Article

BACH1 Stabilization by Antioxidants Stimulates Lung

Cancer Metastasis
Graphical Abstract Authors
Clotilde Wiel, Kristell Le Gal,
Mohamed X. Ibrahim, ..., Per Lindahl,
Volkan I. Sayin, Martin O. Bergo

Correspondence
volkan.sayin@gu.se (V.I.S.),
martin.bergo@ki.se (M.O.B.)

In Brief
Antioxidants stimulate lung cancer
metastasis by reducing free heme levels
and stabilizing the transcription
factor BACH1

Highlights
d Antioxidants stimulate KRAS-driven lung cancer metastasis

d Antioxidants reduce free heme levels and stabilize BACH1

d BACH1 activates Hk2 and Gapdh transcription triggering

glycolysis-induced metastasis

d Targeting BACH1 or its glycolytic targets prevents

antioxidant-induced metastasis

Wiel et al., 2019, Cell 178, 330–345

July 11, 2019 ª 2019 Elsevier Inc.
https://doi.org/10.1016/j.cell.2019.06.005
 Article

BACH1 Stabilization by Antioxidants

Stimulates Lung Cancer Metastasis
Clotilde Wiel,1,2 Kristell Le Gal,3,4,7 Mohamed X. Ibrahim,2,7 Chowdhury Arif Jahangir,1 Muhammad Kashif,1 Haidong Yao,1
Dorian V. Ziegler,2 Xiufeng Xu,1 Tanushree Ghosh,5 Tanmoy Mondal,5 Chandrasekhar Kanduri,5 Per Lindahl,6
Volkan I. Sayin,3,4,* and Martin O. Bergo1,2,8,*
1Department of Biosciences and Nutrition, Karolinska Institutet, 141 83 Huddinge, Sweden
2Sahlgrenska Cancer Center, Department of Molecular and Clinical Medicine, Institute of Medicine, University of Gothenburg, 405 30
Gothenburg, Sweden
3Sahlgrenska Cancer Center, Department of Surgery, Institute of Clinical Sciences, University of Gothenburg, 405 30 Gothenburg, Sweden
4Wallenberg Centre for Molecular and Translational Medicine, University of Gothenburg, 405 30 Gothenburg, Sweden
5Department of Medical Biochemistry and Cell Biology, Institute of Biomedicine, University of Gothenburg, 405 30 Gothenburg, Sweden
6The Wallenberg Laboratory, Department of Molecular and Clinical Medicine, Institute of Medicine, University of Gothenburg, 405 30

Gothenburg, Sweden
7These authors contributed equally
8Lead Contact

*Correspondence: volkan.sayin@gu.se (V.I.S.), martin.bergo@ki.se (M.O.B.)

https://doi.org/10.1016/j.cell.2019.06.005

SUMMARY however, many randomized clinical trials have disproved this

For tumors to progress efficiently, cancer cells must
overcome barriers of oxidative stress. Although die-
tary antioxidant supplementation or activation of
endogenous antioxidants by NRF2 reduces oxidative
stress and promotes early lung tumor progression,
little is known about its effect on lung cancer metas-
tasis. Here, we show that long-term supplementation
with the antioxidants N-acetylcysteine and vitamin
E promotes KRAS-driven lung cancer metastasis.
The antioxidants stimulate metastasis by reducing
levels of free heme and stabilizing the transcription
factor BACH1. BACH1 activates transcription of
Hexokinase 2 and Gapdh and increases glucose
uptake, glycolysis rates, and lactate secretion,
thereby stimulating glycolysis-dependent metas-
tasis of mouse and human lung cancer cells. Target-
ing BACH1 normalized glycolysis and prevented
antioxidant-induced metastasis, while increasing
endogenous BACH1 expression stimulated glycol-
ysis and promoted metastasis, also in the absence
of antioxidants. We conclude that BACH1 stimulates
glycolysis-dependent lung cancer metastasis and
that BACH1 is activated under conditions of reduced
oxidative stress.
INTRODUCTION
Cancer cells produce high levels of reactive oxygen species
(ROS) through alterations in signaling and metabolic path-
ways. For decades, the belief that ROS stimulate tumor initia-
tion and progression has prompted healthy people and cancer
patients alike to supplement their diets with antioxidants;
strategy (Klein et al., 2011; Alpha-Tocopherol, Beta Carotene
Cancer Prevention Study Group, 1994; van Zandwijk et al.,
2000). Instead, it has become clear that ROS create barriers
to tumor progression that antioxidant supplements can help
cancer cells overcome (Le Gal et al., 2015; Gorrini et al.,
2013; Piskounova et al., 2015; Sayin et al., 2014; Wang
et al., 2016).
In the absence of exogenous antioxidants, cancer cells main-
tain redox homeostasis by expressing endogenous antioxi-
dants, many of which are regulated by the redox-sensitive tran-
scription factor nuclear factor (erythroid-derived 2)-like 2
(NFE2L2, NRF2) and its negative regulator Kelch-like ECH-
associated protein 1 (KEAP1) (DeNicola et al., 2011; Singh
et al., 2006). Although ROS reduction is often beneficial for
tumor cells, specific forms of ROS can stimulate pro-tumori-
genic signaling pathways by oxidizing and inactivating tumor
suppressor proteins and activating oncogenes by oxidizing
DNA (Finkel, 2011; Sabharwal and Schumacker, 2014; Wein-
berg et al., 2010). The anti- and pro-tumorigenic roles of ROS
complicate the understanding of redox regulation in cancer
cells, and these topics need to be studied further (Chio and Tu-
veson, 2017).
Recent studies provide compelling evidence that ROS have
anti-tumorigenic roles and consequently that both exogenous
and endogenous antioxidants act in a pro-tumorigenic
fashion. For example, antioxidant supplementation of the
diet accelerates tumor progression in endogenous and pa-
tient-derived xenograft-based mouse models of lung cancer
and malignant melanoma (Le Gal et al., 2015; Piskounova
et al., 2015; Sayin et al., 2014; Wang et al., 2016). The first
of these studies showed that supplementing the diet with
the antioxidants N-acetylcysteine (NAC) and vitamin E accel-
erates primary lung tumor progression in Kras2LSL/+ (K) mice
(Sayin et al., 2014). The antioxidants reduced ROS and DNA
damage in tumors and eliminated the expression of p53—a
tumor suppressor normally activated by DNA damage. These

330 Cell 178, 330–345, July 11, 2019 ª 2019 Elsevier Inc.
 A B C D

E F

G H I

J K

Figure 1. The Antioxidants NAC and Vitamin E Increase Lung Cancer Metastasis Independently of p53
(A) Schematic showing that Kras2LSL/+ (K) and Kras2LSL/+;Trp53fl/fl (KP) mice were allowed to inhale a low dose of Cre-adenovirus. One week later, NAC (1 g/L) was
administered in the drinking water and vitamin E (VitE, 0.5 g/kg) in the chow.
(B) Percentage of K mice with lymph node metastases. Numbers in bars indicate numbers of mice.
(C) Immunohistochemical staining for pro-surfactant protein C (pro-SPC) in a normal lymph node of a control K mouse (upper) and in an enlarged metastatic
lymph node from an NAC-treated K mouse (lower). Scale bar, 50 mm.
(D) Left, percentage of K mice with distant metastases at necropsy. Right, photos of metastases on kidney (top) and liver (bottom).
(E) Percentage of KP mice with lymph node metastases.
(F) Left, percentage of KP mice with thoracic metastases. Right, photo of thoracic rib cage metastases.
(G) Schematic showing that lung tumor cell lines were established from control (mTC) and NAC-treated (mTN) K mice 58 weeks after Cre-adenovirus inhalation.
The cells were cultured without antioxidants unless otherwise stated.
(H) Real-time cell invasion analyzed with the xCelligence system. Curves show mean invasion index of 3 mTC and 4 mTN cell lines.
(legend continued on next page)

Cell 178, 330–345, July 11, 2019 331

results suggest that antioxidants protect primary tumor
cells from ROS and DNA damage that would otherwise acti-
vate p53 and slow their proliferation. Moreover, stimulating
the transcription of endogenous antioxidant genes—by
activating NRF2 mutations or inactivating KEAP1 muta-
tions—increases primary lung tumor growth, for example, in
the K and K;Trp53fl/fl (KP) mouse models (Best et al., 2018;
Jeong et al., 2017; Romero et al., 2017). However, none
of these studies addressed the important question of whether
antioxidants influence lung cancer metastasis. One reason
is that the K and KP mice were euthanized due to high
primary lung tumor burden relatively early after tumor
initiation and too soon for authentic metastases to develop
(DuPage et al., 2009; Romero et al., 2017; Sayin et al.,
2014). Another reason is that the K model is believed to be
metastasis resistant in the absence of additional mutations
(e.g., in Trp53 and Nkx2.1) (Kim et al., 2005; Winslow
et al., 2011).
Like NRF2, the transcription factor BTB and CNC homology
1 (BACH1) belongs to the cap’n’collar (CNC) b-Zip family of
proteins that bind to antioxidant response elements (AREs) in
response to changes in redox states (Hayes et al., 2010; Sun
et al., 2004; Taguchi et al., 2011). Under conditions of oxidative
stress, the oxidation of heme-containing proteins releases free
heme, which stimulates degradation of BACH1 (Zenke-Kawa-
saki et al., 2007). In low-oxidative stress conditions, heme
levels are low, which leads to BACH1 stabilization. BACH1 is
believed to displace NRF2 from AREs and to act primarily as
a transcriptional repressor for antioxidant genes, including
HMOX-1, which encodes the detoxification enzyme heme oxy-
genase 1 (HO-1), and NQO1, which encodes NAD(P)H dehy-
drogenase (quinone 1). However, BACH1 may also activate
transcription (Liang et al., 2012). Although BACH1 has been
identified in metastatic signatures in a few studies, its role in
lung cancer metastasis is unknown (Liang et al., 2012; Yun
et al., 2011).
Lung cancer is the main cause of cancer-related deaths
worldwide, and most of those deaths are associated with
metastasis (IARC, Globocan 2018 [Bray et al., 2018]).
Thus, understanding basic mechanisms that control lung can-
cer metastasis is essential for identifying tumor cell weak-
nesses that can be exploited for therapy. Although one-third
of lung cancers have NRF2 or KEAP1 mutations (Berger
et al., 2016), the role of endogenous and exogenous antioxi-
dants in lung cancer metastasis has not been explored.
Furthermore, the belief that antioxidant supplements protect
against cancer persists in society. In this study, we combined
long-term studies in mouse models with genomic, metabolic,
and data mining approaches to define the impact of ROS and
antioxidants in lung cancer metastasis—and identify a new
mechanism that controls this process.
(I) Transwell invasion assay of mTC and mTN cells (n = 2 biological replicates/condition).
(J) Left, lung metastases in syngeneic mice 3 weeks after i.v. injection of mTC and mTN cells (0.5 3 105 cells/mouse; n = 10 mice/cell type). Red dots indicate mice
with metastases to organs other than the lung. Right, representative lung sections.
(K) Left, percentage of NSG mice with lymph node metastasis 3 weeks after s.c. transplantation of mTC and mTN cells (2.5 3 105 cells/mouse; n = 6 mice/condition).
Right, weight of primary s.c. tumors 3 weeks after transplantation.
Error bars indicate SEM. ****p < 0.0001; ***p < 0.005; **p < 0.01; *p < 0.05. See also Figures S1 and S2.
332 Cell 178, 330–345, July 11, 2019
RESULTS
The Antioxidants NAC and Vitamin E Stimulate Lung
Cancer Metastasis in a p53-Independent Fashion
To define antioxidant effects on lung cancer metastasis, we used
Kras2LSL/+ and Kras2LSL/+Trp53fl/fl mice (hereafter K and KP)
(Jackson et al., 2001; Meuwissen et al., 2003). Intranasal
Cre-adenovirus administration activates KRASG12D expression
in K and KP mice and inactivates p53 in KP mice, resulting in
lung adenocarcinoma (LUAD). KP mice develop metastases,
particularly to lymph nodes, but K mice do not (Kwon and Berns,
2013). We administered a low dose Cre-adenovirus (99% lower
than in DuPage et al., 2009; Sayin et al., 2014) to K and KP mice
and gave NAC and vitamin E in the drinking water and chow
1 week later (Figure 1A). The incidence of lymph node metastasis
was 6- to 7-fold higher in antioxidant-treated K mice than in
controls (Figure 1B). Lymph nodes in antioxidant-treated mice
were larger and stained positive for pro-surfactant protein C,
indicating a pulmonary origin, and for the invasive marker high-
mobility group AT-hook 2 (HMGA2, Morishita et al., 2013;
Winslow et al., 2011) (Figures 1C, S1A, and S1B). Antioxidants
also stimulated distant metastasis in some K mice (Figure 1D).
Moreover, NAC and vitamin E increased lymph node and
thoracic metastasis in KP mice and increased the frequency of
HMGA2-positivity (Figures 1E, 1F, S1C, and S1D).
The antioxidants did not affect survival or primary tumor
burden in K and KP mice (Figures S1E–S1G). However, tumors
of antioxidant-treated K mice were more advanced (Figures
S1H–S1I). Consistent with those observations, HMGA2 expres-
sion was higher in tumors of antioxidant-treated K and also KP
mice (Figure S1J); no differences in proliferation index was
observed (Figure S1K). Moreover, a proportion of tumors from
antioxidant-treated K mice had lost expression of the metas-
tasis-suppressor NK2 homeobox 1 (NKX2.1) (Figure S1L), which
is present at low levels in all KP tumors (Winslow et al., 2011).
Chronic Antioxidant Administration Increases Lung
Cancer Cell Invasiveness, Reduces ROS, and Increases
Reducing Equivalents
To define mechanisms underlying the pro-metastatic effect of
chronic antioxidant administration, we established cell lines
from tumors of control and NAC-treated K mice (mTC and mTN,
respectively) and cultured them in the absence of antioxidants
(Figure 1G). mTC and mTN cells proliferated at similar rates and
retained functional p53 (Figures S2A–S2C), but mTN cells had
higher invasive and migratory capacities (Figures 1H, 1I, and
S2D). The migration of mTC cells increased to mTN levels after in-
cubation with NAC for 7 days (Figure S2D). After intravenous (i.v.)
injection into syngeneic recipient mice, mTN cells produced far
more lung metastases than mTC cells and formed occasional
metastatic tumors in the liver, kidney, heart, and rib cage
 A B C

D E G

H I J

K L

Figure 2. Antioxidants Stabilize BACH1 by Reducing Free Heme Levels

(A) Venn diagram of RNA-seq data showing the number of genes differentially expressed in mTN versus mTC cells (blue). Small circles show genes with NRF2 and
BACH1 binding motifs in their proximal promoter.
(B) Real-time qPCR analyses of BACH1 and NRF2 target genes in mTC and mTN cells (n = 3). Data are first normalized to Rplp0 expression and then to mTC and
are mean of two experiments.
(C) Kaplan-Meier graph of TCGA data showing survival of lung adenocarcinoma (LUAD) patients with high and low BACH1 expression (Z score = 2).
(D) Schematic of ROS- and hemin-induced BACH1 degradation.
(E) Left, western blots showing steady-state amounts of BACH1 in mTC and mTN cell lines (n = 3). Right, amounts of BACH1 determined by densitometry of
protein bands from two experiments. ACTIN was the loading control.
(F) Left, western blot showing amounts of BACH1 in mTC cells incubated with NAC or Trolox (>7 days). Right, amounts of BACH1 determined by densitometry of
protein bands from three experiments.
(legend continued on next page)

Cell 178, 330–345, July 11, 2019 333

(Figure 1J). Moreover, after subcutaneous (s.c.) implantation, only
mTN cells metastasized to lymph nodes (Figure 1K).
Incubation with NAC and Trolox (a water-soluble vitamin E
analog) for 7 days increased migration and invasion (Figures
S2E–S2N) in 5 of 7 human non-small cell lung cancer (NSCLC)
cell lines. These effects did not depend on the mutational profile
and remained when antioxidants were withdrawn 48 h before the
assay (Figures S2O–S2R).
ROS levels were lower in mTN cells and in NSCLC cells pre-
incubated for 7 days with NAC than in controls (Figures S2S
and S2T). Analyses with genetically encoded cytosolic H2O2
and glutathione disulfide (GSSG)/glutathione (GSH)-biosensors
revealed that baseline levels of oxidation were lower in NAC-
treated than control A549 cells and returned faster to redox
homeostasis after addition of the pro-oxidant menadione (Fig-
ure S2U). Moreover, the total amounts of GSH, NADH, and
NADPH were higher in mTN cells and in NAC- and Trolox-treated
NSCLC cells than in controls (Figures S2V–S2AA). NAC is a pre-
cursor of GSH, but the increased migration of mTN cells did not
depend on new GSH synthesis, as the migration of mTN and also
mTC cells was unaffected by the GSH inhibitor buthionine sul-
foximine and GSH (Figures S2AB–S2AD).
Antioxidants Stabilize BACH1 by Reducing Levels of
ROS and Free Heme
We next did a transcriptomic analysis (RNA sequencing [RNA-
seq]), which identified 1,025 genes whose mRNA levels differed
significantly between mTN and mTC cell lines (Figure 2A). Gene
ontology analyses revealed that mTN cells were enriched in
mRNAs that help regulate cell motility and migration, cell-cell
adhesion, and stem cell differentiation, consistent with activation
of a pro-metastatic transcriptional program (Figure S3A).
Conversely, genes involved in antioxidant mechanisms were
depleted in mTN cells, reflecting the low levels of oxidative stress
(Figure S3B). NRF2 target genes were expressed at lower levels
in mTN than mTC cells (Figures S3C and S3D). Moreover, NRF2
protein levels were lower in lung tumors from antioxidant-treated
mice than controls (Figure S3E). In line with these findings, we
identified an NRF2-binding motif and also a BACH1-binding
motif in the proximal promoters of 267 and 310 genes, respec-
tively (Figure 2A). BACH1 displaces NRF2 from promoters and
represses the expression of antioxidant genes (Figure S3F).
Indeed, 207 of 267 genes with a NRF2 motif also contained a
consensus motif recognized by BACH1 (Figure 2A).
RNA-seq data and qPCR analyses confirmed regulation of
BACH1’s previously known—and new Transfac-identified—target
genes. For example, Nqo1 expression was lower, and Pkp3 and
Mmp1a expression was higher, in mTN than mTC cells (Figure 2C).
Pkp3 and Mmp1a have been linked to cell invasion (Furukawa
et al., 2005; Toruner et al., 2004). These gene expression changes
would be consistent with increased BACH1. Analyses of data in
The Cancer Genome Atlas (TCGA) revealed that high BACH1
expression in LUAD patients is associated with poor survival (Fig-
ure 2C), as are its targets PKP3 and MMP1 (Figures S3G and S3H).
BACH1 also predicts poor survival in patients with kidney clear cell
carcinoma and pancreatic adenocarcinoma (Figures S3I and S3J).
BACH1 is degraded by the proteasome when levels of intra-
cellular free heme are high (Suzuki et al., 2004; Zenke-Kawasaki
et al., 2007), and ROS stimulates the release of free heme by
oxidizing heme-containing proteins (Gozzelino et al., 2010; Pam-
plona et al., 2007). We therefore hypothesized that antioxidants,
by lowering ROS levels, inhibit the release of free heme and
thereby prevent BACH1 degradation (Figure 2D).
To test this possibility, we first confirmed that BACH1 protein
levels were higher in mTN than mTC cells (Figure 2E); Bach1
mRNA levels were not altered, which suggests stabilization of
the protein (Figure 2B). NAC and Trolox also increased BACH1
protein levels in mTC and A549 cells (Figures 2F, S3K, and
S3L). Furthermore, activating the expression of endogenous an-
tioxidants with the NRF2-activating peptide KI-696 (Sayin et al.,
2017) increased BACH1 levels in mTC and mTN cells and
increased the migration of mTC cells (Figures S3M and S3N).
Conversely, increasing oxidative stress by adding H2O2 reduced
BACH1 (Figure 2G).
Next, we measured free heme under conditions of low and high
oxidative stress. Free heme levels were reduced by NAC and Tro-
lox and increased by H2O2 and diamide, as judged by enzymatic
assays and a fluorescent heme sensor (Figures 2H and 2I). More-
over, BACH1 levels in mTC and mTN cells were reduced after
addition of hemin (a heme derivative) to the culture medium (Fig-
ure 2J). Hemin-induced BACH1 degradation was blocked by the
proteasome inhibitors MG132 and bortezomib and the neddyla-
tion inhibitor MLN4924 (Figure 2K). BACH1 also disappeared at
a slower rate in antioxidant-treated lung cancer cells after protein
synthesis was inhibited with cycloheximide (Figures 2L and Fig-
ure S3O); incubation with MG132, bortezomib, and MLN4924
blocked BACH1 degradation in the cycloheximide-treated cells.
BACH1 Is Required for Antioxidants to Induce Metastasis
and Can Induce Metastasis in the Absence of Antioxidants
Next, we evaluated the functional role of BACH1 for the migra-
tory and metastatic phenotype of antioxidant-treated cells. The

(G) Top, western blots of BACH1 in mTC and mTN cells incubated for 24 h with H2O2 (200 mM). Bottom, amounts of BACH1 were quantified from two experiments.
(H) Steady-state levels of free heme in A549 cells incubated with 1 mM NAC for 2 weeks. Red bar, positive control; cells were incubated with 200 mM H2O2
overnight to stimulate release of free heme.
(I) Free heme levels measured with the pCDNA-HS1 sensor in A549 cells incubated for 2 weeks with 1 mM NAC or 100 mM Trolox. Cells were incubated with 5 mM
diamide for 48 h as a positive control.
(J) Left, western blot showing amounts of BACH1 and ACTIN in cells incubated with 10 mM hemin for 24 h. Right, amounts of BACH1 determined with densi-
tometry. Values are the mean of 3 cell lines/condition from 2 experiments and are normalized to mTC.
(K) Western blot showing amounts of BACH1 and ACTIN in cells incubated with 10 mM hemin. Cells were incubated with 10 mM MG132, 1 mM bortezomib, or 2 mM
MLN4924 for 30 min before the addition of hemin.
(L) Western blots showing amounts of BACH1 and ACTIN in cells incubated with 20 mg/mL cycloheximide (CHX). Cells were incubated with 10 mM MG132, 1 mM
bortezomib, or 2 mM MLN4924 for 30 min before CHX treatment.
****p < 0.0001; **p < 0.01; *p < 0.05. See also Figure S3.

334 Cell 178, 330–345, July 11, 2019

 A B C

D E F

G H I J

Figure 3. BACH1 Is Required for Antioxidant-Induced Metastasis and Can Induce Metastasis in the Absence of Antioxidants
(A) Left, Transwell migration assay of mTC and mTN cells incubated with 10 mM hemin for 24 h. Right, representative photos of migrated cells.
(B) Western blots showing amounts of BACH1 in mTC and mTN cells transduced with CAS9 and sgRNAs targeting Bach1; sgRNA targeting dTomato (Tom) was
used as control. HISTONE 3 (H3) was the loading control.
(C) Left, Transwell migration assay of mTN-sgBach1, mTN-sgTom, and control mTC cells (n = 2 biological replicates/condition). Right, representative photos of
migrated cells.
(D) Left, lung tumor burden in NSG recipient mice 3 weeks after i.v. injection of control and Bach1-deficient mTC and mTN cells (0.5 3 105 cells/mouse;
n = 5–8 mice/condition). Right, representative lung sections.

(legend continued on next page)

Cell 178, 330–345, July 11, 2019 335

addition of hemin, which degrades BACH1, reduced the high
migration rates of mTN cells but did not affect basal migration
of mTC cells (Figure 3A). CRISPR/CAS9-mediated knockout of
Bach1 did not affect the proliferation of mTC and mTN cells
but normalized the high migration rates of mTN cells (Figures
3B and 3C; Figure S4A). Bach1 knockout also prevented the
increased migration induced by NRF2 activation in mTC cells
(Figure S4B) and by antioxidant treatment in human lung cancer
cell lines (Figure S4C–S4F). In NSG mice, Bach1 knockout also
prevented mTN cells from metastasizing to the lung after i.v.
injection (Figure 3D), but it did not alter the growth of primary
tumors when the cells were injected subcutaneously (Fig-
ure S4G). We also used the pSECC lentivirus (Sánchez-Rivera
et al., 2014) for in vivo CRISPR/CAS9-mediated knockout of
Bach1 in KP tumors (Figure 3E). In line with the previous exper-
iment, BACH1 depletion in vivo prevented vitamin E-induced
authentic metastasis in KP mice without affecting the growth of
primary tumors (Figures 3F and S4H–S4J).
To determine whether BACH1 is sufficient to stimulate migra-
tion and metastasis we used the CRISPR-SAM (synergistic activa-
tion mediator) strategy to increase the expression of endogenous
BACH1 (Figure 3G). In naive mTC cell lines transduced with SAM-
sgBach1 constructs, BACH1 protein levels increased 4- to 6-fold,
which increased cell migration and invasion (Figures 3H–3J). The
ability of SAM-sgBach1 mTC cells to metastasize to the lung after
i.v. injection in NSG mice was 2.5-fold higher than in controls and
similar to that of mTN cells (Figure 3K). Moreover, transducing
A549 and H1975 human lung cancer cells with SAM-sgBACH1
increased endogenous BACH1 levels, stimulated migration, and
increased lung metastases by 3- to 4-fold (Figures S4K–S4N).
Genes Encoding the Glycolytic Enzymes HK2 and
GAPDH Are BACH1 Targets
To identify BACH1 target genes responsible for the increased
metastasis, we immunoprecipitated chromatin bound to
BACH1 in mTC and mTN cells and sequenced the associated
DNA (chromatin immunoprecipitation sequencing [ChIP-seq]).
The known BACH1 binding motif (from GEO: GSE31477) was
present in half of the identified target genes, as was a de novo
BACH1-like motif containing the ARE consensus motif (Fig-
ure S5A). Known BACH1 target genes were also identified (Fig-
ure S5B). BACH1 bound to several regions of the Hmox-1 pro-
moter in mTC and mTN cells, but binding levels did not differ
significantly (Figures S5B and S5C). Integrating ChIP-seq and
RNA-seq data revealed that BACH1 had bound to 240 differen-
tially expressed genes (Figure 4A).
Further analysis of these genes in the STRING database of
protein-protein interactions identified ‘‘metabolic process’’ as
one of three enriched networks (Figure 4A). Among the ‘‘meta-
bolic process’’ genes that showed higher BACH1 binding in
mTN than mTC cells, Hexokinase 2 (Hk2) was the most signifi-
cantly upregulated in the RNA-seq analysis (Figure 4B). We
confirmed that expression of Hk2 and also Gapdh, but not
Hk1, was 2- to 3-fold higher in mTN than mTC cells (Figures
4C and 4D). Analyses of Hk2 and Gapdh promoters revealed
that BACH1-binding sequences were present
300 base pairs
(bp) upstream of the annotated transcriptional start site (Fig-
ure 4E). ChIP-qPCR analyses confirmed the increased BACH1
occupancy on Hk2 and Gapdh promoters in mTN cells (Figures
4F, 4G, S5D and S5E).
To test whether the new BACH1-binding sequences partici-
pate in Hk2 and Gapdh transcriptional activation, we cloned
400- to 500-bp promoter regions containing the wild-type
BACH1 binding sequence, or a mutated version that would pre-
vent BACH1 binding, into luciferase reporter vectors (Figure 4E).
Luciferase activity from the Hk2 and Gapdh promoters was 4- to
5-fold higher in mTN than in mTC cells (Figures 4H and 4I).
Knockout of Bach1 essentially abolished the signal in mTN cells,
as did expressing the vectors with mutated sequences (Figures
4H and 4I). Thus, BACH1 stimulates transcription of Hk2 and
Gapdh, which raises the possibility that BACH1 regulates
glycolysis.
Antioxidants Stimulate Glycolysis in a
BACH1-Dependent Fashion
Glycolysis rates were 50% higher in mTN than in mTC cells, as
judged by analyses of the oxygen consumption rate (OCR) and
the extracellular acidification rate (ECAR); the OCR/ECAR ratio
was reduced correspondingly (Figures 5A, 5B, and S6A). This
was accompanied by increased glucose uptake and lactate
secretion (Figure 5C). The involvement of glycolysis prompted
further analyses of the RNA-seq data. In addition to Hk2 and
Gapdh, mTN cells had increased transcript levels of other glyco-
lytic enzymes, including 6-phosphofructo-2-kinase/fructose-2,6-
bisphosphatase 3 (Pfkfb3) and solute-carrier family 16 member
1 (Slc16a1, encoding the lactate transporter MCT-1) (Figure 5D).
Furthermore, analyses of the SEEK co-expression database
revealed that in 173 human lung cancer datasets BACH1 expres-
sion correlated with HK2 expression (Figure 5E) and tended to
correlate with PFKFB3 and SLC16A1 (Figure 5E).
We next determined whether BACH1 is functionally involved in
the increased glycolysis. Using the CRISPR-SAM approach, we

(E) Schematic showing intratracheal administration of pSECC lentiviruses encoding Cre recombinase, CAS9, and the gRNAs sgTom or sgBach1.
(F) Metastasis incidence in KP mice 8 months after intratracheal administration of pSECC-sgTom or -sgBach1 lentiviruses; vitamin E (VitE, 0.5 mg/kg) was
administered in the chow diet 1 week after the lentiviral infection.
(G) Schematic of the CRISPR/sgBach1-SAM strategy. sgRNAs target a CAS9-VP64 fusion to the Bach1 promoter, stimulating transcription of the endoge-
nous gene.
(H) Left, western blots showing amounts of BACH1 in mTC cells transduced with SAM-sgBach1; control cells received a nontargeting construct (SAM-sgTom).
H3 and ACTIN were loading controls. Right, amounts of BACH1 determined by densitometry in two experiments.
(I) Transwell migration of mTC-SAM-sgBach1 and mTC-SAM-sgTom cells. Right, representative photos of migrated cells.
(J) Transwell invasion assay of mTC-SAM-sgBach1 and mTC-SAM-sgTom cells.
(K) Lung tumor burden of NSG mice 3 weeks after i.v. injection of mTC-SAM-sgTom, mTC-SAM-sgBach1, and mTN cells (0.5 3 105 cells/mouse;
n = 5–10 mice/cell type).
****p < 0.0001; ***p < 0.005; **p < 0.01 *p < 0.05. See also Figure S4.

336 Cell 178, 330–345, July 11, 2019

 A B

C D E

F G H I

Figure 4. Combined Genome Occupancy and Transcriptomic Analyses Identify Hk2 and Gadph as BACH1 Target Genes
(A) Left, Venn-diagram showing overlap of 240 genes bound by BACH1 in ChIP-seq analyses (green) and genes regulated in RNA-seq analyses (blue). Right,
STRING analysis of protein-protein interactions (PPI) identified three clusters among the 240 genes: one centered around metabolic processes (circled), one
around RHO proteins, and a MYC-centered network. PPI enrichment, p = 4.31e–06.
(B) Plot of the 20 ‘‘metabolic process’’ genes. x axis, gene expression from RNA-seq data; y axis, level of BACH1 binding identified in the ChIP-seq data.
(C) qPCR analyses of RNA from mTC and mTN cells (n = 3). Values were normalized to Rplp0 expression and then to mTC.
(D) Top, western blots showing amounts of HK2 and GAPDH in mTC and mTN cells. Bottom, protein amounts determined by densitometry data from 3
and 1 experiments. respectively.
(E) Left, identification of BACH1-binding sites
300 bp upstream of transcriptional start sites (TSSs) of Hk2 and Gapdh. Red arrows show primers used for
ChIP-qPCR. Right, 400–500 bp of promoter sequences containing the wild-type BACH1 motifs (blue) or mutated motifs (red) were cloned into the pGL3 luciferase
reporter vector.
(F) BACH1 enrichment in promoter regions of Hk2 (compared with control IgG binding). Values are the mean of two experiments with two biological
replicates/condition.
(G) BACH1 enrichment in promoter regions of Gapdh (compared with IgG binding). Values are the mean of two experiments with two biological
replicates/condition.
(H) Luciferase activity of vectors reporting Hk2 promoter activity (shown in E) and transfected into mTC and mTN cells with and without BACH1 expression.
(I) Luciferase activity of vectors reporting Gapdh promoter activity.
Error bars indicate SEM. ****p < 0.0001; ***p < 0.005; **p < 0.01 *p < 0.05. See also Figure S5 and Table S1.

found that increasing BACH1 expression was sufficient to in-
crease glycolysis in naive lung cancer cells (Figures 5F, 5G,
and S6B). We also tested the effect of inhibiting BACH1 on
glycolysis with three strategies. First, knockout of Bach1
reduced Gapdh and Hk2 expression and abolished the
increased glycolysis rates, glucose uptake, pyruvate levels,
and lactate secretion of mTN cells (Figures 5H–5K, S6C, and
S6D). Similarly, knockout of BACH1 in A549, H1975, and H838
cells prevented antioxidant-induced glycolysis (Figures S6E–
S6H). Second, BACH1 suppression with shRNAs reduced

Cell 178, 330–345, July 11, 2019 337

 A B C D E

F G H I J K

L M N O

Figure 5. Antioxidants Stimulate Glycolysis in a BACH1-Dependent Fashion

(A) Glycolysis rates in mTC and mTN cells (n = 3), as judged by Seahorse analyses. Values were normalized to mTC.
(B) Ratio of basal OCR and ECAR (n = 3/cell type).
(C) Glucose uptake and lactate secretion (n = 3/cell type).
(D) Heatmap showing levels of transcripts for glycolytic genes identified in the RNA-seq analysis.
(E) Co-expression of BACH1 and HK2, PFKFB3, and SLC16A1 in human lung cancer (173 datasets). Data are from the SEEK co-expression database.
(F) Glycolysis rates of mTC-SAM-sgBach1 and control mTC-SAM-sgTom cells. Values are the mean of two experiments with two cell lines/condition normalized
to control.
(G) Lactate secretion by cells in (F).
(H) Glycolysis rates of mTC cells and control (sgTom) and Bach1-deficient mTN cells (n = 2/condition). Values are normalized to mTC.
(I) Glucose uptake by cells in (H).
(J) Pyruvate levels in cells in (H).
(K) Lactate secretion by cells in (H).
(L) Glycolysis rates of mTC and mTN cells incubated for 24 h with 5 mM of the NRF2-activating peptide KI-696 (n = 2).
(M) Hk2 and Gapdh expression determined by qPCR of RNA isolated from mTC and mTC-sgBach1 cells incubated for 24 h with KI-696.
(N) Glucose uptake by cells shown in (M).
(O) Lactate secretion by cells shown in (M).
Error bars indicate SEM. ****p < 0.0001; ***p < 0.005; **p < 0.01; *p < 0.05. See also Figure S6.

338 Cell 178, 330–345, July 11, 2019

A B C D E F

G H I J

K L

M N O P

Figure 6. HK2-Stimulated Glycolysis Mediates the Antioxidant- and BACH1-Induced Metastatic and Invasive Phenotype
(A) Top, western blot showing amounts of HK2 and BACH1 in mTC cells transduced with a control plasmid or a plasmid encoding human HK2 and their glycolysis
rates (bottom).
(legend continued on next page)

Cell 178, 330–345, July 11, 2019 339

Bach1 expression by 40%–60% and reduced Hk2 expression,
glycolysis rates, and migration of mTN cells to the levels in
mTC cells (Figures S6I–S6K). Third, hemin administration
reduced glycolysis rates specifically in mTN cells and reduced
migration and glycolysis in antioxidant-treated human NSCLC
cells (Figures S6L–S6Q).
Interestingly, KI-696-induced activation of NRF2, which stabi-
lized BACH1 and increased migration of mTC cells (Figures S3M
and S3N), increased glycolysis in mTC but not mTN cells (Figures
5L and S6R). NRF2-induced glycolysis was accompanied by
Bach1-dependent increases in Hk2 and Gapdh expression,
glucose uptake, and lactate secretion (Figures 5M–5O). We
conclude that BACH1 can stimulate glycolysis both in the pres-
ence and absence of exogenous antioxidants and in response to
NRF2 activation.
Glycolysis Drives Antioxidant- and BACH1-Dependent
and -Independent Migration and Metastasis
To determine whether the invasion and glycolysis phenotypes
are connected, we used genetic constructs to manipulate
glycolysis rates. Overexpressing human HK2 increased glycol-
ysis and migration of mTC and A549 cells without affecting
BACH1 levels (Figures 6A, 6B, S7A, and S7B). After i.v. injection
into NSG mice, mTC cells overexpressing HK2 produced
2.5-fold more lung metastases than control cells (Figure 6C),
and, after s.c. transplantation, they produced more and larger
lymph node metastases, despite producing slightly smaller pri-
mary tumors (Figures 6D–6F). Conversely, overexpressing the
catalytic subunit of human glucose-6-phosphatase reduced
glycolysis rates and migration of mTN cells and significantly
reduced lung metastases after i.v. injection into NSG mice (Fig-
ures 6G–6I). Furthermore, short hairpin RNA (shRNA)-mediated
suppression of Hk2 reversed BACH1-induced glycolysis and
migration of mTC-SAM-sgBach1 cells (Figures 6J–6L). One
advantage of a high glycolysis rate is that it can increase ATP
production rates and total ATP levels, which fuel cell motility
(Cairns et al., 2011; Liberti and Locasale, 2016; Pollard and
Borisy, 2003; Shiraishi et al., 2015). Indeed, mTN cells and anti-
oxidant-treated A549 cells had higher glycolysis-derived and
total ATP production rates than controls and higher steady-
state ATP levels (Figures 6M–6O, S7C, and S7D). The increased
ATP availability of mTN cells was normalized in Bach1-
knockout cells (Figure 6P).
Targeting Glycolysis Prevents Antioxidant- and
BACH1-Stimulated Metastasis
Next, we evaluated how drugs that activate or inhibit enzymes
associated with glycolysis affect antioxidant- and BACH1-
induced migration (Figure 7A). In response to high doses of
2-deoxyglucose (2-DG), mTN cells had 50% lower viability, indi-
cating greater dependence on glycolysis, than mTC cells (Fig-
ure 7B). Nontoxic inhibition of glycolysis around the hexokinase
step with 2-DG and the HK2 inhibitor lonidamine reduced glycol-
ysis rates and the antioxidant-induced migration of mTN cells
and also the basal migration of mTC cells (Figures 7C–7E).
2-DG and lonidamine also reversed BACH1-induced migration
of mTC-SAM-sgBach1 cells (Figure S7E). Inhibiting GAPDH
with 3-bromopyruvate (3-BP) specifically prevented antioxi-
dant-induced migration of mTN cells (Figures 7F and 7G), as
did dicholoroacetate, a pyruvate dehydrogenase kinase inhibitor
that inhibits lactate production (Figure 7H) (Michelakis et al.,
2008). Inhibiting mitochondrial import of pyruvate with the mito-
chondrial pyruvate carrier (MPC) inhibitor UK5099 did not influ-
ence migration (Figure S7F); however, inhibiting lactate transport
out from the cell with the MCT-1 inhibitor AZD3965 specifically
prevented mTN migration (Figure 7I, S7G, and S7H). Inhibiting
lactate secretion also prevented antioxidant-induced migration
of A549 cells (Figure S7I). The GAPDH and lactate secretion
steps are important in human LUAD as high expression of
GAPDH and SLC16A1 is associated with reduced survival (Fig-
ures S7J and S7K). Last, the pentose-phosphate pathway
(PPP) provides reducing power in the form of NADP(H) and can
contribute to the increased fitness of cells performing aerobic
glycolysis (Vander Heiden et al., 2009). However, incubating
cells with the PPP inhibitor 6-aminonicotinamide (6-AN) did not
influence the migration of mTN or mTC cells, despite inhibition
of NADPH production (Figures S7L and S7M). Thus, the HK2,
GAPDH, and MCT-1 steps of glycolysis are required for antioxi-
dant-induced migration, whereas the PPP and MPC steps are
not. To determine whether glycolysis inhibition would influence
antioxidant-induced metastasis in vivo, we chose 3-BP and
AZD3965 as they specifically blocked migration of mTN cells.

(B) Migration of cells shown in (A).

(C) Lung tumor burden of NSG mice 3 weeks after i.v. injection of mTC and mTC-HK2 cells (0.5 3 105; n = 6 mice/cell type).
(D) Incidence of lymph node (LN) metastasis of NSG recipient mice 5 weeks after s.c. injection of mTC and mTC-HK2 cells (2.5 3 105; n = 17 and
18 mice/cell type).
(E) Size mm3 of lymph node metastases of mice in (D).
(F) Weight of primary s.c. tumors of mice in (D).
(G) Glycolysis rates of mTN cells transduced with a control plasmid or a plasmid encoding the catalytic subunit of G6PC3.
(H) Migration of cells shown in (G).
(I) Lung tumor burden of NSG mice 3 weeks after i.v. injection of mTN and mTN-G6PC3 cells (0.5 3 105; n = 6 mice/cell type).
(J) Western blot showing levels of HK2 in mTC-SAM-sgTom and mTC-SAM-sgBach1 after retroviral transduction of two different Hk2 shRNAs.
(K) Glycolysis rates of cells shown in (J).
(L) Left, Transwell migration assay of mTC-SAM-sgTom and mTC-SAM-sgBach1 after retroviral transduction of Hk2 shRNAs. Right, representative photos of
migrated cells.
(M) Glycolysis-derived ATP production rate of mTC and mTN cells (n = 3) as judged by Seahorse analyses.
(N) Total ATP production rate of mTC and mTN cells (n = 3) as judged by Seahorse analyses.
(O) Steady-state ATP levels in mTC and mTN cells (n = 3).
(P) Steady-state ATP levels in mTC and mTN cells with and without BACH1 expression (n = 2).
Error bars indicate SEM. ***p < 0.0001; ***p < 0.005; **p < 0.01; *p < 0.05. See also Figure S7.

340 Cell 178, 330–345, July 11, 2019

 A B C

D E

F G H I

J K

Figure 7. Targeting Glycolysis Inhibits Antioxidant- and BACH1-Induced Migration and Metastasis
(A) Schematic of glycolysis and inhibitors (red) and an activator (green) used to define the role of an enzymatic step in the ability of antioxidants to increase cell
migration. Blue ovals, proteins whose genes were increased in mTN versus mTC cells. Red oval, gene reduced in mTN cells.
(B) Survival of mTC and mTN cells (n = 3) incubated for 48 h with the glycolysis inhibitor 2-DG. Values are the percentage of untreated mTC cells.

(legend continued on next page)

Cell 178, 330–345, July 11, 2019 341

Both inhibitors reduced lung metastases of mTN cells, but 3-BP
was more effective (Figure 7J) and also reduced lung metastases
of mTC-SAM-Bach1 cells (Figure 7K).
DISCUSSION
This study identifies BACH1-induced glycolysis as a new
mechanism that drives lung cancer metastasis, which can be
stimulated by antioxidants and inhibited by oxidative stress.
The results are relevant to the debate on the promises and perils
of antioxidant supplementation, especially for lung cancer
patients and for the 30% of them who harbor KEAP1/NRF2 mu-
tations (Berger et al., 2016).
Metastasis requires at least six steps: detachment, intravasa-
tion, immune evasion, survival in circulation, extravasation, and
colonization in a distant organ. We find that antioxidant-induced
BACH1 stabilization increases the efficiency of several of these
steps. BACH1 was involved in antioxidant-induced metastasis
in KP mice and metastasis from subcutaneously transplanted
tumor cells, which involves all six steps. BACH1 was both required
and sufficient for metastasis in the i.v. transplantation experiments,
which involves the last three steps. Immune evasion is likely a less
important factor because the effect was cell autonomous and
observed in immune-competent and immune-deficient mice.
Antioxidants stimulated metastasis in the presence and
absence of p53. However, in early lung tumors, antioxidants accel-
erate progression only when p53 is present (Sayin et al., 2014).
Indeed, p53 appears to underlie the effects observed in those
studies. Thus, the mechanisms underlying ROS-mediated barriers
to tumor progression differ depending on the stage of tumor devel-
opment. Previous studies concluded that the K mouse model is
metastasis resistant in the absence of cooperating mutations—
although advanced-grade adenocarcinoma are observed (Fisher
et al., 2001; Jackson et al., 2001, 2005; Meuwissen et al., 2001;
Sutherland et al., 2014). Therefore, metastasis in the presence of
p53 was surprising. But similarly, antioxidants activated BACH1,
glycolysis, and migration in human NSCLC cells with and without
known TP53 mutations. Thus, BACH1 enables antioxidants to
overcome p53’s potent metastasis-inhibiting activity.
We find that BACH1 is stabilized by antioxidants and that this
effect is driven by reduced levels of ROS and free heme. The
latter result confirms reports that free heme stimulates nuclear
export and proteasomal degradation of BACH1 (Gozzelino
et al., 2010; Pamplona et al., 2007; Suzuki et al., 2004; Zenke-
Kawasaki et al., 2007). In a companion paper, Lignitto et al.
show that heme induces BACH1 degradation by stimulating an
interaction with the ubiquitin ligase FBXO22. They also show
that NRF2 activation stimulates lung cancer metastasis by
inducing HO-1, leading to heme degradation, FBXO22 uncou-
pling, and BACH1 stabilization. Consequently, in that study,
high BACH1 levels stimulated metastasis in the setting of high
NRF2 activity. In contrast, antioxidant supplementation sup-
pressed the activity of NRF2 in lung cancer cells—and thus
reduced the expression of NRF2-target genes—without altering
Hmox1 transcripts or HO-1 protein levels. Thus, in our study,
high BACH1 levels stimulated metastasis in the setting of low
NRF2 activity. Our two studies provide complementary evidence
that BACH1 stabilization stimulates lung cancer metastasis and
that BACH1 can be stabilized by both exogenous and endoge-
nous antioxidants. But importantly, we also find that BACH1 is
pro-metastatic in the absence of antioxidants.
Aerobic glycolysis, a hallmark of progression and metastasis,
has not been associated with antioxidant effects or with BACH1
(Hanahan and Weinberg, 2011). We found that BACH1 binds to
the Hk2 and Gapdh promoters after antioxidant administration,
stimulating their expression and that of several other glycolytic
genes, and increases glucose uptake, glycolysis rates, and
lactate secretion. Moreover, in human lung cancer datasets,
BACH1 is co-expressed with HK2. Interestingly, NRF2’s ability
to increase tumor progression has been linked to glycolysis (Mit-
suishi et al., 2012; Rojo de la Vega et al., 2018; Sayin et al., 2017;
Zhang et al., 2018). We found that NRF2 activation, like antioxi-
dant supplementation, increases Hk2 and Gapdh transcription,
stimulates glycolysis, and increases migration of naive lung
cancer cells in a BACH1-dependent fashion. Thus, a possible
advantage for cancer cells harboring NRF2/KEAP1 mutations
is activation of BACH1-induced glycolysis.
How aerobic glycolysis drives cancer cell invasion has been
studied for decades, and, although there is no unifying hypothesis,
several explanations have been proposed (Elia et al., 2018; Liberti
and Locasale, 2016; Payen et al., 2016). By-products of glycol-
ysis, such as methylglyoxal, stimulate cell motility by activating
the epithelial-mesenchymal transition. Extracellular acidification
by lactate triggers apoptosis of neighboring healthy cells and se-
lects for low pH-resistant cancer cells; lactate also controls tumor
cell adhesion to the extracellular matrix by modulating integrin-
collagen interactions and by stimulating the secretion of matrix-
degrading enzymes. Furthermore, aerobic glycolysis increases
ATP levels; if this happens near filopodia, lamellipodia, and actin
fibers, it could fuel the rapid cytoskeletal remodeling required for

(C) Glycolytic rates of mTN cells (n = 3) incubated for 24 h with 50 mM lonidamine (LND, a glycolysis inhibitor) and 25 mM 3-BP.
(D) Migration of mTC and mTN cells (n = 3) incubated with 1 mM 2-DG.
(E) Migration of mTC and mTN cells (n = 3) incubated with 50 mM LND.
(F) Migration of mTC and mTN cells (n = 3) incubated with 25 mM of the glycolysis inhibitor 3-bromopyruvate (3-BP).
(G) Glycolytic rates of mTC and mTN cells (n = 3) incubated for 24 h with 25 mM 3-BP.
(H) Migration of mTC and mTN cells incubated with 10 mM of the pyruvate dehydrogenase kinase inhibitor dicholoroacetate (DCA).
(I) Migration of cells incubated with 1 and 10 mM of the lactate secretion inhibitor AZD3965.
(J) Lung tumor burden of NSG mice 3 weeks after i.v. injection of mTC and mTN cells (0.5 3 105; n = 3–9 mice/condition). The mice were injected four times (1/day)
with AZD3965 (100 mg/kg, oral gavage) or 3-BP (10 mg/kg, i.p.), starting the day after cell injection.
(K) Lung tumor burden of NSG mice 3 weeks after i.v. injection of mTC-SAM-sgBach1 cells (0.5 3 105; n = 4 mice/condition). The mice were injected four times
(1/day) with 3-BP (10 mg/kg, i.p.), starting the day after cell injection.
In (D)–(F), (H), and (I), y axes show cell migration as a percentage of scratch-wound closure. Error bars indicate SEM. ****p < 0.0001; ***p < 0.005; **p < 0.01;
*p < 0.05. See also Figure S7.

342 Cell 178, 330–345, July 11, 2019

migration (De Bock et al., 2013). However, a simple explanation is
that multiple mechanisms contribute to glycolysis-driven inva-
sion. Although our results do not allow us to distinguish between
these possibilities, they establish that antioxidant- and BACH1-
induced invasion depends entirely on glycolysis and lactate
secretion and is associated with high ATP production rates.
Our findings raise the possibility that targeting BACH1 or pro-
teins up- or downstream might inhibit lung cancer metastasis.
Such a strategy might be effective in patients with NRF2/
KEAP1 mutations, who would be expected to have tumors
with high BACH1 levels. Targeting metastasis would make sense
in conjunction with surgery or radiotherapy. One potential strat-
egy would be to target glycolysis (Liberti et al., 2017; Porporato
et al., 2011; Polanski et al., 2014). Indeed, the MCT-1 inhibitor
AZD3965 blocked BACH1-induced lung cancer cell migration
and reduced metastasis. The GAPDH inhibitor 3-BP reduced
metastasis more efficiently than AZD3965 but has been associ-
ated with severe side effects in some studies. Regardless, our
results suggest that lung cancer cells with high BACH1 levels
possess a strong metabolic liability—a finding that warrants
further exploration.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d LEAD CONTACT AND MATERIALS AVAILABILITY
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Mice, Lung Cancer Experiments, and Antioxidant
Administration
B Cell Culture and Regents
d METHODS DETAILS
B Histology and Immunohistochemical Analyses
B Immunohistofluorescence
B Migration and Invasion Assays
B ROS Measurements
B GSH, NADH and NADPH Measurements
B Free Heme Measurements
B Lentiviral Production and Transduction
B Western Blotting
B Cell Viability Assay
B Extracellular Flux Measurements
B Total ATP, Glucose Uptake and Lactate Secretion
B RNA-Sequencing and Bioinformatics
B Real-Time Quantitative PCR
B Chromatin Immunoprecipitation-Sequencing
(ChIP-Seq)
B ChIP-qPCR
B Luciferase Assays
d QUANTIFICATION AND STATISTICAL ANALYSIS
d DATA AND CODE AVAILABILITY
SUPPLEMENTAL INFORMATION
Supplemental Information can be found online at https://doi.org/10.1016/j.
cell.2019.06.005.
ACKNOWLEDGMENTS
We thank O. Persson and E. Tüksammel for help with mouse experiments, C.
Karlsson for histology, S. Ordway for editing the manuscript, and The Feno
core facility at the Department of Laboratory Medicine for histology. The study
was supported by grants from the Knut and Alice Wallenberg Foundation, Sjö-
berg Foundation, Strategic Research Program in Cancer at Karolinska Institu-
tet, Center for Innovative Medicine, Swedish Cancer Society, Medical
Research Council, and Children’s Cancer Fund to M.O.B.; The Swedish Soci-
ety for Medical Research, Medical Research Council, and Wallenberg Center
for Molecular and Translational Medicine to V.I.S.; and the Alex and Eva Wall-
ström Foundation to C.W. C.W. holds a Marie Slowdoska-Curie Individual
Fellowship and a Swedish Cancer Society Fellowship.
AUTHOR CONTRIBUTIONS
Conceptualization, C.W., P.L., V.I.S., and M.O.B.; Methodology, C.W., K.L.G.,
M.X.I., X.X., T.M., and V.I.S.; Software, M.X.I. and M.K.; Formal Analysis, C.W.,
K.L.G., M.K., C.K., P.L., and V.I.S.; Investigation, C.W., K.L.G., M.X.I., C.A.J.,
H.Y., D.V.Z., and T.G.; Original Draft, C.W., V.I.S., and M.O.B.; Review and Ed-
iting, C.W., V.I.S., and M.O.B.; Visualization, C.W.; Supervision, C.W., V.I.S.
and M.O.B.; Funding Acquisition, C.W., V.I.S., and M.O.B.
DECLARATION OF INTERESTS
The authors declare no competing interests.
Received: November 25, 2018
Revised: March 29, 2019
Accepted: June 3, 2019
Published: June 27, 2019
REFERENCES
Anders, S., Pyl, P.T., and Huber, W. (2015). HTSeq–a Python framework to
work with high-throughput sequencing data. Bioinformatics 31, 166–169.
Berger, A.H., Brooks, A.N., Wu, X., Shrestha, Y., Chouinard, C., Piccioni, F.,
Bagul, M., Kamburov, A., Imielinski, M., Hogstrom, L., et al. (2016). High-
throughput Phenotyping of Lung Cancer Somatic Mutations. Cancer Cell 30,
214–228.
Best, S.A., De Souza, D.P., Kersbergen, A., Policheni, A.N., Dayalan, S., Tull,
D., Rathi, V., Gray, D.H., Ritchie, M.E., McConville, M.J., and Sutherland,
K.D. (2018). Synergy between the KEAP1/NRF2 and PI3K Pathways Drives
Non-Small-Cell Lung Cancer with an Altered Immune Microenvironment.
Cell Metab. 27, 935–943.e4.
Boehm, J.S., Zhao, J.J., Yao, J., Kim, S.Y., Firestein, R., Dunn, I.F., Sjostrom,
S.K., Garraway, L.A., Weremowicz, S., Richardson, A.L., et al. (2007). Integra-
tive genomic approaches identify IKBKE as a breast cancer oncogene. Cell
129, 1065–1079.
Bray, F., Ferlay, J., Soerjomataram, I., Siegel, R.L., Torre, L.A., and Jemal, A.
(2018). Global cancer statistics 2018: GLOBOCAN estimates of incidence
and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin.
68, 394–424.
Cairns, R.A., Harris, I.S., and Mak, T.W. (2011). Regulation of cancer cell meta-
bolism. Nat. Rev. Cancer 11, 85–95.
Chio, I.I.C., and Tuveson, D.A. (2017). ROS in Cancer: The Burning Question.
Trends Mol. Med. 23, 411–429.
De Bock, K., Georgiadou, M., Schoors, S., Kuchnio, A., Wong, B.W., Can-
telmo, A.R., Quaegebeur, A., Ghesquière, B., Cauwenberghs, S., Eelen, G.,
et al. (2013). Role of PFKFB3-driven glycolysis in vessel sprouting. Cell 154,
651–663.
DeNicola, G.M., Karreth, F.A., Humpton, T.J., Gopinathan, A., Wei, C., Frese,
K., Mangal, D., Yu, K.H., Yeo, C.J., Calhoun, E.S., et al. (2011). Oncogene-
induced Nrf2 transcription promotes ROS detoxification and tumorigenesis.
Nature 475, 106–109.
Cell 178, 330–345, July 11, 2019 343
Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut,
P., Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq
aligner. Bioinformatics 29, 15–21.
DuPage, M., Dooley, A.L., and Jacks, T. (2009). Conditional mouse lung cancer
models using adenoviral or lentiviral delivery of Cre recombinase. Nat. Protoc.
4, 1064–1072.
Elia, I., Doglioni, G., and Fendt, S.-M. (2018). Metabolic Hallmarks of Metas-
tasis Formation. Trends Cell Biol. 28, 673–684.
Espinas, N.A., Kobayashi, K., Takahashi, S., Mochizuki, N., and Masuda, T.
(2012). Evaluation of unbound free heme in plant cells by differential acetone
extraction. Plant Cell Physiol. 53, 1344–1354.
Finkel, T. (2011). Signal transduction by reactive oxygen species. J. Cell Biol.
194, 7–15.
Fisher, G.H., Wellen, S.L., Klimstra, D., Lenczowski, J.M., Tichelaar, J.W.,
Lizak, M.J., Whitsett, J.A., Koretsky, A., and Varmus, H.E. (2001). Induction
and apoptotic regression of lung adenocarcinomas by regulation of a K-Ras
transgene in the presence and absence of tumor suppressor genes. Genes
Dev. 15, 3249–3262.
Furukawa, C., Daigo, Y., Ishikawa, N., Kato, T., Ito, T., Tsuchiya, E., Sone, S.,
and Nakamura, Y. (2005). Plakophilin 3 oncogene as prognostic marker and
therapeutic target for lung cancer. Cancer Res. 65, 7102–7110.
Gitenay, D., Wiel, C., Lallet-Daher, H., Vindrieux, D., Aubert, S., Payen, L.,
Simonnet, H., and Bernard, D. (2014). Glucose metabolism and hexosamine
pathway regulate oncogene-induced senescence. Cell Death Dis. 5, e1089.
Gorrini, C., Harris, I.S., and Mak, T.W. (2013). Modulation of oxidative stress as
an anticancer strategy. Nat. Rev. Drug Discov. 12, 931–947.
Gozzelino, R., Jeney, V., and Soares, M.P. (2010). Mechanisms of cell protec-
tion by heme oxygenase-1. Annu. Rev. Pharmacol. Toxicol. 50, 323–354.
Gutscher, M., Sobotta, M.C., Wabnitz, G.H., Ballikaya, S., Meyer, A.J., Sam-
stag, Y., and Dick, T.P. (2009). Proximity-based protein thiol oxidation by
H2O2-scavenging peroxidases. J. Biol. Chem. 284, 31532–31540.
Hanahan, D., and Weinberg, R.A. (2011). Hallmarks of cancer: the next gener-
ation. Cell 144, 646–674.
Hanna, D.A., Harvey, R.M., Martinez-Guzman, O., Yuan, X., Chandrasekharan,
B., Raju, G., Outten, F.W., Hamza, I., and Reddi, A.R. (2016). Heme dynamics
and trafficking factors revealed by genetically encoded fluorescent heme
sensors. Proc. Natl. Acad. Sci. USA 113, 7539–7544.
Hayes, J.D., McMahon, M., Chowdhry, S., and Dinkova-Kostova, A.T. (2010).
Cancer chemoprevention mechanisms mediated through the Keap1-Nrf2
pathway. Antioxid. Redox Signal. 13, 1713–1748.
Jackson, E.L., Willis, N., Mercer, K., Bronson, R.T., Crowley, D., Montoya, R.,
Jacks, T., and Tuveson, D.A. (2001). Analysis of lung tumor initiation and
progression using conditional expression of oncogenic K-ras. Genes Dev.
15, 3243–3248.
Jackson, E.L., Olive, K.P., Tuveson, D.A., Bronson, R., Crowley, D., Brown, M.,
and Jacks, T. (2005). The differential effects of mutant p53 alleles on advanced
murine lung cancer. Cancer Res. 65, 10280–10288.
Jeong, Y., Hoang, N.T., Lovejoy, A., Stehr, H., Newman, A.M., Gentles, A.J.,
Kong, W., Truong, D., Martin, S., Chaudhuri, A., et al. (2017). Role of KEAP1/
NRF2 and TP53 mutations in lung squamous cell carcinoma development
and radiation resistance. Cancer Discov. 7, 86–101.
Joung, J., Konermann, S., Gootenberg, J.S., Abudayyeh, O.O., Platt, R.J., Brig-
ham, M.D., Sanjana, N.E., and Zhang, F. (2017). Genome-scale CRISPR-Cas9
knockout and transcriptional activation screening. Nat. Protoc. 12, 828–863.
Kim, C.F.B.F.B., Jackson, E.L.L., Kirsch, D.G.G., Grimm, J., Shaw, A.T., Lane,
K., Kissil, J., Olive, K.P.P., Sweet-Cordero, A., Weissleder, R., and Jacks, T.
(2005). Mouse models of human non-small-cell lung cancer: raising the bar.
Cold Spring Harb. Symp. Quant. Biol. 70, 241–250.
Klein, E.A., Thompson, I.M., Jr., Tangen, C.M., Crowley, J.J., Lucia, M.S.,
Goodman, P.J., Minasian, L.M., Ford, L.G., Parnes, H.L., Gaziano, J.M.,
et al. (2011). Vitamin E and the risk of prostate cancer: the Selenium and
Vitamin E Cancer Prevention Trial (SELECT). JAMA 306, 1549–1556.
344 Cell 178, 330–345, July 11, 2019
Kwon, M.C., and Berns, A. (2013). Mouse models for lung cancer. Mol. Oncol.
7, 165–177.
Le Gal, K., Ibrahim, M.X., Wiel, C., Sayin, V.I., Akula, M.K., Karlsson, C., Dalin,
M.G., Akyürek, L.M., Lindahl, P., Nilsson, J., and Bergo, M.O. (2015). Antioxi-
dants can increase melanoma metastasis in mice. Sci. Transl. Med. 7, 308re8.
Liang, Y., Wu, H., Lei, R., Chong, R.A., Wei, Y., Lu, X., Tagkopoulos, I., Kung,
S.Y., Yang, Q., Hu, G., and Kang, Y. (2012). Transcriptional network analysis
identifies BACH1 as a master regulator of breast cancer bone metastasis.
J. Biol. Chem. 287, 33533–33544.
Liberti, M.V., and Locasale, J.W. (2016). The Warburg Effect: How Does it
Benefit Cancer Cells? Trends Biochem. Sci. 41, 211–218.
Liberti, M.V., Dai, Z., Wardell, S.E., Baccile, J.A., Liu, X., Gao, X., Baldi, R.,
Mehrmohamadi, M., Johnson, M.O., Madhukar, N.S., et al. (2017). A Predictive
Model for Selective Targeting of the Warburg Effect through GAPDH Inhibition
with a Natural Product. Cell Metab. 26, 648–659.
Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold
change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550.
Marino, S., Vooijs, M., van Der Gulden, H., Jonkers, J., and Berns, A. (2000).
Induction of medulloblastomas in p53-null mutant mice by somatic inactivation
of Rb in the external granular layer cells of the cerebellum. Genes Dev. 14,
994–1004.
Meuwissen, R., Linn, S.C., van der Valk, M., Mooi, W.J., and Berns, A. (2001).
Mouse model for lung tumorigenesis through Cre/lox controlled sporadic acti-
vation of the K-Ras oncogene. Oncogene 20, 6551–6558.
Meuwissen, R., Linn, S.C., Linnoila, R.I., Zevenhoven, J., Mooi, W.J., and
Berns, A. (2003). Induction of small cell lung cancer by somatic inactivation
of both Trp53 and Rb1 in a conditional mouse model. Cancer Cell 4, 181–189.
Michelakis, E.D., Webster, L., and Mackey, J.R. (2008). Dichloroacetate (DCA) as
a potential metabolic-targeting therapy for cancer. Br. J. Cancer 99, 989–994.
Mitsuishi, Y., Taguchi, K., Kawatani, Y., Shibata, T., Nukiwa, T., Aburatani, H.,
Yamamoto, M., and Motohashi, H. (2012). Nrf2 redirects glucose and glutamine
into anabolic pathways in metabolic reprogramming. Cancer Cell 22, 66–79.
Morgan, B., Sobotta, M.C., and Dick, T.P. (2011). Measuring E(GSH) and H2O2
with roGFP2-based redox probes. Free Radic. Biol. Med. 51, 1943–1951.
Morishita, A., Zaidi, M.R., Mitoro, A., Sankarasharma, D., Szabolcs, M.,
Okada, Y., D’Armiento, J., and Chada, K. (2013). HMGA2 is a driver of tumor
metastasis. Cancer Res. 73, 4289–4299.
Pamplona, A., Ferreira, A., Balla, J., Jeney, V., Balla, G., Epiphanio, S., Chora,
A., Rodrigues, C.D., Gregoire, I.P., Cunha-Rodrigues, M., et al. (2007). Heme
oxygenase-1 and carbon monoxide suppress the pathogenesis of experi-
mental cerebral malaria. Nat. Med. 13, 703–710.
Payen, V.L., Porporato, P.E., Baselet, B., and Sonveaux, P. (2016). Metabolic
changes associated with tumor metastasis, part 1: tumor pH, glycolysis and
the pentose phosphate pathway. Cell. Mol. Life Sci. 73, 1333–1348.
Piskounova, E., Agathocleous, M., Murphy, M.M., Hu, Z., Huddlestun, S.E.,
Zhao, Z., Leitch, A.M., Johnson, T.M., DeBerardinis, R.J., and Morrison, S.J.
(2015). Oxidative stress inhibits distant metastasis by human melanoma cells.
Nature 527, 186–191.
Polanski, R., Hodgkinson, C.L., Fusi, A., Nonaka, D., Priest, L., Kelly, P., Tra-
pani, F., Bishop, P.W., White, A., Critchlow, S.E., et al. (2014). Activity of the
monocarboxylate transporter 1 inhibitor AZD3965 in small cell lung cancer.
Clin. Cancer Res. 20, 926–937.
Pollard, T.D., and Borisy, G.G. (2003). Cellular motility driven by assembly and
disassembly of actin filaments. Cell 112, 453–465.
Porporato, P.E., Dhup, S., Dadhich, R.K., Copetti, T., and Sonveaux, P. (2011).
Anticancer targets in the glycolytic metabolism of tumors: a comprehensive
review. Front. Pharmacol. 2, 49.
Rojo de la Vega, M., Chapman, E., and Zhang, D.D. (2018). NRF2 and the Hall-
marks of Cancer. Cancer Cell 34, 21–43.
Romero, R., Sayin, V.I., Davidson, S.M., Bauer, M.R., Singh, S.X., LeBoeuf,
S.E., Karakousi, T.R., Ellis, D.C., Bhutkar, A., Sánchez-Rivera, F.J., et al.
(2017). Keap1 loss promotes Kras-driven lung cancer and results in depen-
dence on glutaminolysis. Nat. Med. 23, 1362–1368.
Sabharwal, S.S., and Schumacker, P.T. (2014). Mitochondrial ROS in cancer:
initiators, amplifiers or an Achilles’ heel? Nat. Rev. Cancer 14, 709–721.
Sánchez-Rivera, F.J., Papagiannakopoulos, T., Romero, R., Tammela, T., Ba-
uer, M.R., Bhutkar, A., Joshi, N.S., Subbaraj, L., Bronson, R.T., Xue, W., and
Jacks, T. (2014). Rapid modelling of cooperating genetic events in cancer
through somatic genome editing. Nature 516, 428–431.
Sayin, V.I., Ibrahim, M.X., Larsson, E., Nilsson, J.A., Lindahl, P., and Bergo,
M.O. (2014). Antioxidants Accelerate Lung Cancer Progression in Mice. Sci.
Transl. Med. 6, 221ra15–221ra15.
Sayin, V.I., LeBoeuf, S.E., Singh, S.X., Davidson, S.M., Biancur, D., Guzelhan,
B.S., Alvarez, S.W., Wu, W.L., Karakousi, T.R., Zavitsanou, A.M., et al. (2017).
Activation of the NRF2 antioxidant program generates an imbalance in central
carbon metabolism in cancer. eLife 6, 1–23.
Shiraishi, T., Verdone, J.E., Huang, J., Kahlert, U.D., Hernandez, J.R., Torga,
G., Zarif, J.C., Epstein, T., Gatenby, R., McCartney, A., et al. (2015). Glycolysis
is the primary bioenergetic pathway for cell motility and cytoskeletal remodel-
ing in human prostate and breast cancer cells. Oncotarget 6, 130–143.
Singh, A., Misra, V., Thimmulappa, R.K., Lee, H., Ames, S., Hoque, M.O., Her-
man, J.G., Baylin, S.B., Sidransky, D., Gabrielson, E., et al. (2006). Dysfunc-
tional KEAP1-NRF2 interaction in non-small-cell lung cancer. PLoS Med.
3, e420.
Sun, J., Brand, M., Zenke, Y., Tashiro, S., Groudine, M., and Igarashi, K. (2004).
Heme regulates the dynamic exchange of Bach1 and NF-E2-related factors
in the Maf transcription factor network. Proc. Natl. Acad. Sci. USA 101,
1461–1466.
Sutherland, K.D., Song, J.-Y., Kwon, M.C., Proost, N., Zevenhoven, J., and
Berns, A. (2014). Multiple cells-of-origin of mutant K-Ras-induced mouse
lung adenocarcinoma. Proc. Natl. Acad. Sci. USA 111, 4952–4957.
Suzuki, H., Tashiro, S., Hira, S., Sun, J., Yamazaki, C., Zenke, Y., Ikeda-Saito,
M., Yoshida, M., and Igarashi, K. (2004). Heme regulates gene expression by
triggering Crm1-dependent nuclear export of Bach1. EMBO J. 23, 2544–2553.
Taguchi, K., Motohashi, H., and Yamamoto, M. (2011). Molecular mechanisms
of the Keap1–Nrf2 pathway in stress response and cancer evolution. Genes
Cells 16, 123–140.
Alpha-Tocopherol, Beta Carotene Cancer Prevention Study Group. (1994).
The effect of vitamin E and beta carotene on the incidence of lung cancer
and other cancers in male smokers. The Alpha-Tocopherol, Beta Carotene
Cancer Prevention Study Group. N. Engl. J. Med. 330, 1029–1035.
Toruner, G.A., Ulger, C., Alkan, M., Galante, A.T., Rinaggio, J., Wilk, R., Tian,
B., Soteropoulos, P., Hameed, M.R., Schwalb, M.N., and Dermody, J.J.
(2004). Association between gene expression profile and tumor invasion in
oral squamous cell carcinoma. Cancer Genet. Cytogenet. 154, 27–35.
van Zandwijk, N., Dalesio, O., Pastorino, U., de Vries, N., and van Tinteren, H.
(2000). EUROSCAN, a randomized trial of vitamin A and N-acetylcysteine in
patients with head and neck cancer or lung cancer. For the EUropean Organi-
zation for Research and Treatment of Cancer Head and Neck and Lung Cancer
Cooperative Groups. J. Natl. Cancer Inst. 92, 977–986.
Vander Heiden, M., Cantley, L., and Thompson, C. (2009). Understanding the
Warburg effect: The metabolic Requirements of cell proliferation. Science 324,
1029–1033.
Wang, H., Liu, X., Long, M., Huang, Y., Zhang, L., Zhang, R., Zheng, Y., Liao,
X., Wang, Y., Liao, Q., et al. (2016). NRF2 activation by antioxidant antidiabetic
agents accelerates tumor metastasis. Sci. Transl. Med. 8,, 334ra51–334ra51.
Weinberg, F., Hamanaka, R., Wheaton, W.W., Weinberg, S., Joseph, J.,
Lopez, M., Kalyanaraman, B., Mutlu, G.M., Budinger, G.R.S., and Chandel,
N.S. (2010). Mitochondrial metabolism and ROS generation are essential for
Kras-mediated tumorigenicity. Proc. Natl. Acad. Sci. USA 107, 8788–8793.
Winslow, M.M., Dayton, T.L., Verhaak, R.G.W., Kim-Kiselak, C., Snyder, E.L.,
Feldser, D.M., Hubbard, D.D., DuPage, M.J., Whittaker, C.A., Hoersch, S.,
et al. (2011). Suppression of lung adenocarcinoma progression by Nkx2-1.
Nature 473, 101–104.
Yu, G., Wang, L.-G., Han, Y., and He, Q.-Y. (2012). clusterProfiler: an R pack-
age for comparing biological themes among gene clusters. OMICS 16,
284–287.
Yun, J., Frankenberger, C.A., Kuo, W.L., Boelens, M.C., Eves, E.M., Cheng, N.,
Liang, H., Li, W.H., Ishwaran, H., Minn, A.J., and Rosner, M.R. (2011). Signal-
ling pathway for RKIP and Let-7 regulates and predicts metastatic breast
cancer. EMBO J. 30, 4500–4514.
Zenke-Kawasaki, Y., Dohi, Y., Katoh, Y., Ikura, T., Ikura, M., Asahara, T.,
Tokunaga, F., Iwai, K., and Igarashi, K. (2007). Heme induces ubiquitination
and degradation of the transcription factor Bach1. Mol. Cell. Biol. 27,
6962–6971.
Zhang, H.-S., Du, G.-Y., Zhang, Z.-G., Zhou, Z., Sun, H.-L., Yu, X.-Y., Shi,
Y.-T., Xiong, D.-N., Li, H., and Huang, Y.-H. (2018). NRF2 facilitates breast
cancer cell growth via HIF1ɑ-mediated metabolic reprogramming. Int. J. Bio-
chem. Cell Biol. 95, 85–92.
Cell 178, 330–345, July 11, 2019 345
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
BACH1 (F-9), Mouse monoclonal antibody (WB, 1/1000) Santa Cruz Biotechnology Cat#sc-271211; RRID: AB_10608972
BACH1(F-9), Mouse monoclonal antibody (Chip-qPCR) Santa Cruz Biotechnology Cat#sc-271211X
BACH1, Goat polyclonal (Chip-Seq) R and D Systems Cat#AF5777; RRID: AB_2061817
BACH1, Goat polyclonal antibody (IF, 1/50) R and D Systems Cat#AF5776; RRID: AB_2061974
GAPDH, Mouse monoclonal antibody Sigma-Aldrich Cat#G9295; RRID: AB_1078992
HK2, Rabbit polyclonal antibody (1/2000) Life Technologies Cat#PA5-29326; RRID: AB_2546802
bACTIN, Mouse monoclonal antibody (1/5000) Sigma-Aldrich Cat#A2228; RRID: AB_476697
HISTONE 3, Rabbit polyclonal (1/5000) Abcam Cat#ab1791; RRID: AB_302613
LAMIN B1, Mouse monoclonal antibody Santa-Cruz Biotechnology Cat#374015; RRID:AB_10947408
NQO1, Rabbit polyclonal antibody (1/1000) Sigma-Aldrich Cat#HPA007308; RRID: AB_1079501
NRF2, Rabbit monoclonal antibody (1/200) Cell Signaling Technology Cat#12721; RRID: AB_2715528
P21 (C-19), Rabbit polyclonal antibody (1/1000) Santa Cruz Biotechnology Cat#sc-397; RRID: AB_632126
P53 (DO-1), Mouse monoclonal antibody (1/1000) Santa Cruz Biotechnology Cat#sc-126; RRID: AB_628082
Phospho-p53, Rabbit polyclonal antibody (1/1000) Cell Signaling Technology Cat#9284; RRID: AB_331464
Donkey anti-Goat IgG (H+L) Alexa Fluor 568 Life Technologies Cat#A-11057; RRID: AB_2534104
Goat Anti-Mouse IgG (1/10000) Jackson ImmunoResearch Labs Cat#115-035-003; RRID: AB_10015289
Goat Anti-Rabbit IgG (1/10000) Jackson ImmunoResearch Labs Cat#111-035-003; RRID: AB_2313567
Ki-67, Rabbit monoclonal antibody (1/100, IHC) Lab Vision Cat#RM-9106-R7; RRID: AB_149920
NRF2, Rabbit polyclonal antibody (1/400, IHC) Abcam Cat#ab137550; RRID: AB_2687540
SPC, Rabbit polyclonal antibody (1/1000, IHC) Millipore Cat#AB3786; RRID: AB_91588
NKX2.1, Rabbit monoclonal antibody (1/200, IHC) Abcam Cat#ab76013; RRID: AB_1310784
HMGA2, Rabbit polyclonal antibody (1/200, IHC) BioCheck Cat#AP210AP
Bacterial and Virus Strains
Ad5CMVCre Cre-adenovirus Viral Vector Core Facility, VVC-U of Iowa-5
University of Iowa
Chemicals, Peptides, and Recombinant Proteins
2-deoxy-glucose (1 mM) Sigma-Aldrich Cat#D6134-1G
3-Bromopyruvate (25 mM/10 mg/kg) Sigma-Aldrich Cat#16490-10G
6-Aminonicotinamide (100-500 nM) Sigma-Aldrich Cat#A68203-1G
AZD3965 (1-10 mM) MedChemExpress Cat#HY-12750
Bortezomib (1 mM) MedChemExpress Cat#HY-10227
BSO (500 mM) Sigma-Aldrich Cat#B2515
Cycloheximide (20 mg/mL) Sigma-Aldrich Cat#C4859-1ML
Diamide Sigma-Aldrich Cat#D3648-1G
Dichloroacetate Sodium (DCA, 10 mM) Sigma-Aldrich Cat#347795
Doxorubicin (10 mM) Sigma-Aldrich Cat#D2975000
Etoposide (10 mM) Sigma-Aldrich Cat#E2600000
Hemin (10-20 mM) Sigma-Aldrich Cat#51280-1G
Hexadimethrine bromide (polybrene) 8 mg/mL Sigma-Aldrich Cat#107689-10G
Hydrogen Peroxide Sigma-Aldrich Cat#H1009-100ML
KI-696 (1-5 mM) MedChemExpress Cat#HY-101140
Lonidamine (50 mM) Sigma-Aldrich Cat#L4900
MG132 (10 mM) BioVision Cat#BIOV1703-5
(Continued on next page)

e1 Cell 178, 330–345.e1–e8, July 11, 2019

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
MLN4924 (2 mM) MedChemExpress Cat#HY-70062
NAC (1 mM) Sigma-Aldrich Cat#A7250
Trolox 6-hydroxy-2,5,7,8-tetramethylchromane- Sigma-Aldrich Cat#238813
2-carboxylic acid (100 mM)
UK5099 (1 mM) Sigma-Aldrich Cat#PZ0150-5MG
Xfect Transfection reagent Clonetech Cat#631318
X-tremeGENE HP DNA Transfection Reagent Sigma-Aldrich Cat#6366244001
Critical Commercial Assays
ROS-glo Promega Cat#G8820
Glucose-uptake-Glo Promega Cat#J1342
Lactate-Glo Promega Cat#J5021
Pyruvate Assay Kit Abcam Cat#Ab65342
Seahorse Glycolytic Rate Kit Agilent Cat#S7805A
Seahorse ATP production rate Agilent Cat#103592-100
CellTiter-Glo Promega Cat#G7571
GSH-Glo Promega Cat#V6911
GSH/GSSG-Glo Promega Cat#V6611
NAD(H)-Glo Promega Cat#G9071
NADP(H)-Glo Promega Cat#G9081
Dual-Glo Luciferase Assay System Promega Cat#E2920
Epitect Chip One day QIAGEN Cat#334471
Heme Assay kit Sigma-Aldrich Cat#MAK316-1KT
Deposited Data
RNA sequencing and Chip-sequencingIndividual This study GEO: GSE128181; https://www.ncbi.nlm.nih.
links below) gov/geo/query/acc.cgi?acc=GSE128181
RNasequencing data mTC/mTN This study GEO: GSE128153; https://www.ncbi.nlm.nih.
gov/geo/query/acc.cgi?acc=GSE128153
ChipSequencing data on BACH1 mTC/mTN This study GEO: GSE128180; https://www.ncbi.nlm.nih.
gov/geo/query/acc.cgi?acc=GSE128180
Experimental Models: Cell Lines
293-GP2 Clonetech Cat#6314588
293FT Life Technologies Cat#R70007
A549 ATCC Cat#CRL-7909; RRID: CVCL_0023
H838 ATCC Cat#CRL-5844; RRID: CVCL_1594
H1975 ATCC Cat#CRL-5908; RRID: CVCL_1511
H23 ATCC Cat#CRL-5800; RRID: CVCL_1547
H358 ATCC Cat#CRL-5807; RRID: CVCL_1559
H1299 ATCC Cat#CRL-5803; RRID: CVCL_0060
H460 ATCC Cat#HTB-177; RRID: CVCL_0459
mTC and mTN cells (KrasG12D/+) Bergo Lab, this study N/A
Experimental Models: Organisms/Strains
NSG NOD.Cg-Prkdc < scid > Il2rg < tm1Wjl > /SzJ Jackson laboratories 005557 RRID: IMSR_JAX:005557
Kras G12D/+; p53/fl/fl, mixed C57BL/6 and 129S1/SvmJ Bergo lab N/A
Oligonucleotides
sgdTomato 50 –GGCCACGAGTTCGAGATCGA–30 Bergo Lab, this study N/A
mouse sgBach1_m1 50 -GTACTTCCACTCGAGAATCGT–30 Bergo Lab, this study N/A
sgBach1_m2 50 –GTCTGGCCTACGATTCTCGAG–3 Bergo Lab, this study N/A
(Continued on next page)

Cell 178, 330–345.e1–e8, July 11, 2019 e2

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
0 0
sgBACH1_h1 5 –CCTGGCCTACGATTCTTGAG-3 Bergo Lab, this study N/A
sgBACH1_h2 50 –CCACTCAAGAATCGTAGGCC–3 Bergo Lab, this study N/A
sgBACH1_h3 50 –TACTCAGCCTTAAT-GACCAG–30 Bergo Lab, this study N/A
SAM sgBach1_m2 50 –GGCCCGGGGGCGGAACCGG–30 Bergo Lab, this study N/A
SAM sgBACH1_h2 50 –GACACATCAGCACCGCCCTCG–3 Bergo Lab, this study N/A
EpiTect primers for Hk2 QIAGEN Cat#GPM1052127(-)01A
EpiTect primers for Gapdh QIAGEN Cat#GPM1052368(-)01A
Taqman assay for Bach1 Life Technologies Cat#Mm01344527_m1
Taqman assay for Dusp1 Life Technologies Cat#Mm00457274_g1
Taqman assay for Gapdh Life Technologies Cat#Mm03302249_g1
Taqman assay for Gclm Life Technologies Cat#Mm01324400_m1
Taqman assay for Hmox1 Life Technologies Cat#Mm00516005_m1
Taqman assay for Hk1 Life Technologies Cat#Mm00439344_m1
Taqman assay for Hk2 Life Technologies Cat#Mm00443385_m1
Taqman assay for Mmp1a Life Technologies Cat#Mm00473485_m1
Taqman assay for Pkp3 Life Technologies Cat#Mm00451123_m1
Taqman assay for Rplp0 (reference gene) Life Technologies Cat#Mm00725448_s1
Taqman assay for Slc16a1 Life Technologies Cat#Mm01306379_m1
Taqman assay for Sqstm1 Life Technologies Cat#Mm00448091_m1
Recombinant DNA
pLKO-1 empty vector Dharmacon Cat#RHS4080
PLKO.1 Sh-Hk2#2 TRCN0000012545 Dharmacon TRCN0000012545
PLKO.1 Sh-Hk2#5 TRCN0000012548 Dharmacon TRCN0000012548
pGL3 Luciferase reporter vector Promega Cat#E1751
pGL3 Luciferase reporter vector positive control Promega Cat#E1741
psPAX2 Addgene RRID: Addgene_12260
pMD2.G Addgene RRID: Addgene_12259
pLentiCRISPRV2blast Addgene RRID: Addgene_98293
pLentiMPHv2 Addgene, Joung et al., 2017 RRID: Addgene_89308
pLentiSAMv2 Addgene, Joung et al., 2017 RRID: Addgene_75112
pSECC Addgene, Sánchez-Rivera RRID: Addgene_60820
et al., 2014
pWZL-Hk2-Flag Addgene, Boehm et al., 2007 RRID: Addgene_20501
pLPC-G6PC3 David Bernard’s lab Gitenay et al., 2014
pLPCx-Grx1-ro-GFP2 Tobias Dick’s lab Gutscher et al., 2009
pLPCx-ro-GFP2-Orp1 Tobias Dick’s lab Morgan et al., 2011
pCDNA-HS1 Amit Reddi’s lab Hanna et al., 2016
Software and Algorithms
ImageJ ImageJ, NIH RRID: SCR_003070; https://imageJ.nih.gov/
ij/index.html
GraphPad 7.0 and 8.0 GraphPad Prism, v7 RRID: SCR_002798; http://graphpad.com/
scientific-software/prism/
IncuCyte Zoom system Essen Biosciences N/A
Visiopharm Integrator System version 5.0.2.1158 Visiopharm N/A
Seahorse Wave 2.6.0 Seahorse Wave RRID: SCR_014526
Agilent Macro excel sheet Agilent Seahorse N/A
R Statistical programming version 3.4.1 The R foundation http://www.r-project.org/
(Continued on next page)

e3 Cell 178, 330–345.e1–e8, July 11, 2019

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Other
SEEK database http://seek.princeton.edu N/A
TCGA data http://www.cbioportal.org/ N/A
STRING analysis, version 10.5 https://version-10-5.string- N/A
db.org/
Gentle MACS Dissociator Miltenyi Biotec Cat#130-093-235

LEAD CONTACT AND MATERIALS AVAILABILITY

Further information and requests for resources and reagents should be directed to the Lead Contact, Martin O. Bergo (martin.bergo@
ki.se)

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Mice, Lung Cancer Experiments, and Antioxidant Administration

Kras2LSL/+Trp53fl/fl mice (designated KP) (Jackson et al., 2001; Marino et al., 2000) were maintained on a mixed C57BL/6-129/Sv
genetic background; littermates were used as controls. Mice 6–8 weeks old were randomly selected to inhale Cre-adenovirus
(University of Iowa, Iowa City, IA) intranasally. pSECC virus was delivered intratracheally. N-acetylcysteine (NAC, A7250, R 99%
purity, Sigma) was administered in the drinking water (1 g/L). Vitamin E (DL-a-tocopheryl acetate) was administered in the chow
(Lantmännen) at a dose of 0.5 g/kg chow (61.5 mg/kg body weight), calculated from observed daily food intake. For allograft exper-
iments, mouse lung tumor cells were transplanted intravenously into syngeneic mice (1 3 105 cells) or NOD-SCID-gamma mice
(NSG; NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ) (0.5 3 105 cells); mice were killed and lungs harvested 3 weeks later. Cells (2.5 3 105)
were transplanted subcutaneously into NSG mice. For transplantation of human NSCLC cells, 5 3 105 cells were injected intrave-
nously, and lungs were harvested 10 weeks later. For 3-bromopyruvate (3-BP) and AZD3965 experiments, cells were pre-treated
in vitro with the inhibitors for 3 days before injection into mice. After cell injection, 3-BP (10 mg/kg) or vehicle (PBS) was administered
daily intraperitoneally for 4 days. Alternatively, mice were treated with AZD3965 (100 mg/kg) or vehicle (PBS, 0.1% Tween 80, hydrox-
ypropyl methylcellulose 0.5%) by oral gavage for 4 days. Animal experiments were approved by the Research Animal committees in
Gothenburg and Linköping, Sweden.

Cell Culture and Regents

Human NSCLC cell lines A549, H1975, H838, H1299, H23, and H460 were purchased from the American Type Culture Collec-
tion (ATCC). Mouse lung tumor cells lines were isolated from Kras2LSL/+ mice with the tumor dissociation kit for mouse
(130-096-730, MACS Miltenyi Biotec) and the gentleMACS Octo Dissociator (130-096-427, MACS Miltenyi Biotec) 58 weeks
after administration of low-dose Cre-adenovirus. Human and mouse lung cancer cells were cultured in DMEM low-glucose
GlutaMax medium (21885-108, Life Technologies) supplemented with 1% NEAA (11140-035, Life Technologies), 1% peni-
cillin-streptomycin (15140122, Thermo Fisher Scientific), and 10% fetal bovine serum (FBS, 10270106, Thermo Fisher Scienti-
fic). Virus-packaging cells (293FT and GP2-293) were cultured in DMEM high-glucose GlutaMAX (31966047, Thermo Fisher
Scientific), supplemented with 1% penicillin-streptomycin and 10% FBS. All cell lines were negative for mycoplasma. No cell
lines used in this study were found in the database of commonly misidentified cell lines that is maintained by ICLAC and
NCBI Biosample.

METHODS DETAILS

Histology and Immunohistochemical Analyses

Lungs were perfused through the trachea with PBS or 4% paraformaldehyde (PFA), fixed overnight, transferred to 70% ethanol,
embedded in paraffin, cut into 5-mm sections, and stained with hematoxylin/eosin. For immunohistochemical analyses, sections
were incubated with antibodies recognizing Ki-67 (RTU, RM-9106-R7, Thermo Scientific), NRF2 (ab137550, Abcam), SPC
(AB3785, Millipore), HMGA2 (AP210AP, Biocheck), NKX2.1 (ab76013, Abcam) and processed with the Vectastain Elite ABC Kit
(PK6101) and the DAB Peroxidase Substrate Kit (SK4100, Vector Laboratories). Histological slides were scanned with a Zeiss
Axioplan 2 microscope (Carl Zeiss AG), and pathology and staining were quantified with TissueMorph software (Visiopharm Inte-
grator System version 5.0.2.1158). Tumor burden (tumor area/total lung area) on hematoxylin/eosin–stained slides was quantified
with Visiopharm software (Visiopharm Integrator System version 5.0.2.1158).

Cell 178, 330–345.e1–e8, July 11, 2019 e4

Immunohistofluorescence
Four-micrometer-thick sections of PFA inflation–fixed and paraffin-embedded lungs were deparaffinated, rehydrated, and loaded into
a pressure cooker with DIVA Decloaker (DV2004; Biocare Medical) and cooled in Hot Rinse (HTR1001; Biocare Medical). Sections
were then incubated in ice cold methanol for 1 min followed by normal goat serum (50197Z; ThermoFisher) and then by overnight in-
cubation with an antibody against BACH1 (1:50; AF 5776; R&D Systems). Lungs were then incubated with donkey anti-goat IgG (H+L)
Alexa-568 secondary antibody (1:250, A-11057, Life Technologies) for 1 hr. Sections were then mounted with Prolong Gold Antifade
reagent with DAPI (P36935, Life Technologies) and imaged on a Zeiss LSM 700 confocal microscope with a 20xNA0.80 objective in
3x3 or 2x2 tiled fields. Images were acquired with ZEN software (2011, Carl Zeiss Microscopy, Jena, Germany).

Migration and Invasion Assays

Transwell migration and invasion assays were done with the xCELLigence system. For migration assays, cells were plated in CIM
plates (05 665 817 001, ACEA Biosciences) (4 3 104 cells/well); for invasion assays, the CIM plates were precoated with a 1:40 dilu-
tion of Matrigel. The plates were analyzed for 10 hr in the xCELLigence system, which monitors cells migrating or invading from
serum-free conditions in an upper chamber through a microporous membrane to a lower chamber containing 10% serum, where
cells are detected by biosensors. The electrode impedance is displayed as a migration or invasion index. Transwell migration assays
were also done with inserts with a 6.5-mm, 8.0-mm-pore membrane. Cells (1 3 105/well) were suspended in serum-free medium in the
upper chamber. The bottom chamber contained complete medium with 10% FBS. For invasion assays, the inserts were precoated
with a 1:40 dilution of Matrigel. After 12 to 16 hr, cells in the upper chamber were removed with a humidified cotton swab, and
migrating cells on the other side of the membrane were fixed with PFA, stained with crystal violet, and photographed under a bright-
field microscope (10X). The area covered by cells was quantified with ImageJ on at least four random fields per well. Each experiment
was done at least in duplicate.
Cell migration in real-time was also monitored with an IncuCyte ZOOM (Essen BioScience) (4 3 104 cells/well). This system mea-
sures the closure of a scratched area in real time and automatically calculates the relative wound density within the initially vacant
area at each time point. Cells were seeded in 96-well image-lock plates (4379, Essen BioScience). The next day, a scratch was
made in each well with a WoundMaker (Essen Biosciences) which creates identical and reproducible scratches in all wells. After
several washes to remove dead cells and debris, 200 mL of fresh medium containing the different drugs was added to each well.
At least 3 experimental replicates were used per condition and cell line.

ROS Measurements
Cells were treated with NAC or Trolox (6-hydroxy-2,5,7,8-tetramethylchromane- 2-carboxylic acid; 238813, Sigma-Aldrich) for
7 days and seeded in white 96-well plates (5 3 103 cells/well). ROS were measured with the ROS-Glo-H2O2 assay (G8820, Promega).
ROS were also measured in cells stably expressing ro-GFP2-ORP1 or roGFP2-Grx1 (Gutscher et al., 2009; Morgan et al., 2011). Cells
were incubated for 1 week with antioxidants, and the day before analysis they were seeded in a 4-chamber, glass bottom, 35-mm
CELLview dish (627871, Corning). Cells were washed and the medium was replaced with FluoroBrite medium (A18967-01, Life
Technologies) before the assay. Fluorescence (excitation wavelengths, 405 and 488 nm; emission, 555–639 nm) in live cells main-
tained at 37 C and 5% CO2 was recorded every 5 s with a Zeiss LSM 700 confocal microscope and a Plan-Achromat 40 3 /1.3
oil-immersion objective. Fluorescence intensity was determined with Zeiss Zen software.

GSH, NADH and NADPH Measurements

Cells were incubated with NAC or Trolox for 7 days and seeded in white 96-well plates (5–10 3 103 cells/well). The next day, total gluta-
thione and NADH and NADPH levels were measured with GSH-Glo (V6911) and NAD(P)H-Glo (G9061, G9062 Promega) assays. The
ratio of GSH/GSSG was determined with the GSH/GSSG-Glo assay (V6611, Promega).

Free Heme Measurements

Free heme was extracted with neutral acetone as described (Espinas et al., 2012). Heme from neutral acetone extracts was quantified
with the Heme assay kit (MAK316-1KT, Sigma-Aldrich), and measurements were normalized to protein concentration. To induce
release of free heme by ROS, cells were treated with 200 mM hydrogen peroxide overnight.
For labile heme measurements with a heme biosensor, A549 cells were treated for 18 days with NAC, Trolox, or vehicle (water
and DMSO, respectively) and transfected with the genetically encoded heme sensor pCDNA-HS1 (Hanna et al., 2016). Briefly,
5.6 3 104 cells per well of a 96-well plate were reverse transfected with X-tremeGENE HP DNA Transfection Reagent
(6366244001, Sigma-Aldrich) at a 1:3 DNA:Transfection Reagent ratio and seeded together with medium supplemented with antiox-
idant, vehicle, or pro-oxidant (diamide, 5 mM, D3648-1G, Sigma-Aldrich). Cells were incubated at 37 C for 48 hr before eGFP and
mKATE2 imaging (HCS Operetta, Perkin-Elmer). The values presented correspond to 3 transfections per treatment. Each data point
is the average of the fluorescence intensity ratio of eGFP to mKATE2 of 23 fields of view.

Lentiviral Production and Transduction

Lentiviruses were produced by transfecting 293FT packaging cells (R70007, Life Technologies) with lentiviral backbone constructs
(6 mg), packaging plasmid psPAX2 (Addgene plasmid #12260, 3 mg), and envelope plasmid pMD2.G (Addgene plasmid #12259,

e5 Cell 178, 330–345.e1–e8, July 11, 2019

1.5 mg) using the Xfect transfection reagent (631318, Clonetech). Retroviruses were produced by transfecting GP2-293 packaging
cells (6314588, Clonetech) with retroviral backbone (5 mg) and envelope plasmid (1 mg). Lentiviral and retroviral supernatants were
collected 2 days after transfection. Target cells were transduced once with lentiviruses supplemented with 8 mg/ml polybrene
(107689-10G, hexadimethrine bromide; Sigma-Aldrich) and selected with blasticidin (1–5 mg/mL, A1113903), hygromycin B
(100 mg/mL, 10687010), or puromycin (1 mg/mL, A1113803, ThermoFisher Scientific). Lentiviral backbones were pLentiCRISPRv2-
blast (#98293, Addgene) expressing single-guide (sg) RNA targeting genes of interest, or pLentiMPHv2 (#89308, Addgene), pLenti-
SAMv2 (#75112, Addgene) as described (Joung et al., 2017). Retroviral plasmids were pWZL-HK2-Flag (#20501) and pLPC-G6PC3
(Gitenay et al., 2014); pLPCx-Grx1-roGFP2 and pLPCx-roGFP2-Orp1 were from T. Dick (Gutscher et al., 2009; Morgan et al., 2011).
For sgRNA cloning, the lentiCRISPRv2 vector was digested with BsmBI and ligated with BsmBI-compatible pre-annealed oligo-
nucleotides. The following sequences were used for CRISPR-knockout strategies: sgdTomato GGCCACGAGTTCGAGATCGA;
mouse sgBach1_m1 GTACTTCCACTCGAGAA-TCGT; sgBach1_m2 GTCTGGCCTACGATTCTCGAG; human sgBACH1_h1 CCTG
GCCTACGATTCTTGAG, sgBACH1_h2 CCACTCAAGAATCGTAGGCC; and sgBACH1_h3 TACTCAGCCTTAAT-GACCAG. For the
transcriptional activation strategy with dCAS9-SAM, the following sequences were used: sgdTomtato, GGCCACGAGTTCGAGA
TCGA; mouse sgBach1_m2, GGCCCGGGGGCGGAAC-CGG; and human sgBACH1_h2, GACACATCAGCACCGCCCTCG. Expres-
sion of target proteins in CRISPR-knockout and CRISPR-SAM experiments was evaluated by western blotting 3–5 days after
selection. The pSECC lentiviral vector and cloning strategy are described elsewhere (Sánchez-Rivera et al., 2014)

Western Blotting
Cells were lysed in buffer containing 9 M urea and Halt protease inhibitor cocktail (78430, Life Technologies) and Halt phosphatase
inhibitor (78428, Life Technologies). Alternatively, cells were lysed in Laemmli buffer supplemented with b-mercaptoethanol. Cyto-
solic and nuclear extracts were prepared with NE-PER nuclear and cytoplasmic extraction reagents (78835, Life Technologies).
Protein concentration of lysates was determined with the Pierce BCA Protein Assay Kit (23225, Life Technologies). After
denaturation, equal amounts of proteins were resolved on 4%–20% or 12% Mini-PROTEAN TGX Stain-Free gels (BioRad), and
electro-transferred onto nitrocellulose membranes. The membranes were blocked with TBST containing 5% milk and incubated
with antibodies against BACH1 (sc-271211, Santa Cruz Biotechnology, 1:1000), HO-1 (MA1-112, Life Technologies, 1:1000),
HK2 (PA5-29326, Life Technologies, 1:2000), b-actin (A228, Sigma-Aldrich), GAPDH (G9295, Sigma-Aldrich, 1:1000), histone 3
(ab1791, Abcam, 1:5000), NQO1 (HPA007308, Sigma-Aldrich, 1:200), KEAP1 (#8047S, Cell Signaling, 1:1000), and NRF2
(#12721, Cell Signaling, 1:300). Secondary antibodies were from Jackson Immunoresearch laboratories. Clarity Western ECL sub-
strate (1705061, Bio-Rad) was used for detection with the ChemiDoc Touch Imaging system (1708370, Bio-Rad).

Cell Viability Assay

Cell viability was estimated with Presto Blue Cell Viability Reagent (A13262, Life Technologies). Cells (5000/well) were seeded in
96-well plates in triplicate. After 24–72 hr, PrestoBlue reagent (10 ml) was added to wells with cells or medium (blank), and absorption
at 570 and 600 nm was measured with a Synergy plate reader (BioTek). To assess the effect of KI-696 on cell viability, 2.2 3 104 cells
per well of a 24-well plate were treated with KI-696 (5 mM) or vehicle (DMSO). Cells were incubated at 37 C for 48 hr before assay of
cell viability (Vi-Cell XR, Beckman-Coulter).

Extracellular Flux Measurements

Metabolic analyses were done with the Seahorse XFe96 Analyzer (Agilent), which measures the extracellular acidification rate (ECAR)
and oxygen consumption rate (OCR) of live cells. Glycolytic rates were measured with the Seahorse XF glycolytic rate assay (S7805A,
Seahorse Agilent), ATP production rates were measured with the Seahorse XF ATP rate (103592-100, Seahorse Agilent): cells were
seeded in Seahorse XF96 microplates (15,000 cells/well) (101085-004, Agilent) and cultured overnight at 37 C in a CO2 incubator. On
the day of the assay, the medium was replaced with freshly prepared phenol red–free base medium supplemented with HEPES,
glucose, pyruvate, and glutamine and adjusted to pH 7.4. Cells were incubated for 45 min at 37 C in a non-CO2 incubator before
the assay, and the medium was changed immediately before the assay. Before assays, the Seahorse Analyzer pre-warmed to
37 C. Data were normalized to cell numbers obtained from additional wells using Presto Blue Cell Viability. Glycolytic and ATP
production rates were calculated with the Macro Excel file provided by the manufacturer.

Total ATP, Glucose Uptake and Lactate Secretion

Glucose uptake and total ATP were measured on cells seeded in white 96-well plates (5000 cells/well) (Glucose uptake-Glo J1342,
Cell-Titer-Glo, G7571, Promega). Extracellular lactate secretion was measured by collecting medium from 5000 cells cultured for
24 hr in 96-well plates. Harvested medium was diluted in PBS (1:50), and lactate content was determined with the Lactate-Glo assay
(J5021, Promega) using 10 mL of diluted supernatant. Cells remaining in the 96-well plates were used to normalize the data.

RNA-Sequencing and Bioinformatics

Total RNAs were extracted with the RNeasy Plus Mini kit (74136, QIAGEN). Sequencing was done with an Illumina HiSeq PE150
instrument and Promega Relia-Prep. Paired end reads were obtained, and their quality score was determined with FASTQC.
Sequencing reads were mapped to the GRCm38/mm10 mouse genome assembly with STAR Aligner (version 2.5.0a) (Dobin

Cell 178, 330–345.e1–e8, July 11, 2019 e6

et al., 2013), and genes were quantified with the HTSeq-count tool (version 0.6.1) (Anders et al., 2015). Tests for differential expres-
sion of genes identified in RNA-seq analyses were done with DESeq2 (Love et al., 2014). Differentially expressed genes with a
false-discovery rate < 0.05 were considered statistically significant. R Bioconductor package clusterProfiler was used for enrichment
analyses (Yu et al., 2012).
Putative promoter regions 1000 bp upstream of each differentially regulated gene (n = 1025) were successfully extracted for 961
genes. Both Mus musculus BACH1 and NRF2 binding motifs were downloaded from JASPAR database of transcription factor bind-
ing profiles by using R package MotifDb. Sequences 1000 bp upstream of genes were matched by the position-weighted matrix
method using a multinomial model with a Dirichlet conjugate before calculation of estimated probability of base b at the position.
The threshold of matching was set to 75%. Details about the method have been described (Bioconductor Maintainer at https://
bioconductor.org/packages/devel/workflows/vignettes/generegulation/inst/doc/generegulation.html). The SEEK database (http://
seek.princeton.edu) was interrogated to retrieve genes co-expressed with BACH1 in human lung cancer datasets (173 datasets).
TGCA data were downloaded from http://www.cbioportal.org/. STRING analysis was done at https://version-10-5.string-db.org/
(version 10.5) using default settings, medium confidence (0.400), and four clusters.

Real-Time Quantitative PCR

RNA was isolated with the RNeasy Plus Mini kit (74136, QIAGEN), and cDNA was synthesized with the iScript cDNA synthesis
kit (170-889, Bio-Rad). Gene expression was analyzed by TaqMan reverse transcription quantitative polymerase chain reaction
(qPCR) on a CFX384 Real-Time System (Biorad) using mouse and human probe sets for Bach1 Mm01344527_m1, Hk1
Mm00439344_m1, Hk2 Mm00443385_m1, Mmp1a Mm00473485_m1, Dusp1 Mm00457274_g1, Gapdh Mm03302249_g1, Hmox1
Mm00516005_m1, Gclm Mm01324400_m1, Sqstm1 Mm00448091_m1, Nqo1 Mm01253561_m1, Slc16a1 Mm01306379_m1,
Pkp3 Mm00451123_m1, Rplp0 Mm00725448_s1. After screening a panel of murine reference genes (TATAA Biocenter) and
analyzing variability with GenEx, we selected ribosomal protein lateral stalk subunit P0 (Rplp0) as a reference gene. Reactions
were done in triplicate.

Chromatin Immunoprecipitation-Sequencing (ChIP-Seq)

Lung tumor mTC and mTN cells (n = 3 biological replicates per condition) were fixed with 1% formaldehyde for 15 min and quenched
with 0.125 M glycine. Chromatin was isolated by adding lysis buffer, and the cells were disrupted with a Dounce homogenizer.
Lysates were sonicated, and the DNA was sheared to an average length of 300–500 bp. Genomic DNA (input) was prepared by
incubating chromatin aliquots with RNase and proteinase K, heated for de-crosslinking, and precipitated with ethanol. Pellets
were resuspended, and the resulting DNA was quantified with a NanoDrop spectrophotometer. Extrapolation to the original chro-
matin volume allowed quantitation of the total chromatin yield. An aliquot of chromatin (30 mg) was pre-cleared with protein G agarose
beads (Life Technologies). Genomic DNA regions of interest were isolated with 4 mg of antibody recognizing BACH1 (AF577, R&D
Systems). Complexes were washed, eluted from the beads with sodium dodecyl sulfate buffer, and incubated with RNase and
proteinase K. Crosslinks were reversed by incubation overnight at 65 C, and ChIP DNA was purified by phenol-chloroform extraction
and ethanol precipitation.
Illumina sequencing libraries were prepared from the ChIP and input DNAs by the standard consecutive enzymatic steps of end-
polishing, dA addition, and adaptor ligation. After a final PCR amplification step, the resulting DNA libraries were quantified and
sequenced with an Illumina NextSeq 500 (75-nt reads, single end). Reads were aligned to the mouse genome (mm10) with the
BWA algorithm (default settings). Duplicate reads were removed, and only uniquely mapped reads (mapping quality R 25) were
used for further analysis. Alignments were extended in silico at their 30 ends to a length of 200 bp (the average genomic fragment
length in the size-selected library) and assigned to 32-nt bins along the genome. The resulting histograms (genomic ‘‘signal
maps’’) were stored in bigWig files. Peak locations were determined with the MACS algorithm (v2.1.0) with a cutoff P value = 10-7.
Peaks that were on the ENCODE blacklist of known false ChIP-seq peaks were removed. Signal maps and peak locations were
used as input data to the Active Motifs proprietary analysis program, which creates Excel tables containing detailed information
on sample comparison, peak metrics, peak locations, and gene annotations.

ChIP-qPCR
Chromatin obtained as described above was immunoprecipitated with 4 mg of antibodies against BACH1 (sc-271211X, Santa Cruz
Biotechnology) or control IgG (I8765-10MG, Sigma-Aldrich). Samples were prepared according to the Epitect Chip OneDay kit
(334471, QIAGEN). Primers used for qPCR are GPM1052127(-)01A and GPM1052368(-)01A from QIAGEN.

Luciferase Assays
Gapdh and Hk2 promoter sequences (See Table S1) containing BACH1 wild-type or mutant binding sites were cloned into pGL3
Luciferase Reporter Vectors (Promega) using the restriction sites of the enzymes KpnI and HindIII. A pGL3 basic vector served
as a negative control (E1751, Promega); a vector containing luciferase under the control of the SV40 promotor served as a
positive control (E1741, Promega). The sequences used are shown in Table S1. Briefly, 1 3 104 cells per well of a 96-well plate
were transfected with X-tremeGENE 9 DNA Transfection Reagent (6365779001, Sigma-Aldrich) at a 1:3 DNA:reagent ratio. Cells
were incubated at 37 C for 48 hr and assayed as recommended by the manufacturer (Dual-Glo Luciferase Assay System, E2920,

e7 Cell 178, 330–345.e1–e8, July 11, 2019

Promega and Viktor2, Perkin-Elmer). The values presented correspond to 5 transfections per cell line and plasmid and were
normalized to total cell content determined by crystal violet staining.

QUANTIFICATION AND STATISTICAL ANALYSIS

Values are presented as mean ± SEM unless stated otherwise. GraphPad Prism (v.7.0 and v.8.0) was used for statistical analyses.
Cell migration and invasion curves were analyzed by two-way ANOVA. Survival was analyzed with the log-rank test. Incidences and
distributions were analyzed with the chi-square test or Fisher’s exact test. A two-sided t test was used for gene expression analyses
and comparisons of two groups; one-way ANOVA with Tukey’s or Dunnett’s post hoc test was used for all other variables.
Experiments were repeated 2–4 times unless otherwise stated. n indicates biological replicates. P values are omitted when
differences were not significant or when the n values were too low for statistical analysis.

DATA AND CODE AVAILABILITY

The accession number for the RNA-seq and the ChIP-Seq data reported in this paper is GEO: GSE128181. Individual accession
numbers for RNA-seq and ChIP-Seq are GEO: GSE128153 and GEO: GSE128180, respectively.

Cell 178, 330–345.e1–e8, July 11, 2019 e8

Supplemental Figures

(legend on next page)

Figure S1. Antioxidants NAC and Vitamin E Increase Lung Cancer Progression and Metastasis, Related to Figure 1
(A) Lymph node size in K mice.
(B) Percentage of K mice with HMGA2-positive lymph nodes as judged by immunohistochemistry.
(C) Lymph node size in KP mice.
(D) Percentage of KP mice with HMGA2-positive lymph nodes as judged by immunohistochemistry.
(E) Kaplan-Meier curves showing survival of control and NAC- and vitamin E (VitE)-treated K mice (n = 9, 13, and 13/group, respectively) and KP mice (n = 14, 12,
and 15/group).
(F) Lung tumor burden (tumor area/lung area) in K and KP mice from panel E.
(G) Hematoxylin/eosin-stained sections of lungs from K (top) and KP mice (bottom) administered NAC, VitE, or a control diet.
(H) Representative sections of lungs from K mice showing the cytological and growth-pattern characteristics used for primary tumor grading in this study.
(I) Left, distribution of histological grades in primary lung tumors of control and NAC- and VitE-treated K mice (n = 67, 108, and 92 tumors, respectively). Right,
photos of representative tumors.
(J) Left, intensity of immunohistochemical staining for HMGA2 in high-grade tumors (ADC2 and 3) in lungs of K mice (n: Ctrl = 11; NAC = 34; and VitE = 35 tumors)
and KP mice (n: Ctrl = 35; NAC = 57; and VitE = 44 tumors). Tumors from all mice in panels E–F were included in the analyses. Right, photos of representative
HMGA2-stained lung sections.
(K) Left, percentage of Ki67-positive nuclei in lung tumors of K mice (n = 46, 76, and 82 tumors for control, NAC, and VitE groups, respectively). Right, photos of
representative Ki67-stained lung sections.
(L) Left, intensity of immunohistochemical staining for NKX2.1 in lung tumors of K mice (n = 67, 92, and 92 tumors for control, NAC, and VitE groups, respectively).
Right, photos of representative NKX2.1-stained lung sections.
Scale bar in panels H, I, J, K, and L, 50 mm. n.s., not significant.
****p < 0.0001; ***p < 0.005; **p < 0.01; *p < 0.05.
(legend on next page)
Figure S2. Chronic Antioxidant Exposure Increases Tumor Cell Invasion and Reduces ROS Levels, Related to Figure 1
(A) Proliferation of mTC (n = 3) and mTN (n = 4) cells as judged by real-time IncuCyte analyses.
(B) Proliferation of mTC (n = 3) and mTN (n = 4) cells as judged by cell count analyses of population doubling.
(C) Western blots showing levels of p53, phospho-p53, p21, and the loading control ACTIN in mTC and mTN cells at baseline and after incubation for 24 hr with
10 mM doxorubicin (top) or 10 mM etoposide (bottom).
(D) Transwell migration assay of mTC (n = 2) and mTN (n = 3) cells at baseline and after incubation with 1 mM NAC for 7 days. Right, photographs of representative
Transwells after migration.
(E) Left, migration (scratch assay) of A549 human lung cancer cells incubated chronically (> 7 days) with 1 mM NAC. Right, photos of representative scratch gaps
at 20 hr. Veh, vehicle.
(F) and (G) Invasion (xCelligence) of A549 cells incubated chronically (> 7 days) with 1 mM NAC (F) and 100 mM Trolox (G).
(H) Left, migration (scratch assay) of H838 human lung cancer cells incubated chronically (> 7 d) with 1 mM NAC. Right, photos of scratch gaps at 12 hr.
(I) and (J) Invasion (xCelligence) of H838 cells incubated chronically (> 7 days) with 1 mM NAC (I) and 100 mM Trolox (J)
(K) and (L) Migration of H1975 human lung cancer cells incubated for 7 days in medium containing 1 mM NAC (K) or 100 mM Trolox (L).
(M) and (N) Migration of H23 human lung cancer cells incubated for 7 days in medium containing 1 mM NAC (M) or 100 mM Trolox (N).
(O) and (P) Invasion analyses of A549 cells incubated for 14 days with NAC (O) or Trolox (P). Blue and orange dashed lines indicate cells where antioxidant
administration was discontinued 48 hr before the assay.
(Q) Table summarizing mutations in the human NSCLC cell lines used in this study.
(R) western blot confirming NQO1 activation in the NRF2-addicted cell lines A549, H838, and H460.
(S) H2O2 levels under basal conditions and 1 hr after incubation with 50 mM of the prooxidant menadione in mTC and mTN cells (n = 3/each). Values are normalized
to untreated control mTC cells.
(T) H2O2 levels in A549 and H838 cells incubated chronically (> 7 days) with 1 mM NAC. Values are normalized to untreated control cells.
(U) Oxidation of the cytosolic H2O2 detector Orp1-roGFP2 (left) and the GSSG/GSH detector Grx1-roGFP2 (right) stably expressed in A549 cells at baseline and
after menadione administration. Values are mean fluorescence measurements of 30 cells.
(V)–(X) Total GSH (V), NAD(H) (W), and NADP(H) (X) levels in mTC and mTN cells (n = 3/each), under basal conditions and after incubation with 1 mM NAC for 7 d.
(Y)–AA) Total GSH (Y), NAD(H) (Z), and NADP(H) (AA) levels in A549 cells incubated for 7 days with 1 mM NAC or 100 mM Trolox.
(AB) Reductive potential of mTC and mTN cells displayed as GSH/GSSG ratio. Cells incubated for 24 hr with 1 mM NAC served as a positive control. Values are
mean of 2 cell lines/condition and normalized to untreated mTC cells.
(AC–AD) Migration of mTC and mTN cells incubated with 500 mM of the glutathione (GSH) synthesis inhibitor buthionine sulfoximine (BSO) (AC) and with 1 mM
GSH (AD). Values are mean of 3 mTC and mTN cell lines, each assayed in 4–6 wells.
Error bars indicate SEM. ****p < 0.0001; ***p < 0.005; **p < 0.01; *p < 0.05.
(legend on next page)
Figure S3. Exogenous Antioxidants Suppress the Endogenous NRF2-Dependent Antioxidant Pathway, Related to Figure 3
(A) Gene Ontology analysis of significantly upregulated genes in mTN versus mTC lung tumor cells. Data are from RNA-seq analyses of 4 and 3 cell lines,
respectively.
(B) Heatmap showing expression of genes involved in glutathione metabolism.
(C) Heatmap showing expression of genes from an NRF2 signature (Romero et al., 2017).
(D) Left, western blot showing amounts of NQO1, a marker of NRF2 activity, and the loading control ACTIN in mTC and mTN cells. Right, amounts of NQO1
determined by densitometry of protein bands. n = 3 cell lines per condition.
(E) Left, percentage of cells with nuclei staining positive for NRF2 in lung tumors of K mice (n: Ctrl = 18; NAC = 21; and VitE = 18 tumors). Tumors from all mice in
Figures 1A–1C were included in the analyses. Right, photos of lung sections with representative levels of NFR2 expression in tumors of K mice. Scale bar, 50 mm.
(F) Schematic of the current understanding of the antagonist roles of NRF2 and BACH1. Both proteins can heterodimerize with small MAF proteins and compete
for binding to antioxidant response elements (ARE) motifs. In response to oxidative stress, NRF2 binds AREs, displaces repressors such as BACH1, and activates
transcription of endogenous antioxidant and detoxification genes.
(G) Kaplan-Meier graph of TCGA data showing survival of kidney cancer (KIRC) patients with high and low BACH1 expression (Z-score = 2.1).
(H) Kaplan-Meier graph of TCGA data showing survival of pancreatic cancer (PDA) patients with high and low BACH1 expression (Z-score = 2.1).
(I)–(J) Kaplan-Meier graph of TCGA data showing survival of LUAD patients with high and low expression of the BACH1 target genes PKP3 (I) and MMP1 (J).
(K) Left, western blots showing amounts of BACH1 in A549 cells at baseline (Ctrl) and after incubation with 1 mM NAC or 100 mM Trolox for 7 days. ACTIN was the
loading control. Right, amounts of BACH1 determined by densitometry of protein bands from six independent experiments. Aox, antioxidants.
(L) Left, western blots of BACH1 in cytoplasmic (Cyto) and nuclear (Nucl) fractions of A549 cells incubated with 1 mM NAC for 7 days. GAPDH was the loading
control for cytoplasmic fractions; LAMIN B was the loading control for nuclear fractions. Right, amounts of nuclear BACH1 determined by densitometry data from
3 cell lines in 3 independent experiments.
(M) Western blots showing levels of NRF2, NQO1, and BACH1 in mTC and mTN cells incubated for 24 hr with 5 mM KI-696 peptide to activate NRF2.
(N) Left, migration (Transwell assay) of mTC and mTN cells incubated for 24 hr with 5 mM KI-696. Right, representative photos of migrated cells.
(O) Western blots showing amounts of BACH1 and ACTIN that remain in control and NAC-treated A549 cells at various times after incubation with 20 mg/ml
cycloheximide (CHX).
Error bars indicate SEM. ****p < 0.0001, **p < 0.01, *p < 0.05.
(legend on next page)
Figure S4. BACH1 Mediates Antioxidant- and NRF2-Induced Migration, Mediates Antioxidant-Induced Metastasis, and Drives Migration and
Metastasis in the Absence of Antioxidants, Related to Figure 4
(A) Proliferation of mTC and mTN cells transduced with CAS9 and two different sgRNAs targeting Bach1 or a control sgRNA targeting dTomato (Tom) as judged by
real-time IncuCyte analyses (n = 2 biological replicates/condition).
(B) Left, Transwell migration of control and Bach1-deficient (sgBach1) mTC cells incubated with the NRF2-activating peptide Ki-696 (5 mM). Right, representative
photos of migrated cells.
(C) Western blots showing amounts of BACH1 and the loading control ACTIN in A549 cells transduced with CAS9 and sgTom or three different sgRNAs tar-
geting BACH1.
(D) Left, Transwell migration of control and BACH1-deficient A549 cells in panel C after incubation for 7 days with 1 mM NAC. Right, representative photos of
migrated cells.
(E) Western blots showing amounts of BACH1 and the loading control ACTIN in H1975 cells transduced with CAS9 and sgTom or two different BACH1 sgRNAs.
(F) Left, Transwell migration of control and BACH1-deficient H1975 cells in panel E after incubation for 7 days with 1 mM NAC. Right, representative photos of
migrated cells.
(G) Top, weight of primary subcutaneous tumors of NGS recipient mice three weeks after subcutaneous injection of mTN-sgTom and mTN-sgBach1 cells
(2.5 3 105; n = 5 mice/cell type). Bottom, number of mice having lymph node (LN) metastasis three weeks after subcutaneous injection.
(H) Top, lung sections obtained from control and VitE-treated KP mice 8 months after intratracheal administration of pSECC-sgTom or pSECC-sgBach1
lentiviruses and stained with hematoxylin-eosin (H&E). Middle and bottom, serial sections stained with BACH1 antibody and counterstained with DAPI. The
sections are representative of two mice/condition. Scale bars, 100 mm and 50 mm for the low and high magnification, respectively.
(I) Western blots showing reduced expression of BACH1 in unselected mTC cells harvested 2 days after infection with the pSECC-sgBach1 lentivirus at a
multiplicity of infection of 1. Numbers are BACH1/ACTIN-ratios as judged by densitometry.
(J) Primary lung tumor burden of control and VitE-treated KP mice 8 months after intratracheal instillation of the control pSECC-sgTom lentivirus or the pSECC-
sgBach1 lentivirus (n = 6 mice/condition).
(K) Western blots showing increased BACH1 expression in A549 and H1975 cells transduced with SAM-sgBACH1 constructs. Control cells were transduced with
a nontargeting construct (SAM-sgTom).
(L) Scratch-wound migration assay of cells from panel J.
(M) Lung tumor burden of NSG recipient mice 10 weeks after i.v. injection of A549-sgTom and A549-SAM-sgBACH1 cells (5 3 105; n = 10–11 mice/cell type).
(N) Lung tumor burden of NSG recipient mice 10 weeks after i.v. injection of H1975-sgTom and H1975-SAM-sgBACH1 (5 3 105; n = 4–5 mice/cell type).
Error bars indicate SEM. ****p < 0.0001; ***p < 0.005; **p < 0.01.
(legend on next page)
Figure S5. ChIP-Seq Analysis Identifies Known and New BACH1 Target Genes, Related to Figure 4
(A) Known and de novo BACH1-binding motifs in mTC and mTN cells (n = 3) were identified with the findMotifGenome program of the HOMER package. The
highest-ranking motif for each sample is shown.
(B) Mean BACH1 binding to known target genes in mTC and mTN cells.
(C–E) Peaks of BACH1 binding to Hmox-1 (C), Hk2 (D), and Gapdh (E) in mTC, mTN, and mTN-sgBach1.1 cells.
Error bars indicate SEM.
(legend on next page)
Figure S6. BACH1 Is Functionally Responsible for Antioxidant-Induced Glycolysis and Migration of Mouse and Human Lung Cancer Cells,
Related to Figure 5
(A) Compensatory glycolysis in mTC and mTN cells. Values are mean of 3 cell lines/condition and normalized to values for mTC cells.
(B) Glycolysis rates of A549 and H1975 cells transduced with SAM-sgBACH1 and control SAM-sgTom constructs.
(C) Real-time qPCR analysis of Bach1 and BACH1-target genes in mTN cells transduced with CAS9 and either sgTom or sgBach1 (two different constructs). Data
were normalized to Rplp0 expression and then to mTN-sgTom.
(D) Western blots showing amounts of HK2 and the loading control ACTIN in mTN- sgTom and mTN-sgBach1 cells. Numbers are BACH1/ACTIN ratios as judged
by densitometry.
(E) and (F) Glycolysis rates of A549-sgTom and A549-sgBACH1 cells (E) and H1975-sgTom and H1975-sgBACH1 cells (F) incubated for 7 days with 1 mM NAC.
(G) western blots showing amounts of BACH1, HO-1, and the loading control ACTIN in H838 cells transduced with CAS9 and sgTom or two different BACH1
sgRNAs.
(H) Glycolysis rates of H838-sgTom and H838-sgBACH1 cell lines incubated for 7 days with 1 mM NAC.
(I) Real-time qPCR analysis of Bach1 and BACH1 target genes in mTC and mTN cells expressing scrambled (scr) or Bach1-targeting shRNAs. Data are mean of
3 cell lines/condition and normalized to Rplp0 expression.
(J) Left, scratch-wound migration assay of cells from panel I. Data are from 14 hr post-scratch. Values are the mean of 3 cell lines/condition and normalized to
mTC-shScr. Right, photographs of representative scratch gaps at 14 hr.
(K) Glycolysis rates of cells from panels I and J.
(L) Viability of mTC and mTN cells incubated for 24 hr with 20 mM hemin.
(M) Glycolysis rates of mTC and mTN cells incubated for 6 hr with 20 mM hemin.
(N) Left, western blots showing amounts of BACH1 and the loading control ACTIN in human NSCLC cell lines incubated for 24 hr with 10 mM hemin. Right,
amounts of BACH1 determined by densitometry; values are the mean of all seven NSCLC cell lines.
(O) Migration of NSCLC cells incubated for 7 days with 1 mM NAC; 10 mM hemin was added at the start of the scratch-wound assay. Values are the mean of three
NSCLC cell lines and normalized to untreated controls.
(P) Glycolysis rates of NSCLC cell lines at baseline and after incubation with NAC for 7 days; 10 mM hemin was added 24 hr before Seahorse analyses. Values are
the mean of six NSCLC cell lines and normalized to untreated controls.
(Q) Experiment similar to that shown in panel P but done with 100 mM Trolox. Values are the mean of four different NSCLC cell lines and normalized to untreated
controls.
(R) Viability of control and Bach1-deficient mTC and mTN cell lines incubated with 5 mM KI-696 for 48 hr.
Error bars indicate SEM. ****p < 0.0001; ***p < 0.005; **p < 0.01; *p < 0.05.
(legend on next page)
Figure S7. Glycolysis Mediates Antioxidant- and BACH1-Induced Migration and Metastasis, Related to Figures 6 and 7
(A) Top, western blots showing amounts of HK2 and the loading control ACTIN in A549 cells transduced with a control plasmid or a plasmid encoding human
HK2. Bottom, glycolysis rates.
(B) Transwell migration of A549 cells from panel A.
(C) Glycolysis-derived (left) and total (right) ATP production rates in A549 cells after incubation for > 7 days with 1 mM NAC.
(D) Steady-state total ATP levels in A549 cells after incubation for > 7 days with 1 mM NAC.
(E) Scratch-wound migration of mTC-SAM-sgTom and mTC-SAM-sgBach1 incubated with the glycolysis inhibitors 2-DG (1 mM) and lonidamine (LND, 50 mM).
(F) Scratch-wound migration of mTC and mTN cells incubated with 1 mM of the mitochondrial pyruvate transporter inhibitor UK5099.
(G) Lactate concentration in the medium of mTC and mTN cells incubated for 24 hr with the MCT-1 inhibitor AZD3965. Values are the mean of three cell lines per
condition and normalized to untreated mTC.
(H) Viability of mTC and mTN cells incubated for 24 hr with AZD3965. Values are the mean of 3 cell lines per condition and normalized to untreated mTC.
(I) Scratch-wound migration of A549 cells incubated for 24 hr with 10 mM AZD3965.
(J) Kaplan-Meier graph of TCGA data showing survival of lung cancer (LUAD) patients with high and low GAPDH expression (Z-score = 2.0)
(K) Kaplan-Meier graph of TCGA data showing survival of lung cancer (LUAD) patients with high and low SLC16A1 expression (Z-score = 2.0)
(L) Scratch-wound migration of mTC and mTN cells incubated with increasing concentrations of the pentose phosphate pathway inhibitor 6-aminonicotinamide
(6-AN).
(M) Total NADP(H) levels in mTC and mTN cells incubated for 24 hr with 100 nM 6-AN.
Error bars indicate SEM. ****p < 0.0001; **p < 0.01; *p < 0.05.