Eteplirsen

From Wikipedia, the free encyclopedia

Eteplirsen

Clinical data

Trade names Exondys 51

Routes of Intravenous infusion

administration

ATC code  M09AX06 (WHO)

Legal status

Legal status  US: ℞-only

Identifiers

IUPAC name[show]

CAS Number  1173755-55-9

ChemSpider  34983391

UNII  AIW6036FAS

KEGG  D09900

Chemical and physical data

Formula C364H569N177O122P30

Molar mass 10305.738 g/mol

3D model (JSmol)  Interactive image

SMILES[show]

InChI[show]

Eteplirsen (Exondys 51, Sarepta Therapeutics Inc.), also called AVI-4658, is a drug designed for
treatment, but not a cure, of some mutations that cause Duchenne muscular dystrophy (DMD), a genetic
degenerative muscle disease. Eteplirsen only targets mutations in a region implicated in 13% of DMD
cases.[1] After a controversial debate surrounding the efficacy of the drug, eteplirsen received
accelerated approval from the US Food and Drug administration in late 2016.[2][3] A year's worth of
treatment with Eteplirsen is expected to cost approximately $300,000.[4] A comprehensive review of the
molecule and its clinical trials was published in early 2017.[5]

Contents
[hide]
 1Mechanism of action
 2Clinical studies
 3Current status
 4Pharmacokinetic (PK) properties and potential side effects
 5Nature and sequence of oligo and target
 6References

Mechanism of action[edit]
Duchenne muscular dystrophy is caused when a mutation in the DMD gene changes the DMD RNA so
that it no longer codes for functional dystrophin protein, usually due to a mutation that alters the reading
frame of the RNA downstream of the mutation. If an exon with an appropriate number of bases lies near
the mutation, by removing that exon the downstream reading frame can be corrected and production of
partially functional dystrophin can be restored. This is the general strategy used for designing exon-
skipping oligos for DMD; as there are 79 exons in the longest splice form of the dystrophin transcript,
many different oligos are needed to address the range of mutations present in the population of people
with DMD.
Eteplirsen is a morpholino antisense oligomer which triggers excision of exon 51 during pre-mRNA
splicing of the dystrophin RNA transcript. Skipping exon 51 changes the downstream reading frame of
dystrophin;[6] giving eteplirsen to a healthy person would result in production of dystrophin mRNA which
would not code for functional dystrophin protein but, for DMD patients with particular frameshifting
mutations, giving eteplirsen can restore the reading frame of the dystrophin mRNA and result in
production of functional (although modified by having an internal deletion consisting of both the patient's
original defect, as well as the therapeutically skipped exon) dystrophin.[7] Eteplirsen is given by
intravenous infusion for systemic treatment of DMD.
Exon skipping is induced by eteplirsen, a charge-neutral, phosphorodiamidate morpholino oligomer
(PMO) that selectively binds to exon 51 of dystrophin pre-mRNA, restoring the phase of the reading
frame and enabling production of functional, but truncated, dystrophin.[8] The uncharged nature of the
PMO helps make it resistant to biological degradation.[9] This truncated dystrophin protein produced by
eteplirsen causes a less severe form of dystrophinopathy, much like Becker muscular dystrophy. PMO
technology to treat other genotypes amenable to exon skipping could potentially treat an estimated 70 to
80% of all DMD patients with dystrophin gene deletion. Eteplirsen's proposed mechanism of action is to
bind to pre-mRNA needed to make a particular muscle protein, dystrophin, and rearrange the splicing of
the RNA so that more dystrophin is made. By increasing the quantity of an abnormal, but potentially
functional, dystrophin protein, the objective is to slow or prevent the progression of DMD.[8][10]

Clinical studies[edit]
Several clinical trials have been conducted to test eteplirsen, one in the UK involving local injection to
the foot,[11][12] one in the UK involving systemic injection at low doses[1][13] and one in the USA at higher
systemic doses[14] that progressed to a rollover extension study.[10][15] In the phase II study of 12 boys,
dystrophin production was increased in 72% of the participants. It is questioned whether increasing the
dose — which is feasible due to the lower toxicity of eteplirsen compared to drisapersen — would
benefit the non-responders and whether this could result in any increased side effects. A phase III study
has begun in the USA.[16]
In 2011, in a UK study eteplirsen (AVI-4658) was given to 19 children with Duchenne muscular
dystrophy; researchers found that higher doses of the drug led to an increase in dystrophin.
Researchers believe that drugs which are designed to make the body “skip over” mutations in this way
could be used to treat approximately 83% of Duchenne muscular dystrophy cases. Eteplirsen only
targets mutations in a region implicated in 13% of cases. This study demonstrated the potential of this
approach for increasing the levels of dystrophin in the short term. The trial’s principal aim was to work
out the appropriate dosages of the drug, therefore the drug’s safety profile and effects will need to be
confirmed in larger, longer-term studies, particularly as patients would need to take it for the rest of their
lives (or until a better treatment is available).[1]
A similar drug was also in clinical trials, drisapersen, which is a 2'-O-methyl phosphorothioate antisense
oligo that, like eteplirsen, triggers skipping of dystrophin exon 51. In January 2016, the FDA rejected
drisapersen (Kyndrisa) for lack of efficacy, effectively shifting focus to eteplirsen.[17]

Current status[edit]
Eterplirsen has received accelerated approval from the US FDA.[2]
Both eteplirsen and the similar drug drisapersen filed New Drug Application (NDA) for review with the
US Food and Drug Administration (FDA).[18] The Prescription Drug User Fee Act (PDUFA) goal dates for
these were December 27, 2015 for drisapersen and February 26, 2016 for eteplirsen. Following FDA
rejection of drisapersen, the agency announced a three-month time extension for its review of
eteplirsen. The FDA panel decision was controversial because the FDA staff and the panel used a
stricter standard of evidence than Sarepta and patient groups used. The FDA panel said that it was
required by law to apply the standard of “substantial evidence” of effectiveness. This required
randomized, controlled trials showing effectiveness of a meaningful clinical outcome, such as the ability
to function in daily life. Sarepta and the patient groups wanted to use the standard of historical controls,
personal testimonies, and the presence of altered dystrophin in the body. On April 25, 2016, the
Advisory Committee Panel voted against approval;.[19] In June 2016, FDA requested for additional data
from Sarepta, to confirm findings of dystrophin production by Eteplirsen. Janet Woodcock, director of the
FDA’s Center for Drug Evaluation and Research, overruled the panel, and FDA Commissioner Robert
Califf deferred to her decision. Eterplirsen received accelerated approval on September 19, 2016.[20]

Pharmacokinetic (PK) properties and potential side effects[edit]

On January 22, 2016 the FDA Briefing Document containing information about eteplirsen (ND 206488)
was submitted to the Peripheral and Central Nervous System Advisory Committee Meeting. The most
common treatment for DMD is glucocorticoid use, which do not sufficiently ameliorate symptoms or
address the underlying genetic mutation and lack of functional dystrophin. Part of the document
included the following information pertaining to the pharmacokinetic properties of eteplirsen:[8]

 Clinical safety data shows that there has been no adverse effects from treatment with Eteplirsen-
based off the doses administered in several trials.
 In general, dose-proportionality and linearity in PK properties may be concluded following weekly
doses of 0.5~20 mg/kg in Phase 1 dose-ranging study and 30 and 50 mg/kg in efficacy trials. There
was insignificant drug accumulation following weekly dosing across this dose range of 0.5~50 mg/kg
 Eteplirsen is not metabolized by hepatic microsomes and was not a potent inducer or inhibitor of the
major human CYP enzymes, and was not a substrate, nor did it have any major inhibitory potential
for any of the key human drug transporters at the concentration range given in clinical trials. Based
on these findings, it is expected to have a low potential for drug-drug interactions (DDI) in humans.
 Eteplirsen was found to be metabolically stable in vitro with no evidence of metabolism or metabolite
formation.
 Most of the metabolism of eteplirsen is done through the kidneys.
 Following single or multiple IV infusion, the peak plasma concentrations (Cmax) of eteplirsen occurred
near the end of infusion and plasma concentration-time profiles of eteplirsen were generally similar
and showed multi-phasic decline; the majority of drug elimination occurred within 24 hours.
 Plasma protein binding of eteplirsen in human is relatively low, ranging 6.1~16.5% and is
independent of concentration studied.

Nature and sequence of oligo and target[edit]

Eteplirsen is a morpholino phosphorodiamidate antisense oligomer.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING
DOCUMENT NDA 206488[8]),
30-mer,
20% G,
43% CG,
Predicted Tm: 88.9 °C at 10 µM oligo.
Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG
DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target
site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering
splicing by interfering with splice regulation.
CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT
CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC
GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA
GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG

References[edit]
1. ^ Jump up to:a b c Cirak, Sebahattin; Arechavala-Gomeza, Virginia; Guglieri, Michela; Feng, Lucy; Torelli,
Silvia; Anthony, Karen; Abbs, Stephen; Garralda, Maria Elena; Bourke, John; Wells, Dominic J; Dickson,
George; Wood, Matthew JA; Wilton, Steve D; Straub, Volker; Kole, Ryszard; Shrewsbury, Stephen B;
Sewry, Caroline; Morgan, Jennifer E; Bushby, Kate; Muntoni, Francesco (2011). "Exon skipping and
dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate
morpholino oligomer treatment: an open-label, phase 2, dose-escalation study". The Lancet. 378 (9791):
595–605. doi:10.1016/S0140-6736(11)60756-3. PMC 3156980  . PMID 21784508. Lay summary – NHS
Choices (July 25, 2011).
2. ^ Jump up to:a b "FDA grants accelerated approval to first drug for Duchenne muscular dystrophy". Press
Announcements. U.S. Food & Drug Administration. September 19, 2016. Retrieved September 19, 2016.
3. Jump up^ "Railroading at the FDA" (PDF). Nature Biotechnology. 34 (11): 1078. November
2016. doi:10.1038/nbt.3733. Retrieved 29 November 2016.
4. Jump up^ Kounang, Nadia (4 October 2016). "The families that fought for controversial new drug". CNN.
Retrieved 29 November 2016.
5. Jump up^ Lim, Kenji Rowel Q; Maruyama, Rika; Yokota, Toshifumi (February 2017). "Eteplirsen in the
treatment of Duchenne muscular dystrophy". Drug Design, Development and Therapy. 11: 533–
545. doi:10.2147/DDDT.S97635. Retrieved 28 February 2017.
6. Jump up^ Anthony, Karen; Feng, Lucy; Arechavala-Gomeza, Virginia; Guglieri, Michela; Straub, Volker;
Bushby, Katherine; Cirak, Sebahattin; Morgan, Jennifer; Muntoni, Francesco (17 Oct 2012). "Exon
Skipping Quantification by qRT-PCR in Duchenne Muscular Dystrophy Patients Treated with the
Antisense Oligomer Eteplirsen". Hum Gene Ther Methods. 23 (5): 336–
45. doi:10.1089/hgtb.2012.117. PMID 23075107.
7. Jump up^ Moulton, HM; Moulton, JD (17 Feb 2010). "Morpholinos and Their Peptide Conjugates:
Therapeutic Promise and Challenge for Duchenne Muscular Dystrophy". Biochim Biophys
Acta. 1798 (12): 2296–303. doi:10.1016/j.bbamem.2010.02.012. PMID 20170628.
8. ^ Jump up
to:a b c dhttp://www.fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/Drugs/Peripheral
andCentralNervousSystemDrugsAdvisoryCommittee/UCM497063.pdf
9. Jump up^ http://www.discoverymedicine.com/Ryszard-Kole/2012/07/26/targeting-mrna-splicing-as-a-
potential-treatment-for-duchenne-muscular-dystrophy
10. ^ Jump up to:a b Mendell, Jerry; Rodino-Klapac, Louise R; Sahenk, Zarife; Roush, Kandice; Bird, Loren;
Lowes, Linda P; Alfano, Lindsay; Gomez, Ann Maria; Lewis, Sarah; Kota, Janaiah; Malik, Vinod; Shontz,
Kim; Walker, Christopher M; Flanigan, Kevin M; Kean, John R; Allen, Hugh D; Shilling, Chris; Melia,
Kathleen R; Sazani, Peter; Saoud, Jay B; Kaye, Edward M; Kaye, Edward M. (2013). "Eteplirsen for the
treatment of duchenne muscular dystrophy". Ann. Neurol. 74 (5): 637–647. doi:10.1002/ana.23982.
11. Jump up^ Gary Roper, Manager Clinical Research Governance Organisation, Imperial College
London. "Safety and Efficacy Study of Antisense Oligonucleotides in Duchenne Muscular
Dystrophy". ClinicalTrials.gov. US Government, NIH. Retrieved 30 October 2012.
12. Jump up^ Kinali, M; Arechavala-Gomeza, V; Feng, L; Cirak, S; Hunt, D; Adkin, C; Guglieri, M; Ashton, E;
Abbs, S; Nihoyannopoulos, P; Garralda, ME; Rutherford, M; McCulley, C; Popplewell, L; Graham, IR;
Dickson, G; Wood, MJ; Wells, DJ; Wilton, SD; Kole, R; Straub, V; Bushby, K; Sewry, C; Morgan, JE;
Muntoni, F (25 Aug 2009). "Local restoration of dystrophin expression with the morpholino oligomer AVI-
4658 in Duchenne muscular dystrophy: A single-blind, placebo-controlled, dose-escalation, proof-of-
 concept study". Lancet Neurol. 8 (10): 918–28. doi:10.1016/S1474-4422(09)70211-X. PMC 2755039 
. PMID 19713152.
13. Jump up^ Professor Francesco Muntoni, University College of London Institute of Child Health. "Dose-
Ranging Study of AVI-4658 to Induce Dystrophin Expression in Selected Duchenne Muscular Dystrophy
(DMD) Patients". ClinicalTrials.gov. US Government, NIH. Retrieved 30 October 2012.
14. Jump up^ Sarepta Therapeutics. "Efficacy Study of AVI-4658 to Induce Dystrophin Expression in
Selected Duchenne Muscular Dystrophy Patients". ClinicalTrials.gov. US Government, NIH. Retrieved 30
October 2012.
15. Jump up^ Sarepta Therapeutics. "Efficacy, Safety, and Tolerability Rollover Study of Eteplirsen in
Subjects With Duchenne Muscular Dystrophy". ClinicalTrials.gov. US Government, NIH. Retrieved 30
October 2012.
16. Jump up^ Sarepta Therapeutics. "Confirmatory Study of Eteplirsen in DMD Patients
(PROMOVI)". ClinicalTrials.gov. US Government, NIH. Retrieved 3 October 2014.
17. Jump up^ FDA rejects BioMarin's muscle wasting drug; Sarepta drug in focus. Jan 2016
18. Jump up^ "FDA Accepts Sarepta's NDA for Eteplirsen". Rare Disease Report.
19. Jump up^ https://www.nytimes.com/2016/04/26/business/muscular-dystrophy-drug-fda-sarepta-
eteplirsen.html
20. Jump up^ Column: To appease a patient lobby, did the FDA approve a $300,000 drug that doesn't work?
Michael Hiltzik, Los Angeles Times, October 28, 2016

Eteplirsen in the treatment of Duchenne muscular dystrophy

Kenji Rowel Q Lim,1 Rika Maruyama,1 and Toshifumi Yokota1,2

Author information ► Copyright and License information ►

This article has been cited by other articles in PMC.

Abstract
Go to:

Duchenne muscular dystrophy (DMD): introduction and management

issues in treatment
DMD is a fatal X-linked recessive neuromuscular disorder characterized by progressive muscle
weakening and wasting.1 It affects around one in 3,500–5,000 males born worldwide.2,3 The
disorder progresses rapidly, with boys losing ambulation by 12 years of age or earlier; death often
occurs within the 20s, usually due to respiratory or cardiac complications.4,5 DMD is caused by
mutations in the DMD gene coding for dystrophin,1,6 a membrane-associated protein that links
cytoskeletal actin in muscle fibers with the surrounding extracellular matrix by forming a network
with sarcolemmal glycoproteins (otherwise known as the dystrophin-associated glycoprotein
complex [DAGC]).7–9 This linkage strengthens muscle structure during stressful
contraction/relaxation cycles;10 recent studies, however, indicate that dystrophin also has
nonmechanical roles.11 Dystrophin has four domains: an N-terminal domain for binding actin, a rod
domain mainly for structural flexibility, a cysteine-rich domain for facilitating protein–protein
interactions, and a C-terminal domain for binding DAGC proteins at the
sarcolemma.9,12 Dystrophin loss predisposes muscle fibers to mechanical damage, leading to
muscle degeneration.
DMD is considered the longest gene in humans, spanning 2.4 Mb in chromosomal region Xp21 with
79 exons and producing a 14 kb transcript.13,14 Due to its length, it is highly susceptible to
mutations. Furthermore, certain regions of DMD are mutation hotspots.15,16 Approximately 60% of
DMD cases are due to deletions of at least one exon in DMD,4,12 ~6% to duplications,17 and the
rest to small mutations. In most cases, these disrupt the DMD reading frame or introduce a
premature stop codon, both of which cease dystrophin production.
At present, most practices for DMD treatment are palliative at best, aimed at managing problems
with ambulation, respiration, and cardiac health that are typical of DMD.4,5 Of these, corticosteroid
treatment has been found to be the overall most effective option for patients. Improved muscular
strength, prolonged ambulation, and better respiratory function were observed in patients treated
with the corticosteroids prednisolone/prednisone or deflazacort in separate long-term clinical
trials.18,19 However, these improvements were temporary – disease progression was only delayed –
and treatment was associated with a number of side effects (eg, weight gain, bone fractures,
cataracts).
There is thus a push toward the development of curative therapies for DMD. To date, a number of
cell- and gene-based strategies have been explored, with varying degrees of success.5,12 Cell-based
strategies involve transplantation of healthy myoblasts into patients, and as such are handicapped by
issues of immune rejection and poor systemic delivery and viability of transplanted cells. Likewise,
conventional gene-based strategies aiming to deliver functional copies of DMD in patients have
turned out problematic, mostly due to poor delivery (owing to the large, complex structure of the
gene)13,14 and the activation of an immune response in cases when a viral vector is used.
Novel strategies without these problems of safety and efficacy are currently emerging.12 One
promising strategy is exon skipping, which attempts to fix the defective DMD gene through the use
of nucleic acid-based drugs.20,21 This approach has shown much promise and has spurred the
development of numerous pharmaceuticals, one of which is eteplirsen, also known as Exondys 51 or
AVI-4658.
Developed by Sarepta Therapeutics (Cambridge, MA, USA), eteplirsen was approved by the US
Food and Drug Administration (FDA) in September 2016, making it the first and currently only
FDA-approved drug for DMD.22 Eteplirsen was granted accelerated approval on the basis of
surrogate end-point results showing that it was able to increase dystrophin levels in
patients.22,23 While the drug is now accessible to patients, an additional clinical trial is still
required by the FDA to demonstrate strong evidence of clinical benefit. This review discusses the
pharmacology of eteplirsen, findings from clinical trials on its efficacy and safety, and issues faced
by the drug in its course to definitive approval. The review ends by highlighting the implications of
eteplirsen on the DMD community and the DMD-therapy scene as a whole.
Go to:

Clinical pharmacology of eteplirsen

Mechanism of action: exon skipping

Not all DMD deletions result in out-of-frame mutations: some lead to in-frame mutations,
generating variants able to produce functional albeit truncated versions of dystrophin. This kind of
deletion occurs in patients with Becker MD (BMD), a milder dystrophinopathy compared to
DMD.24 The genetic difference between DMD and BMD presents an important observation: the
nature of the deletion determines the severity of the disorder. This led to the realization that making
a deletion less harmful by turning an out-of-frame to an in-frame mutation should alter the DMD
phenotype to that of the less severe BMD.
It is with this underlying principle that exon skipping was developed as a therapeutic strategy for
DMD. In this approach, the translational reading frame of a gene is restored using synthetic nucleic
acid analogs called antisense oligonucleotides (AOs) to interfere with pre-messenger RNA (mRNA)
splicing20,25 (Figure 1). AOs are employed to bind target complementary sequences in the pre-
mRNA, which influence the splicing machinery to exclude an exon (or exons) from the final
transcript. The therapeutic potential of the method was first demonstrated in 1993, where correct
splicing of the human β-globin gene was successfully restored in vitro through the use of a 2′O-
methyl RNA AO.26 Since then, the strategy has grown to use a wide array of AO chemistries for the
treatment of various disorders.25

Figure 1

Eteplirsen is an exon-skipping therapeutic.

Eteplirsen is a 30-nucleotide phosphorodiamidate morpholino oligomer (PMO) type of

AO20,27 (Figure 2) with the sequence CTCCAACATCAAGGAAGATGGCATTTCT.28 In
contrast to regular RNA or DNA, PMO bases are attached to a morpholine moiety, and subunits are
connected via phosphorodiamidate linkages that are neutrally charged at physiological
pH.20,29 Eteplirsen hybridizes to exon 51 of DMD(codes for part of hinge 3 within the rod
domain)30 and causes it to be skipped during splicing;20 this corrects the translational reading
frame, resulting in the production of shortened functional dystrophin proteins (Figure 1). A related
DMD therapeutic, drisapersen (BioMarin, San Rafael, CA, USA), is also an AO-based drug with the
same mechanism of action.20 It differs from eteplirsen in that it is an 18-mer 2′O-methyl
phosphorothioate type of AO, which is negatively charged (Figure 2). The FDA rejected drisapersen
in early 2016, due to safety issues associated with the use of the drug and insufficient evidence of
clinical utility.31

Figure 2

Chemical structures for the 2′O-methyl phosphorothioate (2′O-MePS) and phosphorodiamidate morpholino
oligomer (PMO) classes of antisense oligonucleotides (AOs).
Eteplirsen is beneficial for DMD patients with deletions ending at exon 50 and starting at exon
52.12 This covers ~20.5% of DMD patients with deletion mutations, or 14% of all DMD
patients.32 This is the largest group of patients to which single exon skipping is applicable, making
exon 51 a reasonable therapeutic target. Also, in vivo efficacy of DMD exon 51 skipping using
PMOs has been demonstrated in the mdx52dystrophic mouse model,33 further making it a good
target choice.

Pharmacokinetics
Table 1 lists all clinical trials on eteplirsen to date, together with the respective study details. The
pharmacokinetic properties of eteplirsen were studied in two trials: NCT00844597 (Cirak et
al)34 and NCT01396239 (Mendell et al).35 The former was an open-label Phase I/II dose-escalation
study, with eteplirsen administered to DMD patients (19 patients total) as an intravenous (IV)
infusion over a dose range of 0.5–20 mg/kg/week for 12 weeks. The latter was a double-blind Phase
II placebo-controlled study that involved treating DMD patients with eteplirsen at 30 mg/kg/week or
50 mg/kg/week doses for 24 weeks. Each cohort, including the placebo-treated cohort, consisted of
four patients, for a total of 12 enrolled patients. Inclusion/exclusion criteria for these studies are
shown in Table 2. Besides these sources, pharmacokinetic information on eteplirsen is also available
via its drug label.36

Table 1

Information listing of all conducted, ongoing, and recruiting clinical trials on eteplirsen

Table 2

Major inclusion/exclusion criteria for NCT00844597, NCT01396239/...

Eteplirsen had a volume of distribution of 450–981 mL/kg in the dose-escalation study.34 At the
recommended dose of 30 mg/kg/week, the mean apparent volume of distribution was 600
mL/kg.36Specific tissue-distribution data for eteplirsen are not available in the current literature.
However, studies have shown that PMOs do exhibit broad tissue distribution,37 with one study
showing PMO uptake in six different muscle groups in mdx mice.38 Note though that PMO
distribution to muscle and most tissues, other than in the kidney and liver, is poor; this is because
PMOs are neutral, water-soluble molecules, and are thus more favorably cleared from the circulation
than other drugs.37,38 On a different note, metabolism of eteplirsen was not found to occur in the
liver;36 this is consistent with PMOs being unamenable to metabolic action.39
Cirak et al34 showed that eteplirsen had a plasma half-life of 1.62–3.6 hours within the 0.5–20.0
mg/kg dose range. In Mendell et al,35 after 12 weeks of treatment with single IV infusion doses of
30 mg/kg or 50 mg/kg eteplirsen, mean plasma half-lives found were 3.3 hours and 3.2 hours,
respectively. No drug accumulation was observed between doses for dosing schemes of 0.5
mg/kg/week to 50 mg/kg/week.34–36Total plasma clearance was 233–615 mL/h/kg over the dose
range examined in Cirak et al;34 at a 30 mg/kg/week dose, total clearance was 339 mL/h/kg after 12
weeks of treatment.36 The kidneys are responsible for most of this clearance, with the extent of
renal clearance increasing with dose. Mendell et al35 showed that 65%–70% of total clearance was
attributable to renal clearance. It was observed that this magnitude of clearance occurred within the
first 24 hours after drug administration.36
Go to:

Efficacy of eteplirsen
Much of the data on the efficacy of eteplirsen as an IV administered drug for DMD treatment comes
from four trials: NCT00844597, NCT01396239, NCT01540409, and NCT02255552 (Table 1). An
earlier trial39also produced efficacy data, but it involved an intramuscular route of
administration. NCT0154040927 is an extension of NCT01396239, with two modifications:
masking was changed to open-label, and patients in the placebo-treated cohort were switched to
receive eteplirsen treatment. The four patients in the placebo-treated cohort were split, with two
patients receiving either 30 mg/kg/week or 50 mg/kg/week eteplirsen. Matched historical controls
from Italian and Belgian databases were used for the study.
NCT02255552 is the confirmatory study required by the FDA to support the clinical benefit of the
drug.22,23 It is an ongoing, recruiting Phase III trial. Inclusion/exclusion criteria for this study are
shown in Table 2. It is an open-label study planned to consist of two 80-patient cohorts: an
eteplirsen-treated and an untreated cohort. Patients in the former cohort will be subjected to 30
mg/kg/week of etep-lirsen for 96 weeks.40 The reasons behind the choice of dose were not
discussed in the published clinical trial literature. Efficacy will be assessed 48 weeks posttreatment;
treatment will go on to 96 weeks for longitudinal evaluation. In deciding whether to grant
accelerated approval for the drug, the FDA requested preliminary efficacy data from 13 patients
enrolled in the trial 48 weeks posttreatment.23
The efficacy of eteplirsen in these studies was assessed by dystrophin amounts produced as a result
of treatment (a surrogate end point) and by treatment effect on patient ambulation (a clinical end
point). Data from immunohistochemistry (IHC) and Western blotting (WB), which were employed
to determine dystrophin protein localization and levels in patient muscle with antibodies against
DMD rod-domain regions, served as outcome measures for the surrogate end point.34,35 Results
from the 6-minute walk test (6MWT), which measures the distance a patient can independently walk
in 6 minutes, mostly formed the basis for the clinical end point.35

NCT00844597 findings
Eteplirsen treatment was found to improve dystrophin expression in seven of 19 patients: six given
10–20 mg/kg/week and one given 2 mg/kg/week. Dystrophin fluorescence intensity from
semiquantitative IHC showed a significant average increase to 16.4% from 8.9% of healthy controls
posttreatment (P=0.0287). Three patients responded particularly well, showing posttreatment
increases in dystrophin expression to 7.7%, 17%, and 18% of healthy controls in WB. Considering
all results, however, there was an inconsistency of effect. The other four positive responders did not
give appreciable results as the three patients mentioned, and the assays gave results that did not
always agree with each other. Overall, dystrophin expression was not found to increase with dose.
Result variability was ascribed to genetic background differences and random events surrounding
eteplirsen uptake. The investigators suggested performing an extended clinical trial, with the
argument that clinical benefit would only be observable upon prolonged treatment.

NCT01396239/NCT01540409 and NCT02255552 findings

NCT01396239/NCT01540409 was an extended clinical trial that responded to the shortfall
of NCT00844597 with regard to study length. The results from these studies (summarized in Table
3) mostly formed the basis of the FDA decision.23 Patients treated with 30 mg/kg/week of
eteplirsen had a significant mean 22.9% increase in dystrophin-positive fibers via IHC 24 weeks
posttreatment compared to pretreatment values (P≤0.002); such an increase was not observed in the
placebo-treated cohort. This rose significantly to a mean 51.7% at 48 weeks posttreatment
(P≤0.001). Significant increases in dystrophin-positive fibers were also observed in the 50
mg/kg/week and delayed eteplirsen-treated cohorts. Because the FDA found the IHC method
questionable, additional testing was conducted on 11 patient biopsies from all cohorts at 180 weeks
posttreatment with an improved protocol.23 Dystrophin-positive fiber counts were observed at
17.4% on average, casting further doubt on results obtained earlier in the trial.

Table 3

Key efficacy data from NCT01396239/NCT01540409

WB-based quantification of dystrophin expression from 11 of 12 patient muscle biopsies after 180
weeks of treatment in NCT01396239/NCT01540409 revealed that eteplirsen-treated patients
(combined data from 30 mg/kg/week- and 50 mg/kg/week-treatment cohorts) had 0.93% of
dystrophin levels observed in healthy individuals. A similar method was performed for 13 patients
in NCT02255552, 48 weeks into the 30 mg/kg/week-treatment regimen, and a statistically
significant mean increase in dystrophin levels was observed at 0.22%–0.32% of normal levels (the
lower percentage obtained may partly have been because patients were treated for a shorter time).
As at least 10% of normal dystrophin amounts are predicted to translate into clinical benefit in
patients, there has been much dispute23,31 as to whether the dystrophin levels observed are
“reasonably likely to predict clinical benefit”.23
Functional assays conducted in NCT01396239/NCT01540409 include the 6MWT to test ambulation
and measurement of forced vital capacity and maximum inspiratory and expiratory pressures to test
pulmonary function. Results from the 6MWT showed that 30 mg/kg/week eteplirsen did not appear
to provide clinical benefit compared to placebo/delayed-treatment controls 24 and 48 weeks post-
treatment. On the other hand, treatment with 50 mg/kg/week of eteplirsen for 48 weeks showed a
significant difference in the 6MWT compared to the placebo/delayed-treatment control group
(P≤0.001). Comparison of the combined eteplirsen-treated cohort to historical controls after 3 years
of treatment showed a significant 151 m mean difference between the groups in the 6MWT
(P<0.01).
In this study, eteplirsen treatment was observed at most only to delay disease progression in terms of
ambulatory ability as measured by the 6MWT. In fact, 3 years into the study, two of 12 patients lost
ambulation. Although it was argued that this was a considerable improvement compared to
historical controls (where six of 13 patients lost ambulation in the same period of time), the action of
eteplirsen still cannot be deemed sufficient to satisfy the clinical end point of the trial, as also
concluded by the FDA.23
On the other hand, eteplirsen was observed to affect pulmonary function positively in patients
(Table 3). Compared to natural history data – as pulmonary function was not tested in historical
controls – treatment markedly slowed progressive decline in forced vital capacity and maximum
inspiratory and expiratory pressure predicted percentages. Again, however, it would seem that
eteplirsen had more of a delaying rather than an improving effect on these parameters.

Issues and challenges

Eteplirsen is facing two major issues in proving its efficacy as a DMD therapeutic. One is its lack of
apparent efficacy, and the other related issue is clinical trial design, particularly
for NCT01396239/NCT01540409. The unsatisfactory performance of eteplirsen
in NCT01396239/NCT01540409 may be ascribed in part to its chemistry. A main challenge of using
PMOs for treatment is to increase target-tissue uptake, as PMOs exhibit rapid clearance due to their
neutral nature.37 Without altering its chemistry, eteplirsen uptake can be improved by increasing
either its dose or administration frequency. Key efficacy results
in NCT01396239/NCT01540409 were mostly presented with combined data from both the 30
mg/kg/week and 50 mg/kg/week cohorts (Table 3), and so the effect of an increased dose in this
case cannot be clearly established; dosing frequency was not studied in any of the clinical trials. As
also suggested by the FDA,23 it may prove helpful to see how increasing both parameters can
improve efficacy. Additionally, uptake can be improved by administering eteplirsen with hexoses.
Research has shown that PMO administration in a formulation containing glucose and fructose is
eight times more effective in improving dystrophin production through exon skipping than PMOs
administered in saline.41
Another key question is whether the antisense sequence used for eteplirsen was an optimal choice.
The efficacy of exon skipping at different target positions of an exon typically varies more than 20-
fold.42Although screening efforts to identify the best target positions for exon 51 skipping were
made, they relied highly on nonquantitative reverse-transcription polymerase chain-reaction
methods from nonimmortalized, nonclonal primary DMD muscle cells,28 which can produce very
high background signals. Currently available DMD myoblast cell models immortalized by
introduction of the telomerase catalytic subunit (hTERT) and CDK443 can proliferate and
differentiate well enough to produce a large amount of dystrophin after exon skipping that can be
quantified by WB.42 Optimization of the sequence using this cell-based model could potentially
improve the efficacy of exon skipping.
On a related note, dystrophin produced from in-frame DMD deletions starting/ending at exon 51 was
found to be more associated with DMD than BMD patients.44,45 As such, another possible reason
for the poor efficacy observed for eteplirsen might be that the truncated dystrophin produced from
the skipped transcript was not as functional as initially hoped. However, as the functionality of
truncated dystrophin variants resulting from exon skipping has not yet been studied in depth, this
assertion remains a possibility at best.
As mentioned, another issue is clinical trial design. NCT01396239/NCT01540409 is mainly dealing
with four issues: absence of good controls, sample heterogeneity, inadequate sample size, and the
use of a limited selection of outcome measures. While the use of historical controls is somewhat
justified in NCT01540409 – with investigators selecting the most matched controls – there remain
external factors that can make conclusions on efficacy difficult.23 For instance, not all historical
control patients seem to meet the inclusion/exclusion criteria
for NCT01396239/NCT01540409 (Table 2). As such, control values used for assessing treatment
effect may not be entirely accurate.
Cohort heterogeneity is another complicating factor. The patients who participated
in NCT01396239/NCT01540409 had different ages, mutation types, and baseline characteristics (eg,
6MWT baseline results).35 Given the natural history of DMD, age plays a critical role in disease
progression5 and could affect how well a patient responds to treatment. Different DMD-mutation
genotypes have also been shown to lead to DMD-phenotype variability.46 No details were given on
the corticosteroid treatments received by participants; however, it is likely that these varied among
patients and may confound efficacy results. The challenge, therefore, would be to design a trial that
can handle the natural phenotypic variability associated with DMD,46 constructing as homogeneous
a cohort as possible with the available participants. Among other things, this should help set a
representative baseline and improve the reliability of efficacy tests.
Another issue is the low sample size used in NCT01396239/NCT01540409. Due to the said
variability among patients and the difficulty of obtaining statistically useful results with a limited
number of patients, the efficacy of eteplirsen may not have been duly represented in the study.
While the following trial, NCT02255552, has addressed this by planning to enroll 160 patients
(Table 1), other steps can be taken to increase sample size further. One way would be to consider
enrolling nonambulant patients into trials, as the majority of DMD patients are nonambulant.47 This
prevents patients from dropping out due to ambulation loss, provides the opportunity for
nonambulant patients to participate in trials, and potentially facilitates the creation of more
homogeneous cohorts.47,48 This would, however, entail the development and/or use of appropriate
outcome measures to assess efficacy.
On the topic of outcome measures, not all those used in NCT01396239/NCT01540409 were
sufficient to demonstrate efficacy, specifically with regard to muscle function. While the 6MWT is a
standard end point for assessing the clinical utility of DMD therapeutics,49 it is limited, as it applies
only to ambulant patients and has been shown to be motivation-dependent.50 It is suggested to
explore other methods for assessing muscle function, such as the Performance of Upper Limb scale,
which grades the ability of patients to perform 22 different daily tasks using their upper
muscles,48 and myometry, which quantitatively assesses muscular strength, eg, hand grip and knee
extension, through a variety of tests.51 Not only are these more inclusive to nonambulant patients,
they will also determine how treatment affects specific muscle groups.
Finally, there is the issue with the reproducibility and reliability of the methods done for the
surrogate end point in NCT01396239/NCT01540409. IHC and WB are standard procedures for
quantifying effects on dystrophin expression; however, investigations by the FDA have shown that
the methods used for these techniques were questionable.23 Consequently, any correlation between
results from these tests and observed effects on muscle function in patients cannot be reliably made.
After being subjected to rigorous examination, these methods likely have been improved and
validated according to FDA standards for NCT02255552. Nevertheless, it would be helpful to use
an additional highly reproducible outcome measure, such as the quantification of muscle–fat
conversion through magnetic resonance imaging and spectroscopy,47,52,53 to further strengthen the
surrogate end point.
Go to:

Safety and tolerability of eteplirsen

The chemical nature of PMOs presents certain advantages in terms of safety. This safety is, for the
most part, due to the fact that PMOs lack charge29 (Figure 2). It is thought that this makes PMOs
largely incapable of interacting with proteins like nucleases, whose affinity to their natural targets
(DNA, RNA) is highly dependent on the presence of a negative charge.29,54 As a result, PMOs are
not subject to nuclease-mediated degradation and are highly stable in cellular environments. This
improved stability adds to their safety as a therapeutic, as unwanted incorporation of individual
PMO subunits into the genetic material of a patient is made virtually unlikely.29
Notably, this insusceptibility to protein interaction also renders PMOs unable to sufficiently bind
and activate Toll-like receptors, a class of receptors responsible for producing an innate immune
response against pathogenic material.25,54 Upon activation, Toll-like receptors initiate signaling
cascades that lead in turn to the activation of transcription factors belonging to the nuclear factor
kappa B (NF B), AP1, and IRF families; these families collectively stimulate the production of pro-
inflammatory cytokines and type I IFNs that induce inflammation.55 The independence of PMOs
from the RNase H degradative pathway also adds to safety, as it promotes specificity of antisense
activity.29,54 Because the RNase H system is not used, unwanted degradation of nontarget
(possibly important) transcripts is avoided.

Preclinical trials
Preclinical studies on eteplirsen have been done on cynomolgus monkeys and mdx mice. One of
these involved the subcutaneous or IV administration of eteplirsen up to the 320 mg/kg maximum
dose (clinically, this translates to 100 mg/kg in humans) in cynomolgus monkeys.56 This study
found that eteplirsen was well tolerated using either administration route at the highest dose, with no
observable adverse effects on cardiovascular, respiratory, neurological, or renal parameters.
Genotoxicity assays were also done through the bacterial reverse-mutation assay with Salmonella
typhimurium and Escherichia colitester strains, the chromosome-aberration assay with CHO cells,
and the bone marrow-micronucleus test with ICR mice. No toxic effects were found in these assays
with eteplirsen compared to corresponding controls up to the maximum tested doses of 5,000
µg/plate, 5,000 µg/mL, or 2,000 mg/kg, respectively. Safety results in this study paved the way for
the initiation of NCT00844597, the Phase I/II dose-ranging study with eteplirsen (Table 1).
Subsequent research in cynomolgus monkeys,57 in an effort to support NCT00844597, tested the
toxicological effect of repeated IV bolus dosing of eteplirsen at 5–320 mg/kg/week with untreated
controls for 12 weeks. As found previously, eteplirsen was well tolerated, with no observable
adverse effects. Histological observations from kidney samples revealed instances of basophilic
granules/tubules and tubular vacuolation that became more prevalent with dose, but these
spontaneously reversed with time during recovery and did not affect measured serum chemistry
parameters or renal function. This histological occurrence has been attributed to the renal
accumulation of the drug, likely as a result of clearance activity. Studies in mdx mice58 with up to
960 mg/kg/week of IV-administered eteplirsen produced similar results, including the observed
histological changes in kidneys.

Clinical trials
Eteplirsen was well tolerated with no adverse effects in NCT00844597, where the maximum dose
administered as an IV infusion was 20 mg/kg/week for 12 weeks. There was a reported case of
serious cardiac fractional shortening in one patient, but this was attributed to a DMD-related and not
a drug-related complication. Safety issues external to the expected DMD phenotype were not found
with respect to lung, kidney, liver, or bone marrow function. Inflammatory infiltrates, as revealed by
IHC on muscle biopsies with a set of T-cell-specific antibodies, were found at generally decreased
frequencies among treated patients. This is consistent with the nonimmunogenic nature of PMOs
described earlier.54,55 Anti-dystrophin antibody production was not induced by eteplirsen
treatment.
A similar safety profile for eteplirsen was observed in NCT01396239/NCT01540409 at 48 weeks
posttreatment with 30 mg/kg/week or 50 mg/kg/week of eteplirsen. At this time posttreatment, the
drug was well tolerated, neither hepatic nor renal function were compromised, serum chemistry and
properties appeared to be within expectations given the progression of DMD, and no T-cell-based
immune response was stimulated. Three years into the trial, eteplirsen was still well tolerated. Note,
though, that there were some generally observed adverse effects in patients during the course of the
entire study that were deemed related to eteplirsen treatment. These included, among others,
vomiting, headaches, balance disorder, and proteinuria. These events were manifest in about half of
patients treated with eteplirsen (independently of dose) for 168 weeks. Treatment schedules
remained uninterrupted and as planned amid these events.
Go to:

Patient-focused perspectives
The approval and use of eteplirsen are seen as a welcome hope, widely supported and celebrated by
DMD patients and a number of advocacy groups.59,60 However, there is the issue of efficacy that
has to be resolved by Sarepta. At present, eteplirsen is far from curative: trial results have shown
eteplirsen to have a marginal effect on improving DMD clinical manifestations and all while the
drug is administered with the standard of care for DMD, eg, corticosteroid treatment. Sarepta has
also announced that eteplirsen will cost ØS$300,000 a year on average, with the price varying
depending on patient weight.61 The price is thought to be reasonable for a rare disorder, but whether
patients should spend so much for a drug with disputed efficacy remains contested. Eteplirsen is
indeed a landmark achievement for the DMD community; however, stronger evidence of efficacy is
undoubtedly required for cementing its place as a viable DMD therapeutic.
On the other hand, while much investment has been made in eteplirsen, it is still only applicable to a
highly specific subset of DMD patients, ie, th 14% of patients with mutations amenable to exon 51
skipping.32Therapeutics aimed at skipping other exons or that use a cocktail of exon-skipping AOs
must be developed to cover other patients.62–64 Currently, Sarepta has two other exon-skipping
AOs for DMD in Phase III clinical trials. These are SRP-4045 and SRP-4053, PMOs that target
exons 45 and 53, respectively (NCT02500381). There is also another PMO-based drug, NS-
065/NCNP-01, developed by Nippon Shinyaku and the National Center of Neurology and
Psychiatry (Tokyo, Japan), that acts by exon 53 skipping. A Phase II trial (NCT02740972) to test
this drug is currently recruiting. Trial results for the aforementioned drugs are not yet available in
the literature. In relation to this, it has been shown that besides AOs, small chemical compounds that
affect the phosphorylation of SR proteins can also be used to promote DMD exon skipping in DMD
patients.65 Also, besides exon skipping, another promising strategy is nonsense suppression,
wherein premature stop codons in the DMD gene are bypassed or ignored by translational
machinery, leading to successful dystrophin production.5 One drug working under this principle is
PTC Therapeutics’ (South Plainfield, NJ, USA) ataluren or Translarna.66 Ataluren has performed
satisfactorily in clinical trials to obtain conditional approval from the European Medicines Agency
in 2014 (~2 years ahead of eteplirsen, making it the first drug ever approved for DMD) for DMD
treatment in the EU.5,67 Like eteplirsen, a confirmatory clinical trial is required for its final
approval in the EU.
On a different note, the highly specific nature of exon-skipping therapy presents additional concerns
for patients. Under the current regulatory framework, AOs targeting different sequences or with
different chemistry are seen as different therapeutics. Each chemistry-unique, sequence-specific AO
will thus have to be individually checked for safety and efficacy in the form of lengthy preclinical
and clinical trials.68The same situation applies for therapies aiming to use exon-skipping AOs in
combination. All in all, this equates to high costs accrued over long periods of time spent for each
therapeutic, for a few DMD cases: an assemblage of factors bound to discourage potential drug
manufacturers. There thus exists a strong need to rethink the regulatory procedure for AO-based
therapeutics, in the interests of time – recall the rapid progression of DMD – and of providing
treatment accessibility to a huge number of DMD patients.68,69
Another related issue is AO patenting by pharmaceutical companies, academic institutes, and others.
Numerous patents claiming exclusive use of AOs covering entire DMD-exon sequences have been
granted to such entities70–72 and are seen to hamper the development of new DMD therapies using
antisense technology. Revisions to patent policy, eg, redefining what constitutes as
patentable,73 and the adaptation of less stringent licensing policies by patent holders, eg, by using
patent pools or making licenses more affordable,74 could prove vital to streamlining the DMD
therapy-development process and speeding up the creation of therapeutics for patients. As this issue
of gene-based patenting is not specific to DMD,75,76such changes would also be beneficial for the
development of therapies and molecular diagnostic tools74,75,77 for other genetic disorders.
All that aside, as a therapeutic technique, AO-based exon skipping of at most two exons is only
applicable to about 83% of all patients with amenable deletions, duplications, and small
mutations.78 Patients with mutations in key DMD protein domain-coding regions are not amenable
to treatment by exon skipping. Alternative options to AO-based therapy must thus be explored for
the treatment of these patients.
Go to:

Conclusion
Multidisciplinary management of symptoms is currently the standard of treatment for DMD, with
interventions primarily focused on delaying disease progression.5 None of these directly addresses
the molecular etiology of DMD. The envisioned place of eteplirsen in therapy would thus be to
serve as a curative treatment option for patients, as it acts directly on the DMD gene itself to restore
dystrophin production. While accelerated approval of the therapeutic has paved the way for early
patient access to eteplirsen, it was faced with heated controversy over the observed efficacy of the
drug in clinical trials.23,31 A confirmatory Phase III trial is ongoing and recruiting participants to
resolve this issue; results from this trial are also vital for eteplirsen to obtain final approval from the
FDA.
Eteplirsen is beneficial for patients with amenable DMD mutations, comprising ~14% of the entire
DMD-patient population.32 This leaves a majority of DMD patients without a treatment option that
directly addresses the molecular cause of the disorder. In the meantime, while eteplirsen
development is under way, it would be most beneficial if research on improving present antisense-
based therapeutic strategies were continued (not only for exon 51 skipping but also for the skipping
of other exons) or if other avenues for treatment of the disorder were explored. For instance, recent
advances in enhancing PMO uptake and efficacy through its conjugation with cell-penetrating
peptides (called peptide-conjugated PMOs) are showing promising results in animal
models79,80 and have great potential to enter clinical trials soon. Concurrent with these scientific
advancements, however, must be a reevaluation of the current regulatory process to accommodate
the personal nature of antisense therapies better. Above anything else, collaborative efforts among
the scientific, regulatory, and patient communities must be sustained to help keep the DMD-therapy
scene moving forward.
Go to:

Acknowledgments
This work was supported by Muscular Dystrophy Canada, the Friends of Garrett Cumming
Research Fund, the HM Toupin Neurological Science Research Fund, Canadian Institutes of Health
Research (CIHR), Alberta Innovates: Health Solutions (AIHS), Jesse’s Journey, Canada Foundation
for Innovation (CFI), Alberta Advanced Education and Technology, and the Women and Children’s
Health Research Institute (WCHRI).
Go to:

Footnotes
Disclosure

The authors report no conflicts of interest in this work.

Go to:

References
1. Hoffman EP, Brown RH, Kunkel LM. Dystrophin: the protein product of the Duchenne muscular dystrophy
locus. Cell. 1987;51(6):919–928. [PubMed]

2. Emery AE. Population frequencies of inherited neuromuscular diseases: a world survey. Neuromuscul
Disord. 1991;1(1):19–29. [PubMed]

3. Mendell JR, Shilling C, Leslie ND, et al. Evidence-based path to newborn screening for Duchenne muscular
dystrophy. Ann Neurol. 2012;71(3):304–313. [PubMed]

4. Manzur A, Kinali M, Muntoni F. Update on the management of Duchenne muscular dystrophy. Arch Dis
Child. 2008;93(11):986–990. [PubMed]
5. Mah JK. Current and emerging treatment strategies for Duchenne muscular dystrophy. Neuropsychiatr
Dis Treat. 2016;12(3):1795–1807. [PMC free article] [PubMed]

6. Koenig M, Monaco AP, Kunkel LM. The complete sequence of dystrophin predicts a rod-shaped
cytoskeletal protein. Cell. 1988;53(2):219–228. [PubMed]

7. Ervasti JM, Campbell KP. A role for the dystrophin-glycoprotein complex as a transmembrane linker
between laminin and actin. J Cell Biol. 1993;122(4):809–823. [PMC free article] [PubMed]

8. Ervasti JM, Campbell KP. Membrane organization of the dystrophin-glycoprotein

complex. Cell. 1991;66(6):1121–1131. [PubMed]

9. Ervasti JM. Dystrophin, its interactions with other proteins, and implications for muscular
dystrophy. Biochim Biophys Acta. 2007;1772(2):108–117. [PubMed]

10. Petrof BJ, Shrager JB, Stedman HH, Kelly AM, Sweeney HL. Dystrophin protects the sarcolemma from
stresses developed during muscle contraction. Proc Natl Acad Sci U S A. 1993;90(8):3710–3714.[PMC free
article] [PubMed]

11. Nichols B, Takeda S, Yokota T. Nonmechanical roles of dystrophin and associated proteins in exercise,
neuromuscular junctions, and brains. Brain Sci. 2015;5(3):275–298. [PMC free article] [PubMed]

12. van Deutekom JC, van Ommen GJ. Advances in Duchenne muscular dystrophy gene therapy. Nat Rev
Genet. 2003;4(10):774–783. [PubMed]

13. Koenig M, Hoffman EP, Bertelson CJ, Monaco AP, Feener C, Kunkel LM. Complete cloning of the
Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in
normal and affected individuals. Cell. 1987;50(3):509–517. [PubMed]

14. Roberts RG, Coffey AJ, Bobrow M, Bentley DR. Exon structure of the human dystrophin
gene. Genomics. 1993;16(2):536–538. [PubMed]

15. Buzin CH, Feng J, Yan J, et al. Mutation rates in the dystrophin gene: a hotspot of mutation at a CpG
dinucleotide. Hum Mutat. 2005;25(2):177–188. [PubMed]

16. Takeshima Y, Yagi M, Okizuka Y, et al. Mutation spectrum of the dystrophin gene in 442
Duchenne/Becker muscular dystrophy cases from one Japanese referral center. J Hum
Genet. 2010;55(6):379–388. [PubMed]

17. White S, Kalf M, Liu Q, et al. Comprehensive detection of genomic duplications and deletions in the DMD
gene, by use of multiplex amplifiable probe hybridization. Am J Hum Genet. 2002;71(2):365–374.[PMC free
article] [PubMed]

18. Goto M, Komaki H, Takeshita E, et al. Long-term outcomes of steroid therapy for Duchenne muscular
dystrophy in Japan. Brain Dev. 2016;38(9):785–791. [PubMed]

19. Biggar WD, Harris VA, Eliasoph L, Alman B. Long-term benefits of deflazacort treatment for boys with
Duchenne muscular dystrophy in their second decade. Neuromuscul Disord. 2006;16(4):249–255.[PubMed]
20. Kole R, Krieg AM. Exon skipping therapy for Duchenne muscular dystrophy. Adv Drug Deliv
Rev. 2015;87:104–107. [PubMed]

21. Guncay A, Yokota T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have
we come and what does the future hold? Future Med Chem. 2015;7(13):1631–1635. [PubMed]

22. US Food Drug Administration . FDA grants accelerated approval to first drug for Duchenne muscular
dystrophy [press release] Silver Spring (MD): FDA; 2016. Sep 19, [Accessed November 18, 2016]. Available
from: http://www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/ucm521263.htm.

23. US Food Drug Administration Application number 206488Orig1s000: summary review. 2016. [Accessed
November 5, 2016]. Available
from:http://www.accessdata.fda.gov/drugsatfda_docs/nda/2016/206488_summaryreview_redacted.pdf.

24. Monaco AP, Bertelson CJ, Liechti-Gallati S, Moser H, Kunkel LM. An explanation for the phenotypic
differences between patients bearing partial deletions of the DMD locus. Genomics. 1988;2(1):90–
95.[PubMed]

25. Lee JJA, Yokota T. Antisense therapy in neurology. J Pers Med. 2013;3(3):144–176. [PMC free
article][PubMed]

26. Dominski Z, Kole R. Restoration of correct splicing in thalassemic pre-mRNA by antisense

oligonucleotides. Proc Natl Acad Sci U S A. 1993;90(18):8673–8677. [PMC free article] [PubMed]

27. Mendell JR, Goemans N, Lowes LP, et al. Longitudinal effect of eteplirsen versus historical control on
ambulation in Duchenne muscular dystrophy. Ann Neurol. 2016;79(2):257–271. [PMC free article][PubMed]

28. Arechavala-Gomeza V, Graham IR, Popplewell LJ, et al. Comparative analysis of antisense
oligonucleotide sequences for targeted skipping of exon 51 during dystrophin pre-mRNA splicing in human
muscle. Hum Gene Ther. 2007;18(9):798–810. [PubMed]

29. Summerton J, Weller D. Morpholino antisense oligomers: design, preparation, and properties. Antisense
Nucleic Acid Drug Dev. 1997;7(3):187–195. [PubMed]

30. Leiden University Medical Center DMD (dystrophin) 2004. [Accessed January 22, 2017]. Available
from: http://www.dmd.nl/DMD_home.html.

31. Kesselheim AS, Avorn J. Approving a problematic muscular dystrophy drug: implications for FDA
policy. JAMA. 2016;316(22):2357–2358. [PubMed]

32. Bladen CL, Salgado D, Monges S, et al. The TREAT-NMD DMD Global Database: analysis of more than
7,000 Duchenne muscular dystrophy mutations. Hum Mutat. 2015;36(4):395–402. [PMC free
article][PubMed]

33. Aoki Y, Nakamura A, Yokota T, et al. In-frame dystrophin following exon 51-skipping improves muscle
pathology and function in the exon 52-deficient mdx mouse. Mol Ther. 2010;18(11):1995–2005.[PMC free
article] [PubMed]
34. Cirak S, Arechavala-Gomeza V, Guglieri M, et al. Exon skipping and dystrophin restoration in patients
with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an
open-label, phase 2, dose-escalation study. Lancet. 2011;378(9791):595–605. [PMC free article] [PubMed]

35. Mendell JR, Rodino-Klapac LR, Sahenk Z, et al. Eteplirsen for the treatment of Duchenne muscular
dystrophy. Ann Neurol. 2013;74(5):637–647. [PubMed]

36. Sarepta Therapeutics Exondys 51 [prescribing information] 2016. [Accessed November 6, 2016].
Available from: http://www.accessdata.fda.gov/drugsatfda_docs/label/2016/206488lbl.pdf.

37. Geary RS, Norris D, Yu R, Bennett CF. Pharmacokinetics, biodistribution and cell uptake of antisense
oligonucleotides. Adv Drug Deliv Rev. 2015;87:46–51. [PubMed]

38. Burki U, Keane J, Blain A, et al. Development and application of an ultrasensitive hybridization-based
ELISA method for the determination of peptide-conjugated phosphorodiamidate morpholino
oligonucleotides. Nucleic Acid Ther. 2015;25(5):275–284. [PMC free article] [PubMed]

39. Kinali M, Arechavala-Gomeza V, Feng L, et al. Local restoration of dystrophin expression with the
morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose-
escalation, proof-of-concept study. Lancet Neurol. 2009;8(10):918–928. [PMC free article] [PubMed]

40. Sarepta Therapeutics Confirmatory study of eteplirsen in DMD patients (PROMOVI) [Accessed
November 5, 2016]. Available from: https://clinicaltrials.gov/ct2/show/study/NCT02255552. NLM identifier:
NCT02255552.

41. Han G, Gu B, Cao L, et al. Hexose enhances oligonucleotide delivery and exon skipping in dystrophin-
deficient mdx mice. Nat Commun. 2016;7:10981. [PMC free article] [PubMed]

42. Echigoya Y, Mouly V, Garcia L, Yokota T, Duddy W. In silico screening based on predictive algorithms as a
design tool for exon skipping oligonucleotides in Duchenne muscular dystrophy. PLoS
One. 2015;10(3):e0120058. [PMC free article] [PubMed]

43. Mamchaoui K, Trollet C, Bigot A, et al. Immortalized pathological human myoblasts: towards a universal
tool for the study of neuromus-cular disorders. Skelet Muscle. 2011;1:34. [PMC free article][PubMed]

44. Yokota T, Duddy W, Partridge T. Optimizing exon skipping therapies for DMD. Acta
Myol. 2007;26(3):179–184. [PMC free article] [PubMed]

45. Yokota T, Takeda S, Lu QL, Partridge TA, Nakamura A, Hoffman EP. A renaissance for antisense
oligonucleotide drugs in neurology: exon skipping breaks new ground. Arch Neurol. 2009;66(1):32–38.[PMC
free article] [PubMed]

46. Ricotti V, Muntoni F, Voit T. Challenges of clinical trial design for DMD. Neuromuscul
Disord. 2015;25(12):932–935. [PubMed]

47. Straub V, Balabanov P, Bushby K, et al. Stakeholder cooperation to overcome challenges in orphan
medicine development: the example of Duchenne muscular dystrophy. Lancet Neurol. 2016;15(8):882–
890. [PubMed]
48. Mayhew A, Mazzone ES, Eagle M, et al. Development of the performance of the upper limb module for
Duchenne muscular dystrophy. Dev Med Child Neurol. 2013;55(11):1038–1045. [PubMed]

49. Bushby K, Connor E. Clinical outcome measures for trials in Duchenne muscular dystrophy: report from
International Working Group meetings. Clin Investig (Lond) 2011;1(9):1217–1235.[PMC free
article] [PubMed]

50. Alfano L, Lowes L, Berry K, et al. Pilot study evaluating motivation on the performance of timed walking
in boys with Duchenne muscular dystrophy. Neuromuscul Disord. 2014;24(9–10):860.

51. Parent Project Muscular Dystrophy Guidance for industry – Duchenne muscular dystrophy: developing
drugs for treatment over the spectrum of disease. 2014. [Accessed February 13, 2017]. Available
from:http://www.parentprojectmd.org/site/DocServer/Guidance_Document_Submission_Duchenne_Musc
ular_Dystrop.pdf?docID=15283.

52. Ricotti V, Evans MR, Sinclair CD, et al. Upper limb evaluation in Duchenne muscular dystrophy: fat-water
quantification by MRI, muscle force and function define endpoints for clinical trials. PLoS
One. 2016;11(9):e0162542. [PMC free article] [PubMed]

53. Forbes SC, Willcocks RJ, Triplett WT, et al. Magnetic resonance imaging and spectroscopy assessment of
lower extremity skeletal muscles in boys with Duchenne muscular dystrophy: a multicenter cross sectional
study. PLoS One. 2014;9(9):e106435. [PMC free article] [PubMed]

54. Moulton JD. Guide for morpholino users: toward therapeutics. J Drug Discov Dev Deliv. 2016;3(2):1023.

55. Murphy K. Janeway’s Immunobiology. 8th ed. New York: Garland Science; 2012.

56. Sazani P, Weller DL, Shrewsbury SB. Safety pharmacology and genotoxicity evaluation of AVI-4658. Int J
Toxicol. 2010;29(2):143–156. [PubMed]

57. Sazani P, Van Ness KP, Weller DL, Poage DW, Palyada K, Shrewsbury SB. Repeat-dose toxicology
evaluation in cynomolgus monkeys of AVI-4658, a phosphorodiamidate morpholino oligomer (PMO) drug
for the treatment of Duchenne muscular dystrophy. Int J Toxicol. 2011;30(3):313–321. [PubMed]

58. Sazani P, Van Ness KP, Weller DL, Poage D, Nelson K, Shrewsbury AS. Chemical and mechanistic
toxicology evaluation of exon skipping phosphorodiamidate morpholino oligomers in mdx mice. Int J
Toxicol. 2011;30(3):322–333. [PubMed]

59. Parent Project Muscular Dystrophy PPMD applauds FDA for landmark approval of first-ever disease-
modifying drug to treat Duchenne muscular dystrophy. 2016. [Accessed November 18, 2016]. Available
from: http://www.prnewswire.com/news-releases/ppmd-applauds-fda-for-landmark-approval-of-first-ever-
disease-modifying-drug-to-treat-duchenne-muscular-dystrophy-300330263.html?tc=eml_cleartime.

60. Global Genes Duchenne community rejoices over FDA approval of eteplirsen! 2016. [Accessed
November 18, 2016]. Available from: https://globalgenes.org/raredaily/duchenne-community-rejoices-
over-fda-approval-of-eteplirsen.
61. Black A, Radke J. Sarepta’s Duchenne drug to cost $300k annually. 2016. [Accessed January 29, 2017].
Available from: http://www.raredr.com/news/duchenne-drug-to-cost-300k.

62. Echigoya Y, Yokota T. Skipping multiple exons of dystrophin transcripts using cocktail antisense
oligonucleotides. Nucleic Acid Ther. 2014;24(1):57–68. [PubMed]

63. Aoki Y, Yokota T, Wood MJ. Development of multiexon skipping antisense oligonucleotide therapy for
Duchenne muscular dystrophy. Biomed Res Int. 2013;2013:402369. [PMC free article] [PubMed]

64. Yokota T, Duddy W, Echigoya Y, Kolski H. Exon skipping for nonsense mutations in Duchenne muscular
dystrophy: too many mutations, too few patients? Expert Opin Biol Ther. 2012;12(9):1141–1152.[PubMed]

65. Nishida A, Kataoka N, Takeshima Y, et al. Chemical treatment enhances skipping of a mutated exon in
the dystrophin gene. Nat Commun. 2011;2:308. [PMC free article] [PubMed]

66. Bushby K, Finkel R, Wong B, et al. Ataluren treatment of patients with nonsense mutation
dystrophinopathy. Muscle Nerve. 2014;50(4):477–487. [PMC free article] [PubMed]

67. PTC Therapeutics PTC Therapeutics receives conditional approval in the European Union for Translarna
for the treatment of nonsense mutation Duchenne muscular dystrophy. 2014. [Accessed November 18,
2016]. Available from: http://ir.ptcbio.com/ReleaseDetail.cfm?ReleaseID=863914.

68. Aartsma-Rus A, Ferlini A, Goemans N, et al. Translational and regulatory challenges for exon skipping
therapies. Hum Gene Ther. 2014;25(10):885–892. [PubMed]

69. Douglas AG, Wood MJ. Splicing therapy for neuromuscular disease. Mol Cell Neurosci. 2013;56:169–
185. [PMC free article] [PubMed]

70. Sazani P, Kole R, inventors. Sarepta Therapeutics, assignee Multiple exon skipping compositions for
DMD. US9234198B1. United States patent. 2016 Jan 12;

71. Wilton SD, Fletcher S, McClorey G, inventors. University of Western Australia, assignee Antisense
oligonucleotides for inducing exon skipping and methods of use thereof. US9035040B2. United States
patent. 2015 May 19;

72. Platenburg G, De Kimpe J, van Deutekom JC, van Ommen GJ, Aartsma-Rus A, inventors. Biomarin
Technologies, assignee Methods for efficient exon (44) skipping in duchenne muscular dystrophy and
associated means. US9139828B2. United States patent. 2015 Sep 22;

73. Cook-Deegan R. Law and science collide over human gene patents. Science. 2012;338(6108):745–
747.[PubMed]

74. Andrews LB. Genes and patent policy: rethinking intellectual property rights. Nat Rev
Genet. 2002;3(10):803–808. [PubMed]

75. Caulfield T, Cook-Deegan RM, Kieff FS, Walsh JP. Evidence and anecdotes: an analysis of human gene
patenting controversies. Nat Biotechnol. 2006;24(9):1091–1094. [PMC free article] [PubMed]
76. Cook-Deegan R, Heaney C. Patents in genomics and human genetics. Annu Rev Genomics Hum
Genet. 2010;11:383–425. [PMC free article] [PubMed]

77. Huys I, Matthijs G, Van Overwalle G. The fate and future of patents on human genes and genetic
diagnostic methods. Nat Rev Genet. 2012;13(6):441–448. [PubMed]

78. Aartsma-Rus A, Fokkema I, Verschuuren J, et al. Theoretic applicability of antisense-mediated exon

skipping for Duchenne muscular dystrophy mutations. Hum Mutat. 2009;30(3):293–299. [PubMed]

79. Yin H, Moulton HM, Seow Y, et al. Cell-penetrating peptide-conjugated antisense oligonucleotides
restore systemic muscle and cardiac dystrophin expression and function. Hum Mol
Genet. 2008;17(24):3909–3918. [PubMed]

80. Yin H, Moulton HM, Betts C, et al. Functional rescue of dystrophin-deficient mdx mice by a chimeric
peptide-PMO. Mol Ther. 2010;18(10):1822–1829. [PMC free article] [PubMed]

FDA Approves Eteplirsen for Duchenne Muscular Dystrophy: The

Next Chapter in the Eteplirsen Saga
Annemieke Aartsma-Rus 1
and Arthur M. Krieg2

Author information ► Article notes ► Copyright and License information ►

This article has been cited by other articles in PMC.

ETEPLIRSEN, A PHOSPHORODIAMIDATE morpholino antisense oligonucleotide (PMO) that modulates

splicing to treat Duchenne muscular dystrophy (DMD) patients, received accelerated approval by
Food and Drug Administration (FDA) on September 19, 2016 [1]. This heralded a number of firsts:
it is the first drug that is approved for DMD in the United States, the first approved oligonucleotide
that modulates splicing, the first approved PMO, and also the first oligonucleotide to be approved
based on very limited data. Although its approval was shrouded in controversy, eteplirsen could also
become the first oligonucleotide to be a commercial success. This brief commentary reviews the
disease, the therapy, the clinical data, and what eteplirsen's approval means for the oligonucleotide
therapeutics field.
DMD is an X-linked progressive disease by which patients lose muscle function from an early age,
resulting in wheelchair dependency generally around the age of 12, the need for assisted ventilation
around the age of 20, and premature death in the third–fourth decade of life. Apart from
symptomatic care, there is no treatment; while their peers gain skills and become independent, DMD
patients will lose one function after another until they rely on around-the-clock care before they die
prematurely. Given the severe and progressive nature and the unmet medical need, the disease
clearly qualifies for the FDA-accelerated approval pathway.
DMD is caused by mutations in the dystrophin gene. Normally, dystrophin stabilizes muscle fibers
during contraction by connecting the actin cytoskeleton within muscle fibers to the extracellular
matrix surrounding muscle fibers. DMD patients have mutations that disrupt the reading frame
and/or cause premature truncation of protein translation. Interestingly, mutations that maintain the
reading frame allow the production of an internally deleted protein that is partially functional, owing
to the fact that the crucial domains of dystrophin are located at the very beginning and end of the
protein, whereas the middle is largely redundant. These internally deleted dystrophins are found in
the later onset and less progressive Becker muscular dystrophy.
The exon skipping approach stems from the fact that most DMD patients have in theory the genetic
capacity to produce Becker-like dystrophins. Using antisense oligonucleotides (AONs) to interfere
with the splicing process, the reading frame can be restored to allow the production of a partially
functional Becker-type dystrophin rather than a nonfunctional DMD-type dystrophin. Depending on
the mutation present in any individual patient, one or more different exons may need to be skipped
to restore the reading frame. However, because mutations cluster, skipping certain exons is expected
to be therapeutic in larger groups of patients, with most notably exon 51 skipping applying to 13%–
14% of patients. Ultimately, exon skipping of various exons may be an effective therapy in more
DMD patients.
After obtaining proof of concept in patient-derived cell models and animal models, two AON
chemistries were clinically developed for exon skipping in DMD. The 2′-O-methyl
phosphorothioate exon 51 skipper drisapersen was developed by Prosensa/GSK/BioMarin. After a
first dose-finding study, 12 DMD patients were treated on and off with 6 mg/kg for more than 6
years in an open-label study. Eight of the 10 ambulant patients were stable in the distance walked in
6 min for the duration of the study, whereas 2 patients lost ambulation [2]. Drisapersen was then
tested in two phase 2 and one phase 3 placebo-controlled trials in more than 300 DMD patients. The
primary endpoint in these trials was the 6-min walk test. Although there was a tendency of
drisapersen-treated patients to walk further than placebo-treated patients, the difference was small
and not statistically or clinically significant.
Post hoc analysis suggested that treatment may have had a therapeutic effect on younger patients
and a marketing approval application was filed. FDA did not grant this, based on the facts that the
pivotal trials failed to demonstrate significant clinical benefit (or clear increase in dystrophin
expression) and that significant toxicities were observed (skin reactions and proteinuria in many
patients and severe thrombocytopenia in about 2% of patients). After the FDA rejection of
drisapersen's application, BioMarin recently withdrew its marketing authorization application with
the European Medicine Agency and announced its decision to stop clinical development of its exon
skipping compounds and to focus on the next generation of compounds [3].
The PMO exon 51 skipper eteplirsen has been tested in a far smaller cohort of patients. A first dose-
finding study revealed that the highest dose tested, 20 mg/kg, was suboptimal. Then a new study was
initiated in 2011 in 12 patients, comparing 30, 50 mg/kg, and placebo weekly for 24 weeks, after
which the placebo group was switched to 30 or 50 mg/kg dosing. All 12 patients have now been
treated weekly for more than 4 years without apparent treatment-related side effects.
The primary endpoint was dystrophin restoration as assessed by the percentage of muscle fibers that
express detectable dystrophin by immunohistochemistry of muscle biopsies. In biopsies taken at
baseline, 12, 24, and 48 weeks, the number of dystrophin-positive fibers was counted subjectively in
a blinded manner and was initially reported to be significantly increased to 30%–50% of dystrophin-
positive fibers for the 24- and 48-week-treated specimens [4]. However, subsequent reanalysis of
these biopsy slides performed by the FDA raised questions regarding the magnitude of any increase
in dystrophin expression [5].
To more rigorously evaluate the possible restoration of dystrophin expression, FDA requested
dystrophin amounts to be quantified by a well-controlled western blot assay, and this was performed
on additional biopsies taken after 188 weeks of treatment. This revealed average levels of 0.93% of
the normal amount of dystrophin, compared with a baseline value of 0.08% in biopsies of untreated
Duchenne muscles. This suggested that the 30%–50% fibers designated as positive each produce
only small amounts of dystrophin. Indeed, a rigorously controlled assessment of the percentage of
muscle fibers expressing detectable dystrophin by immunohistochemistry showed an increase from
1.1% of dystrophin-expressing muscle fibers in untreated samples to 17.4% of the muscle fibers in
treated biopsies, and the intensity of dystrophin expression in positive fibers increased from 9.4% of
normal at baseline to 22.6% of normal in the treated biopsies [6].
Patients were assessed for their functional status primarily with the 6-min walk test, but lacking a
placebo group beyond 24 weeks of treatment, and having two treated patients who lost ambulation
within 3 months of trial initiation, the only comparison possible was with historical controls selected
from natural history data of baseline-matched patients from Belgium and Italy [7]. Using historical
controls as a comparison, a slower decrease in the distance walked in 6 min in eteplirsen-treated
patients was observed than would be expected from natural history. However, such comparisons in
small groups of patients are challenging to interpret, and the FDA reviewers were not convinced that
the 6-min walk times demonstrated any benefit.
Reluctant to approve eteplirsen based on such a small number of patient samples, the FDA asked
Sarepta in June 2016 to provide evidence of increased dystrophin expression by western blot from
additional biopsies of eteplirsen-treated patients in a new ongoing clinical trial before they would
make a decision. Sarepta had initiated a confirmatory phase 3 trial with eteplirsen (PROMOVI) in
September 2014 [8]. In this study, 80 ambulant DMD patients whose dystrophin mutations were
amenable to exon 51 skipping have been receiving weekly dosing of eteplirsen at 30 mg/kg, while
80 matched DMD patients with mutations not amenable to exon 51 skipping do not receive
treatment, but are followed with the same functional outcome measures.
Thirteen patients in the PROMOVI study had been treated for at least 48 weeks with eteplirsen, and
western blot analysis of biopsies taken from these patients before and after 48 weeks of treatment
revealed an increase from 0.16% at baseline to 0.44% at 48 weeks on average, with the caveat that
not all patients demonstrated a post-treatment response in dystrophin on Sarepta's validated western
blot system [9,10]. In fact, about half of the patients had no or minimal apparent increase in
dystrophin expression and the increases in the others were higher, up to more than 1% of normal
[10]. The lower increases in dystrophin expression at 48 weeks compared with the 180-week
biopsies may be related to the longer duration of therapy.
Although the levels of dystrophin restoration are disappointing, the increases of 0.28% and 0.93%
do provide evidence for the intended mechanism of action for eteplirsen: the FDA reviewers agreed
that eteplirsen increases dystrophin levels in some patients. What the data do not tell us is whether
this very small amount of dystrophin expression will be enough to slow down disease progression.
Such modest increases in dystrophin may seem negligible, and some FDA reviewers of the
eteplirsen application wanted to reject it because of their beliefs that such small increases are not
going to provide any therapeutic benefit [10].
Nevertheless, earlier preclinical studies in mouse models have revealed that a little bit of dystrophin
may go a long way, with <4% dystrophin significantly increasing survival in a severe background.
Furthermore, it has become clear that patients requiring exon 44 skipping have higher baseline
levels of dystrophin, and also have a slower disease progression than patients with other mutations.
The dystrophin levels in these patients, however, have not been quantified with a validated western
blot system, so how they relate to the increases found after eteplirsen treatment is unclear.
Furthermore, these mice and patients have had these low amounts of dystrophin since birth. The
question that one cannot answer yet is whether an increase to 0.28%–0.93% of dystrophin can be
sufficient to slow down disease progression once pathology is established.
FDA indeed stated in their approval that “A clinical benefit of Exondys 51 (tradename of
eterplirsen), including improved motor function, has not been established” [1] and mandated that
Sarepta will have to perform confirmatory studies to establish that eteplirsen can slow down disease
progression. Within the FDA, there was intense and unprecedented disagreement concerning
eteplirsen's approval, which was made public on September 16, 2016, when the FDA commissioner
released a document summarizing in remarkable detail the internal controversies surrounding the
eteplirsen review [10]. In brief, the Director of the Office of Drug Evaluation, Dr. Ellis Unger, and
the Division of Neurology Products, headed by Dr. Ronald Farkas, had initially rejected the
eteplirsen application. However, they were overruled by Dr. Janet Woodcock, the Director of
CDER. An internal FDA dispute resolution process was then initiated, culminating in an appeal to
the FDA Commissioner, Dr. Robert Califf, who allowed Dr. Woodcock's approval decision to stand
[10]. Dr. Farkas and at least one other member of the eteplirsen review team resigned from the FDA.
Although the reason for these resignations has not been made public, the timing led to speculation
that they are related to the eteplirsen approval. Regardless of the controversies, the patient
community celebrates the approval as a victory, pointing to the fact that 10 of the 12 boys in the
original trial are still walking and functioning at a level higher than expected in DMD. Indeed, a
group of 36 prominent DMD clinician-scientists had published a letter calling for eteplirsen's
approval based on the dystrophin data and clinical results [11]. Meanwhile, some critical voices
argue that eteplirsen is a very expensive placebo. Several insurance companies have already
approved coverage of eteplirsen and patients have begun receiving it, but one major insurance
company, Anthem, indicated on October 7, 2016, that they will not reimburse eteplirsen treatment
[12]. Eteplirsen treatment will cost in the order of $300,000–400,000 per year per patient initially,
meaning that without reimbursement, most patients in the United States will not have access to the
drug.
What lessons does eteplirsen's approval hold for the oligonucleotide therapeutics community? One
point worth noting is that, like other drugs, oligonucleotides are going to be reviewed and approved
or rejected based on their merits. Some commentators on the eteplirsen controversy have expressed
fears that approval of a drug based on such a small data set means that the FDA has “lowered the
bar” and that more companies will now seek approval of marginally effective drugs based on small,
underpowered clinical trials and unvalidated endpoints. That would be a mistake, there is no
indication that FDA will “lower the bar” for other rare disease drugs and/or oligonucleotides that are
currently in development. One should also not forget that the road to approval for eteplirsen was
long, with plans for a new drug application announced already in 2013 [13].
If there is one lesson from the eteplirsen saga for drug developers, it is that clinical development
always should be rigorous and well controlled, and that working with the FDA in a constructive
manner is the best way to rapidly deliver new therapeutics for patients in need, perhaps using the
ongoing dialogue between the DMD patient community, academics, and regulators in Europe as an
example [14].
In all this controversy, one can only hope that eteplirsen indeed does work and that longer term
treatment will reveal a slower disease progression in DMD patients. Eteplirsen may have only a
modest effect on restoring dystrophin expression, but there is reason to expect that even small
amounts of dystrophin could provide clinical benefits to patients. DMD patients and parents face the
consequences of this disease on a daily basis, coping with progressive loss of function and dreading
loss of the next function. These patients deserve an effective drug and hope for more effective drugs
than eteplirsen to be developed in the future.

Go to:

Author Disclosure Statement

A.A.R. report being employed by LUMC, which has patents on exon skipping technology. As a
coinventor of some of these patents, A.A.R. may receive a share of potential royalties. A.A.R.
reports being an ad hoc consultant for BioMarin, PTC, BMS, and Summit. Remuneration for these
activities and speaker honoraria for BioMarin and PTC-organized satellite symposia go to LUMC.
A.M.K. was previously employed as Sarepta's CSO and has been a consultant to companies working
on RNA and DMD therapeutics.
Go to:

References
1. www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/ucm521263.htm
2. Goemans NM, Tulinius M, van den Hauwe M, Kroksmark AK, Buyse G, Wilson RJ, van
Deutekom JC, de Kimpe SJ, Lourbakos A, and Campion G. (2016). Long-term efficacy, safety, and
pharmacokinetics of drisapersen in Duchenne muscular dystrophy: results from an open-label
extension study. PLoS One11:e0161955. [PMC free article] [PubMed]
3. http://investors.bmrn.com/releasedetail.cfm?ReleaseID=973536
4. Mendell JR, Rodino-Klapac LR, Sahenk Z, Roush K, Bird L, Lowes LP, Alfano L, Gomez AM,
Lewis S, et al. ; Eteplirsen Study Group. (2013). Eteplirsen for the treatment of Duchenne muscular
dystrophy. Ann Neurol 74:637–647 [PubMed]
5. www.fda.gov/downloads/advisorycommittees/committeesmeetingmaterials/drugs/peripheralandce
ntralnervoussystemdrugsadvisorycommittee/ucm481912.pdf
6. www.fda.gov/downloads/advisorycommittees/committeesmeetingmaterials/drugs/peripheralandce
ntralnervoussystemdrugsadvisorycommittee/ucm497064.pdf
7. Mendell JR, Goemans N, Lowes LP, Alfano LN, Berry K, Shao J, Kaye EM, and Mercuri E;
Eteplirsen Study Group and Telethon Foundation DMD Italian Network. 2016). Longitudinal effect
of eteplirsen versus historical control on ambulation in Duchenne muscular dystrophy. Ann
Neurol 79:257–271 [PMC free article] [PubMed]
8. https://clinicaltrials.gov/ct2/show/NCT02255552
9. Presented by Prof. Francesco Muntoni at the Sarepta sponsored satellite symposium of the World
Muscle Society, October 2016, Granada, Spain
10. www.accessdata.fda.gov/drugsatfda_docs/nda/2016/206488_summary%20review_Redacted.pdf
11. www.cdmd.ucla.edu/files/view/FDA_ETEPLIRSEN_LETTER_02242016.pdf
12. www.srnnews.com/anthem-says-will-not-cover-first-fda-approved-duchenne-drug
13. www.drugs.com/nda/eteplirsen_130725.html
14. Straub V, Balabanov P, Bushby K, Ensini M, Goemans N, De Luca A, Pereda A, Hemmings R,
Campion G, et al. (2016). Stakeholder cooperation to overcome challenges in orphan medicine
development: the example of Duchenne muscular dystrophy. Lancet Neurol 15:882–890 [PubMed]

Study Description
Go to
Brief Summary:
The primary objective of this study is to assess the ongoing efficacy, safety, and tolerability of an
additional 212 weeks of treatment with eteplirsen injection in Duchenne muscular dystrophy (DMD)
subjects who have successfully completed the 28 week eteplirsen study: Study 4658-us-201. This study
will also evaluate the correlation between biomarkers for DMD and the clinical status of participating
DMD subjects.

Condition or disease Intervention/treatment Phase

Duchenne Muscular Dystrophy (DMD) Drug: AVI-4658 (Eteplirsen) Phase 2

Detailed Description:
This is an open label, multiple dose extension study to assess the ongoing efficacy, safety, and
tolerability of weekly intravenous (IV) infusions of eteplirsen in DMD subjects who have
successfully completed Study 4658-us 201.
Subjects will have the opportunity to enroll in this study during the last visit of Study 4658-us-
201 (Week 28). Eligible subjects will receive once weekly IV infusions of eteplirsen (50 or 30
mg/kg) for an additional 212 weeks. Subjects will receive the same dose of eteplirsen they
received in Study 4658-us-201. Subjects will thereafter continue to receive once weekly IV
infusions of eteplirsen for up to an additional 72 week period (through week 284). If commercial
eteplirsen becomes available during this additional 72 week period, participation in the study
will be discontinued as subjects transition to commercial eteplirsen.
Safety, efficacy, pharmacokinetic (PK), and biomarker assessments will be performed at
scheduled visits; adverse events (AEs) and concomitant medications and therapies will be
continuously monitored.
If review of data from this open label study suggests that continued treatment with eteplirsen is
warranted, this study may be extended by protocol amendment or subjects who successfully
complete this study may have the opportunity to participate in a separate follow on, open label
eteplirsen study.

Study Design
Go to
Study Type : Interventional (Clinical Trial)

Actual Enrollment : 12 participants

Intervention Model: Single Group Assignment

Masking: None (Open Label)

 Primary Purpose: Treatment

Official Title: Open-Label, Multiple-Dose, Efficacy, Safety, and

Tolerability Study of Eteplirsen in Subjects With
Duchenne Muscular Dystrophy Who Participated in
Study 4658-US-201

Study Start Date : February 2012

Primary Completion Date : April 2016

Estimated Study Completion Date : February 2017

Resource links provided by the National Library of Medicine

Genetics Home Reference related topics: Duchenne and Becker muscular dystrophy

MedlinePlus related topics: Muscular Dystrophy

Drug Information available for: Eteplirsen

Genetic and Rare Diseases Information

Center resources: Muscular Dystrophy Duchenne Muscular Dystrophy Becker Muscular Dystro
phy

U.S. FDA Resources

Arms and Interventions

Go to
Arm Intervention/treatment
Experimental: AVI-4658 Drug: AVI-4658 (Eteplirsen)
(Eteplirsen) Eteplirsen will be administered once weekly via an IV infusion. There
Multiple-Dose are two treatment groups, 30 mg/kg and 50 mg/kg.
Extension Study Other Name: EXONDYS 51

Outcome Measures
Go to
Primary Outcome Measures :
1. Percent of dystrophin positive fibers [ Time Frame: Baseline to Week 20 ]

The primary biological efficacy endpoint will be the change from baseline at Week 20
in the percent of dystrophin positive fibers (type = anti-dystrophin antibody
MANDYS106) in muscle biopsy tissue as measured by immunohistochemistry (IHC).

2. 6 Minute Walk Test (6MWT) [ Time Frame: Baseline to Week 212 ]

The primary functional efficacy endpoint will be the change from baseline to Week
212 on the 6 Minute Walk Test (6MWT).

Other Outcome Measures:

1. Muscle Biopsy Tests [ Time Frame: Baseline to Week 20, Week 140 (optional) ]
o Dystrophin intensity per fiber in muscle biopsy tissue as determined by IHC
o CD3, CD4, and CD8 lymphocyte count in muscle biopsy tissue
o Total dystrophin protein in muscle biopsy tissue as determined by Western blot
analysis
o Exon skipping in muscle biopsy tissue as assessed by reverse transcriptase
polymerase chain reaction (RT PCR).

2. Timed 4 Step Test results [ Time Frame: Baseline to Week 212 ]

3. North Star Ambulatory Assessment (NSAA) results [ Time Frame: Baseline to Week
212 ]
4. Maximum voluntary isometric contraction test (MVICT) results [ Time Frame: Baseline
to Week 212 ]
5. 9 Hole Peg Test results [ Time Frame: Baseline to Week 212 ]
6. Pediatric Quality of Life Inventory (PedsQL) results, including the neuromuscular
module (NMM) [ Time Frame: Baseline to Week 212 ]
7. Pulmonary function test results [ Time Frame: Baseline to Week 212 ]

including forced vital capacity (FVC), percent predicted FVC, forced expiratory
volume in 1 second (FEV1), FEV1%, FEV1/FVC ratio, maximum inspiratory pressure
(MIP), and maximum expiratory pressure (MEP).

Eligibility Criteria
Go to
Information from the National Library of Medicine

Choosing to participate in a study is an important personal decision. Talk with your doctor and
family members or friends about deciding to join a study. To learn more about this study, you
or your doctor may contact the study research staff using the contacts provided below. For
general information, Learn About Clinical Studies.

Ages Eligible for Study: 7 Years to 13 Years (Child)

Sexes Eligible for Study: Male
Accepts Healthy Volunteers: No
Criteria
Inclusion Criteria:
A subject must meet all of the following criteria to be eligible for this study.
1. The subject and/or their parent/legal guardian are willing and able to provide signed
informed consent.
2. The subject has successfully completed 28 weeks of treatment in Study 4658-US-
201.
3. The subject has a parent(s) or legal guardian(s) who is able to understand and
comply with all of the study procedure requirements.

Exclusion Criteria:
A subject who meets any of the following criteria will be excluded from this study.
1. The subject has a prior or ongoing medical condition that, in the Investigator's opinion, could
adversely affect the safety of the subject or make it unlikely that the course of treatment or
follow-up would be completed or impair the assessment of study results.
Contacts and Locations
Go to
Information from the National Library of Medicine

To learn more about this study, you or your doctor may contact the study research staff using
the contact information provided by the sponsor.
Please refer to this study by its ClinicalTrials.gov identifier (NCT number): NCT01540409

Locations

United States, California

Miller Children's Hospital
Long Beach, California, United States, 90806

United States, Florida

University of Florida Clinical Research Center
Gainesville, Florida, United States, 32610

United States, Illinois

Rush University Medical Center
Chicago, Illinois, United States, 60612

United States, Massachusetts

Massachusetts General Hospital
Boston, Massachusetts, United States, 02114

United States, Missouri

Washington University Medical School
St. Louis, Missouri, United States, 63110

United States, New York

Summerwood Pediatrics/Infusacare Medical Services
Liverpool, New York, United States, 13088

United States, North Carolina

Levine Children's Hospital
Charlotte, North Carolina, United States, 28203
 United States, Ohio
Nationwide Children's Hospital
Columbus, Ohio, United States, 43205

United States, Pennsylvania

Children's Hospital of Pittsburgh of UPMC
Pittsburgh, Pennsylvania, United States, 15224

United States, Virginia

Children's Specialty Group, Pediatric Neurology
Norfolk, Virginia, United States, 23510

United States, Wisconsin

Osceola Medical Center
Osceola, Wisconsin, United States, 54020
Sponsors and Collaborators
Sarepta Therapeutics
Investigators
Principal Investigator: Jerry R Mendell, MD Nationwide Children's Hospital
More Information
Go to

Additional Information:
Online resource center for patients with DMD, families, and their healthcare providers

Publications automatically indexed to this study by ClinicalTrials.gov Identifier (NCT Number):

Mendell JR, Goemans N, Lowes LP, Alfano LN, Berry K, Shao J, Kaye EM, Mercuri E;
Eteplirsen Study Group and Telethon Foundation DMD Italian Network. Longitudinal effect of
eteplirsen versus historical control on ambulation in Duchenne muscular dystrophy. Ann
Neurol. 2016 Feb;79(2):257-71. doi: 10.1002/ana.24555. Epub 2016 Jan 8.

Responsible Party: Sarepta Therapeutics

ClinicalTrials.gov Identifier: NCT01540409 History of Changes
Other Study ID Numbers: 4658-us-202
First Posted: February 28, 2012 Key Record Dates
Last Update Posted: November 25, 2016
Last Verified: November 2016

Keywords provided by Sarepta Therapeutics:

DMD, Duchenne, Eteplirsen, dystrophy,
dystrophin, exon 51

Additional relevant MeSH terms:

Muscular Dystrophies Neuromuscular Diseases
Muscular Dystrophy, Duchenne Nervous System Diseases
Muscular Disorders, Atrophic Genetic Diseases, Inborn
Muscular Diseases Genetic Diseases, X-Linked
Musculoskeletal Diseases

Study Description
Go to
Brief Summary:
The main objective of this study is to provide confirmatory evidence of efficacy of eteplirsen
(AVI-4658) in Duchenne muscular dystrophy (DMD) patients that are amenable to skipping
exon 51. Additional objectives include evaluation of safety, biomarkers and the long-term
effects of eteplirsen up to 96 weeks, followed by a safety extension (not to exceed 48 weeks).
Sites are currently being initiated into the study. Initiation of approximately 39 planned sites in
the United States is expected to be completed by June 2016. The initiated sites can be found
in the "Contacts and Locations" section of this posting in addition to a listing of the city and
states of sites the investigators are working to initiate. This information will be updated on a
rolling basis as additional sites are initiated.

Condition or disease Intervention/treatment Phase

Duchenne Muscular Dystrophy (DMD) Drug: eteplirsen Phase 3

Detailed Description:
This is an open-label, multi-center study to evaluate the efficacy and safety of eteplirsen in
patients with genotypically confirmed Duchenne muscular dystrophy (DMD) with genetic
deletions amenable to exon 51 skipping (treated group), with a concurrent control arm of DMD
patients not amenable to exon 51 skipping (untreated group). Following primary efficacy
endpoints, dosing will continue to week 144 to evaluate the long term effects of eteplirsen.
Patients in the treated group will receive once weekly intravenous (IV) infusions of 30 mg/kg
Eteplirsen for 96 weeks, followed by a safety extension (not to exceed 48 weeks). Patients in
the untreated group will not receive treatment.
Clinical efficacy will be assessed at regularly scheduled study visits, including functional tests
such as the six minute walk test. Patients in the treated group will undergo a muscle biopsy at
Baseline and a second muscle biopsy over the course of the study. Patients in the untreated
group will not undergo muscle biopsy.
Safety, including adverse event monitoring and routine laboratory assessments, will be
continuously monitored for all patients.
The sponsor is working to initiate approximately 39 sites across the United States. Sites will
vary in the following functions:
1. Local Site (N=39) - Enrolls patients and is the primary contact point for their
patients. Sites will perform all protocol activities (including dosing and laboratory
assessments), except for functional assessments and biopsies.
 2. Hub Site (N=14) - Performs functional (physical) assessments at specified times
per protocol.
3. Surgical Site (N=2) - Performs muscle biopsies for the Treated group.

Study Design
Go to
Study Type : Interventional (Clinical Trial)

Estimated Enrollment : 160 participants

Allocation: Non-Randomized

Intervention Model: Parallel Assignment

Masking: None (Open Label)

Primary Purpose: Treatment

Official Title: An Open-Label, Multi-Center, Study With a Concurrent

Untreated Control Arm to Evaluate the Efficacy and
Safety of Eteplirsen in Duchenne Muscular Dystrophy

Study Start Date : September 2014

Estimated Primary Completion Date : January 2019

Estimated Study Completion Date : May 2019

Resource links provided by the National Library of Medicine

Genetics Home Reference related topics: Duchenne and Becker muscular dystrophy

MedlinePlus related topics: Muscular Dystrophy

Drug Information available for: Eteplirsen

Genetic and Rare Diseases Information

Center resources: Muscular Dystrophy Duchenne Muscular Dystrophy Becker Muscular Dystro
phy

U.S. FDA Resources

Arms and Interventions
Go to
Arm Intervention/treatment
Experimental: Treated Group Drug: eteplirsen
Approximately 80 patients with genotypically Eteplirsen 30 mg/kg will be administered
confirmed Duchenne muscular dystrophy (DMD) as an IV infusion once a week for 96
with genetic deletions amenable to treatment by weeks, followed by a safety extension
exon 51 skipping will receive 30 mg/kg of (not to exceed 48 weeks).
eteplirsen weekly for 96 weeks, followed by a Other Names:
safety extension (not to exceed 48 weeks).
 AVI-4658
 EXONDYS 51®

No Intervention: Untreated Group

Approximately 80 DMD patients not amenable to
exon 51 skipping will not receive eteplirsen.

Outcome Measures
Go to

Primary Outcome Measures :

1. Change in 6-Minute Walk Test (6MWT) distance from baseline [ Time Frame: Baseline,
Weeks 12, 24, 36, 48 ]

Secondary Outcome Measures :

1. The percentage of dystrophin-positive fibers [ Time Frame: Baseline, Weeks 24, 48, 72,
96 ]
2. Maximum inspiratory/expiratory pressure percent predicted (MIP/MEP % predicted)
[ Time Frame: Baseline,Weeks 12, 24, 36, 48 ]

Other Outcome Measures:

1. Evaluate the long-term effects of eteplirsen up to 96 weeks [ Time Frame: Week 1-96 ]

Eligibility Criteria
Go to
Information from the National Library of Medicine

Choosing to participate in a study is an important personal decision. Talk with your doctor and
family members or friends about deciding to join a study. To learn more about this study, you
or your doctor may contact the study research staff using the contacts provided below. For
general information, Learn About Clinical Studies.

Ages Eligible for Study: 7 Years to 16 Years (Child)

Sexes Eligible for Study: Male
Accepts Healthy Volunteers: No
Criteria
Inclusion Criteria:
 Male 7-16 years old
 Diagnosed with DMD, genotypically confirmed
 Stable dose of corticosteroids for at least 24 weeks
 Have intact right and left alternative upper muscle groups
 Mean 6MWT greater than 300m (primary analysis on 300 to 450 meters)
 Stable pulmonary and cardiac function: predicted FVC equal to or greater than 50% and
LVEF of greater than 50%
Exclusion Criteria:
 Previous treatment with drisapersen or any other RNA antisense agent or any gene
therapy within the last 6 months
 Participation in any other DMD interventional clinical study within 12 weeks
 Major surgery within 3 months
 Presence of other clinically significant illness
 Major change in the physical therapy regime within 3 months
Other inclusion/exclusion criteria apply.
Contacts and Locations
Go to
Information from the National Library of Medicine

To learn more about this study, you or your doctor may contact the study research staff using
the contact information provided by the sponsor.
Please refer to this study by its ClinicalTrials.gov identifier (NCT number): NCT02255552

Show 37 Study Locations

Sponsors and Collaborators
Sarepta Therapeutics
Investigators
Study Chair: Chris Mix, MD Sarepta Therapeutics
Study Chair: Catherine Stehman-Breen, MD, MS Sarepta Therapeutics
More Information
Go to

Responsible Party: Sarepta Therapeutics

ClinicalTrials.gov Identifier: NCT02255552 History of Changes
Other Study ID Numbers: 4658-301
First Posted: October 2, 2014 Key Record Dates
Last Update Posted: October 3, 2017
Last Verified: October 2017

Individual Participant Data (IPD) Sharing Statement:

Plan to Share IPD: No

Keywords provided by Sarepta Therapeutics:

DMD, Duchenne, Eteplirsen, dystrophy,
dystrophin, exon 51

Additional relevant MeSH terms:

Muscular Dystrophies Neuromuscular Diseases
Muscular Dystrophy, Duchenne Nervous System Diseases
Muscular Disorders, Atrophic Genetic Diseases, Inborn
Muscular Diseases Genetic Diseases, X-Linked
Musculoskeletal Diseases

[Clinical significance of dystrophin positive fibers in

Duchenne muscular dystrophy].
[Article in Chinese]

Chuang YH1, Jong YJ, Liu KM, Chen SS.

Author information
Abstract
Dystrophin is a protein product of the Xp 21 gene which is defective in patients with Duchenne muscular
dystrophy (DMD). In immunohistochemical staining of dystrophin, the majority of DMD muscle fibers
show negative staining. Nevertheless, biopsy specimens from DMD patients labeled with many different
antibodies may show a small number of fibers which are clearly dystrophin positive. This very small
percentage of dystrophin-positive fibers (DPF) probably represents somatic reversion, suppression of
the DMD gene mutation or alternating splicing of dystrophin mRNA. To determine the significance of
isolated DPF in muscle specimens of DMD patients, we examined 30 DMD muscle specimens, aged 4
years to 16 years, by the use of monoclonal antibody against the C-terminal region of dystrophin.
Additionally, muscle specimens from 2 normal human controls and 2 mice with X-linked muscular
dystrophy were used for positive and negative controls, respectively. Muscle specimens from DMD
patients and mdx mice showed almost totally negative dystrophin staining in most of their muscle fibers,
but in 20 patients, three was a trace of isolated DPF ranging from 0.06% to 0.77%. DMD patients with
no isolated DPF seemed to have higher functional disability. In the whole group of 30 patients, a
significant negative correlation was found between the abundance of DPF and clinical functional grading
(r = -0.85, p < 0.0001, based on linear regression). It is suggested that even the very low concentrations
of dystrophin found in DMD patients may have a favorable functional significance.

PMID:

7650780

[Indexed for MEDLINE]

Distrofia musculară Duchenne (DMD). Aceasta este cea mai

frecventă formă de
distrofie şi poartă numele neurologului francez Gillaume Amand
Duchenne sau Duchenne de
Boulogne (1806 – 1875) care a descris boala aceasta în cartea sa De
l’electrisation localisee din
1861 şi cu detalii mai numeroase în câteva publicaţii din 1868 [2,
9].
Afectînd aproximativ 1:3500 de băieti, care se manifestă prin
slăbiciune musculară și care
debutează devreme în copilărie. Este o boală ereditară, cu
transmitere autosomal recesivă legată
de cromozomul X, reprezentată de un defect al genei distrofina,
situată pe braţul scurt al
cromozomului X (Xp21.2). Absenţa distrofinei duce la apariţia de
leziuni ale membranelor ce
acoperă celulele musculare (miocite), antrenînd degenerarea
fibrelor musculare și necroza
miocitară. Prin urmare, miopatia Duchenne afectează numai nou-
născuții de sex masculin.
În unele cazuri, boala Duchenne se manifestă încă din stadiul
embrionar, în altele însă, ea
se manifestă după vîrsta de 3 sau 4 ani. Copiii afectaţi necesită mai
mult timp pentru a învăţa să
meargă decît în mod normal, vîrsta medie la care merg băieții
afectați de distrofie musculară

254
Duchenne se situează în jurul vîrstei de 18 luni. Ei au un mers
legănat (mers de rață), sau pe
vîrfuri și întîmpină dificultăți în urcarea scărilor, alergare sau
ridicarea de la sol. Tendința de
cădere este accentuată.

Figura 3. Schema unui bolnav cu distofie musculară Duchenne.

Din punct de vedere clinic este cea mai gravă formă a distrofiilor
musculare, boala devine
aparentă în primii ani de viaţă. Evoluţia este aşa de lentă încît
simptomele iniţiale sunt adesea
trecute cu vederea. Iniţial acestea sunt adesea limitate la existenţa
unei dificultăţi la urcarea
scărilor, la ridicarea de la podea sau la realizarea altor activităţi ce
implică musculatura pelvină.
O indicaţie precoce a hipotoniei pelviene este maniera în care
pacientul se ridică de la podea
(semnul Gowers) din poziție șezîndă pentru a se ridica se cațără pe
el însuși.

Figura 4. Semnul Gowers- caracteristic copiilor cu distrofie

musculară Duchenne
Cu timpul, retracțiile tendinoase ale ahilianului face ca mersul să
devină digiticrad (picior
varus equin). Lordoza este deseori întîlnită pe măsură ce boala
evoluează. Atrofia musculară şi
dispariţia progresivă şi precoce a ROT acompaniază progresiunea
bolii, sunt prezente
pseudohipertrofii a muşchilor gambieri şi mai rar a muşchilor
deltoizi şi infraspinali (mușchii au
aspect de mingi). Contracturile sunt frecvente. Hipertrofia cardiacă,
tahicardia persistentă şi
insuficienţa miocardică sunt observate la 50-80% din pacienţi.
Hipomotilitatea gastrică poate
induce epizoade bruşte de vome, dureri abdominale, distensie
abdominală, uneori diaree şi
malabsorbţie. Aceste manifestări clinice corespund modificărilor
patologice din muşchii netezi
[6, 7].
Un număr de copii cu distrofie musculară au o dezvoltare
intelectuală întîrziată. QI mediu
este de aproximativ 85, limitele acestuia părând să urmeze o curbă
de distribuţie normală.
Retardarea este neprogresivă, iar severitatea ei nu se corelează cu
severitatea hipotoniei
musculare. DMD este una din bolile musculare severe în care
sistemul nervos central este
afectat, de obicei sub forma retardului mintal. La varsta de 12 ani,
copiii își pierd capacitatea de

255

mers și sunt imobilizați în scaune cu rotile. În general, decesul

survine de obicei în adolescenţă,
ca urmare a complicațiilor respiratorii sau a insuficienței cardiace
[2, 8].
 Fetele purtătoare de genă pentru distrofia musculară sunt de obicei
asimptomatice, dar
ocazional prezintă pseudohipertrofie şi hipotonie uşoară a
musculaturii pelviene.

What is exon skipping and how does it work?

Donate now

In order to explain the concept of exon skipping, it is first necessary to explain

how genes work and how mutations in the
dystrophin gene can cause
both Duchenne and Becker muscular dystrophy.

What are genes?

A gene is a section of DNA that contains the instructions for the production of one
specific protein. Proteins are essential parts of cells and play a role in every process
occurring within the cell, as well as having structural or mechanical functions which help
maintain the cells’ shape. It is estimated that we have about 25,000 different genes.

Ce este săriturile peste exoni și cum funcționează?

Pentru a explica conceptul de a sări peste exon, este necesar mai întâi pentru a explica modul în care gene de lucru si

modul in care mutatii ale genei distrofină poate provoca atat Duchenne si Becker distrofiei musculare.

Ce sunt genele? O genă este o secțiune a ADN-ului care conține instrucțiunile pentru producerea unei proteine

specifice. Proteinele sunt părți esențiale ale celulelor și joacă un rol în fiecare proces care apar in interiorul celulei,

precum și cu funcții structurale sau mecanice care contribuie la menținerea formei celulelor. Se estimează că avem

aproximativ 25.000 de gene diferite.

What are exons?

Genes are divided into sections called exons and introns. Exons are the sections of
DNA that code for the protein and they are interspersed with introns which are also
sometimes called ‘junk DNA’. The introns are cut out and discarded in the process of
protein production, to leave just the exons. The dystrophin gene is our largest gene- it has
79 exons which are joined together like the pieces of a puzzle.

Ce sunt exonii?

Genele sunt împărțite în secțiuni numite exoni și introni. Exonii sunt secțiunile de ADN care codifică proteina și acestea

sunt intercalate cu introni, care sunt, de asemenea, uneori numite "ADN-ul junk’. Intronii sunt tăiate și aruncate în

procesul de producție de proteine, pentru a lăsa doar exonilor.

Gena distrofină este cel mai mare gena - are 79 exonii care sunt unite împreună ca piesele unui puzzle.

What happens in Becker muscular dystrophy?

Let’s zoom in on exons 68 to 75 to look at this a bit more closely:

In Becker muscular dystrophy an exon is deleted, for example exon number 74 in the
diagram:

Although a part of the gene is missing, exon 73 can join up with exon 75, and the puzzle
can be completed to the end of the gene:

What impact does a Becker mutation have on the dystrophin protein?

The dystrophin protein normally sits in the membrane that surrounds muscle fibres like a
skin, and protects the membrane from damage during muscle contraction. Without
dystrophin the muscle fibre membranes become damaged and eventually the muscle fibres
die.

Dystrophin is a very large protein with a section in the middle consisting of lots of repeated
segments (in green below) and it is known that the protein can still work to some extent if
some of these repeated segments are missing. Individuals with Becker muscular dystrophy
have some of these repeated segments missing and have relatively mild symptoms- often
being able to still walk into their 40s and 50s.

A man has even been known to be still walking at 61 years of age, despite having a
deletion of 46% of the dystrophin gene!
What happens in Duchenne muscular dystrophy?

In Duchenne muscular dystrophy an exon, or exons are deleted which interfere with the
rest of the gene being pieced together. In our example (using exons 50-57), exon 52
illustrates this:

Ce se întâmplă în distrofiei musculare Duchenne? In distrofiei musculare Duchenne un exon sau exonii sunt șterși care

interferează cu restul genei fiind pus cap la cap. În exemplul nostru (folosind exonii 50-57), exonul 52 ilustrează acest

lucru:

Exon 51 can not join up with exon 53, which prevents the rest of the exons being
assembled. For the dystrophin protein to work it must have both ends of the protein.
Therefore, this mutation results in a completely non-functional dystrophin protein and the
severe symptoms of Duchenne muscular dystrophy.

Exon 51 nu se pot alătura cu exon 53, care împiedică restul exonilor sa fie asamblate. Pentru proteina distrofină la locul

de muncă trebuie să aibă ambele capete ale proteinei. Prin urmare, această mutație are ca rezultat o proteină dystrophin

complet non-funcțional și simptome severe ale distrofiei musculare Duchenne

How can exon skipping help?

As the name suggests, the principle of exon skipping is to encourage the cellular
machinery to ‘skip over’ an exon. Small pieces of DNA called antisense
oligonucleotides (AOs) or ‘molecular patches‘ are used to mask the exon that
you want to skip, so that it is ignored during protein production. In our example, if we use a
‘molecular patch or plaster’ designed to mask exon 53:
Cum se poate sări peste exoni de ajutor?

După cum sugerează și numele, principiul de a sări peste exon este de a încuraja tehnologiile celulare de a „trece peste“

un exon. Bucăți mici de ADN numite oligonucleotide antisens (AOS) sau "patch-uri moleculare sunt folosite pentru a

masca exonul pe care dorim să sărim, astfel încât acesta este ignorat în timpul producției de proteine. In exemplul nostru,

dacă folosim un "plasture sau ipsos molecular concepute pentru a masca exonul 53:

Exon 51 can now join up to exon 54 and continue to make the rest of the protein,
with exons 52 and 53 missing in the middle:

Exon 51 se pot alătura acum până la exonul 54 și continuă să codifice restul proteinei, cu exonii 52 și 53 dispăruți în mijloc:

Does this really work?

So far scientists have shown this technique to be effective in a mouse model of

Duchenne muscular dystrophy (the mdx mouse) and in muscle biopsies from people
with Duchenne muscular dystrophy.

Several clinical trials have now been conducted that show that injecting a molecular patch
into the blood stream or under the skin results in the production of dystrophin in the
muscles. On the whole the molecular patches have been well tolerated although the side
effect profile of the different patches varies with some causing skin and kidney related
problems. There are two companies involved in conducting clinical trials of exon skipping.
The principal of exon skipping is the same for all of the clinical trials but the molecular
patch being tested has a slightly different chemical formulation.
Asta funcționează cu adevărat? Până în prezent, oamenii de știință au demonstrat această tehnică pentru a fi eficient
într-un model de mouse-ul de distrofie musculară Duchenne (MDX mouse-ul) si in biopsii musculare la persoanele cu
distrofiei musculare Duchenne. Mai multe studii clinice au fost efectuate, care arată că injectarea unui plasture molecular
în fluxul sanguin sau sub rezultatele pielii la producerea distrofinei în mușchi. Pe ansamblu patch-uri moleculare au fost
bine tolerate, deși profilul efect secundar al diferitelor patch-uri variază cu unele piele care cauzează și probleme legate
de rinichi. Există două companii implicate în efectuarea studiilor clinice de sărind peste exon. Principal al sărind peste
exon este aceeași pentru toate studiile clinice, dar plasturele molecular testată are o formulare chimică ușor diferită.

Will it work for everyone with Duchenne muscular dystrophy?

It is thought that skipping one or two exons would be able to treat around 83% of the
genetic errors causing Duchenne muscular dystrophy.

Va lucra pentru toata lumea cu distrofiei musculare Duchenne?

Se crede că sărind peste unul sau doi exoni ar fi în măsură să trateze în jur de 83% dintre erorile genetice care cauzeaza distrofiei

musculare Duchenne.

Will the same ‘molecular patch’ work for everyone?

No, the dystrophin gene is very large and the genetic errors associated with Duchenne
muscular dystrophy occur in different places along this gene. There are however some
common areas for mutations and initially ‘molecular patches’ will be made for these. For
example exon 51 skipping would be applicable for around 13% of boys. Once the
technology has been shown to be effective for a particular error it will be possible to design
other ‘patches’.

Va fi acelasi rezultat ale„patch-uri moleculare“ pentru toată lumea?

Nu, gena distrofină este foarte mare și erorile genetice asociate cu distrofie musculară Duchenne apar în locuri diferite

de-a lungul acestei gene. Există totuși unele zone comune pentru mutații și inițial "patch-uri moleculare vor fi făcute

pentru acestea. De exemplu, exon 51 sarind peste ar fi aplicabilă în jur de 13% din băieți. Odată ce tehnologia a fost

dovedit a fi eficace pentru o anumită eroare va fi posibil pentru a proiecta alte „patch-uri“.

Are ‘molecular patches’ a cure?

Scientists hope that this type of therapy will halt or even reverse the symptoms of
Duchenne muscular dystrophy so that the symptoms are more like those of boys with
Becker muscular dystrophy. It will not be a cure because if proven to be effective, this
treatment would need to be repeated regularly- how often will become apparent during
clinical trials.

Sunt "patch-uri moleculare o solutie?

Oamenii de stiinta spera ca acest tip de terapie va opri sau inversa simptomele de distrofie musculară

Duchenne. Nu va fi o metoda de tratament , pentru ca daca dovedit a fi eficace, acest tratament ar trebui să

fie repetate regulat

Further information and links

Read about Duchenne muscular dystrophy

If you have any questions, please get in touch

with research@musculardystrophyuk.org