An Integrated Kinetic Model for Design and Operation of

Solar-Septic Tanks

by

Tatchai Pussayanavin

A dissertation submitted in partial fulfillment of the requirements for the

degree of Doctor of Philosophy in
Environmental Engineering and Management

Examination Committee: Dr. Thammarat Koottatep (Chairperson)

Prof. Ajit P. Annachhatre
Prof. Chongrak Polprasert (External Member)
Prof. Siddharth Jabade (External Member)

External Examiner: Prof. Marcos von Sperling

Department of Sanitary and Environmental Engineering
Federal University of Minas Gerais
Brazil

Nationality: Thai
Previous Degree: Master of Science in Environmental Engineering and
Management
Asian Institute of Technology
Thailand

Scholarship Donor: Bill & Melinda Gates Foundation

under the framework of the SaniUP Project

Asian Institute of Technology

School of Environment, Resources and Development
Thailand
May 2015

i
 Acknowledgements
I would like to express my profound gratitude and sincere appreciation to Dr. Thammarat
Koottatep, my advisor, for the opportunities, his kindness supportive, supervision, his
valuable suggestion, valuable and encouragement throughout the study. My deepest sincere
gratitude to Prof. Chongrak Polprasert for the inspiration, excellence guidance, kindly
support and valuable knowledge. I would like to express my sincere thanks to Prof. Ajit P.
Annachhatre and Prof. Siddharth Jabade for their valuable suggestion and constructive
criticism, which made grateful acknowledgement and fulfilled this research.

Acknowledgements are also due to Bill & Melinda Gates Foundation and SaniUP project for
the author’s fellowship which gives this opportunity to study.

I would like to express my sincere thanks to Prof. Marcos von Sperling, external examiner,
for valuable suggestion and constructive comment given to improve this research.

Special thanks and a profound gratitude to Dr. Chalor Jarusutthirak for his impressive
support and valuable suggestion. Also, I would like to express my sincere thanks to Asso.
Prof. Boonmee for his valuable suggestion and kindly support.

Special thanks and a profound gratitude to Ms. Suchitra Piempinsest, for excellent support,
valuable suggestion and encouragement throughout the study.

I am very thankful to Dr. Nawatch Surinkul, Dr. Atitaya Panuvatvanich, Dr. Yuttachai
Sarathai, Mr. Jirasak Rojanacongse, Dr. Saroj K. Chapagain, Ms. Mingkhuan Wanitchow
and all member of NATS, for their recommendations, helps and kindly supports. I am
thankful to all members of the laboratory staffs and secretaries of the Environmental
Engineering and Management program, AIT, Ms. Salaya, Mr. Chaiyaporn. Ms. Orathai and
Ms. Chanya. Special thanks to Mr. Nimit and Mr. Panupong for their support and help
particularly at the time of need such as set up the experiment or filed work. Special thanks
to Mr. Ath Utsahakijamnuay for his impressive supports about the prototype.

I wish to acknowledge the technical support provided by Dr.Variga Sawaittayotin and Dr.
Suda Ittisupornrat of the Environmental Research and Training Centre (ERTC) and also Dr.
Somkiet Techkarnjanaruk and Ms. Nimaradee Boonapatcharone from King Mongkut's
University of Technology Thonburi for their help in molecular analysis. Furthermore, I am
grateful to Ms. Sarunnoud, Ms. Nan, Ms. Rawintra, Mrs. Nitasha, Mr. Sumeth, Mr. Eric, Mr.
Cyrill and Mr. Jaruwat, solar septic tank team, for their impressive support and
encouragement. Sincere thanks for their valuable comments, helping hands, encouragement,
inspiration and supporting that I always receive from my friends, my seniors and my juniors.

I would like to sincere thanks to Mr. Peeravit Pussayanavin and Bansungneon family’s for
their help, encouragement and support. I am very thankful to Ms Sudatip Putsri and her
family for inspiration, compassion, and encouragement. Lastly and the most importance,
unlimited appreciation are given to Mrs. Parichat and Mr. Visut Pussayanavin, my beloved
parent, for their love, encouragement, and extreme of support.

ii
 Abstract

It is a well-established fact that septic tanks are a prevalent on-site treatment system to
treat/collect toilet wastewater in most developing countries. Due to instabilities of organic
loading rates (OLRs) and short hydraulic retention times (HRTs), septic tank effluents still
contain high concentrations of organic matters and other pollutants. After operation for a
certain period, there will be high accumulation of septic tank sludge which requires frequent
desludging. To alleviate the above problems, a modified conventional septic tank with solar-
heated water called as “Solar septic tanks” was considered to be an effective on-site
sanitation technology. Because of the complex processes comprising of biological and
physical reactions, the design and operation of solar septic tanks are still lacking. The
ultimate goal of this research is to establish design criteria and operational conditions of
solar-septic tanks.

The experimental study, employing four laboratory–scale septic tanks (each with volume of
40 L) fed with diluted septage and operating at HRTs of 12, 24 and 48 h and temperatures
of 40 and 30 oC. To evaluate technical feasibilities of increasing temperatures inside a septic
tank, a pilot-scale solar septic tank with a size of 600 L and equipped with a locally made 2
m2 solar collector was operated for a 4-month period.

The 40 oC laboratory-scale septic tank operating at HRTs of 12 h resulted in the lowest BOD5
and TCOD removal efficiencies of 67%, while those units operating at HRTs of 24 and 48 h
resulted about 71 and 74 % for BOD5, and 76 and 78 % for TCOD, respectively. It was
apparent that the HRT of 12 h did not provide sufficient residence time for solids
sedimentation, resulting in the low TS and TVS removal efficiencies of 49 and 53 %,
respectively. There were not significant differences in TS and TVS removal efficiencies at
HRTs of 24 and 48 h, but higher than those of HRT of 12 h in the ranges of 68-70 % and 71-
75%, respectively. At steady-state conditions, more methanogenic activities could be
observed in the sludge layer of the septic tank operating at the temperature of 40 oC, resulting
in less TVS or sludge accumulation and more methane (CH4) production than in the unit
operating at 30 oC. Molecular analysis indicated more intense and diversity of
methanobacteriales in the septic tank sludge operating at 40 oC than at 30 oC. The less TVS
accumulation in the 40 oC septic tank would lengthen the period of septage removal, resulting
in cost-saving in desluging and septage treatment.

The integrated kinetic model was developed to simulate performance of a solar septic tank
and identify relevant parameters affecting changes occurring in biological pathways and
treatment efficiencies of organic and solids removal, sludge reduction, and methane
production. Validation of the model with the results obtained from the laboratory-scale septic
tanks, actual septic tanks and literature was done with the correlation coefficient (R2) values
of 0.85-0.90 which showed the applicability this model. Application of the integrated kinetic
model to design and operation and cost-benefit analysis of increasing temperatures in septic
tanks were discussed. However, it should be noted that the results from this study mainly
obtained from the laboratory-scale septic tanks fed with the synthetically made of diluted
septage and sludge reduction efficiency was observed within 4 month. Due to these
limitations of this experiment, the recommendations for further study are further validation
of the integrated kinetic model with the data of septic tanks operating at temperatures above
30-40 oC and investigation the sludge reduction efficiency in the septic tank in long term
operation.

iii
 Table of Contents

Chapter Title Page

Title Page i
Acknowledgements ii
Abstract iii
Table of Contents iv
List of Tables vi
List of Figures vii
List of Abbreviations ix

1 Introduction 1
1.1 Background 1
1.2 Objectives of This Study 2
1.3 Scope 2

2 Literature Review 3
2.1 Septic Tank: Design and Performance 3
2.2 Model Development 19
2.3 Effects of Temperature Variation in Septic Tanks on the 21
Efficiency of Organic Reduction and Biogas Production
2.4 Solar Water Heating Device and Application for Septic Tank 22

3 Theoretical Consideration 26
3.1 Hydraulic Characteristic 26
3.2 Dynamic Modelling 28
3.3 Septic Tank Mechanisms and Development of a Series of the 30
Models

4 Material and Methods 31

4.1 Research Plan 31
4.2 Laboratory-Scale Septic Tanks 32
4.3 On-Line Temperature Sensors Inside the Laboratory-Scale Septic 32
Tank Operating at 40 oC
4.4 Experimental Operation 34
4.5 Septage Characteristics 34
4.6 Pilot-Scale Solar Septic Tank 34
4.7 Model Development and Data Analysis 37
4.8 Actual-Scale Septic Tanks 37
4.9 Sampling and Analytical Methods 37
4.10 Molecular Analysis 38

5 Results and Discussion 40

5.1 Design Consideration of Septic Tank for Treating Black Water 40
5.2 Variation of Operation Conditions 43
5.3 Performance of Laboratory-Scale Septic Tanks 47
5.4 Microbial Identification 61
5.5 Kinetic Model Development 64
5.6 Modelling to Investigate Effects of Increasing Temperatures in 72

iv
 Septic Tanks
5.7 Application of Results 77

6 Conclusions and Recommendations 80

6.1 Conclusions 80
6.2 Recommendations 81

References 82

Appendix A 90
Appendix B 98
Appendix C 126

v
 List of Tables

Table Title Page

2.1 Black Water Characteristics 5

2.2 Feces Composition 5
2.3 Sizing of Septic Tank per Number of Bedrooms 7
2.4 Septic Tanks Effluent 10
2.5 Removal Efficiencies of Septic Tanks 11
2.6 Kinematic Viscosity of the Liquid at Different Temperatures 13
2.7 Empirical Constant Values 13
2.8 Chemical Oxygen Demand Conversion Factors 14
2.9 Kinetic Values of Hydrolysis 15
2.10 Anaerobic Degradation of Glucose 16
2.11 Kinetic Values in Each Reaction Step of Anaerobic Pathways 18
2.12 Inhibition Values of Acetoclastic, Propionic and Butyric 18
2.13 List of Anaerobic Digestion Models 20
2.14 Biogas Production of Laboratory-Scale Septic Tanks at Various 21
Temperatures
2.15 Applications of Solar Water Heating Device 24
2.16 Summary of Energy Requirement for Septic Tank 25
3.1 Hydraulic Characteristic in Septic Tanks 27
3.2 Basic Entities for Equation Translation 29
4.1 Parameters and Methods 38
5.1 Black Water Generation Rate in Thailand 40
5.2 Sizing and Dimension of Septic Tank in Thailand (Commercial 41
Treatment Package or Readymade Septic Tank)
5.3 Summary Design Approach of Septic Tank 42
5.4 Temperatures and pHs of Influent and Effluent Black Water of 45
Laboratory-Scale Septic Tanks
5.5 OLRs, SLRs and VSLRs of Laboratory-Scale Septic Tanks 45
5.6 TCOD, SCOD and BOD5 Concentrations of Laboratory-Scale 48
Septic Tanks
5.7 TS and TVS Concentrations of Laboratory-Scale Septic Tanks 53
5.8 Reduction of Accumulated Sludge 54
5.9 Methane Production 58
5.10 Effects of HRTs on Removal Efficiencies of Laboratory-Scale 60
Septic Tanks
5.11 Sequencing Results 62
5.12 TVS Reduction per Day 66
5.13 Sludge Accumulation in Actual Septic Tanks of Thailand 70
5.14 Performance of Solar Septic Tanks 78
5.15 Application of Solar Septic Tanks 79

vi
 List of Figures

Figure Title Page

2.1 Septic tank installation 3

2.2 Typical septic tank components 6
2.3 Installation procedure for a septic tank 9
2.4 Settling phenomena in the septic tank 12
2.5 Anaerobic pathways 15
2.6 Substrate balance in the septic tank 16
2.7 FISH analysis of laboratory-scale septic tank at 40 ˚C 22
2.8 Solar water heating device 23
3.1 Configuration design of septic tanks 26
3.2 RTD curve of septic tanks 27
3.3 Substrate balance of completely-mix equation in septic tank 27
3.4 Feedback loops of microorganisms 28
3.5 Equation translation and model simulation 29
3.6 Septic tank mechanisms 30
4.1 Research plan 31
4.2 Laboratory-scale septic tanks maintained at 40 oC 32
4.3 18 Positions of on-line temperature sensors inside laboratory-scale 32
septic tank
4.4 Laboratory-scale septic tanks design 33
4.5 Operating conditions 35
4.6 Experimental set up of a pilot-scale solar septic tank at Asian 36
Institute of Technology, Thailand
5.1 1000 L-Septic tank (Balloon shape) 40
5.2 Temperature and pHs of influent and effluent black water of 43
laboratory-scale septic tanks
5.3 Average temperatures (18 positions) of laboratory-scale septic tank 44
operating at 40 oC
5.4 OLRs, SLRs and VSLRs of laboratory-scale septic tanks 46
5.5 TCOD removal efficiencies of laboratory-scale septic tanks 49
5.6 SCOD removal efficiencies of laboratory-scale septic tanks 50
5.7 BOD5 removal efficiencies of laboratory-scale septic tanks 51
5.8 TS removal efficiencies of laboratory-scale septic tanks 52
5.9 TVS removal efficiencies of laboratory-scale septic tanks 54
5.10 TS accumulated in laboratory-scale septic tanks 56
5.11 Accumulated TS and TVS concentrations (mg/L) in laboratory- 57
scale septic tanks
5.12 Methane production (L/d) of laboratory-scale septic tanks 58
5.13 Effects of HRTs on removal efficiencies of laboratory-scale septic 59
tanks at 40 oC
5.14 Microbial diversity in laboratory-scale septic tanks operating at 40 61
and 30 oC
5.15 Phylogenetic relationship of partial 16S rRNA genes of the 63
methanogenic microorganisms present in the settled sludge of the
laboratory-scale septic tanks operating at 40 and 30 oC
5.16 Completely mixed model 64
5.17 Mass balances analysis of sludge accumulation 65

vii
5.18 TVS reduction in laboratory-scale septic tank fitted with first-order 67
model
5.19 Integrated kinetic model of sludge accumulation in septic tanks 68
5.20 Comparison of simulation data and results of sludge accumulation 69
in laboratory-scale septic tanks
5.21 Sludge accumulation data of actual and laboratory-scale septic tank 71
and simulated results at various SLRs
5.22 Modelling to investigate septic tank performance 75
5.23 Dynamic modelling of septic tank performance 76
5.24 Temperatures of a solar septic tank 77
5.25 Temperatures of a hybrid solar septic tank 77

viii
 List of Abbreviations

AIT Asian Institute of Technology

BOD5 5-day Biochemical oxygen demand, mg/L
C0 Influent concentration, mg/L
cm Centimeter
o
C Celsius
Ct Concentration at a time, mg/L
d Day
DGGE Denaturing gradient gel electrophoresis
DNA Deoxyribonucleic acid
E. coli Escherichia coli, MPN/100 mL
EFF Effluent
FS Fixed solids, mg/L
g Gram
h Hour
HRT or t Hydraulic retention time, h
INF Influent
J Joule
kT First-order rate constant at temperature
kWh Kilowatt-hour
L Liter
LCFA Long chain fatty acids
MLSS Mixed liquor suspended solids, mg/L
MLVSS Mixed liquor volatile suspended solids, mg/L
OLR Organic loading rate, kg/m3.d
PCR Polymerase chain reaction
S0 Initial substrate concentration, mg/L
SCOD Soluble chemical oxygen demand, mg/L
SEE Standard error of the estimate
SLR Solid loading rate, kg/m3.d
St Substrate concentration at a time, mg/L
T Temperature, °C
TCOD Total chemical oxygen demand, mg/L
TKN Total Kjeldahl nitrogen, mg/L

ix
TN Total nitrogen, mg/L
TP Total phosphorus, mg/L
TS Total solids, mg/L
TSS Total suspended solids, mg/L
TVS Total volatile solids, mg/L
VFA Volatile fatty acid, mg/L
VSLR Volatile solid loading rate, kg/m3.d

x
 Chapter 1

Introduction

1.1 Background

The World Health Organization and United Nation reported that more than 2 billion people,
mostly in developing countries, still lack of access basic sanitation facilities. More than 1
million people die every year, especially in children, due to infection and diarrhea as a result
of poor sanitation. Currently, human wastes or waste generating from human activities and
containing high level of organic pollutants and pathogens, are discharged into nearby
vicinities which can cause environmental pollution and health risks to people (Koottatep et
al., 2001). A recent reports of the United Nations estimated that more than 1,000 km3 of
untreated wastewater is usually discharged to nearby environments or canals and rivers.

Centralized wastewater treatment as being practiced in most developed countries is one of

the solutions to treat those wastes, but it seems to be inappropriate for developing countries
because of high investment cost and requirement of skilled operation. Considering the case
of Thailand, restricted local budgets or funding, coverage of wastewater treatment plants in
many small and isolated villages are still inadequate (PCD, 2014). Moreover, large
investment of sewerage system and pumping associated with centralized treatment systems
is one of barriers for decreasing affordability of construction of wastewater management
systems (Massoud et al., 2009). Thus, to come up with cost-effective and implementable
solutions, onsite wastewater treatment technologies such as cesspools and septic tanks, low
investment cost and easy to operate, are more applicable (Rybczynski et al., 1978). For this
reason, the on-site treatment system has been used as a privilege technology in households
and a primary treatment device to treat sewage or black water.

Due to limitations of the on-site treatment processes and improper design/operation, their
effluents still contain high concentration of BOD5 and E. coli (Corey et al., 1978; Rodgers
et al., 2011). Previous studies of Bounds, (1997) and Seabloom et al. (2004) reported the
concentration of BOD5 and E.coli from septic tank effluent to be about 100 mg/L and 106
MPN/100 mL, respectively, which were still higher than the discharge standard of surface
water in Thailand (PCD, 2014) or the WHO guidelines for safe reuses (WHO, 1989), and
requiring post treatment. Moreover, septage or untreated sludge requires frequent desludging
and consequently treatment. Most developing countries (Thailand, Vietnam and Philippine)
still lack septage treatment facilities, thus, the common practice of septage management is
direct disposal into paddy fields or canals without any treatment (Koottatep et al., 2004). Up
to present, there are many reports of pollution and health problems caused by unsanitary
septage disposal (Heinss et al., 1999).

Since 2012, the Bill & Melinda Gates Foundation has invested more than hundreds million
US$ to reinvent the sanitation technologies to alleviate the above problems. The aims of this
project are to develop effective sanitation technologies, focusing on onsite treatment
technologies, that poor people can access and also to create a platform of global
sustainability. One of the innovative sanitation technologies is “Solar septic tanks”. A
modified conventional septic tank with solar-heated water is considered to be an effective
on-site sanitation technology. It is hypothesized that operating a septic tank at temperatures
higher than ambient condition could enhance pathogen die-offs and increasing
biodegradation of organic matters and reducing sludge accumulation (Lettinga et al., 1984;

1
Wiegant and Lettinga, 1985). Due to the complex mechanisms inside the septic tanks system,
the design and operation of solar septic tanks are still lacking. However, there are very few
research on the application of septic tanks operating at higher temperatures. Thus, basic
criteria for design and operation of septic tanks operating at higher temperatures is required
for this technology. To develop the solar septic tank technology with proper functioning, an
integrated kinetic modeling or a series of the models is considered as an effective tools to
understand the complex mechanisms inside the solar septic tank and predicting treatment
performance for removing of organic matters and pathogens at various environmental
conditions.

1.2 Objectives of This Study

The ultimate goal of this research is to develop an integrated kinetic model for design and
operation of solar-septic tanks

The specific objectives of this study are:

- To investigate the performance of septic tanks operating at high temperatures

treating black water (with emphasis on organic and solids removal, sludge
reduction, and methane production efficiencies)

- To determine roles of microbial communities in the septic tanks operating at

different temperatures

- To develop integrated kinetic models for design and operation of the septic tank

- To optimize a solar-septic tank prototype design based on the integrated kinetic

model and cost-benefit analysis

1.3 Scope

The experiment study involved laboratory-scale septic tanks operating at the Environmental
Engineering Research Station of the Asian Institute of Technology, Thailand. The
laboratory-scale septic tanks, each with a volume of 40 L, were constructed and operated at
the hydraulic retention times (HRTs) of 12, 24 and 48 h and temperatures of 40 oC and 30
o
C. Data of the actual septic tank located at municipalities in different regions of Thailand
were used for validation of the laboratory-scale septic tanks data. An integrated kinetic
model was developed to predict the level of sludge accumulation in the solar septic tanks,
while a dynamic modelling was employed to simulate septic tank performance at various
temperatures.

2
 Chapter 2

Literature Review

2.1 Septic Tank: Design and Performance

Septic tanks in developing countries are mostly dealing with black water or toilet
wastewater, while septic tanks in developed countries (Figure 2.1) receive both black water
and grey water (washing, bathing and cleaning water) (Tilley et al., 2008).

Figure 2.1 Septic tank installation

2.1.1 Black water

Black water component consists of feces, urine and washing/flushing water. Most of black
water components are the water used from toilet flushing, resulting more than 80 percent of

3
total volume, to transport and cleaning the closet bowl. The average volume of black water
generated per person is around 10-50 L/d, depending on the available water, type of toilet
and personal habit. Up to present, there are very few reports or guidelines about black water
volume in developing countries. Pickford (1980) and Polprasert and Rajput (1982) reported
that the volume of wastewater flow to septic tanks generated per day are fluctuated due to
irregular toilet flushing or frequencies of toilet usages.

The characteristic of black water is found to be high organic (BOD5 and TCOD) and solid
(TS and TVS) contents. A previous study of Luostarinen et al. (2007) reported that the
characteristic of black water (without grey water) contained high concentrations of TCOD,
BOD5, TS, TVS and TKN and are several times higher than those of domestic wastewater.
Average characteristics of black water were found to be in the ranges of 600-1,500 mg/L of
TCOD, 220-600 mg/L of BOD5, 20-100 mg/L of TP, 300-700 mg/L of TS and 25-300 mg/L
of TN (Table 2.1). The C/N ratio of black water is about 6-10. Based on the feces
composition, the average concentration of TCOD in black water is about 1,000 mg/L and
lesser concentrations of BOD5, because those characteristic of feces contain high level of
organic particles which is difficult to degrade (Table 2.1).

Feces is the remaining materials of a digestive system from a human body and contains
organic matters, trace elements and microorganisms, also the main compositions of black
water. In developing countries, the quantity of feces production per people depend on food,
culture, habit and health, which vary between 130 and 520 g/d (wet weight). The generation
rates of human feces per person in Thailand and Vietnam were 120-400 and 130-140 g/d,
respectively (Polprasert, 2007; Schouw et al., 2002). About 65-80 percent of feces are water,
only in the case of diarrhea, where percent of water can be up to 85. The feces compositions
are mainly comprised of organic materials (50 percent of dry weight) such as polysaccharide,
fat and protein, as shown in Table 2.2.

4
Table 2.1 Black Water Characteristics

Parameter Polprasert and Lens et al. Koottatep et Coquin Van Voorthuizen Al-Jamal and
Rajput (1982) (2001) al. (2001) (2005) et al. (2008) Mahmoud
(2009)
TCOD (mg/L) 610 900-1,500 1,450 980-1,900 830-1,405 900-1,500
SCOD (mg/L) - - - - 530 305
BOD5 (mg/L) 220 300-600 290 - - 300-600
pH 6.5-7 7.2-7.3 - 6.1-7.3 - -
TS (mg/L) 300-700 - - - - -
TDS (mg/L) 400 - - - - -
TP (mg/L) 30 20-40 100 15-25 100-120 40-90
TN (mg/L) 35 100-300 25 130-220 130-180 100-300
Total coliform 106 - - - - -
(MPN/100 mL)
Fecal coliform 105 - - - - -
(MPN/100 mL)

Table 2.2 Feces Composition

Composition* %
Fiber and Carbohydrate (Polysaccharides) 30
Bacteria 30
Fat 10-20
Inorganic matter 10-20
Protein 2-3
Source: Jönsson et al. (2005)
*By weight

5
2.1.2 Septic tank system: design and operation

A septic tank is commonly used as an on-site sanitation system and installed in the areas
without centralized wastewater treatment system to treat toilet wastewater from households.
Septic tank constructions in most developing countries are designed as watertight receptacle,
made of plastic or concrete, to collect human waste (including feces, urine and flush water).
The septic tank is the complex processes of physical and biological treatment. It is normally
considered that the major mechanism of the septic tank is simply sedimentation, where
heavily settleable solids are accumulated in the tank bottom and partially clarified liquid is
leaching into nearby environments such as soil, ground water and canal (Rybczynski et al.,
1978). In the septic tank, there are three main layers including sludge, liquid and scum.
Generally, the septic tank component is equipped with inlet pipe, outlet pipe, baffle and
cover. The details of components within a septic tank is shown in Figure 2.2.

Cover
Inlet
Outlet

Baffle

Figure 2.2 Typical septic tank components

Due to the low-oxygen environment, microorganisms growing in the septic tank is mainly
anaerobic bacteria. These microorganisms could digest organic matters in the settleable
solids and soluble organic in liquid to methane and carbon dioxide. Accumulated sludge in
the septic tank requires frequent desludging around 1-2 times per year. Due to no mixing
equipment and also loading of top layer, the bottom sludge in septic tank becomes dense.

The design of a septic tank has to ensure the removal of settleable solids as much as possible
biodegradation processes of soluble organics. Normally, HRTs in septic tank are designed
in the range of 1-3 days. It is reported Polprasert and Rajput (1982) that the removal
efficiencies of TCOD, BOD5 and solids in septic tanks depend on the HRT. The designed
HRT for the highest solid separation (> 65% of total suspended solids (TSS)) in septic tank
is found in the range of 8-24 h (Pickford, 1980; Weibel, 1949; White et al., 1972).

Septic tank design depends on the operating HRTs (not be less than 1 day) or the averages
of daily flow rates of wastewater, and the rate of accumulated solids in the tank. In general,
septic tank sizing is calculated from wastewater generation per day, number of user and
average flow rate, while some literatures include sludge accumulation rate to design of septic
tanks. Polprasert and Rajput (1982) concluded that designing of septic tanks could be
estimated from the number of user and number of bedrooms as shown in Table 2.3.

6
Table 2.3 Sizing of Septic Tank per Number of Bedrooms

Number of Volume of septic Equivalent Equivalent

bedrooms tank (m3) capacity of tank capacity of tank
per person (m3) per bedroom (m3)
1 2.84 0.05 1.42
2 2.84 - 1.42
3 3.41 - 1.14
4 3.79-4.16 0.47 0.95-1.04
5 4.92 0.40 0.98
Sources: Kiker (1956) and Wagner and Lanoix (1958)

The basic equation to estimate septic tank capacities is as followed (BSI, 1972):

C = 18 P+2000 (2.1)

Where: C is capacity of septic tank (L) and P is number of persons. Pickford (1980)
developed Equation 2.2 for septic tank design which included other relevant parameters.

C = A+P (rq+ns) (2.2)

Where: A is a constant value (given as 2000 L), r is HRT (d), q is flow rates (L/d), n is the
desludging time (year) and s is accumulation rate of sludge (L/person.year) in which this
value taken as 77-80 L/person.year or it could be estimated from the following equations
from Seabloom et al. (2004) and Weibel (1949).

s = (47τ0.60)/3.78 (2.3)

s = (13.4τ+50.9)/3.78 (2.4)

Where: τ is number of the years between desludging.

Another equation to calculate the capacities for storage of sludge could be expressed as:

C =A+B (2.5)

A = Pnfs (2.6)

B = Prq (2.7)

Where: A is the required capacities of sludge storage (L) and B is the required capacities of
liquid retentions (L).

However, because septic tanks in developing countries collect mainly black water or toilet
water which is more concentrated and has low flow rate, the above equations which have
been developed based on the condition of black water mixing with grey water, might not be
applicable in most of developing countries.

The other factors for the design of septic tanks are:

- Depth
- Inlet and outlet pipe

7
 - Number of compartment

Depth: The depth is not a direct design factor because solids removal depends on the surface
area of the septic tank. In general, the most favored design with a length three times with
width, while the depth is about 1.2-1.8 m (Polprasert and Rajput, 1982).

Inlet and outlet pipet: The inlet and outlet pipe has an influence on the tank operation.
Sewage or black water should enter the septic tank without any turbulence and also outlet
has to convey only less of solids concentrations. The diameter of the inlet pipe should not be
less than 10 cm, and the slope should not be too steep (Polprasert and Rajput, 1982). If it is
too steep, the water will run very fast and make turbulence condition. To prevent the biogas
or suspended solids wash out, the outlet pipe of a septic tank should be a tee or small baffle.

Number of compartment: It is usually reported that two compartment of septic tank could
improve the quality of the effluent. A single compartment usually provides satisfactory
performance, but more compartment is reported to be better than a single compartment for
removal of organic matters or solids. Well-designed of two compartment tanks could reduce
the effect of intermittent flow and peak hourly load. The large compartment is holding at
least 2/3 of the tank (Polprasert and Rajput, 1982).

2.1.3 Installation procedure

The most important requirement of septic tank installation is that the foundation to support
the tank content and at depth which provides sufficient gravity flow of sewage/black water
to the tank. The procedure for septic tank installation is summarized as following:

1.) Excavate the hole for installing the septic tank

2.) Lay the foundation with sand (10 cm) and concrete (10 cm) (if the excavation is too
deep, it should be filled back with sand)
3.) After concrete settle down and pack, the septic tank was placed into the foundation
4.) Connect the pipe
5.) To prevent the damage of the tank, before bury the sand, the septic tank has to
fill water inside until it’s full
6.) Cover with the soil

All the steps are shown in Figure 2.3.

8
 Figure 2.3 Installation procedure for a septic tank

2.1.4 Septic tank performance

Due to relatively short HRT of septic tanks (1-3 d) and less interaction between accumulated
solids and liquid, septic tank effluent still contain high concentrations of organic matter and
pathogen, as shown in Table 2.4. The effluent is normally high in the TCOD, BOD5,
pathogen and nitrogen (Brandes, 1978; Polprasert and Rajput, 1982; Hammer, 1989; Li-hua
et al., 2006). HRTs of septic tanks is the major parameter affecting removal efficiencies of
organic matters (TCOD, BOD5) and settelable solids (TS and TVS).

9
Table 2.4 Septic Tanks Effluent

Parameter* Brandes Polprasert Hammer Crites and U.S. EPA. Seabloom et Li-hua et al.
(1978) and Rajput (1989) Tchobanoglous (2002) al. (2004) (2006)a
(1982) (1998)
TCOD 170-490 - - 250-500 - - 70-140
BOD5 40-160 90-130 100 150-250 140-200 90-190 35-140
TSS 40-260 40-74 - 40-140 50-100 40-120 20-40
Dissolve oxygen - 0 - - - - -
Alkalinity - 300-400 - - - - -
TN 140-170 5-10 - 50-90 - - 30-100
Fecal coliform 104-106 106-108 10 5
- - -
(MPN/100mL)
*Unit of mg/L
a
In summer season

10
Because TS or TSS contained in black water is heavy material such as feces or paper which
can easily settle. The solids removal efficiencies in septic tanks are usually higher than other
parameters. Pickford (1980) found the efficiencies of TSS removal to be 65 % at the HRT
of 6 h and the removal efficiencies were stable at the HRTs above 8 h. Similarly, Phadke et
al. (1972) and Weibel (1949) reported that the TSS removal efficiencies of septic tanks
operating in the HRTs of more than 10 d were found about 63-85 %. Seabloom et al. (2004)
and Bounds (1997) reported that the removal efficiencies of TSS were found to increase to
around 77 % with 2 compartment septic tanks operating at a HRT of 1 d. The results from
previous studies suggested that the treatment efficiencies could be increase with increasing
HRTs. The treatment efficiencies of septic tanks operating at HRTs more than 3 d seem to
be better than the septic tank operating at HRTs of 1-3 d (Nguyen et al., 2007; Ittiusupornrat
et al., 2009; Koottatep et al., 2014). A summarized treatment performance of septic tanks
increasing shown in Table 2.5. Because septic tank effluent still contains high concentrations
of the pollutants, post treatments and techniques to improve septic tank performance are
required. Luostarinen et al. (2007), Al-Jamal and Mahmoud (2009) and Moussavi et al.
(2010) researched on a upflow septic tank to treat black water, found the removal efficiencies
of TCOD and TSS to be better than septic tank alone. However, due to clogging problems
and requirement of high skilled operation, the UASB-septic tank is difficult to be applied at
household communities.

Table 2.5 Removal Efficiencies of Septic Tanks

Previous study HRT Removal efficiency

(d) TCOD BOD5 TS TVS
Koottatep et al. (2014)a 1 76 84 72 77
5 88 84 66 52
7 93 93 75 70
9 90 94 66 72
16 97 95 66 58
Rochmadi et al. (2010)b 2 84 97 87 92
Polprasert and Rajput (1982)b <2 47 27 46 -
Seabloom et al. (2004)b <2 - 60 77 -
Bounds (1997)b <2 - 64 91 -
Ittiusupornrat et al. (2009)a 0.5 - 52 - -
1 - 60 - -
Nguyen et al. (2007)a 2 - 58 - -
Luostarinen et al. (2007)a,c 29 78 - - -
Al-Jamal and Mahmoud (2009) a,c 2 51 43 - -
4 54 49 - -
Moussavi et al. (2010) b,c 0.25 31 33 - -
0.5 67 71 - -
1 77 85 - -
aTreatedblack water
bTreated sewage water
c Upflow septic tank

Koottatep et al. (2013) developed thermal septic tanks and reported that the removal
efficiencies of septic tanks operating at temperatures of 30, 40, 50, 60 and 70 oC were more
than 80 % for TCOD and BOD5 and E.coli reductions were 4-6 logs. Modified Weibull
model (Equations 2.8 and 2.9), by raising temperatures of a conventional septic tank to 60

11
o
C, the E. coli concentration of the septic tank effluents could be reduced to be less than 103
MPN/100 mL, at a contact time of 5 days suitable for discharge or for agricultural and
aquacultural reuses.

Nt
log   b t n (2.8)
N0

Where, Nt is the number of microbial populations at any time, N0 is the number of microbial
populations at initial time, t is contact time, n is Weibull coefficient of 0.33, γ is a correction
coefficient 0.5 and bT is a temperature-dependent coefficient.

bT = 0.05T – 1.02 (2.9)

2.1.5 Sedimentation process in the septic tank

In many literatures, the septic tank is classified as a primary treatment (or sedimentation
basis) with respect to remove organic matters or solids from the raw wastewater. Typical
performance for the removal of those pollutants is mainly due to the separation solid particles
with a density higher than surrounding water by gravitational settling (Von Sperling and de
Lemos Chernicharo, 2005). Basically, Seabloom et al. (2004) stated that four types of
settling phenomena occurred in the septic tank have been defined: (1)Discrete particle
(removes heavier discrete particles), (2)Flocculant (lighter particles flocculate into heavier
particles), (3)Hindered (biological floc develops), and (4)Compression (occurs in the bottom
sludge layer) (Figure 2.4).

t =0 t =1 t =2 t =0 t =1 t =2

(1)Discrete particle (3)Hindered

t =0 t =1 t =2 t =0 t =1 t =2

(2)Flocculant (4)Compression

Figure 2.4 Settling phenomena in the septic tank

(Modified from Von Sperling and de Lemos Chernicharo (2005) and Seabloom et al.
(2004))

12
From the laws of settling phenomena by Newton and Stokes, a discrete particle settling in a
fluid will accelerate to a terminal vertical velocity at the time of the frictional drag (a function
of the particle velocity, fluid density, fluid viscosity, particle diameter and drag coefficient),
equals the gravitational force (the density of the particle and the fluid, the acceleration of
gravity and the volume of the particle) (Metcalf and Eddy, 2003). Based on the stokes law,
the discrete settling velocity of a practice (vs) could express by:

1 g  s  1 2
vs  x x xd (2.10)
18  1
Where: vs is settling velocity of a practice (m/s), g is acceleration due to gravity (m/s2), v is
kinematic viscosity of the liquid (m2/s), ps is particle density (kg/m3), pl is liquid density
(kg/m3) and d is particle diameter.

The discrete settling velocity of a practice must be equal or greater than the velocity of a
particle that falls through high of reactor in time t. The discrete settling velocity of a practice
are influenced by the factor of temperatures and wastewater characteristics. The value of
kinematic viscosity and liquid density are changed with the temperature as shown in Table
2.6.

Table 2.6 Kinematic Viscosity of the Liquid at Different Temperatures

Temperature (oC) Kinematic viscosity (m2/s)

0 1.79x10-6
10 1.31x10-6
20 1.01x10-6
30 0.80x10-6
40 0.66x10-6
Source: Von Sperling and de Lemos Chernicharo (2005)

The empirical modeling to predict the removal efficiency of BOD5 and TSS in the primary
sedimentation basis with respect to HRTs and concentrations are presented (Metcalf and
Eddy, 2003; Crites and Tchobanoglous, 1998):
t (2.11)
R
a  bt
Where: R is percent removal efficiency, t is time or HRT and a,b is empirical constants (at
20 oC). Empirical constant values in Equation 2.11 are summarized as follows in the Table
2.7

Table 2.7 Empirical Constant Values

Parameter a b
BOD5 0.018 0.020
TSS 0.075 0.014

13
2.1.6 Biological treatment in the septic tank

The sedimentation reaction occurring in the septic tanks will cause most of organic particles
are removed to settle in the sludge layer and be degraded by several anaerobic microbes to
intermediate products and biogas. The biodegradability of the main organic compositions in
feces such as fiber, fat and protein are different and range from medium to hard. According
to Haug (1993) medium biodegradation is fiber with the chemical composition of C6H10O5,
while other hard biodegradations are fat and protein with the chemical composition of
C57H104O6 and C5H7NO2, respectively. To define the difficulty to digest in term of
degradable, the value of TCOD for those chemical compositions could be expressed as:

3C6H10O5 + 18O2  18CO2 + 15H2O (2.12)

C57H104O6 + 80O2  57CO2 + 52H2O (2.13)

C5H7NO2 + 5O2  5CO2 + 2H2O + NH3 (2.14)

It can be calculated from the above equations that 576 g oxygen required to degrade 486 g
of fiber or 1.185 g oxygen per g fiber, 1.42 g of oxygen per 1 g of protein and 2.90 g of
oxygen per 1 g of fat. The summarized values of chemical oxygen demand are shown in
Table 2.8.

Table 2.8 Chemical Oxygen Demand Conversion Factors

Compound Formula g oxygen /g organic g oxygen /g carbon

Glucose C6H12O6 1.07 2.67
Fiber C6H10O5 1.19 2.67
Fat C57H104O6 2.90 3.74
Protein C5H7NO2 1.42 2.67
Source: Haug (1993)

In the first stage of anaerobic digester (Figure 2.5), complex organic matters such as
carbohydrates, proteins and fats are hydrolyzed to soluble organic matters (Long-chain fatty
acids (LCFAs)) (Grady Jr et al., 2011). Feces compound is mainly a contained polymeric
substrates which is insoluble compounds consisting of many molecules of monomer joined
together by chemical bonding. The hydrolysis stage, comprised of chemical and biological
reactions, is the breaking of chemical compounds with water. This stage is considered to be
an importance stage in the anaerobic pathway (McInerney, 1988). The reaction rate of
hydrolysis could be assumed as the first-order reaction. The kinetic values of carbohydrates,
proteins and lipids of hydrolysis are summarized in Table 2.9.

In the second step of anaerobic degradation (Figure 2.5), hydrolysis products such as amino
acid sugar and long-chain fatty acids could be diffused inside the cell membrane of acid-
forming bacteria, and anaerobically oxidized to volatile fatty acids (VFAs), carbon dioxide
(CO2) and hydrogen (H2). The acidogenesis stage is energetically favorable for the
microorganisms which is rarely rate limiting.

14
Table 2.9 Kinetic Values of Hydrolysis

Substrate Kinetic value of hydrolysis (d-1) Reference

Carbohydrates 0.041-0.13 Gujer and Zehnder (1983)
0.21-1.94 O'Rourke et al. (1988)
0.025-0.2 Christ et al. (2000)
0.25 Batstone et al. (2002)
Proteins 0.02-0.03 Gujer and Zehnder (1983)
0.0096-0.1 O'Rourke et al. (1988)
0.015-0.075 Christ et al. (2000)
0.2 Batstone et al. (2002)
Lipids 0.08-0.4 Gujer and Zehnder (1983)
0.0096-0.17 O'Rourke et al. (1988)
0.005-0.01 Christ et al. (2000)

Organic compound
Carbohydrate/cellulose Proteins Fat

Amino acids/Sugar Long chain fatty acid

Acid forming
microorganism

Propionate Butyrate

Propionic acid and

butyric acid
Acetate
microorganism H2+CO2

Acetoclastic methane H2 utilizing methane

microorganism microorganism

CH4+CO2 CH4+CO2

Figure 2.5 Anaerobic pathways

(Modified from Lettinga (1995) and Zehnder (1988))

15
In methanogenic stage, most of intermediate products could be converted directly and
indirectly by methane-forming archaea to become methane and carbon dioxide, while some
other organic compounds which are not degraded still remain in supernatant of the anaerobic
digesters (Figure 2.5). The methane gas is produced from VFAs, hydrogen and carbon
dioxide. This stage is the rate limiting step and very sensitive with environmental factors
such as pH and temperature. The bio-chemical reactions in the anaerobic degradation
pathway are shown in Table 2.10. The variation of standard free energy is summarized in
the last column of the Table 2.10. Under assumed standard condition (pH equal to 7 and
pressure 1 atm), the standard free energy of propionate and butyric (reactions in the stage of
the acetogenic organism) are not converted to acetate (∆Go > 0) (Von Sperling and de Lemos
Chernicharo, 2005).

Table 2.10 Anaerobic Degradation of Glucose

Stoichiometry for anaerobic degradation of glucose ∆Go (kJ/mole)

A) Energy producing reactions of acid forming organism
C6H12O6  2CH3CH2COOH (propionic) + 2H2O -192
C6H12O6  CH3CH2 CH2COOH (butyric) + 2CO2 + 2H2 -264
C6H12O6  2CH3COOH (acetic) + 2CO2 + 4H2 -216
B) Energy producing reactions of the acetogenic organism
CH3CH2COOH + 2H2O  CH3COOH + CO2 + 3H2 +76
CH3CH2 CH2COOH + 2H2O  2CH3COOH + 2H2 +48
C) Energy producing reactions of the methanogenic archaea
CH3COOH  CH4 + CO2 -31
CO2 + 4H2  CH4 + 2H2O -131
Source: Klass (1998)

Bio-chemical reactions in anaerobic system, the reaction rate in each step depends on
microbial activities. Thus, the model which are used to investigate and predict the
performance of anaerobic digester could be applied as following equations (Siegrist et al.
1993; Batstone et al. 2002; Metcalf and Eddy, 2003):

QSin QS out

S utilization V

Figure 2.6 Substrate balance in the septic tank

Substrate in = Substrate out + Substrate utilization

 dS 
Q S 0  Q S t    t V (2.15)
 dt 
 d S  dX
Y t   (2.16)
 dt  dt

16
  dX 
   r x  rd (2.17)
 dt net

r x  uX (2.18)

rd  k d X (2.19)

Where: rx is growth rates (mg/L.d), rd is decay rates (mg/L.d),  is the specific growth rate
(d-1), kd is kinetic constants of decay rate (d-1), X is concentrations of viable microorganism
(concentration of VS) (mg/L).  has most frequently been expressed by the empirical of
Monod:
S
  μmax, (2.20)
ks  S

Where: ks is saturation constant (mg/L), μmax, is the maximum specific growth rate (d-1).
dX  u m  SX (2.21)
   kd X
dt  Y  K s  S

Where, Y is the growth yield (mg viable microorganism/mg substrate)

Many pure and mixed culture studies have been conducted to determine values for u max, ks,
Y and kd for the microorganism that present in the anaerobic treatment system (Pavlostathis
et al., 1991; Stumm and Morgan, 2012; Siegrist et al., 1993). The kinetic values in each
reaction has been reported by several researcher as summarized in Table 2.11.

The inhibition effects on microorganism’s growth could be modified (Smith et al., 1988) as
shown in Equation 2.22.

μ max,
  μ max, (2.22)
ks S
1 
S KI

Where: KI is the inhibition constant. The inhibition values is shown in Table 2.12.

The effect of the temperature on the kinetic values such as growth rate, Monod and also
inhibition constants could be assumed as Equation 2.23.

F ( T )  e ( T T 0 )
(2.23)

Where: θ is temperature coefficient which is varies in the range of 0.05-0.10.

17
Table 2.11 Kinetic Values in Each Reaction Step of Anaerobic Pathways

Reaction step u max (d-1) ks (mg COD/L) Y (mg of VS/mg of kd (d-1)

COD)
Acid-former fermentation 7.3-30 22-530 0.14-0.17 -
Amino acid fermentation 4.0 50 - 0.8
Sugar fermentation 4.0 50 - 0.8
Acidtogenic oxidation of propionic acid 0.13-1.2 17-500 0.025-0.051 -
Acidtogenic oxidation of butyric acid 0.35-0.86 12-300 0.03-0.47 -
Anaerobic oxidation of LCFA 0.6 1,000 0.06 -
Anaerobic oxidation propionic 0.6 200 0.006 -
Acetoclastic methanogen 0.08-1.4 15-420 0.01-0.54 -
Acetoclastic methanogen 0.37 40 - 0.05
Methanogenesis (hydrogen and carbon dioxide) 0.05-4.07 0.00005-0.145 0.017-0.045 -
Methanogenesis (hydrogen and carbon dioxide) 2.0 1 - 0.3
Sources: Pavlostathis et al. (1991), Stumm and Morgan (2012) and Siegrist et al. (1993)

Table 2.12 Inhibition Values of Acetoclastic, Propionic and Butyric

Inhibition coefficient Value Unit

Acetoclastic 1,000 mg/L
Propionic 500 mg/L
Butyric 1,000 mg/L
Source: Siegrist et al. (2002)

18
2.2 Model Development

Due to complex anaerobic degradation partway involving actions of several microbes, a

mathematical model investigating the processes is required to simulate with the optimum
design, operating strategies. Several approaches from previous researchers have been
conducted over the last decade simulating mechanistic mathematical modelling which used
to help understanding of the anaerobic treatment system as shown in Table 2.13.

The first dynamic model was developed by Greaf and Andrews (1974). Call as “Andrews’s
model”, it was simulated under the condition of single substrate (acetic acid) and
microorganism (acetate utilizing methanogens). In this model, constant pH was assumed and
the single microorganism was comprised of dynamic mass balances for the effluent
concentrations of acetic acid and also biosolid. In 1977, Hill and Barth developed based on
Andrews’s model by adding the second microorganism for acid formation and incorporated
hydrolysis. This model considers three substrates and two kinds of microorganisms (acid
formers and methanogens). The model includes the inhibitory effect of high concentration
of volatile acids on both acid formers and methanogens.

In 1983-1985, Mosey et al. (1983) was the first one that incorporated the dissolved hydrogen
gas. This model was simulated with four microorganism groups and included the hydrogen
gas in the digestion stage. Bryers (1985) developed the model that consider the role of
propionic acid utilizing bacteria by individually specifying the microorganism
concentration, as the acid is an important intermediate and has a significant effect on the
stability of anaerobic system. Angelidaki et al. (1993) developed a model with the various
substrate composition.

The model was defined by its organic (carbohydrates, lipids, and proteins), inorganic
components (ammonium, phosphate, cations, and anions), and their degradation
intermediates (volatile fatty acids). Siegrist et al. (1993) developed a model for mesophilic
and thermophilic digestion of sewage sludge and used the first-order equations for hydrolysis
kinetics of particulate organic material and the biomass decay process. Batstone et al. (2002)
introduced the Anaerobic Digestion Model Number 1 (ADM1). The aim of the model was
to provide a tool that overcomes the limitation of the models developed over the last few
decades. This model therefore can be taken as a platform for applications to specific
processes of anaerobic treatment system.

19
Table 2.13 List of Anaerobic Digestion Models
Researcher Scope Kinetic model Detail
Graef and Andrews Methanogenesis Andrews  Acetoclastic methanogens (unionized VFA as acetate)
(1974)
Hill and Barth (1977) 1.) Hydrolysis Monod  Acidogenic bacteria (glucose)
2.) Acidogenesis  Hydrogenogenic bacteria (total propionate and butyrate homoacetogenic bacteria
3.) Acetogenesis (H2 and CO2)
4.) Homoacetogenesis  H2 methanogenic bacteria (H2 and CO2)
5.) Methanogenesis  Methanogenesis acetate methanogenic (acetate)
Smith et al. (1988) 1.) Hydrolysis 1.) First order  Acidogenic bacteria (soluble organic matter)
2.) Acidogenesis 2.) Andrews  Methanogenic bacteria (unionised VFAs)
3.) Methanogenesis
Mosey et al. (1983) 1.) Acidogenesis Monod  Acid-forming bacteria (glucose)
2.) Methanogenesis  Acid-forming bacteria (propionate)
 Acid-forming bacteria (butyrate)
 Acetoclastic methane bacteria (acetate)
 Hydrogen-utilising methane bacteria (H2 and CO2)
Bryers (1985) 1.) Hydrolysis 1.) First order  Acid forming bacteria (insoluble organic matter)
2.) Acidogenesis 2.) Monod  Propionic acid utilising bacteria
3.) Acetogenesis (total propionic acid)
4.) Methanogenesis  Methanogenic bacteria (total acetic acid, hydrogen)
Angelidaki et al. (1999) 1.) Hydrolysis 1.) First order  The substrate composition was defined by organic (carbohydrates, lipids, and
2.) Acidogenesis 2.) Monod proteins), inorganic components (ammonium, phosphate, cations, and anions)
3.) Acetogenesis
4.) Methanogenesis
Siegrist et al. (1993) 1.) Hydrolysis 1.) First order  Developed the modelling for mesophilic and thermophilic digestion of sewage
2.) Acidogenesis 2.) Monod sludge
3.) Acetogenesis
4.) Methanogenesis
Batstone et al. (2002) 1.) Hydrolysis 1.) First order  Anaerobic digestion model number 1 (ADM1)
2.) Acidogenesis 2.) Monod
3.) Acetogenesis
4.) Methanogenesis

20
2.3 Effects of Temperature Variation in Septic Tanks on the Efficiency of Organic
Reduction and Biogas Production

Generally, a variety of temperatures affects microbial activities to digest organic matters and
producing biogas in the septic tank. The preliminary results of Koottatep et al. (2013) found
the percent removal of TCOD and BOD5 of the laboratory-scale septic tanks at various
temperatures from 32-60 oC to be in the similar ranges of 84-94% and 76-94%, respectively.
Biogas production in the septic tanks operating at temperatures of 32, 40, 50 and 60 oC were
found to be significantly different, and the septic tank operating at 40 C gave the highest
biogas volume and methane content as shown in Table 2.14.

Table 2.14 Biogas Production of Laboratory-Scale Septic Tanks at Various

Temperatures
Temp C Biogas
Biogas volume (mL) % CH4 content
32 870 40.5+7.4
40 1,394 45.9+14
50 781 38.8+9.9
60 809 33.8 +15.7

There were less biogas production at the temperatures of 50 and 60 C probably because the
methanogenic microorganisms originally present in the septage could not survive at these
high temperatures or due to the absence of thermophilic methanogenic bacteria in the
septage. A parallel study of Syne (2013) using the polymerase chain reaction technique
found the DNA concentrations of methanogen microorganisms operating at 40C to be
higher than those operating at 32, 50 and 60 C. The FISH analysis also showed the high
number of cells hybridized with EUB338 and Arc 915 at the temperature of 40 oC, whereas
the number of these cells were much lower at the 50 and 60 ˚C (Figure 2.7).

According to Birgitte et al. (2001), less number of microbial groups could grow at higher
temperatures because the optimum temperatures for most of archaea and bacteria are within
the range of mesophilic temperatures. In principle, higher temperatures should promote
higher bacterial activities and consequently higher biogas production, but lack of additional
seeding of thermophilic bacteria or insufficient acclimatization time to support the growth
of thermophilic methanogenic bacteria, could be a reason for the low biogas production in
the laboratory-scale septic tanks operating at the high temperatures.

21
 1 2

a) Hybridized cells with EUB 338: (1) DAPI and (2) CY3

1 2

b) Hybridized cells with ARC915: (1) DAPI and (2) CY3

Figure 2.7 FISH analysis of laboratory-scale septic tank at 40 ˚C

2.4 Solar Water Heating Device and Application for Septic Tank

Solar septic tanks or septic tanks operating at temperatures more than 30 oC has many
advantages such as higher metabolic rates and a higher pathogen inactivation (Koottatep et
al., 2013). To increase temperature inside septic tank, external source of heating is required.
There are several sources of energy such as fossil fuel or biogas, it seem to be low energy
efficiency. Another renewable energy such as solar thermal energy could be integrated in
the process with high energy efficiency. The combination of solar thermal energy with the
septic tank could be potentially to increase temperature in the system.

2.4.1 Solar water heating device

Solar water heating devices (Figure 2.8) are commonly applied to produce hot water for
bathing and washing for people who living in household or apartment. The principle of the
solar water heating device is to increase water temperature by solar energy. To apply the
22
solar water heating device with septic tank, hot water from the solar heating device are
recirculating by a pump thought a heat exchanger in the solar septic tank. The application of
solar water heating devices is found mostly in anaerobic digester as summarized in Table
2.15.

The amount of heat delivered by a solar water heating system depends primarily on the
amount of heat delivered by the sun at a particular place (the insolation). In tropical places
the insolation can be relatively high 7 kWh/m2.d (1 W/m2 = 0.024 kWh/m2.d), whereas the
insolation can be much lower in temperate areas where the days are shorter in winter 3.2
kWh/m2.d (NREL, 2014).

Figure 2.8 Solar water heating device

(Ravotek, 2015)

23
Table 2.15 Applications of Solar Water Heating Device

Reactor Detail Reference

Anaerobic digester with a size of 45 m3 - Operating at a temperature of 35 oC Axaopoulos et al. (2001)
- Four flat plate solar collector with an area of 8 m2
- Solar collectors were insulated 50 mm
- Absorber constructed by mild steel 0.9 mm.

Continuous flow stirred-tank reactor (CSTR) - Operating at temperatures of 50-60 oC El-Mashad et al. (2003)
with a size of 8 L - Flat plate solar collector with an area of 2 m2

Anaerobic digester with a size of 10 m3 (non- - Operating at a temperature of 52 oC. El-Mashad et al. (2006)
mixed) - Heat transfer coefficient between the heat exchanger and the
inoculum is 100 W/m2.K

Bioreactor with a size of 53 L - Operating at a temperature of 40 oC Alkhamis et al. (2000)

- Absorber was insulated with a glass wool layer of 4 cm thickness
at the bottom

24
2.4.2 Energy requirement

To incooperate solar water heating device with the septic tank, the energy requirement is
very important factor to design the system. The heat (Q) depends upon the factor of the
change in temperature (ΔT), amount of water (m), and initial temperature, external pressure,
and other state function. For preliminary calculating the heat requirement, Equations 2.24 is
used (assuming the condition of the initial temperature is 30 oC with the heat up time is about
1 h). The summary of energy requirement for thermal septic tank at different capacities is
shown in Table 2.16.

Q= m Cp (ΔT) (2.24)

Where: Q is heat (change in enthalpy) (kJ), m is mass density of water (kg), Cp is heat
capacity of water (4.187 kJ/kg.oC) and ΔT is change in temperature (expected temperature –
initial temperature).

Table 2.16 Summary of Energy Requirement for Septic Tank

Septic tank capacity (L) Temperature (oC)* Energy requirement

(kWh)**
600 40 7.0
50 13.9
60 20.9
800 40 9.3
50 18.6
60 27.9
1,000 40 11.6
50 23.2
60 34.8
*Calculated from the initial temperature of 30 oC
** Heat up time is 1 h, calculated from Equation 2.24

25
 Chapter 3

Theoretical Consideration

3.1 Hydraulic Characteristic

One of the main factors affecting on performance of septic tanks is the hydraulic
characteristic and the flow pattern, which depends on configuration or shape of the septic
tank. Bounds (1997) proposed that septic tanks should be constructed with length to height
(L:H) ratios of 1:1-3:1 (commonly design in a ratio of 1.5:1) and height to width (H:W) ratio
of 1:1 (Figure 3.1). For pipe design to minimize short circuit effects, inlet and out let should
be longer than the height or width.

Figure 3.1 Configuration design of septic tanks

Tracer experiments and normalized resident time distribution (RTD) (Metcalf and Eddy,
2003) are used to define hydraulic conditions in a septic tank, such as dispersion numbers.
The RTD curve is plotted from the results of tracer experiment between t/T and Ct/C0 and
the mean resident time ( t ) is determined by:

it i C i  t i V
t  (3.1)
iC i  t i v

D
  2 
2
(3.2)
 uL 

The dispersion number is calculated from the mean resident time ( t ) and variance of curve
(σ2). The dispersion number of 0 is defined as plug flow or no dispersion, while the value of
infinity is defined as completely mixed. Koottatep et al. (2014) conducted the tracer study
in septic tanks at HRTs of 12, 24, 48 120 and 360 h and concluded the d values in the range
of 0.11-0.22 as shown in Figure 3.2 and Table 3.1. The mean HRTs or actual HRTs were
found lower than designed HRTs of 1 2 , 2 4 and 4 8 h, and suggesting the prevalence of

26
complete-mix conditions. Thus, it could be summarized from these tracer data that the
hydraulic conditions occurring in the septic tanks operating at the HRTs values of 12 -48 h
are complete-mix.

Figure 3.2 RTD curve of septic tanks

(Modified from Koottatep et al., 2014)

Table 3.1 Hydraulic Characteristic in Septic Tanks

Operating condition of septic tank Dispersion number

HRT 12 h 0.17
HRT 24 h 0.21
HRT 48 h 0.22
HRT 120 h 0.11
HRT 360 h 0.14
Source: Koottatep et al. (2014)

Thus, it was summarized that the hydraulic characteristic in septic tanks is dispersion flow
approaching completely-mix condition. Accordingly, to develop kinetic models for design
and operation septic tanks, a completely-mix equation could be applied (Figure 3.3),
according to Equation 3.3-3.6.

QC0 QCt

kCt

Figure 3.3 Substrate balance of completely-mix equation in septic tank

27
 Substrate in = Substrate out + Substrate utilization (3.3)

QC0 = QCt + kCV (3.4)

QC0 = QCt + kCQt (3.5)

C 1

C0 1  kT t (3.6)

Where: V is volume of the tank (L).

3.2 Dynamic Modelling

The evolution of dynamic modelling of anaerobic treatment system has followed the
development of understanding of the microbe interactions with in the process over operation
times. STELLA software is used to translate mathematical equations (section 2.1.6) to model
structures and it is a graphical programming developed language by High performances
System, Inc (2000).

STELLA could be applied in many field of research such as business, engineering and
economical (Duplisea, 1998; Deaton, 2000; Mesplé et al., 1996). The methodological
approach for dynamic model development by STELLA program are involved 4 main steps.

1.) Feedback loop

The feedback loop is a closed‐loop circle of cause and effect in which ‘conditions’ in one of
part of the system cause ‘results’ elsewhere in the system, which in turn act on the original
‘conditions’ to change them. Figure 3.4 shown the example of a feedback loop diagram of
microorganism with growth rate and decay rate.

Growth rate Microorganisms Decay rate

Figure 3.4 Feedback loops of microorganisms

2.) Equation translation

The feedback loop diagram could be converted to model structures and showed the
interactions between the principle elements in form of basic entity diagrams. Four types of
structure variables are shown in Table 3.2.

28
 Table 3.2 Basic Entities for Equation Translation

Basic entities Picture Description

Stock Main element of the model

Flow Decreasing and increasing process

operation

Convertor Factors for process operation

Connector Interlink among the factors

3.) Model simulation

Model simulation is the process of converting the conceptual model into quantitative
representation. Series of equations are translated to dynamic modelling structure (Figure
3.5).

Microorganism (t) = Microorganism (t-DT)+(birth rate x birth – Dies x decay rate) x DT (3.7)

Figure 3.5 Equation translation and model simulation

4.) Validation and sensitivity analysis

The applicability of the dynamic model was validated actual septic tank data to determine
the accuracy of the model's simulation. There are many statistical methods that can be used
to validate of the model such as correlation coefficient, standard error of the estimate and t-
test. Sensitivity analysis is a procedure which is normally performed on the completion at
the last stage.

29
3.3 Septic Tank Mechanisms and Development of a Series of the Models

The septic tank takes up the load of the black water and it allows solids to settle in the tank.
The major mechanism occurring in the septic tank is simply sedimentation where heavily
settleable solids are accumulated in the tank bottom and partially clarified liquid is leaching
into nearby environments such as soil, ground water and canal. Septic tanks normally
operating in the low oxygen environment which have multi steps involving several anaerobic
microbes to digest organic matters to methane and carbon dioxide (Figure 3.6). The major
mechanisms responsible for TCOD and BOD5 removal in septic tanks are sedimentation of
settable solids and anaerobic digestion of organic matters in the settled sludge and in
supernatants. The clarify liquid stays in the tank for an average time (the designed HRT) of
more than 12 h. Based on the results obtained from the tracer experiment, the hydraulic
characteristics have similar trend approaching complete-mix conditions, it is probably due
to some of dissolved organic still contained in the clear liquid portion diffuse and randomly
move around in the liquid zone. Thus, in this study would propose to use a completely-mix
equation to develop the model for the organic removal the liquid portion. Due to instabilities
of organic loading rates (OLRs) and HRTs, septic tank effluents still contain high
concentration of organic matters and other pollutants. After operation for a certain period,
there will be high accumulation of septic tank sludge which requires frequent desludging.
The settled solids remaining and accumulating in the sludge layer for a long period of time,
which the Monod equation could be applied to predict the anaerobic microorganism
activities to be effective in digesting the settled organic in bottom sludge. Thus, the septic
tank system is considered to be the complex processes comprising of physical and biological
reactions. Understanding, these processes is essential in developing proper design and
operation criteria for proper functioning of septic tanks treating sewage or black water.

Figure 3.6 Septic tank mechanisms

30
 Chapter 4

Material and Methods

4.1 Research Plan

The experiments study of four laboratory-scale septic tanks was prepared to investigate
septic tanks performance and developing the integrated kinetic model. To evaluate technical
feasibilities of increasing temperatures inside a septic tank, a pilot-scale solar septic tank and
equipped with a locally made solar collector was operated for a 4-month period. All
experiments studies were set up at the Environmental Engineering Research Station and the
Ambient Laboratory of the Asian Institute of Technology, Thailand. Research plan is shown
in Figure 4.1.

Literature review and research planning

Experimental set up Mathematical modelling

Pilot-scale solar septic tank Laboratory-scale septic tanks

Development of a solar Microbial identification Development of kinetic Investigaion septic tank

water heating device values performance

Liquid Sludge

Evaluation of the technical feasibilities Development of an integrated kinetic model and validation

Optimization of solar-septic tank prototype

Figure 4.1 Research plan

31
 4.2 Laboratory-Scale Septic Tanks

Four laboratory-scale septic tanks, each with a volume of 40 L and a dimension of 64x25x40
cm (LxWxH) were constructed at the Asian Institute of technology (AIT) campus,
Pathumthani, Thailand. The temperature in three laboratory-scale septic tanks was controlled
at 40 oC using heated water circulating around the reactors (Figures 4.2 and 4.4), while a
laboratory-scale septic tank was maintained at the ambient temperature of 30 oC (used as a
control reactor).

2 Fig. 1 Figure 4.2 Laboratory-scale septic tanks maintained at 40 oC

On-line temperature sensors (Thermocouple type K (CA) (series SK PCR-1)) were used to
monitor temperatures inside those laboratory-scale septic tanks (more details are explained
in section 4.3) and biogas samples was collected by using air-bag.

4.3 On-Line Temperature Sensors Inside the Laboratory-Scale Septic Tank Operating
at 40 oC

Inside the 40 oC laboratory-scale septic tank was equipped with the 18 on-line temperature
sensors. To monitor temperatures in the liquid portion, 9 sensors (L1-L9) were installed with
the depth of 10 cm from the top, and 9 sensors (S1-S9) were installed with the depth of 20
cm from the top to measure temperatures in sludge layer. The positions of the 18 on-line
temperature sensors inside the 40 oC laboratory-scale septic tank are shown in Figure 4.3(b).

(a) (b)

Figure 4.3 18 Positions of on-line temperature sensors inside laboratory-scale

septic tank: (a) laboratory-scale septic tank and (b) top view

32
 2 cm

5 cm

3 cm
40 cm
3 cm

18 cm 25cm
16 cm

2/3 1/3

64 cm

(a) Side View

25 cm

6 cm 6 cm 6 cm
1.5 2 cm 2 cm
cm

(b) Front view

5 cm 20 cm 10 cm
10 cm
25 cm

64 cm

(c) Top view

Figure 4.4 Laboratory-scale septic tanks design:

(a) Side view, (b) Front view and (c) Top view

33
4.4 Experimental Operation

To start up the experiment, septage collected from a household community was mixed in a
ratio of 50:50 with anaerobic inoculums collected from a septage treatment plant and added
into the laboratory-scale septic tanks, and nitrogen gas was fed to purge out the oxygen gas.
All laboratory-scale septic tanks were allowed to acclimatize until steady-stage condition,
based on stable biogas production rate of about 2 weeks, was reached.

During experimental period, laboratory-scale septic tanks were operated at the hydraulic
retention times (HRTs) of 12, 24 and 48 h for around 6 month (only operation periods after
acclimatization stage) by continuous feeding with a septage collected from household
communities in central Thailand. To maintain the TCOD, TS and TVS loading rates, the
septage (or the synthetic black water) was diluted with tap water to control the concentrations
of TCOD, TS and TVS within the ranges of 1,100-3,500, 900-2,500 and 600-1,700 mg/L,
respectively (Figure 4.5).

4.5 Septage Characteristics

The average concentrations of TCOD, BOD5, TS, TVS and TKN of the septage fed to the 4
laboratory-scale septic tanks were found to be 17,660+1,080, 3,390+2,270, 9,980+260,
7,570+2,340 and 480+30 mg/L, respectively. Although, the average age of these septage
was about 1 year, resulting in the BOD5/COD ratio of about 0.19. These characteristics were
in the same ranges as those reported (Koottatep et al., 2004) in the literatures which had high
concentrations of organics and solid contents. However, the BOD5:TKN ratio was about 8,
much lower than the optimum ratio for anaerobic digestion (Metcalf and Eddy, 2003;
Polprasert, 2007).

4.6 Pilot-Scale Solar Septic Tank

An actual septic tank equipped with a solar water heating device was constructed at the
Ambient Laboratory of the Asian Institute of technology, Thailand. To investigate in the real
condition, pilot-scale solar septic tank was fed with black water (from the mobile toilet). A
solar water heating device had 3 main parts: (1) solar collector, (2) hot water storage tank
and (3) control panel as shown in Figure 4.6. The solar collector was made with a locally
material of a polycarbonate sheet, which had a dimension of 120x70 cm (LxW), and covered
with a transparent glass to protect heat loss and wind effects. The solar collector was face in
south with angle of 15o. A hot water storage tank was made of stainless steel and had a
capacity of 20 L. To control temperatures inside hot water storage tank, a control panel which
consisted of an automatic value (it will allow to open when water temperatures inside the
storage tank reach to the setting point of the temperature).

To increase temperatures of the septic tank content, hot water from the solar water heating
device was circulating by a pump (3 L/min) through a heat transfer equipment (size of 0.2
m2) inside septic tank (600 L). To minimize heat loss, each part of the solar water heating
device and septic tank content was insulated with elastomeric materials.

34
Figure 4.5 Operating conditions

35
 7
9
2 Tap water

1
5

8 8

Figure 4.6 Experimental set up of a pilot-scale solar septic tank at Asian Institute of
Technology, Thailand: (1) solar collector, (2) hot water storage tank (tap water), (3) actual-
scale septic tank, (4) heat transfer equipment, (5) control panel, (6) pump, (7) temperature
sensor, (8) automatic value and (9) electricity heater

36
To evaluate the technical feasibility to heat up septic tank content, on-line temperature
sensors were installed in 2 main positions: (1) hot water generating from a solar water
heating device and (2) inside septic tank. The data of ambient temperatures and solar
radiations (150 inclined plane) was provided meteorological station of Department of Energy
Engineering, Asian Institute of Technology, Thailand.

4.7 Model Development and Data Analysis

Dynamic modelling was simulated by using STELLA (version 10) software and SPSS
statistic (version 20) software was used to analyze the experimental data. To collect organize
the data form temperature sensors of a pilot-scale solar septic tank, PROTAKAL (version
1.06) software was applied.

4.8 Actual-Scale Septic Tanks

To validate the results from model development, two actual-scale septic tanks (sizes of
1,000-1,200 L) in central Thailand (in areas of Pathumthani and Nonthaburi) were used to
monitor their performance. There were 3-5 users per household and these two houses used
flush toilets which generated black water about 20-30 L/ person.d.

4.9 Sampling and Analytical Methods

After acclimatization, the influent and effluent samples were collected weekly for analysis
of pH, TCOD, SCOD, BOD5, TS, TVS and TKN. In this study, method for collecting water
sample for laboratory analysis was the grab sampling technique. Biogas samples were
collected and analyzed for the volume and percent content of methane gas. The accumulated
sludge in the septic tanks was determined monthly by thoroughly mixing the septic tank
contents with N2 gas and collecting the mixed liquor samples for analysis of TS and TVS
concentrations. These samples will analyze according to the methods described in “Standard
Methods for the Examination of Water and Wastewater” (APHA, AWWA and WEF, 2005).
The major microbial species of the mixed liquor samples were determined by the polymerase
chain reaction - denaturing gradient gel electrophoresis (PCR-DGGE) technique ( Metcalf
and Eddy, 2003).

37
Table 4.1 Parameters and Methods

Parameters Methods of analysis

pH pH meter (Melttler-Toledo AG 8603, Switzerland)
TCOD Closed dichromate reflux
SCOD*
BOD5 Azide modification
TKN Kjeldahl digestion
TS Evaporation at 105 C
TVS Evaporation and burning at 550 C
Biogas composition Gas chromatograph (Agilent 7890) equipped with FID detector
* 0.45 m membrane-filter

4.10 Molecular Analysis

4.10.1 DNA extraction

DNA extraction of the microbial cells was based on the method of Zhou et al. (1996) using
sodium dodecyl sulfate (SDS) with some modifications. For each of the septage samples, 3
mL were centrifuged at 12,000 rpm for 5 min, followed by decantation of the supernatant
and washing of the settled sludge with 1 mL of phosphate-buffered saline 3 times. The sludge
pellet was lysed by adding 0.3 g sterile glass beads, 700 L of pH-8 DNA extraction buffer
(100 mM Tris-HCl, 100 mM sodium EDTA, 100 mM sodium phosphate, 1.5 M NaCl and
1% cyltrimethylammonium bromide (CTAB)), and 50 µL of lysozyme (10 mg/mL) in a 2
mL microcentrifuge tube with horizontal shaking at 200 rpm for 30 min at 37 ºC. After that,
100 L of 20% SDS was added and the lysed sample was incubated at 70 ºC for 30 min with
gentle mixing every 10 min and then centrifuged at 12,000 rpm for 10 min at room
temperature. The collected supernatant was further mixed with an equal volume of
chloroform-isoamyl alcohol (24:1). The aqueous phase of the mixture was recovered by
centrifugation and precipitated with 0.6 mL of isopropanol at room temperature for 4 h. The
pellet of genomic DNA was obtained by centrifugation at 14,000 rpm for 10 min at 4 ºC,
washed with 70% ethanol, and resuspended in sterile deionized water. Finally, the genomic
DNA was further purified by using a Gel/PCR DNA fragments extraction kit (Geneaid,
Taipei, Taiwan).

4.10.2 PCR amplification

Partial 16S rRNA genes of the archaea were amplified from the purified DNA by PCR using
the primer set: Parch519f primer (5’-CAGCCGCCGCGGTAA-3’) and ARC915r-GC
primer, which was attached to a GC clamp at the 5’ terminus (5’-
CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCGTGCTCCCCCGCC
AATTCCT-3’) (Coolen et al., 2004). The PCR amplification was performed in a total
volume of 50 L which contained 50 ng of DNA template, 10 mM of each primer, 0.2 mM
dNTPs, 3 mM MgCl2, and 1U Taq DNA polymerase (Qiagen, Germany). The conditions
used for the PCR amplification were: heating at 95 C for 5 min followed by 30 cycles of
denaturation at 95 C for 30 sec, annealing at 60 C for 10 sec, and a final extension at 72
C for 7 min. The size and amount of PCR products were visualized and estimated on a 1.5%
agarose gel electrophoresis and ethidium bromide staining.
38
4.10.3 DGGE analysis

The profiles of amplified 16S rDNA fragments were analyzed by the DGGE-2000 system
apparatus (CBS Scientific Company, Del Mar, CA, USA). Samples containing equal
amounts of PCR products (about 2,000 ng) were loaded into 6% polyacrylamide gels in 1X
Tris-acetate-EDTA (TAE) with a denaturing gradient ranging from 40 to 60% denaturants
(100% denaturant contains 7 M urea and 40% formamide in 1X TAE) (Watanabe et al.,
2004). Electrophoresis was performed at 60 °C for 15 h at a constant voltage of 80 V.
Following electrophoresis, the gel was stained with SYBR Gold nucleic acid stain
(Invitrogen, USA) for 30 min. The images were visualized on a UV transilluminator and
captured using Biovision CN 1000/26M (Vilber Lourmat, France).

4.10.4 DNA-sequencing

The targeted DGGE bands were resuspended in 20 µL of MilliQ water, and stored at 4 ºC
overnight to elute the DNA fragments. The gel was then used as templates for
reamplification using primer set without GC-clamp. The amplified PCR products were
purified and sequenced by the First Base Laboratories, Malaysia. The obtained sequences
were determined with available databases by using the BLAST search programme of the
National Center for Biotechnology Information (NCBI) website (Maryland, USA). A
multiple sequence alignment of was generated using ClustalX (version 2.1) and a
phylogenetic tree was prepared by MEGA (version 5.03) (Keyser et al., 2006) The sequences
determined in this study have been deposited in GenBank under accession numbers
AB921775 - AB921784.

39
 Chapter 5

Results and Discussion

5.1 Design Consideration of Septic Tank for Treating Black Water

Septic tanks in most developing countries are designed to collect only black water from
toilet, while most of grey water (wastewaters from kitchens, washing and bathing, etc.) is
discharged untreated into nearby watercourses. Based on data from Pollution Control
Department (PCD, 2012) and Otaki et al. (2008), the rate of black water generation is found
in the range of 20 – 31 L/person.d, which is lower than the rate of sewage water generation
about 6-8 times (Table 5.1).

Table 5.1 Black Water Generation Rate in Thailand

Type of wastewater Generation rate (L/person.d)

Otaki et al. (2008) PCD (2012)
Black water 20 31
Grey water 100 184
Sewage water 120 215

In Thailand, the septic tank can call as “Commercial Treatment Package” (readymade septic
tank) and normally made of plastic in the balloon or circular shape (Figure 5.1). The size of
a septic tank can easily be calculated by the number of users or the average water flow. It is
normally considered that HRT should not be less than 1 d. Thus, the minimum sizing for
proper functioning of the septic tank for treating sewage or black water can be determined
based on Equations 5.1 and 5.2. The summary septic tank design for single houses in
Thailand is presented in Table 5.2.

Figure 5.1 1000 L-Septic tank (Balloon shape)

40
Table 5.2 Sizing and Dimension of Septic Tank in Thailand (Commercial Treatment
Package or Readymade Septic Tank)

Size (L) Number of users Diameter (m) Height (m)

Sewage water Black water
600 2 6 1.10 1.17
800 2-3 8 1.15 1.30
1,000 3 11 1.20 1.35
1,200 4 13 1.30 1.40
1,600 5 17 1.50 1.57
2,000 6 22 1.57 1.72
Sources: Tankcenter (2015), Perfecthomecenter (2015) and Light-and-Bath (2015)

Having made the separate calculation of the size of septic tank recommended for treating
sewage or black water. The basic formula (Equations 5.1 and 5.2) used to estimate the size
of septic tank, developed from this study, could be expressed as followed:

Equation for septic tank treating sewage water:

C = 336P-63 (5.1)

Equation for septic tank treating black water:

C = 88P+69 (5.2)

Where: C is capacity of septic tank (L) and P is number of person.

Up to present, there are several equations for calculating the sizing of septic tank. However,
for developing countries, most of the available equation are still inapplicable and the most
appropriate criteria for the effective capacity of a septic tank could simply calculate from the
number of users or the average flow (Table 5.3). Comparing between septic tank design for
treating sewage water and black water, based on the summary design approach (Table 5.3),
The constant values of those empirical models were varied. The constant values of the
empirical models for sewage water from BSI (1972), Pickford (1980) and this study were
found to be much higher than the constant values of the empirical model for treating black
water (Equation 5.2). To establish the platform for design criteria and operational condition
of septic tanks with proper functioning and investigating the septic tank mechanisms, all
experimental results from this study (sections 5.2-5.7) were used to develop a series of
models for this propose.

41
Table 5.3 Summary Design Approach of Septic Tank

Design factor Type of wastewater Approach/Equation Reference

Number of bathrooms, number Sewage water Summary table Kiker (1956), Wagner and
of users and the average daily Lanoix (1958)
flow
Number of users Sewage water C = 18 P+2000 BSI (1972)
Number of users and volume of Sewage water C = A+P (rq+ns)
sewage water
Volume of sludge and scum, Sewage water C =A+B Pickford (1980)
and liquid retention A = Pnfs
B = Prq
Number of users Sewage water C=336P-63 This study
Number of users Black water C=88P+69 This study

42
5.2 Variation of Operation Conditions

The experiments for laboratory-scale septic tanks were conducted for about 170 days and
the results obtained are described below.

5.2.1 Temperatures and pHs

Data of temperatures and pHs of the septic tank influent and effluent are shown in Figure
5.2.
60 60
8 8

6 6
30 30
pH

pH
oC

oC
4 4
pH INF pH EFF
2 2
T INF T EFF
0 0 0 0
0 50 100 0 50 100
Operation time, d Operation time, d

(a) HRT 12 h, Temperature 40 (b) HRT 24 h, Temperature 40

oC oC

60 60
8 8

6 6
30 30
pH

pH
oC

oC
4 4

2 2

0 0 0 0
0 50 100 0 50 100
Operation time, d Operation time, d

(c) HRT 24 h, Temperature 30 (d) HRT 48 h, Temperature 40

oC oC

Figure 5.2 Temperature and pHs of influent and effluent black water of
laboratory-scale septic tanks

Temperatures of the septic tank influent were fluctuated in the range of 21-30 oC, depending
on ambient temperatures, while those of 40 oC and 30 oC septic tanks effluent were 33-42
o
C and 23-37 oC, respectively (Figure 5.2 and Table 5.3). pH of the septic tank influent and
effluent were found to be similar, being about 7-8, appropriate for growth of anaerobic
microorganisms. Due to low concentrations of volatile fatty acids (VFAs) and high
concentrations of alkalinity contained in septic tank influent (Polprasert and Rajput, 1982),
the effects of VFAs accumulated and pH decrease during operation period of 170 days were
not apparent (Van Handel et al., 1994; Visser et al., 1993).

The measured temperatures (18 positions) inside the septic tank operating at 40 oC in the
liquid portion and sludge layer are shown in Figure 5.3. The average temperatures in liquid
(L1-L8) and sludge (S1-S8) were found to be about 36+0.9 and 42+1.0 oC, respectively. The

43
temperatures in the liquid portion and sludge layer were found to be different because heat
capacity values of sludge (1.7-5.4 J/g.oC) were higher than of liquid layer (1.0 J/g.oC)
(Koottatep et al, 2012).

30-35 35-40 40-45

45 Effluent
L7
40 L8
oC L4
L9
L5
35 L1 L6
L2
30 L3

Influent

Liquid layer

S7 Effluent
45 S1 S4 S8
S5 S9
40 S6
S2
oC

35
S3
30

Influent

Sludge layer

Figure 5.3 Average temperatures (18 positions) of laboratory-scale septic tank

operating at 40 oC

5.2.2 OLRs, SLRs and VSLRs

TCOD, TS and TVS concentrations in the black water were prepared in the ranges of 1,100-
3,300, 900-2,500 and 600-1,700 mg/L, respectively. The average values of OLR, SLR and
VSLR during the operation period were found to be in the ranges of 1.7-2.2, 1.2-2.0 and 0.9-
1.2 kg/m3.d (Figure 5.4 and Table 5.5), respectively. The values of OLR, SLR and VSLR
were found to occasionally fluctuate because of variation in concentrations of the saptage.
Generally, due to varying of feces quantity and volumes of flushing water, OLRs of the black
water were found to fluctuate in the range of 0.5-1.3 kg/m3.d (Koottatep et al, 2012). Metcalf
and Eddy (2003) and Polprasert (2007) reported that the optimum values of VSLR for
anaerobic digesters, to start up and operate, should be about 1.0-2.0 kg/m3.d.

44
Table 5.4 Temperatures and pHs of Influent and Effluent Black Water of Laboratory-Scale Septic Tanks

pH Temperature
Laboratory-scale septic tank
Influent Effluent Influent Effluent
HRT T Flow Range Average Range Average Range Average Range Average
o o
h C L/d - C
12 40 80 6.8-8.6 7.5+0.4 6.9-8.4 7.5+0.3 21-30 26+2 33-40 37+2
24 40 40 6.9-8.1 7.5+0.3 33-42 37+2
7.0-8.3 7.5+0.3 21-30 26+2
24 30 40 6.8-8.1 7.4+0.3 23-37 30+4
48 40 20 7.0-8.3 7.5+0.3 6.8-8.1 7.4+0.3 22-30 26+2 33-41 38+3

Table 5.5 OLRs, SLRs and VSLRs of Laboratory-Scale Septic Tanks

Laboratory-scale septic tank OLR SLR VSLR
HRT Temperature Flow Range Average Range Average Range Average
o 3 3 3
h C L/d kg/m .d kg/m .d kg/m .d
12 40 80 0.3-5.1 2.2+1.0 0.7-4.1 2.0+1.0 0.2-2.5 1.2+0.6
24 40, 30 40 0.6-3.2 1.7+0.6 0.3-3.9 1.7+0.8 0.3-3.8 1.4+0.7
48 40 20 0.7-3.2 1.7+0.1 0.4-2.7 1.2+0.6 0.2-1.9 0.9+0.4

45
 10 100

8 80

6 60

L/d
OLR, kg/m3.d

4 40

2 20

0 0
0 50 100 150
Operation time, d

OLR HRT12 T40 OLR HRT24 T40,30 OLR HRT48 T40

Flow HRT 12 Flow HRT 24 Flow HRT48

(a) Organic loading rate

10 100

8 80

6 60
SLR, kg/m3.d

L/d
4 40

2 20

0 0
10 30 50 70 90 110 130
Operation time, d
SLR HRT12 T40 SLR HRT24 T40,30 SLR HRT48 T40
Flow HRT 12 Flow HRT 24 Flow HRT48

(b) Solid loading rate

10 100

8 80

6 60
VSLR, kg/m3.d

L/d

4 40

2 20

0 0
10 30 50 70 90 110 130
Operation time, d
VSLR HRT12 T40 VSLR HRT24 T40,30 VSLR HRT48 T40
Flow HRT 12 Flow HRT 24 Flow HRT48

(c) Volatile solid loading rate

Figure 5.4 OLRs, SLRs and VSLRs of laboratory-scale septic tanks

46
5.3 Performance of Laboratory-Scale Septic Tanks

Performance of laboratory-scale septic tanks in term of removals of organic matters, solids

and sludge reduction are reported in the following sections.

5.3.1 Removal efficiencies of organic matters (TCOD, SCOD and BOD5)

Removal efficiencies of TCOD and SCOD of the 3 laboratory-scale septic tanks operating
at HRTs of 12, 24 and 48 h and temperature of 40 oC and a laboratory-scale septic tank
operating a HRT of 24 h and temperature of 30 oC are shown in Figures 5.5 and 5.6 and
Table 5.6.

Average removal efficiencies of TCOD of the laboratory-scale septic tanks operating at

HRTs of 12, 24 and 48 h were 67, 76 and 78%, respectively, while there were no significant
decrease of SCOD probably due to the solubilization effects of the settled organic solids
(Figure 5.6 and Table 5.6). The concentrations of SCOD in septic tank influent (synthetically
made with septage) was not substantial decreased in the septic tank effluent, probably
because there was less biological reactions to degrade the solubilized organic compound in
the liquid portion, and the solubilization effects of organic matter in the sludge layer could
release some of soluble organic compound which contributed to the increase of the SCOD
concentrations in the septic tank effluent. However, effluent TCOD concentrations of these
laboratory-scale septic tanks were in the same magnitude of about 330-380 mg/L (Figure
5.5). It was apparent that, due mainly to solid sedimentation, an increasing in HRT more
than 24 h in this study did not have effects on the TCOD removal efficiencies. Baumann and
Babbitt (1953) and Polprasert and Rajput (1982) reported TCOD removal efficiencies of
conventional septic tanks operating at HRTs of 12-36 h were found to be about 40-50 %.

BOD5 removal efficiencies of the 3 laboratory-scale septic tanks operating at HRTs of 12,
24 and 48 h and temperature of 40 oC and a laboratory-scale septic tank operating a HRT of
24 h and temperature of 30 oC are shown in Figure 5.7. Average BOD5 removal efficiencies
of the laboratory-scale septic tanks operating at HRTs of 12, 24 and 48 h at 40 oC were 61,
71 and 74 %, respectively. The results showed that the septic tank operating at HRT of 48 h
could remove BOD5 better than those units operating at HRTs of 12 and 24 h. Pickford
(1980) and Seabloom et al. (2004) reported that BOD5 removal efficiencies of the septic tank
operating at HRTs more than 24 h were 25-50%. In addition, Figure 5.7 b and 5.7 c showed
the average BOD5 removal efficiency of the laboratory-scale septic tank operating at 40 oC
was higher than the unit operating at 30 oC (p<0.01). It could be hypothesized that the septic
tank operating at temperatures higher than ambient temperature could activate
microorganisms and increase the removal efficiencies of easily biodegradable organic
matters.

47
Table 5.6 TCOD, SCOD and BOD5 Concentrations of Laboratory-Scale Septic Tanks

TCOD SCOD BOD5

Laboratory-scale septic tank
Influent Effluent Influent Effluent Influent Effluent
HRT T Flow Range Average Range Average Range Average Range Average Range Average Range Average
o
h C L/d mg/L mg/L mg/L
12 40 80 140-2,530 1,120+510 35-970 340+190 20-200 90+40 30-320 80+51 100-315 170+65 10-122 55+40
24 40 40 130-840 373+162 30-350 110+60 20-220 80+50
630-3,240 1,735+695 30-260 120+50 135-720 300+145
24 30 40 220-1,180 480+190 25-230 100+40 40-210 100+50
48 40 20 1,300-6,480 3,310+1,220 30-1340 660+310 30-590 215+100 30-1,010 185+191 210-1,680 715+370 30-450 170+110

48
 TCOD INF TCOD EFF % TCOD Removal
100
6,000
Concentration, mg/L
80

% Removal
4,000 Average 67 %
60
40
2,000
20
0 0
0 50 100 150
Operation time, d

(a) HRT 12 h, Temperature 40 oC

100
Concentration, mg/L

6,000
80

% Removal
4,000 60
Average 76 %
40
2,000
20
0 0
0 50 100 150
Operation time, d

(b) HRT 24 h, Temperature 40 oC

100
Concentration, mg/L

6,000 Average 69 %
80

% Removal
4,000 60
40
2,000
20
0 0
0 50 100 150
Operation time, d

(c) HRT 24 h, Temperature 30 oC

100
Average 78 %
Concentration, mg/L

6,000
80
% Removal

4,000 60
40
2,000
20
0 0
0 50 100 150
Operation time, d

(d) HRT 48 h, Temperature 40 oC

Figure 5.5 TCOD removal efficiencies of laboratory-scale septic tanks

49
 SCOD INF SCOD EFF % SCOD Removal
500 100

Concentration, mg/L
400

% Removal
-100
300
Average -13 %
200
-300
100

0 -500
0 20 40 60 80 100 120 140 160
Operation time, d

(a) HRT 12 h, Temperature 40 oC

500 100
Concentration, mg/L

400

% Removal
-100
300
Average -8 %
200
-300
100

0 -500
0 20 40 60 80 100 120 140 160
Operation time, d

(b) HRT 24 h, Temperature 40 oC

500 100
Concentration, mg/L

400

% Removal
-100
300 Average 4 %
200
-300
100

0 -500
0 20 40 60 80 100 120 140 160
Operation time, d

(c) HRT 24 h, Temperature 30 oC

500 100
Concentration, mg/L

400
% Removal

Average -1 % -100
300

200
-300
100

0 -500
0 20 40 60 80 100 120 140 160
Operation time, d

(d) HRT 48 h, Temperature 40 oC

Figure 5.6 SCOD removal efficiencies of laboratory-scale septic tanks

50
 BOD INF BOD EFF % BOD Removal
2,000 100

Concentration, mg/L
1,500 80

% Removal
60
1,000
Average 67 % 40
500 20
0 0
0 50 100 150
Operation time, d

(a) HRT 12 h, Temperature 40 oC

2,000 100
Concentration, mg/L

1,500 80

% Removal
60
1,000
40
500 Average 71 % 20
0 0
0 50 100 150
Operation time, d

(b) HRT 24 h, Temperature 40 oC

2,000 100
Concentration, mg/L

Average 63 %
1,500 80

% Removal
60
1,000
40
500 20
0 0
0 50 100 150
Operation time, d

(c) HRT 24 h, Temperature 30 oC

2,000 100
Concentration, mg/L

Average 74 %
1,500 80
% Removal

60
1,000
40
500 20
0 0
0 50 100 150
Operation time, d

(d) HRT 48 h, Temperature 40 oC

Figure 5.7 BOD5 removal efficiencies of laboratory-scale septic tanks

51
5.3.2 Removal efficiencies of TS and TVS

The removal efficiencies of TS and TVS of the 3 laboratory-scale septic tanks operating at
HRTs of 12, 24 and 48 h and temperature of 40 oC and a laboratory-scale septic tank
operating a HRT of 24 h and temperature of 30 oC are shown in Figures 5.8 and 5.9 and
Table 5.7. The average TS removal efficiency of the 40 oC laboratory-scale septic tank
operating at the HRT of 12 h was 49 %, while those operating at the HRTs of 24 and 48 h
were not much different, being 70 and 68 %. The 12 h HRT was not sufficient for the solids
sedimentation, hence the TS removal efficiency was less than the 24 and 48 h HRTs.

A previous study of Pickford (1980) reported that at the HRTs longer than 6 h the percent
removal efficiencies of TS were about 60 %. Removal efficiencies of TS in septic tanks were
dependent on configuration (L:H or H:W) and the number of compartments (Bounds, 1997).
The average percent removal efficiencies of TVS were found in similar trend with the TS
removal (Figure 5.8). From Figures 5.8 and 5.9 and Table 5.7, the percent average TS and
TVS removal efficiencies of the 40 oC septic tanks were significantly higher than those of
30 oC septic tank (p<0.05). Higher temperatures probably caused the liquid density and
viscosity to decrease, resulting in better sedimentation of incoming TS and TVS matter
(Metcalf and Eddy, 2003).
TS INF TS EFF % TS Removal
5,000 100 5,000 100
Average 49 % Average 70 %
Concentration, mg/L

Concentration, mg/L

4,000 80 4,000 80
% Removal

% Removal
3,000 60 3,000 60
2,000 40 2,000 40
1,000 20 1,000 20
0 0 0 0
0 50 100 0 50 100
Operation time, d Operation time, d

(a) HRT 12 h, Temperature 40 oC (b) HRT 24 h, Temperature 40 oC

5,000 100 5,000 100
Average 63 % Average 68 %
Concentration, mg/L

Concentration, mg/L

4,000 80 4,000 80
% Removal

% Removal
3,000 60 3,000 60
2,000 40 2,000 40
1,000 20 1,000 20
0 0 0 0
0 50 100 0 50 100
Operation time, d Operation time, d

(c) HRT 24 h, Temperature 30 oC (d) HRT 48 h, Temperature 40 oC

Figure 5.8 TS removal efficiencies of laboratory-scale septic tanks

52
Table 5.7 TS and TVS Concentrations of Laboratory-Scale Septic Tanks

TS TVS
Laboratory-scale septic tank
Influent Effluent Influent Effluent
HRT T Flow Range Average Range Average Range Average Range Average
o
h C L/d mg/L mg/L
12 40 80 330-2,075 980+510 70-870 460+260 120-1,275 615+320 30-670 245+140
24 40 40 160-820 410+200 130-520 290+120
320-3,900 1,650+780 280-3,800 1,380+730
24 30 40 170-990 540+260 120-800 400+190
48 40 20 900-5,550 2,490+1,300 210-2,030 790+490 480-3,790 1,720+860 190-955 440+200

53
 TVS INF TVS EFF % TVS Removal
5,000 100 5,000 100
Average 75 %
Concentration, mg/L

Concentration, mg/L
Average 53 %
4,000 80 4,000 80

% Removal

% Removal
3,000 60 3,000 60
2,000 40 2,000 40
1,000 20 1,000 20
0 0 0 0
0 50 100 0 50 100
Operation time, d Operation time, d

(a) HRT 12 h, Temperature 40 (b) HRT 24 h, Temperature 40

oC oC

5,000 100 5,000 100

Average 71 %
Concentration, mg/L

Concentration, mg/L
Average 67 %
4,000 80 4,000 80

% Removal

% Removal
3,000 60 3,000 60
2,000 40 2,000 40
1,000 20 1,000 20
0 0 0 0
0 50 100 0 50 100
Operation time, d Operation time, d

(c) HRT 24 h, Temperature 30 (d) HRT 48 h, Temperature 40

oC oC

Figure 5.9 TVS removal efficiencies of laboratory-scale septic tanks

5.3.3 Reduction of accumulated sludge

TS and TVS concentrations of accumulated sludge in laboratory-scale septic tanks operating

at HRTs 12, 24 and 48 h and temperatures of 40 and 30 oC are shown in Table 5.8 and Figure
5.10.

Table 5.8 Reduction of Accumulated Sludge

Operating condition* TVS input TVS accumulation TVS output

HRT T Flow
h o C L/d mg/L g/d g/d g/g TVS input mg/L g/d
12 40 80 615+320 49 10+3 0.20 245+140 20
24 40 40 1,380+740 55 10+3 0.18 290+120 12
24 30 40 1,380+740 55 22+10 0.40 400+190 16
48 40 20 1,720+860 34 7+1 0.20 440+200 9
*Operation time of 4 months

54
The amount of TVS accumulation in the laboratory-scale septic tanks operating at HRT 12,
24 and 48 h and at a temperature of 40 oC were found to be in the range of 0.20-0.40 g/g
TVS input, about 50 % lower than that in the laboratory-scale septic tank operating at a HRT
of 24 h and at a temperature of 30 oC septic tank, which was 0.18 g/g TVS input. The example
of calculation for the TVS input, TVS accumulation and TVS output is shown below

The laboratory scale septic tank operating at a HRT of 12 h and temperature of 40 oC

1.) TVS input

TVS concentration = 615 mg/L
Flowrate = 80 L/d
TVS input = (615x80)/1,000
= 49 g/d
2.) TVS accumulation
Volume of laboratory scale septic tanks = 40 L

At 20-day operation
TVS concentration (inside laboratory scale septic tank) = 4,560 mg/L
TVS accumulation at 20 day operation = ((4,560/1,000) x 40)/20
= 9 g/d
At 40-day operation
TVS concentration (inside laboratory scale septic tank) = 12,700 mg/L
TVS accumulation at 40 day operation = ((12,700/1,000) x 40)/40
= 13 g/d
At 105-day operation
TVS concentration (inside laboratory scale septic tank) = 18,320 mg/L
TVS accumulation at 105 day operation = ((18,320/1,000) x 40)/105
= 7 g/d

Average TVS accumulation per day = (9+13+7)/3 = 10 g/d

3.) TVS output
TVS concentration = 245 mg/L
Flowrate = 80 L/d
TVS input = (245x80)/1,000
= 20 g/d

Angelidaki et al. (1999) reported that increasing temperature in anaerobic digesters

increased the biodegradability of TVS digestion and also enhancing growth of anaerobic
microorganisms (McHugh et al., 2003) to convert the settled TVS to methane gas, similar to
the Table 5.8 data. The TS accumulation analysis based on TS input, output, accumulation
in the laboratory-scale septic tanks operating at a HRT of 24 h with temperatures of 40 and
30 oC are shown in the Figure. 5.10. With the same TS input of 66 g/d and output in the
range of 17-21 g/d, the rate of TS accumulation in the 40 oC septic tank was found to be 17
g/d, less than that in the 30 oC septic tank which was 39 g/d.

55
 100

80

60 30
TS, g/d

40
49 17
20
8 20
0 10
Influent Accumulated Effluent
TVS FS
(a) HRT 12 h, Temperature 40 oC

80

60 11
TS, g/d

40
55
20
7 5
10 12
0
Influent Accumulated Effluent
TVS FS
(b) HRT 24 h, Temperature 40 oC

80

60 11
TS, g/d

40
55 17
20 5
22 16
0
Influent Accumulated Effluent
TVS FS
(c) HRT 24 h, Temperature 30 oC

80

60
TS, g/d

40 15

20 34 7 7
10 9
0
Influent Accumulated Effluent
TVS FS
(d) HRT 48 h, Temperature 40 oC

Figure 5.10 TS accumulated in laboratory-scale septic tanks

56
Consequently, the TS and TVS concentrations in the laboratory-scale septic tanks operating
at temperatures of 40 oC were found to be 25,000 and 16,000 mg/L, respectively, less than
those in the 30 oC septic tank which were about 44,000 and 28,000 mg/L, respectively
(Figure 5.11). These results indicated that the 40 oC septic tank could digest the accumulated
sludge better than the 30 oC septic tank. The direct benefits to be gained from the increased
temperature in septic tanks would be lengthened period of desluging and reduced cost of
septic tank sludge treatment.

50,000

40,000
Concentration, mg/L

30,000

20,000

10,000

0
0 20 40 60 80 100
Day

TS HRT12 T40 TS HRT24 T40 TS HRT24 T30 TS HRT48 T40

50,000

40,000
Concentration, mg/L

30,000

20,000

10,000

0
0 20 40 60 80 100
Day

TVS HRT12 T40 TVS HRT24 T40

TVS HRT24 T30 TVS HRT48 T40

Figure 5.11 Accumulated TS and TVS concentrations (mg/L) in laboratory-scale septic

tanks

57
5.3.4 Methane production

Methane production in the laboratory-scale septic tanks operating at HRTs of 12, 24 and 48
h with temperature of 40 oC and HRT of 24 h with temperature of 30 oC during the operation
time of about 5 month are shown in Figure 5.12. Biogas produced by the laboratory-scale
septic tanks operating at the 40 and 30 oC consisted mainly of methane (44-59 %), while the
rest are carbon dioxide and other trace gases. The average methane production at the 40 oC
at 30 oC were 1.3 L/d and 0.6 L/d, respectively (p<0.05). It can be hypothesized that there
were increased methanogenic activities in the sludge layer of 40 oC septic tank which could
digest the settled TVS to become methane gas better than that of a 30 oC septic tank.

3
Methane production, L/d

0
35 54 69 70 74 119 124 127 130 136
Operation time, d
Methane HRT12 T40 Methane HRT24 T40

Methane HRT24 T30 Methane HRT48 T40

Figure 5.12 Methane production (L/d) of laboratory-scale septic tanks

Table 5.9 Methane Production

Operating condition TVS input Methane L CH4/g TVS degraded a

HRT T Flow (L/d) TVS input (g/d)
h o C L/d mg/L g/d
12 40 80 615+320 49 0.9+0.6 0.02 2.6
24 40 40 1,380+740 55 1.3+0.6 0.02 3.6
24 30 40 1,380+740 55 0.6+0.5 0.01 1.7
48 40 20 1,720+860 34 1.5+0.5 0.04 4.2
a
Calculated from theoretical values in which 1 g organic destroyed produces 0.35 L
methane (Gerardi, 2003)

Based on mass input, the amount of methane production at 40 oC was found to be 0.02 L/g
TVS input, about 50 % higher than those of the 30 oC which was 0.01 L/g TVS input (Table
5.9). Besided the increased anaerobic microbial activities at the 40 oC, the solubilization
effects which produced more SCOD concentrations (Figure 5.6) should enable the anaerobic
microorganisms to better digest the organic matter to become methane gas. However, the
amount of methane production of 0.01 to 0.04 L CH4/g TVS input were still much be lower
than those reported in the literature (Metcalf and Eddy, 2003; Polprasert, 2007) because the
influent C/N ratio of these septic tank were 8-10/1 (section 4.5) less than the optimum value
58
of 32/1. From an analysis of the UASB-septic tank data (Al-Shayah and Mahmoud, 2008),
probably due to the presence of more active microorganisms in the form of granules in the
sludge blanket, the methane production was calculated to be 0.041 L/g TCOD input, higher
than those found in the data of this study, probably due to the presence of active
microorganisms in the form of granular in sludge blanket of the UASB-septic tank. The
amount of degraded TVS calculated from the theoretical in the 40 oC septic tank was 3.6
g/d, also higher than that in the 30 oC septic tank which was 1.7 g/d. For this reasons, it can
be hypothesized that there were more abundance of specific methanogenic microorganisms
in the sludge layer of the 40 oC septic tank responsible for anaerobic conversion of TVS into
CH4 gas and other by-products, more details of the molecular study are given in section 5.4.

5.3.5 Effects of HRTs on septic tank performance

Effects of HRTs on removal efficiencies of BOD5, TCOD, TS and TVS of the laboratory-
scale septic tanks could be depicted in Figure 5.13. HRTs of 12 h resulted in the lowest
BOD5 and TCOD removal efficiencies of 67%, while the HRTs of 24 and 48 h resulted about
71 and 74 % for BOD5, and 76 and 78 % for TCOD, respectively. It could be because more
wash out of the SCOD at the short HRT of 12 h than the longer HRTs (Figure 5.6 and Table
5.6). HRTs do not have significant effects on BOD5 removal (Table 5.6) (p<0.5).
Ittiusupornrat et al. (2009) reported that 52-60 % removal of BOD5 by providing 12 and 24
h retention periods in the tank, which was not significantly different of the BOD5 removal
efficiency in the study. It was probably because the active anaerobic microorganisms in the
septic tank operating at high temperature converted the insoluble complex organic matter in
the bottom sludge into easily biodegradable organic (as intermediate products), resulting in
increased BOD5 concentrations in the septic tank effluent. Consequently, the removal
efficiencies of BOD5 concentrations did not change much during the septic tank operation.
It was apparent that the HRT of 12 h did not provide sufficient times for sedimentation
resulting in relatively low TS and TVS removal efficiencies of 49 and 53 %, respectively.
There was not much difference in the TS and TVS removal efficiencies at the HRTs of 24
and 48 h, being 70 and 68 %, and 75 and 71 %, respectively. Similarly, Sarathai et al. (2010)
reported that the solid removal efficiencies in onsite wastewater treatment systems were
stable at the HRTs above 24 h. Frequent desludging should be done to avoid excessive sludge
accumulation in the septic tank which could impair the septic tank performance (Table 5.8).

90
% Removal efficiency

75

60

BOD TCOD TS TVS

45
10 20 30 40 50
HRT, h
Figure 5.13 Effects of HRTs on removal efficiencies of
laboratory-scale septic tanks at 40 oC

59
Table 5.10 Effects of HRTs on Removal Efficiencies of Laboratory-Scale Septic Tanks

Laboratory-scale septic tank TCODa BOD5b TSa TVSa

HRT T Flow Min Max Average Min Max Average Min Max Average Min Max Average
h oC L/d % % % %
12 40 80 24 94 67+17 5 92 67+24 17 94 49+20 9 96 53+23
24 40 40 21 89 76+14 31 95 71+17 21 89 70+18 45 92 75+14
24 30 40 38 89 69+14 16 92 63+19 30 90 63+16 33 91 67+15
48 40 20 43 98 78+13 21 93 74+17 35 89 66+17 46 90 71+12
aThe data of the removal efficiencies of TCOD, TS and TVS of the laboratory-scale septic tanks operating at HRTs of 12,24 and 48 were significantly different with the p > 0.001
bThe data of the removal efficiencies of BOD5 of the laboratory-scale septic tanks operating at HRTs of 12,24 and 48 were the predetermined level of statistical significance with the p < 0.5

60
5.4 Microbial Identification

Dominant species of the methanogenic microorganisms present in the settled sludge of the
laboratory-scale septic tanks operating at 40 and 30 oC were determined by the PCR-DGGE
technique (Bialek et al., 2011). The DGGE bands no. 1,3,4,5 and 6, shown in Figure 5.14
and Table 5.11, indicated band intensity and diversity of the hydrogenotrophic methanogens
(genus Methanobacterium) at the 40 oC more intense than those found at the 30 oC. Gerardi
(2003) reported the optimum temperatures of the hydrogenotrophic methanogens which
utilize hydrogen and carbon dioxide to produce methane to be around 40-45 oC. The
optimum temperatures for acetoclastic methanogens, such as Methanosarcina which utilize
acetate to produce methane, are active at temperatures below 37 oC and 45-55 oC (Gerardi,
2003) and this methanogenic group was found in the settled sludge of 30 oC, band no. 14
(Figure 5.14 and Table 5.11). Some previous studies by McHugh et al. (2003) also found
that increasing temperatures in anaerobic digesters could shift the microbial diversity from
acetoclastic methanogens to hydrogenotrophic methanogens. Thus, it can be stated from
Figure 5.14 that the hydrogenotrophic methanogens present in the settled sludge at 40 oC
were mainly responsible for the production of methane which were more effective than the
group of methanogens present in the settled sludge at the 30 oC. Although, the laboratory-
scale septic tanks were operated in short HRTs, the settled solids remained and accumulated
in the sludge layer for a long period of time enabled the methanogenic activities to be
effective in digesting the settled TVS, resulting in more CH4 production. Because, in general,
higher temperatures that do not kill microorganisms support higher metabolic rates, there
was more sludge digestion or less sludge production in the 40 oC septic tank than in the 30
o
C septic tank.

40 oC 30 oC
1 1

2 2
3

5 5
6 10
7

9 9
8

Figure 5.14 Microbial diversity in laboratory-scale septic tanks operating at 40 and 30 oC

To study the evolutionary relationships among a set of microbial groups (Homklin et al.,
2012) , a phylogenetic tree was prepared by the data base sequences from NCBI and the
results obtained from this study (Figure 5.15). The sequencing results of the septic tank
operating at 40 oC (band no. 1,3,4,5 and 6) were mostly in the order of Methanobacteriales.

61
Band no. 3 and 6 were closely related to Methanobacterium aarhusense (99 % similarity),
which were found only in the settled sludge of 40 oC, being their optimum temperature
(Shlimon et al., 2004). Band no. 1, 4 and 5 were relatively close to Methanobacterium
formicicum and Methanobrevibacter species (>94 % similarity), whose optimum
temperatures were in the range of 30-40 oC (Leadbetter et al., 1996; Leadbetter et al., 1998),
hence these microorganisms were present in both laboratory-scale septic tanks.

Table 5.11 Sequencing Results

Band Affiliation Closest relative Similarity

(Accession no.) (%)
1 Methanobacterium Uncultured archaeon clone Pa10A_A02 94
(AB921776)
2 Thermogymnomonas Uncultured Thermoplasmata archaeon clone 97
NSArc6
(AB921775)
3 Methanobacterium Uncultured Methanobacteriaceae archaeon 99
clone JM-ASBR-Arch-118 (AB921777)
4 Methanobacterium Uncultured Methanobacteriales archaeon 96
clone
QECB1ZH121 (AB921778)
5 Methanobacterium Uncultured Methanobacterium sp. clone 100
g10-173 (AB921779)
6 Methanobacterium Uncultured Methanobacteriales archaeon 99
clone QECB1ZH121 (AB921780)
7 Methanobrevibacter Methanobrevibacter sp. LRsD2 (AB921781) 95
8 unclassified Uncultured archaeon clone HWA1012-3-64 93
Euryarchaeota (AB921783)
9 Thermoprotei Uncultured archaeon clone YLA08 94
(AB921784)
10 Methanosarcinaceae Uncultured Methanosarcinaceae archaeon 92
clone LrhA69
(AB921782)

62
 Figure 5.15 Phylogenetic relationship of partial 16S rRNA genes of the methanogenic
microorganisms present in the settled sludge of the laboratory-scale septic tanks operating
at 40 and 30 oC

63
5.5 Kinetic Model Development

5.5.1 Kinetic models of TCOD and BOD5 removal efficiencies

Based on the experimental results obtained from this study, the kinetic values for TCOD and
BOD5 were developed. Because Koottatep et al. (2014) found the dispersion numbers of
septic tanks approaching completely-mixed condition, a completely mixed model were
derived as below:

C 1
 (5.3)
C0 1  kT t

Where: C is effluent concentration (mg/L), C0 is influent concentration (mg/L), t is HRTs

(h), kT is first-order rate constant at temperatures T (d-1) according to Equation 5.4.

kT  k 20
T 20
(5.4)
Where: k20 is first-order rate constant at a temperature 20 C (d ),  is temperature
o -1

coefficient, which is 1.02 (Metcalf and Eddy, 2003).

1.0
Simulated(30)
0.8 Simulated(40)
This study(30)
*
This study(40)*
C/C0

0.6
Actual-data

0.4

0.2

0.0
0 50 100 150
HRT, h

(a) TCOD

1.0
Simulated(30)

0.8 Simulated(40)

This study(30)*
0.6 This study(40)*
C/C0

Actual-data

0.4 Baumann and Babbitt (1953)

0.2

0.0
0 50 100 150
HRT, h

(b) BOD5

Figure 5.16 Completely mixed model

(* data from Figure 5.13 )

64
The k20 for TCOD and BOD5 calculated from Equations 5.3 and 5.4, were found to be about
2.16 and 1.61 d-1 (calculated from Equation 5.4 and the experimental results of this study),
respectively. Generally, typical values of k (at 20oC) for treating TCOD in wastewater are
in the range of 0.05-0.30 d-1, depending on wastewater treatment systems (Metcalf and Eddy,
2003). In this study, a relatively high k20 of TCOD value of 2.16 d-1 was probably due to
mainly sedimentation of the solids in addition to biological reaction in the septic tanks. As
the results obtained from the experiment (Table 5.6), presence of SCOD concentration in
septic tank effluent were always equal to the influent, probably because of insufficient for
liquid retention time for microbes to decompose the colloidal or soluble organic solids. The
k20 values of BOD5 was lower than that of TCOD likely because it involves mainly
biodegradable organic matter, but rather with the physical mechanism.

Validation of the completely-mixed model with the results obtained from the laboratory-
scale septic tanks, actual-scale septic tanks (section 4.8) and literature was done as shown in
Figure 5.16. The correlation coefficient (R2) values of the model were about 0.91-0.97
which showed the applicability these kinetic values. However, it should be noted that
Equation 5.3 and the kinetic values for TCOD and BOD5 are applicable for septic tanks
operating at temperatures of 30 and 40 oC. Further validation of the model with septic tank
data operating at high temperature is required.

5.5.2 Sludge accumulation model

The results of TVS reduction in the laboratory-scale septic tank operating at 30 oC were
calculated based on mass balances analysis as (Equations 5.5 and 5.6 and Figure 5.17):

TVS reduction  TVS input  TVS output  TVS accumulation (5.5)

TVS insideTVS initial (5.6)

TVS accumulation 

Where :  is reaction times (d), TVSinside is TVS concentration inside septic tank (mg/L),
TVSinitial is TVS concentration at the beginning (mg/L)

TVSinput (mg/L)
(t=1,2,3,…., n d) TVSoutput (mg/L)
(t=1,2,3,….., n d)
TVS accumulations (mg/L), t=4,5…., n d

TVS accumulation (mg/L), t=3 d

TVS accumulation (mg/L), t=2 d

TVS accumulation (mg/L), t=1 d

Figure 5.17 Mass balances analysis of sludge accumulation

65
Table 5.12 TVS Reduction per Day

Day TVS input TVS output TVS settled* TVS accumulation** TVS reduction***
mg/L mg/L mg/L mg/L mg/L
0 980 0
20 460 510
1,380 400 980
40 530 450
105 220 760
* TVS settled is TVSinput-TVSoutput
**Per day operation (Equation 5.6)
*** TVS reduction is TVS settled- TVS accumulation

The TVS concentrations in the laboratory-scale septic tank during the operation periods were
found to decrease from 980 to 220 mg/L (Table 5.12). The rate of TVS reduction in the
laboratory-scale septic tank could be expressed as a first-order reaction:

C TVS
In   kT  (5.7)
C TVS 0

In which CTVS  is TVS concentration at reaction times (mg/L), CTVS0 is settled TVS
concentrations (mg/L), kT is first-order rate constant at temperature T (d-1), k20 is first order
rate constant at temperature 20 oC and the 𝜃 is temperature coefficient which is 1.11 (Van
Haandel et al., 1994). Therefore, a relationship between CTVSt/CTVS0 and reaction times
shown in Figure 5.18, exhibited a linear relationship with the k20 value of 0.004 d-1 and R2
value of 0.96. The outlier of the result in 20 day operation, presumably due to the number of
sample would not be large enough to show the inline of the result.

Equation 5.8 is applicable for estimation of TVS accumulation in septic tanks operating at
30 oC; further validation of this equation with data of septic tanks operating at higher
temperatures is recommended. However, it should be noted that the k20 value of this study
was more precise to predict sludge accumulation in the septic tank during the operation
period of 4 month, which required more information for prolonging periods of sludge
measurement.

66
 0.0

ln(CTVSt/CTVS0)

-0.5
y = -0.0127x - 0.1866
R² = 0.96

-1.0

-1.5

-2.0
0 20 40 60 80 100 120
Reaction time, d

Figure 5.18 TVS reduction in laboratory-scale septic tank fitted with first-order model

Probably due to the less amount of active microorganisms and characteristic of the influent
(Chapter 4), the k20 value of 0.004 d-1 was found to be relatively low when compared with
the literatures data. Chatsanguthai (1986) reported that the kinetic values of organic
reduction in anaerobic waste stabilization ponds to be about 0.08-0.20 d-1. Nwabanne et al.
(2010) found the kinetic values of anaerobic digestion of municipal waste to be about 0.14
d-1. Up to present, there are very few research about the TVS reduction in the septic tanks.

Based on the experimental data and Equation 5.7, a model of sludge accumulation in septic
tanks was developed as shown in Equation 5.8.

dC sludge Q
dt

V
  
C TS settled  C TS settled 1ek T   (5.8)

Where:  is an average TVS/TS ratio which was equal to 0.8 (based on results obtained
from the section 5.3.2).

An integrated kinetic model for sludge accumulation in septic tanks was consequently
developed to simulate the concentrations of TS and TVS, as shown in Figure 5.19.

67
 Figure 5.19 Integrated kinetic model of sludge accumulation in septic tanks

Equation 5.8 was validated with the experimental data obtained from the laboratory-scale
septic tank experiments (Appendix B). Comparison of the model’s simulation data and the
results of sludge accumulation in the laboratory-scale septic tanks operating at HRT 24 h
and temperatures of 30 and 40 oC are shown in Figure 5.20. Because of the solubilization
effects occurring in the septic tank operating at 40 oC (Figure 5.6), Equation 5.8 could fit
well with only the laboratory-scale septic tank operating at 30 oC with R2 value of 0.90,
while the unit operating at 40 oC was found to have a less R2 value of 0.79. It was
hypothesized that the degradation rate and the solubilization effect of organic matters in the
septic tank was found to increase when increasing of temperatures. Thus, to compensate the
model, a correction factor (β), from trial and error, was developed from the operating
temperature at 30 oC and was incorporated in the model (Equations 5.9 and 5.10) with the
high satisfactorily value of R2:

dC sludge Q
dt

V
   
CTS settled  CTS settled 1 ek T   

(5.9)

30
 (5.10)
T

Simulation data from Equations 5.9-5.10 were validated satisfactorily with the experimental
results of the laboratory-scale septic tanks (Appendix B), as shown in Figure 5.20, which R2
value of 0.85.

68
 40
R2 (Sludge model at 30 oC) = 0.90
35

Concentration, g/L
30

25

20

15

10

0
0 5 10 15 20 25 30 35 40 45

Operation time, d

TS simulated(30) TVS simulated(30) TS (30) TVS (30)

(a) Laboratoty-scale septic tank operating at 30 oC

40
R2 (Sludge model at 40 oC) = 0.79
35 R2 (Modified sludge model at 40 oC) = 0.85

30
Concentration, g/L

25

20

15

10

0
0 5 10 15 20 25 30 35 40 45

Operation time, d

TS simulated(40) TVS simulated(40) TS modified (40)

TVS modified (40) TS (40) TVS (40)

(b) Laboratoty-scale septic tank operating at 40 oC

Figure 5.20 Comparison of simulation data and results of sludge accumulation

in laboratory-scale septic tanks

Equation 5.9 was further validated with data of actual septic tanks located in household
communities of 4 provinces located in different regions of Thailand (Nonthaburi, Lampang,
Ratchaburi and Nakorn Ratchaseema) (Koottatep et al., 2012). These actual septic tanks had
sizes ranging from 200-1,000 L and TS concentrations of 3,000-80,000 mg/L, depending
SLRs (Table 5.13).

69
Table 5.13 Sludge Accumulation in Actual Septic Tanks of Thailand

No. Code Number of Volume HRT SLR Desludging TS Simulated TS accumulation

people (L) (d) 3
(kg/m .d) period accumulation (mg/L)*
(year) (mg/L)a
1 AIT-1** 4 1,181 10 0.2 1 3,668 33,502
2 AIT-6 3 975 11 0.2 1 3,288 33,502
3 AIT-17 6 777 4 0.4 1 14,820 50,254
4 AIT-20 3 6,256 70 0.02 1 10,153 8,375
5 AIT-21 9 810 3 0.6 1 80,010 83,756
6 AIT-27 2 235 4 0.4 1 20,868 50,254
7 AIT-35 2 1,200 20 0.1 1 8,864 16,751
8 AIT-38 6 1,153 6 0.3 0.25 5,200 18,000
Source: Koottatep et al. (2012)
*
From Equation 5.9 and using following values: water used per person per day is 35 L, TS per person per day is 50 g, TVS/TS is 0.8 and T at 30 oC
**Sample code
a
Mixed liquid samples in septic tank sludge

70
Figure 5.21 shows the simulated sludge accumulation results at various SLRs. TS data
obtained from actual septic tanks and the laboratory-scale septic tanks in which the R2 values
was found to be 0.69, suggesting the applicability of the Equation 5.9. It is obvious that
Equation 5.9 could not accurately simulate the actual septic tank data probably because of
the behavior of the septic tank user which vary considerably depending on socio-economic
and climatic conditions.

90,000
0.05 SLR*

0.1 SLR

80,000 0.2 SLR

0.3 SLR

0.5 SLR
70,000 1.0 SLR

Actual data No.1

Actual data No.2

60,000
Actual data No.3
Sludge accumulation (TS), mg/L

Actual data No.4

Actual data No.5

50,000
Actual data No.6

Actual data No.7

40,000 Actual data No.8

Labaratory-scale septic tank data

30,000

20,000

10,000

0
0 0.5 1 1.5 2
Year

Figure 5.21 Sludge accumulation data of actual and laboratory-scale septic tank and
simulated results at various SLRs
(*SLRs, kg/m3.d)

71
5.6 Modelling to Investigate Effects of Increasing Temperatures in Septic Tanks

In this study, a dynamic modelling was applied to describe anaerobic pathways of organic
matter degradation such as: hydrolysis, acidogenic and methanogenic reactions with time.
The main contributing factors affecting septic tank performance (assuming complete
conversions of organic matters to intermediate products in each step of the anaerobic
pathway) included fecal characteristics, HRT or water use and influent flow rate. The
mathematical equations from the previous studies of Batstone et al. (2002), Christ et al.
(2000), Gujer et al. (1983) and O'Rourke, (1968) was used to simulation this modelling. The
influent TCOD was simulated by varying the concentration in the range of 1,000-2,500
mg/L. The hydrolysis rate was determined by a first-order expression with respect to
concentration of particulate organic matter as shown in Equation 5.11:

rH  kH S (5.11)

Where rH is the rate of production of hydrolysis, kH is the hydrolysis rate constant (d-1); and
S is the substrate concentration (mg/L). The kH values of cellulose, protein and fat were 0.1,
0.1 and 0.075 d-1, respectively (Batstone et al., 2002; Christ et al., 2000; Gujer et al., 1983;
O'Rourke, 1968). To convert solubilised organic matter or intermediate products into biogas,
the rate of substrate utilization can be expressed (Equation 5.12):

μ
 rS  (X ) (5.12)
Y

where, µ is the bacteria specific growth rate (d-1), Y is the growth yield (mg biomass /mg
substrate utilized) and X is the concentration of viable bacteria (mg/L).The reactions of acid
forming bacteria, acetogenic bacteria (acetic acid, propionic acid and butyric acid) and the
acetoclastic methanogenic bacteria, each was expressed by Equations 5.13-5.19. The kinetic
value of each bacteria was summarized according to the previous study of Pavlostathis et al.
(1991) and Stumm and Morgan (2012) as shown in Appendix C.

Sg
af  μmax,af
k af  S g (5.13)

Sp
 pa  μmax,pa
 
 k pa  S p   1  S a 
  K I , pa 
   (5.14)

Sb
ba  μmax,ba
 
 k ba  S b   1  S a  
  K I ,ba 
   (5.15)

Sa
 am  μ max, am
 
     1  S p 
 k am S a  K I ,am 
  
(5.16)

72
Where: k is the saturation coefficient (d-1) and KI is the inhibition coefficient (mg/L). Regular
functions of each step of the anaerobic pathway were expressed as:

Sa
P p ,af  f
k gp  S a
p

(5.17)
1
Pa ,af  1 S a 
 K I .ga 
  (5.18)

Sa
Pb ,af  f p
k gp  S a (5.19)

Where: P is the regular functions and fp is the value of maximum fraction of propionic acid.
The substrate balance of anaerobic degradation pathway in each step can be formulated in
Equations 5.20-5.23.
 1 1 
S g ,in S g ,out      af  X af  
dS g ,out  Q  
dt V  naf  Y af  (5.20)

 v  1 
 S p ,in  S p ,out     p ,af   P p ,af  af  X af      pa  X pa  
dS p ,out Q (5.21)
  Y pa 
dt V   Y af 

  vb ,bf  
dS b ,out  Q  
S b ,in S b ,out       Pb ,af  af  X af     ba  X ba  
1
dt V   Y af   Y ba 
(5.22)

dS a ,out Q   v a ,af         1  
 S a ,in  S a ,out      am 
v a , pa v a .ap
  P a ,af  af           
  Y pa    X pa     Y ba    X ba   Y am am X
 
dt V   Y af    pa   ba 
(5.23)

Where: Q is the flow rate (L/d), V is volume (L) and v is the stoichiometric coefficient
(mmole/mg). The methane production in septic tanks could be expressed as Equation 5.24:

   
     
Q g ,CH 4  V s V  vCH 4 ,am   am    X af  vCH 4 ,hm vh p af  P p ,af  vhb af  Pb ,af    vha af  P p ,af   af  X af  
  Y am     Y af 
       
  vh p a   pa   X pa    vhb a   ba   X ba 
  Y pa     Y ba  
(5.24)

According to Siegrist et al. (2002), the effect of the temperature on kinetic values is
determined by Equation 5.25 and the θ values are in the range of 0.05-0.10.

F ( T )  e ( T T 0 )
(5.25)

Where: T is temperature (oC).

73
The dynamic models (Equations 5.11-5.25) were developed to simulate performance of the
laboratory scale septic tanks operating at temperatures of 30, 50 and 50 oC. Tables C-1 and
C-2 summarized the related kinetic values as reported by Pavlostathis et al. (1991), Siegrist
et al. (1993) and Stumm and Morgan (2012). Equations 5.11-5.25 were translated into the
model structure of a dynamic model by using STELLA software (Figure 5.22).

According to Jönsson et al. (2005) and Koottatep et al. (2001), the simulated black water
composed of more than 50 percent of cellulose (not easily biodegradable), less of fixed solid,
fat and protein. The simulation data and the results of treatment efficiencies of TCOD,
SCOD and methane production of the laboratory-scale septic tanks operating at HRT of 24
h and temperatures of 30, 40 and 50 oC are shown in Figure 5.23. The simulated results of
average methane production from the septic tanks operating at temperatures of 30, 40 and
50 oC were found to increase with increasing temperatures, which were about 1.0, 1.4 and
1.5 L/d, respectively, with the standard error of the estimate (SEE) value of 0.3-0.5.
Similarly, as previously mentioned about the effect of solubilization occurring in septic
tanks, the simulated results of SCOD concentrations (estimated from VFAs generated per
day) in the septic tank effluent operating at temperatures of 30, 40 and 50 oC were also found
to increase with increasing temperatures, which were about 180, 220 and 290 mg/L,
respectively, with the SEE value of 40-52. The dynamic modelling results suggested that the
main mechanism of organic removal in the septic tank was hydrolysis of cellulose, protein
and fat.

To support the above finding that hydrolysis was the main mechanism occurring in the septic
tank, although the simulated SCOD concentration were 180-290 mg/L, the measured
concentrations of VFAs such as acetic acid, butyric acid, propionic acid in the 40 oC
laboratory-scale septic tank during the experimental period of 60 days were in the ranges of
8.4-7.3, 4.0-5.6 and 0.2-1.0 mg/L, respectively, while the simulated concentrations were
found to be in the ranges of 3.0-36.2, 2.0-2.4 and 4.2-5.3 mg/L, respectively. However,
VFAs concentrations in normal anaerobic digesters were reported to be more than 100 mg/L
(Metcalf and Eddy, 2003; Polprasert, 2007). Likely due to the relatively short HRTs of 24
to 48 h, the acid forming bacteria could not effectively convert the hydrolyzed products to
become fatty acids, which eventually led to lower methane production, as earlier reported in
section 5.3.4

74
Figure 5.22 Modelling to investigate septic tank
performance 75
 3,500 6

Methane production, L/d

Concentration, mg/L 3,000 SEE (methane) = 0.3 5
2,500 SEE (SCOD) = 40.9
4
2,000
3
1,500
2
1,000
500 1

0 0
0 20 40 60 80 100 120 140 160
Day
TCOD INF simulated(30) TCOD INF(30) SCOD EFF simulated(30)
SCOD EFF(30) Methane simulated(30) Methane(30)

(a) Laboratory-scale septic tank operating at 30 oC

3,500 6
Concentration, mg/L

Methane production, L/d

3,000 SEE (methane) = 0.5 5
2,500 SEE (SCOD) = 52.4 4
2,000
3
1,500
2
1,000
500 1

0 0
0 20 40 60 80 100 120 140 160
Day
TCOD INF simulated(40) TCOD INF(40) SCOD EFF simulated(40)
SCOD EFF(40) Methane simulated(40) Methane(40)

(b) Laboratory-scale septic tank operating at 40 oC

3,500 6
Methane production, L/d
Concentration, mg/L

3,000 5
2,500
4
2,000
3
1,500
2
1,000
500 1

0 0
0 20 40 60 80 100 120 140 160
Day
TCOD INF simulated(50) SCOD EFF simulated(50) Methane simulated(50)

(c) Laboratory-scale septic tank operating at 50 oC

Figure 5.23 Dynamic modelling of septic tank performance

76
5.7 Application of Results

5.7.1 Solar septic tank operation

Figure 5.24 shows the temperature profile of a solar septic tank operating at 40 oC

Figure 5.24 Temperatures of a solar septic tank

During the operation period, the average ambient temperature and solar radiation were about
32oC and 200 J/m2.min, respectively. The temperature range in the solar septic tank (a size
of 600 L) equipped with a solar water heating device (an areas of 2 m2) was about 37-44 oC,
while the hot water temperatures were 34-51 oC. It is technically possible to raise the septic
tank temperature to 60 oC or more by adjusting the heated water circulation rate or adding
more solar collectors. However, to minimize the effect of temperature variation during
operation period, the result of a hybrid solar septic tank (with installed an electric heater)
was tested with the results shown in Figure 5.25.

Figure 5.25 Temperatures of a hybrid solar septic tank

77
It can be seen that the temperature inside the solar septic tank were be more stable at 44-46
o
C, while the hot water temperatures were 44-51 oC. Since, other operating conditions of the
solar heating system such as design of novel solar heating device (parabolic solar collector)
and areas for a heat transfer equipment have effects on solar heating efficiency further studies
in this respect should be explored.

5.7.2 Advantages and cost-benefit analysis

Using the data obtained from this study and the literature, performance of solar septic tanks
operating at various temperatures and HRTs could be summarized as shown in Table 5.11.

Table 5.14 Performance of Solar Septic Tanks

Settled DegradedCODb E. colic (Log Methane

CODa (%) (%) reduction) production (L/d)
30 oC 12h 57 21 0.4 1.2
24h 72 21 0.6 1.0
48h 84 21 0.8 0.9
40 oC 12h 62 27 1.0 1.4
24h 76 27 1.2 1.4
48h 87 27 1.5 1.3
50 oC 12h 66 35 1.3 1.5
24h 80 35 1.5 1.6
48h 89 35 1.8 1.6
Note: OLRs 1-2 kg/m3.d
a
Refer to organic fraction settled in experimental units sludge (per day)
b
Hydrolysis of cellulose, protein and fat in accumulated sludge
c
Modified Weibull model’s (Koottatep et al., 2013) (Equations 2.8-2.9)

The results of this study suggested the technical feasibility of increasing temperatures in the
septic tanks to increase the efficiencies of COD removal, E.coli inactivation and methane
production. Since the major operation cost of septic tank management at household level in
developing countries is septage emptying or desludging, the reduced septage production
would lengthen the desludging period or a cost saving in septage management. The reduced
septage production should lessen the pollution problems caused by unsanitary disposal of
septage in developing countries. Table 5.14 compares investment and operation costs of
household septic tanks operating at 40 and 30 oC. In general, a conventional septic tank for
a household of 4 people in Thailand costs about US$ 250 with the estimated cost of a local
solar heating water device to heat the septic tank of about US$ 200, the total investment of
a 40 oC septic tank would be US$ 450. Since the cost of desludging, which is done once a
year, in Thailand is US$ 33, the 40 oC septic tank which has 50 % TS reduction (Table 5.15)
should be desludged once in 2 years, or the cost of desluging of US$ 16/year. The payback
period for the cost of the solar water heating device is therefore about 12 years. In addition
to the sludge reduction, energy generation from biogas of the 40 oC septic tank is calculated
to be 0.08 kWh/d, higher than the 30 oC septic tank which was 0.04 kWh/d. This energy can
be used for cooking, lighting or heating etc. According to Feachem et al. (1983) higher
temperatures obviously result in more inactivation of pathogenic microorganisms and the 40
o
C temperature would be sufficient to kill Vibrio cholera bacteria in 1 day.

78
Table 5.15 Application of Solar Septic Tanks

Solar septic tanks Conventional septic

(40oC) tank
People 4 4
Investment cost (US$) 450b 250
Septage accumulation (m3/ year) 0.5 1
Average desludging cost 16 33
(US$/year)
Payback period for solar heating 12 -
device (year)
Energy generation (kWh/d)a,c 0.08d 0.04e
*The average cost in 1 year was around US$ 33 per 1 family (4 people) (Mueang Nonthaburi
Municipality, 2014)
a
1 m3 of methane is equal to 10 kWh (Blignaut and De Wit, 2014)
b
Additional cost from solar heated water system 200 US$ divided by 16 US$ per year
c
TVS input is around 400 g/d
d
Energy generation of solar septic tank = 0.02 L/gTVS x 400 g/d x 0.01 kWh/L of methane
= 0.08 kWh/d
e
Energy generation of conventional septic tank = 0.01 L/gTVS x 400 g/d x 0.01 kWh/L of methane
= 0.04 kWh/d

79
 Chapter 6

Conclusions and Recommendations

6.1 Conclusions

The results obtained from this study which aimed to create a design platform for solar septic
tank can be summarized as follow:

1. The laboratory-scale septic tank operating at HRTs of 12 h resulted in the lowest

BOD5 and TCOD removal efficiencies of 67%, while the laboratory-scale septic
tanks operating at HRTs of 24 and 48 h resulted about 71 and 74 % for BOD5, and
76 and 78 % for TCOD, respectively. It was apparent that the HRT of 12 h did not
provide sufficient time for solids sedimentation, resulting in the low TS and TVS
removal efficiencies of 49 and 53 %, respectively. There was not much different in
the TS and TVS removal efficiencies at the HRTs of 24 and 48 h, being 70 and 68
%, and 75 and 71 %, respectively.

2. Rates of TVS accumulation in the laboratory-scale septic tanks operating at HRT 12,
24 and 48 h and at a temperature of 40 oC were found to be in the range of 0.20-0.40
g/g TVS input, about 50 % lower than that in the laboratory-scale septic tank
operating at a HRT of 24 h and at a temperature of 30 oC septic tank which was 0.18
g/g TVS input. The amount of CH4 production at 40 oC was found to be 0.02 L/g
TVS input, about 50 % higher than those of the 30 oC which was 0.01 L/g TVS input.

3. Molecular analysis of the sludge samples in the 40 oC septic tank by the PCR-DGGE
techniques revealed the intensity and diversity of Methanobacterium species
responsible for CH4 production. Whereas, there was less diversity of
Methanobacterium species in the sludge samples of the 30 oC septic tank.

4. The TCOD and BOD5 removal efficiencies data were found to follow a completely-
mixed model with the k20 values 2.16 and 1.61 d-1, respectively. The completely-
mixed model could be applied to predict the TCOD and BOD5 removal efficiencies
in actual septic tanks with the R2 value of 0.91-0.97.

5. An integrated kinetic model shown below could be applied to predict actual sludge
accumulation in actual septic tanks satisfactorily (R2 = 0.69)

dC sludge Q
dt

V
   
CTS settled  CTS settled 1ek T   


30

T

6. A dynamic modelling was able to simulate results of methane production and TCOD
degradation in the septic tanks satisfactorily. The dynamic modelling results
suggested that the main mechanism of organic degraded in the septic tank was
hydrolysis of cellulose, protein and fat.

80
However, it should be noted that the results from this study mainly obtained from the
laboratory-scale septic tanks fed with the synthetically made of diluted septage and sludge
reduction efficiency was observed within 4 month. Thus, due to these limitations of this
experiment and to fulfill the ultimate goal of this research area, the following
recommendations are required for further study.

6.2 Recommendations

The recommendations for further study are:

1. Further validation of the integrated kinetic model (Equation 5.9) with the data of
septic tanks operating at temperatures above 30-40 oC

2. Mathematical modelling of solar collector and energy balance to improve solar

heating efficiency

3. Investigation the sludge reduction efficiency in the septic tank in long term
operation

4. Life cycle assessment (LCA) of the solar septic tanks with respect to carbon food
prints and CO2 emission and comparing with other conventional on-site treatments
systems

5. Actual-scale testing of solar septic tanks under various conditions of organic

loading rate, C/N ratio and HRTs and cost-benefit analysis

6. On-line measurement of biogas production from solar septic tanks by using

wireless sensor network

81
 References

Al-Jamal, W. and Mahmoud, N. (2009). Community Onsite Treatment of Cold Strong

Sewage in a UASB-Septic Tank. Bioresource Technology, 100(3), 1061-1068.

Al-Shayah, M. and Mahmoud, N. (2008). Start-Up of an UASB-Septic Tank for Community

On-Site Treatment of Strong Domestic Sewage. Bioresource Technology, 99(16),
7758-7766.

Alkhamis, T., El-Khazali, R., Kablan, M. and Alhusein, M. (2000). Heating of a Biogas
Reactor Using a Solar Energy System with Temperature Control Unit. Solar Energy,
69(3), 239-247.

American Public Health Association/American Water Works Association/Water

Environment Federation (2005). Standard Methods for the Examination of Water and
Wastewater (21th edition). Washington D.C., United States of America.

Angelidaki, I., Ellegaard, L. and Ahring, B.K. (1999). A Comprehensive Model of

Anaerobic Bioconversion of Complex Substrates to Biogas. Biotechnology and
Bioengineering, 63(3), 363-372.

Axaopoulos, P., Panagakis, P., Tsavdaris, A. and Georgakakis, D. (2001). Simulation and
Experimental Performance of a Solar-Heated Anaerobic Digester. Solar Energy,
70(2), 155-164.

Batstone, D.J., Keller, J., Angelidaki, I., Kalyuzhnyi, S., Pavlostathis, S., Rozzi, A. and
Vavilin, V. (2002). The IWA Anaerobic Digestion Model No. 1 (ADM 1). Water
Science and Technology, 45(10), 65-73.

Baumann, E.R. and Babbitt, H.E. (1953). An Investigation of the Performance of Six Small
Septic Tanks. University of Illinois, United States of America.

Bialek, K., Kim, J., Lee, C., Collins, G., Mahony, T. and O’Flaherty, V. (2011). Quantitative
and Qualitative Analyses of Methanogenic Community Development in High-Rate
Anaerobic Bioreactors. Water Research, 45(3), 1298-1308.

Birgitte, K.A., Ashraf, A. and Ibrahim, Z.M. (2001). Effect of Temperature Increase from
55 to 65°C on Performance and Microbial Population Dynamics of an Anaerobic
Reactor Treating Cattle Manure. Water Research, 35(10), 2446–2452.

Blignaut, J.N. and De Wit, M.P. (2004). Sustainable Options: Economic Development
Lessons from Applied Environmental Economics in South Africa. Juta and Company
Ltd. , Cape Town, South Africa.

Bounds, T. (1997). Design and Performance of Septic Tanks. ASTM Special Technical
Publication, 1324, 217-234.

Brandes, M. (1978). Characteristics of Effluents from Gray and Black Water Septic Tanks.
The Journal of the Water Pollution Control Federation, 50(11), 2547-2559.

82
British Standards Institution (BSI). (1972). Small Sewage Treatment Works. Code of
Practice, CP 302. London, United Kingdom.

Bryers, J. (1985). Structured Modelling of the Anaerobic Digestion of Biomass Particulates.

Biotechnology and Bioengineering, 27(5), 638-649.

Chatsanguthai, S. (1986). Kinetics of Anaerobic Waste Stabilization Pond Treatment.

(Master's Thesis No. EV-86-18, Asian Institute of Technology, 1986) Bangkok:
Asian Institute of Technology.

Christ, O., Wilderer, P. and Faulstich, M. (2000). Mathematical Modelling of the Hydrolysis
of Anaerobic Processes. Water Science and Technology, 41(3), 61-65.

Coolen, M.J., Hopmans, E.C., Rijpstra, W.I.C., Muyzer, G., Schouten, S., Volkman, J.K.
and Sinninghe Damsté, J.S. (2004). Evolution of the Methane Cycle in Ace Lake
(Antarctica) During the Holocene: Response of Methanogens and Methanotrophs to
Environmental Change. Organic Geochemistry, 35(10), 1151-1167.

Coquin, M.C. (2005). Black Water Recycling at Skogaberg VSEP Reverse Osmosis
Membrane Pilot Tests. Master’s Thesis, International Master’s Programme Applied
Environmental Measurement Techniques, Göteborg, Sweden.

Corey, R., Tyler, E. and Olotu, M. (1978). Effect of Water Softener Use on the Permeability
of Septic Tank, Seepage Fields. Paper Presented at the Proceedings of the National
Home Sewage Treatment Symposium.

Crites, R.W. and Tchobanoglous G. (1998). Small and Decentralized Wastewater

Management Systems. New York, United States of America: McGraw-Hill.

El-Mashad, H.M., Van Loon, W.K., Zeeman, G., Bot, G. and Lettinga, G. (2006). Effect of
Inoculum Addition Modes and Leachate Recirculation on Anaerobic Digestion of
Solid Cattle Manure in an Accumulation System. Biosystems Engineering, 95(2),
245-254.

El-Mashad, H.M., Zeeman, G., van Loon, W.K.P., Gerard, P.A.B. and Lettinga, G. (2004).
Effect of Temperature and Temperature Fluctuation on Thermophilic Anaerobic
Digestion of Cattle Manure. Bioresource Technology, 95(2), 191–201.

Feachem, R.G., Bradley, D.J., Garelick, H. and Mara, D.D. (1983). Sanitation and Disease
– Health Aspects of Excreta and Wastewater Management. Chichester, United
Kingdom: John Wiley & Sons.

Gerardi, M.H. (2003). The Microbiology of Anaerobic Digesters. Hoboken, New Jersey,
United States of America: John Wiley & Sons.

Grady Jr, C.L., Daigger, G.T., Love, N.G., Filipe, C.D. and Leslie Grady, C. (2011).
Biological Wastewater Treatment. United Kingdom: IWA Publishing.

Graef, S.P. and Andrews, J.F. (1974). Stability and Control of Anaerobic Digestion. Water
Pollution Control Federation, 46, 666-683.

83
Gujer, W. and Zehnder, A. (1983). Conversion Processes in Anaerobic Digestion. Water
Science and Technology, 15(8-9), 127-167.

Hammer, D.A. (1989). Constructed Wetlands for Wastewater Treatment: Municipal,

Industrial and Agricultural. Boca Raton, United States of America: CRC
Press, Lewis Publishers.

Haug, R.T. (1993). The Practical Handbook of Compost Engineering. United States of
America: CRC Press, Lewis Pubishers.

Heinss, U., Larmie, S.A. and Strauss, M. (1999). Characteristics of Faecal Sludges and
Their Solids-Liquid Separation. EAWAG/SANDEC, Rio de Janeiro, Brazil.

Hill, D. and Barth, C. (1977). A Dynamic Model for Simulation of Animal Waste Digestion.
Pollution Control Federation, 10, 2129-2143.

Homklin, S., Ong, S.K. and Limpiyakorn, T. (2012). Degradation of 17α-Methyltestosterone

by Rhodococcus sp. and Nocardioides sp. Isolated from a Masculinizing Pond of Nile
Tilapia Fry. Journal of Hazardous Materials, 221, 35-44.

Ittiusupornrat, S., Sienglum, C., Wongsila, K., Poonnotok, A., Sunthornwatthanophong, V.,
Yaithavorn, P. and Milintawisamai, M. (2009). Project on Efficiency Verification
Testing of Wastewater Treatment Tank. Environmental Research and Training Centre
(ERTC).

Jönsson, H., Baky, A., Jeppsson, U., Hellström, D. and Kärrman, E. (2005). Composition of
Urine, Feaces, Greywater and Biowaste for Utilisation in the URWARE Model.
Urban Water Report.

Keyser, M., Witthuhn, R., Lamprecht, C., Coetzee, M.P.A. and Britz, T. (2006). PCR-Based
DGGE Fingerprinting and Identification of Methanogens Detected in Three Different
Types of UASB Granules. Systematic and Applied Microbiology, 29(1), 77-84.

Kiker, J. (1956). New Developments in Septic Tank Systems. Paper Presented at the
Journal of the Sanitary Engineering Division, Proceeding, ASCE.

Klass, D.L. (1998). Biomass for Renewable Energy, Fuels, and Chemicals. Academic Press.

Koottatep, T., Eamrat, R., Pussayanavin, T. and Polprasert, C. (2014). Hydraulic Evaluation
and Performance of On-Site Sanitation Systems in Central Thailand. Environ Eng
Res., 19(3), 269-274.

Koottatep, T., Phuphisith, S., Pussayanavin, T., Panuvatvanich, A. and Polprasert, C. (2013).
Modelling of Pathogen Inactivation in Thermal Septic Tanks. Water Sanitation
Hygiene Development, 4(1), 81–88.

Koottatep, T., Polprasert, C., Oanh, N., Heinss, U., Montangero, A. and Strauss, M. (2001).
Septage Dewatering in Vertical-Flow Constructed Wetlands Located in the Tropics.
Water Science and Technology, 44(2-3), 181-188.

84
Koottatep, T., Surinkul, N., Paochaiyangyuen, R., Suebsao, W., Sherpa, M.,
Liangwannaphorn, C. and Panuwatvanich, A. (2012). Assessment of Faecal Sludge
Rheological Properties. Asian Institute of Technology, Thailand.

Koottatep, T., Surinkul, N., Polprasert, C., Kamal, A., Koné, D., Montangero, A. and Strauss,
M. (2004). Treatment of Septage in Constructed Wetlands in Tropical Climate–
Lessons Learnt after Seven Years of Operation. Water Science and Technology,
51(9), 119-126.

Leadbetter, J.R. and Breznak, J.A. (1996). Physiological Ecology of Methanobrevibacter

Cuticularis sp. nov. and Methanobrevibacter Curvatus sp. nov., Isolated from the
Hindgut of the Termite Reticulitermes Flavipes. Applied and Environmental
Microbiology, 62(10), 3620-3631.

Leadbetter, J.R., Crosby, L.D. and Breznak, J.A. (1998). Methanobrevibacter Filiformis sp.
nov., a Filamentous Methanogen from Termite Hindguts. Archives of Microbiology,
169(4), 287-292.

Lens, P., Zeeman, G., and Lettinga, G. (2001). Decentralised Sanitation and Reuse -
Concepts, Systems and Implementation. London, United Kingdom: IWA Publishing.

Lettinga, G. (1995). Anaerobic Digestion and wastewater Treatment systems. Antonie van
Leeuwenhoek, 67(1), 3-28.

Lettinga, G., Pol, L.H., Koster, I., Wiegant, W., De Zeeuw, W., Rinzema, A. and Hobma, S.
(1984). High-Rate Anaerobic Waste-Water Treatment using the UASB Reactor
under a Wide Range of Temperature Conditions. Biotechnology and Genetic
Engineering Reviews, 2(1), 253-284.

Light-and-Bath. (2015). Retrieved March 14, 2015, from http://www.light-and-bath.com

Li-hua, C., Wen, L., Xi-zhen, Z., Mei, M.A., Xi-hua H. and Yan-yang, X. (2006).
Performance of Hybrid Constructed Wetland Systems for Treating Septic Tank
Effluent. Journal of Environmental Sciences, 18(4), 665-669.

Luostarinen, S., Sanders, W., Kujawa-Roeleveld, K. and Zeeman, G. (2007). Effect of

Temperature on Anaerobic Treatment of Black Water in UASB-Septic Tank
Systems. Bioresource Technology, 98(5), 980-986.

Massoud, M.A., Akram, Tarhini, A. and Nasr, J.A. (2009). Decentralized Approaches to
Wastewater Treatment and Management: Applicability in Developing Countries,
Journal of Environmental Management, 90, 652–659.

McHugh, S., Carton, M., Mahony, T. and O'Flaherty, V. (2003). Methanogenic Population
Structure in a Variety of Anaerobic Bioreactors. FEMS Microbiology Letters, 219(2),
297-304.

McInerney, M.J. (1988). Anaerobic Hydrolysis and Fermentation of Fats and Proteins.
Biology of Anaerobic Microorganisms, 38, 373-415.

85
Metcalf and Eddy (2003). Wastewater Engineering: Treatment, Disposal and Reuse (4th
edition), New York, United States of America: McGraw-Hill.

Mosey, F. (1983). Mathematical Modelling of the Anaerobic Digestion Process: Regulatory

Mechanisms for the Formation of Short-Chain Volatile Acids From Glucose. Water
Science and Technology, 15(8-9), 209-232.

Moussavi, G., Kazembeigi, F. and Farzadkia, M. (2010). Performance of a Pilot Scale Up-
Flow Septic Tank for On-Site Decentralized Treatment of Residential
Wastewater. Process Safety and Environmental Protection, 88(1), 47-52.

Mueang Nonthaburi Municipality. (2014). Retrieved November 14, 2014, from

http://www.nakornnont.com

National Renewable Energy Laboratory. (2014). Retrieved December 1, 2014, from

www.nrel.gov

Nguyen, A.V., Pham, N.T., Nguyen, T.H., Morel, A. and Tonderski, K. (2007). Improved
Septic Tank with Constructed Wetland, a Promising Decentralized Wastewater
Treatment Alternative in Vietnam. Paper Presented at the Join International
Conference of the National Onsite Wastewater Recycling Association (NOWRA) and
International Water Association (IWA), Maryland, United States of America.

Nwabanne, J., Onukwuli, O. and Ifeakandu, C. (2010). Biokinetics of Anaerobic Digestion

of Municipal Waste. International Journal of Environmental Research, 3(4), 511-
516.

O'Rourke, J.T. (1968). Kinetics of Anaerobic Treatment at Reduced Temperatures. Stanford

University, United States of America.

Otaki, Y., Otaki, M., Pengchai, P., Ohta, Y., and Aramaki, T. (2008). Micro-Components
Survey of Residential Indoor Water Consumption in Chiang Mai. Drinking Water
Engineering and Science, 1, 17–25.

Pavlostathis, S. and Giraldo-Gomez, E. (1991). Kinetics of Anaerobic Treatment. Water

Science and Technology, 24(8), 35-59.

Perfecthomecenter. (2015). Retrieved March 14, 2015, from www.perfecthomecenter.com

Phadke, N., Thacker, N. and Deshpande, S. (1972). Study of a Septic Tank at Borivli,
Bombay. CPHERI Bombay Zonal Laboratory, Bombay, India.

Pickford, J. (1980). The Design of Septic Tanks and Aqua-Privies. Overseas Building Notes,
187, 1-11.

Pollution Control Department, Thailand (PCD). (2012). Manual of Management for

Domestic Wastewater. Thailand.

Pollution Control Department. (2014). Retrieved November 29, 2014, from www.pcd.go.th

86
Polprasert, C. (2007). Organic Waste Recycling (3rd edition). London, United Kingdom:
IWA Publishing.

Polprasert, C. and Rajput, V.S. (1982). Septic Tank and Septic Systems. Environmental
Sanitation Reviews, Environmental Sanitation Information Center. Asian Institute of
Technology, Thailand.

Ravotek. (2015). Retrieved January 10, 2015, from www.ravotek.co.th

Rochmadi, R., Ciptaraharja, I. and Setiadi, T. (2010). Evaluation of the Decentralized

Wastewater Treatment Plants in Four Provinces in Indonesia. Water Practice and
Technology, 5(4).

Rodgers, M., Walsh, G. and Healy, M. (2011). Different Depth Intermittent Sand Filters for
Laboratory Treatment of Synthetic Wastewater with Concentrations Close to
Measured Septic Tank Effluent. Journal of Environmental Science and Health, Part
A, 46(1), 80-85.

Rybczynski, W., Polprasert, C. and McGarry, M. (1978). Low-Cost Technology Options for
Sanitation. A State-Of-The-Art Review and Annotated Bibliography, World Bank,
Washington D.C., United States of America.

Sarathai, Y., Koottatep, T. and Morel, A. (2010). Hydraulic Characteristics of an Anaerobic

Baffled Reactor as Onsite Wastewater Treatment System. Journal of Environmental
Science (China), 22(9), 1319-1326.

Schouw, N.L., Danteravanich, S., Mosbæk, H. and Tjell, J.C. (2002). Composition of Human
Excreta-a Case Study from Southern Thailand. Science of the Total Environment,
286(1), 155-166.

Seabloom, R.W., Bounds, T., Loudon, T. and Hall, F. (2004). Septic Tanks. University of
Washington D.C., United States of America.

Shlimon, A.G., Friedrich, M.W., Niemann, H., Ramsing, N.B. and Finster, K. (2004).
Methanobacterium Aarhusense sp. nov., a Novel Methanogen Isolated from a Marine
Sediment (Aarhus Bay, Denmark). International Journal of Systematic and
Evolutionary Microbiology, 54(3), 759-763.

Siegrist, H., Renggli, D. and Gujer, W. (1993). Mathematical Modelling of Anaerobic

Mesophilic Sewage Sludge Treatment. Water Science and Technology, 27(2), 25-36.

Siegrist, H., Vogt, D., Garcia-Heras, J.L. and Gujer, W. (2002). Mathematical Model for
Meso and Thermophilic Anaerobic Sewage Sludge Digestion. Environmental
Science and Technology, 36(5), 1113-1123.

Smith, P., Bordeaux, F., Goto, M., Shiralipour, A., Wilkie, A., Andrews, J. and Barnett, M.
(1988). Biological Production of Methane from Biomass. Methane from Biomass: A
Systems Approach, 291-334.

87
Stumm, W. and Morgan, J.J. (2012). Aquatic Chemistry: An Introduction Emphasizing
Chemical Equilibria in Natural Waters. Canada: John Wiley & Sons.

Syne, N.E. (2013). Determination of Microbial Dynamics and Pathogen Inactivation

Efficiency from Themophilic Septic Tanks. (Master’s Thesis No. EV-13-13, Asian
Institute of Technology, 2013) Bangkok: Asian Institute of Technology.

Tankcenter. (2015). Retrieved March 14, 2015, from www.tankcenter.net

Tilley, E., Lüthi, C., Morel, A., Zurbrügg, C. and Schertenleib, R. (2008). Compendium of
Sanitation Systems and Technologies, Swiss Federal Institute of Aquatic Science and
Technology (EAWAG), Dübendorf, Switzerland.

U.S. EPA. (2002). Design Manual: Onsite Wastewater Treatment and Disposal Systems.
Washington D.C., United States of America.

Van Haandel, A.C. and Lettinga, G. (1994). Anaerobic Sewage Treatment: A Practical
Guide for Regions with a Hot Climate. Chichester, United Kingdom: John Wiley &
Sons.

Van Voorthuizen, E., Zwijnenburg, A., van der Meer, W. and Temmink, H. (2008).
Biological Black Water Treatment Combined with Membrane Separation. Water
Research, 42(16), 4334-4340.

Visser, A., Gao, Y. and Lettinga, G. (1993). Effects of pH on Methanogenesis and Sulphate
Reduction in Thermophilic (55 oC) UASB Reactors. Bioresource Technology, 44(2),
113-121.

Von Sperling, M. and de Lemos Chernicharo, C.A. (2005). Biological Wastewater

Treatment in Warm Climate Regions. London, United Kingdom: IWA publishing.

Wagner, E.G. and Lanoix, J.N. (1958). Excreta Disposal for Rural Areas and Small,
Communities.World Health Organization, Geneva, Switzerland.

Watanabe, T., Asakawa, S., Nakamura, A., Nagaoka, K. and Kimura, M. (2004). DGGE
Method for Analyzing 16S rDNA of Methanogenic Archaeal Community in Paddy
Field Soil. FEMS Microbiology Letters, 232(2), 153-163.

Weibel, S.R. (1949). Studies on Household Sewage Disposal Systems. Federal Security
Agency, Public Health Service, Environmental Health Center.

White, G.F., Bradley, D.J., White, A.U. and Ahmed, T. (1972). Drawers of Water.
University of Chicago, United States of America.

Wiegant, W. and Lettinga, G. (1985). Thermophilic Anaerobic Digestion of Sugars in

Upflow Anaerobic Sludge Blanket Reactors. Biotechnology and Bioengineering,
27(11), 1603-1607.

88
World Health Organisation (WHO). (1989). Health Guidelines for the Use of Wastewater in
Agriculture and Aquaculture. Report of a WHO Scientific Group, Technical Report
Series No. 778, Geneva, Switzerland.

Zehnder, A.J. (1988). Biology of Anaerobic Microorganisms. New York, United States of
America: John Wiley& Sons.

Zhou, J., Bruns, M.A. and Tiedje, J.M. (1996). DNA Recovery from Soils of Diverse
Composition. Applied and Environmental Microbiology, 62(2), 316-322.

89
Appendix A

90
Figure A-1 Experiment set up at Environmental Engineering Research Station of Asian
Institute of Technology, Thailand

91
Figure A-2 On-line temperature sensors inside laboratory-scale septic tank

Figure A-3 Diluted septage in a feeding tank

92
Figure A-3 Septage collected from household communities in central Thailand

93
Figure A-4 Control panel of solar septic tank system

Figure A-5 Solar water heating device

94
Figure A-6 Solar septic tank

95
Figure A-7 Heat exchanger device

96
 Figure A-8 Locally made solar collector

Figure A-9 Solar radiation measurement (incline 15o)

97
Appendix B

98
Table B-1 Results of Laboratory-Scale Septic Tank Operating at a HRT of 12 h and Temperature of 40 oC

TCOD SCOD BOD5

Day Influent Effluent Influent Effluent Influent Effluent
(mg/L) (mg/L) %Removal (mg/L) (mg/L) (mg/L) (mg/L) %Removal
1 806 403 50 88 96
3 422 134 68 19 119
6 422 230 45 19 54
8 1,536 325 79 200 138
10 1,790 99 94 114 52 152 25 83
13 992 397 60 99 40
15 873 315 64 79 71
17 630 310 51 110 77 315 122 61
20 929 155 83 77 66 297 118 60
35 142 36 75 71 31
40 178 54 70 60 26 137 34 75
58 2,031 476 77 33 81
63 1,463 586 60 64 87
65 1,096 495 55 72 55
69 2,528 535 79 92 70 291 103 65
70 923 372 60 85 316 126 120 5
73 1,484 465 69 153 108
74 781 205 74 182 48 165 25 85
77 1,823 124 93 78 32 273 88 68
79 1,376 388 72 53 64

99
Table B-1 Results of Laboratory-Scale Septic Tank Operating at a HRT of 12 h and Temperature of 40 oC (Con’t)

TCOD SCOD BOD5

Day Influent Effluent Influent Effluent Influent Effluent
(mg/L) (mg/L) %Removal (mg/L) (mg/L) (mg/L) (mg/L) %Removal
81 1,271 971 24 99 50 207 85 59
84 1,181 381 68 65 38
86 1,143 762 33 84 61 132 99 25
93 1,486 438 71 141 194
97 800 476 40 19 57 120 102 15
95 724 229 68 95 69 100 24 76
100 533 381 29 76 84
105 610 267 56 91 99
109 914 526 43 130 147 130 12 91
112 1,682 455 73 147 84 189 29 85
114 1,191 420 65 133 30
116 1,436 185 87 53 70 201 44 78
119 1,141 136 88 94 82 112 13 88
124 1,702 116 93 204 63 175 24 86
126 1,490 215 86 56 89 213 18 92
127 1,026 364 65 142 40 105 24 77
130 794 66 92 53 43
136 1,331 313 76 99 108 129 33 74
155 800 174 78 87 73 123 55 55
163 1,486 438 71 89 63 150 60 60
171 800 222 72 99 50 139 24 83

100
Table B-1 Results of Laboratory-Scale Septic Tank Operating at a HRT of 12 h and Temperature of 40 oC (Con’t)

TS TVS Methane
Day Influent Effluent Inside Influent Effluent Inside
(mg/L) (mg/L) %Removal (mg/L) (mg/L) (mg/L) %Removal (mg/L) L/d
1 9,784 5,238
10 410 207 50 267 137 49
13
15 347 223 36 250 187 25
17 334 186 44 240 180 25
20 580 193 67 10,356 366 147 60 4,557
22
35 0.2
40 21,310 12,700
44
46 423 193 54 123 93 24
53 0.3
70 2.1
73 0.5
74 0.5
77 1,287 73 94 857 33 96
79 1,360 303 78 913 227 75
86 1,060 833 21 743 673 9
93 747 577 23 577 330 43

101
Table B-1 Results of Laboratory-Scale Septic Tank Operating at a HRT of 12 h and Temperature of 40 oC (Con’t)

TS TVS Methane
Day Influent Effluent Inside Influent Effluent Inside
(mg/L) (mg/L) %Removal (mg/L) (mg/L) (mg/L) %Removal (mg/L) L/d
93 747 577 23 577 330 43
95 793 577 27 510 330 35
97 387 260 33 203 150 26
100 420 190 55 300 117 61
102 823 180 78 580 133 77
105 29,195 18,317
109 805 665 17 460 230 50
112 1,195 580 51 640 230 64
114 1,195 720 40 745 395 47
116 1,560 625 60 1,100 225 80
119 1,210 625 48 665 345 48 1.3
124 1,865 640 66 1,275 210 84 0.9
126 2,075 620 70 1,145 310 73
127 1,245 835 33 835 310 63 1.3
130 1,535 870 43 740 390 47 1.4
136 0.7

102
Table B-1 Results of Laboratory-Scale Septic Tank Operating at a HRT of 12 h and Temperature of 40 oC (Con’t)

Operation
Day pH Temperature (oC) Flow OLR SLR VSLR TVS/TS
Influent Effluent Influent Effluent (L/d) (kg/m3.d) (kg/m3.d) (kg/m3.d) Influent Effluent
1 7.3 7.5 28.9 39.6 80 1.6
3 7.4 7.8 27.1 38.5 80 0.8
6 7.7 7.3 27.8 40.2 80 0.8
8 7.2 6.9 27.5 37.5 80 3.1
10 6.8 7.4 28.7 37.9 80 3.6 0.8 0.5 0.7 0.7
13 7.4 7.8 29.9 40 80 2.0
15 7.8 7.1 28.6 36.8 80 1.7 0.7 0.5 0.7 0.8
17 7.3 7.8 27.5 38.1 80 1.3 0.7 0.5 0.7 1.0
20 7.8 7.8 28.2 40.2 80 1.9 1.2 0.7 0.6 0.8
22 7.6 7.6 28.7 37.6 80
35 7.5 7.6 27.4 38.6 80 0.3
38 7.6 7.5 28.8 38.5 80
40 7.8 7.4 27.5 37.5 80 0.4
44 7.5 7.6 27.3 37.5 80
46 7.6 7.5 27.2 36.8 80 0.8 0.2 0.3 0.5
49 7.3 7.4 27.4 35.2 80
51 7.4 7.7 27.4 38.2 80
53 7.3 7.5 28.3 34.1 80
54 80
58 80 4.1
60 8.3 7.7 27.7 35 80
63 7.5 7.0 26.4 34 80 2.9
65 6.8 8.4 28 36.8 80 2.2
69 8.6 7.7 26.3 34.1 80 5.1
70 7.6 7.6 25.9 33.7 80 1.8
73 7.6 7.6 27.7 32.5 80 3.0
74 7.6 7.7 26.5 34.1 80 1.6

103
Table B-1 Results of Laboratory-Scale Septic Tank Operating at a HRT of 12 h and Temperature of 40 oC (Con’t)

Operation
Day pH Temperature (oC) Flow OLR SLR VSLR TVS/TS
Influent Effluent Influent Effluent (L/d) (kg/m3.d) (kg/m3.d) (kg/m3.d) Influent Effluent
77 8.3 7.5 27.9 36.3 80 3.6 2.6 1.7 0.7 0.5
79 7.8 7.5 23.4 35.2 80 2.8 2.7 1.8 0.7 0.7
81 7.4 7.2 26.4 35 80 2.5
84 7.3 7.2 23.9 34.1 80 2.4
86 7.2 7.2 24.3 37.7 80 2.3 2.1 1.5 0.7
93 7.6 7.1 24.3 37.7 80 3.0 1.5 1.2 0.8 0.6
95 80 1.6 1.6 1.0 0.6 0.6
97 80 1.4 0.8 0.4 0.5 0.6
100 7.0 7.1 23 35.9 80 1.1 0.8 0.6 0.7 0.6
102 7.1 7.1 23 35.9 80 0.0 1.6 1.2 0.7 0.7
105 7.3 7.5 24 36.4 80 1.2
109 7.8 7.8 21 37.3 80 1.8 1.6 0.9 0.6 0.3
112 7.4 8.1 24 33.6 80 3.4 2.4 1.3 0.5 0.4
114 8.3 7.6 22 33.8 80 2.4 2.4 1.5 0.6 0.5
116 7.3 7.8 23.2 33.3 80 2.9 3.1 2.2 0.7 0.4
119 7.4 7.6 24.3 33.4 80 2.3 2.4 1.3 0.5 0.6
124 7.4 7.6 25.2 32.6 80 3.4 3.7 2.5 0.7 0.3
126 80 3.0 4.1 2.3 0.6 0.5
127 80 2.1 2.5 1.7 0.7 0.4
130 80 1.6 3.1 1.5 0.5 0.4
136 80 2.7
155 80 1.6
163 80 3.0
171 80 1.6

104
Table B-2 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 40 oC

TCOD SCOD BOD5

Day Influent Effluent Influent Effluent Influent Effluent
%Removal %Removal
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)
1 1,114 749 33 134 288
3 653 518 21 42 157
6 653 195 70 42 84
8 1,766 692 61 100 138
10 2,278 357 84 130 95 270 85 69
13 2,975 516 83 171 95
15 992 275 72 175 102
17 944 310 67 181 93 340 165 51
20 2,013 290 86 116 112 633 164 74
35 3,019 428 86 135 107
40 2,518 741 71 32 97 720 54 93
58 1,883 403 79 85 154
63 2,063 359 83 109 79
65 1,323 238 82 147 121
69 2,528 462 82 77 70 330 33 90
70 1,366 391 71 92 353 195 85 56
73 1,377 465 66 100 115
74 1,898 353 81 190 71 270 60 78
77 3,237 441 86 138 67 414 222 46
79 2,718 529 81 95 64
81 1,553 362 77 78 34 435 67 85
84 2,019 229 89 80 53

105
Table B-2 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 40 oC (Con’t)

TCOD SCOD BOD5

Day Influent Effluent Influent Effluent Influent Effluent
%Removal %Removal
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)

86 3,048 838 73 107 110 292 54 82

93 1,333 210 84 126 65
95 1,867 324 83 95 103 300 135 55
97 800 152 81 141 99 240 90 63
100 2,133 267 88 152 84
105 990 381 62 99 99
109 1,143 420 63 175 126 225 90 60
112 1,682 315 81 259 105 427 22 95
114 1,261 386 69 147 77
116 1,647 252 85 123 37 220 52 76
119 1,410 272 81 74 65 226 26 88
124 2,383 281 88 116 76 150 45 70
126 1,556 215 86 63 93 195 18 91
127 1,761 331 81 149 53 135 72 47
136 1,265 348 73 79 97 270 48 82
155 1,591 261 84 101 87 157 108 31
163 626 134 79 205 129 277 93 66
171 2,017 239 88 94 194 205 36 82

106
Table B-2 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 40 oC (Con’t)

TS TVS Methane
Day Influent Effluent Inside Influent Effluent Inside
%Removal %Removal L/d
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)
1 10,086 5,392
10 317 250 21 283 157 45
13 853 473 45 597 225 62
15
17 731 183 75 511 149 71
20 11,793 5,307
35 1.0
40 18,270 12,500
54 1.8
58 1,249 210 83 1,023 393 62
69 1.1
70 0.7
73 2,363 343 85 1,376 465 66
74 0.6
77 2,757 450 84 2,363 243 90
79 1,722 293 83 1,463 250 83
81 1,814 346 81 1,597 246 85
84 1,772 583 67 1,400 513 63
86 1,873 197 89 1,423 183 87

107
Table B-2 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 40 oC (Con’t))

TS TVS Methane
Day Influent Effluent Inside Influent Effluent Inside
%Removal %Removal L/d
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)

93 1,512 161 89 1,210 157 87

95 1,869 237 87 1,403 157 89
100 790 223 72 593 133 78
105 24,592 16,669
109 1,087 535 51 1,055 460 56
112 1,451 645 56 1,420 315 78
114 3,893 610 84 3,815 290 92
116 1,988 825 59 1,710 355 79
119 1,150 578 50 1,035 520 50 1.7
124 2,269 525 77 1,815 315 83 1.1
126 1,433 253 82 1,275 225 82
127 2.5
130 1,783 760 57 1,605 290 82 1.0
136 1.2

108
Table B-2 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 40 oC (Con’t)

Operation
Day pH Temperature (oC) Flow OLR SLR TVS/TS
VSLR
Influent Effluent Influent Effluent (L/d) (kg/m3.d) (kg/m3.d) (kg/m3.d) Influent Effluent
1 7.4 7.7 28.7 41.7 40 1.1
3 7.8 7.7 27.0 40.4 40 0.7
6 7.8 7.2 27.9 40.0 40 0.7
8 7.2 6.9 28.0 39.8 40 1.8
10 7.0 7.5 28.5 38.2 40 2.3 0.3 0.3 0.9 0.6
13 7.3 7.3 29.6 40.5 40 3.0 0.9 0.6 0.7 0.5
15 7.8 7.4 28.5 36.4 40 1.0
17 7.2 7.8 27.5 39.9 40 0.9 0.7 0.5 0.7 0.8
20 7.7 7.7 28.4 38.9 40 2.0
22 7.9 7.6 28.1 40.0 40
35 40 3.0
38 7.6 7.6 27.5 38.4 40
40 7.7 7.4 28.7 35.3 40 2.5
44 7.9 7.4 27.3 34.7 40
46 7.3 7.1 25.9 35.6 40
49 7.2 7.3 25.6 38.9 40
51 7.5 7.3 27.4 37.5 40
53 7.3 7.6 29.4 35.1 40
54 40
58 40 1.9 1.2 1.0 0.8 1.9
60 7.3 7.0 27.7 35.8 40
63 40 2.1

109
Table B-2 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 40 oC (Con’t)

Operation
Day pH Temperature (oC) Flow OLR SLR TVS/TS
VSLR
Influent Effluent Influent Effluent (L/d) (kg/m3.d) (kg/m3.d) (kg/m3.d) Influent Effluent
65 7.1 7.4 27.7 35.5 40 1.3
69 7.6 7.6 26.7 35.8 40 2.5
70 7.7 7.5 26.6 35.5 40 1.4
73 7.6 7.6 26.9 35.9 40 1.4 2.4 1.4 0.6 1.4
74 7.7 7.5 28.4 35.2 40 1.9
77 7.6 7.2 25.7 35.3 40 3.2 2.8 2.4 0.9 0.5
79 40 2.7 1.7 1.5 0.8 0.9
81 40 1.6 1.8 1.6 0.9 0.7
84 7.4 7.1 24.4 33.4 40 2.0 1.8 1.4 0.8 0.9
86 7.3 7.5 24.4 35.1 40 3.0 1.9 1.4 0.8 0.9
93 40 1.3 1.5 1.2 0.8 1.0
95 40 1.9 1.9 1.4 0.8 0.7
95 40 0.8
100 7.0 7.1 23.0 35.9 40 2.1 0.8 0.6 0.8 0.6
102 7.1 7.1 23.0 35.9 40
105 7.3 7.5 24.0 36.4 40 1.0
109 7.8 7.8 21.0 37.3 40 1.1 1.1 1.1 0.9
112 7.4 8.1 24.0 33.6 40 1.7 1.5 1.4 1.0 0.5
114 8.3 7.6 22.0 33.8 40 1.3 3.9 3.8 1.0 0.5

110
Table B-2 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 40 oC (Con’t)

Operation
Day pH Temperature (oC) Flow OLR SLR TVS/TS
VSLR
Influent Effluent Influent Effluent (L/d) (kg/m3.d) (kg/m3.d) (kg/m3.d) Influent Effluent
116 7.3 7.8 23.2 33.3 40 1.6 2.0 1.7 0.9 0.4
119 7.4 7.6 24.3 33.4 40 1.4 1.1 1.0 0.9 0.9
124 7.4 7.6 25.2 32.6 40 2.4 2.3 1.8 0.8 0.6
126 40 1.6 1.4 1.3 0.9 0.9
127 40 1.8 0.7
130 40 1.8 1.6 0.4
136 40 1.3
155 40 2
163 40 1
171 40 2

111
Table B-3 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 30 oC

TCOD SCOD BOD5

Day Influent Effluent Influent Effluent Influent Effluent
%Removal %Removal
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)
1 1,114 518 53 134 150
3 653 250 62 42 119
6 653 230 65 42 77
8 1,766 569 68 100 146
10 2,278 476 79 130 91 270 124 54
13 2,975 317 89 171 71
15 992 393 60 175 110
17 944 271 71 181 101 340 153 55
20 2,013 406 80 116 97 633 194 69
35 3,019 502 83 135 149
40 2,518 812 68 32 90 720 57 92
58 1,883 476 75 85 103
63 2,063 397 81 109 94
65 1,323 421 68 147 70
69 2,528 462 82 77 63 330 63 81
70 1,366 279 80 92 228 195 39 80
73 1,377 428 69 100 123
74 1,898 353 81 190 63 270 80 71
77 3,237 371 89 138 25 414 186 55
79 2,718 459 83 95 71

112
Table B-3 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 30 oC (Con’t)

TCOD SCOD BOD5

Day Influent Effluent Influent Effluent Influent Effluent
%Removal %Removal
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)

81 1,553 857 45 78 50 435 183 58

84 2,019 343 83 80 69
86 3,048 495 84 107 53 292 90 69
93 1,333 629 53 126 103
95 1,867 667 64 95 110 300 210 30
97 800 252 68 141 69 240 108 55
100 2,133 343 84 152 99
105 990 571 42 99 76
109 1,143 701 39 175 147 225 72 68
112 1,682 481 71 259 84 427 120 72
114 1,261 420 67 147 64
116 1,647 218 87 123 77 220 67 70
119 1,410 511 64 74 85 226 60 73
124 2,383 546 77 116 56 150 40 73
126 1,556 546 65 63 70 195 36 82
127 1,761 728 59 149 66 135 114 16
136 1,265 426 66 79 79 270 55 80
155 1,591 400 75 101 96 157 120 24
163 626 391 38 205 212 277 113 59
171 2,017 1,182 41 94 159 205 57 72

113
Table B-3 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 30 oC (Con’t)

TS TVS Methane
Day Influent Effluent Inside Influent Effluent Inside
%Removal %Removal L/d
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)
1 10,388 5,546

10 317 197 38 283 167 41

13 853 200 77 597 158 74

15
17 731 172 77 511 120 77
14,813
20 31,518
35 0.2
35,575 26,570
40
54 0.5
58 1,249 349 72 1,023 286 72

69 0.3
70 0.2
73 2,363 280 88 1,376 576 58

74 0.3
77 2,757 343 88 2,363 207 91

114
Table B-3 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 30 oC (Con’t)

TS TVS Methane
Day Influent Effluent Inside Influent Effluent Inside
%Removal %Removal L/d
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)

79 1,722 733 57 1,463 577 61

81 1,814 540 70 1,597 440 72

84 1,772 386 78 1,400 340 76

86 1,873 987 47 1,423 653 54

93 1,512 640 58 1,210 430 64

95 1,869 700 63 1,403 393 72

100 790 243 69 593 157 74

102
105 44,407 28,436
109 1,087 546 50 1,055 410 61

112 1,451 630 57 1,420 315 78

114 3,893 388 90 3,815 380 90

116 1,988 685 66 1,710 260 85

119 1,150 802 30 1,035 690 33 0.6

124 2,269 930 59 1,815 550 70 1.2
126 1,433 725 49 1,605 790 51

127 1.5
130 1,783 888 50 1,275 580 55 0.6
136 0.7

115
Table B-3 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 30 oC (Con’t)

Operation
Day pH Temperature (oC) Flow OLR SLR TVS/TS
VSLR
Influent Effluent Influent Effluent (L/d) (kg/m3.d) (kg/m3.d) (kg/m3.d) Influent Effluent
1 7.4 7.6 28.7 29.0 40 1.1
3 7.8 8.0 27.0 29.6 40 0.7
6 7.8 7.2 27.9 28.8 40 0.7
8 7.2 6.8 28.0 29.0 40 1.8
10 7.0 7.8 28.5 28.9 40 2.3 0.3 0.3 0.9 0.8
13 7.3 6.9 29.6 30.0 40 3.0 0.9 0.6 0.7 0.8
15 7.8 7.1 28.5 28.8 40 1.0
17 7.2 7.8 27.5 28.3 40 0.9 0.7 0.5 0.7 0.7
20 7.7 7.7 28.4 28.3 40 2.0
22 7.9 7.6 28.1 28.9 40
35 40 3.0
38 7.6 7.6 27.5 28.7 40
40 7.7 7.4 28.7 26.9 40 2.5
44 7.9 7.3 27.3 25.5 40
46 7.3 7.2 25.9 25.7 40
49 7.2 7.4 25.6 24.7 40
51 7.5 7.2 27.4 29.0 40
53 7.3 7.6 29.4 27.0 40
54 40
58 40 1.9 1.2 1.0 0.8 0.8
60 7.3 7.5 27.7 25.2 40
63 40 2.1

116
Table B-3 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 30 oC (Con’t)

Operation
Day pH Temperature (oC) Flow OLR SLR TVS/TS
VSLR
Influent Effluent Influent Effluent (L/d) (kg/m3.d) (kg/m3.d) (kg/m3.d) Influent Effluent
65 7.1 7.3 27.7 25.3 40 1.3
69 7.6 7.5 26.7 24.9 40 2.5
70 7.7 7.6 26.6 26.0 40 1.4
73 7.6 7.5 26.9 27.3 40 1.4 2.4 1.4 0.6 2.1
74 7.7 7.5 28.4 25.8 40 1.9
77 7.6 7.1 25.7 28.9 40 3.2 2.8 2.4 0.9 0.6
79 40 2.7 1.7 1.5 0.8 0.8
81 40 1.6 1.8 1.6 0.9 0.8
84 7.4 7.2 24.4 25.8 40 2.0 1.8 1.4 0.8 0.9
86 7.3 7.2 24.4 22.7 40 3.0 1.9 1.4 0.8 0.7
93 40 1.3 1.5 1.2 0.8 0.7
95 40 1.9 1.9 1.4 0.8 0.6
97 40 0.8
100 7.0 7.1 23.0 35.9 40 2.1 0.8 0.6 0.8 0.6
102 7.1 7.1 23.0 35.9 40
105 7.3 7.5 24.0 36.4 40 1.0
109 7.8 7.8 21.0 37.3 40 1.1 1.1 1.1 1.0 0.8

117
Table B-3 Results of Laboratory-Scale Septic Tank Operating at a HRT of 24 h and Temperature of 30 oC (Con’t)

Operation
Day pH Temperature (oC) Flow OLR SLR TVS/TS
VSLR
Influent Effluent Influent Effluent (L/d) (kg/m3.d) (kg/m3.d) (kg/m3.d) Influent Effluent
114 8.3 7.6 22.0 33.8 40 1.3 3.9 3.8 1.0 1.0
116 7.3 7.8 23.2 33.3 40 1.6 2.0 1.7 0.9 0.4
119 7.4 7.6 24.3 33.4 40 1.4 1.1 1.0 0.9
124 7.4 7.6 25.2 32.6 40 2.4 2.3 1.8 0.5 0.6
126 40 1.6 1.4 1.6 1.3 1.1
127 40 1.8
130 40 1.8 1.3
136 40 1.3
155 40 1.6
163 40 0.6
171 40 2.0

118
Table B-4 Results of Laboratory-Scale Septic Tank Operating at a HRT of 48 h and Temperature of 40 oC

TCOD SCOD BOD5

Day Influent Effluent Influent Effluent Influent Effluent
%Removal %Removal
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)
1 1,306 749 43 242 119
3 1,882 173 91 27 35
6 1,882 422 78 27 61
8 3,763 1,261 66 146 203
10 3,010 337 89 212 147 630 187 70
13 4,959 873 82 409 175
15 2,380 669 72 333 220
17 2,675 503 81 94 232 1,325 230 83
20 2,632 368 86 310 115 1,230 183 85
35 2,133 196 91 370 147
40 3,284 455 86 107 180 1,680 122 93
58 2,931 356 88 185 117
63 3,704 861 77 188 129
65 4,763 942 80 265 110
69 3,618 874 76 125 126 930 180 81
70 2,158 1,098 49 185 1,009 435 90 79
73 2,456 912 63 186 246
74 6,474 688 89 380 171 360 285 21
77 4,729 812 83 156 92 1,140 450 61

119
Table B-4 Results of Laboratory-Scale Septic Tank Operating at a HRT of 48 h and Temperature of 40 oC (Con’t)

TCOD SCOD BOD5

Day Influent Effluent Influent Effluent Influent Effluent
%Removal %Removal
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)

79 4,941 705 86 134 148

81 4,190 686 84 155 145 1,012 180 82
84 5,486 610 89 160 137
86 3,276 362 89 107 198 480 105 78
93 1,448 476 67 221 65

95 1,448 495 66 236 168 600 270 55

97 2,286 876 62 282 137 660 300 55
100 4,114 800 81 168 533
105 4,114 736 82 152 137
109 4,485 783 83 373 266 780 180 77
112 2,663 1,393 48 589 825 915 135 85
114 3,434 117 97 238 108
116 3,357 613 82 231 47 300 37 88
119 3,949 546 86 175 150 570 60 89
124 3,906 745 81 204 73 480 40 92
126 3,112 1,390 55 139 99 450 120 73
127 2,119 33 98 232 26 210 30 86
136 1,426 470 67 212 63 780 180 77
155 4,114 736 82 226 94 690 360 48
163 4,485 783 83 225 126 555 165 70
171 3,310 664 78 185 209 225 45 80

120
Table B-4 Results of Laboratory-Scale Septic Tank Operating at a HRT of 48 h and Temperature of 40 oC (Con’t)

TS TVS Methane
Day Influent Effluent Inside Influent Effluent Inside
%Removal %Removal L/d
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)
1 8,450 4,349

10 897 443 51 477 190 60

15 1,287 510 60 1,120 363 68
17 1,543 257 83 1,120 217 81
4,063
20 1,797 210 88 9,911 1,309 203 84
35 1.1
8,445 5,485
40
46 2,480 596 76 1,720 413 76
54 0.8
69 2.0
70 1.4
74 0.9
77 5,497 623 89 3,790 477 87
79 5,470 610 89 3,707 473 87
86 1,333 340 75 1,060 307 71
93 1,817 340 81 1,433 307 79

121
Table B-4 Results of Laboratory-Scale Septic Tank Operating at a HRT of 48 h and Temperature of 40 oC (Con’t)

TS TVS Methane
Day Influent Effluent Inside Influent Effluent Inside
%Removal %Removal L/d
(mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)

95 1,470 500 66 1,030 287 72

97 1,047 337 68 730 263 64
100 1,477 850 42 1,107 455 59
102 1,930 507 74 1,407 427 70
105 22,793 16,646
109 2,090 1,030 51 1,480 495 67
112 3,680 2,030 45 2,505 650 74
114 2,030 1,080 47 1,345 325 76
116 3,360 670 80 2,395 240 90
119 2,925 1,020 65 1,850 715 61 1.3
124 3,815 1,140 70 2,650 480 82 1.3
126 3,570 1,135 68 2,280 730 68
127 2,725 1,760 35 1,760 955 46 1.7
130 2,410 1,385 43 1,495 720 52 2.1
136 2

122
Table B-4 Results of Laboratory-Scale Septic Tank Operating at a HRT of 48 h and Temperature of 40 oC (Con’t)

Operation
Day pH Temperature (oC) Flow OLR SLR TVS/TS
VSLR
Influent Effluent Influent Effluent (L/d) (kg/m3.d) (kg/m3.d) (kg/m3.d) Influent Effluent
1 7.8 7.5 28.4 40.0 20 0.7
3 7.9 7.6 26.8 38.6 20 0.9
6 7.9 7.1 27.9 40.0 20 0.9
8 7.2 6.9 27.6 39.2 20 1.9
10 7.0 8.0 28.5 39.7 20 1.5 0.2 0.2 0.5 0.4
13 7.4 6.8 29.6 40.2 20 2.5
15 7.9 7.3 28.3 40.4 20 1.2 0.6 0.6 0.9 0.7
17 7.3 8.0 27.5 40.6 20 1.3 0.8 0.6 0.7 0.8
20 8.3 7.8 28.1 40.1 20 1.3 0.9 0.7 0.7 1.0
22 7.5 8.0 28.1 40.1 20
35 8.2 8.1 27.5 40.7 20 1.1
38 8.3 7.5 28.4 40.0 20
40 7.8 7.5 27.5 40.0 20 1.6
44 7.7 7.4 27.2 40.1 20
46 7.9 7.3 26.8 39.8 20 1.2 0.9
49 7.5 7.4 27.4 36.8 20
51 7.7 7.5 27.0 38.7 20
53 7.4 7.3 28.5 32.6 20
54 20
58 20 1.5
60 8.3 7.6 27.5 38.4 20
63 7.5 6.9 25.0 37.0 20 1.9

123
Table B-4 Results of Laboratory-Scale Septic Tank Operating at a HRT of 48 h and Temperature of 40 oC (Con’t)

Operation
Day pH Temperature (oC) Flow OLR SLR TVS/TS
VSLR
Influent Effluent Influent Effluent (L/d) (kg/m3.d) (kg/m3.d) (kg/m3.d) Influent Effluent
65 7.3 8.4 27.4 36.0 20 2.4
69 8.7 7.6 25.9 36.0 20 1.8
70 7.9 7.6 26.5 34.0 20 1.1
73 7.6 7.8 27.1 34.0 20 1.2
74 7.6 7.5 26.9 35.3 20 3.2
77 7.7 7.5 28.0 36.9 20 2.4 2.7 1.9 0.7 0.8
79 8.0 7.5 25.1 36.4 20 2.5 2.7 1.9 0.7 0.8
81 7.7 7.3 27.3 32.6 20 2.1
84 7.2 7.3 24.1 32.6 20 2.7
86 7.5 7.3 23.5 32.8 20 1.6 0.7 0.5 0.8 0.9
93 7.3 7.2 23.5 32.9 20 0.7 0.9 0.7 0.8 0.9

95 20 0.7 0.7 0.5 0.7 0.6

97 20 1.1 0.5 0.4 0.7 0.8
100 7.1 7.9 23.6 37.2 20 2.1 0.7 0.6 0.7 0.5
102 7.3 7.3 23.6 37.2 20 - 1.0 0.7 0.7 0.8
105 7.3 7.7 25.2 33.4 20 2.1
109 7.6 7.7 21.8 36.8 20 2.2 1.0 0.7 0.7 0.5

124
Table B-4 Results of Laboratory-Scale Septic Tank Operating at a HRT of 48 h and Temperature of 40 oC (Con’t)

Operation
Day pH Temperature (oC) Flow OLR SLR TVS/TS
VSLR
Influent Effluent Influent Effluent (L/d) (kg/m3.d) (kg/m3.d) (kg/m3.d) Influent Effluent
112 7.3 7.3 23.0 35.9 20 1.3 1.8 1.3 0.7 0.3
114 7.4 7.2 22.0 37.0 20 1.7 1.0 0.7 0.7 0.3
116 7.3 7.7 21.6 36.9 20 1.7 1.7 1.2 0.7 0.4
119 7.5 7.7 24.0 37.1 20 2.0 1.5 0.9 0.6 0.7
124 7.4 7.6 26.0 41.1 20 2.0 1.9 1.3 0.7 0.4
126 20 1.6 1.8 1.1 0.6 0.6
127 20 1.1 1.4 0.9 0.6 0.5
130 20 1.2 0.7 0.6 0.5
136 20 0.7
155 20 2.1
163 20 2.2
171 20 1.7

125
Appendix C

126
Table C-1 Dynamic Modelling
Parameter Type of Description Unit Useful info
elements
SG Stock Biodegradation (Non VFA) soluble organic concentration mg/L Initial value = 300
Sp Stock Propionic acid mg/L Initial value = 5
SB Stock Butyric acid mg/L Initial value = 2
SA Stock Acetic acid mg/L Initial value = 30
Xaf Stock Acid former concentration mg/L Initial value = 85
Xpa Stock Propionic acid utilizing acetogen concentration mg/L Initial value = 1250
Xba Stock Butyric acid utilizing acetogen concentration mg/L Initial value = 400
Xam Stock acetoclastic acetogens utilizing acetogen concentration mg/L Initial value = 1900
uaf Convertor Growth rate acid former d-1
Pp,af Convertor Regular function for the production of propionic acid by acid former -
Pa,af Convertor Regular function for the production of acetic acid by acid former -
Pb,af Convertor Regular function for the production of butyric acid by acid former -
upa Convertor Growth rate propionic former d-1
uba Convertor Growth rate butyric former d-1
uam Convertor Growth rate acetoclastic acetogens d-1
Q Convertor Flow rate L/d
Qg,CH4 Stock Total methane flow L/d
t Convertor Time d
Yaf Convertor Acid-former yield coefficient 0.15 mg/mg
Ypa Convertor Propionic acid acetogens yield coefficient 0.04 mg/mg
Yba Convertor Butylic acid acetogens yield coefficient 0.04 mg/mg
Yam Convertor Acetoclastic acetogens yield coefficient 0.055 mg/mg
vp,af Convertor Stoichiometric coefficient for propionate production 2MWp/MWg mg/mg
vb,af Convertor Stoichiometric coefficient for butyrate production MWb/MWg mg/mg
va,af Convertor Stoichiometric coefficient for acid former acetate production 2MWa/MWg mg/mg
va,pa Convertor Stoichiometric coefficient for acid former acetate production from propionate MWa/MWp mg/mg
va,ba Convertor Stoichiometric coefficient for acid former acetate production from butyrate 2MWa/MWb mg/mg
vCH4,am Convertor Stoichiometric coefficient for acetoclastic methanogenesis 1/MWa mmole/mg
vCH4,bm Convertor Stoichiometric coefficient for methane from hydrogen 1/4 mmole/mmole

127
Table C-1 Dynamic Modelling (Con’t)
Parameter Type of Description Unit Useful info
elements
vhpaf Convertor Stoichiometric coefficient for hydrogen in propionate production reaction -2/MWg mmole/mg
v hbaf Convertor Stoichiometric coefficient for hydrogen in butyrate production reaction 2/MWg mmole/mg
v haaf Convertor Stoichiometric coefficient for hydrogen in acid former acetate production reaction 4/MWg mmole/mg
vhpa Convertor Stoichiometric coefficient for hydrogen in acetogenic consumption of propionate 3/MWp mmole/mg
vhba Convertor Butyrate 2/MWb mmole/mg
umax af Convertor Maximum specific growth rate acid formers 13 d-1
umax pa Convertor Maximum specific growth rate propionic acetogen 0.4 d-1
umax ba Convertor Maximum specific growth rate butylic acetogen 0.4 d-1
umax am Convertor Maximum specific growth rate acetoclastic methanogen 0.3 d-1
naf Convertor maximum acid formation yield factor 0.80 -
KIam Convertor Inhibition coefficient - acetoclastic 1000 mg/L
Kaf Convertor Saturation coefficient acid former 300 mg/L
Kpa Convertor Saturation coefficient propionic acitogen 130 mg/L
Kba Convertor Saturation coefficient butyric acitogen 10 mg/L
Kam Convertor Saturation coefficient acetoclastic methanogen 75 mg/L
KIpa Convertor Inhibition coefficient propionic acitogen 500 mg/L
KIba Convertor Inhibition coefficient butyric acitogen 1000 mg/L
KIga Convertor Inhibition coefficient acetoclastic methanogen 250 mg/L
fp Convertor Maximum fraction of propionic acid from acid formers 0.8 -
kgp Convertor Saturation coefficient acid former propionate production 1000 mg/L
kdaf Convertor Decay rate AF 0.8 d-1
kdp Convertor Decay rate P 0.06 d-1
kdb Convertor Decay rate B 0.06 d-1
kdam Convertor Decay rate AM 0.05 d-1
Ratio cellulose Convertor Fraction of cellulose from feces 0.3 -
Ratio fat Convertor Fraction of Fat from feces 0.18 -
Ratio protein Convertor Fraction of protein from feces 0.15 -
Ratio bacteria Convertor Fraction of bacteria from feces 0.02 -
Ratio IC Convertor Fraction of IC from feces 0.3 -

128
Table C-2 Dynamic Modelling: Simulated Equations
Parameter Type of Description Value
elements
Inflow Flow Influent wastewater Flow*s
Outflow Flow Effluent wastewater Convert_to_p+Convert_to_AA+Convert_to_b)
Convert p Flow Convert glucose to propionic acid r_su_aF*acid_re_for_p
Convert b Flow Convert glucose to butyric acid r_su_aF*Acid_re_for_b
Convert a Flow Convert glucose to acetic acid (r_su_aF*aicsd_rate_for_A)+(S_P_convert*vapa)+(SB_CONVERT*vaba)
CH4 Flow Convert glucose to CH4 Vs*(vCH4AM+(vCH4HM*vh*r_su_aF)+vhpa+vhba)
In uaf Flow Inflow and growth rate of biomass af rg_AF = uAF*X_AF
In up Flow Inflow and growth rate of biomass p Rg_p = UPA*X_p
In ub Flow Inflow and growth rate of biomass b Rg_B = UB*X_B
In uam Flow Inflow and growth rate of biomass am Rg_AM = U_am*X_AM
Out af Flow Decay rate acid former Kdaf*xaf
Out p Flow Decay rate propionic acid by acid former Kdp*xp
Out b Flow Decay rate butyric acid by acid former Kdb*xb
Oot am Flow Decay rate acetoclastic acetogens Kdam*xam

129
Table C-3 Dynamic Modelling of Septic Tank Performance

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

1.0 1,377.1 0.6 32.4 1,354.8 0.4 33.9 2,131.8 0.3 34.9

1.5 1,308.1 0.3 17.6 1,455.0 0.2 17.9 1,440.5 0.2 26.4

2.0 1,730.0 0.3 38.1 1,370.0 0.3 45.5 1,358.7 0.2 37.9

2.5 1,298.2 0.4 64.5 1,945.8 0.4 86.0 1,483.2 0.3 55.9

3.0 1,901.6 0.5 96.6 1,843.0 0.6 117.7 2,161.3 0.4 76.2

3.5 1,450.9 0.6 114.6 1,577.0 0.7 156.4 1,617.8 0.5 97.1

4.0 1,679.5 0.7 137.2 1,304.6 0.8 185.9 1,705.8 0.6 123.5

4.5 1,847.3 0.7 146.8 1,547.6 0.9 199.3 1,564.0 0.7 146.8

5.0 1,530.6 0.8 155.3 1,824.5 0.9 197.8 1,310.3 0.8 168.1

5.5 1,850.8 0.8 165.5 1,615.3 0.9 198.9 1,783.9 0.9 185.8

6.0 1,352.4 0.9 167.1 1,307.0 1.0 208.1 1,382.1 0.9 198.3

6.5 1,905.4 0.9 172.8 1,558.1 1.0 212.0 1,420.0 1.0 211.1

7.0 1,699.0 0.9 167.8 1,698.5 1.0 205.1 1,961.1 1.0 219.9

7.5 2,161.6 0.9 172.6 1,836.3 1.0 203.4 2,002.1 1.0 226.1

8.0 1,680.4 0.9 174.9 1,831.6 1.0 207.4 2,061.3 1.1 235.4

8.5 1,443.0 1.0 186.0 1,884.8 1.1 216.0 1,812.6 1.1 246.1

9.0 1,574.1 1.0 186.9 1,948.1 1.1 224.1 1,851.4 1.2 257.8

9.5 1,404.5 1.0 179.4 1,363.3 1.1 231.8 2,051.9 1.2 267.2

10.0 1,794.8 0.9 173.9 1,827.6 1.2 239.5 2,035.9 1.2 275.1

10.5 1,994.1 0.9 166.5 1,664.8 1.1 229.5 1,789.3 1.3 283.6

11.0 1,716.8 0.9 168.5 1,903.2 1.1 229.2 1,863.5 1.3 291.7

130
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

12.0 1,539.1 1.0 180.1 1,715.1 1.2 231.9 2,138.2 1.4 301.1

12.5 1,374.2 1.0 183.7 2,018.2 1.2 235.7 1,516.4 1.4 302.5

13.0 1,323.7 1.0 179.8 1,613.5 1.2 235.1 2,051.0 1.4 306.4

13.5 1,661.1 0.9 171.0 1,398.5 1.2 241.6 1,819.4 1.4 306.0

14.0 2,002.1 0.9 161.4 1,669.5 1.2 237.7 2,009.9 1.4 307.9

14.5 2,045.2 0.9 161.0 2,020.7 1.1 225.7 1,425.7 1.4 309.0

15.0 1,396.4 0.9 170.7 1,956.3 1.1 221.2 1,525.9 1.4 311.1

15.5 1,426.9 1.0 182.4 1,818.4 1.1 229.6 1,466.8 1.4 308.7

16.0 1,438.2 0.9 178.0 1,690.2 1.2 238.2 2,045.9 1.4 304.7

16.5 2,172.9 0.9 170.5 1,323.2 1.2 241.2 2,165.0 1.4 299.3

17.0 1,953.9 0.9 163.9 1,996.6 1.2 238.5 1,456.0 1.4 298.5

17.5 2,095.3 0.9 174.9 1,866.1 1.1 224.6 1,908.0 1.4 301.4

18.0 1,357.9 1.0 184.1 1,890.2 1.1 228.8 2,069.4 1.4 300.2

18.5 1,845.0 1.0 193.9 1,900.5 1.2 233.9 2,014.7 1.4 300.6

19.0 1,681.1 1.0 185.7 1,795.8 1.2 238.8 1,439.2 1.4 303.4

19.5 1,900.4 1.0 184.5 2,124.5 1.2 242.9 2,048.9 1.4 306.9

20.0 1,315.7 1.0 182.2 2,004.4 1.2 243.1 1,555.9 1.4 305.6

20.5 1,592.7 1.0 184.7 2,158.8 1.2 251.1 1,866.9 1.4 307.0

21.0 1,929.5 1.0 175.5 2,008.6 1.3 256.4 1,970.4 1.4 305.4

21.5 2,156.2 0.9 170.7 1,693.2 1.3 264.1 1,292.7 1.4 305.0

131
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

22.5 1,286.5 1.0 187.2 1,323.9 1.3 258.7 1,318.0 1.4 302.3

23.0 1,741.7 1.0 185.5 1,486.3 1.3 252.0 2,086.4 1.4 302.2

23.5 1,483.0 0.9 174.2 1,334.9 1.2 234.1 1,874.6 1.4 298.0

24.0 1,305.3 0.9 172.3 1,768.0 1.1 221.2 2,138.0 1.4 298.3

24.5 1,819.5 0.9 168.0 2,000.7 1.1 208.2 1,393.8 1.4 299.3

25.0 1,754.4 0.9 160.0 1,451.1 1.1 209.8 1,580.1 1.4 303.1

25.5 1,993.9 0.9 163.8 1,832.0 1.1 221.7 1,427.7 1.4 301.8

26.0 1,903.5 0.9 168.8 1,585.1 1.1 219.1 1,752.5 1.4 299.2

26.5 1,598.8 0.9 178.3 1,384.3 1.1 223.2 2,130.0 1.4 294.7

27.0 1,321.9 1.0 185.2 1,373.9 1.1 221.7 1,462.3 1.4 292.0

27.5 1,364.7 1.0 183.3 1,808.2 1.1 213.3 2,078.6 1.4 293.9

28.0 1,526.4 0.9 173.1 1,427.8 1.0 204.4 1,969.8 1.4 292.6

28.5 2,133.3 0.9 163.6 2,145.1 1.0 209.1 1,859.9 1.4 294.8

29.0 1,316.7 0.9 159.8 1,762.5 1.0 206.3 1,688.3 1.4 298.0

29.5 1,617.0 0.9 171.6 2,108.9 1.1 221.7 2,009.4 1.4 300.7

30.0 1,487.3 0.9 167.9 1,524.1 1.1 228.6 2,021.8 1.4 301.5

30.5 1,679.5 0.9 166.9 1,910.7 1.2 241.2 2,094.6 1.4 303.9

31.0 1,668.4 0.9 164.0 1,373.3 1.2 236.7 1,901.1 1.4 307.3

31.5 1,426.2 0.9 165.4 1,644.1 1.2 238.8 1,276.9 1.4 311.6

32.0 1,642.1 0.9 167.5 1,776.9 1.1 227.6 1,753.6 1.4 314.7

132
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

33.5 1,767.0 0.9 159.3 1,947.3 1.1 227.9 2,036.5 1.4 309.9

34.0 2,120.8 0.9 165.0 1,353.3 1.2 233.7 1,560.9 1.4 310.5

34.5 1,488.3 0.9 170.6 1,633.1 1.2 240.5 1,841.7 1.4 312.5

35.0 1,491.4 1.0 182.7 2,120.9 1.2 229.7 2,163.2 1.4 311.2

35.5 1,945.2 1.0 180.4 1,870.8 1.1 223.8 1,852.6 1.4 310.4

36.0 1,679.1 0.9 174.4 1,391.7 1.2 234.0 1,316.9 1.4 312.7

36.5 1,753.8 1.0 178.4 1,460.0 1.2 239.8 1,932.8 1.5 314.0

37.0 2,163.2 1.0 178.8 1,583.4 1.2 230.0 1,292.4 1.4 310.1

37.5 1,738.8 1.0 179.7 1,460.2 1.1 219.6 1,642.5 1.4 308.6

38.0 1,820.2 1.0 189.4 2,170.8 1.1 214.5 1,818.5 1.4 302.9

38.5 1,954.0 1.0 190.4 1,574.4 1.1 208.6 2,150.0 1.4 298.3

39.0 1,970.3 1.0 190.5 1,823.5 1.1 223.3 1,273.3 1.4 295.9

39.5 1,660.9 1.0 193.1 1,446.2 1.1 224.5 2,066.9 1.4 298.0

40.0 2,060.6 1.1 196.3 1,934.5 1.1 228.5 1,748.9 1.4 294.8

40.5 2,004.8 1.1 192.3 1,473.7 1.1 221.9 1,378.0 1.4 295.8

41.0 2,055.9 1.1 195.7 1,949.3 1.1 227.2 1,832.6 1.4 296.3

41.5 2,007.1 1.1 199.4 2,076.9 1.1 222.1 1,892.8 1.4 293.2

42.0 2,029.5 1.1 203.5 1,706.3 1.1 228.1 2,123.7 1.4 292.3

42.5 1,400.3 1.1 205.7 1,794.4 1.2 239.7 1,372.9 1.4 293.1

43.0 2,130.3 1.1 207.5 1,491.5 1.2 240.2 2,136.4 1.4 296.9

43.5 1,298.6 1.1 195.1 1,544.0 1.2 239.9 2,019.6 1.4 295.8

133
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

44.5 2,128.6 1.0 184.6 1,380.2 1.1 222.9 1,655.6 1.4 302.3

45.0 1,459.0 1.1 189.5 2,137.9 1.1 226.1 1,485.4 1.4 304.4

45.5 1,756.8 1.1 197.6 1,704.1 1.1 218.0 1,472.8 1.4 304.4

46.0 2,170.4 1.0 190.4 1,327.4 1.2 229.3 2,076.5 1.4 301.6

46.5 2,028.9 1.0 186.7 1,485.1 1.2 231.8 1,920.7 1.4 297.2

47.0 1,529.2 1.1 193.7 1,798.3 1.1 220.9 1,400.1 1.4 297.3

47.5 1,939.7 1.1 199.4 2,155.2 1.1 212.8 1,743.6 1.4 298.8

48.0 2,008.0 1.1 192.6 1,394.4 1.1 215.7 1,695.3 1.4 296.3

48.5 1,691.4 1.1 192.5 1,625.0 1.2 231.1 1,348.5 1.4 294.8

49.0 1,974.1 1.1 195.9 1,518.4 1.1 225.9 1,887.1 1.4 293.4

49.5 2,041.8 1.1 192.7 2,071.2 1.1 222.2 2,051.6 1.4 289.2

50.0 1,459.0 1.1 194.4 1,544.7 1.1 216.8 2,092.6 1.3 288.2

50.5 2,055.0 1.1 198.6 1,727.9 1.2 227.2 1,520.5 1.4 290.6

51.0 2,152.4 1.1 190.1 1,762.6 1.2 225.5 2,067.9 1.4 295.2

51.5 1,488.2 1.1 192.5 1,746.1 1.2 225.8 1,417.8 1.4 295.9

52.0 1,629.1 1.1 199.7 1,347.9 1.2 227.5 2,021.2 1.4 299.1

52.5 2,000.8 1.1 192.5 1,609.8 1.2 228.8 1,939.1 1.4 297.9

53.0 1,340.2 1.0 185.5 1,489.5 1.1 218.8 1,676.4 1.4 299.4

53.5 1,512.6 1.0 188.2 1,907.7 1.1 214.7 1,987.2 1.4 301.8

54.0 2,111.4 1.0 178.8 2,028.7 1.1 209.9 1,866.8 1.4 302.2

134
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

55.0 1,843.3 1.0 179.4 1,726.4 1.2 230.3 1,504.4 1.4 305.8

55.5 1,883.6 1.0 174.9 1,387.1 1.2 241.1 2,045.0 1.5 309.9

56.0 1,956.4 1.0 177.1 1,351.0 1.3 241.7 1,361.1 1.5 309.4

56.5 2,044.8 1.0 181.6 1,434.3 1.2 229.9 1,454.6 1.5 311.0

57.0 2,033.4 1.0 187.5 1,722.4 1.2 215.9 1,664.9 1.5 307.7

57.5 1,620.7 1.0 194.5 1,427.6 1.1 206.4 1,728.0 1.4 302.6

58.0 1,454.2 1.1 200.1 1,792.5 1.1 208.1 1,724.0 1.4 298.4

58.5 1,323.4 1.1 195.1 2,075.4 1.1 204.7 1,456.2 1.4 295.5

59.0 1,784.7 1.0 184.4 2,130.7 1.1 210.5 1,893.4 1.4 293.6

59.5 1,568.4 1.0 171.6 1,604.5 1.2 225.7 1,779.6 1.4 289.9

60.0 1,947.1 1.0 170.7 1,972.1 1.3 242.0 1,812.8 1.4 289.3

60.5 1,455.7 0.9 168.9 1,600.2 1.3 240.6 2,052.5 1.4 289.4

61.0 1,604.4 1.0 175.4 1,902.5 1.3 244.6 1,602.0 1.4 290.4

61.5 1,289.9 0.9 172.3 2,057.0 1.3 239.0 1,369.8 1.4 293.8

62.0 1,562.7 0.9 170.3 2,033.3 1.3 240.1 1,976.5 1.4 294.6

62.5 1,350.9 0.9 162.1 1,298.7 1.3 247.2 1,523.4 1.4 291.9

63.0 2,009.5 0.9 159.8 1,283.9 1.4 253.9 1,518.8 1.4 292.4

63.5 1,591.6 0.8 155.1 1,588.7 1.3 238.9 1,795.6 1.4 290.9

64.0 2,153.6 0.9 165.0 1,607.7 1.2 220.3 1,374.7 1.4 288.2

64.5 1,594.6 0.9 168.0 2,022.3 1.2 212.7 1,647.7 1.4 287.4

135
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

65.5 1,272.7 1.0 181.2 1,457.1 1.2 221.9 1,450.5 1.4 281.7

66.0 2,119.0 1.0 180.9 1,535.4 1.2 220.9 1,915.8 1.4 284.4

66.5 2,002.5 0.9 170.7 1,440.0 1.2 214.8 1,842.3 1.4 283.9

67.0 1,975.6 1.0 178.0 2,127.4 1.2 210.7 1,582.7 1.4 285.7

67.5 1,911.4 1.0 186.5 1,934.7 1.2 205.4 1,397.0 1.4 288.1

68.0 1,370.7 1.0 193.0 1,602.0 1.2 219.8 1,286.1 1.4 288.4

68.5 1,372.3 1.1 196.0 1,360.7 1.3 231.7 2,100.5 1.4 285.9

69.0 1,476.9 1.0 185.8 2,099.4 1.3 231.2 1,974.9 1.4 280.9

69.5 1,778.3 1.0 173.7 1,348.0 1.3 220.5 1,891.6 1.4 281.7

70.0 1,908.0 0.9 166.0 1,397.1 1.3 229.4 1,661.0 1.4 284.8

70.5 1,963.1 0.9 167.7 1,303.7 1.3 221.5 1,768.8 1.4 288.5

71.0 1,572.1 1.0 174.6 1,991.1 1.2 211.7 1,404.2 1.4 290.2

71.5 1,427.9 1.0 182.9 1,650.2 1.2 200.7 1,619.1 1.4 291.7

72.0 1,824.0 1.0 181.2 1,548.5 1.2 210.7 1,993.4 1.4 289.8

72.5 1,451.4 1.0 173.9 1,411.9 1.2 215.3 1,329.6 1.4 287.8

73.0 2,084.1 1.0 175.0 1,777.4 1.2 214.6 1,415.2 1.4 289.2

73.5 1,875.5 0.9 170.3 1,717.5 1.2 208.8 1,797.4 1.4 286.6

74.0 1,451.8 1.0 178.6 2,138.1 1.2 212.7 1,816.1 1.4 282.7

74.5 1,778.1 1.0 184.5 1,961.9 1.3 217.0 1,520.2 1.4 281.4

75.0 2,063.8 1.0 179.2 1,529.2 1.3 232.1 1,535.7 1.4 281.9

136
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

75.5 2,150.6 1.0 178.8 1,861.6 1.4 242.4 1,435.3 1.4 280.9

76.0 1,863.2 1.0 186.2 1,508.5 1.4 237.3 1,625.8 1.4 279.2

76.5 1,677.0 1.1 196.2 1,333.0 1.4 237.8 1,318.7 1.4 276.3

77.0 2,148.9 1.1 198.6 1,477.5 1.4 230.1 1,861.9 1.4 274.5

77.5 1,323.6 1.1 194.2 1,705.0 1.3 216.8 1,887.5 1.4 270.7

78.0 1,295.0 1.1 199.0 1,714.6 1.3 208.6 1,715.6 1.4 270.8

78.5 1,583.0 1.1 187.6 1,368.3 1.3 209.8 1,603.7 1.4 273.3

79.0 1,785.3 1.0 173.2 1,710.5 1.3 213.8 1,827.3 1.4 275.6

79.5 1,794.2 1.0 167.2 2,035.1 1.3 208.3 1,430.8 1.4 276.7

80.0 1,325.1 1.0 169.3 1,800.6 1.3 210.6 1,990.3 1.4 279.1

80.5 1,716.2 1.0 173.6 1,410.5 1.3 223.6 1,926.4 1.4 278.6

81.0 1,543.3 0.9 167.4 1,734.2 1.4 230.7 1,613.8 1.5 281.3

81.5 2,067.1 0.9 167.9 1,776.5 1.4 223.8 2,016.2 1.5 285.2

82.0 1,663.0 0.9 166.5 1,342.6 1.4 223.1 1,396.6 1.5 286.8

82.5 1,705.2 1.0 176.2 2,043.1 1.4 225.5 1,352.0 1.5 290.7

83.0 1,543.1 1.0 178.4 2,084.9 1.4 216.4 1,489.0 1.5 290.1

83.5 1,566.0 1.0 178.8 2,092.7 1.4 225.1 1,668.6 1.5 286.6

84.0 1,333.7 1.0 175.1 1,649.3 1.5 238.4 2,131.3 1.5 282.7

84.5 1,755.1 1.0 171.4 1,449.2 1.6 250.5 1,955.5 1.5 280.4

137
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

85.0 1,764.5 0.9 163.5 1,823.1 1.6 247.6 1,403.3 1.5 283.1

85.5 1,921.9 0.9 165.2 1,739.8 1.5 235.3 1,626.8 1.5 287.2

86.0 1,289.6 0.9 169.5 1,505.5 1.5 233.0 1,340.6 1.5 287.0

86.5 1,882.2 1.0 177.1 1,322.9 1.5 231.9 1,630.6 1.5 286.3

87.0 1,480.9 0.9 170.4 1,679.7 1.5 224.9 1,421.6 1.5 282.8

87.5 1,805.0 1.0 173.7 2,158.6 1.4 212.6 2,057.9 1.5 280.4

88.0 1,331.9 1.0 170.5 1,836.6 1.4 211.1 2,102.0 1.5 276.8

88.5 1,328.8 1.0 173.2 1,724.3 1.4 226.4 1,454.1 1.5 278.4

89.0 1,860.0 0.9 166.8 1,998.0 1.5 234.5 1,348.1 1.5 283.3

89.5 1,593.0 0.9 158.9 1,689.8 1.5 235.8 1,957.3 1.5 284.3

90.0 1,918.0 0.9 163.8 1,718.3 1.6 242.3 1,437.6 1.5 281.9

90.5 2,164.0 0.9 165.6 1,800.2 1.6 240.5 1,287.2 1.5 283.1

91.0 1,729.8 1.0 173.3 1,719.9 1.6 237.4 1,538.9 1.5 281.8

91.5 1,967.4 1.0 186.3 1,862.1 1.6 236.9 2,049.0 1.5 277.6

92.0 1,797.5 1.0 188.8 2,126.2 1.6 234.9 2,008.5 1.5 274.3

92.5 1,784.8 1.1 192.8 1,620.2 1.6 236.9 1,855.3 1.5 276.0

93.0 1,907.2 1.1 192.7 2,005.4 1.6 246.9 1,813.1 1.5 280.3

93.5 1,886.0 1.1 191.2 1,893.3 1.6 243.3 1,560.6 1.6 284.6

94.0 1,901.5 1.1 192.2 1,997.2 1.6 247.0 1,877.9 1.6 288.3

138
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

95.5 1,933.7 1.1 193.0 1,401.7 1.7 252.2 1,406.9 1.6 291.2

96.0 1,798.7 1.1 183.4 1,947.4 1.7 254.8 1,544.5 1.6 293.0

96.5 1,996.5 1.1 184.2 1,947.7 1.7 241.4 1,376.0 1.6 291.3

97.0 1,380.3 1.1 185.1 1,281.1 1.6 241.0 2,068.5 1.6 288.7

97.5 1,790.3 1.1 190.0 1,375.3 1.6 244.5 1,587.8 1.6 284.3

98.0 1,826.4 1.1 181.8 1,725.4 1.6 230.1 2,002.8 1.6 285.1

98.5 2,146.7 1.0 180.3 1,960.4 1.5 216.0 1,864.7 1.6 284.6

99.0 1,855.1 1.1 181.9 1,675.5 1.4 214.5 1,583.3 1.6 287.2

99.5 2,115.1 1.1 191.0 1,297.6 1.5 223.6 1,485.8 1.6 290.1

100.0 1,980.9 1.1 194.1 1,550.3 1.5 226.1 1,579.4 1.6 290.7

100.5 1,749.2 1.1 200.4 1,802.7 1.5 215.7 1,351.4 1.6 289.1

101.0 1,539.6 1.2 203.4 1,487.0 1.4 210.6 1,632.3 1.6 287.0

101.5 1,720.4 1.2 199.8 2,002.0 1.4 215.1 1,347.0 1.6 282.7

102.0 1,448.3 1.1 190.4 1,432.4 1.4 212.8 1,476.6 1.6 279.9

102.5 1,374.8 1.1 185.3 1,709.8 1.5 223.1 2,027.5 1.6 275.5

103.0 1,771.9 1.1 176.6 1,577.8 1.5 219.4 1,409.8 1.5 271.5

103.5 2,091.5 1.0 167.0 1,326.5 1.5 219.9 1,898.5 1.5 272.8

104.0 1,504.3 1.0 167.8 1,913.8 1.5 217.9 1,694.7 1.5 271.8

104.5 1,939.1 1.0 178.4 1,602.8 1.4 208.7 1,520.3 1.5 273.8

139
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

106.0 1,513.7 1.1 180.4 1,586.5 1.5 231.7 2,143.3 1.6 279.6

106.5 1,955.6 1.1 186.6 1,613.7 1.5 225.8 2,131.6 1.6 285.2

107.0 1,896.4 1.1 182.4 2,008.7 1.5 221.0 1,880.6 1.7 292.5

107.5 1,636.8 1.1 185.5 1,595.7 1.5 218.2 2,061.6 1.7 300.3

108.0 1,941.7 1.1 188.9 2,144.0 1.5 227.5 1,453.6 1.7 306.0

108.5 1,898.0 1.1 186.0 1,714.0 1.5 227.0 1,873.7 1.8 311.6

109.0 1,763.9 1.1 188.4 1,788.2 1.6 238.9 2,160.7 1.8 311.6

109.5 2,049.4 1.1 191.0 1,317.6 1.6 240.1 2,172.5 1.8 311.9

110.0 1,885.9 1.1 190.2 1,890.3 1.7 240.0 1,840.8 1.8 314.9

110.5 1,428.8 1.2 194.8 1,588.1 1.6 226.5 2,111.9 1.8 319.3

111.0 1,477.7 1.2 196.4 2,015.3 1.6 227.6 1,964.1 1.8 321.6

111.5 2,051.8 1.1 186.9 1,694.6 1.5 224.5 2,067.3 1.9 324.8

112.0 2,171.1 1.1 177.2 1,553.9 1.6 232.5 1,394.7 1.9 327.1

112.5 1,551.7 1.1 181.8 1,497.9 1.6 233.4 1,723.8 1.9 329.7

113.0 1,511.7 1.2 192.5 1,888.9 1.6 228.1 1,621.5 1.9 326.3

113.5 2,025.2 1.1 189.1 1,635.5 1.5 220.5 1,390.7 1.9 322.6

114.0 1,845.5 1.1 181.5 1,692.7 1.5 224.6 1,590.3 1.8 317.9

114.5 2,090.1 1.1 185.3 1,495.9 1.5 224.2 1,785.1 1.8 310.8

115.0 1,595.6 1.1 187.8 1,982.4 1.5 224.3 1,630.9 1.8 304.4

140
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

116.0 1,658.2 1.2 190.8 1,371.7 1.5 226.7 1,551.7 1.7 296.8

116.5 1,359.7 1.1 180.3 2,155.4 1.6 236.0 1,919.9 1.7 295.9

117.0 1,696.4 1.1 175.6 1,452.3 1.6 227.6 1,854.0 1.7 293.7

117.5 1,584.3 1.1 167.1 1,955.1 1.6 237.3 1,538.4 1.7 294.0

118.0 1,838.7 1.0 166.5 2,120.6 1.6 231.0 2,057.2 1.7 295.1

118.5 1,674.2 1.0 166.1 1,470.1 1.6 235.1 1,308.3 1.7 294.0

119.0 1,333.5 1.0 171.2 1,524.7 1.7 246.0 1,716.3 1.7 296.2

119.5 2,011.1 1.1 173.3 1,273.7 1.7 238.7 1,357.5 1.7 293.6

120.0 1,456.3 1.0 166.8 1,548.6 1.6 229.1 1,501.2 1.7 291.9

120.5 2,090.8 1.1 173.6 1,495.8 1.5 213.9 1,555.2 1.7 287.7

121.0 1,968.6 1.0 171.1 2,150.9 1.5 207.6 1,284.3 1.6 283.5

121.5 1,305.1 1.1 180.0 1,710.1 1.4 203.9 1,507.6 1.6 279.9

122.0 2,095.0 1.1 187.8 1,812.8 1.5 219.8 1,801.7 1.6 274.5

122.5 1,701.8 1.1 179.3 1,273.9 1.5 226.0 1,429.8 1.6 270.3

123.0 1,803.0 1.1 184.8 1,768.9 1.6 231.0 1,512.8 1.6 269.6

123.5 1,896.3 1.2 184.8 2,164.6 1.6 219.7 1,532.8 1.5 267.7

124.0 2,154.1 1.2 185.4 1,650.5 1.5 219.6 2,128.5 1.5 266.0

124.5 1,690.5 1.2 188.0 1,713.4 1.6 233.7 1,881.3 1.5 264.6

125.0 2,036.5 1.2 196.4 1,712.1 1.6 234.8 1,718.8 1.5 268.8

141
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

126.5 1,723.0 1.2 189.0 1,459.3 1.6 233.6 2,154.0 1.6 281.6

127.0 2,088.1 1.2 178.0 1,889.4 1.7 245.0 1,787.9 1.6 280.7

127.5 1,317.1 1.2 175.0 2,159.5 1.7 237.8 1,997.3 1.6 284.5

128.0 1,897.8 1.2 183.0 1,880.0 1.7 238.4 1,274.2 1.7 287.7

128.5 1,992.2 1.1 175.8 1,511.8 1.7 248.7 1,764.1 1.7 292.2

129.0 1,572.7 1.1 178.2 1,418.3 1.8 251.9 2,045.0 1.7 291.0

129.5 1,795.7 1.2 185.0 1,829.1 1.7 242.4 1,879.9 1.7 290.7

130.0 2,029.1 1.2 182.5 1,381.3 1.6 228.4 1,516.6 1.7 293.4

130.5 1,930.2 1.2 182.7 1,324.5 1.6 227.2 1,882.5 1.7 296.2

131.0 2,032.3 1.2 188.7 2,172.9 1.5 217.8 1,770.3 1.7 295.9

131.5 1,865.3 1.2 193.0 2,057.8 1.5 206.4 1,899.8 1.7 296.9

132.0 1,949.7 1.3 198.1 1,716.2 1.5 220.0 1,756.8 1.7 297.7

132.5 2,151.8 1.3 198.8 1,635.5 1.6 235.2 1,879.2 1.7 299.3

133.0 2,129.4 1.3 199.8 2,007.5 1.6 238.2 1,962.7 1.7 300.2

133.5 1,428.3 1.4 205.1 1,843.9 1.6 234.8 1,610.7 1.7 301.7

134.0 1,306.5 1.4 210.1 1,305.5 1.7 240.5 1,366.0 1.8 304.2

134.5 2,060.1 1.4 198.8 1,937.6 1.7 243.1 2,048.3 1.8 304.0

135.0 2,002.2 1.3 182.3 1,502.6 1.6 229.5 1,978.5 1.7 300.2

135.5 1,293.2 1.3 184.1 2,129.0 1.6 231.2 1,340.6 1.7 300.3

142
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

137.0 1,940.0 1.2 174.6 1,953.7 1.7 248.2 1,669.9 1.7 301.2

137.5 1,774.2 1.2 178.5 1,290.1 1.7 245.9 2,171.6 1.7 302.7

138.0 1,420.8 1.2 184.6 1,574.7 1.7 248.1 1,709.7 1.8 302.6

138.5 2,139.4 1.2 186.4 1,871.6 1.7 232.9 1,386.2 1.8 305.9

139.0 1,427.0 1.2 178.9 2,074.3 1.6 223.5 1,488.4 1.8 307.0

139.5 1,645.4 1.2 185.8 1,714.3 1.6 225.9 2,075.9 1.8 303.9

140.0 1,615.7 1.2 180.1 1,716.3 1.6 236.9 1,494.8 1.7 299.4

140.5 1,605.5 1.2 176.5 1,742.0 1.7 238.3 2,052.7 1.7 299.5

141.0 1,755.5 1.2 173.7 2,055.1 1.7 236.6 1,321.3 1.7 297.0

141.5 1,784.6 1.2 171.5 1,844.9 1.7 235.1 1,453.6 1.7 298.2

142.0 1,508.2 1.2 173.2 1,968.0 1.7 242.5 1,331.6 1.7 295.0

142.5 1,639.9 1.2 176.4 1,552.7 1.7 245.3 1,601.5 1.7 290.6

143.0 1,654.0 1.2 173.3 1,825.1 1.7 249.5 1,524.3 1.7 284.7

143.5 1,906.2 1.2 171.8 1,350.3 1.7 241.8 2,060.6 1.6 280.4

144.0 1,413.4 1.2 171.4 1,354.5 1.7 239.7 1,935.3 1.6 276.7

144.5 2,125.8 1.2 177.0 1,735.6 1.6 226.6 1,944.8 1.6 278.2

145.0 1,985.8 1.2 172.4 1,425.5 1.5 213.0 2,028.0 1.6 281.6

145.5 1,913.2 1.2 181.2 1,500.3 1.5 212.6 1,630.3 1.7 286.1

146.0 1,656.6 1.3 189.2 2,086.9 1.4 207.7 1,961.2 1.7 291.7

143
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

147.5 2,018.6 1.3 191.5 1,907.1 1.5 227.5 1,891.1 1.7 298.8

148.0 1,872.6 1.3 186.7 1,615.7 1.6 240.2 1,640.0 1.7 300.0

148.5 1,397.8 1.3 190.1 1,670.1 1.7 246.8 1,941.2 1.8 301.7

149.0 1,384.1 1.3 192.2 1,507.2 1.7 242.1 1,404.9 1.8 301.5

149.5 2,022.5 1.3 183.1 1,669.1 1.7 236.6 1,775.5 1.8 302.8

150.0 2,079.0 1.3 172.2 2,029.6 1.6 227.4 1,931.0 1.7 300.3

150.5 1,411.6 1.2 177.0 1,494.5 1.6 223.5 1,453.8 1.7 298.8

151.0 2,082.3 1.3 186.7 1,928.6 1.6 231.9 1,620.9 1.7 299.3

151.5 1,546.4 1.3 181.3 1,621.5 1.6 227.5 1,736.6 1.7 296.9

152.0 2,105.6 1.3 187.0 1,334.2 1.6 232.2 2,023.8 1.7 294.3

152.5 1,319.1 1.3 183.3 1,843.5 1.6 230.1 1,517.5 1.7 292.7

153.0 2,001.7 1.3 189.7 1,388.5 1.6 218.6 1,551.8 1.7 294.4

153.5 1,321.3 1.3 180.7 1,590.1 1.5 220.6 1,831.8 1.7 293.4

154.0 1,699.3 1.3 183.8 1,704.9 1.5 213.7 1,418.4 1.7 291.2

154.5 1,538.3 1.3 175.1 1,608.1 1.5 211.2 1,366.9 1.7 290.9

155.0 1,328.1 1.2 172.9 1,304.9 1.5 213.6 1,775.6 1.7 288.1

155.5 2,086.1 1.2 169.6 1,332.0 1.5 214.4 1,881.8 1.7 283.5

156.0 1,809.9 1.2 162.1 1,668.7 1.5 206.1 1,815.1 1.6 281.7

156.5 2,149.3 1.2 171.4 1,773.1 1.4 197.7 2,140.0 1.6 282.5

144
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

158.0 1,384.9 1.3 185.5 1,625.9 1.5 219.0 1,297.4 1.7 290.7

158.5 1,396.8 1.3 188.4 1,515.2 1.6 230.0 1,592.0 1.7 289.9

159.0 2,114.2 1.3 180.1 1,674.5 1.6 230.4 1,496.9 1.7 285.9

159.5 1,971.5 1.3 170.4 1,575.0 1.6 224.5 1,377.9 1.7 282.6

160.0 1,929.6 1.3 177.9 1,566.9 1.6 222.4 1,918.8 1.6 279.2

160.5 1,754.6 1.3 185.8 2,077.4 1.5 219.0 1,551.3 1.6 274.8

161.0 1,805.8 1.3 191.4 1,667.5 1.5 215.8 2,081.9 1.6 274.7

161.5 1,742.5 1.4 191.2 1,725.5 1.6 227.4 2,069.3 1.6 274.0

162.0 1,324.3 1.4 190.4 1,677.5 1.6 229.6 1,396.7 1.6 277.7

162.5 1,957.6 1.4 188.3 2,006.2 1.6 230.2 1,898.8 1.6 283.6

163.0 1,982.5 1.3 177.2 1,984.3 1.6 228.9 1,482.6 1.7 284.7

163.5 1,302.1 1.3 179.4 1,479.2 1.6 236.4 1,728.1 1.7 287.3

164.0 2,138.7 1.3 185.8 1,429.8 1.7 244.3 1,494.3 1.7 287.0

164.5 1,501.3 1.3 177.2 1,540.1 1.7 236.7 1,737.4 1.7 287.1

165.0 2,116.0 1.3 184.1 1,365.2 1.6 224.8 1,422.9 1.7 285.4

145
Table C-3 Dynamic Modelling of Septic Tank Performance (Con’t)

30 oC 40 oC 50 oC

Day Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD Influent TCOD Methane production Effluent SCOD

mg/L L/d mg/L mg/L L/d mg/L mg/L L/d mg/L

165.5 1,367.9 1.3 180.4 1,537.0 1.5 217.1 1,640.6 1.7 284.9

166.0 2,055.3 1.3 187.6 2,043.5 1.5 207.4 2,171.8 1.6 282.3

166.5 1,861.0 1.3 180.4 1,494.2 1.4 203.9 2,097.3 1.6 280.5

167.0 2,137.1 1.3 185.2 1,508.6 1.5 216.9 1,525.2 1.6 284.0

167.5 2,008.9 1.4 188.4 1,521.9 1.5 216.9 1,965.6 1.7 289.7

168.0 1,791.1 1.4 196.5 1,851.1 1.5 213.6 1,830.8 1.7 291.5

168.5 1,465.3 1.5 201.5 2,086.2 1.5 210.3 1,431.2 1.7 294.7

169.0 1,478.0 1.5 199.9 1,428.0 1.5 216.7 1,471.4 1.7 297.4

169.5 2,141.5 1.4 189.5 1,848.3 1.6 231.2 1,581.4 1.7 296.2

170.0 1,933.1 1.4 179.0 2,046.2 1.6 226.9 1,919.4 1.7 293.1

170.5 1,653.1 1.4 185.0 1,781.8 1.6 229.6 1,716.2 1.7 289.9

146
Table C-4 Simulation Data of Sludge Accumulation Model

Simulated results of laboratory-scale septic tanks

o
30 C 40 oC 40 oC (with a correction factor)

Day TS accumulation TVS accumulation TS accumulation TVS accumulation TS accumulation TVS accumulation
3 3 3 3 3
kg/m kg/m kg/m kg/m kg/m kg/m3
0 9.90 5.30 9.90 5.30 9.90 5.30
2 11.90 7.08 11.90 7.08 10.50 5.62
4 13.86 8.79 13.79 8.67 11.02 5.93
6 15.78 10.47 15.58 10.22 11.62 6.21
8 17.66 12.14 17.28 11.62 12.21 6.48
10 19.52 13.70 18.89 12.97 12.73 6.75
12 21.32 15.30 20.42 14.20 13.31 6.99
14 23.10 16.82 21.86 15.38 13.80 7.23
16 24.85 18.27 23.24 16.46 14.34 7.45
18 26.57 19.71 24.54 17.49 14.86 7.67
20 28.24 21.13 25.78 18.46 15.38 7.87
22 29.88 22.56 26.97 19.36 15.88 8.06
24 31.49 23.94 28.07 20.23 16.39 8.25
26 33.07 25.28 29.15 21.02 16.87 8.42
28 34.62 26.59 30.17 21.76 17.31 8.59
30 36.13 27.88 31.15 22.46 17.68 8.76

147
Table C-4 Simulation Data of Sludge Accumulation Model (Con’t)

Simulated results of laboratory-scale septic tanks

o
30 C 40 oC 40 oC (with a correction factor)

Day TS accumulation TVS accumulation TS accumulation TVS accumulation TS accumulation TVS accumulation
3 3 3 3 3
kg/m kg/m kg/m kg/m kg/m kg/m3
30 36.13 27.88 31.15 22.46 17.68 8.76
32 37.62 29.13 32.07 23.12 18.09 8.91
34 39.11 30.30 32.97 23.73 18.49 9.06
36 40.54 31.52 33.79 24.32 18.93 9.20
38 41.97 32.64 34.63 24.85 19.33 9.33
40 43.34 33.81 35.45 25.34 19.77 9.46
42 44.72 34.89 36.15 25.83 20.19 9.58
44 46.07 35.95 36.91 26.27 20.53 9.70
46 47.41 36.97 37.65 26.67 20.95 9.80
48 48.73 37.96 38.27 27.07 21.31 9.91
50 50.01 38.95 38.87 27.45 21.71 10.01

148
 0.4 0.4
0.3 0.3
0.3 0.3
C/C0

C/C0
0.2 0.2
0.2 R² = 0.9181 0.2 R² = 0.9758
0.1 0.1
0.1 0.1
0.0 0.0
0 0.2 0.4 0.6 0 0.2 0.4 0.6

(a) TCOD (b) BOD5

Figure C-1 Completely-mixed model

50 20
40
15
30
10
20 R² = 0.7997
R² = 0.9028 5
10

0 0
0 20 40 60 0 10 20 30 40

(a) Laboratory-scale septic tanks (b) Laboratory-scale septic tanks

operating at 30 oC operating at 40 oC

20

15

10 R² = 0.8565

0
0 10 20 30
Laboratory-scale septic tanks operating at 40 oC with a correction factor

Figure C-2 Sludge accumulation model

149