TN XII - STD - Bio-Botany - English - Medium PDF

GOVERNMENT OF TAMIL NADU
BIOLOGY
BOTANY
HIGHER SECONDARY SECOND YEAR
Untouchability is Inhuman and a Crime

A publication under Free Textbook Programme of Government of Tamil Nadu
Department of School Education
TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 1 03-03-2019 14:51:26

Government of Tamil Nadu
First Edition - 2019
(Published under New Syllabus)
NOT FOR SALE
Content Creation
The wise
possess all
State Council of Educational

Research and Training
© SCERT 2019
Printing & Publishing
Tamil NaduTextbook and Educational

Services Corporation
www.textbooksonline.tn.nic.in
II

CONTENTS
BIOLOGY: BOTANY
UNIT VI: Reproduction in Plants

Chapter 1 Asexual and Sexual Reproduction in Plants 1
UNIT VII: Genetics

Chapter 2 Classical Genetics 33
Chapter 3 Chromosomal Basis of Inheritance 53
UNIT VIII: Biotechnology

Chapter 4 Principles and Processes of Biotechnology 78
Chapter 5 Plant Tissue Culture 107
UNIT IX: Plant Ecology

Chapter 6 Principles of Ecology 122
Chapter 7 Ecosystem 148
Chapter 8 Environmental Issues 169
UNIT X: Economic Botany

Chapter 9 Plant Breeding 185
Chapter 10 Economically Useful
Plants and Entrepreneurial Botany 200
Annexure
References 220
English – Tamil Terminology 222
Competitive Examination Questions 225
Botany Practicals 239
E-book Assessment DIGI links
Lets use the QR code in the text books ! How ?

• Download the QR code scanner from the Google PlayStore/ Apple App Store into your smartphone
• Open the QR code scanner application
• Once the scanner button in the application is clicked, camera opens and then bring it closer to the QR code in the text book.
• Once the camera detects the QR code, a url appears in the screen.Click the url and goto the content page.
III

Career corner List of professions related to the subject
Learning objectives are brief statements that describe what

Learning Objectives: students will be expected to learn by the end of school year,
course, unit, lesson or class period.
Chapter Outline Illustrate the complete overview of chapter
Amazing facts, Rhetorical questions to lead students

to biological inquiry
Activity Directions are provided to students to conduct activities

in order to explore, enrich the concept.
Infographics Visual representation of the lesson to enrich learning .

HOW TO USE
THE BOOK Evaluation Assess students to pause, think and check their understanding
To motivate the students to further explore the content

digitally and take them in to virtual world
ICT To enhance digital Science skills among students
Conceptual diagram that depicts relationships between

Concept Map concepts to enable students to learn the content schematically
Glossary Explanation of scientific terms
Tamil terminology for Botanical terms given for easy

English - Tamil Terminology understanding
References List of related books for further details of the topic
Web links List of digital resources
Competitive
Model questions to face various competitive exams
Exam questions
IV

Scope of Botany
Higher Studies and Career Opportunities
List of Medical Courses

8 B.O.T (Occupational Therapy) – 3 years
1 M. B. B. S. (Bachelor of Medicine and
The Occupational Therapy helps the
Bachelor of Surgery) – 5.5 years
people to enable in their everyday life
MBBS is the bachelor degree in medical and treats the emotionally and physically
field for cure & diagnose, awarded in challenged people.
many countries.
2 B. D. S. (Bachelor of Dental Surgery) – 4

years 9 B.U.M.S (Unani Medicine) – 5.5 years
BUMS degree is equivalent to the BAMS,
BDS is a professional degree programme
but in Unani medicines.
in dentistry.
Naturopathy & Yogic Science is one of
3 B. H. M. S. (Bachelor of Homeopathic the trusted fields after Allopathy in India.
Medicine & Surgery) – 5.5 years Duration: 4 Years
BHMS is a bachelor degree in
Homeopathic Education in India
regulated by the National Institute of 10 D.Pharm (Ayurvedic, Siddha Medicine)
Homeopathy. – 2 years
It is a medical diploma course in pharmacy
4 B. A. M. S. (Bachelor of Ayurvedic of ayurvedic medicines.
Medicine and Surgery) – 5.5 years
BAMS is a bachelor degree in ayurvedic
system of medical field. In India, the BMLT (Bachelor of Medical Lab
11
Ayurvedic Education is regulated by Technicians) – 3 year
the Central Council of Indian Medicine
It is a bachelor degree of medical
(CCIM).
laboratory technology, contains the
B.Pharm (Bachelor of Pharmacy) – 4 entire laboratory practices of the
5
years medical system. Various institutions are
This degree involves the knowledge of offering the B.Sc. programme in medical
pharmacy. laboratory technology in India.
6 B.Sc Nursing – 4 years

The motive of B.Sc. Nursing programme 12 DMLT (Diploma of Medical Lab
is to produce the qualified nurses, as a Technicians) – 1 year
member of the health care team. It is a medical diploma course of medical
laboratory technology, contains the
7 B.P.T (Physiotherapy) – 4.5 years laboratory practices of the medical field.
Physiotherapy helps the temporary Candidate must have cleared the 10+2
disabled people in their rehabilitation. exam with PCB.
V

Agricultural Courses Botany Career Opportunities and
 B.Sc in Agriculture Job Prospects
 B.Sc in Genetics and Plant Breeding
 B.Sc in Agriculture Economics and Farm The amount of diversity in the field of Botany
Management gives it students to choose their specializations
 B.Sc in Animal Husbandry as per their choice, aptitude and interests. One
 B.Sc in Fisheries can be a part of any reputed organization as a
 B.Sc in Forestry Plant explorer: Botanist with a passion for
 B.Sc Soil and water management plants who could be a photographer, writer,
 B.Sc in Horticulture expeditioner, etc
 B.Sc Agriculture and Food Business Conservationist: Is an individual who works
 M.Sc in Agronomy for the conservation of the environment and is
 M.Sc Agricultural Economics often linked to organisations working for the
 M.Sc Seed science and Technology cause.
 M.Sc Agricultural Entomology
 M.Sc Agricultural Statistics Ecologist: A person who works for the eco-
 Diploma in Agriculture system and a balanced environment.
Environment consultant: Some botanists
Various Botany courses qualify to work as environmental consultants,
 Bachelor of Science in Botany providing inputs and advice for the conservation
 Bachelor of Science (Hons) in Botany of the environment.
 Master of Science in Botany Horticulturist: A horticulturist knows the
 Master of Science in Botany and Forestry science behind different plants, flowers, and
 Master of Science in Applied Botany greenery. They conduct research in gardening
 Master of Science in Herbal Science and landscaping, plant propagation, crop
 Post Graduate Diploma in Medico botany production, plant breeding, genetic engineering,
 Post Graduate Diploma in Plant Biodiversity plant biochemistry, and plant physiology.
Specializations available for botany are: Plant biochemist: Biochemists study the
chemical and physical principles of living
 Cytology  Genetics
things and of biological processes, such as cell
 Lichenology  Economic botany
development, growth, heredity, and disease.
 Palynology  Palaeobotany
 Bryology  Ethnobotany Molecular biologist: Molecular biologists
conduct research and academic activities.
 Phycology Phytochemistry
The research component involves the study
 Forestry  Plant morphology
of biological structures in well-equipped
 Phytopathology  Plant anatomy
laboratories with advanced technology to help
 Plant physiology  Plant genetics them explore complex molecular structures
 Agronomy  Horticulture and their particular functions. The equipment
 Plant ecology  Plant systematic may include microscopes, lab centrifuges,
computers with specific software that allows
Veterinary Science
them to analyze obtained data, and many more.
Bachelor of Veterinary Science or B.V.Sc. is an
undergraduate program in veterinary
VI

UNIT VI: Reproduction in Plants
Chapter
1 Asexual and Sexual

Reproduction in Plants
One of the essential features of all living things

Learning Objectives on the earth is reproduction. Reproduction is a
The learner will be able to vital process for the existence of a species and it
also brings suitable changes through variation in
Recall various types of reproduction in
the offsprings for their survival on earth. Plant
lower and higher organisms.
reproduction is important not only for its own
Discuss different methods of vegetative survival but also for the continuation and existence
reproduction in plants. of all other organisms since the latter directly or
Recognise modern methods of indirectly depend on plants. Reproduction also
reproduction. plays an important role in evolution.
Recall the parts of a flower. In this unit let us learn in detail about
Recognise the structure of mature reproduction in plants.
anther. Milestones in Plant Embryology
Describe the structure and types of 1682 - Nehemiah Grew mentioned stamens as
ovules. the male organ of a flower.
Discuss the structure of embryo sac. 1694 - R.J.Camerarius described the structure
Recognise different types of pollination. of a flower, anther, pollen and ovule
Identify the types of endosperms. 1761 - J.G. Kolreuter gave a detailed account
Differentiate the structure of Dicot and on the importance of insects in
Monocot seed. pollination
1824 - G.B.Amici discovered the pollen tube.
Chapter outline 1848 - Hofmeister described the structure of
pollen tetrad
1.1 Asexual reproduction 1870 - Hanstein described the development of
1.2 Vegetative reproduction embryo in Capsella and Alisma
1.3 Sexual Reproduction 1878 - E.Strasburger reported polyembryony
1.4 Pre-fertilization 1884 - E.Strasburger discovered the process of
structure and events Syngamy.
1.5 Fertilization 1898 - S.G.Nawaschin and L. Guignard
1.6 Post fertilization structure and events & independently discovered Double
1.7 Apomixis 1899 fertilization
1.8 Polyembryony 1904 – E.Hanning initiated embryo culture.
1.9 Parthenocarpy 1950 - D.A. Johansen proposed classification
for embryo development
Asexual and Sexual Reproduction in Plants 1
TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 1 03-03-2019 14:26:03

1964 - S.Guha and S.C.Maheswari raised and Binary fission (Bacteria) (Refer chapter 1 of
haploids from Datura pollen grains Unit I of class XI). The individuals formed by
1991 - E.S.Coen and E. M. Meyerowitz this method is morphologically and genetically
proposed the ABC model to describe the identical and are called clones. Higher plants
genetics of initiation and development also reproduce asexually by different methods
of floral parts which are given below:
2015 - K.V.Krishnamurthy summarized the
1.2 Vegetative reproduction
molecular aspects of pre and post
1.2.1 Natural methods
fertilization reproductive development
Natural vegetative reproduction is a form of
in flowering plants
asexual reproduction in which a bud grows
Panchanan Maheswari (1904-1966) and develops into a new plant. The buds may
be formed in organs such as root, stem and
Professor P. Maheswari
leaf. At some stage, the new plant gets detached
was an eminent Botanist from the parent plant and starts to develop
who specialised in plant into a new plant. Some of the organs involved
embryology, morphology in the vegetative reproduction also serve as the
and anatomy. In 1934, organs of storage and perennation. The unit of
he became the Fellow reproductive structure used in propagation is
of Indian Academy of called reproductive propagules or diaspores.
Science. He published Some of the organs that help in vegetative
the book titled “An introduction to the reproduction are given in Figure 1.1.
Embryology of Angiosperms”in 1950. He A. Vegetative reproduction in root
established the International Society for
Plant Morphologists, in 1951. The roots of some plants develop vegetative or
adventitious buds on them. Example Murraya,
Basically reproduction occurring in Dalbergia and Millingtonia. Some tuberous
organisms fall under two major categories adventitious roots apart from developing buds
1. Asexual reproduction also store food. Example Ipomoea batatus
2. Sexual reproduction. and Dahlia. Roots possessing buds become
detached from the parent plant and grow into
1.1 Asexual Reproduction independent plant under suitable condition.
The reproduction method which helps
to perpetuate its own species without the Scourge of water bodies /
involvement of gametes is referred to as asexual Water hyacinth (Eichhornia
reproduction. From Unit I of Class XI we crassipes) is an invasive weed
know that reproduction is one of the attributes on water bodies like ponds,
of living things and the different types of lakes and reservoirs. It is popularly called
reproduction have also been discussed. Lower “Terror of Bengal”. It
plants, fungi and animals show different methods spreads rapidly through
of asexual reproduction. Some of the methods offset all over the water
include, formation of Conidia (Aspergillus body and depletes the
and Penicillium); Budding (Yeast and Hydra); dissolved oxygen and
Fragmentation (Spirogyra); production of causes death of other
Gemma (Marchantia); Regeneration (Planaria) aquatic organisms.
2 Asexual and Sexual Reproduction in Plants

Murraya tree
Epiphyllous
young plant buds
growing from roots (f) Reproduction
by leaf
Bryophyllum
(a) Reproduction by roots – Murraya

Terminal bud
Node
Internode
(g) Runner
Centella asiatica
Runner
(b) Rhizome – Zingiber officinale
Terminal bud
(Daughter plant)
Root
Stolon
(c) Corm – Colocasia (h) Stolon
Fragaria
Offset
Bud from eye

(i) Offset
Pistia stratiotes
(d) Tuber – Solanum tuberosum
Fleshy scale leaf (j) Sucker

Axillary bud Chrysanthemum
Reduced stem
Sucker
Adventitious roots
i) Tunicated – Allium cepa
(e) Bulb
Naked scale
leaves
Bulbil
(k) Axillary bulbils

Dioscorea bulbifera
ii) Naked – Lilium
Figure 1.1 a-k: Natural methods of vegetative reproduction in plants.

• Horticulturists and farmers utilize these
Activity organs of natural vegetative reproduction
Visit to a vegetable market and classify the for cultivation and to harvest plants in
vegetables into root, stem or leaf based on large scale.
their utility and identify how many of them
Disadvantage of natural vegetative
can be propagated through asexual methods. reproduction
• New plants produced have no genetic
B. Vegetative reproduction in stem
variation.
From the Unit 3 of class XI (Vegetative
morphology) you are familiar with the structure 1.2.2 Artificial Methods
of various underground stem and sub aerial stem Apart from the above mentioned natural methods
modifications. These include rhizome (Musa of vegetative reproduction, a number of methods
paradisiaca, Zingiber officinale and Curcuma are used in agriculture and horticulture to
longa); corm (Amorphophallus and Colocasia); propagate plants from their parts. Such methods
tuber (Solanum tuberosum); bulb(Allium cepa are said to be artificial propagation. Some of the
and Lilium) runner (Centella asiatica); stolon artificial propagation methods have been used by
(Mentha, and Fragaria); offset (Pistia, and man for a long time and are called conventional
Eichhornia); sucker (Chrysanthemum) and methods. Now-a-days, technology is being used
bulbils (Dioscorea and Agave). The axillary buds
for propagation to produce large number of plants
from the nodes of rhizome and eyes of tuber give
in a short period of time. Such methods are said
rise to new plants.
to be modern methods.
C. Vegetative reproduction in leaf
A. Conventional methods
In some plants adventitious buds are developed
on their leaves. When they are detached The common methods of conventional
from the parent plant they grow into new propagation are cutting, grafting and layering.
individual plants. Examples: Bryophyllum, a. Cutting: It is the method of producing a new
Scilla, and Begonia. In Bryophyllum, the plant by cutting the plant parts such as root, stem
leaf is succulent and notched on its margin. and leaf from the parent plant. The cut part is placed
Adventious buds develop at these notches and in a suitable medium for growth. It produces root
are called epiphyllous buds. They develop and grows into a new plant. Depending upon the
into new plants forming a root system and part used it is called as root cutting (Malus), stem
become independent plants when the leaf gets cutting (Hibiscus, Bougainvillea and Moringa) and
decayed. Scilla is a bulbous plant and grows leaf cutting (Begonia, Bryophyllum). Stem cutting
in sandy soils. The foliage leaves are long and is widely used for propagation.
narrow and epiphyllous buds develop at their b.Grafting: In this, parts of two different plants
tips. These buds develop into new plants when are joined so that they continue to grow as one
they touch the soil. plant. Of the two plants, the plant which is in
Advantages of natural vegetative contact with the soil is called stock and the
reproduction plant used for grafting is called scion (Figure
• Only one parent is required for propagation. 1.2 a). Examples are Citrus, Mango and Apple.
• The new individual plants produced are There are different types of grafting based on the
genetically identical. method of uniting the scion and stock. They are
bud grafting, approach grafting, tongue grafting,
• In some plants, this enables to spread
crown grafting and wedge grafting.
rapidly. Example: Spinifex

‘T’
shaped Bud (Scion) Scion
insertion Stock Scion
Stock Stock
Stock Scion
(ii) Approach (iii) Tongue
(i) Bud grafting (iv) Crown grafting (v) Wedge grafting
grafting grafting
a) Types of Grafting
Figure 1.2(a): Artificial methods of vegetative reproduction in plants
i. Bud grafting: A T- shaped incision is made c. Layering: In this method, the stem of
in the stock and the bark is lifted. The scion bud a parent plant is allowed to develop roots
with little wood is placed in the incision beneath while still intact. When the root develops,
the bark and properly bandaged with a tape. the rooted part is cut and planted to grow as
a new plant. Examples: Ixora and Jasminum.
ii. Approach grafting: In this method both
Mound layering and Air layering are few types
the scion and stock remain rooted. The stock
of layering (Figure 1.2 b).
is grown in a pot and it is brought close to
the scion. Both of them should have the same i. Mound layering: This method is applied for
thickness. A small slice is cut from both and the the plants having flexible branches. The lower
cut surfaces are brought near and tied together branch with leaves is bent to the ground and
and held by a tape. After 1-4 weeks the tip of part of the stem is buried in the soil and tip of
the stock and base of the scion are cut off and the branch is exposed above the soil. After the
detached and grown in a separate pot. roots emerge from the part of the stem buried
in the soil, a cut is made in parent plant so that
iii. Tongue grafting
the buried part grow into a new plant.
A scion and stock having the same thickness is
cut obliquely and the scion is fit into the stock
and bound with a tape.
iv. Crown grafting.
When the stock is large in size scions are cut
(i) Mound layering
into wedge shape and are inserted on the slits
or clefts of the stock and fixed in position
using graft wax.
v. Wedge grafting
In this method a slit is made in the stock or the Polythene
Bark tissue Moist soil
bark is cut. A twig of scion is inserted and tightly removed tied to retain
bound so that the cambium of the two is joined. moisture
(ii) Air layering
Activity b) Types of Layering

Visit a nursery, observe the method of Figure 1.2(b): Artificial methods of
grafting, layering and do these techniques vegetative reproduction in plants
with plants growing in your school or home

ii. Air layering: In this method the stem is plant tissue in special culture medium under
girdled at nodal region and hormones are suitable controlled conditions is known as
applied to this region which promotes rooting. tissue culture.
This portion is covered with damp or moist soil Micropropagation
using a polythene sheet. Roots emerge in these
The regeneration of a whole plant from
branches after 2-4 months. Such branches are
single cell, tissue or small pieces of vegetative
removed from the parent plant and grown in a
structures through tissue culture is called
separate pot or ground.
micropropagation. This is one of the modern
Advantages of conventional methods methods used to propagate plants. The detailed
• The plants produced are genetically uniform. steps involved in the micropropagation are
• Many plants can be produced quickly by given in Unit VIII.
this method. Advantages of modern methods
• Some plants produce little or no seeds; • Plants with desired characteristics can be
in others, the seeds produced do not multiplied rapidly in a short duration.
germinate. In such cases, plants can be • Plants produced are genetically identical.
produced in a short period by this method.
• Tissue culture can be carried out in any
• Some plants can be propagated more season to produce plants.
economically by vegetative propagation.
• Plants which do not produce viable seeds
Example: Solanum tuberosum.
and seeds that are difficult to germinate
• Two different plants with desirable can be propagated by tissue culture.
characters such as disease resistant and
• Rare and endangered plants can be
high yield can be grafted and grown as a new
propagated.
plant with the same desirable characters.
• Disease free plants can be produced by
Disadvantages of conventional methods meristem culture.
• Use of virus infected plants as parents • Cells can be genetically modified and
produces viral infected new plants. transformed using tissue culture.
• Vegetative structures used for propagation
Disadvantages of modern methods
are bulky and so they are difficult to handle
and store. • It is labour intensive and requires skilled
workers.
B. Modern Method
• Sterile condition must be maintained
Professor F.C. Steward(1932) of Cornell which adds to the cost.
University showed that the mature phloem
• Since the clones are genetically identical,
parenchyma cells removed from the carrot
the entire crop is susceptible to new
were placed in a suitable medium under
diseases or changes in environmental
controlled conditions, could be stimulated to
conditions will wipe out the species.
start dividing again to produce a new carrot
plant. These cells were described as totipotent. • S ometimes, callus
The genetic ability of a plant cell to produce the undergoes genetical
entire plant under suitable conditions is said changes which are
to be totipotency. This characteristic feature undesirable for
of a cell is utilized in horticulture, forestry and commercial use.
industries to propagate plants. The growth of

1.3 Sexual Reproduction structures and events involved in pre-
fertilization are given below
In previous classes reproduction in lower
plants like algae and bryophytes was discussed
in detail. Sexual reproduction involves the Stigma
production and fusion of male and female Style
gametes. The former is called gametogenesis Stamen
and the latter is the process of fertilization. Let Petal
us recall the sexual reproduction in algae and

bryophytes. They reproduce by the production
Sepal
of gametes which may be motile or non motile Ovary
depending upon the species. The gametic Ovule
fusion is of three types (Isogamy, Anisogamy Pedicel

and Oogamy). In algae external fertilization
Figure 1.3 Parts of a Flower
takes place whereas in higher plants internal
fertilization occurs. 1.4.1 Male Reproductive part -
Androecium
Flower Androecium is made up of stamens. Each
A flower is viewed in multidimensional stamen possesses an anther and a filament.
perspectives from time immemorial. It is Anther bears pollen grains which represent
an inspirational tool for the poets. It is a the male gametophyte. In this chapter we
decorative material for all the celebrations. In shall discuss the structure and development of
Tamil literature the five lands are denoted by anther in detail.
different flowers. The flags of some countries Development of anther: A very young
are embedded with flowers. Flowers are anther develops as a homogenous mass of
used in the preparation of perfumes. For a cells surrounded by an epidermis. During
Morphologist, a flower is a highly condensed its development, the anther assumes a four-
shoot meant for reproduction. As you have lobed structure. In each lobe, a row or a few
already learned about the parts of a flower rows of hypodermal cells becomes enlarged
in Unit II of Class XI, let us recall the parts with conspicuous nuclei. This functions as
of a flower. A Flower possesses four whorls- archesporium. The archesporial cells divide
Calyx, Corolla, Androecium and Gynoecium. by periclinal divisions to form primary
Androecium and Gynoecium are essential parietal cells towards the epidermis and
organs(Figure 1.3). The process or changes primary sporogenous cells towards the inner
involved in sexual reproduction of higher side of the anther. The primary parietal cells
plants include three stages .They are Pre- undergo a series of periclinal and anticlinal
fertilization, Fertilization and Post fertilization division and form 2-5 layers of anther walls
changes. Let us discuss these events in detail. composed of endothecium, middle layers and
tapetum, from periphery to centre.
1.4 Pre-fertilization structure Microsporogenesis: The stages involved
in the formation of haploid microspores from
and events
diploid microspore mother cell through meiosis
The hormonal and structural changes
is called Microsporogenesis. The primary
in plant lead to the differentiation and
sporogeneous cells directly, or may undergo
development of floral primordium. The
a few mitotic divisions to form sporogenous

Parietal cell
Archesporial Sporogenous cell
cell
(a) Anther primordium (b) Differentiation of (c) Formation of parietal and (d) Formation of wall layers
archesporial cell sporogenous cell
Epidermis
Epidermis Endothecium
Middle layers Middle layer
Tapetum Tapetum
Sporogenous cell Microspores
Pollen tetrad
Stomium
Connective
(e) Sporogenous stage (f) Pollen tetrad stage (g) Microspore stage
Connective
Epidermis
Endothecium Activity
Middle layer
Pollen grain Collect buds and opened flowers of Datura
Stomium metel. Dissect the stamens, separate the
anthers and take thin transverse sections and
observe the structure under the microscope.
Record the various stages of anther
development from your observations.
(h) Pollen grain stage
Figure 1.4 Stages in the Figure

development of anther
2.1 Development of anther (Microsporogenesis)
(dithecous). A typical anther is tetrasporangiate.
tissue. The last generation of sporogenous tissue
The T.S. of Mature anther is given in Figure 1.5.
functions as microspore mother cells. Each
microspore mother cell divides meiotically 1. Anther wall
to form a tetrad of four haploid microspores The mature anther wall consists of the
(microspore tetrad). Microspores soon separate following layers a. Epidermis b. Endothecium
from one another and remain free in the anther c. Middle layers d. Tapetum.
locule and develop into pollen grains. The stages a. Epidermis: It is single layered and protective
in the development of microsporangia is given in in function. The cells undergo repeated
Figure 1.4. In some plants, all the microspores in anticlinal divisions to cope up with the rapidly
a microsporangium remain held together called enlarging internal tissues.
pollinium. Example: Calotropis. Pollinia are b.Endothecium: It is generally a single layer
attached to a clamp or clip like sticky structure of radially elongated cells found below the
called corpusculum. The filamentous or thread epidermis. The inner tangential wall develops
like part arising from each pollinium is called bands (sometimes radial walls also) of α cellulose
retinaculum. The whole structure looks like (sometimes also slightly lignified). The cells are
inverted letter 'Y' and is called translator hygroscopic. In the anthers of aquatic plants,
T.S. of Mature anther saprophytes, cleistogamous flowers and extreme
Transverse section of mature anther reveals parasites endothecial differentiation is absent.
the presence of anther cavity surrounded by an The cells along the junction of the two sporangia
anther wall. It is bilobed, each lobe having 2 theca of an anther lobe lack these thickenings. This

region is called stomium. This region along with the developing microspores.
the hygroscopic nature of endothecium helps in Invasive tapetum (periplasmodial): The
the dehiscence of anther at maturity. cells loose their inner tangential and radial
Connective walls and the protoplast of all tapetal cells
Epidermis coalesces to form a periplasmodium.
Endothecium
Middle layer Functions of Tapetum:
Tapetum • It supplies nutrition to the developing
Stomium microspores.
Pollen grain
• It contributes sporopollenin through
ubisch bodies thus plays an important
role in pollen wall formation.
Diagrammatic view • The pollenkitt material is contributed by
tapetal cells and is later transferred to the
pollen surface.
• Exine proteins responsible for ‘rejection
reaction’ of the stigma are present in the
cavities of the exine. These proteins are
View under microscope derived from tapetal cells.
Figure 1.5 T.S of Mature anther
Many botanists speak of a
c. Middle layers: Two to three layers of
third type of tapetum called
cells next to endothecium constitute middle
amoeboid, where the cell wall
layers. They are generally ephemeral. They
is not lost. The cells protrude
disintegrate or get crushed during maturity. into the anther cavity through an amoeboid
d. Tapetum: It is the innermost layer of anther movement. This type is often associated with
wall and attains its maximum development at the male sterility and should not be confused with
tetrad stage of microsporogenesis. It is derived periplasmodial type.
partly from the peripheral wall layer and partly
from the connective tissue of the anther lining 2. Anther Cavity : The anther cavity is filled with
the anther locule. Thus, the tapetum is dual in microspores in young stages or with pollen grains
origin. It nourishes the developing sporogenous at maturity. The meiotic division of microspore
tissue, microspore mother cells and microspores. mother cells gives rise to microspores which are
The cells of the tapetum may remain uninucleate haploid in nature.
or may contain more than one nucleus or 3. Connective: It is the column of sterile tissue
the nucleus may become polyploid. It also surrounded by the anther lobe. It possesses
contributes to the wall materials, sporopollenin, vascular tissues. It also contributes to the
pollenkitt, tryphine and number of proteins that inner tapetum.
control incompatibility reaction .Tapetum also Microspores and pollen grains
controls the fertility or sterility of the microspores
Microspores are the immediate product of
or pollen grains.
meiosis of the microspore mother cell whereas
There are two types of tapetum based on its the pollen grain is derived from the microspore.
behaviour. They are: The microspores have protoplast surrounded
Secretory tapetum (parietal/glandular/ by a wall which is yet to be fully developed. The
cellular): The tapetum retains the original pollen protoplast consists of dense cytoplasm
position and cellular integrity and nourishes with a centrally located nucleus. The wall is

differentiated into two layers, namely, inner Bee pollen is a natural substance
layer called intine and outer layer called exine. and contains high protein,
Intine is thin, uniform and is made up of pectin, carbohydrate, trace amount of
hemicellulose, cellulose and callose together minerals and vitamins. Therefore,
with proteins. Exine is thick and is made up it is used as dietary supplement and is sold as
pollen tablets and syrups. Further , it increases
of cellulose, sporopollenin and pollenkitt. The
the performance of
exine is not uniform and is thin at certain areas. athletes, race horses
When these thin areas are small and round it is and also heals the
called germ pores or when elongated it is called wounds caused by
furrows. It is associated with germination of burns . The study of
pollen grains. The sporopollenin is generally honey pollen is called
absent in germ pores.The surface of the exine Mellitopalynology.
is either smooth or sculptured in various
patterns (rod like, grooved, warty, punctuate Pollen calendar shows
etc.) The sculpturing pattern is used in the the production of pollen
by plants during different
plant identification and classification.
seasons. This benefits the
Shape of a pollen grain varies from species allergic persons. Pollen grains cause allergic
to species. It may be globose, ellipsoid, fusiform, reactions like asthma, bronchitis, hay fever,
lobed, angular or crescent shaped. The size of the allergic rhinitis etc.,
pollen varies from 10 micrometers in Myosotis Parthenium hysterophorus L. (Family-
to 200 micrometers in members of the family Asteraceae) is commonly called Carrot
Cucurbitaceae and Nyctaginaceae grass is a native of tropical America and
was introduced into India as a contaminant
Palynology is the study of pollen along with cereal wheat. The pollen of this
grains.It helps to identify the plant cause Allergy.
distribution of coal and to locate
oil fields. Pollen grains reflect
the vegetation of an area.
Liquid nitrogen (-1960C) is used to
preserve pollen in viable condition for
prolonged duration. This technique is called
cryopreservation and is used to store pollen
grains (pollen banks) of economically
important crops for breeding programmes..
The wall material sporopollenin is

contributed by both pollen cytoplasm and
tapetum. It is derived from carotenoids.
It is resistant to physical and biological
decomposition. It helps to withstand high
temperature and is resistant to strong acid,
alkali and enzyme action. Hence, it preserves
the pollen for long periods in fossil deposits,
and it also protects pollen during its journey
from anther to stigma.

Pollenkitt is contributed by the tapetum The intine grows as pollen tube through the germ
and coloured yellow or orange and is chiefly pore. In case the pollen is liberated at 2 celled stage the
made of carotenoids or flavonoids. It is an oily generative cell divides in the pollen into 2 male cells
layer forming a thick viscous coating over pollen (sperms) after reaching the stigma or in the pollen
surface. It attracts insects and protects damage tube before reaching the embryo sac. The stages
from UV radiation. in the development of male gametophyte is given
Development of Male gametophyte: in Figure 1.6.
The microspore is the first cell of the male
gametophyte and is haploid. The development of 1.4.2 Female reproductive part -
male gametophyte takes place while they are still in Gynoecium
the microsporangium. The nucleus of the microspore The gynoecium represents the female
divides to form a vegetative and a generative reproductive part of the flower. The word
nucleus. A wall is laid around the generative nucleus gynoecium represents one or more pistils of a
resulting in the formation of two unequal cells, a flower. The word pistil refers to the ovary, style
large irregular nucleus bearing with abundant food and stigma. A pistil is derived from a carpel. The
reserve called vegetative cell and a small generative
word ovary represents the part that contains the
cell. At this 2 celled stage, the pollens are liberated
ovules. The stigma serves as a landing platform
from the anther. In some plants the generative
for pollen grains. The style is an elongated slender
cell again undergoes a division to form two male
part beneath the stigma. The basal swollen part
gametes. In these plants, the pollen is liberated at
of the pistil is the ovary. The ovules are present
3 celled stage. In 60% of the angiosperms pollen is
inside the ovary cavity (locule)on the placenta
liberated in 2 celled stage. Further, the growth of the
.Gynoecium (carpel) arises as a small papillate
male gametophyte occurs only if the pollen reaches
the right stigma. The pollen on reaching the stigma outgrowth of meristematic tissue from the
absorbs moisture and swells. growing tip of the floral primordium. It grows
actively and soon gets differentiated into ovary,
style and stigma. The ovules or megasporangia
(e)
arise from the placenta. The number of ovules in
Generative nucleus
Pollen tube
an ovary may be one (paddy, wheat and mango)
Tube nucleus or many (papaya, water melon and orchids).
Structure of ovule(Megasporangium):
(f)
Ovule is also called megasporangium and is
Exine
(a) Intine protected by one or two covering called
Nucleus Dividing
Germ pore
generative integuments. A mature ovule consists of a stalk
nucleus
and a body. The stalk or the funiculus (also called
(b)
Vacuole
Tube nucleus funicle) is present at the base and it attaches the
Nucleus ovule to the placenta. The point of attachment of
(g)
funicle to the body of the ovule is known as
hilum. It represents the junction between ovule
(c)
Dividing nucleus and funicle. In an inverted ovule, the funicle is
Male gametes adnate to the body of the ovule forming a ridge
Vegetative cell called raphe. The body of the ovule is made up of
(d)
Generative cell
a central mass of parenchymatous tissue called
Tube nucleus
nucellus which has large reserve food materials.
Figure 1.6Stages
Figure 2.3 Development of male
in the development gametophyte
of male gametophyte The nucellus is enveloped by one or two protective

coverings called integuments. Integument on the position of the sporogenous cell. If the
encloses the nucellus completely except at the top sporogenous cell is hypodermal with a single
where it is free and forms a pore called micropyle. layer of nucellar tissue around it is called
The ovule with one or two integuments are said tenuinucellate type. Normally tenuinucellate
to be unitegmic or bitegmic ovules respectively. ovules have very small nucellus. Ovules with
The basal region of the body of the ovule where subhypodermal sporogenous cell is called
the nucellus, the integument and the funicle meet crassinucellate type. Normally these ovules
or merge is called as chalaza. There is a large, have fairly large nucellus. Group of cells found
Chalazal end at the base of the ovule between the chalaza and
Integument embryo sac is called hypostase and the thick
Raphe -walled cells found above the micropylar end
Nucellus
above the embryo sac is called epistase. The
Embryo sac structure of ovule is given in Figure 1.7.
Hilum
Types of Ovules
Micropyle
Funicle The ovules are classified into six main types
Vascular supply based on the orientation, form and position
Ovule structure - diagrammatic
of the micropyle with respect to funicle and
chalaza. Most important ovule types are
orthotropous, anatropous, hemianatropous and
campylotropous. The types of ovule is given in
Figure 1.8.
Orthotropous: In this type of ovule, the
micropyle is at the distal end and the micropyle,
the funicle and the chalaza lie in one straight
View under microscope
vertical line. Examples: Piperaceae, Polygonaceae
Figure 1.7 Structure of an ovule
Anatropous: The body of the ovule becomes
oval, sac-like structure in the nucellus toward completely inverted so that the micropyle
the micropylar end called embryo sac or female and funiculus come to lie very close to each
gametophyte. It develops from the functional other. This is the common type of ovules
megaspore formed within the nucellus. In some found in dicots and monocots.
species(unitegmic tenuinucellate) the inner
Hemianatropous: In this, the body of the
layer of the integument may become specialized
ovule is placed transversely and at right angles
to perform the nutritive function for the embryo
to the funicle. Example: Primulaceae.
sac and is called as endothelium
or integumentary tapetum (Example : Campylotropous: The body of the ovule at the
Asteraceae). There are two types of ovule based micropylar end is curved and more or less bean
(a) Orthotropous (b) Anatropous (c) Hemianatropous (d) Campylotropous (e) Amphitropous (f) Circinotropous
Figure 1.8 Types of ovule

shaped. The embryo sac is slightly curved. All the tetrad. Of the four megaspores formed, usually
three, hilum, micropyle and chalaza are adjacent the chalazal one is functional and other
to one another, with the micropyle oriented three megaspores degenerate. The functional
towards the placenta. Example: Leguminosae megaspore forms the female gametophyte
In addition to the above main types there are or embryo sac. This type of development is
two more types of ovules they are, called monosporic development (Example:
Amphitropous: The distance between hilum Polygonum). Of the four megaspores formed
and chalaza is less. The curvature of the ovule if two are involved in Embryo sac formation
leads to horse-shoe shaped nucellus. Example: the development is called bisporic (Example:
some Alismataceae. Allium). If all the four megaspores are involved
in Embryo sac formation the development is
Circinotropous: Funiculus is very long and
called tetrasporic (Example: Peperomia).
surrounds the ovule. Example: Cactaceae
An ovule generally has a single embryo sac.
Megasporogenesis The development of monosporic embryo sac
The process of development of a megaspore (Polygonum type) is given in Figure 1.9.
from a megaspore mother cell is called Development of Monosporic embryo sac.
megasporogenesis. To describe the stages in embryo sac development
As the ovule develops, a single hypodermal and organization the simplest monosporic type
cell in the nucellus becomes enlarged and of development is given below.
functions as archesporium. In some plants,
The functional megaspore is the first cell
the archesporial cell may directly function
of the embryo sac or female gametophyte.
as megaspore mother cell. In others, it may
The megaspore elongates along micropylar-
undergo a transverse division to form outer
chalazal axis. The nucleus undergoes a mitotic
primary parietal cell and inner primary
division. Wall formation does not follow the
sporogenous cell. The parietal cell may remain
nuclear division. A large central vacuole now
undivided or divide by few periclinal and
appears between the two daughter nuclei. The
anticlinal divisions to embed the primary
vacuole expands and pushes the nuclei towards
sporogenous cell deep into the nucellus.
the opposite poles of the embryo sac. Both the
The primary sporogenous cell functions as a
nuclei divide twice mitotically, forming four
megaspore mother cell. The megaspore mother
nuclei at each pole. At this stage all the eight
cell undergoes meiotic division to form four
haploid megaspores. Based on the number nuclei are present in a common cytoplasm (free
of megaspores that develop into the Embryo nuclear division). After the last nuclear division
sac, we have three basic types of development: the cell undergoes appreciable elongation,
monosporic, bisporic and tetrasporic. The assuming a sac-like appearance. This is followed
megaspores are usually arranged in a linear by cellular organization of the embryo sac. Of
Archesporial cell
Synergid
Egg
polar nucleus
Antipodal
Nucellus
Megaspore Functional 2-nucleate stage
megaspore 4-nucleate stage 8-nucleate stage
mother cell
Figure 1.9 Development of ovule and embryo sac (Polygonum type).

the four nuclei at Filiform apparatus organisms and those that depend on these
the micropylar end Synergids pollinating organism for the food? Here lies
of the embryo sac, Egg apparatus the significance of the process of pollination.
three organize into Egg
The pollen grains produced in the anther
an egg apparatus, Polar nucleus
will germinate only when they reach the stigma
the fourth one of the pistil. The reproductive organs, stamens
is left free in and pistil of the flower are spatially separated, a
the cytoplasm mechanism which is essential for pollen grains
of the central Antipodal cell to reach the stigma is needed. This process of
cell as the upper Figure 1.10 Structure transfer of pollen grains from the anther to a
polar nucleus. of Embryo sac stigma of a flower is called pollination.
Three nuclei of Pollination is a characteristic feature
the chalazal end form three antipodal cells of spermatophyte (Gymnosperms and
whereas the fourth one functions as the lower Angiosperms). Pollination in gymnosperms is
polar nucleus. Depending on the plant the 2 said to be direct as the pollens are deposited
polar nuclei may remain free or may fuse to directly on the exposed ovules, whereas
form a secondary nucleus (central cell). The in angiosperms it is said to be indirect, as
egg apparatus is made up of a central egg cell the pollens are deposited on the stigma of
and two synergids, one on each side of the egg the pistil. In majority of angiosperms, the
cell. Synergids secrete chemotropic substances flower opens and exposes its mature anthers
that help to attract the pollen tube. The special and stigma for pollination. Such flowers are
cellular thickening called filiform apparatus of called chasmogamous and the phenomenon
synergids help in the absorption, conduction is chasmogamy. In other plants, pollination
of nutrients from the nucellus to embryo sac. It occurs without opening and exposing their sex
also guides the pollen tube into the egg. Thus, a organs. Such flowers are called cleistogamous
7 celled with 8 nucleated embryo sac is formed. and the phenomenon is cleistogamy.
The structure of embryo sac is given in Figure
Based upon the flower on which the pollen of a
1.10.
flower reaches, the pollination is classified into
two kinds, namely, self-pollination (Autogamy)
1.4.3 Pollination
and cross-pollination(Allogamy).
Pollination is a wonderful mechanism which
provides food, A.
Self-pollination or Autogamy (Greek
shelter etc., for Auto = self, gamos = marriage):
the pollinating According to a majority of Botanists, the
animals. Many transfer of pollen on the stigma of the same
plants are flower is called self-pollination or Autogamy.
pollinated by Self-pollination is possible only in those
a particular plants which bear bisexual flowers. In order
animal species to promote self- pollination the flowers of the
and the flowers are modified accordingly and plants have several adaptations or mechanisms.
thus there exists a co-evolution between plants They are:
and animals. Let us imagine if pollination fails.
1. Cleistogamy: In cleistogamy (Greek Kleisto
Do you think there will be any seed and fruit
= closed. Gamos = marriage) flowers never open
formation? If not what happens to pollinating
and expose the reproductive organs and thus the

pollination is carried out within the closed flower. i. Geitonogamy: When the pollen deposits on
Commelina, Viola, Oxalis are some examples another flower of the same individual plant, it
for cleistogamous flowers. In Commelina is said to be geitonogamy. It usually occurs in
benghalensis, two types of flowers are produced- plants which show monoecious condition. It is
aerial and underground flowers. The aerial functionally cross-pollination but is similar to
flowers are brightly coloured, chasmogamous autogamy because the pollen comes from same
and insect pollinated. The underground flowers plant.
are borne on the subterranean branches of the ii. Xenogamy: When the pollen (genetically
rhizome that are dull, cleistogamous and self different) deposits on another flower of a
pollinated and are not depended on pollinators different plant of the same species , it is called
for pollination.(Figure 1.11). as xenogamy.
Contrivances of cross-pollination
The flowers of the plants have also several
mechanisms that promote cross-pollination
which are also called contrivances of cross-
pollination or outbreeding devices. It
includes the following.
1. Dicliny or Unisexuality
Chasmogamous flower
When the flowers are unisexual only cross-
pollination is possible. There are two types.
i. Monoecious: Male and female flowers
on the same plant. Coconut, Bitter gourd.
Cleistogamous flower
In plants like castor and maize, autogamy is
prevented but geitonogamy takes place.
Figure 1.11 Commelina with Cleistogamous
Figure 2.8 Commelina with cleistogamous and chasmogamous flower ii. Dioecious : Male and female flowers on
and Chasmogamous flowers different plants. Borassus, Carica papaya
and date palm. Here both autogamy and
2. Homogamy: When the stamens and
geitonogamy are prevented.
stigma of a flower mature at the same time
it is said to be homogamy. It favours self- 2. Monocliny or Bisexuality
pollination to occur. Example: Mirabilis jalapa, Flowers are bisexual and the special adaptation
Catharanthus roseus of the flowers prevents self-pollination.
3. Incomplete dichogamy: In dichogamous i. Dichogamy: In bisexual flowers anthers
flowers the stamen and stigma of a flower and stigmas mature at different times, thus
mature at different time. Sometimes , the time of checking self-pollination. It is of two types.
maturation of these essential organs overlap so a. Protandry: The stamens mature earlier
that it becomes favourable for self-pollination. than the stigmas of the flowers. Examples:
B. Cross - pollination Helianthus, Clerodendrum (Figure 1.12 a).
It refers to the transfer of pollens on the stigma b. Protogyny: The stigmas mature earlier than
of another flower. The cross-pollination is of the stamens of the flower. Examples: Scrophularia
two types: nodosa and Aristolochia bracteata (Figure 1.12 b).

Stamens pin lie in same level to bring out pollination.
Style
Stamens
Similarly the anther of Thrum-eyed and stigma
Style
of pin ones is found in same height. This helps
in effective pollination.
(a) Protandry - Clerodendrum
Stigma
Style Stamens Long style Short style
Style
a) Distyly - Primula
i) Pin-eyed flower ii) Thrum-eyed flower
Figure 2.11 Heterostyly

a) Distyly - Primula vulgaris
(b) Protogyny - Scrophularia

Figure 1.12 Dichogamy
ii. Herkogamy: In bisexual flowers the
Long style Normal style Short style
essential organs, the stamens and stigmas, are b) Tristyly - Lythrum
Fig 2.11b Tristyly - Lythrum
arranged in such a way that self-pollination

Figure 1.14 Heterostyly
becomes impossible. For example in Gloriosa
superba, the style is reflexed away from the b. Tristyly: The plant produces three kinds of
stamens and in Hibiscus the stigmas project flowers, with respect to the length of the style
far above the stamens (Figure 1.13). and stamens. Here,the pollen from flowers of
one type can pollinate only the other two types
but not their own type. Example : Lythrum
(Figure 1.14b).
iv. Self sterility/ Self- incompatibility: In
Stigma
some plants, when the pollen grain of a flower
reaches the stigma of the same, it is unable to
Figure 1.13 Herkogamy - Gloriosa germinate or prevented to germinate on its
own stigma. Examples: Abutilon, Passiflora. It
iii. Heterostyly: Some plants produce two is a genetic mechanism.
or three different forms of flowers that are
Agents of pollination
different in their length of stamens and style.
Pollination will take place only between organs Pollination is effected by many agents like
of the same length.(Figure 1.14) wind, water, insects etc. On the basis of the
agents that bring about pollination, the mode
a. Distyly: The plant produces two forms
of pollination is divided into abiotic and biotic.
of flowers, Pin or long style, long stigmatic
The latter type is used by majority of plants.
papillae, short stamens and small pollen grains;
Thrum-eyed or short style, small stigmatic Abiotic agents
papillae, long stamens and large pollen grains. 1. Anemophily - pollination by Wind
Example: Primula (Figure 1.14a). The stigma of
2. Hydrophily - pollination by Water
the Thrum-eyed flowers and the anther of the

Biotic agents Pollination in Maize (Zea mays): The maize
3. Zoophily is monoecious and unisexual. The male
inflorescence (tassel) is borne terminally and
Zoophily refers to pollination through animals
female inflorescence (cob) laterally at lower
and pollination through insects is called
levels. Maize pollens are large and heavy and
Entomophily.
cannot be carried by light breeze. However,
1. Anemophily: Pollination by wind. The wind
the mild wind shakes the male inflorescence to
pollinated flowers are called anemophilous.
release the pollen which falls vertically below.
The wind pollinated plants are generally
The female inflorescence has long stigma (silk)
situated in wind exposed regions. Anemophily
measuring upto 23 cm in length, which projects
is a chance event. Therefore, the pollen may
beyond leaves. The pollens drop from the tassel
not reach the target flower effectively and are
is caught by the stigma (Figure 1.15).
wasted during the transit from one flower
to another. The common examples of wind Male inflorescence (Tassel)
pollinated flowers are - grasses, sugarcane,
Female inflorescence (Cob)
bamboo, coconut, palm, maize etc.,
Anemophilous plants have the following Silk

characteristic features: (Stigma
and Style)
• The flowers are produced in pendulous,
catkin-like or spike inflorescence.
• The axis of inflorescence elongates so that
the flowers are brought well above the leaves.
Figure 1.15 Pollination in Zea mays
• The perianth is absent or highly reduced.
2. Hydrophily: Pollination by water is called
• The flowers are small, inconspicuous,
hydrophily and the flowers pollinated by
colourless, not scented, do not secrete nectar.
water are said to be hydrophilous (Example:
• The stamens are numerous, filaments are Vallisneria, Hydrilla). Though there are a
long, exerted and versatile. number of aquatic plants, only in few plants
• Anthers produce enormous quantities of pollination takes place by water. The floral
pollen grains compared to number of ovules envelop of hydrophilous plants are reduced or
available for pollination. They are minute, absent. In water plants like Eichhornia and water
light and dry so that they can be carried to lilly pollination takes place through wind or
long distances by wind. by insects. There are two types of hydrophily,
• In some plants anthers burst violently and Epihydrophily and Hypohydrophily. In most
release the pollen into the air. Example: of the hydrophilous flowers, the pollen grains
Urtica. possesses mucilage covering which protects
• Stigmas are comparatively large, protruding, them from wetting.
sometimes branched and feathery, adapted a. Epihydrophily: Pollination occurs at the
to catch the pollen grains. Generally single water level. Examples: Vallisneria spiralis,
ovule is present. Elodea.
• Plant produces flowers before the new leaves Pollination in Vallisneria spiralis: It is a
appear, so the pollen can be carried without dioecious, submerged and rooted hydrophyte.
hindrance of leaves. The female plant bears solitary flowers which rise
to the surface of water level using a long coiled

stalk at the time of pollination. A small cup Ornithophily. Some common plants that are
shaped depression is formed around the female pollinated by birds are Erythrina, Bombax,
flower on the surface of the water. The male plant Syzygium, Bignonia, Sterlitzia etc., Humming
produces male flowers which get detached and birds, sun birds, and honey eaters are some
float on the surface of the water. As soon as a male of the birds which regularly visit flowers and
flower comes in closer to a female flower, it gets bring about pollination.
settled in the depression and contacts with the The ornithophilous flowers have the
stigma thus bringing out pollination. Later the following characteristic features:
stalk of the female flower coils and brings back
• The flowers are usually large in size.
the flower from surface to under water where
fruits are produced. (Figure 1.16). • The flowers are tubular, cup shaped or urn-
shaped.
Male flower • The flowers are brightly coloured, red,
Female flower scarlet, pink, orange, blue and yellow which
attracts the birds.
• The flowers are scentless and produce nectar
Ribbon
in large quantities. Pollen and nectar form
shaped leaves the floral rewards for the birds visiting the
flowers.
Male inflorescence • The floral parts are tough and leathery to
Root withstand the powerful impact of the visitors.
B. Cheiropterophily: Pollination carried out
Figure 1.16 Pollination in Vallisneria
by bats is called cheiropterophily. Some of the
common cheiropterophilous plants are Kigelia
Activity africana, Adansonia digitata, etc.,
Visit to a nearby park and observe the C. Malacophily: Pollination by slugs and
different flowers. Record the adaptations snails is called malacophily. Some plants of
or modifications found in the flowers for Araceae are pollinated by snails. Water snails
different types of pollination. crawling among Lemna pollinate them.
D. Entomophily: Pollination by insects is
called Entomophily. Pollination by ant is called
b. Hypohydrophily: Pollination occurs myrmecophily. Insects that are well adapted to
inside the water. Examples: Zostera marina and bring pollination are bees, moths, butterflies,
Ceratophyllum. flies, wasps and beetles. Of the insects, bees
3. Zoophily: Pollination by the agency of animals are the main flower visitors and dominant
is called zoophily and flowers are said to be pollinators. Insects are chief pollinating agents
zoophilous. Animals that bring about pollination and majority of angiosperms are adapted for
may be birds, bats, snails and insects. Of these, insect pollination. It is the most common type
insects are well adapted to bring pollination. of pollination.
Larger animals like primates (lemurs), arboreal The characteristic features of entomophilous
rodents, reptiles (gecko lizard and garden lizard) flowers are as follows:
have also been reported as pollinators. • Flowers are generally large or if small they
A. Ornithophily: Pollination by birds is called are aggregated in dense inflorescence.
Example: Asteraceae flowers.

POLLINATION
Self-Pollination Cross-Pollination
(Autogamy) (Xenogamy or Allogamy)
Abiotic Agencies
1. Anemophily (Wind) Biotic Agencies
2. Hydrophily (Water)
Cantharophily Phalaenophily Mellitophily Psychophily Malacophily Ornithophily Chieropterophily Myrmecophily

(Beetle) (Moths) (Bees) (Snails) (Birds) (Bats) (Ants)
• Flowers are brightly coloured. The adjacent by pushing its head into the corolla. During
parts of the flowers may also be brightly the entry of the bee into the flower the body
coloured to attract insect. For example strikes against the sterile end of the connective.
in Poinsettia and Bougainvillea the bracts This makes the fertile part of the stamen to
become coloured. descend and strike at the back of the bee.
• Flowers are scented and produce nectar. The pollen gets deposited on the back of the
bee. When it visits another flower, the pollen
• Flowers in which there is no secretion of
RECURRENTgets rubbed against the stigma and completes
nectar, the pollen is either consumed as
APOMIXISthe act of pollination in Salvia (Figure 1.17).
food or used in building up of its hive by the
honeybees. Pollen and nectar are the floral
Pistil
rewards for the visitors. Anther Pollen gets dusted
on the body of
the insect
• Flowers pollinated byVegetative flies and beetles
Agamospermy
produce foul odour toreproduction
attract pollinators.
(i) (ii)
• In some flowers juicy cells are present which Pollen gets

transferred
are pierced and the contents areAdventivesucked byembryony Stigma
to the stigma
the insects. Diplospory (iii) (iv)

Pollination in Salvia (Lever mechanism):
AposporyFigure 1.17 Pollination in Salvia - Lever
The flower of Salvia is adapted for Bee
pollination. The flower is protandrous and the mechanism
corolla is bilabiate with 2 stamens. A lever Some of the other interesting pollination
mechanism helps in pollination. Each anther mechanisms found in plants are a) Trap
has an upper fertile lobe and lower sterile lobe mechanism (Aristolochia);Pit fall mechanism
which is separated by a long connective which (Arum);Clip or translator mechanism
helps the anthers to swing freely. When a bee (Asclepiadaceae) and Piston mechanism
visits a flower, it sits on the lower lip which acts as (Papilionaceae).
a platform. It enters the flower to suck the nectar

Advantages of self-pollination:
Pollination – A composite
• Pollination is almost certain in bisexual
event
flowers.
Pollination provides
• When the members of the species are
information about
uncommon and are separated by large
evolution, ecology, animal learning and
distances, the plant has to depend on self-
foraging behaviour. Flowers not only supply
nectar but also provide microclimate, site and pollination.
shelter for egg laying insects. The association • If all the chances of cross-pollination fails,
of insects benefits the flower by getting self-pollination will take place and prevent
pollinated and ensures the propagation the extinction of the species.
of its own progeny. The floral parts are Disadvantages of self-pollination:
well modified in shape, size to attract the
•
C ontinuous self-pollination, generation
pollinators to accomplish pollination .
after generation results in weaker progeny.
The relationship between Yucca and •
Chances of producing new species and
moth (Tegeticula yuccasella) is an example varieties are meager.
for obligate mutualism. The moth bores a
hole in the ovary of the flower and lays eggs Advantages of cross-pollination:
in it. Then it collects pollen and pushes it • It always results in bringing out much
in the form of balls down the hollow end healthier offsprings.
of the stigma. Fertilization takes place and • Germination capacity is much better.
seeds develop. Larvae • New varieties may be produced.
feed on developing seeds. • The adaptability of the plants to their
Some seeds remain environment is better.
unconsumed for the
propagation of the plant Disadvantages of cross-pollination:
species. It is interesting •
Depend on external agencies for the
that the moth cannot pollination and the process is uncertain.
survive without Yucca •
Various devices have to be adopted to
flowers and the plant fails attract pollinating agents.
to reproduce sexually Bee Orchid Significance of Pollination
without the moth.
• Pollination is a pre-requisite for the process
Similarly in Amorphophallus, flowers
of fertilisation. Fertilisation helps in the
apart from providing floral rewards, also
formation of fruits and seeds.
forms safe site for laying eggs. Many visitors
• It brings the male and female gametes
consume pollen and nectar and do not help
closer for the process of fertilisation.
in pollination. They are called pollen / nectar
• Cross-pollination introduces variations in
robbers.
plants due to the mixing up of different genes.
In Bee orchid (Ophyrus) the morphology
These variations help the plants to adapt to
of the flower mimics that of female wasp
the environment and results in speciation.
(Colpa). The male wasp mistakes the flowers
for a female wasp and tries to copulate. This 1.5 Fertilization
act of pseudocopulation helps in polli nation. The fusion of male and female gamete is called
The pollination in Fig (Ficus carica) by the fertilization. Fertilization in angiosperms is
Wasp (Blastophaga psenes) is also an example double fertilization type.
for similar Plant – insect interaction.

Events of fertilization when viewed through the microscope. This
The stages involved in double is called cap block. As soon as the cap block
fertilization are:- germination disappear the growth of the pollen tube stops.
of pollen to form pollen Pollen tube in the style
tube in the stigma; growth
After the germination the pollen tube enters into
of pollen tube in the style;
the style from the stigma. The growth of the pollen
direction of pollen tube
tube in the style depends on the type of style.
towards the micropyle of the
ovule; entry of the pollen Types of style
tube into one of the synergids There are three types of style a) Hollow or
of the embryo sac, discharge open style b)solid style or closed style c) semi-
of male gametes; syngamy solid or half closed style.
and triple fusion. The events from pollen
Hollow style (Open style): It is common
deposition on the stigma to the entry of pollen
among monocots. A hollow canal running from
tube in to the ovule is called pollen- pistil
the stigma to the base of the style is present.
interaction. It is a dynamic process which
The canal is lined by a single layer of glandular
involves recognition of pollen and to promote
canal cells (Transmitting tissue).They secrete
or inhibit its germination and growth.
mucilaginous substances. The pollen tube grows
Pollen on the stigma on the surface of the cells lining the stylar canal.
In nature, a variety of pollens fall on the receptive The canal is filled with secretions which serve
stigma, but all of them do not germinate and as nutrition for growing pollen tubes and also
bring out fertilization. The receptive surface controlling incompatibility reaction between
of the stigma receives the pollen. If the pollen the style and pollen tube. The secretions contain
is compatible with the stigma it germinates to carbohydrates, lipids and some enzymes
form a tube. This is facilitated by the stigmatic like esterases, acid phosphatases as well as
fluid in wet stigma and pellicle in dry stigma. compatibility controlling proteins.
These two also decide the incompatibility and Solid style (Closed type): It is common among
compatibility of the pollen through recognition- dicots. It is characterized by the presence of
rejection protein reaction between the pollen central core of elongated, highly specialised
and stigma surface. Sexual incompatibility may cells called transmitting tissue.This is equivalent
exist between different species (interspecific) to the lining cells of hollow style and does the
or between members of the same species same function. Its contents are also similar
(intraspecific).The latter is called self- to the content of those cells. The pollen tube
incompatibility. The first visible change in the grows through the intercellular spaces of the
pollen, soon after it lands on stigma is hydration. transmitting tissue.
The pollen wall proteins are released from the
Semi-solid style (half closed type): This is
surface. During the germination of pollen its
intermediate between solid and open type.
entire content moves into the pollen tube. The
growth is restricted to the tip of the tube and There is a difference of opinion on the
all the cytoplasmic contents move to the tip nature of transmitting tissue. Some authors
region. The remaining part of the pollen tube consider that it is found only in solid styles
is occupied by a vacuole which is cut off from while others consider the lining cells of hollow
the tip by callose plug. The extreme tip of pollen style also has transmitting tissue.
tube appears hemispherical and transparent

Entry of pollen tube into the ovule: There gametophyte are involved in the fertilization.
are three types of pollen tube entry into the They fertilize two different components of
ovule(Figure 1.18). the embryo sac. Since both the male gametes
Porogamy: when the pollen tube enters are involved in fertilization, the phenomenon
through the micropyle. is called double fertilization and is unique
to angiosperms. One of the male gametes
Pollen tube fuses with the egg nucleus (syngamy) to form
Zygote. (Figure 1.19)
Pollen grain Ovule
Antipodal (n)
Secondary
nucleus (2n)
Vegetative
Egg (n)
tube nucleus (n)
Pollen tube Pollen tube

Male nuclei (n)
a) Porogamy b) Chalazogamy c) Mesogamy
Figure 1.18 Path of pollen tube entry into the ovule
Chalazogamy: when the pollen tube enters

through the chalaza. (n) (n) (n) (2n)
Mesogamy: when the pollen tube enters Zygote (2n)
Endosperm(3n)
through the integument.
Embyo
Entry of pollen tube into embryo sac:
Irrespective of the place of entry of pollen
tube into ovule, it enters the embryo sac at the
micropylar end. The pollen enters into embryo Seed
sac directly into one of the synergids. Figure 1.19 Fertilization in Angiosperms
The growth of pollen tube towards the ovary,
ovule and embryo sac is due to the presence of The second gamete migrates to the central cell
chemotropic substances. The pollen tube after where it fuses with the polar nuclei or their
travelling the whole length of the style enters fusion product, the secondary nucleus and
into the ovary locule where it is guided towards forms the primary endosperm nucleus (PEN).
the micropyle of the ovule by a structure called Since this involves the fusion of three nuclei,
obturator (See Do you know). After reaching the this phenomenon is called triple fusion. This
embryo sac, a pore is formed in pollen tube wall at act results in endosperm formation which
its apex or just behind the apex. The content of the forms the nutritive tissue for the embryo.
pollen tube (two male gametes, vegetative nucleus
and cytoplasm) are discharged into the synergids 1.6 Post Fertilization structure
into which pollen tube enters. The pollen tube and events
does not grow beyond it, in the embryo sac. The After fertilization, several changes take place in
tube nucleus disorganizes. the floral parts up to the formation of the seed
(Figure 1.20).
1.5.1 Double fertilization and triple fusion
S.G. Nawaschin and L.Guignard in 1898 and The events after fertilization (endosperm,
1899, observed in Lilium and Fritillaria that embryo development, formation of seed, fruits)
both the male gametes released from a male are called post fertilization changes.

Endosperm
Embryo
Petal
Stigma
Style
Shrivelling
petal & sepal
Ovary
Ovule
Fruit
Sepal
Seed
Seed
Plumule
Cotyledon
Testa
Radicle
Figure 1.20 Post Ferilization changes in the flower of an angiosperms
More to Know
• The receptacle becomes fleshy and edible into a fleshy structure

around the fruit enclosing the seeds as in Pyrus called caruncle. (Ricinus
malus (apple) communis).
• The calyx may persist and • The funiculus develops Ricinus - Caruncle
enlarge (Solanum melongena) into a fleshy structure
or may cover the fruit which is often very colourful and called aril.
(Physalis minima) (Myristica and Pithecellobium)
Physalis - Persistent calyx
• The flower stalk or axis
below the gynoecium
enlarges into a juicy pear Aril
shaped body which is edible
Myristica Pithecellobium
(Anacardium occidentale).
The Perianth becomes • The nucellar tissue is either absorbed completely
Anacardium -
fleshy as in Jack fruit. pedicel (edible) by the developing embryo sac and embryo or
small portion may remain as storage tissue. Thus
• The cells present at the tip of the outer
the remnant of nucellar tissue in the seed is called
integument around the micropyle develop
perisperm. Example: Black pepper and beet root

Parts before Transformation after
fertilization fertilization
Sepals, petals, stamens, Usually wither and fall off
style and stigma
Ovary Fruit
endosperm
Ovule Seed Free nuclei
Egg Zygote endosperm
(a) Nuclear (b) Cellular
(c) Helobial
Funicle Stalk of the seed endosperm endosperm
endosperm
Micropyle (ovule) Micropyle of the

seed(facilitates O2 and
Ruminate
water uptake) endosperm
Nucellus Perisperm d) Ruminate endosperm (Areca catechu)

Outer integument of Testa (outer seed coat) Figure 1.21 Types of Endosperm
ovule
Inner integument Tegmen (inner seed coat) Helobial endosperm: Primary Endosperm
Synergid cells Degenerate Nucleus moves towards base of embryo sac and
divides into two nuclei. Cell wall formation
Secondary nucleus Endosperm
takes place leading to the formation of a large
Antipodal cells Degenerate micropylar and small chalazal chamber. The
nucleus of the micropylar chamber undergoes
Endosperm several free nuclear division whereas that
The primary endosperm nucleus (PEN) divides of chalazal chamber may or may not divide.
immediately after fertilization but before the Examples : Hydrilla and Vallisneria.
zygote starts to divide, into an endosperm. The
The endosperms may either be completely
primary endosperm nucleus is the result of triple
consumed by the developing embryo or it may
fusion (two polar nuclei and one sperm nucleus)
persist in the mature seeds. Those seeds without
and thus has 3n number of chromosomes. It
endosperms are called non- endospermous or
is a nutritive tissue and regulatory structure
ex- albuminous seeds. Examples: Pea, Groundnut
that nourishes the developing embryo.
and Beans. Those seeds with endosperms are
Depending upon the mode of development
called endospermous or albuminous seeds. The
three types of endosperm are recognized in
endosperms in these seeds supply nutrition to
angiosperms. They are nuclear endosperm,
the embryo during seed germination. Examples:
cellular endosperm and helobial endosperm
Paddy, Coconut and Castor.
(Figure 1.21).
Nuclear endosperm: Primary Endosperm Aleurone tissue consists
Nucleus undergoes several mitotic divisions of highly specialised cells
without cell wall formation thus a free nuclear of one or few layers which
condition exists in the endosperm. Examples: are found around the
Coccinia, Capsella and Arachis endosperm of cereals (barley and maize).
Aleurone grain contains sphaerosomes.
Cellular endosperm: Primary endosperm
During seed germination cells secrete
nucleus divides into 2 nuclei and it is
certain hydrolytic enzymes like amylases,
immediately followed by wall formation.
proteases which digest reserved food
Subsequent divisions also follow cell wall
material present in the endosperm cells.
formation. Examples: Adoxa, Helianthus and
Scoparia

Ruminate endosperm: The endosperm with Development of Dicot embryo
irregularity and unevenness in its surface forms The Stages involved in the development
ruminate endosperm. Examples :Areca catechu, of Dicot embryo (Capsella bursa-pastoris –
Passiflora and Myristica Onagrad or crucifer type) is given in Figure
Functions of endosperm: 1.22. The embryo develops at micropylar
end of embryo sac. The zygote undergoes
• It is the nutritive tissue for the developing
transverse division to form upper or terminal
embryo.
cell and lower or basal cell. Further divisions
• In majority of angiosperms, the zygote
divides only after the development of in the zygote during the development lead to
endosperm. the formation of embryo. Embryo undergoes
• Endosperm regulates the precise mode of globular, heart shaped stages before reaching a
embryo development. mature stage. The mature embryo has a radicle,
two cotyledons and a plumule.
Coconut milk is a basic
nutrient medium which Activity
induces the differentiation Collect the fruits of Tridax (Cypsella). Using
of embryo (embryoids) a needle dissect out the content, separate
and plantlets from various plant tissues. the embryo and observe different stages
Coconut water from tender coconut is free- of dicot embryo – globular, torpedo, heart
nuclear endosperm and white kernel part shaped under a dissection microscope.
is cellular.
Embryonal mass
Hypophysis
Terminal cell
Suspensor
Basal cell
(a) (b) (c) (d)

Zygote 2- celled proembryo 4 celled proembryo Globular embryo
Cotyledon
Plumule
Embryonal mass
Hypophysis
Hypophysis Cotyledons
Radicle
Suspensor Radicle
Root cap
Suspensor Root cap
(f) Heart shaped embryo (g) Mature embryo (h) Mature embryo in a seed
Figure 1.22 Development of Dicot embryo (Capsella bursa-pastoris)

Seed axis projecting beyond the cotyledons is
The fertilized ovule is called seed and possesses called radicle or embryonic root. The other
an embryo, endosperm and a protective coat. end of the axis called embryonic shoot is
Seeds may be endospermous (wheat, maize, the plumule. Embryonal axis above the
barley and sunflower) or non endospermous. level of cotyledon is called epicotyl whereas
(Bean, Mango, Orchids and cucurbits). the cylindrical region between the level of
cotyledon is called hypocotyl(Figure 1.23 a).
The epicotyl terminates in plumule whereas
Fresh weight of an
the hypocotyl
Testa ends in radicle.
orchid seed may be Radicle
20.33 microgram and Structure of Oryza seed as an example for
that of double coconut Monocot seed
(Lodoicea maldivica) is about 6 kg. The seed of paddyTestais one seeded and is called
Caryopsis. Each seed remains enclosed by
Seed entire
Structure of a Cicer seed as an example for a brownish husk which consists of glumes
Dicot seed arranged
Plumule
in two rows. The seedCotyledoncoat is a
brownish, membranous layer closely adhered to
The mature seeds are attached to the fruit
the grain. Endosperm forms the bulk of the grain
wall by a stalk called funiculus. The funiculus
and is the storage tissue. It is separatedTestafrom
disappears leaving a scar called hilum. Below
embryo by a definite layer called epithelium.
the hilum a small pore called micropyle is Radicleof one shield-
The embryo is small and consists
present. It facilitates entry of oxygen and Seedknown
cut opened
shaped cotyledon as scutellum present
water into the seeds during germination.
a) Dicot seed (Cicer arientinum)
towards lateral side of embryonal axis.
Each seed has a thick outer covering called
seed coat. The seed coat is developed from
integuments of the ovule. The outer coat is
called testa and is hard whereas the inner coat Fruit (Caryopsis) entire
is thin, membranous and is called tegmen. In
Pea plant the tegmen and testa are fused. Two
cotyledons laterally attached to the embryonic
axis are present. It stores the food materials
in pea whereas in other seeds like castor the Endosperm
endosperm contains reserve food and the
cotyledons are thin. The portion of embryonal Scutellum
Testa Coleoptile
Radicle Shoot apex
Testa Radicle
Root cap
Coleorhiza
Seed entire
L.s. of fruit
Plumule
Cotyledon
Figure
b) 1.23(b)
Monocot Monocot seed
seed (Oryza - Oryza sativa
sativa)
A short Figure
axis with
2.25plumule
Structureand radicle protected
of seed
Testa
by the root cap is present. The plumule is
Radicle surrounded by a protective sheath called
Seed cut opened
coleoptile. The radicle including root cap
Figure 1.23(a) Dicot
a) Dicot seed seed - Cicer arientinum
(Cicer arientinum)
is also covered by a protective sheath called
Fruit (Caryopsis) entire

coleorhiza. The scutellum supplies the growing Vegetative reproduction: Plants propagate by
embryo with food material absorbed from the any part other than seeds
endosperm with the help of the epithelium
Bulbils – Fritillaria imperialis; Bulbs –
(Figure 1.23 b).
Allium; Runner – Mentha arvensis; Sucker -
Chrysanthemum
Activity
Agamospermy: It refers to processes by which
Soak seeds of green gram for three hours.
Embryos are formed by eliminating meiosis and
Drain the water and place few seeds in a
syngamy.
clean tray containing moist cotton or filter
paper. Allow the seeds to sprout. Collect Adventive embryony
the sprouted seeds, cut open and observe An Embryo arises directly from the diploid
the parts. Record your observation. sporophytic cells either from nucellus or
integument. It is also called sporophytic
1.7 Apomixis POLLINATION budding because gametophytic phase is
Reproduction involving fertilization in flowering completely absent. Adventive embryos are found
plants is called amphimixis and wherever in Citrus and Mangifera
Self-Pollination Cross-Pollination
reproduction does not involve union of male and Diplospory (Generative apospory): A diploid
(Autogamy) (Xenogamy or Allogamy)
female gametes is called apomixis. embryo sac is formed from megaspore mother
The term Apomixis was introduced by cell without a regular meiotic division Examples.
Abiotic Agencies
Winkler in the year 1908. It is defined as Eupatorium and Aerva.
1. Anemophily (Wind) Biotic
the substitution of the usual sexual systemAgencies
Apospory: Megaspore mother cell undergoes
(Amphimixis)
2. Hydrophily (Water) by a form of reproduction which the normal meiosis and four megaspores formed
does not involve meiosis and syngamy. gradually disappear. A nucellar cell becomes
Cantharophily Phalaenophily Mellitophily Psychophily Malacophily Ornithophily Chieropterophily Myrmecophily
Maheswari (1950) classified Apomixis into activated and develops into a diploid embryo
(Beetle) (Moths) (Bees) (Snails) (Birds) (Bats) (Ants)
two types - Recurrent and Non recurrent sac. This type of apospory is also called somatic
Recurrent apomixis: It includes vegetative apospory. Examples Hieracium and Parthenium.
reproduction and agamospermy
Non recurrent apomixis: Haploid embryo
1.8 Polyembryony
sac developed after meiosis, develops into a Occurrence of more than one embryo in a
embryo without fertilization. seed is called polyembryony (Figure 1.24).
The first case of polyembryony was reported
The outline classification of Recurrent
in certain oranges by Anton van Leeuwenhoek
apomixis is given below.
in the year 1719. Polyembryony is divided into
RECURRENT
four categories based on its origin.
APOMIXIS a. Cleavage polyembryony (Example: Orchids)
b. F
ormation of embryo by cells of the Embryo
sac other than egg (Synergids – Aristolochia;
Vegetative
Agamospermy
antipodals – Ulmus and endosperm –
reproduction Balanophora)
c. D
evelopment of more than one Embryo sac
Adventive embryony
within the same ovule. (Derivatives of same
Diplospory
MMC, derivatives of two or more MMC –
Apospory
Casuarina)

for 3-19 hours induces parthenocarpy in Pear.
Zygotic embryo
Chemically induced Parthenocarpy:
Application of growth promoting substances
like Auxins and Gibberellins induces
parthenocarpy.
Endosperm Significance
• The seedless fruits have great significance
in horticulture.
• The seedless fruits have great commercial
Antipodal embryo
importance.
• Seedless fruits are useful for the preparation
Figure 1.24 : Polyembryony – Embryo sac of jams, jellies, sauces, fruit drinks etc.
of Ulmus glabra showing zygotic and • High proportion of edible part is available
antipodal embryo in parthenocarpic fruits due to the absence
d. A
ctivation of some sporophytic cells of the of seeds.
ovule (Nucellus/ integuments-Citrus and
Syzygium). Summary
Reproduction is one of the attributes of
Practical applications living things. Lower plants, microbes and
The seedlings formed from the nucellar tissue animals reproduce by different methods
in Citrus are found better clones for Orchards. (fragmentation, gemma, binary fission,
Embryos derived through polyembryony are budding, regeneration). Organisms reproduce
found virus free. through asexual and sexual methods. Asexual
1.9 Parthenocarpy methods in angiosperms occur through natural
or artificial methods. The natural methods
As mentioned earlier, the ovary becomes the
take place through vegetative propagules or
fruit and the ovule becomes the seed after
diaspores. Artificial method of reproduction
fertilization. However in a number of cases,
involves cutting, layering and grafting.
fruit like structures may develop from the
Micropropagation is a modern method used
ovary without the act of fertilization. Such
to raise new plants.
fruits are called parthenocarpic fruits.
Invariably they will not have true seeds. Sexual reproduction includes
Many commercial fruits are made seedless. gametogenesis and fertilization. External
Examples: Banana, Grapes and Papaya. fertilization occurs in lower plants like algae
but in higher plants internal fertilization
Nitsch in 1963 classified the parthenocarpy
takes place. A flower is a modified shoot
into following types:
meant for reproduction. Stamen is the male
Genetic Parthenocarpy: Parthenocarpy
reproductive part and produces pollen grains.
arises due to hybridization or mutation
The development of microspore is called
Examples: Citrus,Cucurbita.
microsporogenesis. The microspore mother
Environmental Parthenocarpy: cell undergoes meiotic division to produce
Environmental conditions like frost, fog, low four haploid microspores. In majority of
temperature, high temperature etc., induce Angiosperms the anther is dithecous and
Parthenocarpy. For example, low temperature are tetrasporangiate. It possesses epidermis,

endothecium, middle layers and tapetum. embryo sac (Polygonum type) possesses three
The hygroscopic nature of endothecial cell antipodals in chalazal end, Three cells in the
along with thin walled stomium helps in the micropylar end constituting egg apparatus(1
dehiscence of anther. Tapetum nourishes the egg and 2 Synergids) and two polar nucleus
microspores and also contributes to the wall fused to form secondary nucleus. Thus, a
materials of the pollen grain. Pollen grain is 7 celled 8 nucleated Embryo sac is present.
derived from the microspore and possesses The transfer of pollen grains to the
thin inner intine and thick outer exine. stigma of a flower is called pollination. Self-
Sporopollenin is present in exine and is resistant pollination and cross-pollination are two
to physiological and biological decomposition. types of pollination. Double fertilization
Microspore is the first cell of male gametophyte. and triple fusion are characteristic features
The nucleus of the microspore divides to form of angiosperms. After fertilization the ovary
a vegetative nucleus and a generative nucleus. transforms into a fruit and the ovule becomes
The generative nucleus divides to form a seed. Endosperm is triploid in angiosperms
two male nuclei. Gynoecium is the female and is of three types – Nuclear, cellular, helobial.
reproductive part of a flower and it represents Reproduction which doesn’t involve meiosis
one or more pistils. The ovary bears ovules and syngamy is called apomixis. Occurrence
which are attached to the placenta. There are of more than one embryo in a seed is called
six major types of ovules. The development polyembryony. Formation of fruit without the
of megaspore from megaspore mother cell act of fertilization is called parthenocarpy.
is called megasporogenesis. A monosporic
Flower
Microspore
mother cell
Anther
is
os
ei
M
Megaspore Megaspore
mother cell Pollen (n)
(n)
Sporophyte (2n)
Embyo sac
Egg (n) Male

gametes (n)
Embryo (2n)
Endosperm Endosperm
(3n) nucleus (3n) Syngamy
Zygote
Double fertilization
(2n)

Evaluation a) Epidermis,middle layers, tapetum,
1. Choose the correct endothecium
statement from the b) Tapetum, middle layers, epidermis,
following endothecium
a) Gametes are c) Endothecium, epidermis, middle
involved in asexual layers, tapetum
reproduction d) Tapetum, middle layers endothecium
b) Bacteria reproduce asexually by epidermis
budding 9. Identify the incorrect pair
c) Conidia formation is a method of a) sporopollenin - exine of pollen grain
sexual reproduction b) tapetum – nutritive tissue for
d) Yeast reproduce by budding developing microspores
2. An eminent Indian embryologist is c) Nucellus – nutritive tissue for
a) S.R.Kashyap b) P.Maheswari developing embryo
c) M.S. Swaminathan d) K.C.Mehta d) obturator – directs the pollen tube into
3. Identify the correctly matched pair micropyle
a) Tuber - Allium cepa 10. Assertion : Sporopollenin preserves
b) Sucker - Pistia pollen in fossil deposits
c) Rhizome - Musa Reason : Sporopollenin is resistant
d) Stolon - Zingiber to physical and biological
4. Pollen tube was discovered by decomposition
a) J.G.Kolreuter b) G.B.Amici a) assertion is true; reason is false
c) E.Strasburger d) E.Hanning b) assertion is false; reason is true
c) Both Assertion and reason are not true
5. Size of pollen grain in Myosotis
d) Both Assertion and reason are true.
a) 10 micrometer b) 20 micrometer
c) 200 micrometer d) 2000 micrometer 11. Choose the correct statement(s) about
tenuinucellate ovule
6. First cell of male gametophyte in a) Sporogenous cell is hypodermal
angiosperm is b) Ovules have fairly large nucellus
a) Microspore b) megaspore c) sporogenous cell is epidermal
c) Nucleus d) Primary Endosperm Nucleus d) ovules have single layer of nucellus tissue
7. Match the following 12. Which of the following represent

I) External fertilization i) pollen grain megagametophyte
II) Androecium ii)anther wall a) Ovule b)Embryo sac
III) Male gametophyte iii)algae c)Nucellus d)Endosperm
IV) Primary parietal layer iv)stamens
13. In Haplopappus gracilis, number of
a)I-iv;II-i;III-ii;IV-iii
chromosomes in cells of nucellus is 4.
b)I-iii;II-iv;III-i;IV-ii
What will be the chromosome number in
c)I-iii;II-iv;III-ii,IV-i
Primary endosperm cell?
d)I-iii;II-i;III-iv;IV-ii
8. Arrange the layers of anther wall from a)8 b)12 c)6 d)2
locus to periphery

14. Transmitting tissue is found in 25. What are clones?
a) Micropylar region of ovule 26. A detached leaf of Bryophyllum produces
b) Pollen tube wall new plants. How?
c) Stylar region of gynoecium 27. Differentiate Grafting and Layering.
d) Integument 28. “Tissue culture is the best method for
propagating rare and endangered plant
15. The scar left by funiculus in the seed is species”- Discuss.
a)tegmen b)radicle 29. Distinguish mound layering and air layering.
30. Explain the conventional methods adopted
c)epicotyl d)hilum
in vegetative propagation of higher plants.
16. A Plant called X possesses small flower with 31. Highlight the milestones from the history of
reduced perianth and versatile anther. The plant embryology.
probable agent for pollination would be 32. Discuss the importance of Modern methods
in reproduction of plants.
a)water b)air
33. What is Cantharophily.
c)butterflies d)beetles
34. List any two strategy adopted by bisexual
17. Consider the following statement(s) flowers to prevent self-pollination.
i) In Protandrous flowers pistil matures 35. What is endothelium.
earlier
36. “The endosperm of angiosperm is
ii) In Protogynous flowers pistil matures
different from gymnosperm”. Do you
earlier
agree. Justify your answer.
iii) Herkogamy is noticed in unisexual flowers
iv) Distyly is present in Primula 37. Define the term Diplospory.
a) i and ii are correct 38. What is polyembryony. How it can
b) ii and iv are correct commercially exploited.
c) ii and iii are correct
39. Why does the zygote divides only after
d) i and iv are correct
the division of Primary endosperm cell.
18. Coelorhiza is found in
40. What is Mellitophily?
a)Paddy b)Bean
41. “Endothecium is associated with
c)Pea d)Tridax
dehiscence of anther” Justify the
19. Parthenocarpic fruits lack
statement.
a)Endocarp b)Epicarp
42. List out the functions of tapetum.
c)Mesocarp d) seed
20. In majority of plants pollen is liberated at 43. Write short note on Pollen kitt.
a) 1 celled stage b) 2 celled stage 44. Distinguish tenuinucellate and
c) 3 celled stage d) 4 celled stage crassinucellate ovules.
21. What is reproduction? 45. ‘Pollination in Gymnosperms is different
22. Mention the contribution of Hofmeister from Angiosperms’ – Give reasons.
towards Embryology.
23. List out two sub-aerial stem modifications 46. Write short note on Heterostyly.
with example. 47. Enumerate the characteristic features of
24. What is layering? Entomophilous flowers

48. Discuss the steps involved in surface of the pollen that helps to attract insects.
Microsporogenesis.
Regeneration: Ability of organisms to replace
49. With a suitable diagram explain the or restore the lost parts.
structure of an ovule.
Sporopollenin: Pollen wall material derived
50. Give a concise account on steps involved from carotenoids and is resistant to physical
in fertilization of an angiosperm plant. and biological decomposition.
51. What is endosperm. Explain the types.
Tapetum: Nutritive tissue for the developing
52. Differentiate the structure of Dicot and sporogenous tissue
Monocot seed.
Transmitting tissue: A single layer of glandular
53. Give a detailed account on canal cells lining the inner part of style.
parthenocarpy. Add a note on its
significance.
Glossary
Apospory: The process of embryo sac formation
from diploid cells of nucellus as a result of
mitosis
Budding: A method of asexual reproduction

where small outgrowth(Bud) from a parent cell
are produced
Callus: Undifferentiated mass of cells obtained

through tissue culture.
Clone: Genetically identical individuals.
Endothecium: A single layer of hygroscopic,

radially elongated cells found below the epidermis
of anther which helps in dehiscence of anther.
Fertilization: The act of fusion of male and

female gamete
Grafting: Conventional method of reproduction

where stock and scion are joined to produce
new plant.
Horticulture: Branch of plant science that

deals with the art of growing fruits, vegetables,
flowers and ornamental plants.
Nucellus: The diploid tissue found on the inner

part of ovule next to the integuments.
Pollenkitt: A sticky covering found on the

UNIT VII: Genetics
Chapter
2 Classical Genetics
Genetics is the study of how living

Learning Objectives things receive common traits from previous
generations. No field of science has changed the
The Learner will be able to world more, in the past 50 years than genetics.
Differentiate The scientific and technological advances in
classical and genetics have transformed agriculture, medicine
modern genetics. and forensic science etc.
Understand Genetics – The Science of heredity (Inheritance)

the concepts - “Genetics” is the branch of biological science
of principles of which deals with the mechanism of transmission
of characters from parents to offsprings. The term
inheritance.
Genetics was introduced by W. Bateson in 1906.
Describe the extensions of Mendelism.
The four major subdisciplines of genetics are
Explain polygenic inheritance and
1. Transmission Genetics / Classical Genetics
Pleiotropy. – Deals with the transmission of genes
Analyze extra chromosomal from parents to offsprings. The foundation
inheritance in cytoplasmic organelles. of classical genetics came from the study
of hereditary behaviour of seven genes by
Gregor Mendel.
Chapter outline
2. Molecular Genetics – Deals with the
structure and function of a gene at molecular
2.1 Heredity and Variation level.
2.2 Mendelism 3. Population Genetics – Deals with heredity
2.3 Laws of Mendelian Inheritance in groups of individuals for traits which is
2.4 Monohybrid, Dihybrid, Trihybrid determined by a few genes.
cross, Backcross and Testcross 4. Quantitative Genetics – Deals with heredity
of traits in groups of individuals where
2.5 Interaction of Genes -Intragenic
the traits are governed by many genes
and Intergenic Incomplete
simultaneously.
dominance, Lethal genes, Epistasis
2.6 Polygenic inheritance in Wheat What is the reason for similarities, differences
of appearance and skipping of generations?
kernel colour, Pleiotropy –
Pisum sativum Genes – Functional Units of inheritance:
The basic unit of heredity (biological
2.7 Extra chromosomal inheritance-
information) which transmits biochemical,
Cytoplasmic inheritance in anatomical and behavioural traits from
Mitochondria and Chloroplast. parents to offsprings.
Classical Genetics 33

2.1 Heredity and variation • Th
ey help the individuals to adapt
themselves to the changing environment.
Genetics is often described as a science which
deals with heredity and variation. • I t provides the genetic material for natural
selection
Heredity: Heredity is the transmission of
• V
ariations allow breeders to improve better
characters from parents to offsprings.
yield, quicker growth, increased resistance
Variation: The organisms belonging to the and lesser input.
same natural population or species that •
They constitute the raw materials for
shows a difference in the characteristics is evolution.
called variation. Variation is of two types (i)
Discontinuous variation and (ii) Continuous 2.2 Mendelism
variation The contribution of Mendel to Genetics is called
1. Discontinuous Variation: Mendelism. It includes all concepts brought out
by Mendel through his original research on
Within a population there are some
plant hybridization. Mendelian genetic concepts
characteristics which show a limited form of
are basic to modern genetics. Therefore, Mendel
variation. Example: Style length in Primula,
is called as Father of Genetics.
plant height of garden pea. In discontinuous
variation, the characteristics are controlled by 2.2.1
Father of Genetics – Gregor
one or two major genes which may have two Johann Mendel (1822 – 1884)
or more allelic forms. These variations are The first Geneticist,
genetically determined by inheritance factors. Gregor Johann
Individuals produced by this variation show Mendel unraveled
differences without any intermediate form the mystery of
between them and there is no overlapping heredity. He was
between the two phenotypes. The phenotypic born on 22nd July
expression is unaffected by environmental 1822 in Heinzendorf
conditions. This is also called as qualitative Silesia (now Hyncice,
Figure 2.1: Gregor
inheritance. Czechoslovakia),
Johann Mendel
2. Continuous Variation: Austria. After school
education, later he studied botany, physics and
This variation may be due to the combining mathematics at the University of Vienna.He
effects of environmental and genetic factors. then entered a monastery of St.Thomas at Brunn
In a population most of the characteristics in Austria and continued his interest in plant
exhibit a complete gradation, from one extreme hybridization.In 1849 Mendel got a temporary
to the other without any break. Inheritance position in a school as a teacher and he performed
of phenotype is determined by the combined a series of elegant experiments with pea plants
effects of many genes, (polygenes) and in his garden. In 1856, he started his historic
environmental factors. This is also known as studies on pea plants. 1856 to 1863 was the
quantitative inheritance. Example: Human period of Mendel’s hybridization experiments
height and skin color. on pea plants. Mendel discovered the principles
Importance of variations of heredity by studying the inheritance of seven
• V
ariations make some individuals better pairs of contrasting traits of pea plant in his
fitted in the struggle for existence. garden. Mendel crossed and catalogued 24,034

plants through many generations. His paper experiments with several true-breeding lines of
entitled “Experiments on Plant Hybrids” was pea plants. A true breeding lines (Pure-breeding
presented and published in The Proceedings of strains) means it has undergone continuous
the Brunn Society of Natural History in 1866. self pollination having stable trait inheritance
Mendel was the first systematic researcher in from parent to offspring. Matings within pure
the field of genetics. breeding lines produce offsprings having specific
Mendel was successful because: parental traits that are constant in inheritance
and expression for many generations. Pure line
•
He applied mathematics and statistical
breed refers to homozygosity only. Fusion of
methods to biology and laws of probability
male and female gametes produced by the same
to his breeding experiments.
individual i.e pollen and egg are
6WHSVLQFURVVSROOLQDWLRQRISHDIORZHUV
•
He followed scientific methods and kept
accurate and detailed records that include :KLWHIORZHU
quantitative data of the outcome of his

crosses. 3ROOHQPDOHVH[
RUJDQLVFXWRII
•
His experiments were carefully planned UHPRYHG
and he used large samples. 3ROOHQ
•
The pairs of contrasting characters which 3LVWLO 3ROOHQRIZKLWH
IORZHULVWDNHQDQG
were controlled by factor (genes)were 3XUSOHIORZHU WUDQVIHUUHGWRSLVWLO
RISXUSOHIORZHU
present on separate chromosomes. 3DUHQWDO3
7KHIHUWLOL]HGSLVWLOJHWV
•
The parents selected by Mendel were pure PDWXUHDQGEHFRPHVSRGV
breed lines and the purity was tested by self

crossing the progeny for many generations. 6HHGVLQHDFK
SRGDUHUHDG\
WREHSODQWHG
Mendel’s Experimental System – The

$OORIIVSULQJV
Garden pea. DUHSXUSOH
He chose pea plant because, )JHQHUDWLRQV
• It is an annual plant and has clear

contrasting characters that are controlled
by a single gene separately.
•
Self-fertilization occurred under normal Figure 2.2: Steps in cross pollination of pea
conditions in garden pea plants. Mendel flowers
used both self-fertilization and cross- derived from the same plant is known as self-
fertilization. fertilization. Self pollination takes place in
•
The flowers are large hence emasculation Mendel’s peas. The experimenter can remove
and pollination are very easy for the anthers (Emasculation) before fertilization
hybridization. and transfer the pollen from another variety of
2.2.2 Mendel’s experiments on pea plant pea to the stigma of flowers where the anthers
are removed. This results in cross-fertilization,
Mendel’s theory of inheritance, known as the which leads to the creation of hybrid varieties
Particulate theory, establishes the existence of with different traits. Mendel’s work on the
minute particles or hereditary units or factors, study of the pattern of inheritance and the
which are now called as genes. He performed principles or laws formulated, now constitute
artificial pollination or cross pollination the Mendelian Genetics.

The First Model Organism in Genetics – Garden Peas
(Pisum sativum) – Seven characters studied by Mendel. Can you identify Mendel’s gene for
regulating white colour in peas? Let us find
&KDUDFWHU 'RPLQDQW7UDLW 5HFHVVLYH7UDLW
the molecular answer to understand the
gene function. Now the genetic mystery of
6WHPOHQJWK 7DOO 'ZDUI
Mendel’s white flowers is solved.
It is quite
3RGVKDSH ,Q
,QIODWHG &RQVWULFWHG fascinating to
trace the Mendel’s
6HHGVKDSH 5RXQG :ULQNOHG
genes. In 2010, the
6HHGFRORXU <HOORZ *UHHQ gene responsible
for regulating Figure 2.5: Purple flower
flower colour of Pea with Pea Gene A
)ORZHU $[LDO 7HUPLQDO
SRVLWLRQ in peas were and White flower of Pea
identified by an
)ORZHUFRORXU 3XUSOH
:KLWH international team of researchers. It was
called Pea Gene A which encodes a protein
3RGFRORXU
*UHHQ <HOORZ
that functions as a transcription factor
which is responsible for the production of
Figure 2.3: Seven characters of Pisum
anthocyanin pigment. So the flowers are
sativum studied by Mendel.
purple. Pea plants with white flowers do not
Character Gene Dominant Recessive have anthocyanin, even though they have
Trait Trait the gene that encodes the enzyme involved
Plant Height Le Tall Dwarf in anthocyanin synthesis.
Seed Shape R Round Wrinkled Researchers delivered normal copies of
Cotyledon colour I Yellow Green gene A into the cells of the petals of white
flowers by the gene gun method. When
Flower colour A Purple White
Gene A entered in a small percentage of
Pod colour GP Green Yellow cells of white flowers it is expressed in those
Pod form V Inflated Constricted particular cells, accumulated anthocyanin
Flower position Fa Axial Terminal
pigments and became purple.
In white flowers the gene A sequence showed
Table 2.1 Seven characters of Pisum sativum
a single-nucleotide change that makes
with genes
the transcription factor inactive. So the
)ORZHU
FRORXU
3RG
VKDSH
3RG mutant form of gene A do not accumulate
FRORXU
3ODQW
KHLJKW 6HHG
anthocyanin and hence they are white.
VKDSH
6HHG
)ORZHU Mendel worked at the rules of inheritance
SRVLWLRQ
FRORXU and arrived at the correct mechanism before any
knowledge of cellular mechanism, DNA, genes,
chromosomes became available. Mendel insights
&KURPRVRPHQXPEHU
and meticulous work into the mechanism of
Figure 2.4: Mendel’s seven characters in Garden
inheritance played an important role which led
Peas, shown on the plant’s seven chromosomes

to the development of improved crop varieties of the parental characters in F1 generation and (b)
and a revolution in crop hybridization. the expression of both in the F2 generation. It also
Mendel died in 1884. In 1900 the work of explains the proportion of 3:1 obtained at the F2
Mendel’s experiments were rediscovered by The Law of Segregation (Law of Purity of
three biologists, Hugo de Vries of Holland, Carl gametes): Alleles do not show any blending,
Correns of Germany and Erich von Tschermak both characters are seen as such in the F2
of Austria. generation although one of the characters is not
2.2.3 Terminology related to Mendelism seen in the F1 generation. During the formation
of gametes, the factors or alleles of a pair separate
Mendel noticed two different expressions of and segregate from each other such that each
a trait – Example: Tall and dwarf. Traits are gamete receives only one of the two factors. A
expressed in different ways due to the fact that a homozygous parent produces similar gametes
gene can exist in alternate forms (versions) for and a heterozygous parent produces two kinds
the same trait is called alleles. of gametes each having one allele with equal
If an individual has two identical alleles of proportion. Gametes are never hybrid.
a gene, it is called as homozygous(TT). An 2.3 Monohybrid cross
individual with two different alleles is called
heterozygous(Tt). Mendels non-true breeding Monohybrid inheritance is the inheritance of a
plants are heterozygous, called as hybrids. single character i.e. plant height.It involves the
inheritance of two alleles of a single gene. When
When the gene has two alleles the dominant the F1 generation was selfed Mendel noticed that
allele is symbolized with capital letter and the 787 of 1064 F2 plants were tall, while 277 of 1064
recessive with small letter. When both alleles are were dwarf. The dwarf trait disappeared in the F1
recessive the individual is called homozygous generation only to reappear in the F2 generation.
recessive (tt) dwarf pea plants. An individual The term genotype is the genetic constitution
with two dominant alleles is called homozygous of an individual. The term phenotype refers to
dominant (TT) tall pea plants. One dominant the observable characteristic of an organism. In
allele and one recessive allele (Tt) denotes non- a genetic cross the genotypes and phenotypes
true breeding tall pea plants heterozygous tall. of offspring, resulting from combining gametes
2.2.4 Mendelian inheritance – Mendel’s during fertilization can be easily understood with
Laws of Heredity the help of a diagram called Punnett’s Square named
Mendel proposed two rules based on his after a British Geneticist Reginald C.Punnett.
observations on monohybrid cross, today these It is a graphical representation to calculate the
rules are called laws of inheritance The first probability of all possible genotypes of offsprings
law is The Law of Dominance and the second in a genetic cross.The Law of Dominance and the
law is The Law of Segregation. These scientific Law of Segregation give suitable explanation to
laws play an important role in the history of Mendel’s monohybrid cross.
evolution. Reciprocal cross – In one experiment, the
tall pea plants were pollinated with the pollens
The Law of Dominance: The characters are
from a true-breeding dwarf plants, the result
controlled by discrete units called factors which
was all tall plants. When the parental types were
occur in pairs. In a dissimilar pair of factors one
reversed, the pollen from a tall plant was used to
member of the pair is dominant and the other
pollinate a dwarf pea plant which gave only tall
is recessive. This law gives an explanation to the
plants. The result was the same - All tall plants.
monohybrid cross (a) the expression of only one

Tall ( ) x Dwarf ( ) and Tall ( ) x Dwarf ( ) or masked only to reappear in ¼ of the F2
matings are done in both ways which are called generation. He concluded that tall and dwarf
reciprocal crosses.The results of the reciprocal alleles of F1 heterozygote segregate randomly
crosses are the same. So it was concluded that the into gametes. Mendel got 3:1 ratio in F2 between
trait is not sex dependent. The results of Mendel’s the dominant and recessive trait. He was the first
monohybrid crosses were not sex dependent. scientist to use this type of quantitative analysis
in a biological experiment. Mendel’s data is
P generation Tall Dwarf
(True - breeding) (True - breeding) concerned with the proportions of offspring.
TT tt
Mendel’s analytical approach is truly
an outstanding scientific achievement. His
meticulous work and precisely executed breeding
X
experiments proposed that discrete particulate
units of heredity are present and they are
T t transmitted from one generation to the other. Now
Tt they are called as genes. Mendel’s experiments
F1 generation T (tall) t
Tt Tt were well planned to determine the relationships
All tall (Selfed) (tall) (tall)
Tt which govern hereditary traits. This rationale
(tall) is called an empirical approach. Laws that were
arrived from an empirical approach is known as
F2 generation T T empirical laws.
gametes Homozygous gametes
t tall plant
t 2. 3.2 Test cross
(TT)
Heterozygous Heterozygous Test cross is crossing an individual of unknown
tall plant tall plant genotype with a homozygous recessive.
(Tt) (Tt)
Homozygous In Mendel’s monohybrid cross all the plants
dwarf plant
(tt)
are tall in F1 generation. In F2 tall and dwarf
Offspring (F2)
plants were in the ratio of 3:1.Mendel self
genotypes TT Tt tt pollinated dwarf F2 plants and got dwarf plants
in F3 and F4 generations. So he concluded that
Genotypic Ratio 1 : 2 : 1
the genotype of dwarf was homozygous (tt). The
Phenotypes Tall Dwarf genotypes of tall plants TT or Tt from F1and F2
Phenotypic Ratio 3 : 1 cannot be predicted. But how we can tell if a
tall plant is homozygous or heterozygous? To
Figure 2.6: Monohybrid Cross determine the genotype of a tall plant Mendel
The gene for plant height has two alleles: Tall crossed the plants from F2 with the homozygous
(T) x Dwarf (t). The phenotypic and genotypic recessive dwarf plant. This he called a test
analysis of the crosses has been shown by cross. The progenies of the test cross can be
easily analysed to predict the genotype of the
Checker board method or by Forkline method.
plant or the test organism. Thus in a typical
2.3.1 Mendel’s analytical and empirical test cross an organism (pea plants) showing
approach dominant phenotype (whose genotype is to be
Mendel chose two contrasting traits for each determined) is crossed with the recessive parent
character. So it seemed logical that two distinct instead of self crossing. Test cross is used to
identify whether an individual is homozygous
factors exist. In F1 the recessive trait and its
or heterozygous for dominant character.
factors do not disappear and they are hidden

If heterozygous tall test cross
Why Mendel’s pea plants are tall and dwarf?
Parental (P) F1 Heterozygous tall x Homozygous dwarf
Phenotypes Find out the molecular explanation.
Genotypes Tt tt
Molecular characterization of Mendel’s
gene for plant height.
Gametes T t t t
The plant height is controlled by a single gene
Offspring (F1)
Tt tt with two alleles. The reason for this difference
genotypes
in plant height is due to the following facts:
Genotypic Ratio 1 : 1
(i) the cells of the pea plant have the ability to
Phenotypes Tall Dwarf convert a precursor molecule of gibberellins
into an active form (GA1) (ii) Tall pea plants
Phenotypic Ratio 1 : 1
have one allele (Le) that codes for a protein
t (functional enzyme) which functions normally
t
in the gibberellin-synthesis pathway and
gametes Homozygous gametes
dwarf plant
catalyzes the formation of gibberellins (GA1).
T (tt)
t The allele is dominant even if it is two (Le Le)
Heterozygous Homozygous or single (Le le), it produces gibberellins and
tall plant dwarf plant the pea plants are tall. Dwarf pea plants have
(Tt) (tt)
two recessive alleles (le le) which code for
Heterozygous
tall plant non-functional protein, hence they are dwarf.
(Tt) Gene for plant height in Peas
If homozygous tall test cross

Parental (P) F1 Homozygous tall x Homozygous dwarf
Phenotypes
Genotypes TT tt
Gametes T T t t
Tall pea plants Dwarf pea plant
Offspring (F1)
Tt Tt (Le Le / Le le) (le le)
genotypes
Gibberellin GA1 Gibberellin Gibberellins
Phenotypes Tall Tall
Active are not
All tall plants Precursor Precursor produced
molecule gibberellins molecule
T t
Le allele codes for le allele codes for
gametes Heterozygous gametes
functional enzyme GA1 nonfunctional enzyme
tall plant
T (Tt)
t Figure 2.8: Gene for plant height in Peas
Heterozygous
Heterozygous
tall plant 2.3.3 Back cross
tall plant
(Tt)
(Tt)
• Back cross is a cross of F1 hybrid with any
Heterozygous
tall plant
one of the parental genotypes. The back
(Tt) cross is of two types; they are dominant
back cross and recessive back cross.
Figure 2.7: Test cross • It involves the cross between the F1 offspring
with either of the two parents.

•
When the F1offsprings are crossed with Independent assortment leads to genetic
the dominant parents all the F2 develop diversity. If an individual produces genetically
dominant character and no recessive dissimilar gametes it is the consequence of
individuals are obtained in the progeny. independent assortment. Through independent
assortment, the maternal and paternal members
•
If the F1 hybrid is crossed with the recessive
of all pairs were distributed to gametes, so all
parent individuals of both the phenotypes
possible chromosomal combinations were
appear in equal proportion and this cross is
produced leading to genetic variation. In sexually
specified as test cross.
reproducing plants / organisms, due to independent
•
The recessive back cross helps to identify assortment, genetic variation takes place which is
the heterozygosity of the hybrid. important in the process of evolution. The Law of
Segregation is concerned with alleles of one gene
2.3.4 Dihybrid cross but the Law of Independent Assortment deals with
It is a genetic cross which involves individuals the relationship between genes.
differing in two characters. Dihybrid inheritance The crossing of two plants differing in two
is the inheritance of two separate genes each pairs of contrasting traits is called dihybrid
with two alleles. cross. In dihybrid cross, two characters (colour
Law of Independent Assortment – When and shape) are considered at a time. Mendel
two pairs of traits are combined in a hybrid, considered the seed shape (round and wrinkled)
segregation of one pair of characters is and cotyledon colour (yellow & green) as the two
independent to the other pair of characters. Genes characters. In seed shape round (R) is dominant
that are located in different chromosomes assort over wrinkled (r) ; in cotyledon colour yellow
independently during meiosis. Many possible (Y) is dominant over green (y). Hence the pure
combinations of factors can occur in the gametes. breeding round yellow parent is represented by
the genotype RRYY and the pure breeding green
wrinkled parent is represented by the genotype
Homozygous Homozygous
Round seeds Wrinkled seeds rryy. During gamete formation the paired genes
Yellow Green
cotyledon
x
cotyledon
of a character assort out independently of the
other pair. During the F1 x F1 fertilization each
Parental RRYY rryy
zygote with an equal probability receives one
Meiosis Meiosis of the four combinations from each parent.
Gametes
RY ry The resultant gametes thus will be genetically
different and they are of the following four types:
RrYy
F1 generation 1) Yellow round (YR) - 9/16
Heterozygous
2) Yellow wrinkled (Yr) - 3/16
3) Green round (yR) - 3/16
Round seeds
Yellow cotyledon 4) Green wrinkled (yr) - 1/16
RrYy x RrYy
These four types of gametes of F1 dihybrids
unite randomly in the process of fertilization
Gametes RY Ry rY ry RY Ry rY ry
and produce sixteen types of individuals in F2
Selfed – Genes are present on separate chromosomes and random in the ratio of 9:3:3:1 as shown in the figure.
assortment takes place. So four different types of gametes in
equal proportions are formed. Law of Independent Assortment. Mendel’s 9:3:3:1 dihybrid ratio is an ideal ratio
Figure 2.9:
Dihybrid cross – Segregation based on the probability including segregation,
of gametes independent assortment and random

fertilization. In sexually reproducing organism
How does the wrinkled gene make
/ plants from the garden peas to human beings,
Mendel’s peas wrinkled? Find out the
Mendel’s findings laid the foundation for
molecular explanation.
understanding inheritance and revolutionized
the field of biology. The dihybrid cross and its The protein called starch branching
result led Mendel to propose a second set of enzyme (SBEI) is encoded by the wild-type
generalisations that we called Mendel's Law of allele of the gene (RR) which is dominant.
When the seed matures, this enzyme SBEI
independent assortment.
catalyzes the formation of highly branched
starch molecules. Normal gene (R) has
P Generation Parent 1 Parent 2
Parental become interrupted by the insertion of extra
Round yellow cotyledon X Wrinkled green cotyledon
phenotype piece of DNA (0.8 kb) into the gene, resulting
in r allele. In the homozygous mutant form of
Diploid
parental
the gene (rr) which is recessive, the activity of
genotype the enzyme SBEI is lost resulting in wrinkled
RR YY rr yy
peas. The wrinkled seed accumulates more
R r sucrose and high water content. Hence the
Haploid X
gametes Y y osmotic pressure inside the seed rises. As
a result, the seed absorbs more water and
R Y
when it matures it loses water as it dries. So
F1 generation
r y it becomes wrinkled at maturation. When
the seed has atleast one copy of normal
F1 phenotype : All round-yellow cotyledon
dominant gene heterozygous, the dominant
F1 genotypes : All Rr Yy
allele helps to synthesize starch, amylopectin
F1 Generation Parent 1 Parent 2 an insoluble carbohydrate, with the osmotic
(selfed)
Round yellow cotyledon X Round yellow cotyledon balance which minimises the loss of water
resulting in smooth structured round seed.
The wrinkled gene make Mendel’s
peas wrinkled
Rr Yy Rr Yy
Haploid
F1 gametes
RY Ry rY ry RY Ry rY ry Round Peas & Wrinkled Peas
F1 gametes RR rr
1/4 1/4 1/4 1/4 Dominant allele RR Active enzyme SBE - I
F2 Generation RY Ry rY ry Linear
Branched
unbranched Round
1/4
starch
starch Converted peas
amylopectin
RY RR YY RR Yy Rr YY Rr Yy amylose to
1/4
Recessive allele rr Inactive enzyme
F1 RR Yy RR yy Rr Yy Rr yy
Ry
gametes Linear Linear
1/4
unbranched unbranched
No Wrinkled
Rr YY Rr Yy rr YY rr Yy starch starch peas
rY conversion
amylose amylose
1/4
ry
Rr Yy Rr yy rr Yy rr yy
Figure 2.11: Molecular explanation of
Phenotypic Ratio 9:3:3:1
round and wrinkled peas.
Figure 2.10: Dihybrid Cross in Garden peas

2.3.5 The Dihybrid test cross 2.3.7 Extensions of Mendelian Genetics
The Dihybrid test cross Apart from monohybrid, dihybrid and
trihybrid crosses, there are exceptions to
The F1 hybrid plant (round yellow peas) is crossed with
homozygous double recessive genotype, wrinkled green Mendelian principles, i.e. the occurrence of
peas (rryy). This is called dihybrid test cross with the
ratio of 1:1:1:1. different phenotypic ratios. The more complex
Parental (P) Heterozygous Homozygous patterns of inheritance are the extensions of
round peas Wrinkled peas
Phenotypes F 1 Mendelian Genetics. There are examples where
Yellow x Green
cotyledon cotyledon phenotype of the organism is the result of the
interactions among genes.
Gene interaction – A single phenotype is
Genotypes RrYy x rryy
controlled by more than one set of genes, each of
which has two or more alleles. This phenomenon
Gametes RY Ry rY ry ry ry ry ry
is called Gene Interaction. Many characteristics of
Gametes RY Ry rY ry the organism including structural and chemical
RrYy Rryy rrYy rryy which constitute the phenotype are the result of
Round Round Wrinkled Wrinkled
all ry interaction between two or more genes.
Yellow Green Yellow Green
Genotypes RrYy Rryy rrYy rryy
Genotypic
ratio 1 : 1 : 1 : 1
Phenotypes round round Wrinkled Wrinkled
Yellow Green Yellow Green
Phenotypic
ratio 25% 25% 25% 25%
Figure 2.12: Dihybrid test cross

Gene interactions
2.3.6. Trihybrid cross
The trihybrid cross demonstrates that Mendel’s
Intralocus Interlocus
laws are applicable to the inheritance of interactions interactions
multiple traits. Mendel Laws of segregation and
(Allelic (Non-allelic
independent assortment are also applicable to interactions) interactions)
three pairs of contrasting characteristic traits
called trihybrid cross.
Epistatic / Additive /
A cross between homozygous parents Non-epistatic Polygenic
that differ in three gene pairs (i.e. producing interactions interactions
trihybrids) is called trihybrid cross. A self
I. Dominant relationship
fertilizing trihybrid plant forms 8 different a) Complete dominance Example: Tall and
gametes and 64 different zygotes. In this dwarf pea plants
a combination of three single pair crosses b) Incomplete dominance
operating together. The three contrasting c) Codominance d) Over dominance
characters of a trihybrid cross are II. Lethal genes
a) Dominant lethals b) Recessive lethals
Tall, Yellow, Round x Dwarf, Green, Wrinkled c) Conditional lethals d) Sex linked lethals
TTYYRR ttyyrr e) Balanced lethals
F1 Tall, Yellow, Round (Selfed) III. Multiple alleles
TtYyRr
F2 Phenotypic ratio - 27 : 9 : 9 : 9 : 3 : 3 : 3 : 1 Figure 2.13: Gene Interaction

Mendelian experiments prove that a were interbred in F2 both phenotypic and
single gene controls one character. But in the genotypic ratios were found to be identical as
post Mendelian findings, various exception 1 : 2 : 1(1 red : 2 pink : 1 white). Genotypic
have been noticed, in which different types of ratio is 1 R1R1 : 2 R1R2 : 1 R2R2.From this we
interactions are possible between the genes. conclude that the alleles themselves remain
This gene interaction concept was introduced discrete and unaltered proving the Mendel’s
and explained by W. Bateson. This concept Law of Segregation. The phenotypic and
is otherwise known as Factor hypothesis or
genotypic ratios are the same. There is no
Bateson’s factor hypothesis. According to
blending of genes. In the F2 generation R1 and
Bateson’s factor hypothesis, the gene interactions
R2 genes segregate and recombine to produce
can be classified as
red, pink and white in the ratio of 1 : 2 : 1.
•
Intragenic gene interactions or Intra allelic R1 allele codes for an enzyme responsible for
or allelic interactions
the formation of red pigment. R2 allele codes
•
Intergenic gene interactions or inter allelic for defective enzyme. R1 and R2 genotypes
or non-allelic interactions produce only enough red pigments to make
the flower pink. Two R1R1 are needed for
2.4 Intragenic gene interactions
producing red flowers. Two R2R2 genes are
Interactions take place between the alleles of
needed for white flowers. If blending had
the same gene i.e., alleles at the same locus is
taken place, the original pure traits would not
called intragenic or intralocus gene interaction.
have appeared and all F2 plants would have
It includes the following:
1) Incomplete dominance (2) Codominance pink flowers. It is very clear that Mendel’s
(3) Multiple alleles (4) Pleiotropic genes are particulate inheritance takes place in this
common examples for intragenic interaction. cross which is confirmed by the reappearance
of original phenotype in F2.
2.4.1. Incomplete dominance – No blending
555HG 55:KLWH
of genes
The German Botanist Carl Correns’s (1905) 3JHQHUDWLRQ
Experiment - In 4 O’ clock plant, Mirabilis
jalapa when the pure breeding homozygous
55VHOIHG
red (R1R1) parent is crossed with homozygous )JHQHUDWLRQ ,QWHUPHGLDWH
white (R2R2), the phenotype of the F1 hybrid is SKHQRW\SH
3LQN+HWHUR]\JRWH
heterozygous pink (R1R2). The F1 heterozygous
phenotype differs from both the parental 5 5
homozygous phenotype. This cross did not 5 5
exhibit the character of the dominant parent 5 5
but an intermediate colour pink. When one
5 5 5 5
allele is not completely dominant to another
allele it shows incomplete dominance. Such
5 5
allelic interaction is known as incomplete )JHQHUDWLRQ

dominance. F1 generation produces 555555
intermediate phenotype pink coloured flower. Figure 2.14:
Incomplete dominance in
When pink coloured plants of F1 generation 4 O’ clock plant

different banding patterns for their seed proteins.
How are we going to interpret the lack of
In hybrids, additive banding pattern was noticed.
dominance and give explanation to the
Their hybrid shows the presence of both the
intermediate heterozygote phenotype?
types of proteins similar to their parents.
How will you explain incomplete
The heterozygote genotype gives rise to a
dominance at the molecular level?
phenotype distinctly different from either of the
Gene expression is explained in a quantitative homozygous genotypes. The F1 heterozygotes
way. Wild-type allele which is a functional produce a F2 progeny in a phenotypic and
allele when present in two copies (R1 R1) genotypic ratios of 1 : 2 : 1.
produces an functional enzyme which
synthesizes red pigments. The mutant allele 2.4.3. Lethal genes
which is a defective allele in two copies (R2 R2) An allele which has the potential to cause
produces an enzyme which cannot synthesize the death of an organism is called a “Lethal
necessary red pigments. The white flower is Allele”. In 1907, E. Baur reported a lethal gene in
due to the mutation causing complete loss snapdragon (Antirrhinum sp.). It is an example
of function. The F1 intermediate phenotype for recessive lethality. In snapdragon there are
heterozygote (R1R2) has one copy of the three kinds of plants.
allele R1. R1 produces 50% of the functional 1. Green plants with chlorophyll. (CC)
protein resulting in half of the pigment of 2. Yellowish green plants with carotenoids are
red flowered plant and so it is pink. The referred to as pale green, golden or aurea
intermediate phenotype pink heterogyzote plants (Cc)
with 50% of functional protein is not enough
3. White plants without any chlorophyll. (cc)
to create the red phenotype homozygous,
which makes 100% of the functional protein. The genotype of the homozygous green
plants is CC. The genotype of the homozygous
white plant is cc.
2.4.2. Codominance (1 : 2 : 1) The aurea plants have the genotype Cc
This pattern occurs due to simultaneous because they are heterozygous of green and
(joint) expression of both alleles in the white plants. When two such aurea plants
heterozygote - The phenomenon in which two are crossed the F1 progeny has identical
alleles are both expressed in the heterozygous phenotypic and genotypic ratio of 1 : 2 : 1 (viz.
individual is known as codominance. Example: 1 Green (CC) : 2 Aurea (Cc) : 1 White (cc))
Red and white flowers of Camellia, inheritance Since the white plants lack chlorophyll
of sickle cell haemoglobin, ABO blood group pigment, they will not survive. So the F2
system in humanbeings. In humanbeings, IA and ratio is modified into 1 : 2. In this case the
IB alleles of I gene are codominant which follows homozygous recessive genotype (cc) is lethal.
Mendels law of segregation. The codominance
Antirrhinum Antirrhinum
was demonstrated in plants with the help of F1 Heterozygote
aurea
x
aurea
electrophoresis or chromatography for protein Cc x Cc
or flavonoid substance. Example: Gossypium F2 1CC : 2 Cc : 1 cc

hirsutum and Gossypium sturtianum, their F1 Green Aurea White (lethal)
hybrid (amphiploid) was tested for seed proteins
Figure: 2.15: Lethal genes
by electrophoresis. Both the parents have

The term “lethal” is applied to those prevents from exhibiting its character is known
changes in the genome of an organism which as hypostatic. When both the genes are present
produces effects severe enough to cause death. together, the phenotype is determined by the
Lethality is a condition in which the death of epistatic gene and not by the hypostatic gene.
certain genotype occurs prematurely. The fully
dominant or fully recessive lethal allele kills In the summer squash the fruit colour locus
the carrier individual only in its homozygous has a dominant allele ‘W’ for white colour and a
condition. So the F2 genotypic ratio will be 2 : 1 recessive allele ‘w’ for coloured fruit. ‘W’ allele is
or 1 : 2 respectively. dominant that masks the expression of any colour.
In another locus hypostatic allele ‘G’ is for yellow
2.4.4. Pleiotropy – A single gene affects fruit and its recessive allele ‘g’ for green fruit. In the
multiple traits first locus the white is dominant to colour where
In Pleiotropy, the single gene affects multiple as in the second locus yellow is dominant to green.
traits and alter the phenotype of the organism. When the white fruit with genotype WWgg is
The Pleiotropic gene influences a number of crossed with yellow fruit with genotype wwGG,
characters simultaneously and such genes the F1 plants have white fruit and are heterozygous
are called pleiotropic gene. Mendel noticed (WwGg). When F1 heterozygous plants are crossed
pleiotropy while performing breeding they give rise to F2 with the phenotypic ratio of 12
experiment with peas (Pisum sativum). Peas white : 3 yellow : 1 green.
with purple flowers, brown seeds and dark spot
Parent
on the axils of the leaves were crossed with generation White fruit Yellow fruit
a variety of peas having white flowers, light
WW gg X ww GG
coloured seeds and no spot on the axils of the
leaves, the three traits for flower colour, seed Gametes Wg wG
colour and a leaf axil spot all were inherited
White fruit
together as a single unit. This is due to the F1 (selfed)
WwGg
pattern of inheritance where the three traits were
controlled by a single gene with dominant and
F2 WG Wg wG wg
recessive alleles. Example: sickle cell anemia.
WWGG WWGg WwGG WwGg
WG
2.5 Intergenic gene interactions White White White White
WWGg WWgg WwGg Wwgg
Interlocus interactions take Wg
White White White White
place between the alleles at WwGG WwGg wwGG wwGg
wG
different loci i.e between White White Yellow Yellow
alleles of different genes.It wg WwGg Wwgg wwGg wwgg
White White Yellow Green
includes the following:
Dominant Epistasis – It
is a gene interaction in which Phenotypes
White fruit Yellow fruit Green fruit
two alleles of a gene at one locus interfere and Phenotypic 12 : 3 : 1
suppress or mask the phenotypic expression ratio
of a different pair of alleles of another gene at

Figure 2.16: Dominant epistasis in summer squash
another locus. The gene that suppresses or masks
the phenotypic expression of a gene at another Since W is epistatic to the alleles ‘G’ and
locus is known as epistatic. The gene whose ‘g’, the white which is dominant, masks the
expression is interfered by non-allelic genes and effect of yellow or green. Homozygous

recessive ww genotypes only can give the 2.6 Polygenic Inheritance in Wheat
coloured fruits (4/16). Double recessive (Kernel colour)
‘wwgg’ will give green fruit (1/16). The Plants
having only ‘G’ in its genotype (wwGg or
Polygenic inheritance - Several genes combine
wwGG) will give the yellow fruit(3/16).
to affect a single trait.
Intra –genic or allelic interaction
A group of genes that together determine
F2
S. Gene
(contribute) a characteristic of an organism
Example Phenotypic is called polygenic inheritance. It gives
No. interaction
ratio explanations to the inheritance of continuous
1 Incomplete Flower colour 1:2:1 traits which are compatible with Mendel’s
Dominance in Mirabilis Law.
jalapa.
The first experiment on polygenic
Flower colour 1 : 2 : 1
in snapdragon inheritance was demonstrated by Swedish
(Antirrhinum Geneticist H. Nilsson - Ehle (1909) in wheat
spp.) kernels. Kernel colour is controlled by two
2 Codominance ABO Blood 1:2:1 genes each with two alleles, one with red
group system in kernel colour was dominant to white. He
humans
crossed the two pure breeding wheat varieties
Table 2.2: Intra- genic interaction dark red and a white. Dark red genotypes
R1R1R2R2 and white genotypes are r1r1r2r2. In
Inter-genic or non-allelic interaction
the F1 generation medium red were obtained
F2 Ratio
S. Epistatic with the genotype R1r1R2r2. F1 wheat plant
Example Phenotypic
No. interaction produces four types of gametes R1R2, R1r2,
ratio r1R2, r1r2. The intensity of the red colour is
1 Dominant Fruit colour 12 : 3 : 1
epistasis in summer determined by the number of R genes in the
squash F2 generation.
2 Recessive Flower colour 9:3:4
epistasis of Antirrhinum Four R genes: A dark red kernel colour
spp. is obtained.Three R genes: Medium - dark
3 Duplicate genes Fruit shape 9:6:1
red kernel colour is obtained.Two R genes:
with cumulative in summer
effect squash Medium-red kernel colour is obtained.One
4 Complementary Flower colour 9:7 R gene: Light red kernel colour is obtained.
genes in sweet peas Absence of R gene:Results in White kernel
5 Supplementary Grain colour 9:3:4
colour.
genes in Maize
6 Inhibitor genes Leaf colour in 13 : 3
rice plants The R gene in an additive manner produces
7 Duplicate genes Seed capsule 15 : 1 the red kernel colour. The number of each
shape (fruit phenotype is plotted against the intensity
shape) in
of red kernel colour which produces a bell
shepherd’s
purse Bursa shaped curve. This represents the distribution
bursa-pastoris of phenotype. Other example: Height and
Table 2.3: Inter-genic interaction skin colour in humans are controlled by three
pairs of genes.

Dark Red White Conclusion:
Parent R 1 R 1R 2R 2 r1 r1 r2 r2
X Finally the loci that was studied by Nilsson –
generation
Ehle were not linked and the genes assorted
Medium Red
F1 generation independently.
R 1 r1 R 2 r2
Later, researchers discovered the third gene
F1 generation (selfed) that also affect the kernel colour of wheat. The
R1r1R2r2 R1r1R2r2 three independent pairs of alleles were involved
X
in wheat kernel colour. Nilsson – Ehle found
R 1R2 R 1 r2 r1 R 2 r1r2
the ratio of 63 red : 1 white in F2 generation –
R1R1R2R2 R1R1R2r2 R1r1R2R2 R1r1R2r2
R 1R 2 1 : 6 : 15 : 20 : 15 : 6 : 1 in F2 generation.
R1R1R2r2 R1R1r2r2 R1r1R2r2 R1r1r2r2

R 1 r2 Parents AABBCC aabbcc
Dark red X White
F2 generation Wheat Kernel Wheat Kernel
R1r1R2R2 R1r1R2r2 r1r1R2R2 r1r1R2r2
r1 R 2
AaBbCc
R1r1R2r2 R1r1r2r2 r1r1R2r2 r1r1r2r2 F1 Intermediate red
r1 r2 (Selfed)
The data produce a bell F2

shaped curve. which 1 6 15 20 15 6 1
demonstrate continuous Dark Moderate Intermediate Light Very light
red Red red red White
variation in wheat red red
kernel from dark red to 63 Red (many shades) : 1 White
white in F2
1 4 6 4 1 Figure 2.18: Polygenic inheritance in

Wheat kernel
Dark From the above results Nilsson – Ehle

White
Red Wheat kernel colour showed that the blending inheritance was
Figure 2.17 (a): Polygenic inheritance in wheat not taking place in the kernel of wheat.
kernel colour In F 2 generation plants have kernels with
wide range of colour variation. This is due
Parents R1 R1 R2 R2 X r1 r1 r2 r2
to the fact that the genes are segregating
Dark red White
and recombination takes place. Another
F1 R1 r1 R2 r2 Medium red evidence for the absence of blending
F2 Genotype Phenotype inheritance is that the parental phenotypes
1 R1 R1 R2 R2 Dark red dark red and white appear again in F 2. There
2 R1 R1 R2 r2 Medium-dark red
is no blending of genes, only the phenotype.
4
2 R1 r1 R2 R2 Medium-dark red The cumulative effect of several pairs of
4 R1 r1 R2 r2 Medium red 15 red
to
gene interaction gives rise to many shades
1 6 R1 R1 r2 r2 Medium red
1 r1 r1 R2 R2
Medium red 1 white of kernel colour. He hypothesized that the
2
4
R1 r1 r2 r2 Light red two loci must contribute additively to the
Light red
2 r1 r1 R2 r2
kernel colour of wheat. The contribution of
1 r1 r1 r2 r2 White
each red allele to the kernel colour of wheat
Figure 2.17 (b) : The genetic control of is additive.
colour in wheat kernels.

2.7 Extra Chromosomal Inheritance This inheritance is not through nuclear
or Extra Nuclear Inheritance gene. It is due to the chloroplast gene found in
(Cytoplasmic Inheritance) the ovum of the female plant which contributes
the cytoplasm during fertilization since the
DNA is the universal genetic material. Genes
male gamete contribute only the nucleus but
located in nuclear chromosomes follow
not cytoplasm.
Mendelian inheritance. But certain traits
are governed either by the chloroplast or Mitochondrial Inheritance
mitochondrial genes. This phenomenon is Male sterility found in pearl maize (Sorgum
known as extra nuclear inheritance. It is a kind vulgare) is the best example for mitochondrial
of Non-Mendelian inheritance. Since it involves cytoplasmic inheritance. So it is called
cytoplasmic organelles such as chloroplast and cytoplasmic male sterility. In this, male sterility
mitochondrion that act as inheritance vectors, it is is inherited maternally. The gene for cytoplasmic
also called Cytoplasmic inheritance. It is based on male sterility is found in the mitochondrial DNA.
independent, self-replicating extra chromosomal
In this plant there are two types, one with
unit called plasmogene located in the cytoplasmic
normal cytoplasm (N) which is male fertile and
organelles, chloroplast and mitochondrion.
the other one with aberrant cytoplasm (S) which
Chloroplast Inheritance is male sterile. These types also exhibit reciprocal
It is found in 4 O’ Clock plant (Mirabilis jalapa). differences as found in Mirabilis jalapa.
In this, there are two types of variegated leaves Plant with
Plant with Plant with Plant with
x x
namely dark green leaved plants and pale green Normal Aberrant Aberrant Normal
cytoplasm cytoplasm cytoplasm cytoplasm
leaved plants. When the pollen of dark green (Male) (Female) (cannot be (can be Female)
Male, Since
leaved plant (male) is transferred to the stigma of (N) (S)
pollen are Sterile)
(N)
(S)
pale green leaved plant (female) and pollen of pale F1 Male sterile Plant (Cross is not possible)
green leaved plant is transferred to the stigma of
Figure 2.20: Mitochondrial Inheritance
dark green leaved plant, the F1 generation of both
the crosses must be identical as per Mendelian
inheritance. But in the reciprocal cross the F1 plant
differs from each other. In each cross, the F1 plant
9DULHJDWHG
reveals the character of the plant which is used as /HDI
female plant.
Pale Green Dark Green Dark Green Pale Green $OOZKLWH

leaved Plant x leaved Plant leaved Plant x leaved Plant FKORURSODVWV
(Male) (Female) (Male) (Female)
*UHHQ
RU
&KORURSODVWV
$OOJUHHQ
1XFOHXV :KLWH FKORURSODVWV
&KORURSODVWV
F1 Dark Green F1 Pale Green Figure 2.21: A cellular explanation of the variegated
leaved leaved
phenotype of the leaves in Mirabilis jalapa
Figure 2.19: Chloroplast inheritance

Recently it has been discovered that Summary
cytoplasmic genetic male sterility is common in
Gregor Johann Mendel, father of Genetics
many plant species. This sterility is maintained
unraveled the mystery of heredity through his
by the influence of both nuclear and cytoplasmic
experiments on garden peas. Mendel’s laws,
genes. There are commonly two types of
analytical and empirical reasoning endure till
cytoplasm N (normal) and S (sterile). The genes
now guiding geneticists to study variation. The
for these are found in mitochondrion. There are monohybrid cross of Mendel proved his particulate
also restores of fertility (Rf) genes. Even though theory of inheritance. In F2 the alternative traits
these genes are nuclear genes, they are distinct were expressed in the ratio of 3 dominant and 1
from genetic male sterility genes of other plants. recessive. The characteristic 3 : 1 segregation is
Because the Rf genes do not have any expression referred to as Mendelian ratio. Parents transmit
of their own, unless the sterile cytoplasm is discrete information about the traits to their
present. Rf genes are required to restore fertility offspring which Mendel called it as “factors”. To
in S cytoplasm which is responsible for sterility. test his experimental results Mendel devised a
So the combination of N cytoplasm with rfrf powerful procedure called the test cross. Test cross
and S cytoplasm with RfRf produces plants is used to determine the genotype of an individual
with fertile pollens, while S cytoplasm with rfrf when two genes are involved. In Mendel’s dihyrbid
produces only male sterile plants. cross, the two pairs of factors were inherited
independently. From the results of dihybrid cross
rfrf Rfrf rfrf Rfrf Mendel gave the Law of Independent Assortment.
N S N S
Mendel’s dihybrid ratio of 9 : 3 : 3 : 1 with the
Fertile Male x Female Fertile Male x Female
representation of two new recombinations
appeared in the progeny, i.e. round green peas
Rfrf rfrf or wrinkled yellow peas. Molecular explanation
S S
of Mendel’s gene for monohybrid cross, dihybrid
Fertile male due to Sterile male due to the
restorer gene absence of restorer gene cross were explained. Extension of Mendelian
Genetics was dealt with examples for interaction
Figure 2.22:Cytoplasmic genetic male sterility among genes. Incomplete dominance is not an
Atavism example for blending inheritance. Incomplete
dominance exhibits a phenotypic heterozygote
Atavism is a modification of a biological intermediate between the two homozygous. In
structure whereby an ancestral trait reappears plants codominance can be demonstrated by the
after having been lost through evolutionary methods of electrophoresis or chromatography
changes in the previous generations. for protein or flavonoid substances. Lethal genes
Evolutionary traits that have disappeared with an example are explained. Pleiotropy a single
phenotypically do not necessarily disappear gene which affects multiple traits was explained
from an organism’s DNA. The gene sequence with an example of Pisum sativum. Dominant
often remains, but is inactive. Such an unused epistatis in summer squash with 12 : 3 : 1 ratio was
gene may remain in the genome for many discussed. Polygenic inheritance is an example
generations. As long as the gene remains intact, a for inheritance of continuous traits which is
fault in the genetic control suppressing the gene compatible with Mendel’s laws. The inheritance
can lead to the reappearance of that character of mitochondrial and chloroplast genes were
again. Reemergence of sexual reproduction in explained with examples which does not follow
the flowering plant Hieracium pilosella is the the rules of nuclear genes.
best example for Atavism in plants.

Evaluation d) Round seeds with yellow cotyledons an
1. Extra nuclear wrinkled seeds with yellow cotyledons
inheritance is a 6. Test cross involves
consequence of a) Crossing between two genotypes with
presence of genes in recessive trait
a) Mitrochondria and b) Crossing between two F1 hybrids
chloroplasts c) Crossing the F1 hybrid with a double
b)
Endoplasmic reticulum and recessive genotype
mitrochondria d) Crossing between two genotypes with
c) Ribosomes and chloroplast dominant trait
d) Lysososmes and ribosomes 7. In pea plants, yellow seeds are dominant
2. In order to find out the different types of to green. If a heterozygous yellow seed
gametes produced by a pea plant having pant is crossed with a green seeded plant,
the genotype AaBb, it should be crossed what ratio of yellow and green seeded
to a plant with the genotype plants would you expect in F1 generation?
a) aaBB b) AaBB a) 9:1 b) 1:3
c) AABB d) aabb b) 3:1 d) 50:50
3. How many different kinds of gametes 8. The genotype of a plant showing the
will be produced by a plant having the dominant phenotype can be determined
genotype AABbCC? by
a) Three b) Four a) Back cross b) Test cross
c) Nine d) Two c) Dihybrid corss d) P
edigree
4. Which one of the following is an example analysis
of polygenic inheritance? 9. Select the correct statement from the ones
a) Flower colour in Mirabilis Jalapa given below with respect to dihydrid cross
b) Production of male honey bee a)
Tightly linked genes on the same
c) Pod shape in garden pea chromosomes show very few
combinations
d) Skin Colour in humans
b)
Tightly linked genes on the
5. In Mendel’s experiments with garden pea,
same chromosomes show higher
round seed shape (RR) was dominant over
combinations
wrinkled seeds (rr), yellow cotyledon
(YY) was dominant over green cotyledon c) Genes far apart on the same chromosomes
(yy). What are the expected phenotypes show very few recombinations
in the F2 generation of the cross RRYY x d)
Genes loosely linked on the
rryy? same chromosomes show similar
a) Only round seeds with green cotyledons recombinations as the tightly linked
ones
b)
Only wrinkled seeds with yellow
cotyledons 10. Which Mendelian idea is depicted by a
cross in which the F1 generation resembles
c)
Only wrinkled seeds with green
both the parents
cotyledons
a) Incomplete dominance

b) Law of dominance a) Seven b) Six
c) Inheritance of one gene c) Five d) Four
d) Co-dominance 16. Which of the following explains how
11. Fruit colour in squash is an example of progeny can posses the combinations of
traits that none of the parent possessed?
a) Recessive epistatsis
a) Law of segregation
b) Dominant epistasis
b) Chromosome theory
c) Complementary genes
c) Law of independent assortment
d) Inhibitory genes
d) Polygenic inheritance
12. In his classic experiments on Pea plants, 17. “Gametes are never hybrid”. This is a
Mendel did not use statement of
a)Flowering position b) Seed colour a) Law of dominance
c) Pod length d) Seed shape b) Law of independent assortment
13. The epistatic effect, in which the dihybrid c) Law of segregation
cross 9:3:3:1 between AaBb Aabb is d) Law of random fertilization
modified as
18. Gene which suppresses other genes
a) Dominance of one allele on another activity but does not lie on the same locus
allele of both loci is called as
b)
Interaction between two alleles of a) Epistatic b) Supplement only
different loci
c) Hypostatic d) Codominant
c)
Dominance of one allele to another
19. Pure tall plants are crossed with pure
alleles of same loci
dwarf plants. In the F1 generation, all
d) Interaction between two alleles of some plants were tall. These tall plants of F1
loci generation were selfed and the ratio of
14. In a test cross involving F1 dihybrid tall to dwarf plants obtained was 3:1. This
flies, more parental type offspring were is called
produced than the recombination type a) Dominance b) Inheritance
offspring. This indicates c) Codominance d) Heredity
a) Th
e two genes are located on two 20. The dominant epistatis ratio is
different chromosomes a) 9:3:3:1 b) 12:3:1
b) C
hromosomes failed to separate during c) 9:3:4 d) 9:6:1
meiosis 21. Select the period for Mendel’s
hybridization experiments
c) Th
e two genes are linked and present
on the some chromosome a) 1856 - 1863 b) 1850 - 1870
c) 1857 - 1869 d) 1870 - 1877
d) B
oth of the characters are controlled by 22. Among the following characters which
more than one gene one was not considered by Mendel in his
15. The genes controlling the seven pea experimentation pea?
characters studied by Mendel are known a) Stem – Tall or dwarf
to be located on how many different
b) Trichomal glandular or non-glandular
chromosomes?
c) Seed – Green or yellow

d) Pod – Inflated or constricted Genetic Code: The set of 64 triplets of bases
23. Name the seven contrasting traits of (codons) corresponding to the twenty amino
Mendel. acids in proteins and the signals for initiation
24. What is meant by true breeding or pure and termination of polypeptide synthesis.
breeding lines / strain? Genotype: The types of alleles in a single
25. Give the names of the scientists who individual is called genotype
rediscovered Mendelism.
Genome: The total complement of genes
26. What is back cross?
contained in a cell.
27. Define Genetics.
28. What are multiple alleles Heterozygous: Diploid organisms that have
two different allels at a specific gene locus are
29. What are the reasons for Mendel’s
said to be heterozygous.
successes in his breeding experiment?
30. Explain the law of dominance in Homozygous: A diploid organism in which
monohybrid cross. both alleles are the same at a given gene locus is
31. Differentiate incomplete dominance and said to be homozygous.
codominance. Hybrid Vigour or Heterosis: The superiority of
32. What is meant by cytoplasmic inheritance hybrid over either of its parents in one or more
33. Describe dominant epistasis with an traits.
example. Locus: The site or position of a particular gene
34. Explain polygenic inheritance with an on a chromosome.
example.
35. Differentiate continuous variation with Phenotype: The physical expression of an
discontinuous variation. individuals gene. The physical observable
36. Explain with an example how single characteristics of an organism.
genes affect multiple traits and alleles the
phenotype of an organism. Punnett Square / Checkerboard: A sort
of cross-multiplication matrix used in the
37. Bring out the inheritance of chloroplast
prediction of the outcome of a genetic cross,
gene with an example.
in which male and female gametes and their
Glossary frequencies are arranged along the edges.
Alleles: Alternative forms of a gene.
Back Cross: Crosses between F1 off-springs with

either of the two parents (hybrid) are known as
back cross
F1 / First Filial Generation: The second stage

of Mendel’s experiment is called F1 generation
Gene: The determinant of a characteristic of an

organism (Mendelian factor). Gene symbols are
underlined or italicized.

UNIT VII: Genetics
Chapter
3 Chromosomal Basis of
Inheritance
3.1 Chromosomal Theory of

Learning Objectives Inheritance
The Learner will be able to G. J. Mendel (1865) studied the
inheritance of well-defined characters of
Understand
pea plant but for several reasons it was
chromosomal theory of
unrecognized till 1900. Three scientists
inheritance.
(de Vries, Correns and Tschermak)
Analyze the three- independently rediscovered Mendel’s results
point test crosses and on the inheritance of characters. Various
appreciate results in cytologists also observed cell division due
linkage map construction. to advancements in microscopy. This led to
Describe the sex determination in plants. the discovery of structures inside nucleus.
Observe and calculate recombination In eukaryotic cells, worm-shaped structures
frequency. formed during cell division are called
Differentiate mutation types with examples. chromosomes (colored bodies, visualized
by staining). An organism which possesses
two complete basic sets of chromosomes are
known as diploid. A chromosome consists
Chapter outline of long, continuous coiled piece of DNA in
which genes are arranged in linear order.
3.1 Chromosomal theory of Inheritance Each gene has a definite position (locus) on
3.2 Linkage - Eye colour in Drosophila a chromosome. These genes are hereditary
and Seed colour in Maize units. Chromosomal theory of inheritance
3.3 Crossing over, Recombination and states that Mendelian factors (genes) have
Gene mapping specific locus (position) on chromosomes and
3.4 Multiple alleles they carry information from one generation
3.5 Sex determination in plants. to the next generation.
3.6 Mutation-types, mutagenic agents 3.1.1 Historical development of
and their significance. chromosome theory
In the previous chapter you have learned about The important cytological findings related
Mendelian genetics, now you are going to be study to the chromosome theory of inheritance are
with deviations of concepts related to Mendelian given below.
genetics and chromosomal theory of inheritance. � Wilhelm Roux (1883) postulated that the
You must recall the structure of chromosome and chromosomes of a cell are responsible for
cell division from eleventh standard. transferring heredity.
Chromosomal Basis of Inheritance 53

� Montgomery (1901) was first to 3.1.2 Salient features of the Chromosomal
suggest occurrence of distinct pairs of theory of inheritance
chromosomes and he also concluded that �
Somatic cells of organisms are derived
maternal chromosomes pair with paternal from the zygote by repeated cell division
chromosomes only during meiosis. (mitosis). These consist of two identical sets of
�
T. Boveri (1902) supported the chromosomes. One set is received from female
idea that the chromosomes contain parent (maternal) and the other from male
genetic determiners, and he was parent (paternal). These two chromosomes
largely responsible for developing the constitute the homologous pair.
chromosomal theory of inheritance. � Chromosomes retain their structural
� W.S. Sutton (1902), a young American uniqueness and individuality throughout
student independently recognized a the life cycle of an organism.
�
E ach chromosome carries specific
parallelism (similarity) between the
behaviour of chromosomes and Mendelian determiners or Mendelian factors which
factors during gamete formation. are now termed as genes.
� The behaviour of chromosomes during
Sutton and Boveri (1903) independently
the gamete formation (meiosis) provides
proposed the chromosome theory of
evidence to the fact that genes or factors
inheritance. Sutton united the knowledge of
are located on chromosomes.
chromosomal segregation with Mendelian
principles and called it chromosomal theory 3.1.3 Support for chromosomal theory
of inheritance. of heredity
This theory was widely discussed and
controversies by scientists around the
; < red-eyed female white-eyed male world. However, this debate has been
0DOH
'URVRSKLOD
finally cleared by the works of Thomas
X X X Y
Hunt Morgan (1910) on the fruit
R R r fly Drosophila melanogaster (2n=8).
This fruit fly completed their life cycle
Eggs Sperms
X X X Y within two weeks. The alleles for red or
R R R rr
white eye colour are present on the X
chromosome but there is no counterpart
X X X X X Y X Y for this gene on the Y chromosome.
R r R r R R
)HPDOH Thus, females have two alleles for this
'URVRSKLOD red-eyed red-eyed gene, whereas males have only one
females males
(Figure 3.1). The genetic results were
Eggs Sperms completely based on meiotic behaviour
X X X Y
R r R of the X and Y chromosomes. Similarly,
the genes for yellow body colour
and miniature wings are also carried
X X X X X Y X Y
; ; R R r R R r on the X chromosome. This study
strongly supports the idea that genes
6RPDWLF 6H[ red-eyed red-eyed white-eyed
FKURPRVRPHV FKURPRVRPH females male male are located on chromosomes. The
linked genes connected together on sex
Figure 3.1: Structure of somatic and sex chromosomes chromosome is called sex linkage.
in Drosophila and sex linkage
54 Chromosomal Basis of Inheritance

3.1.4 Comparison between gene and The important aspects to be remembered
chromosome behaviour about the chromosome behaviour during
Around twentieth century cytologists cell division (meiosis) are as follows.
established that, generally the total number of � The alleles of a genotype are found in the
chromosomes is constant in all cells of a species. same locus of a homologous chromosome
A diploid eukaryotic cell has two haploid sets (A/a) (Figure 3.2).
of chromosomes, one set from each parent. � In the S phase of meiotic interphase each
All somatic cells of an organism carry the chromosome replicates forming two copies of
same genetic complement. The behaviour of each allele (AA/aa), one on each chromatid.
chromosomes during meiosis not only explains
� The homologous chromosomes segregate
Mendel’s principles but leads to new and
different approaches to study about heredity. in anaphase I, thereby separating two
different alleles (AA) and (aa).
Homologous
chromosomes � In anaphase II of meiosis, separation of sister
chromatids of homologous chromosomes

takes place. Therefore, each daughter cell
(gamete) carries only a single allele (gene) of
a character (A), (A), (a) and (a).
Organism Number of
Chromosome 1 Chromosome 2 Chromosome 3
Same genes, chromosomes (2n)
Non homologous chromosomes
same order Adder’s tongue fern
Genes 1262
Genes (Ophioglossum)
Horsetail (Equisetum) 216
Giant sequoia 22
Arabidopsis 10
Sugarcane 80
Different
DNA sequences
Apple 34
GCATTCGAGTCCATAAGCGATGA GCATTCGAGTCTATAAGCGATGA
Rice 24
Allele-A Allele-a Potato 48
Maize 20
Figure 3.2: C
omparison of chromosome
Onion 16
and gene behaviour
Haplopappus gracilis 4
Mendelian factors Chromosomes behaviour
1. Alleles of a factor Chromosomes occur Table 3.2 : Number of Chromosomes
occur in pair in pairs
2. Similar or dissimilar The homologous Thomas Hunt Morgan (1933)
alleles of a factor chromosomes separate received Nobel Prize in
separate during the during meiosis Physiology or Medicine for his
gamete formation discoveries concerning the role
3. Mendelian The paired chromosomes
played by chromosomes in heredity.
factors can assort can separate
independently independently during Fossil Genes: Some of the
meiosis but the linked
junk DNA is made up of pseudo
genes in the same
chromosome normally do genes, the sequences presence
not assort independently. in that was once working genes.
Table 3.1: P
arallelism between Mendelian factors They lost their ability to make proteins. They tell
and chromosomal behaviour. the story of evolution through fossilized parts.

3.2 Linkage Genes located close together on the
The genes which determine the character of an same chromosome and inherited together are
individual are carried by the chromosomes. The called linked genes. But the two genes that are
genes for different characters may be present sufficiently far apart on the same chromosome are
either in the same chromosome or in different called unlinked genes or syntenic genes (Figure
chromosomes. When the genes are present in 3.3). Such condition is known as synteny. It is to
different chromosomes, they assort independently be differentiated by the value of recombination
according to Mendel’s Law of Independent frequency. If the recombination frequency value
Assortment. Biologists came across certain genetic
is more than 50 % the two genes show unlinked.
characteristics that did not assort out independently
when the recombination frequency value is less
in other organisms after Mendel’s work. One
such case was reported in Sweet pea (Lathyrus than 50 %, they show linked. Closely located
odoratus) by Willium Bateson and Reginald C. genes show strong linkage, while genes widely
Punnet in 1906. They crossed one homozygous located show weak linkages.
strain of sweet peas having purple flowers and long
3.2.1 Coupling and Repulsion theory
pollen grains with another homozygous strain
having red flowers and round pollen grains. All The two dominant alleles or recessive alleles
the F1 progenies had purple flower and long pollen occur in the same homologous chromosomes,
grains indicating purple flower long pollen (PL/ tend to inherit together into same gamete are
PL) was dominant over red flower round pollen called coupling or cis configuration (Figure:
(pl/pl). When they crossed the F1 with double 3.5 ). If dominant or recessive alleles are present
recessive parent (test cross) in results, F2 progenies on two different, but homologous chromosomes
did not exhibit in 1:1:1:1 ratio as expected with they inherit apart into different gamete are called
independent assortment. A greater number of F2
repulsion or trans configuration (Figure: 3. 6).
plants had purple flowers and long pollen or red
flowers and round pollen. So they concluded that Cis AB/ab Trans Ab/aB
genes for purple colour and long pollen grain and
the genes for red colour and round pollen grain
were found close together in the same homologous
pair of chromosomes. These genes do not allow $ D $ D
themselves to be separated. So they do not assort
% E E %
independently. This type of tendency of genes to
stay together during separation of chromosomes is
Figure 3.4: Cis-Trans arrangement of genes
called Linkage.
3.2.2 Kinds of Linkage
T.H. Morgan found two types of linkage. They
Gene 1
Gene 1 are complete linkage and incomplete linkage
depending upon the absence or presence of
Gene 1
new combination of linked genes.
Gene 2 Gene 2
Gene 2
Linked genes Unlinked genes Unlinked genes Complete Linkage
Figure 3.3: Arrangement of linked and If the chances of separation of two linked
unlinked genes on chromosome genes are not possible those genes always remain

$OOHOHVLQFRXSOLQJRUFLVFRQILJXUDWLRQ $OOHOHVLQUHSXOVLRQRUWUDQVFRQILJXUDWLRQ
3XUSOHIORZHU UHGIORZHU 3XUSOHIORZHU UHGIORZHU

/RQJSROOHQ URXQGSROOHQ 3JHQHUDWLRQ URXQGSROOHQ /RQJSROOHQ
3JHQHUDWLRQ
3O3O ; S/S/
3/3/ ; SOSO
&URVVHV
&URVVHV
EHWZHHQ 3 3 S S
EHWZHHQ 3 3 S S
KRPR]\JRXV KRPR]\JRXV O O / /
/ / O O
SDUHQWV SDUHQWV
3 S 3 S
*DPHWHIRUPDWLRQ / *DPHWHIRUPDWLRQ O /
O
3XUSOHIORZHU 3XUSOHIORZHU
/RQJSROOHQ /RQJSROOHQ
3/SO 3OS/
)*HQHUDWLRQ )*HQHUDWLRQ
3 S 3 S
/ O O /
3XUSOHIORZHU UHGIORZHU
7HVWFURVV 3XUSOHIORZHU UHGIORZHU
/RQJSROOHQ URXQGSROOHQ 7HVWFURVV /RQJSROOHQ URXQGSROOHQ
+HWHUR]\JRXV)
FURVVHVZLWK 3 S S S +HWHUR]\JRXV)
GRXEOHUHFHVVLYH / O ; 3 S S S
O O &URVVHVZLWK
SDUHQW O / ;
GRXEOHUHFHVVLYH O O
SDUHQW
)*DPHWHVIRUPDWLRQ
)*DPHWHVIRUPDWLRQ
/HVVFKDQFHRI
FURVVLQJRYHU 3 3 S S S
/HVVFKDQFHRI
GXHWROLQNHG / O / O O 3 3 S S S
FURVVLQJRYHU
JHQHV GXHWROLQNHG / O / O O
)HUWLOL]DWLRQ JHQHV
)HUWLOL]DWLRQ
)*HQHUDWLRQ 3 S 3 S S S S S 3 S
3 3 S S S S
/ O O O / O O O )๜*HQHUDWLRQ / /
O O O / O O
3XUSOH 3XUSOH UHG UHG
3XUSOH 3XUSOH UHG UHG
/RQJ URXQG /RQJ URXQG
/RQJ URXQG /RQJ URXQG
3DUHQWDO 5HFRPELQDQW 3DUHQWDO :LWKOLQNHGJHQHV 5HFRPELQDQW 3DUHQWDO 5HFRPELQDQW
:LWKOLQNHGJHQHV
SURJHQ\ SURJHQLHV SURJHQ\ QRQUHFRPELQDQW
QRQUHFRPELQDQW SURJHQ\ SURJHQLHV SURJHQ\
SURJHQLHVDUH SURJHQLHVDUH
SUHGRPLQDQW
SUHGRPLQDQW

2EVHUYHGUDWLR 2EVHUYHGUDWLR
([SHFWHGUDWLR ([SHFWHGUDWLR
Figure 3.5: Alleles in coupling or cis Figure 3.6: A

lleles in repulsion or trans
configuration configuration
together as a result, only parental combinations Incomplete Linkage
are observed. The linked genes are located If two linked genes are sufficiently apart,
very close together on the same chromosome the chances of their separation are possible. As a
such genes do not exhibit crossing over. This result, parental and non-parental combinations
phenomenon is called complete linkage. It is are observed. The linked genes exhibit some
rare but has been reported in male Drosophila crossing over. This phenomenon is called
(Figure 3.7). C.B Bridges (1919) discovered incomplete linkage. This was observed in maize.
that crossing over is completely absent in some (Figure 3.8) It was reported by Hutchinson.
species of male Drosophila.

&RPSOHWHOLQNDJHLQPDOH'URVRSKLOD Incomplete linkage in Maize seed
5HGH\H SXUSOHH\H
YHVWLJLDOZLQJV /RQJZLQJV P generation Coloured colourless
3JHQHUDWLRQ full seed X shrunken seed
CS/CS cs/cs
5O5O ; U/U/
&URVVHV Crosses between
C C c c
EHWZHHQ 5 5 U U homozygous
KRPR]\JRXV O O / / parents S S s s
SDUHQWV
Gametes formation
C c
5 U S
*DPHWHIRUPDWLRQ O /
s
5HGH\H/RQJZLQJV F1 Generation Coloured full seed

CS/cs
5 U Coloured colourless
)*HQHUDWLRQ Test Cross
O / full seed X shrunken seed
5OU/
Heterozygous F1
C c c c
crosses with double
5HGH\H 3XUSOHH\H recessive parent S s s s
7HVWFURVV
JV
/RQJZLQJV V
YHVWLJLDOZLQJV
CS/cs cs/cs
+HWHUR]\JRXV) Test cross result Coloured Coloured colourless colourless

&URVVHVZLWK 5 U U U full seed Shrunken full seed shrunken
O / ; O O Due to crossing seed seed
GRXEOHUHFHVVLYH
SDUHQW over recombinant CS/CS Cs/Cs cS/cS cs/cs
progenies obtained
48% 2% 2% 48%
)*DPHWHVIRUPDWLRQ least in number
Parental Recombinant Parental
2QO\WZRW\SHVRI
progeny progenies progeny
JDPHWHVEHFDXVH 5 U U
ODFNRIFURVVLQJ O / O
RYHU
Figure 3.8: Incomplete linkage in Maize seed
5HGH\H SXUSOHH\H Linkage and crossing over are two processes
YHVWLJLDOZLQJV /RQJZLQJV
that have opposite effects. Linkage keeps
)*HQHUDWLRQ
5 U U U particular genes together but crossing over
7KHRIIVSULQJH[KLELW O O / O
RQO\SDUHQWDO mixes them. The differences are given below.
FRPELQDWLRQVGXHWR 5OUO U/UO
FRPSOHWHOLQNDJH
Linkage Crossing over
2EVHUYHGUDWLR
([SHFWHGUDWLR
1. The genes It leads to separation

present on of linked genes
Figure 3.7: C
omplete linkage in male Drosophila chromosome
stay close
3.2.3 Linkage Groups together
The groups of linearly arranged linked genes 2. It involves It involves exchange
on a chromosome are called Linkage groups. same of segments between
In any species the number of linkage groups chromosome non-sister chromatids
corresponds to the number haploid set of of homologous of homologous
chromosomes. Example: chromosome chromosome.
3. It reduces It increases variability
Name of organism Linkage groups new gene by forming new gene
Mucor 2 combinations combinations. lead
Drosophila 4 to formation of new
Sweet pea 7 organism
Neurospora 7
Maize 10 Table 3.4: D
ifferences between linkage and
Table 3.3 : Linkage groups in some organisms crossing over

3.3 Crossing Over are called Chiasmata (singular-Chiasma). At
Crossing over is a biological process that produces chiasma, cross-shaped or X-shaped structures
new combination of genes by inter-changing are formed, where breaking and rejoining of
the corresponding segments between non-sister two chromatids occur. This results in reciprocal
chromatids of homologous pair of chromosomes. exchange of equal and corresponding segments
The term 'crossing over' was coined by Morgan between them. A recent study reveals that
(1912). It takes place during pachytene stage synapsis and chiasma formation are facilitated by
of prophase I of meiosis. Usually crossing over a highly organised structure of filaments called
occurs in germinal cells during gametogenesis. It Synaptonemal Complex (SC) (Figure 3.9). This
is called meiotic or germinal crossing over. It has synaptonemal complex formation is absent in some
universal occurrence and has great significance. species of male Drosophila hence crossing over
Rarely, crossing over occurs in somatic cells during does not takes place.
mitosis. It is called somatic or mitotic crossing over. Sister chromatid 1
+
Synaptonemal
Sister chromatid 2
3.3.1 Mechanism of Crossing Over Synaptonemal
complex
complex Recombination
Crossing over is a precise process that includes Sister chromatid 3
+ nodules
Sister chromatid 4
stages like synapsis, tetrad formation, cross over
and terminalization.
Figure 3.9: Structure of Synaptonemal Complex
(i) Synapsis
Intimate pairing between two homologous
chromosomes is initiated during zygotene 1RQVLVWHU
stage of prophase I of meiosis I. Homologous 3URSKDVH, FKURPDWLGVRI
RIPHLRVLV $ $D D
KRPRORJRXV
chromosomes are aligned side by side resulting % %E E FKURPRVRPH
in a pair of homologous chromosomes called 7HWUDG
bivalents. This pairing phenomenon is called
synapsis or syndesis. It is of three types,
3DFK\WHQH
1. Procentric synapsis: Pairing starts from D &KLDVPDDVLWH
VWDJHRI $ $ D
middle of the chromosome. SURSKDVH,

% E% E RIFURVVLQJRYHU
2. Proterminal synapsis: Pairing starts from
the telomeres.
3. R andom synapsis: Pairing may start from
0HWDSKDVH,
anywhere. $ $D D
% E% E
(ii) Tetrad Formation

Each homologous chromosome of a
bivalent begin to form two identical sister
0HWDSKDVH,,
chromatids, which remain held together by a $ $ D D
% E % E
centromere. At this stage each bivalent has four
chromatids. This stage is called tetrad stage. 5HFRPELQDQWV
(iii) Cross Over

'DXJKWHU
After tetrad formation, crossing over occurs in FHOOV $ $ D D
% E % E
pachytene stage. The non-sister chromatids of
homologous pair make a contact at one or more 3DUHQWDOW\SH 3DUHQWDOW\SH
points. These points of contact between non-
sister chromatids of homologous chromosomes Figure 3.10: Mechanism of crossing over

(iv) Terminalisation
Activity: Solve this
After crossing over, chiasma starts to move
towards the terminal end of chromatids. This is Consider two hypothetical recessive
known as terminalisation. As a result, complete autosomal genes a and b, where a
separation of homologous chromosomes heterozygote is testcrossed to a double
occurs. (Figure 4.10) homozygous mutant. Predict the phenotypic
ratios under the following conditions:
3.3.2 Types of Crossing Over
(a)
a and b are located on separate
Depending upon the number of chiasmata
autosomes.
formed crossing over may be classified into
(b)
a and b are linked on the same
three types. (Figure 3.11)
autosome but are so far apart that a
Single cross over: Formation of single
1. crossover occurs between them.
chiasma and involves only two chromatids (c)
a and b are linked on the same
out of four.
autosome but are so close together that
No cross over a crossover almost never occurs.
A B
A B D ouble cross over: Formation of two

2.
a b 0
RF = X100 = 0%
4 chiasmata and involves two or three or
a b
all four strands
Single cross over Multiple cross over: Formation of more
3.
A B A B
than two chiasmata and crossing over
A B a B
a b A b
frequency is extremely low.
a b a b 3.3.3 Importance of Crossing Over
RF =
2
X100 = 50% Crossing over occurs in all organisms like
4
Two strand double cross over bacteria, yeast, fungi, higher plants and animals.
A B A B Its importance is
A B a b
�
Exchange of segments leads to new gene
a b A B
a b a b combinations which plays an important

0
role in evolution.
RF = X100 = 0%
4 �
Studies of crossing over reveal that genes
Three strand double cross over are arranged linearly on the chromosomes.
A B A B
� Genetic maps are made based on the

A B a b
a b A b
frequency of crossing over.
a b a B � Crossing over helps to understand the
nature and mechanism of gene action.
2
RF =
4
X100 = 50% � If a useful new combination is formed it
Four strand double cross over can be used in plant breeding.
A B a B
A B
3.3.4 Recombination
a B
a b A b
Crossing over results in the formation of new
a b A b combination of characters in an organism
4
called recombinants. In this, segments of DNA
RF = X100 = 100%
4 are broken and recombined to produce new
Figure 3.11: T
ypes of crossing over and its combinations of alleles. This process is called
Recombination Frequency (RF) Recombination. (Figure 3.12)

$1RFURVVLQJRYHU %&URVVLQJRYHU (a) (b)
A B C A B C
&KLDVPD 5’ 3’
D E
D E 3’ 5’
A B C A B C
D E &URVVLQJRYHU
D % a b c a b c
$ EHWZHHQ 3’ 5’
% $ E WKHVHFKURPDWLGV
5’ 3’
$ % $ % a b c a b c
Heteroduplex region
D E D E 1RQUHFRPELQDQW
FKURPDWLGV (c) (d)
A B C A B C
D E D %
A B C A b C
$ % $ E 5HFRPELQDQW
a B c
$ % FKURPDWLGV a c
$ % b a b c
a b c
D E D E (e) A V
C
A
D E D % B
Holliday junction C
$ % $ E b H
B
$ % $ % c a
Vertical cut b
c Horizontal cut
5HVXOW)RXU 5HVXOW7ZRUHFRPELQDQW (along line V) a
(along line H)
QRQUHFRPELQDQW DQGWZRQRQUHFRPELQDQW and reseal
FKURPDWLGV FKURPDWLGV and reseal
(f) (g)
A B c A B C
Figure 3.12 : Recombination 5’ 3’ 5’ 3’
3’ 5’ 3’ 5’
A b c A b C
The widely accepted model of DNA 5’
a b C
3’ 3’
a B c
5’
recombination during crossing over is 3’
a B C
5’ 5’
a b c
3’
Holliday’s hybrid DNA model. It was first Heteroduplexes Heteroduplexes

and recombinants No recombinants
proposed by Robin Holliday in 1964. It involves
several steps. (Figure 3.13) Figure 3.13: Holliday model showing
Recombination
1. Homologous DNA molecules are paired side
by side with their duplicated copies of DNAs
Number of recombinants
2. One strand of both DNAs cut in one place RF = x 100
by the enzyme endonuclease. Number of off springs
6+6
3. The cut strands cross and join the = x 100
44+6+6+44
homologous strands forming the Holliday
structure or Holliday junction. 12
= x 100
100
4. The Holliday junction migrates away from the
original site, a process called branch migration, RF = 12%
as a result heteroduplex region is formed.
$ %
$ %
5. DNA strands may cut along through the $ % PHLRVLVZLWK $ %
QRQUHFRPELQDQW
QRFURVVRYHU
vertical (V) line or horizontal (H) line. D E D E
QRQUHFRPELQDQW
QRQUHFRPELQDQW
6. The vertical cut will result in heteroduplexes D E D E
QRQUHFRPELQDQW
D
with recombinants. $ % $ %
PHLRVLVZLWKD QRQUHFRPELQDQW
7. The horizontal cut will result in D
$ E VLQJOHFURVVRYHU $ E
UHFRPELQDQW
% D %
heteroduplex with non recombinants. D E
UHFRPELQDQW
D E QRQUHFRPELQDQW
E
Calculation of Recombination Frequency (RF) Figure 3.14 Recombination frequency

The percentage of recombinant progeny observation
in a cross is called recombination frequency.
The recombination frequency (cross over Check your Grasp
frequency) (RF) is calculated by using the
Find out Recombination frequency value
following formula. The data is obtained from
from the above figure.
alleles in coupling configuration (Figure 3.14)

3.3.5 Genetic Mapping In maize (corn), the three recessive alleles are
Genes are present in a linear order along the 1. l for lazy or prostrate growth habit
chromosome. They are present in a specific location 2. g for glossy leaf
called locus (plural: loci). The diagrammatic 3. s for sugary endosperm
representation of position of genes and related These three recessive alleles (l g s) are crossed
distances between the adjacent genes is called with wild type dominant alleles (L G S).
genetic mapping. It is directly proportional to
the frequency of recombination between them. It Parents LGS / LGS x lgs / lgs
is also called as linkage map. The concept of gene Gametes LGS x lgs
mapping was first developed by Morgan’s student F1 trihybrid LGS / lgs
Alfred H Sturtevant in 1913. It provides clues
Test cross
about where the genes lies on that chromosome.
(Heterozygous F1 crosses with
Map distance triple recessive alleles)
The unit of distance in a genetic map is called LGS / lgs x lgs / lgs
a map unit (m.u). One map unit is equivalent to
This trihybrid test cross produces 8
one percent of crossing over (Figure 4. ). One map
different types (23=8) of gametes in which 740
unit is also called a centimorgan (cM) in honour
progenies are observed. The following table
of T.H. Morgan. 100 centimorgan is equal to one
shows the result obtained from a test cross of
Morgan (M). For example: A distance between
corn with three linked genes.
A and B genes is estimated to be 3.5 map units.
It is equal to 3.5 centimorgans or 3.5 % or 0.035 The analysis of a three-point cross:
recombination frequency between the genes. S. Phenotype of test Gamete Number of
A B C D no cross progeny types progenies
1. Normal (wild type) LGS 286
3.5 cM 7.5 cM 5.5 cM 2. Lazy lGS 33
3. Glossy LgS 59
Genetic maps can be constructed from a 4. Sugary LGs 4
series of test crosses for pairs of genes called two 5. Lazy, glossy lgS 2
point crosses. But this is not efficient because 6. Lazy, sugary lGs 44
double cross over is missed. 7. Glossy, sugary Lgs 40
8. Lazy, glossy, sugary lgs 272
Three point test cross Total 740
A more efficient mapping technique is to From the above result, we must be careful to
construct based on the results of three-point observe parental (P) and recombinant (R) types.
test cross. It refers to analyzing the inheritance First note that parental genotypes for the triple
patterns of three alleles by test crossing a triple homozygotes are L G S and l g s, then analyse two
recessive heterozygote with a triple recessive recombinant loci at a time orderly L G/ l g, L S/ l
homozygote. It enables to determine the s and G S/ g s. In this any combination other than
distance between the three alleles and the order these two constitutes a recombinant (R).
in which they are located on the chromosome. Let’s analyse the loci of two alleles at a
Double cross overs can be detected which will time starting with L and G Since the L G and l
provide more accurate map distances. g parental genotypes the recombinants will be
Three-point test cross can be best understood L g and l G. The Recombinant frequency (RF)
by considering following an example. for these two alleles can be calculated as follows

Number of
Phenotype of test Gamete Recombinant for loci
S.no progenies
cross progeny types
L and G L and S G and S
1. Normal (wild type) LGS 286
2. Lazy lGS 33 R R
3. Glossy LgS 59 R R
4. Sugary LGs 4 R R
5. Lazy, glossy lgS 2 R R
6. Lazy, sugary lGs 44 R R
7. Glossy, sugary Lgs 40 R R
8. Lazy, glossy, sugary lgs 272
Total 740 176 79 109
Total number of recombinants map can be drawn as follows: (Figure 3.15)

RF = X 100 l s g
Total number of progenies
33 + 59 + 44 + 40 10.7 map uints 14.7 map uints
RF = X 100
740
176 Figure: 3.15 Gene mapping
RF = X 100
740 A final point note that two smaller map
distances, 10.7 m.u and 14.7., is add up to
RF = 23.7%
25.4 m.u., which is greater than 23.7 m.u., the
For L and S loci, the recombinants are L s distance calculated for l and g. we must identify
and l S. The Recombinant frequency (RF) will the two least number of progenies (totaling 8)
be as follows in relation to recombination of L and G. These
33 + 4 + 2 + 40 two least progenies are double recombinants
RF = X 100
740 arising from double cross over. The two least
79 progenies not only counted once should have
RF = X 100
740 counted each of them twice because each
RF = 10.7% represents a double recombinant progeny.
For G and S loci, the recombinants are G s Hence, we can correct the value adding the
and g S. The Recombinant frequency (RF) will numbers 33+59+44+40+4+4+2+2=188. Of the
be as follows total of 740, this number exactly 25.4 %, which is
59 + 4 + 2 + 44 identical with the sum of two component values.
RF = X 100
740 The test cross parental combination can be
109 re written as follows:
RF = X 100
740 LSG / lsg x lsg / lsg
RF = 14.7%
Original Chromosomes
All the loci are linked, because all the RF Chromosomes after crossing over
values are considerably less than 50%. In this L G L S G L S G L s G
loci show highest RF value, they must be farthest

l s g l s g l S g
apart. Therefore, the S locus must lie between
them. The order of genes should be l s g. A genetic Figure: 3. 16 Gene order showing double
recombinant

Uses of genetic mapping pollen from a plant is unable to germinate on its
�
It is used to determine gene order, identify own stigma and will not be able to bring about
the locus of a gene and calculate the fertilization in the ovules of the same plant. East
distances between genes. (1925) observed multiple alleles in Nicotiana
which are responsible for self-incompatibility
�
They are useful in predicting results of
or self-sterility. The gene for self-incompatibility
dihybrid and trihybrid crosses.
can be designated as S, which has allelic series
�
It allows the geneticists to understand the S1, S2, S3, S4 and S5 (Figure 3.17).
overall genetic complexity of particular Pollen
organism. S3 S4 S2
S3 S1 S1
Style
3.4 Multiple alleles
Pollen tube
A given phenotypic trait of an individual depends
Ovary
on a single pair of genes, each of which occupies a
specific position called the locus on homologous S1S2 S1S2 S1S2
chromosome. When any of the three or more
allelic forms of a gene occupy the same locus in a
given pair of homologous chromosomes, they are Figure: 3.17 The self-incompatibility in relation
said to be called multiple alleles. to its genotype in tobacco
The cross-fertilizing tobacco plants were
Check your Grasp not always homozygous as S1S1 or S2S2, but all
There may be multiple alleles within the plants were heterozygous as S1S2, S3S4, S5S6. When
population, but individuals have only two crosses were made between different S1S2 plants,
of those alleles. Why? the pollen tube did not develop normally. But
effective pollen tube development was observed
when crossing was made with other than S1S2 for
3.4.1 Characteristics of multiple alleles example S3S4.
• M
ultiple alleles of a series always occupy
the same locus in the homologous Female
Male parent (Pollen source)
chromosome. Therefore, no crossing over parent
occurs within the alleles of a series.
(Stigma
• M
ultiple alleles are always responsible for S1S2 S2S3 S3S4
spot)
the same character.
Self S3S2 S3S1
• Th
e wild type alleles of a series exhibit Sterile S3S1 S3S2
dominant character whereas mutant S1S2
S4S1
type will influence dominance or an S4S2
intermediate phenotypic effect. S1S2 Self S4S2
• W
hen any two of the mutant multiple S2S3 S1S3 Sterile S4S3
alleles are crossed the phenotype is always
mutant type and not the wild type S1S3 S2S3 Self
S1S4 S2S4 Sterile
3.4.2 Self-sterility in Nicotiana S3S4
S2S3
In plants, multiple alleles have been reported S2S4
in association with self-sterility or self-
Table: 3.5. D
ifferent combinations of
incompatibility. Self-sterility means that the progeny in self-incompatibility

When crosses were made between seed 3.5.1 Sex determination in papaya
parents with S1S2 and pollen parents with S2S3, Recently researchers in
two kinds of pollen tubes were distinguished. Hawaii discovered sex
Pollen grains carrying S2 were not effective, chromosomes in Papaya
Papaya
but the pollen grains carrying S3 were capable (Carica papaya, 2n=36).
of fertilization. Thus, from the cross S1S2XS3S4, Papaya has 17 pairs of
all the pollens were effective and four kinds of autosomes and one pair of
progeny resulted: S1S3, S1S4, S2S3 and S2S4. Some sex chromosomes. Male Y X
combinations are showed in the table-3.5. papaya plants have XY Figure 3.18 : Sex
and female plants have chromosome of
3.5 Sex determination in plants XX. Unlike human sex papaya
About 94% of all flowering plants have only chromosomes, papaya
one type of individual, which produces flowers sex chromosomes look like autosomes and it is
with male organs (the stamens) and female evolved from autosome. The sex chromosomes
organs (the carpels). Such plants are termed as are functionally distinct because the Y
sexually monomorphic. Some 6% of flowering chromosome carries the genes for male organ
plants which have two separate sexes are called development and X bears the female organ
dimorphic. Male plants produce flowers with developmental genes (Figure 3.18).
stamens and female plants produce flowers
In papaya sex determination is controlled
with carpels only. Researchers are interested
by three alleles. They are m, M1 and M2 of a
to study the mechanism of sex determination
single gene.
in plants.C.E. Allen (1917) discovered sex
determination in plants. Sex determination is Genotype Dominant/ Modification Sex
a complex process determined by genes, the recessive
mm Homozygous Restrict Female
environment and hormones.
recessive maleness
Sex determination in Silene latifolia M1m Heterozygous Induces Male
(Melandrium album) is of controlled by three maleness
distinct regions in a sex chromosome. M2m Heterozygous Induces both Bisexual
the sex (rare)
1. Y chromosome determines maleness M1M1 or Homozygous/ Inviable Sterile
2. X specifies femaleness M2M2 or Heterozygous plants
M1M2 dominant
3. X and Y show different segments
Table 3.6 : Sex determination in Papaya
(I II III IV and V)
3.5.2 Sex Determination in Sphaerocarpos
Does environment play a
Sex determination was first described in the
role on sex determination
bryophyte Sphaerocarpos donnellii which has
in plants?
heteromorphic chromosomes. The gametophyte
Yes. Horsetail plant
is haploid and
(Equisetum) grown under good conditions
heteromorphic. The
develop as female and those grown under
male gametophyte
stress condition develop into males.
as well as the female
gametophyte is an
haploid organism
Bottle liverwort-Sphaerocarpus

with 8 chromosome (n=8). The diploid gibberellin biosynthesis. Gibberellins play an
sporophyte is always heterogametic. Seven important role in the suppression of stamens in
autosomes are similar in both male and female florets on the ears.
gametophyte. But the eighth chromosome Genotype Dominant/ Modification Sex
of female is X which is larger than the seven recessive
autosomes. The eighth chromosome of male is Y ba/ba Double Lacks silk Rudimentary
which is comparatively smaller than autosomes. ts/ts recessive on the female
The sporophyte containing XY combination stalk, but
produces two types of meiospores, that is some transformed
with X and others with Y chromosomes. The tassel to
meiospores with X chromosomes produce pistil
ba/ba Recessive Lacks silk Male
female gametophyte and those with Y
ts /ts
+ +
and and have
chromosome produces male gametophyte.
dominant tassel
3.5.3 Sex determination in maize ba+/ba+ Double Have both Monoecious
Zea mays (maize) is an example for monoecious, ts+/ts+ dominant tassel and
cob
which means male and female flowers are
ba /ba
+ +
Dominant Bears cob Normal
present on the
ts/ts and and lacks female
same plant. There recessive tassel
are two types of Tassel
Table 3.7: Sex determination in Maize
inflorescence.
(Superscript (+) denotes dominant character)
The terminal
inflorescence 3.6 Mutation
which bears Genetic variation among individuals provides
staminate florets the raw material for the ultimate source
develops from Ear of evolutionary changes. Mutation and
shoot apical recombination
meristem called are the two
tassel. The lateral Inflorescence of Zea mays major processes
inflorescence responsible for
which develop pistillate florets from axillary genetic variation.
bud is called ear or cob. Unisexuality in A sudden change
maize occurs through the selective abortion in the genetic
of stamens in ear florets and pistils in tassel Mutant Leaf
material of an
florets. A substitution of two single gene pairs organisms is
'ba' for barren plant and 'ts' for tassel seed called mutation. The term mutation was
makes the difference between monoecious and introduced by Hugo de Vries (1901) while he
dioecious (rare) maize plants. The allele for has studying on the plant, evening primrose
barren plant (ba) when homozygous makes the (Oenothera lamarkiana) and
stalk staminate by eliminating silk and ears. The proposed ‘Mutation theory’.
allele for tassel seed (ts) transforms tassel into There are two broad types of
a pistillate structure that produce no pollen. changes in genetic material.
The table-3.7 is the resultant sex expression They are point mutation and
based on the combination of these alleles. Most chromosomal mutations.
of these mutations are shown to be defects in

Mutational events that take place within that increase the rate of mutation. Mutations
individual genes are called gene mutations or can occur either spontaneously or induced.
point mutation, whereas the changes occur in The production of mutants through exposure
structure and number of chromosomes is called of mutagens is called mutagenesis, and the
chromosomal mutation. Agents which are organism is said to be mutagenized.
responsible for mutation are called mutagens,
S.No Basis of Major types of mutations Major features

classification
1. Origin Spontaneous Occurs in the absence of known
mutagen
Occurs in the presence of known

Induced
mutagen
2. Cell type Somatic Occurs in non-reproductive cells
Germ-line Occurs in reproductive cells

3. Effect on Loss-of-function (knockout, null) Eliminates normal function
function Hypomorphic(leaky) Reduces normal function
Hypermorphic Increases normal function
Gain-of-function (ectopic Expressed at incorrect time or
expression) inappropriate cells
4. Molecular Nucleotide substitution A base pair in DNA duplex is
change replaced with a different base pair
• Transition Purine to purine(A G)or
pyrimidine to pyrimidine(T C)
• Transversion Purine to pyrimidine(A T) or
pyrimidine to purine(C G)
• Insertion One or more extra nucleotides are

present
• Deletion One or more nucleotides are

missing
5. Effect on • Silent (synonymous) No change in amino acid encoded
translation
• Missense (non-synonymous) Change in amino acid encoded
• Nonsense(termination) Creates translational termination

codon (UAA, UAG, or UGA)
• Frameshift Shifts triplet reading of codons out

of correct phase
Table 3.8: Major types of mutations

a) No mutation Point mutation
5' TGT TCA CCA T 3'
DNA
3' ACA AGT GGT A 5' It refers to alterations of single base pairs of
Wild-type protein
Transcription DNA or of a small number of adjacent base pairs
mRNA
produced.
UGU UCA CCA U
Translation Types of point mutations
Protein Thr Ser Gly
Point mutation in DNA are categorised
b) Transition mutation changes a purine into two main types. They are base pair
5' TGT TCG CCA T 3' nucleotide to another substitutions and base pair insertions or
3' ACA AGC GGT A 5' purine or pyrimidine
to another pyrimidine deletions. Base substitutions are mutations in
which there is a change in the DNA such that
c) Transversion mutation
5' TGT TCT CCA T 3'
Single purine one base pair is replaced by another (Figure:
changed to pyrimidine
3' ACA TGA GGT A 5'
or vice versa.
3.17). It can be divided into two subtypes:
d) Missense mutation
transitions and transversions. Addition or
5' TGT T T A CCA T 3' The new codon deletion mutations are actually additions or
3' ACA A A T GGT A 5' encodes a different deletions of nucleotide pairs and also called
amino acid due to
Thr Leu Gly
transtion mutation base pair addition or deletions. Collectively,
they are termed indel mutations (for
e) Non-Sense mutation
5' TGT T A A CCA T 3'
The new codon is a insertion-deletion).
3' ACA A T T GGT A 5' stop codon (UAA) due
UAA to transition mutation, Substitution mutations or indel mutations
it leads to premature affect translation. Based on these different types
Thr Stop
termination translation.
of mutations are given below.
f) Silent mutation
5' TGT T C G CCA T 3' The new codon The mutation that changes one codon for
3' ACA A G C GGT A 5' encodes the same an amino acid into another codon for that same
amino acid after
Thr Ser Gly transition mutation amino acid are called Synonymous or silent
mutations. The mutation where the codon
g) Frame shift mutation
for one amino acid is changed into a codon
i) Addition mutation
Addition or Deletion of for another amino acid is called Missense or
5' TGT C T C ACC AT 3'
one nucleotide, change
3' ACA G A G TGG TA 5'
the reading frame non-synonymous mutations. The mutations
Thr Glu Arg
results completely where codon for one amino acid is changed
different translation
ii) Deletion mutation into a termination or stop codon is called
5' TGT C A C CAT 3' Nonsense mutation. Mutations that result in
3' ACA G T G GTA 5'
the addition or deletion of a single base pair
Thr Val Val of DNA that changes the reading frame for
the translation process as a result of which
Figure: 3.19 Types of point mutation
there is complete loss of normal protein
3.6.1 Types of mutation structure and function are called Frameshift
Let us see the two general classes of gene mutations (Figure: 3.19).
mutation:
3.6.2 Mutagenic agents
• M
utations affecting single base or base The factors which cause genetic mutation
pair of DNA are called point mutation are called mutagenic agents or mutagens.
• M
utations altering the number of copies Mutagens are of two types, physical mutagen
of a small repeated nucleotide sequence and chemical mutagen. Muller (1927) was the
within a gene first to find out physical mutagen in Drosophila.

Physical mutagens: called chemical mutagens. Some chemical
Scientists are using temperature and mutagens are mustard gas, nitrous acid,
radiations such as X rays, gamma rays, alfa rays, ethyl and methyl methane sulphonate (EMS
beta rays, neutron, cosmic rays, radioactive and MMS), ethyl urethane, magnous salt,
isotopes, ultraviolet rays as physical mutagen to formaldehyde, eosin and enthrosine. Example:
produce mutation in various plants and animals. Nitrous oxide alters the nitrogen bases of DNA
and disturb the replication and transcription
Temperature: Increase in temperature that leads to the formation of incomplete and
increases the rate of mutation. While rise defective polypeptide during translation.
in temperature, breaks the hydrogen bonds
between two DNA nucleotides which affects the Comutagens
process of replication and transcription. The compounds which are not having own
Radiation: The electromagnetic spectrum mutagenic properties but can enhance the effects
contains shorter and longer wave length rays of known mutagens are called comutagens.
than the visible spectrum. These are classified Example: Ascorbic acid increase the damage
into ionizing and non-ionizing radiation. caused by hydrogen peroxide.
Ionizing radiation are short wave length and Caffeine increase the toxicity of methotrexate
carry enough higher energy to ionize electrons
from atom. X rays, gamma rays, alfa rays, Mustard gas (Dichloro ethyl sulphide) used
beta rays and cosmic rays which breaks the as chemical weapon in world war I.
chromosomes (chromosomal mutation) and H J Muller (1928) first time used X rays to
chromatids in irradiated cells. Non-ionizing induce mutations in fruit fly.
radiation, UV rays have longer wavelengths
and carry lower energy, so they have lower L J Stadler reported induced mutations in
penetrating power than the ionizing radiations. plants by using X rays and gamma rays.
It is used to treat unicellular microorganisms, Chemical mutagenesis was first reported by
spores, pollen grains which possess nuclei C. Auerback (1944).
located near surface membrane.
Sharbati Sonora 3.6.3 Chromosomal mutations
The genome can also be modified on a larger
Sharbati Sonora is a mutant variety of wheat,
scale by altering the chromosome structure or
which is developed from Mexican variety
by changing the number of chromosomes in
(Sonora 64) by irradiating of gamma rays. It
a cell. These large-scale variations are termed
is the work of Dr. M.S.Swaminathan who is
as chromosomal mutations or chromosomal
known as ‘Father of Indian green revolution’
aberrations. Gene mutations are changes that
and his team.
take place within a gene, whereas chromosomal
Castor Aruna mutations are changes to a chromosome region
Castor Aruna is mutant variety of castor which consisting of many genes. It can be detected
is developed by treatment of seeds with thermal by microscopic examination, genetic analysis,
neutrons in order to induce very early maturity or both. In contrast, gene mutations are never
(120 days instead of 270 days as original variety). detectable microscopically. Chromosomal
mutations are divided into two groups: changes
Chemical mutagens:
in chromosome number and changes in
Chemicals which induce mutation are chromosome structure.

I. Changes in chromosome number showing aneuploidy are known as aneuploids
Each cell of living organisms possesses fixed or heteroploids. They are of two types,
number of chromosomes. It varies in different Hyperploidy and Hypoploidy (Figure 3.21).
species. Even though some species of plants 1. Hyperploidy
and animals are having identical number
of chromosomes, they will not be similar in Addition of one or more chromosomes to
character. Hence the number of chromosomes diploid sets are called hyperploidy. Diploid
will not differentiate the character of species set of chromosomes represented as Disomy.
from one another but the nature of hereditary Hyperploidy can be divided into three types.
material (gene) in chromosome that determines They are as follows,
the character of species. (a) Trisomy
Sometimes the chromosome number of Addition of single chromosome to diploid set
somatic cells are changed due to addition or is called Simple trisomy(2n+1). Trisomics were
elimination of individual chromosome or basic first reported by Blackeslee (1910) in Datura
set of chromosomes. This condition in known stramonium (Jimson weed). But later it was
as numerical chromosomal aberration or reported in Nicotiana, Pisum and Oenothera.
ploidy. There are two types of ploidy. Sometimes addition of two individual
chromosome from different chromosomal
(i). Ploidy involving individual chromosomes pairs to normal diploid sets are called Double
within a diploid set (Aneuploidy) trisomy (2n+1+1).
(ii).
Ploidy involving entire sets of
(b) Tetrasomy
chromosomes (Euploidy) (Figure 3.20)
Addition of a pair or two individual pairs of
(i) Aneuploidy
chromosomes to diploid set is called tetrasomy
It is a condition in which diploid number (2n+2) and Double tetrasomy (2n+2+2)
is altered either by addition or deletion respectively. All possible tetrasomics are
of one or more chromosomes. Organisms available in Wheat.
Ploidy
Aneuploidy Euploidy
Hyperploidy Hypoploidy
Double Double Double Nullisomy Double

Trisomy Tetrasomy Pentasomy Monosomy
Trisomy Tetrasomy Monosomy (2n-2) Nullisomy
(2n+1) (2n+2) (2n+3) (2n-1)
(2n+1+1) (2n+2+2) (2n-1-1) (2n-2-2)
Haploidy (n) Diploidy (2n) Polyploidy

(2n+n+n...)
Monoploidy (x) Autopolyploidy Allopolyploidy
Autotriploid Autotetraploid
Figure 3.20 Types of Ploidy

(c) Pentasomy called diploid (2n). Half the number of somatic
Addition of three individual chromosome from chromosomes is referred as gametic chromosome
different chromosomal pairs to normal diploid number called haploid(n). It should be noted
set are called pentasomy (2n+3). that haploidy (n) is different from a monoploidy
(x). For example, the common wheat plant
2. Hypoploidy is a polyploidy (hexaploidy) 2n=6x=72
Loss of one or more chromosome from the chromosomes. Its haploid number (n) is 36, but
diploid set in the cell is called hypoploidy. It its monoploidy (x) is 12. Therefore, the haploid
can be divided into two types. They are and diploid condition came regularly one after
another and the same number of chromosomes
(a) Monosomy
is maintained from generation to generation, but
Loss of a single chromosome from the diploid monoploidy condition occurs when an organism
set are called monosomy(2n-1). However is under polyploidy condition. In a true diploid
loss of two individual or three individual both the monoploid and haploid chromosome
chromosomes are called double monosomy number are same. Thus a monoploid can be a
(2n-1-1) and triple monosomy (2n-1-1-1) haploid but all haploids cannot be a monoploid.
respectively. Double monosomics are observed
Polyploidy
in maize.
Polyploidy is the condition where an
(b) Nullisomy
organism possesses more than two basic sets of
Loss of a pair of homologous chromosomes or chromosomes. When there are three, four, five
two pairs of homologous chromosomes from or six basic sets of chromosomes, they are called
the diploid set are called Nullisomy (2n-2) and triploidy (3x) tetraploidy (4x), pentaploidy (5x)
double Nullisomy (2n-2-2) respectively. Selfing and hexaploidy (6x) respectively. Generally,
of monosomic plants produce nullisomics. They polyploidy is very common in plants but rarer
are usually lethal. in animals. An increase in the number of
chromosome sets has been an important factor in
the origin of new plant species. But higher ploidy
level leads to death. Polyploidy is of two types.
Disomy Monosomy Double Nullisomy They are autopolyploidy and allopolyploidy
(normal) (2n – 1) Monosomy (2n – 2)
(2n) (2n – 1– 1) 1. Autopolyploidy
The organism which possesses more than two
haploid sets of chromosomes derived from
within the same species is called autopolyploid.
Trisomy
(2n + 1)
Double
Trisomy
Tetrasomy
(2n + 2)
Pentasomy
(2n + 3)
They are divided into two types. Autotriploids
(2n + 1 + 1) and autotetraploids.
Figure 3.21 Types of aneuploidy Autotriploids have three set of its own
genomes. They can be produced artificially by
(ii) Euploidy
crossing between autotetraploid and diploid
Euploidy is a condition where the organisms species. They are highly sterile due to defective
possess one or more basic sets of chromosomes. gamete formation. Example: The cultivated
Euploidy is classified as monoploidy, diploidy and banana are usually triploids and are seedless
polyploidy. The condition where an organism or having larger fruits than diploids. Triploid sugar
somatic cell has two sets of chromosomes are beets have higher sugar content than diploids

and are resistant to moulds. Common doob grass (iii).
Octoploidy: Crosses between hexaploid
(Cyanodon dactylon) is a natural autotriploid. wheat T. aestivum (bread wheat) and rye
Seedless watermelon, apple, sugar beet, tomato, Hexaploidy Triticale hybrid plants demonstrate
banana are man made autotriploids. characteristics of both macaroni wheat and rye.
Autotetraploids have four copies of its own For example, they combine the high-protein
genome. They may be induced by doubling the content of wheat with rye’s high content of the
chromosomes of a diploid species. Example: rye, amino acid lysine, which is low in wheat. It can
grapes, alfalfa, groundnut, potato and coffee. be explained by chart below (Figure: 3.23).
(P) Triticum durum X Secale cereale
2. Allopolyploidy Generation
An organism which possesses two or more

basic sets of chromosomes derived from two
different species is called allopolyploidy. It can 2n = 4x = 28 2n = 2x = 14
be developed by interspecific crosses and fertility Tetraploidy Diploidy
is restored by chromosome doubling with

colchicine treatment. Allopolyploids are formed Gametes n = 2x = 14 n=x=7
between closely related species only. (Figure 3.22)

n=9 F1 hybrid 2n = 3x = 21
(sterile)
(Triploidy)
Gametes Chromosome
doubling by Colchicine
n=9
2n = 6x = 42
Parents Sterile F1 Fertile

Raphanus Brassica hybrid amphidiploid
X n + n = 9+9
2n=18 2n=18 Raphanobrassica Triticale (Hexaploidy)
(2n) = (18) 2n = 4x = 36
Figure 3.23 Triticale
Figure 3. 22 Rhaphanobrassica Colchicine , an alkaloid
Example:1 Raphanobrassica, G.D. is extracted from root
Karpechenko (1927) a Russian geneticist, and corms of Colchicum
crossed the radish (Raphanus sativus, 2n=18) autumnale, when applied
and cabbage (Brassica oleracea, 2n=18) to in low concentration to the
produce F1 hybrid which was sterile. When he growing tips of the plants
doubled the chromosome of F1 hybrid he got it will induce polyploidy. Surprisingly it does
it fertile. He expected this plant to exhibit the not affect the source plant Colchicum, due to
root of radish and the leaves like cabbage, which presence of anticolchicine.
would make the entire plant edible, but the case
was vice versa, so he was greatly disappointed. Activity: Solve this
Example: 2 Triticale, the successful first man When two plants (A and B) belonging to the
made cereal. Depending on the ploidy level same genus but different species are crossed,
Triticale can be divided into three main groups. the F1 hybrid is viable and has more ornate
flowers. Unfortunately, this hybrid is sterile
(i).
Tetraploidy: Crosses between diploid and can only be propagated by vegetative
wheat and rye. cuttings. Explain the sterility of the hybrid
(ii). Hexaploidy: Crosses between tetraploid wheat and what would have to occur for the sterility
Triticum durum (macaroni wheat) and rye of this hybrid to be reversed.

Significance of Ploidy B. Changes in the arrangement of gene loci
• Many polyploids are more vigorous and 3. Inversion
more adaptable than diploids. 4. Translocation
• Many ornamental plants are autotetraploids 1. Deletion or Deficiency
and have larger flower and longer flowering
Loss of a portion of chromosome is called
duration than diploids.
deletion. On the basis of location of breakage
• Autopolyploids usually have increase in fresh
on chromosome, it is divided into terminal
weight due to more water content.
deletion and intercalary deletion. It occurs
• Aneuploids are useful to determine the
due to chemicals, drugs and radiations. It is
phenotypic effects of loss or gain of different
observed in Drosophila and Maize. (Figure 3.24)
chromosomes.
• Many angiosperms are allopolyploids and There are two types of deletion:
they play a role in an evolution of plants. i. Terminal deletion: Single break in any one
end of the chromosome.
II Structural changes in chromosome
ii. Intercalary deletion or interstitial deletion:
(Structural chromosomal aberration)
It is caused by two breaks and reunion of
Structural variations caused by addition or
terminal parts leaving the middle.
deletion of a part of chromosome leading to
Both deletions are observable during meiotic
rearrangement of genes is called structural
pachytene stage and polytene chromosome.
chromosomal aberration. It occurs due to
The unpaired loop formed in the normal
ionizing radiation or chemical compounds. On
chromosomal part at the time of chromosomal
the basis of breaks and reunion in chromosomes,
pairing. Such loops are called as deficiency loops
there are four types of aberrations. They are
and it can be seen in meiotic prophase. Larger
classified under two groups.
deletions may lead to lethal effect.
A. Changes in the number of the gene loci
2. Duplication or Repeat
1. Deletion or Deficiency
The process of arrangement of the same order
2. Duplication or Repeat
of genes repeated more than once in the same
A Duplications
B A A A A A
B
B B B B
C Deletion of Deletion of B
segment C segment C C C C
D A D C D B C D
D
E C B E
E E
F D D F
E G
F F G
E E
H
G F G B
I F F
H G H G G C
I H I H H H
I I I I
Terminal Normal Intercalary Normal Tandem Reverse Displaced

deletion Chromosome deletion chromosome tandem tandem
Figure 3.24 Deletion Figure 3.25 Duplication

chromosome is known as duplication. Due to ii. Pericentric inversion: An inversion that
duplication some genes are present in more than includes the centromere.
two copies. It was first reported in Drosophila Inversions lead to evolution of a new species.
by Bridges (1919) and other examples are Maize
and Pea. It is three types. 4. Translocation
i. Tandem duplication The transfer of a segment of chromosome

The duplicated segment is located immediately to a non-homologous chromosome is called
after the normal segment of the chromosome in translocation. Translocation should not
the same order. be confused with crossing over, in which
an exchange of genetic material between
ii. Reverse tandem duplication homologous chromosome takes place.
The duplicated segment is located immediately Translocation occurs as a result of interchange
after the normal segment but the gene sequence of chromosome segments in non-homologous
order will be reversed. chromosomes. There are three types
iii. Displaced duplication i. Simple translocation
The duplicated segment is located in the same ii. Shift translocation
chromosome, but away from the normal iii. Reciprocal translocation
segment. (Figure 3.25)
i. Simple translocation
Duplications play a major role in evolution. A single break is made in only one chromosome.
3. Inversion The broken segment gets attached to one end of
A rearrangement of order of genes in a a non-homologous chromosome. It occurs very
chromosome by reversed by an angle 1800. This rarly in nature.
involve two chromosomal breaks and reunion. ii. Shift translocation
During this process there is neither gain nor loss Broken segment of one chromosome gets
but the gene sequences is rearranged. Inversion inserted interstitially in a non-homologous
was first reported in Drosophila by Sturtevant chromosome.
(1926). There are two types of inversion,
paracentric and pericentric (Figure 3.26). iii. Reciprocal translocations
i. Paracentric inversion: An inversion which It involves mutual exchange of chromosomal

takes place apart from the centromere segments between two non-homologous
7UDQVORFDWLRQ
A $ $ / /
A A A
% % 0 0
D B B
B D & & 1 1
C C C ' ' 2 2
C C $ $ / / $ $ / /
F ( ( 3 3
B D F % % 0 0 % % 0 0
D B ) ) 4 4
E & & 1 1 & & 1 1
E E E ' ' 2 2
* * 5 5
E + + 6 6
' ' 2 2
D ( ( 3 3 ( ( 3 3
F F D
F , , 7 7
) ) 4 4 ) ) 4 4
G G G
G * 5 5 * 5 5 * *
H H H + 6 6 + 6 6 + +
H
I I I , 7 7 , 7 7 , ,
I
+HWHUR]\JRXV +RPR]\JRXV
a) Paracentric inversion b) Pericentric inversion
(does not include centromere) (includes centromere) 7UDQVORFDWLRQ 7UDQVORFDWLRQ
Figure 3.26 Inversion Figure: 3.27 Translocation

chromosomes. It is also called illegitimate They are m, M1 and M2 of a single gene.
crossing over. It is further divided into two Mutational events that take place within
types (Figure 3.27). individual genes are called gene mutations or
Homozygous translocation: Both the
a. point mutation, whereas the changes occur
chromosomes of two pairs are involved in in structure and number of chromosomes is
translocation. Two homologous of each called chromosomal mutation. The agents
translocated chromosomes are identical. which are responsible for mutation is called
Heterozygous translocation: Only one
b. mutagens.
of the chromosome from each pair of two
Evaluation
homologous are involved in translocation,
1. An allohexaploidy
while the remaining chromosome is normal.
contains
Translocations play a major role in the
formation of species. a) Six different genomes
b) Six copies of three
Summary different genomes
Chromosomal theory of inheritance states c) Two copies of three different genomes
that Mendelian factors have specific locus d) Six copies of one genome
on chromosomes and they carry information 2. The A and B genes are 10 cM apart on a
from one generation to the next generation. chromosome. If an AB/ab heterozygote
Genes located close together on the same is testcrossed to ab/ab, how many of each
chromosome and inherited together are progeny class would you expect out of 100
called linked genes the phenomenon is called total progeny?
Linkage. Two types of linkage are complete
a) 25 AB, 25 ab, 25 Ab, 25 aB
linkage and incomplete linkage. The groups
b) 10 AB, 10 ab
of linearly arranged linked genes are called
c) 45 AB, 45 ab
Linkage groups. Crossing over is biological
d) 45 AB, 45 ab, 5 Ab, 5aB
a process that produces new combination of
genes by inter-changing the corresponding 3. Match list I with list II
segments between non-sister chromatids of List I List II
homologous pair of chromosomes. In this A. A pair of i) monosomy
segment of DNA are broken and recombined chromosomes extra
to produce new combinations of alleles with diploid
a process is called Recombination. The B. One chromosome ii) tetrasomy
diagrammatic representation of distances extra to the diploid
C. One chromosome iii) trisomy
between the adjacent genes which is
loses from diploid
directly proportional to the frequency of
D. Two individual iv) double
recombination between them is called genetic chromosomes lose monosomy
mapping. When any of the three or more from diploid
allelic forms of a gene occupy the same locus
in a given pair of homologous chromosomes, a) A-i, B-iii, C-ii, D-iv b) A-ii, B-iii, C-iv, D-i
they are said to be multiple alleles. Papaya sex c) A-ii, B-iii, C-i, D-iv d) A-iii, B-ii, C-i, D-iv
determination is controlled by three alleles.

4.
Which of the following sentences are correct? c) frameshift mutation d) deletion mutation
1. Th
e offspring exhibit only parental 11. Assertion (A): Gamma rays are generally
combinations due to incomplete linkage use to induce mutation in wheat varieties.
2. Th
e linked genes exhibit some crossing Reason (R): Because they carry lower
over in complete linkage energy to non-ionize electrons from atom
3. Th
e separation of two linked genes are a) A is correct. R is correct explanation of A
possible in incomplete linkage b) A is correct. R is not correct explanation of A
4. Crossing over is absent in complete linkage c) A is correct. R is wrong explanation of A
a) 1 and 2 b) 2 and 3 d) A and R is wrong
c) 3 and 4 d) 1 and 4
12. How many map units separate two alleles A
5. Accurate mapping of genes can be done by and B if the recombination frequency is 0.09?
three point test cross because increases a) 900 cM b) 90 cM c) 9 cM d) 0.9 cM
a) Possibility of single cross over 13. When two different genes came from same
b) Possibility of double cross over parent they tend to remain together.
c) Possibility of multiple cross over i) What is the name of this phenomenon?
d) Possibility of recombination frequency ii) Draw the cross with suitable example.
6. Due to incomplete linkage in maize, the iii) Write the observed phenotypic ratio.
ratio of parental and recombinants are 14. If you cross dominant genotype PV/PV
a) 50:50 b) 7:1:1:7 c) 96.4: 3.6 d) 1:7:7:1 male Drosophila with double recessive
female and obtain F1 hybrid. Now you cross
7. Genes G S L H are located on same
F1 male with double recessive female.
chromosome. The recombination
percentage is between L and G is 15%, S i) What type of linkage is seen?
and L is 50%, H and S are 20%. The correct ii) Draw the cross with correct genotype.
order of genes is iii) W
hat is the possible genotype in F2
generation?
a) GHSL b) SHGL c) SGHL d) HSLG
15.
8. The point mutation sequence for transition,
transition, transversion and transversion in S. no Gamete types Number of progenies
DNA are 1. ABC 349
a) A to T, T to A, C to G and G to C 2. Abc 114
3. abC 124
b) A to G, C to T, C to G and T to A
4. AbC 5
c) C to G, A to G, T to A and G to A 5. aBc 4
d) G to C, A to T, T to A and C to G 6. aBC 116
7. ABc 128
9.
If haploid number in a cell is 18. The double
8. abc 360
monosomic and trisomic number will be
i) What is the name of this test cross?
a) 35 and 37 b) 34 and 35
c) 37 and 35 d) 17 and 19 ii) How will you construct gene mapping
from the above given data?
10. Changing the codon AGC to AGA represents
iii) Find out the correct order of genes.
a) missense mutation b) nonsense mutation

16. What is the difference between missense Heteroduplex: A double stranded molecule
and nonsense mutation? of nucleic acid originated through genetic
recombination from different sources
17. A B C D E F G H I
C B
From the above figure identify the type of Self incompatibility: A genetic mechanism
mutation and explain it. which prevent self fertilization thus encourage
outcross.
18. Write the salient features of Sutton and
Boveri concept. Synapsis: The pairing of two homologous
19. Explain the mechanism of crossing over. chromosomes that occurs during meiosis.
20. Write the steps involved in molecular

Tassel seed: Feminization of the tassel
mechanism of DNA recombination with
diagram. Trans configuration: An arrangement in which
21. How is Nicotiana exhibit self- the dominant allele of one pair of genes and the
incompatibility. Explain its mechanism. recessive allele of another pair are on the same
chromosome
22. How sex is determined in monoecious
plants. write their genes involved in it. Transesterification: A reaction that breaks and
makes chemical bonds in a coordinated transfer,
23. What is gene mapping? Write its uses.
so that no energy is required.
24. Draw the diagram of different types of
aneuploidy. Vestigial: Rudimentary organ of body become
functionless in the course of evolution
25. Mention the name of man-made cereal.
How it is formed?
Glossary
Branch Migration: The process in which base
pairs on homologous strands are consequently
exchanged at a Holliday junction, moving the
branch up or down the DNA sequence.
Cis configuration: The presence of dominant

alleles of two or more pairs on one chromosome
and the recessive alleles on the homologous
chromosome.
Feminizing Masculinizing: To induce

female characteristics in male To induce male
characteristics in female

Chapter
4 Principles and Processes of

Biotechnology
Biotechnology is the
Learning Objectives science of applied
biological process. In
The learner will be able to other words it is science
Apply the knowledge of traditional of development and
and modern biotechnology in day to utilization of biological
day life. processes, forms and
Appreciate the uses of fermentation systems for the benefit of Karl Ereky
process. mankind and other life
Acquire the knowledge on the process forms. The term biotechnology was coined
of genetic engineering by Karl Ereky, a Hungarian Engineer in 1919.
Biotechnology has been extended to include
Analyse the uses
any process in which organisms, tissues,
and limitations of
cells, organelles or isolated molecules such as
genetically modified
enzymes are used to convert biological or other
plants
raw materials to products of greater value.
Cognize the terms
of bio prospecting 4.1 Development of Biotechnology
and bio piracy. Biotechnology has developed by leaps
and bounds during the past century. The
Chapter outline development of the biotechnology can be well
understood under two main heads namely
conventional or traditional biotechnology
4.1 Development of Biotechnology
and modern biotechnology
4.2 Historical Perspective
1. Conventional or traditional
4.3 Traditional Biotechnology biotechnology: This is the kitchen technology
4.4 Advancements in Modern developed by our ancestors, it is as old as
Biotechnology human civilization. This technology uses
4.5 Tools for Genetic Engineering bacteria and other microbes in the daily usage
4.6 Methods of Gene transfer for preparation of dairy products like curd,
ghee, cheese and in preparation of foods
4.7 Screening for Recombiants
like idli, dosa, nan, bread and pizza. This
4.8 Transgenic Plants / Genetically conventional biotechnology also extends to
Modified Crops preparation of alcoholic beverages like beer,
4.9 Applications of Biotechnology. wine, etc.
78 Principles and Processes of Biotechnology

With the advancement of the science and • Biomass for bulk production of single cell
technology during the 18th century, these kitchen protein , alcohol, and biofuel
technologies gained scientific validation. • Enzymes as biosensors, in processing
2. Modern biotechnology industry
There are two main features of this technology, • Biofuels for production of hydrogen,
that differentiated it from the conventional alcohol, methane
technology are its i) ability to change the • Microbial inoculants as biofertiliser, and
genetic material for getting new products with nitrogen fixers
specific requirement through recombinant
• Plant and animal cell culture for production
DNA technology ii) ownership of the newly
of secondary metabolites, monoclonal
developed technology and its social impact.
antibodies
Today, biotechnology is a billion dollar
• Recombinant DNA technology for
business around the world, pharmaceutical
production of fine chemicals, enzymes,
companies, breweries, agro industries and
vaccines, growth hormones, antibiotics, and
other biotechnology based industries apply
interferon
biotechnological tools for their product
improvement. • Process engineering – tools of
biotechnology is used for effluent treatment,
Modern biotechnology embraces all methods
water recycling.
of genetic modification by recombinant DNA
and cell fusion technology. The major focus of This unit will reveal the various aspects of
biotechnology are modern biotechnology, its products and
• Fermentation for production of acids, applications.
enzymes, alcohols, antibiotics, fine
chemicals, vitamins and toxins
Interdisciplinarity Fields of Biotechnology

Biotechnology is one of the most important applied interdisciplinary sciences of the 21st century. It is the
trusted area that enables us to find the beneficial way of life. Biotechnology has wide applications in various
sectors like agriculture, medicine, environment and commercial industries.
*HQHWLFV 0ROHFXODU ,PPXQRORJ\ 0LFURELRORJ\ &HOO%LRORJ\ %LRFKHPLVWU\ %LRLQIRUPDWLFV %LRSK\VLFV
%LRORJ\
6FLHQFHRI 6WXG\RI 6WXG\RI 6WXG\RI 6WXG\RI 0DQDJHPHQW $SSOLFDWLRQ
KHUHGLW\DQG 6WXG\RI ERG\¶VGHIHQFH PLFURRUJDQLVPV FHOOVDQGWKHLU FKHPLFDO RIELRORJLFDO RISK\VLFDO
9DULDWLRQVLQ ELRORJ\DW PHFKDQLVPV DQGWKHLU LQWHUDFWLRQ 3URFHVVHV LQIRUPDWLRQ SULQFLSOHV
RUJDQLVPV PROHFXODU HIIHFWRQ ZLWK LQOLYLQJ ZLWKWKHKHOS DQGPHWKRGV
OHYHO KXPDQV HQYLURQPHQW V\VWHPV RIFRPSXWHU WRELRORJLFDO
WHFKQRORJ\ SUREOHPV
$FXOWLYDWHGSODQWJURZQ
&URS
02'(51%,27(&+12/2*< FRPPHUFLDOO\LQDODUJHVFDOH
'LDJQRVWLF &KDUDFWHULVWLFRULQGLFDWLYHRIDGLVHDVH
1DQRELRWHFKQRORJ\ %LRPHGLFDO 7LVVXH &KHPLFDO(QJLQHHULQJ 'UXJRUPHGLFLQHXVHG

(QJLQHHULQJ (QJLQHHULQJ 3KDUPDFHXWLFDOV
1DQRWHFKQRORJ\ &RQYHUVLRQRIUDZ LQPHGLFDOWUHDWPHQW
$SSOLFDWLRQRI 6WXG\RI
ZLWKELRORJLFDO PDWHULDOVLQWR $Q\DQWLJHQDQWLERG\WKDWFRQIHUV
HQJLQHHULQJ ELRPDWHULDOVDQG YDOXDEOHIRUPVZLWK
DQG%LRFKHPLFDO 9DFFLQH
SULQFLSOHVDQG VWHPFHOOVWRUHSDLU WKHDSSOLFDWLRQRI LPPXQLW\WRDSDUWLFXODUGLVHDVH
DSSOLFDWLRQV WHFKQLTXHVWRWKH RUUHSODFHERG\ SK\VLFDODQG 'RPHVWLFDWHGDQLPDOVNHSWWR
PHGLFDOILHOG WLVVXHRUJDQ OLIHVFLHQFH /LYHVWRFN
SURGXFHFRPPRGLWLHVRUIDYRXULWHV
Figure 4.1: Interdisciplinarity Fields of Biotechnology
Principles and Processes of Biotechnology 79

4.2 Historical Perspective
The major historical events for the development of Biotechnology, as an interdisciplinary
field with multidisciplinary applications are listed below:
Before Common Era 1978 – Production of human insulin in E.Coli
6000 BC – 3000 BC – Bread making,
1979 – Development of Artificial gene –
fermentation of fruit juices and plant exudates functioning within the living cells by
to produce alcoholic beverages using yeast. H.G. Khorana
1982 – U.S approved humulin ( human insulin)
Pre – 20th Century
the first pharmaceutical product of
1770 – Antoine Lavoisier gave chemical basis rDNA technology, for human use.
of alcoholic fermentation.
1983 – Use of Ti plasmids to genetically
1798 – Edward Jenner uses first viral vaccine transform plants
to inoculate a child from smallpox.
1986 – Development of Polymerase Chain
1838 – Protein discovered, named and Reaction (PCR) technology by Kary
recorded by Gerardus Johannes Mullis.
Mulder and Jons Jacob Berzelius.
1987 – Gene transfer by biolistic
1871 – Ernst Hoppe, Seyler discovered transformation
enzyme invertase, which is still used
1992 – First chromosomes of yeast is
for making artificial sweeteners.
sequenced
1876 – Louis Pasteur identified role of
1994 – U.S approved the first Genetically
microorganisms in fermentation.
Modified food: Flavr Savr tomato.
1997 – The first transgenic animal,
20th Century mammalian sheep, Dolly developed
1919 – The term biotechnology was coined by nuclear cloning by Ian Wilmet.
by Karl Ereky 2000 – First plant Genome of Arabidopsis
1928 – Discovery of Penicillin by Alexander thaliana sequenced
Fleming
1941 – Experiment with Neurospora crassa 21st Century
resulting in one gene one enzyme
hypothesis by George Beadle and 2001 – Human genome Project creates a draft
Edward Tatum. of the human genome sequence.
1944 – Identification of DNA as the genetic 2002 – First crop plant genome sequenced
material Avery–MacLeod–McCarty in Oryza sativa
1953 – Discovery of double helix structure of 2003 – Human genome project is
DNA by James Watson and Francis Crick. completed, providing information on
the locations and sequence of human
1972 – Discovery of Restriction enzymes by genes on all 46 chromosomes.
Arber, Smith and Nathans.
2010 – Sir Robert G. Edwards developed in
1973 – Fragmentation of DNA-combined with vitro fertilization in animal.
Plasmid DNA, r-DNA technology -
Genetic engineering -Modified gene 2016 – Stem cells injected into stroke patients re-
by Stanley Cohen, Annie Chang, enable patient to walk – Stem cell therapy
Robert Helling and Herbert Boyer. 2017 – Blood stem cells grown in lab.
1975 – Production of Monoclonal antibodies 2018 – James Allison and TasukuHonjo
by Kohler and Milstein discovered protein found in immune
1976 – Sanger and Gilbert developed cells. This found a new role in cancer
techniques to sequence DNA therapy.

4.3. Traditional Biotechnology ii. Downstream process
As described earlier, it is the kitchen All the process after the fermentation process
technology developed by our ancestors that is known as the downstream process. This
was using the fermenting bacteria. Thus it process includes distillation, centrifuging,
includes the process that is based on the filtration and solvent extraction. Mostly
natural capabilities of organisms. this process involves the purification of the
desired product.
4.3.1 Fermentation
Motor
The word fermentation is derived from the Latin Pressure
guage
verb ‘fervere’ which means ‘ to boil’. Fermentation nutrient or
inoculant
refers to the metabolic process in which organic
Sterile nutrient
molecules (normally glucose) are converted medium
into acids, gases, or alcohol in the absence of Impeller
pH probe
Oxygen
oxygen or any electron transport chain. The concentration probe Temperature
probe
study of fermentation, its practical uses is called Cooling
jacket
zymology and originated in 1856, when French
Sparger
chemist Louis Pasteur demonstrated that
fermentation was caused by yeast. Fermentation Steam
occurs in certain types of bacteria and fungi
that require an oxygen-free environment to
live. The processes of fermentation are valuable Figure 4.2: Bioreactor
to the food and beverage industries, with the Procedure of Fermentation
conversion of sugar into ethanol to produce a.
Depending upon the type of product,
alcoholic beverages, the release of CO2 by yeast bioreactor is selected.
used in the leavening of bread, and with the
b.
A suitable substrate in liquid media is
production of organic acids to preserve and
added at a specific temperature, pH and
flavor vegetables and dairy products.
then diluted.
Bioreactor ( Fermentor) c.
T he organism (microbe, animal/plant
Bioreactor (Fermentor) is a vessel or a cell, sub-cellular organelle or enzyme) is
container that is designed in such a way that added to it.
it can provide an optimum environment in d.
Then it is incubated at a specific
which microorganisms or their enzymes temperature for the specified time.
interact with a substrate to produce the
e. The incubation may either be aerobic or
required product. In the bioreactor aeration,
anaerobic.
agitation, temperature and pH are controlled.
Fermentation involves two process namely f. Withdrawal of product using downstream
upstream and downstream process. processing methods
i. Upstream process Application of fermentation in industries

All the process before starting of the fermenter Fermentation has industrial application such as:
such as sterilization of the fermenter, 1. Microbial biomass production
preparation and sterilization of culture Microbial cells (biomass) like algae,
medium and growth of the suitable inoculum bacteria, yeast, fungi are grown, dried and
are called upstream process. used as source of a complete protein called

‘single cell protein (SCP)’ which serves as high nutritive value due to their higher
human food or animal feed. protein, vitamin, essential amino acids and
2. Microbial metabolites lipid content, there are doubts on whether it
could replace conventional protein sources
Microbes produce compounds that are very
due to their high nucleic acid content and
useful to man and animals. These compounds
slower in digestibility. Microorganisms used
are called metabolites, can be grouped into
for the production of Single Cell Protein are
two categories:
as follows:
a. Primary metabolites: Metabolites
• Bacteria - Methylophilus methylotrophus,
produced for the maintenance of life
Cellulomonas, Alcaligenes
process of microbes are known as primary
metabolites Eg. Ethanol, citric, acid, lactic • Fungi - Agaricus campestris, Saccharomyces
acid, acetic acid. cerevisiae (yeast), Candida utilis
b. Secondary metabolites: Secondary • Algae - Spirulina, Chlorella, Chlamydomonas

metabolites are those which are not The single cell proteins forms an important
required for the vital life process of source of food because of their protein content,
microbes, but have value added nature, this carbohydrates, fats, vitamins and minerals. It is
includes antibiotics e.g -Amphotericin-B used by Astronauts and Antarctica expedition
(Streptomyces nodosus), Penicillin scientists.
(Penicillium chryosogenum) Streptomycin Spirulina can be grown easily on materials
(S. grises) , Tetracycline (S. aureofacins), like waste water from potato processing plants
alkaloids, toxic pigments, vitamins etc. (containing starch), straw, molasses, animal
3. Microbial enzymes manure and even sewage, to produce large
quantities and can serve as food rich in protein,
When microbes are cultured, they secrete
minerals, fats, carbohydrate and vitamins.
some enzymes into the growth media. These
Such utilization also reduces environmental
enzymes are industrially used in detergents,
pollution. 250 g
food processing, brewing and pharmaceuticals.
of Methylophilus
Eg. protease, amylase, isomerase, and lipase.
methylotrophus,
4. Bioconversion, biotransformation or as its high rate
modification of the substrate of biomass
The fermenting microbes has the capacity to production and
produce valuable products, eg. conversion of growth, can Figure 4.3: Spirulina
ethanol to acetic acid (vinegar), isopropanol to be expected to products
acetone, sorbitol to sorbose (this is used in the produce 25 tonnes
manufacture of vitamin C), sterols to steroids. of protein.
4.3.2 Single Cell Protein (SCP) Applications of Single-Cell Protein
Single cell proteins are dried cells of • It is used as protein supplement
microorganism that are used as protein • It is used in cosmetics products for healthy
supplement in human foods or animal hair and skin
feeds. Single Cell Protein (SCP) offers • It is used in poultry as the excellent source
an unconventional but plausible solution of proteins and other nutrients, it is widely
to protein deficiency faced by the entire used for feeding cattle, birds, fishes etc.
humanity. Although single cell protein has

•
It is used in food industry as aroma like electroporation, gene gun, liposome
carriers, vitamin carrier, emulsifying agents mediated, chemical mediated transfers and
to improve the nutritive value of baked microinjection.
products, in soups, in ready-to-serve-meals, 4.4.2 Steps involved in Recombinant
in diet recipes DNA Technology
• It is used in industries like paper processing,
The steps involved in recombinant DNA
leather processing as foam stabilizers.
technology are:
4.4 Advancements in Modern • Isolation of a DNA fragment containing
Biotechnology a gene of interest that needs to be cloned.
The modern biotechnology embraces all This is called an insert.
the genetic manipulations, protoplasmic • Generation of recombinant DNA (rDNA)
fusion techniques and the improvements molecule by insertion of the DNA fragment
made in the old biotechnological processes. into a carrier molecule called a vector that
Some of the major advancements in modern can self-replicate within the host cell.
biotechnology are described below. • Selection of the transformed host cells that
4.4.1 Genetic Engineering is carrying the rDNA and allowing them
Genetic engineering or recombinant DNA to multiply thereby multiplying the rDNA
technology or gene cloning is a collective term molecule.
that includes different experimental protocols
resulting in the modification Bacterium
1 Isolation of plasmid DNA Cell containing gene
and transfer of DNA from one and DNA containing gene of interest
organism to another. of interest
2 Gene inserted
The definition for Bacterial Plasmid into plasmid
conventional recombination chromosome
Recombinant Gene of
was already given in DNA (plasmid) interest
Unit II. Conventional
DNA of chromosome
recombination involves 3 Plasmid put into
exchange or recombination bacterial cell
of genes between homologous

chromosomes during Recombinant
bacterium
meiosis. Recombination
carried out artificially using
4 Cells cloned with gene of interest
modern technology is called
5 Identification of desired clone
recombinant DNA technology
(r-DNA technology). It is also Copies of
gene
known as gene manipulation
technique. This technique
involves the transfer of
DNA coding for a specific 6 Various applications
gene from one organism Basic
into another organism Gene used to alter bacteria research
for cleaning up toxic waste on gene Gene for pest resistance
using specific agents like inserted into plants
vectors or using instruments
Figure 4.4: Steps involved in r-DNA Technology

• The entire process thus generates either a cleaves DNA into fragments at or near specific
large amount of rDNA or a large amount recognition sites within the molecule known
of protein expressed by the insert. as restriction sites. Based on their mode of
•
Wherever vectors are not involved action restriction enzymes are classified into
the desired gene is multiplied by PCR Exonucleases and Endonucleases.
technique. The multiple copies are injected a. Exonucleases are enzymes which remove
into the host cell protoplast or it is shot nucleotides one at a time from the end of a
into the host cell protoplast by shot gun DNA molecule. e.g. Bal 31, Exonuclease III.
method. b. Endonucleases are enzymes which break
the internal phosphodiester bonds within a
PCR: Polymerase Chain Reaction is a common
DNA molecule. e.g. Hind II, EcoRI, Pvul,
laboratory technique used to make copies
BamHI, TaqI.
(millions) of a particular region of DNA.
Restriction endonuclease: Molecular scissors
4.5 Tools for Genetic Engineering The restriction enzymes are called as molecular
scissors. These act as foundation of recombinant
Now we know from the foregoing discussion
DNA technology. These enzymes exist in
that in order to generate recombinant DNA
many bacteria where they function as a part
molecule, certain basic tools are necessary for
of their defence mechanism called restriction-
the process. The basic tools are enzymes, vectors
modification system.
and host organisms. The most important
enzymes required for genetic engineering There are three main classes of restriction
are the restriction enzymes, DNA ligase and endonuclease : Type I, Type II and Type III,
alkaline phosphatase. which differ slightly by their mode of action.
Only type II enzyme is preferred for use in
4.5.1 Restriction Enzymes recombinant DNA technology as they recognise
The two enzymes responsible for restricting and cut DNA within a specific sequence
the growth of bacteriophage in Escherichia typically consisting of 4-8 bp. Examples of
coli were isolated in the year 1963. One was the certain enzymes are given in table 5.1.
enzyme which added methyl groups to DNA, The restriction enzyme Hind II always cut
while the other cut DNA. The later was called DNA molecules at a point of recognising a
restriction endonuclease. A restriction enzyme specific sequence of six base pairs. This sequence
or restriction endonuclease is an enzyme that is known s recognition sequence. Today more
than 900 restriction enzymes that have
Restriction Recognition
enzyme
Microbial source sequence Fragments been isolated from over 230 strains
Arthrobacter 5’AG/CT3’ A-G C-T Blunt of bacteria with different recognition
Alu I 3’TC/GA5’
luteus T-C G-A ends sequences.
Bacillus 5’G/GATCC3’ G G-A-T-C-C Sticky
BamHI
amyloliquefaciens 3’CCTAG/G5’ C-C-T-A-G G ends Restriction endonucleases are named
5’G/AATTC3’ G A-A-T-T-C Sticky by a standard procedure. The first letter
EcoRI Escherichia coli
3’CCTAG/G5’ C-T-T-A-A G ends of the enzymes indicates the genus name,
HaeIII Haemophilus 5’GG/CC3’ G-G C-C Blunt followed by the first two letters of the
aegyptus 3’CC/GG5’ C-C G-G ends
species, then comes the strain of the
5’A/AGCTT3’ A A-G-C-T-T Sticky
HindIII Haemophilus
3’TTCGA/A5’ ends
organism and finally a roman numeral
influenza T-T-C-G-A A
indicating the order of discovery. For
Table 4.1: Type II restriction enzyme with source,
recognition and cleavage site. example, EcoRI is from Escherichia (E)

coli (co), strain RY 13 (R) and first endonuclease DNA Ligase Reaction
(I) to be discovered. O
DNA strand 3’ OH + –O P O 5’ DNA strand

It contains 2 different antibiotic resistance
–O
genes and recognition site for several restriction
DNA ligase
enzymes. This sequence is referred to as a 2Pi PPi ATP (or NAD+) AMP
restriction site and is generally –palindromic O
which means that the sequence in both DNA 3’ O O 5’ DNA strand
DNA strand P
strands at this site read same in 5’ – 3’ direction
–O
and in the 3’-5’ direction
New 3’ – 5’ Phosphodiester bond
Example: MALAYALAM: This phrase is
Figure 4.6: DNA ligase reaction
read the same in either of the directions.
an Adenosine Triphosphate (ATP) dependent
Palindromic repeats: A symmetrical reaction. This is isolated from T4 phage.
repeated sequence in DNA strands
5’ ... CATTATATAATG ... 3’ 4.5.3 Alkaline Phosphatase
3’ ... GTAATATATTAC ... 5’ It is a DNA modifying enzymes and adds
or removes specific phosphate group at 5’
Note: That the sequence of the base pairs in
terminus of double stranded DNA (dsDNA) or
the reverse direction when compare to the single stranded DNA (ssDNA) or RNA. Thus it
first sequence. prevents self ligation. This enzyme is purified
from bacteria and calf intestine.
The exact kind of cleavage produced by a P
restriction enzyme is important in the design Plasmid
OH DNA
ligase
Recircularization
of a gene cloning experiment. Some cleave both cut open
(linear DNA) P OH of plasmid
strands of DNA through the centre resulting (Self ligation)
in blunt or flush end. These are known as Alkaline phosphatase

2Pi
symmetric cuts. Some enzymes cut in a way
OH DNA
producing protruding and recessed ends known HO ligase
No reaction
as sticky or cohesive end. Such cut are called
X
HO OH
staggered or asymmetric cuts.
Ho P
5’ – GAATTC – 3’ Eco RI 5’ – G AATTC – 3’ P Ho
DNA ligase
3’ – CTTAAG – 5’ Digest 3’ – CTTAA G – 5’ Foreign DNA
5’ sticky-ends fragment
5’ – CCCGGG – 3’ SmaI 5’ – CCC GGG – 3’

3’ – GGGCCC – 5’ 3’ – GGG CCC – 5’
Digest
Blunt ends
Figure 4.5: Sticky and Blunt ends
Figure 4.7: Action of Alkaline Phosphatase
Two other enzymes that play an important
4.5.4 Vectors
role in recombinant DNA technology are
DNA ligase and alkaline phosphatase Another major component of a gene cloning
experiment is a vector such as a plasmid. A
4.5.2 DNA Ligase Vector is a small DNA molecule capable of
DNA ligase enzyme joins the sugar and self-replication and is used as a carrier and
phosphate molecules of double stranded transporter of DNA fragment which is inserted
DNA (dsDNA) with 5’-PO4 and a 3’-OH in

• Vector must contain an origin of replication
Formation of recombinant DNA so that it can independetly replicate within
Plasmid EcoRl
the host.
Foreign DNA
GA
CT A
T
• It should contain a suitable marker such as
TT G
GAATTC GAATTC
AA antibiotic resistance, to permit its detection
C
CTTAAG CTTAAG
EcoRl in transformed host cell.

The plasmid and • Vector should have unique target sites for
the foreign DNA
are cut by the same integration with DNA insert and should
restriction enzyme-in
this case, EcoRl have the ability to integrate with DNA
G
CTT
AA
insert it carries into the genome of the host
AATTC
G
G
CTTAA cell. Most of the commonly used cloning
Complementary
stricky ends vectors have more than one restriction site.
When mixed, the These are Multiple Cloning Site (MCS) or
sticky ends anneal,
AA
TT G
C
joining the foreign polylinker. Presence of MCS facilitates the
DNA and plasmid.
use of restriction enzyme of choice.
GAA
T
The following are the features that are required
CTT T
AA
to facilitate cloning into a vector.
C
G
Origin of replication (ori): This is a

1.
sequence from where replication starts
CT AT
GA
TA
AG
TC
and piece of DNA when linked to this
DNA ligase sequence can be made to replicate within
GAA
CTT T
T the host cells.
AA Nicks in the
C
sugar-phosphate
G
bonds are sealed Unique restriction enzyme cleavage sites

by DNA ligase. BamHl
Pstl Sall
CT AT
1. A cloning EcoRl
GA
TA
AG
vector must contain
TC
an orgin of replication ori (orgin of Hindlll

recongnized in the replication)
host cell so that it is Selectable 3. A cloning
The foreign DNA fragement can be inserted into replicated along with marker vector needs
a plasmid with the use of restriction enzymes the DNA that it carries.
a single
cleavage
into it for cloning experiments. Vector is 2. It should carry selectable site for each
markers-traits that enable cells of one or more
also called cloning vehicle or cloning DNA. containing the vector to be restriction
selected or identified enzyme used.
Vectors are of two types: i) Cloning Vector, and
ii) Expression Vector. Cloning vector is used for the
Figure 4.8: Properties of Vector
cloning of DNA insert inside the suitable host cell.
Expression vector is used to express the DNA insert Selectable marker: In addition to ori the
2.
for producing specific protein inside the host. vector requires a selectable marker, which
helps in identifying and eliminating non
Properties of Vectors
transformants and selectively permitting
Vectors are able to replicate autonomously to
the growth of the transformants.
produce multiple copies of them along with
Cloning sites: In order to link the alien
3.
their DNA insert in the host cell.
DNA, the vector needs to have very few,
• It should be small in size and of low molecular
preferably single, recognition sites for the
weight, less than 10 Kb (kilo base pair) in size
commonly used restriction enzymes.
so that entry/transfer into host cell is easy.

Types of vector ori gene for origin for replication and inc gene
Few types of for incompatibility. T-DNA of Ti-Plasmid is
vectors are stably integrated with plant DNA. Agrobacterium
discussed in detail plasmids have been used for introduction of genes
Bacterial Nucleoid Plasmids
below: chromosome (circular)
of desirable traits into plants.
Plasmid Figure 4.9: Bacterial Transposon as Vector
Plasmids are extra chromosome and plasmids Transposons (Transposable elements or mobile
chromosomal, elements) are DNA sequence able to insert
self replicating ds circular DNA molecules, itself at a new location in the genome without
found in the bacterial cells in addition to having any sequence relationship with the
the bacterial chromosome. Plasmids contain target locus and hence transposons are called
Genetic information for their own replication. walking genes or jumping genes. They are
BR 322 Plasmid
p used as genetic tools
pBR 322 plasmid is a reconstructed plasmid for analysis of gene
and most widely used as cloning vector; it and protein functions, ,QWHUUXSWHG
'1$VHTXHQFH
contains 4361 base pairs. In pBR, p denotes that produce new
plasmid, Band R respectively the names of phenotype on host
scientist Boliver and Rodriguez who developed cell. The use of 7UDQVSRVRQ
this plasmid. The number 322 is the number transposons is well
of plasmid developed from their laboratory. It studied in Arabidopsis Figure 4.12: Transposon
contains ampR and tetR two different antibiotic thaliana and bacteria
resistance genes and recognition sites for several such as Escherichia coli.
restriction enzymes. (Hind III, EcoRI, BamH
Walking Genes - Gene walking involves the
I, Sal I, Pvu II, Pst I, Cla I), ori and antibiotic
complete sequencing of large more than 1
resistance genes. Rop codes for the proteins
kb stretches of DNA.
involved in the replication of the plasmid.
(FR5, +LQG,,, Expression vectors

%DP+, Vectors which are suitable for expressing
DPS5 WHW5 DPS5 $PSLFLOOLQ5HVLVWDQFH*HQH
S%5
foreign proteins are called expression vectors.
WHW5 7HWUDF\FOLQH5HVLVWDQFH*HQH
RUL URS
This vector consists of signals necessary for
transcription and translation of proteins in the
3YX,,
host. This helps the host to produce foreign
Figure 4.10: pBR 322 protein in large amounts. Example: pUC 19.
Ti Plasmid
Ti plasmid is found in Agrobacterium tumefaciens, Expression Transcription Restriction Transcription
vectors contain initiation site termination
a bacteria responsible for inducing tumours in operon sequences
sequences sequence
several dicot plants. The plasmid carries transfer that allow inserted
DNA to be
(tra) gene which help Auxin
Cytokinin
Opine
transcribed and Operator (O) Ribosome
binding site
translated.
to transfer T- DNA Bacterial Gene-encoding
Selectable
genetic
marker
from one bacterium T-DNA Region
promoter (P)
sequences
repressor that
binds O and (e.g.,
antibiotic
Opine regulates P
to other bacterial or Catabolism They also include sequences
resistance)
Virulence that regulate—turn on or turn

plant cell. It has Onc Region Orgin of off—the desired gene. Ori
Replication (ORI)
gene for oncogenecity,
Figure 4.11: Ti Plasmid Figure 4.13: E.Coli Expression vector

More vectors to know
3RO\OLQNHU
Cosmid
$PSU FRVPLG
Cosmids are plasmids containing the ‘cos’ - Cohesive
&RVVLWH
Terminus, the sequence having cohesive ends. They are
hybrid vectors derived from plasmids having a fragment of
&RO(
RUL lambda phage DNA with its Cos site and a bacterial plasmid.
Bacteriophage Vectors FO 5HSOLFDWLRQ

JHQHV
Bacteriophages are viruses that infect bacteria. The most
/\VLV
commonly used E. coli phages are l phage (Lambda phage) 5HVWULFWLRQ
VLWH JHQHV
and M13 phage. Phage vectors are more efficient than (VVHQWLDO /DPEGD
JHQH JHQRPH
plasmids - DNA upto 25 Kb can be inserted into phage vector. /\VRJHQLF
JHQHV
Lambda genome: Lambda phage is a temperate bacteriophage &RDW
JHQHV
that infects Escherichia coli. The genome of lambda-Phage is
5HVWULFWLRQ
48502 bp long, i.e. 49Kb and has 50 genes. VLWH
6HFUHDWLRQVLJQDO &RDWSURWHLQ
3URPRWHU 'LVSOD\HGSHSWLGH Phagemid Vectors
Phagemids are reconstructed plasmid vectors, which contain
$PSU
their own origin - ‘ori’ gene and also contain origin of
3KDJHPLG
replication from a phage. pBluescript SK (+/–) is an example
GV'1$RQ
of phagemid vector.
IRUL
1RW, +LQG,,,
Bacterial Artificial Chromosome (BAC) Vector %DP+,
7 1RW,
KH
BAC is a shuttle plasmid vector, created for cloning large-sized SDU%
6S
foreign DNA. BAC vector is one of the most useful cloning &0
SDU$
vector in r-DNA technology they can clone DNA inserts of
UHS(
upto 300 Kb and they are stable and more user-friendly. RQ6
&HQ
VXSRFKUH
$56
&ORQLQJVLWH Yeast Artificial chromosome (YAC vector)
WUS
DPSU
S<$& XUD YAC plasmid vector behaves like a yeast chromosome, which occurs
S0%25,
in two forms, i.e. circular and linear. The circular YAC multiplies in
7HORPHUH 7HORPHUH
%DP+, %DP+, Bacteria and linear YAC multiplies in Yeast Cells.
KLV
Shuttle Vectors <HDVW

%DFWHULDO
UHSOLFDWLRQ RULJLQRI
The shuttle vectors are plasmids designed to replicate in cells of JHQHV UHSOLFDWLRQ
two different species. These vectors are created by recombinant $QWLELRWLF

UHVLVWDQFH 6KXWWOH /HXFLQH
ELRV\QWKHVH
techniques. The shuttle vectors can propagate in one host and JHQH YHFWRU JHQH
<HDVW
then move into another host without any extra manipulation. 0XOWLSOH
FORQLQJVLWH FHQWURPHUH
VHTXHQFH
Most of the Eukaryotic vectors are Shuttle Vectors.

4.5.5 Competent Host (For flanked by the necessary controlling sequences,
Transformation with Recombinant DNA) i.e., the promoter and terminator, and deliver the
The propagation of the recombinant DNA genes into the host plant. There are two kinds of
molecules must occur inside a living system gene transfer methods in plants. It includes:
or host. Many types of host cells are available • Direct or vectorless gene transfer
for gene cloning which includes E.coli, yeast, • Indirect or vector – mediated gene transfer
animal or plant cells. The type of host cell
4.6.1 Direct or Vectorless Gene Transfer
depends upon the cloning experiment. E.coli
In the direct gene transfer methods, the foreign
is the most widely used organism as its genetic
gene of interest is delivered into the host plant
make-up has been extensively studied, it is
without the help of a vector. The following are
easy to handle and grow, can accept a range of
some of the common methods of direct gene
vectors and has also been studied for safety. One
transfer in plants.
more important feature of E.coli to be preferred
as a host cell is that under optimal growing Chemical mediated gene transfer:
a.
conditions the cells divide every 20 minutes. Certain chemicals like polyethylene glycol
(PEG) and dextran sulphate induce DNA
Since the DNA is a hydrophilic molecule,it
uptake into plant protoplasts.
cannot pass through cell membranes, In order
to force bacteria to take up the plasmid, the Microinjection: The DNA is directly
b.
bacterial cells must first be made competent injected into the nucleus using fine tipped
to take up DNA. This is done by treating them glass needle or micro pipette to transform
with a specific concentration of a divalent plant cells. The protoplasts are immobilised
cation such as calcium. Recombinant DNA can on a solid support (agarose on a microscopic
then be forced into such cells by incubating the slide) or held with a holding pipette under
cells with recombinant DNA on ice, followed suction.
by placing them briefly at 420C (heatshock) and Electroporation Methods of Gene
c.
then putting them back on ice. This enables Transfer: A pulse of high voltage is applied
bacteria to take up the Recombinant DNA. to protoplasts, cells or tissues which makes
For the expression of eukaryotic proteins, transient pores in the plasma membrane
eukaryotic cells are preferred because to produce through which uptake of foreign DNA
a functionally active protein it should fold occurs.
properly and post translational modifications Before Pulse During E-field After Pulse
Cell membrane Introduce Cell heals with
should also occur, which is not possible by - genes/drugs gene/drug inside
+ +
prokaryotic cell (E.coli). + + -
+
+ -
- + - -
- - + -
- -+ + --- + +
-- + - + +
+ - + --- +++ + -
4.6 Methods of Gene Transfer
- - + - -
- + - + - + -
+
+ +
- + - +
The next step after a recombinant DNA molecule Electric field induces a
voltage across cell membrane
has been generated is to introduce it into a Figure 4.14: Electroporation Methods of
suitable host cell. There are many methods to Gene Transfer
introduce recombinant vectors and these are
dependent on several factors such as the vector L iposome mediated method of Gene
d.
type and host cell. Transfer: Liposomes the artificial
phospholipid vesicles are useful in gene
For achieving genetic transformation in
transfer. The gene or DNA is transferred
plants, the basic pre-requisite is the construction
from liposome into vacuole of plant
of a vector which carries the gene of interest

Gene gun barrel
Cell membrane
Nucleus
Proteoglycan
Escape from DNA Plastic disc with
Endocytosis endosome DNA-coated
gold particles
Lipoplex
DNA
Endosome with Disc stopped
lipid mixing by screen
DNA-pcoated
Lipoplex Endosomal gold particles
Endosome maturation
DNA
DNA
Liposome fragmentation
Lysosome Target plant cells

Figure 4.16: Gene gun
Figure 4.15: Liposome mediated method of Gene Transfer
method of Gene Transfer
cells. It is carried out by encapsulated 4.6.2 Indirect or Vector-Mediated Gene

DNA into the vacuole. This technique Transfer
is advantageous because the liposome Gene transfer is mediated with the help of a
protects the introduced DNA from being plasmid vector is known as indirect or vector
damaged by the acidic pH and protease mediated gene transfer. Among the various
enzymes present in the vacuole. Liposome vectors used for plant transformation, the
and tonoplast of vacuole fusion resulted Ti-plasmid from Agrobacterium tumefaciens
in gene transfer. This process is called has been used extensively. This bacterium
lipofection. has a large size plasmid, known as Ti
Biolistics: The foreign DNA is coated onto
e. plasmid (Tumor inducing) and a portion
the surface of minute gold or tungsten of it referred as T-DNA (transfer DNA) is
particles (1-3 µm) and bombarded onto transferred to plant genome in the infected
the target tissue or cells using a particle gun cells and cause plant tumors (crown gall).
(also called as gene gun/micro projectile Since this bacterium has the natural ability
gun/shotgun). Then the bombarded cells to transfer T-DNA region of its plasmid into
or tissues are cultured on selected medium plant genome, upon infection of cells at the
to regenerate plants from the transformed wound site, it is also known as the natural
cells.(Figure 4.16) genetic engineer of plants.
Agrobacterium T DNA carrying

DNA containing
tumefaciens new gene within plant
gene for desired trait
chromosome
Plant cell
Ti 1 2 3 3
plasmid Recombinant
Insertion of Ti plasmid Introduction The plant cells
gene into plasmid into plant Regeneration
T DNA are grown in Plant with
using restriction cells of plant
culture new trait
Restriction enzyme and DNA ligase
cleavage site
Figure 4.17: Agrobacterium mediated gene transfer in plants

The foreign gene (e.g. Bt gene for insect medium contain X-gal, whereas the other
resistance) and plant selection marker cells containing non-recombinant DNA will
gene, usually an antibiotic gene like npt develop the blue coloured colonies. On the
II which confers resistance to antibiotic basis of colony colour, the recombinants can
kanamycin are cloned in the T DNA region be selected.
of Ti-plasmid in place of unwanted DNA 4.7.2 Antibiotic resistant markers
sequences.(Figure 4.17)
An antibiotic resistance marker is a gene
4.7 Screening for Recombinants that produces a protein that provides cells
After the introduction of r-DNA into a suitable with resistance to an antibiotic. Bacteria with
host cell, it is essential to identify those cells transformed DNA can be identified by growing on
which have received the r-DNA molecule. This a medium containing an antibiotic. Recombinants
process is called screening. The vector or foreign will grow on these medium as they contain
DNA present in recombinant cells expresses the genes encoding resistance to antibiotics such
characters, while the non-recombinants do not as ampicillin, chloro amphenicol, tetracycline or
express the characters or traits. For this some of kanamycin, etc., while others may not be able to
the methods are used and one such method is grow in these media, hence it is considered useful
Blue-White Selection method. selectable marker.
4.7.1 Insertional Inactivation - Blue- 4.7.3. Replica plating technique

White Colony Selection Method A technique in which the pattern of colonies
It is a powerful method used for screening growing on a culture plate is copied. A sterile
of recombinant plasmid. In this method, a filter plate is pressed against the culture plate
reporter gene lacZ is inserted in the vector. and then lifted. Then the filter is pressed against
The lacZ encodes the enzyme β-galactosidase a second sterile culture plate. This results in the
and contains several recognition sites for new plate being infected with cell in the same
restriction enzyme. relative positions as the colonies in the original
β-galactosidase breaks a synthetic plate. Usually, the medium used in the second
substrates called X-gal (5-bromo-4-chloro- plate will differ from that used in the first. It may
indolyl-β-D-galacto-pyranoside) into an include an antibiotic or without a growth factor.
insoluble blue coloured product. If a foreign In this way, transformed cells can be selected.
gene is inserted into lacZ, this gene will be
Ampicillin sensitive colonies
inactivated. Therefore, no-blue colour will
develop (white) because β-galactosidase
is not synthesized due to inactivation of Incubate
lacZ. Therefore, the host cell containing

r-DNA form white coloured colonies on the Lacks ampicillin Contains ampicillin
a lac promoter Multiple E %OXH Master plate Replicate on

QRLQVHUW fresh media
Ampicilin cloning
site :KLWH
resistance
FRQWDLQLQVHUW
(amp) pUC 18 lacZ
$PSLFLOOLQ,37*;JDOSODWH
Ori
Figure 4.18: a. Plasmid vector designed for
Sterile velvet on a block Imprints of all colonies
blue-white screening b. Blue-white colony
selection method Figure 4.19: Replica plating technique

4.7.4 Molecular Techniques - Isolation of
Agricultural diagnostics refers to a variety of
Genetic Material and Gel Electrophoresis
tests that are used for detection of pathogens
Electrophoresis is a separating technique used in plant tissues. Two of the most efficient
to separate different biomolecules with positive methods are
and negative charges.
1. ELISA (Enzyme Linked Immumo
Principle Sorbent Assay)
By applying electricity (DC) the molecules Elisa is a diagnostic tool for identification
migrate according to the type of charges of pathogen species by using antibodies and
they have. The electrical charges on different diagnostic agents. Use of ELISA in plant
molecules are variable. pathology especially for weeding out virus
will move infected plants from large scale planting is
+ve charged Cations –ve Cathode
towards
well known.
will move
–ve charged Anions +ve Anode
towards 2. DNA Probes
Agarose GEL Electrophoresis DNA Probes, isotopic and non-isotopic
It is used mainly for the purification of specific (Northern and Southern blotting) are
DNA fragments. Agarose is convenient for popular tools for identification of viruses
separating DNA fragments ranging in size and other pathogens
from a few hundred to about 20000 base
pairs. Polyacrylamide is preferred for the 4.7.5 Nucleic Acid Hybridization -
purification of smaller DNA fragments. The gel Blotting Techniques
is complex network of polymeric molecules. Blotting techniques are widely used analytical
DNA molecule is negatively charged molecule tools for the specific identification of desired
- under an electric field DNA molecule DNA or RNA fragments from larger number
migrates through the gel. The electrophoresis of molecules. Blotting refers to the process of
is frequently performed with marker DNA immobilization of sample nucleic acids or solid
fragments of known size which allow accurate support (nitrocellulose or nylon membranes.)
size determination of an unknown DNA The blotted nucleic acids are then used as target
molecule by interpolation. The advantages of in the hybridization experiments for their
agarose gel electrophoresis are that the DNA specific detection.
bands can be readily detected at high sensitivity. Types of Blotting Techniques
The bands of DNA in the gel are stained with Southern Blotting: The transfer of DNA from
the dye Ethidium Bromide and DNA can be agarose gels to nitrocellulose membrane.
detected as visible fluorescence illuminated in
Northern Blotting: The transfer of RNA to
UV light will give orange fluorescence, which
nitrocellulose membrane.
can be photographed.
Western Blotting: Electrophoretic transfer of
Proteins to nitrocellulose membrane.
Southern Blotting Techniques - DNA
The transfer of denatured DNA from Agarose
a b gel to Nitrocellulose Blotting or Filter Paper
Figure 4.20: a. Bands of DNA in Agarose gel technique was introduced by Southern in 1975
b. Gel Electrophoresis Instrument and this technique is called Southern Blotting
Technique.

Steps
The transfer of DNA from agarose gel to 1. DNA is cleaved by
restriction enzymes and
nitrocellulose filter paper is achieved by transferred to an agarose
Capillary Action. gel. The fragments are
separated by gel
A buffer Sodium Saline Citrate (SSC) is electrophoresis.
used, in which DNA is highly soluble, it can be 2. The gel is soaked in an

drawn up through the gel into the Nitrocellulose alkali solution to denature the
double-stranded DNA and
membrane. then placed on a platform in a
Blotting dish containing buffer.
By this process ss-DNA becomes ‘Trapped’ paper
3. A membrane is positioned
in the membrane matrix. Weight on top of the gel.
This DNA is hybridized with a nucleic acid Nitrocellulose

and can be detected by autoradiography. or other membrane
Gel
Autoradiography - A technique that captures Blotting paper
the image formed in a photographic emulsion Alkali solution
due to emission of light or radioactivity from Platform 4. Buffer drawn up into the top
a labelled component placed together with layer of blotting paper passes
through the gel, carrying DNA
unexposed film. onto the membrane.
Weight Membrane
Glass plate DNA
Paper tissues 5. DNA on the

membrane is fixed....
Filter paper
Membrane
Gel 6. ....placed in a
Filter paper wick hybridization bottle with
Plastic solution that contains a
Support block tray radioactively lablled
Transfer probe, and gently rotated.
buffer
Radioactive probe
Figure 4.21: Diagrammatic representation of 7. The probe binds to
a typical blotting apparatus complementary DNA fragments
on the membrane,...
Northern Blot
It was found that RNA is not binding to cellulose Size
nitrate. Therefore, Alwin et al. (1979) devised a standards
procedure in which RNA bands are transferred

Auto radiography
from the agarose gel into nitrocellulose filter
paper. This transfer of RNA from gel to special
filter paper is called Northern Blot hybridization. 8. ...and autoradiography detects
The filter paper used for Northern blot is Amino fragments with probe attached.
Benzyloxymethyl Paper which can be prepared
Figure 4.22: Steps involved in southern
from Whatman 540 paper.
blotting technique
Western Blot
protein is then identified by probing the blot
Refers to the electrophoretic transfer of proteins with a radio-labelled antibody which binds on
to blotting papers. Nitrocellulose filter paper can the specific protein to which the antibody was
be used for western blot technique. A particular prepared.

Differences between Blotting Techniques
Southern blotting Northern blotting Western blotting
Name Southern name of the inventor Northern a misnomer Western a misnomer
Separation of DNA RNA Proteins
Denaturation Needed Not needed Needed
Membrane Nitrocellulose/ nylon Amino Nitrocellulose
benzyloxymethyl
Hybridisaiton DNA-DNA RNA-DNA Protein-antibody
Visualising Autoradiogram Autoradiogram Dark room
Table 4.2: Difference between Blotting Techniques
4.7.6 Bioassay for Target Gene Effect mitochondrial genome or plastid genome.
Target gene is target DNA, foreign DNA, Genome of many plants contain both functional
passenger DNA, exogenous DNA, gene of and non-expressive DNA proteins. Genome
interest or insert DNA that is to be either project refer to a project in which the whole
cloned or specifically mutated. Gene targeting genome of plant is analysed using sequence
experiments have been targeting the nuclei analysis and sequence homology with other
and this leads to ‘gene knock-out’. For this plants. Such genome projects have so far
purpose, two types of targeting vectors are used. been undertaken in Chlamydomonas(algae),
They are insertion vectors and replacement or Arabidopsis thaliana, rice and maize plants.
transplacement vectors. Genome content of an organism is expressed in
1. Insertion vectors are entirely inserted into terms of number of base pairs or in terms of the
targeted locus as the vectors are linearized content of DNA is expressed in c-value.
within the homology region. Initially, these
Genome sequencing: The location of genes
vectors are circular but during insertion,
on the entire diploid chromosome of an
become linear. It leads to duplication of
organism.
sequences adjacent to selectable markers.
2 The replacement vector has the homology
region and it is co-linear with target. This Barcode: You might have
vector is linearized prior to transfection seen in all books barcoding
outside the homology region and then and also in items you buy
consequently a crossing over occurs to in supermarket. This will
replace the endogenous DNA with the reveal the identity of the book or item as well
incoming DNA. the details like prize. Similarily, Barcode in
genetic term refer to the identify of the taxon
Transfection: Introduction of foreign based on its genetic makeup. In practice, it
nucleic acids into cells by non-viral methods. is an optical, machine-
readable representation
4.7.7. Genome Sequencing and Plant
of data which describes
Genome Projects
about the characters
The whole complement of gene that determine
of any plants or any
all characteristic of an organism is called
objects.
genome. The genome may be nuclear genome,

4.7.8 Evolutionary pattern assessed 4.7.10 RNA Interference (RNAi)
using DNA. All characters of organism are the result
In recent years the evolutionary relationship of expression of different genes which are
between different plant taxa is assessed using regions of nuclear DNA. This expression
DNA content as well as the similarities and involves transcription and translation.
differences in the DNA sequence (sequence Transcription refers to the copying of
genetic information from one strand of the
homology). Based on such analysis the
DNA (called sense strand) by RNA. This
taxa and their relationship are indicated in
RNA, as soon as it formed cannot be straight
cladogram. Such cladogram will show the
away sent to the cytoplasm to undertake the
genetic distance between two taxa. It is also process of translation. It has to be edited and
showed antiquity or modernity of any taxon made suitable for translation which brings
with respect to one another (See also Unit-2, about protein synthesis. One of the main
Chapter-5 of XI Std.) items removed from the RNA strand are the
introns. All these changes before translation
4.7.9 Genome editing and CRISPR -
normally take place whereby certain regions
Cas9
of DNA are silence. However, there is an
Genome editing or gene editing is a group of (RNAi) pathway. RNA interference is a
technologies that has the ability to change an biological process in which RNA molecules
organism’s DNA. These technologies allow inhibit gene expression or translation.
genetic material to be added, removed, or This is done by neutralising targetd mRNA
altered at particular locations in the genome. molecules.
Several approaches to genome editing have A simplified model for the RNAi pathway
been developed. A recent one is known is based on two steps, each involving
as CRISPR-Cas9, which is short form of ribonuclease enzyme. In the first step, the
Clustered Regularly Interspaced Short trigger RNA (either dsRNA or miRNA primary
Palindromic Repeats and CRISPR-associated transcript) is processed into a short interfering
protein 9. The CRISPR-Cas9 system has RNA (siRNA) by the RNase II enzymes
generated a lot of excitement in the scientific called Dicer and Drosha. In the second step,
community because it is faster, cheaper, siRNAs are loaded into the effector complex
RNA-induced silencing complex (RISC). The
more accurate, and more efficient than other
siRNA is unwound during RISC assembly
existing genome editing methods.
and the single-stranded RNA hybridizes with
Rice, was among the first plants to be used mRNA target. This RNAi is seen in plant
to demonstrate the feasibility of CRISPR- feeding nematodes.
mediated targeted mutagenesis and gene
replacement. The gene editing tool CRISPR RISC complex with
unzipped SiRNA
can be used to make hybrid rice plants that
Plant cell Cleaved mRNA
can clone their seed. Imtiyaz n
Khand and Venkatesan dsRNA

Sundaresan and colleagues Dicer
reported in a new study Interaction

siRNA Target
of Dicer
which clearly shows one can with ds uptake mRNA
RNA by the Root-knot
re-engineer rice to switch it nematode nematode
from a sexual to an asexual siRNAs
mode.
Figure 4.23: RNA Interference

4.8 Transgenic Plants / Genetically One strategy is to incorporate a soil bacterium
Modified Crops (Gm Crops) gene that produces a glyphosate tolerant form
of EPSPS. Another way is to incorporate a
4.8.1 Herbicide Tolerant – Glyphosate different soil bacterium gene that produces a
Weeds are a constant problem in crop fields. glyphosate degrading enzyme.
Weeds not only compete with crops for sunlight,
Advantages of Herbicide Tolerant Crops
water, nutrients and space but also a carrier for
insects and diseases. If left uncontrolled, weeds • Weed control improves higher crop yields;
can reduce crop yields significantly. • Reduces spray of herbicide;
Reduces
• competition between crop plant
Transgenic plants contain a novel DNA
and weed;
introduced into its genome.
Use
• of low toxicity compounds which do
Glyphosate herbicide produced by Monsanto, not remain active in the soil; and
USA company under the trade name ‘Round The
• ability to conserve soil structure and
up’ kills plants by blocking the 5-enopyruvate microbes.
shikimate-3 phosphate synthase (EPSPS)
enzyme, an enzyme involved in the biosynthesis 4.8.2 Herbicide Tolerant - Basta
of aromatic amino acids, vitamins and many Trade name ‘Basta’ refers to a non-selective
secondary plant metabolites. There are several herbicide containing the chemical compound
phosphinothricin. Basta herbicide tolerant
ways by which crops can be modified to be
gene PPT (L-phosphinothricin) was isolated
glyphosate-tolerant.
from Medicago sativa plant. It inhibits the
Protocol for Glyphosate enzyme glutamine synthase which is involved
tolerant Potato Plant in ammonia assimilation. The PPT gene
Introduction of ‘bar’ gene through vector was introduced into tobacco and transgenic
tobacco produced was resistant to PPT. Similar
Cell culture of potato with ‘bar’ gene enzyme was also isolated from Streptomyces
hygroscopicus with bar gene encodes for PAT
(Phosphinothricin acetyl transferase) and was
Herbicide tolerant potato cells
introduced into crop plants like potato and
sugar-beet and transgenic crops have been
In vitro culture
developed.
Callus → Organogenesis 4.8.3 Insect resistance - Bt Crops:
i. Bt Cotton
Development of Herbicide tolerant
transgenic plants Bt cotton is a genetically modified organism
(GMO) or genetically modified pest resistant
plant cotton variety, which produces an
insecticide activity to bollworm.
Strains of the bacterium Bacillus thuringiensis
produce over 200 different Bt toxins, each
harmful to different insects. Most Bt toxins
are insecticidal to the larvae of moths and
Figure 4.24: Glyphosate butterflies, beetles, cotton bollworms and
Tolerant Potato Plant gatflies but are harmless to other forms of life.

The genes are encoded for toxic crystals in the Lepidopteron insects, in particular the Brinjal
Cry group of endotoxin. When insects attack Fruit and Shoot Borer (Leucinodes orbonalis).
and eat the cotton plant the Cry toxins are
iii. Dhara Mustard Hybrid (DMH)
dissolved in the insect’s stomach.
DMH -11 is transgenic mustard developed
The epithelial membranes of the gut block certain
by a team of scientists Centre for Genetic
vital nutrients thereby sufficient regulation of
Manipulation of Crop Plants at Delhi University
potassium ions are lost in the insects and results
under Government sponsored project. It is
in the death of
genetically modified variety of Herbicide Tolerant
epithelial cells
(HT) mustard. It was created by using “barnase/
in the intestine
barstar” technology for genetic modification by
membrane which
adding genes from soil bacterium that makes
leads to the death
mustard, a self-pollinating plant. DMH -11
of the larvae.
Figure 4.25: Bt Cotton contains three genes viz.
Advantages Bar gene, Barnase and
The advantages of Bt cotton are: Barstar sourced from
• Yield of cotton is increased due to effective soil bacterium. The bar
control of bollworms. gene had made plant Figure 4.27:
• Reduction in insecticide use in the resistant to herbicide Dhara Mustard
cultivation of Bt cotton named Basta.
• Potential reduction in the cost of cultivation.
4.8.4 Virus Resistance
Disadvantages
Many plants are affected by virus attack
Bt cotton has some limitations:
resulting in series loss in yield and even death.
• Cost of Bt cotton seed is high.
Biotechnological intervention is used to
• Effectiveness up to 120 days after that
introduce viral resistant genes into the host plant
efficiency is reduced
so that they can resist the attack by virus. This
• Ineffective against sucking pests like jassids,
is by introducing genes that produce resistant
aphids and whitefly.
enzymes which can deactivate viral DNA.
• Affects pollinating insects and thus yield.
ii. Bt Brinjal 4.8.5 FlavrSavr Tomato
The Bt brinjal is another transgenic brinjal Agrobacterium mediated genetic engineering
created by inserting a crystal protein gene technique was followed to produce Flavr-Savr
(Cry1Ac) from the soil bacterium Bacillus tomato, i.e., retaining the natural colour and
thuringiensis into the genome of various brinjal flavor of tomato.
cultivars. The insertion of the gene, along with Through genetic engineering, the ripening
other genetic elements such as promoters, process of the tomato is slowed down and thus
terminators and an antibiotic resistance marker prevent it from softening and to increase the
gene into the brinjal plant is accomplished shelf life. The tomato was made more resistant to
using Agrobacterium- rotting by Agrobacterium
mediated genetic mediated gene
transformation. The transfer mechanism of
Bt brinjal has been introducing an antisense
developed to give gene which interferes
Figure 4.28:
resistance against with the production of FlavrSavr Tomato
Figure 4.26: Bt Brinjal

the enzyme polygalacturonase, which help in Anaphylactic
• shock (sudden hypersensitive
delaying the ripening process of tomato during reaction) and allergies.
long storage and transportation. Adverse effect in immune system because of
•
bacterial protein.
4.8.6 Golden rice - Biofortification Loss of viability of seeds show in terminator
•
Golden rice is a variety of Oryza sativa (rice) seed technology of GM crops.
produced through genetic engineering of
biosynthesized beta-carotene, a precursor of 4.8.7 Polyhydroxybutyrate (PHB)
Vitamin-A in the edible parts of rice developed Synthetic polymers are non-degradable and
by Ingo Potrykus and his group. The aim is pollute the soil and when burnt add dioxin in
to produce a fortified food to be grown and the environment which cause cancer. So, efforts
consumed in areas with a shortage of dietary were taken to provide an alternative eco-friendly
Vitamin-A, which kills so many children biopolymers. Polyhydroxyalkanoates (PHAs)
under five year age. Golden rice differs from and polyhydroxybutyrate (PHB) are group of
its parental strain by the addition of three degradable biopolymers which have several
beta-carotene biosynthesis genes namely medical applications such as drug delivery,
‘psy’ (phytoene synthase) from daffodil plant scaffold and heart valves. PHAs are biological
Narcissus pseudonarcissus and ‘crt-1’ gene from macromolecules and thermoplastics which are
the soil bacterium Erwinia auredorora and ‘lyc’ biodegradable and biocompatible.
(lycopene cyclase) gene from wild-type rice Several microorganisms have been utilized
endosperm. to produce different types of PHAs including
The endosperm of normal rice, does not contain Gram-positive like Bacillus megaterium,
beta-carotene. Golden-rice has been genetically Bacillussubtilis and Corynebacterium
altered so that the endosperm now accumulates glutamicum, Gram-negative bacteria like group
Beta-carotene. This has been done using of Pseudomonas sp. and Alcaligenes eutrophus.
Recombinant DNA technology. Golden rice can
4.8.8 Polylactic acid (PLA)
control childhood blindness - Xerophthalmia.
Polylactic acid or polylactide (PLA) is a
biodegradable and bioactive thermoplastic. It is
an aliphatic polyester derived from renewable
resources, such as corn starch, cassava
root, chips or starch or sugarcane. For the
production of PLA, two main monomers are
used: lactic acid, and the cyclic diester, lactide.
The most common route is the ring-opening
Figure 4.29: Golden rice polymerization of
GM Food - Benefits lactide with metal
• High yield without pest
catalysts like tin
• 70% reduction of pesticide usage
octoate in solution.
• Reduce soil pollution problem
The metal-catalyzed
• Conserve microbial population in soil
reaction results in
equal amount of d Figure 4.30: Polylactic
Risks - believed to and polylactic acid. acid product
• Affect liver, kidney function and cancer
• Hormonal imbalance and physical disorder

4.8.9 Green Fluorescent Protein (GFP) produce pharmaceutical substances for use of
The green fluorescent protein (GFP) is a protein human beings. This is also called “molecular
containing 238 amino acid residues of 26.9 kDa farming or pharming”. These plants are
that exhibits bright green fluorescence when different from medicinal plants which are
exposed to blue to ultraviolet range (395 nm). naturally available. The use of plant systems
GFP refers to the protein first isolated from the as bioreactors is gaining more significance in
jellyfish Aequorea victoria. GFP is an excellent modern biotechnology. Many pharmaceutical
tool in biology due to its ability to form internal substances can be produced using transgenic
chromophore without requiring any accessory plants. Example: Golden rice
cofactors, gene products, enzymes or substrates 4.8.11 Bioremediation
other than molecular oxygen. In cell and
It is defined as the use of microorganisms or
molecular biology, the GFP gene is frequently
plants to clean up environmental pollution. It
used as a reporter of expression. It has been
is an approach used to treat wastes including
used in modified forms to make biosensors.
wastewater, industrial waste and solid waste.
Protocol Bioremediation process is applied to the removal
Green Fluorescent Protein (GFP) of oil, petrochemical residues, pesticides or
heavy metals from soil or ground water. In many
Isolated from Aequorea victoria (jelly fish) cases, bioremediation is less expensive and more
sustainable than other physical and chemical
Gene splicing technique altering the methods of remediation.Bioremediation
codon process is a cheaper and eco-friendly approach
and can deal with lower concentrations of
Introduced into Arabidopsis thaliana plant contaminants more effectively. The strategies
for bioremediation in soil and water can be as
GFP expressed in A. thaliana plant follows:
Use
• of indigenous microbial population
as indicator species for bioremediation
process.
GFP from
Aequorea Bioremediation with the addition of adapted
•
victoria or designed microbial inoculants.
Use
• of plants for bioremediation - green
technology.
Some examples of bioremediation
technologies are:
GFP in Arabidopsis Phytoremediation
• - use of plants to bring
GFP thaliana about remediation of environmental
pollutants.
4.8.10 Biopharming Mycoremediation
• - use of fungi to bring
about remediation of environmental
Biopharming also known as molecular
pollutants.
pharming is the production and use of
transgenic plants genetically engineered to Bioventing
• is the process that increases
the oxygen or air flow to accelerate the

degradation of environmental pollutants. Oil Extaction
Bioleaching
• is the use of microorganisms Protien
Residue
in solution to recover metal pollutants from
contaminated sites. Sun Energy
Bioaugmentation is the addition of selected

•
Biodiesel
microbes to speed up degradation process. production
Composting
• is the process by which the Algae
(Renewable resource)
solid waste is composted by the use of
microbes into manure which acts as a CO2
nutrient for plant growth. Glycerin
products
Rhizofiltration
• is the uptake of metals
or degradation of organic compounds by Existing Renewable
Technology Fuel
rhizosphere microorganisms.
Figure 4.31: Algal Biofuel
Rhizostimulation is the stimulation of plant
•
Biological hydrogen production by algae
growth by the rhizosphere by providing
The biological hydrogen production with
better growth condition or reduction in
algae is a method of photo biological water
toxic materials.
splitting. In normal photosynthesis the alga,
Limitations Chlamydomonas reinhardtii releases oxygen.
• Only biodegradable contaminants can When it is deprived of sulfur, it switches to the
be transformed using bioremediation production of hydrogen during photosynthesis
processes. and the electrons are transported to ferredoxins.
• Bioremediation processes must be [Fe]-hydrogenase enzymes combine them into
specifically made in accordance to the the production of hydrogen gas.
conditions at the contaminated site. CO2 Fixation H2 Production
• Small-scale tests on a pilot scale must be FNR H2 ase

performed before carrying out the procedure -O2 + CO2 -O2 - CO2
at the contaminated site. Fd
• The use of genetic engineering technology to Cytb6f

create genetically modified microorganism PSII PQ PQ
PSI
or a consortium of microbes for

PC
bioremediation process has great potential. Mn
O2 + 4H+ + 4e-
4.8.12 Biofuel: Algal Biofuel 2H2O
Algal fuel, also known as algal biofuel, or algal Figure 4.32: Hydrogen production by algae
oil is an alternative to liquid fossil fuels, the 4.8.13 Bioprospecting
petroleum products. This use algae as a source
Bioprospecting is the process of discovery and
of energy-rich oils. Also, algal fuels are an
commercialization of new products obtained
alternative to commonly known biofuel sources
obtained from corn and sugarcane. The energy from biological resources. Bioprospecting
crisis and the world food crisis have initiated may involve biopiracy, in which indigenous
interest in algal culture (farming algae) for knowledge of nature, originating with
making biodiesel and other biofuels using land indigenous people, is used by others for profit,
unsuitable for agriculture. Botryococcus braunii without authorization or compensation to the
is normally used to produce algal biofuel. indigenous people themselves.

Biopiracy Biopiracy of Basmati
Biopiracy can be defined as the manipulation of On September 2, 1997, the U.S. Patent and
intellectual property rights laws by corporations Trademarks Office granted Patent on “basmati
to gain exclusive control over national genetic rice lines and grains” to the Texas-based company
resources, without giving adequate recognition RiceTec. This broad patent gives the company
or remuneration to the original possessors of several rights, including exclusive use of the term
those resources. Examples of biopiracy include 'basmati', as well proprietary rights on the seeds and
recent patents granted by the U.S. Patent and grains from any crosses. The patent also covers the
Trademarks Office to American companies on process of breeding RiceTec’s novel rice lines and
turmeric, ‘neem’ and, most notably, ‘basmati’ the method to determine the cooking properties
rice. All three products are indigenous to the and starch content of the rice grains.
Indo-Pak subcontinent. India had periled the United States to take the
Biopiracy of Neem matter to the WTO as an infringement of the
TRIPS agreement, which could have resulted
The people of India used neem and its oil in many
in major embarrassment for the US. Hence
ways to controlling fungal and bacterial skin
voluntarily and due to few decisions take by the
infections. Indian’s have shared the knowledge
US patent office, Rice Tec had no choice but to
of the properties of the neem with the entire
lose most of the claims and most importantly
world. Pirating this knowledge, the United States
the right to call the rice “Basmati”. In the year
Department of Agriculture (USDA) and an
2002, the final decision was taken. Rice Tec
American MNC (Multi Nation Corporation)
dropped down 15 claims, resulting in clearing
W.R.Grace in the early 90’s sought a patent from
the path of Indian Basmati rice exports to the
the European Patent Office (EPO) on the “method
foreign countries. The Patent Office ordered the
for controlling of diseases on plants by the aid of
patent name to be changed to ‘Rice lines 867’.
extracted hydrophobic neem oil”. The patenting
of the fungicidal and antibacterial properties 4.9 Applications of Biotechnology
of Neem was an example of biopiracy but the • Biotechnology is one of the most important
traditional knowledge of the Indians was protected applied interdisciplinary sciences of the 21st
in the end. century. It is the trusted area that enables us
Biopiracy of Turmeric to find the beneficial way of life.
The United States Patent and Trademark Office, in •
Biotechnology has wide applications in
the year 1995 granted patent to the method of use various sectors like agriculture, medicine,
of turmeric as an antiseptic agent. Turmeric has environment and commercial industries.
been used by the Indians as a home remedy for the
• This science has an invaluable outcome like
quick healing of the wounds and also for purpose
transgenic varieties of plants e.g. transgenic
of healing rashes. The journal article published by
cotton (Bt-cotton), rice, tomato, tobacco,
the Indian Medical Association, in the year 1953
wherein this remedy was mentioned. Therefore, in cauliflower, potato and banana.
this way it was proved that the use of turmeric as • The development of transgenics as pesticide
an antiseptic is not new to the world and is not a resistant, stress resistant and disease
new invention, but formed a part of the traditional resistant varieties of agricultural crops is the
knowledge of the Indians. The objection in this immense outcome of biotechnology.
case US patent and trademark office was upheld The synthesis of human insulin and
•
and traditional knowledge of the Indians was
blood protein in E.coli and utilized for
protected. It is another example of Biopiracy.

insulin deficiency disorder in human is organisms. The enzyme restriction endonuclease
a breakthrough in biotech industries in is a molecular scissor that cleaves DNA into
medicine. fragments at or near specific recognition sites with
•
The synthesis of vaccines, enzymes, the molecule known as restriction sites. Other
antibiotics, dairy products and beverages enzymes are DNA ligase and alkaline phosphatase.
are the products of biotech industries. DNA ligase enzyme joins the sugar and phosphate
molecules of double stranded DNA. Alkaline
Biochip based biological computer is one of
•
phosphatase is an enzyme which adds or removes
the successes of biotechnology.
specific phosphate group of double stranded DNA.
•
Genetic engineering involves genetic
A vector is a small DNA molecule capable of
manipulation, tissue culture involves aseptic
self replication and used as a carrier of DNA
cultivation of totipotent plant cell into
inserted in the host cell. Few examples of vectors
plant clones under controlled atmospheric
are plasmid – pBR 322, cosmid – Lambda phage,
conditions.
M13, Phagmid , BAC, YAC, transposon, shuttle
Single cell protein from Spirulina is utilized
•
vector and expression vector.
in food industries.
After production of recombinant DNA molecule
• Production of secondary metabolites,
has been generated is introduced into a suitable
biofertilizers, biopesticides and enzymes.
host cell. Type of host cell depends upon the
•
Biomass energy, biofuel, Bioremediation, cloning experiment. E.coli is the most widely
phytoremediation for environmental used host organism. There are two kinds of gene
biotechnology. transfer methods in plants. They are direct or
Summary vectorless gene transfer and indirect or vector
Biotechnology is the science of applied biological mediated gene transfer. Direct gene transfer
process in which there is a controlled use of includes chemical mediated gene transfer, micro
biological agents such as microorganisms injection, electroporation. Gene gun method and
or cellular components for beneficial use. A Liposome mediated method of gene transfer.
Hungarian Engineer, Karl Ereky (1919) coined Indirect or vector mediated gene transfer is
the term biotechnology. Biotechnology broadly a method of gene transfer with the help of a
categorized into traditional practices and modern plasmid vector. In this method Ti-plasmid
practices. Traditional biotechnology includes our from Agrobactirum tumefeciens has been used
ancient practices such as fermentation. Single extensively for vector mediated gene transfer.
Cell Protein (SCP) organisms are grown in large After the introduction of rDNA into a host
quantities to produce goods rich in protein, cell, it is essential to identify those cells which
minerals, fats, carbohydrates and vitamins. The have received the rDNA molecule. This process
modern biotechnology embraces all the genetic is called screening. One of the method of
manipulations. The recombinant DNA technology recombinant screening is blue white selection
is a technique of modern biotechnology in which method Replica plating technique in which the
transfer of DNA coding for a specific gene pattern of colonies growing on a culture plate is
from one organism is introduced into another copied. Electrophoresis is a separating technique
organism using specific agents like vectors or used to separate different biomolecules.
using instruments like electroporation, gene Blotting techniques are widely used tools for
gun, liposome mediated, chemical mediated and identification of desired DNA or RNA fragments
micro injection. Other tools are enzymes and host from larger number of molecules. Some of the
genetically modified crops are herbicide tolerant

– Basta, Dhara mustard, insects resistance of enzymes called nucleases.
– Bt crops, flavrSavr – Tomato, Golden rice. Choose the correct option regarding above
Biopolymers are polyhydroxybutyrate (PHB), statements
polylactic acid (PLA) and green fluorescent a. I & II b. I & III
protein (GFP) is used to make biosensors. Other c. II & III d. I,II & III
applications are biopharming, bioprospecting, 6.
The process of recombinant DNA
biomedication and biofuel, etc. technology has the following steps
I. amplication of the gene
Evaluation II. Insertion of recombinant DNA into
1. Restriction enzymes are the host cells
a. Not always required in III. Cutting of DNA at specific location
genetic engineering using restriction enzyme .
b. Essential tools in IV. Isolation of genetic material (DNA)
genetic engineering Pick out the correct sequence of step
c. Nucleases that cleave for recombinant DNA technology.
DNA at specific sites a. II, III, IV, I b. IV, II, III, I
d. both b and c c. I, II, III, IV d. IV, III, I, II
2. Plasmids are 7. Which one of the following palindromic
a. circular protein molecules base sequence in DNA can be easily cut
b. required by bacteria at about the middle by some particular
c. tiny bacteria restriction enzymes?
d. confer resistance to antibiotics a. 5 CGTTCG 3 3 ATCGTA 5
b. 5 GATATG 3 3 CTACTA 5
3. EcoRI cleaves DNA at
c. 5 GAATTC 3 3 CTTAAG 5
a. AGGGTT b. GTATATC
d. 5 CACGTA 3 3 CTCAGT 5
c. GAATTC d. TATAGC
8. pBR 322, BR stands for
4. Genetic engineering is
a. Plasmid Bacterial Recombination
a. making artificial genes.
b. Plasmid Bacterial Replication
b. hybridization of DNA of one organism
c. Plasmid Boliver and Rodriguez
to that of the others.
d. Plasmid Baltimore and Rodriguez
c.
production of alcohol by using micro
organisms. 9. Which of the following one is used as a
d. making artificial limbs, diagnostic Biosensors?
instruments such as ECG, EEG etc., a. Electrophoresis b. Bioreactors
c. Vectors d. Electroporation
5. Consider the following statements:
I. Recombinant DNA technology is 10. Match the following :
popularly known as genetic engineering Column A Column B
is a stream of biotechnology which 1 Exonuclease a. add or remove phosphate
deals with the manipulation of genetic 2 Endonuclease b. binding the DNA
fragments
materials by man invitro
3 Alkaline c. cut the DNA at terminus
II. pBR322 is the first artificial cloning Phosphatase
vector developed in 1977 by Boliver 4 Ligase d. cut the DNA at middle
and Rodriguez from E.coli plasmid
III. Restriction enzymes belongs to a class

1 2 3 4 15 An antibiotic gene in a vector usually helps
A) a b c d in the selection of
B) c d b a a) Competent cells b) Transformed cells
C) a c b d c) Recombinant cells d) None of the above
D) c d a b 16 Some of the characteristics of Bt cotton are
11 In which techniques Ethidium Bromide is a) Long fibre and resistant to aphids
used? b) Medium yield, long fibre and resistant
a. Southern Blotting techniques to beetle pests
b. Western Blotting techniques c) high yield and production of toxic protein
c. Polymerase Chain Reaction crystals which kill dipteran pests.
d. Agrose Gel Electroporosis d) High yield and resistant to ball worms
12 Assertion : Agrobacterium tumifaciens 17.
How do you use the biotechnology in
is popular in genetic engineering because modern practice?
this bacteriumis associated with the root 18.
What are the materials used to grow
nodules of all cereals and pulse crops microorganism like Spirulina?
Reason: A gene incorporated in the 19. You are working in a biotechnology lab
bacterial chromosomal genome gets with a becterium namely E.coli. How will
atomatically transferred to the cross with you cut the nucleotide sequence? explain it.
which bacterium is associated. 20. What are the enzymes you can used to
a) Both assertion and reason are true. But cut terminal end and internal phospho di
reason is correct explanation of assertion. ester bond of nucleotide sequence?
b) B oth assertion and reason are true. But
21. Name the chemicals used in gene transfer.
reason is not correct explanation of
assertion. 22.
What do you know about the word
c) Assertion is true, but reason is false. pBR332?
d) Assertion is false, but reason is true. 23. Mention the application of Biotechnology.
e) Both assertion and reason are false. 24.
What are restriction enzyme. Mention
13 Which one of the following is not correct their type with role in Biotechnology.
statement. 25.
Is their any possibilities to transfer a
a) Ti plasmid causes the bunchy top disease suitable desirable gene to host plant
b) Multiple cloning site is known as without vector? Justify your answer.
Polylinker 26. How will you identify a vectors?
c) Non viral method transfection of 27.
Compare the various types of Blotting
Nucleic acid in cell techniques.
d) Polylactic acid is a kind of biodegradable
28. Write the advantages of herbicide tolerant
and bioactive thermoplastic.
crops.
14 An analysis of chromosomal DNA using the
29. Write the advantages and disadvantages of
southern hybridisation technique does not use
Bt cotton.
a) Electrophoresis
b) Blotting 30.
What is bioremediation? give some
c) Autoradiography examples of bioremediation.
d) Polymerase Chain Reaction 31. Write the benefits and risk of Genetically
Modified Foods.

Glossary Plasmid: Extrachromosomal, self-replicating,
3’ Hydroxy end: The hydroxyl group attached circular dsDNA containing some non-essential
to 3’ carbon atom of sugar of the terminal genes.
nucleotide of a nucleic acid. Restriction map: A linear array of sites on DNA
Bacterial artificial chromosomes (BAC): A cleaved by various restriction enzymes.
cloning vector for isolation of genomic DNA Shuttle Vector: A plasmid cloning vector
constructed on the basis of F-factor. that can replicate in two different organisms
Chimeric DNA: A recombinant DNA molecule due to the presence of two different origin of
containing unrelated genes. replication OriEUK and OriE. coli
Cleave: To break phosphodiester bonds of Taq polymerase: A heat stable DNA polymerase
dsDNA, usually with a restriction enzyme. isolated from a thermophilic bacterium Thermus
aquaticus.
Cloning site: A location on a cloning vector
into which DNA can be inserted. Vectors: Vehicles for transferring DNA from
one cell to another.
Cloning: Incorporation of a DNA molecule
into a chromosomal site or a cloning vector. Biofuel: Fuels like hydrogen, ethanol and
methanol produced from a biological source by
Cloning Vector: A small, self-replicating DNA the action of microorganisms.
inserted in a cloning gene.
Bioleaching: Process of using microorganisms
COS sites: The 12-base, single strand, to recover metals from their ores or contaminant
complementary extension of phage lambda (l) environment
DNA.
Bioremediation: Process of using organisms
DNA Polymerase: An enzyme that catalyses the to remove or reduce pollutants from the
phosphodiester bond in the formation of DNA. environment.
Endonucleases: An enzyme that catalyses the Green Technology: Pollution-free technology
cleavage of DNA at internal position, cutting in which pollution is controlled at source.
DNA at specific sites.
Phytoremediation: Use of certain plants to
Genome: The entire complement of genetic remove contaminants or pollutants from the
material of an organism. environment (soil, water or air).
Insert DNA: A DNA molecule incorporated Recombinant: Cell / Organism formed by a
into a cloning vector. recombination of genes.
Ligase: An enzyme used in genetic engineering Transformation: Process of transferring
experiment to join the cut ends of dsDNA. a foreign DNA into a cell and changing its
M-13: AssDNA bacteriophage used as vector genome.
for DNA sequencing. Vector: Agent used in recombinant DNA
Phagemid: A cloning vector that contains technique to carry new genes into foreign cells.
components derived from both phage DNA and Wild Type: Natural form of organisms.
plasmid.

ICT Corner
Principles and Processes of Biotechnology
BIO TECH STUDY APP
Let us know about

the information Bio
Technology through this
activity.
Steps
• Type the URL or scan the QR code to open the activity page.
• Click on the topic to know in detail.
• To know the sub topics in detail click on the dots in top right corner.
Step 1 Step 2 Step 3 Step 4
URL:
https://play.google.com/store/apps/details?id=info.therithal.brainkart.
biotechstudyapp
* Pictures are indicative only

Chapter
5 Plant Tissue Culture
Learning Objectives Growing plant

protoplasts, cells, tissues
The learner will be able to or organs away from
Perceive the concepts of tissue culture. their natural or normal
Cognize the steps of tissue culture environment, under
techniques and its types. artificial condition, is
Understand the protoplast culture in known as Tissue Culture.
detail. It is also known as in vitro Gottlieb
(In vitro is a Latin word, Haberlandt
Elicit the list of secondary metabolites
it means that - in glass
obtained through cell suspension
or in test-tube) growth of plant protoplasts,
culture.
cells, tissues and organs. A single explant can
Learn plant regeneration pathway. be multiplied into several thousand plants in
Appreciate the uses of micro short time period and space under controlled
propagation, somatic hybridization, conditions.
shoot meristem culture and germplasm Tissue culture techniques are often used
conservation. for commercial production of plants as well as
Acquire the knowledge of patenting for plant research. Plant tissue culture serves
Biosafety and Bioethics. as an indispensable tool for regeneration of
transgenic plants. Apart from this some of
Chapter outline the main applications of Plant tissue culture
are clonal propagation of elite varieties,
5.1 Milesones in plant conservation of endangered plants, production
tissue culture of virus-free plants, germplasm preservation,
5.2 Basic concepts in industrial production of secondary metabolites.
plant disuse culture etc., In this chapter let us discuss the history ,
5.3 Plant tissue culture techniques, types , applications of plant tissue
techniques and types culture and get aware on ethical issues.
5.4 Plant regeneration pathway
Gottlieb Haberlandt (1902) the German
5.5 Applications of plant tissue culture
Botanist proposed the concept Totipotency
5.6 Conservation of plant genetic
and he was also the first person to culture plant
resources
cells in artificial conditions using the mesophyll
5.7 Intellectual rights of property (IPR),
cells of Lamium purpureum in culture medium
Biosafety and Bioethics
and obtained cell proliferation. He is regarded
5.8 Future Biotechnology
as the father of tissue culture.
Plant Tissue Culture 107

5.1 Milestones in Plant Tissue Culture
Haberlandt (1902) Yamada et al. (1963)
cultured plant cells in artificial condition produced calli and free cells in tissue
called in vitro (inside glass) in culture culture of Tradescantia reflexa.
medium (Knop’s salt solution) containing
glucose and peptone and developed callus Guha and Maheshwari (1964)
(unorganized growth of cells and tissue) and
proposed the concept Totipotency, it means developed in vitro production of haploid
the development of whole plant from isolated embryos from anthers of Datura.
cells or tissue in in vitro condition.
Vasil and Hildbrandt (1965)
P.R.White (1934) achieved differentiation of tobacco
developed root cultures, used Knop’s solution plants from single, isolated cells in micro
along with three vitamins like pyridoxine, propagation.
thiamine and nicotinic acid
Takebe et al. (1971)
F.C. Steward (1948) regenerated tobacco plants from isolated
used coconut water in plant tissue culture mesophyll protoplasts.
work and obtained cell proliferation from
carrot explants (Cellular totipotency ). Carlson
and co-workers obtained protoplast fusion
Morel and Martin (1952, 1955)
between Nicotiana glauca and Nicotiana
developed virus-free Dahlia and potato longsdorffii and developed first interspecific
plants using shoot meristem culture. somatic hybrid in 1971.
Murashige and Skoog (1962) Melchers and co-workers in 1978

developed intergenic hybrid between potato
formulated tissue culture medium, a land
and tomato called pomato.
mark in plant tissue culture and it is the
most frequently used medium for all kinds of
tissue culture work. Chilton (1983)
produced transformed tobacco plants from

Kanta et al. (1962) single cell transformation and gene insertion.
Horsh et al. (1984)
produced test-tube fertilization in
developed transgenic tobacco by
flowering plants.
Agrobacterium mediated gene transfer.
Knop’s solution: Nutrient solution used in growth experiments of plants which contains:
Calcium nitrate 3.0 g Potassium nitrate 1.0 g Sucrose 50.0 g (optimal)
Magnesium sulfate 1.0 g Dibasic Potassium phosphate 1.0 g Deionized water 1000.0 ml

5.2 Basic concepts of Tissue Culture 5.3 Plant Tissue Culture (PTC)
Basic concepts of plant tissue culture are Plant tissue culture is used to describe the in
totipotency, differentiation, dedifferentiation vitro and aseptic growth of any plant part on a
and redifferentiation. tissue culture medium. This technology is based
Totipotency on three fundamental principles:
• The plant part or explant must be selected
The property of live plant cells that they
have the genetic potential when cultured in and isolated from the rest of plant body.
• The explant must be maintained in controlled
nutrient medium to give rise to a complete
individual plant. physically (environmental) and chemically
defined (nutrient medium) conditions.
Differentiation • Aseptic condition must be maintained,
The process of biochemical and structural Explant: The tissue taken from a selected
which requires high degree of cleanliness in
changes by which cells become specialized in plant transferred to a culture medium often
the laboratory.
form and function. to establish a new plant.
Explant
5.3.1 Laboratory Facilities for PTC
For PTC, the laboratory must have the following
facilities:
Explant in
Nutrient medium
Callus
Plantlet
Early
Late
Embryo
Embryo
Figure 5.1: Totipotency

Figure 5.2: Tissue culture lab
Redifferentiation • Washing facility for glassware and ovens for
The further differentiation of already drying glassware.
differentiated cell into another type of cell. • Medium preparation room with autoclave,
For example, when the component cells of electronic balance and pH meter.
callus have the ability to form a whole plant in
• Transfer area sterile room with laminar
a nutrient medium, the phenomenon is called
air-flow bench and a positive pressure
redifferentiation.
ventilation unit called High Efficiency
Dedifferentiation Particulate Air (HEPA) filter to maintain
The phenomenon of the reversion of mature aseptic condition.
cells to the meristematic state leading to the • Culture facility: Growing the explant
formation of callus is called dedifferentiation. inoculated into culture tubes at 22-28° C
These two phenomena of redifferentiation and with illumination of light 2400 lux, with a
dedifferentiation are the inherent capacities of photoperiod of 8-16 hours and a relative
living plant cells or tissue. This is described as humidity of about 60%.
totipotency.

5.3.2 Technique Involved in PTC iv. Sterilization of Explants: The plant
materials to be used for tissue culture should be
1. Sterilization: surface sterilized by first exposing the material
Sterilization is the technique employed to get in running tap water and then treating it in
rid of microbes such as bacteria and fungi in the surface sterilization agents like 0.1% mercuric
culture medium, vessels and explants. chloride, 70% ethanol under aseptic condition
i. Maintenance of Aseptic Environment: inside the Laminar Air Flow Chamber.
During in vitro tissue culture maintenance of
2. Media Preparation
aseptic environmental condition should be
The success of tissue culture lies in the
followed, i.e., sterilization of glassware, forceps,
composition of the growth medium, plant
scalpels, and all accessories in wet steam
growth regulators and culture conditions
sterilization by autoclaving at 15 psi (121°C)
such as temperature, pH, light and humidity.
for 15 to 30 minutes or dipping in 70% ethanol
No single medium is capable of maintaining
followed by flaming and cooling.
optimum growth of all plant tissues. Suitable
ii. Sterilization of culture room: Floor and
nutrient medium as per the principle of tissue
walls are washed first with detergent and then
culture is prepared and used.
with 2% sodium hypochlorite or 95% ethanol.
MS nutrient medium (Murashige and Skoog
The cabinet of laminar airflow is sterilized by
1962) is commonly used. It has carbon sources,
clearing the work surface with 95% ethanol and
with suitable vitamins and hormones. The media
then exposure of UV radiation for 15 minutes.
formulations available for plant tissue culture
iii. Sterilization of Nutrient Media: Culture
other than MS are B5 medium (Gamborg.et.al
media are dispensed in glass containers, plugged
1968), White medium (white 1943), Nitsch’s
with non-absorbent cotton or sealed with plastic
medium (Nitsch & Nitsch 1969). A medium may
closures and then sterilized using autoclave at
be solid or semisolid or liquid. For solidification,
15 psi (121°C) for 15 to 30 minutes. The plant
a gelling agent such as agar is added.
extracts, vitamins, amino acids and hormones
are sterilized by passing through Millipore filter
Agar: A complex mucilaginous polysaccharide
with 0.2 mm pore diameter and then added
to sterilized culture medium inside Laminar obtained from marine algae (sea weeds) used
Airflow Chamber under sterile condition. as solidifying agent in media preparation.
8QGLIIHUHQWLDWHG
%XG &DOOXVIRUPHG
/HDI 7LVVXHVDPSOH
6WHP
&DOOXV
5RRW &DOOXVVHSDUDWHG
DQGVLQJOHFHOO
)XUWKHUFXOWXULQJ
FXOWXUHG
UHJHQHUDWHGQHZ
Figure 5.3: Basic steps in Plant tissue culture technology SODQWOHW

3. Culture condition
Composition of MS
(Murashige and Skoog) Medium pH
The pH of medium is normally adjusted between
Macronutrients: 5.6 to 6.0 for the best result.
Ammonium nitrate (NH4NO3) 1650.0 mg/l Temperature
Potassium nitrate (KNO3) 1900.0 mg/l The cultures should be incubated normally at
Calcium chloride (CaCl2 2H2O) 440.0 mg/l constant temperature of 25°C ± 2°C for optimal
Magnesium sulphate (MgSO4 6H2O) 370.0 mg/l growth.
Potassium dihydrogen phosphate Humidity and Light Intensity
(KH2PO4) 170.0 mg/l The cultures require 50-60% relative humidity
and 16 hours of photoperiod by the illumination
Micronutrients: of cool white fluorescent tubes of approximately
Manganese sulphate (MnSO4 4H2O) 22.3 mg/l 1000 lux.
Zinc sulphate (ZnSO4 4H2O) 8.6 mg/l Aeration
Boric acid (H3BO3) 6.2 mg/l Aeration to the culture can be provided by
Potassium iodide (KI) 0.83 mg/l shaking the flasks or tubes of liquid culture on
automatic shaker or aeration of the medium by
passing with filter-sterilized air.
Minor nutrient:
Sodium molybdate (Na2 MO4 2H2O) 0.250 mg/l 4. Induction of Callus
Cupric sulphate (CuSO4 5H2O) 0.025 mg/l Explant of 1-2 cm
Cobaltous chloride (CoCl2 6H2O) 0.025 mg/l sterile segment
selected from leaf,
Iron stock stem, tuber or
Na EDTA 37.25 mg/l root is inoculated
Ferrous Sulphate (FeSO4 7H2O) 27.85 mg/l (transferring the
explants to sterile Figure 5.4:
glass tube containing Induction of callus
Vitamins nutrient medium)
Glycine 2.0 mg/l in the MS nutrient medium supplemented
Nicotinic acid 0.5 mg/l with auxins and incubated at 25°C ± 2°C in an
Pyridoxin HCl 0.5 mg/l alternate light and dark period of 12 hours to
Thaiamine HCl 0.1 mg/l induce cell division and soon the upper surface
of explant develops into callus. Callus is a mass
Growth Hormones of unorganized growth of plant cells or tissues
IAA 1.30 mg/l in in vitro culture medium.
Kinetin 0.4–10.0 mg/l 5. Embryogenesis
Myo-inositol 100.0 mg/l
The callus cells undergoes
Sucrose 30.0 g/l
differentiation and produces
somatic embryos, known as
Solidifying Agent Embryoids. The embryoids
Agar 8.0 g/l are sub-cultured to produce Figure 5.5:
plantlets. Embryogenesis

6. Hardening
The plantlets developed in vitro require a
hardening period and so are transferred to
2OGHUOHDYHVDUH
VDUH
greenhouse or hardening chamber and then to RPD
UHPRYHGIURPD
normal environmental conditions. QDWLRQ
FXWWLQJRIFDUQDWLRQ
Hardening is the gradual exposure of in vitro

developed plantlets in humid chambers in
diffused light for acclimatization so as to enable 0DJQLILHGYLHZRI
DJQLILHGYLHZRI 6KRRWWLSZLWKJURZLQJ
6KRRWWLSZ
them to grow under normal field conditions. VKRRWWLSDIWHUUHPRYDO WLSDIWHUUHPRYDORI
RIODUJHUOHDYHV HQFORVLQJOHDYHV
5.3.3 Types of Plant tissue cultures
Based on the explants some other plant tissue
culture types are
1. Organ culture
2. Meristem culture
3. Protoplast culture 3DSHUZLFN &DOOXV 3ODQWOHWV
4. Cell culture.
Figure 5.7: Meristem Culture
1. Organ culture
3. Protoplast Culture:
3ODQW Protoplasts are cells without a cell wall, but
bounded by a cell membrane or plasma
membrane. Using protoplasts, it is possible to
regenerate whole plants from single cells and
,VRODWHGFHOOV
also develop somatic hybrids. The steps involved
/HDI
in protoplast culture.
,VRODWHG i. Isolation of protoplast: Small bits of plant
FHOOV
&HOOVFXOWXUHGLQ
tissue like leaf tissue are used for isolation of
FXOWXUHPHGLXP protoplast. The leaf tissue is immersed in 0.5%
Macrozyme and 2% Onozuka cellulase enzymes
dissolved in 13% sorbitol or mannitol at pH 5.4.
5DLVLQJRISODQWOHWV 3ODQWOHW +DUGHQLQJWRQDWXUDO
HQYLURQPHQW It is then incubated over-night at 25°C. After a
Figure 5.6: Organ Culture gentle teasing of cells, protoplasts are obtained,
and these are then transferred to 20% sucrose
The culture of embryos, anthers, ovaries, roots, solution to retain their viability. They are then
shoots or other organs of plants on culture media. centrifuged to get pure protoplasts as different
2. Meristem Culture: from debris of cell walls.
The culture of any plant meristematic tissue on ii. Fusion of protoplast: It is done through the
culture media. use of a suitable fusogen. This is normally PEG
(Polyethylene Glycol). The isolated protoplast
are incubated in 25 to 30% concentration of
PEG with Ca++ ions and the protoplast shows
agglutination (the formation of clumps of cells)
and fusion.

3ODQWOHWGHULYHG the liquid medium and agitated
IURPSURWRSODVW
/HDI using rotary shaker instrument.
VWHULOL]DWLRQ
The cells are separated from the
callus tissue and used for cell
suspension culture.
<RXQJSODQW
(SLGHUPLV Production of Secondary
'LIIHUHQWLDWLRQ SHHOLQJ
RIFDOOXV
Metabolites
WLVVXH Cell suspension culture can
3HHOHGOHDI
&DOOXV VHJPHQWV be useful for the production
WLVVXH of secondary metabolites like
3ODVPRO\VHG alkaloids, flavonoids, terpenoids,
&OXPS
FHOOV phenolic compounds and
RIFHOOV recombinant proteins. Secondary
metabolites are chemical
&HOOVLQ compounds that are not required
&HOOZDOO HQ]\PHPL[WXUH
UHJHQHUDWLRQ by the plant for normal growth
3ODWLQJRI and development but are produced
:DVKLQJRI
SURWRSODVWV SURWRSODVW in the plant as ‘byproducts’ of
cell metabolism. For Example:
&HOOZDOOGLJHVWLRQ
DQGUHOHDVHRI
Biosynthesis and isolation of indole
,VRODWHG
SURWRSODVW 'HEULV
SURWRSODVW alkaloids from Catharanthus roseus
3URWRSODVW
plant cell culture.
Figure 5.8: Protoplast Culture The process of production
of secondary metabolites can be
iii. Culture of protoplast: MS liquid medium is
scaled up and automated using bio-reactors
used with some modification in droplet, plating
for commercial production. Many strategies
or micro-drop array techniques. Protoplast
such as biotransformation, elicitation and
viability is tested with fluorescein diacetate immobilization have been used to make cell
before the culture. The cultures are incubated in suspension cultures more efficient in the
continuous light 1000-2000 lux at 25°C. The cell production of secondary metabolites. Few
wall formation occurs within 24-48 hours and examples of industrially important plant
the first division of new cells occurs between secondary metabolites are listed below in the
2-7 days of culture. table:
iv. Selection of somatic hybrid cells: The Secondary Plant source Uses
fusion product of protoplasts without nucleus of metabolites
different cells is called a cybrid. Following this Digoxin Digitalis purpuria Cardiac tonic
Codeine Papaver sominiferum Analgesic
nuclear fusion happen. This process is called
Capsaicin Capsicum annum Rheumatic
somatic hybridization. pain
4. Cell Suspension Culture treatment
Vincristine Catharanthus roseus Anti-
The growing of cells including the culture carcinogenic
of single cells or small aggregates of cells Quinine Cinchona officinalis Antimalarial
in vitro in liquid medium is known as cell Table 5.1: Secondary metabolites
suspension culture. The cell suspension is and its plant resources
prepared by transferring a portion of callus to

5.4 Plant Regeneration Pathway 5.4.1 Somatic Embryogenesis
From the explants, plants can be regenerated by Somatic embryogenesis is the formation of
somatic embryogenesis or organogenesis. embryos from the callus tissue directly and
([SODQW these embryos are called Embryoids or from
the in vitro cells directly form pre-embryonic
0HULVWHP
9LUXVIUHHSODQWOHWV cells which differentiate into embryoids.
6KRRWDSH[ Applications
0XOWLSOHVKRRWLQGXFWLRQ • Somatic embryogenesis provides potential
6WHP 1RGH 0LFURSURSDJDWLRQ
plantlets which after hardening period can
/HDI 5RRWLQGXFWLRQ establish into plants.
• Somatic embryoids can be be used for the
5RRW 3ODQWOHWV
production of synthetic seeds.
,QGLUHFW • Somatic embryogenesis is now reported
&DOOXV +DUGHQLQJ
HPEU\RJHQHVLV in many plants such as Allium sativum,
7UDQVIHUWRILHOG Hordeum vulgare, Oryza sativa, Zea mays
'LUHFW 6KRRWLQGXFWLRQ
HPEU\RJHQHVLV and this possible in any plant.
5RRWLQGXFWLRQ
(PEU\RLGV Synthetic seeds are produced by encapsulation
3ODQWOHWV
of embryoids in agarose gel or calcium alginate.
3ODQWOHWV
+DUGHQLQJ 5.4.2 Organogenesis
+DUGHQLQJ
7UDQVIHUWRILHOG
The morphological changes occur in the callus
7UDQVIHUWRILHOG leading to the formation of shoot and roots is
called organogenesis.
Figure 5.9: Flow chart of Plant
regeneration pathway Shoots (Caulogenesis)
Callus Differentiation Plantlets
'LUHFW Roots (Rhizogenesis)

RUJDQRJHQHVLV
5RRWLQJ
• O
rganogenesis can
be induced in vitro
5RRW
RUJDQRJHQHVLV by introducing plant
&DOOXV ,QGLUHFW
RUJDQRJHQHVLV growth regulators in
([SODQWV
the MS medium.
6KRRW
RUJDQRJHQHVLV
• A
uxin and cytokinins
3ODQWOHWV induce shoot and root
5RRWLQJ
formation.
'LUHFW
6RPDWLF ,QGLUHFW6RPDWLFHPEU\RJHQHVLV
HPEU\RJHQHVLV 6RPDWLF
HPEU\R
Figure 5.10: Plant Regeneration Pathway

5.5 Applications of Plant Tissue Culture 0LFURSURSDJDWLRQSURWRFROIRUEDQDQD
Plant tissue culture techniques have several
applications such as: ,QYLWURPLFURSURSDJDWLRQ
i.
Improved hybrids production through RIEDQDQD0XVDVS
somatic hybridization.
ii.
Somatic embryoids can be encapsulated
6XFNHUVVXUIDFHVWHULOL]HGZLWK
into synthetic seeds (synseeds). These 1DR&OIRUPLQXWHV
encapsulated seeds or synthetic seeds help
in conservation of plant biodiversity.
$SLFDOPHULVWHPVZHUHLVRODWHG
iii.
Production of disease resistant plants
FXOWXUHGRQ06EDVDOPHGLXP
through meristem and shoot tip culture. VXSSOHPHQWHGZLWK
iv.
Production of stress resistant plants like %HQ]\ODPLQRSXULQH%$3PJO
herbicide tolerant, heat tolerant plants. DQG,QGROH$FHWLF$FLG,$$PJO
v.
Micropropagation technique to obtain
large numbers of plantlets of both crop and ,QGXFWLRQRIVKRRWVZLWKLQGD\V
tree species useful in forestry within a short
span of time and all through the year.
.LQHWLQPJODQG1DSWKDOHQH$FHWLF$FLG
vi. Production of secondary metabolites from 1$$PJOIRUURRWLQGXFWLRQ
cell culture utilized in pharmaceutical,
cosmetic and food industries.
$FFOLPDWL]DWLRQLQSRO\KRXVH
Somaclonal variations: Somatic variations
found in plants regenerated in vitro (i.e. )ROORZHGE\VKDGHKRXVHXQGHU
variations found in leaf, stem, root, tuber or OLJKWIRUKDUGHQLQJSURFHVV
propagule)
Gametoclonal variations: Gametophytic 7HVWHGIRUJHQHWLFXQLIRUPLW\
variations found in plants regenerated in
vitro gametic origin (i.e. variations found in
7UDQVIHUUHGWRILHOG
gametes and gametophytes)
5.5.1 Micropropagation of Banana 5.5.2 Artificial Seed

Micropropagation of plants at industrial level Artificial seeds or synthetic seeds (synseeds)
maintains high standards of homogeneity in are produced by using embryoids (somatic
plants like pineapple, banana, strawberry and embryos) obtained through in vitro culture.
potato. They may even be derived from single cells
from any part of the plant that later divide to
form cell mass containing dense cytoplasm,
large nuclceus, starch grains, proteins, and oils
etc., To prepare the artificial seeds different
inert materials are used for coating the somatic
embryoids like agrose and sodium alginate.
Figure 5.11: Micropropagation of Banana

Artificial seed coat Protocol for virus free meristem tip culture
Artificial endosperm
Somatic Embryo
Apical meristem tip with 1 or 2 leaf
primordia are excised in sterile
condition froms the explant
In vitro culture in 10ml of solid MS medium

supplemented with growth hormones
Figure 5.12: Artificial seeds
Advantages of Artificial seeds Cultures are maintained at 24±1ºC in
dark for 3 days followed by normal
Artificial seeds have many advantages over the illumination of 2400Lux
true seeds
• Millions of artificial seeds can be produced Plantlets developed from meristem-
at any time at low cost. tip culture after organogenesis process,
• They provide an easy method to produce transferred to hardening process
genetically engineered plants with desirable
traits. Transferred to field condition
• It is easy to test the genotype of plants.
• They can potentially stored for long time Figure 5.14: Protocol for virus
under cryopreservation method. free meristem culture
• Artificial seeds produce identical plants
• The period of dormancy of artificial seeds is
5.6 Conservation of plant genetic
greatly reduced, hence growth is faster with
resources
a shortened life cycle. 5.6.1 Germplasm Conservation
5.5.3 Virus-free plants Germplasm conservation refers to the
The field grown plants like perennial crops, conservation of living genetic resources
usually are infected by variety of pathogens like pollen, seeds or tissue of plant material
like fungi, bacteria, mycoplasma, viruses which maintained for the purpose of selective plant
cause considerable economic losses. Chemical breeding, preservation in live condition and
methods can be used to control fungal and used for many research works.
bacterial pathogens, but not viruses generally. Germplasm conservation resources is a
Shoot meristem tip culture is the method part of collection of seeds and pollen that are
to produce virus-free plants, because the shoot stored in seed or pollen banks, so as to maintain
meristem tip is always free from viruses. their viability and fertility for any later use
such as hybridization and crop improvement.
Germplasm conservation
may also involve a
gene bank, DNA bank
of elite breeding lines
of plant resources for
the maintenance of
biological diversity and
Figure 5.13: Shoot tip - Apical Meristem also for food security. Figure 5.15: Seed bank

5.6.2 Cryopreservation (–195.C) like patents, copyrights, trade secrets and
Cryopreservation, trademarks, designs and geographical
also known as indications.
Cryo-conservation,
is a process by Patent
which protoplasts, Trade
Trademark
cells, tissues, Secrets
organelles, organs, Figure 5.16: Cryopreservation
extracellular matrix, enzymes or any other IPR IN
biological materials are subjected to preservation
Geographical INDIA Copyright
Indication
by cooling to very low temperature of –196°C
using liquid nitrogen. At this extreme low Plant
Utility/Model Breeders
temperature any enzymatic or chemical activity Design right
of the biological material will be totally stopped
and this leads to preservation of material in Figure 5.17: IPR in India
dormant status. Later these materials can be
activated by bringing to room temperature slowly 5.7.1 Patents
for any experimental work. • It is a special right to the discoverer/inventor
Protective agents like dimethyl sulphoxide, that has been granted by the government
glycerol or sucrose are added before through legislation for trading new articles.
cryopreservation process. These protective • A patent is a personal property which
agents are called cryoprotectants, since they can be licensed or sold by the person or
protect the cells, or tissues from the stress of organisation just like any other property.
freezing temperature. • Patent terms give the inventor the rights to
exclude others from making, using or selling
5.7 Intellectual Property Right (IPR) his invention.
Intellectual property right (IPR) is a category • It is difficult to keep secret certain inventions
of property that includes intangible creation and therefore, guidance should be obtained
of the human intellect, and primarily consists from a qualified patent attorney.
of copyrights, patents, and trademarks. It also • A patent consists of three parts: the grant,
includes other types of rights, such as trade specifications and claims.
secrets, publicity rights, moral rights, and rights • The grant is filled at the patent office which
against unfair competition. is not published. It is a signed document,
• In biotechnology, the transformed actually the agreement that grants patent
microorganisms and plants and technologies right to the inventor.
for the production of commercial products • The specification and claims are published
are exclusively the property of the discoverer. as a single document which is made public
• The discoverer has the full rights on his from the patent office. The specification part
property. It should not be neglected by the is narrative in which the subject matter of
others without legal permission. invention is described as how the invention
• The right of discoverer must be protected was carried out.
and it does by certain laws framed by a • The claim specifically defines the scope of
country. the invention to be protected by the patent
• The IPR is protected by different ways which the others may not practice.

General Steps in Patenting Potential risks and consideration for safety
aspects
Discovery / Invention
• Pathogenicity of living organisms and
viruses - natural and genetically modified
Primary appraisal - to infect humans, animals and plants to
cause diseases.
Filing patent Assessment • Toxicity of allergy associated with microbial
in the office of production.
Controller of • Increasing number of antibiotic resistant
Patents License negotiation pathogenic microorganisms.
• Problems associated with the disposal of
Further patenting abroad spent microbial biomass and purification of
effluent from biotechnological process.
• Safety aspects associated with contamination,
Grant / refusal of patent
infection or mutation of process strains.
• Safety aspects associated with the industrial
Enforcement of approved patent use of microorganisms containing in vitro
recombinants.
5.7.2 Biosafety and Bioethics
Biosafety guidelines are being implemented
Advances in biotechnology and their by:
applications are mostly associated with • The Institutional Bio-safety Committees
controverisies. This is because the major part (IBSCs) monitor the research activity at
of the modern biotechnology deals with genetic institutional level.
manipulations. ELSI which represents ethical, • The Review Committee on Genetic
legal and social implications of biotechnology Manipulation (RCGM) functioning in
broadly covers the relationship between the Department of Biotechnology (DBT)
biotechnology and society with particular monitors the risky research activities in the
reference to ethical and legal aspects. laboratories.
Biosafety • The Genetic Engineering Approval
Committee (GEAC) of Ministry of
Biosafety is the prevention of large-scale loss of
Environment and Forest has the power
biological integrity, focusing both on ecology and
to permit the use of Genetically Modified
human health. These prevention mechanisms
Organism (GMO) at commercial level and
include conduction of regular reviews of the
open field trials of transgenic materials
biosafety in laboratory settings, as well as strict
including agricultural crops, industrial
guidelines to follow. Biosafety is used to protect
products and health care products.
from harmful incidents. Many laboratories
handling biohazards employ an ongoing risk Bioethics - Ethical, Legal and Social
management assessment and enforcement Implications (ELSI)
process for biosafety. Failures to follow such Bioethics refers to the study of ethical issues
protocols can lead to increased risk of exposure emerging from advances in biology and
to biohazards or pathogens. Human error and medicine. It is also a moral discernment
poor techniques contribute to unnecessary as it relates to medical policy and practice.
exposure to hazards and compromise the best Bioethicists are concerned with the ethical
safeguards set into place for protection. questions that arise in the relationships among

life sciences, biotechnology and medicine. It and recombinants in research and industrial
includes the study of values relating to primary production. The GEAC is also responsible for
care and other branches of medicine. approval of proposals relating to release of
The scope of bioethics is directly related to genetically engineered organisms and products
biotechnology, including cloning, gene therapy, into the environment including experimental
life extension, human genetic engineering, field trials (Biosafety Research Level trial-I and
astroethics life in space, and manipulation of II known as BRL-I and BRL-II).
basic biology through altered DNA, RNA and
5.8 Future of Biotechnology
proteins. These developments in biotechnology
will affect future evolution, and may require Biotechnology has become a comprehensive
new principles, such as biotic ethics, that values scientific venture from the point of academic
life and its basic biological characters and and commercial angles, within a short time with
structures. the sequencing of human genome and genome
The Ethical, Legal, and Social Implications of some important organisms. The future
(ELSI) program was founded in 1990 as an developments in biotechnology will be exciting.
integral part of the Human Genome Project. The Thus the development in biotechnology will lead
mission of the ELSI program was to identify and to a new scientific revolution that would change
address issues raised by genomic research that the lives and future of people. Like industrial
would affect individuals, families, and society. and computer revolution, biotechnological
A percentage of the Human Genome Project revolution will also promise major changes in
budget at the National Institutes of Health and many aspects of modern life.
the U.S. Department of Energy was devoted to
ELSI research. Summary
Ethical issues in Genomic Research Tissue culture is the in vitro asceptic culture of
• Privacy and fairness in the use of genetic cells, tissues or organs into whole plants under
information, including the potential for controlled nutritional and environmental
genetic discrimination in employment and conditions. A German physiologist Gotllieb
insurance. Haberlant in 1902 for the first time attempted
• The integration of new genetic technologies, to culture plant cells in artificial medium,
such as genetic testing, into the practice of hence he was regarded as father of Tissue
clinical medicine. culture. Tissue culture mainly based on
• Ethical issues surrounding the design and the concepts totipotency, differentiation,
conduct of genetic research with people, redifferentiation and dedifferentiation. Plant
including the process of informed consent. tissue culture technique involves selection
of explants, sterilization, media preparation,
Genetic Engineering Appraisal Committee maintaining culture condition, callus formation,
(GEAC) embryogenesis or organgenesis and hardening.
GEAC is an apex body under Ministry of Based on the explants chosen the types of tissue
Environment, Forests and Climate change culture are organ culture, meristem culture,
for regulating manufacturing, use, import, protoplast culture and cell suspension culture.
export and storage of hazardous microbes or From the explants, plants can be regenerated
genetically modified organisms (GMOs) and by somatic embryogenesis or organgenesis is
cells in the country. It was established as an apex said to be plant regeneration pathway. Some
body to accord approval of activities involving of the main applications of tissue culture are
large scale use of hazardous microorganisms

production of somatic hybrids, artificial seeds, 3. Match the following :
disease resistant and stress resistant plants, Column A Column B
germplasm conservation, micropropagation 1) Totipotency A) Reversion of
and production of secondary metabolites. mature cells into
Intellectual Property Right (IPR) is primarily meristerm
aimed at patents, copyrights, trade secret and 2) Dedifferentiation B) Biochemical
trademark given to the discoverer / inventor and structural
for the commercial production of transformed changes of cells
micro organisms or plants. Biosafety is the 3) Explant C) Properties
prevention mechanism to protect harmful of living cells
incidents due to biohazards or pathogens. develops into
Bioethics dealt with ethical issue emerging from entire plant
biotechnological advancement. ELSI program 4) Differentiation D) Selected plant
addresses issues related to genenomic research. tissue transferred
to culture
GEAC (Genetic Engineering Appraisal
medium
Committee) is a regulatory authority for release 1 2 3 4
of genetically modified products or organisms
a) C A D B
into the environment.
b) A C B D
c) B A D C
Evaluation d) D B C A
Choose the correct answer 4. The time duration for sterilization process by
from the given option: using autoclave is ______ minutes and the
1. Totipotency refers to temperature is _______
a)
capacity to generate a) 10 to 30 minutes and 125° C
genetically identical b) 15 to 30 minutes and 121° C
plants. c) 15 to 20 minutes and 125° C
b) capacity to generate a whole plant from d) 10 to 20 minutes and 121° C
any plant cell / explant. 5. Which of the following statement is correct
c) capacity to generate hybrid protoplasts. a) Agar is not extracted from marine algae
d) recovery of healthy plants from diseased such as seaweeds.
plants. b) Callus undergoes differentiation and
2. Micro propagation involves produces somatic embryoids.
a)
vegetative multiplication of plants by c) Surface sterilization of explants is done
using micro-organisms. by using mercuric bromide
d) PH of the culture medium is 5.0 to 6.0
b)
vegetative multiplication of plants by
6. Select the incorrect statement from given
using small explants. statement
c)
vegetative multiplication of plants by a) A tonic used for cardiac arrest is obtained
using microspores. from Digitalis purpuria
d) Non-vegetative multiplication of plants b) Medicine used to treat Rheumatic pain
by using microspores and megaspores. is extracted from Capsicum annum

c) An anti malarial drug is isolated from 13. Write the various steps involved in cell
Cinchona officinalis. suspension culture.
d) Anti-cancinogenic property is not seen in 14. What do you mean Embryoids? Write its
application.
Catharanthus roseus.
7. Virus free plants are developed from 15. Give the examples for micro propagation
performed plants .
a) Organ culture
16. Explain the basic concepts involved in
b) Meristem culture
plant tissue culture.
c) Protoplast culture
17. Based on the material used, how will you
d) Cell suspension culture
classify the culture technology? Explain it.
8. The prevention of large scale loss of biological
interity 18. Give an account on Cryopreservation.
a) Biopatent b) Bioethics 19. What do you know about Germplasm
conservation. Describe it.
c) Biosafety d) Biofuel
9. Cryopreservation means it is a process to 20. Write the protocol for artificial seed
preserve plant cells, tissues or organs preparation.
a) at very low temperature by using ether.
b) at very high temperature by using liquid Glossary
nitrogen
Aseptic condition: Preparation of materials
c) at very low temperature of -196 by using free from microbes in in vitro cultures.
liquid nitrogen
Cell Culture: Growing of cells in vitro, including
d) at very low temperature by using liquid the culture of single cells or small aggregates of
nitrogen cells in a liquid medium.
10. Solidifying agent used in plant tissue culture is
Chemically defined medium: A nutritive
a) Nicotinic acid
medium used for culturing cells or tissue; each
b) C
obaltous chloride chemical of this medium is known and defined;
c) EDTA
Cybrid: Cytoplasmic hybrid obtained by
d) Agar the fusion of cytoplasm of cells of different
11. What is the name of the process given parental sources; a term applied to the fusion of
below? Write its 4 types. cytoplasms of two different protoplasts;
8QGLIIHUHQWLDWHG
Organogenesis: The process of initiation and
%XG &DOOXVIRUPHG
/HDI 7LVVXHVDPSOH
development of shoot or root though in vitro
6WHP
culture particularly from callus
&DOOXV
5RRW &DOOXVVHSDUDWHG
DQGVLQJOHFHOO
)XUWKHUFXOWXULQJ
FXOWXUHG
UHJHQHUDWHGQHZ
SODQWOHW
12. How will you avoid the growing of

microbes in nutrient medium during
culture process? What are the techniques
used to remove the microbes?

Chapter
6 Principles of Ecology
Learning Objectives • How soil, climate and other physical features

affect the flora and fauna or vice versa?
The learner will be able to
These questions can be better answered with
Understand the interaction between the study of ecology.
organisms and their
Ecology is essentially a practical science
environment.
involving experiments, continuous
Describe biotic and observations to predict how organisms react
abiotic factors that to particular environmental circumstances
influence the dynamics of and understanding the principles involved in
populations. ecology.
Describe how organisms
adapt themselves to environmental changes. 6.1 Ecology
Learn the structure of various fruits and The term “ecology”
seeds related to their dispersal mechanism. (oekologie) is derived from
two Greek words – oikos
(meaning house or dwelling
Chapter outline place and logos meaning
study) It was first proposed by R. Misra
6.1 Ecology
Reiter (1868). However, the
6.2 Ecological factors
most widely accepted definition of ecology was
6.3 Ecological adaptations given by Ernest Haeckel (1869).
6.4 Dispersal of seeds and fruits
Alexander von Humbolt - Father of Ecology
Ecology is a division of biology which deals Eugene P. Odum - Father of morden Ecology
with the study of environment in relation to
R. Misra - Father of Indian Ecology
organisms. It can be studied by considering
individual organisms, population, community,
biome or biosphere and their environment. 6.1.1 Definitions of ecology
While observing our different environments, “The study of living organisms, both plants and
one can ask questions like animals, in their natural habitats or homes.”
- Reiter (1885)
• Why do plants or animals vary with places?
“Ecology is the study of the reciprocal
• What are the causes for variation in relationship between living organisms and their
biological diversity of different places? environment.” - Earnest Haeckel (1889)
TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_136 -161 CH 06.indd 122 02-03-2019 12:22:04

6.1.2 Ecological hierarchy habitat and niche of any organism is called
The interaction of Ecotope
Biosphere
organisms with their
The differences between habitat and niche are
environment results in Biome as follows.
the establishment of
grouping of organisms Landscape
Habitat Niche
which is called ecological 1. A specific A functional space
hierarchy or ecological Ecosystem physical space occupied by an
levels of organization. occupied by organism in the same
The basic unit of an organism eco-system
Community
ecological hierarchy is (species)
an individual organism. 2. Same habitat A single niche is
Population
The different hierarchy may be shared by occupied by a single
of ecological systems is many organisms species
Individual organism
illustrated below: (species)
3. Habitat Organisms may
6.1.3 Branches of Ecology:
specificity is change their niche
Ecology is mainly divided into two branches, exhibited by with time and season.
they are autecology and synecology. organism.
1. Autecology is the ecology of an individual Table 6.1: Difference between habitat and niche
species and is also called species ecology.
2. Synecology is the ecology of a population or Applied ecology or
community with one or more species and also environmental technology :
called as community ecology. Application of the
Many advances and developments in the field Science of ecology is
ecology resulted in various new dimensions otherwise called as Applied ecology or
and branches. Some of the advanced fields are Environmental technology. It helps us to
Molecular ecology, Eco technology, Statistical manage and conserve natural resources,
ecology and Environmental toxicology. particularly ecosystems, forest and wild
6.1.4 Habitat and Niche life conservative and management.
Environmental management involves
Habitat Bio-diversity conservation, Ecosystem
Habitat is a specific physical place or locality restoration, Habitat management,
occupied by an organism or any species which Invasive species management, Protected
has a particular combination of abiotic or areas management and also help us plan
environmental factors. But the environment of landscapes and environmental impact
any community is called Biotope. designing for the futuristic ecology.
Niche
An ecological niche refers to an organism’s place 6.1.5 Ecological equivalents
in the biotic environment and its functional Taxonomically different species occupying
role in an ecosystem. The term was coined by similar habitats (Niches) in different geographical
the naturalist Roswell Hill Johnson but Grinell regions are called Ecological equivalents.
(1917) was probably first to use this term. The
Principles of Ecology 123

Examples:
•
Certain species of epiphytic orchids of Sun light
Western Ghats of India differ from the Precipitation
epiphytic orchids of South America. But

they are epiphytes.
Carbon
•
Species of the grass lands of Western Ghats dioxide and
Water vapour Climatic factors
of India differ from the grass species of Wind
temperate grass lands of Steppe in North
America. But they are all ecologically
primary producers and fulfilling similar
roles in their respective communities. Biotic factors
Grazing animals
Birds
Rodents
6.2 Ecological factors Insects
Man
Plant Pathogens
Epiphytes
Many organisms, co-exist in an environment. Soil slope Edaphic factors
The environment (surrounding) includes Soil water Minerals
physical, chemical and biological components.

Physical nature
When a component surrounding an organism of the soil
Soil air
affects the life of an organism, it becomes a
factor. All such factors together are called Figure 6.1: Environmental factors affecting a plant
environmental factors or ecological factors. a. Light
These factors can be classified into living Light is a well known factor needed for the
(biotic) and non-living (abiotic) which make basic physiological processes of plants, such as
the environment of an organism. However the photosynthesis, transpiration, seed germination
ecological factors are meaningfully grouped and flowering. The portion of the sunlight which
into four classes, which are as follows: can be resolved by the human eye is called
i. Climatic factors visible light. The visible part of light is made-
ii. Edaphic factors up of wavelength from about 400 nm (violet)
to 700 nm (red). The rate of photosynthesis is
iii. Topographic factors
maximum at blue (400 – 500 nm) and red (600 –
iv. Biotic factors 700 nm). The green (500 – 600 nm) wave length
We will discuss the above factors in a concise of spectrum is less strongly absorbed by plants.
manner.
Effects of light on plants
Flowers of poppy, chicory,
dog rose and many other
esis Light regulates St
nth
plants, blossom before the Pho
t osy
Le
af
for
em
an
d ma d
an a
break of dawn (4 – 5 am), g at tio
eds
nin m
n
to n
rmatio
e s
Op
f se
evening primrose open up with the onset of

Ru
Pr
ing
ts
od
nn
no
en
os
uc
Cl
fo
er
em
of dusk (5 – 6 pm) due to diurnal rhythm.

atio
tio
n
Tuber
ov
Floweri
n
in
M
rm
Ge
6.2.1 Climatic Factors

Climate is one of the important natural factors
controlling the plant life. The climatic factors
includes light, temperature, water, wind and Figure 6.2: Various effects of light upon a
fire. green plant

Based on the tolerance to intensities of light, 1. Eurythermal: Organisms which can tolerate
the plants are divided into two types. They are a wide range of temperature fluctuations.
1. Heliophytes - Light loving plants. Example: Zostera (A marine Angiosperm) and

Example: Angiosperms. Artemisia tridentata.
2. Sciophytes - Shade loving plants. 2. Stenothermal: Organisms which can

Example: Bryophytes and Pteridophytes. tolerate only small range of temperature
variations. Example: Mango and Palm
In deep sea (>500m), the environment is (Terrestrial Angiosperms).
dark and its inhabitants are not aware of the
Mango plant donot and cannot grow in
existence of celestial source of energy called
Sun. What, then is their source of energy? temperate countries like Canada and Germany.
Thermal Stratification
Palaeoclimatology–Helps to It is usually found in aquatic habitat. The
reconstruct past climates of change in the temperature profile with
our planet and flora, fauna increasing depth in a water body is called
and ecosystem in which they thermal stratification. There are three kinds
lived. Example: Air bubbles trapped in ice of thermal stratifications.
for tens of thousands of years with fossilized
pollen, coral, plant and animal debris.
Epilimnion
b. Temperature
Metalimnion
Temperature is one of the important factors
which affect almost all the metabolic activities Hypolimnion
of an organism. Every physiological process in
an organism requires an optimum temperature
at which it shows the maximum metabolic rate. Figure 6.3: Thermal stratification of pond
Three limits of temperature can be recognized 1. Epilimniotn – The upper layer of warmer
for any organism. They are water.
Minimum temperature - Physiological
1. 2. Metalimnion – The middle layer with a
activities are lowest. zone of gradual decrease in temperature.
Optimum temperature - Physiological
2. 3. Hypolimnion - The bottom layer of colder
activities are maximum. water.
Maximum temperature - Physiological
3.
Temperature based zonation
activities will stop.
Variations in latitude and altitude do affect the
Based on the temperature prevailing in
temperature and the vegetation on the earth
an area, Raunkiaer classified the world’s
surface. The latitudinal and altitudinal zonation
vegetation into the following four types. They
of vegetation is illustrated below:
are megatherms, mesotherms, microtherms and
hekistotherms. In thermal springs and deep sea Latitude: Latitude is an angle which ranges
hydrothermal vents where average temperature from 00 at the equator to 900 at the poles.
exceed 100oc.
Altitude: How high a place is located above
Based on the range of thermal tolerance,
organisms are divided into two types. the sea level is called the altitude of the place.

c. Water
Water is one of the most important climatic
Ice/ Tund
r
factors. It affects the vital processes of all living
Snow a
organisms. It is believed that even life had
st s
re ou
e
lin
originated only in water during the evolution of

fo er
s
nif
e
ou
Tre
Co
i du st Earth. Water covers more than 70% of the earth’s

ec e
D for
and surface. In nature, water is available to plants in
ssl rt
Gra dese three ways. They are atmospheric moisture,
or
EQUATOR
ical
Trop rest precipitation and soil water.
f o
rain
Figure 6.4: Latitudinal zonation of vegetation Evergreen forests – Found

type where heavy rainfall occurs
throughout the year.
14,500' Snow
12,000' Tundra
13,000' Sclerophyllous forests –
10,000'
Found where heavy rainfall occurs during
Coniferous
forest
winter and low rainfall during summer.
7500'
6500'
Deciduous forest The productivity and distribution of plants depend
4000' 3000'
1800' Grassland or desert 1300' upon the availability of water. Further the quality
Tropical rain forest of water is also important especially for the aquatic
Figure 6.5: Altitudinal zonation of vegetation organisms. The total amount of water salinity in
different water bodies are :i).5% in inland water
Timber line / Tree line : It is an imaginary (Fresh water) ii).30 – 35% in sea water and iii).
line in a mountain or higher areas of land More than 100% in hypersaline water (Lagoons)
that marks the level above which trees do Based on the range of tolerance of salinity,
not grow. The altitudinal limit of normal tree organisms are divided into two types.
growth is about 3000 to 4000m. 1. Euryhaline: Organisms which can live in
water with wide range of salinity. Examples:
Effects of temperature
Marine algae and marina angiosperms
The following physiological processes are
2. Stenohaline: Organisms which can withstand
influenced by temperature:
only small range of salinity. Example: Plants of
•
Temperature affects the enzymatic action estuaries.
of all the bio-chemical reactions in a plant Environmental
body. Terminology
factor
•
It influences CO2 and O2 solubility in the Stenothermal Eurythermal Temperature
biological systems. Increases respiration Stenohaline Euryhaline Salinity
and stimulates growth of seedlings. Stenoecious Euryoecious Habitat selection
•
Low temperature with high humidity can (niche)
spread diseases to plants.
Stenohydric Euryhydric Water
•
The varying temperature with moisture
Stenophagic Euryphagic Food
determines the distribution of the
Stenobathic Eurybathic Depth of water /
vegetation types.
habitat
Table 6.2: Tolerance of Environmental factor

Examples of tolerance to toxicity Effects of wind
i. Soyabean and tomato manage to tolerate • Wind is an important factor for the
presence of cadmium poisoning by isolating formation of rain
cadmium and storing into few group of cells • Causes wave formation in lakes and ocean,
and prevent cadmium affecting other cells . which promotes aeration of water
ii. Rice and Eichhornia (water hyacinth ) tolerate • Strong wind causes soil erosion and reduces
cadmium by binding it to their proteins. soil fertility
These plants otherwise can also be used to • Increases the rate of transpiration
remove cadmium from contaminated soil ,this • Helps in pollination in anemophilous plants
is known as Phytoremediation. • It also helps in
dispersal of many
d. Wind
fruits, seeds, spores,
Air in motion is called wind. It is also a
etc.
vital ecological factor. The atmospheric air
• Strong wind may
contains a number of gases, particles and
cause up-rooting of
other constituents. The composition of gases
big trees
in atmosphere is as follows: Nitrogen -78% ,
• Unidirectional
Oxygen -21%, Carbon-di-oxide -0.03%, Argon
wind stimulates the
and other gases - 0.93%. The other components
development of flag Figure 6.6: Flag
of wind are water vapour, gaseous pollutants,
forms in trees. form in trees
dust, smoke particles, microorganisms,
pollen grains, spores, etc. Anemometer is the e. Fire
instrument used to measure the speed of wind. Fire is an exothermic factor caused due to the
chemical process of combustion, releasing heat
Green House Effect
and light. It is mostly man-made and some-
Albedo Effect
times develops naturally due to the friction
Gases let out to atmosphere between the tree surfaces. Fire is generally
causes climatic change. divided into
Emission of dust and aerosols (small solids 1. Ground fire – Which is flameless and
or liquid particles in suspension in the subterranean.
atmosphere) from industries, automobiles, 2. Surface fire – Which consumes the herbs
forest fire, So2 and DMS (dimethyl sulphur) and shrubs.
play an important role in disturbing the 3. Crown fire – Which burns the forest canopy.
temperature level of any region. Aerosols Effects of fire
with small particles is reflecting the
• Fire has a direct lethal effect on plants
solar radiation entering the atmosphere.
• Burning scars are the suitable places for the
This is known as Albedo effect. So it
entry of parasitic fungi and insects
reduces the temperature (cooling) limits,
• It brings out the alteration of light, rainfall,
photosynthesis and respiration. The
nutrient cycle, fertility of soil, pH, soil flora
sulphur compounds are responsible for
and fauna
acid rain due to acidification of rain water
and destroy the ozone. • Some fungi which grow in soil of burnt areas
called pyrophilous.
Example: Pyronema confluens.

Soil types
Indicators of fire – Pteris ( fern ) and
Pyronema (fungus) indicates the burnt up Based on soil formation (pedogenesis),
and fire disturbed areas. So they are called the soils are divided into
indicators of fire. 1. Residual soils –These are soils formed by
weathering and pedogenesis of the rock.
Fire break – It is a gap made in the vegetation
2. Transported soils – These are transported
that acts as a barrier to slow down or stop the
by various agencies.
progress of fire.
The important edaphic factors which affect
A natural fire break may occur when there vegetation are as follows:
is a lack of vegetation such as River, lake and
1. Soil moisture: Plants absorbs rain water
canyon found in between vegetation may act
and moisture directly from the air
as a natural fire break.
2. Soil water: Soil water is more important
Rhytidome: It is the structural defense by than any other ecological factors affecting the
plants against fire .The outer bark of trees distribution of plants. Rain is the main source
which extends to the last formed periderm is of soil water. Capillary water held between
called Rhytidome. It is composed of multiple pore spaces of soil particles and angles
layers of suberized periderm, cortical and between them is the most important form of
phloem tissues. It protects the stem against water available to the plants.
fire , water loss, invasion of insects and 3. Soil reactions: Soil may be acidic or
prevents infections by microorganisms. alkaline or neutral in their reaction. pH value
of the soil solution determines the availability
6.2.2 Edaphic factors of plant nutrients. The best pH range of the soil
Edaphic factors, the abiotic factors related for cultivation of crop plants is 5.5 to 6.8.
to soil, include the physical and chemical 4. Soil nutrients: Soil fertility and productivity
composition of the soil formed in a particular is the ability of soil to provide all essential
area. The study of soils is called Pedology. plant nutrients such as minerals and organic
The soil nutrients in the form of ions.
Soil is the weathered superficial layer of the 5. Soil temperature: Soil temperature of an
Earth in which plants can grow. It is a complex area plays an important role in determining
composite mass consisting of soil constituents, the geographical distribution of plants. Low
soil water, soil air and soil organisms, etc. temperature reduces use of water and solute
absorption by roots.
Soil formation
6. Soil atmosphere: The spaces left between
Soil originates from rocks and develops gradually soil particles are called pore spaces which
at different rates, depending upon the ecological contains oxygen and carbon-di-oxide.
and climatic conditions. Soil formation is
7. Soil organisms: Many organisms existing
initiated by the weathering process. Biological
in the soil like bacteria, fungi, algae,
weathering takes place when organisms like
protozoans, nematodes,
bacteria, fungi, lichens and plants help in the
insects, earthworms, etc. are
breakdown of rocks through the production of
called soil organisms.
acids and certain chemical substances.

Horizon Description
O–Horizon It consists of fresh or partially decomposed
(Organic horizon) organic matter.
Humus O1 – Freshly fallen leaves, twigs, flowers and fruits
O2 – Dead plants, animals and their excreta
decomposed by micro-organisms.
Usually absent in agricultural and deserts.
A–Horizon It consists of top soil with humus, living creatures
(Leached horizon) and in-organic minerals.
Topsoil - Often rich in A1 – Dark and rich in organic matter because of
humus and minerals. mixture of organic and mineral matters.
A2 – Light coloured layer with large sized mineral
particles.
B-Horizon It consists of iron, aluminium and silica rich clay
(Accumulation horizon) organic compounds.
(Subsoil-Poor in humus,
rich in minerals)
C - Horizon (Partially It consists of parent materials of soil, composed
weathered horizon) of little amount of organic matters without life
Weathered rock forms.
Fragments - Little or no
plant or animal life.
R – Horizon It is a parent bed rock upon which underground
(Parent material) water is found .
Bedrock
Figure 6.7: Soil Profile
Soil Profile
Loamy soil is ideal soil for cultivation. It
Soil is commonly stratified into horizons at
consists of 70% sand and 30% clay or silt or both.
different depth. These layers differ in their
physical, chemical and biological properties. It ensures good retention and proper drainage
This succession of super-imposed horizons is of water. The porosity of soil provides adequate
called soil profile. aeration and allows the penetration of roots.
Types of soil particles Based on the water retention, aeration and
Based on the relative proportion of soil particles, mineral contents of soil, the distribution of
four types of soil are recognized. vegetation is divided into following types.
Soil type Size Relative proportion 1. Halophytes: Plants living in saline soils
1 Clayey Less than 50% clay and 50% 2. Psammophytes: Plants living in sandy soils
soil 0.002 silt ( cold / heavy 3. Lithophytes: Plants living on rocky surface
mm soil )
4. Chasmophytes: Plants living in rocky crevices
2 Silt soil 0.002 to 90% silt and 10%
0.02mm sand 5. Cryptophytes: Plants living below the soil
3 Loamy 0.002 to 70% sand and 30 surface
soil 2mm % clay / silt or both 6. Cryophytes: Plants living in ice surface
(Garden soil) 7. Oxylophytes: Plants living in acidic soil
4 Sandy 0.2 to 2 85% sand and 15% 8. Calciphytes: Plants living in calcium rich
soil mm clay ( light soil )
alkaline soil.
Table 6.3: Types of soil particles

Hollard –Total soil water content Ecotone - The transition zone between two
Chresard –Water available to plants ecosystems. Example: The border between
Echard – Water not available to plants forest and grassland.
Edge effect – Those species are found in
6.2.3 Topographic factors the ecotone areas are due to the effect of
The surface features of earth are called environment of the two habitats. This is called
topography. Topographic influence on the edge effect. Example: Owl in the ecotone area
climate of any area is determined by the between forest and grassland.
interaction of solar radiation, temperature,
The two faces of the mountain or hill receive
humidity, rainfall, latitude and altitude. It affects
different amount of solar radiation, wind action
the vegetation through climatic variations in
and rain. Of these two faces, the windward region
small areas (micro climate ) and even changes
possesses good vegetation due to heavy rains and
the soil conditions. Topographic factors include
the leeward region possesses poor vegetation due
latitude, altitude, direction of mountain,
to rain shadows (rain deficit).
steepness of mountain etc.
Similarly in the soil of aquatic bodies like
a. Latitudes and altitudes ponds the center and edge possess different
Latitudes represent distance from the equator. depth of water due to soil slope and different
Temperature values are maximum at the equator wave actions in the water body. Therefore,
and decrease gradually towards poles. Different different parts of the same area may possess
types of vegetation occur from equator to poles different species of organisms.
which are illustrated below.
c. Steepness of the mountain
The steepness of the mountain or hill allows
the rain to run off. As a result the loss of water
causes water deficit and quick erosion of the top
soil resulting in poor vegetation. On the other
hand, the plains and valley are rich in vegetation
due to the slow drain of surface water and better
retention of water in the soil.
Clouds
Figure 6.8: Latitudinal and Altitudinal Vegetation
Height above the sea level forms the
altitude. At high altitudes, the velocity of wind
remains high, temperature and air pressure
Moist
decrease while humidity and intensity of light Rain winds
increases. Due to these factors, vegetation at
tation
different altitudes varies, showing distinct

Ric
vege
zonation.
hv
eg
Poor
eta
b. Direction of Mountain
t
ion
Sea
North and south faces of mountain or hill possess
different types of flora and fauna because they
differ in their humidity, rainfall, light intensity,
light duration and temperature regions. Figure 6.9: Steepness of mountain

6.2.4 Biotic factors Other examples:
Nodules
The interactions among living organisms •
Water fern
such as plants and animals are called biotic (Azolla) and Root hair
factors, which may cause marked effects upon Nitrogen fixing

vegetation. The effects may be direct and indirect Cyanobacterium Bacteria
and modifies the environment. The plants (Anabaena ).

mostly which lives together in a community Anabaena
•
and influence one another. Similarly, animals in present in Figure 6.10:
association with plants also affect the plant life c or a l l oi d A nodulated legume
in one or several ways. The different interactions roots of Cycas. plant root with bacteria
among them can be classified into following two (Gymnosperm)
types they are positive interaction and negative • Cyanobacterium (Nostoc) found in the
interaction thalloid body of Anthoceros.(Bryophytes)
Positive interactions • Wasps present in fruits of fig.
When one or both the participating species are Lichen is a mutual association of an alga
•
benefited, it is positive interaction. Examples; and a fungus.
Mutualism and Commensalism.
•
Roots of terrestrial plants and fungal
a. Mutualism: It is an interaction between hyphae- Mycorrhiza
two species of organisms in which both are
b. Commensalism: It is an interaction between
benefitted from the obligate association. The
two organisms in which one is benefitted and
following are common examples of mutualism.
the other is neither benefitted nor harmed.
Nitrogen fixation The species that derives benefit is called the
Rhizobium (Bacterium) forms nodules in the commensal, while the other species is called the
roots of leguminous plants and lives symbiotically. host. The common examples of commensalism
The Rhizobium obtains food from leguminous are listed below:
plant and in turn fixes atmospheric nitrogen into
nitrate, making it available to host plants.
Interaction type Combination Effects Examples

1.Positive interaction
1 Mutualism (+) (+) Both species benefitted Lichen, Mycorrhiza etc.
2 Commensalism (+) (0) One species is benefitted and orchids, Lianas etc.
the other species is neither
benefitted nor harmed
2.Negative interaction
4 Predation (+) (-) One species benefitted, the Drosera, Nepenthes etc.
other species are harmed
5 Parasitism (+) (-) One species benefitted, the Cuscuta, Duranta,
other species are harmed Viscum etc.
6 Competition (-) (-) Harmful for both Grassland species
7 Amensalism (-) (0) Harmful for one, but the Penicillium and
other species are unaffected Staphylo coccus
(+) Benefitted, (-) Harmed (0)Unaffected
Table 6.4: Different interactions of plant

Epiphytes Examples:
The plants Leaves •
A number of
which are found plants like Drosera Lamina
growing on Supporting (Sun dew Plant), Lid
other plants plant Nepenthes (Pitcher Tendril
without harming Clinging Plant), Diaonaea Pitcher
root
them are called (Venus fly trap), Insect
Arial absorping root
epiphytes. They Utricularia (Bladder Fluid
Figure 6.11:
are commonly wort) and Sarracenia
An epiphytic plant-Vanda
found in tropical are predators which Figure 6.12: Pitcher
rain forest. consume insects and plant – with insect
The epiphytic higher plant (Orchids) gets other small animals
its nutrients and water from the atmosphere for their food as a source of nitrogen. They
with the help of their hygroscopic roots which are also called as insectivorous plants.
contain special type of spongy tissue called
Sensitive hair
Velamen. So it prepares its own food and does Capsule wall
not depend on the host. They use the host
plant only for support and does not harm it Valve Insect larva
Absorptive
hairs
in any way.
•
Many orchids, ferns, lianas, hanging mosses, Section view
Peperomia, money plant and Usnea (Lichen)
are some of the examples of epiphytes.
•
Spanish Moss –Tillandsia grows on the bark Natural form
Bladder
of Oak and Pine trees.
Figure 6.13: Insectivorous plant Utricularia
Proto Cooperation Many herbivores are predators. Cattles,
•
An interaction between Camels, Goats etc., frequently browse on
organisms of different the tender shoots of herbs, shrubs and
species in which both trees. Generally annuals suffer more than
organisms benefit but neither is dependent the perennials. Grazing and browsing may
on the relationship. Example: Soil bacteria / cause remarkable changes in vegetation.
fungi and plants growing in the soil. Nearly 25 percent of all insects are known
as phytophagous(feeds on plant sap and
Negative interactions other parts of plant)
When one of the interacting species is benefitted Many defense mechanisms are evolved to
•
and the other is harmed, it is called negative avoid their predations by plants. Examples:
interaction . Examples: predation, parasitism, Calotropis produces highly poisonous cardiac
competition and amensalism. glycosides, Tobacco produces nicotine, coffee
a. Predation: It is an interaction between two plants produce caffeine, Cinchona plant
species, one of which captures, kills and eats produces quinine. Thorns of Bougainvillea,
up the other. The species which kills is called spines of Opuntia, and latex of cacti also
a predator and the species which is killed is protect them from predators.
called a prey. The predator is benefitted while
the prey is harmed.

b. Parasitism: It is an interaction between two Hemiparasites
different species in which the smaller partner The organisms which derive only water
(parasite) obtains food from the larger partner and minerals from their host plant while
(host or plant). So the parasitic species is synthesizing their own food by photosynthesis
benefited while the host species is harmed. Based are called Hemiparasites. They are also called
on the host-parasite relationship, parasitism is partial parasites.
classified into two types they are holoparasite Examples:
and hemiparasite.
Viscum and Loranthus are partial stem
•
Holoparasites parasites.
The organisms which are dependent upon the Santalum (Sandal Wood) is a partial root
•
host plants for their entire nutrition are called parasite.
Holoparasites. They are also called total The parasitic plants produce the haustorial
parasites. roots inside the host plant to absorb nutrients
from the vascular tissues of host plants.
T.S of host along with Cuscuta Cuscuta on the host
c. Competition: It is an interaction between
a) Parasite
two organisms or species in which both the
organisms or species are harmed. Competition
Haustoria
is the severest in population that has irregular
Host distribution. Competition is classified into
Xylem intraspecific and interspecific.
1. Intraspecific competition: It is an interaction
Phloem
between individuals of the same species. This
competition is very severe because all the
b) c)
members of species have similar requirements of
Flower
Parasite food, habitat, pollination etc. and they also have
similar adaptations to fulfill their needs.
Host
Root Tuber
2. Interspecific competition: It is an interaction
Haustoria
Host between individuals of different species. In
grassland, many species of grasses grow well as
there is little competition when enough nutrients
Figure 6.14: a) Holoparasite – Cuscuta and water is available. During drought shortage
b) A Partial stem parasite – Viscum
of water occurs . A life and death competition
c) Root parasite on the brinjal root Orobanche spp.
starts among the different species of grass lands.
Survival in both these competitions is determined
Examples: by the quantity of nutrients, availability of water
• Cuscuta is a total stem parasite of the and migration to new areas. Different species of
herbivores, larvae and grass hopper competing
host plant Acacia, Duranta and many
for fodder or forage plants. Trees, shrubs and
other plants. Cuscuta even gets flower
herbs in a forest struggle for sunlight, water and
inducing hormone from its host plant.
nutrients and also for pollination and dispersal of
• Balanophora, orobanche and Refflesia fruits and seeds. The Utricularia (Bladderwort)
are the total root parasites found on competes with tiny fishes for small crustaceans
higher plants. and insects.

d. Amensalism: It is an interspecific interaction • Phyllium frondosum – leaf insect, another
in which one species is inhibited while the other example of protective mimicry.
species is neither benefitted nor harmed. The ii. Myrmecophily: Sometimes, ants take their
inhibition is achieved by the secretion of certain shelter on some trees such as Mango, Litchi,
chemicals called allelopathic substances. Jamun, Acacia etc.
Amensalism is also called antibiosis. Ant
These ants act as
Penicillium notatum produces penicillin to
• body guards of the
inhibit the growth of a variety of bacteria plants against any
especially Staphylococcus. disturbing agent
Trichoderma inhibits the growth of fungus
• and the plants in Figure 6.16:
turn provide food Myrmecophily
Aspergillus.
•
Roots and hulls of Black Walnut Juglans and shelter to these ants. This phenomenon
nigra secretes an alkaloid Junglone which is known as Myrmecophily. Example: Acacia
inhibits the growth of seedlings of Apple, and acacia ants.
Tomato and Alfalfa around it. iii. Co-evolution: The interaction between
organisms, when continues for generations,
Interspecific interactions/ Co-evolutionary
dynamics i n v o l v e s
reciprocal
i. Mimicry: It is a phenomenon in which
changes in
living organism modifies its form, appearance,
genetic and
structure or behavior and looks like another
morphological
living organism as a self defence and increases
characters of
the chance of their survival. Floral mimicry Figure 6.17: Co-evolution
both organisms.
is for usually inviting pollinators but animal
This type of
mimicry is often protective. Mimicry is a result
evolution is called Co-evolution. It is a kind
of evolutionary significance due to shape and
of co- adaptation and mutual change among
sudden heritable mutation and preservation of
interactive species.
natural selection.
Examples:
a) b) •
Corolla length and proboscis length of
butterflies and moths ( Habenaria and Moth ).
•
Bird’s beak shape and flower shape and size.
•
More examples: Horn bills and birds
of Scrub jungles ,Slit size of pollinia of
Figure 6.15: Mimicry Apocynaceae members and leg size of
insects.
a) Phyllium frondosum b) Carausium morosus
Example: Kairomone released from

Pieris rapae caterpillar exposed
The plant, Ophrys an orchid, the flower looks
•
to wild Radish gets the capacity
like a female insect to attract the male insect
to transmit defence induced by predator
to get pollinated by the male insect and it is
to progeny of wild radish. Transmission
otherwise called ‘floral mimicry ‘.
capacity of defence induced by predator to
• Carausium morosus – stick insect or
progeny of wild radish.
walking stick. It is a protective mimicry.

6.3 Ecological adaptations a) b)
Lamina
Floating leaves
The modifications in the structure of Inflated petiole
organisms to survive successfully in an Stolen

Fibrous roots Offset
environment are called adaptations of Water Fibrous roots

Root pocket
organisms. Adaptations help the organisms to i) Free floating hydrophyte
Root pockets
exist under the prevailing ecological habitat. a) Eichhornia b) Pistia

Based on the habitats and the corresponding c) d)
adaptations of plants, they are classified Flower
Leaf lets
as hydrophytes, xerophytes, mesophytes, Lamina
Petiole
epiphytes and halophytes. Petiole
Hydrophytes Flower bud

Water
Water
The plants which are living in water or wet Young leaf
Rhizome
places are called hydrophytes. According to Root
Rhizome
Roots
their relation to water and air, they are sub- Mud Mud
divided into following categories: i) Free ii) Rooted floating hydrophyte

floating hydrophytes, ii) Rooted- floating c) Nymphaea d) Marsilea
hydrophytes, iii) Submerged floating e) f)
hydrophytes, iv) Rooted -submerged Water Stem Submerged leaves
hydrophytes, v) Amphibious hydrophytes.

i. Free floating hydrophytes: These plants
float freely on the surface of water. They
remain in contact with water and air, but not
with soil. Examples: Eichhornia, Pistia and iii) Submerged floating hydrophyte
Wolffia (smallest flowering plant). e) Ceratophyllum f) Utricularia
g) h)
ii. Rooted floating hydrophytes: In these Female plant Male plant
Flower
Female flower
plants, the roots are fixed in mud, but their Water Whorls of
submerged
leaves and flowers are floating on the surface leaves
of water. These plants are in contact with soil, Male flower

Water
water and air. Examples: Nelumbo, Nymphaea, Stolen Branch

Potomogeton and Marsilea. Roots
Mud
Roots
Mud
Lotus seeds showing highest longevity in iv) Rooted - sumerged hydrophyte

plant kingdom. g) Vallisneria h) Hydrilla
i) Flower j)
iii. Submerged floating hydrophytes: These Emergent
Flowers
plants are completely submerged in water and leaves Emergent or

aerial leaves
not in contact with soil and air. Examples: Stem
Ceratophyllum and Utricularia.

Submerged Submerged
iv. Rooted- submerged hydrophytes: These leaves dissected
leaves
plants are completely submerged in water Stolen Water
Roots
and rooted in soil and not in contact with air. Roots
Mud
Mud
Examples: Hydrilla, Vallisneria and Isoetes. v) Rooted emergent hydrophyte-Heterophylly
v. Amphibious hydrophytes (Rooted emergent i) Sagittaria j) Ranunculus
hydrophytes): These plants are adapted to both Figure 6.18: Hydrophytes

aquatic and terrestrial modes of life. They grow • Cortex is well developed with aerenchyma
in shallow water. Examples: Ranunculus, Typha • Vascular tissues are poorly developed. In
and Sagittaria. emergent forms vascular elements are well
developed.
Hygrophytes: The plants which can grow
•
Mechanical tissues are generally absent
in moist damp and shady places are called
except in some emergent forms. Pith cells
hygrophytes. Examples: Habenaria (Orchid), are sclerenchymatous.
Mosses (Bryophytes), etc.
Epidermis
Hypodermis
Morphological adaptations of Hydrophytes:
In root Air chambers
Cortex
• Roots are totally absent in Wolffia and
Salvinia or poorly developed in Hydrilla or
well developed in Ranunculus. Endodermis
• The root caps are replaced by root pockets.
Pericycle
Example: Eichhornia Xylem cavity
In stem Sieve tubes
Phloem
Parenchyma
• The stem is long, slender, spongy and flexible
T.s of Hydrilla stem
in sub-merged forms.
Figure 6.19: T.S. of Hydrilla stem
• In free floating forms the stem is thick, short
stoloniferous and spongy; and in rooted Physiological adaptations of Hydrophytes:
floating forms, it is a rhizome .
• Hydrophytes have the ability to withstand
• Vegetative propagation is through runners, anaerobic conditions .
stolon, stem and root cuttings , tubers,
• They possess special aerating organs.
dormant apices and offsets.
Xerophytes
In leaves
The plants which are living in dry or xeric
• The leaves are thin, long and ribbon shaped in
condition are known as Xerophytes. Xerophytic
Vallisneria or long and linear in Potamogeton
habitat can be of two different types. They are:
or finely dissected in Ceratophyllum
• The floating leaves are large and flat as in a. Physical dryness: In these habitats, soil has a
Nymphaea and Nelumbo. In Eichhornia and little amount of water due to the inability of the
Trapa petioles become swollen and spongy. soil to hold water because of low rainfall.
• In emergent forms, the leaves show b. Physiological dryness: In these habitats,
heterophylly (Submerged leaves are water is sufficiently present but plants are unable
dissected and aerial leaves are entire). to absorb it because of the absence of capillary
Example: Ranunculus, Limnophila spaces. Example: Plants in salty and acidic soil.
heterophylla and Sagittaria Based on adaptive characters xerophytes
Anatomical adaptations are classified into three categories. They are
• Cuticle is either completely absent or if Ephemerals, Succulents and Non succulent
present it is thin and poorly developed plants.
• Single layer of epidermis is present

i. Ephemerals:
In Xerophytic plants with the leaves and
These are also
stem are covered with hairs are called
called drought
escapers or trichophyllous plants . Example: Cucurbits
drought evaders. (Melothria and Mukia )
These plants In stem
complete their
Figure 6.20: • Stems are mostly hard and woody. They may
life cycle within
be aerial or underground
a short period Argemone mexicana-Ephemerals
(single season). • The stems and leaves are covered with wax
These are not true xerophytes. Examples: coating or covered with dense hairs.
Argemone, Mollugo, Tribulus and Tephrosia. • In some xerophytes all the internodes in the
ii. Succulents: These are also called drought stem are modified into a fleshy leaf structure
enduring plants. These plants store water in called phylloclades (Opuntia) .
their plant parts during the dry period. These • In some of the others single or occasionally
plants develop certain adaptive characters to two internodes modified into fleshy green
resist extreme drought conditions. Examples: structure called cladode (Asparagus).
Opuntia, Aloe, Bryophyllum and Begonia. In some the petiole is modified into a fleshy
iii. Non succulents: These are also called leaf like structure called phyllode (Acacia
drought resistant plants ( true xerophytes). melanoxylon).
They face both external and internal dryness.
a) b)
They have many adaptations to resist dry Flower
conditions. Examples: Casuarina, Nerium, Spines
Stipular
Zizyphus and Acacia. Phylloclade spine
a) b)
Marginal Stem
spines
Leaf
Succulent c d)
c) Petiole
leaves 3
2
Leaves
Scale
leaves 1
Rhizome Stipular
Roots spines
Stem 4 Phyllode
Figure 6.21: a)Succulent xerophyte – Aloe 1,2,3 and 4 the gradual development
Spine
b) Non succulent perennial - Ziziphus of phyllodes in Acacia
Figure 6.22: Xerophytes

Morphological Adaptations
a) A succulent xerophyte: Phylloclade – opuntia
In root
b) Non succulent: Perennial - Capparis
• Root system is well developed and is greater
than that of shoot system. c) Cladode of Asparagus
d) Phyllode – Acacia
• Root hairs and root caps are also well
developed.

In leaves Physiological adaptations
• Leaves are generally leathery and shiny to • Most of the physiological processes are
reflect light and heat. designed to reduce transpiration.
• In some plants like Euphorbia, Acacia, • Life cycle is completed within a short
Ziziphus and Capparis, the stipules are period (Ephemerals).
modified into spines. Mesophytes
• The entire leaves are modified into spines The plants which are living in moderate
(Opuntia ) or reduced to scales (Asparagus). conditions (neither too wet nor too dry) are
Anatomical adaptations known as mesophytes. These are common land
• Presence of multilayered epidermis with plants. Example: Maize and Hibiscus.
heavy cuticle to prevent water loss due to Morphological adaptations
transpiration. • Root system is well developed with root
• Hypodermis is well developed with caps and root hairs
sclerenchymatous tissues. • Stems are generally aerial, stout and highly
• Sunken shaped stomata are present only in the branched.
lower epidermis with hairs in the sunken pits. • Leaves are generally large, broad, thin with
• Scotoactive type of stomata found in different shapes.
succulent plants . Anatomical adaptations
• Vascular bundles are well developed with • Cuticle in aerial parts are moderately
several layered bundle sheath. developed.
• Mesophyll is well differentiated into • Epidermis is well developed and stomata are
palisade and spongy parenchyma. generally present on both the epidermis.
• In succulents the stem possesses a water • Mesophyll is well differentiated into palisade
storage region. and spongy parenchyma.
Thick cuticle
Multi-layered epidermis
• Vascular and mechanical tissues are fairly
developed and well differentiated.
Palisade parenchyma
Physiological adaptations
Spongy parenchyma
Stomata • All physiological processes are normal.
Guard cells
Pit (Cavity)
• Temporary wilting takes place at room
Trichomes (Hairs) temperature when there is water scarcity.
Lower epidermis
Cuticle Tropophytes are plants which behave
Figure 6.23: T.S. of Nerium leaf
as xerophytes at summer and behave as
mesophytes (or) hydrophytes during rainy
season.
Upper epidermis
Water storage cells
Palisade parenchyma
Epiphytes
Spongy parenchyma Epiphytes are plants which grow perched on
Lower epidermis other plants (Supporting plants). They use
Figure 6.24: A Succulent leaf of Pepromia (T.S.) the supporting plants only as shelter and not
(lateral wing portion only) for water or food supply. These epiphytes

are commonly seen in tropical rain forests. Physiological adaptations
Examples: Orchids, Lianas, Hanging Mosses Special absorption processes of water by
and Money plant. velamen tissue .
Morphological adaptations Halophytes
• Root system is extensively developed. These There are special type of Halophytic plants
roots may be of two types. They are Clinging which grow on soils with high concentration
roots and Aerial roots. of salts. Examples: Rhizophora, Sonneratia and
Clinging roots fix the epiphytes firmly on Avicennia.
the surface of the supporting objects. Halophytes are usually found near the sea-
shores and Estuaries. The soils are physically
Aerial roots are green coloured roots which
wet but physiologically dry. As plants cannot use
may hang downwardly and absorb moisture
salt water directly they require filtration of salt
from the atmosphere with the help of a
using physiological processes. This vegetation is
spongy tissue called velamen. also known as mangrove forest and the plants
• Stem of some epiphytes are succulent and are called mangroves.
develop pseudo bulb or tuber.
Morphological adaptations
• Generally the leaves are lesser in number
and may be fleshy and leathery • The temperate halophytes are herbaceous
but the tropical halophytes are mostly bushy
• Myrmecophily is a common occurrence
in the epiphytic vegetation to prevent the • In addition to the normal roots, many stilt
predators. roots are developed
• The fruits and seeds are very small and • A special type of negatively geotropic
usually dispersed by wind, insects and birds. roots called pneumatophores with
pneumathodes to get sufficient aeration
Anatomical adaptations
are also present. They are called breathing
• Multilayered epidermis is present. Inner to roots. Example: Avicennia
the velamen tissue, the peculiar exodermis
layer is present. Pneumathode
Pneumatophores Pneumatophores (or) Lenticel
• Presence of thick cuticle and sunken stomata
greatly reduces transpiration.
• Succulent epiphytes contain well developed
parenchymatous cells to store water.
Roots
Epidermis
Velamen Figure 6.26a: Pneumatophores of mangrove plant

Exodermis • Presence of thick cuticle
on the aerial parts of the
Cortex
plant body
• Leaves are thick,
Endodermis
Pith Pericycle entire, succulent and
Metaxylem Conjuctive tissue
Protoxylem glossy. Some species Figure 6.26b:
Phloem
are aphyllous (without Succulent
Figure 6.25: T.S. of an aerial root of orchid leaves). halophyte -
showing velamen tissue Salicornia

• Vivipary mode of seed germination is found protective covering called seed coat. As seeds
in halophytes contain miniature but dormant future plants,
their dispersal is an important criterion for
distribution and establishment of plants over
a wide geographical area. The dissemination of
Calyx Leaf seeds and fruits to various distances from the
Fruit parent plant is called seed and fruit dispersal.
Radicle
It takes place with the help of ecological factors
such as wind, water and animals.
Seed dispersal is a regeneration process
Hypocotyl
of plant populations and a common means of
Water colonizing new areas to avoid seedling level
Mud
competition and from natural enemies like
herbivores, frugivores and pathogens.
Fruit maturation and seed dispersal is
Figure 6.27: Vivipary germination
influenced by many ecologically favourable
Anatomical adaptations conditions such as Season (Example: Summer),
• Epidermal cells of stem is heavy cutinized, suitable environment, and seasonal availability
of dispersal agents like birds, insects etc.
almost squarish and are filled with oil and
tannins. Seeds require agents for dispersal which
are crucial in plant community dynamics in
• ‘Star’ shaped sclereids and ‘H’ shaped heavy
many ecosystems around the globe. They offer
thickened spicules that provide mechanical many benefits to communities such as food and
strength to cortex are present in the stem. nutrients, migration of seeds across habitats
• The leaves may be dorsiventral or isobilateral and helps spreading plant genetic diversity.
with salt secreting glands.
6.4.1 Dispersal by Wind (Anemochory)
Physiological adaptations The individual seeds or the whole fruit may be
•
High osmotic pressure exists in some modified to help for the dispersal by wind. Wind
plants . dispersal of fruits and seeds is quite common in
• Seeds germinate in the fruits of mother tall trees. The adaptation of the wind dispersal
plant itself (Vivipary). plants are
Minute seeds: Seeds are minute, very
•
Out of three districts of Tamil small, light and with inflated covering.
Nadu (Nagapattinam, Thanjavur Example: Orchids.
and Thiruvarur), Muthupet Wings: Seeds or whole fruits are flattened to
•
(Thiruvarur district) was less damaged by form a wing. Examples: Maple, Gyrocarpus,
Gaja cyclone ( November 2018) due to the
Dipterocarpus and Terminalia
presence of mangrove forest.
6.4 Dispersal of Fruits and Seeds

Both fruits and seeds possess attractive colour,
odour, shape and taste needed for the dispersal
by birds, mammals, reptiles, fish, ants and
insects even earthworms. The seed consists
of an embryo, stored food material and a Figure 6.28: Asclepias Figure 6.29: Gyrocarpus

Feathery Appendages: Seeds or fruits may
• beings and get dispersed.
have feathery appendages which greatly ii. Sticky fruits and seeds:
increase their buoyancy to disperse to high a. Some fruits have sticky glandular hairs by
altitudes. Examples: Vernonia and Asclepias. which they adhere to the fur of grazing animals.
C ensor mechanisms: The fruits of many
• Example: Boerhaavia and Cleome.
plants open in such a way that the seeds b. Some fruits have viscid layer which adhere to
can escape only when the fruit is violently the beak of the bird which eat them and when
shaken by a strong wind. Examples: they rub them on to the branch of the tree, they
Aristolochia and Poppy. disperse and germinate. Example: Cordia and
Guess!! Who am I…….? I am dispersed by Alangium
ant and I have caruncle. iii. Fleshy fruits: Some fleshy fruits with
conspicuous colours are dispersed by human
6.4.2 Dispersal by Water (Hydrochory) beings to distant places after consumption.
Dispersal of seeds and fruits by water usually Example: Mango and Diplocyclos
occurs in those plants which grow in or near
water bodies . Adaptation of hydrochory are
•
Obconical receptacle with prominent air
spaces. Example: Nelumbo.
•
Presence of fibrous mesocarp and light
pericarp. Example: Coconut.
•
Seeds are light, small, provided with aril Figure 6.32: Sunflower Figure 6.33: Papaya
which encloses air.Example: Nymphaea. 6.4.3 Dispersal by Explosive Mechanism
•
The fruit may be inflated. Examples: (Autochory)
Heritiera littoralis. Some fruits burst suddenly with a force
•
Seeds by themselves would not float may be enabling to throw seeds to a little distance away
carried by water current. Example: Coconut. from the plant. Autochory shows the following
adaptations.
•
Mere touch of some plants causes the
ripened fruit to explode suddenly and seeds
are thrown out with great force. Example:
Impatiens (Balsam), Hura.
•
Some fruits when they come in contact with
Figure 6.30: Nelumbo Figure 6.31: Coconut water particularly after a shower of rain,
burst suddenly with a noise and scatter the
6.4.3 Dispersal by Animals (Zoochory)
seeds.Examples: Ruellia and Crossandra.
Birds and mammals, including human beings •
C ertain long pods explode with a loud
play an efficient and important role in the noise like cracker, scattering the seeds in
dispersal of fruit and seeds. They have the all directions. Example: Bauhinia vahlii
following devices. (Camel’s foot climber)
i. Hooked fruit: The surface of the fruit or seeds •
As the fruit matures, tissues around seeds are
have hooks,(Xanthium), barbs (Andropogon), converted into a mucilaginous fluid, due to
spines (Aristida) by means of which they adhere which a high turgor pressure develops inside
to the body of animals or clothes of human the fruit which leads to the dispersal of seeds.

Example: Ecballium elatrium (Squirting outcrossing plants.
cucumber) Gyrocarpus and Dipterocarpus. •
Seed dispersal by animals help in
conservation of many species even in
human altered ecosystems.
•
Understanding of fruits and seed dispersal
acts as a key for proper functioning and
establishment of many ecosystems from
deserts to evergreen forests and also for the
Figure 6.34: Ecballium Figure 6.35: Impatents maintenance of biodiversity conservation
and restoration of ecosystems.
Human aided seed dispersal
Seed Ball : Seed ball Summary
is an ancient Japanese Ecology is a division of biology and deals
technique of encasing with the study of environment in relation to
seeds in a mixture of organisms. Ecology is mainly divided into
clay and soil humus two branches Autecology and Synecology. The
(also in cow dung) and environment (surrounding) includes physical,
Figure 6.36: Seed ball
scattering them on to chemical and biological components. These
suitable ground, not planting of trees manually. factors can be classified into living (biotic)
This method is suitable for barren and degraded and non-living (abiotic), which make the
lands for tree regeneration and vegetation before environment of an organism. The ecological
monsoon period where the suitable dispersal factors are meaningfully grouped into four
agents become rare. classes, which are as follows: 1. Climatic factors
Guess? what is atelochory or Achory? 2. Edaphic factors 3. Topographic factors 4.
Biotic factors.
Ecologically important days Climate is one of the important natural
March 21 - World forest day factors controlling the plant life. The climatic
April 22 - Earth day factors includes light, temperature, water,
May 22 - World bio diversity day wind, fire, etc. Edaphic factors, the abiotic
June 05 - World environment day factors related to soil, include the physical and
July 07 - Van Mohostav day chemical composition of the soil formed in a
particular area. The surface features of earth
September 16 - International Ozone day
are called topography. Topographic influence
Advantages of seed dispersal: on the climate of any area is determined by
•
Seeds escape from mortality near the the interaction of solar radiation, temperature,
parent plants due to predation by animals humidity ,rainfall, latitude and altitude. The
or getting diseases and also avoiding interactions among living organisms, the plants
competition. and animals are called biotic factors, which may
•
Dispersal also gives a chance to occupy cause marked effects upon vegetation.
favourable sites for growth. The modifications in the structure of
•
It is an important process in the movement organisms to survive successfully in an
of plant genes particularly this is the only environment are called adaptations of
method available for self-fertilized flowers organisms. Based on the habitats and the
and maternally transmitted genes in corresponding adaptations of plants, they are

classified into 1) Hydrophytes 2) Xerophytes a) i, ii, and iii only b) ii, iii and iv
3) Mesophytes 4) Epiphytes and 5) Halophytes. c) ii and iii only d) i and ii only
The dissemination of seeds and fruits to various 5. Which of the given plant produces cardiac
distances from the parent plant is called seed glycosides?
and fruit dispersal. It takes place with the help a) Calotropis b) Acacia
of ecological factors such as wind, water and
c) Nepenthes d) Utricularia
animals.
6. Read the given statements and select the
Evaluation correct option.
1.
Arrange the correct i) Loamy soil is best suited for plant growth as
sequence of ecological it contains a mixture of silt, sand and clay.
hierarchy starting from ii) The process of humification is slow in
lower to higher level. case of organic remains containing a
a) Individual organism → large amount of lignin and cellulose.
Population Landscape → Ecosystem iii)
Capillary water is the only water
b) Landscape → Ecosystem → Biome → available to plant roots as it is present
Biosphere inside the micropores.
c) community → Ecosystem → Landscape → iv) Leaves of shade plant have more total
Biome chlorophyll per reaction centre, low
d) Population → organism → Biome → ratio of chl a and chl b are usually
Landscape thinner leaves.
2. Ecology is the study of an individual species a) i, ii and iii only b) ii, iii and iv only
is called c) i, ii and iv only d) ii and iii only
i) Community ecology ii) Autecology 7. Read the given statements and select the
iii) Species ecology iv) Synecology correct option.
a) i only b) ii only Statement A : Cattle do not graze on weeds
c) i and iv only d) ii and iii only of Calotropis.
3. A specific place in an ecosystem, where an Statement B : Calotropis have thorns and

organism lives and performs its functions is spines, as defense against herbivores.
a) habitat b) niche a) Both statements A and B are incorrect.
c) landscape d) biome b) Statement A is correct but statement B is
incorrect.
4. Read the given statements and select the c) Both statements A and B are correct but
correct option. statement B is not the correct explanation
i) Hydrophytes possess aerenchyma to of statement A.
support themselves in water. d) Both statements A and B are correct and
ii) Seeds of Viscum are positively statement B is the correct explanation of
photoblastic as they germinate only in statement A.
presence of light.
iii) Hygroscopic water is the only soil water 8. In soil water available for plants is
available to roots of plant growing in soil a) gravitational water
as it is present inside the micropores. b) chemically bound water
iv) High temperature reduces use of water c) capillary water
and solute absorption by roots. d) hygroscopic water

9. Read the following statements and fill up A B C D
the blanks with correct option. a) (+) Parasitism (-) Amensalism
i) Total soil water content in soil is called b) (-) Mutalism (+) Competition
_________________
c) (+) Competition (0) Mutalism
ii) Soil water not available to plants is called d) (0) Amensalism (+) Parasitism
_________________
iii) Soil water available to plants is called 13. Ophrys an orchid resembling the female of
_________________ an insect so as to able to get pollinated is
due to phenomenon of
(i) (ii) (iii)
a) Myrmecophily b) Ecological equivalents
(a) Holard Echard Chresard
(b) Echard Holard Chresard c) Mimicry d) None of these
(c) Chresard Echard Holard 14. A free living nitrogen fixing cyanobacterium
(d) Holard Chresard Echard which can also form symbiotic association
with the water fern Azolla
10.
Column I represent the size of the soil
a) Nostoc b) Anabaena
particles and Column II represents type of
c) chlorella d) Rhizobium
soil components. Which of the following
is correct match for the Column I and 15. Pedogenesis refers to
Column IL a) Fossils b) Water c) Population d) Soil
Column - I Column - II
I). 0.2 to 2.00 mm i) Slit soil 16. Mycorrhiza promotes plant growth by
II) Less than 0.002 mm ii) Clayey soil a) Serving as a plant growth regulators
III) 0.002 to 0.02 mm iii) Sandy soil b) Absorbing inorganic ions from soil
IV) 0.002 to 0.2 mm iv) Loamy soil c) Helping the plant in utilizing atmospheric
I II III IV nitrogen
a) ii iii iv i d) Protecting the plant from infection
b) iv i iii ii
17. Which of the following plant has a non-
c) iii ii i iv
succulent xerophytic and thick leathery
d) None of the above
leaves with waxy coating
11. The plant of this group are adapted to live a) Bryophyllum b) Ruscus
partly in water and partly above substratum c) Nerium d) Calotropis
and free from water
a) Xerophytes b) Mesophytes 18. In a fresh water environment like pond,
c) Hydrophytes d) Halophytes rooted autotrophs are
a) Nymphaea and typha
12 . Identify the A, B, C and D in the given table b) Ceratophyllum and Utricularia
Effects on Effects on c) Wolffia and pistia
Interaction
species X species Y d) Azolla and lemna
Mutualism A (+)
B (+) (-)
Competition (-) C
D (-) 0

19. Match the following and choose the correct 28. What is Phytoremediation ?
combination from the options given below:
29. What is Albedo effect and write their effects?
Column I Column II
(Interaction) (Examples) 30.
The organic horizon is generally absent
I. Mutualism i). T
richoderma and from agricultural soils because tilling, e.g.,
Penicillium plowing, buries organic matter. Why is an
II. Commensalism ii). B
alanophora, organic horizon generally absent in desert
soils ?
Orobanche
III. Parasitism iii). Orchids and Ferns 31. Soil formation can be initiated by biological
IV. Predation iv). L ichen and organisms. Explain how?
Mycorrhiza 32. Sandy soil is not suitable for cultivation.
V. Amensalism v). N epenthes and Explain why?
Diaonaea
33. Describe the mutual relationship between
I II III IV V the fig and wasp and comment on
a) i ii iii iv v the phenomenon that operates in this
b) ii iii iv v i relationship.
c) iii iv v i ii
d) iv iii ii v i 34. Lichen is considered as a good example of
obligate mutualism. Explain.
20. Strong, sharp spines that get attached to 35.
What is mutualism? Mention any two
animal’s feet are found in the fruits of example where the organisms involved
a) Argemone b) Ecballium are commercially exploited in modern
c) Heritier d) Crossandra agriculture.
21. Sticky glands of Boerhaavia and Cleome 36. List any two adaptive features evolved in
support parasites enabling them to live successfully
a) Anemochory b) Zoochory on their host?
c) Autochory d) Hydrochory 37.
Mention any two significant roles of
predation plays in nature.
22. Define ecology.
38.
How does an orchid ophrys ensures its
23.
What is ecological hierarchy? Name the pollination by bees ?
levels of ecological hierarchy.
39. Water is very essential for life. Write any
24. What are ecological equivalents? Give one three features for plants which enable them
example . to survive in water scarce environment.
25. Distinguish habitat and niche 40.
Why do submerged plants receive weak
26.
Why are some organisms called as illumination than exposed floating plants
eurythermals and some others as in a lake?
stenohaline ? 41.
What is vivipary? Name a plant group
27. ‘Green algae are not likely to be found in the which exhibits vivipary.
deepest strata of the ocean’. Give at least one
reason.

42.
What is thermal stratification? Mention Flora: The kinds of plants in region
their types.
Frugivores: Fruit eating organisms
43.
How is rhytidome act as the structural
Hekistotherms: (Temperature less than 70°C)
defence by plants against fire?
Where very low temperature prevails and the
44. What is myrmecophily? dominant vegetation is alpine vegetation.
45. What is seed ball? Landscape: The visible features of an area of

land.
46. How is anemochory differ from zoochory?
Lianes: Twining vines with woody stems,
47. What is co evolution?
common in forest of warm climate.
48.
Explain Raunkiaer classification in the
Megatherms: (Temperature more than 240°C)
world’s vegetation based on the temperature.
Where high temperature prevails throughout
49. List out the effects of fire to plants. the year and the dominant vegetation is tropical
rain forest.
50. What is soil profile? Explain the characters
of different soil horizons. Mesotherms: (Temperature ranges between
170°C and 240°C) Where high temperature
51.
Give an account of various types of
alternates with low temperature and the
parasitism with examples.
dominant vegetation is tropical deciduous
52. Explain different types of hydrophytes with forest.
examples.
Microtherms: (Temperature ranges between
53. Enumerate the anatomical adaptations of 70°C and 170°C) Where low temperature
xerophytes. prevails and the dominant vegetation is mixed
coniferous forest.
54. List out any five morphological adaptations
of halophytes. Population: A group of individuals of a single
species.
55. What are the advantages of seed dispersal?
Scotoactive type of stomata: Stomata opens
56.
Describe dispersal of fruit and seeds by during night in succulent plants and closes
animals. during the day.
Glossary Vivipary: When seeds or embryos begin to
Antibiosis: An association of two organisms develop before they detach from the parent.
which is harmful to one of them.
Biome: A major regional community of

plants and animals with similar life forms and
environmental conditions.
Biosphere: The envelope containing all living

organisms on earth.
Community: A group of organism living in the

same place.

ICT Corner
Principles of Ecology
Let us know about the

Environmental Studies-
Complete Reference
Guide in detail.
Steps
• Type the URL or scan the QR code to open the activity page then Introduction
page will open.
• Click on the Content icon in the introduction page.
• Click on the topic you like.
• To know more applications related to this title click on More apps.
Step 1 Step 2 Step 3
URL:
https://play.google.com/store/apps/details?id=com.dhavaldev.
EnvironmentalStudies

Chapter
7 Ecosystem
Learning Objectives Have you seen lakes, ponds and pools in your
surroundings? They are all called water bodies
with many components in them. Can you list
Learning objectives
out the things which are found in water bodies?
The learner will be able to, Mud, nutrients, clay, dissolved gases, planktons,
Describe the Structure, functions and microorganisms, plants like algae, Hydrilla,
types of ecosystems Nelumbo, Nymphaea and animals like snake,
small fish, large fish, frog, tortoise and crane are
Draw ecological pyramids by means the components in the water bodies which are
of number, biomass and energy all together form an ecosystem. Further, we all
Interpret carbon and phosphorus know that plants and animals are prominent
cycle living components in the environment. They
interact with nonliving components such as air,
Recognise pond ecosystem as a self- water, soil, sunlight, etc. For example, you have
sufficient and self-regulating system studied in class XI, one of the life processes,
Analyse ecosystem services and its photosynthesis which utilize sunlight , water,
management carbondioxide, nutrients from the soil and
release oxygen to the atmosphere. From this, we
Discuss about the importance and
understand that the exchange of materials takes
conservation of ecosystem
place between living and nonliving components.
Explain the types of plant succession Likewise, you can study the structure, function
and types of ecosystem in this chapter. The
term ‘ecosystem’ was proposed by A.G.
Tansley (1935), who defined it as ‘the system
Chapter outline resulting from the integration of all the living
and nonliving factors of the environment’.
Whereas, Odum (1962) defined ecosystem ‘as
7.1 Structure of the structural and functional unit of ecology’.
ecosystem
7.2 Functions of Parallel terms for ecosystem coined by
ecosystem various ecologists
• Biocoenosis – Karl Mobius
7.3 Plant succession • Microcosm – S.A. Forbes
• Geobiocoenosis – V. V. Dokuchaev, G.F. Morozov
• Holocoen - Friederichs
• Biosystem – Thienemann
• Bioenert body – Vernadsky
148 Ecosystem

7.1 Structure of ecosystem The amount of living materials present
Ecosystem comprises of two major components. in a population at any given time is known
They are: as standing crop, which may be expressed
Abiotic (non-living) components: It
i) in terms of number or biomass per unit area.
includes climatic factors (air, water, Biomass can be measured as fresh weight or
sunlight, rainfall, temperature and dry weight or carbon weight of organisms.
humidity), edaphic factors (soil air, Biotic components are essential to construct the
soil water and pH of soil),topography food chain, food web and ecological pyramids.
(latitude, altitude), organic components
(carbohydrates, proteins, lipids and humic
7.2 Functions of ecosystem
substances) and inorganic substances (C, The function of ecosystem include to energy
H, O, N and P ). Abiotic components play creation, sharing of energy and cycling of
vital role in any ecosystem and hence the materials between the living and nonliving
total inorganic substances present in any component of an ecosystem.
ecosystem at a given time is called standing Before studying the productivity in any
quality (or) standing state. ecosystem, We should understand the essential
ii) Biotic (living) components: It includes role of sunlight used by producers of the first
all living organisms like plants, animals, trophic level. The quantity of sunlight is directly
fungi and bacteria. They form the trophic proportional to the production of energy by
structures of any ecosystem. On the basis plants.
of nutritional relationships, trophic levels 7.2.1 Photosynthetically Active
of an ecosystem has two components. Radiation (PAR)
(1) autotrophic components and (2)
The amount of light available for photosynthesis
heterotrophic components.
of plants is called Photosynthetically Active
(1) Autotrophic components: Autotrophs Radiation (PAR) which is between the range
are organisms which can manufacture the of 400-700 nm wave length. It is essential for
organic compounds from simple inorganic photosynthesis and plant growth. PAR is not
components through a process called always constant because of clouds, tree shades,
photosynthesis. In most of the ecosystems, air, dust particles, seasons, latitudes and length
green plants are the autotrophs and are also of the daylight availability. Generally plants
called producers. absorb more blue and red light for efficient
(2) Heterotrophic components: Those photosynthesis.
organisms which consume the producers are Of the total sunlight, 34 percent that
called consumers and can be recognized into reaching the atmosphere is reflected back into
macro and micro consumers. Macroconsumers the atmosphere, moreover 10% is held by ozone,
refer to herbivores, carnivores and omnivores water vapours and atmospheric gases and the
(primary, secondary and tertiary consumers). remaining 56% reaches the earth’s surface. Out
Microconsumers are called decomposers. of this 56%, only 2 – 10% of the solar energy is
Decomposers are organisms that decompose used by green plants for photosynthesis while
the dead plants and animals to release organic the remaining portion is dissipated as heat.
and inorganic nutrients into the environment
PAR is generally reported as millimoles /
which are again reused by plants. Example:
square meter / second by using silicon photo
Bacteria, Actinomycetes and Fungi.
Ecosystem 149

voltic detectors which detect only 400 – 700 b. Net Primary Productivity (NPP)
nm wavelength of light. PAR values range from The proportion of energy which remains
0 to 3000 millimoles /square meter / second. after respiration loss in the plant is called
At night PAR is zero and during midday in net primary productivity. It is also called as
the summer, PAR often reaches 2000 – 3000 apparent photosynthesis. Thus the difference
millimoles /square meter/second. between GPP and respiration is known as NPP.
Types of Carbon NPP = GPP – Respiration

Green carbon – carbon stored NPP of whole biosphere is estimated to be
in the biosphere (by the process about 170 billion tons (dry weight) per year.
of photosynthesis). Out of which NPP of oceanic producers is
Grey carbon – carbon stored in fossil fuel (coal, only 55 billion tons per year in unit time.
oil and biogas deposits in the lithosphere).
2. Secondary productivity
Blue carbon – carbon stored in the atmosphere
The amount of energy stored in the tissues of
and oceans.
heterotrophs or consumers is called secondary
Brown carbon – carbon stored in industrialized
productivity.
forests (wood used in making commercial
articles) a. Gross secondary productivity
Black carbon – carbon emitted from gas, diesel It is equivalent to the total amount of plant
engine and coal fired power plants. material is ingested by the herbivores minus
the materials lost as faeces.
b. Net secondary productivity
7.2.2 Productivity of an ecosystem
Storage of energy or biomass by consumers
The rate of biomass production per unit area per unit area per unit time, after respiratory
in a unit time is called productivity. It can be loss is called net secondary productivity.
expressed in terms of gm /m2/year or Kcal/m2/
3. Community productivity
year. It is classified as given bellow.
1. Primary productivity The rate of net synthesis of organic matter
2. Secondary productivity (biomass) by a group of plants per unit
area per unit time is known as community
3. Community productivity
productivity.
1. Primary productivity:
Factors affecting primary productivity
The chemical energy or organic matter
generated by autotrophs during the process Primary productivity depends upon the
of photosynthesis and chemosynthesis is plant species of an area, their photosynthetic
called primary productivity. It is the source capacity, availability of nutrients, solar
of energy for all organisms, from bacteria to radiation, precipitation, soil type, topographic
human. factors (altitude, latitude, direction), and other
environmental factors. It varies in different
a. Gross Primary Productivity (GPP) types of ecosystems.
The total amount of food energy or organic
matter or biomass produced in an ecosystem by Productivity of different Ecosystems
autotrophs through the process of photosynthesis The primary productivity of an ecosystem is not
is called gross primary productivity determined by size and number of population,
but by the rate of total fixation of radiant energy.
150 Ecosystem

Generally, the average world net primary carnivores. Some organisms which eat both
productivities of open ocean and tropical rain plants and animals are called as omnivores
forest are the maximum among aquatic and (Crow). Such organisms may occupy more than
terrestrial ecosystems respectively. one trophic level in the food chain.
The following graph represents net primary 7.2.4 Energy flow
productivity of various ecosystems. The transfer of energy in an ecosystem between
Open Oceans trophic levels can be termed as energy flow.
Tropical Rain Forests
Temperate Forests It is the key function in an ecosystem. Part of
Savennas
Taiga
the energy obtained from the sun by producer
Continental Shelves is transferred to consumers and decomposers
Agricultural Lands
Temperate Grasslands
through the each trophic level, while some
Woodland and Shrublands amount of energy is dissipated in the form of
Estuaries
Swamps and Marshes heat. Energy flow is always unidirectional in
Desert scrubs
Lakes and Streams
an ecosystem.
0 50 100 150 200
Tundra (artic and alpine) Average World net primary productivity Sun
Extreme deserts (billion kcal/yr)
Figure 7.1: Average world net primary

Heat
production of various ecosystems. Heat Heat
7.2.3 Concept of trophic level in an ecosystem

(Greek word ‘ trophic’ = to food or feeding)
A trophic level refers to the position of an Plants Herbivores Carnivores
organism in the food chain. The number of
trophic levels is equal to the number of steps
in the food chain. The green plants (producers) Decomposers
occupying the first trophic level (T1) are Figure 7.3: Diagrammatic
called producers. The energy produced by representation of energy flow
the producers is utilized by the plant eaters Laws of thermodynamics
(herbivores) they are called primary consumers
and occupies the second trophic level (T2). The storage and loss of energy in an ecosystem
is based on two basic laws of thermo-dynamics.
Fourth Trophic level (T4) Secondary
(Tertiary consumers) carnivore - Eagle i. First law of thermodynamics
Third Trophic level (T3) Primary It states that energy can be transmitted from
(Secondary consumers) carnivore - Snake
one system to another in various forms. Energy
Second Trophic level (T2)
(Primary consumers)
Herbivore - Rabbit Omnivore
- crow
cannot be destroyed or created. But it can be
First Trophic level (T1) transformed from one form to another. As
Autotrophs - Plants
(Producers) a result, the quantity of energy present in the
Figure 7.2: Diagrammatic universe is constant.
representation of trophic levels Example:
Herbivores are eaten by carnivores, which occupy In photosynthesis, the product of starch
the third trophic level (T3). They are also called (chemical energy) is formed by the combination
secondary consumers or primary carnivores. of reactants (chlorophyll, H2O, CO2). The
Carnivores are eaten by the other carnivores, energy stored in starch is acquired from the
which occupy the fourth trophic level (T4). They external sources (light energy) and so there is
are called the tertiary consumers or secondary
Ecosystem 151

no gain or loss in total energy. Here light energy herbivores store only 1 Joule of energy and
is converted into chemical energy. the remaining 9 Joules is dissipated. Finally,
light the carnivores are eaten by tertiary consumers
6 CO2 + 6 H20 C6H1206 + 6 O2 which store only 0.1 Joule of energy and the
Chlorophyll
remaining 0.9 Joule is lost in the environment.
Light energy chemical energy Thus, at the successive trophic level, only ten
percent energy is stored.
ii. Second law of thermodynamics
It states that energy transformation results in the 7.2.5 Food chain
reduction of the free energy of the system. Usually The movement of energy from producers upto
energy transformation cannot be 100% efficient. top carnivores is known as food chain, i.e., in
As energy is transferred from one organism to any food chain, energy flows from producers
another in the form of food, a portion of it is stored to primary consumers, then from primary
as energy in living tissue, whereas a large part of
consumers to secondary consumers, and finally
energy is dissipated as heat through respiration.
secondary consumers to tertiary consumers.
The transfer of energy is irreversible natural
Hence, it shows linear network links. Generally,
process. Example: Ten percent law
there are two types of food chain, (1) Grazing
Ten percent law food chain and (2) Detritus food chain.
This law was proposed by Lindeman (1942). It 1. Grazing food chain
states that during transfer of food energy from
Main source of energy for the grazing food
one trophic level to other, only about 10% stored
chain is the Sun. It begins with the first link,
at every level and rest of them (90%) is lost in
producers (plants). The second link in the food
respiration, decomposition and in the form of
chain is primary consumers (mouse) which
heat. Hence, the law is called ten percent law.
get their food from producers. The third link
in the food chain is secondary consumers
0.9 Joule (snake) which get their food from primary
Tertiary Energy lost
consumers
0.1 Joule
consumers. Fourth link in the food chain is
1 Joule
9 Joules tertiary consumers (eagle) which get their
Energy lost
Secondary consumers food from secondary consumers.
10 Joules
90 Joules
Energy lost
Sunlight Primary consumers
1000 Joules 900 Joules

100 Joules Energy lost Grass Mouse Snake Eagle
Producers
Primary Secondary Tertiary
Producers
Consumers Consumers Consumers
Figure 7.4: Ten percent law
Figure 7.5: Diagrammatic representation of
Example: It is shown that of the 1000 Joules of
Solar energy trapped by producers. 100 Joules Grazing food chain
of energy is stored as chemical energy through 2. Detritus food chain:
photosynthesis. The remaining 900 Joules would
This type of food chain begins with dead organic
be lost in the environment. In the next trophic
matter which is an important source of energy.
level herbivores, which feed on producers get
A large amount of organic matter is derived from
only 10 Joules of energy and the remaining
the dead plants, animals and their excreta. This
90 Joules is lost in the environment. Likewise,
type of food chain is present in all ecosystems.
in the next trophic level, carnivores, which eat
152 Ecosystem

The transfer of energy from the dead organic • It can be used to illustrate indirect
matter, is transferred through a series of organisms interactions among different species.
called detritus consumers (detritivores)- small • It can be used to study bottom-up or top-
carnivores - large (top) carnivores with repeated down control of community structure.
eating and being eaten respectively. This is called • It can be used to reveal different patterns
the detritus food chain. of energy transfer in terrestrial and aquatic
ecosystems.
7.2.7 Ecological pyramids
Graphic representation of the trophic structure
Fallen leaves Earthworm Black bird Hawk
and function at successive trophic levels of an
Small Top
Detritus Detritivores
carnivores carnivores ecosystem is called ecological pyramids. The
Figure 7.6: Diagrammatic representation of concept of ecological pyramids was introduced
Detritus food chain. by Charles Elton (1927). Thus they are also
7.2.6 Food Web called as Eltonian pyramids.
The inter-locking pattern of a number of food There are three types: (1) pyramid of number
chain form a web like arrangement called (2) pyramid of biomass (3) pyramid of energy.
food web. It is the basic unit of an ecosystem, 1. Pyramid of number
to maintain its stability in nature. It is called
A graphical representation of the number of
homeostasis.
organisms present at each successive trophic
Example: In a grazing food chain of a grass level in an ecosystem is called pyramids of
land, in the absence of a rabbit, a mouse may number. There are three different shapes of
also eat food grains. The mouse in turn may be pyramids upright, spindle and inverted.
eaten directly by a hawk or by a snake and the
There is a gradual decrease in the number of
snake may be directly eaten by hawks.
organisms in each trophic level from producers
Grasshopper Lizard to primary consumers and then to secondary
consumers, and finally to tertiary consumers.
Rabbit
Therefore, pyramids of number in grassland
and pond ecosystem are always upright.
Hawk
In a forest ecosystem the pyramid of number
Plants
is somewhat different in shape, it is because the
Mouse
Snake base (T1) of the pyramid occupies large sized
Figure 7.7: Diagrammatic representation trees (Producer) which are lesser in number.
of Food web in a grassland ecosystem Herbivores (T2) (Fruit eating birds, elephant,
deer) occupying second trophic level, are more
Hence, this interlocking pattern of food chains in number than the producers. In final trophic
is the food web and the species of an ecosystem level (T4), tertiary consumers (lion) are lesser in
may remain balanced to each other by some number than the secondary consumer (T3) (fox
sort of natural check. and snake). Therefore, the pyramid of number
Significance of food web in forest ecosystem looks spindle shaped.
• Food web is constructed to describe species The pyramid of number in a parasite
interaction called direct interaction. ecosystem is always inverted, because it
Ecosystem 153

T4
T4
T4 T4
T3 T3
T3 T3 T2
T2
T2 T2
T1
T1 T1
T1
A B C D
T1 - Producers | T2 - Herbivores | T3 - Secondary consumers | T4 - Tertiary consumers
Figure 7.8: Pyramids of numbers ( individuals per unit area) in different types of ecosystems.
Upright-A) Grassland ecosystem B) Pond ecosystem , Spindle shaped -C) Forest ecosystem,
Inverted-D) Parasite ecosystem
starts with a single tree. Therefore there is However, in pond ecosystem, the bottom of
gradual increase in the number of organisms the pyramid is occupied by the producers, which
in successive tropic levels from producer to comprise very small organisms possessing
tertiary consumers. the least biomass and so, the value gradually
2 Pyramid of biomass increases towards the tip of the pyramid.
Therefore, the pyramid of biomass is always
A graphical representation of the amount of inverted in shape.
organic material (biomass) present at each
successive trophic level in an ecosystem is called 3. Pyramid of energy
pyramid of biomass. A graphical representation of energy flow at
In grassland and forest ecosystems, there each successive trophic level in an ecosystem is
is a gradual decrease in biomass of organisms called pyramids of energy. The bottom of the
at successive trophic levels from producers to pyramid of energy is occupied by the producers.
top carnivores (Tertiary consumer). Therefore, There is a gradual decrease in energy transfer
these two ecosystems show pyramids as upright at successive tropic levels from producers to the
pyramids of biomass. upper levels. Therefore, the pyramid of energy is
always upright.
B T4 C T3
A T4
T2
T3
T3
T2 T2
T1
T1
T1

Figure 7.9: Pyramids of biomass ( dry weight per unit area)in different types of ecosystems.
Upright-A) Grassland ecosystem B) Forest ecosystem, Inverted- C)Pond ecosystem
154 Ecosystem

and protein are decomposed rapidly than the
cellulose, lignin, chitin, hair and bone.
Tertiary
consumers Mechanism of decomposition
0.1 Joule
1 Joule Decomposition is a step wise process of
Secondary consumers
degradation mediated by enzymatic reactions.
10 Joules Detritus acts as a raw material for decomposition.
It occurs in the following steps.
a. Fragmentation - The breaking down
1000 Joules
100 Joules
of detritus into smaller particles by
Producers detritivores like bacteria, fungi and earth
worm is known as fragmentation. These
Figure 7.10: Pyramids of energy( Kcal/unit detritivores secrete certain substances
area/unit time ) in any ecosystem to enhance the fragmentation process
and increase the surface area of detritus
7.2.8 Decomposition: particles.
Decomposition is a process in which the detritus b. Catabolism - The decomposers produce
(dead plants, animals and their excreta) are some extracellular enzymes in their
breakdown in to simple organic matter by the surroundings to break down complex
decomposers. It is an essential process for recycling organic and inorganic compounds in to
and balancing the nutrient pool in an ecosystem. simpler ones. This is called catabolism
Nature of decomposition c. Leaching or Eluviation - The movement
The process of decomposition varies based of decomposed, water soluble organic and
on the nature of the organic compounds, i.e., inorganic compounds from the surface to
some of the compounds like carbohydrate, fat the lower layer of soil or the carrying away
Raw material for

Fragmentation Catabolism
decomposition
Senescence
Leaching
Absorption
by plants
Mineralisation Humification
Figure 7.11: Diagrammatic representation – Process of decomposition and cycling of nutrients.
Ecosystem 155

of the same by water is called leaching or Carbon cycle
eluviation.
The circulation of carbon between organisms
d. Humification - It is a process by which and environment is known as the carbon cycle.
simplified detritus is changed into dark Carbon is an inevitable part of all biomolecules
coloured amorphous substance called and is substantially impacted by the change
humus. It is highly resistant to microbial in global climate. Cycling of carbon between
action, therefore decomposition is very organisms and atmosphere is a consequence
slow. It is the reservoir of nutrients. of two reciprocal processes of photosynthesis
e. Mineralisation - Some microbes are and respiration. The relesing of carbon in
involved in the release of inorganic the atmosphere increases due to burning of
nutrients from the humus
of the soil, such process is
Atmospheric CO2
called mineralisation. Volcanic eruption
Diffusion
Factors affecting
Respiration Forest fire
decomposition
Combustion Photosynthesis
Decomposition is affected
by climatic factors like Diffusion
temperature, soil moisture,

soil pH ,oxygen and also the
chemical quality of detritus. Transport
(DOM) Photosynthesis
7.2.9 Biogeochemical cycle
(Nutrient cycle) Respiration
Dead organic
matter (DOM)
Exchange of nutrients
Decomposition Decomposition
between organisms and their Fossil fuel
environment is one of the Peat
Coal Dead organic matter
essential aspects of an ecosystem. Oil and Gas Deposition / Sediments
All organisms require nutrients
Figure 7.12: Diagrammatic Sketch showing Carbon cycle
for their growth, development,
maintenance and reproduction. Circulation of fossile fules, deforestration, forest fire, volcanic
nutrients within the ecosystem or biosphere is eruption and decomposition of dead organic
known as biogeochemical cycles and also called matters. The details of carbon cycle are given in
as ‘cycling of materials.’ There are two basic types, the figure.
1. Gaseous cycle – It includes atmospheric Phosphorus cycle
Oxygen, Carbon and Nitrogen cycles.
It is a type of sedimentary cycle. Already we know
2. Sedimentary cycle – It includes the cycles that phosphorus is found in the biomolecules
of Phosphorus, Sulphur and Calcium - like DNA, RNA, ATP, NADP and phospholipid
Which are present as sediments of earth. molecules of living organisms. Phosphorus
Many of the cycles mentioned above are studied is not abundant in the biosphere, whereas a
by you in previous classes. Therefore, in this bulk quantity of phosphorus is present in rock
chapter, only the carbon and phosphorous deposits, marine sediments and guano. It is
cycles are explained. released from these deposits by weathering
156 Ecosystem

process. After that, it circulates in
lithosphere as well as hydrosphere.
The producers absorb phosphorus
PI
Urban/Industrial in the form of phosphate ions,
Food PI and then it is transferred to
rs
each trophic level of food chain
Agriculture
ize
l
Fe
rti
rti
Fe
PI Weathering P through food. Again death of

liz
ers
I
Mining
Phosphate PO
rocks Guano Dead Uptake the organisms and degradation
organic
PI
Death matter Soil by the action of decomposers, the
Excretion PI
Bacteria phosphorus is released back into
Decomposition
Sediments Mineralization the lithosphere and hydrosphere
Po = Organic phosphates
PI = Inorganic phosphates to maintain phosphorus cycle.
Figure 7.13: Diagrammatic sketch showing Phosphorous cycle
7.2.10 Types of ecosystem Structure of Pond ecosystem

Biosphere consists of different types of
ecosystems, which are as follows:
Producers
Ecosystem
Natural Artificial or Manmade Consumers

Ecosystem Ecosystem
(With or (Artifically maintained Mud Decomposers
without by man)
human Example: Rice field and Abiotic components
interference) Maize field Figure 7.15: Diagram shows structure of pond
ecosystem with abiotic and biotic components.
Terrrestrial Ecosystem Aquatic It is a classical example for natural, aquatic,

Example: Forest ecosystem ecosystem freshwater, lentic type of ecosystem. It helps
Grass land ecosystem (Open us to understand the structure and function
Desert ecosystem water) of an ecosystem. When rain water gathers in a
shallow area, gradually over a period of time,
Fresh water ecosystem Marine ecosystem different kinds of organisms (microbes, plants,
animals) become part of this ecosystem. This
Lotic Lentic pond ecosystem is a self sustaining and self
(Running water (Standing water regulatory fresh water ecosystem, which shows
bodies) bodies) a complex interaction between the abiotic and
Example: River Example: Pond biotic components in it.
Spring and Stream and Lake
Figure 7.14: Types of Ecosystem Activity
Though there are many types of ecosystems Collect few living and nonliving
as charted above. Only the pond ecosystem is components from any water body found
detailed below. near by.
Ecosystem 157

Abiotic components c. Decomposers
A pond ecosystem consists of dissolved They are also called as microconsumers.
inorganic (CO2, O2, Ca, N, Phosphate) and They help to recycle the nutrients in the
organic substances (amino acids and humic ecosystem. These are present in mud water and
acid) formed from the dead organic matter. The bottom of the ponds. Example: Bacteria and
function of pond ecosystem is regulated by few Fungi. Decomposers perform the process of
factors like the amount of light, temperature, decomposition in order to enrich the nutrients
pH value of water and other climatic conditions. in the pond ecosystem.
Biotic components The cycling of nutrients between abiotic and
They constitute the producers, variety of biotic components is evident in the pond
consumers and decomposers (microorganisms). ecosystem, making itself self sufficient and self
regulating.
a. Producers
A variety of phytoplanktons like Oscillatoria, Limnology
Anabaena, Eudorina, Volvox and Diatoms. It is the study of
Filamentous algae such as Ulothrix, Spirogyra, biological, chemical,
Cladophora and Oedogonium; floating plants physical and geological
Azolla, Salvia, Pistia, Wolffia and Eichhornia; components of inland fresh water aquatic
sub-merged plants Potamogeton and Phragmitis; ecosystems (ponds, lakes, etc.).
rooted floating plants Nymphaea and Nelumbo;
macrophytes like Typha and Ipomoea, constitute Oceanography – It is the study of
the major producers of a pond ecosystem. biological, chemical, physical and
b. Consumers geological components of ocean.
The animals represent the consumers of

Stratification of pond ecosystem
a pond ecosystem include zooplanktons
like Paramoecium and Daphnia (primary Sun
consumers); benthos (bottom living animals)

like mollusces and annelids; secondary
consumers like water beetles and frogs; and
tertiary consumers (carnivores) like duck ,
crane and some top carnivores which include LITTORAL ZONE
large fish, hawk ,man, etc. LIMNETIC ZONE

light
compensation
PROFUNDAL ZONE level
Sea grasses and BENTHIC

ZONE
mangroves of Estuarine
Figure 7.16: Diagrammatic sketch shows
and coastal ecosystems
stratification of Pond ecosystem
are the most efficient
in carbon sequestration. Hence, these Based on the factors like distance from the
ecosystems are called as “ Blue carbon shore, penetration of light, depth of water,
ecosystems”. They are not properly utilized types of plants and animals, there may be three
and maintained all over the world although zones, littoral, limnetic and profundal. The
they have rich bioresources potential. littoral zone, which is closest to the shore with
shallow water region, allows easy penetration of
light. It is warm and occupied by rooted plant
158 Ecosystem

species. The limnetic zone refers the open water
of the pond with an effective penetration of Robert Constanza and his
light and domination of planktons. The deeper colleagues estimated the
region of a pond below the limnetic zone is value of global ecosystem
called profundal zone with no effective light services based on various
penetration and predominance of heterotrophs. parameters. According to them in 1997, the
The bottom zone of a pond is termed benthic average global value of ecosystems services
and is occupied by a community of organisms estimated was US $ 33 trillion a year.
called benthos (usually decomposers).The The updated estimate for the total global
primary productivity through photosynthesis of ecosystem services in 2011 is US $ 125
littoral and limnetic zone is more due to greater trillion / year, indicating a four-fold increase
penetration of light than the profundal zone. in ecosystem services from 1997 to 2011.
7.2.11 Ecosystem services ( Benefits) Mangrove ecosystem services

Ecosystem services are defined as the benefits
• Offers habitat and
that people derive from nature. Robert act as nursery for
Constanza et al (1927) stated “Ecosystem aquatic plants and
services are the benefits provided to human, animals
through the transformation of resources (or
• Provides medicine,
Environmental assets including land, water,
fuel wood and
vegetation and atmosphere) into a flow of
timber.
essential goods and services”.
•
Act as bridge
Study on ecosystem services acts as an between sea and rivers by balancing
effective tool for gaining knowledge on sedimentation and soil erosion.
ecosystem benefits and their sustained use. • Help to reduce water force during cyclones,
Without such knowledge gain, the fate of any tsunamis and high tide periods.
ecosystem will be at stake and the benefits they
• Help in wind break, O2 production, carbon
provide to us in future will become bleak.
sequestration and prevents salt spray from
waves.
The varieties of benefits obtained from the ecosystem are generally categorized into the following four types
Ecosystem services
Provisoning Cultural services Supporting services Regulating services

services • Spiritual and • Primary production • Invasion resistance
• Food, fiber religious values • Provision of habitat • Herbivory pollination
and fuel • Knowledge system • Nutrient cycling • Seed dispersal
• Genetic • Education and • Soil formation and • Climate regulation
resources inspiration retention • Pest regulation
• Bio-chemicals • Recreation and • Production of • Disease regulation
• Fresh water aesthetic values atmospherc oxygen • Erosion regulation
• Medicines • Ecotourism • Water cycling • Water purification
• Natural hazard protection
Figure 7.17: Types of Ecosystem services
Ecosystem 159

How do anthropogenic activities affect •
Buy and use only ecofriendly products and
ecosystem services? recycle them.
Now, we all exploit the ecosystem more than •
Grow more trees
that of our needs. The Millennium Ecosystem
•
Choose sustained farm products
Assessment (2005) found that “over the past 50
(vegetables, fruits, greens, etc.)
years, humans have changed the ecosystem more
rapidly and extensively than in any comparable •
Reduce the use of natural resources.
period of time in human history, largely to meet •
Recycle the waste and reduce the amount
rapidly growing demands for food, fresh water, of waste you produce.
medicine, timber, fiber and fuel.”
•
Reduce consumption of water and
Generally the following human activities electricity.
disturb or re-engineer an ecosystem every day.
•
Reduce or eliminate the use of house-hold
•
Habitat destruction
chemicals and pesticides.
•
Deforestation and over grazing
•
Erosion of soils •
Maintain your cars and vehicles properly.
•
Introduction of non-native species (In order to reduce carbon emission)
•
O ver harvesting of plant material •
Create awareness and educate about
•
Pollution of land, water and air ecosystem protection among your friends
•
Run off pesticides, fertilizers and animal wastes and family members and ask them to find
out solution to minimise this problem.
Ecosystem resilience
Ecosystem is damaged
by disturbances from
fire, flood, predation,
infection, drought, etc., removing a great
amount of biomasss. However, ecosystem Go green
is endowed with the ability to resist the
It refers to the
damage and recover quickly. This ability
changing of one’s
of ecosystem is called ecosystem resilience
lifestyle for the
or ecosystem robustness.
safety and benefits of the environments
(Reduce, Reuse, Recycle)
How to protect the ecosystem?
Way to go green and save green
It is a practice of protecting ecosystem at • Close the tap when not in use.
individual, organisational and governmental • Switch off the electrical gadgets
levels for the benefits of both nature and humans. when not in use.
Threats to ecosystems are many, like adverse • Never use plastics and replace them
human activities, global warming, pollution, etc. with biodegradable products
Hence, if we change our everyday life style, we • Always use ecofriendly technology
can help to protect the planet and its ecosystem. and products.
“If we fail to protect environment, we will “USE ECOSYSTEM BUT DON’T
fail to save posterity”. LOSE ECOSYSTEM; MAKE IT
SUSTAINABLE”
Therefore, we have to practice the following
in our day today life:
160 Ecosystem

7.2.12 Ecosystem Management • It involves collaborative management with
It is a process that integrates ecological, socio government agencies, local population,
economic and institutional factors into a communities and NGO’s.
comprehensive strategy in order to sustain • It is used to build the capacity of local
and enhance the quality of the ecosystem to institutions and community groups to assume
meet current and future needs. responsibility for long term implementation
Ecosystem management emphasis on of ecosystem management activities even
human role in judicious use of ecosystem after the completion of the project.
and for sustained benefits through minimal
human impacts on ecosystems. Environmental
Urban ecosystem restoration model
degradation and biodiversity loss will result
in depletion of natural resources, ultimately Adayar Poonga is located in Chennai and
affecting the existence of human covers an area around a total of 358 acres of
Adayar creek and estuary, of which 58 acres
were taken up for eco restoration under the
"By 2025, at least 3.5
billion people, nearly 50% auspices of Government of Tamil Nadu. It is
of the world’s population maintained by Chennai Rivers Restoration
are projected to face water Trust (CRRT).This was a dumping site
scarcity." – IUCN. previously.
"Forests house approximately 50% of Presently it has 6 species of mangroves,
global bio-diversity and at least 300 million about 170 species of littoral and tropical
people are dependent on forest’s goods dry evergreen forests (TDF) which have
and services to sustain their livelihood." – successfully established as a sustainable
IUCN ecosystem. Restoration of plants species
has brought other associated fauna such as
Strategy of ecosystem management butterflies, birds, reptiles, amphibians and
• It is used to maintain biodiversity of other mammals of the ecosystem.
ecosystems. Currently Adayar Poonga functions as an
• It helps in indicating the damaged environmental education Centre for school
ecosystem (Some species indicate the health and college students and the public. The
of the ecosystem: such species are called a entire area stands as one of the best examples
flagship species). for urban eco restoration in the state
• It is used to recognize the inevitability of of Tamil Nadu.
ecosystem change and plan accordingly.
• It is one of the tools used for achieving
sustainability of ecosystem through
sustainable development programme (or
projects).
• It is also helpful in
identifying ecosystems
which are in need of
rehabilitation.
Adayar Poonga
Ecosystem 161

7.3 Plant Succession 7.3.2 Types of succession
We very often see that forests and lands The various types of succession have been
in our areas are drastically affected by classified in different ways on the basis of
natural calamities (Flood, earthquake) and different aspects. These are as follows:
anthropogenic activities (Fire, over grazing, 1. Primary succession - The development
cutting of trees). Due to these reasons all plants of plant community in a barren area where no
of an area are destroyed and the areas become community existed before is called primary
nude. When we observe this area, over a period succession. The plants which colonize first
of a time we can see that it will be gradually in a barren area is called pioneer species or
covered by plant community again and become primary community or primary colonies.
fertile. Such successive replacement of one Generally, Primary succession takes a very
type of plant community by the other of the long time for the occurrence in any region.
same area/ place is known as plant succession.
Example: Microbes, Lichen, Mosses.
The first invaded plants in a barren area are
called pioneers. On the other hand, a series of 2. Secondary succession - The development of
transitional developments of plant communities a plant community in an area where an already
one after another in a given area are called seral developed community has been destroyed by
communities. At the end a final stage and a some natural disturbance (Fire, flood, human
final plant community gets established which activity) is known as secondary succession.
are called as climax and climax community
respectively. Primary succession Secondary succession
1 Developing in an Developing in
7.3.1 Characteristics of ecological barren area disturbed area
succession 2 Initiated due to a Starts due to external
biological or any factors only
• It is a systematic process which causes changes other external factors
in specific structure of plant community. 3 No soil, while It starts where soil
primary succession covers is already
• It is resultant of changes of abiotic and
starts present
biotic factors.
4 Pioneer species Pioneer species
• It transforms unstable community into a come from outside develop from existing
stable community. environment environment
5 It takes more time to It takes comparatively
• Gradual progression in species diversity, complete less time to complete
total biomass, niche specialisation, and
Table 1: Differences between primary and
humus content of soil takes place. secondary succession
•
It progresses from simple food
Secondary Succession
chain to complex food web.
Intermediate Climax
• It modifies the lower and simple Pioneer Species Species Community
life form to the higher life forms.
•
It creates inter-dependence of Annual Grasses
Fire and Grasses, Shrubs Shrubs and trees
plants and animals. plants
Perennials
0 Year 1 - 2 Years 3 - 4 Years 5 - 150 Years 150 + Years
Figure 7.18: Diagrammatic representation of

secondary succession
162 Ecosystem

Types of succession
Primary Secondary Autogenic Allogenic Autotrophic Heterotrophic

Succession Succession Succession Succession Succession Succession
Development Controlled
Development Controlled It occurs in the It occurs in the
of plant by biotic
of plant by abiotic medium that is medium that is
community on components of
community on components rich in inorganic rich in organic
barren area. ecosystem.
disturbed area. of ecosystem. substances . substances.
Figure 7.19: Types of succession
Generally, This succession takes less time than Since, green plants dominate
the time taken for primary succession. in the beginning of this
Example: The forest destroyed by fire and succession, there is a gradual
excessive lumbering may be re-occupied by increase in organic matter
herbs over period of times. and subsequently the energy
flow in the ecosystem.
3. Autogenic succession
6. Heterotrophic succession
Autogenic succession occurs as a result of
biotic factors. The vegetation reacts with If heterotrophic organisms like bacteria, fungi,
its environment and modifies its own actinomycetes, and animals are dominant
environment causing its own replacement by during the early stages of succession it is
new communities. This is known as autogenic called heterotrophic succession. Such a
succession. succession takes place in organic habitats. Since
Example: In forest ecosystem, the larger trees heterotrophs dominate in the beginning of such
produce broader leaves providing shade to the succession, there will be a gradual decrease in
forest floor area. It affects the shrubs and herbs the energy content.
which require more light (heliophytes) but
7.3.3 Classification of plant succession
supports the shade tolerant species (sciophytes)
to grow well. Detailed study of Hydrosere and Lithosere are
discussed below:
4. Allogenic succession
Plant succession
Allogeneic succession occurs as a result of
abiotic factors. The replacement of existing Hydrosere Mesosere Xerosere
community is caused by other external factors (Succession (Succession (Succession
(soil erosion, leaching, etc.,) and not by existing starts in starts in starts in
organisms. regions where regions regions where
water is
where moisture
Example: In a forest ecosystem soil erosion plenty)
Example: moisture is present
and leaching alter the nutrient value of the soil condition in minimal
Ponds, lakes,
leading to the change of vegetation in that area. is amount with
stream ,
5. Autotrophic succession swamps adequate) water
If the autotrophic organisms like green plants are Lithosere Halosere Psammosere
dominant during the early stages of succession it (Initiating on (Initiating in (Initiating on
is called autotrophic succession, this occurs in a barren rock) saline water) a sand)
the habitat which is rich in inorganic substances.
Figure 7.20: Classification of plant succession
Ecosystem 163

Hydrosere
The succession in a freshwater ecosystem is
also referred to as hydrosere. Succession in a
Forest stage
pond, begins with colonization of the pioneers
like phytoplankton and finally ends with the
formation of climax community like forest
stage. It includes the following stages Fig 7.21.
1. Phytoplankton stage - It is the first stage
of succession consisting of the pioneer
community like blue green algae, green algae,
Figure 7.21: Diagrammatic representation shows different stages of hydrosere.

Shrub stage
diatoms, bacteria, etc., The colonization
of these organisms enrich the amount of
organic matter and nutrients of pond due to
their life activities and death. This favors the
development of the next seral stages.
Marsh meadow
2. Submerged plant stage - As the result of death

and decomposition of planktons, silt brought
stage
from land by rain water, lead to a loose mud

formation at the bottom of the pond. Hence,
the rooted submerged hydrophytes begin
to appear on the new substratum. Example:
Chara, Utricularia, Vallisneria and Hydrilla etc.
Reed-swamp
The death and decay of these plants will build

stage
up the substratum of pond to become shallow.

Therefore, this habitat now replaces another
group of plants which are of floating type.
3. Submerged free floating stage - During
Submerged plant Submerged free
floating stage
this stage, the depth of the pond will become

almost 2-5 feet. Hence, the rooted hydrophytic
plants and with floating large leaves start
colonising the pond. Example: Rooted floating
plants like Nelumbo, Nymphaea and Trapa.
Some free floating species like Azolla, Lemna,
Wolffia and Pistia are also present in this stage.
stage
By death and decomposition of these plants,

further the pond becomes more shallow.
Due to this reason, floating plant species is
gradually replaced by another species which
Phytoplankton
makes new seral stage.

4. Reed-swamp stage - It is also called an
stage
amphibious stage. During this stage, rooted

floating plants are replaced by plants which
can live successfully in aquatic as well as aerial
164 Ecosystem

environment. Example: Typha, Phragmites, •
The knowledge of ecological succession
Sagittaria and Scirpus etc. At the end of this helps to understand the controlled growth
stage, water level is very much reduced, making of one or more species in a forest.
it unsuitable for the continuous growth of • Utilizing the knowledge of succession, even
amphibious plants. dams can be protected by preventing siltation.
5. Marsh meadow stage - When the pond • It gives information about the techniques to
becomes swallowed due to decreasing water be used during reforestation and afforestation.
level, species of Cyperaceae and Poaceae such as
Carex, Juncus, Cyperus and Eleocharis colonise • It helps in the maintenance of pastures.
the area. They form a mat-like vegetation with • Plant succession helps to maintain species
the help of their much branched root system. diversity in an ecosystem.
This leads to an absorption and loss of large
•
Patterns of diversity during succession
quantity of water. At the end of this stage, the
are influenced by resource availability and
soil becomes dry and the marshy vegetation
disturbance by various factors.
disappears gradually and leads to shurb stage.
• Primary succession involves the colonization
6. Shrub stage - As the disappearance of marshy
of habitat of an area devoid of life.
vegetation continues, soil becomes dry. Hence,
these areas are now invaded by terrestrial •
Secondary succession involves the
plants like shrubs (Salix and Cornus) and trees reestablishment of a plant community in
(Populus and Alnus). These plants absorb large disturbed area or habitat.
quantity of water and make the habitat dry. • Forests and vegetation that we come across
Further, the accumulation of humus with a all over the world are the result of plant
rich flora of microorganisms produce minerals succession.
in the soil, ultimately favouring the arrival of
new tree species in the area. Summary
7. Forest stage - It is the climax community of The interaction between biotic and abiotic
hydrosere. A variety of trees invade the area components in an environment is called
and develop any one of the diverse type of ecosystem. Autotrophs and heterotrophs are
vegetation. Example:Temperate mixed forest the producers and consumers respectively.
(Ulmus,Acer and Quercus), Tropical rain forest The function of ecosystem refers to creation of
(Artocarpus and Cinnamomum ) and Tropical energy, flow of energy and cycling of nutrients.
deciduous forest (Bamboo and Tectona). The amount of light available for photosynthesis
is called Photo synthetically Active Radiation .
In the 7 stages of hydrosere succession, stage1 is
It is essential for increase in the productivity of
occupied by pioneer community, while the stage
ecosystem. The rate of biomass production per
7 is occupied by the climax community. The
unit area /time is called productivity. It is classified
stages 2 to 6 are occupied by seral communities.
as primary productivity, secondary productivity
7.3.4 Significance of Plant Succession and community productivity. The transfer of
•
Succession is a dynamic process. Hence energy in an ecosystem can be termed as energy
an ecologist can access and study the seral flow. It is explained through the food chain, food
stages of a plant community found in a web , ecological pyramids ( pyramid of number,
particular area. biomass and energy ) and biogeochemical cycle.
Cycling of nutrients between abiotic and biotic
components is evident in the pond ecosystem,
Ecosystem 165

making itself self sufficient and self regulating 4. Pond ecosystem is
Ecosystem protected for the welfare of posterity a) not self sufficient and self regulating
is called ecosystem management. b) partially self sufficient and self regulating
Successive replacement of one type of plant c) self sufficient and not self regulating
community by the other of the same area/ d) self sufficient and self regulating
place is known as plant succession. The first 5. Profundal zone is predominated by
invaded plants in a barren (nude) area are called heterotrophs in a pond ecosystem, because of
pioneers (pioneers communities). On the other a) with effective light penetration
hand, a series of transitional developments b) no effective light penetration
of plant communities one after another in c) complete absence of light
a given area are called seral communities. d) a and b
Succession is classified as primary succession, 6.
Solar energy used by green plants for
secondary succession, autogenic succession, photosynthesis is only
allogeneic succession, autotrophic succession a) 2 – 8% b) 2 – 10%
and heterotrophic succession. Plant succession c) 3 – 10% d) 2 – 9%
is classified in to hydrosere (Initiating on a
7. Which of the following ecosystem has the
water bodies) ,Mesosere and xerosere. Further
highest primary productivity?
xerosere is subdivided in to Lithosere ( Initiating
a) Pond ecosystem
on a barren rock), Halosere and Pasmmosere.
b) Lake ecosystem
c) Grassland ecosystem
Evaluation
d) Forest ecosystem
I Choose the most suitable
8. Ecosystem consists of
answer from the given
a) decomposers b) producers
four alternatives and write
the option code and the c) consumers d) all of the above
corresponding answer. 9. Which one is in descending order of a food
1. Which of the following is chain
not a abiotic component of the ecosystem? a) Producers  Secondary consumers
a) Bacteria  Primary consumers  Tertiary
b) Humus consumers
c) Organic compounds b) Tertiary consumers  Primary
d) Inorganic compounds consumers  Secondary consumers 
Producers
2. Which of the following is / are not a natural
c) Tertiary consumers  Secondary
ecosystem?
consumers  Primary consumers 
a) Forest ecosystem
Producers
b) Rice field
d) Tertiary consumers  Producers 
c) Grassland ecosystem
Primary consumers  Secondary
d) Desert ecosystem
consumers
3. Pond is a type of 10. Significance of food web is / are
a) forest ecosystem a) it does not maintain stability in nature
b) grassland ecosystem b) it shows patterns of energy transfer
c) marine ecosystem c) it explains species interaction
d) fresh water ecosystem d) b and c
166 Ecosystem

11. The following diagram represents 20. Name of the food chain which is generally
T4 present in all type of ecosystem. Explain and
write their significance.
T3 21. Shape of pyramid in a particular ecosystem
is always different in shape. Explain with
T2
example.
22. Generally human activities are against to the
T1 ecosystem, where as you a student how will
you help to protect ecosystem?
a) pyramid of number in a grassland 23. Generally in summer the forest are affected
ecosystem by natural fire. Over a period of time it
b) pyramid of number in a pond ecosystem recovers itself by the process of successions .
c) pyramid of number in a forest ecosystem Find out the types of succession and explain.
d) pyramid of biomass in a pond ecosystem
24. Draw a pyramid from following details and
12. Which of the following is / are not the explain in brief.
mechanism of decomposition Quantities of organisms are given-Hawks-50,
a) Eluviation b) Catabolism plants-1000.rabbit and mouse-250 +250,
c) Anabolism d) Fragmentation pythons and lizard- 100 + 50 respectively.
13. Which of the following is not a 25. Various stages of succession are given bellow.
sedimentary cycle From that rearrange them accordingly. Find
a) Nitrogen cycle b) Phosphorous cycle out the type of succession and explain in
c) Sulphur cycle d) Calcium cycle detail.
14. Which of the following are not regulating Reed-swamp stage, phytoplankton stage,
services of ecosystem services shrub stage, submerged plant stage, forest
i) Genetic resources stage, submerged free floating stage, marsh
ii) Recreation and aesthetic values medow stage.
iii) Invasion resistance
iv) Climatic regulation Glossary
a) i and iii b) ii and iv Ecosystem: Study of interaction between living
c) i and ii d) i and iv and non-living components
15. Productivity of profundal zone will be low. Standing quality: Total inorganic substances
Why? presents in any ecosystem at a given time and
16. Discuss the gross primary productivity is given area
more efficient than net primary productivity.
Standing crops: Amount of living material
17. Pyramid of energy is always upright. Give
present in a population at any time.
reasons
18. What will happen if all producers are Biomass: Can be measured as fresh weight or
removed from ecosystem? dry weight of organisms
19. Construct the food chain with the following Benthic: Bottom zone of the pond
data.
Trophic: Refers to the position of organisms in
Hawk, plants, frog, snake, grasshopper.
food chain
Ecosystem 167

Omnivores: Those eats both plants and animals organisms and environments
Food chain: Refers movement of energy from Guano: It is a accumulated excrement of sea
producers up to top carnivores birds and bats.
Food web: Interlocking pattern of food chain Phosphorus cycle: Circulation of Phosphorus
among organisms and environments
Pyramid of number: Refers number of
organisms in a successive trophic level Succession: Successive replacement of one type
of plant communities by other on barren or
Pyramid of biomass: Refers to quantitative
disturbed area.
relationship of the standing crops
Pioneers: Invaded plants on barren area
Pyramid of energy: Refers transformation of
energy at successive trophic levels Primary succession: Plants colonising on
barren area
Ten per cent law: refers only 10 per cent of
energy is stored in each successive trophic levels Secondary succession: Plants colonising on
disturbed area.
Bio geo chemical cycle: Exchange of nutrients
between organisms and environments Climax communities: Final establishment of
plant communities which are not replaced by
Carbon cycle: Circulation of carbon among
others.
ICT Corner
ECO SYSTEM
Ecosystem in detail through
this activity.
Steps
• Type the URL or scan the QR code to open the activity page then
Introduction page will open.
• Click on the Learn icon in the introduction page to know in detail.
• Click on the Flashcards icon in the introduction page to know about the topics easily.
• Click on the Test icon to write a quiz test finally it displays the marks we scored.

URL: https://play.google.com/store/apps/details?id=com.ksolve.
ecologyfree * Pictures are indicative only
168 Ecosystem

Unit IX - Plant Ecology
Chapter
8 Environmental Issues
Learning Objectives 8.8 Rain water harvesting

8.9 Environmental Impact Assessment
Learning objectives (EIA)
The learner will be able to, 8.10 Geographic Information System
Understand the importance of
growing more plants to mitigate the After understanding the structure and functions
environmental problems. of major ecosystems of the world, now student
Distinguish between the importance community should observe and understand
and conservation of endemic and environmental problems of their surroundings
endangered species. at local, national and international level.
Appreciate the use of technologies for Now we are going to understand some of the
agriculture and forestry. environmental issues such as
Participate in community activities to Over population
improve environmental conditions.
Health issues
Develop methods in conservation
Waste disposal
of water and plants for sustainable
development. All types of pollution
Get acquainted with satellite Green House gases
technology and utilising it in our daily Ozone depletion
life needs Water, energy, food scarcity
De-forestation
Chapter outline Climate change
Industrialisation,
8.1 Green house effect, urbanisation impacts
ozone depletion
8.2 Forestry Figure 8.1: Environmental issues
8.3 Deforestation Environmental issues are the problems and
8.4 Afforestation harmful effects created by human’s unmindful
8.5 Alien invasive activity and over utilisation of valuable resources
species obtained from the nature (environment). Student
8.6 Conservation should understand not only the environmental
issues we are facing now, but also find solutions
8.7 Carbon Capture and Storage (CCS)
to rectify or reduce these problems.
169
Environmental Issues

Countries of the whole world agree that in major ecosystems and climate patterns. For
something needs to be done about these important example, coral ecosystem is affected by increase
environmental issues. Many global summits, in temperature, especially coral bleaching
conferences and conventions are regularly observed in Gulf of Mannar, Tamil Nadu.
conducted by the United Nations and many steps Human activities lead to produce the green
are taken to minimise human-induced issues by house effect by
signing agreements with around 150 countries. • Burning fossil fuels, which releases CO2 and
CH4
Activity
• Way of Agriculture and animal husbandry
Students may form ‘ECOGROUPS’ and practices
discuss eco-issues of their premises and find • Electrical gadgets like refrigerator and air
solutions to the existing problems like, litter conditioners release chloro fluoro carbons
disposal, water stagnation, health and hygiene, • The fertilizers used in Agriculture which
greening the campus and its maintenance. release N2O
• The emissions from automobiles.
Drastic increase in population resulted
The increase in mean global temperature (highest
in demand for more productivity of food
in 4000 years) due to increased concentration of
materials, fibres, fuels which led to many
green house gases is called global warming.
environmental issues in agriculture, land use
modifications resulting in loss of biodiversity, One of the reasons for this is over population
land degradation, reduction in fresh water which creates growing need for food, fibre and
availability and also resulting in man-made fuel and considered to be the major cause of
global warming by green house gases even global warming.
altering climatic conditions. Clouds and Dust particles
can also produce Green House
8.1 Green House effect and Global
effect. That is why clouds,
Warming
dusts and humid nights are
Green House Effect is a process by which warmer than clear dust free dry nights.
radiant heat from the sun is captured by gases
in the atmosphere 8.1.1. Effects of Global Warming
that increase the • Rise in global temperature which causes sea
CH4
temperature of the levels to rise as polar ice caps and glaciers
20%
earth ultimately. begin to melt causing submergence of many
CO2 CFC
The gases that 14% coastal cities in many parts of the world.
60% O
th
capture heat are e rs
• There will be a drastic change in weather
6%
called Green patterns bringing more floods or droughts
House Gases which in some areas.
include carbon Figure 8.2: Relative
contribution of green •
Biological diversity may get modified,
dioxide (CO2),
house gases some species ranges get redefined. Tropics
methane (CH4),
and sub-tropics may face the problem of
Nitrous Oxide
decreased food production.
(N2O) and a variety of manufactured chemicals
like chlorofluorocarbon (CFC). Increase in
greenhouse gases lead to irreversible changes

8.1.2. Sources of Green House Gases • Developing alternate renewable sources of
Emission (Natural and Anthropogenic) energy
CO2 (Carbon dioxide) • Minimising uses of nitrogeneous fertilizers,
and aerosols.
• Coal based power plants, by the burning of
fossil fuels for electricity generation. 8.1.4. Ozone depletion
• Combustion of fuels in the engines of Ozone layer is a region of Earth’s stratosphere that
automobiles, commercial vehicles and air absorbs most of the Sun’s ultra violet radiation.
planes contribute the most of global warming. The ozone layer is also called as the ozone shield
• Agricultural practices like stubble burning and it acts as a protective shield, cutting the ultra-
result in emission of CO2. violet radiation emitted by the sun.
• Natural from organic matter, volcanoes, Just above the atmosphere there are two
warm oceans and sediments. layers namely troposphere (the lower layer)
and stratosphere (the upper layer). The ozone
Methane
layer of the troposphere is called bad ozone
Methane is 20 times as effective as CO2 at and the ozone layer of stratosphere is known as
trapping heat in the atomosphere. Its sources good ozone because this layer acts as a shield
are attributed paddy cultivation, cattle rearing, for absorbing the UV radiations coming from
bacteria in water bodies, fossil fuel production, the sun which is harmful for living organisms
ocean, non-wetland soils and forest / wild fires.
N2O (Nitrous oxide)
Ozone is a colourless gas, reacts readily with
It is naturally produced in Oceans from biological air pollutants and cause rubber to crack, hurt
sources of soil and water due to microbial actions plant life, damages lung tissues. But ozone
and rainforests. Man-made sources include nylon absorbs harmful ultra violet β (uv-β) and UV –
and nitric acid production, use of fertilizers in α radiation from sunlight.
agriculture, manures cars with catalytic converter
What is Dobson Unit? DU is the unit of
and burning of organic matter.
measurement for total ozone. One DU (0.001
Global Warming Effects on Plants atm. cm) is the number of molecules of ozone
• Low agricultural productivity in tropics that would be required to create a layer of pure
• Frequent heat waves (Weeds, pests, fungi ozone 0.01 millimetre thick at a temperature of
need warmer temperature) 0° C and a pressure of 1 atmosphere (atm = the
• Increase of vectors and epidemics air pressure at the surface of earth). Total ozone
• Strong storms and intense flood damage layer over the earth surface is 0.3 centrimetres
• Water crisis and decreased irrigation (3 mm) thick and is written as 300 DU.
• Change in flowering seasons and pollinators The false colour
• Change in Species distributional ranges view of total ozone
• Species extinction - The purple and
blue colours are
8.1.3 Strategies to deal with Global
Warming where there is the
• Increasing the vegetation cover, grow more least ozone, and the
trees yellows and reds are
• Reducing the use of fossil fuels and green where there is more
Figure 8.3: The false
house gases ozone.
colour view of total ozone
171

causing DNA damage. The thickness of the Clean Development Mechanism (CDM)
ozone column of air from the ground to the is defined in the Kyoto protocol (2007) which
top of the atmosphere is measured in terms of provides project based mechanisms with two
Dobson Units. objectives to prevent dangerous climate change
The ozone shield is being damaged by and to reduce green house gas emissions. CDM
chemicals released on the Earth’s surface projects helps the countries to reduce or limit
notably the chlorofluorocarbons widely used emission and stimulate sustainable development.
in refrigeration, aerosols, chemicals used as An example for CDM project activity, is
cleaners in many industries. The decline in the replacement of conventional electrification
thickness of the ozone layer over restricted area projects with solar panels or other energy
is called Ozone hole. efficient boilers. Such projects can earn Certified
Emission Reduction (CER) with credits / scores,
September 16 is WORLD OZONE DAY each equivalent to one tonne of CO2, which can
Ozone depletion in the stratosphere be counted towards meeting Kyoto targets.
results in more UV radiations especially UV B Plant indicators
radiations (shortwaves). UV B radiation destroys
The presence or absence of certain
biomolecules (skin ageing) and damages living
plants indicate the state of environment
tissues. UV – C is the most damaging type of
by their response. The plant species or
UV radiation, but it is completely filtered by the
plant community acts as a measure of
atmosphere (ozone layer). UV – a contribute 95%
environmental conditions, it is referred as
of UV radiation which causes tanning burning
biological indicators or phytoindicators or
of skin and enhancing skin cancer. Hence the
plant indicators.
uniform ozone layer is critical for the wellbeing
of life on earth. Examples
During 1970’s research findings indicated Plants Indicator for
1 Lichens, Ficus, Pinus, SO2 pollution
that man-made chlorofluorocarbons (CFC)
Rose
reduce and convert ozone molecules in the 2. Petunia, Nitrate
atmosphere. The threats associated with reduced Chrysanthemum
ozone pushed the issue to the forefront of global 3. Gladiolus Flouride
climate issues and gained promotion through pollution
organisation such as World Meterological 4. Robinia pseudoacacia Indicator of
Organisation and the United Nations. The (Black locust tree) heavy metal
contamination
Vienna Convention was agreed upon at the
Vienna conference of 1985 but entered into force
8.1.5 Effects of Ozone depletion
in 1988 provided the frameworks necessary to
create regulative measures in the form of the The main ozone depletion effects are:
Montreal protocol. The International treaty • Increases the incidence of cataract, throat
called the Montreal Protocol (1987) was held in and lung irritation and aggravation of
Canada on substances that deplete ozone layer asthma or emphysema, skin cancer and
and the main goal of it is gradually eliminating diminishing the functioning of immune
the production and consumption of ozone system in human beings.
depleting substances and to limit their damage • Juvenile mortality of animals.
on the Earth’s ozone layer. • Increased incidence of mutations.

• In plants, photosynthetic chemicals will be • Multipurpose tree varieties like Acacia are
affected and therefore photosynthesis will used for wood pulp, tanning, paper and
be inhibited. Decreased photosynthesis will firewood industries.
result in increased atmospheric CO2 resulting •
Agro-forestry is recommended for the
in global warming and also shortage of food following purposes. It can be used as
leading to food crisis. Farm Forestry for the extension of forests,
• Increase in temperature changes the climate mixed forestry, shelter belts and linear strip
and rainfall pattern which may result in plantation.
flood / drought, sea water rise, imbalance in Rehabilitation of degraded forests and
ecosystems affecting flora and fauna. recreation forestry
The production of woody plants combined
8.2 Forestry
with pasture is referred to silvopasture system.
8.2.1 Agro forestry The trees and shrubs may be used primarily
Agroforestry is an integration of trees, crops to produce fodder for livestock or they may
and livestock on the same plot of land. The main be grown for timber, fuel wood and fruit or to
objective is on the interaction among them . improve the soil.
Example: intercropping of two or more crops This system is classified into following categories.
between different species of trees and shrubs, Protein Bank: In this various multipurpose
i.
which results in higher yielding and reducing the trees are planted in and around farm
operation costs. This intentional combination lands and range lands mainly for fodder
of agriculture and forestry has varied benefits production.
including increased bio-diversity and reduced Example: Acacia nilotica, Albizzia lebbek,
erosion. Azadirachta indica, Gliricidia sepium,
Some of the major species cultivated in Sesbania grandiflora.
commercial Agroforestry include Casuarina, Livefence of fodder trees and hedges:
ii.
Eucalyptus, Malai Vembu, Teak and Kadambu Various fodder trees and hedges are planted
trees which were among the 20 species as live fence to protect the property from
identified as commercial timber. They are of stray animals or other biotic influences.
great importance to wood-based industries.
Example: Gliricidia sepium, Sesbania
Benefits of agroforestry grandiflora, Erythrina spp., Acacia spp..
• It is an answer to the problem of soil and
water conservation and also to stabilise 8.2.2 Social forestry
the soil (salinity and water table) reduce It refers to the sustainable management of
landslide and water run-off problem. forests by local communities with a goal
• Nutrient cycling between species improves of climate carbon sequestration, change
and organic matter is maintained. mitigation, depollution, deforestation, forest
restoration and providing indirect employment
• Trees provide micro climate for crops and
opportunity for the youth. Social forestry refers
maintain O2 – CO2 balanced, atmospheric
to the management of forests and afforestation
temperature and relative humidity.
on barren lands with the purpose of helping the
•
Suitable for dry land where rainfall is
environmental, social and rural development
minimum and hence it is a good system for
and benefits. Forestry programme is done
alternate land use pattern.
for the benefit of people and participation of
173

the people. Trees grown outside forests by cause of deforestation.
government and public organisation reduce the • Logging for timber
pressure on forests. •
Developmental activities like road
In order to encourage tree cultivation outside construction, electric tower lines and dams.
forests, Tree cultivation in Private Lands was •
Over population, Industrialisation,
implemented in the state from 2007-08 to 2011- urbanisation and increased global needs.
12. It was implemented by carrying out block
Effects of deforestation
planting and inter-crop planting with profitable
tree species like Teak, Casuarina, Ailanthus, •
Burning of forest wood release stored
Silver Oak, etc. in the farming lands and by a carbon, a negative impact just opposite of
free supply of profitable tree species for planting carbon sequestration.
in the bunds. The Tank foreshore plantations • Trees and plants bind the soil particles. The
have been a major source of firewood in Tamil removal of forest cover increases soil erosion
Nadu. The 32 Forestry extension centres and decreases soil fertility. Deforestation in
provide technical support for tree growing in dry areas leads to the formation of deserts.
rural areas in Tamil Nadu. These centres provide • The amount of runoff water increases soil
quality tree seedlings like thorn / thornless erosion and also creates flash flooding, thus
bamboo, casuarinas, teak, neem, Melia dubia, reducing moisture and humidity.
grafted tamarind and nelli, etc. in private lands • The alteration of local precipitation patterns
and creating awareness among students by leading to drought conditions in many
training / camps. regions. It triggers adverse climatic conditions
and alters water cycle in ecosystem.
8.2.3. Major activities of forestry
extension centres • It decreases the bio-diversity significantly as
• Training on tree growing methods their habitats are disturbed and disruption
of natural cycles.
•
Publicity and propaganda regarding tree
growing • Loss of livelihood for forest dwellers and
rural people.
• Formation of demonstration plots
• Increased global warming and account for
• Raising and supply of seedlings on subsidy
one-third of total CO2 emission.
• Awareness creation among school children
• Loss of life support resources, fuel, medicinal
and youth about the importance of forests
herbs and wild edible fruits.
through training and camps.
8.4 Afforestation
8.3 Deforestation
Afforestation is planting of trees where there was
Deforestation is one of the major contributors
no previous tree coverage and the conversion
to enhance green house effect and global
of non-forested lands into forests by planting
warming. The conversion of forested area into
suitable trees to retrieve the vegetation. Example:
a non-forested area is known as deforestation.
Slopes of dams afforested to reduce water run-
Forests provide us many benefits including
off, erosion and siltation. It can also provide
goods such as timber, paper, medicine and
a range of environmental services including
industrial products. The causes are
carbon sequestration, water retention.
• The conversion of forests into agricultural
plantation and livestock ranching is a major

The Man who Single Handedly Created a Achievements
Dense Forest • Degraded forests were restored
Jadav "Molai" Payeng (born 1963) is an •
Community assets like overhead tanks
environmental activist has single-handedly bore-wells, hand pumps, community halls,
planted a forest in the middle of a barren libraries, etc were established
wasteland. This Forest Man of India has • Environmental and ecological stability was
transformed the world’s largest river island, maintained.
Majuli, located on one of India’s major rivers, • Conserved bio-diversity, wildlife and genetic
the Brahmaputra, into a dense forest, home to resources.
rhinos, deers, elephants, tigers and birds. And •
Involvement of community especially
today his forest is larger than Central Park. women in forest management.
Former vice-chancellor of Jawahar Lal
Nehru University, Sudhir Kumar Sopory 8.5 Alien invasive species
named Jadav Payeng as Forest Man of Invasion of alien or introduced species disrupts
India, in the month of October 2013. He was ecosystem processes, threaten biodiversity,
honoured at the Indian Institute of Forest reduce native herbs, thus reducing the ecosystem
Management during their annual event services (benefits). During eradication of
‘Coalescence’. In 2015, he was honoured these species, the chemicals used increases
with Padma Shri, the fourth highest civilian greenhouse gases. Slowly they alter ecosystem,
award in India. He received honorary micro climate and nature of soil and make it
doctorate degree from Assam Agricultural unsuitable for native species and create human
University and Kaziranga University for his health problems like allergy, thus resulting in
contributions. local environmental degradation and loss of
important local species.
Afforestation Objectives
According to World Conservation Union
• To increase forest cover, planting more trees,
invasive alien species are the second most
increases O2 production and air quality.
significant threat to bio-diversity after habitat loss.
•
Rehabilitation of degraded forests to
What is invasive species?
increase carbon fixation and reducing CO2
from atmosphere. A non-native species to the ecosystem or country
under consideration that spreads naturally,
• Raising bamboo plantations.
interferes with the biology and existence of
• Mixed plantations of minor forest produce
native species, poses a serious threat to the
and medicinal plants.
ecosystem and causes economic loss.
• Regeneration of indigenous herbs / shrubs.
It is established that a number of invasive
•
Awareness creation, monitoring and species are accidental introduction through
evaluation. ports via air or sea. Some research organisations
• To increase the level and availability of water import germplasm of wild varieties through
table or ground water and also to reduce which also it gets introduced. Alien species with
nitrogen leaching in soil and nitrogen edible fruits are usually spread by birds.
contamination of drinking water, thus Invasive species are fast growing and are
making it pure not polluted with nitrogen. more adapted. They alter the soil system by
• Nature aided artificial regeneration. changing litter quality thereby affecting the
175

soil community, soil fauna and the ecosystem the waterways hampering agriculture, fisheries,
processes. recreation and hydropower.
It has a negative impact on decomposition Prosopis juliflora
in the soils by causing stress to the neighbouring Prosopis juliflora is an invasive species native
native species. Some of the alien species which to Mexico and South America. It was first
cause environmental issues are discussed below introduced in
Eichhornia crassipes Gujarat to counter
It is an invasive desertification and
weed native to later on in Andhra
South America. Pradesh, Tamil
It was introduced Nadu as a source
as aquatic of firewood. It
is an aggressive Figure 8.5:
ornamental
Figure 8.4: coloniser and as a Prosopis juliflora
plant, which
grows faster Eichhornia crassipes consequence the
throughout the habitats are rapidly covered by this species. Its
year. Its widespread growth is a major cause invasion reduced the cover of native medicinal
of biodiversity loss worldwide. It affects the herbaceous species. It is used to arrest wind
growth of phytoplanktons and finally changing erosion and stabilize sand dunes on coastal and
the aquatic ecosystem. desert areas. It can absorb hazardous chemicals
It also decreases the oxygen content of the from soil and it is the main source of charcoal.
waterbodies which leads to eutrophication. It 8.6 Conservation
poses a threat to human health because it creates a
India due to its topography, geology and
breeding habitat for disease causing mosquitoes
climate patterns has diverse life forms. Now
(particularly Anopheles) and snails with its
this huge diversity is under threat due to many
free floating dense roots and semi submerged
environmental issues for this conservation
leaves. It also blocks sunlight entering deep and
becomes an important tool by which we can
Bio-diversity Conservation
In-situ Ex-situ
Protected area Sacred plants Seed banks, Pollen Botanical gardens

network home gardens banks, Field gene, Arboreta, Zoological
Cryopreservation parks, Aquaria
Community Government
Protected Protected
Sacred groves
Biosphere Wildlife
Sacred lakes National parks
Reserves Sanctuaries
Terrestial Marine
Figure 8.6: Flow chart on biodiversity conservation

Conservation movement In-situ conservation
A community level participation can help It means conservation and management of

in preservation and conservation of our genetic resources in their natural habitats. Here
environment. Our environment is a common the plant or animal species are protected within
treasure for all the living organisms on earth. the existing habitat. Forest trees, medicinal and
Every individual should be aware of this and aromatic plants under threat are conserved
participate actively in the programs meant for by this method. This is carried out by the
the conservation of the local environment. community or by the State conservation which
Indian history has witnessed many people include wildlife, National park and Biosphere
movements for the protection of environment. reserve. The ecologically unique and biodiversity
rich regions are legally protected as wildlife
Chipko Movement sanctuaries, National parks and Biosphere
The tribal women of Himalayas protested reserves. Megamalai, Sathyamangalam wildlife,
against the exploitation of forests in 1972. Later Guindy and Periyar National park, and Western
on it transformed into Chipko Movement by ghats, Nilgiris, Agasthyamalai and Gulf of
Sundarlal Bahuguna in Mandal village of Mannar are the biosphere reserves of Tamil
Chamoli district in 1974. People protested Nadu.
by hugging trees together which were felled
Sacred groves
by a sports goods company. Main features of
Chipko movement were, These are the patches or grove of cultivated trees
which are community protected and are based
• This movement remained non political
on strong religious belief systems which usually
• It was a voluntary movement based on
have a significant religious connotation for
Gandhian thought.
protecting community. Each grove is an abode
• It was concerned with the ecological balance
of a deity mostly village God Or Goddesses
of nature
like Aiyanar or Amman. 448 grooves were
• Main aim of Chipko movement was to give a documented throughout Tamil Nadu, of which
slogan of five F’s – Food, Fodder, Fuel, Fibre 6 groves (Banagudi shola, Thirukurungudi and
and Fertilizer, to make the communities self Udaiyankudikadu, Sittannnavasal, Puthupet
sufficient in all their basic needs. and Devadanam) were taken up for detailed
Appiko Movement floristic and faunistic studies. These groves
The famous Chipko Andolen of Uttarakhand provide a number of ecosystem services to
in the Himalayas inspired the villagers of Uttar the neighbourhood like protecting watershed,
Karnataka to launch a similar movement to save fodder, medicinal plants and micro climate
their forests. This movement started in Gubbi control.
Gadde a small village near Sirsi in Karnataka Ex-situ conservation
by Panduranga Hegde. This movement started It is a method of conservation where species are
to protest against felling of trees, monoculture, protected outside their natural environment.
forest policy and deforestation. This includes establishment of botanical gardens,
reduce many species getting lost from our native zoological parks, conservation strategies such
land. By employing conservation management as gene, pollen, seed, in-vitro conservation,
strategies like germplasm conservation, in situ, cryo preservation, seedling, tissue culture and
ex-situ, in-vitro methods, the endemic as well DNA banks. These facilities not only provide
as threatened species can be protected housing and care for endangered species, but
177

also have educational and recreational values and human intereferences.. Serious efforts need to
for the society be undertaken for their conservation, otherwise
these species may become globally extinct.
8.6.1 Endemic Centres and Endemic
Plants
Endemic species are plants and animals that
exist only in one geographic region. Species can
be endemic to large or small areas of the earth.
Some are endemic to a particular continent, a b
some to a part of a continent and others to a
Figure 8.7: Endemic Plants
single island.
a. Bentinckia condapanna b. Baccaurea courtallensis
Any species found restricted to a specified
geographical area is referred to as ENDEMIC.. 8.7 Carbon Capture and Storage (CCS)
It may be due to various reasons such as
Carbon capture and storage is a technology of
isolation, interspecific interactions, seeds
capturing carbondioxide and injects it deep into
dispersal problems, site specificity and many
the underground rocks into a depth of 1 km or
other environmental and ecological problems.
more and it is an approach to mitigate global
There are 3 Megacentres of endemism and 27
warming by capturing CO2 from large point
microendemic centres in India. Approximately
sources such as industries and power plants
one third of Indian flora have been identified as
and subsequently storing it instead of releasing
endemic and found restricted and distributed in
it into the atmosphere. Various safe sites have
three major phytogeographical regions of india,
been selected for permanent storage in various
that is Indian Himalayas, Peninsular India and
deep geological formations, liquid storage in the
Andaman nicobar islands. Peninsular India,
Ocean and solid storage by reduction of CO2 with
especially Western Ghats has high concentration
metal oxide to produce stable carbonates. It is also
of endemic plants. Hardwickia binata and
known as Geological sequestration which involves
Bentinckia condapanna are good examples for
injecting CO2 directly into the underground
endemic plants. A large percentage of Endemic
geological formations (such as declining oil fields,
species are herbs and belong to families such as
gas fields saline aquifers and unmineable coal have
Poaceae. Apiaceae, Asteraceae and Orchidaceae.
been suggested as storage sites).
Endemic plants Habit Name of endemic centre
Baccaurea Tree Southern Western Carbon Sequestration
courtallensis Ghats Carbon sequestration is the process of capturing
Agasthiyamalaia Tree Peninsular india
and storing CO2 which reduces the amount of
pauciflora
CO2 in the atmosphere with a goal of reducing
Hardwickia Tree Peninsular and
binata northern India
global climate change.
Bentinckia Tree Western ghats of Tamil Carbon sequestration occurs naturally by plants
condappana Nadu and kerala and in ocean. Terrestrial sequestration is typically
Nepenthes Liana Khasi hills, Meghalaya accomplished through forest and soil conservation
khasiyana practices that enhance the storage carbon.
Table 1: Endemic plants As an example microalgae such as species
Majority of endemic species are threatened of Chlorella, Scenedesmus, Chroococcus and
due to their narrow specific habitat, reduced seed Chlamydomonas are used globally for CO2
production, low dispersal rate, less viable nature sequestration. Trees like Eugenia caryophyllata,

Tecomastans, Cinnamomum verum have farming. (vii) reduce use of Laptops (when
high capacity and noted to sequester carbon used for 8 hours, it releases nearly 2 kg. of
macroalgae and marine grasses and mangroves CO2 annually) (viii) Line dry your clothes.
are also have ability to mitigate carbon-di-oxide. (Example: If you buy imported fruit like kiwi,
Carbon Foot Print (CFP) indirectly it increases CFP. How? The fruit has
travelled a long distance in shipping or airliner
Every human activity leaves a mark just like
thus emitting tons of CO2)
our footprint. This Carbon foot print is the
total amount of green house gases produced by Biochar
human activities such as agriculture, industries, Biochar is another long term method to store
deforestation, waste disposal, buring fossil carbon. To increase plants ability to store more
fuels directly or indirectly. It can be measured carbon, plants are partly burnt such as crop
for an individual, family, organisation like waste, waste woods to become carbon rich
industries, state level or national level. It is slow decomposing substances of material called
usually estimated and expressed in equivalent Biochar. It is a kind of charcoal used as a soil
tons of CO2 per year. The burning of fossil amendment. Biochar is a stable solid, rich in
fuels releases CO2and other green house gases. carbon and can endure in soil for thousands of
In turn these emissions trap solar energy and years. Like most charcoal, biochar is made from
thus increase the global temperature resulting biomass via pyrolysis. (Heating biomas in low
in ice melting, submerging of low lying areas oxygen environment) which arrests wood from
and inbalance in nature like cyclones, tsunamis complete burning. Biochar thus has the potential
and extreme weather conditions. To reduce to help mitigate climate change via carbon
the carbon foot print we can
follow some practices like (i)
Eating indigenous fruits and Lentils Protein good choice EAT SMART
of fibre & nutrient Your food choices affect the climate
products (ii) Reduce use of
your electronic devices (iii) Tomatos Veggies, fruits low in
fat and colorie high in
0 1 2 3 4 5 6 7
Reduce travelling (iv) Do nutrient
not buy fast and preserved,

processed, packed foods. Beans
Broccoli
(v) Plant a garden (vi) Less Yoghurt Organic, high
Nuts
consumption of meat and protein, good fat,
Peanut more nutritions
butter
sea food. Poultry requires Rice
conventional foods
little space, nutrients and less Potatoes
pollution comparing cattle

Egg
Fish Organic rich
Carbon Sink Chicken omega
Any system having the
capacity to accumulate Solman
fish, Pork Processed food.
more atmospheric carbon Cheese
during a given time Highest carbon foot print.
Beef
interval than releasing CO2. & Lamb CARBON FOOTPRINT
Example: forest, soil, ocean Processed food. car miles driven per 4oz(118.29 ml). consumed
Different foods have a different impacts.Here’s how the green
are natural sinks. Landfills house gas emissions (GHGs) of twenty common foods compare.
are artificial sinks. Figure 8.8: Carbon foot print
179

sequestration. Independently, biochar when Rainwater harvesting is the accumulation and
added to soil can increase soil fertility of acidic storage of rain water for reuse in-site rather than
soils, increase agricultural productivity, and allowing it to run off. Rainwater can be collected
provide protection against some foliar and soil from rivers, roof tops and the water collected
borne diseases. It is a good method of preventing is directed to a deep pit. The water percolates
waste woods and logs getting decayed instead we and gets stored in the pit. RWH is a sustainable
can convert them into biochar thus converting water management practice implemented not
them to carbon storage material. only in urban area but also in agricultural fields,
which is an important economical cost effective
8.8 Rain water harvesting – RWH method for the future.
(Solution to water crisis – A
ecological problem) 8.8.1 Environmental benefits of Rain
Rain water canal
Water Harvesting:
• Promotes adequacy of underground water
and water conservation.
• Mitigates the effect of drought.
Drain pipe • Reduces soil erosion as surface run-off is
Sand filter reduced.
• Reduces flood hazards.
Water tank •
Improves groundwater quality and water
Over flow
pipe to
table / decreases salinity.
well
Rainwater harvesting • No land is wasted for storage purpose and
Well in individual house no population displacement is involved.
•
Storing water underground is an eco-
Figure 8.9: Pictures of Rain Water friendly measure and a part of sustainable
Harvesting Structures in Ooraniers
water storage strategy for local communities.
Water storage tank
The water is then supplied to 8.8.2 Importance of Lakes
flats, which can be used for
domestic purposes Water bodies like lakes, ponds not only provide
us a number of environmental benefits but
they strengthen our economy as well as our
quality of life like health. Lakes as a storage of
Collection tank rain water provides drinking water, improves
A fitted sensor
then sends
ground water level and preserve the fresh water
the water to bio-diversity and habitat of the area where in
the tank
occurs.
In terms of services lakes offer sustainable
solutions to key issues of water management
Suction tank and climatic influences and benefits like
A filter placed in the
tank clears the Rainwater inlet nutrient retention, influencing local rainfall,
water of impurities The rainwater that collects on removal of pollutants, phosphorous and
the terrace makes its way
down a pipe nitrogen and carbon sequestration.
Figure 8.10: Rain Water Harvesting
Structures in Water Supply sources

8.9 Environmental Impact 8.9.1 Biodiversity Impact Assessment
Assessment (EIA) (BIA)
Environmental Impact Assessment is an Biodiversity Impact Assessment can be
environmental management tool. It helps to defined as a decision supporting tool to help
regulate and recommend optimal use of natural biodiversity inclusive of development, planning
resources with minimum impact on ecosystem and implementation. It aims at ensuring
and biotic communities. It is used to predict the development proposals which integrate bio-
environmental consequences of future proposed diversity considerations. They are legally
developmental projects (example: river projects, compliant and include mechanisms for the
dams, highway projects) taking into account conservation of bio-diversity resources and
inter-related socio-economic, cultural and provide fair and equitable sharing of the benefits
human-health impacts. It reduces environmental arising from the use of bio-diversity.
stress thus helping to shape the projects that Bio-diversity impacts can be assessed by
may suit local environment by ensuring optimal • Change in land use and cover
utilization of natural resources and disposal of
• Fragmentation and isolation
wastes to avoid environmental degradation.
• Extraction
The benefits of EIA to society
• External inputs such as emissions, effluents
• A healthier environment
and chemicals
• Maintenance of biodiversity
• Decreased resource usage • Introduction of invasive, alien or genetically
• Reduction in gas emission and modified species
environment damage • Impact on endemic and threatened flora and
fauna.
Biomonitoring
The act of observing and assessing the current 8.10 Geographic Information System
state and ongoing changes in ecosystem, GIS is a computer system for capturing, storing,
biodiversity components, landscape including checking and displaying data related to positions
natural habitats, populations and species. on Earth’s surface. Also to manipulate, analyse,
An agricultural drone is an unmanned aerial manage and present spacial or geographic data.
vehicle applied to farming in order to help
GPS is a satellite navigation system used to
increased crop production and monitor crop
determine the ground position of an object. It is
growth. Agricultural drones let farmers see
a constellation of approximately 30 well spaced
their fields from the sky. This bird’s eye-view
satellites that orbit the earth and make it possible
can reveal many issues such as irrigation
for the people with ground receivers to pinpoint
problems, soil variation and pest and fungal
their geographic location. Some applications in
infestations. It is also used for cost effective safe
which GPS is currently being used for around
method of spraying pesticides and fertilizers,
the world include Mining, Aviation, Surveying
which proves very easy and non-harmful.
Agricultural and Marine ecosystem.
Importance of GIS
• Environmental impact
assessment
• Disaster management
Figure 8.11: Agricultural drone • Zoning of landslide
hazard
181

• Determination of land cover and land use Summary
• Estimation of flood damage Green house effect leads to climate change which
• Management of natural resources results in global warming. Deforestation causes
• Soil mapping soil erosion, whereas Afforestation helps to
• Wetland mapping restore vegetation and increases ground water
• Irrigation management and identification of table. Regeneration of trees by Agroforestry is
volcanic hazard possible with the involvement of community
• Vegetation studies and mapping of and government. Help to conserve the flora and
threatened and endemic species. fauna in their natural habitat and man-made
Remote Sensing is the process of detecting and environments like zoological parks and national
monitoring the physical characteristics of an area parks. Mitigation of carbon in the atmosphere
by measuring its reflected and emitted radiation done in the form of sequestration. Rain water
at a distance from the targeted area. It is an tool harvesting is done for improving the ground
used in conservation practices by giving exact water table. Importance and location of lakes in
picture and data on identification of even a single Tamil Nadu which aids water supply to the city
is a measure of conservation of drinking water.
tree to large area of vegetation and wild life for
Assessment of Environment and Biodiversity
classification of land use patterns and studies,
helps to study risk analysis and disaster
identification of biodiversity rich or less areas for
management. Forest cover is monitored through
futuristic works on conservation and maintenance
Remote sensing and GIS.
of various species including commercial crop,
medicinal plants and threatened plants. Evaluation
Specific uses 1. Which of the following
• Helps predicting favourable climate, for the would most likely help to
study of spreading of disease and controlling it. slow down the greenhouse
• Mapping of forest fire and species effect.
distribution. a) Converting tropical
• Tracking the patterns of urban area forests into grazing land for cattle.
development and the changes in Farmland b) Ensuring that all excess paper packaging
or forests over several years is buried to ashes.
• Mapping ocean bottom and its resources c) Redesigning landfill dumps to allow
Applications of Satellites methane to be collected.
d) Promoting the use of private rather than
Name of the Year of
Application public transport.
Satellites Launch
SCATSAT – I Sep. 2016 Weather 2. With respect to Eichhornia
forecasting, Statement A: It drains off oxygen from water
cyclone prediction
and is seen growing in standing water.
and tracking
services in India Statement B: It is an indigenous species of
INSAT 3DR Sep. 2016 Disaster our country.
management a) Statement A is correct and Statement B is
CARTOSAT – 2 Jan. 2018 Earth observation wrong.
GSAT – 6A March Communication b) Both Statements A and B are correct.
2018
c) Statement A is correct and Statement B is
CARTOSAT – 2 Jan. 2018 To watch border
(100th Satellite) surveillance
wrong.
d) Both statements A and B are wrong.

3. Find the wrongly matched pair. 9. The unit for measuring ozone thickness
a) Endemism - Species confined to a a) Joule b) Kilos
region and not found c) Dobson d) Watt
anywhere else. 10.
People’s movement for the protection of
b) Hotspots - Western ghats environment in Sirsi of Karnataka is
c) Ex-situ a) Chipko movement
Conservation - Zoological parks b) Amirtha Devi Bishwas movement
d) Sacred groves - Saintri hills of Rajasthan c) Appiko movement
e) Alien sp. d) None of the above
Of India - Water hyacinth 11. The plants which are grown in silivpasture
4. Depletion of which gas in the atmosphere system are
can lead to an increased incidence of skin a) Sesbania and Acacia
cancer? b) Solenum and Crotalaria
c) Clitoria and Begonia
a) Ammonia b) Methane
d) Teak and sandal
c) Nitrous oxide d) Ozone
12. What is ozone hole?
5. One green house gas contributes 14% of total
13. Give four examples of plants cultivated in
global warming and another contributes 6%.
commercial agroforestry.
These are respectively identified as
a) N20 and CO2 b) CFCs and N20 14. Expand CCS.
c) CH4 and CO2 d) CH4 and CFCS 15.
How do forests help in maintaining the
6. One of the chief reasons among the following climate?
for the depletion in the number of species 16.
How do sacred groves help in the
making endangered is conservation of biodiversity?
a) over hunting and poaching
17. Which one gas is most abundant out of the
b) green house effect
four commonest greenhouse gases? Discuss
c) competition and predation
the effect of this gas on the growth of plants?
d) habitat destruction
18. Suggest a solution to water crisis and explain
7. Deforestation means
its advantages.
a) growing plants and trees in an area where
there is no forest 19. Explain afforestation with case studies.
b) growing plants and trees in an area where 20. What are the effects of deforestation and
the forest is removed benefits of agroforesty?
c) growing plants and trees in a pond
d) removal of plants and trees Glossary
8. Deforestation does not lead to Algae Blooms: Sudden sprout of algae growth,
a) Quick nutrient cycling which can affect the water quality adversely and
b) soil erosion indicate potentially hazardous changes in local
c) alternation of local weather conditions water chemistry.
d) Destruction of natural habitat weather Atmosphere: A major regional community of
conditions plants and animals with similar life forms and
environmental conditions.
183

Biodegradable waste: Organic waste, typically Radioactive: A materials is said to be radioactive
coming from a plant or animal sources, which if it emits radiation.
other living organisms can break done.
Recycle:To break waste items done into their
Biosphere: The portion of earth and its raw materials, which are then used to remake
atmosphere that can support life. the original item or to make new items.
Oil spill: The harmful release of oil into the Sustainable development: Development using
environment, usually through water, which is hand of energy sources in a way that meets the
very difficult to clean up and often kills, birds, needs of people today without reducing the
fish and other wildlife. ability in future generation to meet their own
needs.
Radiation: A form of energy that is transmitted
in waves, rays or particles from a natural source
such as the sun and the ground or an artificial
source such as an X-ray machine.
ICT Corner
Let us know about the Environmental

issues using the EARTH NOW app
through this activity.
Steps
• Type the URL or scan the QR code to open the activity page.
• Click on the satellite it displays the shape and activities of the satellite.
• Click on the Vital Signs to see the global Climate data including surface air
temperature, Carbondioxide, Ozone, etc.,
URL:
https://play.google.com/store/apps/details?id=gov.nasa.jpl.earthnow.activity

Unit X: Economic Botany
Chapter
9 Plant Breeding
Economic botany is the study of the

Learning Objectives relationship between people and economically
important plants. It explores the ways by
The learner will be able to which humans use plants for food, medicines
and other uses. Economic botany intersects
Appreciate the relationship between many fields including established disciplines
humans and plants. such as agronomy, anthropology, archaeology,
Recognise the origin of agriculture. chemistry, trade and commerce.
Perceive the importance of organic 9.1 Relationship between humans

agriculture. and plants
From the very early times, human beings have
Understand the different conventional
co-existed with plants which played a vital
methods of plant breeding.
role in their survival. Through a long process
of trial and error, our ancestors have selected
hundreds of wild plants from the various
Chapter outline parts of the world for their specific use. The
knowledge of the plants and its applications
9.1 Relationship have led to the development of the humans and
between human and their civilization in many ways.
plants
9.2 Domestication of plants
9.2 Domestication of Domestication is the process of bringing a
plants plant species under the control of humans and
gradually changing it through careful selection,
9.3 Origin of agriculture genetic alteration and handling so that it is more
useful to people. The domesticated species are
9.4 History of agriculture renewable sources that have provided food and
other benefits to human.
9.5 Organic agriculture
The possible changes in the plant species due
9.6 Plant breeding to domestication are listed below;
• Adaptation to a greater diversity of
9.7 Conventional plant breeding
environments and a wider
methods
geographical range.
9.8 Modern plant breeding Techniques • Simultaneous /uniform flowering
and fruiting.
Plant Breeding 185

• Lack of shattering or scattering of seeds. 1868 Darwin’s evolutionary theory proposed
• Increased size of fruits and seeds. that origin of useful cultivated plants
have existed through natural selection
• Change from a perennial to annual habit. and hybridisation.
• Change in breeding system. 1883 De Candolle in his “Origin of cultivated
• Increased yield. plants” studied 247 cultivated plant
species and attempted to solve the
• Increased resistance for disease and pest.
mystery about the ancestral form,
• Developing seedless parthenocarpic region of domestication and history.
fruit.
1887- 1943 Nikolai Ivanovich Vavilov
• Enhancing colour, appearance, made an inventory of the diverse forms
palatability and nutritional composition. of our most important cultivated plants
9.3 Origin of Agriculture and their distribution based on variety
of facts obtained from morphology,
Archeological evidence for earliest record
anatomy, cytology, genetics and plant
of agriculture is found in the fertile crescent
geography. Vavilov has given the centre
region in and around Tigris and Euphrates river
of diversity of a crop species which may
valleys, approximately about 12,000 years ago.
be the centre of origin for that species.
The earlier Greek and Roman naturalists
like Theophrastus, Dioscorides, Pliny the elder Vavilov initially proposed eight main
and Galen laid down the scientific foundation geographic centres of origin originally
in understanding origin and domestication of in 1926. Later (1935) he named 11
cultivated plants. centres of origin by dividing few
centres into two and three centres and
9.4 History of Agriculture added a new centre USA thus making
the 8 centres of origin into 12.
1807 Alexander Von Humboldt considered
1968 Zhukovsky put forward the concept
the original sources of most
of mega gene centre for the origin of
useful plants and their origin is an
cultivated plants. He divided the whole
impenetrable secret.
world into 12 mega gene centres.
1971 According to Harlan,
Black sea agriculture originated
Caspian
C independently in three different
sea
areas in different times or
Asia simultaneously. Hence a crop
minor Fertile cres may not have a single centre
Turkey
Turrke
Tu rkey
rk
key
key
ke cen Za
gro IRAN
Eup
h
t s
Mo of origin. Harlan says that the
rat un
Tig
es ta
in centre of crop plant means the
rsi
Babylon
B abylon
on places of agricultural origin
Mediter Syrian Desert SUMER of the crop plants. The non-
ranean sea Palestine Jordan
J dan R
Jord
centre denotes the place where
Jerusalem Dead
Sea Arabian Desert Gulf agriculture of the crop was
Isreal
LOWER introduced and spread. Thus

EGYPT
centre and non-centre interact
.R
Sakara
Nile
Red
ed
d Sea with each other.
Figure 9.1: Map shows Fertile crescent region
186 Plant Breeding

Indian
Plant Breeders
5
3
1
a. D
r. M. S. Swaminathan – He is pioneer
4
7 2
mutation breeder.
6 2a
8
8b b. S
ir. T.S. Venkataraman – An eminent
8a
Vavilov’s Centers of Crop Origin
sugarcane breeder.
Figure 9.2: V
avilov’s centres of crop origin c. D
r. B.P. Pal – Famous wheat breeder,
developed superior disease resistant
and crops domesticated
varieties of wheat.
Vavilov’s Centre of
Crops domesticated d. D
r. K. Ramiah – Eminent rice breeder,
Crop Origin
Foxtail millet, soybean, developed several high yielding
1 China varieties of rice.
bamboo, onion, crucifers.
Rice, sugarcane, mango, e. N
.G.P. Rao – An eminent sorghum
2 India
orange, eggplant, sesame. breeder, developed world’s first hybrid
Rice, banana, coconut,
2a South East Asia of Sorghum (CSH-1).
clove , hemp.
3 Central East Wheat, pea, hemp, cotton etc. f. C
.T. Patel – Who developed world’s
Wheat, rye, many subtropical first cotton hybrid.
4 The Near East
and tropical fruits.
Olive, vegetables, oil
g. C
houdhary Ram Dhan – Wheat
5 Mediterranean breeder, who is famous for C-591
yielding plants, wheats
6 Ethiopia Wheat, barley, sesame, variety of wheat, which is made Punjab
(Abyssinian) castor, coffee. as wheat granary of India.
7 Mesoamerica Maize, bean,
(South Mexican sweet potato, papaya, 9.5.1. Biofertilizers
& Central guava, tobacco. Biofertilizers are defined as preparations
American containing living cells or latent cells of
Centre) efficient strains of microorganisms that
8 South America Tomato, pine-apple help crop plants uptake of nutrients by
8a The Chiloe Potato their interactions in the rhizosphere when
Centre applied through seed or soil. Biofertilizers
8b The Brazilian Groundnut, cashew nut, could be also called as microbial cultures,
–Paraguayan pine apple, peppers, bioinoculants, bacterial inoculants or
Centre rubber. bacterial fertilizers.
9.5 Organic Agriculture They are efficient in fixing nitrogen,
Organic farming is an alternative agricultural solubilising phosphate and decomposing
system which originated early in the twentieth cellulose. They are designed to improve
century in reaction to rapidly changing farming the soil fertility, plant growth, and also the
practices. It is a production system that sustains number and biological activity of beneficial
the health of the soils, ecosystems and people. It microorganisms in the soil. They are eco-
relies on ecological processes, biodiversity and friendly organic agro inputs and are more
cycles adapted to local conditions rather than efficient and cost effective than chemical
the use of inputs with adverse effects. fertilizers.
Plant Breeding 187

S.N Groups Examples
Azolla
N2 fixing Biofertilize
Azolla is a free-floating water fern that fixes
A
the atmospheric nitrogen in association with
1. Free-living Azotobacter, Clostridium,
Anabaena, Nostoc, nitrogen fixing blue green alga Anabaena azolla.
Symbiotic Rhizobium, Anabaena azollae
It is used as a bio-fertilizer for wetland rice
cultivation and is known to contribute 40 – 60
3. Associative Symbiotic Azospirillum
kg/ha/crop. The agronomic potential of Azolla
B P Solubilizing Biofertilizer is quite significant particularly for increasing the
1. Bacteria Bacillus subtilis, yield of rice crop, as it quickly decompose in soil.
Pseudomonas striata
(a)
2. Fungi Penicillium, Aspergillus.
C P Mobilizing Biofertilizers
1. Arbuscular Mycorrhiza Glomus, Scutellospora.
2. Ectomycorrhiza Amanita. (b)

D Biofertilizer for Micro nutrients
1. Silicate and Bacillus.

Zinc solubilizers
Figure 9.5: (a) Azolla in paddy field
E Plant Growth Promoting Rhizobacteria
(b) Azolla
2. Pseudomonas Pseudomonas fluorescence
Arbuscular mycorrhizae
Figure 9.3: Classification of Biofertilizers Arbuscular mycorrhizae (AM) is formed by
the symbiotic association between certain
Rhizobium phycomycetous fungi and angiosperm roots.
Bio-fertilisers containing rhizobium bacteria They have the ability to dissolve the phosphates
are called rhizobium bio-fertilizer culture. found in abundance in the soil.
Symbiotic bacteria that reside inside the root
No colonization AM-colonization
nodules convert the atmospheric nitrogen into
a bio available form to the plants. This nitrogen Increased
fixing bacterium when applied to the soil resistance
to foliar
undergoes multiplication in billions and fixes pathogens
the atmospheric nitrogen in the soil. Rhizobium
is best suited for the paddy fields which increase Increased
the yield by 15 – 40%. drought
and salt
(b) (a)
tolerance
Nutrient transfer
via AMF
PO43-
Nutrient transfer PO43-

Zn2+
via root hairs
H2O Local
2+
resistance
Zn NH4+ H2 O NH4+
to root
pathogens
PO43- Phosphate Increased resistance
Figure 9.4 (a) : Root nodules occur on root depletion zone to heavy metal toxicity
(b) C.S. of Root nodule Figure 9.6 Benefits of AM colonisation
188 Plant Breeding

Apart from increasing the availability of productivity (4) resistance to abiotic stress and
phosphorus, AM provides necessary strength to (5) uptake and use of nutrients.
resist disease, germs and unfavourable weather
conditions. It also assures water availability. TRICHODERMA VIRIDE
A Potential bio-control agent for
soil borne diseases
Seaweed Liquid Fertilizer

Seaweed liquid fertilizer (SLF) contains cytokinin,
gibberellins and auxin apart from macro and
micro nutrients. Most seaweed based fertilizers
are made from kelp(brown algae) which grows
to length of 150 metres. Liquid seaweed fertilizer Figure 9.8: Figure 9.8:
is not only (a) Trichoderma fungi (b) Biopesticide
organic but also Beauveria species is an entomo-pathogenic
e c o - f r i e n d l y. fungus that grows naturally in soils throughout
The alginates the world. It acts as a parasite on various
in the seaweed arthropod species causing white muscardine
that reacts with disease without affecting the plant health and
metals in the growth. It also controls damping off of tomato
Figure 9.7 : Seaweed – Kelp soil and form caused by Rhizoctonia solani.
long, cross-
linked polymers in the soil. These polymers
improve the crumbing in the soil, swell up
when they get wet and retain moisture for a
long time. They are especially useful in organic
gardening which provides carbohydrates for (a) (b)
plants. Seaweed has more than 70 minerals,
vitamins and enzymes. It promotes vigorous
growth. Improves resistance of plants to frost
and disease. Seeds soaked in seaweed extract
germinate much rapidly and develop a better
root system.
(c)
Bio-Pesticides Figure 9.9 : (a) Beauveria Fungi
Bio-pesticides are biologically based agents used (b) Beauveria sps infected insect on green plant
for the control of plant pests. They are in high use (c)Entomopathogenic fungi on insets
due to their non-toxic, cheaper and eco-friendly
characteristics as compared to chemical or Green Manuring
synthetic pesticides. Bio-pesticides have become Green manuring is defined as the growing
an integral component of pest management in of green manure crops and use of these crops
terms of the environmental and health issues directly in the field by ploughing. One of the
attributed to the use of chemicals in agriculture. main objectives of the green manuring is to
increase the content of nitrogen in the soil. Also
Trichoderma species are free-living fungi it helps in improving the structure and physical
that are common in soil and root ecosystem. properties of the soil. The most important green
They have been recognized as bio-control agent manure crops are Crotalaria juncea, Tephrosia
for (1) the control of plant disease (2) ability purpurea, Indigofera tinctoria
to enhance root growth development (3) crop
Plant Breeding 189

The green manuring can be practised skills and ability of person involved. But as
as Green in-situ manuring or Green leaf the principles of genetics and cytogenetics
manuring. Green in-situ manuring refers to have elucidated breeding methods such as
the growing of green manuring crops in the selection, introduction, hybridization, ploidy,
border rows or as intercrops along with the mutation, tissue culture and biotechnology
main crops. Example: Sun hemp, Cowpea, techniques were designed to develop improved
Green gram etc. whereas green leaf manuring crop varieties.
is the application of green leaves and twigs of
trees, shrubs, plants growing in wastelands
9.6.1. Objectives of Plant Breeding
and field bunds. The important plant species • o increase yield, vigour and fertility of
T
useful for green leaf manure are Cassia fistula, the crop
Sesbania grandiflora, Azadirachta indica, • To increase tolerance to environmental
Delonix regia, Pongamia pinnata etc., condition, salinity, temperature
and drought.
9.6 Plant Breeding • To prevent the premature falling of buds,
Plant breeding is the science of improvement fruits etc.
of crop varieties with higher yield, better • To improve synchronous maturity.
quality, resistance to diseases and shorter • To develop resistance
durations which are suitable to particular to pathogens and
environment. In other words, it is a purposeful pests.
manipulation of plant species in order to
• To develop
create desired genotype and phenotype for
photosensitive and
the benefit of humans. In early days, plant
thermos-sensitive
breeding activities were based mainly on
varieties.
MILESTONES IN PLANT BREEDING

Plant breeding based on Hybrid breeding
Cross breeding Crossing two genetically GMO
Development of improved varieties different individuals to develop Introducing foreign genes Targeted
by combining good characteristics better performing hybrid into the DNA of a plant Breeding
f
from ttwo parents
t
Crop Understanding Using modern tools such
Domestication the structure of DNA Insect - resistant as genome editing for more
Farmers select the More vigorous James watson and Francis Crick cotton targeted breeding
best wild species to hybrid corn identify the double helix of DNA
create crops
Waxy corn
10,000 BC 1865 1926 1940 1953 1994 2000 now future
Domestication Barely resistant

Blast-resistant
of wheat to yellow dwarf virus
rice
Plant breeding Based on Marker-assisted Selection
Mendel's laws Mutagenesis Genetic information Locating desirable traits in a plant
Gregor Mendel describes the Developing new genetic Development of improved varieties for efficient selection and breeding
inheritance of traits from one diversity by exposing crop by working directly with DNA
generation to the next. His laws plants to chemical
become the core of classical genetics agents or radiation
For 10,000 years, farmers and For 150 years, plant scientists and Today, farmers feed at least 10 times By 2050, we will need 50% more
breeders have been developing breeders have improved plant more people using almost same food to feed the rapid growing
and improving crops breeding on a scientific basis amount of lands as 100 years ago population
Figure 9.10 : Milestones in Plant Breeding
190 Plant Breeding

9.6.2. Steps in Plant Breeding (2) Secondary introduction - When the
The main steps in plant breeding are given below introduced variety is subjected to selection to
Creation of isolate a superior variety and hybridized with a
Domestication Genetic Mutation local variety to transfer one or a few characters
Plant Variation to them. The botanical garden in different
introduction Polyploidy
Selection parts of the world also played a significant role
Tissue in plant introduction. Example : Tea varieties
Hybridization Evaluation and culture collected from China and North East India
Release as a
Germplasm variety Genetic initially grown in Botanical Garden of Kolkata
collection Engineering from which appropriate clones have selected
Seed multiplication
and introduced to different parts of India.
and distribution
Figure 9.11 : Steps in Plant Breeding National Bureau of
9.7 C onventional Plant Breeding plant Genetic Resources
Methods (NBPGR) The Bureau
is responsible for
Conventional plant breeding methods resulting
introduction and maintenance of germ
in hybrid varieties had a tremendous impact on
plasm of various agricultural and
agricultural productivity over the last decades.
horticultural station in our country. It is
It develops new plant varieties by the process
also responsible for maintenance of plant
of selection and seeks to achieve expression of
materials of botanical and medicinal
genetic material which is already present within
interest. It is located at Rangpuri,
the species. In this chapter we will discuss
New Delhi and has four regional plant
about some of the conventional methods of
quarantine stations at Amristsar, Kolkata,
plant breeding.
Mumbai and Chennai at Meenambakkam
9.7.1. Plant Introduction
Plant introduction may be defined as the 9.7.2. Selection
introduction of genotypes from a place where it is Selection is the choice of certain individuals
normally grown to a new place or environment. from a mixed population for a one or more
Rice variety of IR8 introduced from Philippines desirable traits. Selection is the oldest and
and Wheat varieties of Sonora 63, Sonora 64 basic method of plant breeding. There are two
from Mexico. main types of Selection.
The newly introduced plant has to adapt i. Natural Selection: This is a rule in the
itself to the new environment. This adjustment nature and results in evolution reflected
or adaptation of the introduced plant in the in the Darwinian principle “survival of
changed environment is called acclimatization. the fittest”. It takes longer time in bringing
All the introductions must be free from presence about desired variation.
of weeds, insects and disease causing organisms. ii. Artificial Selection: It is a human involved
This has to be carefully examined by the process process in having better crop from a mixed
called quarantine, a strict isolation imposed to population where the individuals differ in
prevent the spread of disease. character. The following are the three main
Introduction may be classified as Primary types of artificial selection.
introduction and Secondary introduction a. Mass Selection: In mass selection a large
(1) Primary introduction - When the number of plants of similar phenotype or
introduced variety is well adapted to the new morphological characters are selected and
environment without any alternation to the their seeds are mixed together to constitute
original genotype. a new variety. The population obtained
Plant Breeding 191

from the selected plants would be more
uniform than the original population and 1st Few to several hundred
are not individually tested. After repeated Year superior plants selected.
Mixture of clones
selection for about five to six years, selected
seeds are multiplied and distributed to (i) Clones from the selected
the farmers. The only disadvantage of 2nd
Clones from
plants grown seprately.
Year
mass selection is that it is difficult to Selected plants
(ii) Desirable clones selected.
distinguish the hereditary variation from

environmental variation. (i) Preliminary yield trail
with standard checks.
Mass Selection vs. Pure LineSelection 3rd (ii) Selection for quality,
Year disease resistance etc,
Line mixture Preliminary
(iii) Few outstanding clones
Yield trail
Mass Selection Pure Line Selection selected.
(i) Multilocation yield trails

4th-6th with standard checks.
Single plant offspring Year (ii) Best clone identified for
Bulk of phenotypically
Multilocation release as a new variety
similar plants
Yield trail
L1 L2 L3........ LN
Cultivar register and Register and market (i) Multilocation yield trails
marketing the best pure lines with standard checks.
5th
Heterogenous cultivars Homogenous cultivars Year (ii) Best clone identified for
Seed release as a new variety
multiplication
Figure 9.12 : Mass selection vs Pureline selection
b. Pureline selection: Johannsen in 1903 Figure 9.13 Clonal Selection
coined the word pureline. It is a collection 9.7.3. Hybridization
of plants obtained as a result of repeated Hybridization is the method of producing new
self-pollination from a single homozygous crop varieties in which two or more plants
individual. Hence, a variety formed by this of unlike genetically constitution is crossed
method shows more homozygosity with together that result in a progeny called hybrid.
respect to all genes. The disadvantage of Hybridization offers improvement in crop and is
this type is that the new genotypes are never the only effective means of combining together
created and they are less adaptable and less the desirable characters of two or more varieties
stable to the environmental fluctuations. or species. The first natural hybridization was
c. Clonal Selection: In asexually propagated observed by Cotton Mather in maize.
crop, progenies derived from a plant
resemble in genetic constitution with the Steps in Hybridization
parent plant as they are mitotically divided. Steps involved in hybridization are as follows.
Based on their phenotypic appearance, 1. Selection of Parents: Male and female
clonal selection is employed to select plants of the desired characters are selected.
improved variety from a mixed population It should be tested for their homozygosity.
(clones). The selected plants are multiplied 2. Emasculation: It is a process of removal of
through vegetative propagation to give rise anthers to prevent self pollination before
to a clone. The genotype of a clone remains anthesis (period of opening of a flower)
unchanged for a long period of time. 3. Bagging: The stigma of the flower is
protected against any undesirable pollen
grains, by covering it with a bag .
192 Plant Breeding

(a) (b)
Figure 9.15 Flower -

(a) G. hirsutum (b) G. arboreum
iv. Intergeneric hybridization – The crosses
are made between the plants belonging to
two different genera. The disadvantages
are hybrid sterility, time consuming
and expensive procedure. Example:
Figure 9.14 a & b: Emasculation Raphanobrassica, Triticale. (Refer chapter
and Bagging (Wheat) 4 for detail illustration)
4. Crossing: Transfer of pollen grains from
9.7.4. Heterosis
selected male flower to the stigma of the
female emasculated flower. Heterosis (hetero- different; sis - condition)
G.H. Shull was the first scientist to use the
5. Harvesting seeds and raising plants: The
term heterosis in 1912. The superiority of
pollination leads to fertilization and finally
the F1 hybrid in performance over its parents
seed formation takes place. The seeds are
is called heterosis or hybrid vigour. Vigour
grown into new generation which are called
refers to increase in growth, yield, greater
hybrid.
adaptability of resistance to diseases, pest
Types of Hybridization and drought. Vegetative propagation is the
According to the relationship between best suited measure for maintaining hybrid
plants, the hybridization is divided into. vigour, since the desired characters are not
lost and can persist over a period of time.
i. Intravarietal hybridization - The cross
Many breeders believe that its magnitude of
between the plants of same variety. Such crosses
heterosis is directly related to the degree of
are useful only in the self-pollinated crops.
genetic diversity between the two parents.
ii. Intervarietal hybridization - The cross Depending on the nature, origin, adaptability
between the plants belonging to two and reproducing ability heterosis can be
different varieties of the same species and is classified as:
also known as intraspecific hybridization.
i. Euheterosis- This is the true heterosis
This technique has been the basis of
which is inherited and is further classified
improving self-pollinated as well as cross
as:
pollinated crops
a. Mutational Euheterosis - Simplest
iii. Interspecific hybridization - The cross type of euheterosis and results from the
between the plants belonging to different sheltering or eliminating of the deleterious,
species belonging to the same genus is unfavourable often lethal, recessive,
also called intragenic hybridization. It mutant genes by their adaptively superior
is commonly used for transferring the dominant alleles in cross pollinated crops.
genes of disease, insect, pest and drought b. Balanced Euheterosis – Well balanced gene
resistance from one species to another. combinations which is more adaptive to
Example: Gossypium hirsutum x environmental conditions and agricultural
Gossypium arboreum – Deviraj. usefulness.
Plant Breeding 193

ii.
Psuedoheterosis – Also termed as heterozygosity, increase the tolerance to
luxuriance. Progeny possess superiority both biotic and abiotic stresses, buffering of
over parents in vegetative growth but not deleterious mutations. In addition, polyploidy
in yield and adaptation, usually sterile or often results in reduced fertility due to meiotic
poorly fertile. error allowing the production of seedless
9.7.5. Mutation Breeding varieties.
Muller and Stadler (1927- 1928) coined the When chromosome number is doubled by
term mutation breeding. It represents a new itself in the same plant, is called autopolyploidy.
method of conventional breeding procedures Example: A triploid condition in sugarbeets,
as they have the advantage of improving the apples and pear has resulted in the increase
defect without losing agronomic and quality in vigour and fruit size, large root size, large
character in agriculture and crop improvement. leaves, flower, more seeds and sugar content
Mutation means the sudden heritable in them. It also resulted in seedless tomato,
changes in the genotype or phenotype of an apple, watermelon and orange. Polyploidy can
organism. Gene mutations are of considerable be induced by the use of colchicine to double
importance in plant breeding as they provide the chromosome number. Allopolyploids are
essential inputs for evolution as well as for produced by multiplication of chromosome
re-combination and selection. It is the only sets that are initially derived from two different
method for improving seedless crops. species. Example: Triticale (Triticum durum
Radiation such as UV short wave, X-ray, x secale cereale) Raphanobrassica (Brassica
Alpha (α), Beta (β), Gamma waves and many oleraceae x Raphanus sativus).
chemicals such as cesium, EMS (ethyl methane 9.7.7. Green Revolution
sulfonate), nitromethyl, urea induces mutation Green revolution the term was coined by
to develop new variety of crops. Example: William S.Gaud in (1968). It is defined as
Triple gene dwarf wheat with increase in the cumulative result of a series of research,
yield and height. Atomita 2 - rice with saline development, innovation and technology
tolerance and pest resistance. transfer initiatives. Agricultural production
Gamma Garden or Atomic (especially wheat and rice) manifolds
worldwide particularly in the developing
Garden: Is a form of mutation
countries between the 1940’s and the late
breeding where plants are
1960’s.
exposed to radioactive sources
typically cobalt-60 or caesium-137 in order to The Green revolution or third Agricultural
generate desirable mutation in crop plants. The Revolution is the intensive plan of 1960’s to
first Gamma garden in India is Bose Research increase crop yield in developing countries
by introducing the high yielding, resistant
Institute at Calcutta in 1959 and the second is
varieties, increased irrigation facilities,
IARI in 1960 which produced large variation in
fertilizer application and better agricultural
short type.
management. The scheme began in Mexico
in 1940’s and was successfully introduced in
9.7.6. Polyploid Breeding
parts of India, Asia, Middle East and Latin
Majority of flowering plants are diploid (2n).
America. Dr.B.P Pal the Director of IARI,
The plants which possess more than two sets of
requested M.S.Swaminathan to arrange for
chromosome are called polyploids. Polyploidy
Dr.NE Borlaug visit to India and for obtaining
is a major force in the evolution of both
a wide range of dwarf wheat possessing the
wild and cultivated plants. Polyploidy often
Norin 10 dwarfing genes from Mexico.
exhibit increased hybrid vigour increased
194 Plant Breeding

In 1963 semi-dwarf wheat of Mexico
was introduced from which India got five Norman E. Borlaug: The plant pathologist
prolonged strategies for breeding a wide range plant breeder devoted his life at the International
of high varieties like Sonora 64, Sonalika and Maize and Wheat improvement centre at
Kalyansona possessing a broad spectrum of Sonord in Mexico. He developed a new high
resistance to major biotic and abiotic condition. yielding, rust resistant, non-lodging dwarf
Same as wheat M.S.Swaminathan produced the wheat varieties like Norin-10, Sonora-64, Lerma
first semi-dwarf fertiliser responsive hybrid rojo-64, etc. which are now being cultivated in
variety of rice TNI (Taichung Native-1) in 1956 many countries. This formed
from Taiwan. The derivatives were introduced in the base for ‘green revolution’.
1966. Later better yielding semi dwarf varieties He was awarded a Nobel prize
of rice Jaya and Ratna developed in India. for Peace in 1970.
Dr. M. S. Swaminathan: He is
NORIN 10 – The cultivars pioneer mutation breeder. He
found that Norin 10 has produced Sharbati Sonora, is the amber grain
dwarfing genes have high coloured variety of wheat by mutation, which
photosynthetic rate per unit is responsible for green revolution in India.
leaf area and increase respiratory activity. Dr. Swaminathan is called
Gonjiro Inazuka selected the semi-dwarf “Father of green revolution
wheat variety that became Norin 10. He in India”.
would have never thought that the semi
dwarf genes would not only revolutionize Nel Jayaraman: Mr.
the world of wheat but also helped to save Jayaraman, hails from
more than one billion lives from hunger Adirangam village in Tiruvarur district. He
and starvation. was a disciple of Dr.Nammalvar and state co-
ordinator of ‘Save our rice campaign, Tamil
Plant Breeding for Developing Nadu. He strived hard for conservation of
Resistance to diseases traditional rice varieties. He had trained a team
of farmers and regularly update them on the
Some crop varieties bred by hybridization
current issues that affect them.
and selection, for disease resistance to fungi,
bacteria and viral diseases are released (Table 9.1). In 2005, he organized a first ever
traditional paddy seed
Crop Variety
Resistance to
festival in his farm as an
diseases
individual. The seed festival
Wheat Himgiri Leaf and Stripe in May 2016 at Adhirangam
rust, hill bunt was 10th in a row and
Brassica Pusa swarnim White rust in which 156 different
(Kara rai) traditional varieties were distributed to more
Cauliflower Pusa Shubhra, Black rot and than 7000 farmers across Tamil Nadu. He was
Pusa snowball curl blight invited by the Philippines Government to
K-1 black rot give a talk at the International Rice Research
Cowpea Pusa Komal Bacterial blight Institute (IRRI) on his work and mission. In
Chilli Pusa Chilly mosaic 2011, he received the State Award for best
Sadabahar virus, Tobacco organic farmer for his contribution to organic
mosaic virus farming, and in the year 2015, he received the
and Leaf curl. National Award for best Genome Savior.
Table 9.1: Disease resistance varieties
Plant Breeding 195

Resistance to yellow mosaic virus in
Biofortification – breeding crops with bhindi (Abelmoschus escullentus) was
higher levels of vitamins and minerals or transferred from a wild species and resulted
higher protein and healthier fats – is the in a new variety of A. Escullentus called
most practical means to improve public Parbharni kranti.
health.
Plant Breeding for Developing
Breeding for improved nutritional quality is
Resistance to Insect Pests
undertaken with the objectives of improving
Insect resistance in host crop plants may
• Protein content and quality be due to morphological, biochemical or
• Oil content and quality physiological characteristics. Hairy leaves in
several plants are associated with resistance
• Vitamin content and to insect pests. Example: resistance to jassids
• Micronutrient and mineral content in cotton and cereal leaf beetle in wheat. In
wheat, solid stems lead to non-preference by the
In 2000, maize hybrids that had twice
stem sawfly and smooth leaves and nectar-less
the amount of amino acids, lysine and cotton varieties do not attract bollworms. High
tryptophan, compared to existing maize aspartic acid, low nitrogen and sugar content in
hybrids were developed. Wheat variety, maize leads to resistance to maize stem borers.
Atlas 66 having a high protein content, has
been used a donor for improving cultivated Crop Variety Insect pests
wheat. It has been possible to develop an Brassica Pusa Gaurav Aphids
iron fortified rice variety containing over (rapeseed
five times as much iron as in commonly mustard)
consumed varieties. Flat been Pusa Sem 2 Jassids, aphids
Pusa Sem 3 and fruit
The Indian Agricultural Research Institute,
borer
New Delhi has also released several
Okra Pusa Sawani Shoot and
vegetable crops that are rich in vitamins
(Bhindi) Pusa A-4 Fruit borer
and minerals, example: vitamin A enriched
carrots, spinach, pumpkin; vitamin C Table 9.2 Pest resistance varieties
enriched bitter gourd, bathua, mustard,
tomato; iron and calcium enriched spinach 9.8 Modern Plant Breeding
and bathura; and protein enriched beans – In the milestones of plant breeding methods
broad, lablab, French and garden peas. Genetic Engineering, Plant tissue culture,
Protoplasmic fusion or somatic hybridisation,
Molecular marking and DNA finger printing
Sugar cane: Saccharum bareri was originally are some of the modern plant breeding tools
grown in North India, but had poor sugar content used to improve the crop varieties. We have
and yield. Tropical canes grown in South India already discussed about the various techniques
Saccharum officinarum had thicker stems and and application of the above mentioned
higher sugar content but did not grow well in concepts in Unit VIII.
North India. These two species were successfully New Plant Engineering Techniques /
crossed to get sugar cane varieties combining the New Breeding Techniques (NBT)
desirable qualities of high yield, thick stems, high
NBT are a collection of methods that could
sugar and ability to grow in the sugarcane areas
increase and accelerate the development of
of North India. new traits in plant breeding. These techniques
196 Plant Breeding

TRADITIONAL New generation plant breeding
Crops with improved characteristics produced by cross
METHOD
Gene has 50-50 chance of being passed to offspring.
breeding plants with desired gene Desired gene will take multiple generations to spread
Combines genes from different species Chromosome

Bacteria
Bacterial
chromosome Gene
MODERN METHOD
Plant cell
1. Plasmid: 3. Vector: Restriction
Circular
enzyme cleaves plasmid.
DNA molecule is 2. DNA containing gene for
Second enzyme –
removed desired trait is removed
from cell. This from chromosome. Restriction DNA ligase – pastes gene
acts as vector to enzyme cuts gene into DNA molecule, making 4. Vector inserts gene into
carry gene from DNA recombinant vector chromosomes of plant cells
NEW BREEDING
CRISPR/Cas9*: Precise gene-editing cuts

Plant with desired gene has gene pasted
TECHNIQUES
DNA at specified sequence and enables

into all its chromosomes. Gene is transmitted
introduction of replacement sequence
to nearly all offspring
*Clustered Regularly Interspaced Short Palindromic Repeats.
Cas9 is a cleaving protein.
Figure 9.16 Sequential development of plant breeding techniques

often involve genome species. In the history of agriculture Vavilov
editing, to modify DNA at has given the eight main centres of origin of
specific locations within the plants were now divided into 12 centres of
plants to produce new traits origin. In Organic agriculture biofertilizers
in crop plants. The various are microbial inoculants which is ecofriendly,
methods of achieving these more effective even though cost effective than
changes in traits include the chemical fertilizers. Rhizobium, Azolla, VAM
following. and sea weeds are used as fertilizers which
• Cutting and modifying the genome increase the crop yield many fold.
during the repair process by tools like Plant breeding is a purposeful
CRISPR /Cas. manipulation of plant species in order to
• Genome editing to introduce changes in create desirable genotype and phenotype for
few base pairs using a technique called the benefit of mankind. Plant introduction,
Oligonucleotide-directed mutagenesis selection, hybridization, heterosis, mutation
(ODM). breeding, polyploidy breeding and green
• Transferring a gene from an identical or revolution are the different methods of
closely related species (cisgenesis) conventional breeding.
• Organising processes that alter gene
activity without altering the DNA itself Evaluation
(epigenetic methods). 1. Assertion: Genetic
variation provides the
Summary raw material for selection
Economic Botany deals with the
Reason: Genetic
relationship between people and economically
variations are differences
important plants to fulfill the three basic
in genotypes of the
needs of life such as food, clothing and
individuals.
shelter. Domestication, a term often used for
a more intricate process, involves the genetic a) Assertion is right and reason is wrong.
alteration of plants which did not appear at b) Assertion is wrong and reason is right.
once, but rather over a substantial period of c) Both reason and assertion is right.
time, perhaps hundreds of years for some d) Both reason and assertion is wrong.
Plant Breeding 197

2. While studying the history of 10. Crosses between the plants of the same
domestication of various cultivated plants variety are called
_______ were recognized earlier a) interspecific b) inter varietal
a) Centres of origin c) intra varietal d) inter generic
b) Centres of domestication 11. Progeny obtained as a result of repeat self
c) Centres of hybrid pollination a cross pollinated crop to called
d) Centres of variation
a) pure line b) pedigree line
3. Pick out the odd pair. c) inbreed line d) heterosis
a) Mass selection - Morphological 12. Jaya and Ratna are the semi dwarf varieties of
characters
a) wheat b) rice
b) Purline selection - Repeated self
c) cowpea d) mustard
pollination
c) Clonal selection - Sexually propagated 13. Which one of the following are the species that
d) Natural selection - Involves nature are crossed to give sugarcane varieties with
high sugar, high yield, thick stems and ability
4. Match Column I with Column II
to grow in the sugarcane belt of North India?
Column I Column II
a) Saccharum robustum and Saccharum officinarum
i) William S. Gaud I) Heterosis
b) Saccharum barberi and Saccharum officinarum
ii) Shull II) Mutation breeding
iii) Cotton Mather III) Green revolution c) S accharum sinense and Saccharum officinarum
iv) Muller and Stadler IV) Natural d) Saccharum barberi and Saccharum robustum
hybridization 14. Match column I (crop) with column II
a) i – I, ii – II, iii – III, iv – IV (Corresponding disease resistant variety)
b) i – III, ii – I, iii – IV, iv – II and select the correct option from the
c) i – IV, ii – II, iii – I, iv – IV given codes.
d) i – II, ii – IV, iii – III, iv – I Column I Column II
5. The quickest method of plant breeding is I) Cowpea i) Himgiri
a) Introduction b) Selection II) Wheat ii) Pusa komal
c) Hybridization d) Mutation breeding III) Chilli iii) Pusa Sadabahar
IV) Brassica iv) Pusa Swarnim
6. Desired improved variety of economically
useful crops are raised by I II III IV
a) iv iii ii i
a) Natural Selection b) hybridization
b) ii i iii iv
c) mutation d) biofertilisers
c) ii iv i iii
7. Plants having similar genotypes produced d) i iii iv ii
by plant breeding are called
15. A wheat variety, Atlas 66 which has been
a) clone b) haploid
used as a donor for improving cultivated
c) autopolyploid d) genome
wheat, which is rich in
8. Importing better varieties and plants from a) iron b) carbohydrates
outside and acclimatising them to local c) proteins d) vitamins
environment is called
16. Which one of the following crop varieties
a) cloning b) heterosis
correct matches with its resistance to a disease?
c) selection d) introduction
Variety Resistance to disease
9. Dwarfing gene of wheat is a) Pusa Komal Bacterial blight
a) pal 1 b) Atomita 1 b) Pusa Sadabahar White rust
c) Norin 10 d) pelita 2 c) Pusa Shubhra Chilli mosaic virus
d) Brassica Pusa swarnim
198 Plant Breeding

17. Which of the following is incorrectly paired? 23. Write a note on heterosis.
a) Wheat - Himgiri 24. List out the new breeding techniques involved
b) Milch breed - Sahiwal in developing new traits in plant breeding.
c) Rice - Ratna
d) Pusa Komal - Brassica Glossary
18. Match list I with list II Acclimatization : The adaptation of an individual
to a changed climate or the adjustment of a
List I List II
species or a population to a changed environment
Biofertilizer Organisms
i) Free living N2 a) Aspergillus over a number of generations.
ii) Symbiotic N2 b) Amanita Agronomy : Science of farming
iii) P Solubilizing c) Anabaena azollae
iv) P Mobilizing d) Azotobactor Anthesis : Period of opening of flower.
a. ic, iia, iiib, ivd b. id, iic, iiia, ivb. Germplasm Collection : The entire collection
c. ia, iic, iiib, ivd c. ib, iia, iiid, ivc. (of plants / seeds) having all the diverse
19. Differentiate primary introduction from alleles for all genes in a given crop is called
secondary introduction. germplasm collection.
20. How are microbial innoculants used to Non recurrent parent : The parent of a hybrid
increase the soil fertility? that is not again used as a parent in backcrossing
21. What are the different types of
Quarantine : Strict isolation imposed to prevent
hybridization?
the spread of disease
22. Explain the best suited type followed by
plant breeders at present? Strain : A group of similar individuals from a
common origin.
ICT Corner
Plant Breeding
Let us know about the details of
Medicinal Plants in detail.
Steps
• Type the URL or scan the QR code to open the activity page then Introduction page will open.
• Click on ‘Plants’ it will display list of Medicinal Plants.
• Click on each plants individually on the next screen it displays the description, harvesting and
properties of the plants.
• Click the option on the top left side of the front page to see the preparation of oils, Powder etc.,

URL:
https://play.google.com/store/apps/details?id=com.dssoft.plantasmedicinales
Plant Breeding 199

Unit X: Economic Botany
Chapter
10 Economically
Useful Plants and
Entrepreneurial Botany
Learning Objectives The land and water of the earth sustain a

vast assemblage of plants upon which all
The learner will be able to other living forms are directly or indirectly
Acquire knowledge about origin, area dependent. Pre-historic humans lived on
of cultivation and uses of various food berries, tubers, herbage, and the wild game
yielding plants. which they collected and hunted that occupied
whole of their time. Domestication of plants
Describe the different spices and
and animals has led to the production of
condiments and their uses.
surplus food which formed the basis for
Elicit the uses of fibre, timbers, paper and civilizations. Early civilization in different
dye yielding plants. parts of the world has domesticated different
Acquire knowledge about the active species of plants for various purposes. Based
principles, chemical composition and on their utility, the economically useful plants
medicinal uses of plants. are classified into food plants, fodder plants,
fibre plants, timber plants, medicinal plants,
Gains knowledge of organic farming- bio
and plants used in paper industries, dyes and
fertilisers and bio pest repellants.
cosmetics. Selected examples of economically
important plants for each category are
discussed in this chapter.
Chapter outline
10.1 Food Plants 10.1 Food plants

Currently about 10,000 food plants are being
10.2 Spices and Condiments
used of which only around 1,500 species were
10.3 Fibre brought under cultivation. However, food
10.4 Timber base of majority of the population depends
10.5 Latex
only on three grass species namely rice, wheat
and maize.
10.6 Pulp wood
10.1.1 Cereals
10.7 Dye
The word cereal is derived from Ceres, which
10.8 Cosmetics according to the Roman mythology denotes
10.9 Traditional system of medicines “Goddess of agriculture”. All cereals are members
of grass family (Poaceae) that are grown for their
10.10 Medicinal plants
edible starchy seeds. The prominence of cereals
10.11 Entrepreneurial Botany as food plants is due to the following attributes:
200 Economically useful plants and Entrepreneurial Botany

i. Greater adaptability and successful
colonisation on every type of habitat.
ii. The relative ease of cultivation
iii.
Tillering property that produce more
branches which results in higher yield per Rice Wheat
unit area. Figure 10.1: Major Cereals
iv. Compact and dry grains that they can be
easily handled, transported and stored Wheat
without undergoing spoilage. Botanical name : Triticum aestivum
v. High caloric value that provides energy. Origin and Area of cultivation
The nutrients provided by cereals include Earliest evidence for wheat cultivation
carbohydrates, proteins, fibres and a wide comes from Fertile Crescent region. The
range of vitamins and minerals. Cereals can common cultivated wheat, Triticum aestivum
be classified into two different types based is cultivated for about 7,500 years. Wheat is
on their size namely Major Cereals and mostly cultivated in the North Indian states
Minor Cereals. such as Uttar Pradesh, Punjab, Haryana,
Rajasthan, Madhya Pradesh and Bihar.
Major Cereals
Uses
Rice / Paddy
Wheat is the staple food in Northern India.
Botanical name : Oryza sativa Wheat flour is suitable to make bread and other
Paddy is a semi-aquatic crop and is grown in bakery products. Processed wheat flour, that
standing water. It is an important food crop has little fibre, is called Maida which is used
of the world, occupying the second position extensively in making parota, naan and bakery
in terms of area under cultivation and products. Malted wheat is a major raw material
production, next to wheat. Rice is the chief for producing alcoholic beverages and nutritive
source of carbohydrate. drinks.
Origin and Area of cultivation
South East Asia is considered as the center PSEUDO-CEREAL
of origin of rice. Earliest evidences of rice The term pseudo-cereal is
cultivation have been found in China, India used to describe foods that
and Thailand. It is mainly cultivated in Delta are prepared and eaten
and irrigated regions of Tamil Nadu. as a whole grain,
Uses but are botanical
Rice is the easily digestible calorie rich outliers from
grasses. Example:
cereal food which is used as a staple food
quinoa. It is
in Southern and North East India. Various
actually a seed from
rice products such as Flaked rice (Aval), Pseudo cereal - the Chenopodium
Puffed rice / parched rice (Pori) are used as Chenopodium quinoa
quinoa plant
breakfast cereal or as snack food in different belongs to the family Amaranthaceae. It is
parts of India. a gluten-free, whole-grain carbohydrate, as
Rice bran oil obtained from the rice bran is well as a whole protein (meaning it contains
used in culinary and industrial purposes. all nine essential amino acids) and have been
Husks are used as fuel, and in the manufacture eaten for 6,000 years in Andes hill region.
of packing material and fertilizer.
Economically useful plants and Entrepreneurial Botany 201

Uses 10.1.3 Minor Millets
Most of the corn produced is used as Foxtail Millet
fodder than food. Corn syrup is used in
Botanical name : Setaria italica
the manufacture of infant foods. Corn is a
This is one of the oldest millet used
raw material in the industrial production of
traditionally in India. Which is domesticated
alcohol and alcoholic beverages.
first in China about 6000 years. Rich in protein,
10.1.2 Millets (Siru Thaniyangal) carbohydrate, vitamin B and C, Potassium and
The term millet is applied to a variety of very Calcium.
small seeds originally cultivated by ancient Uses
people in Africa and Asia. They are gluten free It supports in strengthening of heart and
and have less glycemic index. improves eye sight. Thinai porridge is given to
lactating mother.
Kodo Millet
Botanical name : Paspalum scrobiculatum
Finger Millet Sorghum Kodo millet is originated from West Africa,
Figure 10.2: Millets which is rich in fibre, protein and minerals.
Uses
Finger Millet – Ragi
Kodo millet is ground into flour and used
Botanical name : Eleusine coracana
to make pudding. Good diuretic and cures
Finger millet is the crop of early introduction from constipation. Helps to reduce obesity, blood
East Africa into India. Ragi is rich in calcium. sugar and blood pressure.
Uses
It is used as a staple food in many southern
10.1.4 Pulses
The word Pulse is derived from the Latin
hilly regions of India. Ragi grains are made
words ‘puls’ or ‘pultis’ meaning “thick soup”.
into porridge and gruel. Ragi malt is the
Pulses are the edible seeds that are harvested
popular nutrient drink. It is used as a source
from the fruits of Fabaceae. They provide vital
of fermented beverages.
source of plant-based protein, vitamins and
Sorghum minerals for people around the globe.
Botanical name : Sorghum vulgare
Black gram
Sorghum is native to Africa. It is one of the major
Botanical name : Vigna mungo
millets in the world and is rich in calcium and iron.
Uses Black gram is native to India. Earliest
It is fed to poultry, birds, pigs and cattle and a archeobotanical evidences record the presence
source of fermented alcoholic beverage. of black gram about 3,500
years ago. It is cultivated as
a rain fed crop in drier parts
of India. India contributes to
80% of the global production
of black gram. Important states
growing black gram in India are
Foxtail Millet Kodo Millet Uttar Pradesh, Chattisgarh and
Figure 10.3: Minor Millets Karnataka.

Black gram Sprouted green gram Red gram
Figure 10.4: Pulses
Uses 10.1.5 Vegetables

Black gram is eaten whole or split, boiled or While walking through a market filled with fresh
roasted or ground into flour. Black gram batter vegetables like stacks of lady’s finger, mountains
is a major ingredients for the preparation of of potatoes, pyramids of brinjal, tomatoes,
popular Southern Indian breakfast dishes. cucurbits, we learn to choose the vegetables that
Split pulse is used in seasoning Indian curries. is fresh, tender, ripe and those suit the family
taste through experience and cultural practices.
Red gram / Pigeon pea
Why do we need to eat vegetables and what do
Botanical name : Cajanus cajan they provide us?
Origin and Area of cultivation: It is the only Vegetables are the important part of
pulse native to Southern India. It is mainly grown healthy eating and provide many nutrients,
in the states of Maharashtra, Andhra Pradesh, including potassium, fiber, folic acid and
Madhya Pradesh, Karnataka and Gujarat. vitamins A, E and C. The nutrients in vegetables
Uses are vital for maintenance of our health.
Red gram is a major ingredient of sambar, a Lady’s finger / Okra
characteristic dish of Southern India. Roasted
Botanical name : Abelmoschus esculentus
seeds are consumed either salted or unsalted
Family: Malvaceae
as a popular snack. Young pods are cooked and
consumed.
Lady’s finger is a native of the Tropical Africa.
Green gram Assam, Maharashtra and Gujarat are the
Botanical name : Vigna radiata important states where Lady’s finger is grown in
Origin and Area of cultivation abundance. Coimbatore, Dharmapuri and Vellore
Green gram is a native of India and the earliest are the major cultivating regions of Tamil Nadu.
archaeological evidences are found in the state
Uses
of Maharashtra. It is cultivated in the states of
The fresh and green tender fruits are used
Madhya Pradesh, Karnataka and Tamil Nadu.
as a vegetable. Often they are sliced and
Uses dehydrated to conserve them for later use. It
It can be used as roasted cooked and sprouted has most important nutrients.
pulse. Green gram is one of the ingredients of
10.1.6 Fruits
pongal, a popular breakfast dish in Tamil Nadu.
Edible fruits are fleshy structures with a pleasant
Fried dehulled and broken or whole green gram
aroma and flavours. Fruits are sources of many
is used as popular snack. The flour is traditionally
nutrients including potassium, dietary fiber,
used as a cosmetic, especially for the skin.
folic acid and vitamins.Depending on the
climatic region in which fruit crops grow, they

can be classified into temperate(apple, pear, Uses
plum) and tropical fruits (mango, jack, banana). Cashews are
In this chapter we will study an example of commonly used
tropical fruit. for garnishing
Mango (National fruit of India) sweets or curries, or Cashew
Botanical name : Mangifera indica ground into a paste Figure 10.6: Nuts
Family: Anacardiaceae that forms a base of
sauces for curries or some sweets. Roasted and
Origin and Area of
raw kernels are used as snacks.
cultivation
The mango is the native 10.1.8 Sugars
to Southern Asia, We experienced sweetness while eating the
especially Burma and stems of sugarcane, roots of sugar beet, fruits
Eastern India. It is the of apple and while drinking palmyra sap. This
National fruit of India. Figure 10.5: Mango is due to the different proportions of sugars
Major mango producing found in it. Sugar is the generic name for
States are Andhra Pradesh, Bihar, Gujarat and sweet tasting soluble carbohydrate, which are
Karnataka. Salem, Krishnagiri, Dharmapuri are used in foods and beverages. Sugars found in
the major mango producing districts of Tamil sugarcane and palmyra make them ideal for
Nadu. Some of the major cultivars of mango in efficient extraction to make commercial sugar.
India are Alphonsa, Banganapalli, neelam and
Sugarcane
malgova.
Botanical name : Saccharum officinarum
Uses Family : Poaceae
Mango is the major table fruit of India, which Origin and Area of cultivation
is rich in beta carotenes. It is utilized in many The cultivated Saccharum officinarum
ways, as dessert, canned, dried and preserves has evolved by repeated back crossing of
in Indian cuisine. Sour, unripe mangoes are S.officinarum of New Guinea with wild
used in chutneys, pickles, side dishes, or may S.spontaneum of India to improve the quality.
be eaten raw with salt and chili. Mango pulp is All districts except Kanyakumari and Nilgiris
made into jelly. Aerated and non-aerated fruit of Tamil Nadu cultivate Sugarcane.
juice is a popular soft drink.
Uses
10.1.7 Nuts Sugar cane is the raw material for extracting
Nuts are simple dry fruits composed of a hard white sugar. Sugarcane supports large number
shell and an edible kernel. They are packed of industries like sugar mills producing refined
with a good source of healthy fats, fibre,
sugars, distilleries producing liquor grade
protein, vitamins, minerals and antioxidants.
Cashew nut
Botanical name : Anacardium occidentale
Family: Anacardiaceae
Cashew has originated in Brazil and made its way
to India in the 16th century through Portuguese Palmyra tree and
Palm Jaggery
sailors. Cashew is grown in Kerala, Karnataka, Sugarcane products
Goa, Maharashtra, Tamil Nadu, and Orissa. Figure 10.7: Sugars

ethanol and millions of jaggery manufacturing and India via Philippines. In India Gujarat,
units. Fresh sugarcane juice is a refreshing Andhra Pradesh and Rajasthan are top
drink. Molasses is the raw material for the producers.
production of ethyl alcohol. Uses
Palmyra (State tree of Tamil Nadu) Nuts contain about 45% oil. The kernels
Botanical name : Borassus flabellifer are also rich sources of phosphorous and
Family: Arecaceae vitamins, particularly thiamine, riboflavin
and niacin. It is premium cooking oil because
it does not smoke. Lower grade oil is used in
Palmyra is native to tropical regions of Africa,
manufacture of soaps and lubricants.
Asia and New Guinea. Palmyra grows all over
Tamil Nadu, especially in coastal districts. Sesame / Gingelly
Uses Botanical name : Sesamum indicum
Exudate from inflorescence axis is collected for Family : Pedaliaceae
preparing palm sugar. Inflorescence is tapped for its Origin and Area of cultivation: Sesamum
sap which is used as health drink. Sap is processed indicum has originated from Africa.. Sesame
to get palm jaggery or fermented to give toddy. is cultivated as a dry land crop. West Bengal
Endosperm is used as a refreshing summer and Madhya Pradesh are the top producers
food. Germinated seeds have an elongated embryo in India during 2017-18. It is considered as a
surrounded by fleshy scale leaf which is edible. healthy oil in Southern Indian culture.
Uses
10.1.9 Oil Seeds
Why fried foods are tastier than boiled foods? Sesame oil is used for mostly culinary purposes
in India. Lower grades are used in manufacture
There are two kinds of oils namely, essential
of soaps, in paint industries, as a lubricant and as
oils and vegetable oils or fatty oils. The
an illuminant. In India, the oil is the basis of most
essential oils or volatile oils which possess
of the scented oils used in perfumes. Sesame seed
aroma evaporate or volatilize in contact
with air. Any organ of a plant may be the snacks are popular throughout India.
source of essential oil. For example, flowers
of Jasmine, fruits of orange and roots of
ginger. The vegetable oils or non-volatile
oils or fixed oils that do not evaporate.
Whole seeds or endosperm form the sources
of vegetable oils. Groundnut Sesame
Figure 10.8: Oil Seeds
Let us know about few oil seeds
Groundnut / Peanut 10.1.10 Beverages
Botanical name : Arachis hypogaea How about a cup of coffee or tea? We always
entertain our guests with this offer.
Family : Fabaceae
All non-alcoholic beverages contain alkaloids
Origin and Area of
that stimulate central nervous system and also
Cultivation: Groundnut is
possess mild diuretic properties.
native of Brazil. Portuguese
Coffee
introduced groundnut into
Botanical name : Coffea arabica
Africa. The Spanish took
Family : Rubiaceae
it to the South East Asia

Why does a student Spices are accessory foods mainly used
or a driver prefer for flavouring during food preparation to
tea or coffee during improve their palatability. Spices are aromatic
night work? plant products and are characterized by sweet
Origin and Area or bitter taste. Spices are added in minimal
Coffee
of cultivation: quantities during the cooking process. For
Figure 10.9: Beverages
Coffea arabica is example black pepper.
the prime source Condiments, on the other hand, are
of commercial coffee which is native to the flavouring substances having a sharp taste and
tropical Ethiopia An Indian Muslim saint, are usually added to food after cooking. For
Baba Budan introduced coffee from Yemen
example, curry leaves.
to Mysore.Karnataka is the largest coffee
producing state in India followed by Tamil The following spices and condiment are
Nadu and Kerala. Tamil Nadu is the largest discussed in detail.
consumer of coffee in India. Spices
Uses
Cardamom
Drinking coffee in moderation provides the Botanical name : Elettaria cardamomum
following health benefits:
Family : Zingiberaceae
Caffeine enhances release of acetylcholine
Origin and Area of cultivation: It is
in brain, which in turn enhances efficiency. It can
indigenous to Southern India and Sri Lanka.
lower the incidence of fatty liver diseases, cirrhosis
Cardamom is called as “Queen of Spices”. In
and cancer. It may reduce the risk of type 2 diabetes.
India it is one of the main cash crops cultivated
in the Western Ghats, and North Eastern India
10.2 Spices and Condiments
“Aroma attracts everyone” Uses
History: The seeds have a pleasing aroma and a

characteristic warm, slightly pungent taste. It
Spices were used extensively throughout the
is used for flavouring confectionaries, bakery
world for several thousands of years. Records
products and beverages. The seeds are used
of use of garlic and onion dates back 2500 years.
in the preparation of curry powder, pickles
Majority of the spices are native to and cakes. Medicinally, it is employed as a
Mediterranean region, India and South East stimulant and carminative. It is also chewed
Asian countries. Spices, especially pepper as a mouth freshener.
triggered the search for sea route to India
Black Pepper
and paved way for the exploratory voyages by
Spanish and Portuguese. Botanical name : Piper nigrum
Family : Piperaceae
Cardamom Black Pepper Turmeric Chillies

Figure 10.10: Spices

Origin and Area of cultivation: It is indigenous arteries, which leads to heart attack.
to Western Ghats of India. Pepper is one of Chillies / Red Pepper
the most important Indian spices referred
Botanical name : Capsicum annuum,
to as the “King of Spices” and also termed as
C. frutescens.
“Black Gold of India”. Kerala, Karnataka and
Family : Solanaceae
Tamil Nadu are the top producers in India.
Origin and Area of cultivation: Capsicum
The characteristic pungency of the pepper
is native to South America and is popularly
is due to the presence of alkaloid Piperine.
known as chillies or red pepper in English.
There are two types of pepper available in the
India is leading producer and exporter.
market namely black and white pepper.
C. annuum and C. frutescens are important
Uses
cultivated species of chillies.
It is used for flavouring in the preparation of
Uses
sauces, soups, curry powder and pickles. It is
The fruits of C.annuum are less pungent than the
used in medicine as an aromatic stimulant for
fruits of C.frutescens. C.annum includes large,
enhancing salivary and gastric secretions and
sweet bell peppers. Long fruit cultivars of this
also as a stomachic. Pepper also enhances the
species are commercially known as ‘Cayenne
bio-absorption of medicines.
pepper’ which are crushed, powdered and used
Turmeric as condiment. Chillies are used in manufacture
Botanical name : Curcuma longa of sauces, curry powders and preparation of
Family : Zingiberaceae pickles. Capsaicin is an active component of
Origin and Area of cultivation: It is chillies. It has pain relieving properties and
indigenous to Southern Asia India is the used in pain relieving balms. Chillies are a
largest producer, consumer and exporter of good source of Vitamin C, A and E.
turmeric. Erode in Tamil Nadu is the World’s Capsaicin is responsible
largest wholesale turmeric market. for the pungency or spicy
Uses taste of chillies. Pungency
Turmeric is one of the most important and of Chillies is measured
ancient Indian spices and used traditionally over in Scoville Heat Units
thousands of years for culinary, cosmetic, dyeing (SHU). World’s hottest chilli, Carolina reaper
pepper measures 2,200,000 SHU. Naga viper
and for medicinal purposes. It is an important
chilli is the hottest in India that measures
constituent of curry powders. Turmeric is used
1,349,000 SHU. Commonly used cayenne
as a colouring agent in pharmacy, confectionery
pepper measures 30,000 to 50,000 SHU.
and food industry. Rice coloured with turmeric
(yellow) is considered sacred and auspicious Condiment
which is used in ceremonies. It is also used for
Tamarind
dyeing leather, fibre, paper and toys.
Botanical name:
Curcumin extracted from turmeric is Tamarindus indica
responsible for the yellow colour. Curcumin is
Family : Fabaceae-
a very good anti-oxidant which may help fight
Caesalpinioideae
various kinds of cancer. It has anti-inflammatory,
anti-diabetic, anti-bacterial, anti-fungal and anti- Origin and Area of Figure 10.11 : Tamarind
viral activities. It stops platelets from clotting in cultivation: Tamarind
is native of tropical African region and was

introduced into India several thousand years from the two cultivated species (1) Corchorus
before. It is cultivated in India, Myanmar, south capsularis and (2) C.olitorius is of African
asian countries and several African and Central origin whereas C. capsularis, is believed to be
American countries. Tamarind has long been Indo-Burmese origin. It is an important
used in Africa and in Southern Asia. The name cultivated commercial crop in Gangetic plains
tamarindus is of Arabian origin, which means of India and Bangladesh.
“dates of India”. (tamar – dates; Indus – India). Uses
Uses It is one of the largest exported fibre material of
It is used in flavouring sauces in the United States India. The jute industry occupies an important
and Mexico. In India, the fruit pulp is major place in the national economy of India. Jute is
ingredients for many culinary preparations. used for ‘safe’ packaging in view of being natural,
Sweet tamarinds are sold as table fruits in India renewable, bio-degradable and eco-friendly
imported from Thailand and Malaysia. product. It is used in bagging and wrapping
textile. About 75% of the jute produced is used
10.3 Fibres for manufacturing sacks and bags. It is also used
Botanically a fiber is a long narrow and thick- in manufacture of blankets, rags, curtains etc. It
walled cell. is also being used as a textile fibre in recent years.
Cotton
Botanical name : Gossypium spp.
Family : Malvaceae
Cotton is the world’s most important non-
food commercial crop.
Origin and Area of cultivation: It is
Cotton plant Jute products
one of the oldest cultivated crops of the
world. It has been cultivated for about Figure 10.12: Fibres
8000 years both in new world and in old 10.4 Timber
world. Commercial cotton comes from four The basic need of shelter is obtained from the
cotton species: two from the new world and timber trees.
two from the old world. (1) G. hirsutum
Teak
(2) G.barbadense are the New world species
Botanical name : Tectona grandis
and (3) G. arboretum (4) G. herbaceum
are the old world species. In India cotton Family: Lamiaceae
is cultivated in Gujarat, Maharashtra, Origin and Area of
Andhra Pradesh and Tamil Nadu. cultivation: This is
Uses native to South east
Asia. It is observed
It is mainly used in the manufacturing of
wild in Assam. But
various textile, hosiery products, toys and is
cultivated in Bengal,
also used in hospitals. Teak wood carving
Assam, Kerala,
Jute Tamil Nadu and Figure 10.13: Timber
Botanical name : Corchorus spp. North-West India.
Family : Malvaceae Uses
Origin and Area of cultivation: Jute is derived It is one of best timbers of the world.

The heartwood is golden yellow to golden
brown when freshly sawn, turning darker Rubber – Vulcanization
when exposed to light. Known for its Charles Goodyear
durability as it is immune to the attack of invented vulcanization in
termites and fungi. 1839. He found that the
defects in rubber articles could be overcome
The wood does not split or crack and is
by heating rubber with sulphur under
a carpenter friendly wood. It was the chief pressure at 1500 C. The process was called
railway carriage and wagon wood in India. vulcanization. The name was given from the
Ship building and bridge-building depends on Roman God of Fire, Vulcan. Because of this,
teakwood. It is also used in making boats, toys, solid rubber tyres were used for first time in
plywood, door frames and doors. 1867. That is why we smoothly travel on road.
10.5 Latex
Rubber 10.6 Pulp Wood
The term paper is
Botanical name : Hevea brasiliensis
derived from the
Family : word ‘papyrus’
Euphorbiaceae a plant (Cyperus
Origin and Area papyrus) that was Figure 10.15 : Wood pulp
of cultivation: used by Egyptians
It is a native to make paper-like materials. Paper production
of Brazil and is a Chinese invention. The Chinese discovered
was introduced the paper that was prepared from the inner bark
Figure 10.14: Rubber Tree
outside its of paper mulberry in 105 A.D. For a long time,
native range during the colonial period and the art of paper making remained a monopoly
has become an important cash crop. Asia of the Chinese until Arabs learned the technique
contributed 90% of the world production. and improved it around 750 A.D. Invention of
Kerala is the largest producer in India followed printing increased the demand for paper.
by Tamil Nadu. Manufacture of Wood pulp: Wood
Uses is converted into pulp by mechanical,
Tyre and other automobile parts manufacturing and chemical processes. Wood of Melia
industries consume 70% of the rubber azadirachta, Neolamarkia chinensis, Casuarina
production. Rubber is used in manufacturing spp, Eucalyptus spp are used for making
footwear, wire and cable insulations, rain- paper pulp.
coats, household and hospital goods, shock
Purified dissolving pulp is
absorbers, belts, sports goods, erasers,
used as a basic material in
adhesives, and rubber-bands Hard rubber is
the manufacture of rayon
used in the electrical and radio engineering
or artificial silk, fabrics,
industries Concentrated latex is used for transparent films (cellophane, cellulose
making gloves, balloons and acetate films), plastics. The viscose process of
condoms. Foamed latex is making rayon is the most common process.
used in the manufacture of
cushions, pillows and life-
belts.

10.7 Dyes people have realized the hazards of chemical-
The ability to perceive colour is a wonderful based cosmetics and are turning back to
aspect of human eyes and dyes add colour to natural products. In this chapter one of the
the goods we use. They have been in use since major plants namely Aloe which is used in the
the ancient times. cosmetic industries is discussed.
The earliest authentic records of dyeing Aloe
were found in the tomb painting of ancient Botanical name : Aloe vera
Egypt. Colourings on mummy cements Family: Asphodelaceae (formerly Liliaceae)
(wrapping) included saffron and indigo. They
Origin and Area of cultivation: It is a native
can also be seen in rock paintings in India.
of Sudan. It is cultivated on a large scale in
Henna Rajasthan, Gujarat,
Botanical name : Lawsonia inermis Maharashtra, Andhra
Family : Lythraceae Pradesh and Tamil
Origin and Area of cultivation: It is indigenous Nadu.
to North Africa and South-west Asia. It is Uses Figure 10.17: Aloe vera
grown mostly throughout India, especially in ‘Aloin’ (a mixture
Gujarat, Madya Pradesh and Rajasthan. of glucosides) and its gel are used as skin
Uses tonic. It has a cooling effect and moisturizing
An orange dye ‘Henna’ is obtained from the characteristics and hence used in preparation
leaves and young shoots of Lawsonia inermis. The of creams, lotions, shampoos, shaving creams,
principal colouring matter of leaves ‘lacosone” after shave lotions and allied products. It
is harmless and causes no irritation to the skin. is used in gerontological applications for
This dye has long been used to dye skin, hair and rejuvenation of aging skin. Products prepared
finger nails. It is used for colouring leather, for from aloe leaves have multiple properties such
the tails of horses and in hair-dyes. as emollient, antibacterial, antioxidant,
antifungal and antiseptic. Aloe vera gel is used
in skin care cosmetics.
10.8.1 Perfumes
The word perfume is derived from the Latin
word Per (through) and fumus (to smoke),
meaning through smoke. It refers to the
Henna dye age-old tradition of burning scented woods
Figure 10.16: Naturals Dyes at religious ceremonies.In early days, when
people were less conscious of personal
10.8 Cosmetics hygiene, essential oils not only masked
Traditionally in Southern India, people have offensive odours, but also may have acted as
been using turmeric, green gram powder, antiseptics. Perfumes are added to baths and
henna, sigaikai and usilai for their skin and used for anointing the body.
hair care. These were mostly home prepared Perfumes are manufactured from essential
products that are used for grooming. Today, oil which are volatile and aromatic. Essential
cosmetics have a high commercial value oils are found at different parts of the plant
and have become chemical based industrial such as leaves, (curry leaf, mint), flowers (rose,
products. Providing personal care services jasmine), fruits (citrus, straw berry) and wood
has become a major industry. In recent years, (sandal, eucalyptus).

Jasmine blends well with other perfumes.
Madurai Malli It is much used in modern perfumery and
‘Madurai Malli’ is the pride cosmetics and has become popular in air
of Madurai has a distinct freshners, anti-perspirants, talcum powders,
reputation universally shampoos and deodorants.
because of its uniqueness and has been
given the Geographical Indications (GI) 10.9 Traditional Systems
mark by the Geographical indication of Medicines
Registry of India. Madurai malli has India has a rich medicinal heritage. A number
thick petals with long stalk equal to that of Traditional Systems of Medicine (TSM)
of petals and the distinct fragrance is
are practiced in India some of which come
due to the presence of chemicals such as
from outside India. TSM in India can be
jasmine and alpha terpineol. This makes
broadly classified into institutionalized
it easy to distinguish Madurai Malli from
other places. This is the second GI tag for or documented and non-institutionalized
Jasmine after ‘Mysore Malli’. or oral traditions. Institutionalized Indian
systems include Siddha and Ayurveda which
Jasmine are practiced for about two thousand years.
Botanical name : Jasminum grandiflorum These systems have prescribed texts in which
the symptoms, disease diagnosis, drugs to cure,
Family: Oleaceae
preparation of drugs, dosage and diet regimes,
Jasmine, as a daily and seasonal regimens. Non- institutional
floral perfume, systems, whereas, do not have such records
ranks next to and or practiced by rural and tribal peoples
the rose oil. across India. The knowledge is mostly held in
Major species oral form. The TSM focus on healthy lifestyle
cultivated on the and healthy diet for maintaining good health
commercial scale Figure 10.18: Jasmine and disease reversal.
is Jasminum
grandiflorum, a native of the north-western Siddha system of medicine
Himalayas. In Tamil Nadu, the major jasmine Siddha is the most popular, widely practiced
cultivation centres are Madurai and Thovalai and culturally accepted system in Tamil
of Kanyakumari District. The essential oil is Nadu. It is based on the texts written by 18
present in the epidermal cells of the inner and Siddhars. There are different opinions on the
outer surfaces of both the sepals and petals. constitution of 18 Siddhars. The Siddhars are
One ton of Jasmine blossom yields about 2.5 not only from Tamil Nadu, but have also come
to 3 kg of essential oil, comprising 0.25 to 3% from other countries. The entire knowledge is
of the weight of the fresh flower. documented in the form of poems in Tamil.
Uses Siddha is principally based on the Pancabūta
philosophy. According to this system three
Jasmine flowers have been used since ancient
humors namely Vātam, Pittam and Kapam
times in India for worship, ceremonial purposes,
that are responsible for the health of human
incense and fumigants, as well as for making
beings and any disturbance in the equilibrium
perfumed hair oils, cosmetics and soaps.
of these humors result in ill health. The drug
Jasmine oil is an essential oil that is valued for
sources of Siddha include plants, animal parts,
its soothing, relaxing, antidepressant qualities.
marine products and minerals. This system

specializes in using minerals for preparing demand for herbal products has led to
drugs with the long shelf-life. This system quantum jump in volume of plant materials
uses about 800 herbs as source of drugs. Great traded within and across the countries.
stress is laid on disease prevention, health Increasing demand exerts a heavy strain on
promotion, rejuvenation and cure. the existing resources. Now efforts are being
made to introduce cultivation techniques of
Ayurveda system of medicine
medicinal plants to the farmers.
Ayurveda supposed to have originated from
Brahma. The core knowledge is documented Medicinal plants play a significant role in
by Charaka, Sushruta and Vagbhata in providing primary health care services to rural
compendiums written by them. This system and tribal people. They serve as therapeutic
is also based on three humor principles agents as well as important raw materials for
namely, Vatha, Pitha and Kapha which would the manufacture of traditional and modern
exist in equilibrium for a healthy living. This medicines. Medicinally useful molecules
system Uses more of herbs and few animal obtained from plants that are marketed as drugs
parts as drug sources. Plant sources include are called Biomedicines. Medicinal plants which
a good proportion of Himalayan plants. The are marketed as powders or in other modified
Ayurvedic Pharmacopoeia of India lists forms are known as Botanical medicines.
about 500 plants used as source of drugs. Keezhanelli
Botanical name : Phyllanthus amarus
Folk system of medicine
Folk systems survive as an oral tradition among Family : Euphorbiaceae (Now in Phyllanthaceae)
innumerable rural and tribal communities Origin and Area of cultivation: The plant is
of India. A consolidated study to document a native of Tropical American region and is
the plants used by ethnic communities was naturalised in India and other tropical countries.
launched by the Ministry of Environment and It is not cultivated and is collected from moist
Forests, Government of India in the form of places in plains. Phyllanthus maderspatensis
All India Coordinated Research Project on is also commonly sold in the medicinal plant
Ethnobiology. As a result about 8000 plant markets collected from non-forest are as
species have been documented which are keezhanelli.
used for medicinal purposes. The efforts to Active principle: Phyllanthin is the major
document in several under-explored and chemical component.
unexplored pockets of India still continue. Medicinal importance
Major tribal communities in Tamil Nadu who
Phyllanthus is a well-known hepato-protective
are known for their medicinal knowledge
plant generally used in Tamil Nadu for the
include Irulas, Malayalis, Kurumbas,
treatment of Jaundice. Research carried out
Paliyans and Kaanis. Some of the important
by Dr. S P Thyagarajan and his team from
medicinal plants are discussed below.
University of Madras has scientifically proved
10.10 Medicinal Plants that the extract of P. amarus is effective against
India is a treasure house of medicinal plants. hepatitis B virus.
They are linked to local heritage as well as to Nilavembu
global-trade. All institutional systems in India
Botanical name : Andrographis paniculata
primarily use medicinal plants as drug sources.
Family : Acanthaceae
At present, 90% collection of medicinal plants
is from the non-cultivated sources. Growing Andrographis paniculata, known as the

such plants namely Poppy and Marijuana.
Opium poppy
Botanical name : Papaver somniferum
Family: Papaveraceae
Origin and Area of cultivation:
Phyllanthus amarus Andrographis paniculata Opium poppy is native to South Eastern
Figure 10.19: Medicinal Plants Europe and Western Asia. Madhya Pradesh,
King of Bitters is traditionally used in Indian Rajasthan and Uttar Pradesh are the licenced
systems of medicines. states to cultivate opium poppy.
Active principle: Andrographolides. Opium is derived from the exudates of

fruits of poppy plants. It was traditionally
Medicinal importance:
used to induce sleep and for relieving pain.
Andrographis is a potent hepatoprotective Opium yields Morphine, a strong analgesic
and is widely used to treat liver disorders. which is used in surgery. However, opium is
Concoction of Andrographis paniculata and an addiction forming drug.
eight other herbs (Nilavembu Kudineer) is
Cannabis / Marijuana
effectively used to treat malaria and dengue.
Botanical name : Cannabis sativa
Psychoactive Drugs Family: Cannabiaceae
In the above chapter you have learnt about
Origin and Area of Cultivation: Marijuana
plants that are used medicinally to treat
is native to China. States such as Gujarat,
various diseases. Phytochemicals / drugs
Himachal Pradesh, Uttarkand, Uttarpradesh
from some of the plants alter an individual’s
and Madhaya Pradesh have legally permitted
perceptions of mind by producing
to cultivate industrial hemp/Marijuana
hallucination are known as psychoactive
drugs. These drugs are used in all ancient The active principle in Marijuana
culture especially by Shamans and by is trans-tetrahydrocanabinal (THC). It
traditional healers. Here we focus on two possess a number of medicinal properties.
Table 1: Other commo Medicinal plants

S. Common Tamil Botanical Plant
Family Medicinal Uses
No Name Name Name part used
1 Holy basil துளசி Ocimum Lamiaceae Leaves and The leaves are stimulant, antiseptic, anti-
sanctum Roots hypertensive and anti-bacterial and expectorant
used in bronchitis. Decoction of roots is given
as a diaphoretic in malarial fevel.
2 Indian நெல்லி Phyllanthus Phyllanthaceae Fruit It is a potent rejuvenator and immune
gooseberry emblica modulator. It has a anti-ageing properties.
It helps to promote longevity, enhance
digestion, treat constipation and reduce fever
and cough.
3 Indian குப்பைமேனி Acalypha Euphorbiaceae Leaves Used to cure skin diseases caused by
Acalypha indica ringworms. Powdered leaves are used to cure
bedsores and infected wounds.
4 Vilvam வில்வம் Aegle Rutaceae Fruit The unripe fruit is used to treat problems of
marmelos stomach indigestion. It kills intestinal parasites.
5 Veldt grape பிரண்டை Cissus Vitaceae Stem and Paste obtained from the powdered stem and root
quadrangularis root of this plant is used in bone fractures. Whole plant
is useful to treat asthma and stomach troubles.

It is an effective pain reliever and reduces acquire ability to merge skills and knowledge
hypertension. THC is used in treating in a meaningful way. Converting botanical
Glaucoma a condition in which pressure knowledge into a business idea that can be
develops in the eyes. THC is also used in put into practice for earning a livelihood is the
reducing nausea of cancer patients undergoing much-needed training for the students.
radiation and chemotherapy. THC provides Few examples for activities of
relief to bronchial disorders, especially asthma entrepreneurship are Mushroom cultivation,
as it dilates bronchial vessels. Because of these Single cell protein (SCP) production, Seaweed
medicinal properties, cultivation of cannabis liquid fertilizer, Organic farming, Terrarium,
is legalized in some countries. However, Bonsai and Cultivation of medicinal and
prolonged use causes addiction and has an aromatic plants
effect on individual’s health and society. This part of the chapter is dealt about organic
Hence most of the countries have banned its farming in brief.
cultivation and use.
10.11.1 Organic farming
Narcotics Control Organic farming is an alternative agricultural
Bureau (NCB) system in which plants/crops are cultivated
Drugs come in various in natural ways by using biological inputs to
forms and can be taken maintain soil fertility and ecological balance
in numerous ways. Some are legal and thereby minimizing pollution and wastage.
others are not. Drug abuse and misuse Indians were organic farmers by default until
can cause numerous health problems and the green revolution came into practice.
in serious cases death can occur. Use of biofertilizers is one of the important
The Narcotics Control Bureau (NCB) components of integrated organic farm
is the nodal drug law enforcement and management, as they are cost effective
intelligence agency of India and renewable source of plant nutrients
and is responsible for fighting to supplement the chemical fertilizers for
drug trafficking and the abuse sustainable agriculture. Several microorganisms
of illegal substances. and their association with crop plants are being
exploited in the production of biofertilizers.
10.11 Entrepreneurial Botany Organic farming is thus considered as the
movement directed towards the philosophy of
Entrepreneurial Botany is the study of
Back to Nature.
how new businesses are created using plant
resources as well as the actual process of I. Organic Pesticide
starting a new business. An entrepreneur is Pest like aphids, spider and mites can cause
someone who has an idea and who works to serious damage to flowers, fruits, and vegetables.
create a product or service that people will These creatures attack the garden in swarms, and
buy, by building an organization to support the drain the life of the crop and often invite disease
sales. Entrepreneurship is now a popular topic in the process. Many chemical pesticides prove
for higher secondary students, with a focus on unsafe for human and the environment. It turns
developing ideas to create new ventures among fruits and vegetables unsafe for consumption.
the young people. Thankfully, there are many homemade, organic
Vast opportunities are there for the students of options to turn to war against pests.
Botany. In the present scenario students should

Preparation of Organic Pesticide
Mix 120g of hot Blend the Add the vegetable Pour the solution into a glass
chillies with 110 vegetables together paste to 500 ml of container and leave it undisturbed
g of garlic or manually or using warm water. Give the for 24 hours. If possible, keep the
onion. Chop them an electric grinder ingredients a stir to container in a sunny location. If
thoroughly. until it forms a thoroughly mix them not, at least keep the mixture in a
thick paste. together. warm place.
1 2 3 4
Strain the mixture. Pour the Pour the pesticide into a squirt Spray your plants with the
solution through a strainer, bottle. Make sure that the spray pesticide. Treat the infected
remove the vegetables and collect bottle has first been cleaned plants every 4 to 5 days with the
the vegetable-infused water and with warm water and soap solution. After 3 or 4 treatments,
pour into another container. This to get rid it of any potential the pest will be eliminated. If the
filtrate is the pesticide. Either contaminants. Use a funnel area is thoroughly covered with
to transfer the liquid into the
discard the vegetables or use it as the solution, this pesticide should
squirt bottle and replace the
a compost. keep bugs away for the rest of the
nozzle.
5 6 season. 7
Avoid spraying the plants during the sunny times of the day since it could burn plants. Many
other plants possess insect repellent or insecticidal properties. Combinations of these plants can
be fermented and used as biopesticide.
Figure 10.20: Preparation of organic pesticide
II. Bio-pest repellent • To make sure that the

Botanical pest repellent and insecticide made pest repellent sticks to
with the dried leaves of Azadirachta indica the plants, add 100 ml of
cooking oil and the same
Preparation of Bio-pest repellent amount of soap water.
• Pluck leaves from the neem tree and chop (The role of the soap water
the leaves finely. is to break down the oil,
• The chopped up leaves were put in a 50-liter and the role of the oil is to make it stick to
container and fill to half with water; put the the leaves).
lid on and leave it for 3 days to brew. • The stewed leaves from the mixture can be
• Using another container, strain the mixture used in the compost heap or around the base
which has brewed for 3 days to remove the of the plants.
leaves, through fine mesh sieve. The filtrate
can be sprayed on the plants to repel pests.

Summary Evaluation
Early civilization in different parts of the world 1.
Consider the following
has domesticated different species of plants statements and choose
for various purposes. Based on their utility, the right option.
the economically useful plants are classified i) Cereals are members of
into food plants, fibre plants, timber plants, grass family.
medicinal plants, and plants used in paper ii)
Most of the food grains come from
industries, dyes and cosmetics. monocotyledon.
However, food base of majority of the a) (i) is correct and (ii) is wrong
population depends on very few Cereals, b) Both (i) and (ii) are correct
Millets, Pulses, Vegetables, Fruits, Nuts, Sugars, c) (i) is wrong and (ii) is correct
Oil seeds, Beverages, Spices and Condiments. d) Both (i) and (ii) are wrong
Oils can be classified into two types
2. Assertion: Vegetables are important part of
namely, essential oils and vegetable oils. Fatty
healthy eating.
acids in oil may be saturated or unsaturated.
The oil yielding plants are groundnut and Reason: Vegetables are succulent structures
sesame. The oils are used in cooking, making of plants with pleasant aroma and flavours.
soaps and other purposes. Beverages contain a) Assertion is correct, Reason is wrong
alkaloids that stimulate central nervous b) Assertion is wrong, Reason is correct
system. Spices were used throughout the c) Both are correct and reason is the correct
world for several years. Cardamom is ‘Queen explanation for assertion.
of Spices’ used for flavouring confectionaries
d) Both are correct and reason is not the
and beverages. Black pepper is King of Spices.
correct explanation for assertion.
Botanically a fibre is a long, narrow, thick
walled cell. Cotton and Jute are fibre yielding 3. Groundnut is native of _____________
plants. Teak is wood used for making furniture. a) Philippines b) India
Rubber is produced from the latex of Hevea c) North America d) Brazil
brasiliensis. Paper production is a Chinese
invention. Dyes have been used since ancient 4. Statement A: Coffee contains caffeine
times. The orange dye henna is from the leaves of Statement B: Drinking coffee enhances cancer
Lawsonia. Perfumes are volatile and aromatic in a) A is correct, B is wrong
nature, manufactured from essential oils which
b) A and B – Both are correct
are found at different parts of the plant. Medicinal
plants serve as therapeutic agents. Medicinally c) A is wrong, B is correct
useful molecules obtained from these plants d) A and B – Both are wrong
are marketed as drugs are called Biomedicines. 5. Tectona grandis is coming under family
Whereas phytochemicals from some of the
a) Lamiaceae b) Fabaceae
plants which alter an individual’s perceptions of
c) Dipterocaipaceae e) Ebenaceae
mind by producing hallucination are known as
psychoactive drugs. 6. Tamarindus indica is indigenous to
Entrepreneurial Botany is the study of
a) Tropical African region
how new businesses are created using plant
resources as well as the actual process of b) South India, Sri Lanka
starting a new business.

c) South America, Greece 12.
The active principle trans-tetra hydro
d) India alone canabial is present in
a) Opium b) Curcuma
7. New world species of cotton
c) Marijuana d) Andrographis
a) Gossipium arboretum
b) G.herbaceum 13.
Which one of the following matches is
c) Both a and b correct?
d) G.barbadense a) Palmyra - Native of Brazil
b) Saccharun - Abundant in Kanyakumari
8. Assertion: Turmeric fights various kinds c) Steveocide - Natural sweetener
of cancer d) Palmyra sap - Fermented to give ethanol
Reason: Curcumin is an anti-oxidant
present in turmeric 14.
The only cereal that has originated and
a) Assertion is correct, Reason is wrong domesticated from the New world.
b) Assertion is wrong, Reason is correct a) Oryza sativa b)Triticum asetumn
c) Both are correct c) Triticum duram d) Zea mays
d) Both are wrong 15. Write the cosmetic uses of Aloe.
9. Find out the correctly matched pair. 16. What is pseudo cereal? Give an example.
a) Rubber Shorea robusta 17. D
iscuss which wood is better for making
b) Dye Lawsonia inermis furniture.
c) Timber Cyperus papyrus
18. A
person got irritation while applying
d) Pulp Hevea brasiliensis
chemical dye. What would be your
10. Observe the following statements and pick suggestion for alternative?
out the right option from the following:
19. N
ame the humors that are responsible for
Statement I – Perfumes are manufactured
the health of human beings.
from essential oils.
Statement II – Essential oils are formed at 20. Give definitions for organic farming?
different parts of the plants. 21. W
hich is called as the “King of Bitters”?
a) Statement I is correct Mention their medicinal importance.
b) Statement II is correct 22. D
ifferentiate bio-medicines and botanical
c) Both statements are correct medicines.
d) Both statements are wrong 23. W
rite the origin and area of cultivation of
11. Observe the following statements and pick green gram and red gram.
out the right option from the following: 24. W
hat are millets? What are its types? Give
Statement I: The drug sources of Siddha example for each type.
include plants, animal parts, ores and 25. I f a person drinks a cup of coffee daily it
minerals. will help him for his health. Is this correct?
Statement II: Minerals are used for If it is correct, list out the benefits.
preparing drugs with long shelf-life. 26. Enumerate the uses of turmeric.
a) Statement I is correct
27. W
hat is TSM? How does it classified and
b) Statement II is correct
what does it focuses on?
c) Both statements are correct
28. Write the uses of nuts you have studied.
d) Both statements are wrong
29. G
ive an account on the role of Jasminum
in perfuming.

30. G
ive an account of active principle and Fixative: A substance used to reduce the
medicinal values of any two plants you evaporation rate and improve stability when
have studied. added to more volatile components.
31. Write the economic importance of rice. Lubricant: Oily substance reduces friction.
32. W
hich TSM is widely practiced and
culturally accepted in Tamil Nadu? - Malnutrition: Deficiencies, excesses or
explain. imbalances in a person’s intake of energy and /
or nutrients
33. W
hat are psychoactive drugs? Add a note
Marijuana and Opium Odour: Smell (pleasant or unpleasant).
34. W
hat are the King and Queen of spices?
Perfumery: The art or process of making
Explain about them and their uses.
perfume
35. H
ow will you prepare an organic pesticide
for your home garden with the vegetables Pharmacopoeia: Is a book containing directions
available from your kitchen? for the identification of compound medicines,
and published by the authority of a government
Glossary or a medical or pharmaceutical society.
Alzheimer’s disease: A type of dementia that Seasoning: The processing of food with spices
causes problems with memory, thinking and and condiments to enhance the flavour.
behavior
Antiperspirant: Products whose primary

function is to inhibit perspiration / sweat
Anti-inflammatory: the property of a substance

or treatment that reduces swelling.
Antioxidant: A substance that scavenges free

radicals.
Carminative: A drug causing expulsion of gas

from the stomach or bowel.
Cirrhosis: A chronic liver disease typically

caused by alcoholism or hepatitis.
Confectionary: a place where confections/

sweets are kept or made
Cosmetics: substances or products used foe

personal grooming.
Diuretic: Substance that promote urine

production
Ethnobiology: Ethnobiology is the study of

relationships between peoples and plants.

ICT Corner
Economically Useful Plants

agriculture in detail through this
activity
Steps
• Select Package of Practices to know the various methods of agricultural crops breeding system.
• Click on Chat with expert helps the farmers to clarify their doubts.
• Click on Videos to know about the agricultural methods visually through videos.

URL: https://play.google.com/store/apps/details?id=com.criyagen
Let us know about the Agri

book in detail through this
activity.
Steps
• Click on Agriculture it will display the approaches to cultivate the planted paddy, cotton and
sugarcane.
• Click on Horticulture it will display the approaches to cultivate the agricultural crops
like tea, coffee.
• Click on Organic Farming it will explain the Traditional method of farming and
Traditional Fertilizers.
• Click on Forestry it will explain the gardening methods about plants.

URL: * Pictures are indicative only
https://play.google.com/store/apps/details?id=com.agribook.venkatmc.agri

Leland H. Hartwell, Leroy Hood, (2011),
9.
References Genetics, 4th Edition, New York: McGraw Hill
Companies.
UNIT VI – Reproduction in Plants
10. Linda E Graham, James M. Graham, Lee
1.
Gangulee,H.C., and Datta,C., 1972 College W. Wilcox (2006), Plant Biology, 2nd Edition,
Botany,-Volume 1 New Central Book Pearson Education, Inc.
Agency,Calcutta-9. 11. Monroe W. Strickberger, Genetics – London:
2.
Bhojwani,S.S and Bhatnagar, S.P. 1997. The Pearson Education, Inc.
Embryology of Angiosperms. VIKAS Publishing 12. Peter J. Russell (2003), Essential Genetics,
Housing Pvt Limited, New Delhi. Pearson Education, Benjamin Cummings, San
3.
R ao,K.N and Krishnamurthy, K.V. 1976 Francisco.
Angiosperms ,Publisher S.Viswanathan, 13. Randhawa S.S (2010), A Text Book of Genetics,
Chennai. 3rd Edition, S.Vikas and company.
4. Maheswari, P. 1950. An introduction to the 14. Rober J. Brooker (2015), Genetics, 4th Edition ,
embryology of angiosperms Tata Mcgraw Hill London: McGraw Hill.
Publishing Co Ltd. New Delhi.
5. Pat Willmer, 2011. Pollination and Floral UNIT VIII - Biotechnology
Ecology, Princeton University Press. USA
Alan
1. Seragg (2010). Environmental
6. Embryology of Flowering Plants Terminology Biotechnology. Second Edition. Oxford
and Concepts. 2009 Vol. 3:Reproductive Systems University Press, Oxford, New York.
(Edited by T.B.Batygina) Science Publishers
Bernard R. Glick; Jack J. Pasternak, Cheryl
2.
Enfield (NH) USA.
L. Patten (2010). Molecular Biotechnology:
Principles and Applications of Recombinant
UNIT VII – Genetics DNA. ASM Press, USA.
Anthony J.F. Griffiths, Susan R. Wessler,
1. Bhojwani, S. S. and Razdan, M. K. (2004).
3.
Richard C. Lewontin, Sean B. Carroll (2004) Plant Tissue Culture: Theory and Practice.
Introduction to Genetics Analysis 8th Edition, Elsevier Science.
USA: W.H. Freeman & Co. Ltd. Bhojwani, S. S. and Razdan, M. K. (1996).
4.
Benjamin A. Pierce (2010), Genetics: A
2. Plant Tissue Culture Theory and Practice. A
conceptual approach, 3rd Edition, New York Revised Edition, Elsevier, Amsterdam.
Carl P. Swanson, Timothy Merz, William J.
3. Bimal, C., Bhattacharyya and Rintu Banerjee
5.
Yound, Cytogenetics, (1965) Eastern Economy (2010). Environmental Biotechnology. Oxford
Edition. University Press, Oxford, New York.
Carl-Erik Tornqvist, William G Hopkins,
4. Brown, T. A. (2007). Gene Cloning and DNA
6.
(2006), Plant Genetics, New York: Chelsa House Analysis - An Introduction. 6th ed., Wiley-
publications. Blackwell, UK.
Clegg C J, (2014) Biology, London: Hooder
5. Chen, Z. and Evans, D. A. (1990). General
7.
Education techniques of tissue cultures in perennial crops.
In: Z. Chen et al. (ed.). Handbook of Plant Cell
Daniel L, Hartl, David Freifelder, Leon A.
6.
Culture. Vol. 6. Perennial Crop. McGraw-Hill
Snyder, Jones (2009), Basic Genetics, Bartlett
Publishing Company, New York.
publishers, USA
Dixon, R. A. and Gonzales, R. A. (2004). Plant
8.
James D.Watson, Tania A. Baker, Stephen
7.
Cell Culture. IRL Press.
P.Bell, Alexander Gann, Michael Levine,
Richard Losick, (2013) Molecular Biology of the Dubey, R. C. (2009). A Textbook of Biotechnology.
9.
Gene –London: Pearson Education S. Chand & Co. Ltd., New Delhi.
Krishnan.V, N. Senthil, Kalaiselvi Senthil
8. 10. Glick, B. R. and Pasternak, J. J. (2002).
(2015), Principles of Genetics, 2nd Edition. Molecular Biotechnology: Principles and
220

Applications of Recombinant DNA. Panima 11. Peter Stiling, (2012), Ecology Global Insighto
Publishers Co., USA. and Investigations, New Delhi:.Tata McGrawhill,
11. Gupta, P. K. (2010). Elements of Biotechnology. 12. Sharma P.D., (2018), 13th Edition, Ecology and
Rastogi & Co., Meerut. Environment, Meerut : Rastogi Publication.
12. Kalyankumar De (2007). An Introduction to 13. Shukla and Handel.C, (2016), Plant Ecology, S.
Plant Tissue Culture Techniques, New Central Chand & Company Ltd., New Delhi.
Book Agency, Kolkata. 14. Singh. H.R., (2009), Environmental Biology,
13. Morgan, Thomas Hunt (1901). Regeneration. New Delhi: S. Chand and Company Limited.
New York: Macmillan. 15. Sir Harry G. Champion, Seth S.K., (2005),
14. Ramawat, K. G. (2000). Plant Biotechnology. S. The forest types of India, Natraj Publication,
Chand & Co. Ltd., New Delhi. Dehradun.
15. Razdan, M. K. (2004). Introduction to Plant 16. Thomas M. Smith, Robert Leo Smith, (2015),
Tissue Culture. Second Edition. Oxford & IBH Elements of Ecology, England: Pearson Education
Publishing Co. Pvt. Ltd., New Delhi. Ltd.,
26. Smita Rastogi and Neelam Pathak (2010). 17. Verma. V, (2011), Plant Ecology, New Delhi:
Genetic Engineering. Oxford University Press, Anu Books Pvt. Ltd.,
New Delhi.
UNIT IX Plant Ecology UNIT X – Economic Botany
Chapman J.L. and Reiss M.J., (1995),

1. Gopalan C, Rama Sastri B.V, and
1.
Ecology – Principles and Applications, NewYork:
Balasubramanian S.C., (1989) Nutritive value
Cambridge University Press,
of Indian Foods – Revised and updated by
Dash M.C., (2011), 3rd Edition, Fundamental of
2. Narasinga RaoB.S., Deosthale Y.G.,. and Pant
Ecology, Tata McGrawhill, New Delhi.
K.C., Hyderabad; National Institute of Nutrition,
Eugene P. Odum, Ecology, 2nd Edition, New
3. ICMR.
Delhi:Oxford & IBH Publishing Co. Pvt. Ltd.,
Kochhar, S.L. (2016) Economic Botany in
2.
Kochar P.L., (1995), Plant Ecology, Agra: Ratch
4.
the Tropics, (Fifth Edition), Delhi:Cambridge
Prakashon Mandir,
University Press
Madhab Chandra Dash, Sathya Prakash,
5.
3. Simpson, B.B., Ogozaly, M.C., (2001)
(2011), Fundamentals of Ecology, New Delhi:
Tata McGrawhill,. Economic Botany (3rd Edition)Newyork:
McGraw- Hill.
6. Mannel C. Molles Jr., (2010), Ecology – Concepts
and Applications, New Delhi: Tata McGrawhill, Marriyaom H. Reshid, (2017), The Flavour of
4.
Michael Cain, William D. Bowman, Sally D.
7. Spices – Journeys, Recipes and Stores, Hochette
Hacker, (2008), Ecology, V Publisher: Sinauer India.
Associates, Inc Gerrald E. Wickens, (2001) Economic Botany
5.
Misra K.C., (1998), Manual of Plant Ecology,
8. Principles and Practices, Netherlands: Springer.
Oxford & IBH Publishing Co. Pvt. Ltd., New Rajkumar Joshi, (2013) Aromatic and Vital Oil
6.
Delhi. Plants. New Delhi:Agrotech Press,
Mohan P. Arora, (2016), Ecology, Mumbai:
9. Mukund Joshi, (2015), Text Book of Field Crops,
7.
Himalaya Publishers Delhi: PHI Learning Private Limited.
10. Peter J. Russel, Stephan L. Wolla, Paul
Rajesh Kumar Dubey, (2016) Green Growth,
8.
E. Hertz, Cacie Starr, Haventy McMillan,
Eco-Livelihood & Sustainability New Delhi:
(2008), Ecology, New Delhi: Cengage Learing
Ocean Books Private Limited.
India Pvt. Ltd.,
221

Frame shift
English – Tamil Terminology கட்ட நகர்வு சடுதி மாற்றம்
mutation
Unit VI – Reproduction in plants Gene interaction மரபணு இடைச்செயல்

Gene mapping மரபணு வரைபடம்
Apomixis கருவுறா இனப்பெருக்கம்
Genome மரபணுத்தொகையம்
Apospory கருவுறா வித்து
Archesporium முன்வித்து திசு Genotype மரபணுவகையம்
Cleistogamous மூடிய பூ Haploidy ஒருமடியம் (பன்மம்)

flower Heredity பாரம்பரியம்
Cryopreservation குளிர்பாதுகாப்பு
Heterozygous மாறுபட்டபண்பிணைவு
Embryo sac கருப்பை
Homologous ஒத்த அமைவிட
Floral primordium மலர் த�ோற்றுவி
chromosome குர�ோம�ோச�ோம்
Funiculus சூல் காம்பு
Incomplete முழுமைபெறா
Microsporogenesis நுண் வித்துருவாக்கம் dominance ஓங்குத்தன்மை
Polyembryony பல்கருநிலை
Incomplete linkage முழுமையற்ற பிணைப்பு
Scion ஒட்டுத் தண்டு
Independent
Stock வேர்கட்டை சாராஒதுங்கு விதி
assortment
Internal
Unit VII - Genetics அக மெத்திலாக்கம்
methylation
Inversion தலைகீழ் திருப்பம்
Allele அல்லீல்
Jumping genes தாவும் மரபணுக்கள்
Allopolyploidy அயல்பன்மடியம்
Linkage group பிணைப்புத் த�ொகுதி
Alternative splicing மாற்று இயைத்தல்
Locus நிலையிடம்
Autopolyploidy தன்பன்மடியம்
Map unit வரைபட அலகு
Backcross பிற்கலப்பு
தவறாக
Blending
கலப்பு பாரம்பரியம் Mis-sense mutation வெளிப்பாட்டடையும்
inheritance
சடுதிமாற்றம்
கிளைவழி
Branch migration Monohybrid ஒரு பண்புக்கலப்புயிரி
இடம்பெயர்தல்
Codominance இணைஓங்குத்தன்மை Multiple alleles பல்கூட்டு அல்லீல்கள்
Complete linkage முழுமையான பிணைப்பு Mutagen சடுதிமாற்றக் காரணி
Complementation Mutation சடுதிமாற்றம்

நிரப்பு ச�ோதனை
test வெளிப்பாடடையாத
Non-sense mutation
Coupling இணைப்பு சடுதி மாற்றம்
Crossing over குறுக்கேற்றம் Palindrome முன்பின்ஒத்தவரிசை
DNA metabolism DNA வளர்சிதை மாற்றம் Phenotype புறத்தோற்றவகையம்
Dominance ஓங்குத்தன்மை Purity of gametes இனச்செல்கலப்பற்றது
Duplication இரட்டிப்பாதல் Recessive ஒடுங்குத்தன்மை
F1 generation (first Repulsion விலகல்
முதல் மகவுச்சந்ததி
filial generation)
222

Restriction enzymes தடைக்கட்டு ந�ொதிகள் Dedifferentiation வேறுபாடு இழத்தல்
Saltation திடீர் மாற்றம் Differentiation வேறபாடுறுதல்
Segregation தனித்தொதுங்குதல் DNA Bank DNA வங்கி

Downstream கீழ்காற் பதப்படுத்தம்
Sequence த�ொடர்வரிசை
Process
Sex linkage பால் பிணைப்பு Embryogenesis கரு உருவாக்கம்
Silent mutation அமைதி சடுதிமாற்றம் Embryoids சிறுகருக்கள்
Split genes பிளவுறு மரபணு Explant பிரிகூறு
Synaptonemal இணைப்பிணைப்புக் Fermentation ந�ொதித்தல்
complex கூட்டமைப்பு Gel Electrophoresis இழும மின்னாற் பிரித்தல்
Synopsis இணைச் சேர்தல் Gene மரபணு
Tassel seed கதிர் குஞ்சவிதை Gene Bank மரபணு வங்கி
Test cross ச�ோதனைக்கலப்பு Gene Gun மரபணு துப்பாக்கி
நான்மய நிலை Gene Manipulation மரபணு கையாளும்

Tetrad stage
Technique த�ொழில்நுட்பம்
Three point test முப்புள்ளி ச�ோதனைக்
Genetically மரபணு மாற்றப்பட்ட
cross கலப்பு
modified plants தாவரங்கள்
Translocation இடம்பெயர்தல்
Genome மரபணு த�ொகையம்
Green Fluorescence பசுமை ஒளிர் புரதம்
UNIT VIII - Biotechnology Protein
Hardening வன்மையாக்குதல்
Artificial seeds செயற்கை விதைகள் Human Genome மனித மரபணு த�ொகைய
Aseptic condition நுண்ணுயிர் அற்ற நிலை Sequence த�ொடர் வரிசை
Autoradiography கதிரியக்க படமெடுப்பு Inoculation உள்நுழைத்தல்
Insert செருகி
Biochip உயிரி சில்லு invitro culture ஆய்வுகூட ச�ோதனை
Biomass உயிரி கூளம் வளர்ப்பு
Biopharming உயிரி மருந்தாக்கம் Isolation தனிமைபடுத்துதல்
Biopiracy உயிரிப�ொருள் க�ொள்ளை Laminar air flow சீரடுக்கு காற்று பாய்வு
Bioreactor / உயிரி வினைகலன் / chamber அறை
Fermentor ந�ொதிகலன் Liquid medium/ திரவ ஊடகம் / திரவ
Biosynthesis உயிரி உற்பத்தி liquid culture வளர்ப்பு
Buffer தாங்கல் கரைசல் Marker அடையாளக்குறி
Carriers கடத்தி Microinjection நுண்செலுத்துதல்
Cloned Plants நகல�ொத்த தாவரங்கள் Micropropagation நுண்பெருக்கம்
Cloning நகல்பெருக்கம் Mycoremediation பூஞ்சை சீரமைப்பாக்கம்
Cloning Site நகலாக்க களம் Nutritional medium ஊட்ட ஊடகம்
Cryoconservation உறைகுளிர் வெப்பநிலை Organogenesis உறுப்புகளாக்கம்

பேணல் Palindrome முன்பின் ஒத்த வரிசை
Cybrids கலப்பின பிளாஸ்மிட்கள் Sequence
Phytoremediation தாவர சீரமைப்பாக்கம்
223

Pollen Bank மகரந்த வங்கி Carbon foot print கார்பன் தடம்
Probe துருவி Carbon கார்பன் ஒதுக்கமடைதல்
Recombinant DNA மறுகூட்டிணைவு DNA sequestration
Recombinant மறுகூட்டிணைவு Carbon sink கார்பன் ேதக்கி
Redifferentiation மறுவேறுபாடுறுதல் Co-evolution கூட்டுப் பரிணாமம்
Regeneration மீள் உருவாக்கம்
Decomposers சிதைப்பவைகள்
Replica Blotting நகல் முலாம்
Technique த�ொழில்நுட்பம் Ecological சூழ்நிலைப்படிகள்
hierarchy
Restriction Enzyme தடை கட்டு ந�ொதி
Ecotone இடைச்சூழலமைப்பு
Somatic Embryoids உடல் கருவுருக்கள்
Sterile condition நுண்ணுயிர் நீக்கிய நிலை Ecotope சூழல் நில அமைவு
Sterilization நுண்ணுயிர் நீக்கம் Frugivores பழ உண்ணிகள்
Tissue culture திசு வளர்ப்பு Gnano கடல் அருகு வாழ்
Totipotency முழு ஆக்குத்திறன் பறவைகளின் எச்சம்
பெற்றவை Habitat புவி வாழிடம்
Transfection த�ொற்றுதல்
Humus மட்கு
Transposon இடமாற்றிக் கூறுகள்
Latitude விரிவகலம்
Upstream Process மேல்காற் பதப்படுத்தம்
Mimicry பாவனை செயல்கள்
Vector தாங்கி கடத்தி
Virus free plants வைரஸ் அற்றத் Niche செயல் வாழிடம்
தாவரங்கள் Ozone depletion ஓச�ோன் குறைதல்
Walking Genes நடக்கும் மரபணுக்கள் Photosyntheicaly ஒளிச்சேர்க்கை சார்
active radioactive செயலூக்கக் கதிர்வீச்சு
UNIT IX – Plant Ecology Plant Ecology தாவர சூழ்நிலையியல்
Predation க�ொன்றுண்ணும்
Agroforestry வாழ்க்கை முறை
வேளாண்காடுகள்
Alien Invasive Sacred groves க�ோயில் காடுகள்
அயல் ஊடுருவும்
species சிற்றினங்கள் Seedball விதைப்பந்து
Allelopathic வேதியத்தடைப் Social forestry சமூகக்காடுகள்
chemicals ப�ொருட்கள் Soil profile மண்ணின்
Altitude குத்துயரம் நெடுக்குவெட்டு விவரம்
Autecology சுய சூழ்நிலையில் Standing crops நிலைப்பயிர்
Benthic ஆழ்மிகு மண்டலம் Standing quality நிலைத்தரம்
Benthos ஆழ் உயிரிகள் Succession வழிமுறை வளர்ச்சி
Biochar உயிரித்தொகுப்பு Synecology கூட்டுச் சூழ்நிலையில்
Biome உயிர்மம் Topographic factors நிலப்பரப்பு
Biotope உயிரி நில அமைவு வடிவமைப்பு காரணிகள்
Trophic level ஊட்டஞ்சார் மட்டம்
224

UNIT X - Economic Botany Competitive
Examination Questions
புதிய தட்பவெப்ப
Acclimatization UNIT VI – Reproduction in plants
நிலைக்கு பழகுதல்
Archeological 1. Which of the following plant reproduces by
த�ொல்லியல் பதிவுகள்
records leaf (DPMT 2003)
உயிரிமூலக்கூறு a) Agave b) Bryophyllum
Bio medicine
மருந்து c) Gladiolus d) Potato
Biofertilizers உயிரி உரம் 2. Advantage of cleistogamy (NEET 2013)
Culinary சமையல் a) Higher genetic variability
b) More vigorous offspring
Decoction வடிநீர்
c) No dependence on pollinators
வளர்ப்புச் சூழலுக்கு d) Vivipary
Domestification
உட்படுத்துதல்
3. An example for edible underground stem is
Emasculation மகரந்தத்தாள் நீக்கம் (NEET 2014)
Entrepreneur தொழில் முனைவோர் a) Carrot b) Groundnut
c) Sweet potato d) Potato
Essential oil நறுமண எண்ணெய்
4. Pollen tablets are available in the market for
Gluten பசையம்
(NEET 2014)
Green manuring தழை உரம் a) invitro fertilization
b) Breeding programmes
Kelp பழுப்பு பாசி
c) supplementing food
Organic agriculture இயற்கை வேளாண்மை d) ex situ conservation
Plant pathology தாவர ந�ோயியல் 5. Geitonogamy involves (NEET 2014)
Pseudo cereal ப�ொய் தானியம் a) F ertilization of a flower by pollen from
another flower of a same plant
Pungent நெடி (அல்லது) காரம்
b) Fertilization of a flower by pollen of the
Resin பிசின் same flower
Sapwood மென்கட்டை c) Fertilization of a flower by pollen from
a flower of another plant in a same
நிறைவுற்ற க�ொழுப்பு population
Saturated fatty acids
அமிலம்
d) Fertilization of a flower by the pollen
Stimulant தூண்டி from a flower of another plant belongs to
distant population.
Tillering புல் கிளைத்தல்
6. Which one of the following generates new
Unsaturated fatty நிறைவுறா க�ொழுப்பு
அமிலம்
genetic combinations leading to variations?
acids
(NEET 2016)
Vigour வீரியம் a) vegetative reproduction
எளிதில் ஆவியாகும் b) parthenogenesis
Volatile oil
எண்ணெய் c) Sexual reproduction
d) Nucellar polyembryony
225

7.
Functional megaspore in angiosperm 13)
Function of filiform apparatus is to
develops into an (NEET 2017) (AIPMT 2014)
a) endosperm b) Embryo sac a) recognize the suitable pollen at stigma
c) embryo d) ovule b) stimulate division of generative cell
c) produce nectar
8.
Which of the statement is not true.
d) guide the entry of pollen tube
(NEET 2016)
a) Pollen grain of many species cause severe 14)
The coconut water from tender coconut
allergies represents (NEET 2016)
b) Stored pollen in liquid nitrogen can be a) endocarp
used in crop breeding programmes b) fleshy mesocarp
c) T
apetum helps in the dehiscence of c) free nuclear proembryo
anther d) free nuclear endosperm
d) Exine of pollen grains is made up of
15) Pollination in water hyacinth and water lily
sporopollenin
is brought about by the agency of
9)
When a diploid female plant is crossed (NEET 2016)
with a tetraploid male, the ploidy of a) insects or wind b) birds
endosperm cells in the resulting seed is c) bats d) water
(AIPMT 2004)
a) pentaploidy b) diploidy 16) Perisperm differs from endosperm in
c) triploidy d) tetraploidy (NEET 2013)
a) being haploid tissue
10)
Which one of the following pairs of b) having no reserve food
plant structures has haploid number of c) being a diploid tissue
chromosomes? (AIPMT 2008) d)
its formation by fusion of secondary
a) Egg nucleus and secondary nucleus nucleus with several sperms
b) Megaspore mother cell and antipodal cells
c) Egg cell and and antipodal cells 17) Male gametes in angiosperms are formed
d) Nucellus and antipodal cells by the division of (AIPMT 2007)
a) microspore mother cell b) microspore
11)
The arrangement of nuclei in a normal c) generative cell d) vegetative cell
embryo sac in the dicot plant is
(AIPMT 2006) 18) In a type of apomixes known as adventive
a) 2 + 4 + 2 b) 3 + 2 + 3 polyembryony,embryo develop directly
c) 2 + 3 + 3 d) 3 + 3 + 2 from the (AIPMT 2005)
a) synergids or antipodals in an embryo sac
12)
Wind pollinated flowers are b) nucellus or integuments
(AIPMT PRE 2010) c) zygote
a) Small, producing nectar and dry pollen d) accessory embryo sac in the ovule
b) small, brightly colored, producing large
number of pollen grains 19) In a cereal grain the single cotyledon of the
c) s mall, producing large number of embryo is represented by (AIPMT 2006)
pollen grains a) coleorhizae b) scutellum
d)
large, producing abundant nectar and c) prophyll d) coleoptiles
pollen
226

20) An ovule which becomes curved so that the 5. A Pleiotropic gene
nucellus and embryo sac lie at right angles (AIPMT 2015 – Re-exam)
to the funicle is (AIPMT 2004) a) Controls multiple traits in an individual
a) camylotropous b) anatropous b) Is expressed only in primitive plants
c) orthotropous d) hemianatropous c) Is a gene evolved during Pliocene
d) Controls a trait only in combination with
21) Endosperm is formed during the double
another L gene
fertilization by (AIPMT 2000)
a) t wo polar nuclei and one male gamete 6. A true breeding plant is
b) one polar nuclei and one male gamete (NEET Phase II 2016)
c) ovum and male gametes a) Near homozygous and produces
d) two polar nuclei and two male gametes offspring of its own kind
UNIT VII – Genetics b) Always homozygous recessive in its
genetic construction
1.
Genes for cytoplasmic male sterility c) One that is able to breed on its own
in plants are generally located in d) Produced due to cross pollination among
(AIPMT 2005) unrelated plants
a) M itrochondrial genome b) Cytosol
7. Mendel obtained wrinkled seeds in pea due
c) Chloroplast genome d) Nuclear genome
to the deposition of sugars instead of starch.
2. In which mode of inheritance do you expect It was due to which enzyme?
more maternal influence among the off (AIPMT 2001)
spring (AIPMT 2006) a) Amylase b) Invertase c) Diastase
a) Autosomal b) Cytoplasmic d) Absence of starch branching enzyme
c) Y-linked d) X-linked
8. Ratio of complementary gene is
3.
Which one of the following cannot be
explained on the basis of Mendel’s Law of (AIPMT 2001)
Dominance? (AIPMT 2010) a) 9:3:4 b) 12:3:1 c) 9:3:3:4 d) 9:7
a) Factors occur in pairs
9. If there are 999 bases in an RNA that codes
b) The discrete unit controlling a particular
for a protein with 333 amino acid and the
character is called a factor
base at position 901 is deleted such that the
c) Out of one pair of factors one is dominant
length of the RNA becomes 998 bases, how
and the other is recessive
many codons will be altered?
d) Alleles does not show any blending and
(NEET 2017)
both the characters recover as such in
F2 generation a) 1 b) 11 c) 33 d) 333
4. F2 generation in a Mendelian cross shows 10.

If a homozygous red flowered plant is
that both genotypic and phenotypic ratios crossed with a homozygous white flowered
are same as 1:2:1. It represents a case of plant, then the off-springs will be
(AIPMT 2012) (AIIMS 1999, 2002, 2007)
a) Monohybrid crosses with incomplete a) Half-white flowered b) Half-red flowered
dominance c) All white flowered d) All red flowered
b) Co-dominance c) Dihybrid cross
11. The ratio in a dihyrbid test cross between
d) Monohybrid cross with complete
two individuals is given by (AIIMS 2001)
dominance
227

a) 2:1 b) 1:2:1 c) 3:1 d) 1:1:1:1 17. The year 1900 AD is highly significant for
geneticists due to (JIPMER 2013)
12. Pure line breed refers to
a) Discovery of genes
(AIIMS 2002, AIIMS 2007) b) Principle of linkage
a) Heterozygosity only c) Chromosomal theory of heredity
b) Heterozygosity and linkage d) Rediscovery of Mendelism
c) Homozygosity only
d) Homozygosity and self assortment 18. The phenotypic ratio of trihybrid cross in F2
generation is (JIPMER 2016)
13. How many different types of gametes can a) 27:9:9:9:3:3:3:1 b) 9:3:3:1
be formed by F1 progeny, resulting from the c) 1:4:6:4:1 d) 27:9:3:3:9:1:2:1
following cross AABBCC x aabbcc
19.
In a mutational event when adenine is
(AIIMS 2004)
replaced by guanine, it is the case of
a) 3 b) 8 c) 27 d) 64 (AIPMT 2004)
14.
Which of the following conditions a) Frameshift mutatin b) Transcription
represents a case of co-dominant genes? c) Transition d) Transversion
(AIIMS 2009) 20. Mutations can be induced with
a) A gene expresses itself, suppressing the (AIPMT 2011)
phenotypic effect of its alleles a) Gamma radiations b) Infrared radiations
b) Genes that are similar in phenotypic c) IAA d) Ethylene
effect when present separately, but when 21. The mechanism that causes a gene to move
together interact to produce a different from one linkage group to another is called
trait
(AIPMT 2015, NEET (Phase – II) 2016)
c) Alleles both of which interact to produce
a) Translocation b) Crossing over
a trait which may or may not resemble
c) Inversion d) Duplication
either of the parental type
d) Alleles, each of which produces an 22.
A point mutation comprising the
independent effect in a heterozygous substitution of a purine by pyrimidine is
condition. called (AIIMS 2002)
a) Transition b) Translocation
15. If ‘A’ represents the dominant gene and ‘a’
c) Deletion d) Transversion
represents its recessive allele, which of the
following would be most likely result in 23. Frameshift mutation occurs when
the first generation off spring when Aa is (AIPMT 2008)
crossed with aa? (AIIMS 2016) a) Base is substituted
a) All will exhibit dominant phenotype b) base is deleted or added
b) All will exhibit recessive phenotype c) Anticodons are absent
c) D ominant and recessive phenotypes d) None of these
will be 50% each 24.
The distance between two genes in a
d) Dominant phenotype will be 75% chromosome is measured in cross-over
16. In Pisum Sativum, there are 14 chromosomes. units which represent (AIIMS 2008)
How many types of homologous pairs can a) Ratio of crossing over between them
be prepared? (JIPMER 2010) b) Percentage of crossing over between them
a) 14 b) 7 c) 214 d) 210 c) Number of crossing over between them
d) None of these
228

25.
When a cluster of genes show linkage 31. Which of the following statement is not true
behaviour they (AIPMT 2003) of two genes that show 50% recombination
a) do not show a chromosome map frequency? (NEET 2013)
b) show recombination during meiosis a) The genes may be on different
c) do not show independent assortment chromosomes
d) induce cell division b) The genes are tightly linked
c) The genes show independent assortment
26. Genetic map is one that (AIPMT 2003)
d) If the genes are present on the same
a) E stablish sites of the genes on a
chromosome, they undergo more than
chromosome
one crossover in every meiosis.
b) Establishes the various stages in gene
evolution 32. Haploids are more suitable for mutation
c) Shows the stages during the cell division studies than the diploids. This is because
d) Shows the distribution of various species (AIPMT 2008)
in a region a) A
ll mutations, whether dominant or
27. After a mutation at a genetic locus of the recessive are expressed in haploids
character of an organism changes due to the b) Haploids are reproductively more stable
change in (AIPMT 2004) than diploids
a) DNA replication c)
Mutagens penetrate in haploids more
b) Protein synthesis pattern effectively than diploids
c) RNA transcription pattern d) Haploids are more abundant in nature
d) Protein structure than diploids
28. In a hexaploidy wheat, the haploid (n) and 33.
Crossing over that results in genetic
basic (x) numbers of chromosomes are recombination in higher organisms occurs
(AIPMT 2007) between (AIPMT 2004)
a) n =21 and x =7 b) n =7 and x =21 a) Non-sister chromatids of a bivalent
c) n =21 and x =21 d) n =21 and x =14 b) Two daughter nuclei
c) Two different bivalents
29. Point mutation involves (AIPMT 2009)
d) Sister chromatids of bivalents
a) Deletion b) Insertion
c) Change in single base pair
d) duplication UNIT VIII – Biotechnology
30.
Which one of the following is a wrong
statement regarding mutations? 1. What is the criterion for DNA fragments
movement on agarose gel during gel
(AIPMT 2012)
electrophoresis? (NEET 2017)
a) UV and Gamma rays are mutagens
a) Th e smaller the fragment size, the
b) C hange in a single base pair of DNA
farther it moves.
does not cause mutation
b) Positively charged fragments move to
c) Deletion and insertion of base pairs cause
farther end.
frame shift mutations.
c) Negatively charged fragments do not
d) Cancer cells commonly show
move.
chromosomal aberrations.
d) The larger the fragment size, the farther
it moves.
229

2. Stirred-tank bioreactors have been designed 8. During the process of isolation of DNA,
for (NEET – II 2016) chilled ethanol is added to
a) Purification of product. (Karnataka NEET 2013)
b) Addition of preservatives to the product a) Precipitate DNA
c) Availability of oxygen throughout the b) Break open the cell to release DNA
process c) Facilitate action of restriction enzymes
d) Ensuring anaerobic conditions in the d) Remove proteins such as histones.
culture vessel.
9. For transformation, micro-particles coated
3. Which of the following is not a component with DNA to be bombarded with gene gun
of downstream processing? (NEET-II 2016) are made up of (AIPMT 2012)
a) Separation b) Purification a) Silver or platinum b) Platinum or zinc
c) Preservation d) Expression c) Silicon or platinum d) Gold or tungsten.
4. Which of the following is not a feature of 10. Biolistics (gene-gun) is suitable for
the plasmids? (NEET-I 2016) (AIPMT Mains 2012)
a) Transferable b) Single-stranded a) disarming pathogen vectors
c) Independent replication b) transformation of plant cells
d) Circular structure c) constructing recombinant DNA by
joining with vectors
5. Which of the following is not required for
d) DNA fingerprinting.
nay of the techniques of DNA fingerprinting
available at present? (NEET-I 2016) 11. Genetic engineering is possible because
a) Restriction enzymes (CBSE 1998)
b) DNA-DNA hybridization a) phenomenon of transduction in bacteria
c) Polymerase chain reaction understood
d) Zinc finger analysis b) we can see DNA by electron microscope
c) we can cut DNA at specific sites by
6.
Which vector can clone only a small
endonuclease like DNAase I
fragment of DNA? (AIPMT 2014)
d) restriction endonuclease purified from
a) Bacterial artificial chromosome
bacteria can be used invitro
b) Yeast artificial chromosome
c) Plasmid d) Cosmid 12. Genetic Engineering is (BHU 2003)
a) Making artificial genes
7.
The colonies of recombinant bacteria
b) H ybridisation of DNA of one organism
appear white in contrast to blue colonies
to that of the others
of non-recombinant bacteria because of
c) Production of alcohol by using
(NEET 2013)
microorganisms
a) Insertional inactivation of alpha
d) Making artificial limbs, diagnostic
galactosidase in recombinant bacteria.
instruments such as ECG, EFG, etc.
b) Inactivation of glycosidase enzyme in
recombinant bacteria. 13. Ligase is used for (AMU 2006)
c) Non-recombinant bacteria containing a) Joining of two DNA fragments
beta galactosidase. b) Separating DNA
d) Insertional inactivation of alpha c) DNA polymerase reaction
galactosidase in non-recombinant bacteria. d) All of these
230

14. In genetic engineering, gene of interest is a>b and d>c, was subjected to agarose
transferred to the host cell through a vector. gel electrophoresis. The position of these
Consider the following four agents (1-4) fragmets from cathode to anode sides of the
in this regard and select the correct option gel would be (DPMT 2010)
about which one or more of these can be a) b,a,c,d b) a,b,c,d
used as vectors c) c,b,a,d d) b,a,d,c
1. A bacterium 2. Plasmid 19. An analysis of chromosomal DNA using
3. Plasmodium 4. Bacteriophage the southern hybridisation technique does
(AIPMT Main 2010) not use (AIPMT 2014)
a) 1 and 4 only b) 2 and 4 only a) Electrophoresis
c) 1 only d) 1 and 3 only
b) Blotting
15. Given below is a sample of a portion of c) Autoradiography
DNA strand giving the base sequence on d) PCR
the opposite strands. What is so special
20.
The colonies of recombinant bacteria
shown in it? (AIPMT 2014)
appear white in contrast to blue colonies of
5’---GAATTC---3’ 3’---CTTAAG---5’
non- recombinant bacteria because of
a) Palindromic sequence of base pairs (NEET 2013)
b) Replication completed a) Non-recombinant bacteria containing
c) Deletion mutation beta galactosidase
d) Start codon at the 5’end b) Insertional inactivation of a-galactosidase
16. There is a restriction endonuclease called in non-recombinant bacteria
EcoRI. What does “co” part in it stand for ? c) I nsertional inactivation of
(AIPMT 2011) b-galactosidase in recombinant
a) Coelom b) Colon bacteria
c) Coli d) Coenzyme d) Inactivation of glycosidase enzyme in
recombinant bacteria
17.
The figure below is the diagrammatic
representation of the vector pBR322. Which 21. Which one of the following palindromic
one of the given options correctly identifies base sequence in DNA can be easily cut
its certain components? (AIPMT 2012) at about the middle by some particular
restriction enzyme? (AIPMT 2010)
(FR5, +LQG,,,
a) 5’CGTTCG3’ 3’ATCGTA 5’
%DP+,
DPS5 WHW5
b) 5’ GATATG 3’ 3’ CTACTA 5’
DPS5 $PSLFLOOLQ5HVLVWDQFH*HQH
S%5
WHW5
c) 5’ GAATTC 3’ 3’ CTTAAG 5’
7HWUDF\FOLQH5HVLVWDQFH*HQH
RUL URS d) 5’ CACGTA 3’ 3’ CTCAGT 5’
3YX,, 22.
Silencing of mRNA has been used in
producing transgenic plants resistant to
a) Ori-original restriction enzyme (AIPMT, 2011)
b) rop-reduced osmotic pressure a) Boll worms b) Nematodes
c) Hind III, EcoRI – selectable markers c) White rusts d) Bacterial blights
d) ampR, tetR – antibiotic resistance genes 23. Some of the characteristics of Bt cotton are
18.
A mixture containing DNA fragments (AIPMT,2010)
a,b,c,d with molecular weights of a+b=c, a) Long fibre and resistant to aphids
231

b) Medium yield, long fibre and resistant to a) Theodore Schwann
beetle pests b) A.V. Leeuwenhoek
c)
High yield and production of toxic c) F.C. Steward
protein crystals which kill dipteran pests d) Robert Hooke
d) High yield and resistant to boll worms 30.
Tissue culture technique can produce
24. An improved variety of transgenic basmati infinite number of new plants from a small
rice (AIPMT,2010) parental tissue. The economic importance
a) Does not require chemical fertilisers and of the technique is raising. (Karnataka
growth hormones NEET 2013)
b) G ives high yield and is rich in a) g enetically uniform population
vitamin A identical to the original parent.
c) Is completely resistant to all insect pests b) homozygous diploid plants
and diseases of paddy c) new species
d) Gives high yield but no characteristic d) variants through picking up somaclonal
aroma variations
25) Consumption of which one of the following 31.
Which of the following statements is
foods prevent the kind of blindness not true about somatic embryogenesis?
associated with vitamin A deficiency? (Karnataka NEET 2013).
(AIPMT 2012) a. The pattern of development of a somatic
a) Flavr Savr b) Canola embryo is comparable to that of a zygotic
c) Golden rice d) Bt brinjal embryo.
26. A protoplast is a cell (NEET 2016) b) S omatic embryos can develop from
a) undergoing division microspores.
c) Somatic embryo is induced usually by an
b)without cell wall
auxin such as 2, 4-D.
c) without plasma membrane
d) A somatic embryo develops from a
d) without nucleus.
somatic cell.
27. A technique of micropropagation is (NEET
32. Which one of the following is a case of
2015)
wrong matching? (AIPMT 2012)
a) Protoplast fusion
a) Somatic - Fusion of
b) embryo rescue
two diverse hybridization cells
c) somatic hybridization
b) Vector DNA - Site for tRNA
d) somatic embryogenesis
synthesis
28. To obtain virus-free healthy plants from a c) Micropropagation - in vitro
diseased one by tissue culture technique, production of plants in large numbers
which part/parts of the diseased plant will d) Callus - U n o r g a n i s e d
be taken? (AIPMT 2014) mass of cells produced in tissue culture.
a) Apical meristem only
33. Polyethylene glycol method is used for
b) Palisade parenchyma
(AIPMT 2010)
c) Both apical and axillary meristems
a) biodiesel production
d) Epidermis only.
b) seedless fruit production
29. Cellular totipotency was demonstrated by
c) energy production from sewage
(AIPMT 1991)
d) gene transfer without a vector.
232

34. Somaclones are obtained by (AIPMT 2009) a) Aerenchyma - Opuntia
a) Plant breeding b) Age pyramid - Biome
b) Irradiation c) P
arthenium - Threat to
c) genetic engineering hysterophorus biodiversity
d) tissue culture. d) Stratification - Population
35. The technique of obtaining large number of
5. An association of individuals of different
plantlets by tissue culture method is called
a) Plantlet culture ( AIPMT 2005) species living in the same habitat and
b) Organ culture having functional interactions is
c) Micropropagation (Re-AIPMT 2015)
d) Macropropagation a) Population b) Ecological niche
36. Coconut milk is used in tissue culture in c) Biotic community d) Ecosystem
which present ( AIPMT 2000) 6. Roots play in significant role in absorption
a) cytokinin b) auxin
of water in (Re-AIPMT 2015)
c) gibberellins d) ethylene. a) Wheat b) Sunflower
37.
Haploid plants can be obtained by c) Pistia d) Pea
culturing. ( AIPMT 1994)
7. If we uncover half of the forest covering the
a) pollen grains b) root tips
earth, what crisis will be produced at most
c) young leaves d) endosperm.
and the first? (AIPMT 1996)
UNIT IX - Plant Ecology a. Some species will be extinct
b. Population and ecological imbalance will
1.
Plants which produce characteristic rise up
pneumatophores and show vivipary belong c. Energy crisis will occur
to (NEET 2017) d. Rest half forests will maintain this
a) Halophytes b) psammophytes imbalance.
c) hydrophytes d) mesophytes
8. Most animals are tree dwellers in a
2. Mycorrhizae are the example of (AIPMT 2015)
(NEET I 2017) a) Tropical rain forest
a) amensalism b) antibiosis b)Coniferous forest
c) mutualism d) fungistatis c) Thorn woodland
3. If ‘+’ sign is assigned to beneficial interaction, d) Temperate deciduous fo
‘-’ sign to detrimental and ‘0’ sign to neutral Cuscuta is an example of
9.
interaction, then the population interaction (AIPMT Mains 2012)
represented by ‘+’ ‘-’ refers to (NEET 2016) a) Ectoparasitism b) Brood parasitism
a) mutualism b) amensalism c) Predation d) Endoparasitism
c) commensalism d) parasitism
10.
Large woody vines are more commonly
4.
Which of the following is correctly found in (AIPMT Prelims 2011)
matched? (NEET Phase 2 – 2016) a) Alphine forests b) Temperate forests
c) Mangroves d) Tropical rain forests
233

11. Niche overlap indicates 16. Secondary succession takes place on / in
(AIPMT Prelims 2006) (NEET 2015 cancelled)
a) Active co-operation between two species a) newly created pond b) newly cooled lava
c) bare rock d) degraded forest
b) Two different parasites on the same host
c) S haring of one or more resources 17. In an ecosystem the rate of production of
between the two species organic matter during photosynthesis is
termed as (NEET 2015 cancelled)
d) Mutualism between two species
a) Secondary productivity
12.
Which one of the following pairs is b) net productivity
mismatched? (AIPMT Prelims 2005) c) Net primary productivity
a) Savanna – Acacia trees d) gross primary productivity
b) Prairie – Epiphytes 18. Natural reservoir of phosphorous is
c) Tundra – Permafrost (NEET 2013)
d) Coniferous forest – Evergreen trees a) rock b) fossils
c) sea water d) animal bones
13.
Which ecosystem has the maximum
biomass? (NEET 2017) 19. Secondary productivity is rate of formation
of new organic matter by (NEET 2013)
a) Grassland ecosystem
a) consumers b) decomposers
b) Pond ecosystem
c) producers d) parasites
c) Lake ecosystem
d) Forest ecosystem 20. Which one of the following processes during
decomposition is correctly described?
14. Which of the following would appear as the
(NEET 2013)
pioneer organisms on bare rocks?
a) Catabolism – Last step in the decomposition
(NEET 2016) under fully anaerobic condition
a) Mosses b) Green algae b) Leaching – Water soluble inorganic nutrient
c) Lichens d) Liverworts rise to the top layers of soil
15. In which of the following both pairs have c) Fragmentation – Carried out by organisms
correct combination? (NEET 2015) such as earthworms.
Gaseous nutrient Nitrogen and d) Humification – Leads to the accumulative
cycle Sulphur of a dark coloured substance humus which
a)
Sedimentary Carbon and undergoes microbial action in a very fast
nutrient cycle Phosphorous rate.
Gaseous nutrient Sulphur and
cycle Phosphorous 21.
Which one of the following is not a
b)
Sedimentary Carbon and functional unit of an ecosystem?
nutrient cycle Nitrogen (AIPMT 2012)
Gaseous Carbon and
a) Energy flow b) decomposition
nutrient cycle Nitrogen
c) c) Productivity d) stratification
Sedimentary Sulphur and
nutrient cycle Phosphorous 22. The upright pyramid of number is absent in
Gaseous nutrient Carbon and
(AIPMT 2012)
cycle Sulphur
d) a) Pond b) forest
Sedimentary Nitrogen and
nutrient cycle Phosphorous c) lake d) grassland
234

23. The rate of formation of new organic matter 29.Match the following and select the correct
by rabbit in a grassland is called option (AIPMT 2014)
(Mains 2012) Column I Column II
a) net productivity (I) Earthworm (i) pioneer species
b) secondary productivity (II) Succession (ii) Detritivore
c) net primary productivity (III) Ecosystem service (iii) Natality
d) gross primary productivity (IV) Population growth (iv) Pollination
24. The second stage of hydrosere is occupied I II III IV
by plants like (Mains 2012) a) i ii iii iv
a) Azolla b) Typha b) iv i iii ii
c) Salix d) Vallisneria c) iii ii iv i
d) ii i iv iii
25. Which one of the following is a characteristic
feature of cropland ecosystem? 30.
Given below is a simplified model of
(NEET 2016) phosphorous cycling in a terrestrial
a) Ecological succession ecosystem with four blanks (A – D. Identify
b) Absence of soil organisms the blanks. (AIPMT 2014)
c) Least genetic diversity
Consumers C
d) Absence of weeds
26.
Most animals that live in deep oceanic
waters are (Re-AIPMT 2015) D
A
a) Detritivores
b) Primary consumers
c) Secondary consumers Uptake
Soil Solution
d) Tertiary consumers Run off
27. During ecological succession
(Re-AIPMT 2015) B
a) The changes lead to a community that is
in near equilibrium with the environment
A B C D
and is called pioneer community.
Rock
b) Th e gradual and predictable change in a) Detritus Litter fall Producers
minerals
species composition occurs in a given Rock
area. b) Litter fall Producers Detritus
minerals
c) The establishment of a new biotic community Rock
c) Detritus Producers Litter fall
is very fast in its primary phase. minerals
d) The number and types of animals remain Rock
d) Producers Litter fall Detritus
constant. minerals
28. The mass of living material at a trophic level 31. If 20 J of energy is trapped at producer level,
at a particular time is called (AIPMT 2015) then how much energy will be available to
a) Standing crop peacock as food in the following chain?
b) Gross primary productivity (AIPMT 2014)
c) Standing state Plant → Mice → Snake → Peacock
d) Net primary productivity a) 0.02 J b) 0.002 J
c) 0.2 J d) 0.0002 J
235

32.
Given below is an imaginary pyramid 36. Of the total incident solar radiation the
of numbers. What could be one of the proportion of PAR is (AIPMT Prelims 2011)
possibilities about certain organisms at a) More than 80% b) About 70%
some of the different levels ? c) About 60% d) Less than 50%
(AIPMT Prelims 2012)
37.
The breakdown of detritus into smaller
TC 10 particles by earthworm is a process called
SC 50 (AIPMT Mains 2011)
a) Mineralisation b) Catabolism
PC 500 c) Humification d) Fragmentation
PP 1 38.
The biomass available for consumption
by the herbivores and the decomposers is
a) Level one PP is ‘pipal trees’ and the level
called (AIPMT Prelims 2010)
SC is ‘sheep’.
a) Gross primary productivity
b) Level PC is ‘rats’ and level SC is ‘cats’
c) Level PC is ‘insects’ and level SC is b) Net primary productivity
‘small insectivorous birds’ c) Secondary productivity
d) Level PP is ‘phytoplanktons’ in sea and d) Standing crop
‘whale’ on top level TC 39. The correct sequence of plants in a hydrosere
33. Which one of the following statements for is (AIPMT Prelims 2009)
pyramid of energy is incorrect, whereas the a) Volvox → Hydrilla → Pistia → Scirpus
remaining three are correct? (AIPMT → Lantana → Oak
Prelims 2011) b) Pistia→Volvox→Scirpus→Hydrilla→Oak
a) It is upright in shape
→ Lantana
b) Its base is broad
c) Oak→Lantana→Volvox→Hydrilla→Pistia
c) It shows energy content of different
→Scirpus
trophic level organisms
d) Oak→Lantana→Scirpus→Pistia→Hydrilla
d) It is inverted in shape
→Volvox
34. Which one of the following animals may
40. About 70% of the total global carbon is
occupy more than one trophic levels in the
found in (AIPMT Prelims 2008)
same ecosystem at the same time?
(AIPMT Mains 2011) a) Forests b) Grasslands
a) Goat b) Frog c) Agro ecosystems d) Oceans
c) Sparrow d) Lion 41.
Consider the following statements
35. Both hydrarch and xerarch successions lead concerning food chains
to (AIPMT Mains 2011) i)
Removal of 80% tigers from an area
a) Highly dry conditions resulted in greatly increased growth of
b) Excessive wet conditions vegetation.
c) Medium water conditions ii)
Removal of most of the carnivores
d) Xeric conditions resulted in an increased population of
deers.
iii) The length of food chains is generally
limited to 3 – 4 trophic levels due to
236

energy loss. 47. The ozone of atmosphere in which the ozone
iv) The length of food chains may vary from layer is present is called
2 to 8 trophic levels. (AIPMT 2014)
Which two of the above statements are a. ionosphere b. mesosphere
correct? (AIPMT Prelims 2008) c. stratosphere d. troposphere
a) i and ii b) ii and iii 48.
Which one of the following is a wrong
c) iii and iv d) i and iv statement? (AIPMT 2012)
a. Most of the forests have been lost in
42. Which one of the following is not used for
tropical areas.
construction of ecological pyramids?
b. Ozone in upper part of atmosphere is
(AIPMT Prelims 2006) harmful to animals.
a) Dry weight c. Greenhouse effect is a natural
2) Number of individuals phenomenon.
c) Rate of energy flow d.Eutrophication is a natural phenomenon
4) Fresh weight in freshwater bodies.
43. The UN Conference of Parties on climate 49. Good ozone is found in the (Mains 2011)
change in the year 2012 was held at (NEET a. mesosphere b.troposphere
2015) c. stratosphere d. ionosphere
a. Lima b. Warsaw 50.
Chipko movement was launched for the
c. Durban d. Doha. protection of (AIPMT 2009)
44. Which of the following are most suitable a. forests b. livestock
indicators of SO2 pollution in the c.wetlands d.grasslands
environment? ( NEET 2015) 51. Identify the correctly matched pair.
a. Algae b. Fungi (AIPMT 2005)
c. Lichens d. Conifers a. Basal convention -Biodiversity
45. Which of the following is not one of the conservation
prime health risks associated with greater b.Kyoto protocol -Climatic change
UV radiations through the atmosphere due c. Montreal protocol -Global warming
to depletion of stratospheric ozone? (NEET d. Ramsar convention -Ground water
2015) pollution
a. Damage to eyes
52.
Common indicator organism of water
b. Increased liver cancer
pollution is (AIPMT 2004)
c. Increased skin cancer d.
a. Lemna pancicostata
d. Reduced Immune system
b. Eichhornia crassipes
46. A location with luxuriant growth of lichens c. Escherichia coli
on the trees indicates that the d. Entamoeba histolytica
(AIPMT 2014)
53. Which country has the greatest contribution
a. t rees are very healthy for the hole formation in ozone layer?
b. trees are heavily infested (AIPMT 1996)
c. location is highly polluted a. Russia b. Japan
d. location is not polluted. c. USA d Germany
237

UNIT X - Economic Botany diverse alleles for all genes in a given crop is
called (NEET 2013)
1. The name of Dr. Norman Borlaug is a) cross hybridization among the selected
associated with (JIPMER 2007) parents
a) Green revolution b) evaluation is selection of parents
b) Yellow revolution c) germplasm collection
c) White revolution d) selection of superior recombinants
d) Blue revolution 16. An example for semi dwarf variety of wheat
2. Which of the following is generally used for is (HPPMT 2012)
induced mutageneis in crop plants a) IR 8 b) Sonalika
(JIPMER 2007) c) Triticum d) Saccharum
a) Alpha b) X-ray 17.

Himgiri developed by hybridization is
c) UV ray d) Gamma ray selection for disease resistance against rust
3. A man-made allopolyploid cereal crop is pathogen is a variety of (AIPMT 2011)
(OJEE 2010) a) Chilli b) Maize
a) Hordeum vulgare b) Triticale c) Sugarcane d) Wheat
c) Raphanus brassica d) Zee mays 18.
Breeding of crops with high levels of
4.
Objective of plant breeding is minerals, vitamins and proteins is called
(MP PMT 2001) (CBSE AIPMT 2010)
a) better yield a) somatic hybridization
b) better quality b) biofortification
c) disease / stress resistance c) bio magnification
d) All of the above d) micro propagation
5. Selection is a method of (MP Pmet 2001) 19.
The reason for vegetatively reproducing
a) cytology b) plant phycology crop plants to suit for maintaining hybrid
c) plant breeding d) genetics vigour is that (AIPMT 1998)
6. Green revolution in India occurred during a) they are more resistant to disease
( AIPMT 2012) b) o nce a desired hybrid produced, no
a) 1960’s b) 1970’s chances of losing it
c) 1980’s d) 1950’s c) they can be easily propagated
d) they have a longer life span.
7.
Jaya and ratna developed for green
revolution in India are the varieties of 20.
Wonder wheat is a new wheat variety
(AIPMT 2011) developed by (AIIMS 2009)
a) maize b) rice a) M exico’s International Wheat and
c) sugarcane d) wheat. Maize improvement centre
b) Indian National Botanical Research
9. First man-made cereal triticale is Institute
(HPMT 2008) c) Australian crop Improvement centre
a) Octaploid b) hexaploid d) African Crop Improvement centre
c) Both a & b d) diploid
11. In plant breeding programmes, the entire
collection (of plants / seeds) having all the
238

HIGHER SECONDARY - SECOND YEAR
BIOLOGY: BOTANY PRACTICALS
INTRODUCTION
Laboratory is a place where ideas and concepts can be tested through experiments. Laboratory
investigations in biology increase the reasoning abilities, brings scientific attitude in a learner and also
helps in acquisition of skills of scientific processes. Hence, a biology student too, is obliged to attend
practical in laboratory with utmost sincerity, honesty and inquisitiveness. The practical work includes
 Study of permanent slides  Section, cutting and mounting

 Microscopic preparation of slides  Analysing the problem and solving it
 Study of preserved and fresh specimens  Physiological experiments, etc.
GENERAL INSTRUCTIONS
In order to perform experiments successfully, a learner needs to go to the Biology Laboratory well
prepared. This includes the following.
1. Laboratory record book
2. Dissection box
3. Laboratory manual
4. A laboratory coat or apron
5. A hand towel
6. Drawing pencil (HB) and pencil eraser to record various experiments and to draw diagrams
7. Any item more as per the instructions of the teacher
While in the laboratory, a student should be very careful and methodical. One should listen carefully
to the instructions given by the teacher / instructor before performing an experiment. Maintain a
complete silence and working atmosphere in the laboratory. Record keeping is most important in
practical. Diagrams should be correctly drawn and well labelled. Always get the signature of the
teacher in the practical note book on each day after the practical class.
However, it is important that every student of Botany / Biology may pay proper attention to the
practical work and should try to acquire basic laboratory skills and develop a keen sense of observation
and acquire a sound training in the reporting of the work done.
If the material suggested for a particular experiment is not available, a suitable alternate material
may be used.
239
TN_GOVT_XII_BIOLOGY_BOTANY_PRACTICAL_MANUAL_PAGES_239-258.indd 239 03-03-2019 14:55:23

BIOLOGY BOTANY PRACTICALS
MODEL QUESTION
Identify the given slide ‘A’ and give any two reasons. Draw a neat labelled
I.
diagram.
Identify the given specimen / model / photograph ‘B” and give any two
II.
reasons.
Analyse the given ecological / genetic problem ‘C’. Solve it by giving
III.
appropriate reasons.
Write the aim, procedure, observation and inference of the given
IV.
experiment ‘D’.
Identify the economically important plant product ‘E’. Mention its Botanical
V.
name, useful part and their uses.
MARKS ALLOTMENT-PRACTICAL EXAMINATION

Identification – ½ , Reason (any two) – ½ , Diagram – ½ ,
I. A 2
Labelling – ½
II. B Identification – ½ , Reason (any two) – ½ 1
Identification – ½ , Solve/ Construct– ½,
III. C 1½
Reason/ Observation and Inference/ Answer – ½
IV. D Aim – ½ , Procedure – ½ , Table (Observation and Inference) – ½ 1½
V. E Identification and Botanical name – ½ , Useful part – ½, use – ½. 1½
Total 7 ½ marks
Record 1 ½ marks
Skill 1 marks
Maximum marks 10 marks
240

QUESTION No- I (A) - Preparation and Demonstration of Slides
Note: Teacher has to prepare a temporary slide using fresh specimen for demonstration. (During
examination permanent slides can be used if temporary slide preparation is not possible).
Exercise 1 T.S. of Mature anther
Exercise 2 L.S. of an Angiospermic ovule
Exercise 3 T.S. of Nerium leaf
QUESTION No- II (B) - Fresh or preserved specimens and Models / Photographs / Charts
Exercise 4 Adaptations of flowers for pollination by different agents – Wind, Insects.
Exercise 5 Structure of Dicotyledonous seed – Gram (Cicer).
Exercise 6 Picture of a vector (pBR 322)
Exercise 7 Plant tissue culture – Callus with plantlets
Exercise 8 Types of ecological pyramids – Number, Biomass, Energy
QUESTION No- III (C) - Problems – Genetics and Ecology
Exercise 9 To verify Mendel’s Monohybrid cross
Exercise 10 Analysis of seed sample to study Mendelian Dihybrid Ratio
Exercise 11 Flow of energy and Ten percent law
Determination of population density and percentage frequency of different plant species of

Exercise 12
given area by Quadrat method
Exercise 13 Chromosomal aberration – Deletion, Duplication, Inversion
Exercise 14 Genetic / Linkage maps
QUESTION No- IV (D) - Experiments
Exercise 15 Study of pollen germination on a slide
Exercise 16 Study of pH of different types of soils
Exercise 17 Isolation of DNA from plant material
QUESTION No- V (E) -Economic importance of plants
Economically important plant products and their uses:Sesame / Gingelly oil, Rubber, Aval
Exercise 18
(Flaked rice), Rose water, Henna powder,Aloe gel
241

BIOLOGY BOTANY PRACTICALS
I - Preparation and Demonstration of Slides

Note: Teacher has to prepare a temporary slide using fresh specimen for demonstration.
(During examination permanent slides can be used if temporary slide preparation is not
possible)
Exercise 1: T.S of Anther
Aim: To study and identify the given slide – T.S of Anther

Principle: Androecium is made up of stamens. Each stamen possesses an anther and a filament.
Anther bears pollen grains which represent the male gametophyte.
Requirements: Anther of Datura metel, glycerine, safranin, slide, cover slip, blade, brush,
needle to prepare temporary slides, permanent slide of T.S. of mature anther and compound
microscope.
Collect buds and opened flowers of Datura metel. Dissect the stamens, separate the
anthers and take thin sections and observe the structure under the microscope.
Record the various stages of anther from your observation.
Diagnostic Features
Connective
• A mature anther is bilobed (dithecous) and the two
Epidermis
lobes are joined by a connective.
Endothecium
• Each anther lobe has two pollen chambers in which Middle layer
pollen grains are produced. Pollen grain
• A microsporangium or pollen sac is surrounded by Stomium
four wall layers. They are epidermis , endothecium,

middle layers and tapetum.
• Centre of the microsporangium (pollen sac) is filled
with haploid pollen grains. Figure 1: Pollen grain stage of anther
Exercise 2: L.S of an Angiospermic ovule.
Aim: To study and identify the L.S. of an Angiospermic Ovule.
Principle: In female reproductive part of a flower, the basal swollen part is ovary. The ovules are
present inside the ovary, later they develops to seed.
Requirement: Permanent slide of L.S. of Ovule, microscope
242

Diagnostic Features
Chalazal end
• Ovule or megasporangium is protected by
one / two coverings called integuments.
Integument
• The stalk of the ovule is called funicle.
• The point of attachment of funicle to the
body of the ovule is known as hilum.
Nucellus
• The body of the ovule is made up of a
central mass of parenchymatous tissue
called nucellus.
Embryo sac
• The integuments form a pore called Hilum
micropyle and the region opposite to the
micropyle is called as chalaza.
Micropyle
• The nucellus has a large, oval, sac like
structure towards the micropylar end Funicle
called embryo sac.
• A mature ovule, has 8 nuclei in its embryo Vascular supply
sac. Figure 2: L.S of ovule
Exercise 3: T.S. of Nerium Leaf

Aim: To observe and understand the xerophytic adaptations found in Nerium leaves for living
in dry or xeric habitat.
Principle: The plants which are living in dry or xeric condition are known as Xerophytes.
Requirements: Nerium leaf, few pieces of carrot / pith / styrofoam, blade, brush, needle,
compound microscope, glycerine, coverslip, wash glass, microslide, saffranin solution, petri
dish, etc.
Start cutting transverse sections of

Thick cuticle
Nerium leaf placing it in between a piece Multi-layered epidermis
of carrot. Select the thinnest section of
the material with the help of a delicate brush. Palisade parenchyma
Take a clean watch glass with water, transfer
thin sections of the material. Put a few drops Spongy parenchyma
Stomata
of safranin stain in the watch glass with water. Guard cells
Leave it for 3-5 minutes. Drain off stain and wash Pit (Cavity)
with water if necessary. Put the thinnest section Trichomes (Hairs)
in the centre of the slide. Put a drop of glycerine
Lower epidermis
over the material. Cover it with a coverslip with
Cuticle
the help of needle. Observe it under a compound
microscope. Figure 3: T.S. of Nerium leaf
243

Diagnostic Features
• Presence of multilayered epidermis with thick cuticle.
• Sunken stomata are present only in the lower epidermis.
• Mesophyll is well differentiated into palisade and spongy parenchyma.
• Mechanical tissues are well developed.
II - Fresh or preserved specimens and Models / Photographs / Charts
Exercise 4: Adaptations of flowers for pollination by different agents.
Aim: To study the adaptations in flowers for pollination by different agents (wind and insects)
Principle: The process of transfer of pollen grains from the anther to stigma of a flower is called
pollination.
Requirements: Fresh flowers of maize or any other cereal / gram, any insect pollination flowers
like Salvia, Calotropis, Ocimum and Asteraceae flowers.
Place the given flower on a slide and observe it with the help of hand lens. Note down the
adaptations of the flowers meant for pollination by the external agents.
5 A. Wind Pollinated Flowers - Anemophily Male inflorescence (Tassel)
Diagnostic Features Female inflorescence(Cob)
• The flowers are small, inconspicuous, colourless, odourless

and nectarless. Silk
• Anthers and stigmas are commonly exerted.

• Pollen grains are light, small, powdery and produced in
large numbers.
• The stigmas are large, sometimes feathery and branched
adapted to catch the pollens. Figure 4a: Maize
5 B. Insect Pollinated Flowers - Entemophily
Diagnostic Features
• The flowers are showy,
brightly coloured and scented.
Disc
• The flowers produce nectar or edible Retinaculum
Pollinium
pollen.
• Anthers and stigmas are commonly
inserted.
• Stigmas are usually unbranched and flat or lobed. Figure 4b: Calotropis
244

Exercise 5: Dicot seed
Aim: To study and identify the Dicot seed

Principle: The fertilized ovule is called seed and possesses an embryo, endosperm and a
protective coat. Seeds may be endospermous or non endospermous.
Requirements: Chick pea, bowl, water
Soak the seeds of chick pea or gram in water for 2 – 3 hours. Drain the water and place the
seeds in a moist cotton cloth for 2 – 3 days. Observe for germination. Select some sprouted
seeds, observe under a dissection microscope and record the parts.
Diagnostic Features Testa

Radicle
• Seeds of gram have two cotyledons and an embryonal

axis. Testa
• Each seed is covered by two seed coats (a) Testa –
Seed entire
outer coat and (b) Tegmen – inner coat.
Cotyledon
• The embryonal axis consists of radicle and plumule. Plumule
• The portion of the embryonal axis above the level of

cotyledons is called epicotyl. It terminates into the Testa
plumule. Radicle
• The portion of the embryonal axis below the level of Seed cut opened
cotyledons is called hypocotyl. It terminates into the a) Dicot seed (Cicer arientinum)
Figure 5: Dicot seed – Gram (Cicer)
radicle or root tip.
Exercise 6: E.coli cloning vector (pBR 322) Fruit (Caryopsis) entire
Aim: To study and identify the features of cloning vector – pBR 322
Principle: Vectors are used as carriers to deliver the desired foreign DNA into a host cell.
Endosperm
Requirements: Models/ Photographs / Pictures of E.coli Cloning vector pBR 322.
Scutellum
Coleoptile
Diagnostic Features (FR5, +LQG,,,
Shoot apex
• pBR 322 plasmid is a reconstructed plasmid containing 4361 base Radicle %DP+,
pairs and most widely used as cloning vector. DPSRoot
5 cap
WHW5
Coleorhiza
L.s. of fruit
• In pBR, p denotes plasmid and B and R respectively the notes S%5
of scientists Boliver and Rodriguez who developed the plasmid.b) Monocot seed (Oryza sativa)
RUL URS
The number 322 is the number of plasmids developed from theirFigure 2.25 Structure of seed
laboratory. 3YX,,
• It contains two different antibiotic resistance genes and recognition Figure 6: E-coli cloning
site for several restriction enzymes (Hind III, Eco R I, Bam H I, Sal vector (pBR 322)
I, Pvu II, Pst I, Cla I), Ori and antibiotic resistance genes (ampR and
tetR). Rop codes for the proteins involved in the replication of the plasmid.
245

Exercise 7: Plant tissue culture – Callus with plantlets
Aim: To study and identify the Callus with plantlets.

Principle: Growing the plant cells, tissues and organs in an artificial, synthetic medium
under controlled conditions is called plant tissue culture. The technique of cloning plant
is easier than animals because plant cells are simple in structure and most plant cells
shows totipotency (i.e) ability to regenerate from cells.
Requirements: Model / Photograph / Picture of callus with plantlets.
Diagnostic Features
• The callus is an unorganized mass of undifferentiated

tissue.
• The mechanism of callus formation is that auxin
induce cell elongation and cytokinin induces cell
Callus culture
division as a result of which masses of cells are Further culturing
formed. regenerated new plantlet
• Roots and shoots are differentiated from the callus. Figure 7: Callus with plantlets
Exercise 8: Types of ecological pyramid
Aim: To study and identify the different types of ecological pyramids

Principle: The relationship between different trophic levels in an ecosystem when
shown diagrammatically appear as ‘ecological pyramids’. In these ecological pyramids,
the successive tiers represent successive trophic levels towards the apex. The base of the
pyramid is of producers, the next one above it is of herbivores and the top tiers are of
carnivores. The top most or apex represents the tertiary or top level consumers.
Requirements: Models / Photographs / Pictures of different types of ecological pyramid.
8 A. Pyramid of numbers
Diagnostic Features T4
• The number of organism that are present in successive T 3

trophic levels of an ecosystem is shown in the pyramid of
numbers of a grassland ecosystem. T 2
• There is a gradual decrease in the number of organisms in T 1
each trophic level from producers to primary consumers,

then to secondary consumer, and finally to tertiary Figure 8 a: Pyramid of numbers in
consumers. grassland ecosystem
• Therefore, pyramid of number in grassland ecosystem is always upright.
246

8 B. Pyramid of biomass T3
Diagnostic Features T2
• Pyramid of biomass represents the total biomass or standing crop

(dry weight) of organisms in each trophic level at a particular time.
• In aquatic ecosystem, the bottom of the pyramid is occupied by T1
the producers, which comprises very small organisms (algae and

phytoplanktons) possessing the least biomass and so the value Figure 8 b: Pyramid
gradually increases towards the tip of the pyramid. of biomass in aquatic
• Therefore, here the pyramid of biomass is always inverted in shape. ecosystem
T1 - Producers | T2 - Herbivores | T3 - Secondary consumers |
8 C. Pyramid of energy
Diagnostic Features Tertiary
consumers
0.1 Joule
• Pyramid of energy represents the number of joules 1 Joule
transferred from one trophic level to next. Secondary consumers
10 Joules
• The bottom of the pyramid of energy is occupied by the
producers. There is a gradual decrease in energy transfer Sunlight Primary consumers
1000 Joules
at successive trophic levels from producers to the upper 100 Joules
Producers
levels.
Figure 8 c: Pyramid of Energy
• Therefore pyramid of energy is always upright.
III - Solving the Problems

Exercise 9: To verify Mendel’s Monohybrid cross
NOTE: Student have to work in pairs to perform this experiment and record the data in the
observation and record note book with the help of the teacher.
Need not consider this Monohybrid cross experiment for Board Practical Examination.
Aim:
To verify Mendel’s Monohybrid cross.
Principle:
When two purelines with contrasting traits of a particular character (phenotype) are crossed to produce
the next generation (F1 generation), all the members of the progeny are of only one phenotype, i.e.
of one of the two parents. The phenotype that appears is called dominant and the one that does not
appear is called recessive. When the F1 plants are selfed, the progeny i.e. the F2 generation, is in the
ratio of 3 dominant : 1 recessive (¾ : ¼ of 75% : 25%). This reappearance of the recessive phenotype in
F2 generation, verifies Mendel’s Monohybrid cross.
Requirements:
64 yellow and 64 green plastic beads, all of exactly same shape and size (when beads are not available,
pea seeds may be painted and used). Plastic beakers, petri dish and a napkin / hand towel.
247

Procedure
Make the student to work in pairs to perform the Parents Pure Yellow x Pure Green
YY yy
experiment. Follow the steps in given sequence.
1. Put 64 yellow beads in one beaker and 64 green Gametes Y Y y y
beads in the other to represent male and female
gametes respectively. Let the yellow bead be F1 generation Yy Hybrid Yellow seeds
indicated by ‘Y’ and the green bead by ‘y’

Selfing of F1 plants Yy x Yy
2. Take a bead from each container and place them
together (it represents fertilization) on the hand Gametes Y y Y y
towel spread before you on the table.
3.
Just like the previous step, continue to pick F2 generation YY Yy yY yy
beads and arrange them in pairs. Thus 64
Pure Hybrid Pure
pairs of beads are obtained representing the 64 Yellow 25% Yellow 50% Green 25%
heterozygous F1 progeny.
4. Put 32 F1 progeny in one petridish and the Figure 9 : Monohybrid cross
remaining 32 in another petridish (representing the F1 males and females).
5. To obtain the F2 generation, the student should withdraw one bead from one beaker labelled male
and one from the other beaker labelled female keeping his / her eyes closed (to ensure randomness)
and put them together on the hand towel spread over the table. Continue this process till all the
beads are paired. Thus 64 offsprings of F2 progeny are obtained.
6. Note the genotype (YY or Yy or yy) of each pair and their possible phenotype.
7. Pool all the data and calculate the genotypic and phenotypic ratios.
Observation:
Record the result in the following table:
Total Number of Genotypes
Generation Phenotype(s)
individuals YY Yy yy
F1
Total
F2
Total
Phenotypic ratio : in F1
in F2
Genotypic ratio : in F1
in F2
Inference:
The results are so because when the F1 individuals are crossed together to raise the F2 generation, each
F1 individual produces two types of gametes: 50% having dominant allele and the remaining 50%
having recessive allele. These gametes undergo random fusion during fertilization to produce the F2
generation. According to simple probability of mixing of opposite sex gametes, offsprings of three
genotypes are likely to appear as follows:
Among these, proportion of dominant phenotype would be YY + Yy = yellow and recessive phenotype
yy = green, which occur in 3 : 1 or 75% : 25% ratio.
248

This ratio of 3 :1 in the F2 suggests that the hybrids or heterozygotes of F1 generation have two
contrasting factors or alleles of dominant and recessive type. These factors, though remain together
for a long time, do not contaminate or mix with each other. They separate or segregate at the time of
gamete formation so that a gamete carries only one factor, either dominat or recessive.
Precautions:
1. Take a sufficiently large number of seeds for analysis to minimise the error.
2. Observe the contrasting form of trait carefully.
Exercise 10: Analysis of seed sample to study Mendelian dihybrid ratio
Aim: P Generation Parent 1 Parent 2
To analyse seed sample of pea for Mendelian dihybrid Round yellow cotyledon X Wrinkled green cotyledon
ratio of 9 : 3 : 3 : 1.
RR YY rr yy
Principle:
F1 generation R r Yy
In a dihyrbid cross, the segregation of one gene pair
All round-yellow cotyledons
is independent of the segregation of the other pair.
It means that when the factors (genes) for different F1 Generation Round yellow cotyledon X Round yellow cotyledon
(selfed) R r Yy R r Yy
characters inherited from parents do not remain
linked in the offsprings, but their distribution in the RY Ry rY ry
gametes and in the progeny of subsequent generations R Y RR YY RR Yy Rr YY Rr Yy
is independent of each other. F2 Generation R y RR Yy RR yy Rr Yy Rr yy
rY Rr YY Rr Yy rr YY rr Yy
Requirement: r y Rr Yy Rr yy rr Yy rr yy
Plastic beakers, Pea seed samples or plastic beads, tray, Phenotypic Ratio 9:3:3:1
petri dishes, notebook, pencil / pen. Figure 10 : Dihybrid cross
Teachers should select the Pea seed or plastic beads which represents the four types of traits such
as yellow round, yellow wrinkled, green round and green wrinkled in the ratio of 9:3:3:1
Procedure:
1. Take a lot of about 160 Pea seeds or plastic beads in a tray.
2. Separate out yellow round, yellow wrinkled, green round and green wrinkled and put them in
separate petridishes.
3. Note down the number of seeds in each plate and find out their approximate ratio.
Observation:
Present your finding in the form of a table.
Total Number of No. of yellow No. of yellow No. of green No. of green Approximate
seeds observed round seeds wrinkled seeds round seeds wrinkled seeds ratio
160 90 30 30 10 9 : 3:3:1
Inference:
The ratio of yellow round : yellow wrinkled : Green round : green wrinkled is approximately 9 : 3 : 3 : 1
which is exactly the same as obtained by Mendel for a dihybrid cross. This indicates that the contrasting
genes for seed colour and seed shape show an independent assortment in the population of pea seeds.
249

Exercise 11: Flow of energy and Ten percent law
Aim:
To understand the unidirectional flow of energy 270 Joules
Tertiary
in an ecosystem and transfer of energy follows the consumers
Energy lost
30 Joules
10% law. 300 Joules
2700 Joules
Energy lost
Principle: Secondary consumers
The student studies about flow of energy and that 3000 Joules
27000 Joules
Energy lost
only about 10% of energy is made available to the
next trophic level. Large amount of energy about 270000 Joules
Energy lost
90% is lost at each trophic level in a food chain. 300000
Joules
30000 Joules
Producers
Requirements:
Problems to be given to students based on different Figure 11: Ten percent law
examples with alternating food chain and amount of energy.
The teacher must train the student by giving them various kinds of food chain with different
values.
Problem
Analyse the food chain given below and find out the amount of energy received by the organism in
third trophic level.
Sun
Grass receives 30,000. J of energy from sun

Grass Rabbit Snake Eagle
Given: The amount of energy in the producers, i.e. grass = 30,000 J.
Solution:
Grass Rabbit Snake Eagle
T1 T2 T3 T4
Producer Primary Consumer Secondary Consumer Tertiary Consumer
T1 – Grass (Producer) = 30,000 J of energy

T2 – Rabbit (Primary Consumer) = ?
T3 – Snake (Secondary Consumer) = ?
According to the ten percent law, during the transfer of energy, only about 10% of the energy flows
from each trophic level to the next lower trophic level. So 10% of energy from T1 gets transferred to T2
10
So T2 - Rabbit (primary consumer) receives 30000 X = 3000 J
100
Similarly, 10% of energy from T2 gets transferred to T3
So T3 – Snake (Secondary consumer) receives 10
3000 X = 300 J
100
Answer:
1. The third tropic level T3 – (Snake) receives 300 J of energy.
250

Exercise 12: Determination of Population density and Percentage frequency by Quadrat
method.
NOTE: Teachers can take the students to open space and teach them how to construct plot/
quadrats and to record the number of individuals of each plant species occurring in the quadrat.
The percentage frequency should be calculated and entered in the practical observation and
record note book. Examiner need not consider this experiment for Board Practical Examinations.
Aim:
To study population density and percentage frequency of different plant species of a given area by
quadrat method.
Principle:
The number of individuals in a population never remains constant. It may increase or decrease due
to many factors like birth rate, death rate, migration, etc. The number of individuals of a species
presents per unit area or space of a given time is called population density. The population density
and percentage frequency of different plant species can be determined by laying quadrats / segments
of suitable size and recording of the number of individuals of each species occurring in the quadrat.
Requirements:
Metre scale, string or cord, hammer, nails, paper, pencil, etc.
Procedure:
1. In the selected site of study, hammer the nails firmly in the soil without damaging the vegetation.
2. Fix four nails to make a square plot.
3. Tie each end of the nails using a thread, to make 1 m X 1 m plot.
4. If the number of plants in the plot is large, the plot can be divided into quadrats.
5. Count the number of individuals of a species “A” present in the first quadrat and record the data
in the table.
6. Similarly count the individuals of the species “A” in other quadrats respectively and record the data
in the table.
7. Count the number of individuals of a species “B” present in the all quadrats and record the data
in the table.
8. Repeat the same procedure for other species and record the data in the table.
Nail
Species No. 1 Species No. 3
Species No. 2 Species No. 4

Quadrat I Quadrat II Species No. 5
1m
String
Quadrat III Quadrat IV

Nail
1m Plants outside the quadrat
A plot Figure 12: Occurrance of plant species in a quadrat

251

Total number of individuals in all the quadrats studied
Population Density =
Total number of quadrats studied
Total number of quadrats in which species occurred

Percentage frequency = X 100
Total number of quadrats studied
Observation and Inference:
Different plant species, their population density and percentage frequency occurring in a given area.
No. of individuals
Total number of Total number of Total Population Frequency
Plant species
per quadrat
individuals in quadrats in which Number of
S. No.
Density percentage
all the quadrats each species quadrats
I II III IV (N/B) (A/B) x 100
studied (N) occurred (A) studied (B)
1
2
3
4
5
Precautions:
1. The measurement of quadrat should be accurate.
2. The string or cord used should not be very thick.
Exercise 13: Chromosomal aberrations – Deletion, Duplication and Inversion

Problem:
Given below is the representation of a kind of chromosomal aberration such as deletion, duplication
and inversion. Identify and give reasons for identification. Also mentions its significance.
Aim:
To understand the abnormality in the chromosomal structure in an organism.
Principle:
To study about the chromosomal aberration which can occur due to ionizing radiations or chemicals.
On the basis of breaks and reunions in the chromosomal segment different types of aberrations can
be recognized.
Requirements:
Copper wire, Alphabets marked ( A to H ) yellow colour beads denotes gene, and red colour bead
without alphabet denote centromere. Using this materials make different kinds of chromosomal
segments with specific gene sequence, that can be given to the students and asked to analyse the
aberration involved in it.
Procedure:
1. Make a normal chromosome model using copper wire and yellow beads and place it on the table.
In the model chromosome with gene sequence A to H, along with centromere ( red bead).
2. For Deletion - Give yellow colour beads without one or more marked alphabets A to H (The lack
252

of any one or more beads denotes deletion type of chromosomal aberration).
3. For Duplication – Give yellow colour beads with addition of one or more marked alphabets A to
H (The repetition of one or more beads denotes duplication type of chromosomal aberration).
4. For Inversion – Give yellow colour beads which marked alphabets from A to H as in normal
chromosome. (There is no addition or deletion of beads (A to H) given, so the students can
construct the inverted segment of the chromosome using the given beads).
Based on the type of beads given the student has to identify and
construct the relevant chromosomal aberration. A
B A
13 A. Chromosomal Aberration – Deletion C
B
B
Deletion of Deletion of
segment C segment
Reasons: D A D C
D
1.
The deletion of the chromosomal segement A and D. E E
E
(Refer figure 13a) F
F
F
G G
2. When there is a loss of a segment of the genetic material in a H G
H
H
I I
chromosome it is called deletion. I
Terminal Normal Intercalary
Significance: deletion Chromosome deletion
Most of the deletions lead to death of an organism. Figure: 13 a: Deletion
Duplications
13 B. Chromosomal Aberration - Duplication A A A A
B B B B
Reasons: C C C C
1. When a segment of a chromosome is present more than once in a chromosome, D
E
B
C
C
B
D
then it is called duplication (Tandem duplication) F

G
D D F
G
E E
2. The order of the genes in a chromosome is A, B, C, D, E, F, G, H and I. Due H
I F F
B
C
to aberration, the genes B and C are duplicated and the sequence of genes
G G
H H H
I I
becomes A, B, C, B, C, D, E, F, G, H and I. (Refer figure 13b)
I
Normal Tandem Reverse Displaced

chromosome tandem tandem
Significance:
Figure 13 b:
Some duplications are useful in the evolution of the organism. Duplication
13 C. Chromosomal Aberration - Inversion

A A A A
Problem: B D D B B
C C
Given below is the representation of a kind of chromosomal C C C
F
F
B B D
D
aberration. Identify it giving reasons for your identification. E E
E
E
E
Also mentions its significance. F F F
D
D
G G G
G
Identification: H H H H
I I I
I
The given genetic problem is identified as inversion type of a) Paracentric inversion b) Pericentric inversion
(does not include centromere) (includes centromere)
chromosomal aberration.
Figure: 13 c: Inversion
Reasons:
1. When the order of genes in a chromosomal segment is reversed due to rotation by an angle of 180°,
it is called inversion.
2. The order of genes in a chromosome is A, B, C, D, E, F, G, H and I. Due to aberration, the sequence
of genes become A, D, C, B, E, F, G, H and I (Refer figure 13c)
253

Significance:
Sometimes inversion is responsible for evolution of the organism.
NOTE: Likewise the teacher can give different types of chromosomal aberrations with various
gene sequence to students for practise. The external examiner can also use the same technique
by giving different gene sequence.
Exercise 14: Genetic / linkage maps

Aim:
To understand the frequency of recombination between the gene pairs on the same chromosome.
Principle:
To analyse the relative distance between the various genes and map their position in the chromosome,
which is called genetic or linkage maps.
Requirements:
Different kinds of linkage / genetic maps can be constructed by giving the students the relative distance
between the linked genes of a chromosome. A diagrammatic representation can be drawn showing
the location and arrangement of genes and their relative distance between them.
Solve the Problem
Problem: There are three linked genes A, B and C in a chromosome. Percentage of crossing over
(recombination frequency) between A and B is 20, B and C is 28 and A and C is 8. What is the
sequence of genes on the linkage map?
Given: Percentage of crossing over between the 3 linked genes A – B = 20%, B – C = 28% and A – C = 8%.
Solution
28%
B A C
20% 8%
Figure 14: Linkage Map
Reasons:
1. The frequency of crossing over is directly proportional to the relative distance of the genes on the
chromosomes.
2. More crossing over = More distance between two genes and
Less crossing over = Less distance between the two genes.
In the above problem, the sequence of the genes on the linkage map is B, A, C
NOTE: Teachers can give different crossing over percentage between its linked genes in a
chromosome and make the students construct the linkage maps. The external examiner can
also do the same for the Board Practical Examinations.
254

IV - Experiments
Exercise 15: Study of Pollen germination on a slide
NOTE: Pollen germination can be studied by dusting some pollens from common flowers like
Crotalaria, Hibiscus, Pisum, etc. on a glass slide containing a drop of 10% sugar solution or
tender coconut water or any nutrient medium.
Observe the slide after about 10 – 15 minutes under the low power of compound microscope.
You will be able to observe the pollen tubes coming out of the pollen grains.
Aim: To study the pollen germination on a slide. (a)

Vegetative cell
Requirements: Fresh seasonal flowers, cavity slide, cover slip, compound Generative cell
microscope, sucrose, boric acid, distilled water, beakers, etc. (b)
Procedure: Generative nucleus
1. Prepare a nutrient solution by dissolving 1 gm. of sucrose / 1 gm. of boric Pollen tube
Tube nucleus
acid in 100 ml. of distilled water. (c)

2. Take a clean cavity slide and put a few drops of nutrient solution in the
cavity of the slide.
3. Dust a few pollen grains from the stamen of a mature flower on it. Male gametes
4. View the slide in the microscope after 5 minutes and then observe it
Tube nucleus
regularly for about half an hour.
Figure 15: Pollen
Observation: In nutrient medium, the pollen grains germinate. The tube cell germination
enlarges and comes out of the pollen grain through one of the germ pores to
form a pollen tube. The tube nucleus descends to the tip of the pollen tube. The
generative cell also passes into it. It soon divides into two male gametes.
Inference: Different stages of germinating pollens are observed. Some pollens are in their initial
stage of germination while others have quite long pollen tube containing tube nucleus and two
male gametes.
Precautions: 1. Flowers should be freshly plucked. 2. Use clean cavity slide to observe the pollen
grains. 3. The slides should not be disturbed, otherwise position of pollen grains will get changed.
Exercise 16: Study of pH of different types of soil

Some nutrients become toxic in higher concentration. Therefore pH of the soil is an important
chemical property of the soil. Plants thrive well in neutral or slightly acidic soils. The pH of the
soil determines the types of soil organisms and also controls the solubility of different nutrients.
The pH of soil ranges from 0 - 14.
a. pH level 7 - Neutral soil
b. pH level below 7 - Acidic soil
c. pH level above 7 -Alkaline soil
d. Optimum pH for plant growth ranges from 5.5 to 7.
Most plants thrive best in neutral pH. Slight acidity favours tree growth and forms forests.
Slight alkalinity is favourable for grasses and legume crops.
255

Aim:
To study pH of different types of soil.
Requirements:
Soil samples (from two different sites such as crop soil, garden
soil, roadside soil, pond soil, river bank soil), test tubes, funnel,
filter papers, pH papers of different range, distilled water, beaker.
Procedure: Figure 16: Study of pH of
Dissolve one tablespoon or 1 gram of soil from each soil sample different types of soil
in 100 ml of distilled water in separate beakers. Stir the solutions
well and keep aside for half an hour to settle down the suspended
particles. Filter off each solution separately in different test tubes. Dip a small piece of broad range
pH paper on each of the solution. Match the colour of the pH paper with the colour scale given on the
pH paper booklet. This gives an approximate pH.
Observation:
Record the pH of different soil samples in the observation table.
S. No. Soil sample pH Value
1
2
3
Inference:
Thus the pH value of different soil samples required for plant growth can be determined.
Precautions:
1. Wash the glassware thoroughly and get it dried before the experiment.
2. Dry the pH papers before comparing the colour with the colour scale.
3. Match the colour carefully and determine pH accurately.
Exercise 17: Isolation of DNA from plant materials
DNA is one of the nucleic acids found in living systems. DNA acts as the genetic material in
most of the organisms.
Principle: Recombinant DNA technology has allowed breeders to introduce foreign DNA
in other organisms including bacteria, yeast, plants and animals. Such organisms are called
Genetically Modified Organisms (GMOs). Thus rDNA technology involves isolation of DNA
from a variety of sources and formation of new combination of DNA.
Aim: To isolate DNA from available plant materials such as spinach leaves, fresh green pea seeds,
green papaya, etc.
Requirements: Plant materials, mortar and pestle, beakers, test tubes, ethanol, etc.
Procedure: Take a small amount of plant material and grind it in a mortar with a little amount of
water and sodium chloride. Make it into a solution and filter it. To this filterate, add liquid soap
solution or any detergent solution and mix it with a glass rod. Then tilt the test tube and add
256

chilled ethanol and leave it aside in the stand. After half-an-hour
we can observe the precipitated DNA as fine threads. DNA that
separates can be removed by spooling
Observation: DNA appears as white precipitate of very fine
threads on the spool.
Inference: Thus DNA can be isolated from the plant cell nucleus
by this technique.
Figure 22: Isolation of DNA
Precautions:
1. All the glasswares must be thoroughly cleaned and dried.
2. The chemicals used for the experiments must be of standard quality.
3. If ordinary ethanol is used, the time duration for obtaining precipitated DNA may extend further.
V - Economic Importance of Plants

Exercise 18: Economically important plant products
S. Identification Botanical Useful

Uses
no (Product name) Name parts
1. Sesame/ Sesamum Seeds 1. Sesame oil is mostly used for culinary purposes.
Gingelly oil indicum 2. Lower grades are used in manufacture of soaps, in paint
industries, as a lubricant and as an illuminant.
2. Rubber Hevea Latex 1. Rubber is used in the manufacture of footwear, wire and cable
brasiliensis insulations, rain coat, sports goods, erasers, adhesives, rubber
bands, household and hospital goods and shock absorbers.
2. Concentrated latex is used for making gloves and balloons.
3. Foamed latex is used in the manufacture of cushions, pillows
and life-belts.
3. Flaked Rice Oryza Seeds 1. Flaked rice (aval) is used as breakfast cereal or as snacks.
(Aval) sativa
4. Henna Powder Lawsonia Leaves 1. An orange dye “henna” obtained from leaves and young shoots
inermis is used to dye skin, hair and fingernails.
2. It is also used for colouring leather, tails of horses and hair.
5. Aloe Gel Aloe vera Leaves 1. Aloe gel is used as skin tonic.
2. Because of its cooling effect and moisturizing characteristics,
it is used in the preparation of creams, lotions, shampoos,
shaving creams and allied products.
3. It is used in gerontological applications for rejuvenation of
ageing skin.
257

Biology: Botany - Class XII
List of Authors and Reviewers
Reviewers Authors
Dr. K. V. Krishnamurthy, P. Saravanakumaran, PG Assistant in Botany,
Professor and Head (Retd.) GHSS, Koduvalarpatti, Theni.
Bharathidasan University, Trichy
P. Anandhimala, PG Assistant in Botany,
Dr. S. Palaniappan, GGHSSS, Pochampalli, Krishnagiri.
Principal (Retd.),
Govt. Arts College for Men (A), Nandanam, Chennai M.V. Vasudevan, PG Assistant in Botany,
Adhiyaman GBHSS, Dharmapuri
J. Mani, PG Assistant in Botany,
Domain Experts GHSS, R. Gobinathampatti, Dharmapuri.
Dr. M.N. Abubacker, Associate Professor & Head, G. Muthu, PG Assistant in Botany,
PG and Research Department of Biotechnology, GHSS (ADW), Achampatti, Madurai.
National College (A), Tiruchy
G. Sathiyamoorthy, PG Assistant in Botany,
Dr. S.S. Rathinakumar, Principal (Retd.), GHSS, Jayapuram, Tirupattur, Vellore.
Sri Subramania Swamy Government Arts College , Thiruthani
T. Ramesh, PG Assistant in Botany,
Dr. D. Narashiman, Professor and Head (Retd.) GBHSS, Vettavalam, Thiruvannamalai
Plant Biology & Biotechnology, MCC College
Tambaram, Kancheepuram S. Malar Vizhi, PG Assistant in Botany,
GHSS, Chenbagaramanputhoor, Kanyakumari.
Dr. K.P. Girivasan, Associate Professor of Botany,
Govt. Arts & Science College, Nandanam, Chennai G. Bagyalakshmi, PG Assistant in Botany,
GGHSS, Jalagandapuram, Salem.
Dr. C.V. Chitti Babu, Associate Professor of Botany,
Presidency College, Chennai C. Kishore Kumar, PG Assistant in Botany,
GHSS, Thattaparai, Vellore.
Dr. Renu Edwin, Associate Professor of Botany,
Presidency College, Chennai Sathyawathi Sridhar, PG Assistant in Botany,
Sri Sankara Senior Secondary School, Adyar, Chennai.
M. Lakshmi, PG Assistant in Botany,
Academic Coordinators Sri Sankara Senior Secondary School, Adyar, Chennai.
K. Manjula, M. Chamundeswari, PG Assistant in Botany,
Lecturer in Botany, DIET, Triplicane, Chennai. Prince MHSS, Nanganallur, Kancheepuram.
J.Radhamani, D. Padma, PG Assistant in Botany,
Lecturer in Botany, DIET, Kaliyampoondi, Kancheepuram Prince MHSS, Madipakkam, Chennai.
(Author, Practicals)
V. Kokiladevi,
PGT Botany, GHSS, Sunnambukulan, Thiruvallur.
Content Readers
Art and Design Team

Dr. T.S. Subha, Associate Professor in Botany,
Bharathi Womens College, Chennai.
Dr. P.T. Devarajan, Associate Professor in Botany,
Illustration Presidency College, Chennai
A. Jeyaseelan, Art Teacher
GBHSS, Uthangarai, Krishnagiri. Dr. N. Pazhanisami, Associate Professor in Botany,
Govt. Arts College, Nandanam, Chennai
S. Gopu
Gopu Rasuvel Dr. G. Rajalakshmi, Associate Professor in Botany,
Santhana Krishnan Bharathi Womens College, Chennai.
Dr. R. Kavitha, Associate Professor in Botany,
Layout Bharathi Womens College, Chennai
Santhiyavu Stephen S
Balaji
Prasanth C OR Code Management Team
In-House R. Jaganathan, SGT,
PUMS - Ganesapuram, Polur, Thiruvannamalai.
QC - Arun Kamaraj Palanisamy
- Rajesh Thangappan J.F. Paul Edwin Roy, B.T.Assistant,
PUMS -Rakkipatty, Salem.
Wrapper Design
S. Albert Valavan Babu, B.T.Assistant
Kathir Aarumugam G.H.S, Perumal Kovil, Paramakudi, Ramanathapuram
Co-ordination
Ramesh Munisamy
Typist
S. Chitra, SCERT, Chennai
This book has been printed on 80 G.S.M.

Elegant Maplitho paper.
Printed by offset at:
258

TN XII - STD - Bio-Botany - English - Medium PDF

Caricato da

Informazioni sul documento

Titolo originale

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

TN XII - STD - Bio-Botany - English - Medium PDF

Caricato da

Copyright:

Formati disponibili

GOVERNMENT OF TAMIL NADU

HIGHER SECONDARY SECOND YEAR

Untouchability is Inhuman and a Crime

Department of School Education

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 1 03-03-2019 14:51:26

NOT FOR SALE

State Council of Educational

Printing & Publishing

Tamil NaduTextbook and Educational

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 2 03-03-2019 14:51:26

UNIT VI: Reproduction in Plants

UNIT VII: Genetics

UNIT VIII: Biotechnology

UNIT IX: Plant Ecology

UNIT X: Economic Botany

E-book Assessment DIGI links

Lets use the QR code in the text books ! How ?

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 3 03-03-2019 14:51:26

Learning objectives are brief statements that describe what

Chapter Outline Illustrate the complete overview of chapter

Amazing facts, Rhetorical questions to lead students

Activity Directions are provided to students to conduct activities

Infographics Visual representation of the lesson to enrich learning .

To motivate the students to further explore the content

ICT To enhance digital Science skills among students

Conceptual diagram that depicts relationships between

Glossary Explanation of scientific terms

Tamil terminology for Botanical terms given for easy

References List of related books for further details of the topic

Web links List of digital resources

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 4 03-03-2019 14:51:27

List of Medical Courses

2 B. D. S. (Bachelor of Dental Surgery) – 4

6 B.Sc Nursing – 4 years

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 5 03-03-2019 14:51:27

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 6 03-03-2019 14:51:28

1 Asexual and Sexual

One of the essential features of all living things

Asexual and Sexual Reproduction in Plants 1

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 1 03-03-2019 14:26:03

2 Asexual and Sexual Reproduction in Plants

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 2 03-03-2019 14:26:04

(a) Reproduction by roots – Murraya

Bud from eye

Fleshy scale leaf (j) Sucker

(k) Axillary bulbils

ii) Naked – Lilium

Figure 1.1 a-k: Natural methods of vegetative reproduction in plants.

Asexual and Sexual Reproduction in Plants 3

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 3 03-03-2019 14:26:06

4 Asexual and Sexual Reproduction in Plants

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 4 03-03-2019 14:26:06

Activity b) Types of Layering

Asexual and Sexual Reproduction in Plants 5

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 5 03-03-2019 14:26:07

6 Asexual and Sexual Reproduction in Plants

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 6 03-03-2019 14:26:07

gametes. The former is called gametogenesis Stamen

and the latter is the process of fertilization. Let Petal

us recall the sexual reproduction in algae and

fusion is of three types (Isogamy, Anisogamy Pedicel

Asexual and Sexual Reproduction in Plants 7

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 7 03-03-2019 14:26:07

7. Match the following 12. Which of the following represent