ISOLATION, IDENTIFICATION AND CHARACTERIZATION OF

MICROORGANISMS INVOLVED IN CONCRETE CORROSION

A PROJECT REPORT

Submitted by

NAHEETHA FATHIMA RAJA MOHAMED

Under the guidance of

Dr. S. HEMALATHA

In partial fulfilment for the award of the degree of

BACHELOR OF TECHNOLOGY

In

BIOTECHNOLOGY

JUNE 2018
 BONAFIDE CERTIFICATE

Certified that this project report ISOLATION, IDENTIFICATION AND

CHARACTERIZATION OF MICROORGANISMS INVOLVED IN CONCRETE
CORROSION is the bonafide work of NAHEETHA FATHIMA RAJA MOHAMED
(140151601026) who carried out the project work under my supervision. Certified
further, that to the best of my knowledge the work reported herein does not form part
of any other project report or dissertation on the basis of which a degree or award
was conferred on an earlier occasion on this or any other candidate.

Dr. S. HEMALATHA Dr. S. HEMALATHA

DEAN, SCHOOL OF LIFE

SUPERVISOR SCIENCES

Dean, School of Life Sciences Professor

Department of Biotechnology Department of Biotechnology

B.S.Abdur Rahman Crescent B.S.Abdur Rahman Crescent

Institute of Science and Technology Institute of Science and Technology

Chennai – 600 048 Chennai – 600 048

 www.bsauniv.ac.in

VIVA-VOCE EXAMINATION

The viva-voce examination of the project work titled “ISOLATION, IDENTIFICATION

AND CHARACTERIZATION OF MICROORGANISMS INVOLVED IN CONCRETE
CORROSION”, submitted by NAHEETHA FATHIMA RAJA MOHAMED
(140151601026) is held on 04.06.2018.

INTERNAL EXAMINER EXTERNAL EXAMINER

 DECLARATION

I hereby declare that the project titled “Isolation, Identification and Characterization
of microorganisms involved in concrete corrosion ” submitted to the Department of
Life Sciences, B.S. Abdur Rahman Crescent Institute of Science and Technology,
Chennai for the partial fulfillment of the Bachelor degree in Biotechnology is a faithful
record of bonafide and original research work carried out by me under the guidance and
supervision of Dr. S. HEMALATHA, Dean, School of Life Sciences, B.S.Abdur Rahman
Crescent Institute of Science and Technology.

Date: 04.06.2018

Place: B.S. Abdur Rahman Crescent Institute of Science and Technology,

Chennai

(NAHEETHA FATHIMA RAJA MOHAMED)

 ACKNOWLEDGMENTS

First and foremost, I would like to express my sincere gratitude to the Dean, School of
Life Sciences, B.S Abdur Rahman Institute of Science and Technology, whom I was
lucky enough to have as a mentor, Dr. S. Hemalatha, for giving me an opportunity to
work with her. Working under her supervision has been a great learning, stimulating
and rewarding experience for me. Her constructive critiques and accurate reviews
generated many of the insight upon which this research is based upon.

I am also grateful to the Vice-chancellor, Mr. Sahol Hameed Bin Abu Baker, B.S
Abdur Rahman Institute of Science and Technology, for providing excellent, up to date
lab facilities and equipment without which this research would not have been possible.

I express my gratitude to our class advisor Dr. Sudarkodi Sukumar, Assistant

Professor, Department of Biotechnology, B.S Abdur Rahman Institute of Science and
Technology for her support.

I also express my heartfelt gratitude towards Ms. Tahira and Mr. Saroj Kumar, Ph.D
scholars, Department of Biotechnology, for their guidance throughout the project.

I would also like to thank Dr. M.S. Haji Sheik Mohammed, Dean of Academic Affairs,
B.S Abdur Rahman Institute of Science and Technology for broadening my knowledge
in the civil aspect of this project. I also express my gratitude to Mr. Umar Mohamed,
Ph.D. scholar, Department of Civil Engineering and Haseena.I, Saranya.S,
Vaishnavi.N, Shruthi.N and Sangavi.S, B.Tech students, Department of Civil
Engineering, for providing me with few specimens required for the completion of this
project.

I would like to extend my appreciation to AgriGenome Labs, Cochin which aided me

in DNA Sequencing, Royal Bio Research Centre, Tamil Nadu for XRD analysis and
UV Spectroscopy and also SAIF-STIC, Cochin which helped me in SEM and TEM
Analysis.

Last but most importantly, I would like to express my heartfelt thanks to my family and
friends whose endless support and encouragement was crucial in the realization of this
work.
 TABLE OF CONTENTS

CHAPTER TITLE PAGE NO.

NO.

Abstract viii
List of Tables ix
List of Figures x
List of Abbreviations xi
1 Introduction 1
2 Review of Literature 2
2.1 Microbial Corrosion in Marine Environment 2
2.2 Nanotechnology 3
2.2.1 Bio-Nanotechnology 3
2.3 Copper Nanoparticles 4
3 Material and Methods 4
3.1 Reagents and Measurements 4
3.2 Sample Collection 5
3.3 Isolation and Identification 5
3.3.1 Pour Plate technique 5
3.3.2 Streak Plate technique 5
3.3.3 Preparation of Bacterial Culture 6
3.3.4 DNA Extraction 6
3.3.4.1 Preparation of Reagents 6
3.3.4.2 Isolation of DNA 7
3.3.5 DNA Amplification 8
3.3.6 DNA Sequencing 8
3.4 Corrosion Studies 8
3.4.1 Total Viable Count 9
3.5 Nanoparticle Production 9
3.5.1 Culture Preparation 9
3.5.2 Synthesis of Copper Nanoparticles 9
3.5.3 Mechanism of Copper Nanoparticle Formation 9
3.6 Nanoparticle Characterization 10
3.6.1 UV-Visible Spectra Analysis 10
3.6.2 X-Ray Diffraction Analysis 10
3.6.3 Scanning Electron Microscopy 10
3.6.4 Transmission Electron Microscopy 11
3.7 Antibacterial Activity 11
3.7.1 Zone Of Inhibition Test 11
3.7.2 Minimum Inhibitory Concentration Assay 11
3.7.3 Minimum Bacterial Concentration Assay 12
4 Results and Discussions 12
4.1 Pour plate and Streak plate of the bacteria 12
4.2 DNA Sequencing 13
4.3 Corrosion studies 16
4.4 Synthesis of Nanoparticles 19
4.5 Characterization of Nanoparticles 20
4.5.1 UV-Visible Spectroscopy 20
4.5.2 XRD Analysis 22
4.5.3 Scanning Electron Microscopy 22
4.5.4 Transmission Electron Microscopy 23
4.6 Antibacterial activity 23
5 Conclusion and Further Scope 26
References 27
Technical Biography 32
Plagiarism Report
ABSTRACT:

The marine environment includes various types of microorganisms that lead to the
corrosion of concrete resulting in a phenomenon called ‘Microbiologically Induced
Deterioration’ (MID). In this current study, samples were collected from ICAR-CIBA,
Muttukadu, Chennai, Tamil Nadu. These samples included scraps from walls, rocks,
and rust. From these samples, microorganisms were isolated and sequenced for
identification. After identification, these microorganisms were made to react with
different types of cement such as PPC-786, PPC-WP, PPC Control, PSC Control and
PSC-SN. This study was done to get a holistic idea about the behavior of different types
of cement when exposed to bacteria. In addition to exposure studies, nanoparticles
were synthesized from the isolated microorganisms and characterized by UV-Visible
Spectroscopy, X-Ray Diffraction Analysis, Scanning Electron Microscopy (SEM) and
Transmission Electron Microscope (TEM). Nanotechnology is an emerging technology
with wide applications in various fields. Nanoparticle production utilizing bacteria has
spread rapidly as a research area in green nanotechnology. The nanoparticles were
further tested for antibacterial activity against test organisms like E.Coli, Klebsiella,
Staphylococcus aureus and Pseudomonas aeruginosa using Ampicillin as an antibiotic.
The tests carried out for the antibacterial studies were Zone of Inhibition Test, Minimum
Inhibitory Concentration Assay (MIC) and Minimum Bacterial Concentration Assay
(MBC).

Key Words: Corrosion, Marine environment, Nanoparticles, Antibacterial Activity

viii
 LIST OF TABLES

TABLE NO. DESCRIPTION PAGE NO.

4.3.1 TVC value of types of cement every 36 hours 18

4.5.1.1 Absorbance values using UV Spectroscopy 21
4.6.1 Zone Of Inhibition Test using Ampicillin as 24
antibiotic
4.6.2 Minimum Inhibitory Concentration Assay 25
4.6.3 Minimum Bacterial Concentration Assay 26

ix
 LIST OF FIGURES

FIGURE DESCRIPTION PAGE NO.

NO.

4.1.1 Pour plate of the bacteria 13

4.1.2 Streak plate of the bacteria 13
4.2.1 Graphical summary of BLASTn 15
4.2.2 Sequences producing significant alignment 16
4.3.1 Different types of Types of cement 17
4.3.2 Cement inoculated in bacterial culture 17
4.4.1 Colour change depicting nanoparticle formation 20
4.5.1.1 UV-Visible graph for the nanoparticles 21
4.5.2.1 XRD Analysis 22
4.5.3.1 SEM image of the nanoparticles 22
4.5.4.1 TEM image of the nanoparticles 23

x
 LIST OF ABBREVIATIONS

MID Microbiologically Induced Corrosion

PPC Pozzolana Portland Cement
PSC Portland Slag Cement
UV Ultra Violet
XRD X-Ray diffraction
SEM Scanning Electron Microscopy
TEM Transmission Electron Microscopy
ZOI Zone of Inhibition
MIC Minimum Inhibitory Concentration
MBC Minimum Bacterial Concentration
SDS Sodium Dodecyl Sulphate
EDTA Ethylenediaminetetraacetic acid
Tris Trisaminomethane
TE Buffer Tris-EDTA Buffer
DMSO Dimethyl sulfoxide
PCR Polymerase Chain Reaction
NaCl Sodium Chloride
CuSO4 Copper Sulphate
LB Broth/Agar Luria-Bertani Broth/Agar
g Gram
mg Milli Gram
ml Milli Litre
µl Micro Litre
% Percentage
⁰C Degree Celcius

xi
1. INTRODUCTION:

Microbial corrosion has always been a threat to marine structures. Among the different
species of microorganisms found in the marine environment, not all of them cause
corrosion. Concrete being highly alkaline in nature, gets deteriorated only by acidophilic
microorganisms. Marine concrete structures offer favourable conditions for their growth.
Microbial weathering of the concrete and cement raises the porosity of the structure,
thereby enhancing the penetration of water and microbes. Microbial processes have
affected the structural integrity of various bridges, buildings and ocean structures. It has
been recognized as an issue worldwide. Concrete structures that are exposed to the
marine environment get easily corroded due to the action of the microorganisms. These
microorganisms first attack the surface of the concrete as well as the pores and
capillaries thereby causing damage through bio-deterioration. The most important
microorganisms responsible for this bio-deterioration have still not been completely
identified. Nanotechnology is an emerging technology that provides opportunities for the
enhancement of concrete properties. Materials that are made up of constituents of
nanoscale dimensions, or those that are produced by nanotechnology, are termed as
Nanoparticles. These particles range from size 1-100 nm. Synthesis of nano-size
particles of varying morphologies and sizes is a growing platform of research in
nanotechnology [1]. Therefore, there is a developing need to come up with dependable,
non-toxic, clean and environment friendly protocols for the synthesis of nanoparticles
[2-8]. Nanoparticles show morphology dependent characteristics which can be used for
several applications ranging from bio-sensing and catalysts to optics and antimicrobial
activity. Nanoparticles are also used in different fields such as medical imaging,
nanocomposites and drug delivery [9-12]. Nanotechnology has given rise to
Nanobiotechnology, which is the integration of biology and nanotechnology. There are
several ways for the production of nanoparticles such as the use of vitamins, enzymes,
polysaccharides, bio-degradable polymers and microorganisms. Nanoparticle synthesis
using bacteria shows immense potential. One of the earliest studies on the production
of metallic nanoparticles by bacteria was reported by Temple and Le Roux in 1964.
However, only in the 21st century has the production of metallic nanoparticles been
more deeply investigated. Microscopic organisms possess the ability to mobilize and
immobilize metals. In some cases, these microbes reduce metal particles to a
nanometer scale. Various biological entities are being used for this purpose of

1
nanoparticle synthesis. This is being shaped as an alternative for routine chemical and
physical strategies. Prokaryotic organisms like bacteria are used for the producing
nanoparticles due to its ease of culturing, short generation period, controllable
experimental conditions, extracellular production and its easy downstream processing
thereby gaining importance in nanoparticle production [13]. Amongst the various
metals, copper nanoparticles have been of great interest due to its low cost and easy
availability along with properties of other metallic nanoparticles. Nanoparticles have
increased surface-to-volume ratio compared to the bulk material and therefore show
unique physical and chemical properties. Nanotechnology and Nanobiotechnology have
opened up several opportunities for exploration of the bactericidal effect of metallic
nanoparticles. The bactericidal effect of the nanoparticles is a result of their nano-size
and increased surface to volume ratio. Antibacterial agents are those that kill bacteria or
hinder their growth without actually being harmful or toxic to the surrounding tissues.
The word ‘‘antibiotic’’ was first brought into use back in 1941 by Selman Waksman. He
used it to refer to antimicrobial compounds produced by microorganisms [14]. The
nano-sized particles received a lot of attention and response as a result of its potential
in several pharmaceutical and biomedical applications. The particles in nano-size have
the capacity to easily interact with bacterial membranes [15]. Antibacterial agents are
used in various fields like the textile industry, water disinfection processes, food
packaging, as well as in the medical industry [16]. Presently, there is an increase in the
occurrence of antibiotic-resistant genes in various bacterial species. This could possibly
be due to the overuse of antibiotics. Many known antimicrobials have shown resistance
by at least one microorganism or another [17]. It has been demonstrated that copper
nanoparticles show antimicrobial properties against a broad range of microorganisms
and pathogenic bacteria [18]. Copper-containing compounds like CuSO4 are utilized as
conventional antibacterial agents. Further, as for antifungal compounds, aqueous
copper solutions, polymers with copper or complex copper species are used [19]. In
some cases, copper exhibits better properties than expensive metals like gold and
silver. For instance, copper nanoparticles indicated more antibacterial effect compared
to the silver nanoparticles against E. coli and Bacillus subtilis [20, 21].

2. REVIEW OF LITERATURE:

2.1. Microbial corrosion in Marine Environment:

2
In literature, Bio-deterioration is explained as the unwanted change caused in the
properties and characteristics of any material due to the action of microorganisms. It is
also said to be the phenomenon by which biological agents cause lowering of value and
quality [22]. Studies from recent years show that microorganisms play a big role in the
corrosion of concrete structures [23]. Organisms such as bacteria, fungi, green algae
are regularly found on the walls and surfaces of concrete structures [24, 25]. Concrete
usually has a pH between the ranges 11-13 [26]. Sometimes the pH goes down in
some harsh environments and makes way for the microorganisms to deteriorate the
concrete surface [27]. Due to environmental factors, hydrogen sulphide is formed in the
surface of the concrete by the reduction of sulphate. This hydrogen sulphide is oxidized
by the microorganisms thus leading to deterioration [28].

2.2. Nanotechnology:

Nanoparticles are more reactive than the bulk material due to their high surface to
volume ratio [29]. Advancement in nanotechnology has helped resolve many problems
involved in water quality by the production of nano absorbents, nanocatalysis and
filtration techniques enhanced by nanoparticles [30]. Nanotechnology in agriculture is
used for detection of diseases and other uses like enhancing the nutrient delivery as
well as nutrient absorption. Nanotechnology has also helped in increasing yield by
targeted pesticide delivery [31-34]. Nanoparticles exhibit various potential applications
in the pharma industry. They have the ability to interact with mucosal surfaces and also
can escape endolysosomal compartments [35]. Many nanoparticles are studied and
investigated for their antibacterial properties as well. [36]. Exposure to the human body,
or direct release into the environment, has stirred up debates which are still unresolved
due to possible toxicity as a result of high effectiveness [37].

2.2.1. Bio-Nanotechnology:

Bio-nanotechnology can be projected as nanotechnology through biotechnology.

Microbes are an ideal producer of a diversity of nanostructures due to their
physiological diversity, size, controllable culture conditions and genetic manipulability
[38]. Bacteria are a remarkable candidate for the production of nanoparticle as they
possess excellent capability for reduction of heavy metals. Some can also survive in
high metal ion concentrations [39, 40]. The bacteria contain a wide range of molecular
compounds and these compounds help in the synthesis of nanoparticles by reducing

3
the metallic ions [41, 42, 43]. Apart from gold, iron and silver nanoparticles, copper
nanoparticles stood out unique due to some of their properties like electrical, thermal
and magnetic. They also play an important role cosmetic production and in
pharmaceuticals [43, 44]. It has become a trend to use bacteria as a source of
nanoparticle production due to its efficient operational cost, competitiveness and of
course, its effectiveness [45]. Metallic nanoparticles synthesised by bacteria are mostly
during stationary phase. Since the metabolic stress is higher in the stationary phase
when compared to logarithmic phase, there is more synthesis of reducing metabolites in
the stationary phase. These metabolites thus reduce the metal ions and lead to the
formation of the nanoparticles [46, 47, 43].

2.3. Copper Nanoparticles:

Like all the other metallic nanoparticles, copper nanoparticles can be synthesised by
natural processes as well as chemical methodologies [48]. In Mesopotamia, during the
ninth century, copper nanoparticles were used to colour ceramics and glass and was
noted as one of the first ever uses of copper nanoparticles [49]. When compared to
commercial copper, copper nanoparticles exhibit unique properties like antifungal and
antibacterial activities. They also display catalytic activity. The catalytic activity can be
associated with the large catalytic area. Nanoparticles achieve a high reaction yield in a
small reaction time because of its small size and porous nature [50]. In a reaction where
iodobenzene was condensed, both copper nanoparticles and commercial copper was
used for comparison. Copper nanoparticles attained 88% of conversion whereas
commercial copper attained about 43% thereby proving the copper nanoparticle
efficiency [50]. Due to the catalytic ability of the copper nanoparticles, these
nanoparticles can be used in biosensors. Usually, bio-sensors require high energy
(overpotentials) and the redox reactions are irreversible. Copper nanoparticles have the
capability to reduce the amount of energy and all can reverse the redox reactions [51].

3. MATERIAL AND METHODS:

3.1. Reagents and Measurements:

All the reagents used in this project were provided by the School of Life Sciences, B.S
Abdur Rahman Crescent Institute of Science and Technology. The reagents were not
purified further and were used as received. For the exposure studies, bacterial colonies

4
were counted using Scan 100 manual colony counter. During DNA extraction and
amplification; Centrifuge 5810R was used for centrifugation, SUB15 standard
submarine gel system was used for gel electrophoresis, ChemiDoc MP system with red
module for viewing DNA bands and
Mastercycler nexus gradient for PCR. UV-Visible Spectroscopy analysis for
nanoparticles was carried out using Thermofisher evolution 201 between wavelengths
190-800 nm. SEM images of nanoparticles were obtained with a JEOL Model JSM -
6390LV whereas TEM images were obtained with Jeol/JEM 2100 HRTEM. XRD
analysis was carried out using an SC-70 detector.

3.2. Sample Collection:

ICAR-CIBA is a research institute dealing with brackishwater aquaculture. It has an

experimental field station in Muttukadu, roughly 30 km from the south of Chennai. The
samples for this study were collected from this field station. Visible corrosion could be
noticed in the buildings, tanks and machineries present there. Scraps from rocks and
rust from machines used in the institute were scraped and put in 15 ml sterile falcon
tubes. These were taken back to the lab, maintained in 4 ⁰C.

3.3. Isolation and Identification:

3.3.1. Pour Plate technique:

Pour plate method was used for the isolation of bacteria from the samples. LB Agar was
used in this method. The media was prepared by dissolving 2g of LB Agar in 50 ml of
distilled water and autoclaved at 121 ⁰C for 15 minutes. 1g of sample was dissolved in
10 ml distilled water and was then serially diluted. 1ml of this serially diluted sample
was placed in a sterile petri dish using a sterile pipette. The cooled media was then
poured into the petri dish carefully and was mixed well. Inversion of the plate was done
after the solidification of the agar and was left for overnight incubation at 37 ⁰C.

3.3.2. Streak Plate technique:

After overnight incubation of the pour plate, the pour plate was observed. The main
objective of using this method was to isolate a pure strain from a mixed bacterial
population. First, a sterile petri dish was taken and autoclaved LB Agar prepared for the
pour plate technique was poured into it. It was let to solidify. An inoculation loop was

5
taken and was sterilized using a burner by heating the loop until red. It was allowed to
cool and a colony was picked from the pour plate. The inoculum was streaked over the
petri dish over a quarter of it in a back and forth motion. The streaks were extended in
the second and third quarter of the petri dish. From the third quarter, the streaks were
extended to the centre of the petri dish. The streak plate was incubated overnight at 37
⁰C.

3.3.3. Preparation of Bacterial Culture:

The streak plates were observed after overnight incubation. Colonies from the streak
plates were selected for bacterial culture preparation. For the culture preparation, LB
Broth was used. LB Broth was prepared by dissolving 2.5 g of LB Both in 100 ml
distilled water. The prepared media was autoclaved at 121 ⁰C for 15 minutes. After
cooling, 10 ml of LB broth was poured into a sterile test tube. A sterile inoculation loop
was used to pick a single colony from the streak plate. The inoculum was then
inoculated into the test tube containing LB Broth. This was left for overnight shaking at
37 ⁰C.

3.3.4. DNA Extraction:

DNA was extracted from the bacterial cultures using Phenol-Chloroform method, which
is a liquid-liquid extraction. This extraction is a process that separates molecular
mixtures based on solubilities of the molecules individually, in two different immiscible
liquids [52].

3.3.4.1. Preparation of Reagents:

1). NaCl buffer (pH 8):

NaCl buffer was prepared by mixing 0.876 g of 150 mM NaCl, 3.72 g of 100 mM EDTA
and 0.121 g of 10 mM Tris base in 100 ml distilled water.

2). TE buffer (pH 8):

TE buffer was prepared by adding 1.21 g of 10 mM Tris base and 0.372 g of 1 mM

EDTA in 1000 ml of distilled water.

3). 10% SDS:

6
1.4 mg of SDS was mixed in 10 ml of distilled water. 1 ml of this was taken and mixed
with 9 ml distilled water.

4). Phenol-chloroform mixture (1:1):

2 ml of phenol and 2ml of chloroform were mixed.

5). 95% Ethanol:

9.5 ml was mixed in 0.5 ml distilled water.

6). 90% Ethanol:

9 ml was mixed in 1 ml distilled water.

7). 75% Ethanol:

7.5 ml was mixed in 2.5 ml distilled water.

3.3.4.2. Isolation of DNA:

2 ml of bacterial culture was pipetted out from the test tube containing bacterial culture
and filled in a sterile 2 ml centrifuge vial. Sterile tips were used throughout the process.
The sample was centrifuged using a tabletop centrifuge for 10 minutes at 10,000 r.p.m.
The supernatant was discarded and the pellet was transferred to a 15 ml falcon tube. 2
ml of NaCl buffer was added to the pellet followed by 250 µl of 10% SDS. It was mixed
well and was incubated in a hot water bath for at 60 ⁰C for 15 minutes. After the
incubation period, it was let to cool down until it reached room temperature. Next, 1000
µl of the 1:1 phenol-chloroform mixture was added followed by 500 µl of chloroform.
The contents were centrifuged using a refrigerated centrifuge at 10,000 r.p.m for 5
minutes, maintained at 4 ⁰C. After centrifugation, there was a formation of three phases.
The first phase was transferred to a sterile 15 ml falcon tube. An equal amount of 95%
ice-cold ethanol was added to the falcon tube. The tube was then slowly inverted and
mixed gently until the precipitation of DNA was seen. Next, the tube was incubated in -
20 ⁰C for 30 minutes. After 30 minutes incubation, the falcon tube was again centrifuged
for 5 minutes at 10,000 r.p.m. The supernatant after centrifugation was discarded and 1
ml of 90% ethanol was added carefully to the pellet without shaking the falcon tube.
After 5 minutes, the ethanol was pipetted and discarded. This was followed by the
addition of 1 ml of 75% ethanol which was also carefully pipetted and discarded after 5

7
minutes. After this ethanol wash, the pellet was dried in a laminar air flow for 15
minutes. The pellet was then mixed with 50 µl TE buffer. The extracted DNA was mixed
with distilled water and stored at -80 ⁰C.

3.3.5. DNA Amplification:

PCR amplification of 16s rRNA was carried out , using the isolated genomic DNA as a
template. The total volume of the reaction mixture was 25 μl, containing 12.5 μl of Red
dye master-mix, 1 μl of 27F primer, 1 μl of 1492R primer, 5.5 μl of autoclaved distilled
water and 5 μl of DNA. The amplification reaction was performed in a MasterCycler that
was programmed as follows: initial denaturation at 95ºC for 5 minutes; 30 cycles of
denaturation of 94ºC for 30 sec, annealing at 56ºC for 30 sec, extension at 72ºC for 2
minutes and the final extension at 72ºC for 7 minutes. The PCR products were stored at
−80ºC for further use. The amplified products were quantified in 1% agarose gel
electrophoresis. PCR product (10 µl) and 4 µl loading dye were loaded along with 5 μl
of 1 kb ladder into the separate wells. The gel was run at 100 volts for 1 hour.

3.3.6. DNA Sequencing:

16s rRNA sequencing of the genomic DNA was done by Agrigenome, Smart City Kochi,
Infopark Road, Kakkanad, Kerala. The obtained sequence was run in BLAST tool for
identification of bacteria.

3.4. Corrosion studies:

Different combinations of Pozzolanic Portland Cement (PPC) and Portland Slag

Cement (PSC) were used for the corrosion studies. The different combinations of PPC
were PPC-Control, PPC-WP and PPC-786 whereas the different combinations of PSC
were PSC-Control and PSC-SN. LB Broth was prepared by dissolving 2.5 g of LB Broth
powder in 100 ml distilled water and was autoclaved at 121 ⁰C for 15 minutes. Five
sterile 50 ml falcon tubes were filled with 30 ml of cooled LB Broth each. Bacterial
colony from the streak plate was inoculated into all the five tubes using an inoculation
loop under sterile conditions. The falcon tubes were then left for overnight shaking at 37
⁰C. After overnight shaking, the falcon tubes exhibited a turbid appearance, depicting
the growth of the bacteria. The five cement combinations were inoculated in each of
these five falcon tubes and were again left for shaking at 37 ⁰C for 6 days. During the

8
shaking period, the cement samples were taken every 36 hours for determining the
Total Viable Count (TVC).

3.4.1. Total Viable Count (TVC)

LB Agar was prepared by dissolving 2 g LB Agar powder in 50 ml distilled water. This

was autoclaved at 121 ⁰C for 15 minutes. 1 g of the cement sample was taken and
dissolved in 10 ml distilled. This was serially diluted to 10-6 dilution. 0. 1 ml of this
serially diluted sample was pipetted using a sterile pipette and placed in a sterile petri
dish. Cooled agar was then poured over it and mixed well. The petri dish was left for 48
hour incubation at 37 ⁰C. After the incubation period, the petri dish was observed using
a colony counter for determining the number of bacterial colonies or Colony forming
units (CFU). From this, average bacterial per ml of serially diluted bacteria was
determined. This process was repeated once in every 36 hours for 6 days.

𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑐𝑜𝑙𝑜𝑛𝑦 𝑓𝑜𝑟𝑚𝑖𝑛𝑔 𝑢𝑖𝑡𝑠

The average bacteria/ml = 𝑉𝑜𝑙𝑢𝑚𝑒 𝑜𝑓 𝑠𝑒𝑟𝑖𝑎𝑙𝑙𝑦 𝑑𝑖𝑙𝑢𝑡𝑒𝑑 𝑠𝑢𝑠𝑝𝑒𝑛𝑠𝑖𝑜𝑛 𝑥 𝐷𝑖𝑙𝑢𝑡𝑖𝑜𝑛 𝑓𝑎𝑐𝑡𝑜𝑟

3.5. Nanoparticle Production:

Copper nanoparticles were synthesised from the isolated bacteria using CuSO 4.

3.5.1. Culture Preparation:

100 ml of LB Broth was prepared by dissolving 2.5 g in 100 ml of distilled water. The
media was autoclaved at 121 ⁰C for 15 minutes. Under aseptic conditions, bacterial
colonies from the streak plate were selected and inoculated using an inoculation loop
into a sterile test tube containing 10 ml of the prepared LB Broth. This was left for
overnight shaking at 37 ⁰C.

3.5.2. Synthesis of Copper Nanoparticles:

0.79 g copper sulphate was mixed in 1000 ml distilled water to prepare 5 mM copper
sulphate solution. The prepared copper sulphate was added to the bacterial culture and
kept for 72 hours shaking to form a green colour. Centrifugation at 5000 rpm for 8
minutes was carried out after the shaking period. Further, the supernatant was collected
for analysis of copper nanoparticles.

3.5.3. Mechanism of Copper Nanoparticle Formation:

9
The formation of nanoparticles vary from organism to organism i.e., different
microorganisms have different mechanisms for nanoparticle formation. The general
mechanism by which the nanoparticles are synthesized is that; environmental ions
accumulate on the surface of the microbial cells or inside them so as to reduce the
metal ions to nano-sized particles, defined as nanoparticles. These reactions are
carried out with the presence of a few enzymes. These enzymes are generated by the
various cellular activities. The ions and cell walls which are negatively charged generate
an electrostatic force between them that reduce the metal ions which further go through
reduction and accumulate as nanoparticles.

3.6. Nanoparticle Characterization:

The synthesised nanoparticles were characterized by techniques like UV-Visible

Spectroscopy, X-Ray Diffraction Analysis, Scanning Electron Microscope (SEM) and
Transmission Electron Microscope (TEM).

3.6.1. UV-Visible Spectra Analysis:

Different salts give characteristic peaks at different absorptions, using UV-visible

spectroscopy, thus confirming the synthesis of nanoparticles. Copper nanoparticles
generally show characteristic absorption peaks at the range of 200-800 nm [15]. UV-
Visible readings were taken from wavelengths 190-800 nm. UV- Visible Analysis was
carried out in Royal Bioresearch Centre, Velachery, Chennai, Tamil Nadu.

3.6.2. X-Ray Diffraction Analysis:

This technique was used to confirm the metallic nature of the nanoparticles. Information
on shape of the unit cell from peak positions and translational symmetry size were
acquired. Further, information on electron density within the unit cell is also known [16].
Size of the crystal is calculated using Scherrer equation, CS= Kλ /β cosθ. XRD Analysis
was carried out in Royal Bioresearch Centre, Velachery, Chennai, Tamil Nadu.

3.6.3. Scanning Electron Microscopy:

The nanoparticles suspension was dried and subjected to SEM for obtaining SEM
images. SEM was carried out in Sophisticated Analytical Instruments Facility, STIC,
Kochi, Kerala.

10
3.6.4. Transmission Electron Microscopy:

Copper nanoparticle suspension was transferred to a carbon-coated grid. It was then

dried and was sent for obtaining TEM images. The TEM analysis was carried out in
Sophisticated Analytical Instruments Facility, STIC, Kochi, Kerala.

3.7. Antibacterial Activity:

Antibacterial activity of the synthesised copper nanoparticles was tested using Zone Of
Inhibition (ZOI) Test. Further, Minimum Inhibitory Concentration and the Minimum
Bacterial Concentrations were also determined by carrying out MIC and MBC assays
respectively.

3.7.1. Zone Of Inhibition Test:

Pure cultures of E.Coli, Klebsiella, Staphylococcus aureus and Pseudomonas

aeruginosa were prepared using streak plate method. Subcultures were prepared in LB
Broth from each pure culture under aseptic conditions and were left for overnight
shaking at 37 ⁰C. After shaking period, using a sterile swab, subculture suspension of
E. Coli was spread evenly over the surface of a sterile agar petri dish. Using a sterile 1
ml pipette tip, a well was made in the centre of one petri dish. Surrounding this well,
four other wells were made. 10 mg of Ampicillin was added to 1 ml DMSO. 100 µl of this
was filled into the middle well. The copper nanoparticles were brought to a suspension
by adding 10 mg of it to 1 ml DMSO. The other four wells were filled with 100 µl of
100g/L copper nanoparticles, 100 µl of 50g/L copper nanoparticles, 100 µl of 5mM
copper sulphate and 100 µl of Serratia marcescens culture. This method was done with
the other three bacterial suspensions as well. All four Petri dishes were then incubated
overnight at 37 ⁰C. After incubation period, the zones were measured.

3.7.2. Minimum Inhibitory Concentration Assay:

A 96 well plate was used for carrying out this assay. A typical well plate consists of 12
columns labelled from 1-12 and 8 rows, labelled from A-H.100 µl of autoclaved LB Broth
was filled in 8 columns and 8 rows of a 96 well plate. Copper nanoparticles were
brought to a suspension by adding 10 mg of copper nanoparticle in 1 ml of DMSO.
Ampicillin was also brought to a liquid form by adding 10 mg of it to 1 ml DMSO. In
wells A1, B1, C1 and D1, 100 µl of copper nanoparticles was added in each. In wells

11
E1, F1, G1 and H1, 100 µl of ampicillin was added in each well. The contents in each
well were mixed well sterile pipette tips. Serial dilution was done in each column for 100
µl. 100 µl from the last wells were discarded. 10 µl of E.Coli culture was added to all
wells in columns A and E. 10 µl of Klebsiella culture was added to all wells in columns B
and F. 10 µl of Staphylococcus aureus culture was added in all wells in columns C and
G. Lastly 10 µl of Pseudomonas aeruginosa culture was added to all wells in columns D
and H. The 96 well plate was left for overnight incubation at 37 ⁰C.

3.7.3. Minimum Bacterial Concentration Assay:

For each test organism, separate Petri dishes were used for determining the MBC. The
petri dish was divided into two halves, one half for the nanoparticles and the other for
the antibiotic. Eight equal divisions were made on the petri dish and were labelled A-H
on both halves. LB Agar was prepared and autoclaved and let to cool. After cooling, it
was poured on the petri dish and was allowed to solidify. 5 µl from the A1 well of the
MIC well plate was taken and two dots of this was put on the first division of the first
half. Then 5 µl of A2 was taken and two dots were put on the second division of the first
half. This was repeated for the other divisions in the first half. Next, 5 µl from E1 was
taken and two dots were placed on the first division of the second half. 5 µl was taken
from E2 and two dots were placed on the second division and so on. This process was
used for all test organisms, thus ending with four Petri dishes. The Petri dishes were left
for overnight incubation at 37 ⁰C.

4. RESULTS AND DISCUSSIONS:

4.1. Pour plate and Streak plate of the bacteria:

12
 Figure 4.1.1. Pour plate of the bacteria

Figure 4.1.2. Streak plate of the bacteria

4.2. DNA Sequencing:

The genomic sequence obtained after sequencing was

13
TCGAGCGGTAGCACAGGGGAGCTTGCTCCCCGGGTGACGAGCGGCGGACGGGT
GAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGC
TAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCAT
CAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAGGCGA
CGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTC
CAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTG
ATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGC
GAGGAGGAAGGTGGTGAACTTAATACGTTCATCAATTGACGTTACTCGCAGAAGAA
GCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTA
ATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAA
ATCCCCGGGCTCAACCTGGGAACTGCATTTGAAACTGGCAAGCTAGAGTCTCGTA
GAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAAT
ACCGGTGGCGAAGGCGGCCCCCTGGACGAAGACTGACGCTCAGGTGCGAAAGC
GTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGTCGA
TTTGGAGGTTGTGCCCTTGAGGCGTGACTTCCGGAGCTAACGCGTTAAATCGACC
GCCTGGGGAGTACGGGCCGCA

The sequence was run in BLASTn for identification of the bacteria.

14
Figure 4.2.1 Graphical summary of BLASTn

15
 Figure 4.2.2. Sequences producing significant alignments

The bacterium was identified to be Serratia marcescens.

Serratia marcescens is a rod-shaped gram-negative bacteria, belonging to the family

Enterobacteriaceae. It is present commonly in the environment and due to its
preference for damp conditions, it is found abundantly in bathrooms and marine
environments.

4.3. Corrosion studies:

Figure 4.3.1 shows the different types of cement namely, PPC-Control, PPC-WP, PPC-
786, PSC-Control, and PSC-SN.

Figure 4.3.2 shows the cement inoculated in bacterial culture. The inoculation process
was carried out for 144 hours in which the cement samples were tested every 36 hours
for TVC.

Table 4.3.1. shows the TVC value of the cement samples every 36 hours for 6 days.

16
 Figure 4.3.1. Different types of Cement

Figure 4.3.2. Cement inoculated in bacterial culture

17
 Table 4.3.1. TVC Value of cement every 36 hours

Number of colony Average bacteria

Number of hours Type of Cement forming units per ml of 1x10-6
sample (cfu) dilution

PPC-Control 48 480x106

PPC-WP 55 550x106
36
PPC-786 32 320x106

PSC-Control 60 600x106

PSC-SN 42 420x106

PPC-Control 70 700x106

PPC-WP 79 790x106
72
PPC-786 58 580x106

PSC-Control 87 870x106

PSC-SN 85 850x106

PPC-Control 95 950x106

PPC-WP 99 990x106
108
PPC-786 86 860x106

18
 PSC-Control 130 1300x106

PSC-SN 169 1690x106

PPC-Control 200 2000x106

PPC-WP 180 1800x106

144
PPC-786 125 1250x106

PSC-Control 167 1670x106

PSC-SN 230 2300x106

According to the TVC results, at the end of 144 hours, the bacterial count per ml in
PSC-SN and PPC-Control were the highest with very little difference whereas the
bacterial count per ml PPC-786 was the least.

4.4. Synthesis of Nanoparticles:

The first confirmation of the synthesis of the nanoparticles was by the color change. A
green color was witnessed in the culture suspension as shown in Figure 4.4.1.

19
 Figure 4.4.1 Colour change depicting nanoparticle formation

4.5. Characterization of Nanoparticles:

The synthesized copper nanoparticles were characterized using UV-Visible

Spectroscopy, XRD and microscopic techniques like SEM and TEM.

4.5.1. Uv-Visible Spectroscopy:

Absorbance values were taken for wavelengths ranging from 190-800 nm.

Table 4.5.1.1 gives the absorbance values for wavelengths 800, 700, 600, 500, 400,
300 and 200 nm.

Figure 4.5.1.1 shows UV-Visible spectroscopy graph. Here, the nanoparticles show
absorption peak at the range of 200-250 nm.

20
Table 4.5.1.1. Absorbance values using UV spectroscopy

Wavelength (nm) Absorbance

800.00 0.176344

700.00 0.262656

600.00 0.338430

500.00 0.495019

400.00 0.858883

300.00 1.932201

200.00 3.884377

Figure 4.5.1.1. UV-Visible graph of the nanoparticles

21
4.5.2. XRD Analysis:

The XRD pattern of the sample is depicted in Figure 4.5.2.1. The crystallite size was
found by applying Scherrer's equation. The presence of diffraction peaks indicates that
these are crystalline in nature.

Figure 4.5.2.1. XRD graph of the nanoparticles

1000
Intensity (counts)

500

0
20 40 60 80
2-theta (deg)

4.5.3. Scanning Electron Microscopy:

Figure 4.5.3.1. shows the SEM analysis of the synthesized nanoparticles. SEM sheds
light on the topography, morphology, composition and the crystalline structure of the
particles.

Figure 4.5.3.1. SEM image of the nanoparticles

22
4.5.4. Transmission Electron Microscopy:

For the confirmation of the spectra analysis findings and to identify the presence of
copper nanoparticle structure, HRTEM analysis was also performed. Typical HRTEM
images of the synthesized copper nanoparticles are seen in Figure 4.5.4.1.

Figure 4.5.4.1. TEM image of nanoparticles

4.6. Antibacterial activity:

Four test organisms were used to determine the antibacterial properties. Ampicillin was
the antibiotic used.

Table 4.6.1. shows the result of the zone of inhibition test.

Table 4.6.2. shows the result for MIC assay.

Table 4.6.3. shows the result for MBC assay.

23
 Table 4.6.1. Zone of Inhibition Test using Ampicillin as antibiotic

Zone of Inhibition (in mm)

100 µl 50 µl
Test organisms Ampicillin copper copper Serratia 5mM
nanoparticles nanoparticles marcescens CuSO4

E.Coli 4 11 10 8 3.8

Klebsiella 5 17 12 6 5

Staphylococcus 6 20 16 8.5 7
aureus

Pseudomonas 4.5 16 11 7.4 6.5

aeruginosa

Highest ZOI of 100 µl copper nanoparticles was shown against Staphylococcus aureus
and the lowest was against E.Coli.

Similarly, for 50 µl copper nanoparticles, highest ZOI was also against Staphylococcus
aureus whereas the lowest was against Pseudomonas aeruginosa.

24
 Table 4.6.2. Minimum Inhibitory Concentration Assay

MIC

Bacterial strain Cu NPs Control

(Ampicillin)

0.24
E.Coli 0.017543

Klebsiella 0.05436 0.25

Staphylococcus aureus 0.03578 0.126

Pseudomonas aeruginosa 0.00653 0.25

The least MIC was seen in Pseudomonas aeruginosa with a value of 0.00653.

25
 Table 4.6.3. Minimum Bacterial Concentration Assay

MBC

Bacterial strain Cu NPs Control

(Ampicillin)

E.Coli 0.02194 1

Klebsiella 0.0625 0.9

Staphylococcus aureus 0.0457 1.2

Pseudomonas aeruginosa 0.0745 1

The least MBC was seen for E.Coli with a value of 0.02194.

5. CONCLUSION AND FURTHER SCOPE:

Bio-based processes are still in the improvement ranges, and balance and aggregation
of the biosynthesized NPs, control of crystal increase, form, length, and length
distribution are the most important experienced issues. Copper nanoparticles are
synthesized by Serratia marcescens when copper sulfate is added to it. The technique
used here for the copper nanoparticle synthesis is simple and environmentally benign.

The synthesized nanoparticles can be used during the manufacturing of cement, as

they may act as vaccines and resist or reduce the bacteria from attacking the
structures.

26
REFERENCES:

[1] M. Sastry, A. Ahmad, M. Islam Khan, and R. Kumar, “Biosynthesis of metal

nanoparticles using fungi and actinomycete,” Current Science, vol. 85, no. 2, pp. 162–
170, 2003.

[2] S. Iravani, “Green synthesis of metal nanoparticles using plants,” Green Chemistry,
vol. 13, no. 10, pp. 2638–2650, 2011.

[3] S. Iravani, H. Korbekandi, S. V. Mirmohammadi, and H. Mekanik, “Plants in

nanoparticle synthesis,” Reviews in Advanced Sciences and Engineering, vol. 3, no. 3,
pp. 261–274, 2014.

[4] S. Iravani and B. Zolfaghari, “Green synthesis of silver nanoparticles using Pinus
eldarica bark extract,” Biomed Research International, vol. 2013, Article ID 639725, 5
pages, 2013.

[5] H. Korbekandi, Z. Ashari, S. Iravani, and S. Abbasi, “Optimization of biological

synthesis of silver nanoparticles using Fusarium oxysporum,” Iranian Journal of
Pharmaceutical Research, vol. 12, no. 3, pp. 289–298, 2013.

[6] H. Korbekandi and S. Iravani, “Biological synthesis of nanoparticles using algae,”

in Green Biosynthesis of Nanoparticles: Mechanisms and Applications, M. Rai and C.
Posten, Eds., pp. 53–60, CABI, Wallingford, UK, 2013.

[7] H. Korbekandi, S. Iravani, and S. Abbasi, “Production of nanoparticles using

organisms,” Critical Reviews in Biotechnology, vol. 29, no. 4, pp. 279–306, 2009

[8] H. Korbekandi, S. Iravani, and S. Abbasi, “Optimization of biological synthesis of

silver nanoparticles using Lactobacillus casei subsp. casei,” Journal of Chemical
Technology & Biotechnology, vol. 87, no. 7, pp. 932–937, 2012

27
[9] D. Bhattacharya and R. K. Gupta, “Nanotechnology and potential of
microorganisms,” Critical Reviews in Biotechnology, vol. 25, no. 4, pp. 199–204, 2005

[10] D. Goodsell, Bionanotechnology: Lessons from Nature, Willey-Less, New Jersey,

NJ, USA, 2004.

[11] R. Paull, J. Wolfe, P. Hébert, and M. Sinkula, “Investing in

nanotechnology,” Nature Biotechnology, vol. 21, no. 10, pp. 1144–1147, 2003.

[12] O. V. Salata, “Applications of nanoparticles in biology and medicine,” Journal of

Nanobiotechnology, vol. 2, no. 1, article 3, 2004

[13] M. Sastry, A. Ahmad, M.I. Khan and R. Kumar, Microbial Nanoparticle Production,
In: Niemeyer CM, Mirkin CA (eds) Nanobiotechnology. Wiley-VCH, Weinheim,
Germany, 2004, 126-135.

[14] Clardy J, Fischbach MA, Currie CR (2009). The natural history of antibiotics. Curr
Biol 19: 437-441.

[15] Parikh P, Zala D, Makwana BA (2014) Biosynthesis of Copper Nanoparticles and

Нeir Antimicrobial Activity. OALib 01: 1-15.

[16] Hajipour MJ, Fromm KM, Ashkarran AA, de Aberasturi DJ, de Larramendi IR, et al.
(2012) Antibacterial properties of nanoparticles. Trends Biotechnol 30: 499-511

[17] Usman MS, El Zowalaty ME, Shameli K, Zainuddin N, Salama M, et al. (2013)
Synthesis, characterization, and antimicrobial properties of copper nanoparticles. Int J
Nanomedicine 8: 4467-4479.

[18] Gunawan C, Teoh WY, Marquis CP, Amal R 2011 ACS Nano 5 7214-7225

[19]. 5a‫ ٹ‬M, Mehrwan S, Bhatti TM, Akhter JI, Hameed A, et al. (2010) Investigations
into the antibacterial behavior of copper nanoparticles against Escherichia coli. Ann
Microbiol 60: 75-80.

[20]. Ruparelia JP, Chatterjee AK, Duttagupta SP, Mukherji S (2008) Strain specificity in
antimicrobial activity of silver and copper nanoparticles. Acta Biomater 4: 707-716.

28
[21]. Yoon KY, Hoon Byeon J, Park JH, Hwang J (2007) Susceptibility constants of
Escherichia coli and Bacillus subtilis to silver and copper nanoparticles. Sci Total
Environ 373: 572-575

[22] Rose AH. Economic Microbiology. Vol. 6. Academic Press; London: 1981.
Microbial Biodeterioration; pp. 35–80.
[23] DECHEMA, Mikrobiologische Materialzerstörung und Materialschutz, DECHEMA-
Studies (1989) 1–165.
[24]Bock, E., Biologisch induzierte Korrosion von Naturstein-starker Befall mit
Nirifikanten. Bautenschutz Bausanierung10 (1987) 24–27.

[25] Bock, E., and Krumbein, W. E., Aktivitäten von Mikroorganismen und mögliche
Folgen für Gestein von Baudenkmälern, 2. Sonderheft Bautenschutz Bausanierung:
Bausubstanzerhaltung in der Denkmalpflege (1989) 34–37.

[26] Lea, F.M., The Chemistry of Cement and Concrete. 3rd edition Edward Arnold Ltd.,
London United Kingdom. 1970.

[27] Schremmer, H, Die Schwefelwasserstoff-Korrosion in Abwasseranlagen.

Tiefbau, Ingenieurbau, Strassenbau. 1980. 22:786796.

[28] Lea, FM, and Desch, CH, The Cement, and Concrete. Edward Arnold Ltd.,
London United Kingdom. 1936. 33.

[29] G.A. Ozin, A.C. Arsenault, L. Cademartiri Nanochemistry: a chemical approach to

nanomaterials R. Soc. Chem. (2009)

[30] Diallo, M.S., Savage N, Diallo M S (2005). J. Nanomaterials and water purification
opportunities and challenges. Nanopart. Res. 7:331 – 342

[31] C.R. Chinnamuthu and P. Murugesa Boopathi, Nanotechnology and

Agroecosystem,‖Madras Agric. J., 96(1-6), 2009, 17-31.

[32] Zenu Jha, Neha Behar, Shiv Narayan Sharma, G. Chandel, D. K. Sharma and M.P.
Pandey, Nanotechnology: Prospects of Agricultural Advancement, Nano Vision,
1(2),2011, 88-100.

29
[33] Chittaranjan Kole, Phullara Kole, K Manoj Randunu, Poonam Choudhary,
Ramakrishna Podila, Pu Chun Ke, Apparao M Rao, and Richard K Marcus, (Momordica
charantia), BMC Biotechnology, 13(37),2013, 1-10.

[34] Manzer H. Siddiqui and Mohamed H. Al-Whaibi, Role of nano-SiO2 in germination

of tomato (Lycopersicum esculentum seeds Mill.), Saudi Journal of Biological Sciences,
21(1),2014, 13-17

[35] Hallaj-Nezhadi S, Dass CR, /otfipour F (2013) Intraperitoneal delivery of

nanoparticles for cancer gene therapy. Future Oncol 9: 59-68

[36] R. García-Contreras, L. Argueta-Figueroa, C.Mejía-Rubalcava, R. Jiménez-

Martínez, S.Cuevas-Guajardo, P.A. Sánchez-Reyna, H.Mendieta-Zerón Int. Dent. J.

[37] Sanvicens N, Marco MP: Multifunctional nanoparticles--properties and prospects

for their use in human medicine. Trends Biotechnol. 2008, 26: 425-433.
10.1016/j.tibtech.2008.04.005.

[38] Sarikaya M, Tamerler C, Jen AK, Schulten K, Baneyx F: Molecular biomimetics:

nanotechnology through biology. Nat Mater. 2003, 2: 577-585. 10.1038/nmat964.

[39] C. Haefeli, C. Franklin, and K. Hardy, “Plasmid-determined silver resistance in

Pseudomonas stutzeri isolated from a silver mine,” Journal of Bacteriology, vol. 158, no.
1, pp. 389–392, 1984.

[40] Y. Konishi, K. Ohno, N. Saitoh et al., “Bioreductive deposition of platinum

nanoparticles on the bacterium Shewanella algae,” Journal of Biotechnology, vol. 128,
no. 3, pp. 648–653, 2007.

[41] Singh, V., Patil, R., Ananda, A., Milani P., Gade. W. (2010) ‘Biological synthesis of
copper oxide nanoparticles using Escherichia coli', Current Nanoscience, vol. 6, pp.
365-369. 33.

[42] Singh, O.V. (2015) Bio-nanoparticles: Biosynthesis and sustainable

biotechnological implications, USA: Wiley-Blackwell. ISBN: 978-1-118-67768-1: pp.
155- 186. 34.

30
[43] Shobha, G., Moses, V., Ananda, S. (2014) ‘Biological synthesis of copper
nanoparticles and its impact – a review’, International Journal of Pharmaceutical
Science Invention, vol. 3, August, pp. 28-38.

[44] Shankar, P.D., Shobana, S., Karuppusamy, I., Pugazhendhi, I., Ramkumar, V.S.,
Arvindnarayan, S., Kumar, G. (2016) ‘A review on the biosynthesis of metallic
nanoparticles (gold and silver) using biocomponents of microalgae: Formation
mechanism and applications’

[45] Salvadori, M.R., Ando, R.A., Nascimento, C.A.O., Corrêa, B. (2014) ‘Intracellular
biosynthesis and removal of copper nanoparticles by dead biomass of yeast isolated
from the wastewater of a mine in the Brazilian Amazonia’, PLOS ONE, vol 9, issue 1,
e87968.

[46] Hasan, S.S., Singh, S., Parikh, R.Y., Dharne, M.S., Patole, M.S., Prasad, B.L.V.,
Shouche, Y.S. (2007) ‘Bacterial synthesis of copper/copper oxide nanoparticles’,
Journal of Nanoscience and Nanotechnology, vol. 8, June, pp. 1-6

[47] Ammar, S.H. (2016) ‘Cultivation of microalgae Chlorella vulgaris in airlift

photobioreactor for biomass production using commercial NPK nutrients’, Engineering
Journal, vol. 12, pp. 90-99

[48] Heiligtag, Florian J.; Niederberger, Markus (2013). "The fascinating world of
nanoparticle research". Materials Today. 16 (7–8): 262–271.

[49] Khan, F.A. Biotechnology Fundamentals; CRC Press; Boca Raton, 2011

[50] Dhas, N. A.; Raj, C. P.; Gedanken, A. (1998). "Synthesis, Characterization, and
Properties of Metallic Copper Nanoparticles". Chem. Mater. 10: 1446–1452.

[51] Luo, X.; Morrin, A.; Killard, A. J.; Smyth, M. R. (2006). "Application of Nanoparticles
in Electrochemical Sensors and Biosensors". Electroanalysis. 18: 319–326.

[52] Stenesh J. Dictionary of Biochemistry and Molecular Biology. 2nd edition. New
York: John Wiley & Sons; 1989

31
 TECHNICAL BIOGRAPHY

Ms. Naheetha Fathima Raja Mohamed (140151601026) was born on 24th September
1996, Tirunelveli. She finished her schooling in M.E.S Indian School, Doha-Qatar and
secured 77.4% in All India Senior School Certificate Examination. She is pursuing her
B.Tech Degree in Biotechnology from B. S. Abdur Rahman Crescent Institute of
Science and Technology, Chennai. Her areas of interests include Bio-Nanotechnology,
Food Science, Pharmaceutical Biotechnology.

E-mail ID: naheetha24@gmail.com

Contact number: +91 8220060775

32