This is an open access article published under an ACS AuthorChoice License, which permits

copying and redistribution of the article or any adaptations for non-commercial purposes.

Article

pubs.acs.org/jmc

Synthesis, Anticancer Activity, and Genome Profiling of Thiazolo

Arene Ruthenium Complexes
Adriana Grozav,*,† Ovidiu Balacescu,*,‡ Loredana Balacescu,‡ Thomas Cheminel,§
Ioana Berindan-Neagoe,‡,∥ and Bruno Therrien*,§
†
Faculty of Pharmacy, “Iuliu Hatieganu” University of Medicine and Pharmacy, Victor Babes Str. 41, RO-400012 Cluj-Napoca,
Romania
‡
Department of Functional Genomics, Proteomics and Experimental Pathology, The Oncology Institute “Prof Dr. Ion Chiricuta”,
34-36 Republicii Str, RO-400015, Cluj-Napoca, Romania
§
Institut de Chimie, Université de Neuchâtel, 51 Avenue de Bellevaux, CH-2000 Neuchâtel, Switzerland
∥
Research Center of Functional Genomics, Biomedicine and Translational Medicine, “Iuliu Hatieganu″ University of Medicine and
Pharmacy, 23 Marinescu Str, RO-400337 Cluj-Napoca, Romania
*
S Supporting Information

ABSTRACT: Sixteen hydrazinyl-thiazolo arene ruthenium complexes of the general formula [(η6-p-cymene)Ru(N,N′-
hydrazinyl-thiazolo)Cl]Cl were synthesized. All complexes were tested in vitro for their antiproliferative activity on three tumor
cell lines (HeLa, A2780, and A2780cisR) and on a noncancerous cell line (HFL-1). A superior cytotoxic activity of the ruthenium
complexes as compared to cisplatin and oxaliplatin, on both cisplatin-sensitive and cisplatin resistant ovarian cancer cells, was
observed. In addition, the biological activity of two selected derivatives was evaluated using microarray gene expression assay and
ingenuity pathway analysis. p53 signaling was identified as an important pathway modulated by both arene ruthenium
compounds. New activated molecules such as FAS, ZMAT3, PRMT2, BBC3/PUMA, and PDCD4, whose overexpressions are
correlated with overcoming resistance to cisplatin therapy, were also identified as potential targets. Moreover, the arene
ruthenium complexes can be used in association with cisplatin to prevent cisplatin resistance development and synergistically to
induce cell death in ovarian cancer cells.

■ INTRODUCTION
Ovarian cancer is the eighth leading cause of cancer-related
deaths in women worldwide and the second cause of
gynecologic cancer-related deaths, responsible for over
150000 deaths per year around the world.1 While often
combined with other techniques such as radiotherapy or
surgery, chemotherapy is certainly the most widely used
treatment for cancer. However, this technique has several
limitations, mainly the lack of selectivity of the drug, which
often also kills healthy cells and thus leads to undesirable side
effects (hair loss, fatigue, nausea, etc.). The resistance of
cancerous cells to drugs is also a major problem in
chemotherapy; one of those drugs is the well-known transition
metal complex cisplatin, which has been used in cancer
treatment for more than 30 years.2,3 Its inefficiency on
platinum-resistant tumors is a major disadvantage, which led
to the search for alternative agents to resolve this drawback.
Since then, complexes of other transition metals have been
designed as alternatives to cisplatin. Among these candidates,
ruthenium derivatives have undoubtedly stood out.
Over the last few decades, many examples of anticancer
ruthenium compounds have been reported, some of which are
already into clinical trials, such as the well-known complexes
[imiH]trans-[Ru(N-imi)(S-dmso)Cl4] (NAMI-A)4 and [Na]
trans-[Ru(N-ind)2Cl4] (NKP1339).5 Those complexes present
Received: June 4, 2015
Published: October 21, 2015

© 2015 American Chemical Society 8475 DOI: 10.1021/acs.jmedchem.5b00855

J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry Article

Scheme 1. Synthesis of Complexes 1−16a

a
R1, R2, and R3 functional groups are given in Table 1.

Table 1. Identification of the Functional Groups R1−R3 Attached to the Hydrazinyl-thiazole Compounds L1−L16

R1 R2 R3 R1 R2 R3
L1 Ph Me H L9 4-MeO-C6H4 Me H
L2 Ph Ph H L10 4-MeO-C6H4 Ph H
L3 Ph Me COMe L11 4-MeO-C6H4 Me COOEt
L4 2,4-Cl2−C6H3 CH2COOEt H L12 4-MeO-C6H4 Me COMe
L5 2,4-Cl2−C6H3 Me COMe L13 3-Cl-C6H4 Me H
L6 2,4-Cl2−C6H3 Me COOEt L14 3-Cl-C6H4 Me COMe
L7 4-HO-C6H4 Me H L15 3−Cl-C6H4 Ph H
L8 4-HO-C6H4 Ph H L16 3−Cl-C6H4 Me COOEt

some advantages over cisplatin, such as their activity against
cisplatin- resistant cancerous cell lines and their higher
selectivity for cancerous over healthy cells, leading to reduced
side effects.6,7 The mechanisms of action of ruthenium
complexes appear to be different from platinum drugs used in
the clinic, and many of them are not known yet. However,
some mechanisms have been proposed for the anticancer
activity of ruthenium complexes, such as the inhibition of
metastasis,8,9 interaction with DNA,10 interaction with
proteins,11 production of reactive oxygen species,12 inhibition
of topoisomerase,13 induction of apoptosis,14 and antiangio-
genic effects.15,16
In recent years, much attention was given to compounds
with pharmacophore hydrazine-thiazolo or thiazolo moieties
due to the identification of several thiazolo lead compounds
showing antiproliferative activity,17 inhibition of Bcl-XL,18
inhibition of tautomerase,19 inhibition of metastatic cancer
cell migration and invasion,20 and antitumor activity.21,22
Therefore, in this study, we have combined a p-cymene
ruthenium unit with a hydrazinyl-thiazolo ligand to generate a
series of organometallic compounds with significant antitumor
activity, taking advantage of the synthetic versatility of
hydrazinyl-thiazolo derivatives and the promising biological
activity of ruthenium complexes.
h; and (b) a microwave-assisted synthetic method, whose
optimal reaction conditions were established after several
experiments, varying the solvent (methanol, acetonitrile, and
dichloromethane), the temperature (40 °C, 60 °C, 82 °C, and
100 °C), and the reaction time (0.5 h, 1 h, 1.5 h, and 2 h). The
best yields for the complexes were obtained after 0.5 h of
microwave irradiation at 60 °C and using dichloromethane as
solvent (see Table S1). The two alternative synthetic methods
(microwave irradiation and conventional synthesis) are
comparable for the resulting yield (50−80%), but the
microwave-assisted method demands a shorter reaction time
(30 min vs 10 h). In order to obtain a greener synthesis, one
has tried to replace standard organic solvents by water.
Unfortunately, in water, the complexes could only be recovered
in traces.
All complexes were isolated as their chloride salts, and they
have been fully characterized by 1H NMR spectroscopy, mass
spectrometry, IR spectroscopy, elemental analysis, and for 12
by a single-crystal X-ray structure analysis. No attempt to
separate the cationic enantiomers was performed, and the
chiral-at-metal complexes were isolated and used as racemic
mixtures. All complexes are stable in D2O and DMSO solutions
as well as in biological media (aqueous solution containing
RPMI 1640 medium with 5% fetal calf serum, glutamine, and

■
RESULTS AND DISCUSSION
A series of monocationic arene ruthenium complexes (1−16)
containing hydrazinyl-thiazole bidentate ligands (L1−L16) were
prepared (Scheme 1). The synthesis of the complexes was
realized by two methods: (a) a conventional synthetic method
involving one equivalent of the ruthenium dimer (η6-p-
cymene)2Ru2Cl4 and two equivalents of the hydrazinyl-thiazole
derivatives (L1−L16) in methanol at room temperature for 10
8476
antibiotics), showing no decomplexation of the hydrazinyl-
thiazolo ligands. The 1H NMR spectra of all complexes show,
in addition to the signals of the p-cymene ring, the
characteristic signals of the ligand at higher chemical shifts
related to its free form because of the deshielding effect
produced by the arene ruthenium unit. Typical signals for the
ligands after complexation are a singlet at around 9 ppm
associated with the proton of the azomethine moiety (CHN)
and the proton from the hydrazine moiety (N-NH), which is
the most deshielded one, appearing as a singlet at around 15
DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry Article

ppm (in some cases the signal is not observed due to the
deuterium exchange). In the case of the complexes where R3 =
H, the corresponding proton of the thiazolo ring is observed as
a singlet around 6.5 ppm.
Crystals suitable for a single-crystal X-ray structure analysis
were obtained for [(η6-p-cymene)Ru(L12)Cl]Cl. The molecular
structure of the cation is presented in Figure 1, together with
Figure 1. ORTEP drawing of complex 12 at 35% probability level,
with hydrogen atoms being omitted for clarity. Selected bond lengths
(Å) and angles (deg): Ru(1)−Cl(1) 2.408(2), Ru(1)−N(1) 2.090(6),
Ru(1)−N(3) 2.123(6), N(2)−N(3) 1.396(7), and N(3)−C(17)
1.299(8); Cl(1)−Ru(1)−N(1) 85.61(15), Cl(1)−Ru(1)−N(3)
90.04(15), N(1)−Ru(1)−N(3) 76.2(2), N(1)−C(16)−N(2)
120.5(6), C(16)−N(1)−Ru(1) 112.1(4), C(14)−N(1)−Ru(1)
133.8(5), C(17)−N(3)−Ru(1) 133.7(5), N(2)−N(3)−Ru(1)
111.1(4), N(2)−N(3)−C(17) 114.2(6), and C(13)−S(1)−C(16)
88.2(3).
selected geometrical parameters. In complex 12, the ruthenium
center shows a typical pseudotetrahedral geometry with the
hydrazinyl-thiazolo ligand being N,N′-coordinated. The Ru−N
bond distances are 2.090(6) (thiazole) and 2.123(6) Å
(hydrazine), and these values are similar to those found in
analogous N,N′-coordinated pyridyl-thiazolo arene ruthenium
complexes.23−25 In the solid state, an angle of 34.6(3)° is
observed between the plane formed by the hydrazinyl-thiazolo
unit and the plane of the methoxyphenyl group.
In Vitro Antiproliferative Activity. The hydrazinyl-
thiazolo arene ruthenium complexes 1−16 were tested in
vitro for their antiproliferative activity on four cell lines: HeLa
(human cervical cancer cells), A2780 (human ovarian cancer
cells), A2780cisR (cisplatin-resistant human ovarian cancer
cells), and HFL-1 (noncancer cells, human fibroblast). IC50
values were used to determine the antiproliferative activity of
the complexes (IC50 = drug concentration necessary for 50%
inhibition of cell viability); these values are listed in Table 2.
Moreover, the calculated partition coefficients (log P) of the
hydrazinyl-thiazole compounds L1−L16 together with their IC50
values on HeLa cells17 are presented in Table 3, thus giving an
approximation of the lipophilicity of the ligands and their
cytotoxicity. Cisplatin and oxaliplatin, two metal-based drugs
currently used in the clinic to treat cancer, were used as
controls, and their IC50 values are also reported in Table 2.
The results obtained on the three tumor cell lines (HeLa,
A2780, and A2780cisR) show a promising profile for the
antiproliferative activity of all complexes, most of them having a
cytotoxic activity at concentrations significantly lower than that
of cisplatin and oxaliplatin (Tables S2 and S3). Moreover, by
comparing the antiproliferative effect produced by the
complexes on the tumor cell lines A2780 and A2780cisR, we
noticed that at almost the same concentrations (see Table 2), a
similar effect is observed on both cell lines, suggesting a mode
of action different from that of cisplatin. By analyzing the effect
of the treatment with the complexes on the normal fibroblasts
cell line HFL-1, a significant reduction of cytotoxicity can be
noticed for complexes 4 (IC50 = 181 μM) and 14 (IC50 = 36.6
μM) (Figure 2). When comparing the cytotoxic effect produced

Table 2. Cytotoxic Activity of Complexes 1−16 in HeLa, A2780, A2780cisR, and HFL-1 Cells
IC50 (μM)a
compd HeLa A2780 A2780cisR HFL-1
cisplatin 20.10 ± 0.02 11.30 ± 0.02 41.13 ± 1.24 9.50 ± 0.02
oxaliplatin 12.72 ± 0.02 10.10 ± 0.03 16.57 ± 0.02 13.53 ± 0.02
1 7.42 ± 0.01 9.65 ± 0.01 12.95 ± 0.04 18.48 ± 0.02
2 2.55 ± 0.02 2.49 ± 0.02 0.93 ± 0.02 6.27 ± 0.01
3 11.42 ± 0.02 6.99 ± 0.02 2.08 ± 0.03 6.43 ± 0.02
4 3.65 ± 0.03 12.21 ± 0.03 12.62 ± 0.01 181 ± 0.89
5 7.98 ± 0.01 50.08 ± 0.03 55.58 ± 0.03 47.33 ± 0.32
6 0.84 ± 0.25 2.86 ± 0.01 6.06 ± 0.02 4.52 ± 0.01
7 19.40 ± 0.03 6.13 ± 0.25 6.19 ± 0.01 49.40 ± 0.31
8 6.87 ± 0.23 5.25 ± 0.03 4.24 ± 0.01 7.30 ± 0.03
9 7.95 ± 0.03 6.97 ± 0.33 6.80 ± 0.05 6.47 ± 0.23
10 2.26 ± 0.03 5.12 ± 0.03 1.33 ± 0.02 13.88 ± 0.03
11 5.66 ± 0.01 9.47 ± 0.03 3.14 ± 0.01 4.27 ± 0.03
12 7.88 ± 0.01 4.54 ± 0.01 2.25 ± 0.03 3.84 ± 0.01
13 11.15 ± 0.01 6.13 ± 0.02 2.14 ± 0.05 6.32 ± 0.02
14 2.69 ± 0.01 2.26 ± 0.03 2.14 ± 0.04 36.61 ± 0.48
15 6.81 ± 0.03 7.70 ± 0.12 2.77 ± 0.01 13.69 ± 0.01
16 1.72 ± 0.01 3.75 ± 0.02 3.76 ± 0.03 2.81 ± 0.03

a
Data are reported as IC50 values (concentrations of complexes required to inhibit cell viability by 50%) determined by MTT assay after 24 h of
continuous exposure to each compound. The data represent the mean values ± SEM (standard error of mean) of at least three independent
experiments.

8477 DOI: 10.1021/acs.jmedchem.5b00855

J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry Article

Table 3. Cytotoxic Activity of Compounds L1−L16 in HeLa pharmacological index of these hydrazinyl-thiazolo arene
Cells and Calculated Partition Coefficients ruthenium complexes.
Gene Expression Profiling As a Response to
compd log Pa IC50 (μM)b
Ruthenium Complexes Treatment. In order to identify
L1 3.1 ± 0.6 11.4 ± 0.005 molecular mechanisms induced by treatment with the thiazolo
L2 4.4 ± 0.6 >100 arene ruthenium compounds, we profiled a global mRNA
L3 2.6 ± 0.8 64.87 ± 0.005 expression assay. Two ovarian carcinoma cell lines, A2780 and
L4 4.4 ± 0.6 >100 A2780cisR, treated with two selected compounds (4 and 14)
L5 4.0 ± 0.9 >100 were used for 24 h after treatment, for microarray analysis.
L6 4.6 ± 0.9 >100 Although both compounds presented similarities in their
L7 2.9 ± 0.6 25.59 ± 0.010 structure (Figure 2), our microarray data showed different
L8 4.2 ± 0.6 20.04 ± 0.019 transcriptional patterns of the two cell lines in response to these
L9 3.3 ± 0.6 >100 compounds. The specific genes modulated by ruthenium
L10 4.6 ± 0.6 11.1 ± 0.009 complexes in each cell line were selected using a fold change
L11 3.8 ± 0.9 >100 (Fc) threshold of 1.5 and an FDR-adjusted p-value <0.05. As
L12 2.7 ± 0.9 >100 shown in the Venn diagram (Figure 3), the numbers of genes
L13 3.9 ± 0.6 57.53 ± 0.011
L14 3.4 ± 0.9 >100
L15 5.2 ± 0.6 >100
L16 4.4 ± 0.9 >100
a
The partition coefficients were calculated using ACD/ChemSketch.26
b
Taken from ref 17.

Figure 2. Molecular structures of complexes 4 and 14.

by these two complexes on the tumor cell lines (HeLa, A2780,
and A2780cisR), one may notice selectivity in favor of the
noncancerous cell line, namely, a cytotoxic effect upon normal
fibroblasts 15 times lower than upon cancerous cells. Moreover,
the activity of the hydrazinyl-thiazole compounds L4 and L14 on
HeLa cells (Table 3) is very low (>100 μM), confirming the
beneficial effect of complexation to arene ruthenium units.
Such variations in the activity appear to be dependent on
some minor modifications in the molecular structure of the
complexes (see Table 1), thus revealing some interesting
trends: the presence of electron-withdrawing groups (chloro
and dichloro) on the phenyl ring of R1 leads to a higher
antiproliferative effect on the cancerous cell lines (HeLa,
A2780, and A2780cisR), and the presence of a more
hydrophobic substituent (phenyl) at the R2 position of the
thiazole ring also increases the antiproliferative effect, with the
exception of 15 (phenyl) and 13 (methyl) which show a higher
activity but only on the HeLa cell line. However, the nature of
the R3 group (H, COMe, and COOEt) appears to have a less
predictable effect: in complexes 13, 14, and 16 where only R3
varied, the cytotoxicity of the complexes is comparable, while
between complexes 5 and 6 the COMe derivative is
significantly less cytotoxic than the COOEt analogue. More-
over, when looking at the log P values of L1−L16 in conjunction
with the IC50 values of the ligands on HeLa cells (Table 3), it
appears that the lipophilicity of the ligands does not correlate
with the activity. Therefore, the functionalization of the ligands
should be better explored for further optimization of the
8478
Figure 3. Venn diagram of transcriptional changes induced by
complexes 4 and 14 in the A2780 and A2780cisR ovarian carcinoma
cell lines. The overlap areas indicate the common set of genes for both
ruthenium compounds in both cell lines. Complexes 4 and 14
modulate a unique set of 169 differentially expressed genes (DEGs) in
A2780 cells and 3723 common DEGs in A2780cisR cells.
regulated by 14 were higher than those modulated by 4, for
both ovarian cisplatin-sensitive and cisplatin-resistant cell lines.
Compound 4 induced transcriptional changes of 444 genes
(319 up-regulated genes and 125 down-regulated genes) in
A2780 cells and 4840 genes (2569 up-regulated genes and 2271
down-regulated genes) in the A2780cisR cell line. Compara-
tively, complex 14 modulated 1392 genes (867 up-regulated
genes, 525 down-regulated genes) in A2780 cells and 7577
genes (3826 up-regulated genes and 3751 down-regulated
genes) in A2780cisR cells. In addition, we have identified a
unique set of 169 genes modulated by both compounds in
A2780 cells and a unique set of 3723 genes in A2780cisR cells
(Figure 3).
Identification of the Biological Pathway Induced by
Ruthenium Complexes 4 and 14. To investigate the
molecular mechanisms underlying the effects induced by the
hydrazinyl-thiazolo arene ruthenium compounds, we searched
databases for gene ontology (GO) terms and canonical
pathways. The GO enrichment analysis showed that the
common set of genes (n = 169) modulated by both ruthenium
compounds in the A2780 cell line was significantly enriched in
response to stimulus (GO:0050896|GO:0051869, 76 genes, p =
8.85 × 10−07), apoptotic process (GO:0006915|GO:0006917|
GO:0008632, 21 genes, p = 1.02 × 10−06), programmed cell
DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry Article

death (GO:0012501|GO:0016244, 21 genes, p = 1.39 × 10−06), of the p53 signaling pathway in inducing apoptosis, in both
response to stress (GO:0006950, 39 genes, p = 5.95 × 10−06), cisplatin-sensitive and cisplatin-resistant ovarian carcinoma cell
and cell death (GO:0008219, 21 genes, p = 1.09 × 10−05). In lines (Table 5). Our data showed that activation of autophagy
Table 4, we present the 21 common genes involved in was triggered by overexpression of DRAM1, AEN, and
apoptotic and cell death-related processes. TP53INP1 in the A2780 cell line (Figure 4). Under conditions
of genotoxic stress induced by different agents, TP53INP1
Table 4. Common Set of Differentially Expressed Genes promotes autophagy-dependent cell death by binding the
Involved in Apoptotic and Cell Death-Related Processes proteins of the ATG8-family, followed by degradation of certain
Modulated by Complexes 4 and 14 on the Ovarian A2780 antiapoptotic proteins, through partial displacement of
Cell Line sequestosome 1 (SQSTM1/p62).27,28 Moreover, the inhibition
of SQSTM1 can be orchestrated by DRAM129 which regulates
fold change autophagy through increasing the lysosomal activity and
ANOVA clearance of autophagosomes.30 In our study, we found high
gene symbol description 4 14 p-value levels of TP53INP1 induced by both complexes 4 (Fc = 3.96
DRAM1 DNA-damage regulated 2.87 2.33 0.039 up) and 14 (Fc = 3.33 up) and an increased expression of
autophagy modulator 1 DRAM1 induced by 4 (Fc = 3.19 up) and 14 (Fc = 2.53 up) in
ZMAT3 zinc finger, matrin-type 3 2.79 2.92 0.038
(ZMAT3) the A2780 ovarian cell line. The p53-dependent autophagy, as
TP53INP1 tumor protein p53 inducible 2.72 2.66 0.007 an effect of treatment, was also enhanced by overexpression of
nuclear protein 1 AEN, which is involved in the growth of autophagic vacuoles
RPS27L ribosomal protein S27-like 2.15 2.25 0.006 and LC3-II after genotoxic stress.31 The role of TP53INP1,
TP53I3 tumor protein p53 inducible 2.10 1.66 0.014 DRAM1, and AEN in ovarian cancer was little studied.
protein 3 Nevertheless, in a recent study,32 it was demonstrated that
PRMT2 protein arginine 2.07 1.97 0.040 downregulation of TP53INP1 expression by miR569 provided
methyltransferase 2
to ovarian cancer cells the ability to survive and develop
SHF Src homology 2 domain 1.94 2.19 0.033
containing F metastases, while by overexpression of TP53INP1 using anti-
ID1 inhibitor of DNA binding 1, 1.94 2.69 0.019 miR569 therapy, an activation of cell death was obtained.
dominant negative helix− Moreover, it was demonstrated that the combination of anti-
loop−helix protein miR569 and cisplatin therapy significantly reduces tumor
BAX BCL2-associated X protein 1.85 1.66 0.018
weights as compared to treatment with cisplatin alone,
FAS Fas (TNF receptor superfamily, 1.83 1.65 0.006
member 6) emphasizing the role of TP53INP1 in the management of
AEN apoptosis enhancing nuclease 1.78 1.81 0.013 ovarian tumor treatment. On the basis of these findings, the
C16orf5 chromosome 16 open reading 1.72 1.66 0.014 combination of cisplatin with ruthenium compounds could be
frame 5 considered as a valuable alternative for the treatment of ovarian
HTRA2 HtrA serine peptidase 2 1.65 1.65 0.033 cancer.
TRIAP1 TP53 regulated inhibitor of 1.64 1.63 0.008 To the best of our knowledge, there is no evidence regarding
apoptosis 1 the role of DRAM 1 in ovarian cancer, but AEN has been
SERPINB9 serpin peptidase inhibitor, 1.59 2.32 0.021 linked to the activation of UCHL1, an important regulator of
clade B (ovalbumin),
member 9 cisplatin resistance in ovarian cancer. Downregulation of tumor
RHOC Ras homologue gene family, 1.56 1.65 0.019 suppressor gene UCHL1 was associated with increased cisplatin
member C resistance, and there is the assumption that an increased level of
APH1B anterior pharynx defective 1 1.54 1.59 0.024 UCHL1 mediated pathways is considered a new promising
homologue B (C. elegans)
strategy to overcome cisplatin resistance in ovarian cancer.33
SLIT2 slit homologue 2 (Drosophila) −1.51 −1.88 0.017
Moreover, UCHL1 and HTRA2 are considered two key
BNIP3L BCL2/adenovirus E1B 19 kDa −1.62 −1.57 0.048
interacting protein 3-like components of inducing of apoptosis by proteolysis, in a
HK2 hexokinase 2 −1.91 −2.23 0.016 caspase-independent way mediated by TNf-α.34 Our microarray
CXCR4 chemokine (C-X-C motif) −4.21 −3.86 0.044 data revealed up-regulation of UCHL1 expression induced by
receptor 4 (CXCR4) both 4 (Fc = 2.00 up) and 14 (Fc = 2.76 up) in the A2780
ovarian cell line and more than 1.5-fold for complexes 4 and 14
The GO enrichment analysis conducted on the A2780cisR (microarray data).
cell line showed an over-representation of 85 GO terms in the TP53-dependent apoptosis was also modulated by the
common set of genes modulated by both 4 and 14. The overexpression of FAS, BAX, ZMAT3, TRIAP1, and TP53I3
majority of the GO terms were related to cellular processes and molecules in A2780 cells. In a recent paper,35 it was
component organization, metabolic processes, apoptosis, and demonstrated that overexpression of FAS could avoid the
cell death (Table S4). Furthermore, we focused our attention development of resistance to cisplatin, and thus, FAS could be a
on the genes involved in apoptosis and cell death. Our data promising therapeutic target to restore the sensitivity to
highlighted 180 differentially expressed genes with different cisplatin in ovarian cancer cells. In sensitive ovarian cell lines,
roles in apoptosis and cell death that were taken into we observed a 2.42-fold overexpression of FAS induced by 4
consideration for further analysis (Table S5). and a 1.92-fold overexpression of FAS induced by 14.
In order to better understand the mechanisms by which BAX was previously identified as an important target
complexes 4 and 14 modulate apoptosis in ovarian cell lines, we modulated by ruthenium compounds in the treatment of
performed a functional analysis on the sets of genes, modulated patients with acquired cisplatin resistance.36 Our data showed
by these compounds, and known to be involved in apoptosis. an increased expression of BAX, emphasizing its role as an
Using ingenuity pathway analysis (IPA), we highlighted the role activator of apoptosis by ruthenium compounds. We also
8479 DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry Article

Table 5. Top Five Canonical Pathways Identified in Gene Sets Related to Apoptotic Processes by Ingenuity Pathway Analysis
(IPA)
canonical pathways p-value ratio genes
A2780 cell line
p53 signaling 9.48 × 10−08 5/98 BAX, DRAM1,FAS, TP53I3, TP53INP1
(0.051)
−07
induction of apoptosis by HIV1 6.76 × 10 4/59 BAX, CRC4, FAS, HTRA2
(0.068)
tumoricidal function of hepatic 3.00 × 10−06 3/24 BAX, FAS, SERPINB9
natural killer cells (0.125)
apoptosis signaling 1.55 × 10−04 3/88 BAX, FAS, HTRA2
(0.034)
molecular mechanisms of cancer 7.76 × 10−04 4/356 APH1b, BAX, FAS, RHOC
(0.011)
A2780cisR Cell Line
protein ubiquitination pathway 4.68 × 10−12 20/252 HSPA5, HSPB8, PSMA1, PSMB1, PSMB4, PSMC1, PSMC3, PSMC5, PSMC6, PSMD3, PSMD4,
(0.079) PSMD6, PSMD11, PSMD12, PSMD13, PSME1, PSME2, SACS, UBA1, UBE2D3
p53 signaling 7.26 × 10−10 12/98 BBC3, BIRC5, E2F1, GADD45A, HIPK2, JMY, JUN, MDM4, PERP, PMAIP1, SIRT1, TP73
(0.122)
molecular mechanisms of cancer 8.86 × 10−06 15/356 ARHGEF2, ARHGEF9, ARHGEF16, ARHGEF17, BBC3, CDKN2C, E2F1, HIPK2, JAK2, JUN,
(0.042) MAX, PMAIP1, RHOB, SMAD6, TGFB3
cell cycle: G2/M DNA damage 1.91 × 10−04 5/49 CDK1, GADD45A, HIPK2, MDM4, TOP2A
checkpoint regulation (0.102)
ATM signaling 4.59 × 10−04 5/59 CDK1, GADD45A, JUN, MDM4, TP73
(0.085)

Figure 4. Activation of apoptotic and autophagy mechanisms induced by 4 and 14 in the A2780 cell line. Apoptosis is modulated by overexpression
of genes involved in p53 pathways such as FAS, BAX, HTRA2, TRIAP1, TP53INP1, CDIP1, or TP53I3, while autophagy is activated by
overexpression of DRAM1 and TP53INP1. The red color means overexpression of the mRNAs of specific genes in A2780 cells treated with 4 and 14
compared to that of untreated A2780 cells. Red intensities are proportional to mRNAs transcripts.

8480 DOI: 10.1021/acs.jmedchem.5b00855

J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry Article

Figure 5. Activation of apoptosis by 4 and 14 in the A2780cisR cell line. Both complexes induce apoptosis in A2780cisR cells by activation of
TNFRSF8 and TNFRSF10D death receptors, and by the transcription factors NURP1, FOXO3, AATF, JUN, FOSL2, and SIAH2. Molecules
involved in resistance mechanisms of platinum-based compounds such as ERCC2, HMGB1, and CLSPN are not activated by 4 and 14. The intensity
of the red color is proportional to the overexpression of the mRNAs induced by 4 and 14 in A2780cisR cells compared with those of untreated
A2780cisR cells, while the green color means a loss of the activity or a downregulation of gene expression in A2780cisR cells after treatment with 4
or 14 as compared to that of untreated cells.

noticed a 2.5-fold up-regulation of ZMAT3 induced by both
complexes 4 and 14. ZMAT3 is involved in activation of
apoptosis, either directly through the regulation of BAX, p21,
and FAS expression or indirectly by regulating the cell cycle
through cyclin D1 and 14−3−3σ.37,38 Moreover, ZMAT3
through its double-stranded-RNA-binding zinc finger protein
can bind different types of dsRNAs, increasing the effects on
cell cycle regulation and apoptosis, mediated by silencing
RNA.39,40 To date, no study reported ZMAT3 activation by
ruthenium compounds or their role in cisplatin-induced
apoptosis in ovarian cancer.
Genotoxic agents as these ruthenium compounds could also
activate apoptosis through oxidative stress by enzymatic
activity. One of the main actors involved in the control of
apoptosis in the generation of stress oxidative in a p53-
dependent manner is TP53I3.41 High levels of TP53I3 were
found in stress conditions during p53-mediated growth arrest,
followed by exposure to genotoxic agents.42 Our data confirm
the implication of TP53I3 in TP53-mediated apoptosis under
genotoxic stress conditions, almost a 2 up Fc regulation was
reported for both complexes 4 and 14 (Figure 4). Likewise, we
found a 2.8 Fc expression of RPS27L gene, induced by both
8481
complexes. RPS27L represents a target of the p53 wild-type
gene, which was previously reported to be a promoter of
apoptosis in genotoxic stress conditions under etoposide
treatment.43
The modulation of apoptosis could also be dependent on a
negative regulation of some important antiapoptotic genes by
blocking their transcriptional factors as NF-Kb.44 Along this
line, PRMT2, one of the NF-kB modulators, blocks trans-
location of NF-kB in the nucleus and therefore its antiapoptotic
target genes;45 however, there are no data related to the role of
PRMT2 in the modulation of apoptosis in ovarian cancer
induced by ruthenium compounds.
All of the above taken together revealed new molecules and
pathways involved in the cell death of A2780 ovarian cancer
cells by the hydrazinyl-thiazolo arene ruthenium complexes.
Then, we focused our attention on the mechanism and
pathways modulated by complexes 4 and 14 in the cisplatin-
resistant A2780cisR ovarian cancer cells (Figure 5).
Among the genes in the network generated by A2780cisR
cells, NURP1 and TRIB3 were indicated as upstream regulators
by IPA analysis. NURP1 is a transcription regulator predicted
to be “activated” by ruthenium compounds and significantly
DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry
Table 6. Upstream Regulators Activated by 4 and 14 in the A2780cisR Cell Line
upstream fold predicted activation
regulator change molecule type state
TRIB3 6.253 kinase inhibited
NURP1 3.829 transcription activated
regulator
Figure 6. qRT-PCR validation of microarray data in the A2780 cell line. Fold change (Fc) values were calculated by the ΔΔCt method relative to the
CTR group (untreated cells). The p-values were assessed by ANOVA, and a Tukey’s test was used for posthoc pairwise comparisons (* p < 0.05, **
p < 0.01, *** p < 0.001).
affect the expression of their target genes such as CYR61,
FOXO3, and TRIB3. The relationship between upstream
regulators and their target genes is presented in Table 6.
We noticed different transcriptional patterns for A2780cisR
compared with those of the A2780 ovarian cell line in response
to 4 and 14. One hundred eighty differentially expressed genes
with a different role in apoptosis and cell death were commonly
modulated by 4 and 14 in the A2780cisR ovarian cell line
(Figure 3). Our data indicated that p53 signaling was, as for the
cisplatin-sensitive cell line, one of the most important pathways
activated by the hydrazinyl-thiazolo arene ruthenium complexes
in the A2780cisR cell line (Table 5). However, unlike the
A2780 cell line, a different set of pro-apoptotic molecules such
as BBC3,46 BCL2L13,47 HRK,48 AIFM3,49 PMAIP1,50 and
GADD45A,51 was activated in the A2780ciR cell line (Figure
5). An overexpression greater than 2.5 Fc was recorded for
HRK, AIFM3, PMAIP1, and GADD45A, while for BBC3 and
BCL2L13 a minimum of 1.78 Fc up-regulation was recorded
for both complexes. To our knowledge, there are no studies to
present data related to these molecules as modulators of
Article
p-value of
z-score overlap target molecules in data set
−2.236 2.94 × 10−06 DDIT4, GARS, HERPUD1, PMAIP1, TRIB3
3.464 1.63 × 10−03 BUB1, BUB1B, CEBPB, CYR61, DHCR24, ESPL1,
FOXO3, TRIB3
apoptosis induced by ruthenium compounds. Nevertheless, low
levels of GADD45A and BBC3/PUMA were previously
associated with cisplatin resistance in ovarian cancer.52
Considering this issue, by the growth of its expression, BBC3
was already proposed as a chemosensitizer in ovarian cancer
therapy based on platinum compounds.53 Our qRT-PCR data
confirm the role of BBC3 as a sensitizer for cisplatin resistance,
induced by ruthenium compounds, with 2.78 and 3.38 Fc up-
regulation for complexes 4 and 14.
Going deeper with functional analysis, we focused our
attention on five transcriptional factors including JUN, AATF,
SIAH2, NUPR1, and FOXO3 that were positively correlated
with activation of apoptosis. FOXO3 and JUN were both
associated with BBC3/PUMA activation, their dual expression
being considered necessary to overcome chemo-resistance in
ovarian cancer cells.54 Moreover, our data revealed that JUN-
mediated pathways have involved supplementary molecules and
death modulators. In brief, JUN activated by the NURP1
upstream regulator and FOXO3 via CYR6 led to the activation
of two supplementary death modulators, DEDD2 and PDCD4,
8482 DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry
Figure 7. qRT-PCR validation of microarray data in the A2780cisR cell line. Fold change (Fc) values were calculated by the ΔΔCt method relative
to the CTR group (untreated cells). The p-values were assessed by ANOVA, and a Tukey’s test was used for posthoc pairwise comparisons (* p <
0.05, ** p < 0.01, *** p < 0.001).
respectively. Recently, it was demonstrated that low levels of
PDCD4 were associated with cisplatin resistance in ovarian
cancer cells, and by increasing PDCD4 expression by miRNA
modulation, sensitivity to cisplatin was restored.55 With 1.66 Fc
expression for 4 and 1.90 Fc expression for 14, our microarray
data confirmed the activation of PDCD4 by ruthenium
compounds. In addition, under cellular stress, AATF triggers
and increases the expression of JUN-mediated apoptosis.56 We
found that SIAH2 activates the proteasome protein ubiquitin
pathway by PSMD4 and UBE2D3 molecules; however, there
are still no studies that evaluated the activation of these
molecules in relation to apoptosis induced by platinum or
ruthenium metal-based drugs. Interestingly, we noticed that
molecules involved in DNA repair, associated with cisplatin
resistance, such as ERCC2, HMGB1, CLSPN, or E2F, were not
activated following the treatment with 4 or 14, which also
highlights the advantage of these classes of compounds for
treatment of ovarian cancer cells resistant to cisplatin.
Microarray Data Validation. In order to assess the
reliability of the microarray data, 21 common genes modulated
by both ruthenium complexes were considered for qRT-PCR
validation. The selected genes were chosen according to their
known functions in apoptosis and autophagy related to p53
pathways. For the A2780 cell line, PCR data showed a good
correlation with the microarray data, except for the BNIP3L
gene (Figure 6). This result could be explained because BNIP3l
had a p-value close to the threshold (0.048) in the microarray
experiment (Figure 6). For the A2780cisR cell line, all of the
selected genes showed the same expression pattern as in the
microarray experiment and were validated by qRT-PCR (Figure
7).
One of the major problems reported for ovarian cancers is
related to the development of a multidrug resistance to a broad
8483
Article
range of chemotherapeutic agents. Although, initially about
85% of ovarian cancers respond very well to first-line
chemotherapy based on platinum compounds and taxanes,
less than 15% will remain in complete remission. Unfortunately,
the majority of patients with ovarian cancers will develop
progressive resistance. Depending on the time of relapse, three
kind of platinum resistance mechanisms have been recorded:
increased resistance if the relapse occurs within 6 months after
the first-line treatment; partial resistance if the relapse is
recorded between 6 and 12 months after completing the initial
treatment; and theoretically no resistance if relapse occurs after
one year of finishing the first line therapy. Nevertheless,
cisplatin based retreatment in the second line of patients with
no platinum resistance will be effective only for about 60% of
the patients, while for partial platinum resistance only a quarter
of the patients will respond to a second platinum-based
therapy.57 Generally, the classical treatment based on platinum
compounds had a modest impact on overall survival (OS) in
the last two decades.58,59 Because treatments with platinum
compounds have reached a threshold of efficacy, it is necessary
to identify new chemical compounds with less cross-resistance.
Processes of Cell Death. As previously discussed, the
biological pathway induced by the hydrazinyl-thiazolo arene
ruthenium complexes 4 and 14 suggests apoptosis as the main
cell death mechanism. Therefore, all cancerous cell lines (HeLa,
A2780, and A2780cisR) were treated with complexes 4 and 14
at the corresponding IC50 concentrations and with staurospor-
ine (2 μg/mL) as a positive control (see Experimental Section).
The percentage of apoptotic cells (cells with condensed and/or
fragmented nuclei) was determined by Hoechst staining (see
Figure S1). For both compounds and on all cancer cell lines, at
least 60% of the nuclei showed chromatin condensation and
fragmentation, two typical apoptotic features.60 The morphol-
DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry Article

Figure 8. Morphology of the nuclei of HeLa cells observed by fluorescence microscopy (Hoechst staining, 24 h incubation at IC50 concentrations)
after treatment with or without (control) complexes 4 and 14, and with staurosporine (2 μg/mL).

Figure 9. Disruption of mitochondrial membrane potential by TMRE staining upon addition of complexes 4, 14, and staurosporine to the cancerous
cells A2780 and A2780cisR.

Figure 10. Combination of Hoechst (blue fluorescence) and TMRE (red fluorescence) staining experiments, showing the effect of complexes 4, 14,
and staurosporine on HeLa cells (24 h incubations at IC50 concentrations).

ogy of the nuclei of HeLa cells after 24 h of incubation with or
without (control) complexes 4 and 14 and with staurosporine
is presented in Figure 8.
In addition, the effect of complexes 4 and 14 on the
mitochondrial membrane potential was assessed using
tetramethylrhodamine ethyl ester (TMRE) staining. As can
be appreciated in Figure 9, undisrupted mitochondrial
membranes are observed for control cells (intense fluorescence
staining), while upon addition of complexes 4 and 14 to A2780
and A2780cisR cells, mitochondrial membranes are altered
Finally, using an inverted fluorescence microscopy, the
implication of autophagy was also investigated on the cancerous
cell lines HeLa, A2780, and A2780cisR. Autophagy was
evaluated using a protocol based on monodansylcadaverine
(MDC) staining, and tamoxifen (10 μM) was used as a positive
control. Like tamoxifen, both complexes (24 h of incubation
with 4 and 14 at IC50 concentrations) clearly increase the
fluorescence intensity of the staining agent as compared to that
of untreated cells (control), confirming that autophagy is also
involved in the cell death of HeLa, A2780, and A2780cisR
cancerous cells (Figure 11).

(weak or no fluorescence staining).
Moreover, by combining the Hoechst and TMRE staining
procedures, morphological modifications of the nucleus and
disruption of the mitochondrial membranes on HeLa cells can
be visualized (Figure 10). Indeed, the combination of both
staining agents emphasized cell death and confirmed the role of
apoptosis in sustaining tumor cell death, which further support
the gene expression data.
8484
■
CONCLUSIONS
In this study, we have reported the synthesis, the in vitro
antiproliferative activity, and the molecular mechanisms
underlying cell death in cancer cells from a new class of
hydrazinyl-thiazolo arene ruthenium complexes. Our data bring
a better understanding of the molecular mechanisms underlying
biological and pharmacological profiles induced by arene
DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry
Figure 11. Fluorescence intensity corresponding to autophagy upon
addition of complexes 4, 14 (24 h incubation at IC50 concentrations),
and tamoxifen (10 μM) to cancer cells (control = cells treated with
only the staining agent).
ruthenium compounds and highlights their role in treating and
overcoming cisplatin resistance mechanisms in ovarian cancers.
We found that the p53 signaling pathway was one of the
most important activated pathways in both cisplatin-sensitive
and cisplatin-resistant cancer cell lines, despite the fact that
signal transduction occurs through different molecules in these
cell lines. Moreover, new activated molecules such as FAS,
ZMAT3, PRMT2, BBC3/PUMA, GADD45A, and PDCD4
whose overexpression is associated with overcoming resistance
to cisplatin therapy in ovarian cancers were identified.
Consequently, these results suggest that our hydrazinyl-thiazolo
arene ruthenium complexes could be used in association with
cisplatin to prevent the development of cisplatin resistance
mechanisms, thus inducing cell death in ovarian cancers under a
synergetic effect. This study describes for the first time on
ovarian cancer cell lines the pathways and molecular
mechanisms modulated by hydrazinyl-thiazolo arene ruthenium
complexes.
■
EXPERIMENTAL SECTION
The starting material (η6-p-cymene)2Ru2Cl461 and the hydrazinyl-
thiazole derivatives (L1−L16)17 were prepared according to the
literature. All other reagents were commercially available (Sigma-
Aldrich, TCI Europe) and were used without further purification. The
1
H NMR spectra were recorded on a Bruker Avance II 400
spectrometer, using the residual protonated solvent as an internal
standard. Infrared spectra were recorded as KBr pellets on a
PerkinElmer FTIR 1720 X spectrometer. Elemental analyses were
performed by the Mikroelementarisches Laboratorium, ETH Zürich
(Zürich, Switzerland). Elemental analyses confirm ≥95% purity for all
of the tested compounds. Electrospray ionization mass spectra were
recorded in positive-ion mode with a Bruker FTMS 4.7T BioAPEX II
mass spectrometer (University of Fribourg, Switzerland). Microwave
assisted syntheses were performed in sealed vessels using a CEM
Discover LabMate instrument, ensured with online inside temperature
and pressure controls.
Synthesis and Characterization of Compounds 1−16. (a) A
mixture of (η6-p-cymene)2Ru2Cl4 (100 mg; 0.163 mmol) and
hydrazinyl-thiazole (0.327 mmol) in methanol (50 mL) was stirred
at room temperature for 10 h. The solvent was then completely
removed under vacuum, and the residue was dissolved in dichloro-
methane (5 mL). The product was precipitated by pouring this
solution into 200 mL of n-hexane, filtering, washing multiple times
with n-hexane, and finally drying under vacuum to afford the
corresponding salts in good yields (Table S1).
(b) A reaction mixture containing (η6-p-cymene)2Ru2Cl4 (100 mg;
0.163 mmol) and the hydrazinyl-thiazole (0.327 mmol) in dichloro-
methane (10 mL) was introduced into a quartz reaction vessel, which
was sealed and then subjected to microwave irradiation for 30 min at
an internal temperature of 60 °C. The mixture was then concentrated
under vacuum (2 mL), and the residue was precipitated with n-hexane
8485
Article
(50 mL), filtered, and washed multiple times with n-hexane, and the
solid was dried under vacuum. The yields are listed in Table S1.
1: [(η6-p-Cymene)Ru(L1)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.07 (d, 3JH−H = 7.1 Hz, 3H), 1.15 (d, 3JH−H = 7.1 Hz, 3H), 2.26 (s,
3H), 2.46 (s, 3H), 2.57 (sept, 3JH−H = 7.1 Hz, 1H), 4.52 (d, 3JH−H =
6.0 Hz, 1H), 5.06 (d, 3JH−H = 6.0 Hz, 1H), 5.18 (d, 3JH−H = 6.0 Hz,
1H), 5.44 (d, 3JH−H = 6.0 Hz, 1H), 6.49 (s, 1H), 7,55−7.57 (m, 3H),
8.12 (m, 2H), 9.32 (s, 1H), 15.63 (s, 1H) ppm. ESI-MS m/z (+):
488.05 M+. Anal. Calcd for C21H25N3SCl2Ru: C, 48.18; H, 4.81; N,
8.03. Found: C, 48.18; H, 4.83; N, 7.96. IR (KBr): 2958 (m), 2919
(m), 2525 (s), 1557 (s), 1505 (s), 1387 (m), 1306 (s), 1257 (m),
1093 (m) cm−1.
2: [(η6-p-Cymene)Ru(L2)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
0.96 (d, 3JH−H = 6.8 Hz, 3H), 1.01 (d, 3JH−H = 6.8 Hz, 3H), 2.14 (s,
3H), 2.36 (sept, 3JH−H = 6.8 Hz, 1H), 4.03 (d, 3JH−H = 5.4 Hz, 1H),
4.25 (d, 3JH−H = 5.4 Hz, 1H), 4.65−4.66 (m, 2H), 6.74 (s, 1H), 7.54−
7.56 (m, 6H), 7.90−7.91 (m, 2H), 8.12−8.13 (m, 2H), 9.30 (s, 1H),
15.88 (s, 1H) ppm. ESI-MS m/z (+): 550.06 M+. Anal. Calcd for
C26H27N3SCl2Ru·0.5 H2O: C, 52.52; H, 4.75; N, 7.07. Found: C,
52.63; H, 4.55; N, 6.90. IR (KBr): 2916 (m), 2501 (m), 1575 (s),
1500 (s), 1384 (m), 1313 (m), 1090 (s) cm−1.
3: [(η6-p-Cymene)Ru(L3)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.08 (d, 3JH−H = 6.9 Hz, 3H), 1.16 (d, 3JH−H = 6.9 Hz, 3H), 2.28 (s,
3H), 2.45 (s, 3H), 2.56 (sept, 3JH−H = 6.9 Hz, 1H), 2.82 (s, 3H), 4.51
(d, 3JH−H = 5.8 Hz, 1H), 5.09 (d, 3JH−H = 5.8 Hz, 1H), 5.22 (d, 3JH−H =
5.8 Hz, 1H), 5.41 (d, 3JH−H = 5.8 Hz, 1H), 7.58−7.60 (m, 3H), 8.14
(d, 3JH−H = 7.1 Hz, 2H), 9.34 (s, 1H), 12.95 (s, 1H) ppm. ESI-MS m/z
(+): 529.9 M+. Anal. Calcd for C23H27N3OSCl2Ru: C, 48.85; H, 4.81;
N, 7.43. Found: C, 48.96; H, 5.34; N, 6.87. IR (KBr): 2965 (w), 1637
(m), 1568 (s), 1475 (s), 1374 (m), 1309 (s) cm−1.
4: [(η6-p-Cymene)Ru(L4)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.08 (d, 3JH−H = 6.8 Hz, 3H), 1.16 (d, 3JH−H = 6.8 Hz, 3H), 1.35 (t,
3
JH−H = 7.2 Hz, 3H), 2.20 (s, 3H), 2.60 (sept, 3JH−H = 6.8 Hz, 1H),
3.80 (s, 2H), 4.29 (q, 3JH−H = 7.2 Hz, 2H), 4.37 (d, 3JH−H = 5.9 Hz,
1H), 5.19 (d, 3JH−H = 5.9 Hz, 1H), 5.24 (d, 3JH−H = 5.9 Hz, 1H), 5.62
(d, 3JH−H = 5.9 Hz, 1H), 6.83 (s, 1H), 7.47 (dd, 3JH−H = 8.4 Hz, 4JH−H
= 1.9 Hz, 1H), 7.58 (d, 4JH−H = 1.9 Hz, 1H), 8.42 (d, 3JH−H = 8.4 Hz,
1H), 9.24 (s, 1H), 16.08 (s, 1H) ppm. ESI-MS m/z (+): 630.0 M+.
Anal. Calcd for C24H27N3O2SCl4Ru·H2O: C, 42.24; H, 4.28; N, 6.16.
Found: C, 42.43; H, 4.08; N, 6.31. IR (KBr): 2918 (m), 1732 (m),
1589 (s), 1551 (s), 1470 (s), 1384 (s), 1259 (m), 1146 (m), 1083
(m), 1056 (m) cm−1.
5: [(η6-p-Cymene)Ru(L5)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.07 (d, 3JH−H = 7.1 Hz, 3H), 1.13 (d, 3JH−H = 7.1 Hz, 3H), 2.49 (s,
3H), 2.54 (sept, 3JH−H = 7.1 Hz, 1H), 2.63 (s, 3H), 2.79 (s, 3H), 5.08
(d, 3JH−H = 5.4 Hz, 1H), 5.35 (d, 3JH−H = 5.4 Hz, 1H), 5.57 (d, 3JH−H =
5.4 Hz, 1H), 5.65 (d, 3JH−H = 5.4 Hz, 1H), 7.31 (d, 3JH−H = 8.6 Hz,
1H), 7.42 (s, 1H), 7.98 (d, 3JH−H = 8.6 Hz, 1H), 8.29 (s, 1H), 12.83 (s,
1H) ppm. ESI-MS m/z (+): 599.8 M + . Anal. Calcd for
C23H25N3OSCl4Ru·H2O: C, 42.34; H, 4.17; N, 6.44. Found: C,
42.66; H, 3.96; N, 6.30. IR (KBr): 2975 (m), 1604 (m), 1564 (m),
1384 (s), 1328 (s), 1055 (s) cm−1.
6: [(η6-p-Cymene)Ru(L6)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.07 (d, 3JH−H = 6.2 Hz, 3H), 1.15 (d, 3JH−H = 6.2 Hz, 3H), 1.33 (t,
3
JH−H = 6.6 Hz, 3H), 2.21 (s, 3H), 2.62 (sept, 3JH−H = 6.2 Hz, 1H),
2.78 (s, 3H), 4.27 (q, 3JH−H = 6.6 Hz, 2H), 5.12 (d, 3JH−H = 5.5 Hz,
1H), 5.18 (d, 3JH−H = 5.5 Hz, 1H), 5.41 (d, 3JH−H = 5.5 Hz, 1H), 5.59
(d, 3JH−H = 5.5 Hz, 1H), 7.44 (d, 3JH−H = 8.2 Hz, 1H), 7.56 (s, 1H),
8.55 (d, 3JH−H = 8.2 Hz, 1H), 8.78 (s, 1H), 13.43 (s, 1H) ppm. ESI-
MS m/z (+): 630.0 M+. Anal. Calcd for C24H27N3O2SCl4Ru: C, 43.39;
H, 4.10; N, 6.32. Found: C, 43.47; H, 4.24; N, 6.26. IR (KBr): 2965
(w), 1709 (m), 1585 (s), 1474 (s), 1373 (s), 1317 (s), 1276 (s), 1099
(s) cm−1.
7: [(η6-p-Cymene)Ru(L7)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.07 (d, 3JH−H = 6.9 Hz, 3H), 1.14 (d, 3JH−H = 6.9 Hz, 3H), 2.27 (s,
3H), 2.46 (s, 3H), 2.54 (sept, 3JH−H = 6.9 Hz, 1H), 4.81 (d, 3JH−H =
5.7 Hz, 1H), 5.09 (d, 3JH−H = 5.7 Hz, 1H), 5.18 (d, 3JH−H = 5.7 Hz,
1H), 5.44 (d, 3JH−H = 5.7 Hz, 1H), 6.48 (s, 1H), 7.12 (d, 3JH−H = 8.4
Hz, 2H), 7.70 (d, 3JH−H = 8.4 Hz, 2H), 8.76 (s, 1H), 14.23 (s, 1H)
ppm. ESI-MS m/z (+): 504.05 M + . Anal. Calcd for
DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry
C21H25N3OSCl2Ru·0.5 H2O: C, 45.99; H, 4.78; N, 7.66. Found: C,
45.90; H, 4.98; N, 7.12. IR (KBr): 2965 (m), 1607 (s), 1552 (m),
1509 (s), 1383 (m), 1284 (m), 1254 (m), 1174 (m) cm−1.
8: [(η6-p-Cymene)Ru(L8)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
0.96 (d, 3JH−H = 6.3 Hz, 3H), 1.01 (d, 3JH−H = 6.3 Hz, 3H), 2.16 (s,
3H), 2.32 (sept, 3JH−H = 6.3 Hz, 1H), 3.95 (d, 3JH−H = 5.7 Hz, 1H),
4.60 (d, 3JH−H = 5.7 Hz, 1H), 4.71−4.73 (m, 2H), 6.73 (s, 1H), 7.15−
7.18 (m, 2H), 7.54−7.55 (m, 3H), 7.75−7.77 (m, 2H), 7.90−7.92 (m,
2H), 8.77 (s, 1H), 14.25 (s, 1H) ppm. ESI-MS m/z (+): 565.9 M+.
Anal. Calcd for C26H27N3OSCl2Ru·H2O: C, 50.40; H, 4.72; N, 6.78.
Found: C, 50.17; H, 4.61; N, 6.32. IR (KBr): 2969 (s), 1605 (s), 1572
(s), 1508 (s), 1278 (m), 1174 (m) cm−1.
9: [(η6-p-Cymene)Ru(L9)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.13 (d, 3JH−H = 6.8 Hz, 3H), 1.20 (d, 3JH−H = 6.8 Hz, 3H), 2.33 (s,
3H), 2.50 (s, 3H), 2.63 (sept, 3JH−H = 6.8 Hz, 1H), 3.96 (s, 3H), 4.83
(d, 3JH−H = 5.8 Hz, 1H), 5.15 (d, 3JH−H = 5.8 Hz, 1H), 5.26 (d, 3JH−H =
5.8 Hz, 1H), 5.50 (d, 3JH−H = 5.8 Hz, 1H), 6.51 (s, 1H), 7.10 (d, 3JH−H
= 8.8 Hz, 2H), 8.18 (d, 3JH−H = 8.8 Hz, 2H), 9.25 (s, 1H), 15.36 (s,
1H) ppm. ESI-MS m/z (+): 517.9 M + . Anal. Calcd for
C22H27N3OSCl2Ru: C, 47.74; H, 4.92; N, 7.59. Found: C, 47.52; H,
4.94; N, 7.40. IR (KBr): 2966 (w), 2481 (w), 1604 (s), 1554 (m),
1509 (s), 1378 (w), 1306 (m), 1266 (s), 1180 (m), 1087 (w) cm−1.
10: [(η6-p-Cymene)Ru(L10)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
0.98 (d, 3JH−H = 6.8 Hz, 3H), 1.02 (d, 3JH−H = 6.8 Hz, 3H), 2.17 (s,
3H), 2.38 (sept, 3JH−H = 6.8 Hz, 1H), 4.00 (d, 3JH−H = 6.1 Hz, 1H),
4.53 (d, 3JH−H = 6.1 Hz, 1H), 4.70 (d, 3JH−H = 6.1 Hz, 1H), 4.74 (d,
3
JH−H = 6.1 Hz, 1H), 6.72 (s, 1H), 7.06 (d, 3JH−H = 8.7 Hz, 2H), 7.55
(m, 3H), 7.91 (m, 2H), 8.15 (d, 3JH−H = 8.7 Hz, 2H), 9.20 (s, 1H),
15.67 (s, 1H) ppm. ESI-MS m/z (+): 580.1 M+. Anal. Calcd for
C27H29N3OSCl2Ru·H2O: C, 51.18; H, 4.93; N, 6.63. Found: C, 51.36;
H, 4.78; N, 6.49. IR (KBr): 2966 (w), 1604 (s), 1574 (m), 1509 (s),
1309 (m), 1271 (s), 1178 (m), 1085 (m) cm−1.
11: [(η6-p-Cymene)Ru(L11)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.10 (d, 3JH−H = 6.9 Hz, 3H), 1.16 (d, 3JH−H = 6.9 Hz, 3H), 1.33 (t,
3
JH−H = 7.1 Hz, 3H), 2.32 (s, 3H), 2.57 (sept, 3JH−H = 6.9 Hz, 1H),
2.82 (s, 3H), 3.93 (s, 3H), 4.30 (q, 3JH−H = 7.1 Hz, 2H), 4.78 (d, 3JH−H
= 5.9 Hz, 1H), 5.13 (d, 3JH−H = 5.9 Hz, 1H), 5.26 (d, 3JH−H = 5.9 Hz,
1H), 5.45 (d, 3JH−H = 5.9 Hz, 1H), 7.07 (d, 3JH−H = 8.7 Hz, 2H), 8.15
(d, 3JH−H = 8.7 Hz, 2H), 9.20 (s, 1H), 16.01 (s, 1H) ppm. ESI-MS m/z
(+): 589.9 M+. Anal. Calcd for C25H31N3O3SCl2Ru·CH2Cl2: C, 43.95;
H, 4.68; Found: C, 43.67; H, 4.75. IR (KBr): 2966 (w), 1710 (m),
1604 (s), 1575 (s), 1509 (s), 1477 (m), 1372 (m), 1314 (s), 1268 (s),
1178 (m), 1099 (s) cm−1.
12: [(η6-p-Cymene)Ru(L12)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.13 (d, 3JH−H = 6.4 Hz, 3H), 1.20 (d, 3JH−H = 6.4 Hz, 3H), 2.35 (s,
3H), 2.47 (s, 3H), 2.62 (sept, 3JH−H = 6.4 Hz, 1H), 2.86 (s, 3H), 3.96
(s, 3H), 4.81 (d, 3JH−H = 4.8 Hz, 1H), 5.16 (d, 3JH−H = 4.8 Hz, 1H),
5.29 (d, 3JH−H = 4.8 Hz, 1H), 5.46 (d, 3JH−H = 4.8 Hz, 1H), 7.10 (d,
3 These cell lines were cultivated under sterile conditions by using RPMI
JH−H = 8.0 Hz, 2H), 8.20 (d, 3JH−H = 8.0 Hz, 2H), 9.18 (s, 1H), 12.46
(s, 1H) ppm. ESI-MS m/z (+): 560.1 M+. Anal. Calcd for
C24H29N3O2SCl2Ru·H2O: C, 46.98; H, 5.09; N, 6.85. Found: C,
46.94; H, 4.91; N, 6.77. IR (KBr): 2963 (w), 1638 (m), 1604 (s), 1574
(m), 1510 (s), 1475 (m), 1374 (m), 1307 (s), 1262 (s), 1179 (m)
cm−1.
13: [(η6-p-Cymene)Ru(L13)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.06 (d, 3JH−H = 6.8 Hz, 3H), 1.15 (d, 3JH−H = 6.8 Hz, 3H), 2.30 (s,
3H), 2.45 (s, 3H), 2.59 (sept, 3JH−H = 6.8 Hz, 1H), 4.63 (d, 3JH−H =
5.6 Hz, 1H), 5.11 (d, 3JH−H = 5.6 Hz, 1H), 5.17 (d, 3JH−H = 5.6 Hz,
1H), 5.46 (d, 3JH−H = 5.6 Hz, 1H), 6.44 (s, 1H), 7.51 (m, 2H), 7.91 (d,
3
JH−H = 7.1 Hz, 1H), 9.24 (s, 1H), 13.95 (s, 1H) ppm. ESI-MS m/z
(+): 524.1 M+. Anal. Calcd for C21H24N3SCl3Ru·CH2Cl2: C, 41.10; H,
4.08; N, 6.54; Found: C, 41.40; H, 4.08; N, 6.33. IR (KBr): 2966 (w),
1604 (s), 1509 (s), 1375 (m), 1309 (s), 1261 (m), 1178 (m) cm−1.
14: [(η6-p-Cymene)Ru(L14)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
0.98 (d, 3JH−H = 6.8 Hz, 3H), 1.03 (d, 3JH−H = 6.8 Hz, 3H), 2.18 (s,
3H), 2.40 (sept, 3JH−H = 6.8 Hz, 1H), 4.02 (d, 3JH−H = 5.9 Hz, 1H),
4.42 (d, 3JH−H = 5.9 Hz, 1H), 4.69 (d, 3JH−H = 5.9 Hz, 1H), 4.78 (d,
3
JH−H = 5.9 Hz, 1H), 6.77 (s, 1H), 7.54 (m, 5H), 7.90 (m, 3H), 8.50
(s, 1H), 9.27 (s, 1H), 16.05 (s, 1H) ppm. ESI-MS m/z (+): 584.0 M+.
8486
Article
Anal. Calcd for C26H26N3SCl3Ru·1.5 H2O: C, 48.27; H, 4.52; N, 6.49.
Found: C, 48.23; H, 4.01; N, 6.32. IR (KBr): 2969 (w), 2478 (m),
1578 (s), 1499 (m), 1379 (w), 1325 (w), 1257 (w), 1088 (m) cm−1.
15: [(η6-p-Cymene)Ru(L15)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.11 (d, 3JH−H = 6.8 Hz, 3H), 1.28 (d, 3JH−H = 6.8 Hz, 3H), 2.16 (s,
3H), 2.37 (s, 3H), 2.80 (s, 3H), 2.92 (sept, 3JH−H = 6.8 Hz, 1H), 4.50
(d, 3JH−H = 5.9 Hz, 1H), 5.03 (d, 3JH−H = 5.9 Hz, 1H), 5.18 (d, 3JH−H =
5.9 Hz, 1H), 5.48 (d, 3JH−H = 5.9 Hz, 1H), 7.37 (m, 2H), 7.52 (d,
3
JH−H = 7.4 Hz, 1H), 7.70 (s, 1H), 8.34 (s, 1H), 12.69 (s, 1H) ppm.
ESI-MS m/z (+): 564.0 M+. Anal. Calcd for C23H26N3OSCl3Ru: C,
46.05; H, 4.37; N, 7.00. Found: C, 45.89; H, 4.32; N, 6.98. IR (KBr):
2963 (w), 1638 (m), 1560 (s), 1475 (m), 1374 (m), 1308 (s), 1079
(w) cm−1.
16: [(η6-p-Cymene)Ru(L16)Cl]Cl. 1H NMR (CDCl3, 400 MHz): δ =
1.08 (d, 3JH−H = 6.2 Hz, 3H), 1.17 (d, 3JH−H = 6.2 Hz, 3H), 1.34 (t,
3
JH−H = 7.2 Hz, 3H), 2.32 (s, 3H), 2.60 (sept, 3JH−H = 6.2 Hz, 1H)
2.82 (s, 3H), 4.31 (q, 3JH−H = 7.2 Hz, 2H), 4.61 (d, 3JH−H = 5.3 Hz,
1H), 5.15 (d, 3JH−H = 5.3 Hz, 1H), 5.24 (d, 3JH−H = 5.3 Hz, 1H), 5.47
(d, 3JH−H = 5.3 Hz, 1H), 7.56 (m, 2H), 7.93 (m, 1H), 8.46 (s, 1H),
9.32 (s, 1H), 12.68 (s, 1H) ppm. ESI-MS m/z (+): 593.9 M+. Anal.
Calcd for C24H28N3O2SCl3Ru·1.5 H2O: C, 43.88; H, 4.76; N, 6.40.
Found: C, 43.76; H, 4.46; N, 5.88. IR (KBr): 2965 (w), 1711 (m),
1574 (s), 1475 (s), 1372 (m), 1316 (s), 1276 (s), 1100 (s) cm−1.
X-ray Crystallography. A crystal of 12 was mounted on a Stoe
Image Plate Diffraction system equipped with a Φ circle goniometer,
using Mo Kα graphite monochromated radiation (λ = 0.71073 Å) with
Φ range 0−200°. Crystal data for 12: Monoclinic space group P21/c
(No. 14), cell parameters a = 16.2513(19), b = 15.1904(12), and c =
13.3986(13) Å, β = 107.817(8), V = 3149.0(5) Å3, T = 173(2) K, Z =
4, Dc = 1.256 g cm−3, F(000) 1216, λ (Mo Kα) = 0.71073 Å, 8557
reflections measured, and 2494 unique (Rint = 0.2499), which were
used in all calculations. The structure was solved by direct methods
using the program SHELXS-97, while the refinement and all further
calculations were carried out using SHELXL-97.62 The hydrogen
atoms were included in calculated positions and treated as riding
atoms using the SHELXL default parameters. The non-hydrogen
atoms were refined anisotropically, using weighted full-matrix least-
squares on F2 with 304 parameters. R1 = 0.0515 (I > 2σ(I)) and wR2 =
0.0975, GOF = 0.629; max/min residual density 0.447/−0.729 eÅ−3.
Figure 1 was drawn with ORTEP63 and the structural data deposited at
The Cambridge Crystallographic Data Centre: CCDC 1063589.
These data can be obtained free of charge from The Cambridge
Crystallographic Data Centre via www.ccdc.cam.ac.uk/data_request/
cif.
Biology. Cell Cultures. The human cervical cancer cells (HeLa),
the human ovarian cancer cells (A2780), the cisplatin-resistant human
ovarian cancer cells (A2780cisR), and the noncancerous cells (HFL-1)
were obtained from the European Centre of Cell Cultures (ECACC).
1640 (Sigma-Aldrich) growth media. This medium was supplemented
with fetal calf serum (FCS, Sigma-Aldrich, 5%), antibiotics (penicillin−
streptomycin, Actavis Sindan Pharma, 0.1%), and glutamine (Sigma-
Aldrich, 0.1%) at 37 °C and CO2 (5%).
Cell Proliferation Inhibition. The cytotoxicity activity was
determined using the MTT assay. The cells were seeded in 96-well
plates with 100 μL of cell solution (cca. 10.000 cells/well) and
incubated for 24 h. The 2a−p compounds were initially dissolved in
DMSO, followed by a series of successive dilutions using RPMI 1640
media, so that the final concentration of DMSO was under 0.1%.
The cells were treated with thiazolo-ruthenium complexes
(concentrations between 0.1 μM−100 μM) for 24 h, with a final
volume in the well of 200 μL. After the treatment, the culture media
were removed, MTT (3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-
tetrazolium bromide)−Hanks media solution was added to each well,
and the plates were incubated for a further 2 h. The formazan crystals
formed by the mitochondrial dehydrogenase activity of vital cells were
dissolved in DMSO.
The optical density, quantified by colorimetric measurements, is
directly proportional to the amount of formazan crystals formed in the
cells, and it is an indicator of the cellular viability. The plates were
DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry
measured with a multimode microplate reader (Biotek Synergy 2
Multi-Mode Microplate Reader with SQ Xenon Flash light source),
and absorbance was detected at 570 nm.
Note: Cisplatin and oxaliplatin drugs were used as a positive control
in our experiment, in the same concentrations of the studied
compounds. All of the experiments were performed in triplicate.
Statistical Analysis. Values are given as the mean ± SEM. Data are
represented as averages of independent experiments, performed in
triplicate. The experimental data were processed with Graph Pad
Prism 5 biostatistics software.
RNA Processing. Total RNA from treated and parental ovarian
carcinoma cell lines (A2780 and A2780cisR) was isolated with
TriReagent (Sigma-Aldrich) following the classical protocol and
purified with RNeasy Mini kit (Qiagen, Hilden, Germany). RNA
quality and quantity were checked with a Lab on-a-chip Bioanalyzer
2100 (Agilent Technologies, Santa Clara, CA, USA) and a NanoDrop
ND-1000 spectrophotometer (Thermo Scientific, Wilmington, DE,
USA). The RNA Integrity Number (RIN) was calculated for each
sample and was used to assess the integrity of extracted RNA. To
reduce biases due to poor RNA quality, only RNAs with RIN > 8 were
considered for further analysis.
Microarray Expression Profiling. For each sample, 100 ng of total
RNA was labeled (Cy3) and amplified using Low Input Quick Amp
Labeling Kit (Agilent Technologies, Santa Clara, CA, USA) according
to the manufacturer’s instructions. Labeled cRNA targets were further
purified using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and
quantified with a NanoDrop ND-1000 spectrophotometer. All samples
had a minimum of 1.65 μg of cRNA and Cy3 specific activity >6. For
each cell line (A2780 and A2780cisR) and each treatment, three
biological replicates were hybridized to a 4 × 44k Whole Human
Genome Oligo Microarray (Agilent Technologies, Santa Clara, CA,
USA) for 17 h at 65 °C, then washed and dried following the Agilent
protocol. Slides were scanned with an Agilent Technologies Scanner
G2505C US45102867 at 5 μm resolution, and pixel intensities were
quantified using Feature Extraction software v. 11.5.1.1 (Agilent
Technologies, Santa Clara, CA, USA).
Microarray Data Analysis. Raw microarray data were analyzed with
Gene Spring GX v.11.5.1 (Agilent Technologies, Santa Clara, CA,
USA). The signal intensities were normalized using the Quantile
method. Features flagged as outliers, nonuniform, or saturated were
removed from subsequent analysis. Differentially expressed transcripts
induced by two compounds in each line were selected using ANOVA
followed by Tukey’s posthoc test and taking a fold change (Fc) cutoff
of 1.5. To account for multiple testing, the p-values were corrected
using the Benjamini−Hochberg procedure. The differentially ex-
pressed genes were subjected to agglomerative hierarchical clustering
based on Euclidian distances and the Ward method. GO enrichment
analysis was performed for the data set of common differentially
expressed genes (DEGs) induced by the two compounds in the A2780
cell line but also in the A2780cisR cell line. The significance of GO
categories was assessed by a hypergeometric distribution, and the p-
value was adjusted using the Benjamini−Yekutieli correction. Differ-
entially expressed genes were mapped to molecular function and
canonical pathways in IPA. The upstream regulators considered key
molecules that can affect the expression of their target genes were
identified with IPA upstream regulator analysis. A z-score defining the
activation state of the upstream regulators (“activated” or “inhibited”)
was calculated based on Fischer’s exact test (p < 0.01). A z score
greater than 2 defined a statistically significant “activated” upstream
regulator and a value smaller than −2 defined an “inhibited” status.
Validation of Microarray Data by Quantitative Real-Time PCR
(qRT-PCR). The expression of 21 genes of interest identified by
microarray was validated with qRT-PCR reaction using a Light Cycler
480 (Roche) device. A specific set of primers and a fluorescent probe,
named Universal Probe Library (UPL), were identified for every
selected gene, with Roche Applied Science software as follows:
DRAM1 (NM_018370.2) F-tgtctgtgcttcactaatttcca, R-tcacagatcg-
cactcactacg (UPL#78); TP53INP1 (NM_033285.3) F-catagccca-
agtagtcccaga, R-gcaagagctgcaacataacaat (UPL#43); TP53I3
(NM_004881.4) F-gatttgcctgatcctcttcg, R-aagtgggatggcggtaca
8487
Article
(UPL#15); ZMAT3(NM_152240.2) F-ccaggaaagaagggaatgagt, R-
gcggggattgaagtaaggac (UPL#2); RPS27L (NM_015920.3) F-cagatcgc-
ttgcagcttg, R-tcttccaaggacggatgtagtaa (UPL#23); PRMT2
(NM_206962.2) F-ccagtgtggagaaggcaca; R-ggggaagactttttctccaac
(UPL#21); BAX (NM_138761.3) F-caagaccagggtggttgg, R-cactcccgc-
cacaaagat (UPL#55); AEN (NM_022767.3) F-tgcagaccggaagagacac,
R-ggaagcctggggagtaatct (UPL#43); TRIAP1 (NM_016399.2) F-
gcagttcaggaattaagatacttgg, R- gctggcaatagcagatctttg (UPL#69);
BNIP3L (NM_004331.2) F-aatgtcgtcccacctagtcg, R-agctccac-
ccaggaactgt (UPL#70); HTRA2 (NM_013247.4) F-attggggtga-
tgatgctgac, R-agcttggttctcgaagctgt (UPL#89); FAS (NM_000043.4)
F-tttctcaggcatcaaaagca, R-ggagaggtggcaaagctcta (UPL#15); TRIB3
(NM_021158.3) F-ccgtcttgggccctatgt, R-cttcctggacggggtaca
(UPL#1); NUPR1 (NM_012385.2) F-ctatagcctggcccattcct, R-
tctctcttggtgcgaccttt (UPL#10); PMAIP1 (NM_021127.2) F-
ggagatgcctgggaagaag, R-ccaaatctcctgagttgagtagc (UPL#11); BBC3
(NM_014417.3) F-gacctcaacgcacagtacga, R-gagattgtacaggaccctcca
(UPL#68); PDCD4 (NM_145341.3) F-tggaaagcgtaaagatagtgtgtg, R-
ttctttcagcagcatatcaatctc (UPL#10); ERCC2 (NM_000400.3) F-
cagatggcacagcccttc, R-tcctcttcagcgtctcctct (UPL#1); GADD45A
(NM_001924.3) F-ggagagcagaagaccgaaag, R-agtgatcgtgcgctgactc
(UPL#37); HMGB1 (NM_002128.4) F-gagtaatgttacagagcggagaga,
R-aatgtactgcaatggctgtgag (UPL#75); TNFRSF8 (NM001243.3) F-
gctgtcaggaggtgctgttac, R-gtaggcctctgtgggcact (UPL#43); and RN18S1
(NR_003286.2) F-gcaattattccccatgaacg, R-gggacttaatcaacgcacgc
(UPL#48). Complementary DNA (cDNA) was generated from 500
ng of total RNA, with First Strand cDNA Synthesis Kit (Roche
Applied Science, Germany). For each PCR reaction were used 2.5 μL
of 1:10 (v/v) dilution of the first cDNA, 0.5 μM of every primers, and
0.2 μM UPL. The PCR conditions included a 10 min step at 95 °C for
enzyme activation followed by an amplification step including 35
cycles of 15 s at 95 °C, 20 s at 55 °C, and 1 s at 72 °C followed by a
final cooling step at 40 °C for 30 s. The expression of selected genes
was calculated with the ΔΔCt method64 after their normalization with
the RN18S1 housekeeping gene.
Apoptosis Assessment. Apoptosis was assessed by fluorescence
microscopy, using the Multi-Parameter Apoptosis Assay Kit (Cayman
cat no 600330, Estonia), that contains tetramethylrhodamine ethyl
ester (TMRE) and Hoechst dye staining agents. The HeLa, A2780,
and A2780cisR cells were seeded at a density of 20000 cells/well in 96-
well plates, with 200 μL of culture media and treated for 24 h with
complexes 4 and 14 at concentrations corresponding to the IC50
values. Similarly, as a positive control, cells were treated with
staurosporine (2 μg/mL). Cells were harvested, then washed once
with phosphate-buffered saline (PBS), and centrifuged at 500 rpm for
5 min. Further, the cells were resuspended and stained with Hoechst-
TMRE costaining solution and 100 μL/mL of culture medium, and
incubated for 15 min at 37 °C in CO2. A ZEISS LSM 510 inverted
fluorescence microscope at 20× magnification was used to capture the
images, in order to assess the cell death mechanisms. The number of
apoptotic cells was measured by assessing the percentage of cells
displaying condensed or fragmented nuclei. Approximately 200 nuclei
were counted per sample.
Autophagy Assessment. Autophagy was evaluated using an
Autophagy/Cytotoxicity Dual Staining Kit (Cayman Chemical Co,
Ann Arbor, MI, USA), in accordance with the manufacturer’s
recommendation for the multiplate reader detection. The HeLa,
A2780, and A2780cisR cells were seeded at a density of 20000 cells/
well in 96-well plates, with 200 μL of culture media, and treated for 24
h with complexes 4 and 14 at concentrations corresponding to the
IC50 values. As a positive control, cells were treated in a similar manner
with tamoxifen (10 μM). The fluorescence intensity was evaluated
using a BioTek Microplate Reader. The fluorescence intensity of the
autophagy marker MDC (monodansylcadaverine) was determined at
355 nm and the emission wavelength at 512 nm.65
DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry
■
ASSOCIATED CONTENT
*
S Supporting Information
The Supporting Information is available free of charge on the
ACS Publications website at DOI: 10.1021/acs.jmed-
chem.5b00855.
Comparative yields for the synthesis of the complexes;
comparison of the antiproliferative activity of complexes
1−16 to cisplatin and oxaliplatin on the cancerous cell
lines, HeLa, A2780, and A2780cisR; GO terms enriched
in the common set of genes modulated in the A2780cisR
ovarian cell line with complexes 4 and 14; the
differentially expressed genes in the ovarian A2780cisR
cell line, listed in GO categories related to apoptosis and
cell death; percentages of condensed and fragmented
nuclei in cancer cells (PDF)
SMILES data (CSV)
■
AUTHOR INFORMATION
Corresponding Authors
*(A.G.) Phone: +40-264-597257. Fax: +40-264-597257. E-
mail: adriana.ignat@umfcluj.ro.
*(O.B.) Phone: +40-264-590638. Fax: +40-264-590638. E-
mail: ovidiubalacescu@iocn.ro.
*(B.T.) Phone: +41-32-7182499. Fax: +41-32-7182511. E-mail:
bruno.therrien@unine.ch.
Author Contributions
A.G. and O.B. equally contributed to the manuscript.
Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS
This work was supported by the Swiss Enlargement
Contribution in the framework of the Romanian-Swiss
Research Program, project number IZERZO-142198/1.
■
REFERENCES
(1) Jemal, A.; Bray, F.; Center, M. M.; Ferlay, J.; Ward, E.; Forman,
D. Global cancer statistics. CA-Cancer J. Clin. 2011, 61, 69−90.
(2) Muggia, F. Platinum compounds 30 years after the introduction
of cisplatin: implications for the treatment of ovarian cancer. Gynecol.
Oncol. 2009, 112, 275−281.
(3) Wheate, N. J.; Walker, S.; Craig, G. E.; Oun, R. The status of
platinum anticancer drugs in the clinic and in clinical trials. Dalton
Trans. 2010, 39, 8113−8127.
(4) Rademaker-Lakhai, J. M.; Bongard, D.; Pluim, D.; Beijnen, J. H.;
Schellens, J. H. A phase I and pharmacological study with imidazolium-
trans-DMSO-imidazole-tetrachlororuthenate, a novel ruthenium anti-
cancer agent. Clin. Cancer Res. 2004, 10, 3717−3727.
(5) (a) Hartinger, C. G.; Jakupec, M. A.; Zorbas-Seifried, S.; Groessl,
M.; Egger, A.; Bergar, W.; Zorbas, H.; Dyson, P. J.; Keppler, B. K.
KP1019, a new redox-active anticancer agent-preclinical development
and results of a clinical phase I study in tumor patients. Chem.
Biodiversity 2008, 5, 2140−2155. (b) Trondl, R.; Heffeter, P.; Kowol,
C. R.; Jakupec, M. A.; Berger, W.; Keppler, B. K. NKP-1339, the first
ruthenium-based anticancer drug on the edge to clinical application.
Chem. Sci. 2014, 5, 2925−2932.
(6) (a) Gupta, G.; Nowak-Sliwinska, P.; Herrero, N.; Dyson, P. J.;
Therrien, B. Highly water soluble trithiolato-bridged dinuclear arene
ruthenium complexes. Inorg. Chim. Acta 2014, 423, 524−529.
(b) Sava, G.; Bergamo, A.; Dyson, P. J. Metal-based antitumour
drugs in the post-genomic era: what comes next? Dalton Trans. 2011,
40, 9069−9075.
(7) (a) Hartinger, C. G.; Metzler-Nolte, N.; Dyson, P. J. Challenges
and Opportunities in the Development of Organometallic Anticancer
8488
Article
Drugs. Organometallics 2012, 31, 5677−5685. (b) Kilpin, K. J.; Crot,
S.; Riedel, T.; Kitchen, J. A.; Dyson, P. J. Ruthenium (II) and osmium
(II) 1,2,3-triazolylidene organometallics: a preliminary investigation
into the biological activity of ’click’ carbene complexes. Dalton Trans.
2014, 43, 1443−1448.
(8) Sava, G.; Zorzet, S.; Turrin, C.; Vita, F.; Soranzo, M.; Zabucchi,
G.; Cocchietto, M.; Bergamo, A.; Giovine, S.; Pezzoni, G.; Sartor, L.;
Garbisa, S. Dual action of NAMI-A in inhibition of solid tumor
metastasis: selective targeting of metastatic cells and binding to
collagen. Clin. Cancer Res. 2003, 91, 1898−1905.
(9) Bergamo, A.; Masi, A.; Dyson, P. J.; Sava, G. Modulation of the
metastatic progression of breast cancer with an organometallic
ruthenium compound. Int. J. Oncol. 2008, 33, 1281−1289.
(10) Moreno, V.; Font-Bardia, M.; Calvet, T.; Lorenzo, J.; Aviles, F.
X.; Garcia, M. H.; Morais, T. S.; Valente, A.; Robalo, M. P. DNA
interaction and cytotoxicity studies of new ruthenium(II) cyclo-
pentadienyl derivative complexes containing heteroaromatic ligands. J.
Inorg. Biochem. 2011, 105, 241−249.
(11) Martinez, A.; Suarez, J.; Shand, T.; Magliozzo, R. S.; Sanchez-
Delgado, R. A. Interactions of arene-Ru(II)-chloroquine complexes of
known antimalarial and antitumor activity with human serum albumin
(HSA) and transferrin. J. Inorg. Biochem. 2011, 105, 39−45.
(12) Kapitza, S.; Jakupec, M. A.; Uhl, M.; Keppler, B. K.; Marian, B.
The heterocyclic ruthenium(III) complex KP1019 (FFC14A) causes
DNA damage and oxidative stress in colorectal tumor cells. Cancer
Lett. 2005, 226, 115−121.
(13) Du, K. J.; Wang, J. Q.; Kou, J. F.; Li, G. Y.; Wang, L. L.; Chao,
H.; Ji, L. N. Synthesis, DNA-binding and topoisomerase inhibitory
activity of ruthenium(II) polypyridyl complexes. Eur. J. Med. Chem.
2011, 46, 1056−1065.
(14) Li, L.; Wong, Y.; Chen, T.; Zheng, W. Ruthenium complexes
containing bis-benzimidazole derivatives as a new class of apoptosis
inducers. Dalton Trans. 2012, 41, 1138−1141.
(15) Nazarov, A.; Baquié, M.; Nowak-Sliwinska, P.; Zava, O.; Van
Beijnum, J.; Groessl, M.; Chisholm, D.; Ahmadi, Z.; McIndoe, J. S.;
Griffioen, A. W.; Van den Bergh, H.; Dyson, P. J. Synthesis and
characterization of a new class of anti-angiogenic agent based on
ruthenium clusters. Sci. Rep. 2013, 3, 1485.
(16) Nowak-Sliwinska, P.; Van Beijnum, J.; Casini, A.; Nazarov, A.;
Wagnières, G.; Van den Bergh, H.; Dyson, P. J.; Griffioen, A. W.
Organometallic ruthenium(II) arene compounds with antiangiogenic
activity. J. Med. Chem. 2011, 54, 3895−3902.
(17) Grozav, A.; Găină, L.; Pileczki, V.; Crisan, O.; Silaghi-
Dumitrescu, L.; Therrien, B.; Zaharia, V.; Berindan-Neagoe, I. The
synthesis and antiproliferative activities of new arylidene-hydrazinyl-
thiazole derivatives. Int. J. Mol. Sci. 2014, 15, 22059−22072.
(18) Sleebs, B. E.; Kersten, W. J. A.; Kulasegaram, S.;
Nikolakopoulos, G.; Hatzis, E.; Moss, R. M.; Parisot, J. P.; Yang, H.;
Czabotar, P. E.; Fairlie, W. D.; Lee, E. F.; Adams, J. M.; Chen, L.; van
Delft, M. F.; Lowes, K. N.; Wei, A.; Huang, D. C.S.; Colman, P. M.;
Street, I. P.; Baell, J. B.; Watson, K.; Lessene, G. Discovery of potent
and selective benzothiazole hydrazone inhibitors of Bcl-XL. J. Med.
Chem. 2013, 56, 5514−5540.
(19) Dahlgren, M. K.; Garcia, A. B.; Hare, A. A.; Tirado-Rives, J.;
Leng, L.; Bucala, R.; Jorgensen, W. L. Virtual screening and
optimization yield low-nanomolar inhibitors of the tautomerase
activity of Plasmodium falciparum macrophage migration inhibitory
factor. J. Med. Chem. 2012, 55, 10148−10159.
(20) Zheng, S.; Zhong, Q.; Xi, Y.; Mottamal, M.; Zhang, Q.;
Schroeder, R. L.; Sridhar, J.; He, L.; McFerrin, H.; Wang, G.
Modification and biological evaluation of thiazole derivatives as novel
inhibitors of metastatic cancer cell migration and invasion. J. Med.
Chem. 2014, 57, 6653−6667.
(21) (a) Andreani, A.; Burnelli, S.; Granaiola, M.; Leoni, A.; Locatelli,
A.; Morigi, R.; Rambaldi, M.; Varoli, L.; Calonghi, N.; Cappadone, C.;
Farruggia, G.; Zini, M.; Stefanelli, C.; Masotti, L.; Radin, N. S.;
Shoemaker, R. H. New antitumor imidazo[2,1-b]thiazole guanylhy-
drazones and analogues. J. Med. Chem. 2008, 51, 809−816.
(b) Thomas, C. J.; McCormick, M. M.; Vialas, C.; Tao, Z.-F.;
DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry
Leitheiser, C. J.; Rishel, M. J.; Wu, X.; Hecht, S. M. Alteration of the
selectivity of DNA cleavage by a deglycobleomycin analogue
containing a trithiazole moiety. J. Am. Chem. Soc. 2002, 124, 3875−
3884.
(22) Ignat, A.; Lovasz, T.; Vasilescu, M.; Fischer-Fodor, E.; Tatomir,
C. B.; Cristea, C.; Silaghi-Dumitrescu, L.; Zaharia, V. Heterocycles 27.
Microwave assisted synthesis and antitumour activity of novel
phenothiazinyl-thiazolyl-hydrazine derivatives. Arch. Pharm. 2012,
345, 574−583.
(23) Prasad, K. T.; Therrien, B.; Mohan Rao, K. Cationic half-
sandwich complexes (Rh, Ir, Ru) containing 2-substituted-1,8-
naphthyridine chelating ligands: Syntheses, X-ray structure analyses
and spectroscopic studies. J. Organomet. Chem. 2008, 693, 3049−3056.
(24) Prasad, K. T.; Therrien, B.; Mohan Rao, K. Mono and dinuclear
complexes of half-sandwich platinum group metals (Ru, Rh and Ir)
bearing a flexible pyridyl-thiazole multidentate donor ligand. J.
Organomet. Chem. 2010, 695, 226−234.
(25) Gras, M.; Therrien, B.; Süss-Fink, G.; Casini, A.; Edafe, F.;
Dyson, P. J. Anticancer activity of new organo-ruthenium, rhodium
and iridium complexes containing the 2-(pyridine-2-yl)thiazole N,N-
chelating ligand. J. Organomet. Chem. 2010, 695, 1119−1125.
(26) Advanced Chemistry Development. ACD/ChemSketch, version
12.0; Advanced Chemistry Development: Toronto, Canada, 2012.
(27) Seillier, M.; Peuget, S.; Gayet, O.; Gauthier, C.; N’Guessan, P.;
Monte, M.; Carrier, A.; Iovanna, J. L.; Dusetti, N. J. TP53INP1, a
tumor suppressor, interacts with LC3 and ATG8-family proteins
through the LC3-interacting region (LIR) and promotes autophagy-
dependent cell death. Cell Death Differ. 2012, 19, 1525−1535.
(28) Nihira, K.; Miki, Y.; Ono, K.; Suzuki, T.; Sasano, H. An
inhibition of p62/SQSTM1 caused autophagic cell death of several
human carcinoma cells. Cancer Sci. 2014, 105, 568−575.
(29) Crighton, D.; Wilkinson, S.; O’Prey, J.; Syed, N.; Smith, P.;
Harrison, P. R.; Gasco, M.; Garrone, O.; Crook, T.; Ryan, K. M.
DRAM, a p53-induced modulator of autophagy, is critical for
apoptosis. Cell 2006, 126, 121−134.
(30) Zhang, X.-D.; Qi, L.; Wu, J.-C.; Qin, Z.-H. DRAM1 regulates
autophagy flux through lysosomes. PLoS One 2013, 8, e63245.
(31) Eby, K. G.; Rosenbluth, J. M.; Mays, D. J.; Marshall, C. B.;
Barton, C. E.; Sinha, S.; Johnson, K. N.; Tang, L.; Pietenpol, J. A.
ISG20L1 is a p53 family target gene that modulates genotoxic stress-
induced autophagy. Mol. Cancer 2010, 9, 95−102.
(32) Chaluvally-Raghavan, P.; Zhang, F.; Pradeep, S.; Hamilton, M.
P.; Zhao, X.; Rupaimoole, R.; Moss, T.; Lu, Y.; Yu, S.; Pecot, C. V.;
Aure, M. R.; Peuget, S.; Rodriguez-Aguayo, C.; Han, H. D.; Zhang, D.;
Venkatanarayan, A.; Krohn, M.; Kristensen, V. N.; Gagea, M.; Ram, P.;
Liu, W.; Lopez-Berestein, G.; Lorenzi, P. L.; Børresen-Dale, A. L.;
Chin, K.; Gray, J.; Dusetti, N. J.; McGuire, S. E.; Flores, E. R.; Sood, A.
K.; Mills, G. B. Copy number gain of hsa-miR-569 at 3q26.2 leads to
loss of TP53INP1 and aggressiveness of epithelial cancers. Cancer Cell
2014, 26, 863−879.
(33) Jin, C.; Yu, W.; Lou, X.; Zhou, F.; Han, X.; Zhao, N.; Lin, B.
UCHL1 is a putative tumor suppressor in ovarian cancer cells and
contributes to cisplatin resistance. J. Cancer 2013, 4, 662−670.
(34) Sosna, J.; Voigt, S.; Mathieu, S.; Kabelitz, D.; Trad, A.; Janssen,
O.; Meyer-Schwesinger, C.; Schütze, S.; Adam, D. The proteases
HtrA2/Omi and UCH-L1 regulate TNF-induced necroptosis. Cell
Commun. Signaling 2013, 11, 76−83.
(35) Yang, F.; Long, W.; Xuechuan, H.; Xueqin, L.; Hongyun, M.;
Yonghui, D. Upregulation of fas in epithelial ovarian cancer reverses
the development of resistance to cisplatin. BMB Rep. 2015, 48, 30−35.
(36) Kisova, A.; Zerzankova, L.; Habtemariam, A.; Sadler, P. J.;
Brabec, V.; Kasparkova, J. Differences in the cellular response and
signaling pathways between cisplatin and monodentate organometallic
Ru(II) antitumor complexes containing a terphenyl ligand. Mol.
Pharmaceutics 2011, 8, 949−957.
(37) Guo, W.; Zou, Y.-B.; Jiang, Y.-G.; Wang, R.-W.; Zhao, Y.-P.; Ma,
Z. Zinc induces cell cycle arrest and apoptosis by upregulation of
WIG-1 in esophageal squamous cancer cell line EC109. Tumor Biol.
2011, 32, 801−808.
8489
Article
(38) Bersani, C.; Xu, L.-D.; Vilborg, A.; Lui, W.-O.; Wiman, K. G.
Wig-1 regulates cell cycle arrest and cell death through the p53 targets
FAS and 14−3-3σ. Oncogene 2014, 33, 4407−4417.
(39) Méndez Vidal, C.; Prahl, M.; Wiman, K. G. The p53-induced
Wig-1 protein binds double-stranded RNAs with structural character-
istics of siRNAs and miRNAs. FEBS Lett. 2006, 580, 4401−4408.
(40) Vilborg, A.; Glahder, J. A.; Wilhelm, M. T.; Bersani, C.;
Corcoran, M.; Mahmoudi, S.; Rosenstierne, M.; Grandér, D.; Farnebo,
M.; Norrild, B.; Wiman, K. G. The p53 target Wig-1 regulates p53
mRNA stability through an AU-rich element. Proc. Natl. Acad. Sci. U. S.
A. 2009, 106, 15756−15761.
(41) Porté, S.; Valencia, E.; Yakovtseva, E. A.; Borràs, E.; Shafqat, N.;
Debreczeny, J. E.; Pike, A. C.; Oppermann, U.; Farrés, J.; Fita, I.; Parés,
X. Three-dimensional structure and enzymatic function of proapop-
totic human p53-inducible quinone oxidoreductase PIG3. J. Biol.
Chem. 2009, 284, 17194−17205.
(42) Flatt, P. M.; Polyak, K.; Tang, L. J.; Scatena, C. D.; Westfall, M.
D.; Rubinstein, L. A.; Yu, J.; Kinzler, K. W.; Vogelstein, B.; Hill, D. E.;
Pietenpol, J. A. p53-dependent expression of PIG3 during prolifer-
ation, genotoxic stress, and reversible growth arrest. Cancer Lett. 2000,
156, 63−72.
(43) He, H.; Sun, Y. Ribosomal protein S27L is a direct p53 target
that regulates apoptosis. Oncogene 2007, 26, 2707−2716.
(44) Karin, M.; Lin, A. NF-κB at the crossroads of life and death. Nat.
Immunol. 2002, 3, 221−227.
(45) Ganesh, L.; Yoshimoto, T.; Moorthy, N. C.; Akahata, W.;
Boehm, M.; Nabel, E. G.; Nabel, G. J. Protein methyltransferase 2
inhibits NF-kappaB function and promotes apoptosis. Mol. Cell. Biol.
2006, 26, 3864−3874.
(46) Follis, A. V.; Chipuk, J. E.; Fisher, J. C.; Yun, M.-K.; Grace, C.
R.; Nourse, A.; Baran, K.; Ou, L.; Min, L.; White, S. W.; Green, D. R.;
Kriwacki, R. W. PUMA binding induces partial unfolding within BCL-
xL to disrupt p53 binding and promote apoptosis. Nat. Chem. Biol.
2013, 9, 163−168.
(47) Kim, J.-Y.; So, K.-J.; Lee, S.; Park, J.-H. Bcl-rambo induces
apoptosis via interaction with the adenine nucleotide translocator.
FEBS Lett. 2012, 586, 3142−3149.
(48) Barrera-Vilarmau, S.; Obregón, P.; de Alba, E. Intrinsic order
and disorder in the bcl-2 member harakiri: insights into its
proapoptotic activity. PLoS One 2011, 6, e21413.
(49) Xie, Q.; Lin, T.; Zhang, Y.; Zheng, J.; Bonanno, J. A. Molecular
cloning and characterization of a human AIF-like gene with ability to
induce apoptosis. J. Biol. Chem. 2005, 280, 19673−19681.
(50) Sheridan, C.; Brumatti, G.; Elgendy, M.; Brunet, M.; Martin, S.
J. An ERK-dependent pathway to Noxa expression regulates apoptosis
by platinum-based chemotherapeutic drugs. Oncogene 2010, 29, 6428−
6441.
(51) Salvador, J. M.; Brown-Clay, J. D.; Fornace, A. J., Jr. Gadd45 in
stress signaling, cell cycle control, and apoptosis. Adv. Exp. Med. Biol.
2013, 793, 1−19.
(52) Zhang, P.; Liu, S. S.; Ngan, H. Y. S. TAp73-mediated the
activation of c-Jun N-terminal kinase enhances cellular chemo-
sensitivity to cisplatin in ovarian cancer cells. PLoS One 2012, 7,
e42985.
(53) Yuan, Z.; Cao, K.; Lin, C.; Li, L.; Liu, H.-y.; Zhao, X.-y.; Liu, L.;
Deng, H.-x.; Li, J.; Nie, C.-l.; Wei, Y.q. The p53 upregulated modulator
of apoptosis (PUMA) chemosensitizes intrinsically resistant ovarian
cancer cells to cisplatin by lowering the threshold set by Bcl-x(L) and
Mcl-1. Mol. Med. 2011, 17, 1262−1274.
(54) Zhao, Z.; Wang, J.; Tang, J.; Liu, X.; Zhong, Q.; Wang, F.; Hu,
W.; Yuan, Z.; Nie, C.; Wei, Y. JNK- and Akt-mediated Puma
expression in the apoptosis of cisplatin-resistant ovarian cancer cells.
Biochem. J. 2012, 444, 291−301.
(55) Li, H.; Xu, H.; Shen, H.; Li, H. MicroRNA-106a modulates
cisplatin sensitivity by targeting PDCD4 in human ovarian cancer cells.
Oncol. Lett. 2014, 7, 183−188.
(56) Ferraris, S. E.; Isoniemi, K.; Torvaldson, E.; Anckar, J.;
Westermarck, J.; Eriksson, J. E. Nucleolar AATF regulates c-Jun-
mediated apoptosis. Mol. Biol. Cell 2012, 23, 4323−4332.
DOI: 10.1021/acs.jmedchem.5b00855
J. Med. Chem. 2015, 58, 8475−8490
Journal of Medicinal Chemistry Article

(57) Cooke, S. L.; Brenton, J. D. Evolution of platinum resistance in

high-grade serous ovarian cancer. Lancet Oncol. 2011, 12, 1169−1174.
(58) du Bois, A.; Reuss, A.; Pujade-Lauraine, E.; Harter, P.; Ray-
Coquard, I.; Pfisterer, J. Role of surgical outcome as prognostic factor
in advanced epithelial ovarian cancer: a combined exploratory analysis
of 3 prospectively randomized phase 3 multicenter trials. Cancer 2009,
115, 1234−1244.
(59) Vergote, I.; Tropé, C. G.; Amant, F.; Kristensen, G. B.; Ehlen,
T.; Johnson, N.; Verheijen, R. H. M.; van der Burg, M. E. L.; Lacave, A.
J.; Benedetti Panici, P.; Kenter, G. G.; Casado, A.; Mendiola, C.;
Coens, C.; Verleye, L.; Stuart, G. C. E.; Pecorelli, S.; Reed, N. S.
Neoadjuvant chemotherapy or primary surgery in stage IIIC or IV
ovarian cancer. N. Engl. J. Med. 2010, 363, 943−953.
(60) Gupta, G.; Kumar, J. M.; Garci, A.; Rangaraj, N.; Nagesh, N.;
Therrien, B. Anticancer activity of half-sandwich RhIII and IrIII metalla-
prisms containing lipophilic side chains. ChemPlusChem 2014, 79,
610−618.
(61) Bennett, M. A.; Huang, T. N.; Matheson, T. W.; Smith, A. K.
(η6)-Hexamethylbenzene ruthenium complexes. Inorg. Synth. 1982, 21,
74−78.
(62) Sheldrick, G. M. A short history of SHELX. Acta Crystallogr.,
Sect. A: Found. Crystallogr. 2008, 64, 112−122.
(63) Farrugia, L. ORTEP-3 for Windows. J. Appl. Crystallogr. 1997,
30, 565.
(64) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene
expression data using real-time quantitative PCR and the 2(-Delta
Delta C(T)) Method. Methods 2001, 25, 402−408.
(65) Irimie, A. I.; Braicu, C.; Zanoaga, O.; Pileczki, V.; Gherman, C.;
Berindan-Neagoe, I.; Campian, R. S. Epigallocatechin-3-gallate
suppresses cell proliferation and promotes apoptosis and autophagy
in oral cancer SSC-4 cells. OncoTargets Ther. 2015, 8, 461−470.

8490 DOI: 10.1021/acs.jmedchem.5b00855

J. Med. Chem. 2015, 58, 8475−8490