Journal of Infection (2014) xx, 1e9

www.elsevierhealth.com/journals/jinf

Loop-mediated isothermal amplification

assay for rapid and sensitive diagnosis of
tuberculosis
Parveen Kumar a, Deepal Pandya b, Niti Singh c,
Digambar Behera c,e, Praveen Aggarwal d, Sarman Singh a,*

a
Division of Clinical Microbiology and Molecular Medicine, All India Institute of Medical Sciences,
New Delhi 110029, India
b
AmpliGene India Biotech Pvt. Ltd., Ahmedabad, Gujarat, India
c
National Institute of Tuberculosis and Respiratory Diseases, New Delhi, India
d
Department of Emergency Medicine, All India Institute of Medical Sciences, New Delhi, India

Accepted 12 August 2014

Available online - - -

KEYWORDS Summary Objectives: Loop-mediated isothermal amplification (LAMP) is a newly developed

LAMP; molecular method that can be performed isothermally. We developed and evaluated a LAMP
esat-6; assay using novel primers to diagnose tuberculosis directly from clinical samples.
Mycobacterium Materials: Primers were designed to amplify the specific novel esat-6 gene target of Mycobac-
tuberculosis; terium tuberculosis (MTB). Quantitated DNA was used to determine analytical sensitivity and
Multiplex PCR specificity was evaluated by testing 29 NTM and 37 other bacterial species. After standardiza-
tion, its sensitivity and specificity were evaluated on samples from 118 TB suspected and 31
non-TB patients and compared it with smear, culture and mPCR methods.
Results: LAMP was able to detect 5 fg DNA (one MTB) within 21 min and found to be 10 times
more sensitive than mPCR and showed 100% specificity against NTM and other bacterial spe-
cies. In clinical samples, LAMP showed highest MTB detection rate (52.5%) as compared to
mPCR (44%) and culture (30.5%). On culture positive and mPCR positive samples, the sensitivity
of LAMP was found to be 100% (95% CI 90.2e100) and 96.1% (95% CI 86.7e99.5) respectively
with 93.5% (95% CI 78.5e99.2) of overall specificity.
Conclusion: LAMP was found to be more sensitive than culture and mPCR for the detection of
MTB. It showed specificity comparable to mPCR but was rapid and cost effective.
ª 2014 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

* Corresponding author. Tel.: þ91 11 2658 8484; fax: þ91 11 2658 8663, þ91 11 2658 8641.
E-mail addresses: sarman_singh@yahoo.com, sarman.singh@gmail.com (S. Singh).
e
Present address: Post-Graduate Institute of Medical Education and Research, Chandigarh, India.

http://dx.doi.org/10.1016/j.jinf.2014.08.017
0163-4453/ª 2014 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Please cite this article in press as: Kumar P, et al., Loop-mediated isothermal amplification assay for rapid and sensitive diagnosis of
tuberculosis, J Infect (2014), http://dx.doi.org/10.1016/j.jinf.2014.08.017
2 P. Kumar et al.
Introduction
Tuberculosis (TB) remains one of the leading infectious
diseases, particularly in developing countries. India has
more new TB cases annually than any other country. In
2012, out of the 8.6 million global annual incidental cases
of TB, 2.0e2.4 million were estimated to be from India.1
The biggest challenges in TB control remain early and accu-
rate diagnosis. Though smear microscopy is the simplest
and most rapid diagnostic procedure currently available
but its sensitivity is very low and requires at least
5  103 bacilli/ml in the clinical samples which is a very sol-
emn issue specially in extra-pulmonary (EPTB) samples.2
The automated liquid culture based Mycobacteria Growth
Indicator Tube (MGIT) system has reduced this time, but
still it is not optimal.3
In last 6e7 years, the diagnosis of TB has undergone a
major breakthrough with the introduction of nucleic acid
amplification (NAA) techniques. Using these methods
directly on clinical samples, results can be obtained within
1e3 days with high sensitivity and specificity. Centers for
Disease Control and Prevention (CDC)4 and American
Thoracic Society (ATS)5 recommend well-standardized
NAA to be performed for rapid screening of patients with
signs and symptoms of pulmonary TB (PTB). Currently,
several commercial NAA methods based on different princi-
ples are available. These include, Roche’s COBAS Amplicor
MTB test6,7 GenProbe’s Amplified M. tuberculosis Direct
test (AMTD),6e8 BD’s ProbeTec-ET6,9 and Hain’s GenoType
Mycobacteria Direct assay (GTMD).10 Available real-time
polymerase chain reactions (RT-PCR) systems are, Roche
COBAS TaqMan MTB test and the Cepheid Xpert MTB/RIF
test.11 These assays have been widely evaluated on
different clinical samples and strains. Most of the NAA
showed consistent specificity and good positive predictive
values but modest and variable sensitivity, particularly in
smear-negative and extra-pulmonary TB samples. Even
though these NAAs are well established but requirement
of sophisticated infrastructure, prices of commercial kits
and reagents are not affordable for most of the countries
with high TB burden. To circumvent these limitations,
many of these countries use poorly validated in-house
PCR which show variability in their accuracy.12 Hence,
there is a high demand of well validated, affordable com-
mercial NAA for use in low-resource countries.
In year 2000, Notomi et al.13 developed a loop-mediated
isothermal amplification (LAMP) method for the detection
of viral pathogens. This nucleic acid amplification test is
found to be simple, rapid, highly efficient, specific and
cost effective. LAMP assay has several advantages as
compared to the conventional PCR such as requires fewer
steps, performed at a fixed temperature and the amplified
products can be visualized from naked eye by adding the
dye. LAMP assay has been developed for the detection of
a number of infectious agents, including Vibrio parahaemo-
lyticus,14 Dengue virus,15 Trypanosoma brucei,16 Plasmo-
dium parasitemia,17 Mycobacterium tuberculosis
(MTB),18,19 M. bovis,20 M. avium21 and respiratory viruses22
as well as for nonhuman viruses.23 However, so far for MTB
detection in clinical samples only one commercial version
of this method has been developed. This commercial kit
Please cite this article in press as: Kumar P, et al., Loop-mediated isothermal amplification assay for rapid and sensitive diagnosis of
tuberculosis, J Infect (2014), http://dx.doi.org/10.1016/j.jinf.2014.08.017
was recently evaluated by WHO/FIND. The WHO expert
group analyzed this evaluation data and agreed that LAMP
technology has potential as a rapid TB diagnostic tool but
made further recommendations to improve its perfor-
mance.24 In the present study, we developed an improvised
version of LAMP for the specific detection of MTB using the
novel gene target. The efficacy of the LAMP assay was as-
sessed by comparing it with other standard TB diagnostic
methods.
Materials and methods
Study settings
The study was performed at the TB research laboratory,
Division of Clinical Microbiology and Molecular Medicine, All
India Institute of Medical Sciences, New Delhi, which is an
accredited laboratory by the central TB division of the
Government of India and certified by the STOP-TB for non-
commercial rapid culture and drug susceptibility tests.25
The study was approved by the Institute Ethics Committee
(Ref. No.IEC/NP-259/2010) and written informed consent
was obtained from all the participants.
LAMP primer designing
The primer designing is the most crucial step to develop a
successful LAMP assay. LAMP primer sets were designed
against MTB specific novel target east-6 gene by using the
LAMP designer software version 1.10 (Optigene, UK). This
software has special characteristics to design and short
list superior five LAMP primer sets followed by checking
the homology and specificity of primers by BLAST. A primer
set was composed of outer primers F3 and B3, inner primers
forward inner primer (FIP) and backward inner primer (BIP).
Loop primers were forward loop primer (FLP) and backward
loop primer (BLP). FIP consists of F1c sequence comple-
mentary to F1 and F2 sequence; BIP consists of B1c
sequence complementary to B1 and B2 sequence (Table 1).
Optimization of the LAMP reaction
LAMP reactions were performed in a volume of 25 mL
consisting of 20 pmol each of inner primers FIP and BIP,
5 pmol each of outer primers F3 and B3, 10 pmol each of
loop primers FLP and BLP. The reaction mixture contained
of 15 mL of isothermal master mix ISO 0001 (Optigene, UK)
which included Geobacillus species DNA polymerase,
thermo stable inorganic pyrophosphatase, optimized buffer
(containing MgCl2, deoxynucleotide triphosphates and
double-stranded DNA dye) and 5 mL of extracted DNA as
template. The LAMP assay was optimized at 65  C for
35 min on a real-time fluorometer Genie II (Optigene,
UK). The amplification reaction was terminated at 85  C
for 5 min. A melting curve was drawn after the amplifica-
tion by measuring the fluorescence to detect the annealing
temperature. Further, the specificity of MTB LAMP was
examined by performing the assay on 100 ng of genomic
DNA isolated from 6 reference mycobacterial strains [MTB
H37Rv (TMC-102), M. avium (NCTC-8551), M. intracellulare
LAMP assay for TB diangosis
Table 1 Nucleotide sequences of esat6-LAMP primers.
LAMP primers Nucleotide sequences
F3 CAAGCGCAATCCAGGG
B3 GCTTCGCTGATCGTCC
FIP(F1c þ F2) CGCTGCGAGCTTGGTCATGTCACGTCCATTCATTCC
BIP(B1c þ B2) TAGCGGTTCGGAGGCGTACGTTGTTCAGCTCGGTAG
Loop F CTGCTTCCCCTCGTCAAG
Loop B AAATGGGACGCCACGG
(TMC1406), M. terrae (TMC-1450), M. smegmatis MC2155,
M. bovis BCG], 37 laboratory maintained mycobacterial
species and 37 non mycobacterial species as given in
Table 2. In order to investigate the analytical sensitivity,
LAMP assay was performed at different dilutions of DNA.
For this, a known concentration of MTB H37Rv genomic
DNA was 10-fold serially diluted in 1 TE buffer (pH 8.8)
from 5 ng to 5  107 ng. The genome copy number of
each dilution was calculated considering that a single
genome of MTB is equivalent to approximately 5 fg of
DNA.18 After standardization the LAMP results could be
read visually by a simply color change using SYBR green I
dye (100) (Invitrogen, USA).
Use of LAMP assay on clinical samples
The optimized LAMP assay was performed on clinical
samples to evaluate the feasibility of the test. For this,
118 clinical samples (one each) from suspected TB patients
sent from various hospitals within and around Delhi for TB
diagnosis were included. Of these 41 were pulmonary
samples (29 sputa, 7 BAL and 5 GA) and 77 extra pulmonary
samples (28 CSF, 11 pus, 15 pleural fluid, 2 ascitic fluid, 7
lymph node aspirate, 5 urine, 3 abscess pus and 6 other
body fluids). The clinical suspicion of TB was based on
standard clinico-radiological findings mentioned in the CDC
and ATS guidelines,26,27 e.g. fever with or without cough;
weight loss or night sweats lasting longer than 2 weeks;
and/or cavitary lesions in the lung fields on radiological ex-
amination; or suppurating or non-suppurating cold single or
mated lymph nodes. In addition, a total of 31 samples from
patients having no past history of TB and having confirmed
diagnosis of Non-TB infectious or non-infectious diseases
were included as disease controls. These included 11 sputa
from patients with chronic obstructive pulmonary diseases
(COPD), 5 lymph node biopsies from patients of malignant
lymphoma, 7 pus and 8 urine samples from patients with
bacterial urinary tract infection. The methods of samples
processing, mycobacterial culturing, DNA extraction and
multiplex PCR (mPCR) were followed as described else-
where.28,29 All study participants gave informed consent,
as a standard routine TB diagnostic procedure of the
laboratory.
Statistical analysis
The results of LAMP assay were analyzed and compared
with standard TB diagnostic methods. Data were main-
tained on MS Excel 7.0 and statistically analyzed to
Please cite this article in press as: Kumar P, et al., Loop-mediated isothermal amplification assay for rapid and sensitive diagnosis of
tuberculosis, J Infect (2014), http://dx.doi.org/10.1016/j.jinf.2014.08.017
3
Length (bp)
16
16
36
36
18
16
calculate the sensitivity and specificity of the LAMP assay.
Chi-squared test and Fisher’s exact test were also per-
formed to analyze the results using Stata 11.1 software.
The significance level for these analyzes was defined as a p
level of 0.05.
Results
Optimization of LAMP reaction time and
temperature
The LAMP reaction time, temperature, and primer con-
centrations were optimized for the rapid detection of MTB
with the help of Genie II fluorometer. The Genie II displays
the real time amplification signals and at the end of the
assay it displays the time to positivity and annealing Tm
for each sample. During the standardization, the LAMP
reaction was standardized at 65  C isothermal tempera-
ture and the amplification times were observed ranging
from 10.8 to 24 min. The mean time to positivity for all
positive results was 17.2  6.19 min. Thus, the optimized
LAMP reaction was set to run for 35 min for testing all
other samples.
Analytical sensitivity and specificity of LAMP assay
The optimized LAMP assay showed the lowest (5 fg) amount
of MTB DNA was consistently detected within 21 min which
is equivalent to one copy of the MTB genome (Fig. 1A). The
results showed that a reaction time of 35 min was sufficient
to amplify one copy of genomic DNA. The mPCR was able to
detect 5  105 ng of DNA which is a minimum of 10 copies
of purified MTB DNA (50 fg) (Fig. 1B). In conclusion, esat6-
LAMP assay was 10 times more sensitive than conventional
mPCR. In addition, the LAMP results could be read visually
by a change in the color/fluorescence after addition of
5 mL of SYBR green (Fig. 2). In order to investigate the spec-
ificity, the efficient amplification of DNA by esat6-LAMP was
observed only in MTB strains within 35 min. In contrast, no
DNA amplification was observed with the 29 NTM species
and 37 other bacterial species, giving 100% specificity
(Table 2).
LAMP assay on clinical samples
A total of 118 suspected TB patients, 75 (63.5%) men and 43
(36.4%) women were enrolled in this study. Majority [80
(67.7%)] of patients were more than 15 years of age (mean
age of 38.1  16.95) and 38 (32.2%) patients aged less than
4 P. Kumar et al.

Figure 1 Comparison of determination of analytical sensitivity of the LAMP (panel A) and mPCR (panel B). (A) Detection of sensi-
tivity of LAMP assay by a real-time fluorometer Genie II. The results showed detection limit of esat6-LAMP was 5  106 ng (equal to
one genome of MTB (5 fg)) (B) detection limit of mPCR was 5  105 ng (50 fg) of MTB DNA.

Figure 2 LAMP amplification results of positive and negative samples can be detected and differentiated with naked eyes (upper
panel A) as well as under ultraviolet light (middle panel B). LAMP results on 2% agarose gel electrophoresis (lower panel C). Panels
are showing LAMP positive results (3e10) and negative results (1e2).

Please cite this article in press as: Kumar P, et al., Loop-mediated isothermal amplification assay for rapid and sensitive diagnosis of
tuberculosis, J Infect (2014), http://dx.doi.org/10.1016/j.jinf.2014.08.017
LAMP assay for TB diangosis 5

Table 2 Determination of specificity of esat6-LAMP assay.

Bacterial species (n) Reference strains LAMP Pos LAMP Neg
I. Mycobacterial species (43)
M. tuberculosis H37Rv (1) TMC-102 1 e
M. avium (1) NCTC-8551 e 1
M. intracellulare (1) TMC1406 e 1
M. terrae (1) TMC-1450 e 1
M. smegmatis (1) MC2155 e 1
M. bovis BCG (1) BCG P3 e 1
M. tuberculosis (13) Lab. maintained 13 e
M. scrofulaceum (5) Lab. maintained e 5
M. fortuitum (4) Lab. maintained e 4
M. avium (7) Lab. maintained e 7
M. smegmatis (2) Lab. maintained e 2
M. terrae (2) Lab. maintained e 2
M. kansasii (2) Lab. maintained e 2
M. chelonae (2) Lab. maintained e 2
II. Non mycobacterial species (37)
Escherichia coli (10) Lab. maintained e 10
Staphylococcus aureus (3) Lab. maintained e 3
Klebsiella pneumonia (3) Lab. maintained e 3
Pseudomonas aeruginosa (5) Lab. maintained e 5
Acinetobacter species (14) Lab. maintained e 14
Enterobacter species (2) Lab. maintained e 2

15 years (mean age 8.6  3.92). Out of 118 patients, 41
were suspected cases of PTB and 77 of EPTB. In the
suspected PTB patients, most common clinical manifesta-
tions were cough of more than 2 weeks in 35 (85.3%), fever
in 31 (75.6%), weight loss in 26 (63.4%), and night sweats
and chest pain in 13 (31.7%). Radiological examination
showed consolidation, infiltration, cavitary lesions and
fibrosis of lungs in 23 (56%) cases. Of the 77 suspected
EPTB patients, they had varied manifestations including,
suspected TB meningitis (28), pleural TB (15), subcutaneous
abscess (11), lymphadenitis (7), genitourinary TB (5),
Abdominal TB (2) and 9 were suspected cases of dissemi-
nated TB. Past history of TB was recorded in 33 (25.7%) and
family history of TB in 27 (22.8%) patients.
The LAMP results on 118 samples were analyzed by
comparing the results with smear microscopy, MGIT culture
and in-house mPCR individually and in combination. The
performance of these tests is shown in Table 3. The positiv-
ity rate of LAMP was found to be highest of all the diag-
nostic tests used in this study (p Z 0.001). From 41
pulmonary samples, 14 (34.14%) were bacteriologically
(smear and/or MGIT culture) positive and 18 (43.9%) were
mPCR positive; while 21 (51.2%) samples were positive by
LAMP. All the culture and mPCR positive samples were pos-
itive by LAMP assay showing 100% sensitivity in bacteriolog-
ically confirmed cases. LAMP was able to detect 13%
additional cases over the bacteriological and mPCR positive
samples (Table 4, Fig. 3A). Similar results were obtained in
EPTB samples. Of the 77 EPTB samples, 22 (28.5%) samples
were bacteriologically positive and 34 (44.1%) by mPCR for
MTB, while 41 (53.2%) were detected positive by the LAMP
assay (Table 4, Fig. 3B). The difference in positivity rate of
LAMP and culture was highly significant (p Z 0.001) in EPTB
samples. In 2 bacteriologically and LAMP negative samples
(CSF and PF one each) mPCR was found positive. Overall
LAMP assay was able to detect 22% and 8.5% additional
cases over the MGIT culture and mPCR, respectively
(p Z 0.001) (Tables 3 and 4). These results indicate that
esat6-LAMP is highly sensitive assay and can detect small
quantity of mycobacterial DNA in clinical samples. The

Table 3 Overall performance of esat6-LAMP in comparison with smear microscopy, MGIT culture and mPCR.
Bacteriological criteria mPCR LAMP
Smear Culture þ  þ 
þ þ 9 9 0 9 0
 þ 27 27 0 27 0
þ  0 0 0 0 0
  82 16 66 26 56
Total 118 52 66 62 56
(44%) (55.9%) (52.5%) (47.45%)

Please cite this article in press as: Kumar P, et al., Loop-mediated isothermal amplification assay for rapid and sensitive diagnosis of
tuberculosis, J Infect (2014), http://dx.doi.org/10.1016/j.jinf.2014.08.017
6 P. Kumar et al.

Table 4 Sensitivity of LAMP assay on pulmonary and extra-pulmonary samples from suspected TB patients.
Samples LAMP results Detection rate % Sensitivity % (95% CI) P value (Fisher’s exact test)
Pos Neg
I PTB samples (41)
Bacteriologicallyþ (14) 14 0 100 100 (76.8e100) 0.001
Bacteriologicallye (27) 7 20 25.9 25.9 (11.1e46.2)
mPCRþ (18) 18 0 100 100 (81.4e100) 0.001
mPCRe (23) 3 20 13 13 (2.7e33.5)
Bacteriologically and mPCRþ 14 0 100 100 (76.8e100) 0.001
(14)
Bacteriologicallye, mPCRþ 4 0 100 100 (39.8e100)
(4)
Bacteriologicallye, mPCRe 3 20 13 13 (2.7e33.5)
(23)
II EPTB samples (77)
Bacteriologicallyþ (22) 22 0 100 100 (84.5e100) 0.001
Bacteriologicallye (55) 23 32 41.8 41.8 (28.6e55.8)
mPCRþ (34) 32 2a 94.1 94.1 (80.3e99.2) 0.001
mPCRe (43) 7 36 16.2 16.2 (68e30.7)
Bacteriologicallyþ, mPCRþ 22 0 100 100 (84.5e100) 0.001
(22)
Bacteriologicallye,mPCRþ 10 2a 83.3 83.3 (51.5e97.9)
(12)
Bacteriologicallye, mPCRe 9 34 26.4 26.4 (10e36)
(43)
a
One pleural fluid and one CSF sample was negative by LAMP.

overall specificity of LAMP assay was found to be 93.5% (95%
CI: 78.6e99.2) and false-positive reaction was seen only in
two samples (pus and urine, one each) (Table 5). The two
false-positive results remained positive even after
repeating the test.
Out of 26 LAMP positive but bacteriologically negative
samples, 19 (73%) were EPTB samples (6 CSF, 5 lymph node
aspirate, 5 pus, lymph node aspirate, urine & pericardial
fluid one of each) and 7 (26.9%) were PTB samples.
Interestingly, 14 (73.7%) of these samples were also positive
by mPCR and all 14 patients from whom these samples were
obtained, gave past history of TB and 5 (26.3%) gave family
history of TB. In one patient both self and family history of
TB could be elicited. Follow-up information was available
only for 17 patients. Of these 15 were put on ATT on the
basis of clinical, radiological and mPCR results and cured.
Two patients died during ATT treatment (Table 6).
Discussion
Early and accurate diagnosis of TB is of paramount
importance for the better management of this disease
particularly in high TB burden countries. Although smear

Figure 3 Concordance of the LAMP assay with bacteriological and mPCR results on PTB samples (panel A) and EPTB samples
(panel B).

Please cite this article in press as: Kumar P, et al., Loop-mediated isothermal amplification assay for rapid and sensitive diagnosis of
tuberculosis, J Infect (2014), http://dx.doi.org/10.1016/j.jinf.2014.08.017
LAMP assay for TB diangosis 7

Table 5 Specificity of the LAMP assay on disease control samples.

Samples Final disease diagnosis LAMP results Specificity (%) (95% CI)
Positive Negative
Sputum (11) COPD with pneumonia e 11 100 (71.5.1e99.6)
Pus (7) Abscess pus 1a 6 85.7 (42.1e99.6)
Urine (8) Bacterial UTI 1b 7 87.5 (47.8e99.6)
Lymph node (5) Lymphoma e 5 100 (47.8e1000)
Total (31) 2 29 93.5 (78.5e99.2)
a
Pus from amebic liver abscess.
b
This patient had bacterial urinary tract infection established by routine culture examination.

microscopy is the most rapid but has poor sensitivity.
Mycobacterial culture is considered as gold standard, but
it is tedious, time-consuming, and requires safety pro-
cedures in laboratories. However, in the last one decade,
several new diagnostic tests have been commercialized,
but most are expensive.30 Therefore, a test that combines
the rapidity and specificity of microscopy and can improve
the sensitivity of culture methods at a reasonable price
would be a boon for the TB management. Although the
NAA methods offer major advantages of speed and sensi-
tivity for pathogen detection, these require sophisticated
laboratory infrastructure and are not feasible for routine
use in developing countries.31e34 Recent research and
development efforts have, however, led to the develop-
ment of novel molecular approaches which may change
this paradigm. LAMP, is a new NAA method, that can be per-
formed in one tube under isothermic condition and with
high amplification efficiency in a very short time i.e.
30e35 min. Globally, two companies: Eiken Chemical Ltd,
Japan and Optigene, UK, have developed LAMP based point
of care test for the detection of various pathogens.22,24 The
Eiken TB kit was evaluated by FIND at selected reference
centers in high TB burden countries. This DATA was
analyzed by WHO expert group and recommended that
more research is needed to improve its specificity and eval-
uation should be carried out in different geographical set-
tings with different prevalence and incidence rates of TB
and HIV-TB.24
Considering the above recommendation of WHO expert
group, the present study was aimed to develop a new LAMP
test and evaluate its diagnostic potential. For this we used
a novel esat-6 gene target (process and product, patented
in the names of Singh S & Sharma P: WO 2005/061730 A1,
AU2004303629, EP 1711620 B1, and US 2007/0072188).
The test was standardized on mycobacterial and other bac-
terial species and finally evaluated for its sensitivity and
specificity directly on clinical samples. While comparing
with three tests, LAMP assay showed 8.5% higher detection
rate than mPCR and 22% higher than MGIT culture. High pos-
itivity of LAMP assay over the standard culture method
could be explained by inclusion of a larger number of
EPTB samples. The EPTB samples are known to be pauci-
bacillary in nature thereby yielding low culture positivity,
while molecular tests can amplify even a small quantity
(as low a 5 fg) of mycobacterial DNA. However, the biggest
limitation of DNA based molecular tests is that these tests
can not differentiate between dead and live target
organisms.6e12

Table 6 Final diagnosis in diseased patients whose samples were LAMP positive but bacteriologically negative.
Bacteriologically negative LAMP positive (n Z 26) Follow-up details (17)a Final diagnosis Treatment outcome
Sample No.
CSF 6b 3 TB meningitis (3) All 3 Cured with ATT
Pleural fluid 5b 4 Pleural TB (4) Three patients cured
with ATT and 1 patient
died during treatment
Pus 5b 3 Cold abscess (2) All received prolonged
Pott’s disease (1) ATT and cured
LN Aspirate. 1 1 TB lymphadenitis (1) ATT received and cured
Urine 1b e e e
Pericardial fluid 1b e e e
Sputum 5 5 PTB (5) Four patients cured with
ATT and 1 patient died
during treatment
BAL 1 1 PTB (1) ATT received and cured
GA 1b e e e
a
Follow-up was available only for 17 cases.
b
Remaining patients lost to follow-up.

Please cite this article in press as: Kumar P, et al., Loop-mediated isothermal amplification assay for rapid and sensitive diagnosis of
tuberculosis, J Infect (2014), http://dx.doi.org/10.1016/j.jinf.2014.08.017
8 P. Kumar et al.
Although culturing is gold standard test for diagnosis of
TB but it can yield false-negative results when sample
contains dormant bacilli, less than 102 bacilli/ml, or non-
culturable bacilli (because of over decontamination process
and under treatment). However, in the analysis of results,
reference standard test is the comparator for the test un-
der evaluation, especially for sensitivity evaluation. The se-
lection and the quality of the reference standard test
directly affect the measurement of test performance.35 In
our study, the analytical sensitivity of our LAMP assay was
higher than conventional mPCR. Aryan et al.18 also reported
that LAMP is more sensitive than conventional PCR in pauci-
bacillary sputum samples. However, other authors have
observed that LAMP assay had broadly similar sensitivity
and specificity in pulmonary samples as of PCR and culture
results.19,36e38
The limitation of our study was small sample size. A
study with larger sample size using the case control
approach would be desirable. A prospective study to
evaluate the utility of LAMP test in the disease prognosis
and treatment success also need to be carried out. The
specificity may be a concern in ultrasensitive test methods
such as LAMP. But this can be improved by using the
flouremeter Genie II real time system. This system provides
a closed tube approach that minimizes the number of liquid
handling steps, and reduces possibility of cross contamina-
tion significantly18
In conclusion, the LAMP assay could be highly useful tool
for diagnosing pauci-bacillary cases of tuberculosis such as
EPTB cases. The test is highly sensitive, cost effective, and
rapid with a turnaround time of less than 6 h. The patient
can be diagnosed on the same day and need not to come
again to the laboratory.
Conflict of interest
The corresponding author holds the process and product
patent on using esta-6 primer sequences for the molecular
diagnosis of Mycobacterium tuberculosis in the names of
Singh S & Sharma P: WO 2005/061730 A1, AU2004303629,
EP 1711620 B1, and US 2007/0072188. Another author
(Deepal Pandya) works for AmpliGene India Biotech Pvt.
Ltd., Ahmedabad, Gujarat, India, who markets fluorometer
Genei-II in India.
Acknowledgments
We wish to thank Ms. Syed Beenish Rufai, Deepika Anand
and Mr. Vinod Kumar for their technical help. Financial
support from the Department of Biotechnology, Govern-
ment of India (vide grant no BT/PR-15206/Med/29/281/
2011) to SS is acknowledged. A senior research fellowship
to PK from Department of Biotechnology, Government of In-
dia is also acknowledged.
References
1. World Health Organization. Global tuberculosis report. 2013.
WHO/HTM/TB/2013.11. Geneva, Switzerland. Retrieved
from: http://apps.who.int/iris/bitstream/10665/91355/1/
9789241564656_eng.pdf.
Please cite this article in press as: Kumar P, et al., Loop-mediated isothermal amplification assay for rapid and sensitive diagnosis of
tuberculosis, J Infect (2014), http://dx.doi.org/10.1016/j.jinf.2014.08.017
2. Gopinath K, Kumar S, Sankar MM, Singh S. Novel method for
clearing red blood cell debris from BacT/ALERT blood culture
medium for improved microscopic and anti-mycobacterial drug
susceptibility test results. J Clin Lab Anal 2007;21(4):220e6.
3. Lu PL, Yang YC, Huang SC, Jenh YS, Lin YC, Huang HH, et al.
Evaluation of the Bactec MGIT 960 system in combination
with the MGIT TBc identification test for detection of Mycobac-
terium tuberculosis complex in respiratory specimens. J Clin
Microbiol 2011;49(6):2290e2.
4. Centers for Disease Control and Prevention (CDC). Updated
guidelines for the use of nucleic acid amplification tests in
the diagnosis of tuberculosis. MMWR Morb Mortal Wkly Rep
2009;58(01):7e10.
5. American Thoracic Society Documents (ATS), American
Thoracic Society/Centers for Disease Control and Preventio-
n/Infectious Diseases Society of America. Controlling tubercu-
losis in the United States. Am J Respir Crit Care Med 2005;172:
1169e227.
6. Ling DI, Flores LL, Pai M. Commercial nucleic-acid amplifica-
tion tests for diagnosis of pulmonary tuberculosis in respiratory
specimens: meta-analysis and meta-regression. PLoS One 2008;
3(2):e1536.
7. Goessens WHF, de Man P, Koeleman GM, Luijendijk A, te
Witt R, Endtz HP, et al. Comparison of the COBAS AMPLICOR
MTB and BDProbeTec ET assays for detection of Mycobacterium
tuberculosis in respiratory specimens. J Clin Microbiol 2005;
43(6):2563e6.
 M, Moreno C, Martı́ N. Routine use of gen-probe
8. Coll P, Garrigo
amplified Mycobacterium Tuberculosis Direct (MTD) test for
detection of Mycobacterium tuberculosis with smear-positive
and smear-negative specimens. Int J Tuberc Lung Dis 2003;
7(9):886e91.
9. Miragliotta G, Antonetti R, Di Taranto A, Mosca A, Del Prete R.
Direct detection of Mycobacterium tuberculosis complex in
pulmonary and extrapulmonary samples by BD ProbeTec ET sys-
tem. New Microbiol 2005;28(1):67e73.
10. de Luna FF, Ruiz P, Gutiérrez J, Casal M. Evaluation of the Ge-
noType Mycobacteria Direct assay for detection of Mycobacte-
rium tuberculosis complex and four atypical mycobacterial
species in clinical samples. J Clin Microbiol 2006;44(8):
3025e7.
11. Antonenka A, Hofmann-Thiel S, Turaev L, Esenalieva A,
Abdulloeva A, Sahalchyk E, et al. Comparison of Xpert MTB/RIF
with ProbeTec ET DTB and COBAS TaqMan MTB for direct detec-
tion of M. tuberculosis complex in respiratory specimens. BMC
Infect Dis 2013;13:280.
12. Flores LL, Pai M, Colford JM, Riley LW. In-house nucleic acid
amplification tests for the detection of Mycobacterium tuber-
culosis in sputum specimens: meta-analysis and meta-regres-
sion. BMC Microbiol 2005;5:55.
13. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K,
Amino N, et al. Loop mediated isothermal amplification of
DNA. Nucleic Acids Res 2000;28(12):e63.
14. Wataru Y, Ishibashi M, Kawahara R, Inoue K. Development of a
loop-mediated isothermal amplification assay for sensitive and
rapid detection of Vibrio parahaemolyticus. BMC Microbiol
2008;8:163.
15. Parida M, Horioke K, Ishida H, Dash PK, Saxena P, Jana AM,
et al. Rapid detection and differentiation of dengue virus sero-
types by a real-time reverse transcription-loop-mediated
isothermal amplification assay. J Clin Microbiol 2005;43(6):
2895e903.
16. Njiru ZK, Mikosza ASJ, Armstrong T, Enyaru JC, Ndung’u JM,
Thompson ARC. Loop-mediated isothermal amplification
(LAMP) method for rapid detection of Trypanosoma brucei rho-
desiense. PLoS Negl Trop Dis 2008;2:e147.
17. Hopkins H, Gonza lez IJ, Jolley SD, Angutoko P, Ategeka J,
Asiimwe C, et al. Highly sensitive detection of Malaria
LAMP assay for TB diangosis
parasitemia in a malaria-endemic setting: performance of a
new loop-mediated isothermal amplification kit in a remote
clinic in Uganda. J Infect Dis 2013;208(4):645e52.
18. Aryan E, Makvandia M, Farajzadeha A, Huygenb K, Bifanib P,
Mousavic SL, et al. A novel and more sensitive loop-mediated
isothermal amplification assay targeting IS6110 for detection
of Mycobacterium tuberculosis complex. Microbiol Res 2010;
165(3):211e20.
19. George G, Mony P, Kenneth J. Comparison of the efficacies of
loop-mediated isothermal amplification, fluorescence smear
microscopy and culture for the diagnosis of tuberculosis.
PLoS One 2011;6(6):1007.
20. Zhu RY, Zhang KX, Zhao MQ, Liu YH, Xu YY, Ju CM, et al. Use of
visual loop-mediated isotheral amplification of rimM sequence
for rapid detection of Mycobacterium tuberculosis and Myco-
bacterium bovis. J Microbiol Methods 2009;78(3):339e43.
21. Iwamoto T, Sonobe T, Hayashi K. Loop-mediated isothermal
amplification for direct detection of Mycobacterium tubercu-
losis complex, M. avium, and M. ntracellulare in sputum sam-
ples. J Clin Microbiol 2003;41(6):2616e22.
22. Mahony J, Chong S, Bulir D, Ruyter A, Mwawasi K, Waltho D.
Development of a sensitive loop-mediated isothermal amplifi-
cation assay that provides specimen-to-result diagnosis of res-
piratory syncytial virus infection in 30 minutes. J Clin Microbiol
2013;51(8):2696e701.
23. Peng J, Shi M, Xia Z, Huang J, Fan Z. Detection of cucumber
mosaic virus isolates from banana by one-step reverse tran-
scription loop-mediated isothermal amplification. Arch Virol
2012;157(11):2213e7.
24. World Health Organization. The use of a commercial loop-
mediated isothermal amplification assay (TB-LAMP) for the
detection of tuberculosis. 2013. WHO/HTM/TB/2013.05.
Geneva, Retrieved from: http://apps.who.int/iris/bitstream/
10665/83142/1/WHO_HTM_TB_2013.05_eng.pdf.
25. Singh S, Kumar P, Sharma S, Mumbowa F, Martin A, Durier N.
Rapid identification and drug susceptibility testing of Mycobac-
terium tuberculosis: standard operating procedure for non-
commercial assays: part 1: microscopic observation drug sus-
ceptibility assay v2.4.12. J Lab Physicians 2012;4:120e6.
26. American Thoracic Society (ATS). Diagnostic standards and
classification of tuberculosis in adults and children. This offi-
cial statement of the American Thoracic Society and the Cen-
ters for Disease Control and Prevention was adopted by the ATS
Board of Directors, July 1999. This statement was endorsed by
the Council of the Infectious Disease Society of America. Am J
Respir Crit Care Med 1999;161:1376e95.
Please cite this article in press as: Kumar P, et al., Loop-mediated isothermal amplification assay for rapid and sensitive diagnosis of
tuberculosis, J Infect (2014), http://dx.doi.org/10.1016/j.jinf.2014.08.017
9
27. Reves R, Reichman LB, Simone PM, Starke JR, Vernon AA.
American Thoracic Society/Centers for Disease Control and
Prevention/Infectious Diseases Society of America: treatment
of tuberculosis. Am J Respir Crit Care Med 2003;167:603e62.
28. Kumar P, Benny P, Jain M, Singh S. Comparison of an in-house
multiplex PCR with two commercial immuno-chromatographic
tests for rapid identification and differentiation of MTB from
NTM isolates. Int J Mycobacteriol 2014;3(1):50e6.
29. Gopinath K, Singh S. Multiplex PCR assay for simultaneous
detection and differentiation of Mycobacterium tuberculosis,
Mycobacterium avium complexes and other mycobacterial spe-
cies directly from clinical specimens. J Appl Microbiol 2009;
107(2):1364e72.
30. Verma S, Dhole TN, Kumar M, Kashyap S. A novel approach for
improving sensitivity of AFB microscopy using ReaSLR method.
J Clin Microbiol 2013;51(11):3597e601.
31. Dora JM, Geib G, Chakr R, Paris Fd, Mombach AB, Lutz L, et al.
Polymerase chain reaction as a useful and simple tool for rapid
diagnosis of tuberculous meningitis in a Brazilian tertiary care
hospital. Braz J Infect Dis 2008;12(3):245e7.
32. Lorino G, Lilli D, Rivanera D, Guarino P, Angeletti S,
Gherardi G, et al. Polymerase chain reaction, with sequencing,
as a diagnostic tool in culture-negative bacterial meningitis.
Clin Microbiol Infect 1999;5(2):92e6.
33. Pai M, Flores LL, Pai N, Hubbard A, Riley LW, Colford JM. Diag-
nostic accuracy of nucleic acid amplification tests for tubercu-
lous meningitis: a systematic review and meta-analysis. Lancet
Infect Dis 2003;3(10):633e43.
34. Pal RB, Desai MM. Polymerase chain reaction for the rapid diag-
nosis of tuberculous meningitis. J Indian Med 2007;105(1):
21e4.
35. Peeling RW, Smith PG, Bossuyt PMM. A guide for diagnostic
evaluations. Nat Rev Microbiol 2010:S2e6.
36. Tomita N, Mori Y, Kanda H, Notomi T. Loop-mediated
isothermal amplification (LAMP) of gene sequences and simple
visual detection of products. Nat Protoc 2008;3(5):877e82.
37. Leila K, Shahhosseiny MH, Razavi MR, Parivar K, Moslemi E,
Werngren J. Evaluation of loop mediated isothermal amplifica-
tion for diagnosis of Mycobacterium tuberculosis complex in
clinical samples. Afr J Biotechnol 2011;10:5096e101.
38. Greco S, Rulli M, Girardi E, Piersimoni C, Saltini C. Diagnostic
accuracy of in-house PCR for pulmonary tuberculosis in
smear-positive patients: metaanalysis and metaregression. J
Clin Microbiol 2009;47(3):569e76.