Chromosome structure

APPLICATION QUESTIONS AND PROBLEMS

Introduction
17
The introduction to this chapter discussed a study of telomere length in Romanian children. The study demonstrated that
children raised in orphanages had shorter telomeres than children raised in foster homes. What effect, if any, do you think
having shorter telomeres in childhood might have on adult life?

Solution:

Somatic cells do not normally express telomerase, so their telomeres shorten with every cell division. People whose telomeres
are already shorter in childhood may have reduced replicative lifespans for their somatic cells, leading to earlier aging for the
immune system and cells and organs that the body needs to replenish continually, such as skin cells, intestinal cells, and blood
cells. They may experience symptoms of aging earlier, and have shorter life expectancies.

Section 11.1

*18. Compare and contrast prokaryotic and eukaryotic chromosomes. How are they alike and how do they differ?

Solution:

Prokaryotic chromosomes are usually circular, whereas eukaryotic chromosomes are linear. Prokaryotic chromosomes
generally contain the entire genome, whereas each eukaryotic chromosome has only a portion of the genome: The eukaryotic
genome is divided into multiple chromosomes. Prokaryotic chromosomes are generally smaller and have only a single origin of
DNA replication. Eukaryotic chromosomes are often many times larger than prokaryotic chromosomes and contain multiple
origins of DNA replication. Prokaryotic chromosomes are typically condensed into nucleoids, which have loops of DNA
compacted into a dense body. Eukaryotic chromosomes contain DNA packaged into nucleosomes, which are further coiled and
packaged into successively higher-order structures.

The condensation state of eukaryotic chromosomes varies with the cell cycle.

*19. a. In a typical eukaryotic cell, would you expect to find more molecules of the H1 histone or more molecules of the H2A
histone? Explain your reasoning
Solution:

Because each nucleosome contains two molecules of histone H2A and only one molecule of histone H1 is associated with each
nucleosome, eukaryotic cells will have more H2A than H1.

b. Would you expect to find more molecules of H2A or more molecules of H3? Explain your reasoning.

Solution:

Because each nucleosome contains two molecules of H2A and two molecules of H3, eukaryotic cells should have equal amounts
of these two histones.

*20. Based on the DNA sensitivity to DNase I illustrated in Figure 11.7, which type of chicken hemoglobin (embryonic or adult)
is likely produced in highest quantity at the following tissues and developmental stages?

o Erythroblasts during the first 24 hours Solution:

o None—neither the embryonic nor adult hemoglobin genes show DNase I sensitivity in erythroblasts at this time.
o Erythroblasts at day 5 Solution:
o Embryonic—the embryonic hemoglobin gene, but not the adult genes, shows
o DNase I sensitivity, indicating an open chromatin conformation that is conducive for transcription.
o Erythroblasts at day 14 Solution:
o Adult—now the adult hemoglobin genes show DNase I sensitivity, but the embryonic gene is DNase I insensitive.
o Brain cells throughout development Solution:
o None—neither embryonic nor adult hemoglobin genes show DNase I
o sensitivity in brain cells at any time of development.
*21. A diploid human cell contains approximately 6.4 billion base pairs of DNA.
How many nucleosomes are present in such a cell? (Assume that the linker DNA encompasses 40 bp.)

Solution:

Given that each nucleosome contains about 140 bp of DNA tightly associated with the core histone octamer, another 20 bp
associated with histone H1, and 40 bp in the linker region, then one nucleosome occurs for every 200 bp of DNA.

6.4 × 109 bp divided by 2 × 102 bp/nucleosome = 3.2 × 107 nucleosomes (32 million).

How many histone proteins are complexed to this DNA?

Solution:

Each nucleosome contains two of each of the following histones: H2A, H2B, H3, and H4. A nucleosome plus one molecule of
histone H1 constitute the chromatosome. Therefore, nine histone protein molecules occur for every nucleosome.

3.2 × 107 nucleosomes × 9 histones = 2.9 × 108 molecules of histones are complexed to 6.4 billion bp of DNA.

*22. Would you expect to see more or less acetylation in regions of DNA that are sensitive to digestion by DNase I? Why?

Solution:

More acetylation. Regions of DNase I sensitivity are less condensed than DNA that is not sensitive to DNase I, the sensitive DNA
is less tightly associated with nucleosomes, and it is in a more open state. Open states can represent areas of euchromatin
which are undergoing DNA repair and/or transcription. Such a state is associated with acetylation of lysine residues in the N-
terminal histone tails.

Acetylation eliminates the positive charge of the lysine residue and reduces the affinity of the histone for the negatively
charged phosphates of the DNA backbone, leading to a more relaxed or looser chromatin structure.

Gunter Korge examined several proteins that are secreted from the salivary glands of Drosophila melanogaster during larval
development (G. Korge. 1975. Proceedings of the National Academy of Sciences of the United States of America 72:4550–4554).
One protein, called protein fraction 4, was encoded by a gene found by deletion mapping to be located on the X chromosome
at position 3C. Korge observed that, about 5 hours before the first synthesis of protein fraction 4, an expanded and puffed-out
region formed on the X chromosome at position 3C. This chromosome puff disappeared before the end of the third larval instar
stage, when the synthesis of protein fraction 4 ceased. He observed that there was no puff at position 3C in a special strain of
flies that lacked secretion of protein fraction 4. Explain these results. What is the chromosome puff at region 3 and why does its
appearance and disappearance roughly coincide with the secretion of protein fraction 4?
Solution:

Chromosomal puffs correspond to relaxation of chromatin structure and transcriptional activity at the locus. The puff at region
3C indicates active transcription of that region, including the gene for protein fraction 4.

Suppose a chemist develops a new drug that neutralizes the positive charges on the tails of histone proteins. What would be
the most likely effect of this new drug on chromatin structure? Would this drug have any effect on gene expression? Explain
your answers.

Solution:

Such a drug would disrupt the ionic interactions between the histone tails and the phosphate backbone of DNA and thereby
cause a loosening of the DNA from the nucleosome. The drug may mimic the effects of histone acetylation, which neutralizes
the positively charged lysine residues. Changes in chromatin structure would result from the altered nucleosome-DNA packing
and possible changes in interaction with other chromatin modifying enzymes and proteins. Changes in transcription would
result because DNA may be more accessible to transcription factors.

Section 11.3

*25. Which of the following two molecules of DNA has the lower melting temperature?

Why?

AGTTACTAAAGCAATACATC
TCAATGATTTCGTTATGTAG

AGGCGGGTAGGCACCCTTA
TCCGCCCATCCGTGGGAAT

Solution:

The molecule above, with a higher percentage of A–T base pairs, will have a lower melting temperature than the molecule
below, which has mostly G–C base pairs. A– T base pairs have two hydrogen bonds, and thus less stability, than G–C base pairs,
which have three hydrogen bonds.

26. In a DNA hybridization study, DNA was isolated from a particular species, labeled with 32P, and sheared into small
fragments (S. K. Dutta et al. 1967. Genetics 57:719–727). Hybridizations between these labeled fragments and denatured DNA
from different species were then compared. The following table gives the percentages of labeled wheat DNA that hybridized to
DNA molecules of wheat, corn, radish, and cabbage.
 Percentage of bound wheat DNA
Species hybridized relative to wheat
Wheat 100
Cabbage 23
Corn 63
Radish 30

What do these results indicate about the evolutionary differences among these organisms?

Solution:

The extent of DNA hybridization correlates with DNA sequence similarity. Corn DNA is more similar to wheat DNA than radish
DNA is to wheat DNA. Cabbage DNA is least similar to wheat DNA. Therefore, corn is most closely related to wheat, followed by
radish; and cabbage is the most evolutionarily distant from wheat. These data do not give any indication of the similarities
among corn, cabbage and radish DNA, only in relation to wheat DNA.

Section 11.4

*27. A wheat plant that is light green in color is found growing in a field. Biochemical analysis reveals that chloroplasts in this
plant produce only 50% of the chlorophyll normally found in wheat chloroplasts. Propose a set of crosses to determine whether
the light-green phenotype is caused by a mutation in a nuclear gene or a chloroplast gene.

Solution:

Nuclear and chloroplast genes in wheat will exhibit different inheritance patterns. A nuclear gene is inherited biparentally,
whereas a chloroplast gene is inherited uniparentally (or maternally). The differences in inheritance patterns will allow us to
determine if the mutation occurred in a nuclear gene or in a chloroplast gene. For the following crosses, the male plant refers to
the pollen donor, while the female plant refers to the plant being pollinated and where fertilization will take place.

If the mutation is located within a chloroplast gene, then we would expect the following results, no matter which trait is
dominant:

Wild-type wheat male × light-green wheat female  offspring all light-green Light-green wheat male × wild-type wheat female
 offspring all wild-type

Matings between light-green offspring should always produce more light-green progeny, whereas matings between wild-type
offspring should always produce wild-type progeny.

If the mutation is in a nuclear gene, then both parents can pass the light-green mutation to their offspring. If we assume that
wild type is dominant, then we would expect the following results:

Wild-type wheat male × light-green wheat female  offspring all wild-type Light-green wheat male × wild-type wheat female
 offspring all wild-type
Separate matings between members of the F1 progeny of each cross should give progeny with a phenotypic ratio of 3:1 wild-
type to light-green.

If we assume that the light-green phenotype is dominant, then we would expect the following:

Wild-type wheat male × light-green wheat female  offspring all light-green Light-green wheat male × wild-type wheat female
 offspring all light-green

Separate matings between members of the F1 progeny of each cross should give progeny with a phenotypic ratio of 3:1 light-
green to wild-type.

*28. A rare neurological disease is found in the family illustrated in the following pedigree. What is the most likely mode of
inheritance for this disorder? Explain your reasoning.

Solution:

The pedigree indicates that the neurological disorder is a cytoplasmically inherited trait. Only females pass the trait to their
offspring. The trait does not appear to be sex-specific in that males as well as females can have the disorder. These
characteristics are consistent with cytoplasmic inheritance. The unaffected progeny of affected mothers may be explained by
the variability of cytoplasmically inherited traits, where a mother with heteroplasmy (a mixture of normal and affected
mitochondria) can pass on variable proportions to their various children.

39. Assume that the disorder shown in the pedigree in the Worked Problem on p. 326 is a rare disease that results from a
defect in mitochrondrial DNA. If individual III- 8 has a daughter, what is the probability that the daughter will inherit the muscle
disorder from her affected parent?
Solution:

Zero. Individual III-8 is male. In humans, mitochondrial DNA is inherited only from the mother, so the daughter cannot inherit
the disease from her father.

reFdrick Wilson and his colleagues studied members of a large family who had low levels of magnesium in their blood (see the
pedigree below). They argued that this disorder of magnesium (and associated high blood pressure

and high cholesterol) is caused by a mutation in mtDNA (F. H. Wilson et al. 2004. Science 306:1190–1194).

What evidence suggests that a gene in the mtDNA is causing this disorder?

Solution:

From the pedigree, it appears that both males and females are affected by the disorder and that it is inherited through the
maternal lineage. From the pedigree, we can see that only females pass the trait to their offspring. Maternal inheritance is
typical of genes found in the mitochondria.

Could this disorder be caused by an autosomal dominant gene? Why or why not?

Solution:

No, it is not likely that the disorder is caused by an autosomal dominant gene. From the pedigree, we can see that males with
the disorder do not pass it along to their offspring, while females with the disorder pass the trait to their offspring at a relatively
high frequency. These results are atypical of an autosomal dominant gene inheritance pattern where both male and female
afflicted parents should be equally likely to pass the trait to their offspring.
[After F.H. Wilson et al. 2004. Science 306:1190-1194.]

*31. In a particular strain of Neurospora, ya pok mutation exhibits biparental inheritance,

whereas poky mutations in other strains are inherited only from the maternal parent. Explain these results.

Solution:

In Neurospora, poky mutations are identified by the mutant organism’s slow growth. Maternal inheritance indicates that the
poky mutations have a mitochondrial origin because mitochondrial genomes are inherited maternally in Neurospora.

Many poky mutations have been identified on the mitochondrial genome. For a Neurospora strain containing a poky mutation
with biparental inheritance, the poky mutation probably is of nuclear origin. In Neurospora, nuclear genes exhibit biparental
inheritance. This particular poky mutation most likely affects the energy producing pathways in the mitochondria as indicated
by the poky phenotype, but the mutation is contained within a nuclear gene whose protein product targets mitochondria.

*32. A scientist collects cells at various points in the cell cycle and isolates DNA from them. Using density-gradient
centrifugation, she separates the nuclear and mtDNA. She then measures the amount of mtDNA and nuclear DNA present at
different points in the cell cycle. On the following graph, draw a line to represent the relative amounts of nuclear DNA that you
expect her to find per cell throughout the cell
cycle. Then draw a dotted line on the same graph to indicate the relative amount of mtDNA that you would expect to see at
different points throughout the cell cycle.

Solution:

Nuclear DNA levels should increase during only the S phase, before declining at cytokinesis. Mitochondrial DNA levels should
increase throughout the cell cycle, before declining at cytokinesis.

2.0x

Relative Amount of DNA

1.5x

1.0x

Cytokinesis Mitosis
Cell Cycle

In 1979, bones found outside Ekaterinburg, Russia, were shown to be those of Tsar Nicholas and his family, who were executed
in 1918 by a Bolshevik firing squad during the Russian Revolution (see the introduction to Chapter 14). To prove that the
skeletons were those of the royal family, mtDNA was extracted from the bone samples, amplified by PCR, and compared with
mtDNA from living relatives of the tsar’s family.

Why was DNA from the mitochondria analyzed instead of nuclear DNA? What are some of the advantages of using mtDNA for
this type of study?

Solution:

Because mitochondrial DNA in humans is inherited only maternally, the tsar’s living relatives of maternal descent should
contain very similar mitochondrial DNA sequences. The mitochondrial sequences of the tsar’s children and his wife can also be
analyzed, but only by comparing their mitochondrial DNA with that of living maternal relatives to the tsarina. Comparisons of
nuclear DNA sequences from the tsar’s family with living relatives would prove difficult because of the biparental transfer of
nuclear genes and recombination between the nuclear chromosomes. Also, the possibility of similar sequences appearing by
chance through matings of the tsar’s contemporary relatives could not be ruled out. The nuclear DNA analysis could, however,
indicate if the skeletons in the gravesite were related to each other.
An advantage of mitochondrial DNA typing for this type of study is the linear maternal inheritance.
Essentially, any maternally related individual should possess very similar mitochondrial DNA sequences
to the deceased individual. A second advantage is the number of mitochondrial genomes present.
Multiple copies of each chromosome exist within each mitochondrion, and each cell contains hundreds
of mitochondria, thus making it more likely that mitochondrial DNA has not completely degraded and
can be extracted in needed quantities for the analysis.

Mitochrondrial DNA from which living relatives would provide useful information for verifying that the
skeletons were those of the royal family?

Solution:

Only those related through female descendants. Because human mtDNA is always inherited from the
mother, only relatives related by maternal descent would provide useful information.

Antibiotics such as chloramphenicol, tetracycline, and erythromycin, inhibit protein synthesis in

eubacteria but have no effect on protein synthesis encoded by nuclear genes. Cycloheximide inhibits
protein synthesis encoded by nuclear genes but has no effect on eubacterial protein synthesis. How
might these compounds be used to determine which proteins are encoded by the mitochondrial and
chloroplast genomes?

Solution:

Proteins that are synthesized by the mitochondrial and chloroplast genomes are typically sensitive to
antibiotics that affect eubacterial protein synthesis. The sensitivity is most likely due to the similarities of
the translational machinery in eubacteria and in chloroplasts and mitochondria. To determine if a
particular protein is coded for on the mitochondrial or chloroplast genomes, we can use antibiotics and
determine their effects on protein synthesis. For example, if the antibiotic cycloheximide does not
inhibit the synthesis of the proteins in question, the lack of inhibition suggests the proteins are not
encoded by the nuclear genome. Subsequently, if the antibiotics chloramphenicol, tetracycline, and
erythromycin do inhibit the synthesis of the proteins, then this suggests again that the proteins are not
of nuclear origin; they are synthesized either in the mitochondria or the chloroplast. This combination
treatment of the different types of antibiotics—those that inhibit nuclear gene protein synthesis and
those that inhibit eubacterial as well as organelle protein synthesis—should indicate if proteins are of
nuclear or organelle origin