Role of Matrix Extracellular Phosphoglycoprotein in the

Pathogenesis of X-Linked Hypophosphatemia

Shiguang Liu,* Thomas A. Brown,† Jianping Zhou,* Zhou-Sheng Xiao,* Hani Awad,‡
Farshid Guilak,‡ L. Darryl Quarles*
*Department of Internal Medicine and the Kidney Institute, the University of Kansas Medical Center, Kansas City,
Kansas; †Groton Laboratories, Pfizer Global Research and Development, Groton, Connecticut; ‡Department of Surgery,
Duke University Medical Center, Durham, North Carolina

X-linked hypophosphatemia (XLH), a disorder characterized by hypophosphatemia, impaired skeletal mineralization, and
aberrant regulation of 1, 25(OH)2D3, is caused by inactivating mutations of Phex, which results in the accumulation of putative
phosphaturic factors, called phosphatonins. Matrix extracellular phosphoglycoprotein (Mepe) is a proposed candidate for
phosphatonin. The authors found that Hyp mice had increased expression of the MEPE and another phosphaturic factor, Fgf23.
To establish MEPE’s role in the pathogenesis of the XLH, Mepe-deficient mice were back-crossed onto the Hyp mouse
homologue of XLH and phenotypes of wild-type, Mepeⴚ/ⴚ, Hyp, and Mepeⴚ/ⴚ/Hyp mice were examined. Transfer of Mepe
deficiency onto the Phex-deficient Hyp mouse background failed to correct hypophosphatemia and aberrant serum
1,25(OH)2D3 levels. Increased Fgf23 levels in Hyp mice were not affected by superimposed Mepe deficiency. In addition,
Mepe-deficient Hyp mice retained bone mineralization defects in vivo, characterized by decreased bone mineral density,
reduced mineralized trabecular bone volume, lower flexural strength, and histologic evidence of osteomalacia; however,
cultures of Hyp-derived bone marrow stromal cells in the absence of Mepe showed improved mineralization and normaliza-
tion of osteoblast gene expression profiles observed in cells derived from Mepe-null mice. These results demonstrate that
MEPE elevation in Hyp mice does not contribute to the hypophosphatemia associated with inactivating Phex mutations and
is therefore not phosphatonin.
J Am Soc Nephrol 16: 1645–1653, 2005. doi: 10.1681/ASN.2004121060

X
-linked hypophosphatemia (XLH), a disorder charac-
terized by defective calcification of cartilage and bone,
impaired renal tubular reabsorption of phosphate (Pi),
and aberrant regulation of 1,25(OH)2D3 production, is caused
by inactivating mutations of the cell surface metalloprotease,
PHEX (1). The mouse Phex cDNA sequence is highly homolo-
gous to that of humans (2), and several mouse XLH homo-
logues have been identified with inactivating Phex mutations,
including Hyp, Gy, and Ska1 mice (2,3). Phex is most highly
expressed in osteoblasts, osteocytes, and odontoblasts (4 –7).
Current data indicate that Phex regulates the production
and/or degradation of phosphaturic hormones, referred to as
phosphatonins (8), and putative local inhibitors of mineraliza-
tion, called minhibins (9), that may contribute to an intrinsic
mineralization defect in osteoblasts that is independent of hy-
pophosphatemia (9 –13). Currently, there are several candidates
for these factors.
FGF23 is a strong candidate for phosphatonin. FGF23, a
phosphaturic member of the fibroblast growth factor (FGF)
family (14 –17), is the disease-causing gene in autosomal-dom-
Received December 8, 2004. Accepted March 7, 2005.
Published online ahead of print. Publication date available at www.jasn.org.
Address correspondence to: Dr. L. Darryl Quarles, University of Kansas Medical
Center, MS 3018, 3901 Rainbow Boulevard, Kansas City, KS 66160. Phone: 913-
588-7607; Fax: 913-588-9251; E-mail: dquarles@kumc.edu
inant hypophosphatemic rickets (16 –18). In addition, circulat-
ing levels of FGF23 are elevated in most patients with XLH
(19 –21). Moreover, Fgf23-null mice are hyperphosphatemic
(22,23) and the transfer of Fgf23 deficiency onto the Hyp mouse
background increases serum phosphate in Hyp mice (23). Pa-
tients with tumor-induced osteomalacia (TIO) also have in-
creased messenger RNA expression of FGF23 in the tumors, as
well as elevated circulating levels of FGF23 that decrease after
tumor removal (14,19 –21,24 –26). Finally, patients with hy-
pophosphatemic forms of McCune Albright syndrome have
increased FGF23 transcripts in fibrous dysplastic bone lesions
and elevated serum levels of FGF23 (27). FGF23, however, may
not fully account for the pathogenesis of XLH. In this regard,
there are discrepancies between FGF23-induced phosphaturia
in vivo (14) and inconsistent effects of recombinant FGF23 to
inhibit renal tubular phosphate uptake in vitro (14,28), suggest-
ing possible intermediate steps. Moreover, the defective min-
eralization in XLH/Hyp is not fully explained by excess FGF23
or hypophosphatemia, because Fgf23-deficient mice paradoxi-
cally have defective mineralization (22) and correction of hy-
pophosphatemia fails to fully cure rickets and osteomalacia in
this disorder (29). Thus, additional factors may be involved in
the renal and skeletal phenotype in XLH.
sFRP-4 is another candidate for phosphatonin. sFRP-4, which
belongs to the family of secreted decoy receptors blocking
Wnt-dependent signaling, is also increased in tumors from

Copyright © 2005 by the American Society of Nephrology ISSN: 1046-6673/1606-1645

1646 Journal of the American Society of Nephrology
subjects with TIO and has phosphaturic activity when admin-
istered in vivo (30). However, elevated serum sFRP4 levels have
not been reported in patients with TIO and expression of sFRP4
has not been assessed in XLH/Hyp.
Matrix extracellular phosphoglycoprotein (MEPE), also
called OF45, a bone-specific extracellular matrix protein be-
longing to the SIBLING protein family (31), has also been
implicated in the pathogenesis of XLH as a candidate for phos-
phatonin and minhibin. MEPE is expressed in osteoblasts and
osteocytes (31–34), and its expression is temporally coordinated
with PHEX (32–39). MEPE has phosphaturic activity when
injected into mice (39), a function that appears to be mediated
by C-terminal ASARM motif that localizes to the proximal renal
tubule. The ASARM peptide also inhibit mineralization (39,40).
Mepe expression is increased in bone derived from Hyp mice
(35), and MEPE C-terminal ASARM peptide is increased in
serum of humans with XLH and Hyp (41). In addition, recent
studies indicate that MEPE binds to PHEX (40), and the prote-
olysis of MEPE is inhibited by PHEX (36). Moreover, TIO
patients have increased MEPE expression in tumors (32). Also,
Mepe transcripts are positively correlated with Fgf23 expres-
sion in Hyp bone, suggesting a functional interrelationship
between MEPE and FGF23 in the pathogenesis of XLH/Hyp
phenotype (42).
In this study, we examine the role of Mepe in mediating the
hypophosphatemia and impaired mineralization in Hyp mice
by transferring Mepe deficiency onto the Hyp mice background.
Materials and Methods
Transfer of Mepe Deficiency onto the Phex-Deficient Hyp
Background
We obtained male heterozygous Mepe-deficient mice (Mepe⫹/⫺/XY)
and female double heterozygous Mepe-deficient Hyp mice (Mepe⫹/⫺/
HypX) from the laboratory of Thomas A. Brown (Department of Genetic
Technologies, Pfizer Global Research and Development, Groton, CT)
(34). The Mepe-deficient mice had been back-crossed onto a C57BL/6
background for more than nine generations and maintained on the
same background. Crosses between heterozygous Mepe-deficient male
mice and female double heterozygous Mepe-deficient Hyp mice pro-
duced 12 genotypes at the predicted frequency. Because we were
interested only in effects of Mepe-null mice on the Hyp phenotype, we
limited our investigations to 12- to 13-wk-old male and female wild-
type (WT) Mepe-null (Mepe⫺/⫺), Hyp, and combined Mepe-null and
Hyp mice (Mepe⫺/⫺/Hyp). We observed no sex-dependent difference
in serum biochemical measurements within any group, allowing the
combination of data from male and female mice in the following
analysis. All mice were maintained and used in accordance with rec-
ommendations in the Guide for the Care and Use of Laboratory Animals,
prepared by the Institute on Laboratory Animal Resources, National
Research Council (DHHS Publication, National Institutes of Health
86-23, 1985). All mice were fed with LabDiet 5001 Rodent Diet (PMI
Nutrition International, LLC, Brentwood, MO) consisting of 0.95% cal-
cium and 0.67% phosphorus.
Genotyping
Genomic DNA tissue was extracted and purified from the tail of each
mouse using a QIAGEN DNeasy Tissue Kit (QIAGEN Inc, Valencia,
CA). To genotype Mepe-deficient mice, we performed PCR with the
following primers specific for the native Mepe gene sequence and the
J Am Soc Nephrol 16: 1645–1653, 2005
inserted neomycin gene sequence: Mepe1016F (5⬘-CCCAAGAGCAG-
CAAAGGTAG-3⬘), Mepe1231R (5⬘-CCGCTGTGACATCCCTTTAT-3⬘),
Neo50F (5⬘-AGAGGCTATTCGGCTATGACTG-3⬘), and Neo-480R (5⬘-
ATCGCCTTCTATCGCCTTCTTGACGAGTTC-3⬘). Amplification prod-
ucts were resolved by electrophoresis on a 1.5% agarose gel and visu-
alized by ethidium bromide staining. Because we can only genotype
male Hyp mice, we only planned to use male mice in our original study
design. After we found that Mepe-deficient Hyp females still had hy-
pophosphatemia and skeletal phenotypes, we diagnosed female Hyp
mice by hypophosphatemia, growth retardation, and characteristic on
radiography (11).
Serum and Urine Assays
Serum calcium was measured using Calcium kit (Sigma-Aldrich, St.
Louis, MO), and urine and serum phosphorus levels were measured by
the phosphomolybdate–ascorbic acid method as described previously
(11). Urine and serum creatinine levels were measured using the Stan-
bio Creatinine (Stanbio Laboratory, Boerne, TX). Serum parathyroid
hormone (PTH) levels were measured by a mouse intact PTH ELISA kit
(Immutopics, Carlsbad, CA). Serum 1,25-(OH)2-vitamin D3 levels were
measured using Gamma-B 1,25-Dihydroxy Vitamin D kit (Immunodi-
agnostic Systems Limited, Boldon, UK). Serum Fgf23 levels were mea-
sured by using FGF-23 ELISA kit (Kainos Laboratories Inc, Tokyo,
Japan) following the manufacturer’s protocol. Fractional excretion
phosphate was calculated as described previously (39).
Bone Densitometry and Dry Ash Weight
Bone mineral density (BMD) of femurs was assessed at age 13 wk
using a LUNARPIXIMUS bone densitometer (Lunar Corp, Madison,
WI). Dry ash weight of femurs collected from 13-wk-old mice was
measured as described previously (11).
Three-Dimensional Analysis of the Femurs by
Microcomputed Tomography
High-resolution microcomputed tomograph (␮CT) was used to eval-
uate trabecular volume fraction and microarchitecture in the distal
femur (␮CT40; Scanco Medical AG, Basserdorf, Switzerland). The fe-
mur was scanned in a 12.3-mm diameter sample holder at 45 kEv, with
cone beam mode and a slice increment of 6 ␮m. Images from each
group were generated at identical threshold. Morphometric parameters
included the bone volume fraction (bone volume/trabecular volume,
%), trabecular thickness (mm), trabecular number (mm-1), and trabec-
ular separation (mm). Trabecular thickness, trabecular number, and
trabecular separation were computed using model-independent dis-
tance transformation algorithms (43). To determine cortical thickness,
cortical bone was imaged over a distance of 0.4 mm at the mid-shaft of
the femurs. The three-dimensional structure was generated and mor-
phometric analysis was conducted on a length of 0.3 mm using the
“midshaft” program built into the ␮CT system software.
Biomechanical Testing of the Femurs
Femurs were dissected and cleaned soft tissue attachments and
stored at ⫺20°C until testing. On the day of testing, the femurs were
thawed and rehydrated with PBS then photographed in the anterior
and medial views to measure bone length. Bending tests were per-
formed using a three-point fixture on the ELF 3200 (EnduraTEC Inc,
Minnetonka, MN). The femurs were flexed in the anterior–posterior
plane by displacing the loading point at 5 mm/min to failure by
modifications of previously described techniques (44).
J Am Soc Nephrol 16: 1645–1653, 2005 Deletion of Mepe in Hyp Mice 1647

Histomorphometric Analysis of Nondecalcified Bone Statistical Analyses

Skeletons of mice were prelabeled with tetracycline hydrochloride
(Sigma-Aldrich, St. Louis, MO) and calcine (Sigma-Aldrich) by intra-
peritoneal injection at days 1 and 3 in 12-wk-old mice before collection
of tibias. Tibias were removed from 13-wk-old mice, fixed in 70%
ethanol, prestained in Villanueva stain, and processed for methyl
methacrylate embedding. Five-micrometer sections were stained with
Goldner’s stain and analyzed under transmitted light, and 10-␮m Vil-
lanueva-prestained sections were evaluated under fluorescent light as
previously reported (11).
Bone Marrow Harvest and Stromal Cell Culture
Bone marrow stromal cells (BMSC) were cultured as described pre-
viously from long bones isolated from 13-wk-old male animals from
each group (45). Adherent cells were grown in the differentiation
medium (␣-MEM containing 10% FBS supplemented with 5 mmol/L
␤-glycerophosphate and 25 ␮g/ml of ascorbic acid) to induce osteo-
blastic differentiation. Mineralization was assessed by staining with
Alizarin red-S, as described previously (11).
RNA extraction and Real-Time PCR
Total RNA was extracted from cultured BMSC with Trizol Reagent
(Invitrogen, Carlsbad, CA). The real-time PCR were performed as
described previously (42). Briefly, cDNA was synthesized from 2 ␮g of
total RNA using TaqMan reverse-transcription reagent kit and random
hexamers according to the manufacturer’s directions (Applied Biosys-
tems, Branchburg, NJ). The reactions were incubated at 25°C for 10 min,
at 42°C for 15 min, and at 99°C for 5 min, and then stored at ⫺20°C until
use. The primer sets for specific genes are shown in Table 1. The iCycler
iQ Real-Time PCR Detection System and iQ SYBR Green Supermix
(Bio-Rad, Hercules, CA) were used for real-time PCR analysis. We
optimized the real-time PCR conditions of all selected genes by testing
efficiency of the reactions and the optimal annealing temperature. The
relative differences in expression between groups were expressed using
cycle threshold values, and cycle threshold values for interested genes
were first normalized with cyclophilin A in the same sample. Assuming
that the cycle threshold value is reflective of the initial starting copy
and that there is 100% efficacy, a difference of one cycle is equivalent to
a two-fold difference in starting copy using the formula of 2(⫺ddCT).
We evaluated differences between groups by one-way ANOVA. All
values are expressed as means ⫾ SEM. P ⬍ 0.05 was considered
statistically significant. All computations were performed using the
Statgraphics statistical graphic system (STSC Inc, Rockville, MD).
Results
Effects of Superimposed Mepe Deficiency on
Hypophosphatemia and Abnormal Vitamin D Metabolism in
Hyp Mice
Hyp mice had significantly lower serum phosphate levels
(40% reduction), a two-fold increase in fractional excretion of
phosphate, and inappropriately normal 1,25-(OH)2-vitamin D3
levels for the degree of hypophosphatemia compared with WT
mice (Table 2). Mepe knockout mice had serum phosphate and
1,25-(OH)2-vitamin D3 levels that were not statistically different
from WT mice. Combined Mepe-null and Hyp mice had persis-
tent hypophosphatemia and increased fractional excretion of
phosphate, as well as inappropriately low 1,25-(OH)2-vitamin
D3 for the degree of hypophosphatemia (Table 2).
Regarding other potential phosphaturic factors, we unex-
pectedly found that serum PTH levels were increased in Hyp
mice compared with WT mice. We also found that serum Fgf23
was markedly elevated (18 fold) in Hyp mice (Table 2). Super-
imposed Mepe deficiency did not change the elevated Fgf23 or
PTH levels in Hyp mice.
Effects of Mepe Deficiency Mice on the Skeletal Phenotype
in Hyp Mice
Bone Histology. To assess the effect of superimposed
Mepe deficiency on bone mineralization, we examined nonde-
calcified bone histology of tibial metaphyseal bone derived
from WT, Hyp, Mepe⫺/⫺, and combined Mepe⫺/⫺/Hyp mice (Fig-
ure 1, A to H). Compared with normal amount of osteoid in WT
littermates (Figure 1A), Hyp mouse bone exhibited a striking
excess of osteoid (Figure 1B) that was caused by an increase in
osteoid seam width as well as the extent of osteoid covered

Table 1. Primers used for real-time PCR

Gene Accession Number Forward Primer Reverse Primer

Cyclophilin A NM_008907 CTGCACTGCCAAGACTGAAT CCACAATGTTCATGCCTTCT

Fgf23 NM_022657 ACTTGTCGCAGAAGCATCA GTGGGCGAACAGTGTAGAA
Sfrp 4 NM_016687 TGGCCATCGAACAGTATGAA GCAGGCACTCCAGGGTACAG
Mepe AF314964 ATGCAGGGAGAGCTGGTTAC TGGTTCCCTTTGGACTCTTC
Dmp1 NM_016779 AGTGAGGAGGACAGCCTGAA GAGGCTCTCGTTGGACTCAC
Osteopontin AF515708 TCTGATGAGACCGTCACTGC CCTCAGTCCATAAGCCAAGC
Osteocalcin NM_007541 AGCAGGAGGGCAATAAGGTA CAAGCAGGGTTAAGCTCACA
AKP2 NM_007431 TTCCTGGCTCTGCCTTTAT GGGAATCTGTGCAGTCTGT
Cathepsin B BC006656 GGAGATACTCCCAGGTGCAA CTGCCATGATCTCCTTCACA
Phex NM_011077 GTGGTGGTCTGTGGAATCAG AGCCGGCTTTCTTCCAATA
Osterix AF184902 ACTGGCTAGGTGGTGGTCAG GGTAGGGAGCTGGGTTAAGG
Runx2 type II NM_009820 GCCTCACAAACAACCACAGA TTAAACGCCAGAGCCTTCTT
RankL NM011613 GCAGAAGGAACTGCAACACA TGATGGTGAGGTCCAAGGTTT
Osteoprotegerin MMU94331 GTTCCTGCACAGCTTCACAA AAACAGCCCAGTGACCATTC
1648 Journal of the American Society of Nephrology J Am Soc Nephrol 16: 1645–1653, 2005

Table 2. Serum and urine markers

Serum Markers WT Hyp Mepe⫺/⫺ Mepe⫺/⫺/Hyp P

Phosphorus, mg/dl 8.9 ⫾ 0.5a 5.3 ⫾ 0.5b 9.4 ⫾ 0.3a 5.8 ⫾ 0.5b ⬍0.0001
(n ⫽ 12) (n ⫽ 12) (n ⫽ 24) (n ⫽ 11)
Calcium, mg/dl 8.6 ⫾ 0.2a 8.5 ⫾ 0.2a 9.1 ⫾ 0.1b 8.4 ⫾ 0.2a 0.0050
(n ⫽ 12) (n ⫽ 12) (n ⫽ 24) (n ⫽ 13)
1,25-(OH)2-VitD3, pM 217.3 ⫾ 34.4 194.8 ⫾ 43.5 262.2 ⫾ 34.4 220.9 ⫾ 43.5 0.6435
(n ⫽ 8) (n ⫽ 5) (n ⫽ 8) (n ⫽ 5)
PTH, pg/ml 24.6 ⫾ 12.3a 84.9 ⫾ 14.0c 30.4 ⫾ 10.2ab 60.5 ⫾ 11.6bc 0.0035
(n ⫽ 22) (n ⫽ 17) (n ⫽ 32) (n ⫽ 25)
Fgf23, pg/ml 123.1 ⫾ 10.6a 2192.6 ⫾ 159.2b 125.3 ⫾ 10.0a 2287.2 ⫾ 234.4b ⬍0.0001
(n ⫽ 4) (n ⫽ 4) (n ⫽ 6) (n ⫽ 3)
FEP, % 9.3 ⫾ 2.7a 20.7 ⫾ 3.2b 7.6 ⫾ 0.8a 19.3 ⫾ 2.7b 0.0005
(n ⫽ 5) (n ⫽ 5) (n ⫽ 6) (n ⫽ 6)
Data shown are mean ⫾ SEM from 12-wk-old mice, except for Fgf23, which are from 5-mo-old mice. Values sharing the
same letter superscript with each row are not significantly different at P ⬍ 0.05 by one-way ANOVA analysis. FEP indicates
fractional excretion of phosphate.

and width of double labels in WT mice (Figure 1E). The hyper-

Figure 1. Representative nondecalcified bone sections of tibias
from wild-type (WT) and mutant mice. (A to D) Goldner-
stained sections are shown in the upper panel (⫻500). In Gold-
ner-stained sections, mineralized bone is blue and unmineral-
ized bone is red– brown in color. WT mice have small amounts
of osteoid relative to mineralized bone (A). In contrast, Hyp
bone has an increased relative osteoid volume (B). Mepe-null
mice did not alter the ratio of osteoid to mineralized bone (C).
Superimposed Mepe deficiency in Hyp mice (D) failed to correct
the hyperosteoidosis, as evidenced by the persistent increase in
relative osteoid volume in Mepe⫺/⫺/Hyp mice. (E to H) Villan-
ueava-stained section viewed under florescent light in the
lower panels (⫻500). Wild-type mice have two distinct double
labels indicative of normal mineralization (E). Hyp mouse bone
has diffuse labels consistent with impaired mineralization (F).
Trabecular bone from Mepe-null mice exhibit an apparent in-
crease in mineral apposition, as evidenced by a greater distance
between double labels (G). Similar to Hyp mice, combined
Mepe⫺/⫺/Hyp mice have diminished florescent labeling of bone
(H), indicating that Mepe deficiency failed to correct the miner-
alization defect in vivo.
bone surfaces. This increase in osteoid was the result of im-
paired mineralization as evidenced by the marked reduction in
surfaces undergoing mineralization in Hyp mice (Figure 1F),
compared with the normal percentage of mineralizing surfaces
osteoidosis and diminished fluorescence labeling of bone in
Hyp mice are classic histologic features of osteomalacia. Tra-
becular bone from Mepe-null mice was indistinguishable from
WT littermates (Figure 1C), except that there was a trend to-
ward increased mineral apposition as evidenced by the slightly
greater distance between double fluorescence bone labels (Fig-
ure 1G). Combined Mepe⫺/⫺ and Hyp mouse bone more closely
resembled that of Hyp mice, with persistent evidence of osteo-
malacia characterized by excessive osteoid relative to mineral-
ized bone (Figure 1D) and no fluorescence labels at the bone–
osteoid interface (Figure 1H), indicating that superimposed
Mepe deficiency failed to rescue the bone phenotype in Hyp
mice.
Bone Mineral Density. We have previously shown that
BMD of femurs measured by DEXA is highly correlated with
dry ash weights and both serve as surrogate markers for the
degree of impaired mineralization of bone in Hyp mice (11).
Consistent with the presence of osteomalacia, Hyp mice exhib-
ited significantly lower BMD (Figure 2A) and dry ash weight
(Figure 2B) of the femur compared with WT littermates. We
failed to observe an increase in BMD or dry ash weight of bone
in Mepe-null mice. More importantly, superimposed Mepe de-
ficiency did not alter the diminished BMD or dry ash weight in
Hyp mice. Similar to Hyp mice, BMD and dry ash weight were
significantly lower in Mepe⫺/⫺/Hyp mice compared with WT
littermates.
The ␮CT analysis of femurs provided additional character-
ization of Hyp bone and the effects of superimposed Mepe
deficiency (Figure 3, A through P and Table 3). Consistent with
the presence of rickets and osteomalacia, the femurs of Hyp
mice (Figure 3, B and F) were short, widened, and bowed
compared with WT littermates (Figure 3, A and E). These
changes were most pronounced in the distal femur. In addition,
the growth plates were widened in Hyp compared with WT
mice (Figure 3F, indicated by brackets). In addition, metaphy-
seal mineralized bone volume was markedly diminished in Hyp
J Am Soc Nephrol 16: 1645–1653, 2005 Deletion of Mepe in Hyp Mice 1649

Figure 2. BMD and dry ash weight of femurs in WT and mutant

mice. (A) BMD of the femur was assessed with the PIXImus
mouse densitometer in 13-wk-old male and female WT, Hyp,
Mepe⫺/⫺, and Mepe⫺/⫺/Hyp mice. (B) Dry ash weight was as-
sessed in 13-wk-old male and female WT, Hyp, Mepe⫺/⫺, and
Mepe⫺/⫺/Hyp mice. The decrease in mineralization of the skel-
eton in the Hyp compared with WT was confirmed by signifi-
cantly reduced bone ash weight and BMD; however, Mepe⫺/⫺/
Hyp exhibited no significant increment in bone ash weight and
BMD compared with Hyp mice. Values sharing the same su-
perscript are not significantly statistic different at P ⬍ 0.05.

compared with WT littermates, reflecting the osteomalacia seen

in histologic sections. Also, increased perpendicular lucency in
the cortical bone, representing nonmineralized osteoid, is con-
sistent with defective mineralization. In contrast, we failed to
observe any significant changes in the gross appearance of bone
from Mepe⫺/⫺ mice (Figure 3, C and G), which was indistin-
guishable from WT. In addition, we did not observe any quan-
tifiable differences in trabecular or cortical bone between Mepe-
null and WT mice. Similar to the histologic and BMD results,
the skeletal phenotype of combined Mepe⫺/⫺/Hyp mice (Figure
3, D and H) had the same appearance as Hyp mice, consisting of
short and widened femurs width with diminished mineralized
trabecular bone and increased cortical porosity consistent with
persistent rickets and osteomalacia. Quantitative analysis of
metaphyseal and cortical bone confirmed these impressions. In
this regard, Hyp mice had significant reductions in all trabecu-
lar bone parameters and diminished cortical thickness com-
pared with WT mice. We were unable to identify any effects of
Mepe deficiency on trabecular and cortical bone measurements
in 12-wk-old mice, and superimposed Mepe deficiency failed to
alter the trabecular and cortical parameters in Hyp mice (Table 3).
Biomechanical Properties. Next, we investigated the bio-
mechanical properties of WT and mutant mice. To accomplish
this, we performed biomechanical testing on femurs using a
three-point bending fixture (Table 4). Compared with WT mice,
the bones of Hyp mice were more pliable and could tolerate
significantly less force before failure. Mepe-null mice also ex-
hibited a decreased biomechanical strength as evidenced by a
significant reduction in the maximum force and deflection at
failure compared with WT mice. The reduced bone biome-
chanical properties were more severe in combined Mepe-null
and Hyp mice than in either Mepe-null or Hyp mice alone. Taken
Figure 3. Three-dimensional structures measured by ␮CT of the
femurs from 13-wk-old male WT and mutant mice. (A to D)
Gross appearance of whole femurs. Femurs derived from Hyp
mice are short, widened, and bowed, consistent with rickets/
osteomalacia. Superimposed Mepe⫺/⫺/Hyp does not alter the
gross appearance of the skeleton. (E to H) Sagittal views of
femurs. Femurs of Hyp and Mepe⫺/⫺/Hyp mice show unminer-
alized growth plates and much less trabecular bones compared
with WT mice. There are no significant changes between WT
and Mepe knockout mice. (I to L) Three-dimensional imagine of
trabecular architecture of femoral metaphysis of distal femurs.
(M to P) Three-dimensional imagine of cortical bones in mid-
shaft of femurs. Cortical thickness is decreased and cortical
porosity is increased in both Hyp and Mepe⫺/⫺/Hyp mice, con-
sistent with excessive unmineralized osteoid on the endosteal
surfaces and Haversian channels. [brackets] represent widened
growth plate.
together, these findings indicate that Mepe deficiency wors-
ened the mechanical properties of bone.
Effects of Mepe Deficiency on the BMSC in Hyp Mice
Although Mepe ablation did not rescue the bone phenotype
in Hyp mice, we tested if Mepe deficiency altered the intrinsic
mineralization defect observed in osteoblasts from Hyp mice
(9). BMSC were grown in the presence of ascorbate and ␤-glyc-
erophosphate to induce osteoblast differentiation and promote
bone nodule formation. Consistent with an earlier report (10),
BMSC derived from Hyp mice displayed impaired mineraliza-
1650 Journal of the American Society of Nephrology J Am Soc Nephrol 16: 1645–1653, 2005

Table 3. Micro CT analysis of femurs in WT and mutant mice

Group WT Hyp Mepe⫺/⫺ Mepe⫺/⫺/Hyp P

BV/TV, % 12.91 ⫾ 0.73a 5.17 ⫾ 0.81b 10.70 ⫾ 0.48a 5.60 ⫾ 0.96b ⬍0.0001
Tb. N, mm⫺1 5.09 ⫾ 0.14a 3.13 ⫾ 0.20b 5.18 ⫾ 0.10a 3.79 ⫾ 0.13c ⬍0.0001
Tb. Th, mm 0.042 ⫾ 0.003a,b 0.047 ⫾ 0.005b 0.036 ⫾ 0.001a 0.040 ⫾ 0.006a,b 0.0350
Tb. Sp, mm 0.193 ⫾ 0.006a 0.337 ⫾ 0.024b 0.189 ⫾ 0.004a 0.267 ⫾ 0.013c ⬍0.0001
Ct.Th, mm 0.186 ⫾ 0.004a 0.117 ⫾ 0.006b 0.177 ⫾ 0.002a 0.105 ⫾ 0.012b ⬍0.0001
Data shown are mean ⫾ SEM from 5 male 13-wk-old mice. Values sharing the same letter superscript are not significantly
different at P ⬍ 0.05 by one-way ANOVA analysis.

Table 4. Bone mechanical testing using three-point bending fixture

Group WT (n ⫽ 5) Hyp (n ⫽ 5) Mepe⫺/⫺ (n ⫽ 14) Mepe⫺/⫺/Hyp (n ⫽ 5) P

Maximum force, N 25.8 ⫾ 1.2a 8.0 ⫾ 1.0 b 23.1 ⫾ 0.7c 4.5 ⫾ 0.9d ⬍0.0001
Maximum deflection,* mm 0.71 ⫾ 0.03a 0.96 ⫾ 0.20a 0.62 ⫾ 0.04a 1.89 ⫾ 0.29b ⬍0.0001
Deflection at failure, mm 0.93 ⫾ 0.14a 2.08 ⫾ 0.08b 0.71 ⫾ 0.06c 2.11 ⫾ 0.22d ⬍0.0001
Stiffness, N/mm 55.4 ⫾ 4.3a 17.6 ⫾ 2.5b 54.3 ⫾ 2.5a 6.4 ⫾ 1.4c ⬍0.0001
Data shown are mean ⫾ SEM from 13-wk-old male mice. Values sharing the same letter superscript with each row are not
significantly different at P ⬍ 0.05 by one-way ANOVA analysis.
*Maximum deflection represents the deformation corresponding to maximum force.

tion compared with WT mice as assessed by alizarin red stain-

ing of mineralization nodules, suggesting an intrinsic defect in
mineralization in the Hyp osteoblast cells (Figure 4). Also con-
sistent with earlier report (34), BMSC derived from Mepe-null
mice had an increased mineralization potential compared with
WT BMSC ex vivo (Figure 4). More importantly, BMSC derived
from combined Mepe-null and Hyp mice displayed greater min-
eralization potential after induction of osteoblast differentiation
than BMSC derived from Hyp mice (Figure 4). The improve-
ment of the mineralization defect, however, was limited, be-
cause mineralization remained significantly less in combined
Mepe⫺/⫺/Hyp-derived BMSC than in WT cultures (Figure 4B).
To further explore the effects of combined Phex and Mepe
deficiency on osteoblast function, we evaluated gene expres-
sion profiles of BMSC (Table 3). Except for impaired mineral-
ization, Hyp-derived BMSC had normal levels of osteoblast
Figure 4. Effects of Mepe deficiency on Hyp-derived bone mar-
transcripts, except for increased Mepe and Fgf23 expression, row stromal cell maturation and mineralization. (A) Alizarin
and a small but significant decrease in the osteoblast transcrip- red-S staining of primary bone marrow stromal cells derived
tion factor Runx2-II. In contrast, Mepe deficiency, consistent from WT, Hyp, Mepe-null, and combined Mepe-null Hyp mice.
with the enhanced mineralization, resulted in significant alter- Compared with WT, bone marrow stromal cells derived from
ations in the osteoblast phenotype ex vivo that was character- Hyp mice formed less mineralization nodules, whereas the cells
ized by an increase in the osteoblastic transcription factors from Mepe⫺/⫺ mice formed much more mineralized nodules.
Runx2-II and osterix, as well as osteoblastic differentiation Mepe⫺/⫺/Hyp mice formed more mineralized nodules com-
markers alkaline phosphatase, DMP-1, and osteocalcin, consis- pared with cells from Hyp. (B) Quantification of mineralization.
tent with increased osteoblastogenesis and/or differentiation. The alizarin red-S stain was extracted with 10% cetylpyridin-
ium chloride and quantified by absorbance measurement at 562
Expression of the osteoclastic coupling factor Rank L was de-
nm as described in Materials and Methods. Numeric values
creased in BMSC from Mepe-null mice. The presence of com-
represent the mean ⫾ SEM of six wells. Bone marrow-derived
bined Phex and Mepe deficiency in the Mepe⫺/⫺/Hyp mouse- mesenchymal stem cells were culture from WT and mutant
derived BMSC reversed all of the effects of Mepe deficiency on mice for 14 d in the presence of ascorbic acid and ␤-glycero-
gene expression profiles, suggesting that the lack of Phex func- phosphate to induce osteoblast differentiation. Values sharing
tion somehow offset the effects of Mepe deficiency on osteoblast the same letter superscript are not significantly different at P ⬍
gene expression. 0.05 by one-way ANOVA analysis.
J Am Soc Nephrol 16: 1645–1653, 2005 Deletion of Mepe in Hyp Mice 1651

Discussion three-fold increased circulating levels of the phosphaturic hor-

We transferred Mepe deficiency onto the Hyp mouse back-
ground to examine the role of Mepe in the pathogenesis of
hypophosphatemia and defective mineralization in XLH/Hyp.
We found that Mepe-deficient mice had serum phosphate levels
and fractional excretion of phosphate indistinguishable from
WT littermates (Table 2), and Mepe-deficient Hyp mice re-
mained hypophosphatemic and phosphaturic, as well as had
persistent inappropriately normal 1,25(OH)2D3 levels (Table 2).
The inability of Mepe deficiency to rescue the renal abnormal-
ities in Hyp mice indicates that Mepe is not the phosphaturic
factor, phosphatonin.
Superimposing Mepe deficiency onto the Hyp background
also did not correct the gross skeletal abnormalities associated
with Phex mutations, indicating that hypophosphatemia
and/or associated factors are more important than Mepe in the
defective skeletal mineralization in Hyp mice. In vitro data,
however, implicate a role for Mepe in regulating mineralization
that may have been masked by persistent hypophosphatemia in
vivo. We observed improved mineralization in Hyp-derived
BMSC ex vivo in the absence of Mepe (Figure 4). In addition,
Mepe deficiency was associated with increased osteoblastic mark-
ers, including DMP1, osteocalcin, Osterix, and Runx2-II, and in-
activating Phex mutations counteracts the changes in osteoblastic
gene expression profiles induced by Mepe deficiency (Table 5).
Mepe deficiency also increases Phex expression in BMSC.
Our studies differ from previous studies by Gowen et al. (34)
because we failed to observe an increase in bone mass by both
DEXA and ␮CT or to demonstrate increased bone strength by
biomechanical testing (Figures 1 to 3). The reasons for these
discrepancies are not clear, although notable differences exist
with regard to age, techniques for assessing the skeletal phe-
notype, and genetic background between the two studies.
With regard to other potential phosphaturic factors, we
found that sfrp-4 (30) was not different in BMSC from Hyp or
Mepe-deficient mice (Table 5). Another interesting finding is the
mone PTH in Hyp mice. PTH, however, is not the primary
phosphaturic factor in Hyp, because parathyroidectomy does
not correct the hypophosphatemia in Hyp mice (46). The mech-
anism of PTH elevation in Hyp remains an enigma, but Phex
has been identified in the parathyroid gland (47), raising the
possibility that a primary abnormality in parathyroid gland
function may also exist in XLH.
Finally, we observed an 18-fold increase in serum Fgf23
levels in Hyp mice compared with WT littermates (Table 2) and
an eight-fold increase in Fgf23 transcripts in BMSC from Hyp
mice compared with WT mice (Table 5). Recent studies dem-
onstrate that transfer of Fgf23 deficiency onto the Hyp back-
ground increases serum phosphorus in Hyp mice (23). Collec-
tively, these findings implicate Fgf23, rather than Mepe, as the
leading candidate for phosphatonin. The mechanisms whereby
Phex deficiency results in increased Fgf23 expression are not
certain, but the original notion that Fgf23 is a substrate of Phex
(28) has not been confirmed (42,48). We interpret the concordant
increase in serum levels and expression of Fgf23 to indicate that
inactivating Phex mutations lead to the increased production of
Fgf23 through intermediate steps that likely involve potential
Phex substrates and/or other intermediate factors (13).
In conclusion, Mepe deficiency does not correct the hypophos-
phatemia in Hyp mice and therefore is not phosphatonin, but
Mepe may play a role in regulating the local mineralization pro-
cess in Hyp mice. It may be necessary to correct the hypophos-
phatemia in combined Mepe⫺/⫺/Hyp mice to uncover the in vivo
function of Mepe in the pathogenesis of XLH. Regardless, the
identification of the physiologically relevant Phex substrates will
be necessary to fully understand the pathogenesis of XLH.
Acknowledgment
This work was supported by National Institutes of Health grant RO1
AR-45955 from the National Institutes of Arthritis and Musculoskeletal
and Skin Diseases.

Table 5. Real-time PCR of bone marrow stromal cells from WT and mutant mice
Gene WT Hyp Mepe⫺/⫺ Mepe⫺/⫺/Hyp P

Phex 0.01 ⫾ 0.001a Not detectable 0.09 ⫾ 0.017b Not detectable 0.0003
Akp2 0.35 ⫾ 0.043a 0.39 ⫾ 0.115a 1.87 ⫾ 0.593b 0.28 ⫾ 0.073a 0.0165
Cathepsin B 4.89 ⫾ 0.613a 3.60 ⫾ 1.043a 3.15 ⫾ 0.622a 3.20 ⫾ 0.281a 0.3232
Mepe 0.002 ⫾ 0.0005a 0.008 ⫾ 0.0028b Not detectable Not detectable 0.0035
Dmp1 0.13 ⫾ 0.028a 0.17 ⫾ 0.023a 0.32 ⫾ 0.055b 0.12 ⫾ 0.017a 0.0120
Osteocalcin 0.05 ⫾ 0.012a 0.06 ⫾ 0.012a 0.53 ⫾ 0.067b 0.06 ⫾ 0.009a ⬍0.0001
Osteoprotegerin 0.04 ⫾ 0.004a 0.04 ⫾ 0.006a 0.02 ⫾ 0.003a 0.03 ⫾ 0.005a 0.1174
Fgf23 0.0006 ⫾ 0.0001a 0.0046 ⫾ 0.0012b 0.0001 ⫾ 0.00001a 0.0064 ⫾ 0.0020b 0.0022
sfrp4 0.11 ⫾ 0.003a 0.08 ⫾ 0.010a 0.09 ⫾ 0.007a 0.08 ⫾ 0.013a 0.0920
RankL 0.001 ⫾ 0.00025a 0.001 ⫾ 0.00017a 0.0001 ⫾ 0.00002b 0.0012 ⫾ 0.00025a 0.0147
Runx2 II 0.011 ⫾ 0.0004a 0.007 ⫾ 0.0012b 0.017 ⫾ 0.0014c 0.008 ⫾ 0.0007ab 0.0004
Osterix 0.004 ⫾ 0.0007a 0.003 ⫾ 0.0005a 0.014 ⫾ 0.0037b 0.004 ⫾ 0.0002a 0.0109
Data shown are mean ⫾ SEM from bone marrow stromal cell cultures from WT and mutant mice at 14 d of culture
duration with ascorbic acid and ␤-glycerophosphate (n ⱖ 3). Values sharing the same letter superscript within each row are
not significantly different at P ⬍ 0.05 by one-way ANOVA analysis.
1652 Journal of the American Society of Nephrology
References
1. The HYP Consortium: A gene (PEX) with homologies to
endopeptidases is mutated in patients with X-linked hy-
pophosphatemic rickets. Nat Genet 11: 130 –136, 1995
2. Strom TM, Francis F, Lorenz B, Boddrich A, Econs MJ,
Lehrach H, Meitinger T: Pex gene deletions in Gy and Hyp
mice provide mouse models for X-linked hypophos-
phatemia. Hum Mol Genet 6: 165–171, 1997
3. Carpinelli MR, Wicks IP, Sims NA, O’Donnell K, Hanzini-
kolas K, Burt R, Foote SJ, Bahlo M, Alexander WS, Hilton
DJ: An ethyl-nitrosourea-induced point mutation in phex
causes exon skipping, x-linked hypophosphatemia, and
rickets. Am J Pathol 161: 1925–1933, 2002
4. Beck L, Soumounou Y, Martel J, Krishnamurthy G, Gau-
thier C, Goodyer CG, Tenenhouse HS: Pex/PEX tissue
distribution and evidence for a deletion in the 3⬘ region of
the Pex gene in X-linked hypophosphatemic mice. J Clin
Invest 99: 1200 –1209, 1997
5. Du L, Desbarats M, Viel J, Glorieux FH, Cawthorn C,
Ecarot B: cDNA cloning of the murine Pex gene implicated
in X-linked hypophosphatemia and evidence for expres-
sion in bone. Genomics 36: 22–28, 1996
6. Guo R, Quarles LD: Cloning and sequencing of human
PEX from a bone cDNA library: Evidence for its develop-
mental stage-specific regulation in osteoblasts. J Bone Miner
Res 12: 1009 –1017, 1997
7. Ruchon AF, Marcinkiewicz M, Siegfried G, Tenenhouse
HS, DesGroseillers L, Crine P, Boileau G: Pex mRNA is
localized in developing mouse osteoblasts and odonto-
blasts. J Histochem Cytochem 46: 459 – 468, 1998
8. Nesbitt T, Fujiwara I, Thomas R, Xiao ZS, Quarles LD,
Drezner MK: Coordinated maturational regulation of
PHEX and renal phosphate transport inhibitory activity:
evidence for the pathophysiological role of PHEX in X-
linked hypophosphatemia. J Bone Miner Res 14: 2027–2035,
1999
9. Xiao ZS, Crenshaw M, Guo R, Nesbitt T, Drezner MK,
Quarles LD: Intrinsic mineralization defect in Hyp mouse
osteoblasts. Am J Physiol 275: E700 –E708, 1998
10. Miao D, Bai X, Panda D, McKee M, Karaplis A, Goltzman
D: Osteomalacia in hyp mice is associated with abnormal
phex expression and with altered bone matrix protein ex-
pression and deposition. Endocrinology 142: 926 –939, 2001
11. Liu S, Guo R, Tu Q, Quarles LD: Overexpression of Phex in
osteoblasts fails to rescue the Hyp mouse phenotype. J Biol
Chem 277: 3686 –3697, 2002
12. Bai X, Miao D, Panda D, Grady S, McKee MD, Goltzman D,
Karaplis AC: Partial rescue of the Hyp phenotype by os-
teoblast-targeted PHEX (phosphate-regulating gene with
homologies to endopeptidases on the X chromosome) ex-
pression. Mol Endocrinol 16: 2913–2925, 2002
13. Quarles LD: Evidence for a bone-kidney axis regulating
phosphate homeostasis. J Clin Invest 112: 642– 646, 2003
14. Shimada T, Mizutani S, Muto T, Yoneya T, Hino R, Takeda
S, Takeuchi Y, Fujita T, Fukumoto S, Yamashita T: Cloning
and characterization of FGF23 as a causative factor of
tumor-induced osteomalacia. Proc Natl Acad Sci U S A 98:
6500 – 6505, 2001
15. Yamashita T, Yoshioka M, Itoh N: Identification of a novel
fibroblast growth factor, FGF-23, preferentially expressed
J Am Soc Nephrol 16: 1645–1653, 2005
in the ventrolateral thalamic nucleus of the brain. Biochem
Biophys Res Commun 277: 494 – 498, 2000
16. White KE, Carn G, Lorenz-Depiereux B, Benet-Pages A,
Strom TM, Econs MJ: Autosomal-dominant hypophos-
phatemic rickets (ADHR) mutations stabilize FGF-23. Kid-
ney Int 60: 2079 –2086, 2001
17. Saito H, Kusano K, Kinosaki M, Ito H, Hirata M, Segawa H,
Miyamoto K, Fukushima N: Human fibroblast growth fac-
tor-23 mutants suppress Na⫹-dependent phosphate co-
transport activity and 1alpha,25-dihydroxyvitamin D3 pro-
duction. J Biol Chem 278: 2206 –2211, 2003
18. The ADHR Consortium: Autosomal dominant hypophos-
phataemic rickets is associated with mutations in FGF23.
Nat Genet 26: 345–348, 2000
19. Yamazaki Y, Okazaki R, Shibata M, Hasegawa Y, Satoh K,
Tajima T, Takeuchi Y, Fujita T, Nakahara K, Yamashita T,
Fukumoto S: Increased circulatory level of biologically active
full-length FGF-23 in patients with hypophosphatemic rick-
ets/osteomalacia. J Clin Endocrinol Metab 87: 4957– 4960, 2002
20. Weber TJ, Liu S, Indridason OS, Quarles LD: Serum FGF23
levels in normal and disordered phosphorus homeostasis.
J Bone Miner Res 18: 1227–1234, 2003
21. Jonsson KB, Zahradnik R, Larsson T, White KE, Sugimoto
T, Imanishi Y, Yamamoto T, Hampson G, Koshiyama H,
Ljunggren O, Oba K, Yang IM, Miyauchi A, Econs MJ,
Lavigne J, Juppner H: Fibroblast growth factor 23 in onco-
genic osteomalacia and X-linked hypophosphatemia.
N Engl J Med 348: 1656 –1663, 2003
22. Shimada T, Kakitani M, Yamazaki Y, Hasegawa H, Takeu-
chi Y, Fujita T, Fukumoto S, Tomizuka K, Yamashita T:
Targeted ablation of Fgf23 demonstrates an essential phys-
iological role of FGF23 in phosphate and vitamin D me-
tabolism. J Clin Invest 113: 561–568, 2004
23. Sitara D, Razzaque MS, Hesse M, Yoganathan S, Taguchi T,
Erben RG, H, JA-P, Lanske B: Homozygous ablation of
fibroblast growth factor-23 results in hyperphosphatemia
and impaired skeletogenesis, and reverses hypophos-
phatemia in Phex-deficient mice. Matrix Biol 23: 421– 432,
2004
24. Takeuchi Y, Suzuki H, Ogura S, Imai R, Yamazaki Y,
Yamashita T, Miyamoto Y, Okazaki H, Nakamura K, Na-
kahara K, Fukumoto S, Fujita T: Venous sampling for
fibroblast growth factor-23 confirms preoperative diagno-
sis of tumor-induced osteomalacia. J Clin Endocrinol Metab
89: 3979 –3982, 2004
25. De Beur SM, Finnegan RB, Vassiliadis J, Cook B, Barberio
D, Estes S, Manavalan P, Petroziello J, Madden SL, Cho JY,
Kumar R, Levine MA, Schiavi SC: Tumors associated with
oncogenic osteomalacia express genes important in bone
and mineral metabolism. J Bone Miner Res 17: 1102–1110,
2002
26. Larsson T, Zahradnik R, Lavigne J, Ljunggren O, Juppner
H, Jonsson KB: Immunohistochemical detection of FGF-23
protein in tumors that cause oncogenic osteomalacia. Eur J
Endocrinol 148: 269 –276, 2003
27. Riminucci M, Collins MT, Fedarko NS, Cherman N, Corsi
A, White KE, Waguespack S, Gupta A, Hannon T, Econs
MJ, Bianco P, Gehron Robey P: FGF-23 in fibrous dysplasia
of bone and its relationship to renal phosphate wasting.
J Clin Invest 112: 683– 692, 2003
28. Bowe AE, Finnegan R, Jan de Beur SM, Cho J, Levine MA,
Kumar R, Schiavi SC: FGF-23 inhibits renal tubular phos-
J Am Soc Nephrol 16: 1645–1653, 2005
phate transport and is a PHEX substrate. Biochem Biophys
Res Commun 284: 977–981, 2001
29. Marie PJ, Travers R, Glorieux FH: Healing of bone lesions
with 1,25-dihydroxyvitamin D3 in the young X-linked hy-
pophosphatemic male mouse. Endocrinology 111: 904 –911,
1982
30. Berndt T, Craig TA, Bowe AE, Vassiliadis J, Reczek D,
Finnegan R, Jan De Beur SM, Schiavi SC, Kumar R: Se-
creted frizzled-related protein 4 is a potent tumor-derived
phosphaturic agent. J Clin Invest 112: 785–794, 2003
31. Fisher LW, Fedarko NS: Six genes expressed in bones and
teeth encode the current members of the SIBLING family
of proteins. Connect Tissue Res 44[Suppl 1]: 33– 40, 2003
32. Rowe PS, de Zoysa PA, Dong R, Wang HR, White KE,
Econs MJ, Oudet CL: MEPE, a new gene expressed in bone
marrow and tumors causing osteomalacia. Genomics 67:
54 – 68, 2000
33. Petersen DN, Tkalcevic GT, Mansolf AL, Rivera-Gonzalez
R, Brown TA: Identification of osteoblast/osteocyte factor
45 (OF45), a bone-specific cDNA encoding an RGD-con-
taining protein that is highly expressed in osteoblasts and
osteocytes. J Biol Chem 275: 36172–36180, 2000
34. Gowen LC, Petersen DN, Mansolf AL, Qi H, Stock JL,
Tkalcevic GT, Simmons HA, Crawford DT, Chidsey-Frink
KL, Ke HZ, McNeish JD, Brown TA: Targeted disruption of
the osteoblast/osteocyte factor 45 gene (OF45) results in
increased bone formation and bone mass. J Biol Chem 278:
1998 –2007, 2003
35. Argiro L, Desbarats M, Glorieux FH, Ecarot B: Mepe, the
gene encoding a tumor-secreted protein in oncogenic hy-
pophosphatemic osteomalacia, is expressed in bone.
Genomics 74: 342–351, 2001
36. Guo R, Rowe PS, Liu S, Simpson LG, Xiao ZS, Darryl
Quarles LD: Inhibition of MEPE cleavage by Phex. Biochem
Biophys Res Commun 297: 38 – 45, 2002
37. Nampei A, Hashimoto J, Hayashida K, Tsuboi H, Shi K,
Tsuji I, Miyashita H, Yamada T, Matsukawa N, Matsumoto
M, Morimoto S, Ogihara T, Ochi T, Yoshikawa H: Matrix
extracellular phosphoglycoprotein (MEPE) is highly ex-
pressed in osteocytes in human bone. J Bone Miner Metab
22: 176 –184, 2004
38. Siggelkow H, Schmidt E, Hennies B, Hufner M: Evidence
of downregulation of matrix extracellular phosphoglycop-
Deletion of Mepe in Hyp Mice 1653
rotein during terminal differentiation in human osteo-
blasts. Bone 35: 570 –576, 2004
39. Rowe PS, Kumagai Y, Gutierrez G, Garrett IR, Blacher R,
Rosen D, Cundy J, Navvab S, Chen D, Drezner MK,
Quarles LD, Mundy GR: MEPE has the properties of an
osteoblastic phosphatonin and minhibin. Bone 34: 303–319,
2004
40. Rowe PS, Garrett IR, Schwarz PM, Carnes DL, Lafer EM,
Mundy GR, Gutierrez GE: Surface plasmon resonance
(SPR) confirms that MEPE binds to PHEX via the MEPE-
ASARM motif: A model for impaired mineralization in
X-linked rickets (HYP). Bone 36: 33– 46, 2005
41. Bresler D, Bruder J, Mohnike K, Fraser WD, Rowe PS:
Serum MEPE-ASARM-peptides are elevated in X-linked
rickets (HYP): Implications for phosphaturia and rickets. J
Endocrinol 183: R1–R9, 2004
42. Liu S, Guo R, Simpson LG, Xiao ZS, Burnham CE, Quarles
LD: Regulation of fibroblastic growth factor 23 expression
but not degradation by PHEX. J Biol Chem 278: 37419 –
37426, 2003
43. Hildebrand T, Laib A, Muller R, Dequeker J, Ruegsegger P:
Direct three-dimensional morphometric analysis of human
cancellous bone: Microstructural data from spine, femur,
iliac crest, and calcaneus. J Bone Miner Res 14: 1167–1174,
1999
44. Silva MJ, Ulrich SR: In vitro sodium fluoride exposure
decreases torsional and bending strength and increases
ductility of mouse femora. J Biomech 33: 231–234, 2000
45. Xiao ZS, Quarles LD, Chen QQ, Yu YH, Qu XP, Jiang CH,
Deng HW, Li YJ, Zhou HH: Effect of asymmetric dimethy-
larginine on osteoblastic differentiation. Kidney Int 60:
1699 –1704, 2001
46. Meyer RA Jr, Tenenhouse HS, Meyer MH, Klugerman AH:
The renal phosphate transport defect in normal mice para-
biosed to X-linked hypophosphatemic mice persists after
parathyroidectomy. J Bone Miner Res 4: 523–532, 1989
47. Blydt-Hansen TD, Tenenhouse HS, Goodyer P: PHEX ex-
pression in parathyroid gland and parathyroid hormone
dysregulation in X-linked hypophosphatemia. Pediatr
Nephrol 13: 607– 611, 1999
48. Benet-Pages A, Lorenz-Depiereux B, Zischka H, White KE,
Econs MJ, Strom TM: FGF23 is processed by proprotein
convertases but not by PHEX. Bone 35: 455– 462, 2004