Journal of Clinical Virology 83 (2016) 66–71

Contents lists available at ScienceDirect

Journal of Clinical Virology

journal homepage: www.elsevier.com/locate/jcv

Simultaneous detection of Zika, Chikungunya and Dengue viruses by a

multiplex real-time RT-PCR assay
Kanti Pabbaraju a,∗ , Sallene Wong a , Kara Gill a , Kevin Fonseca a,b , Graham A. Tipples a,c ,
Raymond Tellier a,b
a
Provincial Laboratory for Public Health, Calgary, Alberta, Canada
b
Department of Microbiology, Immunology and Infectious Diseases, University of Calgary, Alberta, Canada University of Calgary, Alberta, Canada
c
Department of Pathology and Laboratory Medicine, University of Alberta, Edmonton, Alberta, Canada

a r t i c l e i n f o a b s t r a c t

Article history: Background: In the recent past, arboviruses such as Chikungunya (CHIKV) and Zika (ZIKV) have increased
Received 26 July 2016 their area of endemicity and presented as an emerging global public health threat.
Received in revised form 19 August 2016 Objectives: To design an assay for the simultaneous detection of ZIKV, CHIKV and Dengue (DENV) 1–4
Accepted 1 September 2016
from patients with symptoms of arboviral infection. This would be advantageous because of the similar
clinical presentation typically encountered with these viruses and their co-circulation in endemic areas.
Keywords:
Study design: In this study we have developed and validated a triplex real time reverse transcription PCR
Arbovirus
assay using hydrolysis probes targeting the non-structural 5 (NS5) region of ZIKV, non-structural protein
Zika
Chikungunya
4 (nsP4) from CHIKV and 3 untranslated region (3 UTR) of DENV 1–4.
Dengue Results and conclusions: The 95% LOD by the triplex assay was 15 copies/reaction for DENV-1 and less
Multiplex real-time RT-PCR than 10 copies/reaction for all other viruses. The triplex assay was 100% specific and did not amplify any
Molecular diagnosis of the other viruses tested. The assay was reproducible and adaptable to testing different specimen types
including serum, plasma, urine, placental tissue, brain tissue and amniotic fluid. This assay can be easily
implemented for diagnostic testing of patient samples, even in a high throughput laboratory.
© 2016 Elsevier B.V. All rights reserved.

1. Background
Arboviruses constitute an increasing public health burden glob-
ally. Although many of these viruses are geographically restricted,
they can unexpectedly increase their area of endemicity and
become emerging viruses.
Chikungunya virus (CHIKV) is an emerging alphavirus that has
spread across the tropics and subtropics with recent epidemics in
India [1]. In December 2013, it invaded the Western hemisphere
and is now endemic in the Caribbean islands, South and Central
America [2]. According to the Pan America Health Organization
(PAHO) the cumulative number of confirmed cases in the Amer-
icas has reached more than 97,000 (with more than 1.9 million
additional suspected cases) as of July 8, 2016 [3].
∗ Corresponding author at: Provincial Laboratory for Public Health, 3030 Hospital
Drive, Calgary, Alberta, T2N 4W4, Canada.
E-mail addresses: kanti.pabbaraju@ahs.ca (K. Pabbaraju), sallene.wong@ahs.ca
(S. Wong), kara.gill2@ahs.ca (K. Gill), kevin.fonseca@ahs.ca (K. Fonseca),
graham.tipples@ahs.ca (G.A. Tipples), raymond.tellier@ahs.ca (R. Tellier).
Zika virus (ZIKV) was first isolated in 1947 from a rhesus monkey
[4] and initial human infections were reported in Africa [5]. The
first large reported outbreak of Zika fever occurred in 2007 on the
island of Yap in the Federated States of Micronesia [6]; followed by
a larger epidemic in French Polynesia in 2013 and 2014. In 2015,
ZIKV emerged in the Americas; as of August 4 2016, circulation of
ZIKV has been reported in 43 countries throughout the Americas
(including in Florida, USA) [7–9]. In Canada, the first case of Zika
virus related to travel was reported in Alberta in 2013 [10].
Dengue virus (DENV) has been prevalent in nearly all the tropical
and subtropical regions of the world, with infections reported in
over one hundred countries in the Asia–Pacific region, Americas,
Middle East and Africa [11]. Taking asymptomatic infections into
account, an estimated 390 million cases a year occur worldwide
[12].
All three viruses are mainly transmitted by the same vectors,
Aedes aegypti and Aedes albopictus and co-circulation has been doc-
umented in French Polynesia [13] and Brazil [14], and most likely
occurs throughout the Americas, Asia, several Pacific islands, and
Africa, where DENV and CHIKV are endemic. Recent studies show
that the spread of ZIKV is following the path of DENV and CHIKV
[15].

http://dx.doi.org/10.1016/j.jcv.2016.09.001
1386-6532/© 2016 Elsevier B.V. All rights reserved.
 K. Pabbaraju et al. / Journal of Clinical Virology 83 (2016) 66–71 67

Infections with these viruses are often asymptomatic; the initial
clinical presentation is non-specific and symptoms such as fever,
maculopapular rash, musculoskeletal pain, headache and conjunc-
tivitis can be seen with any of these viruses [16,17]. Infection of
the central nervous system (CNS) has been documented with all
three viruses and can manifest as meningo-encephalitis [11,18].
Zika virus has been linked to cases of Guillain-Barré syndrome and
microcephaly in up to 13% of newborns if infection occurs during
the first trimester of pregnancy. Cases have also occurred follow-
ing maternal asymptomatic infection [19,20]; and other congenital
defects are increasingly being documented [21,22]. Chikungunya
virus has been associated with persistent arthritis and DENV infec-
tion can lead to life threatening illnesses such as Dengue shock or
Dengue hemorrhagic fever [23].
Overlapping initial symptoms and areas of endemicity would
dictate that all three viruses be tested for simultaneously. The lab-
oratory diagnosis for arboviruses has long relied on serological
methods which can be challenging [24,25]. Neutralization assays
are useful but cannot always yield a definitive diagnosis [26]. How-
ever, if blood and urine samples are obtained early in the illness, a
firm diagnosis can be established by specific detection using molec-
ular methods.
In order to design the primers and probes in conserved regions
of the genome with structural and functional constraints, the NS5
region of ZIKV and nsP4 of CHIKV encoding the RNA polymerase
were chosen. The 3 UTR of DENVs has highly conserved nucleotide
tracts essential for the viral replication. Oligonucleotides were
designed in this region for the simultaneous detection of all DENV
types. Here we report the development and validation of a triplex
real-time reverse transcription polymerase chain reaction (rtRT-
PCR) assay for the simultaneous detection of Dengue, Chikungunya
and Zika viruses in a format that can be easily implemented for high
throughput testing of patient samples in a diagnostic setting.
300 representative sequences of the non-structural protein 4 (nsP4)
gene of the CHIKV including Eastern, Central, and South African
isolates, the Asian lineage from different countries, and the Indian
Ocean lineage were used for oligo design. The 3 untranslated
region (3 UTR) from Dengue viruses 1–4 (DENV-1 to DENV-4) were
retrieved and one set of primers and a probe were designed to
detect all four serotypes with equal efficiency. Hydrolysis probes
were designed with minor groove binding proteins and labeled
with the fluorescent reporters NED, VIC and FAM for the detection
of ZIKV, CHIKV and DENV viruses, respectively (Applied Biosys-
tems (ABI), Foster City, California). Sequences from the targeted
viruses were contrasted with sequences from other flaviviruses and
alphaviruses to avoid cross detection. All primers were purchased
from the University Core DNA services, (University of Calgary, Cal-
gary, Alberta). Primers were also designed in the regions flanking
the detection region for the amplification of a longer fragment
including the detection region to generate plasmid clones used
in the preparation of in vitro transcribed RNA. The sequences and
source of the oligonucleotides used are provided in Table 1. Primers
and probes were designed using Primer Express® v3.0 from ABI and
all sequence alignments were performed using Clustal W (BioEdit).
2.2. Real-time RT-PCR assay
A one-step RT-PCR was performed using TaqMan® Fast Virus
One-Step RT-PCR Master Mix (ABI), 0.8 ␮M each of sense and anti-
sense primers and 0.2 ␮M of the probes. Five microliters of the
extracted RNA was combined with 5 ␮l of the master mix and the
reverse transcription step was performed at 50 ◦ C for 5 min fol-
lowed by incubation at 95 ◦ C for 20 s. Amplification included 45
cycles of denaturation at 95 ◦ C for 3 s, followed by annealing, exten-
sion and data acquisition at 60 ◦ C for 30 s on the 7500 Fast Real-Time
PCR system (ABI).

2. Study design
2.1. Design of primers and probes
Forty two representative sequences of the non-structural 5
(NS5) region of ZIKV including those from Rhesus monkeys from
Uganda, early human isolates from Nigeria, different African and
Asian mosquito isolates, the strain from Micronesia in 2007 and
sequences from isolates circulating in different parts of the world
from 2013, 2014 and 2015 were used for oligo design. More than
2.3. Preparation of RNA transcripts for sensitivity studies
The cloning primers listed in Table 1 were used for the amplifi-
cation of longer PCR products which were cloned using the TOPO®
TA Cloning Dual Promoter Kit (Life Technologies, California, USA).
RNA transcription was performed using RiboMAXTM SP6 RNA Pro-
duction System or T7 RiboMAXTM Express (Promega, Madison, WI,
USA) using standard protocols. The transcribed RNA was spec-
trophotometrically quantified for the calculation of copy numbers.

Table 1
Primers and probes for the triplex assay.

Virus Name Sequence (5 –3 )

ZIKV Zika NS5 For ACGCTCAGAGTGCTCTCYATG

ZIKV Zika NS5 Rev GTCGCTCCATGGTTTCCATC
ZIKV Zika NS5 NED MGB CTGGTGTATGGGCACA
ZIKV ZIKV-7928For-cloning AGTTACTACGCCGCCACCATC
ZIKV ZIKV-14R-9310 GTCTAAGGACCTTTACCACT
CHIKV Chik NSP For TGTACTGGCWGCAGCCACG
CHIKV Chik NSP Rev ATAGGGCTGGCAGCAAATTC
CHIKV Chik NSP VIC MGB AACGTCACACAGATGAG
CHIKV Chik NSP ClonFor GCAACTATTACTTAAGAAACTCCAGG
CHIKV ALPHA-2 Rev AACAGGGTTAGGAACATACCCGATTTCATCAT
DENV Den 3UTRFor ACTAGTGGTTAGAGGAGACCCCTCCC
DENV Den 3UTRRev GATCTCTGGTCTCTCCCAGCGTCAA
DENV Den 3UTR FAM MGB AAGGACTAGAGGTTA
DENV Deng1 3UTR ClonFor GATCAATGGTGTGGATCTCTGATAGGC
DENV Deng2 3UTR ClonFor GACCAATGGTGTGGCTCATTGATTGG
DENV Deng3 3UTR ClonFor GACCAATGGTGCGGATCACTCATTGG
DENV Deng4 3UTR ClonFor GATTTGTGGTGTGGATCCCTGATTGG
DENV Deng 3UTR ClonRev CCATTTTCTGGCGTTCTGTGCCTGG

All primers and probes were designed in-house. Target regions for ZIKV, CHIKV and DENV were NS5, nsP4 and 3 UTR respectively.
All primers and probes were designed in-house.
68 K. Pabbaraju et al. / Journal of Clinical Virology 83 (2016) 66–71

Table 2
Assay characteristics.

95% LOD (copies/reaction) Dynamic range (copies/reaction) slope Calculated efficiency R2 value Ct corresponding to 95% LOD

ZIKV 7 5.53 × 108

to 6 × 100
−3.21 104.89 0.998 37.90
CHIKV 8 5.24 × 107 to 6 × 100 −3.28 101.78 0.999 35.98
DENV-1 15 5.77 × 108 to 1.5 × 101 −3.24 103.54 0.999 38.02
DENV-2 8 7.83 × 107 to 8 × 100 −3.32 100.08 0.999 37.85
DENV-3 6 9.75 × 107 to 1 × 101 −3.31 100.50 0.998 38.02
DENV-4 9 6.32 × 107 to 7 × 100 −3.35 98.84 0.999 37.22

The 95% LOD is reported as copies detected per reaction; extraction input and output volumes can be used to calculate the sensitivity per ml of patient sample.
Linear regression plots of the copy number and Ct values were used to calculate the Ct value corresponding to the 95% LOD.

2.4. Extraction of viral nucleic acid
Viral RNA from the different specimen matrices including
plasma, serum, urine, cerebral spinal fluid (CSF) and amniotic
fluid was extracted using the easyMAG® automated extrac-
tor (BioMerieux, Quebec, Canada), according to manufacturer’s
instructions. The sample input volumes for plasma, serum and CSF
were 200 ␮l and the output volume was 55 ␮l. For urine and amni-
otic fluid the input and output volumes were 200 ␮l and 110 ␮l
respectively. Tissue samples (placenta and brain) were extracted
on the QIAcube automated extractor using the QIAamp DNA Mini
QIAcube kit (Qiagen, Ontario, Canada) from 60 ␮l of homogenized
tissue as input and nucleic acids were eluted into 200 ␮l.
2.5. Analytical sensitivity, exclusivity, reproducibility and
dynamic range of RT-PCR
Ten and two-fold serial dilutions of quantified in vitro RNA were
used to determine the analytical sensitivity by testing the dilutions
in triplicate on three independent runs. The 95% limits of detection
(95% LOD) were calculated by probit analysis using Microsoft Excel
followed by rounding up the copy number. The range of viral loads
tested in copies/reaction was 5.77 × 108 to 5.77 × 10−2 for DENV-
1, 7.83 × 107 to 7.83 × 10−2 for DENV-2, 9.75 × 107 to 9.75 × 10−2
for DENV-3, 6.32 × 107 to 6.32 × 10−2 for DENV-4, 5.53 × 108 to
5.53 × 10−2 for ZIKV and 5.24 × 107 to 5.24 × 10−2 for CHIKV. Lin-
ear regression fitting of the log viral load versus Ct allowed for the
calculation of Ct values corresponding to the 95% LOD.
Exclusivity of the assay was determined by testing high viral
load samples of several RNA and DNA viruses, including other
arboviruses, and viruses with overlapping clinical symptoms.
The viruses tested were Coxsackie A16, adenovirus serotype 4,
Varicella-Zoster, St. Louis encephalitis, Powassan, West Nile (lin-
eage 1a), Kunjin (West Nile virus lineage 1b), Murray Valley
encephalitis, Japanese encephalitis, Snowshoe hare, Jamestown
Canyon, La Crosse, Cache Valley, Western equine encephalitis, and
Eastern equine encephalitis viruses.
The reproducibility of the triplex assay was evaluated using
high and low viral load aliquots of cultured virus and clinical
samples; all viral cultures were obtained from the National Micro-
biology Laboratory (NML, Winnipeg, Manitoba, Canada). The intra
and inter-assay reproducibility was calculated using samples with
initial Ct values of 24.60 and 33.32 for ZIKV, 25.23 and 32.51 for
CHIKV, 27.16 and 33.64 for DENV-1, 26.03 and 32.38 for DENV-2,
23.87 and 33.79 for DENV-3, 25.69 and 31.55 for DENV-4; three
independent runs were performed with each specimen tested in
triplicate on every run.
2.6. Clinical specimens
Specimens submitted from 2011 to 2016 to the ProvLab for the
investigation of one or more of ZIKV, CHIKV and DENVs from travel
related cases were re-tested by the triplex assay.
Seventy-nine samples including amniotic fluid (n = 1), CSF
(n = 2), plasma (n = 29), serum (n = 29), and urine (n = 18) were
tested for ZIKV. Two real-time RT-PCR assays published by the
Centers for Disease Control (CDC, Atlanta, USA) targeting the mem-
brane and envelope regions of the ZIKV genome [27] were used as
gold standard assays for comparison. In addition, to validate the use
of placental tissue, brain tissue and amniotic fluid, ZIKV culture was
spiked at different viral loads ranging from Ct values of 25.84–33.25
into negative specimen matrices (n = 5), extracted and tested.
Fifteen samples from 2014 to 2016 were tested for CHIKV,
including serum (n = 11), plasma (n = 3) and CSF (n = 1). Samples
from 2011 to 2016 (n = 133) were tested for DENV, including amni-
otic fluid (n = 1), CSF (n = 7), plasma (n = 40), serum (n = 81) and urine
(n = 4). The RealStar® Chikungunya RT-PCR Kit and Dengue RT-PCR
Kit 2.0 from Altona Diagnostics (Hamburg, Germany) are CE-IVD
marked in vitro diagnostic tests that were used as gold standards.
2.7. Co-infections
To assess competitive inhibition of target extraction and detec-
tion in cases of co-infections, combinations of low and high viral

Table 3
Assay variability at different viral loads.

Intra-assay Variability Intra-assay Variability Intra-assay Variability Inter-assay Variability

Avg Ct SD %CV Avg Ct SD %CV Avg Ct SD %CV Avg Ct SD %CV

ZIKV 24.46 0.12 0.50 24.39 0.30 1.24 24.87 0.26 1.03 24.57 0.31 1.24
ZIKV 33.39 0.27 0.81 33.07 0.20 0.61 33.13 0.35 1.07 33.20 0.29 0.86
CHIKV 25.21 0.04 0.17 25.71 0.15 0.57 25.71 0.28 1.09 25.54 0.30 1.16
CHIKV 31.14 0.17 0.54 32.09 0.14 0.44 33.65 1.22 3.63 32.29 1.26 3.90
DENV-1 26.84 0.31 1.14 27.34 0.33 1.22 27.40 0.44 1.59 27.19 0.41 1.52
DENV-1 33.44 0.32 0.96 33.69 0.17 0.50 33.91 0.14 0.40 33.68 0.28 0.84
DENV-2 25.88 0.20 0.79 26.27 0.51 1.96 26.37 0.30 1.14 26.17 0.38 1.47
DENV-2 32.32 0.37 1.14 32.42 0.09 0.28 32.97 0.84 2.55 32.57 0.55 1.70
DENV-3 23.83 0.04 0.17 23.97 0.20 0.82 24.62 0.07 0.26 24.14 0.38 1.58
DENV-3 34.21 0.49 1.44 34.59 0.45 1.32 35.05 0.25 0.70 34.61 0.51 1.47
DENV-4 25.58 0.09 0.37 25.96 0.13 0.51 25.84 0.29 1.11 25.79 0.23 0.91
DENV-4 31.67 0.17 0.54 32.30 0.26 0.80 32.14 0.12 0.36 32.08 0.31 0.97

SD: Standard deviation; %CV: coefficient of variation.

 K. Pabbaraju et al. / Journal of Clinical Virology 83 (2016) 66–71
Table 4
Testing of co-infections.
Average Ct
Target DENV ZIKV CHIKV
DENV High; ZIKV High; CHIKV High 23.72 21.86 25.44
DENV Low; ZIKV Low; CHIKV Low 30.59 29.06 32.76
DENV Low; ZIKV High; CHIKV Low 28.78 21.71 37.15
DENV Low; ZIKV Low; CHIKV High 29.99 28.37 26.24
DENV High; ZIKV Low; CHIKV Low 23.97 27.66 31.70
Expected Ct values for DENV-1, ZIKV, and CHIKV at a high and low viral load were approximately 23, 21, 25 and 29, 28, 32 respectively.
loads with Ct values ranging from about 21 to 32 were spiked into
samples. Cultured ZIKV and a strong positive patient specimen for
DENV-1 were used to spike negative plasma samples. For CHIKV,
RNA was spiked into the extracts as needed. All extracts were tested
in triplicate by the in-house assay.
3. Results
3.1. Assessment of the RT-PCR assay performance: analytical
sensitivity, exclusivity, and reproducibility
The results for analytical sensitivity, dynamic range and assay
efficiency are summarized in Table 2. The 95% LOD by the
triplex assay was 15 copies/reaction for DENV-1 and less than 10
copies/reaction for all other viruses. Log linear amplification of tar-
get was obtained over 7 logs of template concentration. Using these
amplification plots, the Ct value corresponding to the 95% LOD was
calculated for each of the viral targets and as indicated in Table 2,
these values ranged from 35.98 to 38.02.
The triplex assay did not amplify any of the other viruses tested,
thus showing a very high exclusivity.
The intra-assay variability (%CV) was calculated using the
replicates within the same run and varied from 0.17 to 3.63%.
The inter-assay variability was calculated using values obtained
from the different runs and ranged from 0.84 to 3.90% showing
reproducible detection and good precision at different viral loads
(Table 3).
3.2. Testing of clinical samples
Of the 79 samples tested for ZIKV by the gold standard and
triplex assays, 10 samples from 7 patients were tested positive by
all assays. Positive specimen types included serum (n = 6), plasma
(n = 2), and urine (n = 2). Three weak samples gave discordant
results between the assays, these included two sera and one plasma
specimen which tested positive with the probe targeting the mem-
brane, but not the envelope gene by the CDC assays, with Ct values
of 35.6, 38.42 and 38.09; these samples would have been designated
as equivocal according to the original study [27]. These samples
gave Ct values of 36.72, 36.66 and ZIKV not detected, respectively,
by the triplex assay. These discordant samples had low viral loads
and repeat testing did not yield consistently reproducible results
by any of the assays, suggesting that the sensitivity of these assays
is comparable. Sixty-six specimens tested negative by all assays.
For CHIKV, 15 samples from 2014 to 2016 were tested. Of these,
two serum samples tested positive with Ct values of 33.71 and 20.30
by the Altona kit, and gave Ct values of 34.97 and 22.15 by the
triplex assay, respectively, showing equivalent test characteristics.
Thirteen samples tested negative by both assays.
Similarly, 133 samples from 2011 to 2016 were tested for DENV,
of which 43 samples from 39 patients tested positive by the Altona
kit with Ct values ranging from 17.21 to 39.92; the positive spec-
imen types included plasma (n = 8), and serum (n = 35). When
re-tested by the triplex assay, the Ct values for the positive samples
69
Standard Deviation %Coefficient of Variation
DENV ZIKV CHIKV DENV ZIKV CHIKV
0.32 0.31 0.12 1.34 1.44 0.48
0.11 0.08 0.44 0.37 0.28 1.34
0.02 0.26 2.84 0.06 1.21 7.64
0.09 0.25 0.04 0.31 0.87 0.14
0.17 0.12 0.15 0.69 0.44 0.46
ranged from 16.81 to 36.35, with only one sample giving discordant
results by the two assays. The discordant sample had tested pos-
itive in 2012 with a Ct value was 38.40, re-testing by the Altona
assay showed a Ct value of 40.6; this sample tested negative by the
triplex assay. Since this sample had a very low viral load and the
positive result was not reproducible by the gold standard assay, it is
concluded that the triplex assay has an overall comparable sensitiv-
ity to the gold standard assay. Eighty-nine samples tested negative
by both assays. For the 39 positive cases, Dengue virus typing by
sequencing a segment of the NS5 coding region [28] showed that
the viruses detected in these samples included DENV-1 (n = 21),
DENV-2 (n = 10), DENV-3 (n = 5), and DENV-4 (n = 3).
Placental and brain tissue were spiked with ZIKV at high and
low viral loads, and amniotic fluid at an intermediate load. After
extraction and testing, the measured Ct values were essentially the
predicted values, establishing the suitability of these samples.
3.3. Testing of co-infections
Results of the co-infection studies are indicated in Table 4. The
expected Ct values for DENV-1, ZIKV, and CHIKV at a high viral
load were approximately 23, 21, and 25; the expected Ct values
at a low viral load were approximately 29, 28, and 32. All three
viruses were detected in the five spiked samples and the Ct values
obtained from specimens with a co-infection were comparable to
those from specimens with a single target infection showing that
there is no competitive inhibition for the detection of either tar-
get at the different viral loads tested; thus co-infections would be
efficiently detected by the triplex assay.
4. Discussion
Dengue, CHIKV and ZIKV share the same mosquito vectors, over-
lap in their endemic areas and have a similar clinical presentation,
especially in the initial stages of infection. However, each of these
viruses can lead to severe complications; major concerns have been
raised about the high burden of congenital disease caused by ZIKV
[19,22]. Furthermore, co-infections with these agents have been
reported [17,29,30]. A timely diagnosis using molecular assays that
can detect and differentiate these viruses simultaneously would be
valuable.
Single and multiple real-time assays for the detection of DENV
and CHIKV have been reported [31–34]. Protocols for the detection
of ZIKV have been reported to target the envelope, membrane-
envelope junction, and the NS5 encoding genes [27,35,36]. The
approach of a single assay for these three viruses has been pro-
posed [37], and the CDC has released a triplex real-time RT-PCR
assay under an emergency use authorization [38].
The assay reported here uses a simple design with a probe and
primer pair for each virus and differentiates between ZIKV, CHIKV
and DENV. Zika and CHIKV circulating in different geographic areas
from different time periods were used for the design of oligos
to detect all these sequence variants. A single set of primers and
probes were designed to detect all four serotypes of DENV. The six
70 K. Pabbaraju et al. / Journal of Clinical Virology 83 (2016) 66–71
primers and three probes are pre-mixed and used as a primer-probe
mix for easy assay set-up. Total volume of the PCR mix is 10 ␮l and
uses only 5 ␮l of template for the detection of all three viruses. This
triplex assay provides conclusive results in less than one hour of
run time, making it simple, rapid and economical as compared to
other assays currently available.
To date we have had relatively few cases of ZIKV, mostly from
Latin America; but with the large number of sequences used in the
oligo design, in-silico analysis shows that the assay would detect
the sequence variants currently identified, similar considerations
apply for CHIKV. To date in Alberta the number of cases of CHIKV
in returning travelers, by rtRT-PCR or serology, remains relatively
low (data not shown), likely reflecting the pattern of travel. This
is a limitation of the study and we will continue to validate addi-
tional samples as they become available. Testing of patient samples
submitted from infected travelers within our population returning
from countries in South East Asia, Africa, the Indian sub-continent
and Latin America, ensured a large genetic diversity which included
all four serotypes of DENV.
We have noted that returning travelers with symptoms often
consult a physician after at least a few days of illness, resulting in
samples with a low viral load or even no detectable viruses by RT-
PCR. In practice therefore it is likely that serological methods will
continue to be a valuable complementary testing modality; how-
ever, as noted above, there is a multitude of confounding factors in
their interpretation. The use of molecular techniques will be more
rewarding by striving to obtain samples earlier, and to systemat-
ically obtain urine [39] or whole blood [40] since reports suggest
prolonged virus shedding in these specimen types as compared to
serum or plasma.
Conflict of interest
None declared.
Ethical approval
Not required.
Funding
This research did not receive any specific grant from funding
agencies in the public, commercial, or not-for-profit sectors.
Acknowledgements
The authors would like to thank Michael Drebot and David
Safronetz (National Microbiology Laboratory, Winnipeg, Canada)
for providing control viruses. We would also like to thank the tech-
nologists from the Molecular Diagnostics and Virology departments
for their excellent technical help. This work was supported by the
Provincial Laboratory for Public Health of Alberta.
References
[1] G. Pialoux, B.A. Gauzere, S. Jaureguiberry, M. Strobel, Chikungunya, an
epidemic arbovirosis, Lancet Infect. Dis. 7 (May 5) (2007) 319–327.
[2] H.E. Prince, B.L. Seaton, J.L. Matud, H.J. Batterman, Chikungunya virus RNA and
antibody testing at a National Reference Laboratory since the emergence of
Chikungunya virus in the Americas, Clin. Vaccine Immunol. 22 (March 3)
(2015) 291–297.
[3] (PAHO) PAHO. 2016 [cited; Available from: http://www.paho.org/hq/index.
php?option=com topics&view=readall&cid=5927&Itemid=40931&lang=en.
[4] G.W. Dick, S.F. Kitchen, A.J. Haddow, Zika virus I, Isolations and serological
specificity, Trans. R. Soc. Trop. Med. Hyg. 46 (5) (1952) 509–520.
[5] F.N. Macnamara, Zika virus: a report on three cases of human infection during
an epidemic of jaundice in Nigeria, Trans. R. Soc. Trop. Med. Hyg. 48 (March 2)
(1954) 139–145.
[6] M.R. Duffy, T.H. Chen, W.T. Hancock, A.M. Powers, J.L. Kool, R.S. Lanciotti,
et al., Zika virus outbreak on Yap Island, Federated States of Micronesia, N.
Engl. J. Med. 360 (June 24) (2009) 2536–2543.
[7] M. Hennessey, M. Fischer, J.E. Staples, Zika virus spreads to new areas – region
of the americas, may 2015–January 2016, MMWR. Morb. Mortal. Wkly. Rep.
65 (3) (2016) 55–58.
[8] Control ECFDPA, Zika virus infection outbreak, Brazil and the Pacific Region,
2015, cited; Available from: http://ecdc.europa.eu/en/publications/
Publications/rapid-risk-assessment-Zika%20virus-south-america-Brazil-
2015.pdf.
[9] W.H. Organization, Situation Report Zika Virus Microcephaly Guillain-barrÉ
Syndrome, 2016, cited; Available from: http://apps.who.int/iris/bitstream/
10665/247197/1/zikasitrep4Aug2016-eng.pdf?ua=1.
[10] K. Fonseca, B. Meatherall, D. Zarra, M. Drebot, J. MacDonald, K. Pabbaraju,
et al., First case of Zika virus infection in a returning Canadian traveler, Am. J.
Trop. Med. Hyg. 91 (November 5) (2014) 1035–1038.
[11] A. Guzman, R.E. Isturiz, Update on the global spread of Dengue, Int. J.
Antimicrob. Agents (November 36 Suppl. 1) (2010) S40–S42.
[12] S. Bhatt, P.W. Gething, O.J. Brady, J.P. Messina, A.W. Farlow, C.L. Moyes, et al.,
The global distribution and burden of Dengue, Nature 496 (April 7446) (2013)
504–507.
[13] V.M. Cao-Lormeau, D. Musso, Emerging arboviruses in the Pacific, Lancet 384
(November 9954) (2014) 1571–1572.
[14] G.S. Campos, A.C. Bandeira, S.I. Sardi, Zika Virus Outbreak, Bahia, Brazil,
Emerg. Infect. Dis. 21 (October 10) (2015) 1885–1886.
[15] D. Musso, V.M. Cao-Lormeau, D.J. Gubler, Zika virus: following the path of
Dengue and Chikungunya? Lancet 386 (July 9990) (2015) 243–244.
[16] D.J. Gubler, Dengue and Dengue hemorrhagic fever, Clin. Microbiol. Rev. 11
(July 3) (1998) 480–496.
[17] D. Musso, D.J. Gubler, Zika Virus, Clin. Microbiol. Rev. 29 (July 3) (2016)
487–524.
[18] J. Nelson, J.J. Waggoner, M.K. Sahoo, P.M. Grant, B.A. Pinsky, Encephalitis
caused by Chikungunya virus in a traveler from the Kingdom of Tonga, J. Clin.
Microbiol. 52 (September 3) (2014) 3459–3461.
[19] M.A. Johansson, Y.T.-R.L. Mier, J. Reefhuis, S.M. Gilboa, S.L. Hills, Zika and the
risk of microcephaly, N. Engl. J. Med. 25 (May) (2016).
[20] N. Broutet, F. Krauer, M. Riesen, A. Khalakdina, M. Almiron, S. Aldighieri, et al.,
Zika virus as a cause of neurologic disorders, N. Engl. J. Med. 374 (April 16)
(2016) 1506–1509.
[21] H.A. Miranda, M.C. 2nd Costa, M.A. Frazao, N. Simao, S. Franchischini, D.M.
Moshfeghi, Expanded spectrum of congenital ocular findings in microcephaly
with presumed Zika infection, Ophthalmology (May 25) (2016).
[22] S.A. Rasmussen, D.J. Jamieson, M.A. Honein, L.R. Petersen, Zika virus and birth
defects–reviewing the evidence for causality, N. Engl. J. Med. 20 (May 374)
(2016) 1981–1987.
[23] J. Whitehorn, C.P. Simmons, The pathogenesis of Dengue, Vaccine 29
(September 42) (2011) 7221–7228.
[24] S.K. Mardekian, A.L. Roberts, Diagnostic options and challenges for Dengue
and Chikungunya viruses, BioMed Res. Int. 2015 (2015) 834371.
[25] I.B. Rabe, J.E. Staples, J. Villanueva, K.B. Hummel, J.A. Johnson, L. Rose, et al.,
Interim guidance for interpretation of Zika virus antibody test results,
MMWR. Morb. Mortal. Wkly. Rep. 65 (21) (2016) 543–546.
[26] J.T. Roehrig, J. Hombach, A.D. Barrett, Guidelines for plaque-reduction
neutralization testing of human antibodies to Dengue viruses, Viral Immunol.
21 (June 2) (2008) 123–132.
[27] R.S. Lanciotti, O.L. Kosoy, J.J. Laven, J.O. Velez, A.J. Lambert, A.J. Johnson, et al.,
Genetic and serologic properties of Zika virus associated with an epidemic,
Yap State, Micronesia, 2007, Emerg. Infect. Dis. 14 (August 8) (2008)
1232–1239.
[28] M. Ayers, D. Adachi, G. Johnson, M. Andonova, M. Drebot, R. Tellier, A single
tube RT-PCR assay for the detection of mosquito-borne flaviviruses, J. Virol.
Methods 135 (August 2) (2006) 235–239.
[29] M. Dupont-Rouzeyrol, O. O’Connor, E. Calvez, M. Daures, M. John, J.P.
Grangeon, et al., Co-infection with Zika and Dengue viruses in 2 patients, New
Caledonia, 2014, Emerg. Infect. Dis. 21 (February 2) (2015) 381–382.
[30] W.E. Villamil-Gomez, O. Gonzalez-Camargo, J. Rodriguez-Ayubi, D.
Zapata-Serpa, A.J. Rodriguez-Morales, Dengue, Chikungunya and Zika
co-infection in a patient from Colombia, J. Infect. Public Health (January)
(2016) 3.
[31] T.R. Poloni, A.S. Oliveira, H.L. Alfonso, L.R. Galvao, A.A. Amarilla, D.F. Poloni,
et al., Detection of Dengue virus in saliva and urine by real time RT-PCR, Virol.
J. 7 (2010) 22.
[32] T. Hirayama, Y. Mizuno, N. Takeshita, A. Kotaki, S. Tajima, T. Omatsu, et al.,
Detection of Dengue virus genome in urine by real-time reverse transcriptase
PCR: a laboratory diagnostic method useful after disappearance of the
genome in serum, J. Clin. Microbiol. 50 (June 6) (2012) 2047–2052.
[33] K. Saha, R. Firdaus, S. Chakrabarti, P.C. Sadhukhan, Development of rapid,
sensitive one-tube duplex RT-PCR assay for specific and differential diagnosis
of Chikungunya and Dengue, J. Virol. Methods 193 (November 2) (2013)
521–524.
[34] D. Cecilia, M. Kakade, K. Alagarasu, J. Patil, A. Salunke, D. Parashar, et al.,
Development of a multiplex real-time RT-PCR assay for simultaneous
detection of Dengue and Chikungunya viruses, Arch. Virol 160 (January 1)
(2015) 323–327.
 K. Pabbaraju et al. / Journal of Clinical Virology 83 (2016) 66–71
[35] O. Faye, O. Faye, D. Diallo, M. Diallo, M. Weidmann, A.A. Sall, Quantitative
real-time PCR detection of Zika virus and evaluation with field-caught
mosquitoes, Virol. J. 10 (2013) 311.
[36] O. Faye, O. Faye, A. Dupressoir, M. Weidmann, M. Ndiaye, A. Alpha Sall,
One-step RT-PCR for detection of Zika virus, J. Clin. Virol. 43 (September 1)
(2008) 96–101.
[37] J.J. Waggoner, L. Gresh, A. Mohamed-Hadley, G. Ballesteros, M.J. Davila, Y.
Tellez, et al., Single-reaction multiplex reverse transcription PCR for detection
of Zika, Chikungunya, and Dengue viruses, Emerg. Infect. Dis. 22 (July 7)
(2016) 1295–1297.
71
[38] Prevention CfDCa. Trioplex Real-time RT-PCR Assay. 2016.
[39] A.M. Bingham, M. Cone, V. Mock, L. Heberlein-Larson, D. Stanek, C. Blackmore,
et al., Comparison of test results for Zika virus RNA in urine, serum, and saliva
specimens from persons with travel-Associated Zika virus disease – florida,
2016, MMWR. Morb. Mortal. Wkly. Rep. 65 (18) (2016) 475–478.
[40] Y. Lustig, E. Mendelson, N. Paran, S. Melamed, E. Schwartz, Detection of Zika
virus RNA in whole blood of imported Zika virus disease cases up to 2 months
after symptom onset, Israel,D ecember 2015 to April 2016, Euro Surveill. 21
(June 26) (2016).