Thesis Final

A STUDY ON THE ROLE OF FEW COMPONENTS OF THE NEUROTROPHIN
SIGNALING PATHWAY AND ANTIOXIDANTS IN MAJOR

DEPRESSION AND ITS TREATMENT
Thesis submitted to the Bharathiar University in partial fulfillment of the

requirements for the award of the degree of
Doctor of Philosophy
in
Biochemistry
By
ANUBHAMA K V
2009PR114
Supervisor
Dr. D. VICTOR AROKIA DOSS
Since 1947
Department of Biochemistry
PSG COLLEGE OF ARTS & SCIENCE

College with Potential for Excellence (Status awarded by UGC)
An Autonomous College Affiliated to Bharathiar University
Reaccredited at A+ grade by NAAC
An ISO 9001:2000 certified Institution
Coimbatore - 641014
October 2015
CERTIFICATE
This is to certify that the thesis, entitled “A Study on the Role of few
Components of the Neurotrophin Signaling Pathway and Antioxidants in Major
Depression and its Treatment” submitted to the Bharathiar University, in partial
fulfilment of the requirements for the award of the Degree of Doctor of Philosophy in
Biochemistry is a record of original research work done by ANUBHAMA K V
during the period between October 2009 to October 2015 of her research in the
Department of Biochemistry at PSG College of Arts & Science, Coimbatore - 641
014, under my supervision and guidance and the thesis has not formed the basis for the
award of any Degree / Diploma / Associateship / Fellowship or other similar title to any
candidate of any University.
Counter signed Signature of the Guide
----------------------------------- ------------------------------------------
Dr. R. RAJENDRAN Dr. D. VICTOR AROKIA DOSS

Principal Associate Professor
DECLARATION
I, ANUBHAMA K V hereby declare that the thesis, entitled “A Study on the
Role of few Components of the Neurotrophin Signaling Pathway and Antioxidants
in Major Depression and its Treatment” submitted to the Bharathiar University,
in partial fulfillment of the requirements for the award of the Degree of Doctor of
Philosophy in Biochemistry is a record of original and independent research work
done by me during October 2009 to October 2015 under the supervision and
guidance of Dr. D. VICTOR AROKIA DOSS, Associate Professor, Department
of Biochemistry, PSG College of Arts & Science, Coimbatore - 641014, and it has not
formed the basis for the award of any Degree / Diploma / Associateship / Fellowship or
other similar title to any candidate of any university.
Counter signed Signature of the Student
----------------------------------------- -------------------------------------
Dr. D BRINDHA ANUBHAMA K V
Head of the Department
ACKNOWLEDGEMENT
I wish to place on record my sincere and most grateful thanks to

Dr. Victor Arokia Doss, MSc., MPhil., Ph.D., Associate Professor of Biochemistry,
PSG College of Arts and Science (Autonomous), Coimbatore - 641 014, for his able
guidance, valuable suggestions, objective criticism, fair comments and kind help in the
completion of the thesis.
I express my deep sense of gratitude to Shri. L. Gopalakrishnan, Managing

Trustee, PSG & Sons Charities, Dr. R. Rajendran, Principal, PSG College of Arts and
Science (Autonomous), Coimbatore - 641 014 for providing me with all the facilities to
carry out this research work successfully.
I am equally grateful to Dr. Ramalingam Sankaran, MD, Principal,

Dr. G. Raghuthaman, DPM, MD, DNB, Professor and Head, Department of
Psychiatry and Dr. Sudha Ramalingam, MD, Assistant Professor, Department of
Community Medicine, PSG Institute of Medical Sciences and Research,
Coimbatore – 641004 for extending their ready help and encouragement in the pursuit
of my research.
I am extremely grateful to Dr. Thiagarajan Sairam, PhD, Assistant Professor

(Research), Ms. Meenu, Ms. Brindha and Ms. Deepa, PSG Centre for Molecular
Medicine and Therapeutics for sharing their technical expertise, their constant support
and help rendered during the tenure of this investigation.
I render my heartfelt thanks to my Juniors Ms. R. Sowndarya, MSc., MPhil.,

Mr. D. A. B. Rex, MSc., MPhil., and Mr. Sathish Kumar, MSc., MPhil., for their
practical help and kindness in this investigation.
I am indebted to Mr. Sanjay Prasad, Scientific Officer, Imaging Facility,

Radiological Safety Officer, Dept. of Inorganic & Physical Chemistry, Indian
Institute of Science, Bangalore – 560012 for his help in literature collection for the
investigation.
I am very much thankful to the Management, CMS College of
Science and Commerce, Coimbatore - 641049 for providing the laboratory and
Infrastructure facilities for the completion of the investigation. I am most grateful to
Dr. S. Sandhya Menon, Principal and Dr. V. Ravikumar, Vice-principal, CMS
College of Science and Commerce, Coimbatore – 641049 for their constant support and
encouragement.
I would also like to place on record my sincere thanks to Dr. K. T. Varkey,

Former Principal, CMS College of Science and Commerce for his enduring support and
encouragement throughout my study.
I would also like to express my gratitude to Dr. T. Vinoth Kumar, MSc.,

MPhil., Ph.D., Director, School of Biological Sciences, CMS College of Science and
Commerce, Coimbatore - 641049 for his timely help and constant encouragement.
I must thank Mrs. Jaisree and Mrs. Stella, Biochemistry Laboratory Staff,
CMS College of Science and Commerce, Coimbatore - 641049 for extending all
possible help in completing the research work.
I thankfully acknowledge and express my gratitude to Dr. N. Anusuya, M.Sc.,

Ph.D., Manian Institute of Science and Technology for helping me in planning various
aspects of the research work.
With great pleasure I express my gratitude to all my Colleagues of CMS

College of Science and Commerce, Coimbatore for their kind encouragement and
support.
Mere words would fail to express the love and gratitude I have for
my Family for their exemplary patience and moral support throughout my life.
I am eternally indebted to my Husband who has been my pillar of support and

constant source of encouragement.
Finally, I submit myself to the Almighty as nothing in this world would be

possible without HIM or HIS BLESSINGS.
CONTENTS
PAGE
S. NO TITLE
NO
LIST OF TABLES
LIST OF FIGURES
ABBREVIATIONS
1. INTRODUCTION 1
2. AIM AND OBJECTIVES 10
3. REVIEW OF LITERATURE 11
4. MATERIALS AND METHODS 28
5. RESULTS AND DISCUSSION 74
SUMMARY AND CONCLUSION 143
BIBLIOGRAPHY 146
APPENDICES 174
LIST OF TABLES
Table Page
TITLE
No No
1 List of Instruments used 29
2 Protocol for Stress induction 35
3 Reaction mixture for Annealing 45
4 Reaction mixture for first strand cDNA synthesis 45
5 Reaction mixture for PCR amplification 46
6 PCR protocol 46
7 Components for first strand synthesis 59
8 Primers used 59
9 Components for PCR 60
10 PCR protocol 61
11 Components for Real time PCR 63
12 RT-PCR protocol 64
13 Few popular Applications in the EMBOSS package 66
14 Results of Forced Swim Test after 1st and 3rd week of 75

Venlafaxine treatment
15 Results of Sucrose consumption test 77
16 Estimation of Total Protein in serum and tissue homogenate 79
17 Activity of Superoxide dismutase 81
18 Activity of Catalase in serum and tissue homogenate 82
19 Activity of Glutathione peroxidase in serum and tissue 83

homogenate
20 Estimation of Vitamin C in serum and tissue homogenate 85

Table Page
TITLE
No No
21 Lipid peroxidation in serum and tissue homogenate 86
22 Assay of Total protein from PBMC and hippocampal cell lysates 88

using UV spectroscopy
23 Densitometric analysis of the Western Blot 89
24 Estimation of the Total RNA isolated from whole blood and 90

hippocampus using UV spectroscopy
25 Details of Study subjects 94
26 Results of the Hamilton Depression Rating Scale for the patient 95

volunteers
27 Classification of samples 96
28 Results of PBMC isolation and viable cell count 97
29 Concentration of Total protein present in the PBMC lysates 98
30 Activity of pGSK‐3β and pCREB in PBMC lysates 99
31 Amount of total RNA isolated from whole blood 100
32 Threshold values of the Real time PCR analysis of bdnf, bcl2a1 101
and hprt mRNA expression
33 Available crystal structures of NGF and TrkA 105
34 Results of Rampage server for NGF and Trk A models 114
35 Crystal structures of BDNF and its receptor TrkB 117
36 Evaluation of the BDNF and Trk B models using Ramachandran 124

plot
37 Available Crystal structures of NT-4 126
38 Evaluation of NT-4 model using Ramachandran Plot 129
39 Available X-Ray Crystal structures for NT-3 And TrkC 133
40 Evaluation of NT-3 and Trk C models using Ramachandran Plot 140

LIST OF FIGURES
Figure Page
Title
No No
1 Gender and age-wise prevalence of depression in Chennai 2
2 PET scan showing the brain areas of depressed and normal 3

individuals
3 Pathway showing Neuronal plasticity and Cellular resilience 7

affected during stress, depression and antidepressant treatment
4 The Forced swim test 8
5 Basic structure of Neurotrophins 14
6 1BET, Crystal structure of murine NGF 15
7 2IFG, Crystal structure of NGF – Trk A 16
8 Crystal structures of BDNF 17
9 Crystal structure of human NT-3 18
10 Crystal structure of the NT-4 homodimer 19
11 1HCF – The Crystal structure of NT-4 – Trk B 20
12 BDNF – TrkB signaling pathway 21
13 Structure of Venlafaxine 26
14 Screenshot of the UniProt KB webpage 65
15 Screenshot of the EMBOSS command prompt 66
16 Screenshot of the BLASTp search page 67
17 Screenshot of the RCSBPDB search page 67
18 Screenshot of the Clustal X2 Graphical User Interface 68
19 Screenshot of the Swiss PDB Viewer 69
20 Screenshot of the Q – site finder 69
21 Screenshot of the SOPMA webpage 70

Figure Page
Title
No No
22 Screenshot of the TMHMM webpage 71
23 Screenshot of the ProP 1.0 server page 71
24 Screenshot of the PyMOL Graphical User Interface 72
25 Screenshot of the Hex 6.12 Graphical User Interface 73
26 Forced Swim Test (FST) 75
27 Sucrose Consumption Test taken at the end of Venlafaxine 77

Treatment
28 Estimation of Total Proteins 79
29 Estimation of Superoxide dismutase 81
30 Estimation of Catalase 82
31 Estimation of Glutathione peroxidase 84
32 Estimation of serum Vitamin C 85
33 Determination of Lipid peroxidation in serum 86
34 Histopathological Examination of the Rat hippocampus 87
35 Western Blotting using antibodies against GSK-3β and CREB 88
36 Agarose Gel Electrophoresis of the RT-PCR products 91
37 Activity of pGSK‐3β and pCREB in the PBMC lysates 100
38 Real time PCR analysis of bdnf, bcl2a1 and hprt mRNA 102
expression
39 Amino acid sequence of human NGF 104
40 Amino acid sequence of human TrkA 104
41 CDD search result for NGF 106
42 CDD search result for TrkA 107
43 ProP result for NGF 108
44 ProP result for TrkA 109

Figure Page
Title
No No
45 Secondary structure prediction for NGF 110
46 SOPMA secondary structure prediction for TrkA 110
47 TMHMM prediction results for TrkA 111
48 Sequence alignment of NGF with V chain of 1WWW 112
49 Sequence alignment of 2IFG A chain and TrkA Ectodomain 112

sequence
50 Structural Superposition of 1BTG and modelled NGF 113
51 Hydrogen bonding interactions observed in the NGF homodimer 114

model
52 Hydrogen bonding interactions observed between the docked 115

NGF and TrkA receptor models
53 Amino acid sequence of BDNF 117

54 Amino acid sequence of TrkB 117
55 CDD search result for BDNF 118
56 CDD search result for TrkB 118
57 ProP prediction result for BDNF 119
58 ProP prediction result for Trk B 120
59 SOPMA secondary structure prediction result for mature BDNF 121
60 SOPMA secondary structure prediction result for the mature 121

TrkB
61 TMHMM prediction result for TrkB 122
62 Sequence alignment for the query BDNF sequence with the 122
sequence of 1B8M_A chain
63 Sequence alignment for the query TrkB Ectodomain sequence 123

with the sequence of 2IFG A chain
64 Hydrogen bonding interactions observed in the BDNF 124

homodimer model

BDNF and Trk B receptor models
Figure Page
Title
No No
66 Amino acid sequence of NT-4 125
67 CDD search result for NT-4 126
68 Signal and Pro-peptide site prediction 127
69 SOPMA prediction results for NT-4 128
70 Sequence alignment of NT-4 and 1B8M B chain 128
71 Hydrogen bonding interactions observed in the NT-4 homodimer 130

model

NT-4 and Trk B receptor models
73 Amino acid sequence of NT-3 131
74 Amino acid sequence of Trk C 132
75 Conserved domain identified in the NT-3 amino acid sequence 133
76 CDD search result for TrkC 134
77 ProP prediction result for NT-3 135
78 ProP version 1.0 prediction result for TrkC 136
79 Secondary structure prediction for NT-3 137
80 Secondary structure prediction for Trk C 137
81 Sequence alignment for the query NT-3 sequence with the 138
sequence of 1B8K_A chain
82 Sequence alignment for the query TrkC Ectodomain sequence 139

with the sequence of 2IFG_A chain
83 Hydrogen bonding interactions observed in the NT-3 homodimer 140

model

NT-3 and Trk C receptor models
ABBREVIATIONS
CUMS Chronic Unpredictable Mild Stress
pCREB phosphorylated cAMP Responsive Element Binding protein
pGSK-3β phosphorylated Glycogen Synthase Kinase 3 beta
NGF Nerve Growth Factor
BDNF Brain-derived Neurotrophic Factor
NT-3 Neurotorphin-3
NT-4 Neurotorphin-4
TrkA Trophomyosin-related kinase A
TrkB Trophomyosin-related kinase B
TrkC Trophomyosin-related kinase C
PBMC Peripheral Blood Mononuclear Cells
HDRS Hamilton Depression Rating Scale
DSM Diagnostic and Statistical Manual of Mental Disorders
ICD International Classification of diseases
RIPA Radio-Immunoprecipitation Assay

Introduction
1
INTRODUCTION
MENTAL DISORDERS
Mental disorders or mental illnesses are psychological or behavioural patterns

generally associated with subjective distress or disability that occurs in an individual, and
which is not a part of normal development or culture. Such a disorder may consist of a
combination of affective, behavioural, cognitive and perceptual components (Insel and
Wang, 2010).
Mood disorders such as Major Depression and Bipolar disorder are the most
common psychiatric disorders in modern society (Kessler et al., 2005). Depression is related
to the normal emotions of sadness and bereavement, but it does not remit when the external
cause of these emotions dissipates, and it is disproportionate to their cause. Classic severe
states of depression often have no external precipitating cause (Wakefield et al., 2007).
MAJOR DEPRESSIVE DISORDER (MDD)
Depression presents with depressed mood, loss of interest or pleasure, decreased

energy, feelings of guilt or low self-worth, disturbed sleep or appetite, and poor
concentration. Moreover, depression often comes with symptoms of anxiety. These
problems can become chronic or recurrent and lead to substantial impairments in an
individual’s ability to take care of his or her everyday responsibilities. At its worst,
depression can lead to suicide. Almost 1 million lives are lost yearly due to suicide, which
translates to 3000 suicide deaths every day. For every person who completes a suicide, 20 or
more may attempt to end his or her life (WHO, 2012).
Depression is estimated to affect 350 million people worldwide. The World Mental
Health Survey conducted in 17 countries found that on an average about 1 in 20 people
reported having an episode of depression in the previous year (WHO, 2012). A WHO report
ranked Depression as the fourth medical condition with the greatest disease burden
worldwide, measured in Disability-Adjusted Life Years, which expresses years of life lost to
A Study on the Role of few Components of the Neurotrophin Signaling Pathway and 1
Antioxidants in Major Depression and its Treatment
Introduction
premature death and years lived with a disability of specified severity and duration.
They also predicted that depression would be the second condition with the greatest disease
burden worldwide by the year 2020 (Murray and Lopez, 1999). A study determined the
prevalence of depression in a major city in South India to be 15.1%. The study also reported
that age, gender and socio-economic status were also contributing factors for depression
among the Urban population (Figure 1) (Poongothai et al., 2009).
Depression is also a risk factor for a number of communicable and non-

communicable diseases (Prince et al., 2007) like cardiovascular diseases (Hemingway and
Marmot, 1999; Kuper et al., 2002) and type II diabetes (Anderson et al., 2001).
In general, mental disorders are classified separately into Neurological disorders,

learning disabilities and mental retardation. Currently there are two widely established
systems that classify mental disorders: ICD – 10 Chapter IV: Mental and behavioural
disorders, which is a part of the International Classification of diseases produced by the
World Health Organization (WHO); and the Diagnostic and Statistical Manual of Mental
Disorders (DSM – IV) produced by the American Psychiatric Association (APA).
The official diagnosis of depression is subjective and rests on the documentation of a

certain number of symptoms that significantly impair functioning for certain duration
(Nestler et al., 2002). These diagnostic criteria overlap with other conditions such as anxiety
Introduction
disorders, which have substantial co-morbidity with depression (Hasler et al., 2004; Ressler
and Mayberg, 2007).
NEUROLOGICAL CHANGES ASSOCIATED WITH DEPRESSION
Several animal and post-mortem studies of the human brain have revealed defective
neurogenesis in the hippocampus of depressed individuals (MacQueen et al., 2003; Henn
and Vollmayr, 2004). Post-mortem studies report a reduction in the size of neurons and loss
of glia (Drevets et al., 2008; Miguel-Hidalgo and Rajkowska, 2003) and preclinical studies
show that exposure to repeated stress causes atrophy of neurons in the hippocampus and
prefrontal cortex, as well as loss of glia as contributing factors to depression and stress-
related disorders (Figure 2) (Duman and Monteggia, 2006; Krishnan and Nestler, 2008).
Volumetric decreases observed in the hippocampus and other forebrain regions in

subsets of depressed patients have supported a popular hypothesis for depression involving
decrements in neurotrophic factors, which are neuro-developmentally expressed growth
factors that also regulate plasticity within adult brain (Duman and Monteggia, 2006;
Monteggia et al., 2004). These studies have focused largely on the role of brain-derived
Introduction
neurotrophic factor (BDNF), which is expressed abundantly in adult limbic structures.

Support for this ‘BDNF hypothesis’ has come from a large preclinical literature showing
that several forms of stress reduce BDNF-mediated signalling in the hippocampus, whereas
chronic treatment with antidepressants increases BDNF-mediated signalling (Nestler, 2002;
Duman and Monteggia, 2006). Similar changes have been observed in the post-mortem
hippocampus of humans with depression (Karege et al., 2005), as well as in the
concentrations of serum BDNF (Duman and Monteggia, 2006).
Moreover, treatment with antidepressants, possibly through the actions of CREB

(Nestler, 2002; Pittenger and Duman, 2008), increases the amounts of several growth factors
in the hippocampus that influence neurogenesis. These include BDNF (Sairanen et al.,
2005), as well as vascular endothelial growth factor (VEGF) and neuropeptide VGF
(nonacronym), which have antidepressant and pro-neurogenic properties in rodents
(Hunsberger et al., 2007; Thakker-Varia et al., 2007; Warner-Schmidt and Duman, 2007)
but the mechanisms by which new neurons might restore mood are largely unknown.
NEUROTROPHINS
Neurotrophins are a family of structurally and functionally related proteins

responsible for the maintenance, proliferation and differentiation of subsets of neurons
bearing specific tyrosine kinase receptors, the Trophomyosin-related kinases (Trks)
(Barbacid, 1995). Neurotrophins belong to the cystine knot superfamily, which may share a
conserved core of three intertwined disulphide bonds (Hallbook, 1999). Currently, four
neurotrophins have been isolated in the mammalian system viz., Nerve Growth factor
(NGF), Brain-derived nerve growth factor (BDNF), Neurotrophin-3 (NT3) and
Neurotrophin-4 (NT4).
The first neurotrophin to be characterised in mammals was NGF (Levi-Montalcini,

1987), followed by BDNF which was purified from pig brain (Barde et al., 1982),
Neurotrophin-3 (Maison-pierre et al., 1990) and Neurotrophin-4 which was discovered
through homology cloning (Ip et al., 1992). Neurotrophins generally function as non-
covalently associated homodimers (Bothwell and Shooter, 1977; Radziejewski et al., 1992)
but some are able to form heterodimers (Radziejewski and Robinson, 1993; Jungbluth et al.,
1994).
Introduction
The role of neurotrophins in cell atrophy and loss is supported by studies that have
found the expression of these factors to be decreased during stress or depression, particularly
the levels of BDNF (Duman and Monteggia, 2006; Krishnan and Nestler, 2008; Castren and
Rantamaki, 2010).
NEUROTROPHIN SIGNALING PATHWAY IN DEPRESSION

Several studies have suggested that depression arises from the inability of the brain
to respond to environmental changes as a result of the altered brain structure and/or synaptic
plasticity (Rajkowska, 1997; Rajkowska, 2000; Duman et al., 2000; Miguel-Hidalgo and
Rajkowska, 2002; Manji et al., 2003). Neuronal survival and development is controlled by
several extracellular signals of which one family of signaling molecules are the
Neurotrophins of which BDNF has gained prominence as a candidate gene in various mental
disorders owing to many pre-clinical and clinical studies which provide direct evidence
suggesting that modulation in expression of BDNF could be involved in the behavioural
changes observed in depression and other mood disorders (Duman et al., 2000; Duman,
2002).
There are many studies in the recent past which report decrease in the levels of
BDNF in neuronal cells of animal models and in depressed human post mortem samples. An
accompanying decrease of BDNF in the Peripheral blood Mononuclear cells (Karege et al.,
2002), and in the serum of the depressed patients (as it crosses Blood-Brain Barrier) were
also reported. This decrease was found to increase after Anti-depressant treatments
(Sen et al., 2008).
The key regulatory events of the Cell survival pathway that lead to this decrease in
BDNF is the activation of GSK3β (Karege et al., 2007) and concomitant inactivation of
pCREB, a transcriptional activator (Grimes and Jope, 2001) that leads to decreased
expression of BDNF at the gene level. Delay and variations in the modulations by these key
regulators in each person at the cellular level seems to be the deciding factor in succumbing
to the disease, in delay in responding to the treatment and in relapse as seen among the
animal and post mortem samples.
All neurotrophins bind to two classes of cell surface receptors viz., Trks
(Bothwell, 1995) and p75NTR (Rodriguez-Tebar et al., 1991). Neurotrophin binding to Trks
Introduction
is highly specific and results in receptor dimerization and subsequent activation of the
cytoplasmic tyrosine kinase domain (Bothwell, 1995) through phosphorylation of
cytoplasmic tyrosine residues, which further activates the receptor and creates a docking site
for adaptor proteins containing PTB or SH-2 motifs (Pawson and Nash, 2000). These
adaptor proteins couple the Trk receptors to intracellular signaling cascades like Ras/ERK
pathway, PI-3 kinase/Akt pathway and the PLC-γ pathway (Reichardt and Farinas, 1997;
Kaplan and Miller, 2000).
Activation of the Ras/ERK pathway results in the activation of CREB and other
transcription factors (Xing et al., 1998), which in turn control the expression of many genes
regulated by the neurotrophins, whose products are essential for survival of neurons
(Bonni et al., 1999; Riccio et al., 1999).
A study reported the effect of BDNF on the components of the signaling cascades in
human neuroblastoma cells. BDNF was found to increase the phosphorylation and activation
of Akt, ERK and CREB. The study also found that BDNF increased the inhibitory Serine-9
phosphorylation of GSK3β (Mai et al., 2002). Activated GSK3β, on the other hand was
found to impair activation of CREB (Grimes and Jope, 2001) and promote cell death
(Bijur et al., 2000).
GSK3β has been found to contain a phospho-Tyrosine residue in its activation loop
(Tyr 216), which is important for its activity as mutation or dephosphorylation has been
found to decrease its activity (Hughes et al., 1993; Wang et al., 1994).
ANIMAL MODELS IN THE STUDY OF DEPRESSION
To date, a wide range of animal models have been developed for the study of
depression, they include models in which depressive behaviour is the result of genetic
selection or manipulation, environmental stressors during development or in adulthood or
pharmacological treatments which induce stress (Keller et al., 2007). The reliability of such
animal models is based on behavioural tests that measure traits that are homologous to
symptoms of the human disorder and behavioural tests that are responsive to appropriate
pharmacological treatments (Pittenger and Duman, 2008).
Introduction
Stressful life events are environmental factors that may play a role in the etiology of
depression. Thus a valuable model of depression could result from an altered behavioural
state induced by stress response. It is assumed that exposure to uncontrollable stressors
induce a feeling of loss of control which might result in a depressive behavioural state
(Ho et al., 2002).
CHRONIC STRESS MODEL OF DEPRESSION
The first chronic stress model of depression was developed by Katz (Katz et al.,
1981). In this model, various stress procedures involving relatively harsh stressors like
electrical shock, 40 hours food deprivation, cold swim, water deprivation, heat stress, shaker
stress, etc., were applied.
CHRONIC MILD STRESS (CMS) MODEL
In 1987, Willner and co-workers developed the Chronic Mild Stress (CMS) protocol,
which induces a variety of low-grade stressors administered over a long period of time. The
presentation of different stressors is an essential feature of the model, as repeated
presentation of a single stressor results in rapid behavioural habituation (Muscat and
Willner, 1992).
Introduction
CHRONIC UNPREDICTABLE MILD STRESS (CUMS) MODEL
The Chronic Unpredictable Mild Stress (CUMS) procedure appears to cause a

moderate stress response, in which the rodents are exposed to 21 days of mild stress regime,
which are repetitive but unpredictable due to a semi-random schedule. The protocol aims to
model a chronic depressive-like state that develops gradually over time in response to stress
and is thus considered more naturalistic in the induction (Willner, 1997). Chronic sequential
exposure to a variety of mild stressors has been found to decrease the consumption of
palatable weak solutions of sucrose or saccharin in rats (Piran et al., 1985; Weissenburger
et al., 1986; Willner et al., 1991) or mice (Monleon et al., 1995).
BDNF LEVELS IN ANIMAL MODELS OF DEPRESSION
A number of studies suggest that BDNF action could be impaired in depression and
stress-related affective disorders and that BDNF is involved in the etiology of these
illnesses. Duman and co-workers first demonstrated that the chronic administration of
several antidepressants, like Selective Serotonin Reuptake Inhibitors (SSRI) increase BDNF
expression in the brain hippocampus (Nibuya et al., 1995). Another study demonstrated that
environmental stressors such as immobilization decreased the central BDNF mRNA
(Jonsson et al., 1997).
Introduction
FREE RADICALS AND STRESS IN DEPRESSION
Stressful life conditions can cause anxiety and depression, which can lead to
excessive production of free radicals which in turn result in oxidative stress and an
imbalance in the antioxidant system. A study demonstrated that Venlafaxine treatment
decreased the lipid peroxidation in the cerebral cortex of depression-induced animals
(Eren et al., 2007a). Another study demonstrated that patients with Generalized Anxiety
Disorder (GAD) and Depression showed lower levels of vitamins A, C and E, and that
dietary supplementation of these vitamins significantly decreased their depression scores
(Gautam et al., 2012).
HOMOLOGY/COMPARATIVE MODELLING OF PROTEINS
Functional characterisation of a protein is usually facilitated by obtaining the

accurate three dimensional structure of the protein. In the absence of experimentally
determined structures, comparative or homology modelling can provide a useful 3D model
for a protein. Comparative modelling predicts the 3D structure of a given protein sequence
(query/target protein) based on its alignment to one or more proteins of known structure
(template protein). The model prediction process consists of fold assignment, target-
template alignment, model building and model evaluation (Pieper et al., 2002).
PROTEIN – PROTEIN INTERACTION
Many biological functions involve the formation of protein-protein complexes,

which are critical for all cellular pathways, regulation and packaging (Janin et al., 2003).
The structures of known protein complexes can be used to structurally model the
interactions between the query protein sequences. Protein - protein docking techniques can
also be used to predict the interaction between proteins. Geometric and steric considerations
are taken into account in these techniques (Ogmen et al., 2005). Hydrogen bonding between
a protein and its ligands (protein, nucleic acid, substrate, effector or inhibitor) provides a
directionality and specificity of interaction that is a fundamental aspect of molecular
recognition (Hubbard and Haider, 2010).
Introduction
2
AIM AND OBJECTIVES
The objectives of the study are
 Checking biochemical parameters in depression using an animal model
 Determination of the mRNA expression levels of bdnf in the depression induced and
Venlafaxine (drug) treated groups and in human subjects
 Comparing the biochemical and molecular parameters in the brain and whole blood
of the animal model and human subjects
 Determination of the levels of proteins involved in the Neurotrophin signaling

pathway
 In silico modelling of the interactions between Neurotrophins and their receptors.
Review of Literature
3
REVIEW OF LITERATURE
DEPRESSION
Depression is the most common mental disorder and a major cause of disability
across the world. About 16% are estimated to be affected by Major Depression (Kessler et
al., 2005). Depression describes a transient mood state experienced by virtually all
individuals at some time in their life as well as a clinical or behavioural syndrome, usually
called Major Depressive disorder (MDD). It is a medical condition that includes
abnormalities of affect and mood, neuro-vegetative functions (such as appetite and sleep
disturbances), cognition (such as inappropriate guilt and feelings of worthlessness) and
psychomotor activity (such as agitation or retardation) (Fava and Kendler, 2000).
DIAGNOSTIC CRITERIA
The diagnostic clinical criteria for depression as per the International Classification
of Diseases – 10 (ICD-10) are:
A. Episode: At least two of the following three symptoms must be present, for at least
two weeks:-
a) Depressed mood to a degree that is definitely abnormal for the individual, present
for most of the day and almost every day, largely influenced by circumstances and
sustained for at least two weeks.
b) Loss of interest or pleasure in activities that was normally pleasurable.
c) Decreased energy or increased fatigability.
B. In addition, at least two of the following seven symptoms should be present [WHO,
2005]:
1. Loss of confidence and self esteem
2. Unreasonable feelings of self-reproach or excessive and inappropriate guilt.
3. Recurrent thoughts of death or suicide, or any suicidal behaviour.
4. Complaints or evidence of diminished ability to think or concentrate, such as
indecisiveness or vacillation.
5. Change in psychomotor activity, with agitation or retardation (either subjective or

objective).
6. Sleep disturbances of any type.
7. Change in appetite (decrease or increase) with corresponding weight change.
ASSESSMENT OF SEVERITY OF DEPRESSION
The Hamilton Depression Rating Scale (HDRS), also known as HAM-D and the
Structured Interview Guide for the HDRS (SIGH-D) are widely used for the assessment of
severity of depression (Hamilton, 1960; Williams, 1988).
HAM-D, is a multiple item questionnaire used to provide an indication

of depression, and as a guide to evaluate recovery (Hedlund and Viewig, 1979).
Max Hamilton originally published the scale in 1960 (Hamilton, 1960) and revised it in
1966 (Hamilton, 1966), 1967 (Hamilton, 1967), 1969 (Hamilton, 1969), and 1980
(Hamilton, 1980). The questionnaire is designed for adults and is used to rate the severity of
their depression by probing mood, feelings of guilt, suicide ideation, insomnia, agitation or
retardation, anxiety, weight loss, and somatic symptoms. The original 1960 version contains
17 items to be rated (HRSD-17), but four other questions are not added to the total score and
are used to provide additional clinical information. Each item on the questionnaire is scored
on a 3 or 5 point scale, depending on the item, and the total score is compared to the
corresponding descriptor. The assessment time is estimated at 20 minutes.
Other scales include the Montgomery-Åsberg Depression Rating Scale (MADRS),

the Beck Depression Inventory (BDI), the Zung Self-Rating Depression Scale, the Wechsler
Depression Rating Scale (Wechsler et al.,1963), the Raskin Depression Rating Scale (Raskin
et al., 1969), the Inventory of Depressive Symptomatology (IDS) and the Quick Inventory of
Depressive Symptomatology (QIDS).
CAUSES
Studies have shown that Major Depression is not caused by any single gene but is a
disease with complex genetic features (Belmaker and Agam, 2008). The genetic
contributions to the manifestations of Depression have been estimated as 40 – 50% (Fava
and Kendler, 2000). Pedigree analysis have identified chromosomal regions linked with the
disease, although no single chromosomal region has been replicated in all the family studies
of genetic linkage in depression (Belmaker and Agam, 2008).
NEUROTROPHIC FACTOR HYPOTHESIS OF DEPRESSION
Several theories were postulated to explain the genetic basis of depression, of which
the Neurotrophin hypothesis suggested by Professor Duman’s research is gaining
importance as targets for newer drugs. Studies in animal models have revealed that stress
suppresses neurogenesis, which is enhanced on the other hand by the use of antidepressants
(Reagen et al., 2004; Perera et al., 2007).
NEUROTROPHINS
Neurotrophins are important regulators of neuronal survival, development, function

and plasticity (Sofroniew et al., 2001). The neurotrophic factor hypothesis postulates that the
targets of innervation secrete limiting amounts of survival factors that function to ensure a
balance between the size of the target organ and the number of innervating neurons (Purves,
1988). The search for such survival factors resulted in the characterisation of Nerve Growth
factor (NGF) (Levi-Montalcini, 1987). NGF was found to be able to support survival of
sympathetic and sensory spinal neurons in culture and that it was important in maintaining
survival of sympathetic neurons in vivo as well as in vitro (Korsching, 1993).
Several such studies revealed the role of other neurotrophins, BDNF, NT-3 and NT-4
in neuronal populations (Farinas et al., 1996; Huang et al., 1999). Efforts were made to
purify these neurotrophins and study their crystal structure. The neurotrophins were found to
belong to the family of secreted growth factors containing a tertiary fold and cystine knot
(McDonald and Chao, 1995). The neurotrophins are synthesized as pre-proproteins which
are sequentially cleaved by mammalian proprotein convertases to attain the mature,
functional form (Mowla et al., 2001; Seidah et al., 1996). The mature neurotrophins bind to
their cell surface receptors, Trks in the dimeric form, resulting in receptor dimerization and
activation (Bothwell, 1995).
The structures of all neurotrophins were elucidated by X-ray crystallography and

were found to have a basic structure comprising seven β-strands which contribute to three
anti-parallel pairs of twisted β-strands. This extended structure is locked by a “cystine knot”
of three disulphide bonds (McDonald et al., 1991; Robinson et al., 1995; Butte et al., 1998;
Robinson et al., 1999).
NERVE GROWTH FACTOR (NGF)
NGF was the first neurotrophic factor to be characterised in mammals (Levi-

Montalcini, 1987). The crystal structure of murine NGF was reported as a homodimer at
2.3Å resolution (Figure 1). The protomer structure was found to contain three anti-parallel
pairs of β-strands, together forming a flat surface, through which the subunits associate to
form dimers (McDonald et al., 1991).
Another study reported the crystal structure of human NGF (PDB ID: 1WWW),
which was very much similar to that of the murine NGF. Three major differences were
observed between the human and murine NGF, which might be due to the sequence
variations. The study also revealed the receptor binding sites of NGF and the conformational
changes occurring during complex formation. NGF binds to Trk A through the interface of
the NGF dimer, where residues from both protomers involve in receptor binding
(Weismann et al., 1999).
NGF – TRK A INTERACTION
The Trks have a common architecture made of two Cysteine-Rich Clusters, a

Leucine-Rich domain and two Ig-like domains in the extracellular region (Schneider and
Schweiger, 1991), of which only the D5 region was found to be important for NGF binding
(Urfer et al., 1995). The Trk A-D5 consists of a β-sandwich formed by two four-stranded
sheets. The interface between the NGF and Trk A-D5 was found to contain two patches of
similar size. The first patch involves the central β-sheet of NGF dimer and the loops on the
C-terminal of Trk A-D5, which are conserved in all the neurotrophins and their receptors
(Figure 2). The second patch, which controls the specificity of Neurotrophin-Trk interaction,
consists of the N-terminal residues of NGF and the first four-stranded β-sheet of Trk A.
The N-terminal of NGF adopts a helical conformation upon receptor binding and packs
against the disulphide bond at the surface of the four-stranded β-sheet, whose residues are
poorly conserved in the Trks. The residues 4 – 9 of NGF are completely embedded in the
cavity of Trk A and are important for receptor binding (Weismann et al., 1999).
BRAIN-DERIVED NEUROTROPHIC FACTOR (BDNF)
BDNF was the second neurotrophin to be purified and characterised from the pig
brain (Barde et al., 1982). The crystal structure of BDNF was reported as two heterodimeric
structures in combination with either Neurotrophin-3 (1BND; Robinson et al., 1995) or with
Neurotrophin-4 (1B8M; Robinson et al., 1999) (Figure 3). The studies reported that all the
neurotrophins had the common structural scaffold and that the BDNF in both the
heterodimers had the same structure and so would be the same in a homodimeric structure
also (Robinson et al., 1999). The dimeric neurotrophins form a closed cavity with ordered
water molecules at the interface, which is also conserved in all the neurotrophins.
BDNF – TRK B INTERACTION
Studies using affinity separation and cross-linking, suggested that the regions of
Trk B responsible for BDNF binding are the LRM-3 and the second Ig-like domain
(Haniu et al., 1997). But another study using mutant Trk B showed that only the second Ig-
like domain was sufficient for BDNF binding (Ninkina et al., 1997). This was supported by
a later study using models of BDNF and the TrkB-D5 region. They also found that the
BDNF-Trk B interaction was similar to that of NGF – Trk A interaction, occurring through
two patches, the conserved patch and the specificity patch (Naylor et al., 2002).
NEUROTROPHIN – 3 (NT-3)
Neurotrophin – 3, the third neurotrophic factor to be characterised (Maison-pierre

et al., 1990), shares closest structural similarity with NGF and BDNF. The heterodimeric
structure of NT-3 with BDNF was solved through X-ray crystallography, and was found to
have a topology similar to that of the NGF homodimer. Five regions were found to have
high sequence variability out of which only two regions bring about significant structural
difference. The dimer interface was found to be formed by hydrophobic interactions, which
were also found to be structurally conserved in all neurotrophins. This leads to the
suggestion that all neurotrophins are capable of forming heterodimeric structures. The
dimers contain a closed cavity at the interface, which was also found to be conserved
(Jungbluth et al., 1994). The homodimeric structure of NT-3 was also solved later through
X-ray crystallography, which found that the structure conformed to the findings of the
earlier studies (Butte et al., 1998).
NT-3 – TRK C INTERACTION
NT-3 has high affinity and specificity to bind Trk C, but can also bind Trk A and Trk
B to a limited extent with lesser affinity. Several studies using chimeric molecules have
identified the binding epitopes of NT-3 to Trk C (Urfer et al., 1994; Ryden and Ibanez,
1996). However, the studies indicate that the binding epitopes of the neurotrophins are not
identical and that each neurotrophin interacted with its receptor in a unique way. Particularly
NT-3 was also found to interact with Trk A and Trk B, but with reduced affinities when
compared to its interaction with Trk C. This has several implications as NT-3 might be
capable of eliciting response from NGF-induced or BDNF-induced neurons, which might be
involved in some unknown mechanisms of neuronal development and survival (Ryden and
Ibanez, 1996).
NEUROTROPHIN – 4 (NT-4)
NT-4 was discovered and characterised in mammals through homology cloning

(Ip et al., 1992) and is also called as Neurotrophin – 5. NT-4 has specificity to the same cell
surface receptor as BDNF, the Trk B receptor (Davies, 1994). The homo- and heterodimeric
structures of NT-4 have been solved by X-ray crystallography (Robinson et al., 1999). NT-4
is presented with the same structural scaffold as the other mammalian neurotrophins and
shares structural similarity with BDNF, except for a 7 amino acid insert that forms a loop
and extends away (Figure 5).
NT-4 –TRK B INTERACTION
The crystal structure of the NT-4 – Trk B complex was solved containing the ligand-
binding D5 domain of the receptor (Banfield et al., 2001). The study revealed that the
receptor-ligand interaction occurs through two important sites, the conserved and specificity
patch, as observed in the other neurotrophin-Trk interactions (Figure 4). Another study
using surface plasmon resonance of the Trk B Ig-2 domain, showed that the region was
sufficient for BDNF and NT-4 binding, and that the region also conferred the specificity of
binding interactions (Naylor et al., 2002). However, these studies fail to differentiate or
determine the relative binding specificity of BDNF and NT-4 towards Trk B.
ROLE OF NEUROTROPHINS IN MAJOR DEPRESSION
An emerging hypothesis of depression suggests that the pathogenesis and treatment

of the disease involves plasticity of neuronal pathways (Duman et al., 1997; Duman et al.,
1999). Cellular signaling pathways that modulate the signal generated by multiple
neurotransmitter and neuropeptide systems are involved in the neuroplastic events that
regulate complex psychological and cognitive processes (Bourne and Nicoll, 1993; Bhalla
and Iyengar, 1999). Studies using Positron emission tomography (PET) have revealed
multiple abnormalities of regional cerebral blood flow (CBF) and glucose metabolism in
limbic and prefrontal cortical (PFC) structures in mood disorders. Un-medicated subjects
show consistent increase in regional CBF and metabolism in the amygdala, orbital cortex
and medial thalamus; and decrease in dorsomedial/dorsal anterolateral PFC and anterior
cingulate cortex (Drevets, 2000). These regions have also been implicated in emotional
behaviour by electrophysiological lesion analysis and brain-mapping studies (Le Doux,
1987; Drevets, 2000).
Post-mortem studies have shown abnormal reductions in cortex volume, glial cell
counts and neuron size in the PFC, orbital cortex and amygdala (Ongur et al., 1998;
Rajkowska et al., 1999; Rajkowska, 2000). During antidepressant treatment the amygdala
CBF and metabolism were found to decrease to normal levels (Drevets, 2000). Studies of
cellular models of learning and activity-dependent plasticity have indicated that adaptations
in response to stimuli include enhanced synaptic strength and morphological changes (Bliss
and Collingridge, 1993; Thoenen, 1995), which are mediated to an extent by molecular
adaptations in intracellular signal transduction cascades (Abel et al., 1997; Impey et al.,
1998).
Neurotrophic factors are necessary for the survival and functioning of neurons,
suggesting that any reductions of these factors could affect neuronal viability (Black, 1999;
Riccio et al., 1999). These factors inhibit apoptotic pathways by activating the MAP kinase
pathway and the phosphatidylinositol-3 kinase (PI-3K)/Akt pathway.
ACTIVATION OF TRK B
BDNF binding to Trk B results in the receptor dimerization and auto-

phosphorylation of the tyrosine residues in the intracellular domain of the receptor, which
subsequently activates the cytoplasmic signaling pathways viz., Mitogen-activated protein
(MAP) kinase, phospholipase C-γ (PLC- γ) and phosphatidylinositol-3-kinase (PI-3K)
(Kaplan and Miller, 2000).
The Akt/PI-3K signaling pathways regulates mRNA translation and is enhanced by

BDNF (Kang and Schuman, 1996; Takei et al., 2001). A study using cultured neurons from
the rat visual cortex identified CREB as the transcriptional regulator that is activated through
the BDNF-Trk B signaling pathway (Pizzorusso et al., 2000). Another study in human
neuroblastoma SH-SY5Y cells reported that overexpression of GSK-3β abolished CREB
phosphorylation induced by BDNF and that BDNF treatment increased the Serine-9
phosphorylation of GSK-3β, which inhibits its activity (Mai et al., 2002).
STRESS AND FREE RADICALS IN MAJOR DEPRESSION
Oxidative stress, an imbalance between levels of antioxidants and generation of pro-

oxidants in vivo, has been suggested to be involved in the pathophysiology of major
depression. Depression has been reported to be associated with enhanced activation of the
immune system (Maes, 1999) and the combination of low folate and elevated homocysteine
levels (Bottiglieri et al., 2000) both of which may lead to or be associated with, a state of
increased oxidative stress (Floyd et al., 1999, Huang et al., 2001). The association between
depression and low membrane phospholipid content of long chain ω-3 polyunsaturated fatty
acids (PUFA) (Peet et al., 1998) may also be suggestive of enhanced oxidative stress as long
chain ω-3 PUFA are highly oxidisable (Song et al., 2001).
The brain is particularly vulnerable to reactive oxygen species (ROS) production

because it metabolizes 20% of total body oxygen and has a limited amount of antioxidant
capacity (Floyd, 1999). A growing body of evidence has suggested that reactive oxygen
species (ROS) may play an important role in the pathogenesis of neurological and
psychiatric diseases including bipolar disorder and major depression (Kodydkova et al.,
2008; Lucca et al., 2009a; Lucca et al., 2009b; Jafari et al., 2014). Oxidative stress is well
known to contribute to neuronal degeneration in the central nervous system (CNS) in the
process of aging, as well, in neurodegenerative diseases. Studies have consistently reported

increase ROS in plasma on patients with major depression, especially with melancholia
associated (Bilici et al., 2001).
Depression and sleep deprivation are reported to cause oxidative stress (Gilmour and
Patten, 2007), resulting in the formation of reactive oxygen species (ROS) and eventually
lead to neuronal and cellular damage. ROS are formed in the human body, in the cytosol,
mitochondria, lysosomes, peroxisomes, and plasma membranes under both physiological
and pathological conditions (Hemnani and Parihar, 1998); their levels can increase by stress
situations such as occupational stress (Casado et al., 2005; Casado et al., 2006). Stressful
conditions lead to the excessive formation of ROS and cause oxidative stress (Casado et al.,
2008). Oxidative stresses occur when the production of free radicals exceeds the defensive
response of the antioxidant system. Free radicals initiate a cascade, causing lipid
peroxidation, DNA damage, cell death, and neurological problems. Total plasma antioxidant
capacity is measured as an indicator of oxidative stress (Sharifian et al., 2005).
An earlier study observed that patients with Generalised Anxiety Disorder (GAD)
and Depression had significantly lower blood levels of Vitamins A, C and E in comparison
to healthy controls (Gautam et al., 2012). Recent study showed evidences of oxidative stress
in major depression as reflected in increased oxidative stress from frontal regions of patients
compared to those of matched controls (Michel et al., 2007). Moreover another study
showed that rats subjected to chronic mild stress (CMS) had increased superoxide
production in the hippocampus, prefrontal cortex and brain, also an increase in levels of
thiobarbituric acid reactive in the cortex (Lucca et al., 2009a).
Maes et al., (2000) reported that serum levels of α-tocopherol were lower in 42
patients suffering from major depression compared to healthy controls, and suggested that
this might be due to decreased antioxidant defences. In another larger study of 262 elderly
subjects with depressive symptoms, plasma α-tocopherol levels were found to be lower in
males, but not females, when compared to healthy controls (Tiemeier et al., 2002).
USE OF SERUM AND PERIPHERAL BLOOD MONONUCLEAR CELLS (PBMC)

IN THE STUDY OF DEPRESSION
Several studies have linked the severity of depressive symptoms with the low levels
of BDNF in the serum of the patients (Cunha et al., 2006; Jevtovic et al., 2011;
Rojas et al., 2011), which increases on antidepressant treatment (Sen et al., 2008). Another
study has shown that the use of PBMCs in the study of drug effects on neuropsychiatric
disorders (Li et al., 2007).
A study reported the increase in phosho-CREB levels in the lymphocytes of

depressed patients in response to antidepressant treatment (Koch et al., 2002). Another pilot
study used lymphocytes from depressed patients to study the effect of antidepressant
treatment in the levels of phosho-CREB and Glucocorticoid receptor (Rojas et al., 2011).
ANIMAL MODELS OF DEPRESSION
Exposure to stress is a main environmental risk factor associated with the occurrence
of Depression (Keller et al., 2007). Recent studies have indicated that stress exposure may
interact with genetic risk factors to increase the susceptibility to depression (Capsi et al.,
2003; Kaufman et al., 2006). Experimentally, the outcome of stress exposure is influenced
by several variables, including the nature of the stress and the exposure parameters
(Anisman and Matheson, 2005). The degree of control an animal has over the stress
exposure has been demonstrated to be important for the consequences of the stress exposure.
The degree of predictability is also thought to affect the outcome of the stress exposure
(Anisman and Matheson, 2005).
CHRONIC UNPREDICTABLE MILD STRESS (CUMS) MODEL
Stress is known to be one of the causal factors for development of major depression
(Kendler et al., 1999). Based on this observation, the chronic unpredictable mild stress
(CUMS) animal model has been developed to mimic the development and progress of
clinical depression. In the CUMS model, one of the main symptoms of major depression,
namely anhedonia, is mimicked (Willner et al., 1992). In the CUMS procedure, rats or mice
are chronically exposed to a variety of mild stressors. During 1–3 weeks of stress exposure,
the animals display a reduction in the consumption of, or preference for, sucrose solution
(Willner et al., 1987).
Decreased sucrose consumption or preference is believed to reflect a decrease in

sensitivity to reward (Willner, 2005). This has been confirmed by a comparable decrease in
the rewarding properties of food pellets and amphetamine (Papp et al., 1991) and morphine
(Bergstrom et al., 2008) in chronically stressed rats, as assessed by place preference
conditioning. CUMS increases the threshold for intracranial ventral tegmental self-
stimulation, also indicating decreased sensitivity to rewarding stimuli (Moreau et al., 1992).
In the CUMS model, exposure to the various stressors result in several behavioural
and physiologic changes that have analogy with symptoms of depression, such as decreased
reward-related behaviour, decreased self-care and changes in sleep that respond to
antidepressant treatment. These abnormalities and other changes like increased
hypothalamic-pituitary-adrenal (HPA) axis activation and immune system abnormalities
make this a valid model for depression (Willner, 2005).
In addition to decreasing responsiveness to rewarding stimuli, CMS exposure results

in behavioural changes related to major depression, including decreased sexual (Gronli
et al., 2005), aggressive (D’Aquila et al., 1994) and investigative behaviours (Willner,
1997). Moreover, disruption of normal sleep patterns in animals exposed to CMS includes
decreases in active waking and deep sleep, a reduced latency to enter the first REM period
(Cheeta et al., 1997), and more fragmented sleep patterns (Gronli et al., 2004). In addition,
dysregulation of hypothalamic–pituitary–adrenal (HPA) axis (Konkle et al., 2003; Stout
et al., 2000) and immunological dysfunctions (Edgar et al., 2002; Edgar et al., 2003) have
been reported in CMS animals. All of the clinically active classes of antidepressants
(Willner, 1997) and electroconvulsive seizure (Moreau et al., 1995) mediate recovery from
stress-induced anhedonia.
VENLAFAXINE
Various studies have shown that antidepressant treatment may ameliorate cognitive
impairments in parallel to mood improvement of depressive patients (Airaksinen et al.,
2004; Vermetten et al., 2003). Chronic sequential exposure to a variety of mild stressors
causes a substantial decrease in the consumption of 1% sucrose solution, and that this deficit
can be effectively reversed by chronic treatment with traditional antidepressant drugs,
imipramine, and fluoxetine (Muscat et al, 1992).
Venlafaxine is an antidepressant belonging to the Serotonin-Norepinephrine reuptake

inhibitor (SNRI) class (Yardley et al., 1990; Bymaster et al., 2001). It is used in the
treatment of Depression, General Anxiety disorder, social phobia, panic disorder and
vasomotor symptoms. A recent study showed that Venlafaxine lowers brain neurotransmitter
metabolite levels by decreasing brain neurotransmitters turnover. Venlafaxine could correct

the disorder of neurotransmitters' metabolism and coordinate the balance of 5-HT, NE and
DA to reach the anti-depressed function (Fenli et al., 2013).
At low doses (<150 mg/day), Venlafaxine acts only on the serotonergic transmission.
At moderate doses (>150 mg/day), it acts on both the serotonergic and noradrenergic
systems, whereas at high doses (>300 mg/day), it also affects the dopaminergic
neurotransmission (Redrobe et al., 1998). 92% of the oral dose of venlafaxine is absorbed
into the systemic circulation and is metabolized in the liver by the
CYP2D6 isoenzyme to Desvenlafaxine, which is just as potent as the parent compound.
The primary route of excretion of venlafaxine and its metabolites is via the kidneys.
Venlafaxine is a phenylethylamine derivative which facilitates neurotransmission in

the brain by blocking presynaptic reuptake of serotonin and noradrenaline. In patients with
Major Depression, 75 to 375 mg/day administered for 6 weeks was significantly effective
and coparable to Imipramine, Clomipramine, Trazodone or Fluoxetine. But unlike the
tricyclic antidepressants it does not appear to significantly affect cardiac conduction
(Holliday and Benfield, 1995). In animal models of depression, it was found to be effective
in decreasing the period of immobility in the forced swim test at 8, 16, 32 and 64 mg/kg
body weight (Redrobe et al., 1998).
Several clinical trials and efficacy studies with placebo-controlled trials have used a
wide range of doses (25 - 375 mg/day) and different dose regimens. These studies clearly
establish that venlafaxine is significantly more effective than placebo, which was observed
on the Montgomery- Asberg Depression Rating Scale (MADRS), after 4 days of
treatment in the in-patient study and after 1 week of treatment in the out-patient study
(Mendlewicz, 1995).
Data from eight comparable randomised, double-blind studies of Major depression

were pooled to compare the remission rates between Venlafaxine, Fluoxetine, Paroxetine,
Fluoxamine and placebo. The studies showed that Venlafaxine showed significant increase
in remission rates at 2 weeks, which was significantly higher than that with an SSRI
(Thase et al., 2001).
Another study investigated the effect of orally administered venlafaxine (20 mg/kg
body weight) on lipid peroxidation and antioxidant levels in the brain cortex, medulla and
erythrocytes of Male Wistar rats. The study showed that induction of depression resulted in
significant decrease in Glutathione peroxidase activity and Vitamin C concentrations in the
brain cortex and a significant increase in the lipid peroxidation levels. This was found to be
effectively modulated by Venlafaxine treatment, which suggested that Venlafaxine may also
play a role in preventing oxidative stress (Eren et al., 2007a).
EFFECTS OF VENLAFAXINE TREATMENT IN THE CUMS MODEL
A recent study reported the effect of venlafaxine on the levels of monoamine

neurotransmitters in the brain tissue of Sprague-Dawley rats induced with depression using
the CUMS protocol. They found that venlafaxine could regulate the metabolism of the
neurotransmitters and coordinate the balance between Serotonin (5-HT), Norepinephrine
(NE) and Dopamine (DA) to reach the antidepressed state (Fenli et al., 2013).
An earlier study showed that chronic administration of venlafaxine increased

the BDNF mRNA levels in the rat hippocampus (Czubak et al., 2009). Another recent study
reported a dose-related increase in the expression of p-CREB and BDNF mRNA in the rat
hippocampus (Li et al., 2011). Another study reported that venlafaxine treatment reduced
the production of free radicals in the brain and medulla of depression-induced rats
signifying the role of oxidative stress in depression (Eren et al., 2007a).
Materials and Methods
4
MATERIALS AND METHODS
CHEMICALS AND KITS
The following brands of chemicals/reagents/kits/consumables were used;
1. BD Vacutainer Cell Preparation Tube with Sodium Heparin from Becton Dickinson
and Company, USA.
2. Ficoll-paque from GE Healthcare companies, Sweden.
3. Histopaque 1077, DNase I kit, Sybr Green Jumpstart Taq ready mix, Bradford
reagent, TRI reagent, Tryphan blue, MOPS, DEPC, Agarose, Tris, NP40, Sodium
orthovanadate and other fine chemicals from Sigma-Aldrich, USA.
4. STAR phospho-GSK 3 β (Tyr 216) ELISA kit, RT-PCR kit, Western blotting kit and
RIPA buffer from Millipore, USA.
5. Phospho-CREB (Ser133) InstantOne ELISA kit from eBioscience, Inc, USA.
6. Aurum Total RNA mini kit and iScript Select cDNA synthesis kit from Bio-Rad
Laboratories, Inc, USA.
7. RT-PCR kit from Aristogene Biosciences Pvt Ltd, India.
8. Primary antibodies for Western blotting from Santa Cruz Biosciences, USA.
9. General laboratory plasticware from Falcon, Corning and Eppendorf were used.
TABLE 1: LIST OF INSTRUMENTS USED
S. No Instrument name & Model Manufacturer

1. Eppendorf centrifuge 5810R Eppendorf AG, Germany
2. Clean Air CAB1200 Clean Air Systems, India
3. Leica DFC 295 Leica Microsystems, Germany
4. Eppendorf centrifuge 5415R Eppendorf AG, Germany
5. Clean Air CAFH1200 Clean Air Systems, India
6. Varioskan Flash Thermo Fischer Scientific Inc, USA
7. NanoDrop 2000 Thermo Fischer Scientific Inc, USA
8. SynGene G: BOX Synoptics Ltd, UK
Real time PCR Detection System
9. Bio-Rad Laboratories Inc, USA
CFX96 Touch
Eppendorf Mastercycler epGradient
10. Eppendorf AG, Germany
S cycler with controller
11. Horizontal Electrophoresis unit Medox, India
12. Power pack for Electrophoresis unit Bio Tech, India
13. Electronic balance AUY220 Shimadzu, USA
14. SPINIX Vortex Shaker 3001 Tarsons Products Pvt Ltd,
15. Thermo-mixer comfort (1.5 mL) Eppendorf AG, Germany
16. LG intellocook microwave oven LG
LG Frost-free refrigerator GL-305
17. LG
VM5/2009
18. COLD ROOM BLUESTAR
19. Ice-maker CRYOTECH FM-120EE Hoshizaki Europe Ltd, EU
20. Labline Autoclave Labline
21. Milli-Q water purification system Millipore
*Instruments used for the work are those present in the PSG Centre for Molecular Medicine
& Therapeutics, Peelamedu, Coimbatore – 641004, India.
PART A
EFFECT OF VENLAFAXINE TREATMENT IN DEPRESSION-INDUCED

MALE WISTAR RATS
PHASE I
1. Animal ethical clearance and procurement of animals
2. Grouping of animals
3. Induction of depression using stress protocol (CUMS protocol)
4. Assessment of depression
5. Administration of Venlafaxine
6. Blood collection by cardiac puncture
7. Harvesting of the hippocampus
PHASE II
BIOCHEMICAL STUDIES
1. Estimation of total protein

2. Analysis of Enzymic antioxidants
3. Catalase (CAT)
4. Glutathione peroxidase (GPx)
5. Superoxide dismutase (SOD)
6. Analysis of Non-enzymic antioxidants
7. Vitamin C
8. Lipid peroxidation
PHASE III
1. Histopathological analysis of brain hippocampus

2. Isolation of total protein from PBMC and hippocampus using RIPA buffer
and quantification using UV spectroscopy
3. SDS-PAGE of total proteins
4. Western blotting using anti-GSK-3β and anti-CREB antibodies
PHASE IV
1. Isolation of total RNA from whole blood and hippocampus using TRI
reagent and quantification using UV spectroscopy
2. Cleaning total RNA and quantification using UV spectroscopy
3. First strand Synthesis
4. PCR Analysis of bdnf, bcl2a1 and g3pdh cDNA and measurement of
increase in PCR products using UV spectroscopy
5. Agarose gel Electrophoresis of the PCR products
PART B
EFFECT OF VENLAFAXINE TREATMENT IN DRUG NAIVE PATIENTS

DIAGNOSED WITH MAJOR DEPRESSION
PHASE I
1. Procurement of Human ethical clearance
2. Identification and Selection of Depressive patients and healthy subjects using

Hamilton Depression Rating Scale or other standard methods by Dr.
Raghuthaman. G, Psychiatrist, PSG-IMS & R, Coimbatore.
3. Obtaining consent, recruitment of the patients and healthy volunteers (subjects)

and prescription by Dr. Raghuthaman G, Chief Psychiatrist, PSG-IMS & R,
Coimbatore.
4. Collection of blood sample(s) from the study subjects by PSG-IMS & R

laboratory personnel [healthy individuals and drug naive patients and at the end
of 10 weeks Venlafaxine treatment (i.e., Venlafaxine XR 35mg/day for the initial
2 weeks and Venlafaxine XR 225mg/day for 8 weeks)].
PHASE II
1. Isolation of Peripheral Blood Mononuclear Cells (PBMC).
2. Measurement of p-GSK 3 β in PBMC lysates using ELISA.
3. Measurement of p-CREB in PBMC lysates using ELISA.
PHASE III
1. Isolation of total RNA from whole blood using TRI reagent.
2. Cleaning the total RNA using RNA spin columns.
3. First strand Synthesis.
4. mRNA expression studies of bdnf, bcl2a1 and hprt gene by Real Time PCR
analysis.
PART C
HOMOLOGY MODELLING AND DOCKING STUDIES OF NEUROTROPHINS

WITH THEIR RESPECTIVE TRK RECEPTORS
1. Retrieval of the protein sequences from UniProtKB
2. Identification of templates using BLASTp
3. Secondary structure prediction
4. Signal peptide and pro-peptide prediction
5. Transmembrane region prediction for the Trk sequenceS
6. Homology modelling of the target proteins
7. Model validation
8. Molecular docking studies
9. Comparison of the modelled structures with the crystal structures of related
molecules
PART A
PHASE I
PROCUREMENT OF ANIMALS
Wistar Male albino rats of 120 ± 20 g procured from the Animal Facility, PSG IMS
& R were used for the study. The animals were maintained under standard laboratory
condition with controlled temperature and humidity where they were allowed to get
acclimatized to standard laboratory diet and water for the first week. The animals were
maintained at constant room temperature with a 12 hour day and night cycle.
EXPERIMENTAL SET UP
The experimental animals were divided into 4 groups of 6 animals each.
Group I : Normal Control
Group II : Depression induced
Group III : Treatment with Venlafaxine low dose (16 mg/kg body weight)
Group IV : Treatment with Venlafaxine high dose (32 mg/kg body weight)
INDUCTION OF STRESS BY CHRONIC UNPREDICTABLE MILD STRESS

(CUMS) PROTOCOL (Nirmal et al., 2008)
1. Food deprivation for 24 hrs
2. Day – night reversal (0600 hrs – 1800 hrs)
3. Soiled bedding (~ 150 mL water per cage of) for 22 hrs
4. Cage tilting (~ 45° inclined) for 22 hrs
5. Crowded housing (10 animals per cage) for 12 hrs
6. Exposure to a novel odour (household air freshner) for 12 hrs
7. Restraint stress for 20 minutes
8. Cold stress (4° - 8°C) and heat stress (38° - 39°C) for 20 minutes
TABLE 2 : PROTOCOL FOR STRESS INDUCTION
Week Day Stressor Remarks

1 Food deprivation for 24 hrs* Only water provided
2 Cold stress for 20 minutes 4° - 8°C
3 Day – night reversal 0600 hrs – 1800 hrs
1st 4 Cage tilting for 22 hrs ~ 45° inclined
5 Exposure to a novel odour for 12 hrs Household air freshner
6 Heat stress for 20 minutes 38° - 39°C
7 Soiled bedding for 22 hrs ~ 150 mL water per cage
9 Crowded housing for 12 hrs 10 animals per cage
10 Cage tilting for 22 hrs ~ 45° inclined
nd
2 11 Cold stress for 20 minutes 4° - 8°C
13 Restraint stress for 20 minutes
14 Heat stress for 20 minutes 38° - 39°C
16 Restraint stress for 20 minutes
3rd 18 Crowded housing for 12 hrs 10 animals per cage
19 Soiled bedding for 22 hrs ~ 150 mL water per cage
20 Cage tilting for 22 hrs ~ 45° inclined
21 Food deprivation for 24 hrs* Only water provided
* During food deprivation, the animals were provided with water and for all other stressors
both food and water was provided.
BEHAVIOURAL ASSESSMENT
1. Behavioural despair test (Forced Swim test): The rats were allowed to swim
individually in a chamber (45 x 12 x 45 cm) containing fresh water (25 ± 2°C), of height
35 cm, such that the rat could not touch the bottom of the cylinder with its limb or tail or
climb over the edge of the chamber. Two swim sessions were conducted, an initial
15 minute pre-test followed by a 6 minute test, 24 hrs later. The period of immobility
after an initial 2 – 3 minute period of vigorous activity was recorded. A rat was
considered immobile when it remained floating in the water without struggling, making
only minimum movements to keep its head above water. The total duration of
immobility was recorded during the next 4 minutes of the total 6 minute long test. The
rats were then allowed to dry in a pre-warmed enclosure (~32°C) before being returned
to their cages (Porsolt et al., 1978).
2. Sucrose consumption test: During this test, mice were given, for 24 h, a free choice
between two bottles, one with 1% sucrose solution and another with tap water. To
prevent possible effects of side preference in drinking behaviour, the positions of the
bottles were switched after 12 h. No previous food or water deprivation was applied
before the test. The consumption of water and sucrose solution was estimated
simultaneously in control and experimental groups by weighing the bottles. The sucrose
intake was calculated as an amount of consumed sucrose in mg/g body weight. The
preference for sucrose was calculated as a percentage of consumed sucrose solution of
the total amount of liquid drunk (Vogel et al, 1990; Moreau et al, 1992; Willner, 1997).
COLLECTION OF SERUM AND BRAIN TISSUES
REAGENTS – APPENDIX I
At the end of the treatment period (21 days), the animals were anesthetized under
mild chloroform. Blood was collected by cardiac puncture and the serum was separated by
centrifugation at 2500 rpm for 15 minutes. The whole brain was excised immediately and
thoroughly washed in ice cold saline before use. The whole brain was used for
histopathological study, 100 mg of the hippocampal tissue was used for RNA isolation and
protein isolation each, and the remaining brain tissue was used for the various biochemical
assays.
PREPARATION OF TISSUE HOMOGENATE
REAGENTS – APPENDIX II
A 10% homogenate of the washed animal tissue was prepared using 0.1M cold Tris-
HCl buffer (pH 7.4) in potter homogenizer fitted with a Teflon plunger running at 600
revolutions per minute for 4 minutes. The homogenate was used for various biochemical
assays.
SEPARATION OF PBMC FROM BLOOD SAMPLES USING FICOLL-PAQUE

DENSITY GRADIENT CENTRIFUGATION (Boyum, 1968)
PRINCIPLE
Human Mononuclear cells and platelets have a lower density than Ficoll-Hypaque
(1.077 g/L) and are separated from higher density granulocytes and red blood cells when
centrifuged after either under or overlaying the diluted blood on the Ficoll-Hypaque layer.
REAGENTS – APPENDIX III
PROCEDURE
The blood sample was collected into blood collection tubes containing EDTA or
heparin. In the Class II biosafety cabinet, the blood was transferred into a 50 ml tube and
diluted in 1:1 ratio with sterile saline. The diluted blood was carefully layered over Ficoll
medium in another 50 ml tube and centrifuged at 1500 rpm for 30 min, at 20°C, without
acceleration and brakes. Carefully removed the tubes from the centrifuge without disturbing
the layering. The PBMCs present in the whitish layer was carefully aspirated using a Pasteur
pipette into a 15 ml tube (Discarded the remainder Ficoll and red blood cells in closed
tubes). The volume was made up to 15 ml with sterile saline and centrifuged at 1500 rpm
for 10 min at 20°C, with acceleration 9 and deceleration 9. This was done to wash the
PBMCs of any contaminating Ficoll or platelets or RBCs. The washing step was repeated
until the pellet became cream coloured. After washing, the pellet was re-suspended in 10 ml
of sterile Saline for the subsequent procedures.
VIABLE CELL COUNT USING TRYPAN BLUE (Strober, 2001)
PRINCIPLE
The Trypan Blue Exclusion Test of Cell Viability is used to determine the number
of viable cells present in a cell suspension. It is based on the principle that live cells possess
intact cell membranes that exclude certain dyes, such as trypan blue, whereas dead cells do
not.
REAGENTS – APPENDIX IV
PROCEDURE
10 µl of 0.4% Trypan blue was taken in a round-bottom microtiter well plate under
the Class II Biosafety cabinet. 10 µl of the PBMC suspension was added and mixed with the
trypan blue solution by pipetting up and down. 10 µl of this mixture was then loaded on to
the haemocytometer and observed under microscope. The viable cells present in the four
WBC squares were counted and their average value was used to calculate the total number
of viable cells using the formula
Total no. of viable cells = Avg. of 4 squares x 2 x 104 x dilution factor
ISOLATION OF TOTAL PROTEINS FROM PBMC AND HIPPOCAMPUS USING

RADIO-IMMUNOPRECIPITATION ASSAY (RIPA) BUFFER
PRINCIPLE
Extraction of cellular proteins requires efficient cell lysis and protein solubilisation,
while avoiding protein degradation and/or interference with protein immunoreactivity and
biological activity.
RIPA Buffer enables rapid, efficient cell lysis and solubilisation of proteins
from both adherent and suspension cultured mammalian cells. It has long been a widely
used lysis and wash buffer for small-scale affinity pull-down applications, such as
immunoprecipitation, since most antibodies and protein antigens are not adversely affected
by the components of this buffer. In addition, RIPA Buffer minimizes non-specific protein-
binding interactions to keep background low, while allowing most specific interactions to
occur, enabling studies of relevant protein-protein interactions.
REAGENTS - APPENDIX V
PROCEDURE
To the cell pellet added an appropriate volume of RIPA Buffer (1 ml per 0.5 - 5 x
107 cells). Mixed or vortexed briefly to resuspend the cells completely and incubated at
2 – 8 °C for five minutes. Vortexed briefly to resuspend and lyse the residual cells and
clarified the lysate by centrifugation at 8000 g for 10 minutes at 4 °C to pellet the cell
debris.
Note: Mucoid aggregates if found were carefully removed with a micropipette before
centrifugation.
Carefully transferred the supernatant containing the soluble protein to a sterile
Eppendorf tube for use in SDS-PAGE and consequent Western blot analysis otherwise the
lysate was quickly frozen under liquid nitrogen and stored at –70 °C until further use.
UV QUANTIFICATION OF TOTAL PROTEIN

PRINCIPLE
Most biological molecules do not intrinsically absorb light in the visible range, but
they do absorb ultraviolet light. UV absorbance is used to quickly estimate the concentration
and purity of DNA, RNA and proteins in a sample. Proteins have two absorbance peaks in
the UV region, one between 215-230 nm, where peptide bonds absorb, and another at about
280 nm due to light absorption by aromatic amino acids (tyrosine, tryptophan and
phenylalanine). Although proteins have little absorbance at 260 nm, both proteins and
nucleic acids absorb light at 280 nm. Therefore, if nucleic acids and proteins are mixed in
the same sample, their spectra interfere (overlap) with one another. Determining
concentration in a “pure” sample containing only proteins or nucleic acids, involves
constructing a standard curve.
It is possible to determine the concentration of nucleic acids or proteins based on

their absorbance at a wavelength of 260 nm or 280 nm respectively. A calibration curve
using standards of known concentration can be constructed. For accurate results, the
standard curve should be prepared using the protein of interest or that which is similar to the
sample being measured. Depending on the protein, UV analysis of proteins at 280 nm has a
linear range from about 0.1 - 5 mg/mL.
The values of average absorptivity constants for proteins vary. A very rough rule is
that if a sample containing pure protein has an absorbance of 1 at 280 nm, then it contains
approximately 1 mg/mL of protein. It is possible to use UV spectrophotometry to estimate
the purity of a solution of protein. This method involves measuring the absorbance of the
solution at two wavelengths, usually 260 nm and 280 nm, and calculating the ratio of the
two absorbances, where an A260/A280 ratio of about 0.6 is characteristic of pure proteins.
REAGENTS – APPENDIX VI
PROCEDURE
Using a set of standard protein (Bovine serum albumin) solution, a calibration curve
using standards of known concentration was constructed at 260 nm. The sample solution
was measured at 260 nm and interpolated with the calibration curve to obtain the protein
concentration. The purity of the protein solution was assessed by measuring the absorbance
at 280 nm and applying the formula given above.
WESTERN BLOTTING FOR GSK3Β AND CREB PROTEINS USING GeNei

WESTERN BLOTTING KIT (Towbin et al., 1979) (Cat No. 626102100011730)
PRINCIPLE
Western blotting is a rapid and sensitive assay for detection and characterisation of
proteins. The technique exploits the inherent specificity of antigen-antibody interaction to
identify specific antigens (proteins). Sodium Dodecyl Sulphate – Polyacrylamide Gel
Electrophoresis (SDS – PAGE) is carried out in a discontinuous buffer system wherein the
reservoir buffer is of a different pH and ionic strength from the buffer used to cast the gel.
The SDS – polypeptide complexes in the sample applied to the gel are swept along by a
moving boundary created when an electric current is passed between the electrodes. After
migrating through the stacking gel of high porosity, complexes get deposited in a very thin
zone on the surface of the resolving gel of low porosity. On further electrophoresis, the
polypeptides get resolved based on their molecular size.
The resolved proteins are then transferred from the gel onto the surface of a
nitrocellulose membrane by electroblotting. In this technique, the gel is placed in contact
with a nitrocellulose membrane which is then sandwiched between filter papers, two porous
pads and two plastic supports. The entire set up is then placed in an electrophoretic tank
containing the blotting buffer. The protein bands are transferred to the corresponding
position on the membrane as they are resolved in the gel, forming a mirror image. The
specific protein of interest can be further localized by immunodetection using specific
antibodies. It initially involves blocking the unoccupied sites on the membrane using a
suitable blocking agent. The membrane is then probed with the primary antibody which is
specific to the protein of interest. The antigen – antibody complex formed on the membrane
is then detected using an enzyme – labelled secondary antibody and a suitable substrate for
the enzyme, which results in a coloured band on the nitrocellulose membrane.
REAGENTS – APPENDIX VII

PROCEDURE
Performed SDS – PAGE on the samples to be analyzed, loading 20 µg of total
protein per lane. The protein bands were then transferred onto the Nitrocellulose membrane
using the electroblotting apparatus at 50 V for 2 hours. The membrane was carefully
removed with the help of forceps and placed in 10 mL of freshly prepared blocking buffer
overnight at 4ºC.
Discarded the blocking buffer, immersed the blot in 10 mL of the primary antibody
solution and mixed gently for 30 minutes. Discarded the primary antibody solution and
immersed in 10 mL of the wash buffer for 3 – 5 minutes; this was performed twice to
remove any unbound primary antibodies. Immersed the membrane in 10 mL of 1X HRP
conjugate and mixed gently for 30 minutes. Discarded the HRP conjugate and immersed in
10 mL of the wash buffer for 3 – 5 minutes. The wash was repeated 4 – 5 times to ensure
complete removal of any residual HRP conjugate. Immersed the blot in 10 mL of 1X
TMB/H2O2 (Substrate) solution and mixed gently for 5 – 10 minutes. A violet-blue coloured
band was observed. Discarded the substrate solution, washed with sterile distilled water and
dried the membrane. To prevent fading of the bands, the membrane was stored in the dark.
The bands on the membrane were compared with the SDS-PAGE image obtained. The blots
were visualized using a Gel documentation unit and the image at 300 dpi was stored as a
.tiff image file. The intensity of the bands were then measured densitometrically for
quantitative analysis.
TOTAL RNA ISOLATION FROM WHOLE BLOOD AND TISSUE USING TRI
REAGENT (Chomczynski and Sacchi, 1987)
PRINCIPLE
The TRI Reagent is a quick and convenient reagent for the simultaneous isolation of
RNA, DNA, and protein, which is done by a single-step liquid phase separation. This
procedure is an improvement of the single-step method reported by Chomczynski and
Sacchi for total RNA isolation. The TRI Reagent is a mixture of guanidine thiocyanate and
phenol in a monophase solution, which effectively dissolves DNA, RNA, and protein on
homogenization or lysis of tissue sample. After adding chloroform or 1-bromo-3-
chloropropane and centrifuging, the mixture separates into 3 phases: an aqueous phase
containing the RNA, the interphase containing DNA, and an organic phase containing
proteins. Each component can then be isolated after separating the phases. The resulting
RNA is intact with little or no contaminating DNA and protein.
REAGENT – APPENDIX VIII

PROCEDURE
For the isolation of total RNA from tissues, 1.0 ml of TRI reagent was added
aseptically to 100 mg of tissue and homogenized after a 10 minute incubation period on ice.
Alternatively, for soft tissues a simple vortex step was be sufficient. The mixture was then
centrifuged at 12,000 g for 10 minutes at 4°C; the supernatant was then transferred to a fresh
Eppendorf tube and added 0.2 ml of Chloroform, vortexed for 15 seconds and allowed to
stand on ice for 10 minutes. Centrifuged the tubes at 12,000 g for 10 minutes at 4°C, the
mixture separated into three phases from which the aqueous phase was carefully aspirated
into a fresh eppendorf tube, without disturbing the interphase containing DNA. Added 500
µl of ice-cold Isopropanol and vortexed, placed on ice for 10 minutes.
Centrifuged at 12000 g for 10 minutes at 4°C and discarded the supernatant. To the
RNA pellet 1.0 ml of ice-cold 75% ethanol was added to wash off any remaining TRI
reagent. Mixed well by vortexing and then centrifuged at 7500 g for 10 minutes at 4°C and
decanted the supernatant. Quick-spin at 12000 g for 30 seconds at 4°C, to drive the
remaining fluid to the bottom of the tube. The pellet was dried completely by inverting over
a paper towel and then was dissolved in 20 – 25 µl of DEPC treated water (All the steps
were carried out in ice).
For the isolation of total RNA from whole blood, an initial RBC lysis procedure was
performed to obtain the WBCs, which were then processed using the TRI reagent to obtain
the total RNA. To 1.0 ml of the whole blood sample, added 1.0 ml of 1X RBC Lysis Buffer,
mixed well and allowed to stand at room temperature for 10 minutes. Centrifuged at 600 g
for 10 minutes at 4o C and decanted the supernatant. This procedure was repeated until a
creamy coloured WBC pellet was obtained. To the WBC pellet added 0.5 ml of TRI reagent
and 0.1ml of Chloroform (CHCl3) and vortexed for 15 seconds and allowed to stand on ice
for 10 minutes. This was a convenient stage for overnight or 24 hr storage at -70°C.
Centrifuged the tubes at 12,000 g for 10 minutes at 4°C, the mixture separated into
three phases from which the aqueous phase was carefully aspirated into a fresh eppendorf
tube, without disturbing the interphase containing DNA. Added 250 µl of ice-cold
Isopropanol and vortexed, placed on ice for 10 minutes.
Centrifuged at 12000 g for 10 minutes at 4°C and discarded the supernatant. The
RNA pellet was then washed in a similar fashion as that described for that of tissue RNA
isolation. The dried pellet was then dissolved in 20 – 25 µl of DEPC treated water.
UV QUANTIFICATION OF TOTAL RNA

PRINCIPLE
The concentration of an RNA or DNA sample can be checked by the use of UV
spectrophotometry. Both RNA and DNA absorb UV light very efficiently making it possible
to detect and quantify either at concentrations as low as 2.5 ng/µl. The nitrogenous bases in
nucleotides have an absorption maximum at about 260 nm. Using a 1 cm light path, the
extinction coefficient for nucleotides at this wavelength is 20. Based on this extinction
coefficient, the absorbance at 260 nm in a 1 cm quartz cuvette of a 40 µg/ml solution of
single stranded RNA will be equal to 1. The concentration of the RNA in the sample can be
calculated as follows:
RNA concentration (µg/ml) = (OD 260) x (dilution factor) x (40 µg RNA/ml)/(1 OD260 unit)
PROCEDURE
The RNA sample was diluted appropriately and taken in a quartz cuvette and its
absorbance at 260 nm was recorded. The amount of RNA present was calculated using the
formula given above.
CLEANING TOTAL RNA USING DEOXYRIBONUCLEASE I (DNASE I)

(Huang et al., 1996)
PRINCIPLE
DNase I is an endonuclease isolated from bovine pancreas that digests double and
single stranded DNA into oligo and mononucleotides. Amplification Grade DNase I has
been purified to remove RNase activity, and is suitable for eliminating DNA from RNA
preparations prior to sensitive applications, such as RTPCR (Reverse Transcriptase –
Polymerase Chain Reaction). No current RNA isolation procedure removes 100% of the
DNA. Because PCR can detect even a single molecule of DNA, RNA samples should be
digested with DNase I before RT-PCR, and parallel reactions should be run without adding
reverse transcriptase to check for amplification of contaminating DNA.
REAGENTS – APPENDIX IX
PROCEDURE
To an RNase-free PCR tube added 8.0 mL of RNA, 1.0 mL of 10X Reaction Buffer
and 1.0 mL of DNase I. Prepared duplicate tubes for reactions with and without reverse
transcriptase. Mixed gently and incubated for 15 minutes at room temperature. Added 1.0
mL of Stop Solution to bind Calcium and Magnesium ions and to inactivate the DNase I.
Heated at 70°C for 10 minutes to denature both the DNase I and the RNA and chilled on
ice.
Note: The Stop Solution (50 mM EDTA) was added before heating to prevent metal
(Mg/Ca) ion catalysed hydrolysis of the RNA.
SYNTHESIS OF cDNA – REVERSE TRANSCRIPTION PCR (M-MuLV RT-PCR)
Principle
Mature (fully spliced) mRNA is used as a template for preparing cDNA by reverse
transcriptase, an RNA dependent DNA polymerase. It acts on a single strand of mRNA, the
template thereby producing complementary DNA based on the pairing of RNA base pairs.
This enzyme executes reactions in the same way as DNA polymerase. It also requires a
primer with a free 3’-hydroxyl group. For transcribing RNA with secondary structures,
reverse transcriptase with high temperature performance is recommended.
Two step RT PCR kit allows the researcher the flexibility of independently carrying
out these two reactions; therefore multiple targets can be detected from a single cDNA
sample by use of multiple primer sets. Transcripts can be detected from 100 ng to 1 µg of
total RNA and from 100 pg to 100 ng of mRNA. Optimal designing of gene specific primers
allows higher specificity and sensitivity of reaction.
REAGENTS - APPENDIX X
PROCEDURE
First Strand cDNA Synthesis
The Total RNA were thawed on ice along with the oligo dT and/or Random
hexamer, dNTP mix and the 5X Assay Buffer at room temperature (20 - 25°C). The reaction
mixture for annealing was set up as shown below in Table 3.
TABLE 3: REACTION MIXTURE FOR ANNEALING
Components Volume (μl)
Total RNA (500 ng) 5μl

Oligo dT primer 1 μl
Nuclease free water 4 μl
Total Volume 10 μl
The contents were mixed well and incubated at 65°C for 10 minutes followed by
incubation at 32°C for 2 minutes. For the reverse transcription reaction, to both the Control
and test reactions, the following components were added in the order given in Table 4.
TABLE 4: REACTION MIXTURE FOR FIRST STRAND CDNA SYNTHESIS
Component Volume (µl)

RNasin 1.0
100mM DTT 1.0
5X Assay Buffer for M-MuLV RT 4.0
30mM dNTP mix 2.0
MMuLV Reverse Transcriptase 1.0
Nuclease Free Water 1.0
Total volume 20
The contents were mixed well and incubated at 37°C for 1 hour in dry bath and
incubated at 94°C for 2 minutes. The tubes were placed on ice and spun briefly to denature
RNA – cDNA hybrids. This was followed by the PCR amplification of the RNA – cDNA
hybrids.
Note: All the components required for PCR amplification were set on ice.
The Taq DNA polymerase was diluted to 1U/µl concentration using the dilution
buffer for Taq DNA Polymerase provided in the kit (i.e. 1 volume of Taq DNA Polymerase
and 2 volumes of dilution buffer for Taq DNA Polymerase). The components were added in
a 0.2 ml PCR vial in the order given in Table 5.
TABLE 5: REACTION MIXTURE FOR PCR AMPLIFICATION
Component Volume (µl)
Nuclease free water 18.5
10X Assay Buffer for Taq

2.5
DNA Polymerase
30Mm dNTP Mix 0.5
Forward primer 0.5
Reverse primer 0.5
cDNA product 2.0
Taq DNA Polymerase 0.5
Total volume 25
The components of the PCR reaction were mixed thoroughly and the following
protocol given in the Table 6 was set up in the Thermal cycler.
TABLE 6: PCR PROTOCOL
Control Temperature Time

Initial denaturation 94°C 2 minutes
30 CYCLES
Denaturation 94°C 45 secs
Annealing 52°C 30 secs
Extension 72°C 1 minute
Final Extension 72°C 5 minutes
4°C α (forever)
For the samples optimized the PCR cycle conditions. If cycle conditions are identical
to the Control Reaction the amplification can be carried out in a single run. The number of
cycles required is dependent on the abundance of the original target RNA. Usually 25 – 30
cycles would be adequate. The synthesized cDNA was screened using 0.8% agarose gel
electrophoresis and stored at -20oC for further use.
AGAROSE GEL ELECTROPHORESIS
PRINCIPLE
Agarose gel electrophoresis is based on the ethidium bromide fluorescent staining of

nucleic acids. The nucleic acid molecules separate by applying an electric field which
moves the negatively charged molecules through the agarose matrix. Smaller fragments
move faster than larger fragments because the smaller fragments migrate more easily
through the pores of the gel which can be viewed by using ethidium bromide (a fluorescent
dye) intercalates between the stacked bases. The quality of nucleic acids (DNA and RNA)
can be estimated by comparing the fluorescent yield of the samples with a series of
standards such as the 100 bp or 1kb DNA ladder.
REAGENTS - APPENDIX XI
PROCEDURE
Agarose (0.8%) was dissolved in 50 mL distilled water containing 1X TAE and

melted in an oven. The agarose solution was cooled to 45ºC and to this 2.0 µL of Ethidium
bromide (20 mg/mL) was added and the solution was poured into the casting tray with the
comb placed in it and was allowed to solidify.
The 2X gel loading dye was added to the PCR product which in turn was loaded on
the gel (5 – 10 µl) and the submarine electrophoresis unit was run at 40V/100mA with an
appropriate DNA ladder/marker till the dye migrated to a sufficient distance in the gel. The
cDNA was then visualised using a UV transilluminator and was documented using a gel
documentation system.
PHASE II
BIOCHEMICAL ANALYSIS
1. ESTIMATION OF PROTEIN (Lowry et al., 1957)
PRINCIPLE
The aromatic amino acids tyrosine and tryptophan present in the protein react with
the phosphomolybdic acid and phospho tungstic acids present in the Folin’s Ciocalteau
reagent to produce a dark blue colour. Along with this the colour developed by the biuret
reaction of the protein with the alkaline cupric tartarate was read colorimetrically at 660 nm.
REAGENTS - APPENDIX XII
PROCEDURE
Into a series of test tubes taken 0.2, 0.4, 0.6, 0.8 and 1.0 ml of the working standard
protein solution corresponding to 40 to 200 µg and the final volume was made up to 1.0 ml
with distilled water. 1.0 ml of distilled water served as the reagent blank. 0.1 ml of the test
solution (PBMC lysate/tissue homogenate) was taken and the volume was made up to 1.0
ml with distilled water. To all the tubes added 5.0 ml of alkaline copper reagent, mixed well
and allowed to stand for 10 minutes. To this added 0.5 ml of Folin’s Ciocalteau reagent,
mixed well and incubated at room temperature in the dark for 40 minutes. The blue colour
developed was read at 640 nm against the reagent blank. A standard graph was plotted and
the concentration of the test solution was calculated.
2. ENZYMIC ANTIOXIDANTS
2.1 ESTIMATION OF SUPEROXIDE DISMUTASE (Marklund and Marklund, 1974)
PRINCIPLE
Superoxide dismutase (SOD) activity was estimated using a modified method of

Marklund and Marklund with some modifications. This method utilizes the inhibition of
auto-oxidation of pyrogallol by SOD enzyme.
REAGENTS - APPENDIX XIII

PROCEDURE
1.0 mL of the tissue homogenate was centrifuged at 12,000 rpm at 4ºC for
20 minutes and the clear supernatant was taken for measurement. The reaction mixture
consisted of 100 μL of the supernatant, 0.05 mL of pyrogallol solution, and the volume was
made up to 2.5 mL with Tris-HCl buffer. The absorbance was read at 420 nm against
reagent blank. A unit of enzyme was defined as the amount of enzyme, which inhibits the
auto oxidation reaction by 50%. Specific activity was expressed as units/mg of protein.
2.2 ESTIMATION OF CATALASE (CAT) (Sinha, 1972)
PRINCIPLE
Catalase causes rapid decomposition of hydrogen peroxide in water
This method is based on the fact that dichromate in acetic acid is reduced to chromic
acetate when heated in the presence of H2O2 with the formation of perchloric acid as an
unstable intermediate. The chromic acetate thus produced was measured colorimetrically
at 610 nm.
REAGENTS - APPENDIX XIV
PROCEDURE
Catalase was assayed colorimetrically at 620 nm and expressed as µmoles of

hydrogen peroxide (H2O2) consumed/minute/mg of protein as described by Sinha in 1972.
The reaction mixture contained 1.0 ml of 0.01 mol/l phosphate buffer (pH 7.0), 0.1 ml of
test solution (PBMC lysate/tissue homogenate) and 0.4 ml of 2 mol/ H 2O2. The reaction was
stopped by the addition of 2.0 ml of dichromate-acetic acid reagent.
2.3 ESTIMATION OF GLUTATHIONE PEROXIDASE (Ellman, 1959)
PRINCIPLE
Glutathione peroxidase catalyses the following reaction:
2GSH + H2O2 GSSH + 2H2O
The amount of Glutathione present was measured by its reaction with DTNB to
give a compound that absorbs at 412 nm.
REAGENTS - APPENDIX XV
PROCEDURE
To 0.4 ml of buffer, 0.2 ml of EDTA, 0.1 ml of sodium azide and 0.2 ml of reduced
glutathione, 0.1 ml of H2O2 were added to two test tubes labeled as test (T) and control (C).
To the test added 0.2 ml of sample and to the control added 0.2 ml of water. The contents
were mixed well and incubated at 37°C for 10 minutes. The reaction was arrested with the
addition of 0.5 ml of 10% TCA. To determine the glutathione content, 1.0 ml of supernatant
was removed by centrifugation. To that 3.0 ml of buffer and 0.5 ml of Ellman’s reagent was
added. The colour developed was read at 412nm.
Standards in the range of 40-200 μg was taken and treated in the similar manner. The
activity was expressed in term of μg of glutathione consumed/min/mg protein.
3. NON-ENZYMIC ANTIOXIDANTS
3.1 ESTIMATION OF ASCORBIC ACID (VITAMIN C) (Omaye et al., 1979)
PRINCIPLE
Ascorbic acid is oxidized by copper to form dehydroascorbic acid and

diketoglutaric acid. These products are treated with 2,4-DNPH to form the derivatives of bis
2,4 dinitrophenyl hydrazene. This compound in strong H2SO4 undergoes a rearrangement to
form a product with an absorption band that is measured at 520nm. The reaction is run in
the presence of thiourea to provide a mildly reducing medium which helps to prevent
interference from non-ascorbic acid chromogens.
REAGENTS - APPENDIX XVI
PROCEDURE
0.1ml of 10% homogenate is precipitated with 5% ice cold TCA and centrifuged for
20 min at 4500 g. 1.0 ml of the supernatant was mixed with 0.2 ml of DTCS reagent and
incubated for 4 hours at 47° C. Then 1.5 ml of ice cold 65% H2SO4 was added, mixed well
and allowed to stand at room temperature for an additional 40 minutes. Absorbance was
determined at 520 nm. The results are expressed as µg/mg protein.
4. ESTIMATION OF LIPID PEROXIDATION (LPO) (Nehius and Samuleson, 1968)

PRINCIPLE
In this method, malonalderhyde and other Thiobarbituraic Acid Reactive Substances

(TBARS) were measured by their reactivity with thiobarbituric acid in acidic condition to
generate a pink coloured chromophore which was read at 545 nm.
REAGENTS - APPENDIX XVII
PROCEDURE
LPO in serum and tissues were estimated colorimetrically by TBARS using the
method of Nehius and Samuelson, 1968. 0.1 ml of tissue homogenate/serum (Tris-HCl
buffer, pH 7.5) was treated with 2.0 ml of (1:1:1 ratio) TBA-TCA-HCl reagent (TBA
47%,TCA 15% and 0.25 N HCl) and placed in a water bath for 15 minutes, cooled and
centrifuged at room temperature for 10 minutes at 1000 rpm. The absorbance of the clear
supernatant was measured against reference blank at 545 nm and expressed as mmol/100g
tissue.
PART B

COLLECTION OF BLOOD SAMPLES
10 ml blood sample was collected twice from the Depressed patients (before and
after treatment) and once from the age and sex-matched healthy control subjects.
METHODS
SEPARATION OF PERIPHERAL BLOOD MONONUCLEAR CELLS (PBMC)

FROM BLOOD SAMPLES USING BD VACUTAINER CELL PREPARATION
TUBE (CPT) WITH SODIUM HEPARINN (Cat # 362753) (Fotino et al., 1971)
PRINCIPLE
It is an evacuated tube system containing sodium heparin anticoagulant and blood
separation media composed of a thixotropic gel and a FICOLL™ Hypaque™ solution. The
tube's internal vacuum allows blood to be drawn in during venepuncture and the Sodium
heparin solution acts as anticoagulant. The blood separation media takes advantage of the
lower density of mononuclear cells and of platelets to isolate them from whole blood. The
separation occurs during centrifugation when the gel portion of the media moves to form a
barrier under the mononuclear cells and platelets; this separates them from the denser blood
components below. Later, additional washing and centrifugation steps reduce the quantity of
platelets present, resulting in a suspension of concentrated mononuclear cells.
REAGENTS – APPENDIX XVIII
PROCEDURE
The BD Vacutainer® CPT™ with Sodium HeparinN was brought to room temperature
and labelled for patient identification. The blood sample was collected using the standard
technique. The blood samples were stored in tubes kept upright at room temperature until
centrifugation (within 2hrs of blood collection). Centrifuged the blood samples at 20° C in a
horizontal rotor (swing-out head), for 30 minutes at 1600 RCF (no brakes and no
acceleration). After centrifugation, the mononuclear cells and platelets present in the whitish
layer just under the plasma layer were aspirated without disturbing the separation, using a
Pasteur Pipette and transferred to a fresh 15 ml Falcon tube. The volume was made up to 15
ml using Sterile Saline and mixed well by inversion.
Centrifuged at 300 RCF for 15 minutes at 20° C, with acceleration 9 and brakes 9.
Discarded the supernatant without disturbing the cell pellet. Re-suspended the cell pellet and
washed once again. Re-suspended the cell pellet in 10 ml sterile Saline for the subsequent
procedure.
CELL LYSIS USING 1X CELL LYSIS MIX PREPARED USING P-CREB

INSTANTONE ELISA KIT
The Cell lysis mix provided in the phospho-CREB (Ser 133) InstantOne ELISA kit
contains a combination of detergents, phosphatase inhibitors, salts and buffers. The 1X Cell
lysis mix was prepared and used for PBMC lysis according to the manufacturer’s protocol.
REAGENTS – APPENDIX XIX

PROCEDURE
From the PBMC suspension, a volume corresponding to 1x106 cells was taken and
centrifuged at 1500 rpm for 10 minutes at 20°C. The supernatant was discarded and added
50μL of 1X cell lysis mix to the cell pellet. Alternatively 10 μL of 5X cell lysis mix could
be added to 40 μL of cells. This was allowed to stand at room temperature for 10 minutes in
a shaker at approximately 300 rpm. The cell lysate thus obtained was used immediately in
the subsequent ELISA techniques.
ASSAY OF TOTAL PROTEIN BY BRADFORD’S METHOD - 96 WELL PLATE

ASSAY PROTOCOL (Bradford, 1976)
PRINCIPLE
The procedure is based on the formation of a complex between the dye, Brilliant
Blue G and the proteins in solution. The protein-dye complex causes a shift in the
absorption maximum of the dye from 465 to 595 nm. Bovine serum albumin (BSA) is used
as the standard protein.
REAGENTS – APPENDIX XX
PROCEDURE
The assay was performed in a 96 well plate as it is possible to quickly assay multiple
protein samples, while using a small sample volume (5 ml). It could also be possible to
automate the technique.
The Bradford Reagent was gently mixed and brought to room temperature. The
protein standards ranging from 0.1 – 1.4 mg/ml were prepared using BSA in sterile saline.
5 µl of the protein standards were sequentially added to separate wells in duplicates in a
96 well plate. 5 µl of sterile saline was taken as blank and 5 µl of the unknown sample were
taken in duplicates in separate wells. Added 250 µl of the Bradford Reagent and mixed on a
shaker for ~30 seconds. Incubated at room temperature for 45 minutes in the dark and
measured the absorbance at 595 nm. The protein-dye complex formed was stable up to
60 minutes. A standard graph was plotted and the protein concentration of the unknown
sample(s) was determined by comparing the net A595 values against the standard curve.
ASSAY OF pGSK-3β USING STAR PHOSPHO-GSK‐3β (Tyr 216) ELISA KIT

(Cat # 17-472)
PRINCIPLE
The STAR (Signal Transduction Assay Reaction) ELISA kit is a solid phase
sandwich enzyme linked immunosorbent assay that provides a fast, sensitive method to
detect specific levels of phosphorylated GSK-3β (Tyr 216) in whole cell extracts. The micro
titre plate is coated with a specific mouse monoclonal GSK-3β capture antibody. The
sample lysate or the standards provided in the kit are incubated in the microtiter wells
allowing GSK-3β antigen to be captured in the plate wells. The plate is then washed to
remove any unbound non-specific material. The wells are then incubated with a specific
rabbit anti-GSK-3β antibody to detect the captured phosphor-GSK-3β (Tyr 216) on the plate
well. The unbound detection antibody is washed away followed by incubation with an HRP-
conjugated anti-rabbit antibody. This allows for a sensitive enzymatic detection of the
sample. After the addition of TMB substrate and stop solution the absorbance is measured at
450 nm using a plate reader.
REAGENTS – APPENDIX XXI

PROCEDURE
The desired numbers of strips were placed in the strip well plate holder. 50 μl of the
Standards, Cell lysate and Zero dose were added to the corresponding wells. All reactions
were run in duplicates. 50 μl of the detection antibody was added to all the wells. Sealed the
plate and incubated at room temperature for 3 hours on a shaker.
Gently removed the plate sealer and washed the plate 4 times. The fluid was
removed by inverting the plate over a sink and blotting on a clean paper towel. 100 μl of
secondary anti-rabbit IgG HRP working solution was added to all the wells and incubated
for 30 minutes. Washed the plate 4 times.
Added 100 μL of TMB Solution to all the wells and incubated at room temperature
in the dark for 10 to 45 minutes. The reaction was stopped by adding 100 μL of Stop
Solution to all the wells. The plates were read at 450 nm against a reagent blank prepared by
adding only the TMB reagent and the stop solution. A standard graph was plotted and the
concentration of p-GSK3β (Ser 9) present in the cell lysate was determined by comparing
the net A450 values against the standard curve.
ASSAY OF pCREB (SER 133) USING PHOSPHO-CREB (SER133) INSTANTONE™

ELISA KIT (Cat # 85-86152-11)
PRINCIPLE
The InstantOne ELISA assays use the traditional sandwich ELISA format, but
reduce assay time by allowing the target analyte to bind to both antibodies at the same time.
The unbound antibodies and non-specific sample components are washed away just as in
traditional sandwich ELISA and the specific analyte is detected through a colorimetric
detection reagent.
REAGENTS – APPENDIX XXII
PROCEDURE
Placed the desired number of strips in the strip well plate holder. 50 μl of
the cell lysate, positive and negative controls were added to separate wells and added 50 μl
of the Antibody Cocktail to all the wells. Sealed the plate and incubated for 1 hour at
room temperature on a microplate shaker (~300 rpm). The plates were washed thrice
with the diluted Wash Buffer and completely removed the fluid by inverting on a paper
towel.
Added 100 μl of the Detection Reagent to all the wells and incubated for 30 minutes
in the dark. The reaction was stopped by adding 100 μl of the Stop Solution to all the wells.
The plates were read at 450 nm against the negative control, which also acts as the blank.
QUANTIFICATION OF TOTAL RNA USING NANODROP 2000 (Patents

US6628382 and US6809826)
PRINCIPLE
The NanoDrop 2000 spectrometer measures 0.5 to 2.0 µl sample with high accuracy
and reproducibility. The sample retention system employs surface tension to hold the
sample in place between two optical fibres. This enables the measurement of very highly
concentrated samples without the need for dilutions. The measurement pedestal contains
one fibre optic cable embedded in it. A second fibre optic cable is present in the lever arm,
which is brought into contact with the liquid sample causing the liquid to bridge the gap
between the ends of the two fibres. A pulsed xenon flash lamp provides the light source and
a spectrometer utilizing a linear CCD detector array analyses the light passing through the
sample.
PROCEDURE
The upper and lower optical surfaces of the sample retention system were cleaned by
pipetting 2.0 µl of deionised water onto the pedestal, closing the lever arm, tapping it gently
to bathe the optical surfaces and then wiping with soft tissue paper. The NanoDrop 2000
software was opened and the RNA module was selected. The appropriate constant for
measurement of RNA concentration, i.e., 40 was selected. Initialized the spectrometer by
placing 1.0 µl of deionized water on the pedestal, closed the lever arm and selected “blank”.
This took a few seconds to initialize, after which the pedestal and lever arm were wiped
with soft tissue paper. 1.0 µl of the sample was loaded onto the pedestal similarly and
selected the option “measure”. The RNA concentration was obtained in ng/µl and the purity
of the sample was indicated by the A260/280 value. A value of 2.0 indicated a pure RNA
sample.
RNA AGAROSE GEL ELECTROPHORESIS (Sambrook and Russel, 2001)

PRINCIPLE
Nucleic acid molecules are size separated by the aid of an electric field where
negatively charged molecules migrate towards the anode. The migration flow is determined
solely by the molecular weight, where smaller molecules migrate faster than the larger ones.
In order to visualize nucleic acid molecules in Agarose gels, ethidium bromide or Sybr
Green are commonly used. Illumination of the Agarose gels with 300 nm UV rays is
subsequently done to visualize the stained nucleic acid molecules.
Since Ethidium bromide stained DNA is not visible in natural light, negatively
charged loading buffers are commonly added to the sample prior to loading onto the gel.
They are particularly useful, as they are visible in natural light and also co-sediment with
the nucleic acids. RNA is usually denatured before electrophoresis as double stranded RNA
and RNA: RNA hybrids have hairpin elements and other secondary structures that may
interfere in the electrophoresis. MOPS or Formaldehyde RNA Agarose Gel Electrophoresis
overcomes this problem.
REAGENTS – APPENDIX XXIII
PROCEDURE
1.2% Formaldehyde gel was prepared and set in the casting tray. Once the gel was
set, it was placed inside the electrophoretic chamber filled with the 1X FA gel running
buffer. The RNA sample was mixed with the gel loading buffer and then loaded onto the
wells. The power supply was set at 75 V for 35 to 45 minutes. Once the dye front reached
the edge of the gel, the electrophoresis was stopped and the gel was visualized under UV
rays in a gel documentation system. The RNA bands obtained were compared with that of
the markers.
CLEANING TOTAL RNA USING AURUMTM TOTAL RNA MINI KIT – SPIN
PROTOCOL (Cat # 732-6820)
PRINCIPLE
The technique is an RNA-binding column based kit method, which can be used in
the spin or vacuum format. A DNase I digestion during the purification effectively removes
genomic DNA contamination. The spin protocol is performed using a commercially
available microcentrifuge at maximum speed (>12,000 g) at room temperature or 4°C.
REAGENTS – APPENDIX XXIV

PROCEDURE
The RNA sample was thawed in ice and added 700 µl of Lysis solution to it, mixed
well by pipetting up and down. Then added 700 µl of 70% Ethanol and mixed well.
Into a 2.0 ml cap-less wash tube inserted an RNA-binding column and transferred
the above solution onto the column. Centrifuged at high speed at room temperature for 60
seconds, discarded the filtrate and replaced the column. Added 700 µl of Low stringency
wash solution to the column and centrifuged for 30 seconds at high speed. Discarded the
filtrate and replaced the column.
Added 80 µl of the diluted DNase I solution onto the column and incubated
at room temperature for 15 minutes. Added 700 µl of High stringency wash solution to the
column and centrifuged for 30 seconds at high speed. Discarded the filtrate,
replaced the column and centrifuged once again for 2 minutes to remove any residual wash
solution.
The RNA-binding column was now transferred to a 1.5 ml capped micro-centrifuge

tube and added 35 µl of the elution solution to it. Incubated for 1 minute and centrifuged for
2 minutes at high speed. The resulting solution was labelled as RNA elute I and was stored
for subsequent cDNA synthesis. A second elution could also be done with 30 µl of elution
solution if needed and the resulting solution could be labelled as RNA elute II and stored for
future use. The elute I contains most of the RNA that was bound to the column, while the
elute II contains any remaining RNA from the column.
cDNA SYNTHESIS USING iSCRIPT SELECT cDNA SYNTHESIS KIT

(Cat # 170-8890)
PRINCIPLE
The reverse transcription kit is a ready to use method for first strand cDNA
synthesis. The kit allows a selection of priming strategies, oligo (dT) primers, random
primers or user-designed gene specific primers. The iScript reverse transcriptase mixture
contains a recombinant RNase H and MMLV reverse transcriptase pre-blended with a
recombinant RNase inhibitor. The reaction mix contains buffers, stabilizers and dNTPs,
which are optimised for the reverse transcriptase activity.
REAGENTS – APPENDIX XXV

PROCEDURE
Thawed all components of the kit except the reverse transcriptase, mixed thoroughly
and centrifuged briefly to collect the contents at the bottom of the tube. All the components
were placed in ice throughout the procedure/experiment. The following components were
added to a 0.2 ml PCR tube on ice:
TABLE 7: COMPONENTS FOR FIRST STRAND SYNTHESIS
S. No Component Volume (µl)

1 *Nuclease free water Variable
2 5X iScript select reaction mix 4
3 Oligo (dT)20 primer 2
†
4 RNA sample Variable
5 iScript reverse transcriptase 1
Total volume 20
†
The volume of RNA solution added to the reaction mix was equivalent to 500 ng.
*The volume of Nuclease free water was varied to make up the total volume to 20 µL.
Note: Negative control was prepared by adding all the above components except the reverse
transcriptase.
[
The reaction mix was gently mixed and incubated for 60 – 90 minutes at 42°C.
Incubated at 85°C for 5 minutes to heat inactivate the reverse transcriptase. The cDNA
product was stored at -20°C to 4°C or can be directly used for PCR amplification.
PRIMER DESIGNING
Primers for the Real Time PCR analysis of bdnf and bcl2a1 mRNA were designed
using Primer3 online tool (frodo.wi.mit.edu). The designed primers were analysed using
online primer calculator (www.sigma-genosys.com/calc/DNACalc.asp). All primers were
synthesized and obtained from Merck Specialities Pvt Ltd, India. The desalted
oligonucleotides were reconstituted and diluted to 10 µM solutions in PCR grade water.
PRIMER RECONSTITUTION – APPENDIX XXVI
TABLE 8: PRIMERS USED
PRIMER NAME 5’ 3’ SEQUENCE

bdnf Forward primer GAGGCTTGACATCATTGGCT
bdnf Reverse primer CGTGTACAAGTCTGCGTCCT
bcl2a1 Forward primer TTTACAGGCTGGCTCAGGAC
bcl2a1 Reverse primer AGCCTCCGTTTTGCCTTATC
PCR AMPLIFICATION OF bdnf AND bcl2a1 CDNA PRODUCTS USING

ARISTOGENE DNA AMPLIFICATION KIT
PRINCIPLE
The polymerase chain reaction is a repetitive bidirectional synthesis of DNA via

extension of two oligonucleotide primers. The primers anneal to opposite strands of the
duplex DNA and will extend the complementary strand of DNA forming new duplex DNA.
Repeated melting of duplex DNA, followed by annealing and extension of the primers
results in amplification of the DNA. The repeating reactions are carried out in a
programmable thermal cycler capable of changing incubation time and temperature.
REAGENTS – APPENDIX XXVII
PROCEDURE
The kit components were thawed in ice prior to the experiment and the following
solutions were added to a 0.2 ml PCR tube on ice:
TABLE 9: COMPONENTS FOR PCR
S. No Component Volume (µL)
1 Sterile water 8.4
2 2X PCR master mix 10.0
3 *Forward primer (100ng/µL) 0.4
4 *Reverse primer (100ng/µL) 0.4
5 Template DNA (50ng/ µL) 0.8
Total volume 20
*bdnf, bcl2a1 and g3pdh (housekeeping gene) primers were added to separate
reaction mixtures.
The amplification was carried out in the Eppendorf Mastercycler ep Gradient S

Cycler with controller using the following reaction condition.
TABLE 10: PCR PROTOCOL
Condition Temperature Time Cycles
Initial denaturation 94°C 1 minute 1
Denaturation 94°C 30 seconds

†
Annealing Gradient 30 seconds 40
Final extension 72°C 2 minutes 1
†
Gradient temperature is according to the optimal annealing temperature of each
primer pair viz., for bdnf it is 60°C, for bcl2a1 it is 50°C and for g3pdh it is 55°C
ELECTROPHORESIS OF PCR PRODUCTS

PRINCIPLE
DNA electrophoresis is an analytical technique used to separate DNA fragments by

size. DNA molecules which are to be analysed are set upon a viscous medium, the agarose
gel, where an electric field forces the DNA to migrate towards the positive potential, the
anode, due to the net negative charge of the phosphate backbone of the DNA chain. The
separation of the DNA fragments is accomplished by exploiting the motilities with which
different sized molecules are able to traverse the gel. Longer molecules migrate more slowly
because they experience more drag within the gel. Because the size of the molecule affects
its mobility, smaller fragments end up nearer to the anode than longer ones in a given
period. The separated PCR products are then analysed by comparing the bands to a DNA
ladder that is run simultaneously.
REAGENTS – APPENDIX XXVIII

PROCEDURE
Prepared a 0.7% Agarose gel in a 100 ml capacity gel casting tray. To this added
10µL of Ethidium bromide. Poured the mixture into the gel tray and placed a comb to create
the wells and allowed the gel to solidify. Loaded the gel into the chamber by setting it
directly onto the chamber’s platform while keeping the gel in the gel tray. Filled the
chamber with 1x TAE until the gel was completely submerged. Prepared the DNA by
adding 1uL of loading dye for every 5uL of DNA sample. Loaded the DNA samples along
with the DNA ladder into individual wells. Run the gel for 45 minutes at a constant 120
volts at the end of which the gel was visualised under UV illumination.
REAL TIME PCR ANALYSIS OF BDNF AND BCL2A1 mRNA EXPRESSION

USING SYBR GREEN JUMPSTART TAQ READY MIX (Cat # S4438)
PRINCIPLE
In conventional PCR, the amplified product, or amplicon, is detected by an end-
point analysis, by running DNA on an agarose gel after the reaction has finished. In
contrast, real-time PCR allows the accumulation of amplified product to be detected and
measured as the reaction progresses, that is, in “real time”. Real-time detection of PCR
products is made possible by including in the reaction a fluorescent molecule that reports an
increase in the amount of DNA with a proportional increase in fluorescent signal. The
fluorescent chemistries employed for this purpose include DNA-binding dyes and
fluorescently labeled sequence specific primers or probes. Specialized thermal cyclers
equipped with fluorescence detection modules are used to monitor the fluorescence as
amplification occurs. The measured fluorescence reflects the amount of amplified product in
each cycle.
The main advantage of real-time PCR over conventional PCR is that real-time PCR
allows you to determine the starting template copy number with accuracy and high
sensitivity over a wide dynamic range. Real-time PCR results can either be qualitative
(presence or absence of a sequence) or quantitative (number of copies of DNA). Real-time
PCR that is quantitative is also known as qPCR. In contrast, conventional PCR is at best
semi-quantitative. Additionally, real-time PCR data can be evaluated without gel
electrophoresis, resulting in reduced experiment time and increased throughput. Finally,
because reactions are run and data are evaluated in a closed-tube system, opportunities for
contamination are reduced and the need for post-amplification manipulation is eliminated.
The most commonly used DNA-binding dye for real-time PCR is SYBR Green I,
which binds non-specifically to double-stranded DNA (dsDNA). SYBR Green I exhibits
little fluorescence when it is free in solution, but its fluorescence increases up to 1,000-fold
when it binds dsDNA (Figure 2.1). Therefore, the overall fluorescent signal from a reaction
is proportional to the amount of dsDNA present, and will increase as the target is amplified.
Melt-curve analysis can be used to identify different reaction products, including

non-specific products. After completion of the amplification reaction, a melt curve is
generated by increasing the temperature in small increments and monitoring the fluorescent
signal at each step. As the dsDNA in the reaction denatures (i.e., as the DNA “melts”), the
fluorescence decreases. The negative first derivative of the change in fluorescence is plotted
as a function of temperature. A characteristic peak at the amplicon’s melting temperature
(Tm, the temperature at which 50% of the base pairs of a DNA duplex are separated)
distinguishes it from other products such as primer-dimers, which melt at different
temperatures.
The major drawback of DNA-binding dyes is their lack of specificity, that is, DNA-
binding dyes bind to any dsDNA. As a result, the presence of nonspecific products in a real-
time PCR reaction may contribute to the overall fluorescence and affect the accuracy of
quantification. Another consequence is that DNA-binding dyes cannot be used for multiplex
reactions because fluorescent signals from different amplicons cannot be distinguished.
Instead, one can set up parallel reactions to examine multiple genes, such as a gene of
interest and reference gene, in a real-time PCR assay with SYBR Green I.
REAGENTS – APPENDIX XXIX

PROCEDURE
The kit components were thawed in ice prior to the experiment and the following
solutions were added to PCR strip tubes on ice:
TABLE 11: COMPONENTS FOR REAL TIME PCR
S. No Component Volume (µL)

1 Sterile water 7.0
2 SyBr Green mix 10.0
3 *Forward primer (100ng/µL) 1.0
4 *Reverse primer (100ng/µL) 1.0
5 cDNA 1.0
Total volume 20
*bdnf, bcl2a1 and hprt (housekeeping gene) primers were added to separate
reaction mixtures.
The PCR strip tubes were sealed with the clear tape provided by the manufacturer
and placed inside the thermocycler according to the plate map (Figure 14). The
amplification was carried out in the BioRad Real time PCR Detection System - CFX96
Touch using the following reaction condition.
TABLE 12: RT-PCR PROTOCOL
Condition Temperature Time Cycles

Initial denaturation 95°C 3 minutes 1
Denaturation 95°C 15 seconds
†
Annealing Gradient 30 seconds 41
Melt curve analysis 1
†
Gradient temperature is according to the optimal annealing temperature of each
primer pair viz., for bdnf it is 60°C, for bcl2a1 it is 50°C and for hprt it is 55°C
PART C
HOMOLOGY MODELLING AND DOCKING STUDIES OF NEUROTROPHINS

WITH THEIR RESPECTIVE TRK RECEPTORS
UNIPROT DATABASE (Magrane and the UniProt Consortium, 2011)

The Universal Protein Resource (UniProt) is a comprehensive resource for protein
sequence and annotation data. The UniProt Knowlegdebase (UniProt KB), the UniProt
Reference clusters (UniRef) and the UniProt Archive (UniParc). UniProt is collaboration
between the European Bioinformatics Institute (EBI), the Swiss Institute of Bioinformatics
(SIB) and the Protein Information Resource (PIR).
Information regarding the sequence of proteins can be obtained from the UniProt KB
and downloaded in FASTA format. Individual proteins are given a unique UniProt ID,
which helps in their easy identification.
EMBOSS (Rice et al., 2000)
The European Molecular Biology Open Software Suite (EMBOSS) is a free open
source software analysis package specially developed for the needs of the molecular biology
and bioinformatics user community. The package contains a variety of applications for
sequence alignment, rapid database searching with sequence patterns, protein motif
identification and sequence analysis.
TABLE 13: FEW POPULAR APPLICATIONS IN THE EMBOSS PACKAGE
Program Description
Water Performs Smith-Waterman local alignment
Matcher Performs Waterman-Eggert local alignment of two sequences.
Needle Performs Needleman-Wunsch global alignment of two sequences.
Prettyseq Writes a nucleotide sequence and its translation to file.
Stretcher Needleman-Wunsch rapid global alignment of two sequences.
Calculate approximate local pair-wise alignments of larger
Supermatcher
sequences
BLASTp (Altschul et al., 1997)
Blast Local alignment Search Tool (BLAST) is an algorithm for comparing primary
biological sequence information, such as the amino acid sequences of different proteins or
the nucleotide sequences of DNA/RNA. It is one of the most widely used bioinformatics
programs and can be used to infer functional and evolutionary relationships between
sequences as well as to identify members of any gene family. The BLAST program was
designed by Eugene Myers, Stephen Altschul, Warren Gish, David J. Lipman and
Webbhilles at NIH (Altschul et al., 1990). The BLASTp program is specific in obtaining
protein sequences from the databases when a protein sequence is given as the query.
RCSBPDB (Bernstein et al., 1977)
The Protein Data Bank (PDB) is a repository for the three dimensional
structural data of large biological molecules, such as proteins and nucleic acids. It is a
central archive of experimentally solved biomolecular structures using X-ray diffraction and
NMR techniques. Data can be downloaded as pdb files or as simple text files.
CLUSTAL X2 (Larkin et al., 2007)
Clustal X is a graphical user interface widely used for Multiple sequence alignment.
Clustal X can recognize several formats and is a general purpose multiple sequence
alignment program for nucleic acids and proteins. It has two modes which can be selected
using the switch directly above the sequence display, Multiple Alignment Mode and Profile
Alignment Mode. The order of the sequences could also be altered by simple cutting-and-
pasting of the filenames. The sequence alignment obtained could also be saved as a
postscript file for future reference or as a phy file for use in PHYLIP program to draw
phylogenetic tree.
Swiss PDB Viewer (Guex and Peitsch, 1997)
The Swiss PDB Viewer (SPDBV) is an application that provides a user friendly
interface allowing analysis of several proteins at the same time. The proteins could be
superimposed in order to deduce structural alignments and compare their active sites or any
other relevant parts. Amino acid mutations, H-bonds, angles and distances between atoms
are also easily obtained. Modelling tools are also integrated and command files for energy
minimisation can also be generated.
Q – SITE FINDER (Laurie and Jackson, 2005)

Q – site finder is a method of ligand binding-site prediction. It works by binding
hydrophobic probes to the protein, and finding clusters of probes with the most favourable
binding energy. These clusters are placed in rank order of the likelihood of being a binding
site according to the sum total binding energies for each cluster.
Figure 20: Screenshot of the Q – site finder

webpage
SOPMA SERVER (Geourjon and Deleage, 1995)
Self-optimized Prediction from Multiple Alignment (SOPMA) is based on the

homologue method of Levin et al., 1986. It is an improvement of SOPM method of
Geourjon and Deleage (1994). The method takes into account information from an
alignment of sequences belonging to the same family. It is also able to predict the turn state
but accuracies are given for only the three states viz., Helix, Sheet and Coil.
TMHMM server (Krogh et al., 2001)
Trans Membrane prediction using Hidden Markov Models (TMHMM) is a

membrane topology prediction server that uses the Hidden Markov Model method to
discriminate between soluble and membrane proteins with high degree of accuracy. The
technique predicts the most probable transmembrane region in a given query protein
sequence.
PROP 1.0 SERVER (Duckert et al., 2004)
The ProP 1.0 server predicts Arginine and Lysine pro-peptide cleavage sites in
Eukaryotic protein sequences using an ensemble of neural networks. It also performs a
general pro-protein Convertase prediction. The server is integrated with the SignalP server,
which predicts the presence and location of signal peptide cleavage sites in amino acid
sequences from different organisms. The method is based on a combination of several
artificial neural networks.
MODELLER (Eswar et al., 2006)
Modeller is a program used in producing homology models of protein tertiary

structures as well as quaternary structures. The technique is based on satisfaction of spatial
restraints in which a set of geometrical criteria are used to create a probability density
function for the location of each atom in the protein. The method relies on the sequence
alignment between the query protein sequence (to be modelled) and the template protein,
whose crystal structure has been solved.
PyMOL (The PyMOL Molecular Graphics System, Version 1.5.0.4 Schrödinger, LLC)
PyMOL is an open-source, molecular visualization system. It can produce high

definition three dimensional images of biological macromolecules. The tool works on
Python programming language and is also extensible based on the user’s requirement. It can
be operated using the graphical user interface (GUI) and also sets of Python commands.
HEX 6.12 PROTEIN DOCKING SOFTWARE (Ritchie and Venkatraman, 2010)
Hex is an interactive protein docking and molecular superposition program, based on

the First Fourier Transform (FFT) module powered by graphics processors. The program
generates up to 1000 docking predictions based on the protein structures provided. The
docking orientations may be refined and adjusted based on the knowledge of the protein
binding sites and hence can shorten the calculations or the prediction time required. It is a
good tool to predict protein-protein interactions based on the docking energies.
Results and Discussion
5
RESULTS AND DISCUSSION
PART A
EFFECT OF VENLAFAXINE TREATMENT IN DEPRESSION-INDUCED

MALE WISTAR RATS
PHASE I
The clearance from the animal ethical committee was sought and obtained (Proposal
No. 195/2013/IAEC) and the study animals were obtained from the Animal Facility, PSG
IMS & R, Coimbatore. The animals were weighed and were found to between 120 and 150g
randomly distributed into the experimental groups following one week acclimatization,
where the animals were placed in ambient conditions with access to food and water. Stress
induction was performed for all the experimental animals except for those of the control
group, which were maintained in the same conditions. A protocol for stress induction
(Table 8) was prepared such that there was minimum repetition of stressors and that two
similar stressors were not applied consecutively.
FORCED SWIM TEST (FST)
FST can be used to assess the action of antidepressant drugs, the experimental
models can engage in at least three different forms of behaviour: immobility, swimming and
climbing. Antidepressants that primarily potentiate 5-HT mediated neurotransmission
increase swimming behaviour whereas those with primary actions through catecholamines
increase climbing behaviour (Cryana et al., 2002). In a recent study, behavioural analysis of
mice exposed to chronic unpredictable mild stress regime found that anhedonia in stressed
mice is accompanied by other features of depressive-like behaviour, such as increased
floating in the forced swim test and decreased exploration of novelty (Strekalova et al.,
2004).
After two days of stress induction, the animals were orally administered with the
Venlafaxine solution (Low dose - 16 mg/kg body weight and high dose - 32 mg/kg body
weight). At the end of the first week (7th day) of Venlafaxine treatment, the Forced Swim
Test (FST) was administered to all the experimental animals to assess the severity of stress
induced. The results (Table 9) showed a significant increase in the immobility time in
Groups II, III and IV as compared to those of Group I.
TABLE 14: RESULTS OF FORCED SWIM TEST AFTER 1 ST AND 3RD WEEK
OF VENLAFAXINE TREATMENT
Immobility (seconds)
S.No Group Dosage st
1 week 3rd week
1. I - 64.73 ± 27.13a 61.41 ± 11.81a
2. II - 139.67 ± 19.41b 157.00 ± 26.19b
3. III 16 mg/kg body weight 136.33 ± 16.09b 103.83 ± 21.83c
4. IV 32 mg/kg body weight 133.17 ± 11.14b 67.67 ± 22.61a
Values are mean ± SD of six samples in each group

a-d
Mean values with in a column no common superscript differ significantly at 5% by DMRT
Figure 26: Forced Swim Test (FST)

180
160 1st week 3rd week
140
Immobility (seconds)
120
100
80
60
40
20
0
Group I Group II Group III Group IV
At the end of the Venlafaxine treatment (21st day), FST was performed once again to
assess the effect of treatment with low and high doses of Venlafaxine as against that of the
untreated animals. The results show that the immobility time has decreased significantly in
Group IV as compared to those of the Group II and III and was observed to be similar to
that of Group I (Figure 25). These results corroborate the findings of an earlier study using
Imipramine and the extract of Tagetes erecta which showed a marked decrease in the
immobility period (Khulbe et al., 2013). Another study also showed the antidepressant
Diazepam and Perment®, a herbal formulation were both found to produce a marked
decrease in the immobility time (Ramanathan et al., 2011).
SUCROSE CONSUMPTION TEST

Repeated exposure to mild stressors induces anhedonia, which is a core symptom of
major depressive disorder. The chronic unpredictable mild stress (CUMS) model is a well-
documented animal model of major depressive disorder, where in up to 70% of the stress-
exposed rats develop anhedonia, and the remaining show resilience to stress (Willner et al,
1987; Willner, 1997). The degree of anhedonia is measured by a reduction in the
consumption of a palatable sucrose solution, reflecting a decreased sensitivity to reward
(Willner, 2005).
The animals were separated and kept in individual cages after FST on the 21 st day.
They were then provided with 50 ml of both 1% Sucrose solution and drinking water in
separate containers overnight. The following day (after 24 hours) the volume of 1% Sucrose
solution and drinking water consumed was measured and percentage of sucrose preference
was calculated using the formula
= x 100
where S is Sucrose preference; V is the Volume of 1% Sucrose solution consumed in 24

hours; and T is the Total Fluid consumed in 24 hours. The percentage of Sucrose
preference is given in Table 10.
According to the World Health Organization depression is one of the primary

disabilities that contribute significantly to the individual and fiscal disease burden of most
countries. Thus, a better understanding of the etiology of depression could have enormous
impact at the individual and societal level. Of the many factors intrinsic to this disorder, the
American Psychiatric Association and the World Health Organization include attenuation or
loss of enjoyment or pleasure in the diagnostic description of major depression (American
Psychiatric Association, 1994).
TABLE 15: RESULTS OF SUCROSE CONSUMPTION TEST
1% Sucrose Water Total volume of Sucrose

S. No Group solution consumed fluids consumed preference
consumed (ml) (ml) (ml) (%)
1. I 65.08 ± 2.13 4.03 ± 0.41 66.74 ± 5.07 95.46 ± 1.04a
2. II 42.93 ± 9.18 5.22 ± 0.76 37.72 ± 6.89 88.31 ± 4.06b
3. III 54.55 ± 7.03 4.30 ± 0.86 60.17 ± 5.16 91.93 ± 2.40a
4. IV 64.63 ± 4.67 4.47 ± 0.49 50.25 ± 7.40 93.02 ± 1.23a

a-d
Figure 27: Sucrose Consumption Test taken at the

end of Venlafaxine Treatment
100
95
Sucrose consumption (%)
90
85
80
75
70
65
60
55
50
The results show that Group IV had an increased sucrose preference when compared
to that of Group II and III, which was found to be similar to that of Group I (Figure 26). A
previous study showed that the intake of sucrose solution was decreased in the anhedonic
animals exposed to chronic mild stress as compared with the control animals and resilient
animals. The resilient animals showed no change of sucrose solution as compared with the
control animals. The findings of our study echo a previous study using Imipramine
and Fluoxetine were found to improve sucrose consumption in an experimental model
(Papp et al., 2003).
COLLECTION OF WHOLE BLOOD SAMPLE AND BRAIN TISSUES
At the end of the Venlafaxine treatment period (21 days), the study animals were
anesthetized under mild chloroform. Blood was collected by cardiac puncture from which
1.0ml was taken separately as an aliquot with EDTA for RNA isolation and with Heparin
for PBMC isolation. From the remaining blood, serum was separated for the Biochemical
studies. The whole brain was excised immediately and thoroughly washed in ice cold saline
to remove any traces of blood before use. The whole brain was stored in formalin and was
used for histopathological study, 100 mg of the hippocampal tissue was taken and used for
RNA isolation and the remaining tissue was used to prepare the tissue homogenate for the
Biochemical studies.
PHASE II
BIOCHEMICAL STUDIES
1. ESTIMATION OF TOTAL PROTEIN
The amount of total proteins present in the serum and brain tissue homogenate was
estimated with BSA as standard using the method of Lowry et al (Table 16).
TABLE 16: ESTIMATION OF TOTAL PROTEIN IN SERUM

AND TISSUE HOMOGENATE
Total protein in Tissue
Total protein in
S. No Group Dosage homogenate
Serum (mg/ml)
(mg/g tissue)
1. I - 1.44 ± 0.12a 3.87 ±0.32a
2. II - 1.36 ± 0.07b 3.17 ± 0.15b
3. III 16 mg/kg body weight 1.30 ± 0.-9b 3.33 ± 0.46b
4. IV 32 mg/kg body weight 1.55 ± 0.07c 3.40 ± 0.83b
a-d
Figure 28: Estimation of Total Proteins

4.5
Serum
4
Tissue homogenate
3.5
3
2.5
2
1.5
1
0.5
0
The results confirm the findings of earlier studies that the total protein levels are
significantly decreased in Major Depression (Roshdy and Fyiad, 2010). The results show a
significant increase in the serum total proteins in the high dose treated group as compared to
the control, induced and low dose treated groups. A significant increase in the total protein
was observed in the tissue homogenate of Group IV, which was found to be near normal
levels when compared with that of Groups II and III where it was significantly decreased
(Figure 28).
2. ENZYMIC ANTIOXIDANTS
Recent data from several reports indicate that free radicals are involved in the
biochemical mechanisms underlying the pathophysiology of neuropsychiatric disorders in
human. The results of several reports suggest that lower antioxidant defences against lipid
peroxidation exist in patients with depression and that there is a therapeutic benefit from
antioxidant supplementation in unstable manic-depressive patients.
The study investigated the antioxidant enzyme status and the indices of oxidative
stress and lipid peroxidation end products in erythrocytes from patients with affective
disorder. The study found that the antioxidant enzymes were significantly decreased in the
pre-treatment period which was significantly increased in the post-treatment period in
patients compared to the control group (Ozcan et al., 2004).
In another study post-mortem prefrontal cortex from patients with BD, MDD, SCZ,
and from non-psychiatric comparison controls were spectrophotometric analysed for the
level of Glutathione, while immunoblotting analyses were used to examine expression of
glutamyl-cysteine ligase (GCL), GSH reductase (GR), and GSH peroxidase (GPx).
The study found that the levels of reduced, oxidized, and total GSH were significantly
decreased in all psychiatric conditions compared to the control group and that the levels of
GPx were reduced in MDD and SCZ compared to control subjects (Gawryluka et al., 2011).
A recent study evaluated the specific activity of the main peripheral antioxidant
defences (superoxide dismutase and glutathione peroxidase) and the level of
malondialdehyde (a lipid peroxidation maker), in depressed patients, as compared to an age-
matched control group. Their results showed an increased oxidative stress status in the
serum of patients with MDD, expressed by a significant decrease of both SOD and GPX
specific activities and a significant increase of MDA, as compared to the control group
(Stefanescu and Ciobica, 2012).
2.1 ESTIMATION OF SUPEROXIDE DISMUTASE (SOD)
The enzymic activity of Superoxide Dismutase in serum and tissue homogenate was
estimated using a modified method of Marklund and Marklund (Table 12) and was found to
be significantly increased in Group III to near normal levels when compared with that of
Group II and IV. On the other hand, the activity of SOD in the tissue homogenate was found
to be significantly increased in Group II when compared to Groups III and IV which were
found to have similar values (Figure 28). This is in accordance with the findings of an
earlier study that showed both acute and chronic treatments with imipramine and harmine
increased superoxide activity in the hippocampus and prefrontal cortex (Réus et al., 2010).
TABLE 17: ACTIVITY OF SUPEROXIDE DISMUTASE
Activity of SOD in tissue

Activity of SOD in serum
S. No Group homogenate
(units/min/mg serum protein)
(units/min/mg protein)
1. I 0.75 ± 0.21a 0.61 ± 0.02a
2. II 0.62 ± 0.21b 1.20 ± 0.23b
3. III 0.87 ± 0.42c 0.74 ± 0.21a
4. IV 0.62 ± 0.24b 0.73 ± 0.18a
a-d
Figure 29: Estimation of Superoxide dismutase

1.4
1.2 Serum
1 Tissue homogenate
0.8
0.6
0.4
0.2
0
2.2 ESTIMATION OF CATALASE (CAT)
The activity of Catalase in serum and tissue homogenate was estimated by the use of
hydrogen peroxide and chromic acid (Table 13). The results were found to be significantly
increased in Group III when compared to that of Groups II and IV, which was similar to that
of the SOD activity in serum, whereas the activity in tissue homogenate was found to
slightly increase in the Group IV when compared with that of Groups II and III (Figure 29).
This reflects the findings of an earlier study where both acute and chronic treatments with
imipramine and harmine were found to increase catalase activity in the hippocampus and
prefrontal cortex (Réus et al., 2010).
TABLE 18: ACTIVITY OF CATALASE IN SERUM AND TISSUE HOMOGENATE
Activity of Catalase in serum Activity of Catalase in tissue

S. No Group (µmoles of H2O2 consumed/min/mg homogenate (µmoles of H2O2
serum protein) consumed/min/mg protein)
1. I 13.92 ± 7.86a 76.85 ± 12.29a
2. II 32.63 ± 7.43b 17.41 ± 8.59b
3. III 55.95 ± 2.05c 28.40 ± 17.07c
4. IV 4.46 ± 1.21d 34.82 ± 11.97c
a-d
Figure 30: Estimation of Catalase

90
80 Serum
70 Tissue homogenate
60
50
40
30
20
10
0
2.3 ESTIMATION OF GLUTATHIONE PEROXIDASE
There are numerous studies indicating that ROS induced neuronal damage has an
important role in the pathophysiology of depression, probably via membrane
ω-3-polyunsaturated fatty acids (PUFAs), decreasing activity of Glutathione Peroxidase
(GSH-Px), Catalase, Superoxide dismutase and antioxidant vitamins. There are various
antioxidant mechanisms in the brain that neutralize the harmful effects of ROS; however
with depression, the loss of efficiency of antioxidant mechanisms and the alterations in the
pro-inflammatory cytokine system result in increased free radical formation (Eren et al.,
2007a).
The activity of Glutathione peroxidase in serum and tissue homogenate was assayed
based on the reaction of glutathione with DTNB (Table 19). The serum Glutathione
peroxidase activity was found to be slightly increased in Group III when compared with that
of Groups II and III, whereas the activity in tissue homogenate was found to be significantly
increased in Group II when compared to that of Groups III and IV (Figure 31). The results
are in lieu with the earlier findings that depression resulted in decreased activity of
Glutathione peroxidase in the rat brain, which was elevated with the administration of
antidepressant drugs (Eren et al., 2007b).
TABLE 19: ACTIVITY OF GLUTATHIONE PEROXIDASE IN

SERUM AND TISSUE HOMOGENATE
Activity of GPx in serum Activity of GPx in tissue

S. No Group (µmoles of GSH oxidised/min/mg homogenate (µmoles of GSH
serum protein) oxidised/min/mg protein)
1. I 20.38 ± 1.05a 412.94 ± 69.34a
2. II 22.40 ± 2.59a 730.61 ± 46.86b
3. III 23.53 ± 4.83a 539.58 ± 80.44c
4. IV 17.40 ± 1.31b 532.45 ± 113.01c

a-d
µmoles of GSH oxidised/min/mg serum Figure 31: Estimation of Glutathione peroxidase

800
Serum
700
Tissue homogenate
600
500
protein
400
300
200
100
0
3. NON-ENZYMIC ANTIOXIDANTS
3.1 ESTIMATION OF ASCORBIC ACID (VITAMIN C)
A previous study showed significant increase in serum SOD, serum MDA and
decrease in plasma ascorbic acid levels in patients of major depression as compared to
control subjects. The trend reversed significantly after treatment with fluoxetine and
citalopram. Results indicated a greater reduction in oxidative stress with citalopram than
fluoxetine (Khanzode et al., 2003). The amount of Ascorbic acid in both serum and tissue
homogenate was estimated by the method of Omaye et al., (Table 15) and was found to be
significantly increased in Group IV to near normal levels when compared to that of Groups
II and III (Figures 31) as observed in the earlier studies suggesting a possible role for
oxidative stress in depression (Eren et al., 2007b). Also the ability of Venlafaxine to reverse
the damage caused by the oxidative stress is proven.
TABLE 20: ESTIMATION OF VITAMIN C IN SERUM AND

TISSUE HOMOGENATE
Amount of Vitamin C in serum Amount of Vitamin C in tissue

S. No Group
(µg/mg serum protein) homogenate (µg/mg protein)
1. I 261.31 ± 28.37a 1204.21 ± 121.24a
2. II 258.04 ± 19.37a 1179.97 ± 91.90a
3. III 260.36 ± 26.92a 1193.70 ± 161.04a
4. IV 261.21 ± 14.23a 1204.76 ± 312.88a

a-d
Figure 32: Estimation of serum Vitamin C

1400
Serum Tissue homogenate
1200
1000
800
600
400
200
0
4. ESTIMATION OF LIPID PEROXIDATION (LPO)
Lipid Peroxidation in the serum and tissue homogenate was estimated

colorimetrically using TBARS (Table 16) and was found to be significantly
decreased to near normal levels in Group IV when compared to that of Groups II and III
(Figure 32).
TABLE 21: LIPID PEROXIDATION IN SERUM AND

TISSUE HOMOGENATE
Lipid Peroxidation in serum Lipid Peroxidation in tissue

S. No Group (µmoles TBARS/mg serum homogenate (µmoles TBARS /mg
protein) protein)
1. I 17.86 ± 11.85a 237.29 ± 46.66a
2. II 21.83 ± 14.23a 288.04 ± 23.40b
3. III 16.80 ± 4.76a 315.91 ± 69.50c
4. IV 10.29 ± 3.52a 256.83 ± 54.67a

a-d
Figure 33: Determination of Lipid peroxidation in serum

350
µmoles TBARS/mg serum protein
Serum
300
Tissue homogenate
250
200
150
100
50
0
PHASE III
HISTOPATHOLOGICAL ANALYSIS OF BRAIN HIPPOCAMPUS
The excised rat brain was examined histopathologically to observe for any
morphological changes occurring in the animal model. The results show that there was
significant neuronal degeneration observed in the pyramidal cell layer of Ammon’s horn
(CA) in the experimental group induced with depression when compared to that of the
control group. There was no significant change observed in the low dose treated group,
whereas there was a significant reduction in neuronal degeneration in the high dose treated
group, which was found to be similar to that of the control untreated group.
Our results were found to confirm the findings of previous studies, in which
antidepressant drug treatment was reported to block the stress-induced atrophy of CA3
pyramidal cells (Watanabe et al, 1992; Duman et al, 1999) and increases neurogenesis of
hippocampal granule cells (Malberg et al, 2000).
A B
CA CA
C D
CA CA
Figure 34: Histopathological Examination of the Rat hippocampus. A) Control Group;

B) Depression induced untreated group; C) Low dose treated group; and D) High dose
treated group. [CA – pyramidal cell layer of Ammon’s horn]
ISOLATION AND QUANTIFICATION OF TOTAL PROTEIN FROM PBMC AND

HIPPOCAMPUS
The cell lysate obtained from the PBMC isolated from the whole blood and that
from the rat hippocampus was analysed for its total protein content using UV spectroscopy.
The results show a significant increase in the High dose treated group, which was similar to
that of the control group when compared to that of the depression induced untreated group
(Table 17).
TABLE 22: ASSAY OF TOTAL PROTEIN FROM PBMC AND HIPPOCAMPAL

CELL LYSATES USING UV SPECTROSCOPY
PBMC count Total protein Total protein from

Groups (x106 cells/5 mL from PBMC hippocampus
of blood) (µg/1 x 106 cells) (µg/mg tissue)
I 6.22 0.495 1.46
II 5.07 0.325 1.02
III 5.61 0.382 1.09
IV 5.89 0.417 1.38
Figure 35: WESTERN BLOTTING USING ANTIBODIES AGAINST

GSK3 β AND CREB
[Western blot for GSK3-β and CREB: Figure A shows the western blot image obtained
using anti-GSK3-β (Tyr 216) antibodies and Figure B shows the western blot image
obtained using anti-CREB antibodies. Lanes 1 to 4 contain PBMC lysates from Groups I, II,
III and IV respectively, whereas lanes 6 to 7 contain Hippocampal tissue lysate from Groups
I, II, III and IV respectively and lane 5 contains the protein marker (14.3 to 66 kDa)].
The results show the presence of 47 kDa GSK3-β Antigen-antibody complex and 37
kDa CREB Antigen-antibody complex in the PBMC and Hippocampal tissue lysates. The
Densitometric readings (Table 1) show that the Induction of depression and treatment with
Venlafaxine does not result in a significant change in the concentrations of GSK 3β and
CREB. These results confirm the earlier findings of Li et al (2009), who showed that there
was no significant change in CREB levels in the Hippocampus of Normal control rats and
that of rats induced by Chronic unpredictable stress.
TABLE 23: DENSITOMETRIC ANALYSIS OF THE WESTERN BLOT ANALYSIS
Relative density for GSK-3 β Relative density for CREB

Groups Hippocampal Hippocampal
PBMC lysate PBMC lysate
tissue lysate tissue lysate
I 37 21 40 19
II 34 22 38 18
III 33 24 38 20
IV 38 24 40 20
ISOLATION AND QUANTIFICATION OF TOTAL RNA FROM WHOLE BLOOD

AND RAT HIPPOCAMPUS
The total RNA was isolated from the whole blood and the hippocampus using the
TRI reagent and was cleaned of any contaminating genomic DNA using amplification grade
DNase I. The amount of RNA present was estimated using UV spectroscopy before and
after cleaning with DNase I and is tabulated in Table 18. The pure RNA thus obtained was
further used for cDNA synthesis and subsequently for PCR analysis of the expression of
bdnf, bcl2a1 and g3pdh genes.
A recent study using the adult rat hippocampus, evaluated the dose-related effects of
chronic venlafaxine on the mRNA expression and protein levels of brain-derived
neurotrophic factor (BDNF) and phosphorylated cyclic-AMP response element binding
protein (pCREB). The study found that chronic low dose (5 mg/kg body weight for 14 and
28 days), but not high dose (10 mg/kg body weight for 14 and 28 days) of venlafaxine
treatment increased the expression of pCREB and BDNF mRNA and protein in the rat
hippocampus.
Another study evaluated the effect of venlafaxine on the cognitive impairment of

learning and memory in rats with post-stroke depression (PSD) and its relationship with the
mRNA expression of brain-derived neurotrophic factor (BDNF) in hippocampus. They
authors concluded that after different dosages of venlafaxine treatment, the BDNF
expression and cognition increased markedly (Dai et al., 2011).
Another recent study showed that the BDNF mRNA level was significantly
increased in the dentate gyrus of the dorsal hippocampus of CUMS induced rats on chronic
antidepressant treatment emphasizing a role for BDNF in the mechanisms underlying
antidepressant activity (Larsen et al., 2010).
TABLE 24: ESTIMATION OF THE TOTAL RNA ISOLATED FROM WHOLE

BLOOD AND HIPPOCAMPUS USING UV SPECTROSCOPY
Total RNA from Whole blood Total RNA from hippocampus

(ng/µL) (ng/µL)
Groups
Before cleaning After cleaning Before cleaning After cleaning
I 498 249 984 500
II 406 203 878 437
III 449 226 896 466
IV 471 238 928 492
RT-PCR ANALYSIS OF THE bdnf, bcl2a1 and g3pdh GENES
From the total RNA isolated, approximately 500 ng of RNA was used as the input
for cDNA synthesis using random hexamers. The cDNA thus synthesized was then used to
analyse the expression of bdnf, bcl2a1 and g3pdh (housekeeping) genes. The PCR products
thus obtained were separated using agarose gel electrophoresis, stained with Ethidium
bromide and the bands visualized using UV light. The results show that there is significant
increase in the expression of bdnf and bcl2a1 genes in the High dose treated group when
compared to the depression induced untreated group (Figure 35).
1 2 3 4 5 6 7 8 9 10
11 12 13 14
1 2 3 4 5 6 7 8 9 10
11 12 13 14
Figure 36: Agarose Gel Electrophoresis of the RT-PCR products. A) RT-PCR products
of total RNA isolated from whole blood; and B) RT-PCR products of total RNA isolated
from the hippocampus. [Lanes 1-4 = bdnf primer pair; lanes 6-7 = g3pdh primer pairs; lanes
11-14 = bcl2a1 primer pairs; lanes 5, 10 = 50 bp ladder]
The neurotrophic hypothesis of depression postulates the etiology of this disease and
the action of antidepressants is due, in part, to the regulation of central neurotrophin
signaling, notably BDNF (Duman and Monteggia, 2006). Stress is known to precipitate or
exacerbate depression in susceptible individuals (Gold and Chrousos, 2002). Moreover,
depressed patients show atrophy in several brain regions, including the hippocampus, frontal
cortex, and amygdala (McEwen, 2001). These anatomical changes caused by stress are
paralleled by reductions in BDNF expression (Duman and Monteggia, 2006). On the other
hand, chronic administration of antidepressant treatments from different classes have been
reported to commonly increase the expression of BDNF mRNA in the hippocampus
(Coppell et al., 2003; Dias et al., 2003; Fujimaki et al., 2000; Molteni et al., 2005;
Nibuya et al., 1995; Nibuya et al., 1996).
PART B

PHASE II
The Ethical clearance for the study was obtained from the Institutional Human
Ethics Committee, PSG IMS & R, Coimbatore (Proposal No. 12/102). Patient and healthy
volunteers for the study were recruited by Dr.Raghuthaman G (Head, Department of
Psychiatry) based on their age and sex. Patients with mild to moderate depression, who were
prescribed with Venlafaxine as the antidepressant, were recruited for the study. The details
of the volunteers for the study are given in the Table 17 (Consent forms – Appendix XXV).
Depression is a common, treatable disorder which continues to remain under-

detected in the primary care settings. A large majority of patients with depression present to
physicians with complaints of medically unexplained somatic symptoms, or masked
depression. Further, the rates of depressive disorders are higher among the chronic
medically ill persons and in primary care patients. It is the third leading cause of global
disease burden, accounting for 4.3% of total disability-adjusted life years. If current trends
continue, it will become the leading cause of disease burden by the year 2030.2,3 At an
individual level, depression affects the mental and emotional wellbeing, lowers the overall
quality of life and may increase the risk of other medical illnesses. It adversely affects the
job and familial functioning. At a societal level, it leads to loss of productivity and
economic burden.
Recently conducted world mental health surveys indicate that major depression is
experienced by 10-15% people in their lifetime (Bromet et al., 2011) and about 5% suffer
from major depression in any given year (Murphy et al., 2000). Lifetime prevalence of all
depressive disorders taken together is over 20%, that is one in five individuals. In the Indian
context, a recent large sample survey with rigorous methodology reported an overall
prevalence of 15.9% for depression (Poongothai et al., 2009), which is similar to western
figures. There is some suggestion that perhaps the prevalence of depression has increased
over past few decades (Nandi et al., 2000). Studies done in primary health care settings in
India have found depression in 21-84% of the cases (Pothen et al., 2003; Amin et al., 1998).
TABLE 25: DETAILS OF STUDY SUBJECTS (PATIENT AND

HEALTHY VOLUNTEERS)
Date of induction into

Study code Age Sex Date of Exit from study
the study
BDNF01 65 F 07.12.12 20.02.13
BDNF02 42 F 21.12.12 08.03.13
BDNF03 42 F 04.03.13 19.07.13
BDNF04 27 F 05.04.13 03.07.13
BDNFH01 65 F 07.06.13 07.06.13
BDNFH02 42 F 06.06.13 06.06.13
BDNFH03 42 F 06.06.13 06.06.13
BDNFH04 27 F 06.06.13 06.06.13
The Hamilton Depression Rating Scale (HDRS) was the instrument used to assess
the severity of Depression in the drug naïve patient volunteers and after 10 weeks of
Venlafaxine treatment, the results of which are tabulated in Table 18.
Stressful life events are one of common precedents in the first episode of depression,
and may leave a person more vulnerable to develop subsequent episodes. Common life
events associated with depression are loss of a parent in childhood, loss of a spouse and
unemployment (Rao, 1970; Rao, 1973). Being a caregiver for a chronically disabled person
in family may also increase the risk of depressive symptoms. Researchers have suggested
the role of psychological factors e.g. faulty or distorted cognitions, with a triad of negative
view of self, negative view of environment and negative view of future (Radu, 2012). Indian
studies have suggested the role of poverty, marginalisation and other socio-economic
adversities in increasing the likelihood of depression (Nandi et al., 1979).
TABLE 26: RESULTS OF THE HAMILTON DEPRESSION RATING SCALE FOR

THE PATIENT VOLUNTEERS
Hamilton Rating scale for Depression

Patient Code
Baseline End of the study
BDNF01 14 1
BDNF02 25 2
BDNF03 23 1
BDNF04 29 1
An earlier study to determine the association of factors indicative of gender

disadvantage and reproductive health with the risk of common mental disorders (CMDs) in
women in Goa found that the prevalence of CMD was 6.6%. Mixed anxiety-depressive
disorder was the most common diagnosis (64.8%). Factors independently associated with
the risk for CMD were factors indicative of gender disadvantage, particularly sexual
violence by the husband, being widowed or separated, having low autonomy in decision
making, and having low levels of support from one's family reproductive health factors,
particularly gynaecological complaints such as vaginal discharge and dyspareunia; and
factors indicative of severe economic difficulties, such as hunger (Patel et al., 2006).
The blood samples were collected in two different blood collection tubes i.e., EDTA
tubes and Cell Preparation Tubes and were processed immediately in two independent
procedures for the isolation of Total RNA and Peripheral Blood Mononuclear Cells
(PBMCs) respectively. The samples were classified into groups as tabulated below
(Table 19).
TABLE 27: CLASSIFICATION OF SAMPLES
Group Samples
Normal healthy subject 1 (BDNFH01)
Group I: Patient 1 Before treatment (BDNF01)
Patient 1 After treatment (BDNF01RE)
Group II: Patient 2 Before treatment (BDNF02)
Group III: Patient 3 Before treatment (BDNF03)
Group IV: Patient 4 Before treatment (BDNF04)
SEPARATION OF PERIPHERAL BLOOD MONONUCLEAR CELLS (PBMC)

FROM THE BLOOD SAMPLES USING BD VACUTAINER CELL PREPARATION
TUBE AND VIABLE CELL COUNT USING TRYPAN BLUE
The Blood sample collected in the BD Vacutainer Cell Preparation Tubes were
processed according to the manufacturer’s protocol. The PBMCs were washed thrice and
finally made up to 10 ml with sterile saline. From this suspension 10 µL was mixed with
equal volume of Tryphan blue and observed under the microscope. The total numbers
of PBMCs were counted using the hemocytometer and are tabulated in the Table 20.
TABLE 28: RESULTS OF PBMC ISOLATION AND VIABLE CELL COUNT
PBMC Count (1 X 106 cells/8 ml of blood)

Group Sample
Before Treatment After Treatment
BDNFH01 3.90 3.91
Group I
BDNF01 0.80 6.15
BDNFH02 6.25 6.23
Group II
BDNF02 5.60 10.10
BDNFH03 5.20 5.24
Group III
BDNF03 7.30 4.55
BDNFH04 3.80 3.76
Group IV
BZDNF04 5.40 4.60
The amount of PBMCs present in the first patient sample (BDNF01) before
treatment was found to be quite low, which could be attributed to the age of the volunteer.
Earlier studies of lymphocyte populations have found that they are affected by the age,
sex and race of the subjects (Chng et al., 2004). From the above PBMC suspensions, sample
volumes corresponding to 1 x 106 cells were taken and used subsequently for preparing the
cell lysate, from which 50 µL was taken for the Assay of pGSK 3 β and pCREB using
ELISA.
ASSAY OF TOTAL PROTEIN BY BRADFORD’S METHOD - 96 WELL PLATE

ASSAY PROTOCOL
From the cell lysate 5 µL samples were taken and assayed for total protein using
Bradford’s method in the 96 well plate protocol along with a set of standards (BSA). Based
on the optical density values of the sample cell lysates and the quantitative curve of the
standards, the concentration of total protein present in 5 µL of the cell lysates were
calculated and are given in the Table 29.
TABLE 29: CONCENTRATION OF TOTAL PROTEIN PRESENT

IN THE PBMC LYSATES
Total Protein (µg/10 x 106 cells)

Group Sample
Before Treatment After Treatment
BDNFH01 353.85 353.80

Group I
BDNF01 560 533.33
BDNFH02 288 288.21

Group II
BDNF02 110.71 324.75
BDNFH03 326.92 325.97

Group III
BDNF03 241.1 162.64
BDNFH04 547.37 548.12

Group IV
BDNF04 303.7 359.4
The results show a significant increase in total protein levels in Groups II and IV,
whereas it is significantly decreased in Groups I and III.
ASSAY OF pGSK-3 β and pCREB ACTIVITY IN THE CELL LYSATES
The amount of phosphorylated GSK-3β present in the sample cell lysates was
determined by comparing with a set of standards provided by the manufacturer. The
standard pGSK 3 β (Tyr 216) provided was serially diluted and treated as per the
manufacturer’s protocol. The optical density values at 450nm were used to calculate the
amount of pGSK-3β present in the sample cell lysates. The presence of phosphorylated
CREB in the sample cell lysates was determined by comparing with a set of positive and
negative controls provided by the manufacturer. The optical density values for the sample
cell lysates at 450 nm were compared with those of the controls.
Results from an earlier study demonstrated that site-specific injection of a lentivirus

induced continuous GSK-3β expression in the hippocampal dentate gyrus of mice, resulting
in pro-depressant-like effects and increased sensitivity to chronic mild stress. Furthermore,
chronic fluoxetine administration reversed these prodepressant-like effects and decreased
neuronal apoptosis in the hippocampal DG in GSK-3β-overexpressing mice (Zhang et al.,

2013).
An earlier study demonstrated that chronic, but not acute, administration of several
different classes of antidepressants, including serotonin- and norepinephrine-selective
reuptake inhibitors, increased the expression of CAMP response element binding protein
(CREB) mRNA in rat hippocampus. Increased expression of CREB would be expected to
alter the expression of specific target genes. Among the many potential target genes
regulated by CREB are those for brain-derived neurotrophic factor (BDNF) and its receptor,
trkB (Condorelli et al., 1994; Ghosh et al., 1994; Duman et al., 1995). Their findings
indicate that upregulation of CREB is a common action of chronic antidepressant treatments
that may lead to regulation of specific target genes, such as BDNF and trkB, and to the long-
term effects of these treatments on brain function (Nibuya et al., 1996).
The results show that after 10 weeks of Venlafaxine treatment there has been a
significant decrease in the activity of pGSK3-β except in the Group I, where it has been
found to increase significantly. In case of pCREB activity, it was found that there has been a
significant increase following venlafaxine treatment in all the groups except Group I, where
it was found to be decreased (Table 30 and Figure 37).
TABLE 30: ACTIVITY OF pGSK‐3β and pCREB IN PBMC LYSATES
Activity of pGSK‐3β Activity of pCREB

Groups (units/100 µg of protein) (OD value/50 µL of cell lysate)
Before Treatment After Treatment Before treatment After treatment
22.7 22.5 0.287 0.291
I
27.1 32 0.582 0.444
14.6 14.8 0.535 0.533
II
74.5 51.6 0.230 0.503
28.4 28.6 0.933 0.930
III
49 40.5 0.267 0.548
24.6 24.9 0.371 0.380
IV
21.7 18 0.200 0.289
FIGURE 37: ACTIVITY OF pGSK‐3β and pCREB IN

THE PBMC LYSATES
600
Healthy Controls
500
Before Treatment
400
After Treatment
300
200
100
0
Total Protein pGSK 3β pCREB HDRS
TOTAL RNA ISOLATION FROM WHOLE BLOOD USING TRI REAGENT OF

THE TOTAL RNA USING QIAGEN RNEASY MINI KIT
The blood samples collected in the BD Vacutainer EDTA tubes were used for the
isolation of total RNA using TRI reagent. The total RNA isolated from the blood samples
were measured using the NanoDrop 2000 spectrophotometer and is tabulated in Table 24.
TABLE 31: AMOUNT OF TOTAL RNA ISOLATED FROM WHOLE BLOOD
Concentration of Total RNA Concentration of Total RNA

(before cleaning) (ng/µL) (after cleaning) (ng/µL)
Group Sample
Before After Before After
treatment treatment treatment treatment
BDNFH01 519.9 520.1 112.5 113.3
Group I
BDNF01 554.3 678.4 27.2 251.3
BDNFH02 574.7 574.9 134.2 133.9
Group II
BDNF02 379.2 309.8 61.8 175.2
BDNFH03 1094.3 1093.8 124.8 125.2
Group III
BDNF03 957.0 528.9 82.1 60.6
BDNFH04 534.0 533.7 58.6 58.5
Group IV
BDNF04 498.9 465.2 69.6 251.9
The total RNA obtained from the whole blood samples were cleaned of
contaminating genomic DNA and other impurities using the RNeasy Mini kit (spin
protocol). During the DNase I treatment a reduction in the concentration of total RNA was
observed which is also tabulated in Table 31.
REAL TIME PCR ANALYSIS OF bdnf, bcl2a1 AND hprt mRNA EXPRESSION
The total RNA obtained from the whole blood samples was then used as the input
for cDNA Synthesis. The cDNA thus obtained was then used for the Real time PCR
analysis of bdnf, bcl2a1 and hprt mRNA expression. The results of which are tabulated in
Table 32 and shown in the Figure 38.
[[[
TABLE 32: THRESHOLD VALUES OF THE REAL TIME PCR ANALYSIS

OF bdnf, bcl2a1 AND hprt mRNA EXPRESSION
CT values CT values CT values

(bdnf) (bcl2a1) (hprt)
Sample
Before After Before After Before After
treatment treatment treatment treatment treatment treatment
BDNFH01 34.27 34.16* 34.34 34.23* 30.72 30.80*
BDNF01 37.11 35.19 33.64 31.59 30.09 29.95
BDNFH02 34.69 34.84* 32.88 32.19* 31.13 31.21*
BDNF02 34.31 33.07 39.02 37.78 31.98 31.29
BDNFH03 35.49 35.96* 32.39 32.99* 32.86 32.59*
BDNF03 37.71 35.28 36.43 34.93 34.87 34.90
BDNFH04 37.35 37.87* 39.89 39.15* 34.62 34.91*
BDNF04 34.28 32.53 34.34 31.64 30.13 30.86
*
Sampling for Healthy Controls was performed after 10 weeks, without any treatment.
FIGURE 38: REAL TIME PCR ANALYSIS OF bdnf, bcl2a1

AND hprt mRNA EXPRESSION
65
Healthy Controls
60 Before Treatment
After Treatment
55
50
45
40
35
30
bdnf bcl2a1 hprt
Previous studies showed that chronic, but not acute treatment with the tricyclic
antidepressant (TCA) desipramine, the selective serotonin reuptake inhibitor (SSRI)
fluoxetine and the monoamine oxidase inhibitor (MAOI) phenelzine increased BDNF
protein levels in the frontal cortex (10-30%), but not in the hippocampus, amygdala,
olfactory bulb, and brain stem. Whereas chronic administration of the typical antipsychotic
haloperidol and the atypical antipsychotic clozapine increased BDNF levels by only 8 - 10%
in the frontal cortex. These results suggest that diverse pharmacologic and somatic
antidepressant treatments, as well as antipsychotics, increase levels of BDNF protein in the
frontal cortex, even though they have different mechanisms of action at neurotransmitter
systems (Balu et al., 2008).
But our results show that there was no significant change in the levels of bdnf and
bcl2a1mRNA before and after treatment. This requires further studies with larger sample
size for confirmation, as this negative result could be also because of the small sample size.
PART C
HOMOLOGY MODELLING AND DOCKING STUDIES OF THE NERVE

GROWTH FACTOR (NGF) WITH ITS RECEPTOR TRK A
Neurotrophins and their receptors influence many aspects of neuronal activity that
result in the generation of new synaptic connections, which can be long lasting (Huang and
Reichardt, 2001). Alterations in neurotrophin levels have profound effects on a wide variety
of phenomena, including myelination, regeneration, pain, aggression, depression and
substance abuse. The actions of neurotrophins depend on two different transmembrane-
receptor signalling systems (Chao and Hempstead, 1995) – the Trk receptor tyrosine kinases
and the p75 neurotrophin receptor (Kaplan and Miller, 2000; Dechant and Barde, 2002).
Protein interactions mediate many cellular processes and form a substantial part of
the regulatory networks responsible for biological function. Many biological functions
involve the formation of protein-protein complexes, which are critical for all cellular
pathways, regulation and packaging (Janin et al., 2003). Biological molecules recognise
each other and form specific associations, which are fundamental to the biology and nature
of the interactions involved. X-ray diffraction analyses have provided detailed information
on several systems involving protein-protein recognition and association.
Many such associations have been found to form via Van der Waals’ contacts,
electrostatic forces and hydrogen bonds (Chothia and Janin, 1975). In the current study
Hydrogen bonding interactions between the Neurotrophins and their cognate Trk receptors
have been used as a measure of their binding and specificity. The hydrogen bonding
interactions present in the structures of the Neurotrophin-Trk complexes obtained from the
RCSB Protein data bank and those obtained by homology modelling were compared to
assess the usefulness of in silico techniques to model protein-protein interactions.
1. RETRIEVAL OF PROTEIN SEQUENCES FROM UNIPROTKB
The amino acid sequences of NGF and TrkA were obtained from the UniProt
Knowledgebase in the fasta format, which were used for the sequence analysis. NGF
(UniProt ID: P01138) has a sequence length of 241 amino acids, whereas TrkA (UniProt ID:
P04629) has a length of 796 amino acids. The protein sequences were downloaded and used
for sequence analysis and homology modelling. The figures 1 and 2 given below show the
amino acid sequences of NGF and TrkA respectively.
Figure 39: Amino acid sequence of human NGF (UniProt ID: P01138)
Figure 40: Amino acid sequence of human TrkA (UniProt ID: P04629)
2. PROTEIN PARAMETERS
The protein parameters of NGF and TrkA were calculated using the ExPASy
ProtParam tool and their molecular weights were found to be 26958.7 and 87497.1
respectively. The isoelectric pH (pI) was calculated to be 9.94 for NGF and 6.17 for TrkA.
Both proteins were classified as unstable owing to a high value for their instability index,
which might be due to the presence of signal peptide or pro-peptide sequences.
3. AVAILABLE CRYSTAL STRUCTURES OF NGF AND TRKA

Neurotrophins generally function as non-covalently associated homodimers, but a few
are able to form heterodimers. The structures of NGF, NT-3, NT-4, NT-3/BDNF and
NT-4/BDNF have been solved and are found to contain the common features – a tertiary
fold and Cystine knot (McDonald et al., 1991; Fandl et al., 1994; Robinson et al., 1995,
1999; Butte et al., 1998).
Three members of the Tropomyosin-related kinase (Trk) receptor tyrosine kinase

family were shown to be directly binding to the Neurotrophins with specificity. Binding to
the Neurotrophins dimerized these receptors resulting in activation of the tyrosine kinase
present in the cytoplasmic domain of the receptor. The specificity of the Neurotrophins for
the Trk receptor is as follows, NGF is specific for Trk A, BDNF and NT-4 are specific for
Trk B and NT-3 is specific for Trk C, although it can less efficiently bind and activate Trk A
and B. The Trk binding sites for the Neurotrophins have been identified by various previous
studies to be the D5 region in the extracellular domain, which contains the proximal
Immunoglobulin-like (Ig) domain.
The three dimensional structures of the Ig domain of all the Trk receptors have been
solved (Ultsch et al., 1999). Further some more detailed information regarding the
specificity of binding has also been obtained (Urfer et al., 1998; Weismann et al., 1999;
Banfield et al., 2001; Naylor et al., 2002).
The available data of the solved crystal structures of NGF and TrkA were retrieved
from the RCSB Protein Databank. The details are tabulated in Table 26
TABLE 33: AVAILABLE CRYSTAL STRUCTURES OF NGF AND TRKA
Region in PDB* Sequence length

Protein Organism PDB ID
Peptide 1 Peptide 2 Peptide 1 Peptide 2
NGF
Mus musculus 1BET Whole - 107 -
monomer
NGF trimer Mus musculus 1BTG Whole Whole 110 110
NGF- Human Ecto
1SG1 Whole 120 161
p75NTR Rattus norvegieus domain
Ecto
TrkA-NGF Human 2IFG Whole 347 120
domain
TrkA-NGF Human 1WWW D5 region Whole 101 120
TrkA Human 1WWA D5 region - 109 -
TrkA Human 1HE7 D5 region - 126 -
* Indicates Whole or Part of the Neurotrophin or Trk structure/complex available in RCSB

PDB
4. IDENTIFICATION OF CONSERVED DOMAINS IN NGF AND TRKA
The Neurotrophins belong to the family of growth factors and have an approximate
Molecular weight of 25KDa. Currently six neurotrophins have been isolated NGF, BDNF,
NT-3, NT-4/NT-5, NT-6 and NT-7. Of which only the first four have been identified in
humans and mammals. There is significant evidence that these proteins have all arose from
a common ancestral gene (Hallbook, 1999) and hence share 50% sequence homology (Bibel
and Barde, 2000).
The amino acid sequences of NGF and its receptor were submitted in the Conserved
Domains Database search tool to identify the presence of conserved regions. The results
show that the NGF belongs to the Nerve Growth Factor superfamily of proteins (Figure 41),
which share good sequence homology. The other members of the family are Brain-derived
Neurotrophic factor, Neurotrophin-3 and Neurotrophin-4.
Figure 41: CDD search result for NGF
The Trk receptors are highly homologous in sequence (Patapoutian and Reichardt,
2001). Though their complete three dimensional structures have not yet been elucidated,
their extracellular domain has been classified into five subdomains based on sequence
similarities to other known receptors (Schneider and Schweiger, 1991). The TrkA sequence
was found to belong to the PKc-like superfamily, and contain Leucine-rich repeats,
Immunoglobulin-like domains and a protein kinase domain (Figure 42).
Figure 42: CDD search result for TrkA
5. SIGNAL PEPTIDE AND PRO-PEPTIDE PREDICTION USING ProP 1.0
Neurotrophins are generally synthesized as pre-proproteins, which are processed by

proprotein convertases to release the mature, functional protein (Mowla et al, 2001 and
Seidah et al, 1996). The NGF and TrkA sequences were submitted in the ProP version 1.0
server to identify the Signal and Pro-peptide sites. The results were then compared with the
data available in the UniProt database to confirm their position.
Figure 43: ProP result for NGF
Likewise the amino acid sequence of TrkA was also submitted in the ProP server.
The receptor was found to contain only the signal peptide cleavage site but not the pro-
peptide cleavage site, similar to the data available in the UniProt Knowledgebase. The
Figure 44 is the result of the ProP version 1.0 prediction result for TrkA.
Figure 44: ProP result for TrkA
6. SECONDARY STRUCTURE PREDICTION
The amino acid sequences of NGF and TrkA without the signal peptide sequence
was submitted in the SOPMA server for the prediction of their secondary structural
characteristics. The prediction results for NGF (Figure 45) indicate a predominance of
random coils, followed by extended strands and α-helices.
Figure 45: Secondary structure prediction for NGF
TrkA on the other hand was found to contain 42% of Random coils, followed by
26% α-helices and 24% extended strands. The SOPMA prediction result for TrkA is
represented in the Figure 46.
Figure 46: SOPMA secondary structure prediction for TrkA
7. TRANSMEMBRANE PREDICTION RESULTS
The TrkA amino acid sequence without the signal peptide sequence was submitted
in the TMHMM server and was predicted to contain the transmembrane helix between
residues 385 and 407 (Figure 47).
Figure 47: TMHMM prediction results for TrkA
8. TEMPLATE IDENTIFICATION USING BLASTP
The amino acid sequences of NGF and TrkA were submitted in the BLASTp server
in order to identify template structures for homology modelling. On submission of the NGF
sequence the BLASTp result with 100% identity was found to be the V chain of the NGF-
TrkA complex (PDB ID: 1WWW). This was subsequently used as the template for
homology modelling. The figure 48 shows the sequence alignment of the NGF sequence
with the 1WWW V chain.
Figure 48: Sequence alignment of NGF with V chain of 1WWW
The BLASTp search for the TrkA sequence yielded templates only for the
Ectodomain and Kinase domains but not for the transmembrane regions. The BLASTp hit
for the Ectodomain was the A chain of the TrkA-NGF complex (PDB ID: 2IFG) with 100%
sequence identity (Figure 49), which was later used for homology modelling.
Figure 49: Sequence alignment of 2IFG A chain and TrkA Ectodomain sequence
9. HOMOLOGY MODELLING OF NGF
The NGF sequence obtained from the Uniprot database was processed to obtain the
sequence of the mature and functional neurotrophin, which was then modelled based on the
templates 1BET_A chain, 1BTG_A chain, 2IJ2_A chain and 1IFG_E chain. The model with
the highest DOPE score (-38089.667969) was selected. The modelled NGF was then
superimposed with 1BTG_A chain (Figure 50) and was found to have an RMS value of
0.83Å.
N-terminal C-terminal
residues residues
Figure 50: Structural Superposition of 1BTG (coloured CYAN) and modelled NGF
(coloured VIOLET)
10. MODEL VALIDATION USING RAMACHANDRAN PLOT
Model validation was carried out by submitting the co-ordinates of the protein model
to the RAMPAGE server. The stereo chemical quality of the protein structures was
examined using the Ramachandran plot, the number of residues that are in the allowed or
disallowed regions of the Ramachandran plot determines the quality of the model, which
indicates the region of possible angel formation of (phi) Φ and (psi) Ψ angles and
distribution of backbone conformational angles for each residue of the refined structure. The
percentage of residues in the most favourable regions of Ramachandran plot was found to
be 81.5% and of those lying in disallowed region was found to be 1.3%.
TABLE 34: RESULTS OF RAMPAGE SERVER FOR NGF AND TRK A MODELS
Evaluation for residues NGF Model Trk A model

Percentage of residues in favoured region 95.5% 82.3%
Percentage of residues in allowed region 4.5% 13.0%
Percentage of residues in outlier region 0.0% 4.6%
11. MOLECULAR DOCKING USING HEX 6.12

The NGF monomer model was made into two copies and the chain names were
given as A and B, these were then used for dimerization using Hex 6.12. The E Total docking
energy was found to be -1002.54. The NGF homodimer model was found to form a closed
cavity at the interface, which is conserved in all the neurotrophin homo- and heterodimers
(Weismann et al., 1999; Robinson et al., 1999). The NGF protomers were found to interact
through hydrogen bonding interactions at similar/conserved regions (Figure 3).
Figure 51: Hydrogen bonding interactions observed in the NGF homodimer model (A
chain is BLUE coloured and B chain is VIOLET coloured)
The NGF homodimer model was then used for docking with its corresponding
receptor Trk A using the Hex 6.12 tool. The crystal structure 2IFG was used as the reference
molecule for the docking studies. The docking was found to occur in a negative cooperative
fashion with a docking energy -678.01 for the first receptor chain and -514.10 for the second
chain.
Previous studies showed that the Neurotrophin – receptor interaction was occurring
through two patches, a conserved site and a specificity site within the D5 domain of the Trk
receptor and the interface of the neurotrophin dimers. The specificity patch is mainly
comprised of the N-terminal residues of the neurotrophins, which were also found to be
embedded within the cavity of the Trk receptors (Weismann et al., 1999). The docked
NGF – Trk A model was also found to confirm the previous findings, which can be
observed by the hydrogen bonding interactions occurring between NGF and Trk A
(Figure 52)
Figure 52: Hydrogen bonding interactions observed between the docked

NGF and TrkA receptor models
HOMOLOGY MODELLING AND DOCKING STUDIES OF BDNF WITH ITS

COGNATE RECEPTOR TRK B
Neurotrophins such as BDNF and NT3 produce rapid increases in synaptic strength
in nerve-muscle synapses, as well as increases in excitatory post-synaptic currents in
hippocampal neurons (Lohof et al., 1993; Kang and Schuman, 1995; Levine et al., 1995).
BDNF and NT3 also induce rapid and long-lasting enhancement of synaptic strength
through long term potentiation (LTP) in hippocampal slices (Korte et al., 1995; Xie et al.,
2000). Several lines of evidence have implicated neurotrophins in depression. First, in
animal models, restraint stress leads to decreased expression of BDNF in the hippocampus
(Smith et al., 1995; Ueyama et al., 1997). Second, the administration of BDNF to the
midbrain or hippocampus results in antidepressant effects in animal models of depression –
forced swim and learned helplessness. This effect is comparable to chronic treatment with
pharmacological antidepressants (Shirayama et al., 2002).

The amino acid sequences of the human Brain-derived neurotrophic factor (BDNF)
and Trophomyosin-related kinase B (TrkB) were retrieved from the UniProt
Knowledgebase using the search terms “BDNF” and “TrkB”. The UniProt ID of BDNF is
P23560, which has a sequence length of 247 amino acids (Figure 48), and that of TrkB is
Q16620 which has a sequence length of 822 amino acids (Figure 49). The protein sequences
were downloaded in the fasta format and were used for the sequence analysis and
modelling.
The protein parameters were calculated for BDNF and TrkB sequences using the
ExPASy ProtParam tool. The molecular weight was calculated and found to be 13511.5 for
BDNF and 88319.5 for TrkB. The theoretical pI was found to be 9.59 for BDNF and 5.86
for TrkB. BDNF was classified as a stable protein with an instability index of 37.38,
whereas TrkB was classified as an unstable protein owing to a high instability index of
43.98. This might be because TrkB is a transmembrane protein with many hydrophobic
amino acids.
Figure 53: Amino acid sequence of BDNF
Figure 54: Amino acid sequence of TrkB
3. AVAILABLE CRYSTAL STRUCTURES OF BDNF AND TRKB

The available crystal structural data for BDNF and TrkB were retrieved from the
RCSB Protein Databank and are given in Table 28.
TABLE 35: CRYSTAL STRUCTURES OF BDNF AND ITS RECEPTOR TRKB

Crystal Structure PDB ID
Protein 1 Protein 2 Protein 1 Protein 2
BDNF/NT3
1BND Whole Whole 119 119
heterodimer
BDNF/NT4
1B8M Whole Whole 119 130
heterodimer
TrkB with
1HCF D5 region Whole 101 130
NT 4/5
Trk B 1WWB D5 region - 103 -
Trk B 4ASZ Kinase domain - 296 -
Trk B 4AT3 Kinase domain - 296 -
PDB
4. IDENTIFICATION OF CONSERVED DOMAINS USING CDD
The amino acid sequences of BDNF and TrkB were submitted in the Conserved
Domain Database (CDD) to identify the presence of conserved domains. BDNF was found
to belong to the Nerve Growth Factor superfamily, the result of which is shown below in
Figure 50.
Figure 55: CDD search result for BDNF
Likewise the amino acid sequence of the human TrkB was found to contain three
major conserved domains viz., three Leucine-rich repeats (LRR), two Immunoglobulin-like
domains and a Protein Kinase catalytic domain. The CDD search result for TrkB is given
below in Figure 56.
Figure 56: CDD search result for TrkB

5. SIGNAL PEPTIDE AND PRO-PEPTIDE PREDICTION USING PROP

VERSION 1.0
The data available in the Uniprot database was compared with the results obtained
from the ProP version 1.0 Server to identify the signal peptide and the propeptide. The
results show that the signal peptide and pro-peptide cleavage sites for BDNF are between
the residues 18 - 19 and 128 - 129 respectively (Figure 57).
Figure 57: ProP prediction result for BDNF shows the Signal peptide cleavage site as a
RED line and the Pro-peptide cleavage site as a BLUE line
In case of TrkB, the ProP prediction results show only a Signal peptide cleavage site
between residues 31 - 32 but no Pro-peptide cleavage site corroborating the data provided in
the UniProt database (Figure 58).
Figure 58: ProP prediction result for TrkB showing the Signal peptide
cleavage site as a RED line
6. SECONDARY STRUCTURE PREDICTION USING SOPMA

The amino acid sequences of the mature BDNF and TrkB were submitted in the
SOPMA server to identify the secondary structural elements present in the above proteins.
BDNF was found to contain approximately 40% of random coils, followed by extended
strands and alpha helices (Figure 59). The results for the TrkB receptor indicate the presence
of more than 40% of Random coils and equal percentage of alpha helices and extended
strands (Figure 60).
Figure 59: SOPMA secondary structure prediction result for mature BDNF
Figure 60: SOPMA secondary structure prediction result for the mature TrkB
7. TRANSMEMBRANE PREDICTION USING TMHMM

The amino acid sequence of the mature TrkB receptor was submitted in the
TMHMM server and was identified as occurring in the region of amino acid numbering 400
(Figure 56). This was found to correlate with the data in the UniProt database.
Figure 61: TMHMM prediction result for TrkB
The protein sequences retrieved from the UniProt KB were submitted in the
BLASTp server to obtain templates for homology modelling. The BLASTp hit for BDNF
(Figure 57) with 100% identity was the A chain of the BDNF-NT4 heterodimer (PDB ID:
1B8M), which was used as the template for homology modelling of the mature BDNF.
Figure 62: Sequence alignment for the query BDNF sequence with the
sequence of 1B8M_A chain
The BLASTp hits for TrkB were obtained only for the Ectodomain region and the
Cytoplasmic kinase domain. Hence the BLASTp hit for the Ectodomain region (Figure 58)
with 40% sequence identity (PDB ID: 2IFG) was initially used for homology modelling of
the Ectodomain region of the TrkB receptor.
Figure 63: Sequence alignment for the query TrkB Ectodomain sequence
with the sequence of 2IFG A chain
12. HOMOLOGY MODELLING OF BDNF
The BDNF sequence obtained from the Uniprot database was processed to obtain the
sequence of the mature and functional neurotrophin. The sequence of the mature functional
BDNF was then submitted to the Online modelling servers Phyre2 and Modweb. From the
models obtained the best model was selected based on the structural similarity with the NGF
structure from the crystal structure, 2IFG, which was used as the template for the docking
studies.
The sequence corresponding to the Ectodomain of Trk B was used to perform

homology modelling based on the structure of the Trk A Ectodomain from the crystal
structure 2IFG, using the SWISS MODEL Workspace. Since the crystal structure of the
ligand-binding domains of the Trk B receptor was available, the model was modified
by ligating the complete Ectodomain model with the corresponding model of the
ligand-binding domain. The generated models of BDNF and Trk B were energy minimised
and validated using the RAMAPGE Online Server, results of which are tabulated in
Table 36.
TABLE 36: EVALUATION OF THE BDNF AND TRK B MODELS USING

RAMACHANDRAN PLOT
BDNF Trk B
Evaluation for residues
model model

The BDNF monomer model was made into two copies and the chain names were
given as X and Y, these were then used for dimerization using Hex 6.12. The ETotal docking
energy was found to be -674.8. The BDNF homodimer model like the NGF model was also
found to form a closed cavity at the interface (Weismann et al., 1999; Robinson et al.,
1999). The BDNF protomers were found to interact through hydrogen bonding interactions
at similar/conserved regions similar to those observed for the NGF homodimer (Figure 64).
Figure 64: Hydrogen bonding interactions observed in the

BDNF homodimer model
The BDNF homodimer model thus generated was used for docking with the model
of its cognate receptor Trk B using the Hex 6.12 tool. The crystal structure 2IFG was used
as the reference molecule and the docking energies were found to be -835.6 for the first
receptor molecule and -521.7 for the second. The hydrogen bonding interactions observed
between BDNF and Trk B (Figure 65) indicate that the binding occurs in a similar fashion
as that observed between NGF and Trk A.
Figure 65: Hydrogen bonding interactions observed between the

docked BDNF and Trk B receptor models
HOMOLOGY MODELLING AND DOCKING STUDIES OF THE

NEUROTROPHIN-4 (NT-4) WITH ITS RECEPTOR TRK B
1. RETRIEVAL OF NT-4 PROTEIN SEQUENCE FROM UNIPROTKB
The amino acid sequence of NT-4 was retrieved from the UniProt Knowledgebase
and was found to contain 210 amino acid residues (UniProt ID: P34130). The sequence was
downloaded in the fasta format (Figure 59) and was used for subsequent sequence analysis
and homology modelling.
Figure 66: NT-4 amino acid sequence
2. PROTEIN PARAMETERS OF NT-4

The amino acid sequence of NT-4 retrieved from the UniProt sequence was
submitted in the ExPASy ProtParam tool to calculate the protein parameters. The results
show that NT-4 has a molecular weight of 22426.7 with a pI of 9.01. The protein was also
classified as unstable owing to a high instability index.
3. AVAILABLE CRYSTAL STRUCTURES OF NT-4

The crystal structural data for NT-4 was obtained from RCSB Protein Databank and
are tabulated in the Table 37.
TABLE 37: AVAILABLE CRYSTAL STRUCTURES OF NT-4
PDB Region in PDB* Sequence length

Protein Organism
ID Protein 1 Protein 2 Protein 1 Protein 2
BDNF/NT4
Human 1B8M Whole Whole 119 130
dimer
NT4 dimer Human 1B98 Whole Whole 130 130
TrkB with
Human 1HCF D5 region Whole 101 130
NT 4/5
PDB
1. IDENTIFICATION OF CONSERVED DOMAINS IN NT-4

The conserved domains of NT-4 were identified using the search form in the
Conserved Domain Database and was found to belong to the Neurotrophin family of
proteins (Figure 66).
Figure 67: CDD search result for NT-4

VERSION 1.0
The NT-4 sequence was submitted in the ProP server to identify the signal and
Pro-peptide sites. The signal peptide cleavage site was found to occur between the residues
24 and 25, whereas the pro-peptide cleavage was found to be between residues 79 and 80
(Figure 67).
Figure 68: Signal and Pro-peptide site prediction
The mature NT-4 sequence was then submitted in the SOPMA server for the
prediction of secondary structures. The results show that like NGF and BDNF, NT-4
also had predominantly random coils followed by αhelices and extended strands
(Figure 68).
Figure 69: SOPMA prediction results for NT-4
The NT-4 sequence was submitted as the query in the BLASTp search page to
obtain templates for homology modelling. The results show that the B chain of the
BDNF/NT-4 heterodimer structure (PDB ID: 1B8M) showed 100% sequence homology
with that of NT-4 (Figure 69) and hence was used as the template subsequently for
homology modelling of NT-4.
Figure 70: Sequence alignment of NT-4 and 1B8M B chain
5. HOMOLOGY MODELLING OF NT-4
The NT-4 sequence obtained from the Uniprot database was processed to obtain the
protein monomer was then submitted to the Online modelling servers Phyre 2 and Modweb.
From the models obtained the best model was selected based on the structural similarity
with the NGF structure from the crystal structure, 2IFG. The generated model was energy
minimised using SPDBV and then validated using the RAMAPGE Online Server, results of
which are tabulated in Table 37.
TABLE 38: EVALUATION OF THE NT-4 MODEL USING

RAMACHANDRAN PLOT
Evaluation for residues NT-4 model
Percentage of residues in favoured region 91.1%
Percentage of residues in allowed region 7.1%
Percentage of residues in outlier region 1.8%

The NT-4 monomer model was made into two copies and the chain names were
given as P and Q, these were then used for dimerization using Hex 6.12. The E Total docking
energy was found to be -547.6. The homodimer model was also found to form a closed
cavity at the interface as observed in the solved crystal structures (Weismann et al., 1999;
Robinson et al., 1999). The protomers were found to interact through hydrogen bonding
interactions at similar/conserved regions similar to those observed for the NGF homodimer
(Figure 65).
Figure 71: Hydrogen bonding interactions observed in

the NT-4 homodimer model
The NT-4 homodimer model thus generated was used for docking with the model of
its cognate receptor Trk B using the Hex 6.12 tool. The crystal structure 2IFG was used as
the reference molecule and the docking energies were found to be -903.2 for the first
receptor molecule and -651.2 for the second. The hydrogen bonding interactions observed
between NT-4 and Trk B (Figure 66) indicate that the binding occurs in a similar fashion as
that observed between those of our models of NGF/Trk A and BDNF/Trk B receptor ligand
structures.
Figure 72: Hydrogen bonding interactions observed between the docked NT-4
homodimer and Trk B receptor models
HOMOLOGY MODELLING AND DOCKING STUDIES OF THE

NEUROTROPHIN-3 (NT-3) WITH ITS RECEPTOR TRK C
The amino acid sequences of NT-3 and Trk C were downloaded from the UniProt
Knowledgebase in the fasta format. NT-3 (UniProt ID: P20783) has a length of 257 amino
acids, whereas Trk C (UniProt ID: Q16288) is 839 residues long. The downloaded protein
sequences were subsequently used for sequence analysis and homology modelling. The
Figures 70 and 71 show the amino acid sequences of NT-3 and Trk C respectively.
Figure 73: Amino acid sequence of NT-3 (UniProt ID: P20783)
Figure 74: Amino acid sequence of TrkC (UniProt ID: Q16288)
The ProtParam results for NT-3 and Trk C show that their molecular weights were
29354.5 and 94428.1 respectively. The isoelectric pH (pI) was found to be 9.46 for NT-3
and 6.12 for Trk C. Both proteins were classified as unstable owing to a high value for their
instability index, which might be due to the presence of signal peptide or pro-peptide
sequences.
3. AVAILABLE CRYSTAL STRUCTURES OF NT-3 AND TRK C
The search terms “NT-3” and “TrkC” were used to search for the available crystal
structural data from the RCSB PDB website, the results of which are tabulated in the Table
38. The data shows that there are no crystal structures available for the complete
Ectodomain of TrkC and neither for a NT-3 – TrkC receptor interaction as is available for
NGF – TrkA.
TABLE 39: AVAILABLE X-RAY CRYSTAL STRUCTURES

FOR NT-3 AND TRKC
Protein PDB ID
Protein 1 Protein 2 Protein 1 Protein 2
BDNF/NT3
1BND Whole Whole 119 119
heterodimer
NT3 monomer 1B8K Whole - 119 -
NT3 with Ecto
3BUK Whole 119 167
p75NTR domain
Trk C 1WWC D5 region - 118 -
Trk C 3V5Q Kinase domain - 297 -
PDB
4. IDENTIFICATION OF CONSERVED DOMAINS IN NT-3 AND TRKC USING
CDD
In the search box of the Conserved Domain Database website, the amino acid
sequences of NT-3 and TrkC were pasted and a search was performed. The results show that
NT-3 belongs to the superfamily of Nerve Growth Factors (Figure 72).
Figure 75: Conserved domain identified in the NT-3 amino acid sequence
Trk C like Trk A and Trk B, was found to belong to the PKc-like Superfamily, and
contains two Leucine-rich regions, two Immunoglobulin-like domains and a cytoplasmic
Protein kinase domain (Figure 73).
32
Figure 76: CDD search result for TrkC

VERSION 1.0
The amino acid sequence of NT-3 and TrkC was submitted in the ProP server in
order to identify the signal peptide and pro-peptide cleavage sites. The NT-3 sequence was
found to contain a signal peptide cleavage site between residues 18 and 19,
whereas the pro-peptide cleavage site was found to be between residues 137 and 138
(Figure 74).
Figure 77: ProP prediction result for NT-3
The TrkC sequence on the other hand was found to contain only a signal peptide
cleavage site between residues 31 and 32 (Figure 75) but no pro-peptide cleavage site was
predicted.
[[
Figure 78: ProP version 1.0 prediction result for TrkC
The secondary structure prediction for NT-3 and TrkC was performed using the
SOPMA server. NT-3 was found to contain more than 40% of random coils and more than
20% of α-helices and random coils (Figure 76). Likewise TrkC was found to contain more
number of random coils, followed by extended strands and α-helices (figure 77).
Figure 79: SOPMA prediction result for NT-3
Figure 80: Secondary structure prediction for TrkC
The amino acid sequences of NT-3 and TrkC retrieved from the UniProt KB were
submitted in the BLASTp server in order to obtain templates for homology modelling. The
BLASTp hit for NT-3 (Figure 78) with 100% identity was the A chain of the NT3 –p75
complex (PDB ID: 1B8K), which was used as the template for homology modelling of the
mature NT-3.
Figure 81: Sequence alignment for the query NT-3 sequence with
the sequence of 1B8K_A chain
The BLASTp hits for TrkC were obtained only for the Ectodomain region and the
Cytoplasmic kinase domain. Hence the BLASTp hit for the Ectodomain region alone
(Figure 79) with 39% sequence identity (PDB ID: 2IFG) was initially used for homology
modelling of the Ectodomain region of the TrkC receptor.
23
Figure 82: Sequence alignment for the query TrkC Ectodomain sequence with the
sequence of 2IFG_A chain
8. HOMOLOGY MODELLING OF NT-3
The NT-3 sequence obtained from the Uniprot database was processed to obtain the
protein monomer was then submitted to the Online modelling servers Phyre 2 and Modweb.
From the models obtained the best model was selected based on the structural similarity
with the NGF structure from the crystal structure, 2IFG. The generated model was energy
minimised using SPDBV and then validated using the RAMAPGE Online Server, results of
which are tabulated in Table 39.
TABLE 40: EVALUATION OF THE NT-3 MODEL USING

RAMACHANDRAN PLOT
Evaluation for residues NT-3 model Trk C model

The NT-3 monomer model was made into two copies and the chain names were
given as R and S, these were then used for dimerization using Hex 6.12. The E Total docking
energy was found to be -642.6. The homodimer model was like the previous modes also
found to form a closed cavity at the interface as observed in the solved crystal structures
(Weismann et al., 1999; Robinson et al., 1999). The protomers were found to interact
through hydrogen bonding interactions at similar/conserved regions similar to those
observed for the NGF, BDNF and NT-4 homodimers (Figure 70).
Figure 83: Hydrogen bonding interactions observed in the

NT-3 homodimer model
The NT-3 homodimer model thus generated was used for docking with the
ectodomain model of its cognate receptor Trk C using the Hex 6.12 tool. The crystal
structure 2IFG was used as the reference molecule and the docking energies were found to
be -931.2 for the first receptor molecule and -617.2 for the second. The hydrogen bonding
interactions observed between NT-3 and Trk C (Figure 71) indicate that the binding occurs
in a similar fashion as that observed between those of our models of NGF/Trk A and
BDNF/Trk B receptor ligand structures.
Figure 84: Hydrogen bonding interactions observed between the

docked NT-3 homodimer and Trk C receptor models
Protein-protein interactions pervade all cellular processes of a living organism

namely, in cellular architecture, signal transduction, biosynthetic and degradation pathways
and their regulations, immune response etc. and depends upon precise recognition involving
two or more proteins. Indeed, the biological function of a protein can be seen as defined by
the context of its interactions in the cell (Eisenberg et al., 2000). A detailed understanding
of hydrogen bonds has been a long standing goal in structural biology, as they are crucial for
the structure and function of proteins (Atwood and Steed, 2004).
These models generated in the current study throw light on the hydrogen bonding
interactions occurring between the neurotrophins and their cognate Trk receptors. This
could pave the way for better understanding of the protein-protein interactions occurring
between these molecules. Modelling of the complete receptor structures and molecular
dynamic simulation studies if performed can further enable us to understand the molecular
changes occurring due to neurotrophin binding, thereby increasing the possibilities of better
understanding their role in cellular function. This could further pave the way for better
therapeutics or diagnostics in major depression and other related psychiatric disorders.
Summary and Conclusion
6
SUMMARY AND CONCLUSION
Major depression is a serious, recurrent disorder linked to diminished role

functioning, quality of life, medical morbidity and mortality. It is related to the normal
emotions of sadness and bereavement, but it does not remit when the external cause of these
emotions dissipate, and is disproportionate to their cause. Classic severe states of depression
often have no external precipitating cause. Depression has been reported to be one of the
most common psychiatric disorders in outpatient clinic populations and also a common
disorder observed in community based studies. Recent reports state that Depression
affects 121 million people worldwide and is responsible for 850,000 deaths every year.
There are many veritable studies in the recent past which report decrease in the
levels of Brain Derived Neurotrophic Factor (BDNF) an important neurotrophin in neuronal
cells of animal models and in depressed human post mortem samples. An accompanying
decrease of BDNF in the Peripheral blood Mononuclear cells (PBMC) and in the serum of
the depressed patients (as it crosses Blood-Brain Barrier) was also reported. This decrease
was found to increase after Anti-depressant treatments.
The key regulatory events of the Cell survival pathway that lead to this decrease in
BDNF is the activation of GSK3β and concomitant inactivation of pCREB, a transcriptional
activator that leads to decreased expression of BDNF at the gene level. Delay and variations
in the modulations by these key regulators in each person at the cellular level seems to be
the deciding factor in succumbing to the disease, delay in responding to the treatment and
relapse as seen among the animal and post-mortem samples.
These putative biochemical markers/regulators were analyzed individually in

separate Western studies, but no integrated study had been carried out till date, with a
holistic approach to assay these key components together for better understanding of the
pathway.
Stress is described as a state of threatened homeostasis provoked by psychological,

physiological or environmental stressors. Stressor can either be an internal or external
stimulus, which activates the hypothalamic-pituitary-adrenal (HPA) axis and the

sympathetic nervous system resulting in an altered physiological state. Stressful conditions
are hypothesised to precipitate anxiety and depression, leading to an excessive production of
free radicalswhich in turn results in oxidative stress.Evidences show reduced
antioxidantdefences in depression, as indicated by lowered levels of key antioxidants and
antioxidant enzymes.
Venlafaxine is a Serotonin Norepinephrinereuptake inhibitor (SNRI) as it blocks

thesynaptosomal uptake of noradrenaline andserotonin and, to a lesser extent
dopamineuptake. It is one of the First-lineantidepressants currently used owing to itsrapid
onset and decreased propensity tocause anticholinergic effects andcardiotoxicity.
The present study was undertaken in three parts – an initial animal study, a pilot
study with human volunteers and an in silico study.
The first part of the study was done in four phases where Phase I included obtaining
Institutional Animal ethical clearance and procurement of animals and Grouping of
animals.After grouping the experimental animals were induced with Depression using the
Chronic unpredictable mild stress (CUMS) protocol, followed by Assessment of depression
using sucrose consumption test and forced swim test (FST). Administration of Venlafaxine
was done following stress induction.This was followed by blood collection by cardiac
puncture and harvesting the hippocampus on the 22nd day. Phase II involved the
Biochemical analysis of the serum and brain homogenate to estimate Total Protein, Enzymic
antioxidants (Catalase, Glutathione peroxidase and Superoxide dismutase), Non-enzymic
antioxidant (Vitamin C) and Lipid peroxidation. Phase III included Histopathological
analysis of brain hippocampus, Isolation of total protein from the Peripheral Blood
Mononuclear Cells (PBMC) and hippocampus and Western blotting. Phase IV involved the
isolation of total RNA from whole blood and hippocampus, RT-PCR Analysis of bdnf,
bcl2a1 and g3pdh mRNA expression.
Phase I of the human study involved Procurement of Institutional Human ethical

clearance, Identification and Selection of Depressive patients and healthy subjects using
Hamilton Depression Rating Scale, Obtaining consent, recruitment and Collection of blood
sample(s) from the study subjects. Phase II included Isolation of Peripheral Blood
Mononuclear Cells (PBMC), Measurement of phosphorylated Glycogen Synthase Kinase-

3β (pGSK3β) (Tyr 216) and phosphorylated CREB (Serine 133) in PBMC lysates using
ELISA. Phase III involved isolation of total RNA from whole blood, Cleaning the total
RNA and Real Time RT-PCR analysis of the mRNA expression of bdnf, bcl2a1 and hprt
(housekeeping) genes.
The in silico experiments were performed in several stages involving Retrieval of

the protein sequence from UniProtKB, Identification of templates by BLASTp, Secondary
structure prediction, Signal peptide and pro-peptide prediction, Transmembrane region
prediction, Homology modelling of the target proteins, Model validation, Molecular
docking studies and identification of hydrogen bonding residues in receptor-ligand models.
The results of the animal study show that venlafaxine treatment effectively improves
the sucrose consumption and decreases the immobility period. Also the levels of the
protective antioxidants were found to improve following venlafaxine administration. The
histopathological analysis shows definite and distinct changes in the hippocampus following
stress induction and venlafaxine treatment. Also the mRNA levels of BDNF were found to
be improved showing the role of BDNF in the etiology of depression.
The human study results confirm the findings of the animal study and showing
changes in the mRNA levels of BDNF. In addition the levels of phosphorylated GSK3β and
CREB were altered following venlafaxine administration. The in silico modelling studies
showed the hydrogen bonding interactions occurring between the neurotrophins and their
receptors.
From the study, it could be concluded that the antidepressant action of Venlafaxine
is through modulation of bdnf expression involving pCREB in the hippocampus, which is
also reflected in the blood. This potentiates the possible role of blood bdnf and/or pCREB as
a biomarker for depression and its treatment. The study also suggests that antidepressants
may bring about their action through mechanisms involving the antioxidant system. Further
studies regarding the action of various other antidepressants with a larger sample size might
be necessary to clarify the results of this study.
Bibliography
BIBLIOGRAPHY
Abel T, Nguyen P, Barad M, Deuel T, Kandel ER and Bourtchouladze R (1997). Genetic

demonstration of a role for PKA in the late phase of LTP in the hippocampus-based
long-term memory. Cell, 88: 615 – 626.
Airaksinen E, Larsson M, Lundberg I and Forsell Y (2004). Cognitive functions in

depressive disorders: evidence from a population-based study. Psychol Med, 34:
83 – 91.
Altschul SF, Gish W, Miller W, Myers EW and Lipman DJ (1990). Basic Local Alignment
Search Tool. J Mol Biol, 215 (3): 403 – 410.
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W and Lipman DJ (1997).
Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res, 25: 3389 – 3402.
American Psychiatric Association (1994). Diagnostic and Statistical Manual of Mental

Disorders – Fourth edition (DSM IV), American Psychiatric Press, Washington, DC.
Amin G, Shah S and Vankar GK (1998). The prevalence and recognition of depression in
primary care. Indian J Psychiatry, 40: 364 – 369.
Anderson RJ, Freedland KE, Clouse RE and Lustman PJ (2001). The prevalence of
comorbid depression in adults with diabetes: a meta-analysis. Diabetes care, 24 (6):
1069 – 1078.
Anisman H and Matheson K (2005). Stress, depression and anhedonia: Caveats concerning
animal models. Neurosci Biobehav Rev, 29 (4-5): 525 – 546.
Atwood JL and Steed JW (2004). Encyclopedia of Supramolecular Chemistry. Boca Raton:

CRC Press.
Bibliography
Balu DT, Hoshaw BA, Malberg JE, Rosenzweig-Lipson S and Lee E (2008). Differential
regulation of central BDNF protein levels by antidepressant and non- antidepressant
drug treatments. Brain Res, 1211: 37 – 43.
Banfield MJ, Naylor RL, Robertson AGS, Allen SJ, Dawbarn D and Brady RL (2001).
Specificity in Trk receptor: Neurotrophin interactions: The crystal structure of Trk
B-d5 in complex with Neurotrophin-4/5. Structure, 9: 1191 – 1199.
Barbacid M (1995). Neurotrophic factors and their receptors. Curr Opin Cell Biol, 7:
148 – 155.
Barde YA, Edgar D and Thoenen H (1982). Purification of a new neurotrophic factor from
mammalian brain. EMBO J, 1: 549 – 553.
Belmaker RH and Agam G (2008). Mechanisms of Disease: Major Depressive disorder.

N Engl J Med, 358 (1): 55 – 68.
Bergstrom A, Jayatissa MN, Mork A and Wiborg O (2008). Stress sensitivity and resilience
in the chronic mild stress rat model of depression; an in situ hybridization study.
Brain Res, 1196: 41 – 52.
Bernstein FC, Koetzle TF, Williams GJ, Meyer Jr. EE, Brice MD, Rodgers JR, Kennard O,
Shimanouchi T and Tasumi M (1977). The Protein Data Bank: A Computer-based
Archival File For Macromolecular Structures. J Mol Biol, 112: 535.
Bhalla US and Iyengar R (1999). Emergent properties of networks of biological signaling

pathways. Science, 283 (5400): 381 – 387.
Bibel M and Barde YA (2000). Neurotrophins: key regulators of cell fate and cell shape in
the vertebrate nervous system. Genes Dev, 14: 2919 – 2937.
Bijur GN, De Sarno P and Jope RS (2000). Glycogen synthase kinase-3β facilitates
staurosporine- and heat shock-induced apoptosis. Protection by lithium. J Biol
Chem, 275: 7583 – 7590.
Bilici M, Efe H, Koroglu MA, Uydu HA, Bekaroglu M and Deger O (2001). Antioxidative
enzyme activities and lipid peroxidation in major depression: alterations by
antidepressant treatments. J Affect Disorders, 64: 43 – 51.
Bibliography
Bliss TVP and Collingridge GL (1993). A synaptic model of memory: long-term

potentiation in the hippocampus. Nature, 361: 31 – 39.
Blum R and Konnerth A (2005). Neurotrophin-mediated rapid signaling in the central

nervous system: mechanisms and functions. Physiology (Bethesda), 20: 70 – 78.
Bonni A, Brunet A, West AE, Datta SR, Takasu MA and Greenberg ME (1999). Cell
survival promoted by the Ras-MAPK signaling pathway by transcription-dependent
and -independent mechanisms. Science, 286 (5443): 1358 - 1362.
Bothwell M (1995). Functional interactions of neurotrophins and neurotrophin receptors.

Annu Rev Neurosci, 18: 223 – 253.
Bothwell MA and Shooter EM (1977). Dissociation equilibrium constant of β - nerve

growth factor. J Biol Chem, 252: 8532 – 8536.
Bottiglieri T, Laundy M, Crellin C, Toone BK, Carney MWP and Reynolds EH (2000).
Homocysteine, folate, methylation and monoamine metabolism in depression.
J Neurol Neurosurg Psychiatry, 69: 228 – 232.
Bourne HR and Nicoll R (1993). Molecular machines integrate coincident synaptic signals.
Cell, 72 (Suppl): 65 – 75.
Böyum A (1968). Isolation of mononuclear cells and granulocytes from human blood.
Scand J Clin Lab Invest, 21(97): 77 - 89.
Bradford MM (1976). A Rapid and Sensitive Method for the Quantitation of Microgram
Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Analytical
Biochemistry, 72: 248 – 254.
Bromet E, Andrade LH, Hwang I, Sampson NA, Alonso J, de Girolamo G, de Graaf R,

Demyttenaere K, Hu C, Iwata N, Karam AN, Kaur J, Kostyuchenko S, Lépine J-P,
Levinson D, Matschinger H, Mora MEM, Browne MO, Posada-Villa J, Viana MC,
Williams DR and Kessler RC (2011). Cross-national epidemiology of DSM-IV
major depressive episode. BMC Medicine, 9: 90
Bustin SA (2000). Absolute quantiﬁcation of mRNA using real-time reverse transcription

polymerase chain reaction assays. Journal of Molecular Endocrinology, 25:
169 – 193.
Bibliography
Butte MJ, Huang PK, Mobley WC and Fletterick RJ (1998). Crystal structure of
Neurotrophin-3 homodimer shows distinct regions are used to bind its receptors.
Biochemistry, 37 (48): 16846 – 16852.
Bymaster FP, Dreshfield-Ahmad LJ, Threlkeld PG, Shaw JL, Thompson L, Nelson
DL, Hemrick-Luecke SK and Wong DT (2001). Comparative affinity of duloxetine
and venlafaxine for serotonin and norepinephrine transporters in vitro and in vivo,
human serotonin receptor subtypes, and other neuronal receptors.
Neuropsychopharmacology, 25 (6): 871 – 880.
Capsi A, Sugden K, Moffitt T, Taylor A, Craig IW, Harrington H, McClay J, Mill J, Martin
J, Braithwaite A and Poulton R (2003). Influence of life stress on depression:
Moderation by a polymorphism in the 5-HTT gene. Science, 301 (5631): 386 – 389.
Casado A, Castellanos A, Lopez-Fernandez ME, Ruiz RR, Aroca CG and Noriega F (2008).
Relationship between oxidative and occupational stress and aging in nurses of an
intensive care unit. Age, 30 (4): 229 – 236.
Casado A, de Lucas Garcıa N, Lopez-Fernandez ME, Rodrıguez-Manzaneque AS and Fraile

JAJ (2005). Antioxidant enzymes, occupational stress and burnout in workers of a
prehospitalary emergency service. The European Journal of Emergency Medicine,
12 (3): 111 – 115.
Casado A, de Lucas N, Lopez-Fernandez ME, Sanchez A and Jimenez JA (2006). Lipid

peroxidation, occupational stress and aging in workers of a prehospital emergency
service. The European Journal of Emergency Medicine, 133: 164 – 171.
Castren E and Rantamaki T (2010). The role of BDNF and its receptors in depression and
antidepressant drug action: Reactivation of developmental plasticity. Dev Neurobiol,
70 (5): 289 – 297.
Chang WL, Baumgarth N, Yu D and Barry PA (2004). Human cytomegalovirus-encoded

interleukin-10 homolog inhibits maturation of dendritic cells and alters their
functionality. J Virol, 78 (16): 8720 – 8731.
Chao MV and Hempstead BL (1995). P75 and trk: a two-receptor system. Trends Neurosci,
19: 321 – 326.
Bibliography
Cheeta S, Ruigt G, van Proosdij J and Willner P (1997). Changes in sleep architecture
following chronic mild stress. Biol Psychiatry, 41: 419 – 427.
Chomczynski P and Sacchi N (1987). Single-step method of RNA isolation by acid

guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem, 162:
156 – 159.
Chothia C and Janin J (1975). Principles of protein-protein recognition. Nature, 256:

705 – 708.
Condorelli DF, Dell Albani P, Mudo G, Timmusk T and Belluardo N (1994). Expression of
neurotrophins and their receptors in primary astroglial cultures: induction by CAMP
elevating agents. J Neurochem, 63: 509 – 516.
Coppell AL, Pei Q and Zetterstrom TS (2003). Bi-phasic change in BDNF gene expression
following antidepressant drug treatment. Neuropharmacology, 44: 903 – 910.
Cryana JF, Markoub A and Luckic I (2002). Assessing antidepressant activity in rodents:
recent developments and future needs. Trends Pharmacol Sci, 23 (5): 238 – 245.
Cunha ABM, Frey BN, Santin A and Kapczinski F (2006). Serum brain-derived
neurotrophic factor is decreased in bipolar disorder during depressive and manic
episodes. Neuroscience Letters, 398: 215 – 219.
Czubak A, Nowakowska E, Kus K, Burda K, Metelska J, Baer-Dubowska W and Cichocki

M (2009). Influences of chronic Venlafaxine, Olanzapine and Nicotine on the
hippocampal and cortical concentrations of Brain-derived neurotrophic factor
(BDNF). Pharmacological Reports, 61: 1017 – 1023.
D’Aquila PS, Brain P and Willner P (1994). Effects of chronic mild stress on performance
in behavioural tests relevant to anxiety and depression. Physiol Behav, 56:
861 – 867.
Dai MH, Li DQ and Han Y (2011). Effect of venlafaxine on cognitive function and
hippocampal brain-derived neurotrophic factor expression in rats with post-stroke
depression. Zhejiang Da Xue Xue Bao Yi Xue Ban, 40 (5): 527 – 534.
Davies AM (1994). Switching neurotrophin dependence. Curr Biol, 4: 273 – 276.
Bibliography
Dechant G and Barde Y-A (2002). The neurotrophin receptor p75NTR: novel functions and
implications for diseases of the nervous system. Nature Neurosci, 5: 1131 – 1136.
Dias BG, Banerjee SB, Duman RS and Vaidya VA (2003). Differential regulation of brain
derived neurotrophic factor transcripts by antidepressant treatments in the adult rat
brain. Neuropharmacology, 45: 553 – 563.
Drevets WC (2000). Neuroimaging studies of mood disorders. Biol Psychiatr, 48:

813 – 829.
Drevets WC, Price JL and Furey ML (2008). Brain structural and functional abnormalities
in mood disorders: implications for neurocircuitry models of depression. Brain
Struct Funct, 213 (1-2): 93 – 118.
Duckert P, Brunak S and Blom N (2004). Prediction of proprotein convertase cleavage sites.
Protein Engineering, Design and Selection, 17: 107 – 112.
Duman RS, Heninger GR and Nestler EJ (1997). A molecular and cellular theory of
depression. Arch Gen Psychiatry, 54 (7): 597 – 606.
Duman RS, Malberg J, Nakagawa S and D’Sa C (2000). Neuronal plasticity and survival in
mood disorders. Biol Psychiatry, 48 (8): 732 – 739.
Duman RS (2002). Synaptic plasticity and mood disorders. Mol Psychiatry, 7 (1): S29 – 34.
Duman RS and Monteggia LM (2006). A neurotrophic model for stress-related mood

disorders. Biol Psychiatry, 59: 1116 – 1127.
Duman RS, Malberg J and Thome J (1999). Neural plasticity to stress and antidepressant
treatment. Biol Psychiatry, 46: 1181 – 1191.
Duman RS, Vaidya VA, Nibuya M, Morinobu S and Fitzgerald LR (1995). Stress,
antidepressant treatments, and neurotrophic factors: molecular and cellular
mechanisms. The Neuroscientist, 1: 351 – 360.
Edgar VA, Cremaschi GA, Sterin-Borda L and Genaro AM (2002). Altered expression of
autonomic neurotransmitter receptors and proliferative responses in lymphocytes
from a chronic mild stress model of depression: effects of fluoxetine. Brain Behav
Immun, 16: 333 – 350.
Bibliography
Edgar VA, Silberman DM, Cremaschi GA, Zieher LM and Genaro AM (2003). Altered
lymphocyte catecholamine reactivity in mice subjected to chronic mild stress.
Biochem Pharmacol, 65: 15 – 23.
Eisenberg D, Marcotte EM, Xenarios I and Yeates TO (2000). Protein function in the post-
genomic era. Nature (London), 405: 823 – 826.
Ellman GC (1959). Tissue sulfhydryl groups. Arch Biochem Biophys, 82: 70 – 77.
Eren I, Naziroghu M, Demirdas A, Celik O, Uguz AC, Altunbasak A, Ozmen I and Uz E

(2007a). Venlafaxine modulates depression-induced oxidative stress in brain and
medulla of rat. Neurochem Res, 32: 497 – 505.
Eren I, Naziroglu M and Demirdas A (2007b). Protective effects of Lamotrigine,

Aripiprazole and Escitalopram on Depression-induced oxidative stress in rat brain.
Neurochem Res, 32: 1188 – 1195.
Eswar N, Marti-Renom MA, Webb B, Madhusudhan MS, Eramian D, Shen M, Pieper U

and Sali A (2006). Comparative Protein Structure Modeling With MODELLER.
Current Protocols in Bioinformatics, 15: 5.6.1 – 5.6.30.
Fandl JP, Tobkes NJ, McDonald NQ, Hendrickson WA, Ryan TE, Nigam S, Acheson A.
Cundy H, Panayotatos N (1994). Characterization and crystallization of recombinant
human neurotrophin 4. J Biol Chem, 269: 755 – 159.
Farinas I, Yoshida CK, Backus C and Reichardt LF (1996). Lack of neurotrophin-3 results
in death of spinal sensory neurons and premature differentiation of their precursors.
Neuron, 17: 1065 – 1078.
Fava M and Kendler KS (2000). Major Depressive disorder. Neuron, 28: 335 – 341.
Fenli S, Feng W, Ronghua Z and Huande L (2013). Biochemical mechanism studies of

Venlafaxine by metabonomic method in rat model of depression. Eur Rev Med
Pharmacol Sci, 17 (1): 41 – 48.
Floyd RA (1999). Antioxidants, oxidative stress and degenerative neurological disorders.

Proc Soc Exp Biol Med, 222: 236 – 245.
Bibliography
Floyd RA, Hensley K, Jaffery F, Maidt L, Robinson K, Pye Q and Stewart C (1999).
Increased oxidative stress brought on by pro-inflammatory cytokines in
neurodegenerative processes and the protective role of nitrone-based free radical
traps. Life Sci, 65: 1893 – 1899.
Fotino M, Merson EJ and Allen FH Jr (1971). Micro-method for rapid separation of

lymphocytes from peripheral blood. Ann Clin Lab Sci, 1 (2): 131 – 133.
Fujimaki K, Morinobu S and Duman RS (2000). Administration of a cAMP

phosphodiesterase 4 inhibitor enhances antidepressant-induction of BDNF mRNA in
rat hippocampus. Neuropsychopharmacology, 22: 42 – 51.
Gautam M, Agarwal M, Gautam M, Sharma P, Gautam AS and Gautam S (2012). Role of

antioxidants in generalised anxiety disorder and depression. Indian J Psychiatry, 54
(3): 244 – 247.
Gawryluk JW, Wang JF, Andreazza AC, Shao L, Yatham LN and Young LT (2011)
Prefrontal cortex glutathione S-transferase levels in patients with bipolar disorder,
major depression and schizophrenia. Int J Neuropsychopharmacol, 14 (8):
1069 – 1074.
Geourjon C and Deleage G (1994). SOPM: a self-optimized method for protein secondary
structure prediction. Protein Eng, 7 (2): 157 – 164.
Geourjon C and Deleage G (1995). SOPMA: significant improvements in protein secondary

structure prediction by consensus prediction from multiple alignments. Comput Appl
Biosci, 11 (6): 681 – 684.
Ghosh A, Carnahan J and Greenberg ME (1994). Requirement for BDNF in activity-

dependent survival of cortical neurons. Science, 263: 1618 – 1623.
Gilmour H and Patten SB (2007). Depression and work impairment. Health Reports, 18 (1):
9 – 22.
Gold PW and Chrousos GP (2002). Organization of the stress system and its dysregulation
in melancholic and atypical depression: high vs low CRH/NE states. Mol Psychiatry,
7: 254 – 275.
Bibliography
Grimes CA and Jope RS (2001) CREB DNA binding activity is inhibited by glycogen
synthase kinase-3 β and facilitated by lithium. J Neurochem, 78: 1219 – 1232.
Gronli J, Murison R, Bjorvatn B, Sorensen E, Portas CM and Ursin R (2004). Chronic mild
stress affects sucrose intake and sleep in rats. Behav Brain Res, 150: 139 – 147.
Gronli J, Murison R, Fiske E, Bjorvatn B, Sørensen E, Portas CM and Ursin R (2005).

Effects of chronic mild stress on sexual behavior, locomotor activity and
consumption of sucrose and saccharine solutions. Physiol Behav, 84 (4): 571 – 577.
Guex N and Peitsch MC (1997). SWISS-MODEL and the Swiss-PDBViewer: An

environment for comparative protein modelling. Electrophoresis, 18: 2714 – 2723.
Hallbook F (1999). Evolution of the vertebrate neurotrophin and Trk receptor gene families.
Curr Opin Neurobiol, 9: 616 – 621.
Hamilton, M (1960). A rating scale for depression. Journal of Neurology, Neurosurgery and
Psychiatry, 23: 56 – 62.
Hamilton M (1966). Assessment of change in psychiatric state by means of rating scales.

Proceedings of the Royal Society of Medicine, 59 (Suppl. 1): 10 – 13.
Hamilton M (1967). Development of a rating scale for primary depressive illness. British
Journal of Social and Clinical Psychology, 6: 278 – 296.
Hamilton M (1969). Standardised assessment and recording of depressive symptoms.

Psychiatria, Neurologia, Neurochirurgia. 72: 201 – 205.
Hamilton M (1980). Rating depressive patients. Journal of Clinical Psychiatry, 41: 21 – 24.
Haniu M, Montestruque S, Bures EJ, Talvenheimo J, Toso R, Lewis-Sandy S, Welcher AA

and Rohde MF (1997). Interactions between brain-derived neurotrophic factor and
the TRKB receptor. Identification of two ligand binding domains in soluble TRKB
by affinity separation and chemical cross-linking. J Biol Chem, 272 (40):
25296–303.
Hasler G, Drevets WC, Manji HK and Charney DS (2004). Discovering endophenotypes

for major depression. Neuropsychopharmacology, 29 (10): 1765 – 1781.
Bibliography
Hedlund JL and Viewig BW (1979). The Hamilton rating scale for depression: a
comprehensive review. Journal of Operational Psychiatry, 10: 149 – 165.
Hemingway H and Marmot M (1999). Evidence based cardiology: psychosocial factors in

the aetiology and prognosis of coronary heart disease. Systematic review of
prospective cohort studies. BMJ, 318 (7196): 1460 – 1467.
Hemnani T and Parihar MS (1998). Reactive oxygen species and oxidative DNA damage.
Indian Journal of Physiology and Pharmacology, 42 (4): 440 – 452.
Ho Y-J, Eichendroff J and Schwarting RKW (2002). Individual response profiles of male
wistar rats in animal models for anxiety and depression. Behav Brain Res, 136:
1 – 12.
Holliday SM and Benfield P (1995). Venlafaxine A review of its pharmacology and

therapeutic potential in depression. Drugs, 49 (2): 280 -294.
Huang E and Reichardt (2001). Neurotrophins: roles in neuronal development and function.
Annu Rev Neurosci, 24: 677 – 736.
Huang EJ, Wilkinson GA, Farinas I, Backus C, Zang K, Wong SL and Reichardt LF (1999).
Expression of Trk receptors in the developing mouse trigeminal ganglion: in vivo
evidence for NT-3 activation of Trk A and Trk B in addition to Trk C. Development,
126 (10): 2191 – 2203.
Huang RF, Hsu YC, Lin HL and Yang FL (2001). Folate depletion and elevated plasma
homocysteine promote oxidative stress in rat livers. J Nutr, 131: 33 – 38.
Huang Z, Fasco MJ and Kaminsky LS (1996). Optimization of DNase I removal of

contaminating DNA from RNA for use in quantitative RNA-PCR. BioTechniques,
20 (6): 1012 – 1020.
Hubbard RE and Kamran Haider M (2010). Hydrogen Bonds in Proteins: Role and
Strength. eLS
Hughes K, Nikolakaki E, Plyte SE, Totty NF and Woodgett JR (1993). Modulation of the
glycogen synthase kinase-3 family by tyrosine phosphorylation. EMBO J, 12:
803 – 808.
Bibliography
Hunsberger JG, Newton SS, Bennett AH, Duman CH, Russell DS, Salton SR and Duman
RS (2007). Antidepressant actions of the exercise-regulated gene VGF. Nat Med, 13
(12): 1476 – 1482.
Impey S, Smith DM, Obrietan K, Donahue R, Wade C and Storm DR (1998). Stimulation of
cAMP response element (CRE)-mediated transcription during contextual learning.
Nat Neurosci, 1: 595 – 601.
Insel T and Wang P (2010). Rethinking Mental Illness. JAMA, 303 (19): 1970 – 1971.
Ip NY, Ibanez CF, Nye SH, McClain J, Jones PF, Gies D, Belhuscio L, LeBean MM,
Espinosa R and Squinto SP (1992). Mammalian neurotrophin-4: Structure,
chromosomal localization, tissue distribution and receptor specificity. PNAS, 89:
3060 – 3064.
Jafari M, Salehi M, Zardooz H and Rostamkhai F (2014). Response of liver antioxidant

defense system to acute and chronic physical and psychological stresses in male rats.
EXCLI Journal, 13: 161 – 171.
Janin J, Henrick K, Moult J, Sternberg MJ, Vajda S, Vasker I and Wodak SJ (2003).
CAPRI: Critical Assessment of Predicted Interactions. Proteins, 52: 2 – 9.
Jevtovic S, Karlovic D, Mihaljevic-Peles A, Servic V, Vrkic N and Jaksic N (2011). Serum

brain-derived neurotrophic factor (BDNF): The severity and symptomatic
dimensions of depression. Psychiatria Danubina, 23 (4): 363 – 369.
Jonsson E, Brene S, Zhang XR, Nimgaonkar VL, Tylec A, Schalling M and Sedvall G
(1997). Schizophrenia and Neurotrophin-3 alleles. Acta Psychiatr Scand, 95:
414 – 419.
Jungbluth S, Bailey K and Barde YA (1994). Purification and characterisation of a

brain-derived neurotrophic factor/neurotrophin-3 (BDNF/NT-3) heterodimer.
Eur J Biochem, 221: 677 – 685.
Kang H and Schuman EM (1996). A requirement for local protein synthesis in

neurotrophin-induced hippocampal synaptic plasticity. Science, 273 (5280):
1402 – 1406.
Bibliography
Kaplan DR and Miller FD (2000). Neurotrophin signal transduction in the nervous system.
Karege F, Perret G, Bondolfi G, Schwald M, Bertschy G and Aubry JM (2002). Decreased

serum brain-derived neurotrophic factor levels in major depressed
patients. Psychiatry Res, 109: 143 – 148.
Karege F, Bondolfi G, Gervasoni N, Schwald M, Aubry JM and Bertschy G (2005). Low

brain-derived neurotrophic factor (BDNF) levels in serum of depressed patients
probably results from lowered platelet BDNF release unrelated to platelet
reactivity. Biol Psychiatry, 47: 1068 – 1072.
Karege F, Perroud N, Burkhardt S, Schwald M, Ballmann E, La Harpe R and Malafosse A

(2007). Alteration in kinase activity but not in protein levels of protein kinase B and
glycogen synthase kinase-3beta in ventral prefrontal cortex of depressed suicide
victims. Biol Psychiatry, 61: 240 – 245.
Katz RJ, Roth KA and Carroll BJ (1981). Acute and chronic stress effects on open field
activity in the rat: Implications for a model of depression. Neurosci Biobehav Rev, 5
(2): 247 – 251.
Kaufman J, Yang BZ, Douglas-Palumberi H, Grasso D, Lipschitz D, Houshyar S, Krystal

JH and Gelernter J (2006). Brain-derived neurotrophic factor – 5-HTTLPR gene
interactions and environmental modifiers of depression in children. Biol Psychiatr,
59 (8): 673 – 680.
Keller MC, Neale MC and Kendler KS (2007). Association of different adverse life events
with distinct patterns of depressive symptoms. Am J Psychiatry, 164 (10): 1521 –
1529.
Kendler KS, Karkowski LM, Prescott CA (1999). Causal relationship between stressful life
events and the onset of major depression. Am J Psychiatry, 156: 837 – 841.
Kessler RC, Berglund P, Demler O, Jin R, Merikangas KR and Walters EE (2005). Lifetime
prevalence and age-of-onset distributions of DSM-IV disorders in the National
Comorbidity Survey Replication. Arch Gen Psychiatry, 62: 593 – 602.
Bibliography
Khanzode SD, Dakhale GN, Khanzode SS, Saoji A and Palasodkar R (2003). Oxidative
damage and major depression: the potential antioxidant action of selective serotonin
re-uptake inhibitors. Redox Rep, 8 (6): 365 – 370.
Khulbe A, Pandey S and Pilkhwal Sah S (2013). Antidepressant-like action of the

hydromethanolic flower extract of Tagetes erecta in mice and its possible
mechanism of action. Indian J Pharmacology, 45 (4): 386 – 390.
Koch JM, Kell S, Hinze-Selch D and Alsenhoff JB (2002). Changes in CREB-

phosphorylation during recovery from major depression. J Psychiatr Res, 36 (6):
369 – 375.
Kodydkova J, Vavrova L, Zeman M, Jirak R, Macašek J, Staňkova B, Tvrzická E and Zák

A (2008). Antioxidative enzymes and increased oxidative stress in depressive
women. Int J Neuropsychopharmacol, 11: 851 – 876.
Konkle AT, Baker SL, Kentner AC, Barbagallo LS, Merali Z and Bielajew C (2003).
Evaluation of the effects of chronic mild stressors on hedonic and physiological
responses: sex and strain compared. Brain Res, 992: 227 – 238.
Korsching S (1993). The Neurotrophic factor concept: A re-examination. J Neurosci, 13 (7):

2739 – 2748.
Korte M, Carroll P, Wolf E, Brem G, Thoenen H and Bonhoeffer T (1995). Hippocampal

long term potentiation is impaired in mice lacking brain-derived neurotrophic factor.
Proc Natl Acad Sci USA, 92: 8856 – 8860.
Krishnan V and Nestler EJ (2008). The molecular neurobiology of depression. Nature, 455
(7215): 894 – 902.
Krogh A, Larsson B, von Heijne G and Sonnhammer ELL (2001). Predicting

transmembrane protein topology with a hidden markov model: application to
complete genomes. J Mol Biol, 305 (3): 567 – 580.
Kuper H, Marmot M and Hemingway H (2002). Systematic review of prospective cohort

studies of psychosocial factors in the aetiology and prognosis of coronary heart
disease. Semin Vasc Med, 2 (3): 267 – 314.
Bibliography
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H,

Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ and Higgins
DJ (2007). Clustal W and Clustal X version 2.0. Bioinformatics, 23 (21):
2947 – 2948.
Larsen MH, Mikkelsen JD, Hay-Schmidt A and Sandi C (2010). Regulation of brain-
derived neurotrophic factor (BDNF) in the chronic unpredictable stress rat model
and the effects of chronic antidepressant treatment. Journal of Psychiatric Research,
44 (13): 808 – 816.
Laurie ATR and Jackson R (2005). Q-site finder: an energy-based method for the prediction
of protein-ligand binding sites. Bioinformatics, 21 (9): 1908 – 1916.
LeDoux JE (1987). Emotion, In F. Plum (Ed.), Handbook of Physiology: Section 1. The

nervous system. Vol.5. Higher functions of the brain. 419 – 460. Bethesda, MD:
American Physiological Society.
Levi-Montalcini R (1987). The nerve growth factor 35 years later. Science, 237:
1154 – 1162.
Levine ES, Dreyfus CF, Black IB and Plummer MR (1995). Brain-derived neurotrophic
factor rapidly enhances synaptic transmission in hippocampal neurons via
postsynaptic tyrosine kinase receptors. Proc Natl Acad Sci USA, 92: 8074 – 8077.
Li J-J, Yuan Y-G, Hou G and Zhang X-R (2011). Dose – related effects of Venlafaxine on
p-CREB and Brain-derived neurotrophic factor (BDNF) in the hippocampus of the
rat by chronic unpredictable stress. Acta Neuropsychiatrica, 23 (1): 20 – 30.
Li X, Friedman AB, Zhu W, Wang L, Boswell S, May RS, Davis LL and Jope RS (2007).
Lithium regulates Glycogen Synthase Kinase-3β in human peripheral blood
mononuclear cells: Implication in the treatment of Bipolar Disorder. Biol Psychiatr,
61 (2): 216 – 222.
Lohof AM, Ip N and Poo M-M (1993). Potentiation of developing neuromuscular synapses
by the neurotrophins NY-3 and BDNF. Nature, 363: 350 – 353.
Lowry OH, Roseobrough NJ, Farr AL and Randall RJ (1957). Protein measurement with
folin’s phenol reagent. J Biol Chem, 93: 265 – 275.
Bibliography
Lucca G, Comim CM, Valvassori SS, Reus GZ, Vuolo F, Petronilho F, Gavioli EC, Dal-
Pizzol F and Quevedo J (2009a). Increased oxidative stress in sub-mitochondrial
particles into the brain of rats submitted to the chronic mild stress paradigm. J Psych
Res, 43: 864 – 869.
Lucca G, Comim CM, Valvassori SS, Réus GZ, Vuolo F, Petronilho F, Dal-Pizzol
F, Gavioli EC and Quevedo J (2009b). Effects of chronic mild stress on the
oxidative parameters in the rat brain. Neurochem Int, 54 (5-6): 358 – 362.
MacQueen GM, Campbell S, McEwen BS, MacDonald K, Amano S, Joffe RT, Nahimas C
and Young LT (2003). Course of illness, hippocampal function and hippocampal
volume in major depression. PNAS, 100 (3): 1387 – 1392.
Maes M (1999). Major depression and activation of the inflammatory response system. Adv
Exp Med Biol, 461: 25 – 46.
Maes M, De Vos N, Pioli R, Demedts P, Wauters A, Neels H and Christophe A (2000).

Lower serum vitamin E concentrations in major depression. Another marker of
lowered antioxidant defences in that illness. J Affect Disord, 58 (3): 241 – 246.
Magrane M and the UniProt Consortium (2011). UniProt Knowledgebase: a hub of

integrated protein data. Database, bar009.
Mai L, Jope RS and Li X (2002). BDNF-mediated signal transduction is modulated by

GSK3β and mood stabilizing agents. J Neurochem, 82: 75 – 83.
Maison-Pierre PC, Belhuscio L, Squinto SP, Ip NY, Furth ME, Lindsay RM and
Yancopoulos GD (1990). Neurotrophin-3 - A neurotrophic factor related to NGF and
BDNF. Science, 247: 1446 – 1451.
Malberg J, Eisch A, Nestler E, Duman RS (2000). Chronic antidepressant treatment

increases neurogenesis in adult rat hippocampus. J Neurosci, 20: 9104 – 9110.
Manji HK, Drevets WC and Charney DS (2001). The cellular neurobiology of depression.
Nat Med, 7 (5): 541 – 547.
Manji HK, Quiroz JA, Payne JL, Singh J, Lopes BP, Viegas JS and Zarate CA (2003). The
underlying neurobiology of bipolar disorder. World Psychiatry, 2 (3): 136 – 146.
Bibliography
Marklund SL and Marklund G (1974). Simple assay for super oxide dismutase using
autooxidation of pyrogallol. Eur J Biochem, 47, 469.
McDonald NQ and Chao MV (1995). Structural determinants of neurotrophin action. J Biol

Chem, 270 (3): 19669 – 19672.
McDonald NQ, Lapatto R, Murray-Rust J, Gunning J, Wlodawer A and Blundell TL (1991).

New protein fold revealed by a 2.3 Å resolution crystal structure of nerve growth
factor. Letters to Nature, 354: 411 – 414.
McEwen BS (2001). Plasticity of the hippocampus: adaptation to chronic stress and

allostatic load. Ann N Y Acad Sci, 933: 265 – 277.
Mendlewicz J (1995). Pharmacologic profile and efficacy of venlafaxine. Int Clin

Psychopharmacol, 10 (2): 5 – 13.
Michel TM, Frangou S, Thiemeyer D, Camara S, Jecel J, Nara K, Brunklaus A, Zoechling

R and Riederer P (2007). Evidence for oxidative stress in the frontal cortex in
patients with recurrent depressive disorder – a post-mortem study. Psychiat Res,
151: 145 – 50.
Miguel-Hidalgo JJ and Rajkowska G (2003). Comparison of prefrontal cell pathology

between depression and alcohol dependence. J Psychiatr Res, 37 (5): 411 – 420.
Modafferi EF and Black DL (1999). Combinatorial control of a neuron-speciﬁc exon. RNA,

5: 687 – 706.
Molteni R, Calabrese F, Bedogni F, Tongiorgi E, Fumagalli F, Racagni G and Andrea Riva

M (2005). Chronic treatment with fluoxetine up-regulates cellular BDNF mRNA
expression in rat dopaminergic regions. Int J Neuropsychopharmacol, 2005: 1 – 11.
Monleon S, D'Aquila P, Parra A, Simon VM, Brain PF and Willner P (1995). Attenuation of
sucrose consumption in mice by chronic mild stress and its restoration by
imipramine. Psychopharmacology (Berlin), 117: 453 – 457.
Monteggia LM, Barrot M, Powell CM, Berton O, Galanis V, Gemelli T, Meuth S, Nagy A,
Greene RW and Nestler EJ (2004). Essential role of brain-derived neurotrophic
factor in adult hippocampal function. Proc Natl Acad Sci USA, 101: 10827 – 10832.
Bibliography
Monteggia LM, Luikart B, Barrot M, Theobold D, Malkovska I, Nef S, Parada LF and

Nestler EJ (2006). Brain-Derived Neurotrophic Factor conditional knockouts show
gender differences in Depression-related behaviours. Biol Psychiatr, 61: 187 – 197.
Moreau JL, Jenck F, Martin JR, Mortas P and Haefely WE (1992). Antidepressant treatment
prevents chronic unpredictable mild stress-induced anhedonia as assessed by ventral
tegmentum self-stimulation behaviour in rats. Eur Neuropsychopharmacol, 2 (1): 43
– 49.
Moreau JL, Scherschlicht R, Jenck F and Martin JR (1995). Chronic mild stress-induced
anhedonia model of depression; sleep abnormalities and curative effects of
electroshock treatment. Behav Pharmacol, 6: 682 – 687.
Mowla SJ, Farhadi HF, Pareek S, Atwal JK, Morris SJ, Seidah NG and Murphy RA (2001).
Biosynthesis and post-translational processing of the precursor to brain-derived
neurotrophic factor. J Biol Chem, 276: 12660 – 12666.
Murphy JM, Laird NM, Monson RR, Sobel AM and Leighton AH (2000). A 40-year
perspective on the prevalence of depression: the Stirling County Study. Arch Gen
Psychiatry, 57: 209 – 215.
Murray CJL and Lopez AD (1996). Global Health Statistics: A compendium of incidence,
prevalence and mortality statistics. Cambridge, MA: Harvard University Press.
Murray CJL and Lopez AD (1999). On the comparable quantification of health risks:
lessons from the Global Burden of Disease study. Epidemiology, 10 (5): 594 – 605.
Muscat R and Willner P (1992). Suppression of Sucrose drinking by Chronic Mild

Unpredictable Stress: A methodological analysis. Neurosci Biobehav Rev, 16 (4):
507 – 517.
Muscat R, Papp M and Willner P (1992). Reversal of stress-induced anhedonia by the

atypical antidepressants, fluoxetine and maprotiline. Psychopharmacology, 109: 433
– 438.
Nandi DN, Banerjee G, Boral GC, Ganguli H, Ajmany S, Ghosh A and Sarkar S (1979).
Socio economic status and prevalence of mental disorders in certain rural
communities in India. Acta Psych Scand, 59: 276 – 293,
Bibliography
Nandi DN, Banerjee G, Mukherjee SP, Ghosh A, Nandi PS and Nandi S (2000). Psychiatric
morbidity of a rural Indian community changes over a 20 year interval. British
J Psychiatry, 176: 351 – 356.
National Crime Research Bureau (2003). Accidental Deaths and Suicides in India, New
Delhi: Ministry of Home Affairs, Government of India.
Naylor RL, Robertson AG, Allen SJ, Sessions RB, Clarke AR, Mason GG, Burston JJ,
Tyler SJ, Wilcock GK, Dawbarn D (2002). A discrete domain of the human TrkB
receptor defines the binding sites for BDNF and NT-4. Biochem Biophys Res
Commun, 291 (3): 501 - 507.
Nestler EJ (2002). Common Molecular and Cellular Substrates of Addiction and Memory.
Neurobiology of Learning and Memory, 78 (3): 637 – 647.
Nestler EJ, Barrot M, DiLeone RJ, Eisch AJ, Gold SJ and Monteggia LM (2002).
Neurobiology of depression. Neuron, 34 (1): 13 – 25.
Nibuya M, Morinobu S and Duman RS (1995). Regulation of BDNF and TrkB mRNA in rat
brain by chronic electro convulsive seizure and antidepressant drug treatments.
J Neuro Sci, 15 (11): 7539 – 7547.
Nibuya M, Nestler EJ and Duman RS (1996). Chronic antidepressant administration

increases the expression of cAMP response element binding protein (CREB) in rat
hippocampus. J Neurosci, 16: 2365 – 2372.
Niehius WG and Samuelson D (1968). Formation malanodoaldehyde from phospholipid

arachidonate during microsomal lipid peroxidation. Eur J Biochem, 6: 126 – 130.
Ninkina N, Grashchuck M, Buchman VL and Davies AM (1997). TrkB variants with

deletions in the leucine-rich motifs of the extracellular domain. J Biol Chem, 272:
13019 - 13025.
Nirmal J, Babu CS, Harisudhan T and Ramanathan M (2008). Evaluation of behavioural

and antioxidant activity of Cytisus scoparius Link in rats exposed to chronic
unpredictable mild stress. BMC Complementary and Alternative Medicine, 8: 15.
Ogmen U, Keskin O, Aytuna AS, Nissino VR and Gursoy A (2005). PRISM: Protein
Interactions by Structural Matching. Nucleic Acids Res, 33 (suppl 2): W331 – W336.
Bibliography
Omaye ST, Turnball TD and Sauberlicn HE (1979). Selected methods for the determination
ascorbic acids in animal cells, tissues and fluids, methods. Enzymology, 62: 1 – 11.
Ongur D, Drevets WC and Price JL (1998). Glial reduction in the subgenual prefrontal
cortex in mood disorders. PNAS, 95 (22): 13290 – 13295.
Ozcan ME, Gulec M, Ozerol E, Polat R and Akyol O (2004). Antioxidant enzyme activities
and oxidative stress in affective disorders. Int Clin Psychopharmacol, 19 (2):
89 – 95.
Papp M, Gruca P, Boyer P-A and Mocaer E (2003). Effect of Agomelatine in the Chronic
Mild Stress Model of Depression in the Rat. Neuropsychopharmacology, 28:
694 – 703.
Papp M, Willner P, Muscat R (1991). An animal model of anhedonia: attenuation of sucrose

consumption and place preference conditioning by chronic unpredictable mild stress.
Psychopharmacology (Berl), 104: 255 – 259.
Patapoutian A and Reichardt LF (2001). Trk receptors: Mediators of Neurotrophin action.

Patel V (1999). The Epidemiology of Common Mental disorders in South Asia. NIMHANS
Journal, 17: 307 – 327.
Patel V, Kirkwood BR, Pednekar S, Pereira B, Barros P, Fernandes J, Datta J, Pai R, Weiss
H and Mabey D (2006). Gender Disadvantage and Reproductive Health Risk Factors
for Common Mental Disorders in WomenA Community Survey in India.
Arch Gen Psychiatry, 63 (4): 404 – 413.
Pawson T and Nash P (2000). Protein-protein interactions define specificity in signal

transduction. Genes Dev, 14 (9): 1027 – 1047.
Peet M, Murphy B, Shay J and Horrobin H (1998). Depletion of omega-3 fatty acid levels in
red blood cell membranes of depressive patients. Biol Psychiatry, 43: 315 – 319.
Perera TD, Coplan JD, Lisanby SH, Lipira CM, Arif M, Carpio C, Spitzer G, Santarelli L,
Scharf B, Hen R, Rosoklija G, Sackeim HA and Dwork AJ (2007). Antidepressant-
induced neurogenesis in the hippocampus of adult non-human primates. J Neurosci,
27(18): 4894 – 4901.
Bibliography
Pieper U, Eswar N, Stuart AC, Ilyin VA and Sali A (2002). MODBASE, a database of
annotated comparative protein structure models. Nucleic Acids Res, 30 (1):
255 – 259.
Piran PD, Kennedy S, Garfinkel PE and Owens M (1985). Affective disturbance in eating
disorders. J Nerv Ment Disord, 173: 395 – 400.
Pittenger C and Duman RS (2008). Stress, depression and Neuroplasticity: A convergence

of mechanisms. Neuropsychopharmacology, 33 (1): 88 – 109.
Pizzorusso T, Ratto GM, Putignano E and Maffei L (2000). Brain-derived neurotrophic

factor causes cAMP response element-binding protein phosphorylation in absence of
calcium increases in slices and cultured neurons from rat visual cortex. J Neurosci,
20: 2809 – 2816.
Poongothai S, Pradeepa R, Ganesan A and Mohan V (2009). Prevalence of Depression in a

Large Urban South Indian Population — The Chennai Urban Rural Epidemiology
Study (CURES – 70). PLoS ONE, 4 (9): e7185
Porsolt RD, Anton G, Deniel M and Jalfre M (1978). Behavioural despair in rats: a new
animal model sensitive to antidepressant treatments. Eur J Pharmacol, 47:
379 – 391.
Pothen M, Kuruvilla A, Philip K, Joseph A and Jacob KS (2003). Common mental disorders
among primary care attenders in Vellore, South India: Nature, prevalence and risk
factors. Int J Soc Psychiatry, 49: 119 – 125.
Prince M, Patel V, Saxena S, Maj M, Maselko J, Philips MR and Rahman A (2007). No

health without mental health. Lancet, 370 (9590): 859 – 877.
Purves D (1988). Body and Brain. A trophic theory of Neural connections. Cambridge MA:
Harvard University Press.
Radu T (2012). Cognitive behavioral therapy and Aaron Beck. The Journal of Nervous and
Mental Disease, 200: 840 – 842.
Radziejewski C and Robinson RC (1993). Heterodimers of the neurotrophic factors:

Formation, Isolation and differential stability. Biochemistry, 32: 13350 – 13356.
Bibliography
Radziejewski C, Robinson RC, DiStefano PS and Taylor W (1992). Dimeric structure and
conformational stability of brain-derived neurotrophic factor and neurotrophin-3.
Biochemistry, 31: 4431 – 4436.
Rajkowska G (1997). Morphometric methods for studying the prefrontal cortex in suicide
victims and psychiatric patients. Ann N Y Acad Sci, 836: 253 – 268.
Rajkowska G (2000). Dysfunction in neural circuits involved in the pathophysiology of

mood disorders. Post-mortem studies in mood disorders indicate altered numbers of
neurons and glial cells. Biol Psychiatr, 48: 766 – 777.
Rajkowska G, Miguel-Hidalgo JJ, Wei J, Dilley G, Pittman SD, Meltzer HY, Overholser
JC, Roth BL and Stockmeier CA (1999). Morphometric evidence for neuronal and
glial prefrontal cell pathology in major depression. Biol Psychiatr, 45 (9):
1085 – 1098.
Ramanathan M, Balaji B and Justin A (2011). Behavioural and neurochemical evaluation of

Perment® an herbal formulation in chronic unpredictable mild stress induced
depressive model. Indian J Experimental Biology, 49: 269 – 275.
Rao AV (1970). Broken home (in particular reference to parental deaths) and its relationship
to depressive illness. Indian J Psychiatry, 12: 23 – 32.
Rao AV (1973). Affective illness in first degree relatives, Parental loss and family jointness
in depressive disorders. Br J Psychiatry, 122: 601
Raskin A, Schulterbrandt J, Reatig N and McKeon JJ (1969). Replication of factors of

psychopathology in interview, ward behavior and self-report ratings of hospitalized
depressives. Journal of Nervous and Mental Diseases, 148: 87 – 98.
Reagen LP, Rosell DR,Wood GE, Spedding M, Munoz C, Rothstein J and McEwen BS
(2004). Chronic restraint stress up-regulates GLT-1 mRNA and protein expression in
the rat hippocampus: Reversal by tianeptine. PNAS, 101 (7): 2179 -2184.
Redrobe JP, Bourin M, Colombel MC and Baker GB (1998). Dose-dependent noradrenergic

and serotonergic properties of Venlafaxine in animal models indicative of
antidepressant activity. Psychopharmacology, 138: 1 – 8.
Bibliography
Reichardt LF and Fariñas I (1997). Neurotrophic factors and their receptors: Roles in
neuronal development and function. In: Cowan WM, Jessell TM, Zipursky SL,
editors. Molecular and Cellular Approaches to Neural Development. New York:
Oxford University Press: 220 – 263.
Ressler KJ and Mayberg HS (2007). Targeting abnormal neural circuits in mood and
anxiety disorders: from the laboratory to the clinic. Nat Neurosci, 10 (9):
1116 – 1124.
Réus GZ, Stringari RB, de Souza B, Petronilho F, Dal-Pizzol F, Hallak JE, Zuardi AW,
Crippa JA and Quevedo J (2010). Harmine and imipramine promote antioxidant
activities in prefrontal cortex and hippocampus. Oxidative Medicine and Cellular
Longevity, 3 (5): 325 – 331.
Riccio A, Ahn S, Davenport CM, Blendy JA and Ginty DD (1999). Mediation by a CREB
Family Transcription Factor of NGF-Dependent Survival of Sympathetic Neurons.
Science, 286 (5448): 2358 – 2361.
Rice P, Longden I and Bleasby A (2000). EMBOSS: The European Molecular Biology
Open Software Suite. Trends in Genetics, 16 (6): 276 – 277.
Ritchie DW and Venkatraman V (2010). Ultra-Fast FFT Protein Docking On Graphics

Processors. Bioinformatics, 26: 2398 – 2405.
Robinson RC, Radziejewski C, Spraggon G, Greenwald J, Kostura MR, Burtnick LD, Stuart
DI, Choe S and Jones EY (1999). The structures of the NT-4 homodimer and the
BDNF/NT-4 heterodimer reveal a common Trk-biding site. Protein Science, 8:
2589 -2597.
Robinson RC, Radziejewski C, Stuart DI and Jones EY (1995). Structure of the brain-
derived neurotrophic factor/neurotrophin 3 heterodimer. Biochemistry, 34:
4139 – 4146.
Rodriguez-Tebar A, Dechant G and Barde YA (1991). Neurotrophins: Structural relatedness

and receptor interactions. Philos Trans R Soc London Ser B, 331: 255 – 258.
Rojas PS, Fritsch R, Rojas RA, Jara P and Fiedler JL (2011). Serum brain-derived
neurotrophic factor and glucocorticoid receptor levels in lymphocytes as markers of
antidepressant response in major depressive patients: A pilot study. Psychiatr Res,
189 (2): 239 – 245.
Bibliography
Roshdy HM and Fyiad AA (2010). Cytogenetic and Biochemical effects of Antidepression

drug (Wellbutrin) on Male mice. New York Science Journal, 3 (6): 121 – 126.
Ryden M and Ibanez CF (1996). Binding of neurotrophin-3 to p75LNGFR, TrkA and TrkB
mediated by a single functional epitope distinct from that recognized by TrkC. J Biol
Chem, 271: 5623 – 5637.
Sairanen M, Lucas G, Ernfors P, Castrén M and Castrén E (2005). Brain-derived

neurotrophic factor and antidepressant drugs have different but coordinated effects
on neuronal turnover, proliferation, and survival in the adult dentate gyrus.
J Neurosci, 25 (5): 1089 – 1094.
Sambrook J and Russel DW (2001). Molecular Cloning: A Laboratory Manual 3rd Ed. Cold
Spring Harbor Laboratory Press. Cold Spring Harbor, NY.
Schneider R and Schweiger M (1991). A novel modular mosaic of cell adhesion motifs in
the extracellular domains of the neurogenic Trk and Trk B tyrosine kinase receptors.
Oncogene, 6: 1807 – 1811.
Seidah NG, Benjannet S, Pareek S, Chretien M and Murphy RA (1996). Cellular processing
of the neurotrophin precursors of NT-3 and BDNF by the mammalian proprotein
convertases. FEBS Letters, 379: 247 – 250.
Sen S, Duman R and Sanacora G (2008) Serum BDNF, Depression and Anti-Depressant
Medications: Meta-Analyses and Implications. Biol Psychiatr, 64 (6): 527 – 532.
Sharifian A, Farahani S, Pasalar P, Gharavi M and Aminian O (2005). Shift work as an

oxidative stressor. Journal of Circadian Rhythms, 3: article 15.
Shirayama Y, Chen A, Nakagawa S, Russell D and Duman R (2002). Brain-derived

neurotrophic factor produces antidepressant effects in behavioural models of
depression. J Neurosci, 22: 3251 – 3261.
Sinha AK (1972). Colorimetric assay of Catalase. Analytical Biochemistry, 47: 389 – 394.
Smith M, Makino S, Kvetnansky R and Post R (1995). Stress alters the expression of brain-
derived neurotrophic factor and neurotrophin-3 mRNAs in the hippocampus.
J Neurosci, 15: 1768 – 1777.
Bibliography
Sofroniew MV, Howe CL and Mobley WC (2001). Nerve Growth factor signaling,
neuroprotection and neural repair. Annu Rev Neurosci, 24: 1217 – 1218.
Song JH and Miyazawa T (2001). Enhanced level of n-3 fatty acid in membrane
phospholipids induces lipid peroxidation in rats fed dietary docosahexaenoic acid
oil. Atherosclerosis, 155: 9 – 18.
Spijker J, Graaf R, Bijl RV, Beekman AT, Ormel J and Nolen WA (2004). Functional
disability and depression in the general population. Results from the Netherlands
Mental Health Survey and Incidence Study (NEMESIS). Acta Psychiatr Scand,
110 (3): 208 - 214.
Stefanescu C and Ciobica A (2012). The relevance of oxidative stress status in first episode
and recurrent depression. J Affect Disord. 143 (1-3): 34 – 38.
Stout SC, Mortas P, Owens MJ, Nemeroff CB and Moreau J. Increased corticotropin
releasing factor concentrations in the bed nucleus of the stria terminalis of anhedonic
rats. Eur J Pharmacol, 401: 39 – 46.
Strekalova T, Spanagel R, Bartsch D, Henn FA and Gass P (2004). Stress-Induced

Anhedonia in Mice is Associated with Deficits in Forced Swimming and
Exploration. Neuropsychopharmacology, 29: 2007 – 2017.
Strober W (2001). Trypan Blue Exclusion Test of Cell Viability. Current Protocols in
Immunology, 21: A.3B.1 – A.3B.2.
Takei N, Kawamura M, Hara K, Yonezawa K and Nawa H (2001). Brain-derived

neurotrophic factor enhances neuronal translation by activating multiple initiation
processes: comparison with the effects of insulin. J Biol Chem, 276: 42818 – 42825.
Thakker-Varia S, Krol JJ, Nettleton J, Bilimoria PM, Bangasser DA, Shors TJ, Black IB
and Alder J (2007). The neuropeptide VGF produces antidepressant-like behavioural
effects and enhances proliferation in the hippocampus. J Neurosci, 27 (45):
12156 – 12167.
Thase ME, Entsuah R and Rudolph RL (2001). Remission rates during treatment with
Venlafaxine or Selective Serotonin reuptake inhibitors. British Journal of
Psychiatry, 178: 234 – 241.
Bibliography
Thoenen H (1995). Neurotrophins and Neuronal plasticity. Science, 270 (5236): 593 – 598.
Tiemeier H, Hofman A, Kiliaan AJ, Meijer J and Breteler MMB (2002). Vitamin E and
depressive symptoms are not related. The Rotterdam Study. J Affect Disord, 72:
79 – 83.
Towbin H, Staehelint T and Gordon J (1979). Electrophoretic transfer of proteins from

polyacrylamide gels to nitrocellulose sheets: Procedure and some applications.
PNAS, 76 (9): 4350 – 4354.
Ueyama T, Kawai Y, Nemoto K, Sekimoto M, Tone S and Senba E (1997). Immobilization

stress reduced the expression of neurotrophins and their receptors in the rat brain.
Brain Res, 28: 103 – 110.
Ultsch MH, Wiesmann C, Simmons LC, Henrich J, Yang M, Reilly D, Bass SH and de Vos
AM (1999). Crystal structures of the neurotrophin-binding domain of Trk A, Trk B
and Trk C. J Mol Biol, 290: 149 – 159.
Urfer R, Tsoulfas P, O’Connell L, Shelton DL, Parada LF and Presta LG (1995). An

immunoglobulin-like domain determines the specificity of neurotrophin receptors.
EMBO J, 14 (12): 2795 – 2805.
Urfer R, Tsoulfas P, O’Connell, Hongo JA, Zhao W and Presta LG (1998). High resolution
mapping of the binding site of Trk A for nerve growth factor and Trk C for
neurotrophin-3 on the second immunoglobulin-like domain of the Trk receptors.
J Biol Chem, 273: 5829 – 5840.
Urfer R, Tsoulfas P, Soppet D, Escandon E, Parada LF, Presta LG (1994). The binding
epitopes of neurotrophin-3 to its receptors trkC and gp75 and the design of a
multifunctional human neurotrophin. EMBO J, 13: 5896 – 5909.
Vermetten E, Vythilingam M, Southwick SM, Charney DS and Bremner JD (2003). Long-

term treatment with paroxetine increases verbal declarative memory and
hippocampal volume in posttraumatic stress disorder. Biol Psychiatry, 54:
693 – 702.
Vogel G, Neill D, Hagler M and Kors D (1990). A new animal model of endogenous
depression: a summary of present findings. Neurosci Biobehav Rev, 14 (1): 85 – 91.
Bibliography
Wakefield JC, Schmitz MF, First MB and Horwitz AV (2007). Extending the bereavement
exclusion for major depression to other losses: evidence from National Comorbidity
Survey. Arch Gen Psychiatry, 64: 433 – 440.
Wang QM, Fiol CJ, DePaoli-Roach AA and Roach PJ (1994). Glycogen synthase kinase-3β
is a dual specificity kinase differentially regulated by tyrosine and serine/threonine
phosphorylation. J Biol Chem, 269: 14566 – 14574.
Watanabe Y, Gould E, Daniels DC, Cameron H, McEwen BS (1992). Tianeptine attenuates

stress-induced morphological changes in the hippocampus. Eur J Pharmacol, 222:
157 – 162.
Warner-Schmidt JL and Duman RS (2007). VEGF is an essential mediator of the

neurogenic and behavioral actions of antidepressants. Proc Natl Acad Sci USA, 104
(11): 4647 – 4652.
Wechsler H, Grosser GH and Busfield BL Jr (1963). The depression rating scale: a

quantitative approach to the assessment of depressive symptomatology. Archives of
General Psychiatry, 9: 334 – 343.
Weissenburger J, Rush JA, Giles DE and Stunkard AJ (1986). Weight change in depression.
Psychiatry Res, 17: 275 – 283.
WHO (2005) International Classification of Diseases – 10. Second Edition. Geneva.
WHO (2008). Suicide prevention (SUPRE).
Weismann C, Ultsch MH, Bass SH and de Vos AM (1999). Crystal structure of nerve
growth factor in complex with the ligand-binding domain of the Trk A receptor.
Letters to Nature, 401: 184 – 188.
Williams JBW (1988). A structured interview guide for the Hamilton Depression Rating
Scale. Arch Gen Psychiatry, 45: 742 – 747.
Willner P (1986). Validation criteria for animal models of human mental disorders: Learned
helplessness as a paradigm case. Prog Neuropsychopharmacol Biol Psychiatry, 10
(6): 677 – 690.
Willner P (1997). Validity, reliability and utility of the chronic mild stress model of
depression: A 10-year review and evaluation. Psychopharmacology (Berl), 134:
319 – 329.
Bibliography
Willner P (2005). Chronic mild stress (CMS) revisited: Consistency and behavioural –
neurobiological concordance in the effects of CMS. Neuropsychobiology, 52 (2):
90 – 110.
Willner P, Klimek V, Golembiowska K and Muscat R (1991). Changes in mesolimbic

dopamine may explain stress-induced anhedonia. Psychobiology, 19: 79 – 84.
Willner P, Muscat R, Papp M (1992). Chronic mild stress-induced anhedonia: a realistic

animal model of depression. Neurosci Biobehav Rev, 16: 525 – 534.
Willner P, Towell A, Sampson D, Sophokleous S and Muscat R (1987). Reduction of

sucrose preference by chronic unpredictable mild stress, and its restoration by a
tricyclic antidepressant. Psychopharmacology (Berl), 93: 358 – 364.
World Health Organization, Sixty-fifth world health assembly 2012.

http://www.who.int/mediacentre/events/2012/wha65/journal/en/index4.html
Xie CW, Sayah D, Chen QS, Wei WZ, Smith D and Liu X (2000). Deficient long-term
memory and long-lasting long-term potentiation in mice with a targeted deletion of
neurotrophin-4. Proc Natl Acad Sci USA, 97: 8116 – 8121.
Xing J, Kornhauser JM, Xia Z, Thiele EA and Greenberg ME (1998). Nerve growth factor
activates extracellular signal-regulated kinase and p38 mitogen-activated protein
kinase pathways to stimulate CREB serine 133 phosphorylation. Mol Cell Biol, 18
(4): 1946 – 1955.
Yardley JP, Husbands GEM, Stack G, Butch J, Bicksler J, Moyer JA, Muth EA, Andree T,
Fletcher H III, James MNG and Sielecki AR (1990). 2-Phenyl-2-(1-
hydroxycycloalkyl) ethylamine derivatives: synthesis and antidepressant activity.
J Med Chem, 33: 2899 – 2905.
Zhang K, Song X, Xu Y, Li X, Liu P, Sun N, Zhao X, Liu Z, Xie Z and Peng J (2013).
Continuous GSK-3β overexpression in the hippocampal dentate gyrus induces
prodepressant-like effects and increases sensitivity to chronic mild stress in mice.
Journal of Affective Disorders, 146 (1): 45 – 52.
Zhang ZJ (2004). Therapeutic effects of herbal extracts and constituents in animal models of
psychiatric disorders. Life Science, 75: 1659 – 1699.
Bibliography
WEBOGRAPHY
http://www.balancingbrainchemistry.co.uk/49/Does-Low-Serotonin-Cause-Depression.html
http://www.uniprot.org/
http://blast.ncbi.nlm.nih.gov/Blast.cgi
http://www.rcsb.org/pdb/home/home.do
http://www.expasy.org/spdbv/
http://www.modelling.leeds.ac.uk/qsitefinder/
http://www.cbs.dtu.dk/services/TMHMM/
http://www.cbs.dtu.dk/services/ProP/
http://www.pymol.org/
http://salilab.org/modeller/about_modeller.html
http://hexserver.loria.fr
Appendices
APPENDICES
APPENDIX I
1. Chloroform
2. Saline: 0.9 g of Sodium chloride was dissolved in 100 ml of water, autoclaved and
stored at 4°C.
APPENDIX II
0.1M Tris-HCl buffer (pH 7.4)
Tris Base – 60.57 g
12 M HCl – 32.5 ml
Distilled water – 350 ml
Completely dissolved the Tris Base in distilled water and then added 12 M HCl. pH
was corrected to 7.4 using 12 M HCl. The final volume was made upto 500 ml using
distilled water.
APPENDIX III
SEPARATION OF PBMC USING FICOLL-PAQUE DENSITY GRADIENT
CENTRIFUGATION
1. Sterile Saline: 0.9 g of Sodium chloride was dissolved in 100 ml of water,

autoclaved and stored at 4°C.
2. Ficoll-paque: Was purchased as a ready to use solution from Sigma-Aldrich
(Histopaque 1077).
APPENDIX IV
CELL VIABILITY TEST
0.4% Trypan blue: Available as a ready to use solution of Tetrasodium 3, 3'-[(3, 3'-
dimethyl [1, 1'-biphenyl]-4,4'-diyl) bis (azo)] bis [5-amino-4-hydroxynaphthalene-2, 7-
disulphonate] from Sigma-Aldrich (Catalogue number – T8154).
Appendices
APPENDIX V
ISOLATION OF TOTAL PROTEINS FROM PBMC AND HIPPOCAMPUS USING

RIPA BUFFER
RIPA Buffer: Was purchased as a ready to use solution from Sigma-Aldrich
APPENDIX VI
Stock solution: 100 mg of Bovine serum albumin was dissolved in 100 mL of Sterile
distilled water (Concentration = 1 mg/mL).
Working standard solution: Diluted 10 mL of the stock solution to 100 mL with Sterile
distilled water (Concentration = 100 µg/mL).
APPENDIX VII
WESTERN BLOTTING FOR GSK3Β AND CREB PROTEINS USING GeNei

WESTERN BLOTTING KIT
1. SDS Separating Gel mix: Added 50 µl of APS to 5.0 ml of the ready to use
Separating Gel mix and used.
2. SDS stacking gel mix: Added 20 µl of APS to 2.0 ml of the ready to use Stacking
Gel mix and used.
3. Sample loading buffer: Added 25 µl of sample loading buffer to 25 µl of the protein
sample and placed in a boiling water bath for 5 minutes. Cooled before loading onto
the stacking gel.
4. 1 X Diluent buffer: Diluted 1.0 ml of the 10 X Diluent buffer with 9.0 ml of sterile
distilled water.
5. 1 X Assay buffer: To 2.0 ml of 10 X Assay buffer added 18.0 ml of sterile distilled
water.
Appendices
6. 1 X Wash buffer: 4.0 ml of the 25 X Wash buffer was diluted with 96 ml of sterile
distilled water.
7. Primary antibody: The anti-GSK3β and Anti-CREB primary antibodies from Abcam
were resuspended in the 1 X Assay buffer (Concentration 1/1000).
8. 1 X Secondary antibody: To 10 µl of the 1000 X HRP conjugate added 9.90 ml of 1
X Assay buffer (Freshly prepared).
9. 1 X TMB/H2O2: To 1.0 ml of TMB/H2O2 added 9.0 ml of sterile distilled water
(Freshly prepared).
10. Ammonium persulphate (APS): Resuspended an aliquot of APS in 1.0 ml of sterile
distilled water. The solution was stable for 2 to 3 months when stored at 4 °C.
11. 1 X Reservoir buffer: To 25 ml of the 10 X Reservoir buffer added 225ml of sterile
distilled water.
12. Blotting buffer: 25 ml of the 20 X Blotting buffer components A and B were mixed
with 450 ml of sterile distilled water.
13. Blocking buffer: 300 mg of the Blocking agent was suspended in 10.0 ml of 1 X
Diluent buffer.
14. Nitrocellulose membrane
15. Coommassie brilliant blue Stainer for SDS – PAGE: Provided as a ready to use
solution in the kit.
APPENDIX VIII
TOTAL RNA ISOLATION
1. TRI reagent: Available as a ready to use solution from Sigma-Aldrich, is a mixture

of guanidine thiocyanate and phenol in a monophase solution (Catalogue number –
T9424).
Appendices
2. DEPC treated water: Added 0.1% of Diethyl pyrocarbonate (DEPC) to distilled

water and mixed overnight with magnetic stirrer. Autoclaved for 20 minutes to
destroy DEPC.
3. Chloroform
4. Isopropanol
5. 75% Ethanol: Mixed 75 mL of Ethanol with 25 mL of double distilled water and
mixed thoroughly.
6. RBC lysis Buffer:
10X RBC lysis buffer - 1000 mL
Ammonium chloride (NH4Cl) - 89.9 g
Potassium bicarbonate (KHCO3) - 10.0 g
0.5 M EDTA - 2.0 mL
Dissolved the above in approximately 800 mL of double distilled water and adjusted
the pH to 7.3. Made up the volume to 1 litre and mixed thoroughly. This solution
was stable for 6 months at 2 – 8° C in a tightly closed bottle.
7. 1X RBC Lysis Buffer: Simply diluted the 10X Stock solution 1:10 with double
distilled water. The solution was stable for 1 week at room temperature.
APPENDIX IX
CLEANING TOTAL RNA USING DNase I
The 10 X Reaction Buffer, DNase I solution and Stop Solution (50 mM EDTA) were
purchased as ready to use solutions from Merck Millipore.
APPENDIX X
SYNTHESIS OF cDNA AND PCR AMPLIFICATION OF bdnf and bcl2A1 mRNA
1 RNA template
2 dNTP (30 mM)
3 Oligo dT or random hexamers (0.5 µg/µL)
4 5X First Strand Buffer
Appendices
5 100M DTT
6 RNasin
7 M-MuLV Reverse Transcriptase
8 Nuclease free double distilled water
APPENDIX XI
AGAROSE GEL ELECTROPHORESIS
1. TAE Buffer (50X)
Tris base - 242 gram
Glacial acetic acid - 57.1 mL
0.5 M EDTA (pH 8.0) - 100 mL
Made up the final volume to 1000 mL and stored. For the experiment 1X TAE
Buffer was prepared by diluting the 10X TAE as required.
2. Ultrapure Agarose
3. Ethidium Bromide
4. 5X/2X RNA gel loading dye
APPENDIX XII
ESTIMATION OF TOTAL PROTEIN BY LOWRY’S METHOD
1. 0.1 N NaOH: Dissolved 4 g in 1000 ml of distilled water.

2. 1% sodium potassium tartarate: Dissolved 1 g in 100 ml of distilled water
3. Reagent A: 2% sodium carbonate in 0.1N NaOH
4. Reagent B: 0.5% CuSO4 in 1% sodium potassium tartarate.
5. Reagent C: The Alkaline copper sulphate solution was prepared by mixing 50 ml of
reagent A with 1 ml of reagent B prior to use.
6. Reagent D: Folin’s Ciocalteau reagent was diluted in the ratio 1:1 before use.
7. Stock standard (concentration 1mg/ml): Dissolved 50 mg of BSA in distilled
water and made up to 50 ml in a standard flask.
8. Working standard (concentration 200µg/ml): Diluted 10 ml of the stock solution
to 50 ml with distilled water.
Appendices
APPENDIX XIII
ASSAY OF SUPEROXIDE DISMUTASE ACTIVITY
1. 0.025 mol/l sodium pyrophosphate (pH 8.3)

2. 186 mmol/l PMS
3. 300 mmol/l NBT
4. 780 mmol/l NADH
5. Glacial acetic acid
6. n-butanol
APPENDIX XIV
ASSAY OF CATALASE ACTIVITY
1. 0.01 mol/l phosphate buffer (pH 7.0)

2. 2 mol/l H2O2
3. 5 % Potassium dichromate and Glacial acetic acid (1:3 ratio)
APPENDIX XV
ACTIVITY OF GLUTATHIONE PEROXIDASE
1 0.4 mol/l phosphate buffer (pH 7.0)

2 10 mmol/l sodium azide
3 0.2 mmol/H2O2
4 10 % TCA
5 0.3 M Disodium hydrogen phosphate buffer
6 DTNB : 0.04 g DTNB in 100 ml 1 % sodium citrate
7 Standard reduced glutathione : 20 mg/100 ml
APPENDIX XVI
ESTIMATION OF ASCORBIC ACID
1. 4% TCA
2. 85 % concentrated sulphuric acid
Appendices
3. DTCS reagent: Dissolved 0.3 g DNPH, 0.04 g Thiourea and 0.005 g CuSO4 in 9
N concentrated sulphuric acid.
4. Stock standard: Dissolved 500 mg ascorbic acid in 5 % oxalic acid and made
up to 50 ml in a standard flask (10 mg/ml).
5. Working standard: 5 ml of the stock solution was diluted to 50 ml with glacial
acetic acid. (10 mg/ml).
APPENDIX XVII
ESTIMATION OF LIPID PEROXIDATION (LPO)
1 15 % TCA
2 37 % TBA
3 0.25 N HCl
APPENDIX XVIII
PBMC ISOLATION
1. Sterile Saline: 0.9g of Sodium Chloride was dissolved in 100 mL of distilled water
and was autoclaved before use.
2. Ficoll-paque: Available as a ready to use solution from GE Healthcare, contains
Diatrizoate Sodium, 9.0 g, with Edetate Calcium Disodium in Purified Water
(Catalogue number – 17-1440-02).
APPENDIX XIX
CELL LYSIS
1. 5X Cell lysis Mix: Mixed 900 μL of cell lysis buffer and 100 µL of Enhancer
solution (both provided in the p-CREB (Ser133) InstantOne™ ELISA kit - Part No.
IOCLB1 and IOES1). The solution was freshly prepared and utilized completely as
it cannot be stored. The 5X Cell Lysis Buffer contains a combination of detergents,
phosphatase inhibitors, salts and buffers.
2. 1X cell lysis mix: 200 μL of 5X cell lysis mix was diluted to 1000 μL with double
distilled water.
Appendices
APPENDIX XX
ESTIMATION OF PROTEIN
1. Bradford Reagent: Available as a ready to use solution from Sigma-Aldrich,

consists of Brilliant Blue G in phosphoric acid and methanol (Catalogue number –
B6916).
2. Protein stock standard solution: 10 mg of Bovine Serum Albumin (BSA) was
dissolved in 5.0 mL of sterile saline to prepare a solution of 2 mg/mL concentration.
3. Working standard (WS) solutions: Working solutions were prepared from the
sock standard solution as given below.
Preparation of Protein Working Standard solutions
Concentration Volume of BSA stock Volume of sterile

Solution
(μg/mL) standard solution (μL) saline (μL)
Blank - - 20.0
WS 1 100 1.0 19.0
WS 2 250 2.5 17.5
WS 3 500 5.0 15.0
WS 4 750 7.5 12.5
WS 5 1000 10.0 10.0
WS 6 1250 12.5 7.5
WS 7 1400 14.0 6.0
From the above working solutions 5.0 μL was taken into the microtitre well plates for the
Bradford assay.
APPENDIX XXI
STAR phospho‐GSK‐3β (Tyr 216) ELISA Kit (Catalogue number – 17‐472)
1. 1X Wash Buffer: Warmed the 25X ELISA Wash Buffer to room temperature and
mixed well to ensure that any precipitated salts have re-dissolved. For 500 µL of
Wash Buffer, combined 20 µL of 25X ELISA Wash Buffer and 480 µL distilled or
deionized water. Stirred to homogeneity. Wash Buffer could be stored up to 4 weeks
Appendices
at 2 - 8°C. Discarded the Wash Buffer when it became turbid or if a precipitate

developed.
2. Anti-Rabbit IgG HRP Conjugate: Diluted the Anti-Rabbit IgG HRP Conjugate
100-fold with HRP Diluent immediately before use.
3. Phospho-GSK 3β Standards: Reconstituted the lyophilized p-GSK3β (Tyr 216)
standard provided in the kit with the volume of ELISA Diluent specified on the vial
label to give a concentration of 100 Units/mL. Gently swirled the vial and allowed
the vial to sit for 10 minutes to ensure the material was completely reconstituted.
This stock material was then used to generate a series of standards. A 2-fold dilution
scheme was prepared as per the manufacturer’s instructions.
Diagram for serial dilution of p-GSK3β standards
APPENDIX XXII
Phospho-CREB (Ser133) InstantOne™ ELISA kit (Catalogue number – 85-86152)
1. Antibody cocktail: Prepared fresh as per manufacturer’s instructions by mixing an

equal volume of Capture Antibody Reagent and Detection Antibody Reagent.
Prepared enough to use 50 μL/well.
2. Positive control lysate: The lyophilized control was reconstituted with 250 μL of
reagent grade water.
3. 1X Wash buffer: Diluted the Wash Buffer (10X) to 1X with reagent grade double
distilled water.
Appendices
APPENDIX XXIII
RNA ELECTROPHORESIS
1. 10X MOPS buffer:
3-[N-morpholino] propane sulfonic acid (MOPS) - 200 mM
Sodium acetate - 50 mM
EDTA - 10 mM
Adjusted the pH to 7.0 with Sodium hydroxide.
2. 1X MOPS buffer (Gel running buffer):
10X FA gel buffer - 100 ml
37% (12.3 M) formaldehyde - 20 ml
RNase-free water - 880 ml
3. Sample loading buffer:
Glycerol - 50%
EDTA - 1 mM
Bromophenol blue - 0.25%
Completely dissolved the above in DEPC-treated water.
4. 1.2% Formaldehyde Gel
Volume
S. No Component
30mL 50mL 100mL
1 Agarose 0.36 g 0.6 g 1.2 g
2 5X MOPS Buffer 3.0 mL 5.0 mL 10 mL
3 DEPC-treated water 30 mL 50 mL 100 Ml
Heated the mixture to melt the Agarose. Cooled to 65°
4 Formaldehyde 540 µL 900 µL 1.8 ml
5 Ethidium bromide 0.2 µL 0.5 µL 0.75 µL
Appendices
APPENDIX XXIV
AurumTM Total RNA Mini kit (Catalogue number – 732-6820)
1. 70% Ethanol: Mixed 70 mL of Ethanol with 30 mL of double distilled water.

2. 1X Low Stringency Wash Solution: Diluted the 5X Low Stringency Wash Solution
provided in the kit with 90 – 100% ethanol before use.
3. High Stringency Wash Solution: Available as a ready to use solution in the kit.
4. 1% Lysis solution: Diluted the lysis solution provided in the kit with β-
Mercaptoethanol as per the manufacturer’s instructions.
5. RNase-free DNase I: Reconstituted the lyophilized enzyme by adding 250 µL of 10
mM Tris, pH 7.5. Stored at -20°C in a non-frost free freezer.
6. 10mM Tris, pH 7.5:
RNase-free Tris base - 303 mg
Elution Solution (provided in the kit) - 200 µL
Adjusted the pH to 7.5 and made up the final volume to 250 µL with the Elution
Solution provided in the kit.
APPENDIX XXV
iScript Select cDNA synthesis kit (Catalogue number – 170-8897)
1. iScript Reverse transcriptase mixture: It contains a recombinant RNase Hand

MMLV reverse transcriptase preblended with a recombinant RNase inhibitor.
2. 5X iScript select reaction mix: It contains buffers, stabilizers, magnesium chloride
and dNTPs optimized for synthesis of first strand cDNA
3. Oligo (dT)20 primer mix: It contains purified oligo(dT)20 primer in a proprietary
enhancer solution
Note: The above solutions are available as ready to use solutions in the kit.
APPENDIX XXVI
Primer reconstitution
The designed primers were reconstituted in 100 µL sterile water according to the
supplier’s specifications to prepare stock solutions of the following concentrations.
Appendices
Concentration (µM)
S. No Primer
when reconstituted with 100 µL sterile water
1 bdnf Forward primer 740
2 bdnf Reverse primer 840
3 bcl2a1 Forward primer 714
4 bcl2a1 Reverse primer 531
From the above primer Stock 1 solutions, 1.0 mL of 10 µM solutions (Stock 2) were
prepared. The following formula was used to calculate the volume of the specific primer
Stock 1 solution required to prepare the corresponding 10 µM solutions (Stock 2).
X = 10 x 1000/M
Where, X is the volume of primer Stock 1 solution and M is the concentration of the primer
Stock 1 solution. Using the above formula the 10 µM solutions (Stock 2) were prepared as
given below
Volume of Stock 1 Volume of sterile water

S. No Primer
(µL) (µL)
1 bdnf Forward primer 13.51 986.49
2 bdnf Reverse primer 11.90 988.10
3 bcl2a1 Forward primer 14.00 986.00
4 bcl2a1 Reverse primer 18.80 981.20
From the above primer Stock 2 solutions, 1 µM working solutions of the primers
were prepared for use in the PCR reactions. The Stocks 1 and 2 were stored at -70°C for
future use.
APPENDIX XXVII
Aristogene DNA amplification kit
2X PCR Master mix: Provided by the supplier as a ready to use solution in the kit, contains
DNA polymerase, dNTPs, Magnesium chloride and buffers.
Appendices
APPENDIX XXVIII
AGAROSE GEL ELECTROPHORESIS OF PCR PRODUCTS
1. 50X TAE buffer:
Tris base - 24.2 g
Glacial acetic acid - 5.7 mL
0.5M EDTA, pH 8.0 - 10 mL
Completely dissolved the above in 100 mL of distilled water.
2. 1X TAE buffer: Diluted the 50X TAE buffer to 1X with distilled water.
3. DNA loading dye: Available as a ready to use solution in the Aristogene DNA
amplification kit.
4. Ethidium bromide
5. 2% DNA Agarose gel:
Preparation of 2% Agarose gel
Volume
S. No Component
30mL 50mL 100mL
1. Agarose 0.6 g 1g 2g
2. 50X TAE Buffer 0.6 mL 1.0 mL 2 mL
3. Distilled water 29.4 mL 49 mL 98 mL
Heated the mixture to melt the Agarose. Cooled to 65°
4. Ethidium bromide 0.1 µL 0.2 µL 0.4 µL
APPENDIX XXIX
Sybr Green JumpStartTM Taq Ready Mix (Catalogue number – S4438)
Available as a ready to use solution from Sigma-Aldrich. Contains Sybr Green I fluorescent
dye, Taq DNA polymerase, dNTPs and reaction buffer in optimal concentration.
Appendices
APPENDIX XXXI
Animal Ethical Clearance certificate
Appendices
APPENDIX XXXII
Human Ethical Clearance certificate
Appendices
LIST OF PUBLICATIONS AND PRESENTATIONS
PUBLICATIONS
 Anubhama K V and Doss V A (2014). Behavioral and Antioxidant Profile of

Venlafaxine treated Animal Model of Depression. Int J Pharm Bio Sci, 5 (2) B:
775 – 784.
PAPER PRESENTATIONS
1. Anubhama KV and Doss VA. Docking of Neurotrophin mimetic to Trk B receptor

for developing new Neurodegenerative antagonists. UGC Sponsored National
Seminar on Recent Advances in Computer Aided Drug Designing, 23rd and
24th March, 2011 at Malabar Christian College, Calicut.
2. Anubhama KV and Doss VA. Docking Studies of the complete Ectodomain of

Trophomyosin-related kinase B (Trk B) Receptor to its ligand BDNF. National
Conference on Confluence of Research and Ethics in Biological Sciences – A
Scenario on the Emerging trends (NCBS-2013), 14th and 15th March, 2013 at
PSG College of Arts and Science, Coimbatore.
3. Anubhama KV and Doss VA. Molecular modelling and docking studies of BDNF
and its cognate receptor Trk B in depression. DBT, DRDO and DST sponsored
National Conference on Immunoinformatics – An in silico aid towards better
medicines, 3rd and 4th October, 2013 at Nirmala College for Women, Coimbatore
POSTER PRESENTATIONS
1. Anubhama K V, Sowndarya R and Doss VA. Behavioural Assessment during

Venlafaxine treatment in Chronic Unpredictable Mild Stress (CUMS) Induced
Rat Model of Depression. 11th IAAM National Conference on Recent Developments
in Microbiology, Biochemistry & Biotechnology, 29th and 30th November, 2013 at
PSG College of Arts and Science, Coimbatore.

Thesis Final

Caricato da

Informazioni sul documento

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

Thesis Final

Caricato da

Copyright:

Formati disponibili

A STUDY ON THE ROLE OF FEW COMPONENTS OF THE NEUROTROPHIN

SIGNALING PATHWAY AND ANTIOXIDANTS IN MAJOR

Thesis submitted to the Bharathiar University in partial fulfillment of the

PSG COLLEGE OF ARTS & SCIENCE

Counter signed Signature of the Guide

Dr. R. RAJENDRAN Dr. D. VICTOR AROKIA DOSS

I, ANUBHAMA K V hereby declare that the thesis, entitled “A Study on the

Role of few Components of the Neurotrophin Signaling Pathway and Antioxidants

in Major Depression and its Treatment” submitted to the Bharathiar University,

Philosophy in Biochemistry is a record of original and independent research work

guidance of Dr. D. VICTOR AROKIA DOSS, Associate Professor, Department

other similar title to any candidate of any university.

Counter signed Signature of the Student

I wish to place on record my sincere and most grateful thanks to

I express my deep sense of gratitude to Shri. L. Gopalakrishnan, Managing

I am equally grateful to Dr. Ramalingam Sankaran, MD, Principal,

I am extremely grateful to Dr. Thiagarajan Sairam, PhD, Assistant Professor

I render my heartfelt thanks to my Juniors Ms. R. Sowndarya, MSc., MPhil.,

I am indebted to Mr. Sanjay Prasad, Scientific Officer, Imaging Facility,

I would also like to place on record my sincere thanks to Dr. K. T. Varkey,

I would also like to express my gratitude to Dr. T. Vinoth Kumar, MSc.,

I thankfully acknowledge and express my gratitude to Dr. N. Anusuya, M.Sc.,

With great pleasure I express my gratitude to all my Colleagues of CMS

I am eternally indebted to my Husband who has been my pillar of support and

Finally, I submit myself to the Almighty as nothing in this world would be

2. AIM AND OBJECTIVES 10

4. MATERIALS AND METHODS 28

5. RESULTS AND DISCUSSION 74

SUMMARY AND CONCLUSION 143

2 Protocol for Stress induction 35

3 Reaction mixture for Annealing 45

4 Reaction mixture for first strand cDNA synthesis 45

5 Reaction mixture for PCR amplification 46

7 Components for first strand synthesis 59

9 Components for PCR 60

11 Components for Real time PCR 63

13 Few popular Applications in the EMBOSS package 66

14 Results of Forced Swim Test after 1st and 3rd week of 75

15 Results of Sucrose consumption test 77

16 Estimation of Total Protein in serum and tissue homogenate 79

17 Activity of Superoxide dismutase 81

18 Activity of Catalase in serum and tissue homogenate 82

19 Activity of Glutathione peroxidase in serum and tissue 83

20 Estimation of Vitamin C in serum and tissue homogenate 85

22 Assay of Total protein from PBMC and hippocampal cell lysates 88

23 Densitometric analysis of the Western Blot 89

24 Estimation of the Total RNA isolated from whole blood and 90

25 Details of Study subjects 94

26 Results of the Hamilton Depression Rating Scale for the patient 95

28 Results of PBMC isolation and viable cell count 97

29 Concentration of Total protein present in the PBMC lysates 98

30 Activity of pGSK‐3β and pCREB in PBMC lysates 99

31 Amount of total RNA isolated from whole blood 100

33 Available crystal structures of NGF and TrkA 105

34 Results of Rampage server for NGF and Trk A models 114

35 Crystal structures of BDNF and its receptor TrkB 117

36 Evaluation of the BDNF and Trk B models using Ramachandran 124

37 Available Crystal structures of NT-4 126

38 Evaluation of NT-4 model using Ramachandran Plot 129

39 Available X-Ray Crystal structures for NT-3 And TrkC 133

40 Evaluation of NT-3 and Trk C models using Ramachandran Plot 140

2 PET scan showing the brain areas of depressed and normal 3

3 Pathway showing Neuronal plasticity and Cellular resilience 7

4 The Forced swim test 8