Accepted Manuscript

Effect of temperature on thermophilic composting of aquaculture sludge: NH3

recovery, nitrogen mass balance, and microbial community dynamics

Mitsuhiko Koyama, Norio Nagao, Fadhil Syukri, Abdullah Abd Rahim, Mohd
Salleh Kamarudin, Tatsuki Toda, Takuya Mitsuhashi, Kiyohiko Nakasaki

PII: S0960-8524(18)30777-6
DOI: https://doi.org/10.1016/j.biortech.2018.05.109
Reference: BITE 20015

To appear in: Bioresource Technology

Received Date: 20 April 2018

Revised Date: 27 May 2018
Accepted Date: 30 May 2018

Please cite this article as: Koyama, M., Nagao, N., Syukri, F., Rahim, A.A., Kamarudin, M.S., Toda, T., Mitsuhashi,
T., Nakasaki, K., Effect of temperature on thermophilic composting of aquaculture sludge: NH3 recovery, nitrogen
mass balance, and microbial community dynamics, Bioresource Technology (2018), doi: https://doi.org/10.1016/
j.biortech.2018.05.109

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Effect of temperature on thermophilic composting of aquaculture
sludge: NH3 recovery, nitrogen mass balance, and microbial
community dynamics

Mitsuhiko Koyama*, Norio Nagao**, Fadhil Syukri**, Abdullah Abd Rahim**, Mohd
Salleh Kamarudin**, Tatsuki Toda***, Takuya Mitsuhashi*, Kiyohiko Nakasaki*

*School of Environment and Society, Tokyo Institute of Technology, 2-12-1 Ookayama,

Meguro-ku, Tokyo 152-8550, Japan.
**Faculty of Agriculture, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor
Darul Ehsan, Malaysia.
***Faculty of Science and Engineering, Soka University, 1-236 Tangi-machi, Hachioji,
Tokyo 192-8577, Japan.

Email address of the corresponding author: koyama.m.ad@m.titech.ac.jp

Abstract

Development of thermophilic composting for maximizing NH3 gas recovery

would enable the production of a nitrogen source which is free from pathogen/heavy

metal, for the cultivation of high-value microalgae. The present study examined the

effect of NH3 recovery, nitrogen mass balance, and microbial community dynamics on

thermophilic composting of shrimp aquaculture sludge. The emission of NH3 gas at 60

and 70 °C was 14.7 % and 15.6 %, respectively, which was higher than that at 50 °C

(9.0 %). The nitrogen mass balance analysis revealed that higher temperatures enhanced

the solubilization of non-dissolved nitrogen and liberation of NH3 gas from the

produced NH4+-N. High-throughput microbial community analysis revealed the shift of

1
the dominant bacterial group from Bacillus to Geobacillus with the rise of composting

temperature. In conclusion, thermophilic composting of shrimp aquaculture sludge at

60–70 °C was the most favorable condition for enhancing NH3 gas recovery.

1. Introduction

The aquaculture production has recently been rapidly grown against capture

fisheries thus the destruction of the aquatic environment is a great concern. In shrimp

farming, accumulation of sludge at the bottom of the pond induces the deterioration of

the aquatic environment such as by continuous uprooting of mangroves for the

construction of the pond. The accumulation of sludge also greatly affects the growth and

survival of shrimps, either by causing early mortality syndrome/acute hepatopancreatic

necrosis disease (EMS/AHPND) and/or by deterioration of water quality (Hopkins et al.,

1994). To prevent sludge accumulation, it needs to be constantly removed from the pond,

but effective treatment or utilization method is yet to be established.

Aquaculture sludge is conventionally treated mainly by composting (Marsh et al.,

2005; Zhang and Sun, 2017) or anaerobic digestion (Mirzoyan et al., 2010, 2008). These

methods, though useful for low-cost sludge reduction or utilization, but their product

(i.e. compost or biogas) is not much beneficial; therefore, an improved process for the

2
production of high-value product would be required for a more sustainable aquaculture

system. Previous studies have attempted release of nutrients from the sludge into the

water to culture microalgal biomass, considering that sludge is rich in nitrogen (Yusoff

et al., 2003, 2001). Releasing nutrients from sludge into the water in an algae bioreactor

would provide nutrients to microalgae for their accelerated growth; however, the

utilization of harvested algal biomass is limited to only bioenergy purposes, since the

algal biomass is required to be free from contaminants, such as pathogens or heavy

metals, for it to be used in high-value products such as health supplements, cosmetics,

or medicines (Griffiths et al., 2016). Thus, a new technology for nutrient recovery from

sludge should be developed to produce commercial values from aquaculture sludge

treatment.

Application and development of solid-state thermophilic aerobic fermentation, or

thermophilic composting technique, would enable the recovery of “clean nutrients”

from sludge in the form of NH3 gas. During thermophilic composting process (or

primary fermentation period), the organic nitrogen or non-dissolved nitrogen of the raw

material is degraded by aerobic microorganisms to dissolved nitrogen, which is

eventually degraded to NH4＋-N; some fraction of NH4＋-N then evaporates as NH3 gas.

NH3 gas is “clean N source” for microalgae, since it is free from pathogens and heavy

3
metals. Therefore, ammonia recovery from aquaculture sludge could be of potential use

in the cultivation of high-value microalgae toward commercial production of medicines,

cosmetics, or health supplements.

Previous studies of composting have focused mostly on the reduction of NH3 gas,

in order to minimize the odor and/or to maximize nutrient retention in the compost for

its agricultural use. Reduction of NH3 emission had been achieved by increasing the

C/N ratio of raw materials for accelerating ammonia assimilation (Jiang et al., 2011;

Meng et al., 2016; Nakasaki et al., 1992), addition of absorbent such as zeolite (Bernal

et al., 1993; Chan et al., 2016) or bulking agent (Nakasaki et al., 2001), or delayed

addition of nitrogen-rich materials (Nigussie et al., 2017). Some other studies have

addressed the effect of composting temperature on NH3 emission. Pagans et al. (2006)

compared the amount of NH3 emission during composting of five different raw

materials and confirmed that NH3 emission increased at a higher temperature. Many

studies have observed the increase of NH3 emission with increase of compost

temperature (e.g. M. Wang et al., 2017), but the direct effect of temperature on the

nitrogen dynamics is not yet clear. Understanding the NH3 emission characteristics and

change of nitrogen mass balance, in relation to the composting temperature, would be

useful to optimize the NH3 recovery system from aquaculture sludge. Furthermore,

4
various environmental conditions, including temperature, strongly influence the

microbial community (Li et al., 2014; X. Wang et al., 2017), which could cause further

differences in nitrogen dynamics during thermophilic composting. Recent

advancements in high-throughput microbial community analysis or next generation

sequencing (NGS) enable detailed elucidation of the shift of microbial community. Thus,

application of NGS would significantly contribute to clarify the mechanism of

thermophilic composting of aquaculture sludge in relation to NH3 recovery.

The objective of the present study was to investigate the effect of NH3 recovery,

nitrogen mass balance, and microbial community dynamics on thermophilic composting

of shrimp aquaculture sludge.

2. Materials and methods

2.1. Composting raw materials

Shrimp aquaculture sludge was obtained from a sludge discharge channel in

Malaysia. The collected sludge was simply dewatered by squeezing with a filter cloth.

Sawdust was used as the bulking agent. For the inoculum, a commercial seeding

material Alles G (Matsumoto Laboratory of Microorganisms Co. Ltd., Matsumoto,

Japan) was utilized in the present study.

5
 Thermophilic composting of shrimp aquaculture sludge was conducted at three

different temperatures (50, 60, and 70 °C) using the lab-scale composting reactors for

10 days (see Supplementary data). For a mini-reactor, a Pyrex glass cylinder (45 mm in

diameter, 100 mm in depth) sealed with silicone rubber stoppers was used. Air was first

introduced into a flask containing NaOH solution to eliminate CO2, and then passed

through a bubbler filled with distilled water to saturate the air with moisture. The

aeration rate was maintained at 5.5 mL/min throughout the experiment by using an air

flow meter, in order to sufficiently maintain the aerobic condition as we have tested in

our previous study (Kuok et al., 2012). Sludge was mixed with sawdust and seeding

materials with the dry-weight (dwt) based mixing ratio of 5:14:1 according to our

previous paper (Nakasaki et al., 2009), and sterilized distilled water was added to adjust

the moisture content of the raw material mixture to 60 %; pH of the mixture was not

adjusted. Twelve gram wet-weight (wwt) of the mixture was loaded into each

mini-reactor. The incubator temperature was raised from 30 °C to a set point of 50, 60,

and 70 °C at a constant rate of 2.5 °C/h, and each temperature was maintained until the

end of the experiment. The exhaust gas from the composting reactor was introduced into

an ammonia trap, which is a glass test tube containing 0.1 M H 2SO4 solution, to collect

all NH3 gas and water vapor from the compost. The cleaned exhaust gas was introduced

6
into a 10 L plastic gas bag made of vinyl alcohol series polymer film (Smart bag PA

AA-10; GL Sciences Inc., Tokyo, Japan); the gas bag was changed daily. The volume of

exhaust gas and concentration of CO2 was analyzed by a dry gas meter (DC-1C,

Shinagawa Corporation, Tokyo, Japan) and a CO2 sensor (GMP221 Vaisala Oyj, Vantaa,

Finland), respectively. The composting material inside the reactor was mixed daily by a

sterilized spatula. Eight reactors were operated for each temperature condition, and the

compost sample was collected on days 1, 2, 3, 5, 7, and 10.

2.2. Measurement of physical and chemical parameters

The moisture content of raw materials and compost samples was measured by

drying the samples at 105 °C for 24 h in a drying oven. The volatile solid (VS) content

of raw materials was quantified by combusting the samples at 550 °C for 3 h in a muffle

furnace. To measure the pH, total dissolved nitrogen, and NH4+-N content of the

compost, a suspension was prepared by homogenizing the compost sample in water at a

ratio of 1:9 (w/w) using a homogenizer (Cell Master CM-100, As One Co., Osaka,

Japan), 10,000 rpm for 10 min at ambient temperature. pH was measured by a pH meter

(9625-10D, Horiba, Japan). The compost suspension was centrifuged, and the

supernatant was filtered through 0.2 µm membrane filter (25CS020AN, Advactec,

7
Tokyo, Japan). The NH4+-N concentration and total dissolved nitrogen concentration of

the supernatant was measured by indophenol blue method (JIS K 0102 42.2) and

alkaline persulfate digestion method (JIS K 0102 45.2), respectively. The total carbon

and nitrogen contents of sludge were quantified by using a CHN corder (Micro corder

JM10, J-Science Lab Co. Ltd., Kyoto, Japan, Nakasaki et al., 2009). The content of the

intermediate nitrogen, defined as dissolved nitrogen fraction, except NH4+-N, was

calculated by subtracting the NH4+-N content from the total dissolved nitrogen content

of the compost sample. The non-dissolved nitrogen content of the compost sample was

calculated by subtracting the total dissolved nitrogen content and the cumulative

emission of NH3 gas from the total nitrogen content of the raw material. The amount of

water evaporated from the compost was quantified by measuring the change in volume

of H2SO4 solution in the NH3 trap, since all evaporated water vapor was trapped in the

NH3 trap.

2.3. Microbial analysis

The microbial cell density was quantified by dilution plating method on

trypticase-soy (TS) agar medium (Nakasaki and Hirai, 2017). Composition of the TS

agar medium was as follows: trypticase peptone, 17 g; phytone peptone, 3 g; K2HPO4,

8
2.5 g; NaCl, 5 g; glucose, 2.5 g; agar, 20 g; distilled water, 1000 mL; pH 7.3. The

incubation temperature was the same as the temperature of each composting (i.e. 50, 60,

and 70 °C) with an incubation period of three days. Cell density of the microorganisms

was expressed in terms of colony-forming units (CFU) per unit of dry weight of the

composting material (CFU g-ds-1).

2.4. DNA extraction and next-generation sequencing

The 16S rRNA gene region of bacteria and archaea was used for next generation

sequencing analysis. DNA from the compost samples of day 0 and day 10, at each

temperature, was extracted by using the ISOIL for Beads Beating Kit (No. 319-06201,

Nippon Gene Co., Ltd., Toyama, Japan) according to the manufacturer’s instructions.

The extracted DNA was amplified with the following primers: Forward (5ʹ-

TCGTCGGCAGCGTCAGATGTG TATAAGAGACAGCCTACGGGNGGCWGCAG

-3ʹ), and Reverse (5ʹ-

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAA

TC C -3ʹ) to target the V3 and V4 regions of the 16S rRNA genes. The PCR product

was purified using the Wizard SV Gel and PCR Clean-Up system (Promega, Madison,

WI). Thereafter, a second PCR was performed using Nextera XT index primers

9
(Illumina, San Diego, CA) according to the provided protocol. Indexed PCR products

were cleaned up using the same method as the previous PCR, and pooled together in

equimolar concentrations for sequencing. Prior to sequencing, the quality of the library

was validated (2100 Bioanalyzer, Agilent) and the library was quantified (KAPA

Library Quantification Kit, KAPA Biosystems). The mixed library was paired-end

sequenced with the Illumina MiSeq system (2 x 300 bp) following the Illumina

sequencing protocols. 16S rRNA demultiplex sequences were analyzed with the

software package of Quantitative Insights into Microbial Ecology (QIIME), version

1.9.1 (Caporaso et al., 2010). The paired-end V3–V4 sequence reads were paired using

fastq-join with the default settings for Illumina processing in QIIME. Trimmed barcodes

and denoised sequence assemblies were clustered into operational taxonomic units

(OTUs) (97 % identity). The representative sequences of OTUs were assigned taxonomy

using BLAST against the Greengenes database.

2.5. Calculations

Solubilization efficiency of non-dissolved nitrogen, ammonia (NH3+NH4+-N)

conversion efficiency of dissolved nitrogen, and volatilization efficiency of ammonia

were calculated as follows:

10
 N solubilization efficiency (%) = ×100

Ammonia conversion efficiency (%) = ×100

NH3 volatilization efficiency (%) = ×100

where MTN is the total nitrogen content of the aquaculture sludge initially (mol batch-1),

MTDN is the total content of dissolved nitrogen in the compost (mol batch-1), MNH3 is the

cumulative NH3 emission (mol batch-1), and MNH4 is the content of NH4+-N in the

compost (mol batch-1).

2.6. Statistical analysis

Data were analyzed using the Tukey-Kramer multiple comparisons test, with a

cutoff of p < 0.05.

3. Results and discussion

3.1. The composition of aquaculture sludge

Chemical composition of the dewatered aquaculture sludge, used in the present

study, is shown in Table 1, together with that of aquaculture sludge from few previous

studies. The VS content, which is equivalent to organic matter content of the sludge,

was 25.2 %-dwt, indicating the sludge to be relatively rich in inorganic matter. The VS

11
content of the present study was similar to that in previous literature (Hopkins et al.,

1994). The large inorganic matter content of sludge is probably due to the in-situ

degradation of organic matter during long-term sedimentation at the bottom and/or upon

mixing with the sediment (soil) after its removal from the pond. The C/N ratio of the

sludge was 8.7, which implicated it as a nitrogen-rich raw material for composting.

Numerous previous studies have investigated the effect of C/N ratio on NH3 emission

during composting, and reported that high C/N ratio of the raw material reduces the

NH3 emission by microbial assimilation (Jiang et al., 2011; Meng et al., 2016). Jiang et

al., (2011) conducted composting of pig feces with corn stalk at different C/N ratios

(such as 15, 18, and 21), and found that NH3 emission decreased with increase of C/N

ratio. Accordingly, the aquaculture sludge used in the present study was suggested to be

a prospective raw material for NH3 recovery owing to its low C/N ratio. In fact, the C/N

ratio of the aquaculture sludge could vary with the in-situ degradability. The main

components of shrimp aquaculture sludge are shrimp feed and feces which are rich in

nitrogen (Funge-Smith and Briggs, 1998). Consequently, the C/N ratio of the fresh

sludge before in-situ degradation could also be low, as well as the sludge we used in the

present study.

12
3.2. Composting characteristics and NH3 recovery

The time course of NH3 evolution rate and nitrogen emission (EN) as NH3 gas is

depicted in Fig. 1. The NH3 evolution immediately started from day 1, at all

temperatures, and occurred obviously at a higher rate at 60 and 70 °C compared to that

at 50 °C. The EN at 60 and 70 °C was 14.7 % and 15.6 % respectively, which was not

significantly different (p > 0.05), whereas that at 50 °C was 9.0 %, significantly lower

than that at other temperatures (p < 0.05). These results revealed that maintaining the

composting temperature between 60–70 °C would be beneficial for improving the NH3

recovery from aquaculture sludge. Till date, there has been no study that investigated

NH3 emission from aquaculture sludge during composting. The reported value of EN

from composting of anaerobic digestion sludge (6.8 to 23.5 %, Nakasaki et al., 2009) is

relatively comparable to that seen in the present study, but lower than that in other labile

biomass such as food waste (65 %) (Komilis and Ham, 2006), probably due to the

in-situ degradation of the labile fraction of organic matter.

The time course of physical and chemical parameters during thermophilic

composting of aquaculture sludge is summarized in Fig. 2. The pH and moisture content

of the compost ranged from 7.6–8.0 and 50–60 % throughout the composting period

(Fig. 2 (a), (b)), which were in the optimal range for stable microbial organic matter

13
degradation (Nakasaki et al., 1993; Wilson, 1989). The microbial cell density of the

compost at 50 and 60 °C immediately increased from day 1 and was maintained at

approximately 107–108 CFU g-ds-1 until day 10 (Fig. 2 (c)). On the other hand, the cell

density at 70 °C started to increase one day later than at other temperatures and peaked

at day 2, but quickly reduced to 106 CFU g-ds-1 and was maintained there until the end

of the composting period. Higher temperature is known to reduce the bacterial species

diversity in the compost (Strom, 1985), indicating that viable bacteria were limited at

70 °C, compared to that at other temperatures.

Figure 3 shows the time course of CO2 evolution rate and emission of carbon (EC)

during thermophilic composting of aquaculture sludge. EC, which is calculated based on

the cumulative CO2 emission during composting, corresponds to the degree of organic

matter decomposition (Nakasaki et al., 2009). In our preliminary experiment, it was

confirmed that the CO2 evolution from sawdust was negligible during 10 days of

thermophilic composting experiment, by changing the sawdust dosage of the compost

(data not shown). In the present study, the CO2 evolution rate at 60 and 70 °C peaked by

day 3 and gradually reduced thereafter (Fig. 3 (a)). On the contrary, the CO2 evolution

rate at 50 °C gradually increased until day 5 and showed lower values throughout the

composting period. The ultimate EC at 50, 60, and 70 °C was 26.4 %, 33.4 %, and

14
28.1 %, respectively, demonstrating the highest EC at 60 °C. From these results, it was

clear that the labile fraction of organic matter in the sludge was rapidly degraded in a

short period of time in high-temperature composting. The higher degradation efficiency

of the organic matter probably contributed to the enhancement of NH3 emission at

higher temperatures.

3.3. Nitrogen mass balance

In composting process, the organic nitrogen or non-dissolved nitrogen is degraded

by microorganisms to form dissolved nitrogen, such as amino acids, and eventually

produces NH4＋-N. During thermophilic composting or primary fermentation period, the

produced NH4+-N is either evaporated as NH3 gas, or left in the compost as NH4+-N, or

assimilated by microorganisms to be returned to non-dissolved nitrogen. The nitrogen

mass balance before and after thermophilic composting of aquaculture sludge is

exhibited in Fig. 4. With the increase of composting temperature, NH3 emission

increased, remaining NH4+-N content decreased, dissolved nitrogen excluding NH4+-N

(the intermediate N) content increased, and non-dissolved nitrogen content decreased.

In order to clarify the relationship between composting temperature and each

formation step of the individual nitrogen fraction, solubilization efficiency of

15
non-dissolved nitrogen, ammonia (NH3+NH4+-N) conversion efficiency of dissolved

nitrogen, and volatilization efficiency of ammonia, were calculated based on the

nitrogen mass balance results (Fig. 5). The solubilization efficiency of non-dissolved

nitrogen at both 60 and 70 °C was approximately 35 %, which was higher than that at

50 °C (31 %) (Fig. 5 (a)). This result suggests the existence of microorganisms with

high protein hydrolysis activity at higher temperatures. More than 60 % of the nitrogen

remained as a non-dissolved form at all temperatures, suggesting that the aquaculture

sludge contained non-labile organic nitrogen. Degradability of sludge (all types,

including aquaculture sludge) is known to be relatively low (e.g. Nakasaki et al., 2009).

The sludge produced in aquaculture system comprises of both labile and recalcitrant

fractions of organic matter; the labile fraction is usually degraded while it is sedimented

at the bottom of the pond. On the other hand, aquaculture sludge could also contain

abundant organic matter (56–76 %-dwt) by quickly flushing out the sludge (i.e. fresh

sludge) via recirculating aquaculture system (RAS) (Mirzoyan et al., 2008). Therefore,

the use of fresh sludge, before in-situ degradation, by its frequent discharge from the

pond is necessary for enhancing NH3 recovery from aquaculture sludge and accelerating

the organic nitrogen hydrolysis. In addition, although the sludge itself contains abundant

inorganic matter, the compost in the present study comprises not only sludge but also

16
sawdust as bulking agent. It significantly reduces the bulk density and improves the

water holding capacity, which would be suitable for agricultural use in terms of soil

conditioner. Therefore, investigation of the soil conditioning potential of the sludge

compost rich in inorganic matter will have a great significance for future study.

Fig. 5 (b) shows the relationship between composting temperature and ammonia

conversion efficiency (NH3 and NH4+) of dissolved nitrogen. Contrary to the

solubilization of non-dissolved nitrogen, the ammonia conversion efficiency decreased

with increase of composting temperature. Microbial ammonia assimilation reduces the

NH4+ content of the compost, thereby influencing the apparent ammonia conversion

efficiency; however, the lower ammonia conversion efficiency at 70 °C should not be

due to ammonia assimilation, since the microbial cell density at this temperature was

significantly lower than at other temperatures (see Fig. 2(c)). Consequently, the decline

of ammonia conversion efficiency with the rise of temperature was suggested to be

possibly due to the reduction of ammonia-producing bacteria and/or their activity at

elevated temperatures.

The evaporation efficiency of NH3 from the generated ammonia (NH3 and NH4+)

in relation to composting temperature was also evaluated. Fig. 5 (c) exhibits the

relationship between NH3 evaporation efficiency and cumulative water evaporation

17
during thermophilic composting of aquaculture sludge. The amount of evaporated water

increased with the rise of composting temperature, and the NH 3 evaporation efficiency

increased with the enhancement of water evaporation. This result implied that

accelerating the water evaporation could be a useful operation to improve NH3

evaporation from the compost. Water evaporation from compost could be enhanced by

increasing the temperature (Ahn et al., 2007), air flow rate, and/or limiting water

addition to the compost for maintaining microbial activity. However, these operations

may also reduce the microbial activity. Therefore, in future studies, optimal operational

method for enhancing water (and NH3) evaporation should be explored for further

improvement of the NH3 emission; water addition may be stopped when majority of the

organic matter has degraded, in order to reduce the moisture content of the compost.

3.4. Microbial community dynamics

Understanding the microbial community is important to understand the mechanism

of composting and to find the prospective processes for promoting or limiting the

microorganisms. Fig. 6 (a) shows the relative abundance of the microbial community in

order level, before and after thermophilic composting of aquaculture sludge. Before

composting (day 0), Rhodobacterales were dominant (37 %), with Campylobacterales,

18
Chlorophyta, Flavobacteriales, and Bacteroidales as the other major bacterial groups.

On the other hand, Bacillales and Clostridiales, which are often observed in

thermophilic composting, were a minority in day 0. All Rhodobacterales bacteria, found

in the present study, belonged to Rhodobacteraceae family (see Supplementary data).

Most Rhodobacteraceae are assigned to the Roseobacter group, which mainly originated

from marine habitat, such as aquaculture pond, coast, or the sea (Simon et al., 2017;

Wongwilaiwalin et al., 2010). Many Rhodobacteraceae are saline-tolerant and are

known to be deeply involved in sulfur and carbon biogeochemical cycling (Pujalte et al.,

2014). In shrimp aquaculture pond, an enormous amount of organic matter, such as

shrimp feed or feces, rapidly accumulates at the bottom as sludge, considerable fraction

of which is degraded by microorganisms simultaneously. Therefore, Rhodobacteraceae

have been suggested to play a significant role in degrading organic matter of the

aquaculture sludge in the pond.

The microbial community dramatically changed upon thermophilic composting

(Fig. 6 (a)). At all temperatures, Bacillales became dominant from day 2 and exhibited

a high relative abundance of 57–93 % in most of the samples. Bacillales form a

common bacterial group involved in composting, which often contains thermophilic

bacteria. The major bacterial groups found on day 0 (Rhodobacterales,

19
Campylobacterales, Chlorophyta, Flavobacteriales, and Bacteroidales) were mostly

eliminated after day 2. These results suggested that rapid microbial succession to

thermophilic Bacillales takes place during thermophilic composting of aquaculture

sludge. The majority of Bacillales belonged to the family Bacillaceae (see

Supplementary data) and these were considered as the main organic matter degraders in

this system.

The changes in microbial composition, in the family Bacillaceae, during

thermophilic composting of aquaculture sludge is demonstrated in Fig. 6 (b). The

differences in microbial community were observed clearly at different composting

temperatures. The genus Bacillus was dominant at 50 and 60 °C, whereas the genus

Geobacillus increased with the rise of temperature and dominated at 70 °C, when the

relative abundance of Bacillus drastically declined. Geobacillus, which belonged to

Bacillus was proposed as new genus in 2001 by Ivanov et al., (2001). Geobacillus is a

thermophilic bacteria, known to grow at 45–70 °C (Ivanov et al., 2001; Rhee et al.,

2002). Bacillus is also often found in thermophilic (50–70 °C) compost (e.g. Bhatia et

al., 2013). The shift from Bacillus to Geobacillus at an elevated temperature, as seen in

the present study, was consistent with a recent report on composting. Li et al., (2014)

conducted the thermophilic composting of cow manure for 43 days and reported that

20
Bacillus was dominant in the early period (days 3–13, compost temperature 51–63 °C),

but drastically declined when the temperature reached 71 °C on day 18, when

Geobacillus became dominant (days 18–28, compost temperature 69–72 °C). In their

study, the compost temperature varied with the progress of organic matter degradation,

which implied that the shift of microbial community may not be simply owing to the

change of temperature alone. On the other hand, the present study directly indicated

that rise of temperature caused the shift from Bacillus to Geobacillus during

thermophilic composting, since temperature was maintained constant throughout the

process.

In the present study, Geobacillus bacteria may be considered to play the main role

in the hydrolysis of non-dissolved nitrogen of sludge, owing to the higher hydrolysis

efficiency (Fig. 5 (a)) and higher relative abundance of Geobacillus bacteria at 70 °C

(Fig. 6 (b)). Moreover, the total bacterial cell density at 70 °C was approximately 10 %

of that at 50 and 60 °C (Fig. 2 (c)), indicating that the sludge hydrolysis activity of each

Geobacillus cell was remarkably high. Geobacillus bacteria are known to secrete

thermo-tolerant protease. Chen et al., (2004) reported that the protease activity of

Geobacillus caldoxylosilyticus strain SF03 was the highest at pH 8.0–9.0 and 70–80 °C.

Thus, Geobacillus bacteria could be a potential candidate to be considered as a useful

21
microorganism for the enhancement of aquaculture sludge hydrolysis. Till date, various

studies have attempted the inoculation of “useful” microorganisms in the compost

(Sarkar et al., 2010; Tran et al., 2015). Further studies will be needed to elucidate the

effect of Geobacillus bacterial inoculation on protein degradability, microbial

community structure, and the competitive relationship with Bacillus spp. for confirming

the usefulness of Geobacillus bacteria in aquaculture sludge compost for improving

NH3 recovery.

4. Conclusion

During thermophilic composting of shrimp aquaculture sludge, the emission of

nitrogen as NH3 gas at 60 and 70 °C was 14.7 % and 15.6 %, respectively, which is

much higher than that at 50 °C (9.0 %). The nitrogen mass balance analysis revealed

that higher temperature enhanced the solubilization of non-dissolved nitrogen and

evaporation of NH4+-N as NH3 gas. Microbial community analysis clarified the change

of dominant bacteria from Bacillus to Geobacillus group, with the rise of composting

temperature. Taken together, thermophilic composting of shrimp aquaculture sludge at

60–70 °C is the most favorable condition for enhancing NH3 recovery.

22
Acknowledgment

This research was supported by Japan Science and Technology Agency (JST)/Japan

International Cooperation Agency (JICA), Science and Technology Research

Partnership for Sustainable Development (SATREPS) through the project for

Continuous Operation System for Microalgae Production Optimized for Sustainable

Tropical Aquaculture (COSMOS), and the SATREPS-COSMOS Matching Fund from

the Ministry of Higher Education Malaysia (MOHE).

Appendix A. Supplementary data

E-supplementary data for this work can be found in e-version of this paper online.

References

Ahn, H.K., Richard, T.L., Choi, H.L., 2007. Mass and thermal balance during
composting of a poultry manure—Wood shavings mixture at different aeration
rates. Process Biochem. 42, 215–223.

Bernal, M.P., Lopez-Real, J.M., Scott, K.M., 1993. Application of natural zeolites for
the reduction of ammonia emissions during the composting of organic wastes in a
laboratory composting simulator. Bioresour. Technol. 43, 35–39.

Bhatia, A., Madan, S., Sahoo, J., Ali, M., Pathania, R., Kazmi, A.A., 2013. Diversity of
bacterial isolates during full scale rotary drum composting. Waste Manag. 33,
1595–1601.

Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F.D., Costello,
E.K., Fierer, N., Peña, A.G., Goodrich, J.K., Gordon, J.I., Huttley, G.A., Kelley,
S.T., Knights, D., Koenig, J.E., Ley, R.E., Lozupone, C.A., McDonald, D.,
Muegge, B.D., Pirrung, M., Reeder, J., Sevinsky, J.R., Turnbaugh, P.J., Walters,
W.A., Widmann, J., Yatsunenko, T., Zaneveld, J., Knight, R., 2010. QIIME allows

23
 analysis of high-throughput community sequencing data. Nat. Methods 7, 335.

Chan, M.T., Selvam, A., Wong, J.W.C., 2016. Reducing nitrogen loss and salinity
during ‘struvite’ food waste composting by zeolite amendment. Bioresour. Technol.
200, 838–844.

Chen, X.-G., Stabnikova, O., Tay, J.-H., Wang, J.-Y., Tay, S.T.-L., 2004. Thermoactive
extracellular proteases of Geobacillus caldoproteolyticus, sp. nov., from sewage
sludge. Extremophiles 8, 489–498.

Funge-Smith, S.J., Briggs, M.R.., 1998. Nutrient budgets in intensive shrimp ponds:
implications for sustainability. Aquaculture 164, 117–133.

Griffiths, M., Harrison, S.T.L., Smit, M., Maharajh, D., 2016. Major commercial
products from micro-and macroalgae, in: Algae Biotechnology. Springer, pp.
269–300.

Hopkins, J.S., Sandifer, P.A., Browdy, C.L., 1994. Sludge management in intensive
pond culture of shrimp: Effect of management regime on water quality, sludge
characteristics, nitrogen extinction, and shrimp production. Aquac. Eng. 13, 11–30.

Ivanov, M. V, Lysenko, A.M., Petrunyaka, V. V, Ivanova, A.E., Nazina, T.N., Poltaraus,

A.B., Tourova, T.P., Belyaev, S.S., Grigoryan, A.A., Novikova, E. V, Osipov,
G.A., 2001. Taxonomic study of aerobic thermophilic bacilli: descriptions of
Geobacillus subterraneus gen. nov., sp. nov. and Geobacillus uzenensis sp. nov.
from petroleum reservoirs and transfer of Bacillus stearothermophilus, Bacillus
thermocatenulatus, Bacillus thermoleovorans, Bacillus kaustophilus, Bacillus
thermodenitrificans to Geobacillus as the new combinations G. stearothermophilus,
G. th. Int. J. Syst. Evol. Microbiol. 51, 433–446.

Jiang, T., Schuchardt, F., Li, G., Guo, R., Zhao, Y., 2011. Effect of C/N ratio , aeration
rate and moisture content on ammonia and greenhouse gas emission during the
composting. J. Environ. Sci. 23, 1754–1760.

Komilis, D.P., Ham, R.K., 2006. Carbon dioxide and ammonia emissions during
composting of mixed paper, yard waste and food waste. Waste Manag. 26, 62–70.

Kuok, F., Mimoto, H., Nakasaki, K., 2012. Effects of turning on the microbial consortia
and the in situ temperature preferences of microorganisms in a laboratory-scale
swine manure composting. Bioresour. Technol. 116, 421–7.

Li, R., Li, L., Huang, R., Sun, Y., Mei, X., Shen, B., Shen, Q., 2014. Variations of
culturable thermophilic microbe numbers and bacterial communities during the
thermophilic phase of composting. World J. Microbiol. Biotechnol. 30,
1737–1746.

Marsh, L., Subler, S., Mishra, S., Marini, M., 2005. Suitability of aquaculture effluent
solids mixed with cardboard as a feedstock for vermicomposting. Bioresour.
Technol. 96, 413–418.

24
Meng, L., Li, W., Zhang, S., Wu, C., Wang, K., 2016. Effects of sucrose amendment on
ammonia assimilation during sewage sludge composting. Bioresour. Technol. 210,
160–6.

Mirzoyan, N., Parnes, S., Singer, A., Tal, Y., Sowers, K., Gross, A., 2008. Quality of
brackish aquaculture sludge and its suitability for anaerobic digestion and methane
production in an upflow anaerobic sludge blanket (UASB) reactor. Aquaculture
279, 35–41.

Mirzoyan, N., Tal, Y., Gross, A., 2010. Anaerobic digestion of sludge from intensive
recirculating aquaculture systems. Aquaculture 306, 1–6.

Nakasaki, K., Hirai, H., 2017. Temperature control strategy to enhance the activity of
yeast inoculated into compost raw material for accelerated composting. Waste
Manag. 65, 29–36.

Nakasaki, K., Ohtaki, A., Takano, H., 2001. Effect of bulking agent on the reduction of
NH3emissions during thermophilic composting of night-soil sludge. Waste Manag.
Res. 19, 301–307.

Nakasaki, K., Tran, L.T.H., Idemoto, Y., Abe, M., Rollon, A.P., 2009. Comparison of
organic matter degradation and microbial community during thermophilic
composting of two different types of anaerobic sludge. Bioresour. Technol. 100,
676–82.

Nakasaki, K., Yaguchi, H., Sasaki, Y., Kubota, H., 1993. Effects of pH Control On
Composting of Garbage. Waste Manag. Res. 11, 117–125.

Nakasaki, K., Yaguchi, H., Sasaki, Y., Kubota, H., 1992. Effects of CN ratio on
thermophilic composting of garbage. J. Ferment. Bioeng. 73, 43–45.

Nigussie, A., Bruun, S., Kuyper, T.W., de Neergaard, A., 2017. Delayed addition of
nitrogen-rich substrates during composting of municipal waste: Effects on nitrogen
loss, greenhouse gas emissions and compost stability. Chemosphere 166, 352–362.

Pagans, E., Barrena, R., Font, X., Sánchez, A., 2006. Ammonia emissions from the
composting of different organic wastes. Dependency on process temperature.
Chemosphere 62, 1534–1542.

Pujalte, M.J., Lucena, T., Ruvira, M.A., Arahal, D.R., Macián, M.C., 2014. The Family
Rhodobacteraceae, in: Rosenberg, E., DeLong, E.F., Lory, S., Stackebrandt, E.,
Thompson, F. (Eds.), The Prokaryotes: Alphaproteobacteria and
Betaproteobacteria. Springer Berlin Heidelberg, Berlin, Heidelberg, pp. 439–512.

Rhee, S.K., Sung, M.H., Kim, J.J., Yoon, J.H., Kim, H., Hong, S.P., Jeon, C.O., Park,
Y.H., Bae, J.W., Baek, D.H., Lee, S.G., Kim, K., 2002. Geobacillus toebii sp. nov.,
a novel thermophilic bacterium isolated from hay compost. Int. J. Syst. Evol.
Microbiol. 52, 2251–2255.

25
Sarkar, S., Banerjee, R., Chanda, S., Das, P., Ganguly, S., Pal, S., 2010. Effectiveness of
inoculation with isolated Geobacillus strains in the thermophilic stage of vegetable
waste composting. Bioresour. Technol. 101, 2892–2895.

Simon, M., Scheuner, C., Meier-Kolthoff, J.P., Brinkhoff, T., Wagner-Döbler, I.,
Ulbrich, M., Klenk, H.-P., Schomburg, D., Petersen, J., Göker, M., 2017.
Phylogenomics of Rhodobacteraceae reveals evolutionary adaptation to marine and
non-marine habitats. ISME J. 11, 1483.

Strom, P.F., 1985. Effect of temperature on bacterial species diversity in thermophilic

solid-waste composting. Appl. Environ. Microbiol. 50, 899–905.

Tran, Q.N.M., Mimoto, H., Nakasaki, K., 2015. Inoculation of lactic acid bacterium
accelerates organic matter degradation during composting. Int. Biodeterior.
Biodegradation 104, 377–383.

Wang, M., Awasthi, M.K., Wang, Q., Chen, H., Ren, X., Zhao, J., Li, R., Zhang, Z.,
2017. Comparison of additives amendment for mitigation of greenhouse gases and
ammonia emission during sewage sludge co-composting based on correlation
analysis. Bioresour. Technol. 243, 520–527.

Wang, X., Pan, S., Zhang, Z., Lin, X., Zhang, Y., Chen, S., 2017. Effects of the feeding
ratio of food waste on fed-batch aerobic composting and its microbial community.
Bioresour. Technol. 224, 397–404.

Wilson, G.B., 1989. Combining raw materials for composting. Biocycle 29, 82–85.

Wongwilaiwalin, S., Rattanachomsri, U., Laothanachareon, T., Eurwilaichitr, L.,

Igarashi, Y., Champreda, V., 2010. Analysis of a thermophilic lignocellulose
degrading microbial consortium and multi-species lignocellulolytic enzyme system.
Enzyme Microb. Technol. 47, 283–290.

Yusoff, F.M., Law, A.T., Soon, J., 2003. Effects of aeration and chemical treatments on
nutrient release from the bottom sediment of tropical marine shrimp ponds. Asian
Fish. Sci. 16, 41–50.

Yusoff, F.M., Matias, H.B., Khalid, Z.A., Phang, S.-M., 2001. Culture of microalgae
using interstitial water extracted from shrimp pond bottom sediments. Aquaculture
201, 263–270.

Zhang, L., Sun, X., 2017. Addition of fish pond sediment and rock phosphate enhances
the composting of green waste. Bioresour. Technol. 233, 116–126.

26
Table 1. Composition of aquaculture sludge used in the present study and the
comparison with that of previous literatures.

Parameter Unit Present study [1] [2] [3]

Moisture content % 74.6 87.0 73.0 -

Volatile solid %-dwt 25.2 26.2 - -

Total C %-dwt 14.9 - 3.9 2.4
Total N %-dwt 1.7 2.0 0.2 0.2
C/N ratio - 8.7 - 20.1 14.9
[1] Hopkins et al. 1994; [2] Hanh et al. 2005; [3] Sonnernholzner & Boyd 2000

27
Fig. 1. The time course of NH3 evolution rate and emission of nitrogen during
thermophilic composting of aquaculture sludge.

Fig. 2. The time course of pH, moisture content and bacterial cell density during
thermophilic composting of aquaculture sludge.

Fig. 3. The time course of CO2 evolution rate and emission of carbon during
thermophilic composting of aquaculture sludge.

Fig. 4. Nitrogen mass balance before and after thermophilic composting of aquaculture
sludge.

Fig. 5. The relationship between composting temperature and each evolution steps of
the individual nitrogen fractions. (a) solubilization efficiency of non-dissolved
nitrogen at different temperature, (b) ammonia (NH3+NH4) conversion efficiency
of dissolved nitrogen at different temperature, and (c) NH3 volatilization efficiency
of ammonia in relation with the evaporated water amount.

Fig. 6. Relative abundance of bacteria during composting of aquaculture sludge at

different temperature conditions. (a) order level, (b) genus level within Bacillaceae.

28