting changes in
cell volume, oxidative stress, or accumulation of damaged pro-
teins [24]. If autophagy is induced excessively, it can cause a
form of cell death, known as type II PCD, distinct from type I
(apoptosis) and necrosis [25]. Autophagy is involved in normal
development, immunity, and defense against microbial infections,
156 Maria Grazia Bottone et al.
3 Procedures
3.1 Treatment All experiments are performed according to the guidelines for care
of Wistar Rats and use of laboratory animals aiming to minimize the number of
with Platinum animals used and their suffering.
Compounds P10 Wistar rats are given a single subcutaneous injection in
and Preparation the nape of the neck at a dose of 5 μg/g body weight (corre-
of Paraffin Sections sponding to the therapeutic dose suggested by [40]) of cisPt or
PtAcacDMS [41]. Throughout the experiment, rats were kept in
an artificial 12-h light: 12-h dark cycle and provided with chow
and tap water ad libitum.
One day (P11), 7 days (P17), and 20 days (P30) after drug
injection, treated and untreated control rats of the same age are
deeply anesthetized and euthanized. The brains are quickly
removed, fixed in Carnoy’s solution for 48 h, then placed in absolute
ethanol for 50 min and in acetone for 30 min, and embedded in
Paraplast X-tra. Paraplast-embedded sections of the cerebellar ver-
mis are obtained parallel to the sagittal plane.
Apoptosis and Autophagy in Neural Cells 159
Table 1
Primary and secondary antibodies
Primary antibodies
Type of marker Antigen Type of antibody Suggested supplier or reference
Apoptosis AIF Rabbit polyclonal Cell Signalling Technology, Danvers, MA
Bax Rabbit polyclonal Santa Cruz Biotechnology, Santa Cruz, CA
Active caspase-3 Rabbit polyclonal Cell Signalling Technology
Active caspase-8 Rabbit polyclonal Cell Signalling Technology
Active caspase-9 Rabbit polyclonal Cell Signalling Technology
Autophagy Atg5 Mouse monoclonal Cell Signalling Technology
Beclin-1 Rabbit polyclonal Cell Signalling Technology
LC3B Rabbit polyclonal Cell Signalling Technology
mtHSP70 Mouse monoclonal ALEXIS® Biochemicals, Enzo® Life
Sciences, Farmingdale, NY
p62/SQSTM Mouse monoclonal Abcam, Cambridge, UK
Cell type Calbindin Mouse monoclonal Swant, Bellinzona, Switzerland
cytoskeleton α-tubulin Mouse monoclonal Molecular Probes®, Life Technologies™,
organelles Carlsbad, CA
Golgi apparatus Human autoimmune [42]
serum
Lysosomes Human autoimmune [43]
serum
Secondary antibodies
Host species Specificity Tag Fluorescence Suggested supplier
Goat Rabbit Biotin N/A Vector Laboratories,
Burlingame, CA
Rabbit Alexa-Fluor®488 Green Molecular Probes®
Mouse Alexa-Fluor®488
Human Alexa-Fluor®594 Red
Rabbit Alexa-Fluor®594
Mouse Alexa-Fluor®594
Other fluorescent probes
Tag Fluorescence Suggested supplier
a ®
Phalloidin Alexa-Fluor 594 Red Molecular Probes®
Abbreviations: AIF apoptosis inducing factor, Atg5 autophagy protein 5, LC3B microtubule-associated protein 1 light
chain 3B, mtHSP70 heat shock protein 70 mitochondrial isoform, p62/SQSTM p62/sequestosome 1
a
Phalloidin is a toxin isolated from the deadly Amanita phalloides that binds directly F-actin
3.2 Terminal Sections (from P11 and P17 rats) are dewaxed in xylene, rehy-
Transferase dUTP drated in a decreasing ethanol series, rinsed in PBS, and incubated
Nick-End Labeling with the permeabilization solution for 8 min at room tempera-
(TUNEL) Reaction ture. After two rinses in PBS (5 min each), slides are incubated
with 50 μL of TUNEL mixture conjugated with FITC (5 μL ter-
minal deoxynucleotidyl transferase solution and 45 μL label solution)
according to the manufacturer’s instructions for 3 h at 37 °C.
160 Maria Grazia Bottone et al.
3.3 Immuno- All passages are carried out at room temperature unless otherwise
cytochemistry In Vivo stated. After slides are dewaxed and brought to water, endogenous
peroxidases are suppressed by the incubation of sections with 3 %
H2O2 in 10 % methanol in PBS for 7 min. Subsequently, sections
are incubated for 20 min in normal serum to block nonspecific
antigen-binding sites.
3.4 Treatment B50 neuroblastoma rat cells in flasks are cultured in culture medium
of Neuroblastoma Rat under 5 % CO2 humidified atmosphere. Twenty-four hours before
Cells (B50) experiments, cells are seeded on glass coverslips for IMF.
with Platinum Cells are submitted to (1) continued exposure to cisPt 40 μM
Compounds or PtAcacDMS 10 μM for 48 h at 37 °C and (2) continued expo-
sure to cisPt 40 μM or PtAcacDMS 10 μM for 48 h and then
recovery of 7 days. This concentration corresponds to the most
common dose used in chemotherapy [40].
Apoptosis and Autophagy in Neural Cells 161
3.5 Immuno- All passages are carried out at room temperature unless otherwise
cytochemistry In Vitro stated.
Parameters for fixation and primary/secondary antibody incu-
bation are summarized in Table 2.
Both primary and secondary antibodies are diluted in PBS.
After the incubation in secondary antibodies, sections are washed
in PBS, incubated with 0.1 μg/mL Hoechst 33258 for 5 min,
washed again with PBS, and finally mounted in Mowiol for analysis
under conventional fluorescence or laser confocal microscopy.
3.6 Microscopy Slides with immunoperoxidase reaction can be observed with any
and Photography type of transmitted light microscope. After IMF reactions, slides
can be viewed with any type of fluorescence microscope or with a
confocal microscope. See Notes 1–3.
4 Typical/Anticipated Results
4.1 Immuno- The TUNEL reaction (Fig. 1a–c) allows to detect apoptotic cells
peroxidase: on the basis of their fragmented DNA, whereas Bax immunoreac-
Cerebellum tivity (Fig. 1d–f) is an earlier indicator of the activation of the
apoptotic machinery. The different effects of the two platinum
4.1.1 Apoptosis
compounds can be easily appreciated as both methodological
approaches confirm that PtAcacDMS does not induce apoptosis in
the proliferating cells of the germinative matrix (EGL). Two differ-
ent patterns of Bax labeling are found in the EGL: after cisPt, there
is a high presence of Bax-labeled apoptotic bodies in the EGL,
whereas after PtAcacDMS, the intensity and distribution of Bax
immunoreactivity are the same as in controls, except for the pres-
ence of microglial-like cells.
Table 2
Single and double IMF parameters for in vitro immunocytochemistry on neuroblastoma cells
Dilution Dilution
Markers Fixation I antibody incubation II antibody incubation
Single IMF
Activated caspases Acetone Caspase-3 1:50 Alexa-Fluor® 1:200
(10 min) Caspase-8 60 min 488-anti- 60 min
Caspase-9 rabbit
Mitochondrial 4 % PFA Mitochondrial HSP70 1:50 Alexa-Fluor® 1:200
(30 min) 60 min 488-anti- 60 min
70 % ethanol mouse
(24 h −20 °C)
Golgi apparatus 4 % PFA Human autoimmune 1:250 Alexa-Fluor® 1:200
(30 min) serum [42] 60 min 594-anti- 60 min
70 % ethanol human
(24 h −20 °C)
Double IMF
Cytoskeletal proteins 4 % PFA α-Tubulin 1:40 Alexa-Fluor® 1:200
(30 min) 60 min 488- anti- 60 min
70 % ethanol mouse
(24 h −20 °C)Alexa-Fluor® 1:40 N/A N/A
594-conjugated 60 min
phalloidina
Mitochondrial/AIF 4 % PFA AIF 1:100 Alexa-Fluor® 1:200
(30 min) 60 min 488-anti- 60 min
70 % ethanol rabbit
(24 h –20 °C) Mitochondrial HSP70 1:50 Alexa-Fluor® 1:40
60 min 594-anti- 60 min
mouse
Lysosomal/LC3B 4 % PFA Human autoimmune 1:200 Alexa-Fluor® 1:200
(30 min) serum [43] 60 min 594-anti- 60 min
70 % ethanol human
(24 h –20 °C) LC3B 1:100 Alexa-Fluor® 1:200
60 min 488- anti- 60 min
mouse
Lysosomal/ 4 % PFA Human autoimmune 1:200 Alexa-Fluor® 1:200
mitochondrial (30 min) serum [43] 60 min 594-anti- 60 min
70 % ethanol human
(24 h –20 °C) Mitochondrial HSP70 1:50 Alexa-Fluor® 1:200
60 min 488-anti- 60 min
mouse
N/A not applicable. Double IMF reactions are carried out sequentially in the order indicated
a
As phalloidin binds directly F-actin, this is not per se an immunocytochemical reaction
Apoptosis and Autophagy in Neural Cells 163
Fig. 1 TUNEL reaction and Bax immunoreaction at P11. Compared with control rats (a), the number of TUNEL-
positive cell bodies is higher in the EGL after cisPt treatment (b). On the contrary, PtAcacDMS does not alter
the distribution and labeling of TUNEL-positive cells in the EGL (c). Compared with controls (d), there are
changes of Bax labeling after both platinum compound treatments (e, f) in the EGL. At PD11, Bax immunoreac-
tive cell bodies are present in the EGL after cisPt treatment (e, inset ). After PtAcacDMS (f), there is an increased
Bax immunoreactivity in very small cells, likely corresponding to microglia. After both platinum compounds,
Bax immunoreactivity in Purkinje cells is intense both in untreated and treated rats. Abbreviations: EGL exter-
nal granular layer, IGL internal granular layer. Scale bars: 80 μm (d–f), 200 μm (a–c)
164 Maria Grazia Bottone et al.
Fig. 2 Single immunoperoxidase staining for Atg5 at P11 and P17. Single immunoperoxidase staining at P11
(a—inset ) shows small immunopositive granules, mainly around the nucleus in Purkinje cells of control rats,
and some immunopositive EGL cells. After cisPt treatment, some Purkinje cells show an increased labeling
(b—inset ), and large granules are well visible in the cytoplasm and the stem dendrite. Also after PtAcacDMS
treatment, Purkinje cells display immunopositive somas (c—inset ) with accumulation in the main dendritic
shaft. At P17, granular aggregations can still be seen, often at one side of the cell, in control animals (d—inset ).
After cisPt treatment, Purkinje cells (e—inset ) remain positive with very large immunoreactive granules. After
PtAcacDMS treatment, immunopositivity takes the form of small granulations in the perinuclear zone of the
Purkinje cell body (f—inset ), but there are no detectable changes in morphology compared to controls.
Abbreviations: EGL external granular layer. Scale bars: 80 μm
Apoptosis and Autophagy in Neural Cells 165
Fig. 3 Single immunoperoxidase staining for p62/SQSTM at P11, P17, and P30. At P11, the EGL is labeled in
control rats (a). After cisPt the reaction intensity increases (b), as well as after PtAcacDMS in parallel with an
increase in the immunoreactivity in Purkinje neurons (c). At P17, immunoreactivity is weak in control rats (d).
The immunoperoxidase staining depicts some Purkinje cells with very intense, large immunopositive precipi-
tations (e—inset ). About 40 % of them display flattened and shrunken soma (f—inset ). After PtAcacDMS,
immunoreactive granular aggregations in the Purkinje cell soma are very similar to those in controls, and cells
maintain a round shape. At P30, there is a weak labeling in the cytoplasm of control Purkinje cells (g). After
cisPt treatment, an increased immunopositivity is detectable in Purkinje neurons (h), also with large granules.
After PtAcacDMS treatment, labeling takes the form of small granules (i) and localizes in the perinuclear zone
of the Purkinje neurons (inset ). Abbreviations: EGL external granular layer, IGL internal granular layer. Scale
bars: 50 μm (d–i); 100 μm (a–c)
Fig. 4 Single immunoperoxidase staining for LC3B at P11, P17, and P30. At P11, the ML of control rats is
intensely immunopositive (a). After treatment with platinum compounds, there are no obvious differences in
immunoreactivity (b, c). At P17, there is a reduction of immunoreactivity in Purkinje cells of controls (d) and
that becomes much more evident after treatment with cisPt (e) and PtAcacDMS (f). At P30, immunoreactivity
has completely disappeared from the ML. In parallel, a weak labeling appears in the Purkinje neuron cytoplasm
and main dendrites (g–i). Abbreviations: EGL external granular layer, IGL internal granular layer, ML molecular
layer. Scale bars: 50 μm (e–i); 100 μm (a–f)
4.2 Double IMF: Exemplificative results of double IMF experiments for the localization
Cerebellum of autophagy markers (beclin-1 and LC3B) in Purkinje neurons
labeled with the anti-calbindin antibody are shown in Fig. 5.
Micrographs are taken with conventional fluorescence microscopy.
Results of quantitative analysis are reported in Fig. 6.
4.3 B50 The terminal events of apoptosis involve the activation of a specific
Neuroblastoma Cells series of cytoplasmic proteases, termed caspases. The activation of
these self-catalytic caspases in the cytoplasm is tightly regulated [44].
4.3.1 Apoptosis
B50 cells, after treatment with cisPt for 48 h, show activation of
caspase-9 (a), caspase-8 (b), and caspase-3 (c), with the immu-
nopositivity at the level of the cytoplasm. Nuclei are dense and
show many blebs. See Note 4 (Fig. 7).
Fig. 5 Double immunofluorescence staining for beclin-1/calbindin at P11 and for LC3B/calbindin at P17. P11:
Beclin-1 immunoreactivity is visualized in red with Alexa-Fluor® 594 (a, d, g), calbindin immunoreactivity in
green with Alexa-Fluor® 488 (b, e, h). Colocalization in merged images is yellow (c, f, i). Purkinje cells with a
well-branched dendritic tree after labeling for calbindin show a general diffuse immunopositivity for beclin-1 in
soma (a–c). After cisPt treatment, Purkinje cells display atrophic dendrite trees (d–f). After PtAcacDMS treat-
ment, the Purkinje cells maintain intensely stained cell bodies (g–i). P17: L3CB immunoreactivity is visualized
in red with Alexa-Fluor® 594 (j, m, p), calbindin immunoreactivity in green with Alexa-Fluor® 488 (k, n, q).
Colocalization in merged images is yellow (l, o, r). LC3B is mainly localized in Purkinje cell soma. The IGL
shows positive granule cells and glomeruli. After cisPt, Purkinje cells display intense, not homogeneous immu-
nolabeling of the cytoplasm. After PtAcacDMS, labeling decreases, but it appears as small diffuse granules.
Abbreviations: EGL external granular layer, IGL internal granular layer. Scale bars: 80 μm
a
100
90 ***
80
70
*** Purkinje
60
EGL
50 ***
40
30
20
10
0
CTR cisPt PTacacDMS
b
90
80 ***
70
60 *** Purkinje
50
*** EGL
40
30
20
10
0
CTR cisPt PTacacDMS
c
100
90
80
70
60 ** ***
Purkinje
50
40
30
20
10
0
CTR cisPt PTacacDMS
100
90
80
70 **
60 Purkinje
50
40
30
20
10
0
CTR cisPt PTacacDMS
Fig. 6 Quantitative analysis of fluorescence intensity. (a) Fluorescence intensity measurements for beclin-1 at
P11 indicate diminished optical density (OD) values (Student’s t-test, ***p < 0.001 extremely significant) in
Purkinje cells after cisPt treatment with respect to controls (***). Conversely, OD significantly increases after
Apoptosis and Autophagy in Neural Cells 169
Fig. 7 IMF of activated caspases. Immunocytochemical reaction for activated caspase-9 (a), caspase-8 (b),
and caspase-3 (c) in cisPt-treated neuroblastoma (B50) cells (green fluorescence). DNA is counterstained with
Hoechst 33258 (blue). Scale bars: 20 μm
Fig. 6 (continued) PtAcacDMS (***). The same trend is observed in EGL cells after PtAcacDMS treatment (***).
(b) Fluorescence intensity measurements for LC3B at P11 show that after PtAcacDMS, there are increased OD
values in Purkinje cells (***) (Student’s t-test, ***p < 0.001 extremely significant). The same happens in EGL
after both cisPt and PtAcacDMS treatment (***). (c) Fluorescence intensity measurements for beclin-1 at P30
indicate increased OD values (Student’s t-test, **p < 0.01 very significant; ***p < 0.001 extremely significant)
in Purkinje cells after cisPt treatment respect the controls (**) and a further increase after PtAcacDMS (***). The
EGL is no longer present. (d) Fluorescence intensity measurements for LC3B at P30 indicate increased OD
values (Student’s t-test, **p < 0.01 very significant) in Purkinje cells after PtAcacDMS treatment (**). The EGL
is no longer present
170 Maria Grazia Bottone et al.
Fig. 8 Confocal fluorescence microscopy of B50 neuroblastoma cells. (a, b): Immunolabeling of mtHSP70
(green ) in B50 cells in controls (a) and cisPt-treated cells (b). After cisPt, mitochondria are clustered around
the nucleus and form dense masses in the cytoplasm (b). Nuclei are counterstained with Hoechst (blue ). (c, d):
Double immunolabeling of filamentous actin (red ) and α-tubulin (green ) in B50 control cells (c) and in 48 h
cisPt-treated cells (d). CisPt-induced cytoskeleton damage leads tubulin to reorganize into thick bundles (e) and
to disruption of filamentous actin microfilaments and accumulation of depolymerized actin at cell periphery (f).
Apoptosis and Autophagy in Neural Cells 171
Fig. 8 (continued) (g, h): Immunolabeling of Golgi apparatus (red ) in control cells (g) and in 48-h cisPt-treated
cells (h). In control cells, the Golgi apparatus maintains its perinuclear location, whereas in late apoptosis cell, the
Golgi is redistributed into the cytoplasm. DNA is counterstained with Hoechst 33258 (blue ). Scale bars: 20 μm
Fig. 9 Confocal microscopy of double IMF labeling of mitochondria (red ) and AIF (green ). (a) Control cells, (b)
treatment with cisPt. AIF is found in the cytoplasm only and colocalizes with mitochondria. DNA is counter-
stained with Hoechst 33258 (blue ). Scale bars: 20 μm
4.3.2 Autophagy Lysosomes are organelles that contain an array of enzymes capable
of breaking down all types of biological polymers: proteins, nucleic
acids, carbohydrates, and lipids [55]. Lysosomes’ functions are
both to degrade a material taken up from outside the cell and to
digest obsolete cellular components. Lysosomes are also responsi-
ble for autophagy: the first step of autophagy appears to be the
enclosure of an organelle (e.g., a mitochondrion) in a membrane
derived from the endoplasmic reticulum. The resulting vesicle (an
autophagosome) then fuses with a lysosome, and its contents are
digested. Autophagy is responsible for the gradual turnover of
cytoplasmic organelles.
Neuroblastoma B50 cells after 48 h of continuous exposure to
cisPt 40 μM were left for 7 days in drug-free medium. After double
IMF for lysosomes (red) and mitochondria (green), cells show
numerous orange dots indicating a probable presence of mito-
chondria within lysosomal vesicles (Fig. 10c). This does not occur
in control cells (Fig. 10a) and even in cells treated for 48 h with
cisPt and fixed immediately thereafter (Fig. 10b). In apoptotic
cells, the number of lysosomes decreases. This indicates that recov-
ering cells display autophagic features.
Apoptosis and Autophagy in Neural Cells 173
Fig. 10 Confocal microscopy double IMF of neuroblastoma B50 cells. Staining for mitochondria (green ) and
lysosomes (red ) in (a) controls, (b) after 48-h treatment with cisPt, and (c) recovery. Images show that, after
cisPt, lysosomes and mitochondria are distributed in cytoplasmic clusters compared to control, but do not
show colocalization. During recovery, cells assume a morphology similar to control cells and show an increase
of lysosomes. Immunohistochemistry for LC3B (green ) and lysosomes (red ) in (d) control and (e) recovery
cells. Graph analysis shows the fluorescence peak and colocalization of the two labels. DNA is counterstained
with Hoechst 33258 (blue ). Scale bars: 20 μm
6 Conclusion
Acknowledgments
References
1. Rodier PM (1995) Developing brain as a target and transformed thyroid cell lines to cisplatin
for neurotoxicity. Environ Health Perspect treatment. Biochem Pharmacol 71:50–60
103:73–76 13. Muscella A, Calabriso N, De Pascali SA et al
2. Maris JM (2010) Recent advances in neuro- (2007) New platinum(II) complexes contain-
blastoma. N Engl J Med 36:2202–2211 ing both an O, O′-chelated acetylacetonate
3. Cohn SL, Pearson AD, London WB et al ligand and a sulfur ligand in the platinum
(2009) The International Neuroblastoma Risk coordination sphere induce apoptosis in HeLa
Group (INRG) classification system: an INRG cervical carcinoma cells. Biochem Pharmacol
Task Force report. J Clin Oncol 27:289–297 74:28–40
4. Brezden CB, Phillips KA, Abdolell M et al 14. Muscella A, Calabriso N, Fanizzi FP et al
(2000) Cognitive function in breast cancer (2008) Pt(O, O′-acac)(gamma-acac)(DMS), a
patients receiving adjuvant chemotherapy. J new Pt compound exerting fast cytotoxicity in
Clin Oncol 18:2695–2701 MCF-7 breast cancer cells via the mitochon-
5. Kellie SJ (1999) Chemotherapy of central ner- drial apoptotic pathway. Br J Pharmacol 153:
vous system tumours in infants. Childs Nerv 34–49
Syst 15:592–612 15. Haanen C, Vermes I (1996) Apoptosis: pro-
6. Kline NE, Sevier N (2003) Solid tumors in grammed cell death in fetal development. Eur J
children. J Pediatr Nurs 18:96–102 Obstet Gynecol Reprod Biol 64:129–133
7. Sancho-Martínez SM, Piedrafita FJ, Cannata- 16. Taatjes DJ, Sobel BE, Budd RC (2008)
Andía JB et al (2011) Necrotic concentrations Morphological and cytochemical determina-
of cisplatin activate the apoptotic machinery but tion of cell death by apoptosis. Histochem Cell
inhibit effector caspases and interfere with the Biol 129:33–43
execution of apoptosis. Toxicol Sci 122:73–85 17. Hail N Jr, Carter BZ, Konopleva M et al
8. Pisu MB, Roda E, Guioli S et al (2005) (2006) Apoptosis effector mechanisms: a
Proliferation and migration of granule cells in requiem performer in different keys. Apoptosis
the developing rat cerebellum: cisplatin effects. 11:889–904
Anat Rec A Discov Mol Cell Evol Biol 287: 18. Elmore S (2007) Apoptosis: a review of pro-
1226–1235 grammed cell death. Toxicol Pathol 35:
9. Avella D, Pisu MB, Roda E et al (2006) 495–516
Reorganization of the rat cerebellar cortex dur- 19. Santin G, Scietti L, Veneroni P et al (2012)
ing postnatal development following cisplatin Effects of Cisplatin in neuroblastoma rat cells:
treatment. Exp Neurol 201:131–143 damage to cellular organelles. Int J Cell Biol
10. Piccolini VM, Avella D, Bottone MG et al 2012:1–6
(2012) Cisplatin induces changes in the matrix 20. Bottone MG, Santin G, Aredia F et al (2013)
metalloproteinases and their inhibitors in the Morphological features of organelles during
developing rat cerebellum. Brain Res 1484: apoptosis: an overview. Cells 2:294–305
15–28 21. Willingham MC (1999) Cytochemical meth-
11. Galluzzi L, Senovilla L, Vitale I et al (2013) ods for the detection of apoptosis. J Histochem
Molecular mechanisms of cisplatin resistance. Cytochem 47:1101–1109
Oncogene 31:1869–1883 22. Bottone MG, Soldani C, Veneroni P et al
12. Muscella A, Urso L, Calabriso N et al (2005) (2008) Cell proliferation, apoptosis and mito-
Differential response of normal, dedifferentiated chondrial damage in rat B50 neuronal cells
Apoptosis and Autophagy in Neural Cells 177
action of apoptosis inducing factor. Nat Struct 56. Crowley LC, O’Donovan TR, Nyhan MJ et al
Biol 9:680–684 (2013) Pharmacological agents with inherent
53. Scovassi AI, Soldani C, Veneroni P et al (2009) anti-autophagic activity improve the cytotoxic-
Changes of mitochondria and relocation of the ity of imatinib. Oncol Rep 29:2261–2268
apoptosis-inducing factor during apoptosis. 57. Cerri S, Piccolini VM, Santin G et al (2011)
Ann N Y Acad Sci 1171:12–17 The developmental neurotoxicity study of plat-
54. Bottone MG, Santin G, Piccolini VM et al inum compounds. Effects of cisplatin versus a
(2012) Cisplatin neurotoxicity induces cell death novel Pt(II) complex on rat cerebellum.
in vivo and in vitro. Cisplatin neurotoxicity Neurotoxicol Teratol 33:273–281
induces cell death in vivo and in vitro. In: Kojima 58. Scherini E, Bernocchi G (1994) CisDDP treat-
T, Morita Y (eds) Cisplatin pharmacology. ment and development of the rat cerebellum.
Clinical uses and adverse effects. Nova Science Prog Neurobiol 42:161–196
Publishers, Hauppauge, NY, pp 123–140 59. Bernocchi G, Bottone MG, Piccolini VM et al
55. Luzio JP, Pryor PR, Bright NA (2007) (2011) Developing central nervous system and
Lysosomes: fusion and function. Nat Rev Mol vulnerability to platinum compounds.
Cell Biol 8:622–632 Chemother Res Pract 2011:315418
Chapter 10
Abstract
Alzheimer’s disease (AD) represents a severe progressive neurodegenerative disorder and the most frequent
form of dementia. It is characterized by major neuropathological hallmarks consisting of either extracel-
lular deposited amyloid-β (Aβ) peptides or intracellular accumulations of hyperphosphorylated tau protein
in the form of so-called neurofibrillary tangles (NFTs). In addition to the presence of the extracellular
amyloid plaques, intraneuronal Aβ accumulations have been repeatedly reported in postmortem tissue
from AD patients, as well as in numerous transgenic AD mouse models overexpressing the amyloid precur-
sor protein (APP). Several staining protocols to detect intraneuronal Aβ exist, employing different meth-
ods of tissue pretreatment, including the use of microwave heat treatment or formic acid, among others.
In this book chapter, we outline an efficient protocol for reliable antigen retrieval of intracellular Aβ in AD
mouse models using paraffin-embedded brain material.
Key words Alzheimer’s disease, Antibodies, Antigen retrieval, APP, Amyloid, Immunohistochemistry,
Intraneuronal amyloid beta, Mouse model, Paraffin
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_10, © Springer Science+Business Media New York 2015
179
180 Oliver Wirths and Anika Saul
Table 1
Overview of some AD transgenic mouse models in which intraneuronal Aβ accumulation has been
demonstrated
2 Materials
2.1 Fixative, General ● 0.01 M phosphate buffered saline solution (PBS) (e.g.,
Washing Buffers Invitrogen™, Life Technologies™, Carlsbad, CA).
and Solutions ● 4 % paraformaldehyde (PFA) in 0.01 M PBS.
● 0.01 M PBS supplemented with 0.1 % Triton X-100.
● Xylene (caution: harmful and flammable).
● Series of ethanol: range from 70 %, 95 % to 100 % (caution:
flammable).
2.3 Solutions ● 0.01 M citrate buffer (citric acid), pH 6.0 for microwave
for Antigen Retrieval treatment.
● 88 % formic acid (FA) (caution: corrosive, irritant, and
sensitizer).
Visualization of Intraneuronal Aβ 183
3 Procedure
Fig. 1 Schematic drawing illustrating mouse brain removal for subsequent paraformaldehyde fixation and
paraffin embedding
Fig. 2 Qualitative comparison for staining of intraneuronal Aβ in the medial cortex of APP, APP/PS1KI, APP/PS1,
and 5xFAD mice. No clear intraneuronal Aβ staining was observed in APP, APP/PS1KI, and APP/PS1 mice with-
out heat or FA treatment (a–c), whereas 5xFAD mice showed some intraneuronal Aβ staining without any
pretreatment (d). Ten-minute heat treatment in citric acid buffer pH 6 had a minor increasing effect on the
intracellular staining in all four mouse models (e–h); however, 3-min FA pretreatment markedly increased
intracellular Aβ immunoreactivity, disclosing a distinct granular pattern being most obvious in the APP/PS1KI,
APP/PS1, and 5xFAD mice (i–l). The combination of heat and FA pretreatment led to a further increase in the
intracellular staining in APP mice and had a minor intensifying effect in the APP/PS1KI, APP/PS1, and 5xFAD
mice (m–p). Scale bar: 33 μm. Reproduced from [25] with permission from Elsevier
3.3 Combined DAB staining can be also combined with another chromogen of a
Immunohisto- different color, e.g., green (HistoGreen) or red (Nova Red), to
chemistry Using sequentially stain with two different antibodies, for instance, anti-
Two Chromogens bodies against Aβ and NeuN, the latter being a neuronal marker.
In this case, DAB staining is performed first as described above in
Sect. 3.2. After DAB visualization and prior to hematoxylin coun-
terstaining, sections are blocked again with 0.3 % H2O2 in 0.01 M
PBS for 30 min at room temperature followed by blocking with
4 % nonfat dry milk and 10 % FCS in 0.01 M PBS for 1 h at room
temperature. Application of primary and secondary antibodies as
well as incubation of avidin/biotinylated enzyme complex reagents
is performed as described in Sect. 3.2. Visualization of the second
Visualization of Intraneuronal Aβ 187
4 Typical/Anticipated Results
Fig. 3 Parallel sections from 6-month-old APP/PS1KI transgenic mice stained with an antibody detecting Aβ in
paraffin-embedded sections showing micrographs of intracellular Aβ in CA1 and plaque labeling in the thala-
mus. Different protocols with either no antigen retrieval (a, g), 3-min formic acid (FA) pretreatment (b, h),
10-min FA pretreatment (c, i), 10-min microwave heating in a citric acid buffer pH 6 (d, j), combined heating
and 3-min FA pretreatment (e, k), or combined heating and 10-min FA pretreatment (f, l) are compared. Area
percentile quantifications of the corresponding Aβ loads showed that FA pretreatment regardless of exposure
time is essential for the intraneuronal staining of Aβ in the CA1 (m), whereas heat and FA treatment have equal
antigenic retrieval effect on extracellular Aβ plaque pathology in the thalamus (n). Scale bars: a–f, 50 μm; g–l,
100 μm.*P < 0.05; **P < 0.01; ***P < 0.001. Reproduced from [25] with permission from Elsevier
Visualization of Intraneuronal Aβ 189
Fig. 4 Fluorescent double labeling using the Aβ antibody 4G8 (red) and APP (green) in heat + FA pretreated
sections from 1.5-month-old APP/PS1KI mice. The 4G8 antibody (1:10,000) mainly labeled larger granules at
the axon hillock of cortical neurons and did not co-localize with APP staining. Blue counterstaining of nuclei in
the merged pictures was performed with DAPI. Scale bar: 10 μm (color figure online)
6 Conclusion
References
1. Hardy J, Allsop D (1991) Amyloid deposition 7. LaFerla FM, Green KN, Oddo S (2007)
as the central event in the aetiology of Intracellular amyloid-beta in Alzheimer’s dis-
Alzheimer’s disease. Trends Pharmacol Sci 12: ease. Nat Rev Neurosci 8:499–509
383–388 8. Gouras GK, Tsai J, Naslund J et al (2000)
2. Aizenstein HJ, Nebes RD, Saxton JA et al Intraneuronal Abeta42 accumulation in
(2008) Frequent amyloid deposition without human brain. Am J Pathol 156:15–20
significant cognitive impairment among the 9. D’Andrea MR, Nagele RG, Wang HY et al
elderly. Arch Neurol 65:1509–1517 (2001) Evidence that neurones accumulating
3. Schonheit B, Zarski R, Ohm TG (2004) amyloid can undergo lysis to form amyloid
Spatial and temporal relationships between plaques in Alzheimer’s disease. Histopathology
plaques and tangles in Alzheimer-pathology. 38:120–134
Neurobiol Aging 25:697–711 10. Nagele RG, D’Andrea MR, Anderson WJ et al
4. Bertram L, Lill CM, Tanzi RE (2010) The (2002) Intracellular accumulation of beta-
genetics of Alzheimer disease: back to the amyloid(1-42) in neurons is facilitated by the
future. Neuron 68:270–281 alpha 7 nicotinic acetylcholine receptor in
5. Grundke-Iqbal I, Iqbal K, George L et al Alzheimer’s disease. Neuroscience 110:
(1989) Amyloid protein and neurofibrillary 199–211
tangles coexist in the same neuron in Alzheimer 11. Gyure KA, Durham R, Stewart WF et al
disease. Proc Natl Acad Sci U S A 86: (2001) Intraneuronal abeta-amyloid precedes
2853–2857 development of amyloid plaques in Down syn-
6. Gouras GK, Almeida CG, Takahashi RH drome. Arch Pathol Lab Med 125:489–492
(2005) Intraneuronal Abeta accumulation and 12. Mori C, Spooner ET, Wisniewsk KE et al
origin of plaques in Alzheimer’s disease. (2002) Intraneuronal Abeta42 accumulation
Neurobiol Aging 26:1235–1244 in Down syndrome brain. Amyloid 9:88–102
192 Oliver Wirths and Anika Saul
13. Wegiel J, Kuchna I, Nowicki K et al (2007) reduced anxiety coinciding with axonal
Intraneuronal Abeta immunoreactivity is not a degeneration and intraneuronal Abeta
predictor of brain amyloidosis-beta or neurofi- aggregation in the 5XFAD mouse model of
brillary degeneration. Acta Neuropathol Alzheimer’s disease. Neurobiol Aging 33:196.
113:389–402 e29–196.e40
14. Hashimoto M, Bogdanovic N, Volkmann I 25. Christensen DZ, Bayer TA, Wirths O (2009)
et al (2010) Analysis of microdissected human Formic acid is essential for immunohistochem-
neurons by a sensitive ELISA reveals a correla- ical detection of aggregated intraneuronal
tion between elevated intracellular concentra- Abeta peptides in mouse models of Alzheimer’s
tions of Abeta42 and Alzheimer’s disease disease. Brain Res 1301:116–125
neuropathology. Acta Neuropathol 119: 26. Lucassen PJ, Ravid R, Gonatas NK et al (1993)
543–554 Activation of the human supraoptic and para-
15. Duyckaerts C, Potier MC, Delatour B (2008) ventricular nucleus neurons with aging and in
Alzheimer disease models and human Alzheimer’s disease as judged from increasing
neuropathology: similarities and differences. size of the Golgi apparatus. Brain Res 632:
Acta Neuropathol 115:5–38 105–113
16. Wirths O, Multhaup G, Bayer TA (2004) A 27. Oakley H, Cole SL, Logan S et al (2006)
modified beta-amyloid hypothesis: intraneuro- Intraneuronal beta-amyloid aggregates, neu-
nal accumulation of the beta-amyloid pep- rodegeneration, and neuron loss in transgenic
tide—the first step of a fatal cascade. mice with five familial Alzheimer’s disease
J Neurochem 91:513–520 mutations: potential factors in amyloid plaque
17. Wirths O, Multhaup G, Czech C et al (2002) formation. J Neurosci 26:10129–10140
Intraneuronal APP/A beta trafficking and 28. Wirths O, Multhaup G, Czech C et al (2001)
plaque formation in beta-amyloid precursor Intraneuronal Abeta accumulation precedes
protein and presenilin-1 transgenic mice. Brain plaque formation in beta-amyloid precursor
Pathol 12:275–286 protein and presenilin-1 double-transgenic
18. Langui D, Girardot N, El Hachimi KH et al mice. Neurosci Lett 306:116–120
(2004) Subcellular topography of neuronal 29. D’Andrea MR, Nagele RG, Wang HY et al
Abeta peptide in APPxPS1 transgenic mice. (2002) Consistent immunohistochemical
Am J Pathol 165:1465–1477 detection of intracellular beta-amyloid42 in
19. Takahashi RH, Milner TA, Li F et al (2002) pyramidal neurons of Alzheimer’s disease
Intraneuronal Alzheimer abeta42 accumulates entorhinal cortex. Neurosci Lett 333:
in multivesicular bodies and is associated with 163–166
synaptic pathology. Am J Pathol 161: 30. D’Andrea MR, Reiser PA, Polkovitch DA et al
1869–1879 (2003) The use of formic acid to embellish
20. Schmitz C, Rutten BP, Pielen A et al (2004) amyloid plaque detection in Alzheimer’s dis-
Hippocampal neuron loss exceeds amyloid ease tissues misguides key observations.
plaque load in a transgenic mouse model of Neurosci Lett 342:114–118
Alzheimer’s disease. Am J Pathol 164: 31. Aho L, Pikkarainen M, Hiltunen M et al
1495–1502 (2010) Immunohistochemical visualization of
21. Casas C, Sergeant N, Itier JM et al (2004) amyloid-beta protein precursor and amyloid-
Massive CA1/2 neuronal loss with intraneuro- beta in extra- and intracellular compartments
nal and N-terminal truncated Abeta42 accu- in the human brain. J Alzheimers Dis 20:
mulation in a novel Alzheimer transgenic 1015–1028
model. Am J Pathol 165:1289–1300 32. Oddo S, Caccamo A, Shepherd JD et al (2003)
22. Christensen DZ, Kraus SL, Flohr A et al Triple-transgenic model of Alzheimer’s disease
(2008) Transient intraneuronal Abeta rather with plaques and tangles: intracellular Abeta
than extracellular plaque pathology correlates and synaptic dysfunction. Neuron 39:
with neuron loss in the frontal cortex of APP/ 409–421
PS1KI mice. Acta Neuropathol 116:647–655 33. Winton MJ, Lee EB, Sun E et al (2011)
23. Eimer WA, Vassar R (2013) Neuron loss in the Intraneuronal APP, not free Ab peptides in
5XFAD mouse model of Alzheimer’s disease 3xTg-AD mice: implications for Tau versus
correlates with intraneuronal Abeta42 accu- Ab-mediated Alzheimer neurodegeneration. J
mulation and Caspase-3 activation. Mol Neurosci 31:7691–7699
Neurodegener 8:2 34. Wirths O, Dins A, Bayer TA (2012) AbetaPP
24. Jawhar S, Trawicka A, Jenneckens C et al accumulation and/or intraneuronal amyloid-
(2012) Motor deficits, neuron loss, and beta accumulation? The 3xTg-AD mouse
Visualization of Intraneuronal Aβ 193
model revisited. J Alzheimers Dis 28: 38. Billings LM, Oddo S, Green KN et al (2005)
897–904 Intraneuronal Abeta causes the onset of early
35. Gouras GK, Tampellini D, Takahashi RH et al Alzheimer’s disease-related cognitive deficits
(2010) Intraneuronal beta-amyloid accumula- in transgenic mice. Neuron 45:675–688
tion and synapse pathology in Alzheimer’s dis- 39. Knobloch M, Farinelli M, Konietzko U et al
ease. Acta Neuropathol 119:523–541 (2007) Abeta oligomer-mediated long-term
36. Breyhan H, Wirths O, Duan K et al (2009) potentiation impairment involves protein
APP/PS1KI bigenic mice develop early synap- phosphatase 1-dependent mechanisms.
tic deficits and hippocampus atrophy. Acta J Neurosci 27:7648–7653
Neuropathol 117:677–685 40. Tomiyama T, Matsuyama S, Iso H et al (2010)
37. Dong H, Martin MV, Chambers S et al (2007) A mouse model of amyloid-b oligomers: their
Spatial relationship between synapse loss and contribution to synaptic alteration, abnormal
beta-amyloid deposition in Tg2576 mice. tau phosphorylation, glial activation, and neu-
J Comp Neurol 500:311–321 ronal loss in vivo. J Neurosci 30:4845–4856
Chapter 11
Abstract
Olfactory ensheathing cells (OECs) are a specialized type of glia that supports axonal regeneration of
olfactory neurons. OECs derived from olfactory mucosa represent a potential candidate for therapeutic use
in neurological disorders, like amyotrophic lateral sclerosis (ALS). The protocol described below produces
a highly enriched population of proliferating OECs from neonatal mouse olfactory mucosa by means of an
anti-Thy 1.2 antibody leading to a specific cytotoxic lysis of contaminating fibroblasts without damaging
the OECs. Purified OECs expressing the two main antigenic markers, the S100 and p75 neurotrophin
receptors (p75NTR), are plated onto laminin-coated coverslips for immunofluorescence characterization,
or Petri dishes for expansion and further investigations.
Key words Olfactory ensheathing glia, Purification, Characterization, Olfactory mucosa, Mouse,
Neurodegeneration, Repair, Therapy, Amyotrophic lateral sclerosis
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_11, © Springer Science+Business Media New York 2015
195
196 Chrystian Junqueira Alves et al.
Fig. 1 Schematic diagram of the isolation procedure used to generate olfactory ensheathing cells (OECs) from
neonatal mouse olfactory mucosa. (a) Photomicrograph of the lateral wall (delimited by the white continuous
line) of the mouse olfactory cavity dissected surgically, showing the neural olfactory mucosa (surrounded by
dots) to be collected. (b) The neural mucosa placed in a 15 mL tube to be digested by trypsin. (c) Dissociation
phase in DMEM/FBS/penicillin/streptomycin with pipette and a hypodermic needle attached to a syringe; in
this phase fibroblasts (blue) and OECs (red) are found in the suspension. (d) Purification with Thy 1.2 treatment
to eliminate the fibroblasts. (e) Cells plated in coverslips and dropped in DMEM/FBS/penicillin/streptomycin
medium for cell adhesion and subsequent characterization of cell culture. (f) Immunofluorescence for OEC
characterization. (g) Expansion of purified OEC culture to be employed in further in vivo and in vitro studies
(color figure online)
3 Procedures
Table 1
Methodological approaches to achieve OECs from the SOD1G93A ALS mouse model
Box 1 Genotyping the SOD1G93A Transgenic (TG) and Wild-Type (WT) Mice
DNA is extracted from the tail according to standard protocols [20, 21]. Briefly, the
tail is minced into small fragments in proteinase K buffer. The suspension is incu-
bated at 60 °C and centrifuged. The aqueous phase is separated from debris and
transferred into a new tube with cold isopropanol. The DNA precipitate becomes
visible after gentle mixing and centrifugation. The DNA pellet is washed with 70 %
ethanol and resuspended in TE buffer after removal of the ethanol. The DNA
extracted from the tails was subjected to PCR amplification using the following prim-
ers: IMR113 (5′-ATCAGCCCTAATCCATCTGA-3′), IMR114 (5′-CGCGACTAA
CAATCAAAGTGA-3′), and IMR043 (5′GTAGGTGGAAATTCTAGCATC
ATCC-3′) to also amplify a fragment of murine interleukin 2 as a positive control.
Amplicons are characterized by agarose gel electrophoresis and ethidium bromide
staining.
(continued)
Mouse Olfactory Ensheathing Cells 201
3.2 Dissection Dip all dissecting instruments in 70 % ethanol, before use, and wait
of the Olfactory for the instruments to dry before starting surgery.
Mucosa Kill the mouse by decapitation with a large surgical scissor and
place the animal head on the L-15 medium in the Styrofoam iced
box. Hold the head dorsal side up in gauze and spray it with 70 %
ethanol. Remove the skin from the head by using medium curved
scissors. Open the skull with small forceps, revealing the brain.
Carefully remove the brain using a closed curved scissor. Using a
small surgical scissor, very carefully open the nasal cavity through
the midline from the opened skull to the nose. Attention is needed
in order to not damage the lateral wall of the olfactory cavity bilat-
erally. Hold the head in the dissecting table by means of a medium
forceps. Under a 4× magnification stereomicroscope, identify the
yellowish part of the mucosa, in the upper and posterior region of
the lateral wall of the olfactory cavity. Dissect out that part of the
olfactory mucosa bilaterally by means of a small forceps and pinch
the epithelium away from the underlying bone (see Sect. 4).
Transfer the pieces of approximately 5 animals to a 1.5 mL micro-
tube filled with L-15 medium.
3.3 Dissociation By using a P1000 pipette, transfer the pieces of olfactory mucosa
of the Olfactory into a 15 mL conical tube containing 800 μL of trypsin stock
Mucosa solution (0.25 %) and 1.2 mL of HBSS to make a solution con-
taining 0.1 % trypsin. Incubate tubes in a 37 °C warm bath for
45 min. Stop trypsinization by adding 5 mL DMEM/FBS plus
202 Chrystian Junqueira Alves et al.
3.4 Elimination Spin the suspension at 269 × g for 5 min, remove carefully the
of Fibroblasts supernatant, and resuspend the pelleted mucosa in 1 mL
DMEM/FBS plus 1 % penicillin/streptomycin. Add 8 μL anti-
Thy 1.2 antibody in the solution to obtaining a 1:125 dilution.
Place the 15 mL tube in a shaker at slow speed for 30 min at room
temperature to allow anti-Thy 1.2 to reach specific epitopes of
fibroblasts. Centrifuge the suspension at 269 × g for 5 min at 4 °C
and remove the supernatant. Dilute rabbit serum complement
(1 mg/mL) according to manufacturer’s instructions, pass the
solution through a sterile syringe filter, and add 100 μL penicillin/
streptomycin. Resuspend the pellet in 1 mL of the rabbit serum
complement solution described above and place again in shaking
for 30 min.
3.6 Characterization All procedures are carried out at room temperature unless
of OECs by otherwise stated.
Immunofluorescence From the third day after plating, remove the growth media
from wells and gently wash the coverslips in PBS twice. Remove
PBS and add 150 μL 4 % PFA and incubate in a hood for 30 min.
Wash in PBS (3× 5 min) and then add 150 μL/coverslip of per-
meabilization solution for 10 min. Wash coverslips with solution 1
for 5 min, followed by a wash with solution 2 for 5 min. Add
150 μL/coverslip of block solution and incubate for 30 min. Wash
in PBS (3× 5 min) and incubate at 4 °C for 18 h in the primary
antibodies diluted at optimal titer in the dilution solution. We use
S100 at 1:200 and p75NTR at 1:500 to label OECs and Thy 1.1
at 1:200 to label fibroblasts.
Wash coverslips in PBS (3× 5 min) and, meanwhile, dilute the
secondary antibody 1:40 in the dilution solution. Incubate cover-
slips for 2 h in an incubation chamber wrapped with aluminum
foil to protect the slides from light. We have employed a Texas
Red conjugate to label p75NTR-expressing OECs and Thy
1.1-expressing fibroblasts and a FITC conjugate to label S100-
expressing OECs. By this means it is possible to use dual color
immunofluorescence for the characterization of OECs.
Wash in PBS (3× 5 min), remove the coverslip with curved
forceps, and mount it upside down on a small drop of DAPI for
nuclear labeling using a 26 × 76 mm glass slide.
Examples of the immunocytochemical characterization of
OEC cultures are given in Figs. 3, 4, and 5.
3.7 Expansion Once cells are 90 % confluent, remove the growth medium and
and Freezing of OECs wash the cells 2× with HBSS for eliminating floating cells and
debris. Trypsinize the cells and transfer the suspension to 15 mL
3.7.1 Expansion
tube containing 1 mL DMEM/FBS plus 1 % penicillin/streptomycin.
Wash the culture dish with 3 mL DMEM/FBS plus 1 % penicillin/
streptomycin to collect any remainder cell and transfer it to the
same tube. Spin the tube at 269 × g for 10 min at 4 °C. Carefully
remove the supernatant, add 2 mL DMEM/FBS plus 1 % penicillin/
streptomycin, and resuspend the cells using a P200. Complete to a
5 mL final volume DMEM/FBS plus 1 % penicillin/streptomycin.
Spin the tube at 269 × g for 5 min at 4 °C.
Remove carefully the supernatant, add 2 mL growth medium,
resuspend the cells using a P200, and complete to a 4 mL final
volume. Plate half of the volume in two 100 mm dishes, each con-
taining 3 mL growth medium. Change the medium in the next day
and keep changing it three times a week.
3.7.2 Freezing Aspirate off the growth medium and wash the cells twice with
HBSS for eliminating floating cells and debris. Repeat the proce-
dure described above for expansion.
Fig. 3 Photomicrographs of non-purified (a, b) and purified (c, d) olfactory ensheathing cell (OEC) cultures,
labeled with S100 (a, c, green) and p75NTR (b, d, red) immunocytochemistry. Nuclei stained with DAPI (blue).
Photographs were obtained after 5-day plating. See text for details. Scale bars: 50 μm
Acknowledgments
References
1. Doucette R (1995) Olfactory ensheathing 13. Chuah MI, Teague R (1999) Basic fibroblast
cells: potential for glial cell transplantation into growth factor in the primary olfactory path-
areas of CNS injury. Histol Histopathol 10: way: mitogenic effect on ensheathing cells.
503–507 Neuroscience 88:1043–1050
2. Franklin RJ, Barnett SC (1997) Do olfactory 14. Huang ZH, Wang Y, Cao L et al (2008)
glia have advantages over Schwann cells for Migratory properties of cultured olfactory
CNS repair? J Neurosci Res 50:665–672 ensheathing cells by single-cell migration assay.
3. Franklin RJ, Barnett SC (2000) Olfactory Cell Res 18:479–490
ensheathing cells and CNS regeneration: the 15. Guérout N, Derambure C, Drouot L et al
sweet smell of success? Neuron 28:15–18 (2010) Comparative gene expression profiling
4. Raisman G (2001) Olfactory ensheathing of olfactory ensheathing cells from olfactory
cells—another miracle cure for spinal cord bulb and olfactory mucosa. Glia 58:1570–1580
injury? Nat Rev Neurosci 2:369–375 16. Jani HR, Raisman G (2004) Ensheathing cell
5. Wewetzer K, Verdu E, Angelov DN et al cultures from the olfactory bulb and mucosa.
(2002) Olfactory ensheathing glia and Glia 47:130–137
Schwann cells: two of a kind? Cell Tissue Res 17. Li Y, Li D, Khaw PT et al (2008) Transplanted
309:337–345 olfactory ensheathing cells incorporated into
6. Barnett SC, Chang L (2004) Olfactory the optic nerve head ensheathe retinal gan-
ensheathing cells and CNS repair: going solo glion cell axons: possible relevance to glau-
or in need of a friend? Trends Neurosci 27: coma. Neurosci Lett 440:251–254
54–60 18. Richter M, Westendorf K, Roskams AJ (2008)
Culturing olfactory ensheathing cells from the
7. Barnett SC, Riddell JS (2004) Olfactory
mouse olfactory epithelium. Methods Mol
ensheathing cells (OECs) and the treatment of
Biol 438:95–102
CNS injury: advantages and possible caveats.
J Anat 204:57–67 19. Gurney ME (1994) Transgenic-mouse model
of amyotrophic lateral sclerosis. N Engl J Med
8. Lepore AC, Maragakis NJ (2007) Targeted
331:1721–1722
stem cell transplantation strategies in ALS.
Neurochem Int 50:966–975 20. Alves CJ, de Santana LP, dos Santos AJ et al
(2011) Early motor and electrophysiological
9. Mazzini L, Mareschi K, Ferrero I et al (2008) changes in transgenic mouse model of amyo-
Stem cell treatment in amyotrophic lateral trophic lateral sclerosis and gender differences
sclerosis. J Neurol Sci 265:78–83 on clinical outcome. Brain Res 1394:90–104
10. Morita E, Watanabe Y, Ishimoto M et al 21. Scorisa JM, Duobles T, Oliveira GP et al
(2008) A novel cell transplantation protocol (2010) The review of the methods to obtain
and its application to an ALS mouse model. non-neuronal cells to study glial influence on
Exp Neurol 213:431–438 Amyotrophic Lateral Sclerosis pathophysiol-
11. Garbuzova-Davis S, Sanberg PR (2009) ogy at molecular level in vitro. Acta Cir Bras
Feasibility of cell therapy for amyotrophic lat- 25:281–289
eral sclerosis. Exp Neurol 216:3–6 22. Kawaja MD, Boyd JG, Smithson LJ et al
12. Higginson JR, Barnett SC (2011) The culture (2009) Technical strategies to isolate olfactory
of olfactory ensheathing cells (OECs)—a dis- ensheathing cells for intraspinal implantation.
tinct glial cell type. Exp Neurol 229:2–9 J Neurotrauma 26:155–177
Chapter 12
Abstract
Microglial cells are the resident macrophages of the central nervous system involved in all pathological
processes in the brain as well as postnatal neurogenesis, aging, and synaptic plasticity. Therefore, the identi-
fication of microgliocytes is important for experimental neuroscience and clinical histopathological studies.
This chapter presents a detailed protocol of Iba1-immunocytochemistry to be used for detecting the
microglial cells in paraffin sections of the brain of laboratory animals (mouse, rat, and rabbit) and humans
by using the same primary antibody through species. The preparations are suitable for transmitted light
microscopy and confocal laser microscopy. The advantage of the paraffin sections is a better preservation
of morphological details, the possibility to use archival material stored for a long time, the relative ease of
tissue processing, and the opportunity to standardize the separate procedures and the protocol as a whole.
The high intensity of immunocytochemical reaction, absence of nonspecific background staining, and clear
visualization of cell processes allow performing the automated analysis of three-dimensional (3D) organi-
zation of microglia.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_12, © Springer Science+Business Media New York 2015
209
210 Dmitrii E. Korzhevskii et al.
3 Procedures
3.1 General The procedures for the preparation of biological material for
Considerations immunocytochemical revealing of microglia described below
include fixation of the specimen, paraffin embedding, microtome
sectioning, and mounting sections on adhesive-coated slides as
preparatory steps. Once dried in an oven at 37–40 °C, sections
mounted on slides can be stored protected from dust at room tem-
perature for a long time (up to several years) without weakening
immunoreactivity. Good antigen preservation during long-term
storage is a very important parameter [32] making possible immu-
nocytochemical detection of microglia in archival material.
Localization of Microglia 213
made around the section on the slide, which prevents the spreading
of reagents and enables a reduction of the volume of the expensive
reagents used further. This is achieved by gently sopping up the
fluid on the glass slide around the section with a filter paper (to
make a dry field) and outlining the section with a hydrophobic
pen. Immediately thereafter (to prevent drying of the sections),
100–200 μL of blocking solution (depending on section size) is
applied to sections, and slides are allowed to stay at room tem-
perature for 10 min (see Note 14). Excess of the blocking solution
is removed without washing, and the required volume of the anti-
Iba1 antibody diluted 1:300 (see Note 7) is applied to the sec-
tions. After that, slides are placed into the humid chamber (see
Note 8). Put wet filter paper and glass rods to support the slides
on the bottom of the chamber. The humid chambers with prepa-
rations are allowed to incubate in an oven at 27 °C for 18–20 h
(overnight—HRP/DAB) or up to 60–70 h (immunofluorescence—
see Note 15). This completes the processing of preparations on
the first day of the immunocytochemical reaction. Further steps in
the immunocytochemical labeling require different reagents and/
or incubation times depending on whether one is processing for
the HRP/DAB or fluorescent visualization of microglia.
3.2.1 HRP-DAB After overnight incubation, humid chambers are removed from the
Immunostaining oven, and the primary antibody is washed off with PBS or TBS by
of Microglia placing slides into a staining jar for 7–10 min. The fluid around
sections is gently sopped up from slides with filter paper, and the
required volume of rabbit anti-goat biotinylated antibody diluted
1:200 (see Note 7) is applied. Slides in humid chambers are placed
into an oven at 27 °C for 60 min, and secondary antibodies are
washed off with PBS or TBS for 7–10 min by placing the slides
back into the staining jar. After removing excess fluid from the sec-
tion as described above, slides are returned to the humid chambers,
and the required volume of the working solution of HRP-
streptavidin conjugate is applied (see Note 10). Incubation is car-
ried out in an oven at 27 °C for 20–25 min. Then slides are washed
again in PBS or TBS for 7–10 min in a staining jar. Excess fluid is
wiped off from sections which are finally incubated in the required
volume of DAB working solution. The stained product of the his-
tochemical reaction is formed within 1–5 min. This process should
be controlled by microscope examination to stop the reaction
before the appearance of nonspecific background staining. Once
the reaction has been stopped, the chromogen solution is washed
off (see Note 16), and slides are rinsed two to three times in dis-
tilled water for 3–5 min each.
If necessary, the preparations can be counterstained with hema-
toxylin for 0.5–1 min. Then, since hematoxylin turns blue in alka-
line environment, slides are rinsed into ammonia water or Scott’s
tap water substitute to maintain the original violet staining.
216 Dmitrii E. Korzhevskii et al.
3.2.2 Immuno- The second processing step begins after 60–70 h incubation of the
fluorescence of Microglia preparations in primary antibodies. Humid chambers are removed
from the oven, and the primary antibody is washed off with two
changes (10–15 min each) of PBS or TBS by placing slides into a
staining jar. The fluid around sections is gently sopped up from
slides with filter paper, and the required volume of rabbit anti-goat
biotinylated antibody diluted 1:200 (see Note 7) is applied. Slides
in humid chambers are placed into an oven at 27 °C for 90 min,
and then secondary antibodies are washed off with two changes
(10–15 min each) of PBS or TBS for 7–10 min by placing the
slides back into the staining jar. Again excess fluid is wiped off from
slides around sections with filter paper, and the required volume of
the working solution of a fluorochrome-streptavidin conjugate is
applied (see Note 11) by placing slides in humid chambers and
incubating them into an oven at 27 °C for 40 min (see Note 17).
Then slides are washed again in PBS or TBS for 7–10 min in a
staining jar (two washes). If necessary, nuclear counterstaining can
be applied using SYTOX® Green diluted with distilled water 1:100
for 30 min at 27 °C (in an oven inside the humid chambers). After
staining, the preparations should be rinsed in distilled water (three
times 5 min each) and mounted using a nonfluorescent aqueous
mounting medium.
Preparations are ready for microscopy on the following day.
Mounted preparations should be stored in dark in a refrigerator
(2–8 °C). If stored properly, they remain stable up to 3 months.
4 Typical/Anticipated Results
Fig. 1 Microglia of the rabbit fascia dentata (hippocampus). Iba1-immunocytochemistry, hematoxylin counterstaining
Fig. 3 Visualization of the rat brain (neocortex) microglia using confocal laser microscopy (orthogonal projection
of 15 μm z-stack). Confocal laser microscope LSM 710 (Zeiss, Oberkochen, Germany). Iba1-immunocytochemistry,
fluorescence visualization using Cy3
Localization of Microglia 219
Fig. 4 3D reconstruction of the rat neocortical microgliocyte (cell body and processes) created from 15 μm
z-stack using the confocal laser microscope LSM 710 (Zeiss) and the software ZEN 2012 Gray (Zeiss). Iba1
immunocytochemistry, fluorescence visualization—Cy3, nuclear counterstaining—SYTOX® Green
6 Conclusion
Acknowledgments
References
1. Graeber MB, Streit WJ (2010) Microglia: biol- yolk sac, and which proliferate in the brain.
ogy and pathology. Acta Neuropathol 119: Brain Res Dev Brain Res 117:145–152
89–105 5. Harry GJ, Kraft AD (2012) Microglia in the
2. Kaur C, Rathnasamy G, Ling EA (2013) Roles developing brain: a potential target with life-
of activated microglia in hypoxia induced neu- time effects. Neurotoxicology 33:191–206
roinflammation in the developing brain and the 6. Korzhevskii DE, Kirik OV, Sukhorukova EG
retina. J Neuroimmune Pharmacol 8:66–78 et al (2013) Structural organization of striatal
3. Kreutzberg GW (1996) Microglia: a sensor for microgliocytes after transient focal ischemia.
pathological events in the CNS. Trends Neurosci Behav Physiol 43:457–460
Neurosci 19:312–318 7. Gentleman SM (2013) Review: microglia in
4. Alliot F, Godin I, Pessac B (1999) Microglia protein aggregation disorders: friend or foe?
derive from progenitors, originating from the Neuropathol Appl Neurobiol 39:45–50
Localization of Microglia 223
8. Varnum MM, Ikezu T (2012) The classifica- 21. Yamada M, Ohsawa K, Imai Y et al (2006)
tion of microglial activation phenotypes on X-ray structures of the microglia/macrophage-
neurodegeneration and regeneration in specific protein Iba 1 from human and mouse
Alzheimer’s disease brain. Arch Immunol Ther demonstrate novel molecular conformation
Exp (Warsz) 60:251–266 change induced by calcium binding. J Mol Biol
9. Blank T, Prinz M (2013) Microglia as modula- 364:449–457
tors of cognition and neuropsychiatric disor- 22. Deininger MH, Meyermann R, Schluesener HJ
ders. Glia 61:62–70 (2002) The allograft inflammatory factor-1
10. Monji A, Kato TA, Mizoguchi Y et al (2013) family of proteins. FEBS Lett 514:115–121
Neuroinflammation in schizophrenia espe- 23. Kohler C (2007) Allograft inflammatory fac-
cially focused on the role of microglia. Prog tor-1/ionized calcium-binding adapter mole-
Neuropsychopharmacol Biol Psychiatry 42: cule 1 is specifically expressed by most
115–121 subpopulations of macrophages and spermatids
11. Sobin C, Montoya MG, Parisi N et al (2013) in testis. Cell Tissue Res 33:291–302
Microglial disruption in young mice with early 24. Kirik OV, Sukhorukova EG, Korzhevskii DE
chronic lead exposure. Toxicol Lett 220: (2011) Calcium-binding protein Iba-1/
44–52 AIF-1 in rat brain cells. Neurosci Behav Physiol
12. Ekdahl CT, Kokaia Z, Lindvall O (2009) 41:149–152
Brain inflammation and adult neurogenesis: 25. Boche D, Perry VH, Nicoll JA (2013) Review:
the dual role of microglia. Neuroscience 158: activation patterns of microglia and their iden-
1021–1029 tification in the human brain. Neuropathol
13. Wake H, Moorhouse AJ, Jinno S et al (2009) Appl Neurobiol 39:3–18
Resting microglia directly monitor the func- 26. Moon JB, Lee CH, Park CW et al (2009)
tional state of synapses in vivo and determine Neuronal degeneration and microglial activa-
the fate of ischemic terminals. J Neurosci 29: tion in the ischemic dentate gyrus of the gerbil.
3974–3980 J Vet Med Sci 71:1381–1386
14. Wake H, Moorhouse AJ, Miyamoto A et al 27. Shapiro LA, Perez ZD, Foresti ML et al (2009)
(2013) Microglia: actively surveying and shap- Morphological and ultrastructural features of
ing neuronal circuit structure and function. Iba1-immunolabeled microglial cells in the
Trends Neurosci 36:209–217 hippocampal dentate gyrus. Brain Res 1266:
15. Kaur C, Ling EA (1999) Increased expression 29–36
of transferrin receptors and iron in amoeboid 28. Korzhevskii DE, Lentsman MV, Kirik OV et al
microglial cells in postnatal rats following an (2013) Morphological types of activated
exposure to hypoxia. Neurosci Lett 26: microglial cells in the hippocampus present
183–186 after transient total cerebral ischemia. Neurosci
16. Ling EA, Kaur C, Yick TY et al (1990) Behav Physiol 43:861–864
Immunocytochemical localization of CR3 29. Korzhevskiĭ DE, Sukhorukova EG, Gilerovich
complement receptors with OX-42 in amoe- EG et al (2013) Advantages and disadvantages
boid microglia in postnatal rats. Anat Embryol of zink-ethanol-formaldehyde as a fixative for
182:481–486 immunocytochemistry and confocal laser
17. Streit WJ, Sammons NW, Kuhns AJ et al microscopy. Morfologiia 143:81–85
(2004) Dystrophic microglia in the aging 30. Sukhorukova EG, Zakhryapin MS, Anichkov
human brain. Glia 45:208–212 NM et al (2012) Microglia detection in the
18. Greter M, Merad M (2013) Regulation of brain preparations after long-term storage in
microglia development and homeostasis. Glia formalin. Morfologiia 142:68–71
61:121–127 31. Wang D, Kaur C (2000) Response of epiplexus
19. Manzhulo IV, Ogurtsova OS, Dyuizen IV et al cells associated with the choroid plexus in the
(2007) The specific response of neurons and lateral ventricles of adult rats to high altitude
glial cells of the ventromedial reticular forma- exposure. Neurosci Lett 285:197–200
tion in the rat brainstem to acute pain. 32. Sarnat HB (2013) Clinical neuropathology
Neurochemical J 7:62–68 practice guide 5-2013: markers of neuronal
20. Imai Y, Ibata I, Ito D et al (1996) A novel gene maturation. Clin Neuropathol 32:340–369
iba1 in the major histocompatibility complex 33. Sukhorukova EG, Kirik OV, Korzhevskii DE
class III region encoding an EF hand protein (2010) The use of immunohistochemical
expressed in a monocytic lineage. Biochem method for detection of brain microglia in par-
Biophys Res Commun 224:855–862 affin sections. Bull Exp Biol Med 149:768–770
224 Dmitrii E. Korzhevskii et al.
34. Kolos EA, Korzhevskii DE (2013) 36. Roussel AJ, Knol AC, Bourdeau PJ et al (2014)
Decalcification in formic acid after fixation in Optimization of an immunohistochemical
zinc-ethanol-formaldehyde does not preclude method to assess distribution of tight junction
identification of neuronal and glial markers. proteins in canine epidermis and adnexae.
Morfologiia 144:76–79 J Comp Pathol 150:35–46
35. Pileri SA, Roncador G, Ceccarelli C et al 37. Lyck L, Dalmau I, Chemnitz J (2008)
(1997) Antigen retrieval techniques in immu- Immunohistochemical markers for quantitative
nohistochemistry: comparison of different studies of neurons and glia in human neocor-
methods. J Pathol 183:116–123 tex. J Histochem Cytochem 56:201–221
Chapter 13
Abstract
Much of our knowledge of the anatomy and physiology of the blood–brain barrier (BBB) was discovered
before the modern era of neuroimaging and molecular biology. However, discoveries in the past 25
years have added a new dimension to our understanding of the BBB and to what has been referred more
recently as the neurovascular unit (NVU). Disruption of the BBB occurs in many neurological diseases,
including brain trauma, acute and chronic cerebral ischemia, multiple sclerosis, epilepsy, some neurode-
generative diseases, brain tumors, and brain infections, either viral or bacterial. The BBB forms the
interface between the blood and brain tissues. During a brain injury, a cascade of molecular events
involving free radicals and proteases that attack basement membrane proteins and degrade the tight
junction proteins in endothelial cells results in a final common pathway leading to BBB disruption. Free
radicals of oxygen and nitrogen, as well as proteases, matrix metalloproteinases, and cyclooxygenases,
are important in the BBB disruption as the neuroinflammatory response progresses. The challenges to
treatment of the brain diseases involve understanding the timing of the molecular cascades to block the
early BBB injury without interfering with recovery. Morphological methods are important tools, not
only in assessing the disruption of the BBB but also in understanding the pathophysiology of the pro-
cesses leading to BBB leakage. A better knowledge of the intimate events responsible for BBB distur-
bances can pave the way for new therapeutic approaches. Morphological methods can be applied to
experimental models as well as to human specimens. This chapter will describe the different morpho-
logical methods available for the evaluation of BBB structure and disruption and for the assessment of
molecular events leading to BBB injury. We will first examine different ways for assessing the integrity of
the BBB and therefore its leakiness in case of its disruption, then we will consider the immunodetection
of the different components of the BBB and the consequences following BBB injury, and finally, we will
present how to study the processes involved in BBB disruption (i.e., oxidative stress, matrix metallopro-
teinases) by using morphological tools.
Key words Immunohistochemistry, Blood–brain barrier, Evans blue, Brain, Endothelial cells, Tight
junction proteins, Basement membrane proteins, Laminin, Matrix metalloproteinases, In vitro
studies
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_13, © Springer Science+Business Media New York 2015
225
226 Jean-Pierre Louboutin
1.1 Generalities The blood–brain barrier (BBB) protects the brain by limiting the
ability of molecules and cells from the blood to enter the central
nervous system (CNS). Cerebral blood vessels form the major
interface between the blood and the nervous tissue, providing the
basis for the immunological sequestration of the brain and the pre-
vention of perturbation of the neuronal microenvironment by fluc-
tuations in the systemic circulation [1]. Along with astrocyte end
feet, pericytes, basal lamina, and neurons, brain capillary endothe-
lial cells comprise the neurovascular unit (NVU), i.e., the interface
between the blood and brain tissues, which is important in (1)
maintaining the immune-privileged nature of the CNS and (2) in
regulating cellular transmigration [2].
Ehrlich reported in 1885 that the intravenous injection of vital
dyes, such as Trypan blue, into living animals resulted in staining
of all tissues except the brain and spinal cord [3]. Further experi-
ments demonstrated that rare areas of the brain were actually
stained following this procedure: the posterior lobe of the pituitary
gland, the tuber cinereum, the pineal gland, and the area postrema
at the lower end of the fourth ventricle. These results led to the
concept that there was a barrier limiting exchanges between the
blood and brain, then named the blood–brain barrier (BBB). It
was later shown that the size of the molecules determined the per-
meability of the BBB: molecules with molecular weights of 60,000
and above do not cross the BBB, while gases, water, and lipid-
soluble molecules pass quickly through it by passive diffusion.
Thus, plasma proteins and large organic molecules remain within
the blood circulatory system. BBB allows the selective transport of
compounds such as glucose and amino acids, both crucial to neural
function, that pass more slowly. By opposition to the adult, BBB is
not fully developed in fetus, newborn child, or premature infant,
allowing the passage of some substances, some of them potentially
toxic (i.e., bilirubin), into the brain [3].
1.2 BBB Structure The BBB is composed of three elements: the endothelial cells in
the wall of a capillary, a basement membrane surrounding the cap-
illary outside the endothelial cells, and the foot processes of astro-
cytes adhering to the outer surface of the capillary wall (Fig. 1).
Capillaries are critical for delivering the essential nutrients
and maintaining a constant supply of oxygen. The BBB actually
relies on the tight junctions between the endothelial cells of
blood capillaries. The tight junction proteins are stitching together
the endothelial cells [4]. Tight junctions are composed of small
subunits, frequently biochemical dimers formed by proteins such
as occludin, claudin, and junction adhesion molecules (JAMs).
Immunohistochemistry of BBB 227
Fig. 1 Structure of the BBB. The barrier is composed of three structures: the
endothelial cells in the wall of the capillary, a basement membrane located out-
side the endothelial cells and surrounding the capillary, and foot processes of
astrocytes adhering to the outer surface of the capillary wall
1.3 Pathological Break of BBB occurs in many neurological diseases and, depending
Modifications of BBB on the situation, may magnify the damage caused by the initial
insult. BBB functions are impaired in many neurological disorders,
including acute and chronic cerebral ischemia, intracerebral hem-
orrhage, traumatic injuries, neurodegenerative disorders, multiple
sclerosis, brain infections, epilepsy, and tumors. During these con-
ditions, BBB dysfunction is often accompanied by increased
vascular permeability to plasma constituents, including large pro-
teins, and results in water influx and brain edema [9]. Experimental
data demonstrated that serum proteins may serve as direct signal-
ing mechanism resulting in the activation of astrocytes and the
brain immune system, with consequently neuronal hyperexcitabil-
ity and delayed neurodegeneration [10]. The occurrence of BBB
dysfunction during neurological disorders might trigger complica-
tions, can potentially predict neurological outcome after an insult,
and could be used for determining novel therapeutic approaches.
In some situations, such as cerebral ischemia, intrinsic cellular
factors referred as “neuroinflammation” affect blood vessels and
initiate the damage, while in others, including infections and auto-
immune processes, the blood vessels are damaged secondary to the
injury by the activation of extrinsic systemic factors such as
“infectious and autoimmune processes” [1].
Isolation and cloning of the proteins forming the tight junc-
tions between the endothelial cells helped to understand not only
normal BBB function but also to solve some of the mechanisms of
BBB injury. Free radicals of oxygen and nitrogen, matrix metallo-
proteinases (MMPs), cyclooxygenases (COXs), hypoxia-inducible
factor-1α (HIF-1α), and the family of aquaporins play an impor-
tant role in disruption of the BBB. During a brain injury, a cascade
of molecular events leads to the generation of free radicals and to
the activation of proteases, both attacking membranes and degrad-
ing the tight junction proteins in endothelial cells, finally resulting
in BBB disruption. Free radicals of oxygen and nitrogen and the
proteases, matrix metalloproteinases (MMPs) and cyclooxygen-
ases, are important in the early and delayed BBB disruption as neu-
roinflammation progresses. Integrins, selectins, and other adhesion
molecules in the trafficking of white blood cells across endothelial
cells participate also to immunological processes involved in BBB
injury [11].
In addition to the importance of the NVU in acute injury,
angiogenesis contributes to the recovery process. The challenges
to treatment of the brain diseases involve not only facilitating drug
entry into the brain but also understanding the timing of the
molecular cascades to block the early NVU injury without interfer-
ing with recovery.
Loss of BBB integrity may manifest in several ways, including
leakage of blood components into the brain parenchyma, loss of
key protein components of endothelial cell tight junctions, and loss
of vessel structural proteins.
Immunohistochemistry of BBB 229
1.4 In Vitro Models The impermeability of the BBB is due to a number of properties
of the BBB including tight junctions on adjoining endothelial cells, absence of
pinocytic vesicles, and expression of multidrug transporters.
Although the permeability of many chemicals can be predicted by
their polarity, or oil/water partition coefficient, many lipophilic
chemicals are not permeable because of multidrug transporters at
the luminal and abluminal membranes. In contrast, many nutri-
ents, which are usually polar, cross the BBB more readily than pre-
dicted by their oil/water partition coefficients due to the expression
of specific transporters [13]. Studies aimed at characterizing the
pathological paradigms associated with the development and pro-
gression of CNS diseases are primarily performed in laboratory ani-
mals. However, in some cases, limited translational significance,
high cost, and labor to develop the appropriate model (e.g., trans-
genic or inbred strains) have favored parallel in vitro approaches.
In vitro models are of particular interest for cerebrovascular studies
of the BBB, which plays a critical role in maintaining the brain
homeostasis and neuronal functions [14].
Two widely used methods for studying the BBB are a cell cul-
ture model using rat, pig, or cow brain endothelial cells [15] and
isolated microvessels.
1.4.1 Cell Culture Model The cell culture model is more popular likely because it is easier to
of the BBB use and less costly compared to isolated microvessels.
Different rat brain endothelial cell (RBE) lines are available
(RBE4, GP8/3.9, GPNT, RBEC1, TR-BBBs, and rBCEC4)
[16]. In most cases, primary cultures of RBE cells can be trans-
duced with an immortalizing gene (SV40 or polyomavirus large
T-antigen or adenovirus E1A), either by transfection of plasmid
DNA or by infection using retroviral vectors. Some RBE cell lines,
e.g., RBE4, rBEC4, and TR-BBB cells, are responsive to astroglial
factors. Others are also responsive to serum components, hor-
mones, growth factors, lipids, and lipoproteins [15]. RBE cell
230 Jean-Pierre Louboutin
1.4.2 Isolated Because microvessels are isolated directly from the brain, they
Microvessels express all transporters displayed in vivo. Isolated brain microves-
sels are useful in measuring multidrug drug transporters and tight
junction integrity [13]. Their disadvantage is that the preparation
is laborious, requires animals, and has a shorter life span in vitro
[21]. Permeability of freshly isolated microvessels can be assessed
by measuring the uptake of FITC-labeled dextran and transendo-
thelial cell electrical resistance, and paracellular transport in cell
culture models can be evaluated as well [13].
1.4.3 In Vitro Human Since the first attempts in the 1970s to isolate cerebral microvessel
BBB Model endothelial cells (CECs) in order to model the BBB in vitro, the
need for a human BBB model that closely mimics the in vivo phe-
notype and is reproducible and easy to grow has been widely rec-
ognized by cerebrovascular researchers in both academia and
industry [22]. While primary human CECs would ideally be the
model of choice, the paucity of available fresh human cerebral tis-
sue makes wide-scale studies impractical. The brain microvascular
endothelial cell line hCMEC/D3 represents one such model of the
human BBB that can be easily grown and is amenable to cellular
Immunohistochemistry of BBB 231
1.5.1 Markers Brain capillaries are essential for supplying oxygen and delivering
of Endothelial Cells the essential nutrients, as the BBB actually relies on the tight junc-
and Capillaries tions between the endothelial cells of blood capillaries.
Brain capillaries and endothelial cells can be immunostained by
several markers, either in vivo or in vitro. The majority of these
markers is however not specific of the BBB per se (Table 1).
1.5.2 Markers of Tight Endothelial cells of brain capillaries are tied to each other by tight
Junctions junction proteins [4, 5]. These proteins form different types of
tight junctions in BBB and can be used as markers of the barrier
(Table 2).
Table 1
Markers of BBB endothelial cells and capillaries
Table 2
Markers of BBB tight junctions, basement membrane, and extracellular matrix
1.5.4 Markers Relatively little is known about the roles of free radical oxygen
of Oxidative Stress in Brain species (ROS) and oxidative stress in the balance between MMPs
Microvessels and TIMPs. A relationship between oxidative damage, MMP pro-
duction, and BBB disruption has been found in some lesions of the
striatum [24]. Prior gene transfer of antioxidant enzymes mitigates
gp120-induced MMP-9 production and BBB leakiness [25].
Reducing ROS and oxidative stress by gene transfer of antioxidant
enzymes leads to decreased TIMP-1 and TIMP-2 production [26].
Moreover, there is a significant correlation between gp120-related
BBB disturbances and MMP/TIMP upregulation. Following prior
antioxidant gene delivery, a relationship was also seen between the
reduction in EB extravasation and MMP-9/TIMP-1 decreased
production [26].
To identify the cell population(s) undergoing lipid oxidation,
immunodetection of a marker of lipid peroxidation, N-acetyllysine-
4-hydroxy-2-nonenal (HNE), can be performed.
1.7 Injection of Dyes Injection of tracers and dyes constitutes one of the most employed
and Tracers ways to explore BBB leakage. Several dyes and tracers can be used to
this purpose, and the most frequently used ones are summarized in
Table 4.
a
It has been suggested that vascular walls, extracellular spaces, glial cells, and neurons retain antigenic sites for long periods after BBB opening [41]
235
Table 4
Dye injection protocols for the study of BBB permeability
Combination Examples of
Methods Protocol Main results with ICC application References
Fluorescein • Intracardiac perfusion with Leakage in other areas YES, e.g., CD31 FITC accumulates [44]
isothiocyanate (FITC) FITC-containing saline at pH 7.0 with a compromised BBB or pericyte marker in endothelial
• PFA fixation at pH 8.0 Fluorescence prominent in (desmin) cells but not
brain regions without BBB in pericytes
(e.g., area postrema)
FITC–albumin • FITC–albumin (MW about Increased BBB permeability Animal model [45]
70 kDa) intravenous injection of stroke
(20 mg in 1 mL saline)
• 1 h survival
• Perfusion with 4 % PFA in PBS
• 24 h postfixation, cryoprotection
in 30 % PBS sucrose, 30 μm
coronal cryosections
FITC–dextran • FITC–dextran (MW 19,000 and Vascular leak of FITC– Models of [46]
154,000) intravenous injection dextran trauma and
stroke
Systemic HRP • Systemic injection of HRP Extravasation of HRP YES, e.g., Models of [47]
immunodetection syringomyelia
of endothelial cells and trauma
[44, 45]
Immunohistochemistry of BBB 237
3 Procedures
3.1 Immunocyto- All procedures are carried out at room temperature unless other-
chemistry of BBB wise stated.
Markers
3.1.1 IMF on Cryostat Coronal cryostat sections (10 μm thick) are cut after cryoprotec-
Sections tion and processed for indirect IMF. Sections are first incubated for
60 min with 10 % NGS or 10 % normal donkey serum in PBS to
block nonspecific binding. They are then incubated with antibod-
ies diluted according to manufacturers’ recommendations: 1 h
with primary antibody and then 1 h with secondary antibody
diluted 1: 100. Double IMF is performed according to standard
protocols [48]. Mounting media contain DAPI to stain nuclei.
Negative controls are performed each time immunostaining was
done and consisted of preincubation with PBS, substitution of
nonimmune isotype-matched control antibodies for the primary
antibody, and/or omission of the primary antibody. Further details
can be found in [48].
3.1.2 IMF on Paraffin- Specimens are cut into pieces, fixed in formalin overnight, and
Embedded Sections then placed in PBS at 4 °C for several hours and then in ethanol
70 % during several days before being placed in the tissue processor
and finally cut in the microtome.
After placing the sections in the oven (15–30 min), they must
be deparaffinized and hydrated using xylenes and graded alcohols
(2× 5 min in xylene, 1 min in xylene/ethanol (1:1), 2× 1 min in
100 % ethanol, 1 min in 95 % ethanol, 1 min in 70 % ethanol, and
then 2× 1 min in distilled water). Sections are then rinsed for 5 min
in tap water and then washed in PBS for 5 min.
The antigen retrieval process consists in 13 min in the micro-
wave at high power in 0.5–1 L citrate buffer (actual boiling time is
ca. 6 min; the other time is needed for heating up). The sections
are taken out from the microwave and let cool down for 15 min.
Blocking is made with 10 % donkey serum in PBS +0.2 %
Triton® X-100, 10 min. There is no washing after blocking.
The sections are incubated with primary antibodies in blocking
buffer at 37 °C or 4 °C overnight. They are washed in PBS (3×
5 min) before incubation with the secondary antibody during
45 min in 1 % donkey serum in PBS without Triton® X-100. After
washing in PBS (3× 5 min), sections can be mounted with a
medium containing DAPI to visualize nuclei.
Fig. 2 Immunodetection of brain microvessels following injury of blood–brain barrier. Consequences of intra-
caudate–putamen (CP) injection of HIV-1 gp120 (500 ng) on rat brain endothelial cells and capillaries after 1 h
survival. (a) The reduction in the number of microvessels is shown by the decrease in the number of RECA-1-
positive structures. (b) Cryostat sections immunostained for CD31 and processed for the TUNEL assay. Some
of the endothelial cells, positive for CD31, are also TUNEL positive and thus apoptotic (arrows). Scale bars = ADD μm
(modified from [105])
3.3 Injection of EB EB can be used to assess the permeability of the BBB to macromole-
cules. Because of its high molecular weight, serum albumin cannot
cross the BBB, and because virtually all EB is bound to albumin, in
240 Jean-Pierre Louboutin
3.3.2 Biochemistry BBB disruption can also be evaluated biochemically following the
procedure described above for the injection of EB. The brains are
then removed without prior fixation, divided into ipsilateral and
contralateral hemispheres, weighed, homogenized in N,N-
dimethylformamide to solubilize EB, and then centrifuged at
21,000 × g for 30 min. EB can be quantified using a spectropho-
tometer from the absorbance at 620 nm of each supernatant minus
the background calculated from the baseline absorbance between
500 and 740 nm. See Note 6.
3.4 In Situ The gelatinolytic activity of MMP-2 and MMP-9 can be studied in
Zymography for MMP situ on frozen brain sections (10 μm thick) using a commercial
Activity assay kit. Sections are incubated with DQ gelatin conjugate, a fluo-
rogenic substrate, at 37 °C overnight, then washed in PBS, and
mounted in mounting medium containing DAPI. Cleavage of DQ
protein by MMPs results in a green fluorescent product (wave-
length: excitation, 495 nm; emission, 515 nm). Uninjected contra-
lateral sides can be compared to injected sides. Controls can also
consist of sections of normal brains, as well as sections of test brains
incubated with the zinc chelator 1,10-phenanthroline (1 mM in
DMSO), a nonspecific inhibitor of MMP activity. The positive
control can consist in the examination of the hippocampus of con-
trol brains, because a spontaneous increase of MMP activity has
been reported in this structure.
To identify the type of cells expressing gelatinolytic activity,
some sections can be stained for Neurotrace®, a fluorescent neuro-
nal marker, and others immunostained for NeuN, RECA-1, CD31,
and GFAP after in situ gelatinolytic assay was performed. Specimens
are finally examined under a fluorescence microscope.
Immunohistochemistry of BBB 241
4 Typical/Anticipated Results
Fig. 4 In situ zymography and immunohistochemistry of MMPs: Relationship with BBB disruption induced by
HIV-1 gp120. (a) Injection of gp120 into the rat CP induced upregulation of matrix metalloproteinases (MMPs).
Frozen cryostat sections of CP injected with 500 ng gp120 and stained by in situ zymography. Left column: The
fluorescent product was observed in blood vessel-like structures and in cells. Middle column: Positive control.
In situ zymography detects intense fluorescence in the hippocampus. Right column: No gelatinolytic activity
was seen in the contralateral uninjected side or in CPs injected with saline (not shown), neither when a section
of the test brain was incubated with 1,10-phenanthroline, a nonspecific inhibitor of MMP activity. (b) There was
a colocalization between in situ zymography and RECA-1. (c) Colocalization between MMP-2 and the endothe-
lial cell marker RECA-1 in CPs injected with gp120. MMP abnormalities were associated with EB leakage (not
shown in this panel) (modified from [25, 48, 105])
Fig. 3 (continued) assayed by TUNEL. Numerous TUNEL-positive cells were observed after treatment with
gp120, while almost no apoptotic cells were seen in cultures that were not incubated with gp120 (p < 0.001
serum-free media (control) vs. 200 ng/ml gp120 in serum-free media for 24 h). Almost all occludin-positive
cells were TUNEL positive for 200 ng/ml gp120. Control with buffer only and no enzyme showed no TUNEL
staining (not shown). (b) After intra-caudate–putamen (CP) injection of HIV-1 500 ng gp120, fewer occludin-
positive structures were seen. (c) Decrease in the number of claudin-5 (a tight junction protein)-positive struc-
tures parallels the leakage of Evans blue (EB) in CP previously injected with HIV-1 gp120. (d) Reduction in the
number of laminin (a basement membrane protein)-positive structures observed after intra-CP injection of
HIV-1 gp120, suggesting a degradation of the basement membrane protein (modified from [105])
244 Jean-Pierre Louboutin
Fig. 5 Immunodetection of molecules involved in oxidative stress. Role of oxidative stress in gp120-induced BBB
disruption. Cryostat sections of rat caudate–putamen (CP) injected 1 h earlier with saline or 500 ng HIV-1 enve-
lope glycoprotein gp120 were immunostained for HNE, a marker of lipid peroxidation, and RECA-1, a marker of
endothelial cells. HNE immunoreactivity was seen in the CPs injected with gp120 and colocalized with RECA-1
(arrows), while no HNE immunostaining was detected in CPs injected with saline (modified from [105])
Fig. 6 Evans blue extravasation following intracerebral injection of HIV-1 envelope glycoprotein gp120. (a) EB
was injected intravenously before stereotaxic injection of 500 ng HIV-1 envelope glycoprotein gp120 (a neuro-
toxin inducing neuronal apoptosis) into the rat caudate–putamen (CP). Controls consisted of brains injected
with saline and with rat IgG (a component having similar molecular weight as gp120). One day later, extravasa-
tion of EB was seen in the CP (arrow). (b) Fluorescence corresponding to EB extravasation was observed by
fluorescence microscopy in the injected CP. (c) Relationship between concentrations of gp120 and EB-positive
areas in the brain (modified from [105])
Fig. 7 Examples of IgG leakage detected by direct histochemistry. (a) Injection of SV(gp120) into the CP
increased BBB permeability. We developed an animal model of protracted exposure to HIV-1 envelope glyco-
protein gp120 by injecting a SV40-derived vector carrying gp120 into the caudate–putamen (CP) of rats.
Cryostat sections of the CP from rats injected with SV(gp120) or an unrelated control vector, SV(BUGT), in the
striatum, were immunostained for IgG (to evaluate leakage of plasma protein through the BBB) and laminin.
Seven days after injection of SV(gp120) into the CP, significantly less laminin-positive structures were seen,
particularly in the areas of IgG accumulation, while laminin immunostaining was normal and no IgG leakage
was observed after injection of SV(BUGT). (b) In another experiment, seizures were induced in rats by intraperi-
toneal injection of kainic acid. Leakage of plasma components was visualized (arrows) by immunostaining for
IgG (shown in CA1/CA2, in comparison to DAPI) (modified from [35, 36, 105])
6 Conclusion
References
1. Rosenberg GA (2012) Neurological diseases 15. Deli MA, Abrahám CS, Kataoka Y et al (2005)
in relation to the blood-brain barrier. J Cereb Permeability studies on in vitro blood-brain
Blood Flow Metab 32:1139–1151 barrier models: physiology, pathology, and
2. Zozulya AL, Reinke E, Baiu DC et al (2007) pharmacology. Cell Mol Neurobiol 25:
Dendritic cell transmigration through brain 59–127
microvessel endothelium is regulated by 16. Roux F, Couraud PO (2005) Rat brain endo-
MIP-1α chemokine and matrix metallopro- thelial cell lines for the study of blood-brain
teinases. J Immunol 178:520–529 barrier permeability and transport functions.
3. Hawkins BT, Davis TP (2005) The blood- Cell Mol Neurobiol 25:41–58
brain barrier/neurovascular unit in health and 17. Omidi Y, Campbell L, Barar J et al (2003)
disease. Pharmacol Rev 57:173–185 Evaluation of the immortalised mouse brain
4. Furuse M, Fujita K, Hiiragi T et al (1998) capillary endothelial cell line, b.End3, as an
Claudin-1 and -2: novel integral membrane in vitro blood-brain barrier model for drug
proteins localizing at tight junctions with no uptake and transport studies. Brain Res 990:
sequence similarly to occludin. J Cell Biol 95–112
141:1539–1550 18. Takata F, Dohgu S, Yamauchi A et al (2013)
5. Milner R, Hung S, Wang X et al (2008) In vitro blood-brain barrier models using
Responses of endothelial cells and astrocytes brain capillary endothelial cells isolated from
matrix-integrin receptors to ischemia mimic neonatal and adult rats retain age-related bar-
those observed in the neurovascular unit. rier properties. PLoS One 8:e55166
Stroke 39:191–197 19. Abbott NJ, Dolman DE, Drndarski S et al
6. Dore-Duffy P (2008) Pericytes: pluripotent (2012) An improved in vitro blood-brain bar-
cells of the blood-brain barrier. Curr Pharm rier model: rat brain endothelial cells co-
Des 14:1581–1593 cultured with astrocytes. Methods Mol Biol
7. Daneman R, Zhou L, Kebede AA et al (2010) 814:415–430
Pericytes are required for blood-brain barrier 20. Nakagawa S, Deli MA, Kawaguchi H et al
integrity during embryogenesis. Nature (2009) A new blood-brain barrier model
468:562–566 using primary rat brain endothelial cells, peri-
8. Bell RD, Winkler EA, Sagare AP et al (2010) cytes and astrocytes. Neurochem Int 54:
Pericytes control key neurovascular functions 253–263
and neuronal phenotype in the adult brain 21. Vernon H, Clark K, Bressler JP (2011) In
and during brain aging. Neuron 68:409–427 vitro models to study the blood brain barrier.
9. Shlosberg D, Benifla M, Kaufer D et al (2010) Methods Mol Biol 758:153–168
Blood–brain barrier breakdown as a 22. Weksler B, Romero IA, Couraud PO (2013)
therapeutic target in traumatic brain injury. The hCMEC/D3 cell line as a model of the
Nat Rev Neurol 6:393–403 human blood brain barrier. Fluids Barriers
10. Abbot NJ, Friedman A (2012) Overview and CNS 10:16
introduction: the blood-brain barrier in 23. Cucullo L, Hossain M, Rapp E et al (2007)
health and disease. Epilepsia 53:1–6 Development of a humanized in vitro blood-
11. Zlokovic BV (2010) Neurodegeneration and brain barrier model to screen for brain pene-
the neurovascular unit. Nat Med 16: tration of antiepileptic drugs. Epilepsia 48:
1370–1371 505–516
12. Perdiki M, Farooque M, Holtz A (1998) 24. Kim GW, Gasche Y, Grzeschik S et al (2003)
Expression of endothelial barrier antigen Neurodegeneration in striatum induced by
immunoreactivity in blood vessels following the mitochondrial toxin 3-nitropropionic acid:
compression trauma to rat spinal cord. role of matrix metalloproteinase-9 in early
Temporal evolution and relation to the degree blood-brain barrier disruption? J Neurosci
of the impact. Acta Neuropathol 96:8–12 23:8733–8742
13. Bressler J, Clark K, O'Driscoll C (2013) 25. Louboutin JP, Agrawal L, Reyes BAS et al
Assessing blood-brain barrier function using (2010) HIV-1 gp120-induced injury to the
in vitro assays. Methods Mol Biol 1066: blood-brain barrier: role of metalloproteinases
67–79 2 and 9 and relationship to oxidative stress. J
Neuropathol Exp Neurol 69:801–816
14. Naik P, Cucullo L (2012) In vitro blood-
brain barrier models: current and perspective 26. Louboutin JP, Reyes BAS, Agrawal L et al
technologies. J Pharm Sci 101:1337–1354 (2011) HIV-1 gp120 upregulates matrix
250 Jean-Pierre Louboutin
allergic encephalomyelitis in the rat. J Neurosci 62. Ghabriel MN, Zhu C, Reilly PL et al (2000)
Res 45:747–757 Toxin-induced vasogenic cerebral oedema in a
50. Garbuzova-Davis S, Hernandez-Ontiveros rat model. Acta Neurochir Suppl 76:231–236
DG, Rodrigues MC et al (2012) Impaired 63. Sternberger NH, Sternberger LA, Kies MW
blood-brain barrier/spinal cord barrier in et al (1989) Cell surface endothelial proteins
ALS patients. Brain Res 1469:114–128 altered in experimental allergic encephalomy-
51. Maeda M, Furuichi Y, Noto T et al (2009) elitis. J Neuroimmunol 21:241–248
Tacrolimus (FK506) suppresses rt-PA- 64. Abdul Muneer PM, Alikunju S, Szlachetka
induced hemorrhagic transformation in a rat AM et al (2011) Inhibitory effects of
thrombotic ischemia stroke model. Brain Res alcohol on glucose transport across the
1254:99–108 blood-brain barrier leads to neurodegenera-
52. Larochelle C, Cayrol R, Kebir H et al (2012) tion: preventive role of acetyl-L-carnitine.
Melanoma cell adhesion molecule identifies Psychopharmacology 214:707–718
encephalitogenic T lymphocytes and pro- 65. Zhang X, Li G, Guo L et al (2013) Age-
motes their recruitment to the central ner- related alteration in cerebral blood flow and
vous system. Brain 135:2906–2924 energy failure is correlated with cognitive
53. Garbuzova-Davis S, Saporta S, Haller E et al impairment in the senescence-accelerated
(2007) Evidence of compromised blood -spinal prone mouse strain 8 (SAMP8). Neurol Sci
cord barrier in early and late symptomatic 34:1917–1924
SOD1 mice modeling ALS. PLoS One 2:e1205 66. Merlini M, Meyer EP, Ulmann-Schuler A
et al (2011) Vascular β-amyloid and early
54. Macmillan CJ, Starkey RJ, Easton AS (2011)
astrocyte alterations impair cerebrovascular
Angiogenesis is regulated by angiopoietins dur-
function and cerebral metabolism in trans-
ing experimental autoimmune encephalomyelitis
genic arcAβ mice. Acta Neuropathol
and is indirectly related to vascular permeability.
122:293–311
J Neuropathol Exp Neurol 70:1107–1123
67. Abdul Muneer PM, Alikunju S, Szlachetka
55. Duran-Vilaregut J, del Valle J, Camins A et al
AM et al (2011) Impairment of brain endo-
(2009) Blood-brain barrier disruption in the
thelial glucose transporter by methamphet-
striatum of rats treated with 3-nitropropionic
amine causes blood-brain barrier dysfunction.
acid. Neurotoxicology 30:136–143
Mol Neurodegener 6:23
56. Natah SS, Srinivasan S, Pittman Q et al (2009) 68. Nag S (1996) Cold-injury of the cerebral cor-
Effects of acute hypoxia and hyperthermia on tex: immunolocalization of cellular proteins
the permeability of the blood-brain barrier in and blood-brain barrier permeability studies.
adult rats. J Appl Physiol 107:1348–1356 J Neuropathol Exp Neurol 55:880–888
57. Lafuente JV, Argandoña EG, Mitre B (2006) 69. Cornford EM, Hyman S, Cornford ME et al
VEGFR-2 expression in brain injury: its distri- (1996) Glut1 glucose transporter activity in
bution related to brain-blood barrier markers. human brain injury. J Neurotrauma 13:
J Neural Transm 113:487–496 523–536
58. Bhattacharjee AK, Kondoh T, Ikeda M et al 70. Yang Y, Rosenberg GA (2011) MMP-
(2002) MMP-9 and EBA immunoreactivity mediated disruption of claudin-5 in the
after papaverine mediated opening of the brain- blood-brain barrier of rat brain after cerebral
blood barrier. Neuroreport 13:2217–2221 ischemia. Methods Mol Biol 762:333–345
59. Gursoy-Ozdemir Y, Qiu J, Matsuoka N et al 71. Willis CL, Leach L, Clarke GJ et al (2004)
(2004) Cortical spreading depression activates Reversible disruption of tight junction com-
and upregulates MMP-9. J Clin Invest 113: plexes in the rat brain-blood barrier, follow-
1447–1455 ing transitory focal astrocyte loss. Glia 48:
60. Abdel-Rahman A, Shetty AK, Abou-Donia 1–13
MB (2002) Disruption of the blood-brain 72. Nag S, Venugopalan R, Stewart DJ (2007)
barrier and neuronal cell death in cingulate Increased caveolin-1 expression precedes
cortex, dentate gyrus, thalamus, and hypo- decreased expression of occludin and claudin-
thalamus in a rat model of Gulf-War syn- 5 during blood-brain barrier breakdown. Acta
drome. Neurobiol Dis 10:306–326 Neuropathol 114:459–469
61. Abdel-Rahman A, Shetty AK, Abou-Donia 73. Pfeiffer F, Schäfer J, Lyck R et al (2011)
MB (2002) Acute exposure to sarin increases Claudin-1 induced sealing of blood-brain
blood-brain barrier permeability and induces barrier tight junctions ameliorates chronic
neuropathological changes in the rat brain: experimental autoimmune encephalomyelitis.
dose-response relationships. Neuroscience Acta Neuropathol 122:601–614
113:721–741
252 Jean-Pierre Louboutin
brain injury. Neurochem Int. doi:10.1016/j. 102. Huang MB, Hunter M, Bond VC (1999)
neuint.2014.02.006 Effect of extracellular human immunodefi-
98. Kraft P, Göb E, Schuhmann MK (2013) ciency virus type 1 glycoprotein 120 on pri-
FTY720 ameliorates acute ischemic stroke in mary human vascular endothelium cell cultures.
mice by reducing thrombo-inflammation but AIDS Res Hum Retroviruses 15:1265–1277
not by direct neuroprotection. Stroke 103. Price TO, Ercal N, Nakaoke R et al (2005)
44:3202–3210 HIV-1 viral proteins gp120 and Tat induce
99. del Valle J, Duran-Vilaregut J, Manich G et al oxidative stress in brain endothelial cells.
(2001) Cerebral amyloid angiopathy, blood- Brain Res 1045:57–63
brain barrier disruption and amyloid accumu- 104. Kanmogne GD, Schall K, Leibhart J et al
lation in SAMP8 mice. Neurodegener Dis (2007) HIV-1 gp120 compromises blood-
8:421–429 brain barrier integrity and enhances mono-
100. Awad AS (2006) Role of AT1 receptors in cyte migration across blood-brain barrier:
permeability of the blood-brain barrier in implication for viral neuropathogenesis.
diabetic hypertensive rats. Vascul Pharmacol J Cereb Blood Flow Metab 27:123–134
45:141–147 105. Louboutin JP, Strayer DS (2012) Blood-
101. Louboutin JP, Chekmasova AA, Marusich E brain barrier abnormalities caused by HIV-1
et al (2010) Efficient CNS gene delivery by gp120: mechanistic and therapeutic implica-
intravenous injection. Nature Meth 7:905–907 tions. ScientificWorldJournal 2012:482575
Part IV
Quantification of Immunocytochemistry
and Combined Techniques
Chapter 14
Quantification of Immunocytochemical
Colocalization in Neurons
Brad R. Rocco and Kenneth N. Fish
Abstract
Fluorescence immunocytochemistry, which in the most basic terms uses antibodies and fluorochromes to
localize specific proteins, has long been a cornerstone technique in the field of neuroscience. Both fluoro-
chromes and the main tool used to visualize them, the fluorescence microscope, have gone through major
changes since the humble beginnings of fluorescence immunocytochemistry in the early 1940s. These
advances now allow the quantification of immunocytochemical colocalization in the most discrete neuro-
nal compartments (e.g., the axon terminal). However, many scientists still rely on the simplistic method of
using the merging of pseudo-colored pixels (e.g., green and red) that represent the localization of unique
proteins to demonstrate colocalization (yellow) rather than accurately describing the distribution pattern
quantitatively. This chapter details a set of methodologies that can be used to describe quantitatively the
colocalization of proteins within neurons. Specifically, it describes (a) a brief immunocytochemical label-
ing protocol, (b) optimal data collection techniques, (c) how best to process data post-capture, (d) a
method for masking pixels of interest, and (e) how to interpret and present your data. For this purpose,
this chapter focuses on quantification of colocalized fluorescently labeled puncta (putative synaptic com-
ponents) within the same synaptic structure in brain tissue sections.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_14, © Springer Science+Business Media New York 2015
257
258 Brad R. Rocco and Kenneth N. Fish
Table 1
(A) List of primary antibodies used for the figures. (B) Example of a combination of Alexa-Fluor
fluorochromes that have nonoverlapping excitation and emission wavelengths
3.1 Primate Brain We describe below the protocol to prepare primate brain tissue for
Tissue Section sectioning. As this chapter is exemplificative of the procedures for
Preparation quantification of immunofluorescence colocalization, it obviously
follows that experimenters can prepare, e.g., rodent tissues with
standard ad hoc protocols according to their own needs. All experi-
mental procedures were conducted in accordance with the NIH
Guide for the Care and Use of Laboratory Animals and with the
approval from the University of Pittsburgh’s IACUC (or the equiv-
alent guidelines of the country where experimentation is going to
be performed). Guidelines for the use of experimental animals may
substantially vary from different countries and institutions.
Therefore, individual researchers must design in advance their own
experiments in compliance with national/institutional rules.
The presented data comes from studies performed using
brain tissue sections from monkeys. The focus here is on tissue
262 Brad R. Rocco and Kenneth N. Fish
Fig. 1 Monkey brain and principal sulcus. (a) Schematic of the lateral view of the monkey cortex showing the
approximate location (dotted black line) of the prefrontal cortex (PFC) tissue sections used for the figures. (b)
Schematic view of the left hemisphere PFC coronal tissue section designating the dorsal (46-D) and ventral
(46-V) banks of the principal sulcus. The dashed lines on the gray area designate the total gray matter area
spanning area 46
Immunofluorescence Colocalization 263
3.2 Immunocyto- Markers of axon terminals and dendritic spines appear as immu-
chemical Labeling noreactive (IR) puncta under the light microscope when visual-
ized using immunocytochemistry, allowing ready quantification
of structure number and density via the application of stereo-
logical techniques [32]. In addition to quantifying the number
of synaptic structures, IR puncta analysis has been used to gar-
ner information about relative protein levels and synaptic struc-
ture morphology in multiple species (e.g., see refs. 33–41). By
combining multiple markers in multi-label fluorescence experi-
ments, terminals of neuron subclasses can be identified. For
example, the GABA-synthesizing enzymes GAD65 and GAD67
can be measured in two subtypes of PV neurons by immunola-
beling monkey tissue sections for PV, GAD65, and GAD67
because morphology (PV cartridges vs. non-cartridge IR
puncta) can be used to differentiate terminals of PV basket cells
from those of PV chandelier cells [40].
Immunocytochemical labeling is performed on cryoprotected
sections stored at −30 °C. All steps are carried out at room tem-
perature, unless otherwise stated. Sections are first rinsed 3 × 15 min
in PBS and then incubated in fresh 1 % NaBH4 in 0.1 M PBS for
30 min on a rotary shaker operating at 30 rpm (see Note 5). They
are subsequently rinsed 8 × 3 min in PBS (see Note 6) and then
permeabilized with 0.3 % Triton® X-100 in PBS for 30 min.
Sections are then blocked with blocking solution on a shaker and
incubated for 3 h (see Note 7). They are then transferred to 20 ml
glass scintillation vials, and the blocking solution is replaced with
the antibody diluent solution containing the primary antibody(ies)
at optimal titer(s). Sections are incubated in primary antibody
solution at 4 °C for 48 h on a shaker (see Note 8) and rinsed
4 × 30 min in PBS, followed by incubation with secondary
antibody(ies) diluted in antibody diluent solution for 24 h at 4 °C
on a shaker (see Note 9). Sections are then rinsed 4 × 30 min in
PBS followed by mounting. Sections are mounted using #1.5
cover glass to minimize spherical aberration when using high-NA
objectives. They are laid flat on a slide, and any excess buffer is
removed with Kimwipes and then quickly covered with the mount-
ing medium to avoid drying. The cover glass has to be carefully
laid over the section making sure not to introduce air bubbles. The
slides are stored in the dark for 1 h, and then the interface of the
cover glass and slide was thinly coated with clear nail hardener.
264 Brad R. Rocco and Kenneth N. Fish
3.3 Data Acquisition For 3D confocal microscopy, it is imperative that the x-, y-, and
and Processing z-sampling frequency is sufficient to adequately represent objects of
interest in the image stack. The Nyquist sampling theorem explains
3.3.1 Acquisition
exactly how great the sampling density (in both x-y plane and the
spacing of z-planes) has to be to record all information from a sam-
ple. The theorem is based on the realization that one must sample at
a rate greater than twice the maximum frequency in the signal in
order to reconstruct the original from the sampled version, otherwise
aliasing occurs. The theorem takes into account the NA of the objec-
tive, mounting/immersion media, excitation and emission wave-
lengths of the fluorochrome, and the number of excitation photons.
There are several online Nyquist sampling rate calculators (e.g., www.
svi.nl/NyquistCalculator). In the x-y plane the sampling rate is deter-
mined by pixel size, which should be at least two times smaller than
the smallest features that you expect to see in your specimen. As a
rule of thumb, for confocal microscopy imaging, sampling distances
along the z-axis can be up to 1.7 times the Nyquist ones. Note that
oversampling is harmless unless it results in photobleaching. However,
it increases capture and computational time and storage needs.
The resolution of light microscopes is significantly lower in the
z-axis than in the x and y dimensions. The Rayleigh criterion esti-
mates resolution (r) for the x and y axes as: rx,y = 0.61λ/NA (where λ
is the wavelength of the emitted light). In contrast, resolution in the
z-axis is estimated as: rz = 2λη/NA2 (where η is the refractive index of
the mounting/immersion media; the mounting and immersion
media are assumed to have the same refractive index, and the refrac-
tive index of the coverslip is ≥ that of the mounting media). Using
these formulas, for imaging Alexa-Fluor® 488 (emission 519 nm)
using a 60× oil 1.42 NA objective with immersion oil of refractive
index 1.51, x- and y-axis resolution is ~223 nm, while z-axis resolu-
tion is ~777 nm. For these parameters the Nyquist sampling in the
x-, y-, and z-dimension equals 42, 42, and 123 nm, respectively.
Thus, the spacing between optical z-planes should be
≤1.7 × 123 = 209 μm. If imaging was performed on a SDCM using a
Hamamatsu ORCA-R2 (6.45 × 6.45 μm cell size) and the above
parameters, the pixel size would be 0.1075 × 0.1075 μm, which
means that information in the x-y plane would be under sampled
(sampling is ~2.5 × Nyquist value). Here, a LSCM would have the
advantage of being able to zoom in so that each pixel covers an x-y
area of 42 × 42 nm (or smaller), which would be proper Nyquist
sampling. For the data presented here, 3D image stacks (2D images
successively captured at intervals separated by 0.25 μm in the
z-dimension) that were 1,024 × 1,024 pixels (0.1075 μm pixel size)
were acquired over 25% of the total thickness of the tissue section
starting at the coverslip. The stacks were collected using optimal
exposure settings (i.e., those that yielded the greatest dynamic range
with no saturated pixels), with differences in exposures normalized
during image processing.
Immunofluorescence Colocalization 265
3.3.2 Imaging Post-image capture processing, and thus quantitative analysis of the
Optimization data, is critically dependent on the quality of the input data. Many
factors including sample preparation, microscope system, and imag-
ing parameters can significantly affect the quality of the images.
Importantly, saturated pixels cannot be reliably quantified.
Therefore, images should be captured using optimal exposure set-
tings that yield the best image quality (i.e., a wide dynamic range of
pixel intensities) with no saturated pixels. For a list of tips for obtain-
ing better quality images, see Notes 10–19 and read the callout box
below for information about the point-spread function (PSF).
Callout Box
The Point-Spread Function (PSF)
PSF describes how photons spread from their original source and is considered the basic building block
of any image. Deconvolution methods use PSF to determine how much out-of-focus light is expected
for the optics in use and then redistribute this light to its point of origin in the specimen. The most
detailed an image can be is due to the assembly of its PSF.
PSF can be used to characterize the image formation process in any specimen. That is, when a fluo-
rescently labeled specimen is illuminated in each dimension (x, y, and z), there are photons arising from
point sources of light made up of clusters of fluorochromes. The number of photons arising from each
point source is dependent on the number of clustered fluorochromes and on how much light they absorb.
The directionality of the photons is defined by the PSF. Each point source results in out-of-focus light.
Deconvolution seeks to deduce the original distribution of the point sources in the specimen that have
given rise to the image.
Box Callout Figure (a–c) Schematic representation of a 100 nm point source (e.g., a fluorescent bead) in the x-y
plane. (a) The actual point source, (b) the point source captured with a microscope, (c) b after deconvolution. The
center solid circle in b represents the Airy disk, while the concentric circles represent diffraction rings
Fig. 2 Difference of Gaussian channel. Projection image (140 z-planes taken 100 nm apart) of a 500 nm fluo-
rescent microsphere (ex. 495 nm; em. 519 nm) before post-image processing (Raw), after Autoquant’s adap-
tive blind deconvolution algorithm (Autoquant), after applying a Gaussian blur with a σ value of 0.7 to the
deconvolved channel (Autoquant σ = 0.7), after applying a Gaussian blur with a σ value of 2 to the deconvolved
channel (Autoquant σ = 0.7), and after subtracting the Autoquant σ = 0.7 and Autoquant σ = 0.7 channels
(σ0.7 − σ2). The microsphere is shown in the x-y (top rows) and x-z planes (bottom rows) as indicated in the
rightmost image for each row. The line plots in the left corner of the top row images show the intensity of a
line through the center of the microsphere for each image. Bar = 2 μm
3.5 Virtual Images are usually virtually cropped in x-, y-, and z-dimension
Stereology prior to data analyses to eliminate edge effects caused by deconvo-
lution rollover and to ensure only entire objects are included in the
268 Brad R. Rocco and Kenneth N. Fish
Fig. 3 The use of GAD65-IR and GAD67-IR object masks to assess relative levels of GAD protein. Projection
images (5 z-planes taken 0.25 μm apart) of monkey PFC labeled for GAD65, GAD67, and the vesicular GABA
ransporter (vGAT). Single (a) GAD65, (d) GAD67, and (g) vGAT channels. Corresponding (b) GAD65, (e) GAD67, and
Immunofluorescence Colocalization 269
analyses. In addition, the z-planes for each image stack are binned,
and an analysis of variance with post hoc comparison via Tukey’s
honestly significant difference test is performed to assess differ-
ences in the intensity and the number of object masks for each
deconvolved fluorescent channel. The maximum number of adja-
cent z-planes that are not significantly different for both the inten-
sity and the number of object masks is included in the analysis. The
final object masks are then used to collect information on the
deconvolved channels.
Fig. 3 (continued) (h) vGAT object masks. Overlay of GAD65, GAD67, and vGAT channels with their corresponding
object masks (c, f, and i, respectively). (j) Merged GAD65, GAD67, and vGAT channels. (k) Merged GAD65, GAD67,
and vGAT channels overlaid with GAD65/vGAT (red) and GAD67/vGAT (green) object masks. GAD65/vGAT object
masks had to overlap the center of volume of a vGAT object mask and not overlap any voxels of a GAD67 object
mask to be selected. GAD67/vGAT object masks had to overlap the center of volume of a vGAT object mask and
not overlap any voxels of a GAD65 object mask to be selected. (i) Merged GAD65, GAD67, and vGAT channels
overlaid with GAD65/GAD67/vGAT object masks. GAD65/GAD67/vGAT object masks had to overlap the center of
volume of each other to be selected. Arrows depict GAD65-only puncta (open arrowhead), GAD67-only puncta
(closed arrowhead), and GAD65/GAD67 puncta (arrows). Bar = 5 μm
270 Brad R. Rocco and Kenneth N. Fish
3.7 Cross Channel The most commonly employed algorithms for quantifying colocal-
Intensity Correlations ization measurement at the pixel level are derived from Pearson’s
correlation coefficient, first applied for this purpose by Manders [44].
272 Brad R. Rocco and Kenneth N. Fish
GAD65 Masks
no voxel overlaps
GAD67 Masks
(GAD65-only)
Computed Mean
GAD65(67) Masks min. GAD65 Int.
overlap center of vol. of
GAD67(65) Masks
(GAD65/67)
Computed Mean
All GAD-IR
min. GAD67 Int.
Object Masks
GAD67 Masks
no voxel overlaps
GAD65 Masks
(GAD67-only)
Remaining
GAD-IR
Object Masks
Fig. 5 Flow chart showing how to distinguish puncta based on morphological and intensity criteria. To obtain
distinct subpopulations of puncta based on different levels of immunoreactivity (GAD65 only, GAD67 only, and
GAD65/GAD67), individual GAD-IR puncta are initially segregated using strictly morphological criteria. For this
step, GAD65-IR object masks that do not overlap any voxels of GAD67-IR object masks and GAD67-IR object
masks that do not overlap any voxels of GAD65-IR object masks were classified as GAD65-only puncta and
GAD67-only puncta, respectively. To be classified as GAD65/GAD67 puncta, both GAD65-IR and GAD67-IR
object masks have to overlap the center of volume of each other. Voxel intensity characteristics from these
puncta that are defined using only mask operations (definitions in the dashed box) are used to obtain intensity
value cutoffs to classify the remaining puncta that do not meet the criteria to be distinguished by strictly mor-
phological criteria (GAD65 object masks that partially overlap GAD67 object masks). Specifically, the mean
minimum fluorescence intensity of GAD65 within GAD65-only puncta and GAD65/GAD67 puncta and the mean
minimum fluorescence intensity of GAD67 within GAD67-only puncta and GAD65/GAD67 puncta that were
classified using only morphological criteria were calculated and are used as intensity cutoffs to distinguish the
remaining GAD-IR puncta. Any of the GAD-IR puncta that have a mean GAD65 intensity greater than or equal
to the calculated mean minimum GAD65 intensity and a mean GAD67 intensity less than the calculated mean
minimum GAD67 intensity are classified as GAD65-only puncta. GAD67-only puncta classified from the
remaining pool were comprised of GAD-IR puncta that have a mean GAD65 intensity less than the calculated
mean minimum GAD65 intensity and a mean GAD67 intensity greater than or equal to the calculated mean
minimum GAD67 intensity. Finally, GAD65/GAD67 puncta from the remaining pool were comprised of GAD-IR
puncta that had mean GAD65 and GAD67 intensities greater than or equal to the calculated mean minimum
GAD65 and GAD67 intensities, respectively
Immunofluorescence Colocalization 273
Fig. 6 Masking of presynaptic and postsynaptic proteins. (a) Single plane image of a monkey PFC tissue
section labeled for vGAT (red), the gamma2 subunit of the GABAA receptor (green), and ankyrinG (blue), which
is highly enriched in the axon initial segment of pyramidal cells. Grid = 10 μm. (b) A 4× magnification of the
boxed region in a. (c) Object masks of vGAT and gamma2 IR puncta in b
Fig. 7 The use of scrambled channels to compare cross channel correlations. Projection image (3 z-planes
taken 0.25 μm apart) of a monkey PFC tissue section labeled for GAD65 and GAD67. Single (a) GAD65 and (b)
GAD67 channels, and (c) merged GAD65 (red) and GAD67 (green) channels, with masks of colocalized GAD65
and GAD67 puncta (blue), (d) GAD65 channel and masks, (e) GAD67 channel and masks, and (f) scrambled
GAD65 and GAD67 channels and masks. The masks were selected by having GAD65 object masks that over-
lapped the center of volume of a GAD67 object mask, which in turn overlapped the same GAD65 object mask,
and are the same within each image. For masks in (c) Pearson’s correlation, R = 0.29; mean GAD65 intensity
(standard deviation) = 3,136 (969); and mean GAD67 intensity = 3,238 (1,153). For masks in (f) R = −0.09;
mean GAD65 intensity = 237 (210); and mean GAD67 intensity = 222 (126). Bar = 5 μm
Immunocytochemistry
1. If OCT embedding is not done quickly, the media will freeze
before it adheres to the disk; the media should be as flat as pos-
sible on the disk.
2. Before mounting check the specimen for unevenness and try to
place the face of the specimen as parallel to the media as possible.
The region of interest should be mounted face up in the media.
Immunofluorescence Colocalization 275
5 Conclusions
Acknowledgment
References
1. Coons AH, Creech HJ, Jones RN et al (1942) cortex and a comparison with other mammals.
The demonstration of pneumococcal antigen J Comp Neurol 486:344–360
in tissues by the use of fluorescent antibody. 16. Cruz DA, Lovallo EM, Stockton S et al (2009)
J Immunol 45:159–170 Postnatal development of synaptic structure
2. Coons AH (1961) The beginnings of immu- proteins in pyramidal neuron axon initial seg-
nofluorescence. J Immunol 87:499–503 ments in monkey prefrontal cortex. J Comp
3. Zaitsev AV, Povysheva NV, Gonzalez-Burgos Neurol 514:353–367
G et al (2009) Interneuron diversity in layers 17. Gabbott PL, Dickie BG, Vaid RR et al (1997)
2-3 of monkey prefrontal cortex. Cereb Cortex Local-circuit neurones in the medial prefrontal
19:1597–1615 cortex (areas 25, 32 and 24b) in the rat: mor-
4. Povysheva NV, Zaitsev AV, Rotaru DC et al phology and quantitative distribution. J Comp
(2008) Parvalbumin-positive basket interneu- Neurol 377:465–499
rons in monkey and rat prefrontal cortex. 18. Letinic K, Zoncu R, Rakic P (2002) Origin of
J Neurophysiol 100:2348–2360 GABAergic neurons in the human neocortex.
5. Melchitzky DS, Lewis DA (2008) Dendritic- Nature 417:645–649
targeting GABA neurons in monkey prefrontal 19. Molyneaux BJ, Arlotta P, Menezes JR et al
cortex: comparison of somatostatin- and (2007) Neuronal subtype specification in the
calretinin-immunoreactive axon terminals. cerebral cortex. Nat Rev Neurosci 8:427–437
Synapse 62:456–465 20. Povysheva NV, Zaitsev AV, Kroner S et al (2007)
6. Bystron I, Blakemore C, Rakic P (2008) Electrophysiological differences between neuro-
Development of the human cerebral cortex: gliaform cells from monkey and rat prefrontal
Boulder Committee revisited. Nat Rev cortex. J Neurophysiol 97:1030–1039
Neurosci 9:110–122 21. Krimer LS, Zaitsev AV, Czanner G et al (2005)
7. DeFelipe J (2002) Cortical interneurons: from Cluster analysis-based physiological classifica-
Cajal to 2001. Prog Brain Res 136:215–238 tion and morphological properties of inhibi-
8. DeFelipe J, Ballesteros-Yanez I, Inda MC et al tory neurons in layers 2-3 of monkey
(2006) Double-bouquet cells in the monkey and dorsolateral prefrontal cortex. J Neurophysiol
human cerebral cortex with special reference to 94:3009–3022
areas 17 and 18. Prog Brain Res 154:15–32 22. Gottlieb DI, Chang YC, Schwob JE (1986)
9. DeFelipe J, Jones EG (1988) A light and electron Monoclonal antibodies to glutamic acid decar-
microscopic study of serotonin-immunoreactive boxylase. Proc Natl Acad Sci U S A 83:
fibers and terminals in the monkey sensory-motor 8808–8812
cortex. Exp Brain Res 71:171–182 23. Chang YC, Gottlieb DI (1988) Characterization
10. Gabbott PL, Bacon SJ (1996) Local circuit of the proteins purified with monoclonal anti-
neurons in the medial prefrontal cortex (areas bodies to glutamic acid decarboxylase.
24a, b, c, 25 and 32) in the monkey: I. Cell J Neurosci 8:2123–2130
morphology and morphometrics. J Comp 24. Swedlow JR, Platani M (2002) Live cell imag-
Neurol 364:567–608 ing using wide-field microscopy and deconvo-
11. Gabbott PL, Bacon SJ (1996) Local circuit lution. Cell Struct Funct 27:335–341
neurons in the medial prefrontal cortex (areas 25. Murray JM, Appleton PL, Swedlow JR et al
24a, b, c, 25 and 32) in the monkey: (2007) Evaluating performance in three-
II. Quantitative areal and laminar distributions. dimensional fluorescence microscopy.
J Comp Neurol 364:609–636 J Microsc 228:390–405
12. Jones EG (2009) The origins of cortical inter- 26. Wang E, Babbey CM, Dunn KW (2005)
neurons: mouse versus monkey and human. Performance comparison between the high-
Cereb Cortex 19:1953–1956 speed Yokogawa spinning disc confocal system
13. Meyer G (2007) Genetic control of neuronal and single-point scanning confocal systems.
migrations in human cortical development. J Microsc 218:148–159
Adv Anat Embryol Cell Biol 189:1–111 27. Sandison DR, Webb WW (1994) Background
14. Rakic S, Zecevic N (2003) Emerging complex- rejection and signal-to-noise optimization in
ity of layer I in human cerebral cortex. Cereb confocal and alternative fluorescence micro-
Cortex 13:1072–1083 scopes. Applied Optics 33:603–615
15. Yanez IB, Munoz A, Contreras J et al (2005) 28. Benveniste M, Schlessinger J, Kam Z (1989)
Double bouquet cell in the human cerebral Characterization of internalization and endosome
Immunofluorescence Colocalization 279
formation of epidermal growth factor in trans- and fluorescence intensity in tissue sections.
fected NIH-3T3 cells by computerized image- Brain Res 1240:62–72
intensified three-dimensional fluorescence 37. Darya K, Ganguly A, Lee D (2009) Quantitative
microscopy. J Cell Biol 109:2105–2115 analysis of synaptic boutons in Drosophila pri-
29. Hiraoka Y, Agard DA, Sedat JW (1990) mary neuronal cultures. Brain Res 1280:1–12
Temporal and spatial coordination of chromo- 38. Bergsman JB, Krueger SR, Fitzsimonds RM
some movement, spindle formation, and (2006) Automated criteria-based selection and
nuclear envelope breakdown during prometa- analysis of fluorescent synaptic puncta.
phase in Drosophila melanogaster embryos. J Neurosci Meth 152:32–39
J Cell Biol 111:2815–2828 39. Fish KN, Hoftman GD, Sheikh W et al (2013)
30. Shaw PJ (2006) Comparison of widefield/ Parvalbumin-containing chandelier and basket
deconvolution and confocal microscopy for cell boutons have distinctive modes of matura-
three-dimensional imaging. In: Pawley JB (ed) tion in monkey prefrontal cortex. J Neurosci
Handbook of biological confocal microscopy. 33:8352–8358
Springer, New York, pp 453–67 40. Fish KN, Sweet RA, Lewis DA (2011)
31. Oeth KM, Lewis DA (1993) Postnatal devel- Differential distribution of proteins regulating
opment of the cholecystokinin innervation of GABA synthesis and reuptake in axon boutons
monkey prefrontal cortex. J Comp Neurol of subpopulations of cortical interneurons.
336:400–418 Cereb Cortex 21:2450–2460
32. Sweet RA, Fish KN, Lewis DA (2010) Mapping 41. Curley AA, Arion D, Volk DW et al (2011)
synaptic pathology within cerebral cortical cir- Cortical deficits of glutamic acid decarboxylase
cuits in subjects with schizophrenia. Front 67 expression in schizophrenia: clinical, pro-
Hum Neurosci 4:1–14 tein, and cell type-specific features. Am J
33. Sugiyama Y, Kawabata I, Sobue K et al (2005) Psychiatry 168:921–929
Determination of absolute protein numbers in 42. Wallace W, Schaefer LH, Swedlow JR (2001) A
single synapses by a GFP-based calibration workingperson's guide to deconvolution in
technique. Nature Meth 2:677–84 light microscopy. Biotechniques 31:1076–
34. Hohensee S, Bleiss W, Duch C (2008) 1078, 1080, 1082
Correlative electron and confocal microscopy 43. Ridler TW, Calvard S (1978) Picture threshold-
assessment of synapse localization in the central ing using an iterative selection method. IEEE
nervous system of an insect. J Neurosci Meth Trans Syst Man Cybern SMC-8:630–632
168:64–70 44. Manders EM, Stap J, Brakenhoff GJ et al
35. Glynn MW, McAllister AK (2006) (1992) Dynamics of three-dimensional replica-
Immunocytochemistry and quantification of tion patterns during the S-phase, analysed by
protein colocalization in cultured neurons. double labelling of DNA and confocal micros-
Nature Protocols 1:1287–1296 copy. J Cell Sci 103:857–862
36. Fish KN, Sweet RA, Deo AJ et al (2008) An 45. Lewis DA, Hashimoto T, Volk DW (2005)
automated segmentation methodology for Cortical inhibitory neurons and schizophrenia.
quantifying immunoreactive puncta number Nat Rev Neurosci 6:312–324
Chapter 15
Abstract
This chapter describes procedures for quantification of postembedding labeling at brain synapses using
computer-based tools. The postembedding electron microscopic immunogold method allows detection of
epitopes with a resolution of about 20–30 nm. However, plasma membranes belonging to different cells
and membranes of intracellular organelles can often be located even closer together. Localizing epitopes at
such membranes can reliably be performed by using computer programs, such as ImageJ, which offers
automated quantification of gold particles. The present chapter provides a practical description of how to
use ImageJ and plug-ins to obtain an accurate representation of the subcellular localization of proteins and
small molecular compounds.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_15, © Springer Science+Business Media New York 2015
281
282 Max Larsson et al.
3 Procedures
3.1 Tissue A prerequisite for immunogold labeling is that the molecules under
Preparation study must be retained and preserved in the tissue in such a way
that they are recognized by the primary antibodies. Because glutar-
3.1.1 Fixation
aldehyde is required for efficient fixation of free amino acids to
tissue proteins [4], in the immunogold protocol for detecting
amino acids, we use a mixture of 2.5 % glutaraldehyde and 1 %
formaldehyde. This gives an excellent retention of tissue amino
acids and a strong immunogold signal [5–7]. However, such a
high glutaraldehyde concentration will quench the immunogold
signal for most proteins. Thus, in the protocol for immunogold dete-
ction of proteins, we use 4 % formaldehyde only or combined with
a low concentration (e.g., 0.1 %) of glutaraldehyde. It could be
beneficial to add some glutaraldehyde to the fixative also for pro-
tein immunocytochemistry, because this gives a better preservation
of tissue morphology. Quantitative analyses of carboxylic acids can
also be performed using the postembedding immunogold method
[8]. This requires the use of carbodiimide as a fixation agent. One
drawback with carbodiimide is that it is water soluble, meaning
that it will probably not penetrate to the same extent into all tissue
compartments. This must be borne in mind when interpreting
immunogold quantifications from carbodiimide fixed tissue.
3.1.2 Embedding In order to obtain a robust immunogold signal, the brain tissue
and Section Cutting must be embedded in an “antigen-friendly” resin. Routinely, we
use Lowicryl HM20™ which is a water-insoluble acryl-based resin
that is polymerized at low temperatures by UV light [9]. Freeze
embedding with Lowicryl HM20 preserves the antigens to a large
extent and results in high immunogold sensitivity, but the ultra-
structure may be inferior compared to “conventional” osmicated
and epoxy-embedded tissue [3]. Alternatively, we use water-soluble
acrylic LR Gold as an embedding resin. For some epitopes this
286 Max Larsson et al.
3.1.3 Lowicryl HM20™ Cryoprotect tissue specimen in 10 % (30 min), 20 % (30 min), and
Freeze Substitution 30 % (overnight) glycerol in PBS. Rapidly deep-freeze tissue in
propane cooled by liquid nitrogen [N2(liq) −170 °C]. Transfer the
tissue in N2(liq) to the freeze-substitution chamber set to −90 °C
and then to Reichert capsules containing 0.5 % (w/v) uranyl ace-
tate (contrast enhancement) in methanol (dehydration). Increase
the temperature stepwise by 4 °C/h to −45 °C and rinse in metha-
nol at −45 °C. Infiltrate with Lowicryl HM20™ resin at −45 °C:
first, use Lowicryl in methanol (50 %, 1.5–2 h; 67 %, 1.5–2 h) and
then 100 % Lowicryl (1.5–2 h; overnight). Transfer fresh Lowicryl
(100 %) in gelatin capsules cooled by ethanol at −45 °C. Polymerize
by UV illumination (24 h; −45 °C). Increase the temperature grad-
ually by 5 °C/h to 0 °C. Remove capsules from the chamber. Place
in room temperature in fume hood for 24 h.
3.1.4 LR Gold Low Incubate tissue specimens for 2 h at 0 °C with 2 % uranyl acetate
Temperature Embedding in 0.3 M citrate buffer containing 3.5 % sucrose (pH 6.4).
Subsequently dehydrate tissues in a series of diluted ethanol, start-
ing at 50 % (1 h, 0 °C), 70 % (1 h, −20 °C), 90 % (1 h, −20 °C),
and 100 % (2 h, −20 °C). Progressively infiltrate with LR Gold
with a mixture of ethanol and LR Gold at ratios of 7:3 and 3:7 at
−20 °C (1 h each) and then pure LR Gold (−20 °C, 12 h). Then
put the samples in gelatin capsules with LR Gold and 0.1 % benzyl
(light-sensitive initiator) overnight at −20 °C. Polymerize the resin
(UV light at 360 nm) for 48 h (−20 °C) and then stepwise increase
temperature 3 °C/h to 20 °C in 12 h. Post-cure the tissue blocks
in UV light for 72 h.
Fig. 2 Analysis of double immunogold labeling in axon terminals using ImageJ and the ParticleDensityDouble
plug-in. Shown is an electron micrograph of a terminal with immunogold labeling for GABA (large gold parti-
cles) and the vesicular nucleotide transporter, VNUT (small gold particles, barely discernible at the magnifica-
tion shown). The nerve terminal is outlined using the polygon selection tool, while each set of large and small
gold particles is selected separately using the multipoint tool. A mitochondrion (red outline ) is defined as a hole
in the profile and will therefore be excluded from subsequent analysis (color figure online)
Fig. 3 Processing coordinate files using the Python component of ParticleDensityDouble. A set of coordinate
files generated as described in the text and in Fig. 2 is submitted to the Python program, which computes vari-
ous measures of interest and outputs these to files that can be imported to a spreadsheet program for inspec-
tion and further analysis
Fig. 4 Analysis of synaptic immunogold labeling using the Synapse tool. Shown is an electron micrograph of a
perforated synapse immunogold labeled for the glutamate receptor subunit, GluN3B. The pre- and postsynap-
tic membranes are outlined in green and blue, respectively. In this particular ultrathin section, the synapse
exhibits three postsynaptic densities, which are individually outlined in orange and numbered. The gold parti-
cles are marked by the crosshairs of the multipoint selection tool of ImageJ. The profile has been saved to a
coordinate file, which resets the values in the Synapse info window and readies the tool for analysis of another
profile in the same or a different micrograph (color figure online)
3.2.4 Using Random Random rectangular or linear regions of interest can be used to
Compartments and Points estimate the background of an immunogold labeling experiment
to Assess Background (see Note 6). To analyze immunogold labeling density in such ran-
and Enrichment dom regions, two simple auxiliary ImageJ plug-ins, Particle
of Immunogold Labeling DensityRandomBox and DistToRandomLine, are available that are
compatible with the Python components of PointDensity and
DistToPath, respectively.
If an antigen of interest is not randomly dispersed in a profile,
specific immunogold labeling for this antigen should not be ran-
domly distributed, i.e., it should not show so-called complete spa-
tial randomness. If it did, the location of any given gold particle
292 Max Larsson et al.
molecules endogenous to the brain [5, 6, 8]. The dot blots are
made by spotting conjugates of small molecular compounds
bound to brain proteins by the fixative used for producing the
antibodies. If some antibodies show cross-reactivity, this can
be abolished by adding soluble complexes of the cross-reacting
molecules to the primary antibody solution. In immunogold
experiments, we use such pre-absorbed antibodies to label
ultrathin tissue as well as test sections (e.g., [5]). The latter
sections, which contain a “sandwich” of different amino acids
bound to brain proteins with glutaraldehyde [30], are pro-
cessed together with the tissue sections as an inherent specificity
control in each immunogold experiment. As an extra negative
control, we ensure that the immunoreactivities of the ultrathin
tissue sections and the test sections are blocked by adding sol-
uble complexes of the compound against which the antibodies
were raised to the primary antibody solution before perform-
ing the immunogold procedure. To ensure that the antibodies
toward small molecular compounds do not cross-react with
brain proteins, the antibodies can be tested on Western blots
of brain homogenates [8]. In addition, the specificity of the
secondary antibodies should be tested by omitting the primary
antibodies.
2. Density of molecules in tissue compartments: The postembedding
immunogold method offers reliable quantification of the density
of gold particles in different tissue compartments. Moreover, it
has been shown that immunogold labeling density scales essen-
tially linearly with the concentration of accessible epitopes [2].
Thus, by counting the number of gold particles representing a
given antigen (small molecules or proteins) within defined tis-
sue compartments on electron micrographs and measuring the
areas of the compartments, it is possible to calculate the con-
centration of the antigen in the different compartments. This
is based on the Delesse Principle (after the French geologist
Delesse, 1847), which states that the proportion of a com-
pound of the volume of a structure is equal to its proportion
of the area of a section through the structure [31]. We have
recently used this approach to measure the relative densities of
vesicular ATP and glutamate transporters in axons, nerve ter-
minals, and astrocytes [26, 32, 33]. Many other studies using
similar types of analysis can be found in the literature.
3. Density and localization of membrane-associated proteins: Just as
the area density of immunogold labeling can be used to estimate
tissue concentration of an antigen, so can the linear density of
immunogold labeling along cellular membranes be used to
determine the density of a protein at the membrane. In this case,
a particle is considered to be associated with the membrane if its
center is located within 25–30 nm from the membrane, reflecting
294 Max Larsson et al.
estimate both the area density (using random boxes) and linear
density (using random lines) of background labeling. Note
that this measure is likely to be an overestimate of nonspecific
labeling, as it also includes any specific labeling of antigen pres-
ent in the randomly selected tissue.
The background level of immunogold labeling of small
molecular compounds could be assessed over an empty resin in
the ultrathin sections (usually over the lumen of blood vessels).
This gives an estimate of the nonspecific affinity of the antibod-
ies for the embedding medium. We have also used labeling
over tissue profiles in sections processed with antibodies that
have been pre-neutralized with the molecule used to produce
the antibodies to estimate the level of background labeling [8],
although this does not account for the background attributed
to antibodies that also bind specifically to the antigen.
5 Conclusions
References
Abstract
Neuronal tracing (neurotracing) using anterograde and retrograde tracers is widely used to study the projections
between different brain regions and the wiring between individual neurons. Neurotracing is a technique
essential not only for examining the connectivity of complex neuronal networks but also for providing the
neuroanatomical basis for electrophysiological, pharmacological and behavioral experiments. If neurotrac-
ing is combined with immunocytochemical labeling, the combined technique can characterize the neuro-
chemical properties, postsynaptic targets and innervation modes of neurons. The utility and versatility of
this approach can be further extended by adopting appropriate cellular and subcellular markers for
immunocytochemistry, by applying the approach to animal models generated by advanced gene-
manipulation technology, and by using single-cell labeling techniques, e.g., after viral transfection of fluo-
rescent proteins or in utero/in vivo electroporation. In this chapter, we introduce the methods for
combined immunocytochemistry and neurotracing at both light and electron microscopic levels. We have
developed and employed these combined approaches to study the mechanisms underlying the development
and refinement of climbing fiber mono-innervation in cerebellar Purkinje cells. Therefore, we present
some examples of the images obtained in this experimental context.
Key words Climbing fiber, Purkinje cell, Anterograde labeling, Immunohistochemistry, Lentivirus,
Green fluorescent protein
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_16, © Springer Science+Business Media New York 2015
299
300 Taisuke Miyazaki and Masahiko Watanabe
2.1 Stereotaxic For tracer injection, anesthetized mice are fixed on a stereotaxic
Setup and Surgical instrument (e.g., SR-5R, Narishige, Tokyo, Japan). Glass pipettes
Operation are prepared using a puller (e.g., PC-10, Narishige) and the tips are
sharpened with a grinder (EG-400, Narishige). A glass pipette,
filled with 2–3 μL of a 10 % solution of biotinylated dextran amine
(BDA; 10,000 molecular weight; Invitrogen™, Life Technologies™,
Carlsbad, CA) in phosphate-buffered saline (PBS) pH 7.4 (for
bright-field light microscopy and electron microscopy), or with
dextran Alexa Fluor® 594 (Invitrogen™) (for confocal laser scan-
ning microscopy), or with lentivirus solution (for GFP transfection)
is connected to a picopump (Pneumatic Picopump; World Precision
Instruments, Sarasota, FL) via a silicone tube and attached to a
micromanipulator (e.g., SM-15, Narishige). The field of surgical
operation is illuminated with a fiber lamp (e.g., Sugiura Laboratory
Inc., Tokyo, Japan) and observed with a stereomicroscope.
3 Procedures
3.1 Tracer Injection For more detailed procedures of tracer injection into the inferior
olive see [32]. Mice are anesthetized with appropriate procedures
according to age and in compliance with national regulations.
As these may change in different countries, researchers should
strictly adhere to specific laws and ethic issues. Anesthetized mice
are clamped with ear bars at the external acoustic foramen (≈P10)
or at the mastoid process (P1–P10). The line between the clamp-
ing point and the maxilla is set parallel to the horizontal plane of
the stereotaxic instrument. After confirming no response to tactile
stimulation, the dorsal medulla of the anesthetized mouse is
exposed by surgical opening of the posterior atlanto-occipital
membrane. In adult mice, a glass pipette is inserted into the
medulla at an angle of 58–59° to the perpendicular line, 1.00 mm
lateral from the midline, and 1.70–1.85 mm deep from the medulla
surface. For ≈P8 pups, the angle of the manipulator was 55–56°
to the perpendicular line, 0.80 mm lateral from the midline, and
1.3–1.45 mm deep from the medulla surface. Tracer solution is
injected using air pressure at 20 psi and at 5 s intervals for 1 min.
The surgical cut is closed with instant cyanoacrylate adhesive.
After recovery by warming under a glow lamp for 2 h, neonatal
pups and juvenile mice (≈P18) are returned to their mothers. Four
Immunocytochemistry and Neurotracing 303
3.2 Virus Injection For lentivirus injection into the cerebellum, mice are anesthetized
and fixed to the stereotaxic instrument as described above. A small
cranial window is formed on the occipital bone with an electrical
drill (for adult mice) or a 27-G needle (for pups), and the surface
of cerebellar lobules VI–VII is exposed. A glass pipette filled with
lentivirus solution is then inserted into the cerebellum. Two weeks
later, mice are transcardially perfused with 4 % PFA.
For preparation of lentiviral vectors for GFP expression, a mix-
ture of pCAGkGP1R, pCAG4RTR2, and pCAG-VSV-G vectors
and pCL20c-GFP lentivector plasmids (kindly provided by Dr.
K. Kobayashi, Fukushima Medical University, Fukushima, Japan,
and Dr. E.R. Allay, St. Jude Children’s Research Hospital,
Memphis, TN) [33] are cotransfected into HEK 293 T cells using
the calcium phosphate precipitation method. Forty hours after
transfection, medium samples containing lentiviral particles are fil-
tered through 0.22-μm membranes and centrifuged at 6,000× g
for 16 h. Recovered viral particles are resuspended in PBS.
3.3.2 Immuno- For confocal microscopy, cerebellar sections are prepared from
fluorescence for DA-594 mice injected with DA-594 or lentivirus expressing GFP. TPBS is
and GFP-Labeled Sections used as diluent and as the washing buffer. Free-floating DA-594-
labeled sections are incubated with 10 % normal donkey serum in
TPBS for 30 min, then with a mixture of VGluT2 and calbindin
antibodies overnight (1 μg/mL), and subsequently with a mixture
304 Taisuke Miyazaki and Masahiko Watanabe
4 Typical/Anticipated Results
4.1 Immuno- For bright-field microscopy, both the anterograde tracer BDA and
peroxidase Labeling/ molecular markers need to be visualized with the avidin–biotin–
Neurotracing peroxidase complex (ABC) method [34]. To differentiate between
them, BDA-labeled CFs are first visualized in black using DAB and
cobalt, and then the molecular markers are visualized in brown
using DAB only. This immunoperoxidase-based method is limited
to double labeling. Nevertheless, its advantage is that specimens
demonstrating the sites of CF innervation and wiring onto PC
elements are preserved permanently.
Figure 1 shows an example from a juvenile mouse, where a
BDA-labeled CF innervates the soma of PCs, especially the upper
somatic portion. Because of the immaturity, dendritic CF innerva-
tion is restricted to the very basal portion, and proximal dendrites
are mostly free of CF innervation. This corresponds to the capuchon
(i.e., a cone-shaped ceremonial hat) stage in the development of
CF innervation [35].
Fig. 1 Combined immunoperoxidase labeling and neurotracing. Cerebellar Purkinje cells of wild-type mouse at
P10 have been labeled with an anti-calbindin antibody and the immunoperoxidase reaction was developed
with non-intensified DAB (brown) after neurotracing of climbing fibers following injection of the anterograde
tracer BDA into the inferior olive and development with cobalt-intensified DAB (black). BDA biotinylated dextran
amine, calb calbindin, CF climbing fiber, PC Purkinje cell. Bars = A, 20 μm; B, 10 μm
Fig. 2 Combined immunofluorescence labeling and neurotracing. Cerebellar Purkinje cells and CF terminals
have been labeled with an anti-calbindin antibody (gray) and an anti-VGluT2 antibody (green), respectively.
Some CFs have been traced by dextran Alexa 594 (DA-594, red). These triple fluorescent immunoreactions are
scanned by a confocal laser scanning microscopy. (a, b) In the wild-type mouse, tracer-labeled/VGluT2-labeled
CFs (CF1, red) and tracer-unlabeled/VGluT2-labeled CFs (CF2, green) innervate the proximal dendrites of
different PCs, demonstrating mono-innervation of PCs by CFs. (c, d) In Cav2.1-PC-knockout (Cav2.1-PCKO)
mice, both tracer-labeled/VGluT2-labeled CFs (CF1, red) and tracer-unlabeled/VGluT2-labeled CFs (CF2, green)
innervate the same proximal dendrites, indicating multiple CF innervation. VGluT2 vesicular glutamate trans-
porter type 2. Bars: A and C, 20 μm; B and D, 10 μm
Fig. 3 Combined lentivirus-mediated neuronal labeling and neurotracing. Cerebellar inhibitory interneuron
basket cells have been labeled by GFP (green), which is mediated by lentivirus transfection. Simultaneously,
some CFs are neurotraced by DA-594 (red). These two fluorescent reactions are scanned by a confocal laser
scanning microscope. Arrowheads in b indicate CF boutons contacting the somatodendritic domain of this
basket cell. GFP green fluorescent protein. Bars: A, 20 μm; B, 10 μm
Fig. 4 Combined immunoelectron microscopic labeling and neurotracing. Cerebellar CF terminals have been
labeled with an anti-VGluT2 antibody and visualized with pre-embedding silver-enhanced immunogold (metal
particle) and BDA-labeled CFs are visualized with DAB (black) in the wild-type mouse at P10. (a) The somata
of two neighboring PCs are pseudocolored in red (PCBa) and green (PCBb). Boxed regions are enlarged in b
and c. (b, c) Serial electron micrographs showing BDA-labeled/VGluT2-positive aCF innervating spine-like
protrusions (asterisks) on PCBa, while BDA-unlabeled/VGluT2-positive uCF innervates those on PCBb. aCF
anterogradely labeled CF terminal, PCB Purkinje cell body, uCF anterogradely unlabeled CF terminal. Bars: A,
2 μm; B and C, 500 nm
Immunocytochemistry and Neurotracing 309
5 Conclusion
References
1. Palay S, Chan-Palay V (1974) Cerebellar cor- immature control, x-irradiated and hypothy-
tex: cytology and organization. Springer, roid rats. Brain Res 227:59–71
New York, NY, pp 63–69, 242–287 5. Mariani J (1982) Extent of multiple innervation
2. Hashimoto K, Ichikawa R, Kitamura K et al of Purkinje cells by climbing fibers in the olivo-
(2009) Translocation of a “winner” climbing cerebellar system of weaver, reeler, and staggerer
fiber to the Purkinje cell dendrite and subse- mutant mice. J Neurobiol 13:119–126
quent elimination of “losers” from the soma in 6. Bravin M, Rossi F, Strata P (1995) Different
developing cerebellum. Neuron 63:106–118 climbing fibres innervate separate dendritic
3. Woodward DJ, Hoffer BJ, Altman J (1974) regions of the same Purkinje cell in hypogranu-
Physiological and pharmacological properties of lar cerebellum. J Comp Neurol 357:395–407
Purkinje cells in rat cerebellum degranulated by 7. Sugihara I, Bailly Y, Mariani J (2000)
postnatal x-irradiation. J Neurobiol 5:283–304 Olivocerebellar climbing fibers in the granulo-
4. Crepel F, Delhaye-Bouchaud N, Dupont JL prival cerebellum: morphological study of
(1981) Fate of the multiple innervation of cer- individual axonal projections in the x-irradi-
ebellar Purkinje cells by climbing fibers in ated rat. J Neurosci 20:3745–3760
310 Taisuke Miyazaki and Masahiko Watanabe
gene transfer by pseudotyping with fusion signals in cerebellar Purkinje cells. Nature
envelope glycoprotein. Hum Gene Ther 22: 356:601–604
197–206 37. Konnerth A, Dreessen J, Augustine GJ (1992)
34. Sugihara I, Shinoda Y (2004) Molecular, topo- Brief dendritic calcium signals initiate long-
graphic, and functional organization of the lasting synaptic depression in cerebellar Purkinje
cerebellar cortex: a study with combined aldol- cells. Proc Natl Acad Sci U S A 89:7051–7055
ase C and olivocerebellar labeling. J Neurosci 38. Regehr WG, Mintz IM (1994) Participation of
24:8771–8785 multiple calcium channel types in transmission
35. Watanabe M, Kano M (2011) Climbing fiber at single climbing fiber to Purkinje cell syn-
synapse elimination in cerebellar Purkinje cells. apses. Neuron 12:605–613
Eur J Neurosci 34:1697–1710 39. Tamamaki N, Nakamura K, Furuta T et al
36. Kano M, Rexhausen U, Dreessen J et al (1992) (2000) Neurons in Golgi-stain-like images
Synaptic excitation produces a long-lasting revealed by GFP-adenovirus infection in vivo.
rebound potentiation of inhibitory synaptic Neurosci Res 38:231–236
Chapter 17
Abstract
Several substances, once injected in a given central structure, are taken up by axon terminals and transported
retrogradely over long distances, to the cell bodies of neurons projecting to the injection area. They are
then visualized by means of histochemical (or immunohistochemical) reactions, making it possible to trace
neural pathways.
Here we describe a method to label retrogradely neocortical pyramidal neurons in a Golgi-like fash-
ion. This method allows reconstructing the entire dendritic tree of retrogradely labeled cells and can be
easily combined with immunohistochemical techniques. Methods suitable to establish relationships
between morphological and functional features of projecting neurons are also discussed.
Key words Tract tracing, Cortex, Pyramidal neurons, 3D reconstruction, Dextran amine, Dendrites
Early studies on the central nervous system (CNS) and its circuits
were based on the so-called black reaction described by Camillo
Golgi and extensively used by Santiago Ramón y Cajal to conceive
the neuron doctrine (see refs. 1, 2, for historical reviews). While
disclosing fine details of neurons, the Golgi impregnation does not
provide any information about where long-range axonal projections
of labeled neurons are directed. As a consequence, Golgi investiga-
tions on the projection neurons of the cerebral cortex (i.e., the
pyramidal neurons) cannot answer several important questions.
For instance, relationships between the output of a pyramidal
neuron and the geometrical properties of its input section
(represented by the dendritic tree) cannot be established unequiv-
ocally. Given these premises, there was a strong need for methods
making it possible to reliably trace neural connections.
The first methods of neural tract tracing were based on
anterograde degeneration (of axons belonging to injured cell bodies)
or retrograde degeneration (of cell bodies giving origin to
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_17, © Springer Science+Business Media New York 2015
313
314 Alberto Granato and Andrea De Giorgio
● Surgical microscope.
● Hamilton microsyringes or pipettes pulled from borosilicate
glass capillaries.
● Microinjection device: e.g., PV 820 pneumatic picopump;
WPI, Sarasota, FL.
● Biotinylated dextran amine (BDA) 10,000 MW (can be obtained
for example from Life Technologies™, Carlsbad, CA).
● N-methyl-D-aspartic acid (NMDA).
● Phosphate buffer (PB) 0.1 M, pH 7.4 stock solution.
● Phosphate buffered saline (PBS).
● 4 % buffered paraformaldehyde (PFA).
2.3 Immuno- ● All chemicals indicated in Sect. 2.1 (with the exception of
histochemistry nickel ammonium sulfate for the DAB incubation medium).
● Primary mouse monoclonal antibody anti-calbindin (e.g., from
Sigma Chemicals).
● Secondary antibody (biotinylated goat anti-mouse IgG).
3 Procedures
3.1 Golgi-Like The method described herein has been successfully used in our
Retrograde Labeling laboratory to label cortico-cortical associative pyramidal neurons
in adult rats [33, 34] and mice [35]. We have also used the same
technique to label the cortico-thalamic neurons of rats in a Golgi-
like fashion [36]. The observation of pyramidal neurons in the
hemisphere contralateral to the injected cortical site confirmed
that callosal neurons display a complete filling of the dendritic tree,
similar to what is observed for ipsilateral, associative neurons
[33–35]. For the sake of clarity, we provide a detailed description
only for the experimental protocol concerning the retrograde
labeling of cortico-cortical associative projections in Wistar rats.
The protocol can be easily extended and adapted to other species
and/or projections.
The method is based on microinjections of the tracer BDA in
the sensory-motor cortex of adult rats. The tracer is injected in
conjunction with the glutamate receptor agonist NMDA. Probably
due to the NMDA-induced, activity dependent enhancement of
tracer uptake, this technique proves suitable to fill neurons in a
Golgi-like fashion [37].
3.1.2 Post-surgery The post-surgery survival period coincides with the time required
Survival and Tissue for the tracer to be retrogradely transported from the injection
Preparation for Histology point, where it is taken up by axon terminals, to the parent cell
bodies. To label cortico-cortical associative neurons, 72–96 h
represent the optimal survival time. During this period, animals
must be monitored on a regular basis, according to the rules estab-
lished by the Animal Care Facility of your institution, in order to
minimize stress, discomfort, and post-surgical pain.
Thereafter, the brain is fixed by perfusion with PBS followed
by 4 % buffered PFA. The perfusion is carried out under deep
anesthesia (ketamine, 100 mg/kg i.p.), through the ascending
aorta. The brain should be carefully removed, post-fixed for 2–4 h
in the same fixative at 4 °C, and stored in PBS at 4 °C until the
histological procedure is carried out (see Sect. 3.1.3). If you plan
to cut the tissue on a freezing microtome, an intermediate step of
Retrograde Labeling and Immunocytochemistry 319
3.1.3 Histology Cut the brain on the freezing microtome or on the vibratome into
and Histochemistry 50 μm thick coronal sections (see Note 5). Collect the tissue in
PBS, maintaining the rostro-caudal order (see Note 6).
Incubate free floating sections in a solution containing 0.3 %
Triton® X-100 and 3 % NGS in PBS for 20 min at room tempera-
ture under continuous agitation.
Prepare the ABC complex according to the manufacturer’s
instructions at least 30 min before use; dilute the individual
reagents in PBS containing 0.3 % Triton® X-100. Then incubate
sections for 1 h in the ABC complex and once incubation is com-
pleted rinse them three times (5 min each) in PBS.
Prepare the HRP development solution by dissolving a 10 mg
tablet of DAB in 18.8 mL of 0.1 M PB. Filter, then add 0.4 %
NH4Cl (200 μL), 1 % nickel ammonium sulfate (800 μL), 20 %
D-glucose (200 μL).
Use part of this solution to preincubate sections for 10 min.
Since sections are processed in separate wells, keep note of the
amount of solution you put in each well (usually 500 μL). Do not
dispose of the remainder of the solution, but add to it the glucose
oxidase (2.5 μL/10 mL). After preincubation, add the DAB-
glucose oxidase solution to the preincubation solution (for each
well, add exactly the same amount of fluid you put previously; in
our example, 500 μL; the final amount of solution in each well is
1 mL and the final concentration of glucose oxidase is
2.5 μL/20 mL). The reaction should be now controlled visually,
using a dissecting microscope. In about 3–5 min, the injection
area, as well as the soma and dendrites of retrogradely labeled pyra-
midal cells should appear intensely stained in black, contrasting
with the white unlabeled tissue in the background. When the label-
ing is satisfactory, the sections should be rinsed in PBS (three
times, 5 min each). If you want to combine the retrograde BDA
labeling with immunohistochemistry, skip the following steps and
go to Sect. 3.2 (see Note 7 if you want to use a fluorescent labeling
for confocal microscopy). Finally, mount sections on gelatin coated
slides; dehydrate, clear in xylene and coverslip with mounting
medium.
The appearance of Golgi-like retrogradely labeled neurons is
shown in Fig. 1.
3.2 Combination with The retrograde BDA labeling of pyramidal neurons, described in
Immunohistochemistry Sect. 3.1, can be easily combined with the immunohistochemical
detection of several molecules. Here we describe the combination
of the retrograde BDA tracing with the immunohistochemistry for
the calcium binding protein calbindin. In the neocortex, the three
calcium binding proteins parvalbumin, calbindin, and calretinin
320 Alberto Granato and Andrea De Giorgio
3.3 Analysis Some information on the structure of the dendritic tree of retro-
of the Dendritic Tree gradely labeled neurons can be gathered with the simple observation
at the light microscope. However, microscopes can be equipped
with computerized systems allowing a detailed 3D reconstruction
of labeled dendrites and spines. The most widely adopted system
(also in use in our laboratory) is probably Neurolucida [43, 44]. In
its basic configuration, Neurolucida comprises a CCD camera
mounted on the microscope, connected to the PC via a frame
grabber card, and a motorized stage, whose movements can be
recorded by a three-axis digital controller connected to the PC. The
core of the system is the software, matching the images captured
from the microscope with the stage movements, thus making it
possible to map the position of labeled neurons and to reconstruct
in 3D their dendritic trees and axons.
Data obtained from Neurolucida files can be exported to any
spreadsheet (e.g., Microsoft Excel) for the computation of quanti-
tative parameters concerning metric and topological features of
dendrites. The main quantitative parameters that can be evaluated
are the following: (a) total dendritic length; (b) number of end
points; (c) path distance, i.e., the distance from the soma to each
end point; (d) terminal length percentage, i.e., the percentage of
the total dendritic length occupied by terminal dendritic branches;
322 Alberto Granato and Andrea De Giorgio
Fig. 2 (a–c) Combination of Golgi-like retrograde labeling and immunohistochemistry for calbindin. In (a), white
arrows indicate black-stained retrogradely labeled cells, while white arrowheads indicate brown calbindin
immunostained interneurons. Black arrowheads in (b) point to the axon of a retrogradely labeled pyramidal
neuron. Black arrows in the inset of (b) point to an axon contacting a calbindin immunoreactive cell. (d) The
neuron shown in (b) has been reconstructed using Neurolucida. Asterisks indicate incomplete branches,
whose end points lie in adjacent sections. The arrow points to the axon. For one of the dendrites (in red), the
schematic dendrogram is also shown, with the indication of the length of single dendritic branches (in μm).
Scale bar: 60 μm for (a), 30 μm for (b) and (c), 20 μm for the inset of (b)
Retrograde Labeling and Immunocytochemistry 323
(e) the mean proportional sum of absolute deviations [45]. This latter
parameter is a measure of the symmetry of dendritic branching. It
ranges from 0 to 1, where 0 represents the maximum of symmetri-
cal branching and 1 the maximum of asymmetrical branching.
The geometrical features of dendritic arbors are key determi-
nants of the functional properties of neurons [46, 47]. Refer to
Note 8 for a brief overview of methods relating morphology to
functional neuronal properties.
References
1. Glickstein M (2006) Golgi and Cajal: the neu- 3. Vercelli A, Repici M, Garbossa D et al (2000)
ron doctrine and the 100th anniversary of the Recent techniques for tracing pathways in the
1906 Nobel Prize. Curr Biol 16:R147–R151 central nervous system of developing and adult
2. Bentivoglio M, Jones EG, Mazzarello P et al mammals. Brain Res Bull 51:11–28
(2011) Camillo Golgi and modern neurosci- 4. Kristensson K, Olsson Y (1971) Retrograde axo-
ence. Brain Res Rev 66:1–4 nal transport of protein. Brain Res 29:363–365
326 Alberto Granato and Andrea De Giorgio
5. Goldberg S, Kotani M (1967) The projection ents onto primary somatosensory and visual
of optic nerve fibers in the frog Rana catesbei- areas in cats. J Comp Neurol 362:46–70
ana as studied by radioautography. Anat Rec 18. Stanfield BB, O’Leary DD, Fricks C (1982)
158:325–331 Selective collateral elimination in early postna-
6. Cowan WM, Gottlieb DI, Hendrickson AE tal development restricts cortical distribution
et al (1972) The autoradiographic demonstra- of rat pyramidal tract neurones. Nature
tion of axonal connections in the central ner- 298:371–373
vous system. Brain Res 37:21–51 19. O’Leary DD, Stanfield BB (1986) A tran-
7. Kuypers HG, Bentivoglio M, van der Kooy D sient pyramidal tract projection from the
et al (1979) Retrograde transport of bisbenz- visual cortex in the hamster and its removal
imide and propidium iodide through axons to by selective collateral elimination. Brain Res
their parent cell bodies. Neurosci Lett 12:1–7 392:87–99
8. Bentivoglio M, Kuypers HG, Catsman- 20. Innocenti GM (1981) Growth and reshaping
Berrevoets CE et al (1979) Fuorescent retro- of axons in the establishment of visual callosal
grade neuronal labeling in rat by means of connections. Science 212:824–827
substances binding specifically to adenine- 21. Innocenti GM, Clarke S, Kraftsik R (1986)
thymine rich DNA. Neurosci Lett 12:235–240 Interchange of callosal and association projec-
9. Kuypers HG, Bentivoglio M, Catsman- tions in the developing visual cortex. J
Berrevoets CE et al (1980) Double retrograde Neurosci 6:1384–1409
neuronal labeling through divergent axon col- 22. Rende M, Granato A, Lo Monaco M et al
laterals, using two fluorescent tracers with the (1991) Accuracy of reinnervation by periph-
same excitation wavelength which label differ- eral nerve axons regenerating across a 10-mm
ent features of the cell. Exp Brain Res gap within an impermeable chamber. Exp
40:383–392 Neurol 111:332–339
10. Bentivoglio M, Kuypers HG, Catsman- 23. Weinberg RJ, Bentivoglio M, Phend K et al
Berrevoets CE et al (1980) Two new fluores- (1985) A new double-labeling method dem-
cent retrograde neuronal tracers which are onstrates transmitter-specific projections.
transported over long distances. Neurosci Lett Neurosci Lett 55:349–353
18:25–30 24. Skirboll L, Hökfelt T, Norell G et al (1984) A
11. Keizer K, Kuypers HG, Huisman AM et al method for specific transmitter identification
(1983) Diamidino yellow dihydrochloride of retrogradely labeled neurons: immunofluo-
(DY.2HCl); a new fluorescent retrograde neu- rescence combined with fluorescence tracing.
ronal tracer, which migrates only very slowly Brain Res 320:99–127
out of the cell. Exp Brain Res 51:179–191 25. Airan RD, Hu ES, Vijaykumar R et al (2007)
12. Bentivoglio M, Molinari M (1984) Fluorescent Integration of light-controlled neuronal firing
retrograde triple labeling of brainstem reticular and fast circuit imaging. Curr Opin Neurobiol
neurons. Neurosci Lett 46:121–126 17:587–592
13. Bentivoglio M, Molinari M (1981) Axonal 26. Tye KM, Deisseroth K (2012) Optogenetic
branches of the same cerebellar neurons termi- investigation of neural circuits underlying
nate bilaterally in the thalamus. Neurosci Lett brain disease in animal models. Nat Rev
23:291–296 Neurosci 13:251–266
14. Minciacchi D, Molinari M, Bentivoglio M et al 27. Rein ML, Deussing JM (2012) The optoge-
(1985) The organization of the ipsi- and con- netic (r)evolution. Mol Genet Genomics
tralateral claustrocortical system in rat with 287:95–109
notes on the bilateral claustrocortical projec- 28. Aston-Jones G, Deisseroth K (2013) Recent
tions in cat. Neuroscience 16:557–576 advances in optogenetics and pharmacogenet-
15. Granato A, Santarelli M, Minciacchi D (1991) ics. Brain Res 1511:1–5
Bihemispheric organization of amygdalo- 29. Cardin JA, Carlén M, Meletis K et al (2009)
cortical projections in the rat. Neurosci Lett Driving fast-spiking cells induces gamma
127:53–56 rhythm and controls sensory responses. Nature
16. Minciacchi D, Granato A, Barbaresi P (1991) 459:663–667
Organization of claustro-cortical projections 30. Rothermel M, Brunert D, Zabawa C et al
to the primary somatosensory area of primates. (2013) Transgene expression in target-defined
Brain Res 553:309–312 neuron populations mediated by retrograde
17. Minciacchi D, Granato A, Antonini A et al infection with adeno-associated viral vectors. J
(1995) Mapping subcortical extrarelay affer- Neurosci 33:15195–15206
Retrograde Labeling and Immunocytochemistry 327
31. Reiner A, Veenman CL, Medina L et al (2000) nal reconstructions. J Neurosci Methods
Pathway tracing using biotinylated dextran 186:209–214
amines. J Neurosci Methods 103:23–37 45. Verwer RWH, van Pelt J (1986) Descriptive
32. Schmued L, Kyriakidis K, Heimer L (1990) In and comparative analysis of geometrical prop-
vivo anterograde and retrograde axonal trans- erties of neuronal tree structures. J Neurosci
port of the fluorescent rhodamine-dextran- Methods 18:179–206
amine, Fluoro-Ruby, within the CNS. Brain 46. Mainen ZF, Sejnowski TJ (1996) Influence of
Res 526:127–134 dendritic structure on firing pattern in model
33. Giannetti S, Gaglini PD, Rocco F et al (2000) neocortical neurons. Nature 382:363–366
Organization of cortico-cortical associative 47. Schaefer AT, Larkum ME, Sakmann B et al
projections in a rat model of microgyria. (2003) Coincidence detection in pyramidal
Neuroreport 11:2185–2189 neurons is tuned by their dendritic branching
34. Granato A, Di Rocco F, Zumbo A et al (2003) pattern. J Neurophysiol 89:3143–3154
Organization of cortico-cortical associative pro- 48. Freedman LJ, Maddox MT (2001) A compari-
jections in rats exposed to ethanol during early son of anti-biotin and biotinylated anti-avidin
postnatal life. Brain Res Bull 60:339–344 double-bridge and biotinylated tyramide
35. Minciacchi D, Del Tongo C, Carretta D et al immunohistochemical amplification. J
(2010) Alterations of the cortico-cortical net- Neurosci Methods 112:43–49
work in sensori-motor areas of dystrophin defi- 49. Larkman A, Mason A (1990) Correlations
cient mice. Neuroscience 166:1129–1139 between morphology and electrophysiology of
36. Di Rocco F, Giannetti S, Gaglini P et al (2002) pyramidal neurons in slices of rat visual cortex.
Dendritic architecture of corticothalamic neu- I. Establishment of cell classes. J Neurosci
rons in a rat model of microgyria. Childs Nerv 10:1407–1414
Syst 18:690–693 50. Petersen CC, Grinvald A, Sakmann B (2003)
37. Jiang X, Johnson RR, Burkhalter A (1993) Spatiotemporal dynamics of sensory responses in
Visualization of dendritic morphology of cor- layer 2/3 of rat barrel cortex measured in vivo by
tical projection neurons by retrograde axonal voltage-sensitive dye imaging combined with
tracing. J Neurosci Methods 50:45–60 whole-cell voltage recordings and neuron recon-
38. Paxinos G, Watson C (1998) The rat brain structions. J Neurosci 23:1298–1309
in stereotaxic coordinates. Academic, San 51. Granato A, Palmer LM, De Giorgio A et al
Diego, CA (2012) Early exposure to alcohol leads to per-
39. DeFelipe J (1997) Types of neurons, synaptic manent impairment of dendritic excitability in
connections and chemical characteristics of neocortical pyramidal neurons. J Neurosci
cells immunoreactive for calbindin-D28K, par- 32:1377–1382
valbumin and calretinin in the neocortex. J 52. Morishima M, Kawaguchi Y (2006) Recurrent
Chem Neuroanat 14:1–19 connection patterns of corticostriatal pyrami-
40. Markram H, Toledo-Rodriguez M, Wang Y dal cells in frontal cortex. J Neurosci
et al (2004) Interneurons of the neocortical 26:4394–4405
inhibitory system. Nat Rev Neurosci 5: 53. Song S, Sjöström PJ, Reigl M et al (2005)
793–807 Highly nonrandom features of synaptic con-
41. Moore CI, Carlen M, Knoblich U et al (2010) nectivity in local cortical circuits. PLoS Biol
Neocortical interneurons: from diversity, 3:e68
strength. Cell 142:189–193 54. Sakmann B (2006) Patch pipettes are more
42. Elston GN, De Felipe J, Arellano JI et al useful than initially thought: simultaneous pre-
(1999) Variation in the spatial relationship and postsynaptic recording from mammalian
between parvalbumin immunoreactive inter- CNS synapses in vitro and in vivo. Pflugers
neurons and pyramidal neurones in rat somato- Arch 453:249–259
sensory cortex. Neuroreport 10:2975–2979 55. Frick A, Feldmeyer D, Helmstaedter M et al
43. Glaser JR, Glaser EM (1990) Neuron imaging (2008) Monosynaptic connections between
with Neurolucida: a PC-based system for pairs of L5A pyramidal neurons in columns of
image combining microscopy. Comput Med juvenile rat somatosensory cortex. Cereb
Imaging Graph 14:307–317 Cortex 18:397–406
44. Anderson K, Yamamoto E, Kaplan J et al 56. Schubert D, Kötter R, Luhmann HJ et al
(2010) Neurolucida Lucivid versus (2006) Morphology, electrophysiology and
Neurolucida camera: a quantitative and quali- functional input connectivity of pyramidal
tative comparison of three-dimensional neuro- neurons characterizes a genuine layer Va in the
328 Alberto Granato and Andrea De Giorgio
Abstract
Transfection techniques in vitro and ex vivo (organotypic cultures) offer an array of possibilities to investigate
the consequence(s) of the introduction of foreign nucleic acids (DNA but also RNA) and or other biologi-
cally active molecules into neurons, and to combine observations with immunocytochemistry. In particular,
a wide number of fluorescent reporter proteins (FRPs) can be employed for multicolor fluorescence imag-
ing. Here we present a series of protocols for in vitro and ex vivo transfection of DNA or RNA sequences
into cerebellar neuron cultures and organotypic slices based on the use of plasmid vectors and multicolor
laser scanning confocal microscopy. These protocols allow analysis of live transfected cells, and, after
fixation, correlative neurochemical studies.
Key words Granule cell cultures, Organotypic cultures, Biolistic transfection, Plasmid, Cerebellum
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_18, © Springer Science+Business Media New York 2015
329
330 Silvia Alasia et al.
1.1 Biological It is convenient for the sake of simplicity to classify biological vec-
Vectors tors in viral and nonviral.
1.1.1 Viral Vectors Viruses have been the first to be employed in cell transfection by
taking advantage of their natural capability to penetrate cells dur-
ing infections. Viral vectors are usually modified so that they can-
not replicate and destroy infected cells. Some of them are highly
specific for certain cell types, a concept that is currently referred to
as cytotropism. The main disadvantage of viral vectors is that, in
most cases, they can carry a limited amount of genetic material
and, therefore, some genes may be too big for being transfected by
this type of carriers. In addition, some viruses require specific han-
dling and safety procedures and, in general, virus-based transfec-
tion methods are technically more challenging and time-consuming
than those based onto nonviral carriers.
Examples of the use of viral vectors in CNS slice transfections
can be found in refs. [8–10].
Table 1
Simplified classification of the most commonly employed nucleic acid carriers for animal cell transfection with indication of relevant advantages/
disadvantages related to neuronal transfection and to the possibility of in vivo or ex vivo application
Viral Vectors for Stable The viruses used for stable transfection and gene transfer are retro-
Transfection viruses, adeno-associated viruses (AAVs), and lentiviruses.
Retroviruses carry the genetic material in the form of RNA
rather than DNA. They infect only dividing cells and, therefore,
cannot be used for transfecting post-mitotic neurons. However,
the foamy viruses (FVs), a subfamily of retroviruses, appear to be
suitable for transfection of neurons and other non-dividing cells
[5]. The maximum length of the RNA fragment that can be
inserted in a retrovirus is 8,000 base pairs (bp).
AAVs carry their genetic material as a single-stranded DNA
(ssDNA). They infect a wide range of dividing and non-dividing
cells and thus can be used in neuronal transfection. The maximum
length of the RNA fragment that can be inserted in an AAV is
5,000 bp.
Lentiviruses can infect non-dividing cells, thereby allowing sta-
ble gene transfer in post-mitotic mature neurons. Lentiviral vector-
mediated delivery of short hairpin RNAs (shRNAs) results in
persistent knockdown of gene expression. In addition, inducible len-
tiviral vectors offer a powerful tool for better assessing the function
of a gene candidate in targeted neurons by an on–off system [1].
The herpes simplex viruses (HSVs) are a group of DNA viruses
that target and infect cells of the nervous system. Although the
DNA of the HSV does not integrate into the host cell genome, it
can stay in the nucleus for very long time as a separate piece of
circular DNA that replicates when the cell divides. The maximum
length of the DNA fragment that can be inserted into a HSV is
20,000 bp.
Viral Vectors for Transient For transient transfection it is possible to use adenoviruses. These
Transfection viruses carry their genetic material as a double-stranded DNA
(dsDNA), effectively infect both dividing and non-dividing cells
and thus are useful in neuronal transfection. The maximum length
of the DNA fragment that can be inserted in an adenovirus is
7,500 bp.
1.1.2 Plasmids Besides to viral vectors, the most popular vectors for DNA trans-
fection of isolated neurons or brain organotypic cultures are
plasmids. Plasmids are circular, dsDNA molecules separated from
the cell’s chromosomal DNA (extrachromosomal DNAs), and
ranging in size from a few thousand bp to more than 100 kbp.
They occur naturally in a parasitic or symbiotic relationship in bac-
teria, yeast, and some higher eukaryotic cells. Like the host-cell
chromosomal DNA, plasmid DNA is duplicated before every cell
division. During the latter, at least one copy of the plasmid DNA is
segregated to each daughter cell, assuring continued propagation
through successive generations of the host cell [8]. Virtually any
type of DNA construct with a length comprised between a few
base pairs up to ≈20 kbp can be inserted into a plasmid vector.
However, plasmids, differently form viruses, cannot actively penetrate
Immunocytochemistry and Gene Transfer 333
cells and must be delivered to the host cells by means of any of the
transfection procedures that will be described in the following
sections. An exception to this may be represented by the so-called
naked DNAs, a particular subtype of plasmids that can directly
penetrate the cell membrane of certain nerve cells with a low trans-
fection efficiency that can, however, be significantly increased by
ultrasounds and microbubbles [9].
1.2 Nonviral For DNA and RNA delivery to the central nervous system (CNS),
Synthetic Vectors numerous nonviral nanosystems can be employed [10]. These
include cationic and stealth liposomes , cationic polymers ,
dendrimers, cyclodextrin, and cell-penetrating peptides (CPPs). In
general terms, all these synthetic vectors lack of a cytotropism, i.e.,
they do not specifically target a single type/subtype of cell, and
display different degrees of cytotoxicity.
Liposomes are vesicles with a bilayer lipid sheet formed by cat-
ionic lipids in aqueous solutions. When liposomes get in contact
with nucleic acids they undergo a rearrangement into nucleic acid
lipid complexes called lipoplexes. Lipoplexes can be actively taken
up by eukaryotic cells by endocytosis, and the lipoplex is then
internalized into the cell cytosol within endosomes. The endo-
somal complex is finally destroyed by increasing the osmotic pres-
sure created by the lipids' buffering action and by the fusion of the
lipid with the endosomal membrane. The ability of a lipid to
destroy endosomes, also referred to as endosomal escape, is one of
the main characteristics of a good synthetic transfection reagent, as
it indicates the capability of the vector to release its nucleic acid
load into cells once having crossed the cell membrane.
Cationic liposomes typically consist of a mixture of cationic
and/or neutral lipids. They are highly efficient, of low cost, and
widely available commercially. Stealth liposomes are cationic lipo-
somes which have been PEGylated at the surface. Unless further
modified with a targeting ligand they display poor transfection
abilities. There is no maximum length of DNA/RNA that can be
load into liposomes for transfection.
Cationic polymers [11–13], such as polyethylenimine (PEI)
and poly-lysine are linear or branched polymers with a good endo-
somal escape. Their transfection efficiency mainly depends on
molecular weight [14–16].
Dendrimers are repetitively branched nanometric structures,
usually poly(amidoamine) or carbosilane with an effective endo-
somal escape. The so called high-generation dendrimers are highly
efficient but toxic, whereas the low-generation dendrimers, display
minimal toxicity. Cyclodextrin is a sugar molecule backbone modi-
fied with various functional groups. It has high transfection effi-
ciency and biocompatibility, minimal cytotoxicity, potential for
attachment of targeting ligands, and low cost.
CPPs are protein transduction domains undergoing cellular
internalization, independently from endosome formation. CPPs are
334 Silvia Alasia et al.
Fig. 1 Principle of biolistic transfection. (a) The DNA–gold complex consists of a core formed by a particle of
colloidal gold and the DNA adsorbed onto its surface. (b) After being accelerated by helium blast the complex
crosses the cell membrane. (c) The transfected cell contains the DNA–gold complex into its cytoplasm. DNA is
then processed by the cell to produce coded moiety(ies). The red dotted line indicates the trajectory of the
DNA–gold complex in the course of its acceleration (color figure online)
Fig. 2 Principle of bullet preparation in biolistic transfection. (a) The empty bullets are made by a piece of
Tefzel® tube. (b) The DNA–gold suspension is stratified inside the tube and allowed to adsorb onto its surface.
(c) At shooting a high pressure gas (helium) blast mobilizes the DNA–gold particles and accelerates them
inside the target cells. (d) Photograph of bullets and the gun barrel (arrow) where bullets are loaded. The two bullets
at low right display a shiny reflecting line where the DNA–gold particles are stratified (color figure online)
Immunocytochemistry and Gene Transfer 337
1.4 Constructs It is literally impossible to mention here the array of options that
and Reporter are available today in the choice of constructs and reporter mole-
Molecules cules for neuronal transfection. Broadly speaking, transfection meth-
ods enable two main lines of experiments into living neurons.
The first is historically older and is based on the classical princi-
ples of genetic protein engineering. Thus, one of the major advan-
tages in using cell transfection technologies to the study of nerve
cells and neuronal circuitry lies in the possibility to modify the
pattern of expression of a given endogenous protein (or group of
proteins in the case of multiple transfection) by for example
overexpressing it or by reducing/abolishing its translation inside
the cell (by RNA interference), or to make neurons producing a
foreign protein, e.g., a novel receptor type or subunit, to assess the
effects on cell function/viability.
The second main stream of transfection experiments for the
study of CNS neurons is instead based on exploiting the properties
of the introduced foreign molecule not for studying its biological
effects per se, but to take profit of some peculiarities of the newly
synthesized protein. In its simpler application, this offers the pos-
sibility to visualize a specific type of neuron by using a DNA
construct encoding a molecule that can be easily detected in situ,
called the reporter molecule, under the control of a cell-specific pro-
moter. Several types of reporter molecules are available, among
which a wide number of FRPs, β-galactosidase (β-GAL), luciferase,
etc. (Table 2).
FRPs such as the widely known green fluorescent protein (GFP)
and its genetic mutants yellow fluorescent protein (YFP) and
enhanced YFP (EYFP), red fluorescent proteins (RFPs), e.g., DsRed,
cyan fluorescent protein (CFP) and their variants, are nowadays of
particular importance for the possibility to imagine them by fluores-
cence microscopy, single/dual photon confocal microscopy or cer-
tain types of super-resolution microscopies. They belong to the
so-called genetically encoded fluorescent dyes (GEFDs) that not
only offer multicolor tags for fluorescence imaging of specific cellu-
lar targets, but can be used for functional imaging [26].
GEFDs for functional imaging are of several types including:
● Fluorescence resonance energy transfer (FRET) pairs (e.g., the
Venus variant of YFP/CFP) that can be transfected to be
assembled (FRET signal) or disassembled (no FRET signal) in
consequence of specific cell processes (protein cleavage, ligand–
receptor or intramolecular interactions, protein conformational
changes, etc.) enabling the investigator to follow specific cellu-
lar events in transfected cells also quantitatively [27–29].
● Genetically encoded calcium indicators (GECIs) include a series
of new ultrasensitive protein calcium sensors (GCaMP6) that
outperformed other sensors in cultured neurons and in zebra-
fish, flies, and mice in vivo with improved signal-to-noise ratio
and different kinetics [30].
338
Table 2
Most commonly used reporter molecules for neuron transfection and combined immunocytochemistry
Reporter
molecules Preferential visualization Sensitivity Amplification procedures ICC
Silvia Alasia et al.
FRPs, e.g., Direct observation with FM or CLSM 105 to 106 molecules/cell to Yes Yes
GFP, EYFP, achieve a good signal-to-noise ICC with specific anti-FRPs Double or multiple IMF
Venus, RFP, ratio Abs (IMF or enzymatic)
CFP
β-GAL Direct observation with LM (X-gal 105 to 106 molecules/cell to Yes Yes
yields a dark-blue precipitate) achieve a good signal-to-noise ICC with anti-X-gal Abs (IMF Double enzyme ICC, e.g.,
ratio or enzymatic) X-gal blue + HRP brown
Double or multiple IMF
with anti-X-gal Abs
Luciferase Luciferin oxidation by luciferase in the Very high Yes Yes
presence of ATP leads to photon ICC with anti-luciferase Abs Double or multiple IMF
emission. Emitted photons can be (IMF or enzymatic) with anti-luciferase ABs
measured with a luminometer But quality of commercial
product is often not very
good
CAT ELISA High No No (not very good for
histological studies)
Abbreviations: abs Antibodies, β-GAL β-galactosidase, CAT chloramphenicol acetyltransferase, CFP Cyan fluorescent protein, CLSM confocal laser scanning microscope, ELISA
enzyme-linked immunosorbent assay, EYFP enhanced yellow fluorescent protein, FM fluorescence microscope, FRPs fluorescent reporter proteins, GFP green fluorescent pro-
tein, HRP horseradish peroxidase, ICC immunocytochemistry, IMF immunofluorescence, LM light microscope, RFP red fluorescent protein, Venus variant of the yellow fluo-
rescent protein, X-gal 5-bromo-4-chloro-3-indolyl-β-D-galactosidase
Immunocytochemistry and Gene Transfer 339
2.4.2 Transfection ● K2® Transfection System: K2® Multiplier and K2® Transfection
with Cationic Liposomes Reagent (Biontex Laboratories GmbH, Martinsried/Planegg,
(K2® Transfection System) Germany).
● Plasmid DNA (1 μg/μL).
● Serum-free medium (medium 2).
2.4.3 Biolistic ● Seashell gold carrier particles: particles can be purchased in the
Transfection S1000d kit that also contains the Binding and Precipitation
Buffer (Seashell Technology, LLC, La Jolla, CA).
● Pure ethanol.
● Ultrasonic homogenizer.
● Vortex mixer.
● Eppendorf microfuge.
● Tubing Prep Station® (Bio-Rad, Hercules, CA).
● Tefzel® tube (Bio-Rad).
● Helios Gene Gun® (Bio-Rad).
● Helium and nitrogen cylinders with pressure controllers.
● Laminar flow hood.
3 Procedures
3.1 Preparation Euthanize CD1 mice at postnatal day 6–7 (P6–P7, see Note 1)
of NGCCs with an intraperitoneal overdose of sodium pentobarbital
(60 mg⁄100 g body weight). Quickly remove the brain from the
skull while the head is kept submerged in ice-cooled Gey’s solution
and isolate the cerebellum (see Note 9). Transfer the cerebellum in
ice-cooled CMF-PBS solution and mince it into small pieces (cut
350 μm-thick parasagittal slices with a tissue chopper or mince
with a scalpel), digest in a solution containing trypsin-EDTA and
DNAse I (0.5 mg/mL) 1:1 for 14 min at room temperature.
Remove trypsin (wash cerebellum slices/pieces three times in
CMF-PBS), resuspend in DNAse I solution (0.5 mg/mL) and
mechanically dissociate cells (see Note 10). Resuspend isolated
cells in medium 1 and plate at a density of 2 × 105 per cm2 onto
poly-lysine-coated coverslips (see Note 11). Put each coverslip at
the bottom of a 35-mm petri dish. Place a drop (300 μL) of
medium containing cells on the coverslip and let cells attach 1 h at
34 °C in 5 % CO2. Then add 700 μL of medium 1 in each petri
dish and allow cells to equilibrate to the in vitro conditions for at
least 4 DIV before treatments. Change medium twice a week.
Plasmid DNA Extraction Isolate plasmid DNA from recombinant E. coli cultures following
and Concentration the procedure recommended by the manufacturer of the maxi prep
kit. Concentrate the extracted DNA by alcohol precipitation.
Alternatively use Nucleobond Finalizers (contained in the
NucleoBond Xtra Maxi PLUS—follow the manufacturer’s proto-
col). DNA should be concentrated at 1 μg/μL, ready for down-
stream applications. Prior to use, verify size and quality of plasmid
DNA by agarose gel electrophoresis.
3.3.2 Transfection At 3–4 DIV change the medium in which cells on poly-lysine-
with Cationic Lyposomes coated coverslips were grown with the serum-free medium 2.
Transfect cells following K2® Transfection System working instruc-
tions. See Note 13.
3.3.3 Biolistic Connect the Tubing Prep Station® to the nitrogen cylinder. Cut a
Transfection piece of the Tefzel® tube at the right length to be inserted in the
Tubing Prep Station® and wash it three times with ethanol. Insert
Helios Gene Gun®
the tube in the Tubing Prep Station® and dry it with a flow of
Cartridges’ Preparation
nitrogen for about 15 min. Add 330 μL binding buffer to 25 mg
of gold particles, to a final concentration of 30 mg/mL (see Note 14).
Add 50 μg of plasmid DNA (see Note 15), vortex briefly and add
an equal volume of precipitation buffer.
Vortex briefly and let stand for 3 min. Spin at 10,000 × g in an
Eppendorf microfuge for 10 s to pellet the DNA-coated gold par-
ticles. Remove the supernatant and add 500 μL of cold ethanol.
Vortex briefly and repeat spinning and ethanol wash as above.
Remove the supernatant, add 3.5 mL cold ethanol and briefly
sonicate to resuspend the gold particles (sonication minimizes the
aggregation of gold particles).
Close the nitrogen cylinder and fill the Tefzel® tube with the
gold suspension. See Note 16.
344 Silvia Alasia et al.
Let the Tefzel® tube standing for 3 min to allow settling of the
DNA/gold complex at its bottom. Then draw the ethanol out of
the tube using a 5 mL syringe connected to the tube.
Dry the tube in the Tubing Prep Station® by flushing it with
nitrogen for about 5 min.
Finally close the nitrogen cylinder and cut the Tefzel® tube at
the right length to enter in the barrel of the Helios Gene Gun®.
3.4 Fixation and IMF All passages are carried out at room temperature unless otherwise
stated.
Remove the culture medium from a petri dish containing the
coverslip with attached cells or the slices on the Millicell-CM®
insert and add 1 mL of 4 % PFA in PB. Fix for 1 h and wash
3 × 5 min in PBS. From this stage on cultures can be processed in
multi-well plates by transferring them from a well to another with
forceps. Isolated cells attached to coverslips can be directly han-
dled as indicated, whereas organotypic cultures need to be sepa-
rated from the Millicell-CM® insert by carefully cutting the
membrane around tissue slices and leaving enough membrane to
allow manipulation.
If IMF is not necessary, cultures can be directly mounted as
described below at the end of protocol.
Immunocytochemistry and Gene Transfer 345
3.5 Imaging For short term imaging experiments (20–30 min or less) the cov-
erslip containing adherent cells in NGCCs can be simply attached
3.5.1 FM or Laser
onto a microscope slide using spacers to avoid cells damage. The
Scanning Confocal
coverslip can be secured with any type of sealants, including mol-
Microscopy (LSCM)
ten agarose, rubber cement, vacuum grease, or a useful preparation
on Live NGCCs
known as VALAP (a 1:1:1 mixture of vaseline, lanolin, and paraf-
fin), to provide a watertight seal and eliminate evaporation of the
culture medium. Longer imaging experiments can be performed
through a single cavity microscope slide.
3.5.3 FM or LSCM Imaging of fixed cultures does not require particular procedures.
on Fixed Cultures In general, preparations are labeled with a multicolor combination
of FRPs from the GEFD(s), the fluorescent secondary antibodies
and other fluorescent counterstains (if applicable). Of course it will
be necessary to choose the right fluorescent filters or laser excita-
tion wavelengths according to the characteristics of the different
fluorochromes employed. It is obviously possible to use pseudo-
colors in post-imaging processing (see Sect. 4).
It is worth recalling here that measurements of transfected
FRET pairs can also be performed in fixed samples [28].
4 Typical/Anticipated Results
Figures 3 and 4 show some of the results that can be obtained after
implementation of the procedures described in Sect. 3.
One of the main advantages from the use of organotypic cul-
tures (Fig. 3a) is that this type of preparation allows maintaining an
intact or semi-intact architecture of the tissue, so that, for example,
transfected cells are immediately spotted at low magnification and
their locations can be easily tracked (Fig. 3b). If a fluorescent
nuclear stain (DAPI) is applied, it is also possible—in our example—
to map with good precision the individual layers of the cerebellar
cortex (Fig. 3c), and/or to label live/dead cells with two color
fluorescence (Fig. 3d).
A combination of biolistic transfection with a cDNA encoding
for survivin, an anti-apoptotic protein, fused to DsRed and IMF
for the neuron-specific protein NeuN is shown in Fig. 3d.
Another combination of biolistic transfection and ICC is
shown in Fig. 4a, whereas Fig. 4b–d displays the results of a dual
transfection with red and green RFPs, and Fig. 4e–g the combina-
tion of transfection and fluorescent labeling of the ER. In the
example, the cytosolic localization of DsRed (Fig. 4b–d) permits
the recognition of the morphology of the transfected neuron.
These examples are simply meant to give readers a general indica-
tion of the potential of the techniques described in this chapter.
Some additional hints for work planning can be found in Note 22.
Fig. 3 (continued) fluorescence are encircled in red. Slices were maintained 4 DIV before shooting and
photographed at 6 DIV. (c) Particular of the developing cerebellar cortex ex vivo after nuclear counterstaining with
DAPI. The different cortical layers are easily recognized on the basis of their position and cell density. (d) Particular of
the IGL after staining with one of the Molecular Probes® LIVE/DEAD® Fixable Dead Cell Stain Kits. Further details can
be found in ref. [39]. (e) Combined biolistic transfection and ICC. Transfection was carried out with a vector encoding
a fusion protein consisting of the reporter tag DSRed and the cDNA for survivin, an apoptotic inhibitor. Two post-mitotic/
post-migratory transfected cerebellar granule cells in the IGL are tagged in red. Their nuclei are immunocytochemically
labeled by the neuronal marker NeuN (green ICC) and thus appear yellow in the merged image. The arrows and the
arrowheads indicate the axon (parallel fiber) of each of the two neurons. Cultures are kept 4 DIV before transfection
and fixed after two additional DIV. Abbreviations: EGL external granular layer, EYFP enhanced yellow fluorescent pro-
tein, IGL internal granular layer, ML molecular layer. Bars: b = 2 mm; c = 500 μm; d = 10 μm; e = 45 μm
Immunocytochemistry and Gene Transfer 347
Fig. 3 Principle of OCCs preparation and exemplificative images of multicolor fluorescence imaging of transfected
OCCs subjected to post-transfection labeling with fluorescent dyes or ICC. (a) Left: diagram showing the principle of
the membrane interface method for static organotypic cultures. The tissue slice (red) is supported by a permeable
membrane and receives nutrients from the culture medium (bottom) and oxygen from the top. Right: a petri dish
containing a MilliCell-CM® insert with three cerebellar slices after transfection. Note the gilded appearance of the
shot area of support membrane. (b) Low power view of two cerebellar slices transfected with a plasmid encoding for
the human BCL-2 protein (hBCL-2) and EYFP as a RFP. Some individual transfected neurons displaying yellow
348 Silvia Alasia et al.
Fig. 4 Examples of multicolor imaging of transfected OCCs. (a) Combined biolistic transfection and
ICC. Transfection was carried out with a vector encoding a fusion protein consisting of the reporter EYFP and
the cDNA for hBCL-2, an apoptotic inhibitor. A mitotic/post-migratory transfected cerebellar granule cells in the
IGL is tagged in green. Astrocytes are immunocytochemically labeled by the glial marker GFAP (red). (b–d) Dual
transfection with the EYFP/hBCL-2 vector and a vector encoding for the RFP DsRed. BCL-2 displays a subcel-
lular localization restricted to the mitochondria and ER (e–g) and thus the EYFP fluorescence localization does
not allow to recognize the overall morphology of the transfected cells. This is made possible by the co-
transfected DrRed protein that depicts the shape of the transfected neuron (in this case a migrating granule
cell) as it is localized in the general cytosol. The preparation has also been counterstained with the fluorescent
nuclear stain DAPI as shown in the merge image in d. The arrow heads indicate the leading process of the
granule cell that drives its migration across the EGL. (e–g) colocalization of EYFP and ER-Tracker™ Red
(Invitrogen™) demonstrates the subcellular localization of EYFP-hBCL-2. The arrowheads indicate a process
of a transfected cell. Abbreviations: EGL external granular layer, EYFP enhanced yellow fluorescent protein,
GFAP glial fibrillary acidic protein. Bars: a = 15 μm; b–g = 10 μm (color figure online)
apoptosis occurs during the first postnatal week in mouse and rat,
whereas in other animals (e.g., Guinea pigs) apoptosis is maximal
during the last phase of embryonic development.
Neuronal cultures prepared from embryonic or early post-
natal animals, if compared with cultures obtained from older
animals, offer different advantages: (1) they are less susceptible
to damage, (2) they are less dependent on their target cells for
trophic support, (3) meninges are easier to remove cleanly.
2. The temperature settings of the incubator is somehow critical
to the survival of cultures, as OCCs (and organotypic slices
obtained from other CNS areas) survive better at tempera-
tures below 37 °C. We usually maintain OCCs at 34 °C in a
5 % CO2 atmosphere.
3. We describe here exemplificative transfection protocols using the
EYFP-hBCL2 plasmid that consists of the pEYFP-N1 vector
(Clontech, Mountain View, CA) in which the cDNA encoding
for hBCL2 has been inserted at the N terminus of EYFP, the
pEYFP-N1 vector (Clontech) and the pDsRed-Express Vector
(Clontech). Plasmids are amplified in frozen E. coli competent
cells (Promega, Madison, WI), by the use of LB-agar plates con-
taining 100 μg/mL ampicillin or 50 μg/mL kanamycin accord-
ing to the antibiotic resistance cassette of the plasmid, and LB
broth liquid cultures. After agar plating, selected colonies were
grown overnight in LB broth under continuous shaking at 37 °C.
4. Primary antibodies can be chosen according to experimental
needs. It is advisable to test primary antibodies on untrans-
fected material before performing IMF of transfected prepara-
tions to determine the best immunolabeling conditions for
isolated cells and organotypic cultures.
5. Fluorochrome-labeled secondary antibodies can be obtained
from different suppliers, e.g., Alexa® Fluor, Invitrogen™ or
DyLight Fluor, Thermo Fisher Scientific, Waltham, MA.
Caution: light sensitive, store at 4 °C.
6. It is possible to associate transfection with a cDNA encoding for
a RFP to post-transfection labeling of cell specific organelles to
ascertain the subcellular localization of the GEFD. We have
used this protocol to detect the cellular localization of the
EYFP-hBCL2 fusion protein in OCCs [39]: transfected OCCs
were incubated in pre-warmed (37 °C) medium containing 200
nM MitoTracker® Red CMXRos (Invitrogen™, Carlsbad, CA)
or pre-warmed HBSS containing 1 μM ER-Tracker™ Red
(Invitrogen™) or 40 nM DAPI (Sigma Chemicals, St. Louis,
MO) for 30 min in 5 % CO2. The staining solution was removed
and cultures were washed in pre-warmed media and then fixed
in media containing 4 % PFA for 15 min at 37 °C. After three
washes in PBS, cultures were mounted with ProLong®.
350 Silvia Alasia et al.
11. For coating, cover each coverslip with 300 μL of a 0.05 mg/
ml poly-lysine solution in sterile distilled water and incubate
overnight. Before use, wash three times in distilled water and
let coverslips dry in a fume hood.
To determine cell density use a hemocytometer. Mix a
drop of cell suspension (10 μL) with an equal volume of 0.08 %
Trypan blue (dissolved in CMF-PBS) and incubate 4 min at
room temperature. Then count living cells and dilute at the
required concentration. This can be done also by using several
other dyes, such as erythrosine or nigrosin that are excluded
from viable cells but taken up by the damaged ones.
12. Cutting with chopper is made easier if the cerebellum is not
submerged by an excess of Gey’s /CMF-PBS solution. Wipe
off solution with a piece of filter paper and set section thick-
ness to any value between 200 and 400 μm. Other cutting
parameters (e.g., blade force) have to be set according to the
type of chopper in use. To collect slices use a spatula with
curved edges.
13. The K2® Transfection System is optimized for cell lines and
promises best results during the exponential growth phase of
the cells. Isolated neurons from P6–P7 mice are post-mitotic
and this minimizes the uptake of DNA into the nucleus.
However, with the following modifications to the manufac-
turer’s protocol, it is possible to obtain a good expression of
plasmid DNAs:
Incubate cultured cells with K2® Multiplier for 2 h: add
20 μL to each petri dish containing 1 mL of medium 2. Dilute
1 μg of plasmid DNA (i.e., 1 μL of 1 μg/μL solution) in 15 μL
of medium 1 for each petri dish (to obtain solution A) and
2 μL of K2® Transfection Reagent in 15 μL of medium 1 (to
obtain solution B). Twenty minutes before the end of incuba-
tion with K2® Multiplier mix solutions A and B to obtain the
lipoplex. Allow the mixture standing at room temperature for
15–20 min before applying it to cultures.
Important: add the DNA solution (A) to the K2® Transfection
Reagent (B) solution and not vice versa! At the end of incuba-
tion with K2® Multiplier add the lipoplex to the cells and incu-
bate overnight. Replace the transfection medium with fresh
medium 2 and analyze results 12–72 h after. You may see an
increment in the number/intensity of fluorescent cell during
this period.
14. If using Seashell gold carrier particles a volume of 500 μL is
added. Briefly sonicate the tube containing the gold suspen-
sion before drawing out the desired amount of gold. The
original protocol from Bio-Rad uses dry gold particles that
must be directly weighted from a 2 mL plastic tube. During
this procedure there is the risk of a substantial loss of gold.
352 Silvia Alasia et al.
References
27. Arai Y, Nagai T (2013) Extensive use of FRET 36. Williams SC, Deisseroth K (2013)
in biological imaging. Microscopy (Oxf) Optogenetics. Proc Natl Acad Sci U S A
62:419–428 110:16287
28. Merighi A, Alasia S, Gambino G, Lossi L (2012) 37. Nicholls SB, Chu J, Abbruzzese G et al (2011)
Confocal imaging of organotypic brain slices for Mechanism of a genetically encoded dark-to-
real time analysis of cell death. In: Méndez-Vilas bright reporter for caspase activity. J Biol
A (ed) Current microscopy contributions to Chem 286:24977–24986
advances in science and technology. Formatex 38. Zhang J, Wang X, Cui W et al (2013)
Research Center, Badajoz, Spain Visualization of caspase-3-like activity in cells
29. Hsu YY, Liu YN, Lu WW et al (2009) using a genetically encoded fluorescent biosen-
Visualizing and quantifying the differential sor activated by protein cleavage. Nat Commun
cleavages of the eukaryotic translation initia- 4:2157
tion factors eIF4GI and eIF4GII in the 39. Lossi L, Gambino G, Ferrini F et al (2009)
enterovirus-infected cell. Biotechnol Bioeng Posttranslational regulation of BCL2 levels in
104:1142–1152 cerebellar granule cells: a mechanism of neuro-
30. Chen TW, Wardill TJ, Sun Y et al (2013) nal survival. Dev Neurobiol 69:855–870
Ultrasensitive fluorescent proteins for imaging 40. Alasia S, Cocito C, Merighi A, Lossi L (2014)
neuronal activity. Nature 499:295–300 Real time visualization of caspase-3 activation
31. Akemann W, Mutoh H, Perron A et al (2010) by fluorescence resonance energy transfer
Imaging brain electric signals with genetically (FRET). In: Lossi L, Merighi A (eds) Neuronal
targeted voltage-sensitive fluorescent proteins. cell death. Humana, New York
Nat Methods 7:643–649 41. Arsenault J, O’Brien JA (2013) Optimized
32. Lundby A, Mutoh H, Dimitrov D et al (2008) heterologous transfection of viable adult
Engineering of a genetically encodable fluores- organotypic brain slices using an enhanced
cent voltage sensor exploiting fast Ci-VSP gene gun. BMC Res Notes 6:544
voltage-sensing movements. PLoS One 3:e2514 42. Rodighiero S, Bazzini C, Ritter M et al (2008)
33. Perron A, Mutoh H, Launey T et al (2009) Fixation, mounting and sealing with nail pol-
Red-shifted voltage-sensitive fluorescent pro- ish of cell specimens lead to incorrect FRET
teins. Chem Biol 16:1268–1277 measurements using acceptor photobleaching.
34. Mancuso JJ, Kim J, Lee S et al (2011) Cell Physiol Biochem 21:489–498
Optogenetic probing of functional brain cir- 43. Lossi L, Tamagno I, Merighi A (2004)
cuitry. Exp Physiol 96:26–33 Molecular morphology of neuronal apoptosis:
35. Packer AM, Roska B, Hausser M (2013) activation of caspase 3 during postnatal devel-
Targeting neurons and photons for optogenet- opment of mouse cerebellar cortex. J Mol
ics. Nat Neurosci 16:805–815 Histol 35:621–629
Chapter 19
Abstract
The use of transgenic mice expressing fluorescent proteins to report a specific protein or to identify specific
groups of neurons in the brain is revolutionizing many different aspects of neuroscience. Here we use an
example of a GFP-expressing reporter mouse from the GENSAT project that allows identification of a
specific group of neurons in the mouse cortex. Live GFP detection facilitates identification of the neurons
for whole-cell patch clamp electrophysiological recording to probe their functional properties. Post hoc
immunohistochemistry allows specific reconstruction of the shape of the recorded neuron; this together
with the detection of other co-expressed proteins helps confirm the functional identity of specific neuron
types. Approaches such as these are beginning to progress the major task of untangling the complexity of
a variety of brain circuits.
Key words GENSAT, Motor cortex, Whole-cell electrophysiology, E-GFP reporter, Layer 5
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_19, © Springer Science+Business Media New York 2015
357
358 Ruth M. Empson et al.
1.1 Transgenic Mice A large number of transgenic mouse lines that express a FP in spe-
Expressing cific classes of neurons have been generated during recent years. In
Fluorescent Proteins these mice, the cell class specificity of FP tagging is determined by
in Specific Cell the particular promoter used to drive gene transcription and,
Classes hence, protein expression. In its simplest implementation of this
principle, the cell class specific promoter directly drives the expres-
sion of the FP. Conditional and intersectional strategies (e.g., those
that take advantage of the Cre-lox system or multiple regulatory
sequences) are reviewed elsewhere, so here we focus on the former
simple transgenic approaches. Examples of promoters used are
those of the neuron-specific Thy1 gene [1–3], the potassium chan-
nel Kv3.1 gene [4], the glutamate decarboxylase (GAD) 67 gene,
or the glycine transporter GlyT2 [5], the gene for transcription
factor Etv1, or the gene for glycosyltransferase protein Glt25d2
[6]. The advantage of using these transgenic mouse lines com-
pared with in utero electroporated or virus-injected mice is the
high consistency of the expressing cell population across animals in
a given transgenic line [3]. This translates into robust electrophysi-
ological, morphological and molecular characteristics. In this chap-
ter we use an EGFP reporter mouse line derived from the GENSAT
project as an example to describe the various experimental proto-
cols (see Fig. 1) involved in these types of studies.
1.2 The GENSAT “Our understanding of the molecular mechanisms that contribute
Project to the formation and function of the brain must include informa-
tion about the precise distributions of specific genes and proteins
throughout development, and the ability to identify, visualize and
genetically manipulate each of the major central nervous system
(CNS) cell types.” [7]. The GENSAT project therefore set about
Immunocytochemistry and Live Imaging 359
c b
Excitation
+ Emission
Flourescent Reporter
Immunohistochemistry
Readout = Identity - Fezf2
Reporter Verification
e d
Complex
Cortex
Action Potentials
Fig. 1 Using fluorescence reporters and post hoc immunohistochemistry to help untangle the complexity of the
cortex (a). Schematics of how the complex cerebral cortex can be simplified through the combination of
genetically encoded fluorescent reporters/protein signal readouts (b), reporter verification using post hoc
immuno-histochemistry (c), coupled with targeted electrophysiological readouts that identify and control neu-
ron activity (d) together with post hoc detailed analysis of the neuron identity using post hoc histochemistry
and reconstruction methods (e). Complex cortex schematic modified from Fig. 28 after Cajal: Section of the
motor gyrus of an adult man, p. 234. In: DeFelipe and Jones (Eds) Cajal on the cerebral cortex: an annotated
translation of the complete writings. 1988. OUP
1.2.1 Fezf2, a Master We are interested to identify and understand the role of “master
Control Gene in the Cortex, genes” that drive the specification and maintenance of cortical net-
and the Fezf2-GFP Mouse works. One of these is Zfp312, also called Fezf2 that encodes pro-
duction of a zinc finger transcription factor protein, FEZF2. This
protein is considered to control the expression of genes necessary
for the acquisition of neuron-type specific properties during devel-
opment (see also Fig. 3). Transcription factors of this type activate
or repress an array of downstream genes that specify a neuron’s
timing of birth, morphology, molecule expression, and axonal con-
nectivity, and are well suited to control broad aspects of neuronal
phenotype. In this view, master control genes, like Fezf2 are
thought to be expressed by a specific neuron-type and therefore to
specify its unique identity, often in combination with other key
transcription factors. Differential expression of a variety of these
master control genes is thought to establish a molecular code that
underpins the enormous diversity of cortical projection neurons
[8–13]. Understanding their control and downstream effectors is a
major question in neuroscience [14, 15].
Fezf2 is expressed in all subcortical projection neurons from
early stages of development [embryonic day (E) 10.5] through to
adulthood [detected up to postnatal day (P)120] and is necessary
for the formation of corticospinal projection neurons during devel-
opment [10, 11, 16]. Deletion of Fezf2 in a knockout mouse
(Fezf2-KO) results in abnormal morphology and loss of other key
specification genes (i.e., Ctip2, ER81, Crim1, Cdh13, S100a10,
and Netrin-G1) in layer 5 cortical projection neurons. The
Fezf2-KO mice lack axon pathways from cortex to the spinal cord,
brainstem, thalamus, and contralateral cortex via the corpus callo-
sum, and the mice are hyperactive [9, 11]. This evidence suggests
that Fezf2 drives the specification of projection neurons in the cor-
tex. Despite this, very little is known about the morphology and
electrophysiological properties of Fezf2-expressing neurons, and
whether the expression of Fezf2 continues to be important for
maintenance of neuronal phenotype into adulthood.
GENSAT developed a Fezf2 reporter mouse called the
(Zfp312-EGFP)CO61Gsat/Mmnc mouse line that we hereaf-
ter refer to as the Fezf2-GFP mouse. This reporter mouse offered
an ideal opportunity to identify those projection neurons within
the mature mouse cortex that expressed this master control
gene and also allowed us to target them with electrophysiology.
Immunocytochemistry and Live Imaging 361
1.3 Combination of While cell class specific expression of FPs allows targeting specific
FP-Based Methods with cell types for patch clamp electrophysiological examination, auto-
Electrophysiology and fluorescence and light scattering of uncleared brain tissue usually
Immunohisto- prohibits high-resolution structural analysis of the patch clamped
chemistry cell. It is therefore good practice to fill the neurons via the patch
pipette with a marker chemical, such as biocytin. Detection of this
marker post hoc using histochemical methods can then reveal
important additional information about the shape of the neuron,
its spatial position within the network and its proximity to neigh-
boring neurons or other structures (Fig. 1d, e). Immunohistochemical
detection of endogenous marker proteins that characterize the
recorded neuron beyond the specificity of the genetic tagging are
also often necessary if we are to understand the neuronal popula-
tion under study and the complex neuronal circuit within which it
is embedded (Fig. 1c).
2.3 Live-Cell ● High sucrose cutting solution: Sucrose75 mM, NaCl 87 mM,
Microscopy for GFP KCl 2.5 mM, NaH2PO4 1.25 mM, MgCl2 6 mM, CaCl2
Fluorescence 0.5 mM, NaHCO3 25 mM, glucose 25 mM.
Detection and ● Artificial cerebrospinal fluid (ACSF): NaCl 126 mM, KCl
Targeting for Whole- 3 mM, NaH2PO4 1 mM, MgSO4 2 mM, CaCl2 2 mM,
Cell Patch Clamp NaHCO3 25 mM, glucose 15 mM. During recording, ACSF
Electrophysiology was supplemented with 50 μM 2-Amino-5-phosphonopentanoic
acid (AP5 Abcam Biochemicals, Cambridge, UK) and
2.3.1 Slice Preparation
20 μM 1,2,3,4-Tetrahydro-7-nitro-2,3-dioxoquinoxaline-6-
and Electrophysiology
carbonitrile (CNQX) disodium (Abcam Biochemicals) to block
glutamatergic synaptic transmission and 50 μM picrotoxin
(Sigma, Chemicals, St. Louis, MO) to block GABAAergic synap-
tic input.
● Internal pipette solution: KCl 10 mM, Na-phosphocreatine
10 mM, K-gluconate 110 mM, HEPES 10 mM, Mg-ATP
4 mM, Na-GTP 0.3 mM, Biocytin 0.2 %; pH 7.3 and osmolar-
ity adjusted to 295 mOsm with sucrose.
● 95 % O2 and 5 % CO2 gas cylinder.
● Mouse CO2 chamber.
● Peristaltic pump for animal perfusion.
● Dissection tools.
● Petri dish.
● Razor blades.
● Cyanoacrylate glue.
● Vibrating microtome, e.g., VT1000S, Leica Microsystems,
Wetzlar, Germany.
● Peristaltic pump for slice perfusion: MS-Reglo (IsmaTec,
Glattbrugg, Switzerland) or 50S (Watson Marlow, Wilmington,
MA).
● Recording chamber.
● Inline heating system (Warner Instruments, Hamden, CT).
● Upright microscope, e.g., Eclipse (Nikon, Tokyo, Japan)
equipped with a 10× objective (Plan Fluor, Nikon), and a 60×
objective (1.00 NA), water immersion (Plan Fluor, Nikon).
● Infrared DIC optics.
● CCD camera.
● Monitor.
Immunocytochemistry and Live Imaging 363
3 Procedures
3.2 Live-Cell Prior to slicing, the cutting solution was cooled (1–3 °C) on ice
Microscopy for GFP and saturated with a 95 % O2 and 5 % CO2 gas mixture (carbogen)
Fluorescence for at least half an hour. Mice were initially anesthetized in a CO2
Detection and chamber and rapidly decapitated. The head was quickly doused
Targeting for Whole- with cold cutting solution and a midline incision with a scalpel
Cell Patch Clamp exposed the dorsal surface of the skull. The brain was uncovered by
Electrophysiology making a cut across the nasal bone, extending through the skull on
either side of the cranium and terminating near base of the neck.
3.2.1 Brain Slice The brain was separated from the base of the skull and transferred
Preparation to a dish with cold oxygenated cutting solution. The frontal cor-
tex, that is used for sectioning was cut from the rest of the brain by
a coronal razor blade through the parietal cortex. The angle of the
blade was slanted rostrally (~10–15°) to align with the radial axis
of cortex [18]. This off-coronal angle yielded slices with apical
dendrites of layer 5 neurons approximately parallel with the cut
surface. The tissue block was then glued to a platform using cyano-
acrylate glue and transferred to the stage of a vibrating microtome
Immunocytochemistry and Live Imaging 365
Fig. 2 Fez2-GFP reporter expression in the mouse brain. (a) Fez2-GFP reporter expression in a fixed (4 %
paraformaldehyde) coronal slice from mature mouse frontal cortex. The GFP fluorescence (without amplifica-
tion) can be seen as distinctive labeling in layer 5 of the cortex, (bii) but not in the more superficial layer 2/3
(bi), or in the deeper layer 6. Note the large pyramidal shape of the GFP positive neurons (inserts bi and bii).
(c) Images of GFP positive and GFP negative neurons in a living slice observed with infra red (differential inter-
ference contrast) DIC optic, overlay on right hand image. The dotted line indicates the position of a whole-cell
patch clamp recording electrode, seen more clearly in the lower DIC image, targeting a GFP negative neuron.
aca anterior part of anterior commissure
3.2.2 Whole-Cell Brain slices were transferred and anchored to a recording chamber
Recording for Targeting with a nylon grid. A peristaltic pump continually perfused the slices
GFP+ve (Fezf2+ve) with ACSF (bubbled with carbogen) at a rate of 1–2 mL/min. The
Cortical Neurons recording temperature was controlled at either 26 or 35 °C with an
inline heating system. Slices were visualized with an upright micro-
scope equipped with DIC optics and were displayed on a monitor
using a CCD camera.
Before recording, a few steps are needed to orient the slice and
locate the cortical region of interest using a low power 10× objec-
366 Ruth M. Empson et al.
tive Under the 60× objective layer 5 neurons were identified on the
basis of their pial depth and their larger neuronal somata than
neurons in layers 2/3 or 6.
On a given experimental day the types of neurons that were
targeted for electrophysiological recording were: (1) GFP+ neu-
rons, identified with a filter cube for GFP; (2) GFP- neurons, iden-
tified as displaying a fluorescent signal indistinguishable from
background at the region of the soma. The identified neurons of
interest were marked on the monitor. The somas were then visual-
ized using infrared DIC optics in the same field of view and the
patch electrode was guided for whole-cell recording using a micro-
manipulator. Both fluorescence and DIC images of each recorded
neuron were taken as an offline record of their fluorescent label
(Fig. 2). Prior to recording, the major axis of the apical dendrite
near the soma was checked to run close to parallel to the slice sur-
face. This guaranteed that the distal dendrites of recorded neurons
were not cut and were suitable for intracellular biocytin filling.
A variety of electrophysiological tests were applied to the recorded
cells in order to identify their electrical phenotype, including action
potential firing properties and membrane currents and properties
but the details are beyond the scope of this chapter.
3.3 Post hoc Since the neurons targeted by whole-cell patch clamp recording
Histochemistry were also filled with biocytin (0.2 %) we were also able to identify
and Reconstruction the shape and position of these Fezf2-GFP neurons within the cor-
of Fezf2-GFP tical network. We used streptavidin conjugated to a red fluorescent
Expressing Neurons probe (Alexa® 568). Streptavidin reacts directly with biotin (biocy-
tin) within the filled neuron, labeling only the filled neuron in the
red fluorescence channel of the wide-field microscope. Typically
we obtained recovery percentages of 80–100 % of neurons using
the protocol below.
3.3.1 Neuron Capture After the completion of electrophysiological recording, the elec-
and Post hoc Fluorescence trode was slowly withdrawn while continuously monitoring the
Histochemistry seal resistance in voltage clamp using a 5 mV step (20 ms, 100 Hz).
In most cases high resistance seal (>500 MΩ) between the elec-
trode tip and the neuron membrane resulted and, at this instance,
the electrode was quickly withdrawn. The slice was then stored in
a PBS solution containing 4 % paraformaldehyde overnight at 4 °C
and then in PBS until processing. In order to avoid morphology
overlapping between two or more neurons, we only targeted one
neuron per slice.
Slices were rinsed in PBS three times and permeabilized in PBS
containing 0.3 % Triton®X-100 for 4 h in room temperature. The
slices were then incubated for another 4 h in 2–4 μg/mL streptavi-
din Alexa® 568 in PBS containing 0.3 % Triton® X-100. Slices were
thoroughly washed in PBS at least three times and then mounted
on glass slides, air-dried, and coverslipped using VECTASHIELD®
mounting medium.
Immunocytochemistry and Live Imaging 367
Fig. 3 Post hoc histochemistry and reconstruction of a FezF2-GFP positive neuron to access morphological
parameters. (a) Immunofluorescence using streptavidin-Alexa® 568 binding to biotin applied to a single corti-
cal projection neuron via the whole-cell recording pipette (see also Fig. 2c, lower panel). The image is a com-
posite of several image planes through the thickness of the slice. Note the very bright soma but the clear
delineation of the apical dendrite reaching towards the pia. The box inset (dashed lines) shows the beaded
appearance of the axon (shown red in the reconstruction in b) and the fine basal dendrites. (b) Traced recon-
struction of the neuron extracted from the fluorescence image stacks. (c) Different morphological parameters
can be extracted from reconstruction and the inset shows the measurements made to assess soma size and
apical dendrite shaft width (red dashed line)
3.4 Combining The master action of FEZF2 is likely to initiate and maintain a cas-
Fluorescence-Based cade of gene expression that leads to the induction of downstream
Immunohisto- effectors (Fig. 4). One potential effector of FEZF2 function is the
chemistry transcription factor CTIP2 (COUP-TF interacting protein 2), also
with the Fezf2-GFP expressed in subcortical projection neurons during development
Reporter Mouse: [8]. CTIP2 likely controls later aspects of subcortical projection
Immunohisto- neuron development as it plays a role in regulating extension of
chemistry of Fezf2 axons toward subcortical targets, and ectopic expression can rescue
Downstream Effectors the axon pathways lost in the Fezf2-knock out mouse [8, 20].
Equally important are targets that are repressed by FEZF2.
SATB2 (special AT-rich sequence-binding protein 2) is another
key transcription factor thought to be critical for projection neuron
specification. This transcription factor is thought to repress the
expression of Ctip2 as a negative regulator of subcortical axon for-
mation. Downregulation of Satb2 is thus necessary for the preven-
tion of cortico-callosal projection neuron specification and relieves
repression of Ctip2 [21, 22]. Similarly, TBR1 (T-box brain protein
1) is responsible for the specification of layer 6 cortico-thalamic
projection neurons, and its downregulation supports layer 5 sub-
cortical projection neuron specification [23, 24]. In this notion, it
is the differences in the levels of expression and the interplay
between these transcription factors that could specify one projec-
tion neuron type versus another [12, 13]. Once specification has
taken place, these transcription factors presumably also ensure the
same projection neuron identity is retained in the adult brain.
In order to gain some insight into the relationship between
FEZF2 and these other transcription factors, and since there is no
reliable antibody to mouse FEZF2 we utilized the Fezf2-GFP
mouse in conjunction with immunohistochemistry for these other
transcription factors.
3.4.2 Immunohisto- As described above, the expression of these three transcription fac-
chemistry for SATB2, tors is predicted to occur alongside (SATB2 and CTIP2) or dis-
CTIP2 and TBR1 tinct (TBR1) from Fezf2 expression (Fig. 4). Therefore detection
of these proteins alongside Fezf2 expression may help us to resolve
Immunocytochemistry and Live Imaging 369
5 Conclusion
Acknowledgements
References
1. Miller MN, Okaty BW, Nelson SB (2008) in the developing cerebral cortex. Curr Opin
Region-specific spike-frequency acceleration in Neurobiol 18:28–35
layer 5 pyramidal neurons mediated by Kv1 14. Nelson SB, Sugino K, Hempel CM (2006) The
subunits. J Neurosci 28:13716–13726 problem of neuronal cell types: a physiological
2. Yu J, Anderson CT, Kiritani T et al (2008) genomics approach. Trends Neurosci 29:
Local-circuit phenotypes of layer 5 neurons in 339–345
motor-frontal cortex of YFP-H mice. Front 15. Rouaux C, Bhai S, Arlotta P (2012)
Neural Circuits 2:6 Programming and reprogramming neuronal
3. Porrero C, Rubio-Garrido P, Avendaño C et al subtypes in the central nervous system. Dev
(2010) Mapping of fluorescent protein- Neurobiol 72:1085–1098
expressing neurons and axon pathways in adult 16. Özdinler PH, Benn S, Yamamoto TH et al
and developing Thy-eYFP-H transgenic mice. (2011) Corticospinal motor neurons and
Brain Res 1345:59–72 related subcerebral projection neurons undergo
4. Akemann W, Zhong Y-M, Ichinohe N et al early and specific neurodegeneration in
(2004) Transgenic mice expressing a fluores- hSOD1G93A transgenic ALS mice. J Neurosci
cent in vivo label in a distinct subpopulation of 31:4166–4177
neocortical layer 5 pyramidal cells. J Comp 17. Franklin K, Paxinos G (2001) The mouse brain
Neurol 480:72–88 in stereotaxic coordinates, 2nd edn. London
5. Uusisaari M, Knöpfel T (2010) GlyT2+ neu- Academic Press, San Diego
rons in the lateral cerebellar nucleus. 18. Anderson CT, Sheets PL, Kiritani T et al
Cerebellum 9:42–55 (2010) Sublayer-specific microcircuits of corti-
6. Groh A, Meyer HS, Schmidt EF et al (2009) cospinal and corticostriatal neurons in motor
Cell-type specific properties of pyramidal neu- cortex. Nat Neurosci 13:739–744
rons in neocortex underlying a layout that is 19. Meijering E, Jacob M, Sarria JCF et al (2004)
modifiable depending on the cortical area. Design and validation of a tool for neurite trac-
Cereb Cortex 20:826–836 ing and analysis in fluorescence microscopy
7. Heintz N (2004) Gene expression nervous sys- images. Cytometry A 58A:167–176
tem atlas (GENSAT). Nat Neurosci 7:483 20. Chen B, Wang SS, Hattox AM et al (2008)
8. Arlotta P, Molyneaux BJ, Chen J et al (2005) The Fezf2-Ctip2 genetic pathway regulates the
Neuronal subtype-specific genes that control fate choice of subcortical projection neurons in
corticospinal motor neuron development the developing cerebral cortex. Proc Natl Acad
in vivo. Neuron 45:207–221 Sci U S A 105:11382–11387
9. Chen B, Schaevitz LR, McConnell SK (2005) 21. Alcamo EA, Chirivella L, Dautzenberg M et al
Fezl regulates the differentiation and axon tar- (2008) Satb2 regulates callosal projection neu-
geting of layer 5 subcortical projection neurons ron identity in the developing cerebral cortex.
in cerebral cortex. Proc Natl Acad Sci U S A Neuron 57:364–377
102:17184–17189 22. Britanova O, de Juan Romero C, Cheung A
10. Chen J-G, Rašin M-R, Kwan KY et al (2005) et al (2008) Satb2 is a postmitotic determinant
Zfp312 is required for subcortical axonal pro- for upper-layer neuron specification in the neo-
jections and dendritic morphology of deep- cortex. Neuron 57:378–392
layer pyramidal neurons of the cerebral cortex. 23. Han W, Kwan KY, Shim S (2011) TBR1
Proc Natl Acad Sci U S A 102:17792–17797 directly represses Fezf2 to control the laminar
11. Molyneaux BJ, Arlotta P, Hirata T et al (2005) origin and development of the corticospinal
Fezl is required for the birth and specification tract. Proc Natl Acad Sci U S A 108:
of corticospinal motor neurons. Neuron 3041–3046
47:817–831 24. McKenna WL, Betancourt J, Larkin KA et al
12. Molyneaux BJ, Arlotta P, Menezes JRL et al (2011) Tbr1 and Fezf2 regulate alternate cor-
(2007) Neuronal subtype specification in the ticofugal neuronal identities during neocortical
cerebral cortex. Nat Rev Neurosci 8:427–437 development. J Neurosci 31:549–564
13. Leone DP, Srinivasan K, Chen B et al (2008) 25. Tantirigama MLS, Oswald MJ, Duynstee C
The determination of projection neuron identity et al (2014) Expression of the developmental
Immunocytochemistry and Live Imaging 373
transcription factor Fezf2 identifies a distinct zebrafish. Proc Natl Acad Sci U S A 108:
subpopulation of layer 5 intratelencephalic- 5425–5430
projection neurons in mature mouse motor 28. Akemann W, Mutoh H, Perron A (2010)
cortex. J Neurosci 34(12):4303–4308 Imaging brain electric signals with genetically
26. Dombeck DA, Harvey CD, Tian L et al targeted voltage-sensitive fluorescent proteins.
(2010) Functional imaging of hippocampal Nat Methods 7:643–649
place cells at cellular resolution during 29. Akemann W, Mutoh H, Perron A (2012)
virtual navigation. Nat Neurosci 13: Imaging neural circuit dynamics with a voltage-
1433–1440 sensitive fluorescent protein. J Neurophysiol
27. Muto A, Ohkura M, Kotani T et al (2011) 108:2323–2337
Genetic visualization with an improved 30. Knöpfel T (2012) Genetically encoded optical
GCaMP calcium indicator reveals spatiotempo- indicators for the analysis of neuronal circuits.
ral activation of the spinal motor neurons in Nat Rev Neurosci 13:687–700
Part V
Novel Approaches
Chapter 20
Abstract
Understanding synaptic connectivity patterns between neurons and fine anatomical features of neural
circuits represent key steps in our journey to unravel brain connectomes. In the last few years the devel-
opment of new imaging tools and technologies has significantly improved our understanding of neural
circuits. A remarkable example of this is a high-resolution immunofluorescence technique called array
tomography (AT). AT combines conventional immunofluorescence techniques to label antigens with
ultrathin (70 nm) serial sectioning, and 3D reconstruction. Thus, serial images can be aligned and
rendered into volumetric images suitable for semi-automated quantitative analysis using the ImageJ
software. AT allows antibody elution and multiple rounds of immunolabeling, offering the unique pos-
sibility of examining the spatial distribution of multiple antigens and their relationships to each other
in the same tissue volume. AT represents a new powerful and quantitative tool, particularly useful to
characterize molecular components of synapses as well as to explore fine anatomical features within the
synaptic neuropil.
Key words LR white, Ultrathin (70 nm) serial sections, Multiple antigens, Antibody elution, 3D
reconstruction, Quantitative analysis, Synaptic neuropil, Glutamate axons, Vesicular glutamate
transporters (VGLUT1-3), Dorsal raphe nucleus
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_20, © Springer Science+Business Media New York 2015
377
378 Mariano Soiza-Reilly
2.2 Ultrathin (70 nm) ● EMBed 812 (Electron Microscopy Sciences, Hatfield, PA)
Serial Sections chucks.
● Superglue.
● Razor blades.
● Contact cement.
● Xylene.
● Chromium potassium sulfate.
● Gelatin from porcine skin.
● Coverslips (24 × 60 mm, No. 1.5).
● Jumbo Histo Diamond Knife (Diatome, AG, Biel, Switzerland).
● Single bristle brush.
● Dissecting microscope.
● Ultramicrotome (e.g., Leica Ultracut Series, Leica
Microsystems, Wetzlar, Germany).
● Hot plate.
3 Procedures
3.1 Tissue Animals (e.g., mouse, rat) are anesthetized with sodium pentobar-
Preparation bital (75–100 mg/kg) and transcardially perfused through the
ascending aorta with 4 % paraformaldehyde in 0.1 M PB. The
brain is quickly removed and post-fixed in the same 4 % parafor-
maldehyde solution overnight at 4 °C. On the next day, brain tis-
sue is equilibrated in 30 % sucrose for approximately 24–48 h.
Thereafter, the brain is sectioned in thick sections (100 μm) in PBS
using a vibratome. Sections containing the neuroanatomical area
of interest according to brain’s stereotaxic atlases ([8] and [9] for
mice and rats, respectively) are processed for flat-embedded array
tomography. The flat-embedding procedure is especially useful for
non-laminated brain structures. For this, using a paint brush and a
multiwell plate, tissue sections are dehydrated in graded series of
alcohol, starting with 50 % ethanol, and then 70 % ethanol two
times (5 min each step at room temperature). Subsequently, the
tissue is infiltrated in a 1:3 mixture of 70 % ethanol and LR White
resin for 5 min, and then two times of 5 min each in fresh LR
White. This dehydration procedure preserves the endogenous flu-
orescence signal (e.g., GFP). After, the tissue is deposited on top
of an inverted glass petri dish containing a few drops of LR White,
then covered by a glass coverslip, and maintained overnight at 4 °C
for flat-infiltration (Fig. 1).
On the following day, sections are flat embedded between a
glass slide (to provide a flat surface) and two sheets of ACLAR
plastic. The first sheet is the “spacer sheet,” while the other is the
“cover sheet” (Fig. 1). On the “spacer sheet,” make a hole with a
razor blade larger than the tissue section. Glue the “spacer sheet”
on top of the slide with super glue (Fig. 1). Then, a few drops of
High-Resolution Immunofluorescence 381
Fig. 1 Schematic view of flat-infiltration and flat-embedding procedure for array tomography. The tissue is
flat-infiltrated on top of an inverted glass petri dish containing a few drops of LR White, then covered by a glass
coverslip (upper panel), and infiltrated overnight at 4 °C. On the next day, the tissue is flat embedded between
a glass slide and two sheets of ACLAR plastic (lower panel). One of the plastic sheets is a “spacer” while the
other is a “cover.” The tissue section is deposited in the hole of the perforated spacer sheet that was previously
glued to one side of the glass slide (lower panel). Then, a few drops of LR White are added to the tissue section,
and then covered by the cover sheet (lower panel). The tissue is incubated at 55 °C for 24 h for polymerization
LR White resin are added in the hole of the “spacer sheet” (now
glued to the slide), and the tissue section is deposited in the hole.
Cover the slide with the “cover sheet,” avoiding bubble formation
(Fig. 1), and then polymerize in an oven at 55 °C for 24 h.
3.2 Ultrathin (70 nm) Selected neuroanatomical areas are excised from the flat-embedded
Serial Sections tissue section using a razor blade, and mounted on EMBed 812
chucks using superglue. Under a dissecting microscope, the area of
interest is further trimmed to a trapezoidal shape (approximately
2.5 mm × 1.5 mm) with a razor blade. Adhesive contact cement
diluted in xylene is applied with a paintbrush to the top and bot-
tom of the block face to facilitate collection of serial sections
(ribbons). After the glue dries, series of 25 or more 70 nm-thick
sections are cut in ribbons using Jumbo Histo Diamond Knife and
an ultramicrotome. With the help of a single bristle brush, the
ribbon of ultrathin sections is collected and mounted on a glass
coverslip, previously coated five times with 0.1 % gelatin and 0.01 %
chromium potassium sulfate. Coverslips containing the ribbons are
subsequently air-dried for at least 8 h, avoiding dust exposure.
Then, for ribbon attachment, coverslips are placed on a hot plate
(60 °C) for 30 min. Once attached, the ribbons can be stored at
room temperature until processing for immunofluorescence for
several months.
382 Mariano Soiza-Reilly
3.3 Immunolabeling Ribbons of sections are encircled with a PAP pen, and pre-incubated
and Antibody Elution first with 50 mM glycine in filtered PBS, and then with a blocking
solution (0.05 % Tween®20, 0.1 % BSA in filtered PBS) for 5 min
each in a humid chamber. Subsequently, antibodies from different
hosts are diluted together in blocking solution, and then incubated
with tissue sections for 2 h. Following incubation, sections are
thoroughly rinsed with filtered PBS three times by a continuous
flow of buffer for about 20 s using a plastic transfer pipette. This is
followed by incubation with the same buffer in a humid chamber
for 10 min. The appropriate combination of fluorescent-conjugated
secondary antisera (e.g., CY3, Alexa® 488 and Alexa®647), raised
against hosts of applied primary antisera, is diluted in blocking buf-
fer (1:200). This solution is centrifuged at 14,000 × g for 3 min in
a microcentrifuge before use. Serial sections are incubated with
secondary antisera for 20 min, and rinsed with filtered PBS using
the same technique mentioned previously. Coverslips with serial
sections are mounted on glass slides using a glycerol-based mount-
ing medium with or without DAPI. In some cases DAPI staining
is used later on to align serial images. Immunolabeled serial ultra-
thin sections are imaged using a fluorescence microscope with a
high magnification objective (e.g., 60×). Images from the same
spot in adjacent sections are acquired and aligned such that dis-
crete labeling can be followed across serial sections. After image
acquisition, antibodies can be eluted from sections to start a new
round of immunostaining. After each round of immunolabeling,
the mounting medium is washed away with distilled H2O, and
serial sections are incubated with a solution containing 0.02 % SDS
and 0.2 M NaOH in distilled H2O for 20 min. After two washes
with filtered PBS and one with distilled H2O, each 10 min, cover-
slips are air-dried for at least 8 h, and then placed on a hot plate
(60 °C) for 30 min. It has been previously shown using AT that
immunolabeling of the same antigen (e.g., PSD-95, tryptophan
hydroxylase—TPOH) is highly reproducible after several rounds
of labeling/elution (Fig. 2) [4]. That is, a high proportion of the
same pixels were re-labeled after consecutive rounds of labeling/
elution for TPOH (r = 0.94) and PSD-95 (r = 0.89) (Fig. 2a–e).
Consistent with this, total amounts of PSD-95 labeled puncta
either associated or not with TPOH-immunolabeled processes
were also similar for the same stack of images from different rounds
of labeling/elution (Fig. 2f).
Fig. 2 Preservation of antigenicity of PSD-95 and Tryptophan Hydroxylase (TPOH) after three rounds of anti-
body labeling/elution in array tomography. (a–c). The same 70-nm ultrathin section labeled against PSD-95
(red) and TPOH (white) in three consecutive rounds of labeling/elution has consistent patterns of labeling.
Examples of the PSD-95 immunolabeling repeated in each round are shown within yellow circles. Controls
where primary antisera were omitted confirmed immunolabeling was completely removed by elution proce-
dure. (d–e) Merged images from the same 70 nm-thick section labeled for TPOH (upper panel) or PSD-95
(lower panel) in the three consecutive rounds of labeling/elution. The first round of immunolabeling is
pseudocolored in blue, the second in red, and the third one in green. Overlapping pixels are shown in white.
(f) Quantitative analysis of PSD-95 puncta density either associated or not with TPOH-positive areas for the
same stack of images after the three rounds of antibody labeling/elution. Scale bars = 10 μm. Reprinted from
Journal of Comparative Neurology, 519(18), Soiza-Reilly, M., & Commons, K.G., Quantitative analysis of gluta-
matergic innervation of the mouse dorsal raphe nucleus using array tomography, 3802–14, Copyright (2011),
with permission from John Wiley and Sons
384 Mariano Soiza-Reilly
Fig. 3 Image processing steps in array tomography to obtain 3D volumetric images. Imaged immunolabelings
of serial ultrathin sections are converted into stacks and aligned using ImageJ-based Fiji software with
StackReg and MultiStackReg plug-ins. For this, multicolor stacks are split into individual channels. In this
example, sections are immunolabeled against PSD-95 (red) and tryptophan hydroxylase (TPOH) (green). The
channel containing the largest immunolabeled structures (in this case the TPOH channel) is used to align serial
images. After this alignment, the second channel is aligned applying the same parameters obtained from the
first channel alignment. This operation is available in the MultiStackReg plug-in interface. Finally, both aligned
channels are combined into a multicolor aligned stack that can be used for rendering of high-resolution 3D
images using the 3D View function of Fiji. Scale bars = 10 μm
Fig. 4 High-resolution view of the mouse dorsal raphe nucleus revealed by array tomography. (a) 3D volumetric
image rendered from 28 ultrathin (70 nm) serial sections showing immunolabeling for PSD-95 (red), a marker
of excitatory synapses, and tryptophan hydroxylase (TPOH) (green) to identify serotonin cells. With array
tomography, individual molecular components of synapses (e.g., PSD-95) and their associations to different
cell types can be easily detected and subjected to semi-automated quantitative analysis. (b) Arrowheads in a
point to same elements in b at higher magnification, showing discrete labeling of the synaptic marker as well
as individual neuritic processes, with total absence of out of focus light. Scale bars = 50 μm. Adapted from
Journal of Chemical Neuroanatomy, 41(4), Soiza-Reilly, M., & Commons, K.G., Glutamatergic drive of the dorsal
raphe nucleus, 247–55, Copyright (2011), with permission from Elsevier
Fig. 5 Colocalization analyses in array tomography: Absolute and normalized cross-correlation analyses of
pixels. (a) Schematic example illustrating the absolute cross-correlation analysis of pixels. Two populations of
immunolabeled puncta colocalize (black and grey dots), and therefore their overlapping pixels are correlated.
In this analysis, the extinction of this correlation is studied by arbitrarily increasing the physical distance
between these two populations of dots (optical channels). If these labeled puncta colocalize, they would pres-
ent a maximum value of correlation at no shift (original aligned image) followed by a subsequent drop in cor-
relation values as the distance between both channels increases (image displacement). In the case that both
populations of labeled puncta do not colocalize at all, a flat line is obtained after this analysis (dashed line).
Since the cross-correlation analysis could be biased by the relative abundance of labeled puncta, curves
obtained in a are “normalized” by their respective maximum value of cross-correlation (b). These normalized
cross-correlation curves represent a magnitude of proximity between the paired populations of labeled puncta.
If the curve drops sharply, that indicates a close relationship (b, solid line), while if it drops slowly that indicates
a further and weak relationship (b, dashed line)
1. “…the tissue does not remain flat when I put it in the mixture
3:1 of LR White and 70 % alcohol….” It is extremely impor-
tant to start the procedure with fresh alcohol (preferentially
with an unopened bottle), especially if you make the 70 % alco-
hol solution using 100 % absolute ethanol.
2. “…the resin is not polymerizing after 24 hours at 55 °C….”
Check that you have effectively covered the tissue with LR
White and then with the plastic cover, without leaving any air
bubbles inside. Any air contact with the resin will delay or in
some cases, impede the process of polymerization.
3. “…ultrathin sections in the ribbon detach from the cover-
slip….” There are many reasons this could happen, and may
occur at different stages during the procedure (e.g., pre- or
post-elution). If sections are not attached to the glass coverslip
during the first round of immunolabeling that likely indicates
High-Resolution Immunofluorescence 387
5 Conclusion
References
1. Micheva KD, Smith SJ (2007) Array tomogra- pil from the connectomics perspective. Neuron
phy: a new tool for imaging the molecular 67:1009–1020
architecture and ultrastructure of neural cir- 7. Soiza-Reilly M, Commons KG (2011)
cuits. Neuron 55:25–36 Glutamatergic drive of the dorsal raphe
2. Wang G, Smith SJ (2012) Sub-diffraction limit nucleus. J Chem Neuroanat 41:247–255
localization of proteins in volumetric space 8. Paxinos G, Franklin KBJ (2003) The mouse
using Bayesian restoration of fluorescence brain in stereotaxic coordinates: compact sec-
images from ultrathin specimens. PLoS ond edition, 2nd edn. Academic, New York
Comput Biol 8:e1002671 9. Paxinos G, Watson C (2006) The rat brain in
3. Micheva KD, Busse B, Weiler NC et al (2010) stereotaxic coordinates: hard cover edition.
Single-synapse analysis of a diverse synapse Academic, New York
population: proteomic imaging methods and 10. Thévenaz P, Ruttimann UE, Unser M (1998)
markers. Neuron 68:639–653 A pyramid approach to subpixel registration
4. Soiza-Reilly M, Commons KG (2011) based on intensity. IEEE Trans Image Process
Quantitative analysis of glutamatergic innerva- 7:27–41
tion of the mouse dorsal raphe nucleus using 11. Bolte S, Cordelières FP (2006) A guided tour
array tomography. J Comp Neurol 519: into subcellular colocalization analysis in light
3802–3814 microscopy. J Microsc 224:213–232
5. Soiza-Reilly M, Anderson WB, Vaughan CW 12. van Steensel B, van Binnendijk EP,
et al (2013) Presynaptic gating of excitation in Hornsby CD et al (1996) Partial colocaliza-
the dorsal raphe nucleus by GABA. Proc Natl tion of glucocorticoid and mineralocorticoid
Acad Sci U S A 110:15800–15805 receptors in discrete compartments in nuclei of
6. Mishchenko Y, Hu T, Spacek J et al (2010) rat hippocampus neurons. J Cell Sci 109:
Ultrastructural analysis of hippocampal neuro- 787–792
Chapter 21
Abstract
The highly complex and polarized morphology of neurons is established by the cytoskeleton, a network of
protein polymers, such as F-actin and microtubules, and associated proteins that provide shape and
strength. In addition to providing structural support, microtubules serve as tracks for long-range active
transport driven by dynein and kinesin motor proteins. To better understand how microtubule organiza-
tion underlies the establishment and maintenance of neuronal architecture, better mapping of the neuro-
nal microtubule network and its associated proteins is essential.
Different fluorescence microscopy techniques are commonly used to explore the organization of the
microtubule cytoskeleton. The resolution of these techniques is, however, limited by diffraction to approx-
imately 250 nm, which makes them not suitable for nanoscale mapping of microtubule properties. Super-
resolution microscopy techniques that rely on single molecule localization (Single Molecule Localization
Microscopy; SMLM) combine high protein specificity, multi-color imaging, and a resolution in the order
of 5–50 nm, making it an ideal tool to study the neuronal cytoskeleton and its properties.
In this chapter, we discuss the theory behind SMLM, labeling strategies for the fluorescent probes,
describe a workflow and a detailed protocol for fixation and immunostaining of neuronal microtubules,
and provide some tips for successful super-resolution imaging, data analysis, and image reconstruction.
Neurons are highly specialized cells that form long processes to estab-
lish connections in the nervous system. Neuronal processes are classi-
fied based on their morphology, function, and protein composition
as either dendrites or axons. Pyramidal neurons have multiple highly
branched dendrites that conduct electrical stimulations received
from other neurons to the cell body, and a single axon that sends
signals away from the cell body. The axons of neurons in the cortex
and hippocampus usually reach lengths of hundreds of microns.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_21, © Springer Science+Business Media New York 2015
389
390 Bas M.C. Cloin et al.
Dendrites
Axon
1.22l
d=
2 NA
Fig. 2 Principle of SMLM. (a) PSFs of Alexa Fluor® 647 molecules at different spacing. When the spacing
becomes smaller, the PSFs of the two fluorophores cannot be discriminated. (b) Upper panel—Schematic of
two closely spaced fluorescently labeled microtubules with diffraction-limited resolution (290 nm). Middle
panel—When most fluorophores have been brought to a dark state, the PSFs of the few molecules in the fluo-
rescent state can be detected separately. Lower panel—Super-resolved image of the microtubules created by
plotting the accurately determined positions of many fluorophores, collected over several thousand frames. (c)
Workflow of SMLM
Sect. 3.2.
●● Monoclonal Anti-α-Tubulin, clone B-5-1-2 (Sigma Chemicals,
St. Louis, MO).
●● Alexa Fluor® 647 Carboxylic acid succinimidyl ester (Life
Technologies™).
●● Dimethyl sulfoxide (DMSO, e.g., from Sigma Chemicals).
●● Dulbecco’s phosphate-buffered saline (d-PBS, Sigma
Chemicals).
396 Bas M.C. Cloin et al.
2.2 Materials Cultured neurons: e.g., embryonic day (E) 19 rat hippocampal
and Reagents primary neurons [6].
for Immunocyto ●● Light-tight plastic box.
chemistry
●● Parafilm™.
●● 16 % paraformaldehyde (PFA) EM-grade (e.g., Sigma
Chemicals).
●● d-PBS (Sigma Chemicals).
●● Sucrose.
●● EGTA.
●● PIPES.
●● Glucose.
●● Bovine serum albumin (BSA).
●● Gelatin.
●● Glycine.
●● NH4Cl.
●● Triton® X-100.
●● Glutaraldehyde (GA, obtained for example from Electron
Microscopy Sciences, Hatfield, PA).
●● Extraction buffer: 80 mM PIPES, 7 mM MgCl2, 1 mM EGTA,
0.3 % Triton® X-100, 150 mM NaCl, 5 mM glucose, 0.25 %
GA, adjust to pH 6.9 with KOH.
●● Fixative: PFA 4 %, sucrose 4 % in d-PBS.
●● Permeabilization buffer: 0.3 % Triton® X-100 in d-PBS.
●● Blocking buffer: 2 % w/v BSA, 0.2 % gelatin, 10 mM glycine,
50 mM NH4Cl in d-PBS (sterile filtered).
3 Procedures
3.1 Neuronal SMLM can be performed on any type of cell line or primary culture.
Cultures In our example we will describe how to perform the procedure
on rat hippocampal primary neurons prepared at E19. A detailed
description of culture preparation is beyond the purpose of this
chapter and is described in [6]. Dissociated hippocampal neurons
are plated on 19 mm coverslips coated with poly-l-lysine and laminin
at a density of 75,000 cells/coverslip (265 cells per mm2).
OD
c=
e
3.3 Fixation Strong fixation of the structure of interest is important for high
and Immunostaining image quality. Often methanol is used as a fixative in protocols for
of Primary Neurons immunostaining of microtubules. Incubating cells with methanol
cause dehydration of the cells and precipitation of proteins.
Methanol fixation yields good results for conventional diffraction-
limited microscopy. However, methanol causes denaturation of
proteins, largely due to weakening of the hydrophobic interactions
favoring unfolding of globular proteins. This causes artifacts in the
cellular structure which affect the quality of TEM [25, 26] and
SMLM images.
Other commonly used fixatives, such as PFA and GA serve as
cross-linkers. They covalently link protein residues intramolecu-
larly and intermolecularly and provide better preservation of
(microtubule) structure. GA is a stronger fixative then PFA but
PFA penetrates better into the cells and acts faster [27]. Therefore
a combination of PFA and GA is frequently used.
Tubulin is present in cells in soluble form and in polymerized
form (microtubules). The soluble tubulin fraction will also be
immobilized after fixation with a cross-linking reagent increasing
the background staining. Removing soluble tubulin before fixation
greatly reduces this background. This can be done by permeabiliz-
ing the cell membrane which enables diffusion of soluble protein
out of the cell before adding the fixative, or by permeabilization
and slow fixation with GA at the same time. This process is called
“extraction” and is routinely used for preparation of samples for
TEM [28].
400 Bas M.C. Cloin et al.
3.3.1 Extraction Remove the medium from the neurons and gently add 1 mL of
and Fixation preheated d-PBS (37 °C) via the side of the well, then remove the
d-PBS and add 1 mL extraction buffer preheated to 37 °C. Incubate
the neurons for 1990s in extraction buffer. This will permeabilize
the cells and allows enough time for the soluble tubulin fraction to
diffuse out of the cells. If the neurons are incubated with extrac-
tion buffer for (much) longer they can be completely washed away
from the coverslip (see Note 3).
Remove the extraction buffer from the well and add 1 mL of
preheated fixation buffer. Incubate the neurons with the fixation
buffer for 10 min at room temperature, then remove the fixation
buffer and wash the neurons three times with d-PBS for 5 min
each to remove the leftover fixative.
3.3.2 Further Exchange the d-PBS with 1 mL permeabilization buffer and incu-
Permeabilizing bate for 10 min (Triton® X-100 is a detergent that disrupts the cell
and Blocking membrane. This allows antibodies to easily enter and access the
antigens). Remove the permeabilization buffer and wash the neu-
rons three times with 1 mL d-PBS 5 min each to completely
remove the Triton® X-100.
Exchange the d-PBS with 1 mL of blocking buffer. The block-
ing buffer contains reagents that will hinder the antibodies to bind
unspecifically to other proteins. This promotes binding of antibod-
ies only to their epitopes.
because they are fixed, but still proceed with care (see Note 3). The
coverslips can be transferred back to the wells for washing. Use a
needle or a second pair of tweezers to prevent the coverslip from
sliding over the Parafilm® during the pick-up.
Dilute the mouse anti-α-tubulin antibody in blocking buffer
to a final concentration of 1:400. Put a 70–100 μL drop on the
Parafilm® layer. Use tweezers to put the coverslip onto the drop
with the neurons facing downwards. The neurons can be incu-
bated with the primary antibody for 2 h at room temperature, or
overnight at 4 °C. If using directly labeled anti-α-tubulin anti-
body (direct IMF) skip the two steps below and proceed directly
to d-PBS washes, postfixation, and coverslip mounting. Add fresh
d-PBS to the wells before transferring the coverslips. Transfer
coverslips back to the wells. Wash the neurons three times with
d-PBS for 5 min each to remove non-bound antibodies.
Dilute the secondary antibody to a final concentration of
1:400. Again apply a 70–100 μL drop on the Parafilm® and put the
coverslip on the drop with the neurons facing downwards. The neu-
rons can be incubated with the secondary antibody for 2 h at room
temperature, or overnight at 4 °C.
Add fresh d-PBS to the wells before transferring the coverslips.
Wash the neurons three times with d-PBS for 5 min each to remove
non-bound antibodies.
Post-fix with 2 % PFA in d-PBS. Post-fixation is used to cross-
link the antibodies to the structure of interest and to each other.
This decreases the likelihood of dissociation over time. Leave the
neurons in the post-fixation buffer for 10 min (see Note 4).
Wash the neurons three times with d-PBS for 5 min each to
remove excess PFA.
3.3.4 Mounting SMLM is done under conditions that promote fluorophore transi-
tions to and from long-lived dark states and requires the fluoro-
phores to be in a liquid buffer during imaging. This can be achieved
by mounting the coverslips either in open imaging chambers, or on
top of indented microscope slides. The advantage of indented
microscope slides is that the volume is smaller so less buffer is
required, and that the reservoir is closed preventing evaporation of
the imaging buffer and reducing the influx of oxygen. The compo-
sition of the imaging buffer depends on the used fluorophores. For
Alexa Fluor® 647, by far the best fluorophore for SMLM, the
imaging buffer described in Sect. 2.3 is used using a single cavity
indented microscope slide.
To mount the coverslip on an indented slide, add 100 μL
imaging buffer to the indentation and put the coverslip onto the
indentation with the neurons facing downwards. Use a vacuum
suction device to remove excess buffer. Make sure the coverslip is
securely in place and there are no air bubbles under the coverslip.
402 Bas M.C. Cloin et al.
3.4 Imaging Secure the sample on the microscope stage and select a position to
image. It is good practice to limit light exposure of the sample to a
minimum to prevent unwanted photobleaching. Once the sample
is positioned acquire a conventional image to serve as a comparison
for the super-resolved image.
For successful super-resolution imaging, make sure that imag-
ing settings are optimal (for additional information see Note 5):
–– Set exposure time. To achieve the highest signal-to-noise-ratio,
the exposure time should be close to the average on-time of the
used fluorophores. A shorter exposure time will decrease
the number of photons from the fluorophore with respect
to the readout noise of the camera. A longer exposure time will
increase the background noise by collecting more photons not
originating from the fluorophore. Also the chance of having
two fluorophores in the fluorescent state per diffraction lim-
ited area increases with longer exposure times. For Alexa
Fluor® 647 the exposure time is set to 20–30 ms.
–– Set laser power. High laser powers are necessary to bring the
fluorophores quickly to the dark state and to ensure the collec-
tion of many photons from the small subset of fluorophores in
the fluorescent state. Powers in the order of kW/cm2 in the
sample plane are preferable.
–– Set number of images. The number of images to acquire
depends on the density of the structure of interest, the density
of labeling, and the number of detectable PSFs per image.
Usually between 5,000 and 50,000 images are acquired.
–– Bring fluorophores to dark state. Expose the sample to the laser
light to bring most fluorophores to the dark state.
–– Start image acquisition. During acquisition, check that the
PSFs in each image are sparse enough to not overlap each
other. Over time the number of PSFs per image will decrease
due to irreversible photobleaching. This can be compensated
for by actively stimulating fluorophores in the dark state to
switch to the fluorescent state using photoactivation with
405 nm light. Start out by activating with little 405 nm light,
intensity in the order of W/cm2, and increase the intensity
gradually by ramping up the power.
3.5 Analysis/ A super-resolved SMLM image is created by plotting all the fluo-
Reconstruction rophore positions in a new image (see Note 6). The positions of
the fluorophores are determined by fitting all PSFs in the acquired
images and determining the midpoints. Fitting of the PSF and
determination of the midpoint is done by dedicated software
algorithms. Most SMLM software packages consist of separates
parts for the detection and fitting of fluorophores and for the
reconstruction of a super-resolved image. Several packages are
Super-Resolution of Microtubules in Neurons 403
4 Notes and Troubleshooting
Fig. 3 Representative example of the microtubule network in a proximal branch of a DIV4 hippocampal primary
neuron stained with a primary antibody against α-tubulin and visualized via a secondary antibody labeled with
Alexa Fluor® 647. (a) Widefield overview. (b) Super-resolved SMLM image. Enlarged view of the area in the
white box shown in lower panel. (c) Intensity profile of the cross section marked by the white line in (b). Dashed
line corresponds to the widefield image, continuous line indicates the profile of the super-resolved image. Note
that individual microtubules can only be distinguished in the reconstructed SMLM image
References
1. Hirokawa N, Takemura R (2005) Molecular bodies for STORM imaging. Cold Spring Harb
motors and mechanisms of directional trans- Protoc 2013:540–541
port in neurons. Nat Rev Neurosci 6:201–214 11. Klar TA, Hell SW (1999) Subdiffraction reso-
2. Witte H, Bradke F (2008) The role of the cyto- lution in far-field fluorescence microscopy. Opt
skeleton during neuronal polarization. Curr Lett 24:954–956
Opin Neurobiol 18:479–487 12. Fölling J, Bossi M, Bock H et al (2008)
3. Janke C, Kneussel M (2010) Tubulin post- Fluorescence nanoscopy by ground-state
translational modifications: encoding functions depletion and single-molecule return. Nat
on the neuronal microtubule cytoskeleton. Methods 5:943–945
Trends Neurosci 33:362–372 13. Betzig E, Patterson GH, Sougrat R et al (2006)
4. Kapitein LC, Hoogenraad CC (2011) Which Imaging intracellular fluorescent proteins at
way to go? Cytoskeletal organization and nm resolution. Science 313:1642–1645
polarized transport in neurons. Mol Cell 14. Heilemann M, van de Linde S, Schüttpelz M
Neurosci 46:9–20 et al (2008) Subdiffraction-resolution fluores-
5. Kapitein LC, Schlager MA, van der Zwanet cence imaging with conventional fluorescent
WA et al (2010) Probing intracellular motor probes. Angew Chem Int Ed 47:6172–6176
protein activity using an inducible cargo traf- 15. Thompson RE, Larson DR, Webb WW (2002)
ficking assay. Biophys J 99:2143–2152 Precise nm localization analysis for individual
6. Kapitein LC, Yau KW, Hoogenraad CC (2010) fluorescent probes. Biophys J 82:2775–2783
Microtubule dynamics in dendritic spines. 16. Rieger B, Stallinga S (2014) The lateral and
Methods Cell Biol 97:111–132 axial localization uncertainty in super-
7. Hecht E (2014) Optics (new international resolution light microscopy. Chemphyschem
edition—4th edition). Pearson Education 15:664–670
Limited, Harlow, UK 17. Pawley J (2006) Points, pixels, and gray levels:
8. Sharp DJ, Yu W, Baas PW (1995) Transport of digitizing image data. Handbook of biological
dendritic microtubules establishes their non- confocal microscopy. Springer, New York,
uniform polarity orientation. J Cell Biol pp 59–79
130:93–103 18. Hess ST, Girirajan TP, Mason MD (2006)
9. Rust MJ, Bates M, Zhuang X (2006) Sub- Ultra-high resolution imaging by fluorescence
diffraction-limit imaging by stochastic optical photoactivation localization microscopy.
reconstruction microscopy (STORM). Nat Biophys J 91:4258–4272
Methods 3:793–795 19. Testa I, Wurm CA, Medda R et al (2010)
10. Bates M, Jones SA, Zhuang X (2013) Multicolor fluorescence nanoscopy in fixed and
Preparation of photoswitchable labeled anti- living cells by exciting conventional fluorophores
408 Bas M.C. Cloin et al.
Abstract
Single particle tracking (SPT) is a highly sensitive approach for studying the motion of membrane molecules.
This chapter describes the use of nanometer-sized quantum dots (QDs) in single fluorophore optical imag-
ing. QD-based SPT permits to follow molecules over extended time periods and to obtain information
about the lateral diffusion of a particle of interest: its diffusion coefficient, confinement, residency time in
specific submembrane regions. This technique has been used successfully in cultured neurons to follow the
membrane diffusion of, i.e., individual ionotropic and metabotropic receptors, ion channels, ion transport-
ers, neurotransmitter transporters, aquaporins, lipid raft markers, and adhesion molecules.
Key words Single particle tracking, Diffusion coefficient, Confinement, Dwell time, Quantum dot,
Live cell, Surface labeling, Videomicroscopy, Synapse
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_22, © Springer Science+Business Media New York 2015
409
410 Martin Heubl and Sabine Lévi
Fig. 1 Labeling single molecules on the cell surface with QDs. Single membrane proteins are recognized by
a primary antibody, which in turn is recognized by a biotinylated Fab fragment of a secondary antibody.
A streptavidin-coated QD then binds to the biotin on the molecule/antibody complex
Table 1
Membrane-anchored molecules studied with QD-based SPT
ion channels [13, 14], or cell adhesion proteins [15], showing the
importance of surface protein trafficking in the organization of the
cell membrane.
3 Procedures
3.3 Imaging of Transfer a coverslip with a neuronal culture onto a Parafilm™ sheet
QD-Labeled Cultures on a heating block set at 37 °C. See Note 3.
Wash cells briefly with ~400 μL of imaging medium and then
3.3.1 QD Labeling
incubate for 5 min in primary antibody diluted in imaging medium
and Image Acquisition
(1–10 μg mL−1). If poor or excessive QD labeling occurs, change
antibody concentration (see Sect. 5, Table 2). Wash cells three
times in imaging medium and incubate for 5 min in biotinylated
secondary Fab antibody diluted in imaging medium (~10 μg mL−1).
Wash again cells three times in imaging medium and incubate for
1 min in 1 nM QDot 605 streptavidin conjugate in 1× QD binding
buffer supplemented with sucrose. Wash cells thoroughly <5 times
in imaging medium to remove unbound QDs. Mount coverslip
in a recording chamber and image up to 60 min in the imaging
medium at 31 °C.
Snapshots of the synaptic gephyrin-mRFP and homer1c-GFP
markers are acquired before QD recordings. Real-time fluores-
cence images are obtained with an integration time of 30 ms with
1,200 consecutive frames. According to the diffusion speed of the
protein of interest, the integration time has to be adjusted, as fast
diffusing molecules need lower integration time.
Single Particle Tracking 415
Table 2
Troubleshooting
3.3.2 Analysis Single QDs are identified by their blinking property, i.e., their random
of Imaging Data alternation between emitting and nonemitting state [18]. Single
QD tracking and reconstruction of trajectories over the recording
can be performed with homemade software (Matlab, The Math
works, Natick, MA) as described [19]. The center of the fluores-
cence spots is determined with a spatial accuracy of ~10 nm by
cross-correlating the image with a Gaussian fit of the point spread
function (for details see 10). Spots are classified as synaptic when
they overlapped with gephyrin-mRFP or homer1c-GFP clusters.
mRFP and GFP images were first median-filtered (kernel size,
3 × 3 × 1) to enhance cluster outlines. Then, a user-defined intensity
threshold was applied to select clusters and avoid their coalescence,
and a binary mask was generated. Trajectories are considered
416 Martin Heubl and Sabine Lévi
1 N -n é
(
å x ( (i + n )t ) - x (it ) ) + ( y ((i + n )t ) - y (it )) ù
2 2
MSD (nt ) =
N - n i =1 ëê ûú
MSD ( nt ) = 4Dnt + b
3. The confinement area (L) can be estimated by fitting the
MSD–nt plot with the following equation:
L2 æ æ 12Dnt öö
MSD (nt ) = ç 1 - exp ç - ÷÷
3 è è L2 øø
4 Typical/Anticipated Results
Fig. 2 Membrane dynamics of the KCC2 transporter studied with QD-based SPT. (a) Representative trajectory
(white) of QD-bound Flag-tagged recombinant KCC2 overlaid with fluorescent clusters of recombinant
homer1c–GFP (green) and gephyrin–mRFP (red) to identify excitatory (ES) and inhibitory (IS) synapses, respec-
tively. The arrow indicates the starting point of the trajectory. Scale bar, 0.5 μm. (b) Diffusion coefficient of
trajectory 1A over time in the extrasynaptic membrane (black) and at excitatory (green) and inhibitory synapse
(red) showing reduced diffusion at synapses. (c) Time-averaged MSD function of the extrasynaptic part of tra-
jectory 1A (black), and at the excitatory (green) and inhibitory synapse (red). The MSD versus time relationship
for the extrasynaptic part of the trajectory shows a steeper initial slope, suggesting that the observed molecule
was less confined. (d–f) Quantification obtained from 49 cells and five independent experiments (≥140 QDs per
localization). (d) Cumulative probabilities of QD diffusion coefficients d in the extrasynaptic membrane (black)
or at excitatory (green) or inhibitory (red) synapses. Note the reduced diffusion at synapses (**p = 2 × 10−3,
***p < 10−3). (e) Decreased size of the confinement domain L for synaptic QDs (whole population of QDs) versus
extrasynaptic QDs (***p < 10−3). (f) Mean DTs at excitatory synapses (green) and at inhibitory synapses (red)
showing increased DT of KCC2–Flag at excitatory synapses (*p < 5 × 10−2) (color figure online)
418 Martin Heubl and Sabine Lévi
5 Notes and Troubleshooting
6 Conclusion
Acknowledgments
References
1. Bredt DS, Nicoll RA (2003) AMPA receptor 4. Rasse TM, Fouquet W, Schmid A et al (2005)
trafficking at excitatory synapses. Neuron 40: Glutamate receptor dynamics organizing synapse
361–379 formation in vivo. Nat Neurosci 8:898–905
2. Groc L, Choquet D (2006) AMPA and NMDA 5. Sharma K, Fong DK, Craig AM (2006)
glutamate receptor trafficking: multiple roads Postsynaptic protein mobility in dendritic spines:
for reaching and leaving the synapse. Cell long-term regulation by synaptic NMDA recep-
Tissue Res 326:423–438 tor activation. Mol Cell Neurosci 31:702–712
3. Dumoulin A, Triller A, Kneussel M (2009) 6. Tovar KR, Westbrook GL (2002) Mobile
Cellular transport and membrane dynamics of NMDA receptors at hippocampal synapses.
the glycine receptor. Front Mol Neurosci 2:28 Neuron 34:255–264
420 Martin Heubl and Sabine Lévi
7. Adesnik H, Nicoll RA, England PM (2005) 21. Kusumi A, Sako Y, Yamamoto M (1993)
Photoinactivation of native AMPA receptors Confined lateral diffusion of membrane recep-
reveals their real-time trafficking. Neuron 48: tors as studied by single particle tracking
977–985 (nanovid microscopy). Effects of calcium-
8. Choquet D, Triller A (2003) The role of recep- induced differentiation in cultured epithelial
tor diffusion in the organization of the post- cells. Biophys J 65:2021–2040
synaptic membrane. Nat Rev Neurosci 4: 22. Ehrensperger M-V, Hanus C, Vannier C et al
251–265 (2007) Multiple association states between gly-
9. Triller A, Choquet D (2005) Surface traffick- cine receptors and gephyrin identified by SPT
ing of receptors between synaptic and extrasyn- analysis. Biophys J 92:3706–3718
aptic membranes: and yet they do move! 23. Charrier C, Ehrensperger M-V, Dahan M et al
Trends Neurosci 28:133–139 (2006) Cytoskeleton regulation of glycine
10. Triller A, Choquet D (2008) New concepts in receptor number at synapses and diffusion
synaptic biology derived from single-molecule in the plasma membrane. J Neurosci 26:
imaging. Neuron 59:359–374 8502–8511
11. Renner M, Schweizer C, Bannai H et al (2012) 24. Biermann B, Sokoll S, Klueva J et al (2014)
Diffusion barriers constrain receptors at syn- Imaging of molecular surface dynamics in brain
apses. PLoS One 7:e43032 slices using single-particle tracking. Nat Commun
12. Chamma I, Heubl M, Chevy Q et al (2013) 5:3024
Activity-dependent regulation of the K/Cl 25. Chen O, Zhao J, Chauhan VP et al (2013)
transporter KCC2 membrane diffusion, clus- Compact high-quality CdSe-CdS core-shell
tering, and function in hippocampal neurons. nanocrystals with narrow emission linewidths
J Neurosci 33:15488–15503 and suppressed blinking. Nat Mater 12:
13. Brachet A, Leterrier C, Irondelle M et al 445–451
(2010) Ankyrin G restricts ion channel diffu- 26. Smith AM, Nie S (2009) Next-generation
sion at the axonal initial segment before the quantum dots. Nat Biotechnol 27:732–733
establishment of the diffusion barrier. J Cell 27. Betzig E, Patterson GH, Sougrat R et al (2006)
Biol 191:383–395 Imaging intracellular fluorescent proteins at
14. Di Biase V, Tuluc P, Campiglio M et al (2011) nanometer resolution. Science 313:1642–1645
Surface traffic of dendritic CaV1.2 calcium 28. Manley S, Gillette JM, Patterson GH et al
channels in hippocampal neurons. J Neurosci (2008) High-density mapping of single-
31:13682–13694 molecule trajectories with photoactivated local-
15. Giannone G, Mondin M, Grillo-Bosch D et al ization microscopy. Nat Methods 5:155–157
(2013) Neurexin-1β binding to neuroligin-1 29. Manley S, Gillette JM, Lippincott-Schwartz J
triggers the preferential recruitment of PSD-95 (2010) Single-particle tracking photoactivated
versus gephyrin through tyrosine phosphoryla- localization microscopy for mapping single-
tion of neuroligin-1. Cell Rep 3:1996–2007 molecule dynamics. Methods Enzymol 475:
16. Goslin K, Asmussen H, Banker G (1998) Rat 109–120
hippocampal neurons in low-density culture. 30. Hoze N, Nair D, Hosy E et al (2012)
MIT, Cambridge Heterogeneity of AMPA receptor trafficking
17. Alivisatos AP, Gu W, Larabell C (2005) and molecular interactions revealed by super-
Quantum dots as cellular probes. Annu Rev resolution analysis of live cell imaging. Proc
Biomed Eng 7:55–76 Natl Acad Sci U S A 109:17052–17057
18. Bonneau S, Dahan M, Cohen LD (2005) 31. Bouthour W, Leroy F, Emmanuelli C et al
Single quantum dot tracking based on percep- (2012) A human mutation in Gabrg2 associ-
tual grouping using minimal paths in a spatio- ated with generalized epilepsy alters the mem-
temporal volume. IEEE Trans Image Process brane dynamics of GABAA receptors. Cereb
14:1384–1395 Cortex 22:1542–1553
19. Dahan M, Lévi S, Luccardini C et al (2003) 32. Fernandes CC, Berg DK, Gómez-Varela D
Diffusion dynamics of glycine receptors revealed (2010) Lateral mobility of nicotinic acetylcho-
by single-quantum dot tracking. Science 302: line receptors on neurons is determined by
442–445 receptor composition, local domain, and cell
20. Saxton MJ, Jacobson K (1997) Single-particle type. J Neurosci 30:8841–8851
tracking: applications to membrane dynamics. 33. Bürli T, Baer K, Ewers H et al (2010) Single
Annu Rev Biophys Biomol Struct 26:373–399 particle tracking of alpha7 nicotinic AChR in
hippocampal neurons reveals regulated con-
Single Particle Tracking 421
Abstract
Engineered cell culture substrates are used to study how the spatial and temporal organization of proteins
influences cellular and molecular processes. These artificial microenvironments can be tailored with subcel-
lular resolution to mimic in vitro the distribution of proteins that cells encounter in vivo. Various different
methodologies can be used to fabricate these patterned substrates, depending on the specific characteristics
required. Optical protein patterning is a straightforward method for generating substrate-bound protein
patterns, which has the simplicity required to be implemented in typical life science laboratories. The
method described here is based on photobleaching of fluorescently tagged molecules and allows making
arbitrary patterns and concentration gradients of protein with submicron spatial resolution. Furthermore,
patterns can combine several different proteins simultaneously and use antibodies to bind a large spectrum
of molecules.
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7_23, © Springer Science+Business Media New York 2015
423
424 Santiago Costantino
2.3 Setup: General LAPAP requires low-power lasers for which only minimal safety
Considerations precautions are necessary, and the overall implementation is rela-
and Laser tively simple. The wavelength of the laser has to be chosen for
Specifications photobleaching the dye of choice. Nevertheless, there is a trade-off
between an optimal wavelength, ease of use, and price. As opposed
to ion lasers, diode lasers offer the advantage of having very low
prices and analog modulation, which dramatically simplifies the
setup and automation of the process. They are typically operated
by power supplies that have a 0–5 V input that is internally con-
verted into laser power. The laser intensity can, therefore, be con-
trolled varying an analog voltage connected to the input of the
laser power supply, which allows creating a very simple computer
interface. Nowadays, diode lasers that operate at 473 nm are sig-
nificantly less expensive than the ones at 488 nm. Therefore, even
426 Santiago Costantino
2.4 Setup: The most basic LAPAP setup needs three mirrors to direct the laser
Optomechanics beam to the sample. Metal-coated mirrors are ideal for this, since
and Laser Beam Path they have a very low cost and very high reflectivity in the visible
range. Gold, silver, and aluminum are comparable, but gold- and
silver-coated mirrors are ideal for this application. One-inch-
diameter rounded mirrors must be placed on kinematic mounts
that allow fine tilting to be able to accurately point the laser to the
sample. Both a mirror and its mount of good quality can be
acquired for a relatively low cost. An optical breadboard with
threaded holes will greatly simplify the setup of the components,
clamping the posts and adjusting mounts and optics.
A detailed explanation will follow the setup proposed in
Figs. 1 and 2.
The first two mirrors M1 and M2 are used to position the
beam in space, by adjusting both height and direction. The first
mirror M1 is adjusted to direct the beam to a desired height in M2,
and M2 to adjust the direction, usually at a constant height. The
third mirror, M3, is turned at approximately 45° so as to send the
laser beam vertically, in the direction perpendicular to the bread-
board. The microscope objective, or any focusing lens, is placed
right after M3.
As a general rule, all mirrors must be positioned so that the
laser impinges near their centers, where optical quality is optimal.
The mounts and posts should be placed, so that all mirrors are
located at approximately the same height. It is recommended to
adjust the beam height with M1 and keep the beam parallel to the
breadboard using an iris diaphragm on a post as a reference.
An XYZ translation stage is required to displace the sample,
and at least the two horizontal axes must be motorized; the vertical
axis does not need to be computer controlled. Since the orientation
of the sample with respect to the translation stage movement needs
to be very precisely adjusted, a kinematic mirror mount attached to
the translation stage is recommended as a sample holder.
LAPAP 427
Fig. 1 Schematic of the LAPAP optical setup. Two mirrors, M1 and M2, are used to adjust the beam direction,
before it reaches the sample. The back-reflection from the coverslip is directed to a camera using a wedge
window, W1. The image is focused by a lens, L2, to monitor the position of the laser focus on top of the sample
surface (color figure online)
3 Procedures
Fig. 2 Detailed schematic of the sample holder. A mirror, M3, is used to direct the
beam through the microscope objective to the sample. The sample is moved by
a three-axes translation stage, and both horizontal axes must be motorized and
computer controlled. Since the sample surface must be perfectly parallel to the
horizontal movement, a kinematic mirror mount is used as sample holder so as
to finely tune this angle (color figure online)
allow assessing if there are out of focus regions in the pattern, plus
they can be generated with the code provided in Sect. 3.3. Low
magnification (20×) objectives with relatively high NA (~0.7) are
practical to check the overall quality of the patterns.
3.2 Sample The first step is to coat the glass surface of the Petri dish with BSA
Preparation to minimize nonspecific binding. For this, use a 20-min incubation
in a 3 % solution of BSA in PBS by placing a drop near the center
of the cover glass, followed by rinsing the surface at least three
times with PBS. A 100 μL drop of BSA is usually enough to cover
the whole surface of glass-bottom dishes.
The sample must then be placed on the motorized stage and
the height must be adjusted, as detailed below in Sect. 3.5. This
adjustment should be performed before the drop of B4F solution
is placed in order to avoid photobleaching and an undesired spot
of protein concentration where this operation was performed.
See Note 2.
LAPAP 429
Fig. 3 The basic procedure for LAPAP. (a) The substrate is incubated for passivation with BSA. (b) B4F is
photobleached and bound to the surface by a moving laser. (c) Nonbound molecules are rinsed with PBS.
(d) Fluorescently tagged streptavidin is used to reveal the pattern and become a scaffold to bind biotinylated
molecules
Fig. 4 Functional LAPAP patterns. (a) Biotinylated peptides can be used. Since
streptavidin has four binding sites, beyond steric effects, approximately three
peptides will react with each molecule. (b) Primary and biotinylated secondary
antibodies represent an alternative approach for full protein LAPAP patterns.
Adapted from [11]. (c) Fluorescently tagged antibodies can replace B4F and be
combined with primary antibodies to bind full proteins to the pattern. Different
color antibodies can be used to create multicomponent patterns
LAPAP 431
Fig. 5 Examples of LAPAP patterns. (a) Cy5-Streptavidin miniature reproduction of Albert Einstein. Scale bar:
50 μm. (b) Two-component patterns by photobleaching FITC and Cy5-conjugated antibodies simultaneously
illuminated by 473 and 671 nm lasers. In green: FITC goat anti-rabbit IgG + rabbit anti-laminin + FITC goat
anti-rabbit IgG. In red: Cy5 goat anti-mouse + mouse anti-myc + Cy5-goat anti-mouse
photobleach one type of molecule. Thus, blue and red lasers are
strongly suggested as they efficiently photobleach FITC and Cy5
dyes. In addition, the selection of antibodies must avoid cross-reac-
tivity between species; the tagged secondary antibodies should target
two primary antibodies made in different animals (see Fig. 4).
Examples of one- and two-molecule patterns are shown in Fig. 5.
3.3 Software Custom software is needed to control the movement of the sample
and Automation and the intensity of the laser. The software must link the position
and the laser intensity, so that as the sample moves, the power is
adjusted to obtain a desired protein pattern. We suggest dividing
the procedure in two: a routine that generates text files containing
information about positions and intensities to create a specific pat-
tern, and a separate piece of software that reads these text files and
controls the motors and lasers.
As an example, in order to create a squared pattern of linearly
increasing power, a possible sequence of commands would be as
follows:
1. Move the laser along the first line at a constant illumination
power.
2. Turn off the laser, come back to the origin.
3. Displace the sample perpendicularly.
4. Turn the laser on at a higher power and move it along the second
line.
5. Turn it off and move back.
Repeat this procedure by subsequently increasing laser power
until the square is complete.
432 Santiago Costantino
originX originY 0
originX + xLength originY Volt0
originX originY + ySpacing 0
originX + xLength originY + ySpacing Volt0 + 1*(VoltF-
Volt0)/numberLines
originX originY + 2*ySpacing 0
originX + xLength originY + 2*ySpacing Volt0 + 2*(VoltF-
Volt0)/numberLines
…
originX originY + N*ySpacing 0
originX + xLength originY + N*ySpacing VoltF
3.4 Alignment Place all mirrors and a glass-bottom dish as shown in Figs. 1 and 2,
Procedure but not the last focusing lens. The angles of the mirrors should be
such that after reflection on the coverslip, the laser beam comes
back along the same path toward the laser output. The critical element
is the last mirror M3, since its orientation should be very precisely
adjusted for reflecting the beam perpendicularly to the cover glass,
trying to maintain the sample plane parallel to the breadboard. It
is highly recommended to use a piece of paper to retrace the trajec-
tory of the back-reflection, since it is dim.
Once this is achieved, place the focusing element. It is important
to note that the axis of the focusing element must be not only
parallel, but collinear with the beam, and controlling this with
high NA objectives is challenging. One option is to first make a
mark in the ceiling where the collimated laser points and use this
mark as a reference to check for deviations when the lens is placed
in the beam path.
Tight focusing of high NA objectives on the surface of the
sample is essential for high-resolution patterning. For doing this
accurately, a wedge window, W1, is placed between M2 and M3 to
direct the back-reflection of the beam from the sample to a CCD
camera, as shown in Fig. 1. A long distance lens is used to focus
such reflection directly onto the CCD chip. Therefore, the dis-
tance from the CCD to the lens must be adjusted to match the
focal length. The quality of the camera for this is not essential, and
a low-cost webcam can be used, but the built-in lens has to be
removed.
In this configuration, when the sample is positioned at the
focus of the objective, the size of the back-reflection spot on the
CCD is minimum. Thus, the sample-objective distance can be
adjusted by slowly moving the z-axis until the laser spot on the
camera becomes the smallest. When using coverslips and high NA
objectives, while the distance from the sample to the objective is
changed, one can notice two positions at which the image of the
back-reflection is the smallest. These two positions correspond to
the reflections originating at the two interfaces of the coverslip,
and one needs to identify the one that corresponds to the upper
surface, where the biotin solution will be placed.
The sample surface must be parallel to the direction of
movement of the translation stage. Special attention must be paid
to this angle and one should make sure that the sample is not tilted
(see Note 5). In order to check that this angle has been adjusted
properly, the size of the focal spot on the CCD camera must not
change when the sample is moved horizontally.
434 Santiago Costantino
The size of the focal spot of the laser at the sample depends on
the lens or microscope objective that is used. High NA objectives
will render micron- and submicron-sized spots, provided that the
back-aperture is overfilled. The density of photons on the substrate
depends on both the laser power and the focal volume; thus the
two parameters must be adjusted to optimize the dynamic range of
concentrations for different velocities. As an example, when over-
filling the back-aperture of a water immersion 1.2 NA objective [2]
laser power was set at approximately 100 μW at 473 nm, for a lens
of 50 mm of focal length, 1–5 mW.
Finally, a good characterization of the laser spot on the surface
is important for creating protein patterns. Since patterns are made
by a sequence of lines defined by the movement of the laser, the
spacing between such lines must be carefully chosen. Furthermore,
since the spatial concentration profile follows the laser profile,
which is usually Gaussian or bell-shaped, an adequate distance can
minimize concentration ripples and undesired fluctuations within
the pattern area.
References
Adalberto Merighi and Laura Lossi (eds.), Immunocytochemistry and Related Techniques, Neuromethods,
vol. 101, DOI 10.1007/978-1-4939-2313-7, © Springer Science+Business Media New York 2015
437
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
438 Index
Alexa (cont.) Animal(s).................................. 20, 21, 46, 63, 64, 72, 73, 81,
555 ........................................................................363 114, 127, 130, 134, 136, 137, 142–144, 146–148,
568 .............................................98, 99, 258, 275, 395 156, 158, 161, 164, 181, 182, 196, 200, 201, 207,
568: streptavidin ........................... 363, 366, 367, 370 210, 211, 213, 226, 229, 230, 236, 240, 241, 244,
594 ..................... 58, 98, 127, 159, 162, 167, 174, 301 246, 247, 261, 292, 295, 299, 318, 323, 329–331,
647 ................... 58, 258, 260, 275, 392, 395, 397–406 335, 339, 348, 349, 357, 362, 380, 414, 431
Algorithm(s) ...............................................9, 17, 24, 25, 261, Anlage(s) .......................................................................... 155
265–267, 271, 402, 432 Anterior ....................................... 52, 53, 64, 88–90, 318, 365
Aliasing ............................................................................264 Anterograde(ly) ................... 21, 300, 304, 305, 307, 308, 315
Aligning marker ...............................................................387 degeneration ...............................................................313
Alignment ................................................ 276, 384, 433–434 Antibiotic(s) .................................. 83, 86, 340, 343, 349, 412
Aliquot(s) ............................. 41, 43, 57, 58, 83, 84, 183, 206, Antibiotic/antimycotic solution ........................................340
324, 398, 399, 406 Antibody(ies)
Alkaline buffer .................................................................. 363, 370
phosphatase (see AP) diluent.............................................72, 73, 114–116, 213,
phosphatase (AP)-anti-AP (see APAAP) 220, 260, 263, 404
Alkyne ..............................................................................125 dye complex ................................................................419
Allergenic .....................................................................40, 41 specificity ............................................ 190, 260, 292, 371
Allograft inflammatory factor-1. See AIF-1 Antidepressant ..................................................................144
ALS (amyotrophic lateral sclerosis) .................. 195–207, 247 Anti-digoxigenin antibodies ...............................................21
Aluminum ................................................ 204, 275, 398, 426 Antifade.........................................98, 99, 260, 341, 370, 380
Alzheimer’s disease. See AD Antigen(s)
American cockroach ...........................................................39 antibody reaction .....................................1, 3, 5, 6, 11, 18
Amine(s)...................65, 71, 74, 275, 301, 305, 315, 325, 404 concentration ..............................................................276
Amino acid(s) .........................................2, 4, 8, 65, 154, 210, retrieval ................................. 4, 8, 97, 115, 125, 128, 135,
213, 226, 283, 285, 292–294 182, 184, 185, 187, 188, 190, 237, 238
7-Aminoactinomycin D. See 7-AAD Antigenic determinant..................................................1, 211
Ammonia water ........................................................212, 215 Antigenicity ................................ 5, 7, 10, 18, 20, 56, 91, 105,
Ammonium chloride (NH4Cl) ................. 316, 319, 324, 396 125, 135, 241, 383
Amoeboid microglia .........................................................211 Antioxidants .............................................................234, 340
Amount .................................. 24, 41, 43, 48, 59, 81, 90, 105, Antiparvalbumin (PV) ......................257, 258, 263, 277, 316
124, 125, 128, 129, 131, 133, 179, 207, 315, 318, Anti-rabbit IgG ........................................ 115, 198, 258, 431
319, 324, 330, 335, 351, 352, 382, 406, 424 Antiserum(a) .......................................................... 47, 48, 57
AMPA-receptors ..............................................................416 Anxiety .............................................................................142
Ampicillin................................................................. 340, 349 Aorta ........................................................................ 318, 380
Amplification ........................... 9, 11–13, 132, 183, 200, 222, AP5 ..................................................................................362
325, 340, 343, 364, 365, 369, 388 AP (akaline phosphatase) ..................................... 11, 13, 131
Amplifier .................................................... 11, 317, 323, 363 APAAP (alkaline phosphatase (AP)-anti-AP) .............4, 131
Amplitude .......................................................... 74, 300, 325 APC (allophycocyanin) .............................................. 14, 143
Amyloid Aperture diaphragm .........................................................276
β (see Aβ) Apical dendrite ......................................... 320, 364, 366, 367
precursor protein (see APP) Apoptosis.............................................21, 153–175, 245, 349
Amyloidosis ......................................................................180 Apoptotic
Amyotrophic lateral sclerosis. See ALS body(ies) .....................................................................155
Analog to digital converter ...............................................426 cells(s) ...............14, 21, 154, 161, 169, 171, 172, 241–243
Analyze..................................... 25, 49, 58, 59, 287, 288, 290, APP (amyloid precursor protein)............................. 179–182,
291, 295, 351, 378, 387 184–186, 188–191
Anatomical .............. 18, 51–54, 300, 305, 306, 360, 378, 387 APP/PS1KI mouse...........................................................182
Anatomy ............................................................. 64, 104, 357 Aquaporin(s) ....................................................................228
Anesthesia ................................. 114, 144, 317, 318, 323, 418 Aqueous.................................... 128, 129, 133, 136, 200, 212,
Anesthetic(s) .................................. 71–73, 83, 113, 127, 143, 216, 220, 239, 304, 325, 333
157, 237, 244, 301, 339, 378, 412 Arborization(s) ............................................. 47, 50, 121, 325
Angiogenesis ............................................................228, 232 Architecture ................................. 2, 65, 82, 89, 346, 377, 390
Angle ...................................................26, 302, 364, 428, 433 Archival material ......................................................211, 212
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
Index
439
Area Axon(s)
density ................................................ 289, 290, 293, 296 axon terminal(s) ........... 259, 263, 281, 282, 288, 314, 318
postrema .............................................................226, 236 collateral(s) ................................................................. 314
Argon (Ar) laser ................................50, 58, 68, 69, 146, 350 Axonal
Array tomography. See AT branches ................................................ 89, 307, 314, 325
Arsenic ...............................................................................41 connectivity.................................................................360
Artifacts ................................................13, 25, 129, 184, 189, growth ........................................................................195
259, 276, 394, 399 transport .............................................................314, 390
Artificial
cerebrospinal fluid (see ACSF) B
diffusion......................................................................418 BAC (bacterial artificial chromosome) .................. 83, 89, 90,
micro-environments ...........................................423, 424 359, 360
Ascite(s)..............................................................................43 Background
Ascorbic acid ............................................................135, 340 labeling ................................................. 47, 295–296, 394
Aspartate ..........................................................................295 staining ...................... 45, 47, 48, 215, 216, 220, 222, 399
Aspergillus niger.......................................................... 105, 316 Back-propagating axon potentials ....................................325
Association(s) .............................. 65, 182, 378, 384, 385, 390 Back-reflection .........................................................427, 433
Associative neurons ..................................................317, 318 Bacterial artificial chromosome. See BAC
Astrocyte(s) .............................. 112, 120, 226–228, 230, 231, Bacterium(a) ............................................................. 332, 343
245, 281, 282, 293, 348 Ballistics ...........................................................................334
Astroglial factors...............................................................229 Band(s) ..................................................... 201, 292, 350, 369
Asymmetrical Bandwidth ........................................................................106
branching ....................................................................323 Bar(s) .................................... 53, 55, 163–167, 169, 171–173,
synapses ......................................................................309 188, 203, 205, 239, 302, 305–308, 315, 318, 346,
AT (array tomography) .............................................377–387 348, 383–385
Ataxia ...............................................................................134 Barrier ...........................................5, 174, 214, 225–248, 418
Atg5.......................................................... 159, 160, 164, 165 Basal lamina ............................................. 226, 227, 231, 233
Atg7.................................................................................. 156 Basement membrane .................226, 227, 229, 231–233, 243
Atlanto-occipital membrane .............................................302 Base pairs (Bp) ......................................................... 201, 332
Atlas ......................................................................... 364, 380 Basket cells ...............................................................263, 307
Atom(s) ............................................................................ 137 Bax.................................................................... 159–161, 163
ATP .......................................................................... 293, 338 BBB (blood–brain barrier)........................................ 225–248
Atrium ..............................................................................114 B50 cells .................................... 166, 169, 170, 172, 173, 175
Atrophy ............................................................ 155, 174, 179 BDA (biotinylated dextran amine) .................. 301, 303–305,
Attachment .......................................100, 333, 381, 387, 414 307–309, 316–319, 321, 324, 325
Atto 488 ........................................................................... 395 Beam ........................................ 9, 15, 16, 26, 27, 49, 55, 392,
Attracting potential ..........................................................419 397, 426, 429, 433
Autoclave .............................................................. 83, 84, 213 path............................................................. 426–427, 433
Autofluorescence ....................... 10, 58, 59, 76, 105, 275, 361 Beclin-1 ............................................ 156, 159–161, 166–169
Autofluorescent .................................................. 97, 114, 259 Beclin-2 ............................................................................ 156
Autolytic .............................................................................57 Bedding ............................................................................134
Automated........................................ 113–115, 222, 384, 385 Beeswax ............................................................................219
cell counter .................................................................412 Behavior(s) ............63, 65, 81, 82, 126, 262, 334, 360, 409, 424
Automatic staining devices ...............................................189 Behavioral ............................................................... 63, 64, 82
Autophagosome(s)............................................ 156, 172, 174 Bell-shaped .......................................................................434
Autophagy ................................................................153–175 Benchtop centrifuge .....................................................42, 45
Autopsy ............................................................ 189, 190, 241 β-galactosidase (β-GAL) .......................................... 337, 338
Autoquant’s adaptive Blind deconvolution βIII tubulin ................................................... 96, 97, 100, 101
algorithm ........................................ 261, 266, 267 β-particle ..........................................................................124
Autoradiography...............................................................124 B4F (biotin-4-fluorescein) ................425, 427–430, 434, 435
Avidin–biotin–peroxidase complex. See ABC Bifurcating ........................................................................314
Axial resolution ............................................ 17, 24, 260, 266 Bifurcations ......................................................................314
Axis ..................................... 24, 262, 321, 364, 366, 426, 433 Bilaterally ................................................................. 201, 314
Axodendritic .....................................................................290 Bilirubin ...........................................................................226
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
440 Index
Binary Blue ...................................... 13, 14, 17, 55, 84, 86, 117, 128,
expression system ..........................................................49 132, 133, 135, 136, 169–173, 189, 197, 205, 215,
image(s) .............................................................. 266, 384 226, 229, 230, 237, 240, 243, 245, 273, 274, 282,
mask ...........................................................................415 291, 314, 338, 340, 351, 383, 415, 431
segregation ..................................................................266 Blur............................................................. 15, 267, 394, 407
threshold segmentation...............................................266 B-lymphocytes......................................................................1
Binding BME (Eagle basal medium) ............................................. 340
buffer .......................................................... 343, 413–415 Bone ..................................................183, 201, 303, 318, 364
specificity ........................................................................2 Bootstrap ..........................................................................276
Biocompatibility ...............................................................333 Border(s)......................................55, 132, 230, 287–289, 416
Biocompatible surface coatings.........................................410 Boric acid.................................................................. 412, 413
Biocytin ..............................................21, 317, 324, 325, 359, Borosilicate glass capillaries ..............................................316
361, 362, 366 Bouin’s fixative ..................................................................217
Biogenic amine(s) ................................................... 65, 71, 74 Bovine
Biolistic(s)................................. 331, 334–336, 341, 343–344, pituitary extract...................................................198, 207
346, 348, 353 serum albumin (see BSA)
Biological vector(s) ...................................................330–333 Bp. See Base pairs (Bp)
Biomimetic substrate(s) ....................................................424 Br-3 .................................................................................. 131
Biomolecule(s) .......................................................... 410, 423 Brain(s)
Biosafety cabinet........................................... 98, 99, 127, 134 adult tissue ..................................................................130
Biotin bank(s) ........................................................................211
conjugated ..........................................................302, 303 blocker ................................................................ 362, 364
4-fluorescein (see B4F) edema .........................................................................228
Biotinylated embryonic tissue .........................................................130
antibody(ies) ................................................. 11, 215, 216 homogenate(s) .................................................... 292, 293
dextran amine (see BDA) infection(s)..................................................................228
fab antibody ................................................................414 slice(s) ................................................... 21, 363–365, 418
fab fragment .......................................................410, 412 trauma ........................................................................244
secondary antibodies .................................. 113, 128, 160, tumor(s) ......................................................................247
186, 429, 430 Brainstem ................................................................. 314, 360
Bipolar ................................................................................95 BrdU (bromodeoxyuridine) ............................... 21, 100–112,
Birth ......................................................... 3–5, 124, 125, 360 120, 123–137, 142–148
Birthdate .................................................................. 125, 131 Breadboard ....................................................... 425, 426, 433
Bis-benzimides .................................................................135 Breeding .............................................................................82
Black............................11, 23, 44, 55, 56, 126, 262, 275, 276, Bregma .............................................................................318
304, 305, 308, 313, 319, 321, 322, 386, 417 Bright field ............................................... 301, 303, 304, 350
Blade......................................... 10, 47, 72, 74, 275, 339, 351, Brightness ............................. 15, 49, 173, 364, 395, 403, 418
362, 364, 379–381 Bromodeoxyuridine. See BrdU
Blastomere ....................................................................85, 86 5-Bromo-2'-deoxyuridine. See BrdU
Bleach ....................................................................... 134, 406 Bromouracil ......................................................................137
Bleaching .......................................................3, 13, 17, 49, 59 Brown .....................................................11, 23, 84, 136, 186,
solution ...................................................................72, 74 303–305, 321, 322, 338
Blebbing ................................................................... 155, 166 Brownian
Blind deconvolution algorithm ......................... 261, 266, 267 diffusion......................................................................416
Blinking ...............................................17, 394, 406, 415, 695 motion ........................................................................409
Block(ing) Bruchpilot...........................................................................52
buffer ................................... 237, 238, 382, 396, 400, 401 Brush ................................................................ 345, 379–381
serum .................................................................... 71, 237 BSA (bovine serum albumin ) ......................70, 98, 114, 199,
solution ........................... 45–47, 57, 72–74, 99, 132, 186, 212, 302, 341, 379, 396, 412, 424, 425
212, 213, 215, 221, 226, 263, 284, 302, 304, 382 B6SJL-TgN(SOD1-G93A)1Gur mice ............................196
Blood B27 supplement ................................................ 340, 411, 413
–brain barrier (see BBB) Bubble(s) ................59, 84, 207, 263, 275, 352, 381, 386, 401
vessels ............................. 6, 105, 226–228, 231, 234, 240, Buffer(s) .............. 41, 72, 73, 87, 99, 113, 115, 127, 128, 135,
243, 248, 296 143–146, 157, 160, 182, 184, 185, 187, 188, 200,
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
Index
441
211, 214, 220, 237, 238, 243, 259, 263, 284, 286, Cationic
301, 303, 316, 339, 341, 343, 361–363, 370, 378, lipid(s) ................................................................ 333, 342
379, 382, 387, 394–397, 400, 401, 406, 413–415 liposome(s) ................................................. 331, 333, 341
solution ...............................................................220, 413 polymer(s)...................................................................333
Buffered formalin .....................................................217, 241 Caudate–putamen (CP) .................................. 132, 239, 241,
Buffering action ................................................................333 243–246, 331
Bullet ........................................................ 334–336, 344, 352 Cav2.1 .............................................................. 300, 306, 307
PC-knockout mice .....................................................306
C Cavalieri’s method ....................................................118, 119
3C11 ................................................................................... 52 C57BL/6 .................................................................. 146, 147
14
C ....................................................................................142 Cbln1................................................................................ 300
CA1 ...................................................133, 181, 182, 188, 246 CCD (charge-coupled device) ........................... 18, 261, 277,
Ca2+ 316, 321, 350, 362, 365, 393, 405, 425, 433
channel(s) ........................................................... 300, 306 camera .................................. 18, 261, 316, 317, 321, 350,
influx...........................................................................306 362, 365, 405, 425, 433
and Mg2+-free PBS .....................................................339 chip .............................................................................433
CA3 ..................................................................................133 CCR5 ...............................................................................248
Cacodylate ......................................................................8, 41 CD1 ................................................................................. 342
Calbindin.................................. 159, 160, 166, 167, 300, 301, CD31 ........................................232, 236, 239–241, 247, 248
303, 305–307, 309, 316, 319, 321, 322 CD68 ...............................................................................210
Calcium. See also Ca2+ CD90.2 antibody ..............................................................198
binding protein ........................................... 210, 319, 325 CD11b .............................................................................210
concentration(s) .......................................................... 371 Cdh13 ................................................................................ 360
indicator .................................................................21, 22 cDNA ....................................................... 334, 346, 348, 349
phosphate ........................................... 303, 330, 331, 353 CECs. See Cerebral microvessel endothelial cells (CECs)
precipitation................................................................303 Cell(s)
sensor(s) ........................................................................59 birth ............................................................................131
Callosal neurons ...............................................................317 body(ies) .............................. 164, 219, 308, 314, 389, 390
Calmodulin.......................................................................210 counter ....................................................................49
Calretinin ................................................................... 70, 319 compartment(s) ...................................... 20, 51, 342, 419
Cameleon(s) .......................................................................59 counting chamber .......................................................412
Camera ..................................... 17, 18, 26, 54, 114, 119, 173, culture(s) .........................................96–99, 104, 176, 197,
174, 261, 303, 316, 317, 321, 350, 362, 365, 393, 229–230, 329–353
397, 402, 403, 405, 413, 425, 427, 433 substrates ..............................................................424
Cancer ...................................................... 153, 154, 156, 358 cycle ...........................25, 26, 84, 111, 112, 120, 123, 124,
Cancerogenic ................................................................40, 41 126, 129–131, 136, 277
Capillary(ies) .................................................... 226, 227, 230 markers ................................................. 111, 112, 120
Capture ........................................ 20, 180, 264, 265, 366, 367 damage ...............................................................345, 352
Carbodiimide ...........................................................284, 285 death .............................. 14, 129, 154, 155, 174, 175, 241
Carbogen .................................................. 317, 323, 364, 365 division ................................... 82, 90, 111, 112, 120, 124,
Carbohydrate(s) .......................................................... 20, 172 126, 129, 136, 137, 332
Carbosilane .......................................................................333 line(s) ................................ 2, 43, 175, 229, 230, 232, 249,
Carboxylic acids ................................................ 285, 395, 404 329, 342, 351, 397
Carcasse(s) ........................................................................134 membrane ...............................20, 21, 323, 331, 333–335,
Carcinogen ...............................................................222, 324 339, 400, 411
Carnoy’s solution ..............................................................158 number(s) .................... 118, 120, 124, 128, 135–137, 206
Carrier ..................................................8, 232, 330, 331, 334, penetrating peptides (see CPPs)
335, 341, 351 proliferation ........................................111, 112, 120, 124,
protein(s) ................................................................66, 74 125, 135
Cartridge(s) ...................................................... 263, 343–344 strainer ........................................................ 197, 198, 202
Caspase(s) .......................... 155, 159, 162, 166, 169, 174, 175 surface carbohydrates ....................................................20
CAT (choline acetyltransferase) ............................... 8, 52, 53 suspension(s)................................................... 2, 202, 351
Catalase ............................................................................397 viability .................................................................14, 335
Catecholamine(s)................................................................65 volume ................................................................ 155, 169
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
442 Index
Complexity ..................................1–28, 63, 64, 359, 370, 371 Coplin jar(s) ............................................................... 98, 220
Computation ....................................................................321 Coronal...................................... 236, 238, 262, 319, 364, 365
Computational............................................................17, 264 Corpus callosum ...............................................................360
Computer Correction collar ...............................................................276
assisted image analysis ..................................................19 Correlation(s)
interface ......................................................................425 based drift correction ..........................................404, 406
Concentrate ................................................................43, 343 coefficient(s) ................................ 271, 273, 274, 404, 407
Concentration(s)........................... 7, 8, 27, 41, 43, 47, 48, 56, Correlative light and electron microscopy. See CLEM
57, 76, 106, 128, 160, 180, 191, 202, 207, 221, Cortex................................. 26, 132, 134–136, 153, 161, 182,
245, 276, 283, 285, 293, 294, 343, 349, 351, 352, 185, 217, 247, 262, 313, 317, 318, 320, 346, 353,
371, 395, 398, 399, 401, 404, 406, 410, 414, 415, 359–361, 363–365, 368–371, 378, 389
424, 427, 428, 433, 434 Cortical
Condensation ...........................................................155, 171 area ..................................................................... 136, 314
Conditional ......................................................................358 circuitry.......................................................................259
Cone(s) ................................................................. 24, 55, 304 development ...............................................................315
Confined motion ..............................................................410 network(s).................................... 360, 361, 366, 370, 371
Confinement neuron(s).............. 182, 189, 315, 320, 321, 323, 365–366
area ..................................................................... 416, 418 projection neuron(s).................................... 360, 367, 369
domain................................................................416–418 Cortico
Confocal callosal ........................................................................368
laser cortical ........................................................ 317, 318, 320
microscope .............................. 71, 212, 217–219, 307 spinal ...........................................226, 248, 324, 342, 360
microscopy .............................211, 212, 214, 218, 220 thalamic ..............................................................317, 368
scanning Co-storage ............................................................................4
microscope ................................98, 260, 304, 307, Co-transfection ........................................................335, 414
338, 341, 342 Counterstain ...........................5, 99, 100, 115–117, 131–133,
microscopy (see CM) 135, 136, 142, 160, 169–173, 186, 187, 189,
Conjugation ................... 8, 67, 68, 70, 74, 315, 398, 404, 418 214–216, 218, 219, 346, 348
Connection(s) ..................................... 15, 21, 23, 65, 81, 111, Counterstaining ................................115–117, 183, 186, 187,
299–309, 313, 314, 321, 389 189, 216–219, 346
Connectivity .................... 8, 65, 300, 309, 325, 360, 377, 387 Counting .............................. 51, 65, 116–120, 142, 146, 181,
Connectome(s) .............................................................20, 81 260, 286, 293, 412
Constrained iterative deconvolution algorithm ................266 COUP-TF interacting protein 2. See CTIP2
Construct(s)....................................... 82, 83, 89, 90, 332, 337 Cover glass(es) .............................................. 71, 98–100, 260
Contact cement ........................................................379, 381 Cover slip(s) ..................26, 42, 43, 45, 85–88, 100, 160, 186,
Contamination ................................................. 343, 344, 371 197, 198, 200, 202, 204, 234, 264, 275, 319,
Content ................................. 21, 76, 172, 277, 295, 352, 424 340, 342–345, 351, 364, 366, 370, 379–382,
Contralateral............................................. 240, 243, 317, 360 386, 397, 400, 401, 404, 412, 414, 418, 424,
Contrast.................................... 27, 49, 50, 52, 124, 173, 180, 425, 427, 433
203, 209, 221, 229, 260, 264, 269, 277, 286, 305, Cow ..................................................................................229
319, 358, 364, 365, 370, 382, 384, 393, 409 CPPs (cell-penetrating peptides) ......................................333
Control(s) ................................. 12, 13, 27, 47, 48, 64, 65, 86, Cranium ................................................................... 183, 364
97, 99, 105, 112, 114, 144, 146, 147, 155, 158, Cre-lox system ..................................................................358
160, 161, 163–166, 168–173, 180, 195, 196, 200, Cre recombinase ...............................................................315
213, 231, 233, 238, 240, 243–246, 260, 277, 292, Cresyl violet ..............................................................128, 133
293, 337, 347, 359, 360, 364, 368–371, 383, 387, Crim1................................................................................360
393, 394, 398, 424, 427, 431, 432 CRISPR/Cas ......................................................................82
experiments.........................................................260, 277 Critical angle ......................................................................26
Controller ......................................................... 261, 321, 341 Cropping ..........................................................................364
Conventional wide-field microscopy ..................................17 Cross
Convergent evolution .........................................................65 adsorbed .......................................................................98
Convolution......................................................................276 correlating ...................................................................415
Coordinate(s).....................................245, 247, 288, 318, 403 linking ...................................................... 7, 44, 399, 424
Coordination ......................................................................64 reacting ............................ 48, 58, 105, 186, 190, 292, 293
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
444 Index
Dendrite(s) ................................. 51, 110, 111, 121, 164, 166, Diameter(s) .............................. 16, 24, 42, 90, 271, 276, 283,
167, 174, 281, 282, 299, 304–307, 309, 319–322, 294, 318, 335, 336, 350, 390, 412, 426
325, 364, 366, 367, 378, 389–391 Diamidino Yellow .............................................................314
Dendritic Diamond knife .........................................................379, 381
arbor(s) ....................................................... 315, 323, 324 Diarrhea ...........................................................................134
branching ....................................................................323 DIC
reticulum cells .............................................................105 images ................................................................. 365, 366
spike(s)........................................................................ 325 optics .......................................................... 362, 365, 366
spine(s) ................................ 263, 282, 315, 320, 325, 415 Dichromatic vision .............................................................55
tree(s) ........................... 167, 313, 315–317, 321–323, 367 Differentiated ................................................. 63, 96, 97, 367
Dense core vesicles ................................................... 4, 50, 51 Differentiating ............................................ 95–106, 153, 175
Density(ies) .............................. 116, 118, 119, 125, 161, 168, Differentiation ................................96, 97, 99, 100, 110, 111,
206, 263, 264, 283, 286, 287, 289–291, 293–296, 120, 124, 129, 130, 175, 195, 423
342, 346, 351, 357, 383, 390, 393–395, 397–398, Diffracted light .............................................................17–18
402, 414, 424, 434 Diffraction
Dentate gyrus. See DG limited region ...............................................................25
Deoxyribonuclease (DNAse) .............143, 145, 146, 340, 342 limited size .................................................................424
Deoxyribo nucleic acid (DNA) Diffusion ............................................ 3, 5, 7, 9, 45, 226, 283,
gold bullets .........................................................334, 336 399, 409, 410, 414, 416–419, 424
modifications ................................................................21 coefficient ...........................................................416–418
repair...........................................................................137 -trapping.....................................................................409
stock solution ..............................................................352 Digital
synthesis ..................................................... 123, 136, 137 camera ........................................................ 114, 173, 303
Deparaffinization..............................................................213 controller ....................................................................321
Depolarization ..................................................................306 Digitizer ...........................................................................363
Depth discrimination .......................................................260 Digoxigeninated nucleotides ..............................................21
Desmin ............................................................. 105, 227, 236 DiI ................................................................................14, 20
Detection ...............................3, 4, 6, 8, 17, 18, 22, 48, 71, 97, Dilation ............................................................................271
105, 109–121, 124, 125, 131, 156, 173, 179–191, Dilation mask ...................................................................271
212, 213, 231, 235, 239, 240, 277, 285, 292, 319, Diluent solution.............................72–74, 114–116, 260, 263
325, 350, 361, 362, 364, 368, 370, 371, 402, 403, Dilution(s) .............................. 27, 43, 47, 48, 57, 59, 76, 105,
410, 416 106, 133, 162, 187, 191, 199, 202, 204, 221, 258,
Detector(s)................................... 15, 24, 25, 49, 88, 260, 261 343, 394, 415
sensitivity ................................................................49, 88 Dimension(s) ................................. 24, 54, 264, 265, 403, 416
Detergent ...................... 56, 57, 100, 131, 186, 187, 283, 400 Dimethyl sulfoxide. See DMSO
Deterministic ....................................................................423 Dinitrophenol ...................................................................248
Deuteranopes......................................................................55 DiO ..............................................................................14, 20
Developing Diode laser(s) ............................................. 15, 146, 424, 425
brain ................................................................... 124, 209 Direction ............................... 26, 88, 276, 390, 426, 427, 433
solution ............................................... 186, 212, 301, 303 Directional transport ........................................................230
Development .............................. 3–5, 7–9, 15, 18, 19, 24, 39, Direct STORM. See dSTORM
40, 43, 51, 82, 90, 91, 95–97, 109, 111, 125, 130, Disadvantage(s) .................................. 6, 7, 12, 13, 17, 44, 58,
135–137, 153, 155, 175, 210, 214, 229, 259, 266, 111, 116, 119, 125, 230, 330, 331
281, 299, 300, 304, 305, 309, 315, 319, 349, 357, Discomfort .......................................................................318
358, 360, 368, 369, 409 Disease ..................................... 100, 101, 153, 154, 156, 175,
Developmental Study Hybridoma Bank. See DSHB 179–191, 195, 210, 228, 229, 231, 235, 245, 247,
Deviation(s) .............................................. 274, 323, 403, 433 248, 266, 358, 387
De-waxing ................................................................ 214, 220 Disector(s) ........................................................ 114, 118, 119
Dextran.............................. 230, 301, 305, 306, 315, 316, 324 Dishe(s) .................................. 42, 44, 56, 85, 86, 90, 98, 100,
DG (dentate gyrus) ..................................109–121, 129, 131, 115, 199, 200, 204, 220, 340, 344, 425, 428
141, 142, 148, 217 Disorder(s)................................ 142, 156, 179, 195, 196, 210,
Diagnostic .................................................3, 7, 9, 18, 19, 222 228, 235, 244, 245, 247, 248, 358, 419
Disposal ............................................................................134
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
446 Index
Disruption ................................ 170, 228, 229, 234, 235, 240, Drift ............................................ 17, 345, 353, 403, 404, 407
241, 243, 244, 248 correction .................................................... 403, 404, 406
Dissecting microscope ..............................41, 71, 84, 90, 319, Drifting ............................................................................352
339, 379, 381 Drill .................................................................. 301, 303, 315
Dissection ......................................... 1–28, 40, 42, 44, 56, 85, Drinking ................................................................... 129, 144
196–197, 200, 201, 207, 339, 350, 362 Driver(s) ...........................................................................426
Dissociation ......................................143, 197–198, 200–202, Drop(s) ................ 41, 44, 85, 99, 113, 160, 186, 204, 212, 342, 351,
207, 350, 401 380, 381, 385, 386, 401, 427–429, 434
Distance(s).................................. 25, 26, 42, 46, 88, 119, 124, Drosophila ................................................................6, 39–60
142, 264, 282, 283, 287, 289, 290, 292, 294, 295, ringer solution ........................................................40, 45
321, 344, 350, 385, 386, 394, 403, 433, 434 Drug(s) ..................................... 142, 158, 169, 172, 196, 228,
Distress .............................................................................134 230, 231, 390
Distribution ...............................1, 6, 7, 18, 22, 39, 65, 66, 82, resistance ............................................................154, 231
100, 117, 136, 161, 163, 169, 171, 210, 265, 273, Dry ice ...................................................71, 73, 259, 262, 263
286, 292, 294–296, 300, 358, 377, 378, 387, 418, Drying ....................................................57, 73, 99, 100, 207,
423, 424 214–216, 263, 387
DistToPath ...............................................................290, 291 DS (Down syndrome) ...................................................... 180
DistToRandomLine .........................................................291 dsDNA (double stranded DNA) ......................................332
DIV ...................................................342–344, 346, 406, 414 DSHB (Developmental Study Hybridoma
Divergent..........................................................................314 Bank) .................................................... 43, 51, 52
Dividing ................................................5, 209, 385, 398, 431 DsRed ..................................... 14, 21, 50, 337, 346, 348, 349
cells ......................................112, 123–125, 134, 142, 332 dSTORM (direct STORM)....................17, 25, 26, 393, 394
Division ................................ 82, 90, 111, 112, 120, 124, 126, Dulbecco’s minimal essential medium. See DMEM
129, 136, 137, 209, 332 Dulbecco’s phosphate-buffered saline. See DBPS
DLPFC (dorsolateral prefrontal cortex) ........................... 262 Dura mater .......................................................................318
DMEM (Dulbecco’s minimal essential Duration .....................129, 131, 217, 219, 221, 277, 324, 416
medium) ......................................... 157, 198, 202 Dwell time................................................ 416, 418, 419, 424
/fetal bovine serum (FBS).......................... 157, 197–199, Dye(s) ................................3, 9, 22, 58, 81, 87, 106, 135, 184,
201, 202, 204 214, 221, 226, 234, 236, 240, 275, 277, 318, 325,
DMSO (dimethyl sulfoxide) ............................. 83, 199, 206, 337, 341, 342, 347, 351, 394, 397–399, 404, 406,
237, 240, 284, 395, 398 410, 415, 419, 425, 427, 429, 431
DNA. See Deoxyribo nucleic acid (DNA) DyLight™
DNAse. See Deoxyribonuclease (DNAse) 488 ................................................................................ 58
Docking ..............................................................................27 594 ................................................................................ 58
Domain(s) ........................................210, 232, 233, 287, 299, 649 ................................................................................58
307, 333, 339, 390, 410, 416–418 DyLight Fluor .................................................. 183, 187, 349
Donkey ....................................................................... 57, 131 Dynamic range ........................................... 18, 264, 265, 434
serum ......................... 57, 98, 99, 234, 237, 238, 302, 303 Dynamics ..................................... 18, 26, 123, 124, 241, 264,
Dopamine ..................................................8, 65, 66, 100, 411 265, 409–419, 432, 434
Dorsal ......................................... 52, 53, 55, 88, 89, 183, 201,
207, 262, 302, 364 E
raphe nucleus .............................................. 378, 383, 385 6E10 .................................................................................190
Dorsolateral prefrontal cortex. See DLPFC Eagle basal medium. See BME
Dot blot(s) ................................................................ 292, 293 Ear .................................................................... 302, 315, 318
Double bars ............................................................. 302, 315, 318
helix ............................................................................126 Early markers ..................................................... 95, 100, 112
staining ....................................................... 54, 55, 58, 59 EB (embryoid bodies).........................................................97
stranded DNA (see dsDNA) EB (Evans blue) ....................................... 229, 230, 237, 243
Doublecortin. See DCX ECM (extracellular matrix) ...................... 231, 233, 235, 241
Douncer............................................................................144 E.coli .................................................................. 340, 343, 349
Downstream ......................................343, 360, 363, 368, 369 EDC (ethyl-dimethylaminopropyl-carbodiimide) ........... 284
Down syndrome. See DS Edge effects ......................................................................267
DPBS (Dulbecco’s phosphate-buffered EDTA ....................................... 143, 211, 213, 220, 340, 342
saline)...................................................... 144, 395 EdU (ethynyl deoxyuridine/5-ethynyl-2'-
DQ gelatin conjugate .......................................................240 deoxyuridine) ...................123–130, 134, 135, 137
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
Index
447
Effector(s)...................169, 171, 300, 339, 360, 363, 368, 369 Endocytosis ...................................................... 331, 333, 415
Efficacy............................................................. 154, 415, 416 Endo-exocytotic cycling ...................................................409
Efficiency.................................... 90, 244, 260, 261, 267, 330, Endogenous
331, 333, 335, 336, 352, 353, 397, 398, 404, 405 biotin .............................................................. 12, 13, 220
EF hand sites ....................................................................210 peroxidase ........................................... 160, 184, 214, 220
EGFP (enhanced green fluorescent protein) ............ 358, 360 Endoplasmic reticulum .............................................171, 172
EGL (external granular layer) ......................... 161, 163–167, Endosomal escape ............................................................333
169, 346, 348 Endosome(s)............................................................. 156, 333
Elastosil® .............................................................................56 Endothelial ........................226–233, 236, 239, 241–244, 248
Electro-acoustic modulator ..............................................434 Energy .............................................................. 334, 424, 427
Electrode ...........................................317, 323, 325, 365, 366 Engineered ............................................... 292, 334, 394, 424
tip ...............................................................................366 Engineering ...........................................9, 300, 337, 342, 424
Electron(s) Enhanced YFP. See EYFP
beam ...............................................................................9 Enhancement ....................................100, 286, 302, 304, 317
micrographs .........................282, 287, 288, 291, 293, 308 Enriched environment ..............................................111, 141
microscopic ........................4, 23, 281–296, 300, 307–309 Enrichment ..............................................................196, 291
microscopy ...................... 5, 22, 23, 56, 81, 127, 128, 130, Enteric neurons ....................................................................6
181, 282, 284, 285, 301, 303, 304, 309, 378, 396 Environment .....................................111, 141, 215, 415, 424
Electron dense .......................................................... 6, 18, 22 Enzymatic
marker(s) ......................................................................18 activities ........................................................................20
Electrophysiological ...............................20, 21, 65, 300, 307, antigen retrieval ..............................................................4
315, 323, 325, 358–361, 363, 366, 409 treatments ...................................................................125
Electrophysiology ..................20–22, 313–325, 359–364, 371 Enzyme(s) linked immunosorbent assay(s). See ELISA
Electroporated ..................................................................358 Epifluorescence...........................................................98, 364
Electroporation......................................... 132, 209, 331, 353 microscope ............................................................98, 364
Electrostatic ......................................................................295 Epilepsy .............................................228, 231, 235, 244, 247
Eledone cirrhosa .................................................................... 65 Epiplexus cells ..................................................................213
Elimination ....................... 155, 198, 200, 202, 207, 299, 300 Episomal.............................................................................82
ELISA (enzyme(s) linked immunosorbent Epithelial ..........................................................................155
assay(s))............................................... 2, 180, 338 Epithelium ................................................. 95, 195, 196, 201
Elution ......................................378–380, 382, 383, 386, 387 Epitope(s) ................................1, 2, 7, 13, 44, 47, 48, 59, 104,
EM (electron microscopy) ............................5, 22, 23, 56, 81, 131, 184, 190, 202, 210, 213, 214, 257, 283, 285,
127, 128, 130, 155, 181, 282, 284, 285, 301, 303, 293, 294, 400, 410, 415, 434
304, 309, 378, 379, 396 Epon812 ................................................................... 302, 304
blocking solution ........................................................304 Epoxy ......................................................................... 10, 285
EMBed 812 .............................................................. 379, 381 EPSCs (excitatory postsynaptic currents) .........................300
Embedded ................................ 47, 87, 88, 97, 158, 184, 187, Equimolar......................................................... 128, 129, 133
227, 282, 283, 285, 304, 361 ER81 ................................................................................ 360
Embedding Error(s) .......................118, 124, 128, 276, 287, 393, 403, 407
molds ......................................................................71, 73 ER-Tracker™ ........................................... 341, 342, 348, 349
station .........................................................................157 Erythrocyte(s)................................................................... 114
Embryo(s).........................5, 6, 68–70, 82, 85, 86, 89, 90, 232 Erythrosine .......................................................................351
Embryogenesis .................................................................154 Esophagus ..........................................................................64
Embryoid bodies. See EB Ethanol ................................42, 56, 72, 73, 98, 105, 113, 115,
Embryonic ............................ 82, 95, 100, 112, 130, 232, 301, 157–160, 162, 182, 184, 186, 187, 196, 200, 201,
339, 349, 360, 396, 412 211, 213, 214, 216, 217, 237, 238, 247, 286, 316,
Emission ..................................... 14, 17, 26, 50, 58, 106, 133, 341, 343, 344, 379, 380, 386
240, 258, 264, 275, 277, 338, 350, 361, 397, 405, Ethyl-dimethylaminopropyl-carbodiimide. See EDC
410, 413 5-Ethynyl-2'-deoxyuridine. See EdU
peak(s) ................................................................ 133, 240 Ethynyl deoxyuridine (EdU). See EdU
Emitting ..............................................17, 146, 394, 397, 415 Etv1..................................................................................358
Emulsion ..........................................................................124 Eukaryotic cells ........................................................332, 333
End Eukitt ....................................................................... 158, 160
foot(feet) .....................................................................226 Euthanasia ........................................................ 114, 244, 418
point(s) ............................................................... 321, 322 Euthanized ............................................... 134, 158, 241, 414
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
448 Index
Fixative(s) ..................................... 7, 8, 18, 40, 41, 45, 46, 56, Fluoride-resistant acid phosphatase. See FRAP
57, 59, 67, 68, 70–74, 83, 91, 104, 105, 114, 158, Fluorochrome(s)
182, 211, 213, 217, 220–222, 234, 241, 275, 284, conjugated
285, 293, 303, 318, 361, 364, 396, 399, 400 secondary antibodies ............................. 127, 234, 244
Fixed streptavidin ...........................................................214
cell(s) ............................................................................20 labeled albumin...........................................................229
tissue(s) ................................................2, 7, 183, 285, 363 streptavidin conjugate ................................. 212, 216, 221
FL-3 .................................................................................146 Fluorodeoxyuridine. See FdU
Flammable ..................................................................41, 182 Fluorogenic substrate .......................................................240
Flasks................................................................ 113, 157, 160 Fluoromount™ ....................................................... 71, 73, 74
Flat-embedding ........................................................380, 381 FluoroNanogold™.................................................. 18, 22, 23
Flow cytometry.........................................................141–148 Fluorophore(s) .................................... 3, 17, 25, 27, 105, 132,
Flp-out ...............................................................................51 133, 183, 187, 277, 315, 368, 391–395, 398,
Fluctuation(s) ........................................................... 226, 434 400–407, 410, 424, 426
Fluorescein conjugated streptavidin ...............................................325
conjugated antibodies .............................................3, 379 Fluoro-ruby ......................................................................325
isotiocyanate (see FITC) Fluoxetine......................................................... 143, 144, 148
Fluorescence Fly(ies)..............................................................39, 40, 44, 46,
based methods ............................................................357 48, 49, 337
channel(s) ................................................... 265, 269, 366 Flybow................................................................................51
free .............................. 114, 115, 128, 133, 212, 234, 239, FlyCircuit .........................................................................527
260, 325, 345, 352 Fly line(s) ...........................................................................39
imaging techniques .....................................................363 FM (fluorescence microcopy) .............................................21
intensity .......................... 50, 87, 129, 161, 168, 169, 266, FMRF-amide .....................................................................65
269, 271, 272, 276, 277, 353 Foamy virus(es) (FVs).......................................................332
microcopy (see FM) Focal volume.............................................................434, 435
microscope .............................. 3, 24, 41, 71, 99, 106, 128, Focus ................................ 15–17, 24, 49, 261, 335, 345, 353,
161, 221, 234, 240, 314, 338, 341, 350, 361, 367, 357, 358, 367, 384, 385, 393, 394, 410, 419, 424,
382, 393, 397, 427 427, 428, 433, 435
nanoscopy .....................................................................26 Focusing ................................ 40, 66, 119, 191, 426, 433, 434
recovery after photobleaching (see FRAP) element .......................................................................433
resonance energy transfer (see FRET) Foot processes ...........................................................226, 227
signal .......................................11, 50, 187, 259, 353, 380 Forceps ........................................... 41, 42, 44, 56, 73, 85, 87,
Fluorescence recovery after photobleaching (FRAP) ............409 88, 196, 201, 204, 318, 344, 350
Fluorescence resonance energy transfer Forebrain ...................................................... 89, 90, 100, 364
(FRET) ................ 22, 59, 337, 339, 346, 350, 352 Formaldehyde ...................................9, 40–41, 45, 46, 56, 70,
Fluorescent 71, 83, 87, 91, 143, 144, 217, 221, 285
azide ...........................................................................125 Formalin ............................... 9, 56, 83, 87, 91, 190, 211, 213,
biosensor(s) ........................................................... 22, 339 217, 222, 238, 241
byproducts ..................................................................275 Formalin fixed paraffin embedded (FFPE) .................... 9, 18
conjugated dextran amine ...................................324–325 Formamide ....................................................... 128, 237, 240
dye(s) .......................3, 9, 22, 87, 135, 214, 277, 317, 325, Formic acid (FA) ...............................182, 184, 185, 187–190
337, 341, 342, 347, 398, 429 Formvar ............................................................................284
labeling .................................................................342 Forskolin...........................................................................198
microsphere(s) ............................................ 267, 275, 276 Fourth ventricle ................................................................226
protein(s) (see also FPs) FPs (fluorescent protein(s)) .................. 14, 21, 82, 83, 89–91,
recombinant ..........................................................276 132, 276, 300, 307, 309, 337, 338, 346, 348,
reporter(s) ........................................... 359, 360, 363, 371 357–371, 394, 419
protein(s) (see FRPs) Fractionator principle .......................................................119
state .............................................392, 394, 395, 402, 406 Fracturing ................................................................. 131, 183
tag(s) ..............................................13, 114, 131, 133, 344 Fragmentation .................................................. 155, 169, 171
tagged antibody(ies)............................ 361, 364, 429, 430 Frame(s)
tracer(s) ..........................................21, 305, 314, 315, 325 acquisition time ..........................................................416
Fluorescently tagged molecules ........................................424 grabber card ................................................................321
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
450 Index
Hazardous ........................................................ 134, 143, 222 Histology ..................3, 71, 219, 234, 240, 316, 318–319, 353
hBCL2 .............................................................................349 Histone(s) .........................................................................105
HBMECs (human microvascular endothelial Histopathological .............................................................209
cells) ........................................................ 231, 248 HIV-1 (human immunodeficiency virus-1)
HBSS (Hank’s balanced salt solution) ..................... 197, 199, associated neurocognitive disorder.............. 235, 241, 248
201, 204, 340, 349, 412, 414 glycoprotein gp120 (see HIV-1 gp120)
hCMEC/D3 .................................................................... 230 gp120 .................................................. 239, 242, 243, 248
[3H]dT ..................................................... 123–126, 135–137 HIV-1 gp120 (HIV-1 glycoprotein gp120) ......................241
Head ................................ 44, 46, 90, 201, 318, 342, 348, 364 HL3.1................................................................................. 44
Heat induced epitope retrieval. See HIER HLA-DR .........................................................................210
Heating HNE. See N-acetyllysine-4-hydroxy-2-nonenal (HNE)
block ........................................................... 135, 412, 414 H2O2 (hydrogen peroxide) ........................158, 160, 182–184,
system ................................................................. 362, 365 186, 211, 214, 220, 221, 301
Heat-shock .......................................................................343 Hoechst
Height ...............................................117, 118, 426, 428, 429 33242 ............................................................................98
HEK 293T cells (human(s) embryonic kidney 33258 ................................... 157, 160, 161, 169, 171–174
293T cells) .............................................. 301, 303 Holder ..................................... 71, 72, 84, 275, 375, 426–428
Helios Gene Gun® .............................334, 341, 343–344, 353 Hole(s)................................. 90, 284, 287, 288, 318, 380, 381
Helium ..................................................... 334, 336, 341, 344 Homeostasis .....................................................................229
Hellendahl jar ........................................... 211, 213, 214, 220 Homer1c-GFP ................................................. 414, 415, 417
Hematoxylin ...................... 183, 186, 212, 214, 215, 217, 219 markers ...............................................................414, 417
Hemisphere(s) ........................... 183, 240, 262, 314, 317, 365 Homogenate(s) ................................................. 144, 292, 293
Hemocytometer................................................................351 Homogenization............................................... 143, 144, 200
Hemolymph-like solution 3.1 ............................................ 40 buffer .................................................................. 143, 144
Hemorrhage .............................................................228, 247 Homogenizer.................................................... 143, 237, 341
Hemorrhagic stroke ..........................................................244 Homosynaptic ..................................................................299
He/Ne ..............................................................................174 Hood .......................................... 40, 41, 45, 46, 75, 113, 127,
Heparan sulfate ........................................................227, 235 134, 183, 204, 284, 286, 341, 344, 351
Heparin .................................................................... 237, 240 Horizontal ........................................................ 117, 426, 428
HEPES ................................. 40, 83, 143, 317, 362, 411–414 plane ...........................................................................302
Heregulin beta-1 ..............................................................207 Horizontally ............................................. 213, 214, 433, 435
Herpes simplex virus(es). See HSV(s) Hormone(s) .................................................. 55, 70, 155, 229
Heterogeneity(ies) .................................................... 409, 419 Horseradish peroxidase. See also HRP
HIER (heat induced epitope retrieval) ................ 7–9, 12, 13, streptavidin conjugate ......................... 212, 214, 215, 221
19, 213, 214 Horse serum .............................................................340, 412
HIF-1α (hypoxia-inducible factor-1α) ............................. 228 Host....................130, 132, 135, 159, 234, 238, 284, 301, 382
High cell(s) .......................................................... 330, 332, 333
resistance seal ..............................................................366 HPLC (high-performance liquid chromatography) ..........143
resolution ..................................17, 24–28, 210, 294, 361, HRP (Horseradish peroxidase).........................3, 4, 9, 11–13,
377–387, 393, 394, 433 18, 21, 23, 160, 187, 212, 214–216, 221, 222, 236,
Hippocampal ............................109–121, 141, 144, 146, 147, 314, 319, 321, 325, 338
294, 396, 397, 400, 405, 412, 414, 417 HSA (human serum albumin) .............................. 68, 70, 284
Hippocampus ............................. 65, 100, 110, 111, 120, 133, HSV(s) (herpes simplex virus(es)) ....................................332
142, 148, 181, 182, 217, 240, 243, 378, 389 5-HT (serotonin) ..................................... 65–69, 74, 75, 411
Histamine ...........................................................................65 Human(s)
Histochemical................................................... 214, 361, 363 embryonic kidney 293T cells ......................................301
reaction(s) ............................................. 20, 215, 314, 321 (see HEK 293T cells)
Histochemistry .................................3, 20, 23, 183, 246, 314, serum albumin (see HSA)
316, 319, 324, 359, 363, 366–367 Humid chamber(s) ...................................160, 186, 187, 212,
Histogenesis .............................................................174, 175 214–216, 379, 382
HistoGreen....................................................... 183, 186, 187 Humidity ..........................................................................214
Histological ............................ 2–5, 20, 28, 64, 117, 119, 241, Hybridization ...............................................................8, 370
314, 338, 358 Hybridoma ...................................................................39, 43
procedure(s) .................................................... 20, 21, 318 Hydrodynamic ..................................................................418
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
Index
453
Incision ............................................................. 183, 318, 364 Interaction ........................................ 1, 2, 105, 156, 295, 337,
Incisor....................................................................... 315, 318 398, 399, 409, 418, 423
Incorporation.............................................. 21, 123–126, 135 Intermediate
Incubation .......................................... 46, 47, 73, 76, 91, 100, filament(s) .......................................................... 100, 112
105, 116, 132, 135, 160–162, 184, 186–190, 204, marker(s) ......................................................................95
207, 212–222, 238, 239, 257, 263, 303, 304, 316, Internal
319, 321, 325, 342, 345, 350–352, 370, 382, 394, control(s) .................................................................... 105
398, 400, 415, 428 pipette solution ...........................................................362
chamber .............................................. 204, 342, 345, 350 Interneuron(s).....................................65, 111, 259, 277, 307,
Incubator ................................ 84, 85, 98, 100, 157, 340, 345, 315, 321, 322
349, 350, 352, 353, 412, 414 α-Internexin ....................................................... 96, 100, 101
Index............................................................. 66, 97, 261, 264 Interparticle distance(s) ............................................ 287, 292
Indicator mouse(ice) .........................................................371 Interpoint distance(s) ....................................................... 289
Individual molecule(s) ........................................ 65, 391, 409 Interpretation bias ..........................................................8, 19
Indo 1-AM.........................................................................21 Intersectional ....................................................................358
Indodicarbocyanine. See Cy5 Intervesicular distance(s) .................................................. 294
Indolamine(s) .....................................................................65 Intolerance........................................................................134
Inducible lentiviral vector(s) ............................................. 332 Intracellular
Inferior olive ............................................. 300, 302, 305, 307 dye filling ......................................................................18
Inflammatory disorders ....................................................358 sharp pipettes..............................................................325
In focus ............................................................... 15, 276, 335 Intraneuronal ............................................................179–191
Infrared ..................................................................... 362, 366 Intraperitoneal ...................................112, 144, 246, 317, 342
DIC optics ..........................................................362, 366 Intraperitoneally .......................................................129, 245
Inhibitor ............................ 221, 240, 243, 346, 348, 350, 415 Intravenous ................................226, 229, 236, 240, 246, 262
Inhibitory ......................................................... 307, 416–418 Intravenously ....................................................................130
Injection(s) ..................................... 84, 85, 90, 112, 129, 130, Intraventricular .................................................................129
133, 134, 136, 137, 144, 158, 226, 229, 234–237, Intrinsic .............................................105, 155, 175, 228, 390
239–241, 243, 245, 246, 301–303, 305, 307, 314, controls .......................................................................105
315, 317–319, 324 Intubated ..........................................................................262
Injury(ies) .........................................120, 153, 228, 229, 233, Intubation .........................................................................259
235, 239, 244, 247 In utero............................................................... 132, 309, 358
Innervation .........................................65, 299, 300, 304, 306, Invasive .............................................................................129
307, 309, 378, 383 Invertebrate(s) ............................................................ 5, 6, 64
Input ............................................. 64, 82, 142, 265, 288, 299, Inverted microscope ....................84, 174, 261, 276, 397, 413
313, 325, 362, 425, 432 In vitro................................... 11, 97, 153–175, 195, 197, 200,
resistance ....................................................................325 229–231, 241, 248, 323, 329, 330, 335, 342, 343,
Insect ................................................................ 39, 40, 43, 52 363, 424
In situ In vivo ..................................... 21, 22, 82, 141, 153–175, 197,
end-labeling (see ISEL) 200, 230, 231, 248, 309, 325, 329, 331, 334, 335,
hybridization...........................................................8, 370 337, 363, 424
zymography ........................................ 237, 240, 241, 243 Involution .........................................................................155
Insoluble ...........................................................................156 Iododeoxyuridine. See IdU
Intact ............................... 2, 59, 142, 282, 314, 335, 357, 371 5-Iodo-2'-deoxyuridine. See IdU
Integration ..................................................................82, 414 Ion
Integrins ................................................... 227, 228, 233, 235 channel(s) ........................................................... 315, 411
Integrity ....................................................125, 228, 230, 234, laser(s)......................................15, 49, 146, 350, 425, 434
238, 244, 275 transporter(s) ..............................................................410
Intensification.....................................................................11 Ionized calcium-binding adapter molecule 1. See Iba1
Intensified DAB .................................................................13 Ipsilateral .................................................................. 240, 317
Intensity ................ 25, 26, 43, 47, 49, 50, 54, 59, 87, 90, 124, IR. See Immunoreactive (IR)
129–131, 133, 161, 165, 168, 169, 186–188, 216, Iris diaphragm ..................................................................426
222, 266, 267, 269–274, 276, 277, 351, 353, 367, Iron–dextran complexes ......................................................18
397, 402, 403, 405, 415, 424, 425, 431, 432, 434 Irrelevant antibody............................................................105
characteristic(s) ...................................................269–271 Irritant ...................................................................... 182, 222
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
Index
455
Ischemia ........................................................... 228, 235, 247 LAPAP (laser(s) assisted protein adsorption by
ISEL (In situ end-labeling ) ............................................... 21 photobleaching) ...................... 424–427, 429–431
Isotype(s) .................................................................. 105, 238 Large dense-cored vesicle(s). See LGVs
matched ......................................................................238 Large particles ..................................................................287
Iterative Larva(e) ....................................... 5, 44, 46, 52, 82, 87, 89–91
Iu-4............................................................................. 131 Larval .........................................................40, 43, 45, 46, 52,
threshold .............................................................266–267 53, 55, 57, 82
Laser(s)
J assisted protein adsorption by photobleaching
JACoP .............................................................. 380, 384, 385 (see LAPAP)
JAM(s) (junction adhesion molecule(s)) ................... 226, 230 attenuator .....................................................................49
Jan & Jan saline ..................................................................44 beam .................................... 15, 16, 27, 49, 397, 426, 433
Jansson van Cittert algorithm ...........................................266 capture/microdissection ........................................20, 180
Jellyfish .............................................................................357 confocal fluorescence microscopy (see LSCM)
Junction adhesion molecule(s). See JAM(s) scanning confocal microscope (see LSCM)
Late markers ...............................................................96, 100
K Lateral
diffusion...................................................... 409, 417–419
Kanamycin................................................................340, 349
localization..................................................................294
KCC2 ............................................................... 411, 416–418
resolution .........................................17, 26, 283, 294, 410
Flag..................................................................... 414, 417
Latex beads .......................................................................410
K+/Cl- cotransporter .........................................................416
Layer(s) ...............................6, 11, 17, 64, 100, 111, 121, 132,
67-kDa isoform of glutamic acid decarboxylase
133, 136, 141, 144, 145, 161, 163–167, 181, 182,
(GAD67) ................. 258, 263, 268–272, 274, 277
195, 262, 263, 300, 305, 307, 320, 335, 346, 348,
Kernel ...............................................................................415
353, 360, 364–366, 368–370, 400, 429
Ketamine ........................... 143, 144, 259, 262, 315, 317, 318
LB
Ki-67 ........................................................ 100, 111, 112, 120
agar ............................................................. 340, 343, 349
Killer.................................................................................155
broth ........................................................... 340, 343, 349
Kinematic ......................................................... 425, 426, 428
LC3 (light chain 3)...........................................................156
Kinesin .............................................................................390
LC3B ........................................159–162, 166, 167, 169, 173
Kinetic(s) .......................................................... 126, 337, 395
LE (labeling efficiency) .................................................... 398
Kit(s) .................................56, 83, 98, 99, 143, 145, 183, 187,
Lead citrate.......................................................................285
212, 214, 221, 237, 240, 316, 340, 341, 343, 346
Leakage ............................................225, 228, 234–236, 239,
Knockout
243–246, 248
animal(s) ............................................................. 292, 295
Learning ................................................64, 65, 111, 141, 142
mouse(ice) .......................................................... 300, 360
Least-squares fit ...............................................................273
Kolmer cells ......................................................................213
Lectin .................................................................................20
K-Ras .................................................................................90
Length .................................. 87, 90, 119, 146, 180, 196, 290,
Kv3.1 ................................................................................ 358
321, 322, 332, 333, 343, 344, 415, 432–434
L Lens(es) .........................................15, 24, 426, 427, 433, 434
mount(s) ..................................................................... 425
Labeled streptavidin–biotin complex. See LSAB Lentiviral
Labeling particle(s) .................................................................... 303
conditions ...................................................................275 vector(s) ...................................................... 301, 303, 332
density ................. 286, 287, 291, 293, 295, 393–395, 398 Lentivirus(es).....................................300, 301, 303, 307, 332
efficiency (see LE) mediated transfection .................................................300
Laboratory animal(s) ........... 63, 142, 158, 210, 211, 229, 261 LexA...................................................................................54
LabVIEW ................................................................ 425, 426 LexA-LexAop ..............................................................49, 50
Lambda DG-4 monochromator .......................................413 LGVs (large dense-cored vesicle(s)) .....................................4
Lamina propria .........................................................195, 196 Library(ies) ..................................................... 39, 43, 52, 359
Laminin ............................ 198, 202, 227, 231, 233, 241, 243, Ligand ......................... 11, 154, 156, 232, 333, 337, 410, 418
246–248, 397, 431 Light
Landmark(s) ......................................................... 51–54, 367 absorption .....................................................................49
Lanolin .............................................................................345 gated channels ............................................................315
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
456 Index
243, 244, 247, 248, 263, 288, 300, 304, 305, 307, Mesh basket............................................................ 42, 46, 47
309, 341, 346, 348, 361, 363, 369, 385, 387, 398, Metabotropic ............................................................300, 411
403, 404, 410, 414, 417 glutamate receptor(s) .......................................... 300, 411
Mask......................................... 134, 161, 266, 267, 269, 271, Metal-coated mirror(s) ..................................................... 426
272, 274, 415, 416, 424 Metalloproteinases.................................... 228, 231, 233, 243
Masking...............................................97, 266, 267, 270, 273 MetaMorph ..............................................................395, 397
Master MetaView .........................................................................413
control gene(s) .................................... 360–361, 364, 369 Methanol ............56, 68, 98, 99, 104, 158, 160, 217, 286, 399
genes ................................................................... 360, 361 based fixative(s) .......................................................... 217
Mastoid process ................................................................302 Methylcellulose.............................................................84, 87
Matlab ...................................................................... 267, 415 Methylene blue .............................................................84, 86
Matrix(ces) metalloproteinases. See MMPs Methyl salicylate ...........................................................72, 73
Maturation ................................................... 95, 96, 339, 353 Mg2+ ......................................................... 197, 199, 339, 350
Mature ................................ 96, 112, 113, 120, 141, 142, 332, MgCl2......................................................................... 71, 362
360, 365, 390, 417 mGluR1 ...........................................................................300
Maturity ............................................................. 97, 130, 142 Microarray(s) ........................................................................ 8
Maxilla..............................................................................302 Microautophagy ...............................................................156
Maximal intensity .............................................................367 Microbubbles ....................................................................333
Maximum likelihood estimation.......................................266 Microcentrifuge tube ........................................ 41, 45, 46, 58
Maxi prep ................................................................. 340, 343 Microdomain(s) ................................................................ 409
mCherry .............................................................................50 Microenvironment(s) ........................................ 226, 423, 424
MCM2 (minichromosome maintenance Microfilament(s)....................................................... 169, 170
protein 2) ................................................ 112, 120 Microglia .................................................. 161, 163, 209–222
MEA. See β-Mercaptoethylamine (MEA) response factor-1 ........................................................210
Mean square displacement. See MSD Microglial ................................................................. 210, 216
Measurement ............................ 161, 168, 169, 244, 271, 286, cells .....................................................................209–222
346, 353, 367 Microgliocyte(s) ................................209–211, 216, 217, 219
Mechanical artifacts..........................................................276 Micrograph................ 166, 188, 282, 287, 288, 291–293, 308
Mechanism(s) ...................................141, 142, 154, 156, 228, Microinjection(s) ......... 14, 21, 82–86, 90, 316, 317, 331, 334
230, 231, 248, 281, 300, 309, 330, 339, 358, 423 Microloader ........................................................................85
Median Micromanipulator .......................84, 301, 317, 323, 363, 366
filtered ........................................................................415 Micrometer...............................................................219, 427
fissure..........................................................................183 Microparticle(s) ................................................................220
Medulla ............................................................................302 Micropipette(s) ................................ 42, 84–86, 318, 323, 324
Melanoma ................................................................ 105, 233 Microscope(s)
MEM (minimum essential medium)........................411–413 slide(s) ................42, 71, 98, 184, 219, 241, 345, 396, 401
Memantine .......................................................................245 stage incubator ............................................ 345, 350, 352
Membrane(s) Microscopic ..............................12–13, 16, 23, 216, 281–296,
anchored molecule(s) .......................................... 410, 411 300, 307–309, 353
bound................................................................ 50, 52, 57 Microscopy .................................3, 15–18, 59, 133–134, 156,
current(s) .................................................................... 366 157, 161, 166, 173, 174, 180, 200, 211, 212, 214,
de-segmentation ...........................................................20 216, 218, 219, 260–261, 275, 277, 301, 303, 304,
dynamics .............................................................409–419 350, 353, 362–366, 393, 394, 399, 418, 419
potential........................................................ 96, 324, 325 Microslicer........................................................ 301, 303, 304
time constant ..............................................................325 Microsyringe ............................................................316, 318
voltage .......................................................... 22, 339, 371 Microtube(s) ........................................57, 196, 199, 201, 206
Memory ........................................................ 64, 65, 141, 174 Microtubule(s). See MTs
Meninge(s) ....................................................... 335, 349, 350 Microtubule-associated protein 1 light chain 3. See LC3
Mental disorders ...............................................................210 Microvessel(s) ........................................... 229, 230, 234, 239
Menu ................................................................................287 Microwave(s) .............................. 97, 114, 115, 127, 135, 182,
β-Mercaptoethylamine (MEA) ................ 394, 396, 397, 406 184, 188, 190, 211, 213, 220, 237, 238
Mercury lamp ....................................................... 14, 15, 174 oven ..................................... 114, 127, 211, 213, 220, 237
Merged ...................54, 55, 167, 189, 269, 270, 274, 346, 383 Midline ..............................................183, 201, 302, 318, 364
Merging ............................................................................364 Migration ..... 95, 124, 126, 135, 209, 232, 248, 314, 348, 423
Mesenchymal ...........................................................209, 232 Millicell-CM® insert(s)..............340, 343–345, 347, 350, 352
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
458 Index
Multi-well plate(s) .................................85, 98, 339, 379, 380 NeuN. See Neuronal nuclear antigen (NeuN)
Murine ..................................................................... 200, 213 Neural
Musashi-1. See MSI-1 circuit(s) ........................................................ 81, 377, 378
Muscle(s) ............................................................ 48, 227, 232 connection(s) .................................23, 299–309, 313, 314
cell(s) ..........................................................................105 lineage(s).....................................................................125
Mushroom bodies.........................................................52, 53 plate ..............................................................................95
Mutagenic ........................................................................134 tube ...............................................................................95
Mutation(s) ................................................ 59, 180, 181, 300 Neuroactive.........................................................................66
Myopathy(ies)................................................................... 156 Neuroanatomy .........................................4–5, 40, 64, 81, 385
Neurobasal medium..................................................340, 412
N Neurobiology ...........................................9, 25, 101, 209, 410
NA (numerical aperture) ............. 24, 119, 260, 391, 413, 425 Neuroblast(s) ........................................................ 95–97, 100
NaBH4 (sodium borohydride) .................. 41, 46, 59, 72, 260, Neuroblastoma .................. 153, 157, 160, 162, 166–173, 175
263, 275, 302, 304, 394 Neurochemical............................. 4, 21, 81, 97, 234, 241, 309
N-acetyllysine-4-hydroxy-2-nonenal NeuroD .....................................112, 113, 115–116, 120, 121
(HNE) ............................................ 234, 241, 244 Neurodegeneration ................................... 156, 174, 182, 228
Na citrate ..........................................................................128 Neurodegenerative ............................179, 195, 210, 228, 235,
NaCl-Na citrate buffer .............................................128, 135 244, 247
NADPH-diaphorase ....................................................20, 23 Neuroectoderm .................................................................209
Nail polish ............................... 42, 45, 58, 71, 73, 77, 99, 187 Neuroendocrine cell(s)..........................................................4
Naked DNA(s) ......................................................... 331, 333 Neuroepithelial .............................................................95–97
NaN3 .............................................................. 48, 57, 72, 144 Neuroepithelium ................................................................95
Nanocrystal.......................................................................418 Neurofibrillary ..........................................................179, 180
Nanogold® ................................................................ 302, 304 Neurofibrillary tangles. See NFTs
Nanometer(s)............................................................ 418, 419 Neurogenesis ............................109–113, 115, 117–120, 125,
Nanoparticle(s) ................................................................. 230 141–148, 210
Nasal cavity...............................................................201, 207 Neuroimaging................................................... 357–371, 414
nc82 .............................................................................. 52, 53 Neuroinflammation ..................................................209, 228
NCSS ...............................................................................146 Neurological ..............................195, 196, 228, 244, 248, 358
NDS (normal donkey serum ) ............. 98, 234, 238, 302, 303 Neurolucida ...................................................... 316, 321, 322
Near-diffraction-limited resolution ..................................424 Neuromere ....................................................................53, 54
Nearest neighbor deconvolution .......................................266 Neuromodulator(s) .............................................................65
Near-UV light ....................................................................25 Neuron(s)
Neck ......................................................................... 158, 364 doctrine.......................................................................313
Necrotic ............................................................................155 loss ......................................................................180–182
Needle(s) ................................... 197, 198, 202, 303, 318, 401 Neuronal
track ............................................................................244 compartment(s) .......................................................... 414
Negative ............................... 8, 27, 48, 97, 99, 105, 141, 148, differentiation ................................................. 96, 97, 111
200, 213, 238, 290, 293, 314, 323, 365, 368, 369 landmark(s) .............................................................51, 52
control(s) ........................... 27, 48, 99, 105, 213, 238, 293 marker(s) .............................................. 95, 186, 240, 346
Neocortex ................................................. 129, 218, 259, 319 maturity ........................................................................97
Neocortical ...............................................................219, 323 primary culture(s) ....................................................... 342
Neonatal ..............................................96, 100, 197, 230, 302 progenitor(s) ............................................................... 111
Nephrotoxicity ..................................................................154 tracing ............................................. 20–22, 300, 304–309
Nerve(s) transporter ..................................................................416
cell(s) .......................................................... 220, 333, 337 Neuronal nuclear antigen (NeuN) ..................... 96, 100, 101,
terminal(s) .................................................. 287, 288, 293 113, 134, 142, 143, 146, 186, 240, 346
Nervous Neuron-Glia cerebellar cultures. See NGCCs
system ........................... 2, 5–20, 39–59, 63–76, 109, 123, NeuronJ ............................................................................367
137, 210, 315, 332, 358, 389 Neuron-specific enolase (NSE) .................................. 96, 101
tissue ................................... 7, 9, 10, 22, 44, 66, 195, 226, Neuropathological ....................................................189, 190
235, 281 Neuropathology ........................................ 7, 18, 19, 180, 222
Nestin ......................................................... 97, 112, 113, 120 Neuropeptide(s) ...................................................... 4, 5, 8, 39
Netrin-G1 ........................................................................ 360 Neurophysiology...............................................................357
Network(s).............................. 20, 63–76, 113, 360, 361, 366, Neuropil .............................................9, 51–54, 64, 130, 283,
370, 371, 390, 405, 406, 419 378, 387
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
460 Index
Objective(s) .......................... 16, 17, 24, 25, 43, 49, 114, 119, Organotypic...........................................5, 6, 21, 28, 329–353
174, 260, 261, 263, 264, 275, 276, 345, 350, 352, Orientation .......................................17, 52, 76, 87, 119, 390,
353, 361, 362, 366, 367, 382, 397, 403, 413, 425, 391, 426, 433, 435
426, 428, 433, 434 Orienting .................................................................... 95, 275
Obstacle(s)........................................................................ 410 Origin ................................. 70, 209, 211, 259, 265, 299, 307,
Occipital bone ..................................................................303 313, 431, 432
Occludin .................................... 226, 230, 233, 241, 242, 248 Osmicated ....................................................................7, 285
OCCs (organotypic cultures)........................... 340, 342–343, Osmium tetroxide................................................. 5, 302, 304
345–350, 352 Osmolarity................................................................362, 413
OCT (optimum cutting temperature) ................. 71, 73, 237, Osmotic pressure ..............................................................333
260, 262, 274 Ototoxicity .......................................................................154
Octopus ........................................................................63–76 Otsu............................................................................ 83, 266
OD (optical density)................................. 161, 168, 169, 399 Outline(s) ......................................................... 270, 286, 415
OECs (olfactory ensheathing cells).............. 195–200, 202–207 Out-of-focus ...................................15–17, 24, 260, 265, 276
Oil Output(s) ....................... 82, 89, 289, 290, 313, 371, 403, 433
immersion ..................................................... 16, 174, 261 Ovalbumin ......................................................... 70, 341, 345
/water partition coefficient .........................................229 Oven ................................. 114, 127, 211–213, 215, 216, 220,
Olfactory 234, 237, 238, 381
bulb .................................. 89, 90, 109–111, 141, 195, 207 Overexpression .........................................................156, 180
ensheathing cell(s) (see OECs) Overnight ........................48, 56, 72–74, 84, 87, 99, 115, 144,
epithelium...........................................................195, 196 160, 186, 187, 215, 238, 240, 286, 303, 304, 321,
mucosa ........................................ 196–198, 200–203, 207 343, 345, 349, 351, 364, 366, 368, 380, 381, 401
olfactory neuron(s)......................................................195 Oversampling ...................................................................264
Oligodendrocyte(s) ........................................................... 142 OX-6 ................................................................................210
1D4 ..............................................................................52, 54 OX-42 .............................................................................. 210
Ontogenesis ......................................................................209 Oxidation ................................................... 74, 234, 248, 338
Ontogenetic ........................................................................95 Oxidative stress..................................155, 234, 241, 244, 248
Open Oxygen ...............100, 226, 228, 231, 234, 262, 347, 401, 406
chamber ......................................................................413 scavenger system .........................................................406
path.............................................................................290
Optic(s) .............................. 52, 64, 67–69, 75, 232, 265, 317, P
323, 362, 365, 366, 413, 426 Paclitaxel...........................................................................390
fiber(s) ........................................................................ 413 Paired box gene 6. See Pax-6
lobe(s) ......................................................... 52, 64, 67–69 PALM (photoactivated localization
Optical microscopy) ....................17, 25, 26, 393, 394, 419
axis ................................................................................24 Palmitoylation motif ...........................................................90
density (see OD) PAP (peroxidase anti-peroxidase) ............................ 4, 11–13,
disector ....................................................... 114, 118, 119 67–70, 98, 100, 212, 379, 382
image formation .........................................................424 pen .................................................98, 100, 212, 379, 382
protein patterning ...............................................423–435 Paracrine ...........................................................................227
section(s)......................................................... 24, 25, 174 Paraffin
sectioning embedding ...............................9, 157, 183, 184, 212, 219
rate ..........................................................................15 sections ............................... 6, 7, 135, 157, 158, 184, 211,
slice ...............................................................................54 222, 235, 238, 239
Optogenetic ........................................................ 22, 315, 339 Parafilm™.................................... 57, 113, 396, 412, 414, 418
sensors .................................................................. 22, 339 Paraformaldehyde. See PFA
Optomechanics.........................................................425, 426 Parallel fibers. See PFs
Orbital shaker .............................................................71, 198 Parameter(s) ............................. 130, 144, 146, 147, 161, 162,
Oregon Green ..............................................................14, 21 212, 264, 265, 276, 286, 287, 321, 323, 324, 335,
Organ(s) ................................................................. 6, 65, 155 344, 351, 367, 384, 395, 403, 406, 419, 432, 434
Organelle(s) .................................. 57, 96, 104, 155, 156, 159, Paraplast X-tra® .......................................... 10, 157, 158, 219
169, 172, 175, 341, 342, 349 Parasagittal ...............................................................303, 342
Organic Parasitic ............................................................................332
dye(s) .......................................................... 394, 410, 415 Paratope............................................................................1, 2
solvent(s) ....................................................................104 Parenchyma ......................................................................228
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
462 Index
Positive 260, 263, 275, 284, 285, 292–294, 301, 321, 341,
control .........................................144, 200, 213, 240, 243 345, 349, 361, 364, 370, 387, 398, 400, 401, 405,
polarity........................................................................290 410, 412, 414, 429–431
Post culture(s) .......................... 2, 229, 329, 342, 353, 397, 414
fixation........................................................ 396, 401, 406 Primate(s) ................................................................... 54, 259
hoc comparison...........................................................269 Primer(s)................................................................... 200, 370
hoc histochemistry......................................................269 Principal sulcus .................................................................262
ischemic ......................................................................209 Printer ................................................................................55
lesional ........................................................................315 Proboscis.............................................................................46
mitotic ................................. 330, 332, 335, 346, 351, 353 Process(es) .................................................... 6, 17, 19, 22, 26,
mortem ....................................8, 142, 189, 190, 209, 259 49, 57, 66, 81, 86, 88, 95, 105, 109–121, 123, 124,
natal .........................95, 96, 100, 129, 153, 196, 197, 209, 129, 130, 137, 141, 155, 156, 169, 174, 175, 179,
210, 230, 299, 302, 339, 342, 349, 360, 368, 369 210, 215–219, 222, 226–228, 238, 245, 247, 265,
synaptic 266, 271, 281–283, 289, 300, 302, 337, 345, 348,
density ..........................................................290, 294 363, 367, 382, 385, 386, 389, 399, 400, 403,
element .........................................................282, 290 423–425, 429, 434
membrane ............................................. 290, 291, 294 Processing ......................... 8, 10, 18, 19, 25, 49, 64, 67, 68, 70, 73,
Postembedding ........................ 7, 23, 282, 283, 285, 293, 294 125, 127–128, 130–133, 189, 200, 211, 213–216,
Posterior ................................ 52, 53, 200, 201, 207, 226, 302 220, 221, 261, 264–267, 346, 366, 380–385
lobe .............................................................................226 Profile(s) ............................................117, 118, 134, 281–296
Posttranslational modifications. See PTMs Profile border............................................................287–289
Posture ..............................................................................134 Profile-centric ...................................................................289
Potassium channel ............................................................358 Progenitor cells ............................................. 95, 97, 110, 111
Power .......................27, 58, 88, 146, 184, 238, 260, 347, 358, Program ..............19, 21, 49, 55, 155, 259, 286, 289, 426, 427
365, 394, 397, 402, 425, 431, 432, 434 Programmed cell death. See PCD
supply(ies) ........................................................... 425, 432 Projecting ................................................................. 314, 315
P/Q-type Ca2+ channel(s) ......................................... 300, 306 Projection(s) ........................... 49, 52, 53, 218, 267, 268, 270,
Pre- 274, 309, 313, 314, 317, 360, 361, 367–369
absorbed...................................................... 213, 292, 293 Proliferating
absorption ...........................................................48, 2292 cell(s) ................................... 100, 125, 148, 161, 175, 232
embedding cell nuclear antigen (see PCNA)
fluoronanogold™ technique ...................................18 Proliferation..........95, 111, 112, 120, 124, 125, 130, 135, 155
ICC ....................................................................6, 23 ProLong® ......................................... 58, 98, 99, 260, 341, 349
neutralized ..................................................................296 Promoter(s)........................................................... 89, 90, 358
Precipitate(s)...........6, 11, 13, 22, 41, 133, 200, 284, 338, 352 Propane ............................................................................286
Precipitation ...................... 165, 303, 330, 331, 341, 343, 399 Proportional sum ..............................................................323
buffer .................................................................. 341, 343 Propyl gallat........................................................................58
Precursor(s)............................................................... 113, 120 Protanope ...........................................................................55
Pregnant ................................................................... 135, 137 Protease(s) ................................................ 166, 228, 231, 233
Prenatal.............................................................................209 Protein(s)
Presenilin cleavage......................................................... 22, 337, 339
1 (see PS1) pattern ................................................................423–435
2 (see PS2) S100............................................................................ 210
Preservation .............................. 2, 5, 7, 10, 20, 125, 187, 211, Proteofection ....................................................................329
212, 283, 285, 286, 383, 395, 399 Proteomics ......................................................................3, 19
Preservative........................................................... 48, 57, 221 Proximity ............................. 25, 121, 269, 323, 361, 385, 386
Pressure .............................. 85, 213, 302, 318, 323, 324, 333, Pruning .............................................................................315
336, 341, 344 PS1 (presenilin-1) ...............................80–182, 185, 188, 189
cooker .........................................................................213 PS2 (presenilin-2) ............................................................180
Presynaptic ............ 51, 89, 259, 271, 273, 281–283, 290, 411 PSA-NCAM (polysialylated embryonic form of the neural
Primary cell adhesion molecule) ................... 112, 113, 120
antibody(ies) ....................... 11–13, 19, 27, 43, 45–47, 57, Pseudocode .......................................................................432
66, 71–74, 87, 97, 99, 105, 106, 113–116, 125, Pseudocolor(s) ................................... 133, 282, 308, 346, 383
127, 132, 133, 135, 159, 160, 186, 187, 198, 204, Pseudocolored...........................................................308, 383
211, 213–216, 220, 221, 232–234, 238, 257, 258, Pseudostratified ..................................................................95
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
Index
465
PSF. See Point spread function (PSF) Ramified ................................................................... 211, 216
p62/SQSTM .................................................... 159, 160, 165 Random
p62/SQSTM1 ..................................................................156 box(es) ........................................................................296
Psychiatric ........................................................................259 compartment(s) .................................................. 291–292
PtAcacDMS .....................................154, 157, 158, 160, 161, line(s) .......................................................................... 296
163–167, 169, 171, 174, 175 point(s) ....................................................... 287, 289, 292
PTMs (posttranslational modifications)................... 390, 393 region(s)......................................................................291
PTU (N-phenylthiourea) ............................................. 83, 86 Randomly .......................... 119, 271, 273, 291, 295, 296, 419
Puller ............................................................ 84, 85, 301, 317 Raphe ............................................................... 378, 383, 385
Pulse ......................................................... 132, 142, 323, 324 RapidSTORM ................................................. 395, 397, 403
Pump ................................. 113–115, 127, 259, 361, 362, 365 Rat(s) .................................. 57, 127, 129, 130, 132, 133, 136,
Punctum(a) .......................................173, 260, 263, 266, 267, 157–160, 163–166, 196, 198, 211, 213, 217–219,
269–274, 382–386 229, 230, 232, 233, 239, 241, 243–247, 301, 317,
Pup(s) ....................................................................... 302, 303 320, 339, 349, 380, 396, 397, 412
Purification ....................................................... 145, 195–207 brain endothelial cell (see RBE)
Purine(s) .............................................................................65 Ratio ....................................9, 22, 25, 27, 106, 261, 266, 286,
Purkinje cells. See PCs 336–338, 344, 350, 352, 387, 395, 402, 410, 414
PV (parvalbumin) ..................................... 258, 263, 316, 319 Rayleigh criterion .......................................................24, 264
Pyramid ..............................................................................47 Razor blade(s)..............................47, 339, 362, 364, 379–381
Pyramidal rBCEC4 ...........................................................................229
layer ............................................................................182 RBE (rat brain endothelial cell)........................ 229, 230, 239
neuron(s)............................. 313, 315, 317, 319, 321–324, RBE4................................................................................ 229
365, 371, 389 RBEC1............................................................................. 229
Reaction ..................................... 1–3, 5–9, 11, 13, 18–20, 27,
Q 125, 134, 143, 159–161, 163, 165, 169, 176, 186,
QD(s) (quantum dots) ........................................ 22, 409–419 210, 211, 214, 215, 217, 219, 222, 283, 303–307,
QD binding buffer ...................................................413–415 313–315, 319, 321, 398, 404
QDot 605 ................................................................. 412, 414 bias...................................................................... 8, 18–20
streptavidin conjugate .........................................412, 414 Ready-to-use ............................................ 212, 213, 220, 221
QF ................................................................................49, 54 Real-time fluorescence .....................................................414
QF/QUAS..........................................................................49 Rearing medium ..................................................... 83, 86, 87
QIAfilter Plasmid Midi Kit ...............................................83 RECA-1 ........................................... 232, 239–241, 243, 244,
Quality ............................17, 19, 25, 40, 57, 76, 83, 213, 220, 247, 248
262, 265, 267, 283, 294, 338, 343, 399, 403, 426, Receptor(s) ................................. 18, 57, 67, 71, 96, 105, 156,
428, 433 198, 232, 245, 271, 273, 291, 294, 300, 315, 317,
Quantification ..................................4, 7, 12, 18–20, 27, 137, 337, 409–411, 416, 419
141–148, 188, 200, 257–277, 281–296, 385, 417 Reconstruction ......................... 15, 17, 23, 81, 219, 266, 316,
Quantitative 321, 359, 363, 366–368, 378, 397, 402–404, 406,
analysis.................................. 27, 161, 166, 168, 182, 265, 407, 415
283, 285, 286, 292, 295, 378, 380, 382–386 Recorded .................................... 21, 119, 161, 174, 286, 321,
fluorescence microscopy..............................................277 324, 325, 361, 366, 367
Quantum Recording(s)
dot(s) (see QD(s)) chamber .............................................. 323, 362, 365, 414
efficiency.............................................................261, 397 electrode ..................................................... 325, 365, 366
Quenching ................................................................275, 339 Recovery ...................... 12, 160, 173, 228, 241, 302, 366, 409
QuickPalm ....................................................... 395, 397, 403 Red
fluorescent
R probe .....................................................................366
Rabbit ................................... 11, 57, 105, 106, 115, 159, 160, protein(s) (see RFPs)
198, 202, 203, 211, 213, 215–217, 221, 232, 233, Redundancy ........................................................................65
257, 258, 301 Reference .................................. 10, 50–51, 96, 159, 181, 235,
Radical oxygen species (ROS) .......................................... 234 236, 426, 433, 434
Radioactive ....................................................... 125, 137, 142 point .............................................................................52
Radioactivity.....................................................................124 Reflection ....................................................... 17, 26, 44, 433
Radiocarbon dating ..........................................................142 Refractive index ............................................ 17, 26, 264, 275
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
466 Index
Regeneration ....................................................................315 Rodent(s) .......................... 109, 111, 130, 136, 141, 142, 144,
Regenerative .....................................................................300 217, 259, 261, 299
Region of interest(s). See ROIs ROIs (regions of interest) .............................87, 88, 116, 118,
Regular ................................ 24, 133, 292, 318, 325, 335, 413 119, 161, 286, 291, 295, 353
Regularity .........................................................................292 Rollover ............................................................................267
Regulation ........................ 111, 134, 156, 222, 232, 244, 302, ROS. See Radical oxygen species (ROS)
410, 417–419 Rostral migratory stream (RMS) .............................. 109, 110
Regulatory ........................................................ 210, 330, 358 Rotating half-wave plate...................................................434
Rehydration ..............................................................213, 214 Rotation(s)........................................................................ 146
Relative concentration ..........................................................7 Roungers ..........................................................................318
Repair ....................................................................... 137, 195 Routine ..........................7, 9, 25, 97, 189, 190, 211, 213, 216,
Replication ....................................................... 112, 130, 137 285, 358, 399, 431
Reporter ............................... 14, 50, 82, 83, 85, 89, 339, 346, Rubber cement .................................................................345
348, 358–361, 363–365, 368, 370, 371, 394 Run .................................... 13, 52, 53, 99, 144, 146, 287, 366
molecule(s).......................................................... 337–339 Running..................................... 141, 144, 147, 148, 186, 397
Repression ........................................................................368 wheel .......................................................... 143, 144, 146
Reshaping .........................................................................315 r x,y2 ......................................................................................64
Resident microglial cell(s) ................................................209 rz2 ........................................................................................64
Resin(s)........................ 6, 9, 10, 282–286, 296, 379–381, 386
Resinous ...........................................................................212 S
Resistance .......................... 154, 230, 323, 325, 349, 366, 418 S100 ................................................................. 204, 205, 210
Resolution ........................ 2, 16–18, 24–27, 82, 89, 136, 261, a10 .............................................................................. 360
264–266, 271, 281–283, 288, 294, 337, 353, 378, Safety ....................................................10, 143, 330, 418 425
391–395, 403, 410, 418, 424, 427 Sagittal ....................................................... 76, 158, 184, 364
Respiratory system............................................................222 Saline .........................40, 41, 44, 45, 157, 211, 236, 237, 240,
Resting ..................................................................... 111, 216 243–245, 378
membrane potential ..............................................96, 325 Sample ...............................2, 9, 13, 16, 17, 24–27, 45, 59, 67,
Restoration ........................................................... 17, 25, 266 68, 70, 72–74, 76, 87, 90, 98–100, 105, 114, 118,
Restored image ...................................................................25 119, 180, 189, 190, 200, 207, 240, 241, 264, 265,
Retention ......................................................................5, 285 275, 286, 290, 294, 303, 342, 345, 346, 391, 393,
Reticular formation ..........................................................314 394, 398, 399, 402–404, 406, 424, 426–435
Retina ..................................................................... 6, 40, 232 holder .................................................................426–428
Retinotopical ....................................................................314 Sampling
Retrieval ..............................4, 8, 97, 115, 125, 128, 135, 182, frame...........................................................................119
184, 185, 187, 188, 190, 213, 237, 238 frequency ....................................................................264
Retrograde Saponin .................................................... 100, 104, 302, 304
degeneration ...............................................................313 SATB2 ..................................................................... 368–370
fluorescent tracer(s) ....................................................314 Satb2.................................................................................. 368
labeling ....................................... 315, 317–319, 321–324 Saturated .............................................56, 264, 265, 364, 384
tracing .................................................................313–325 Save ..........................................................57, 59, 86, 87, 287,
transport .............................................................314, 315 288, 290, 291
Retrogradely ..................................... 314, 315, 318–322, 325 Scaffold(s)................................................................. 424, 429
Retroviral ..........................................................................229 Scaffolding
Retrovirus(es) ...................................................................332 molecule(s).................................................................. 410
RFPs (red fluorescent proteins) ..................14, 17, 21, 22, 50, protein(s) ....................................................................414
337, 338, 346–349 Scale ............................................. 10, 54, 106, 230, 266, 287,
Rhodamine. See TRITC 293, 392, 394, 398
Ribbon(s) .......................................................... 381, 382, 386 bar(s)..................................... 53–55, 86, 88, 89, 163–167,
Ridler-Calvard..........................................................266, 267 169, 171–173, 185, 188, 189, 203, 205, 206, 239,
Ringer’s solution ............................................. 83, 84, 86, 339 282, 320, 322, 383–385, 417, 431
Ripple(s) ...........................................................................434 Scalpel ....................................... 113, 144, 183, 318, 342, 364
Rise time...........................................................................300 Scanning electron microscope. See SEM
RNA ...................................... 8, 137, 329, 331–334, 336, 337 Schizophrenia ...........................................................142, 277
interference .................................................................337 Scissors ..................................................... 113, 183, 196, 201
RNAse ..............................................................................146 Scott’s tap water substitute .......................................212, 215
Robotics..............................................................................64 Screen ........................................................82, 87, 90, 91, 405
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
Index
467
SDCMs (spinning disk confocal microscopes) ............ 15–17, Short hairpin RNAs. See shRNAs
260, 261, 264, 266, 271 Short-term fixation...........................................................220
SDS .......................................................................... 380, 382 Shrinkage factor ...............................................................117
Seal resistance ...................................................................366 shRNAs (short hairpin RNAs) ......................................... 332
Sea water ............................................................................71 Side................................. 42–44, 90, 154, 164, 201, 240, 243,
Secondary antibody(ies).......................... 4, 11, 13, 45–47, 54, 290, 294, 364, 381, 400, 405, 416
57–59, 71, 73, 74, 87, 97–99, 105, 106, 113–116, SigmaStat .........................................................................146
127, 128, 132, 133, 158–161, 183, 186, 187, 198, Sigma values .....................................................................267
204, 212, 214–216, 231, 234, 238, 244, 257, 258, Signal(s)
260, 263, 275, 283, 293, 302–304, 316, 341, 345, to noise ratio ...............................9, 22, 27, 261, 266, 337,
346, 349, 361, 363, 364, 368, 370, 371, 379, 395, 338, 350, 387, 402, 410
397, 398, 400, 401, 404, 405, 410, 412, 414, separation ...................................................................221
429–431 Signaling.............................. 39, 155, 227, 228, 281, 300, 416
Secretion ...............................................................................5 Silanized slides .................................................................219
Secretory vesicle .................................................................27 Silicon..................................................................... 42, 44, 56
Section(s) SILPOT®............................................................................ 85
surface ................................................................. 116, 124 Silver
thickness ........................................74, 117, 118, 263, 351 enhanced immunogold .......................................307, 308
Sectioning............................... 6, 9, 15, 23, 25, 113, 114, 116, enhancement solution .........................................302, 304
212, 261, 262, 364, 368, 378, 393 grains .......................................................... 124, 133, 283
block(s) .........................................................................73 impregnation ..............................................................210
Segment(s)................................................ 116, 118, 273, 320 intensified immunogold ..............................................283
Segmental ...........................................................................54 SIM (structured illumination microscopy) ................... 17, 27
Segmentation............................................ 266–267, 271, 277 Simulated point pattern(s) ................................................292
Segmented line tool ..........................................................290 Sindbis virus .....................................................................156
Segmenting ......................................................................265 Single
Selectins............................................................................228 cavity microscope slide................................................345
Selective transport ....................................................226, 390 cell
Selectivity .................................... 15, 104, 210, 292, 370, 390 labeling .............................................................51, 89
Self-digestion ...................................................................155 PCR..............................................................370, 371
SEM (scanning electron microscope) ........................... 2, 147 label ...................................................................... 89, 257
Sensitivity ................................... 3, 5, 6, 9, 11–13, 15, 18, 19, molecule localization microscopy (see SMLM)
49, 88, 97, 186, 190, 191, 285, 338 particle tracking (see SPT)
Sensory ........................................................... 64, 65, 82, 195 photon confocal microscopy .................................49, 337
Sensory-motor cortex ...............................................317, 318 point selection.............................................................290
Sepia officinalis ......................................................... 65, 67–69 section.........................................................................324
Sequence................................. 2, 51, 123, 329, 330, 334, 358, staining ...................................................................54, 58
368, 431, 432, 434 stranded DNA (see ssDNA)
Sequential staining ...........................................................131 threshold .....................................................................266
Sequestration ....................................................................226 Site-specific ..............................................................334, 418
Serial section(s) ................................114–116, 118, 324, 378, Size ............................ 8, 18, 24, 25, 41, 42, 54, 63, 75, 82, 85,
379, 381, 382, 385, 387 88, 90, 116–119, 125, 136, 155, 211, 213, 215,
Serotonin. See 5-HT 226, 260, 264, 266, 276, 283, 287, 295, 332, 335,
Serum ..................................... 45–48, 57, 58, 71, 98, 99, 105, 336, 343, 344, 352, 367, 387, 391, 393, 395, 397,
127, 131, 132, 144, 158–160, 162, 171, 198, 199, 403, 407, 410, 415–418, 424, 433, 434
202, 203, 228, 229, 234, 235, 237–239, 260, 284, Skin ............................. 67, 143, 155, 201, 222, 318, 335, 379
302, 303, 316, 340, 343, 350, 412 Skull .......................................... 183, 201, 318, 335, 342, 364
albumin...............................................................237–239 Sleep .................................................................................141
Sex ....................................................................................146 Slice(s) .................................. 3, 21, 28, 54, 74, 115, 323–325,
SGZ (subgranular zone) ........................................... 110, 111 329–353, 362–367, 418
Shaker............. 42, 45, 48, 71, 84, 98, 198, 202, 260, 263, 340 Slide(s).................................... 42, 43, 45, 71, 73, 74, 98–100,
Shape ...................................... 15, 18, 75, 119, 161, 165, 348, 113, 115, 135, 159–161, 184, 186, 187, 199, 204,
361, 365–368, 381 212–216, 219, 220, 234, 241, 261, 263, 275, 316,
Shell width .......................................................................288 319, 325, 341, 345, 350, 364, 366, 370, 379–382,
Shift(s).................................................27, 276, 386, 404, 434 396, 401
Sholl-analysis....................................................................121 oven .................................................................... 212, 234
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
468 Index
Stage(s) ......................... 82, 86, 89–91, 95, 96, 110–114, 117, HRP conjugate ...................................................214, 221
154, 161, 175, 189, 190, 261, 304, 316, 321, 344, Streptococcus pneumoniae ........................................................ 3
345, 350, 352, 353, 360, 364, 386, 400, 402, 424, Streptomycin ............... 83, 157, 196–198, 202, 204, 206, 412
426, 428, 433, 434 Stress ..........................141, 155, 174, 234, 241, 244, 248, 318
Stain(s) ......................................... 3, 5, 21, 54, 127, 131, 133, Striatum.................................................................... 234, 246
135, 186, 212, 221, 238, 346, 348 Striped interference pattern ................................................27
Staining Structural ................................ 5, 96, 125, 210, 216, 228, 231,
buffer ..................................................................144–146 281, 290, 358, 361, 371, 387, 390, 395, 403
jar........................................................................214–216 Structure ........................2, 27, 47, 49, 52, 58, 65, 75, 81, 119,
Standardization ............................................ 18–20, 210, 213 126, 137, 155, 189, 210, 225–248, 259, 261, 263,
State ..........................17, 22, 25, 26, 155, 169, 175, 189, 190, 265, 266, 271, 273, 287, 290–291, 293, 295, 314,
222, 266, 293, 339, 392–395, 401, 402, 406, 415 315, 318, 321, 325, 333, 335, 361, 377, 378, 380,
Statistical 382, 384, 387, 391, 392, 394, 395, 399–404, 407
reliability .....................................................................424 Structured illumination microscopy. See SIM
significance .................................................................353 Student’s t-test ................................................. 161, 168, 169
Statistics ................................................... 146, 269, 271, 292 Styrofoam ........................................................... 56, 196, 201
Stealth liposome(s) ...........................................................333 Sub-
Steamer..................................................... 211, 213, 214, 220 micron ........................................................................434
STED (stimulated emission depletion threshold .....................................................................325
microscopy) .................................................17, 26 Subcellular .............................. 6, 7, 18, 22, 96, 156, 181, 281,
Stellate cell(s) ...................................................................307 296, 305, 348, 349, 390, 424
Stem cell(s) ................................................. 95, 100, 156, 232 storage ............................................................................4
Stereological Subcortical ................................................................360, 368
methods ......................................................................118 nuclei ..........................................................................314
techniques ................................................... 124, 263, 286 Sub-diffraction resolution...................................................26
Stereology .................... 19, 119, 142, 148, 267–269, 286, 378 Subdomain(s) ................................................................... 290
Stereomicroscope .............................................. 196, 201, 301 Subgranular zone. See SGZ
Stereotaxic Subiculum.........................................................................181
frame................................................................... 315, 318 Sublimation ........................................................................57
instrument ..........................................................301–303 Subpopulations .................... 89, 110, 121, 258, 269, 272, 277
Steric hindrance................................................................418 Substance P ....................................................................8, 65
Sterile ................................. 97, 100, 127, 129, 196–198, 202, Substrate(s) ............. 13, 26, 183, 231, 240, 424, 427, 429, 434
340, 343, 351, 396 Substrate-bound ...............................................................424
Sterilize ................................................................ 83, 84, 413 Subventricular zone. See SVZ
Stimulated emission depletion microscopy. See STED Sucrose ............................. 40, 71–73, 76, 127, 131, 143, 144,
Stirrer ..............................................41, 42, 46, 113, 114, 284 236, 237, 259, 262, 286, 319, 361, 362, 364, 378,
Stochastic 380, 396, 412–414
activation ....................................................................398 Sudan Black B ............................................................98, 105
labeling .........................................................................51 Sulphur ligand(s) .............................................................. 154
optical reconstruction microscopy (see STORM) Super-
Stock solution ......................................57, 71, 72, 83 87, 128, resolution
183, 186, 198, 201, 202, 316, 352, 411–413 light microscopy....................................................419
Stoichiometric ..........................................................124, 125 microscopies ...................................................22, 337
Storage ............................................... 4, 51, 57, 99, 173, 212, resolved images ........................... 392, 393, 395, 402–407
216, 217, 220, 264 Superfrost™.......................................................... 71, 74, 241
STORM (stochastic optical reconstruction Superglue .......................................................... 339, 379, 381
microscopy) ............................17, 25, 26, 393, 394 Supernatant ..............43, 47, 58, 144, 202, 204, 206, 240, 343
Strains ...............................................146, 200, 206, 229, 329 Superoxide dismutase 1. See SOD 1
Streptavidin Supraesophageal mass...................................................64, 75
Alexa® 568 .......................................... 363, 366, 367, 370 Suprathreshold .................................................................325
Cy3 .............................................. 114, 116, 221, 222, 325 Surface
Cy5 ..................................................................... 425, 431 passivation ..........................................................429, 435
fluorescein...................................................................325 tension ..........................................................................44
fluorochrome conjugate(s) .................................. 214, 221 Surgery ............................................................. 201, 315–318
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
470 Index
Surgical ..................................... 127, 196, 197, 201, 301, 302, T-bar synapse(s).................................................................. 52
315, 317, 318, 335, 339 T-box brain gene 2. See Tbr2
microscope ..........................................................316, 318 T-box brain protein 1. See TBR1
Survival ...............111, 135, 154, 236, 239, 318–319, 349, 353 TBR1 (t-box brain protein 1) ........................... 363, 368–370
Survivin ............................................................................346 Tbr2 (t-box brain gene 2) ................................. 112, 113, 120
SV40 ......................................................................... 229, 246 TBS (tris-buffered saline) ..................127, 131, 211, 214–216
SVZ (subventricular zone)................................ 109, 110, 141 TBST (tris-buffered saline Triton®) .................................. 284
Swedish mutation .....................................................180, 181 TCA (trichloroacetic acid) ................................................. 91
Sylgard® ........................................................................56, 85 TdR ..................................................................................123
Symbiotic .........................................................................332 TdT (terminal deoxynucleotidyl transferase)....................159
Symmetrical branching.....................................................323 TdT-mediated dUTP nick end-labelling kit ....................158
Symmetry ................................................................. 323, 403 tdTomato ............................................................................50
Synapse(s) ............................. 4, 26, 52, 65, 81, 179, 281–296, Tefzel® ............................................................. 336, 341, 343,
299, 300, 306, 309, 377, 378, 385, 387, 409, 410, 344, 352
416–419 TEM (transmission electron microscope) ............... 2, 4–6, 9,
Synapsin .............................................................................52 18, 22, 23, 127, 155, 156, 281, 285, 302, 304, 392,
Synaptic 393, 399
cleft ..............................................271, 281, 282, 290, 410 Temperature ............................. 10, 40, 45, 46, 56–58, 72–74,
contact(s) .............................................................. 96, 111 76, 83, 90, 98, 99, 143, 159–161, 186, 187, 202,
dwell time ...................................................................416 204, 212, 215 238, 260, 263, 285, 286, 303, 319,
plasticity................................................ 65, 210, 294, 419 321, 325, 342, 344, 345, 349–351, 365, 366, 370,
transmission ..........................................................96, 362 380, 381, 398, 400, 401, 413, 415
vesicle(s) ........................................52, 281–283, 287, 294 Temporal bones ................................................................183
Synaptogenesis .................................................................300 Teratogenic .......................................................................134
Synaptophysin .................................................... 96, 100, 103 Terminal(s) ........................... 54, 97, 125, 144, 159–160, 166,
Synthesis............................................123, 136, 137, 154, 417 259, 263, 277, 281–283, 287, 288, 293, 295, 300,
Synthetic 305, 306, 308, 314, 318, 321, 325
peptide(s) .................................................................... 213 Terminal deoxynucleotidyl transferase. See TdT
transfection reagent(s) ................................................ 333 Test sections .....................................................................293
vector(s) .............................................. 331, 333–335, 353 Texas Red ........................................................... 14, 198, 204
Syringe(s) ............................. 85, 86, 197, 198, 202, 237, 318, Text
339, 340, 344, 352, 379 file(s) ........................................................... 288, 431, 432
filter(s) ................................................ 198, 202, 341, 379 format .........................................................................289
System(s) .............................. 2–21, 24, 25, 27, 39–60, 63–76, Tg2576 mouse ..................................................................181
81, 82, 84, 86, 114, 119, 123, 137, 146, 155, 157, Thalamus .......................................................... 182, 188, 360
174, 175, 210, 221, 222, 226, 228, 232, 258, 260, Theorem ...........................................................................264
261, 265, 275–277, 292, 321, 324, 330, 332, 341, Therapy .............................................154, 195–208, 246, 334
343, 351, 358, 362, 365, 389–391, 406, 418, 423 Thick .............................42, 54, 119, 124, 170, 184, 219, 238,
efficiency.....................................................................261 240, 260, 262, 319, 323, 335, 342, 380, 381, 383
Systematic random approach ............................................142 Thickness ................................... 9, 25, 47, 49, 74, 85, 90, 97,
SYTOX® Green ................... 14, 127, 131, 212, 216, 219, 221 98, 117, 118, 130, 142, 213, 219, 222, 263, 264,
294, 303, 304, 324, 351, 367, 387
T Thin sections ..............................................................10, 282
Tactile .................................................................................64 Thorax ................................................................................44
stimulation ..................................................................302 Three dimensional ................................15, 88, 114, 117, 118,
Tagged antibody ...............................................................410 120, 217, 222. See also 3D
TALEN ..............................................................................82 Threshold ..........................................266, 267, 384, 387, 415
Target ..........................3, 22, 25, 90, 105, 111, 154, 213, 277, segmentation ......................................................266, 267
309, 314, 315, 318, 325, 332–334, 336, 337, 344, Thresholding algorithm............................................266, 267
349, 360, 368, 378, 390, 406, 412, 431 Thy 1.1 ..................................................... 198, 204, 205, 207
Targeted genome editing ....................................................82 Thy 1.2 .............................................. 197, 198, 202, 203, 207
Tat ....................................................................................248 Thymidine ...........................................21, 111, 123–138, 142
Tau protein .......................................................................179 Thymidylate synthetase ....................................................137
τ......................................................................................... 416 TIFF file(s).......................................................................364
Taxa ..............................................................................63, 65 Tight junction(s) .......................226–231, 233, 241–243, 248
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
Index
471
Troponin C .......................................................................210 Vascular ..................................... 228, 232, 235, 236, 238, 423
Trypan Blue ...................................................... 226, 340, 351 Vaseline.............................................................................345
Trypsin ...............197, 199, 201, 207, 340, 342, 350, 412, 414 Vectashield® ................. 58, 128, 133, 325, 362–364, 366, 370
Tuber cinereum.................................................................226 Vector(s) ..................................... 58, 128, 158, 159, 183, 199,
Tubing Prep Station® ........................................ 341, 343, 344 229, 230, 246, 301, 303, 315, 316, 325, 330–335,
Tukey’s honestly significant difference test .......................269 346, 348, 349, 353, 362
TUNEL ....................................158–161, 163, 239, 241, 243 Velocity ..................................................................... 432, 433
Tungsten ...........................................................................335 Ventilated .........................................................................262
Turnover ................................................... 155, 156, 172, 174 Ventilation .................................................................. 59, 259
Turquoise ............................................................................55 Ventral nerve cord. See VNC
Tween® ...............................20, 71, 72, 83, 100, 104, 127, 131, Ventricle(s) ............................................... 114, 132, 141, 226
199, 379, 382 Venule(s)...........................................................................227
2D ................................................................ 25, 27, 264, 266 Venus ...............................................14, 22, 50, 337, 338, 350
Type IV collagen ...................................... 227, 231, 233, 247 Vermis ..............................................................................158
Tyramide signal amplification ..........................................325 Vertebrate(s) ..................................................6, 64, 65, 75, 82
Vertical ....................................................................... 53, 426
U lobe system ...................................................................65
UAS (upstream activating sequences) .................... 49–51, 82, Vesicle(s)
83, 85, 89 marker(s) ...................................................................... 51
Ultramicrotome .................................284, 302, 304, 379, 381 storage site(s) ................................................................51
Ultrasensitive protein calcium sensors ........................22, 337 tracker ..........................................................................49
Ultra-small gold particles ...........................................18, 335 Vesicular ...........................................258, 268, 270, 271, 283,
Ultrasound(s) ............................................................ 127, 333 288, 293–295, 300, 301, 306
Ultrastructural ................................... 2, 4, 5, 7, 8, 18, 65, 283 Vesicular GABA transporter. See vGAT
Ultrastructure ................................................. 5, 7, 9, 10, 285 Vesicular glutamate transporter. See VGLUT
Ultrathin Veterinary ................................................................. 134, 244
cryosection(s) .................................................................. 5 vGAT (vesicular GABA ransporter) ....................... 258, 268,
section(s)............................. 282, 283, 291, 294, 296, 304, 269, 271, 273
381–384, 386, 387 VGluT1 ............................................................................300
sectioning.......................................................... 9, 23, 378 VGluT2 ..................... 258, 270, 300, 301, 303–306, 308, 309
Ultraviolet (UV) VGLUT (vesicular glutamate transporter) ....................... 378
B-photolysis ...............................................................125 Viable ...............................................................................351
light .................................................10, 25, 285, 286, 314 Vial(s) ................................................................. 56, 260, 263
polymerization chamber ...............................................28 Vibrating microtome ................................................362, 364
Umbilical vein ..................................................................248 Vibration .................................................................. 276, 317
Unbiased .............................. 19, 118, 119, 181, 286, 378, 385 Vibratome................................... 42, 46, 47, 72, 73, 113, 115,
Undifferentiated .................................................................96 127, 131, 316, 317, 319, 323, 379, 380
Un-masking section(s)...................................... 6, 42, 46, 47, 66, 72–74
buffer ..........................................................................220 Vimentin ............................................................ 96, 101, 105
solution .......................................................................213 Viral.......................................................... 247, 303, 309, 330
Unspecific .........................................45–48, 57, 97, 105, 106, vector(s) .............................................. 246, 315, 330–332
182, 187, 400 Virtual stereology .....................................................267–269
Upstream activating sequences. See UAS Virus(es) .................... 156, 235, 248, 303, 307, 330–332, 358
Uptake .............................................................. 230, 317, 351 Viscera ................................................................................65
Uranyl acetate ...........................................................285, 286 Viscosity ............................................................. 10, 128, 133
Urine ................................................................................134 Visual.................................................................. 64, 265, 323
Usual mounting medium ..................................................133 inspection ..................................................... 54, 267, 271
Vital dye(s) .......................................................................226
V VNC (ventral nerve cord) .............................................52–54
Vacuum grease ..................................................................345 Voltage ......................................... 22, 323, 339, 371, 425, 432
VALAP ............................................................................345 clamp .................................................................. 323, 366
Vapor ..................................................................................59 Volume .................. 15, 17, 24, 40, 41, 43, 46, 83, 86, 87, 113,
Variable region......................................................................2 116, 118, 119, 128, 144, 155, 169, 186, 204, 206,
Variance ............................................................................269 213, 215, 216, 269, 272, 274, 293, 343, 351, 352,
Varicosity ..........................................................................300 378, 384, 387, 398, 401, 413, 414, 418, 434, 435
Varying intensity thresholds .............................................266 density ........................................................................119
IMMUNOCYTOCHEMISTRY AND RELATED TECHNIQUES
Index
473
Volumetric image(s).................................................. 384, 385 Wiring ...........................................81, 82, 304, 309, 314, 423
Von Willebrand factor ......................................................230 Wistar............................................................... 157, 158, 317
Vortex ....................................................................... 341, 343 Working solution .....................48, 72–74, 183, 215, 216, 222
Voxel(s) ................................................ 24, 266, 269, 272, 276 Würzburg Hybridoma Library .....................................43, 52
VSFP2s.............................................................................339
VSFP3s.............................................................................339 X
X-direction .......................................................................432
W
5XFAD mouse ......................................... 182, 185, 188, 189
Warm bath ...............................................................198, 201 XFP(s) .................................................................... 50, 51, 59
Water ...................................40–42, 46, 58, 72, 73, 83, 85, 86, fusion constructs ...........................................................51
97, 100, 113, 115, 129, 144, 157, 158, 160, 184, X-ray irradiation ...............................................................300
186, 187, 198, 212–216, 219, 220, 226, 228, 229, 3xTg-AD mouse ..............................................................191
238, 285, 339, 340, 351, 361, 362, 434 x-y
Waveform .........................................................................300 plane ....................................................... 16, 24, 264, 276
Wavelength(s)........................... 14, 17, 25, 58, 133, 183, 240, shifting .......................................................................345
258, 261, 264, 275, 276, 314, 341, 346, 391, 392, Xylazine .................................................... 143, 144, 315, 317
397, 415, 425, 426 Xylene............................... 157, 159, 160, 182, 184, 186, 187,
Wedge optical window .....................................................425 211, 213, 214, 216, 237, 238, 316, 319, 379–381
Well(s) ........................... 10, 18, 19, 39, 40, 42–44, 46, 47, 53, XYZ translation stage .......................................................426
55–58, 74, 82, 87, 98, 106, 116, 117, 123, 124,
130, 136, 146, 156, 164, 165, 174, 179–181, 186, Y
189, 190, 198, 202, 204, 210, 211, 213, 216, 229, Y-direction........................................................................432
230, 235, 240, 248, 260, 290, 293–296, 307, 315, Yeast .................................................................................332
316, 319, 334, 343, 344, 360, 370, 377, 378, 384, Yellow fluorescent protein. See YFP
385, 387, 393, 394, 397, 398, 400, 401, 413, 414 YFP (yellow fluorescent protein) ......... 14, 21, 22, 50, 89, 337
24-well culture plate .....................................................72, 74
24-well plates................................ 42, 46, 47, 56, 85, 87, 113, Z
115, 259, 263, 370
Z-
Western .............................................2, 8, 260, 277, 292, 293
area ...............................................................................49
White
axis .................................... 15–17, 24, 25, 54, 87, 88, 114,
blood cell(s) ................................................................228
117–120, 264, 275, 353, 378, 433
matter ......................................................... 136, 220, 307
imaging .................................................................305
Whole
Zamboni’s fixative ..............................................................56
cell(s)
Zebrafish .......................................................... 6, 81–91, 337
configuration................................. 317, 324, 325, 370
ZFN (zinc-finger nuclease) ................................................ 82
recording ............................................... 300, 365–367
Zfp312..............................................................................360
embryo(s) ........................................................................ 5
Zinc finger ........................................................................360
mount(s) .................................... 2, 5, 6, 44–46, 49, 87, 89
ZO-1 ................................................. 227, 230, 233, 247, 248
Wide field .......................................15, 17, 26, 276, 364, 366
ZO-2 ................................................................................ 248
fluorescence microscopy........................15, 16, 24, 26, 27,
Zoom ................................................................................264
260, 350, 361, 364, 368
z-plane(s) .................................................. 264, 267–270, 274
Width ...................84, 271, 288, 294, 325, 367, 369, 391, 403
Wild-type (WT) ........196, 200, 206, 295, 305, 306, 308, 309 z-step ................................................................................367