Eur J Oral Sci 2007; 115: 355–362  2007 The Authors.

Printed in Singapore. All rights reserved Journal compilation  2007 Eur J Oral Sci
European Journal of
Oral Sciences

Thiago P. Garlet1, Ulisses Coelho1,

Cytokine expression pattern in Jo¼o S. Silva2, Gustavo P. Garlet3
1
Department of Dentistry, Ponta Grossa State
compression and tension sides University, UEPG, Ponta Grossa, Brazil;
2
Department of Biochemistry and Immunology,
School of Medicine of Ribeir¼o Preto, S¼o
of the periodontal ligament during Paulo University – FMRP/USP, Ribeir¼o Preto,
Brazil; 3Department of Biological Sciences,

orthodontic tooth movement School of Dentistry of Bauru, S¼o Paulo

University – FOB/USP, Bauru, Brazil

in humans
Garlet TP, Coelho U, Silva JS, Garlet GP. Cytokine expression pattern in compression
and tension sides of the periodontal ligament during orthodontic tooth movement in
humans. Eur J Oral Sci 2007; 115: 355–362  2007 The Authors. Journal compilation
 2007 Eur J Oral Sci

Orthodontic tooth movement is achieved by the remodeling of periodontal ligament

(PDL) and alveolar bone in response to mechanical loading and is believed to be
mediated by several host mediators, such as cytokines. By means of real-time poly-
merase chain reaction (PCR), we studied the pattern of expression of mRNA encoding
several pro- and anti-inflammatory cytokines in relation to several extracellular matrix
and bone remodeling markers, in tension (T) and compression (C) sides of the PDL of
human teeth subjected to rapid maxillary expansion. The PDL of normal teeth was
used as a control. The results showed that both T and C sides exhibited significantly
higher expression of all targets when compared with controls, except for type I col- Gustavo P. Garlet, School of Dentistry of Bauru
lagen (COL-I) and tissue inhibitor of metalloproteinase-1 (TIMP-1) on the C side. (FOB/USP), Department of Biological
Comparing C and T sides, the C side exhibited higher expression of tumor necrosis Sciences, Al. Octvio Pinheiro Brisola,
factor-a (TNF-a), receptor activator of nuclear factor-jB ligand (RANKL), and 9-75 – CEP 17012-901, Bauru, SP, Brazil
matrix metalloproteinase-1 (MMP-1), whereas the T side presented higher expression
Telefax: +55–14–32358274
of interleukin-10 (IL-10), TIMP-1, COL-I, osteoprotegerin (OPG), and osteocalcin E-mail: garletgp@usp.br
(OCN). The expression of transforming growth factor-b (TGF-b) was similar in both
C and T sides. Our data demonstrate a differential expression of pro- and anti- Key words: cytokines; matrix metallo-
proteinases; RANKL; tooth movement
inflammatory cytokines in compressed and stretched PDL during orthodontic tooth
movement. Accepted for publication June 2007

Orthodontic tooth movement is achieved by the remo-
deling of periodontal ligament (PDL) and alveolar bone
in response to mechanical loading (1,2). Mechanical
loading patterns are quite complex as a result of the
intricate anatomy and tissue structure, as recently shown
by finite element analysis (3). However, finite element
studies are only able to determine pure mechanical force
and are not capable of predicting the biological tissue
response. In spite of the mechanical loading complexity,
two distinct opposing sides exist, referred to as tension
(T) (where the displacement of the dental root creates a
strain force in the PDL fibers) and compression (C)
(where a compression force is created by the root against
the bone, and the fibers are unloaded) sides, based on the
predominant forces and in the overall tissue response
observed on them (3).
The transduction of mechanical forces to the cells
triggers a biologic response, which has been described as
an aseptic inflammation because it is mediated by a
variety of inflammatory cytokines and does not represent
a pathological condition (4,5). By contrast to chronic
inflammatory responses, in which persistent stimuli sus-
tain a long-lasting inflammatory response and result in
tissue damage, the expression of inflammatory mediators
after orthodontic force application is transitory and ess-
ential for orthodontic movement, as anti-inflammatory
drugs are capable of blocking tooth movement (6). This
tissue response initially involves vascular changes, fol-
lowed by the synthesis of prostaglandins, cytokines, and
growth factors. Finally, such mediators are believed to
activate tissue remodeling, characterized by selective
bone resorption or deposition in C and T regions of the
PDL, respectively (1–3). Bone formation can be driven
by factors such as bone morphogenetic proteins, cyto-
kines, and growth factors, which induce the differentia-
tion of precursor cells into the osteoblast phenotype (7).
Once differentiated, osteoblasts produce proteins such as
type I collagen (COL-I), osteocalcin (OCN) and alkaline
phosphatase, molecules that represent bone formation
(8). On the other hand, bone resorption is triggered by
356 Garlet et al.
the engagement of receptor activator of nuclear factor-
jB (RANK), present on osteoclast precursors, with its
ligand RANKL, expressed particularly on osteoblasts
(8). The interaction between RANK and RANKL trig-
gers the differentiation and activation of osteoclasts, an
event regulated by osteoprotegerin (OPG), a decoy
receptor that inhibits RANK–RANKL interaction (8).
Recent studies point to the participation of the RANK
system in orthodontic tooth movement (9–11).
In addition to alveolar bone, the collagenous extra-
cellular matrix (ECM) is also remodeled in compressed
and stretched sides of the PDL during orthodontic tooth
movement (12). Among host proteases that target the
ECM, matrix metalloproteases (MMPs; a family of zinc-
and calcium-dependent proteases) play a role in both
degradation and remodeling of matrix proteins during
different physiologic and pathological processes (13).
MMP-1 or interstitial collagenase is active against native
triple-helical interstitial collagens and can initiate tissue
remodeling (13). The activation of MMPs is regulated by
a group of endogenous proteins named tissue inhibitors
of metalloproteinases (TIMPs), which are each capable
of inhibiting almost every member of the MMP family
in a non-specific manner (14). MMPs and TIMPs are
involved in the physiological turnover of periodontal
tissues and are thought to play important roles in ortho-
dontic tooth movement (15,16).
Both soft and mineralized connective tissue metabolism
can be modulated by cytokines and growth factors,
pointing to the possible involvement of such factors in
tissue remodeling during orthodontic tooth movement.
Inflammatory cytokines such as tumor necrosis factor-a
(TNF-a) present a predominant catabolic effect, acting as
positive regulators of osteoclastogenesis and MMP
expression (17). The reverse effect is exerted by trans-
forming growth factor-b (TGF-b), which, in addition to
its anti-inflammatory properties, induces osteoblasto-
genesis and ECM synthesis, presenting therefore an
anabolic effect (18). Similarly, interleukin-10 (IL-10) also
presents anti-inflammatory properties, and, as a gen-
eral rule, exerts an inhibitory effect that can modulate
both tissue deposition and degradation (19). Regarding
orthodontic tooth movement, the TNF-a levels are found
to be up-regulated after orthodontic force application
and are thought to play important roles in bone resorp-
tion (20,21). Indeed, animal model studies demonstrate
that the absence of TNF-a signaling results in impaired
tooth movement (22,23), but the mechanisms involved in
their function remain unknown. On the other hand, the
putative role of anti-inflammatory cytokines in ortho-
dontic tooth movement has been explored in less detail.
TGF-b expression was found to be increased during
orthodontic tooth movement at both T and C sides,
where it is believed to influence both soft and bone tissue
remodeling (24,25). Conversely, the anti-inflammatory
cytokine, IL-10, was not detected during orthodontic
tooth movement in rats by in situ hybridization (26).
Recent studies suggest a differential expression of
tissue remodeling mediators in T and C sides of PDL
throughout tooth movement (27,28). However, the
balance between pro- and anti-inflammatory mediators
in T and C sides, and their impact upon PDL and bone
remodeling, remain unknown. In the present study, we
investigated the pattern of TGF-b, IL-10, and TNF-a
expression by means of real-time polymerase chain
reaction (PCR) and correlated them with the profile of
ECM (COL-I, MMP-1, and TIMP-1) and bone (OCN,
RANKL, and OPG) remodeling markers in both T and
C sides of human teeth submitted to orthodontic force.
Material and methods
Sample collection and RNA extraction
The experimental group, from whose C and T samples were
taken, comprised 7 patients (age 17–23 yr; 2 men and
5 women) scheduled for orthodontic treatment at the
Department of Dentistry, Ponta Grossa State University
(UEPG). A total of 14 teeth was obtained. Clinical exami-
nation and orthodontic records of these patients revealed
deficiencies in both transverse and anteroposterior dimen-
sions of the maxillary arch, and the best treatment option
required a rapid maxillary expansion procedure followed by
extraction of the first premolars. The study was carried out
with the informed consent of the patients (or their parents,
in cases of patients younger than 18 yr of age), and was
approved by the Ethics Committee of UEPG. Teeth were
exposed to orthodontic forces (7 N) for 7 d, as the rapid
maxillary expansion procedure were performed with Hyrax
appliances (Dentaurum, Germany), and were extracted just
after the appliance was removed. The control group com-
prised 5 subjects (age 17–20 yr, 2 men and 3 women), pre-
senting good clinical oral health, from whom biopsies of
PDL were taken after tooth extractions previously sched-
uled for orthodontic reasons. A total of 10 teeth was
obtained.
The patients from both control and experimental groups
were healthy with no evidence of known systemic modifiers
of ECM and bone metabolism (type 1 or 2 diabetes mellitus,
osteoporosis, and medications known to influence peri-
odontal tissues). Gingival tissues around the teeth exposed
to orthodontic force were found to be clinically healthy
(based on measurements of plaque index, gingival bleeding,
and probing pocket depth). Exclusion criteria comprised
patients who did not give informed consent; patients with a
significant medical history indicating evidence of known
systemic modifiers of bone metabolism as described above;
pregnant or lactating women; or patients who had taken
systemic antibiotic, anti-inflammatory, hormonal or other
assisted drug therapy in the 6 months prior to the study.
PDL samples were collected from labial (compression)
and palatal (tension) sides, immediately after tooth extrac-
tion. Total RNA from PDL sample biopsies was extracted
using the TRIZOL reagent (Life Technologies, Grand
Island, NY, USA) according to the directions supplied by
the manufacturer and as previously described (29).
Real-time PCR reactions
Real-time PCR reactions were performed as previously des-
cribed (29). Initially, cDNA was synthesized using 3 lg of
RNA through a reverse transcription reaction (Superscript
II; Gibco Life Technologies, Grand Island, NY, USA).
Real-time PCR quantitative mRNA analyses were per-
formed in an ABI Prism 7000 Sequence Detection System
using the SYBR-green fluorescence quantification system
 Cytokines in orthodontic tooth movement 357

(Applied Biosystems, Warrington, UK) for quantification of primers, and 2.5 ng of cDNA were used in each reaction.
amplicons. The standard PCR conditions were as follows: The samples were considered positive to the target gene
95C (10 min); 40 cycles of 94C (1 min), 56C (1 min), and expression when their fluorescence signals were higher than
72C (2 min); followed by the standard denaturation curve. the threshold determined by negative-control fluorescence.
The sequences of human primers were designed using the Calculations for determining the relative level of gene
primerexpress software (Applied Biosystems) using nucleo- expression were made by reference to the housekeeping
tide sequences present in the GenBank database. The primer gene, b-actin, in the sample, using the cycle threshold (Ct)
sequences, the predicted amplicon sizes, and the annealing method. The mean Ct values from triplicate measurements
and melting temperatures are depicted in Table 1. PCR were used to calculate expression of the target gene, with
conditions for each target were conscientiously optimized normalization to an internal control (b-actin), using the
with regard to primer concentration, absence of primer 2–DCt formula. Negative controls without RNA and without
dimer formation, and efficiency of amplification of target reverse transcriptase were also included.
genes and housekeeping gene control. The SYBR Green
PCR Master Mix (Applied Biosystems), 400 nM specific
Statistical analysis
To access possible differences in the intensity of mRNA
Table 1 expression between controls, and T and C samples, analysis
of variance (ANOVA) followed by the Bonferroni multiple
Primers sequences and reaction properties
comparison test was performed. Linear regression analysis
At Mt
was used to test possible correlations between the levels of
Target Sense and antisense sequences (C) (C) bp expression of COL-I, OCN, MMP-1, TIMP-1, RANKL,
and OPG compared with the levels of cytokines TGF-b,
TGF-b TACCTGAACCCGTGTTGCTCT 60 82 111 TNF-a, and IL-10. For all the tests used, values of P < 0.05
ATCGCCAGGAATTGTTGCTG were considered as statistically significant. All statistical
IL-10 AGATC TCCGAGATGC CTTCA 58 85 307 tests were performed with the graphpad prism 4.0 software
CCGTGGAGCAGGTGAAGAAT (GraphPad Software, San Diego, CA, USA).
TNF-a AAGCCTGTAGCCCATGTTGT 56 79 330
CAGATAGATGGGCTCATACC
COL-I AATCACCTGCGTACAGAACGG 61 84 114
CAGATCACGTCATCGCACAAC Results
MMP-1 TGGACCTGGAGGAAATCTTGC 58 79 155
AGAGTCCAAGAGAATGGCCGA Quantitative analysis of cytokine mRNA expression
TIMP-1 ACTGCAGGATGGACTCTTGCA 30 82 206
As cytokines are known to be regulators of both ECM
TTTCAGAGCCTTGGAGGAGCT
OCN CAAAGGTGCAGCCTTTGTGTC 62 79 150 and bone metabolism, we first investigated their expres-
TCACAGTCCGGATTGAGCTCA sion in the C and T sides of human teeth under
RANKL CAGAAGATGGCACTCACTGCA 65 73 203 orthodontic forces (Fig. 1). Our data showed that the
CACCATCGCTTTCTCTGCTCT expression of TGF-b (P < 0.001 control vs. C and
OPG GGAACCCCAGAGCGAAATACA 57 77 225 control vs. T), IL-10 (P < 0.05 control vs. C, P < 0.001
CCTGAAGAATGCCTCCTCACA
control vs. T), and TNF-a (P < 0.001 control vs. C
b-actin ATGTTTGAGACCTTCAACA 56 75 195
CACGTCAGACTTCATGATGG and control vs. T) was significantly higher in the exper-
imental samples (i.e. C and T sides) when compared with
bp, base pairs of amplicon size; At, annealing temperature; Mt, the controls. When comparing C and T sides, we found
melting temperature. an increased expression of IL-10 in the T side
COL-I, type I collagen; IL-10, interleukin-10; MMP-1, matrix
metalloproteinase-1; OCN, osteocalcin; OPG, osteoprotegerin;
(P < 0.001 C vs. T), whereas the expression of TNF-a
RANKL, receptor activator of nuclear factor-jB ligand; was higher in the C side (P < 0.01 C vs. T). Quantitative
TIMP-1, tissue inhibitor of metalloproteinase-1; TGF-b, analysis did not show a significant difference in the
transforming growth factor-b; TNF-a, tumor necrosis factor-a. expression of TGF-b between C and T sides (Fig. 1).

Fig. 1. Quantitative expression of transforming growth factor-b (TGF-b), interleukin-10 (IL-10), and tumor necrosis factor-a (TNF-a)
in compression (C) and tension (T) sides of periodontal ligament (PDL) during orthodontic tooth movement. Samples of com-
pression and tension sides of PDL of teeth under orthodontic forces, and of control teeth, were taken, total RNA was extracted, and
the levels of TGF-b, IL-10, and TNF-a mRNA were measured quantitatively by the real-time polymerase chain reaction (PCR)
SYBR-Green System. The results are presented as the target mRNA level normalized to b-actin, using the cycle threshold (Ct)
method. Each point represents the mean of triplicate measurements of each sample. *Statistical significance compared with the
control group; **statistical significance between compression and tension.
358 Garlet et al.

These results demonstrate that differential patterns of
cytokine mRNA expression were present in the C and T
sides of teeth submitted to orthodontic forces.
Quantitative analysis of bone activity markers mRNA
expression
In order to evaluate the possible role of pro- and anti-
inflammatory cytokines in the distinct behavior of bone
tissue in C and T areas during orthodontic tooth move-
ment, we next evaluated the levels of mRNA expression
of the bone activity markers OCN, RANKL, and OPG
(Fig. 2). The expression of the bone formation marker,
OCN, was found to be increased in both C (P < 0.05 C
vs. control) and T (P < 0.001 T vs. control) sides, when
compared with the controls. The expression of the oste-
oclastogenic factor RANKL was also found to be
increased in both C (P < 0.001 C vs. control) and T
(P < 0.05 T vs. control) sides when compared with the
controls. Similarly, the expression of OPG, the endoge-
nous RANKL inhibitor, was found to be increased in
both C (P < 0.05 C vs. control) and T sides (P < 0.001
T vs. control). When comparisons were performed bet-
ween the two experimental sides, we found that the
expression of RANKL was higher in the C side
(P < 0.001), whereas the expression of OCN (P <
0.001), and OPG (P < 0.001) was higher in T than in
C samples (P < 0.001). These results demonstrate
molecular evidence of the differential patterns of bone
remodeling in the C and T sides of teeth submitted to
orthodontic forces.
Quantitative analysis of ECM remodeling markers
mRNA expression
In order to evaluate the possible role of cytokines in the
different responses of ECM in the C and T sides of
orthodontic tooth movement, we next evaluated the
expression of markers of ECM metabolism: COL-I,
MMP-1, and TIMP-1 (Fig. 3). There were no signifi-
cant differences in the expression of COL-I between
controls and C side samples, whereas the expression of
COL-I in the T side was significantly higher (P < 0.001
T vs. control). In addition, we found that the expres-
sion of MMP-1, an enzyme involved in ECM proteo-
lysis, was higher in both C (P < 0.001 control vs. C)
and T (P < 0.05 control vs. T) sides when compared
with the controls. The expression of TIMP-1, an endo-
genous MMP inhibitor, was found to be similar in
controls and the C side, whereas increased expression
was verified in the T side (P < 0.05 T vs. control and
T vs. C). When comparing C and T sides, we found
that the T side presented a higher expression of COL-1
(P < 0.001) and TIMP-1 (P < 0.05), whereas the
C side presented a significantly higher MMP-1 expres-
sion (P < 0.001). These results demonstrate that
differential patterns of ECM remodeling are present in
the C and T sides of teeth submitted to orthodontic

Fig. 2. Quantitative expression of osteocalcin (OCN), receptor activator of nuclear factor-jB ligand (RANKL), and osteoprotegerin
(OPG) in compression (C) and tension (T) sides of periodontal ligament (PDL) during orthodontic tooth movement. Samples of
compression and tension sides of the PDL of teeth under orthodontic forces, and of control teeth, were taken, total RNA extracted,
and the levels of OCN, RANKL, and OPG mRNA measured quantitatively by the real-time polymerase chain reaction (PCR)
SYBR-Green System. The results are presented as the target mRNA level normalized to b-actin, using the cycle threshold (Ct)
method. Each point represents the mean of triplicate measurements of each sample. *Statistical significance compared with the
control group; **statistical significance between compression and tension.

Fig. 3. Quantitative expression of type I collagen (COL-I), matrix metalloproteinase-1 (MMP-1), and tissue inhibitor of metallo-
proteinase-1 (TIMP-1) in compression (C) and tension (T) sides of periodontal ligament (PDL) during orthodontic tooth movement.
Samples of compression and tension sides of the PDL of teeth under orthodontic forces, and of control teeth, were taken, total RNA
extracted, and the levels of COL-I, MMP-1, and TIMP-1 mRNA measured quantitatively by the real-time polymerase chain reaction
(PCR) SYBR-Green System. The results are presented as the target mRNA level normalized to b-actin, using the cycle threshold (Ct)
method. Each point represents the mean of triplicate measurements of each sample. *Statistical significance compared with the
control group; **statistical significance between compression and tension.
 Cytokines in orthodontic tooth movement 359

Table 2 patterns, two distinct opposing sides can be discerned in

Correlations between the levels of expression of mRNA for the periodontium – a T side and a C side – based on the
extracellular matrix (ECM) and bone metabolism markers and direction and nature of predominant forces and overall
cytokines in periodontal ligament of teeth under orthodontic force tissue response (1,2,4). Tissue remodeling is modulated
by pro- and anti-inflammatory cytokines (17–19) and is
TGF-b IL-10 TNF-a probably under the influence of distinct cytokine subsets.
COL-I P < 0.0001 The pro-inflammatory cytokine, TNF-a, is present in
NS 1.390 ± 0.2808 NS high levels in the gingival crevicular fluid during ortho-
0.4850 dontic tooth movement (20,21) and, in the mouse, is
MMP-1 P ¼ 0.0007 particularly expressed on the C side (23). Our data
NS )1235 ± 0.3232 NS demonstrate an increased expression of TNF-a in both C
0.3594
and T sides when compared with controls. However, the
TIMP-1 P ¼ 0.0121 P ¼ 0.0032
0.5800 ± 0.2149 0.441 ± 0.1357 NS expression of TNF-a was significantly higher in the
0.2189 0.2890 C side, which is characterized by bone resorption activity
OCN P ¼ 0.0011 and higher RANKL levels. Indeed, TNF-a acts as a
NS 0.9980 ± 0.2713 NS positive regulator of RANKL-mediated osteoclastoge-
0.3423 nesis (8,30–32), and the inhibition of TNF-a signal-
RANKL P ¼ 0.0003 P ¼ 0.0009
ing results in fewer tartrate-resistant acid phosphatase
NS )0.5730 ± 0.1391 0.4363 ± 0.1165
0.3950 0.3504 (TRAP)-positive osteoclasts and reduced tooth move-
OPG P ¼ 0.0001 ment in rodents (22,23). In addition to the expression of
NS 0.6986 ± 0.1560 NS genes associated with bone resorption, TNF-a stimulates
0.4355 PDL cells also to produce MMPs (33,34). In accordance
COL-I, type I collagen; IL-10, interleukin-10; MMP-1, matrix
with a previous study (28), our data demonstrate higher
metalloproteinase-1; NS, non-significant; OCN, osteocalcin; MMP-1 mRNA levels in the C than in the T side, sup-
OPG, osteoprotegerin; RANKL, receptor activator of nuclear porting the view that the pro-inflammatory cytokine,
factor-jB ligand; TIMP-1, tissue inhibitor of metalloprotein- TNF-a, contributes to catabolic activity.
ase-1; TGF-b, transforming growth factor-b;TNF-a, tumor In contrast, the putative roles of anti-inflammatory
necrosis factor-a. cytokines in orthodontic tooth movement are poorly
Linear regression analysis was used to test the correlations
understood. Our results show that IL-10 expression is
between the levels of expression of ECM and bone metabolism
markers and the levels of the cytokines TGF-b, IL-10 and TNF- significantly higher in the C side than in the T side. In
a in periodontal ligament of teeth under orthodontic force. agreement herewith is the observation that tensile
Total RNA was extracted, and the individual levels of mRNA strain induces IL-10 synthesis in PDL (35). However,
were quantified by a RealTimePCR SYBR-Green System, as IL-10 mRNA was not detected during orthodontic tooth
described in the Material and methods. Statistically significant movement in rats by in situ hybridization (26). Previous
values of P, slope and r2 are shown in the table. studies have demonstrated an important role for IL-10 in
bone metabolism in vivo, as IL-10-deficient mice exhib-
forces, and suggest the involvement of MMP-1 and ited decreased osteoblast generation and bone formation
TIMP-1 in this process. (36). Conversely, in vitro data show that IL-10 can sup-
press osteoblast differentation in murine bone marrow
cultures by inhibiting TGF-b production (37). However,
Correlation analysis of the expression of cytokines
in view of the high TGF-b expression in both C and T
and bone and ECM remodeling markers
sides, and the absence of negative correlations between
We also investigated possible correlations between the the levels of IL-10 and TGF-b, we believe that such
levels of expression of COL-I, OCN, MMP-1, TIMP-1, inhibition does not take place during tooth movement.
RANKL, and OPG and the levels of cytokines expressed The effect of IL-10 on osteoclasts seems to be clearer,
in the C and T sides (Table 2). Positive correlations were as IL-10 inhibits bone resorption through the simulta-
found between the expression of TGF-b and TIMP-1; neous up-regulation of OPG and down-regulation
between IL-10 and COL-1, TIMP-1, OCN, and OPG; and of RANKL expression (38–40). Concurring, a positive
between TNF-a and RANKL. Negative correlations were correlation was found between the levels of IL-10 and
found between IL-10 and RANKL, IL-10, and MMP-1. OPG, whereas IL-10 and RANKL levels presented a
There was no correlation between the expression of negative correlation. Hence, the increased expression of
TGF-b, IL-10, and TNF-a. The statistically significant IL-10 could be associated with low osteoclast function
values of P, slope, and r2 are depicted in Table 2. and intense osteoblast activity, characteristic of the T
side. In agreement, positive correlations were found
between the levels of IL-10 and OCN, suggesting that
IL-10 plays a role towards bone formation in the T side.
Discussion IL-10 can also influence ECM metabolism in opposing
Orthodontic tooth movement is achieved by the remo- pathways. One possibility is that IL-10, in spite of
deling of PDL, triggered by a force-induced biologic inhibiting local inflammation, does not affect the out-
response that has been described as an aseptic inflam- come of collagen metabolism (38). Another possibility is
mation. In spite of the complexity of mechanical loading that IL-10 blocks the synthesis of COL-I through the
360 Garlet et al.
down-regulation of TGF-b release (41). As previously
discussed, in view of the absence of any correlation
between IL-10 and TGF-b levels, we believe that such
inhibition does not occur in PDL cells during tooth
movement. Conversely, IL-10 can also indirectly influ-
ence turnover through the modulation of MMPs/TIMPs
balance. As IL-10 characteristically up-regulates TIMPs
and inhibits MMP activity, it can contribute towards the
maintenance of tissue integrity and ECM deposition (42).
In agreement with this possibility, positive correlations
were verified between the levels of IL-10, COL-I, and
TIMP-1, reinforcing the possible anabolic role of IL-10.
Another cytokine potentially involved in orthodontic
tooth movement is TGF-b, whose mRNA expression
was found to be augmented in both C and T sides when
compared with controls. In agreement, TGF-b expres-
sion was found to be increased during orthodontic tooth
movement, being observed in osteoblasts in the T zone
and in osteoclasts in the C zone (21,25,43,44), suggesting
a broad role for this cytokine in orthodontic tooth
movement. In fact, TGF-b is a pleiotropic cytokine
that can regulate cell growth, differentiation, and matrix
production (41). As a general rule, TGF-b represents
anabolic functions, increasing the proliferation and che-
motaxis of PDL cells and up-regulating the expression of
COL-I (45–48). TGF-b also presents anabolic properties
on bone tissue, recruiting osteoblast precursors and
inducing their differentiation, and enhancing the pro-
duction of bone matrix proteins (49,50). In addition,
TGF-b down-regulates the transcription of pro-inflam-
matory mediators and several MMPs, whereas it
up-regulates TIMPs (47,48,51,52). In accordance, a
positive correlation between the levels of TGF-b and
TIMP-1 was found. In this way, TGF-b may exert an
anabolic effect in PDL during tooth movement, pro-
moting the synthesis of both soft and mineralized con-
nective tissues on the T side. However, its expression was
also increased on the C side, which is likely to be dom-
inated by resorptive activity. Usually TGF-b is described
to inhibit recruitment of osteoclast precursor cells and
also to suppress osteoclast activity (49,50), but some
studies suggest that TGF-b can also be involved in the
induction of bone resorption (53,54). However, no cor-
relations between the levels of TGF-b and bone remod-
eling markers were found. Indeed, the role of TGF-b in
osteoclastogenesis and bone resorption is complex and
seems to depend on the cellular phenotype, stage of cell
differentiation, and TGF-b concentration (49,50,55).
It is important to consider that the individual effects of
cytokines on bone and ECM metabolism are usually
investigated in highly controlled systems (i.e. in in vitro
or knockout mice). When interpreting in vivo data, the
putative function of cytokines must be estimated in view
of a complex environment, with the presence of many
cell types, cytokines, and hormones that interact and
influence each other (49,56,57). It is also important to
realize that mechanical loading patterns are complex and
the tissue responses observed in the two opposing sides
are perhaps predominantly, but certainly not exclusively,
the result of opposing forces. Indeed, our data demon-
strate a concomitant occurrence of TGF-b, IL-10, and
TNF-a in both T and C sides, but with seemingly distinct
patterns of expression.
Although the results of the present study do not
provide conclusive insight as to the cause-and-effect
relationships between cytokine expression and tissue
response during orthodontic tooth movement, we ten-
tatively propose that the high level of TGF-b expression
found in both C and T sides represents an overall ana-
bolic response (inducing ECM synthesis and bone for-
mation) that can differentially be modulated by TNF-a
and IL-10. The higher TNF-a expression in the C side
possibly drives the predominance of a catabolic activity
through the up-regulation of RANKL and MMPs,
which may perhaps overcome the effects of TGF-b and
IL-10. The higher levels of IL-10, TIMP, and OPG
expression in the T side possibly result in the pre-
dominance of anabolic activities. Further studies are
needed to understand more fully the role of pro- and
anti-inflammatory mediators in tissue remodeling during
orthodontic tooth movement.
Acknowledgements – This study was supported by grants from
PROPESP (scholarship to T.P.G.), Fundação de Amparo à
Pesquisa do Estado de São Paulo (FAPESP; scholarship to
G.P.G.), and Conselho Nacional de Desenvolvimento Cientı́f-
ico e Tecnológico (CNPq; scholarship to J.S.S.).
References
1. Krishnan V, Davidovitch Z. Cellular, molecular, and tissue-
level reactions to orthodontic force. Am J Orthod Dentofacial
Orthop 2006; 129: 1–32.
2. Masella RS, Meister M. Current concepts in the biology of
orthodontic tooth movement. Am J Orthod Dentofacial Orthop
2006; 129: 458–468.
3. Cattaneo PM, Dalstra M, Melsen B. The finite element
method: a tool to study orthodontic tooth movement. J Dent
Res 2005; 84: 428–433.
4. Meikle MC. The tissue, cellular, and molecular regulation of
orthodontic tooth movement: 100 years after Carl Sandstedt.
Eur J Orthod 2006; 28: 221–240.
5. Wang XJ, Han G, Owens P, Siddiqui Y, Li AG. Role of
TGFbeta-mediated inflammation in cutaneous wound healing.
J Invest Dermatol 2006; 126: 112–117.
6. Walker JB, Buring SM. NSAID impairment of orthodontic
tooth movement. Ann Pharmacother 2001; 35: 113–115.
7. Hughes FJ, Turner W, Belibasakis G, Martuscelli G.
Effects of growth factors and cytokines on osteoblast differ-
entiation. Periodontol 2000 2006; 41: 48–72.
8. Katagiri T, Takahashi N. Regulatory mechanisms of
osteoblast and osteoclast differentiation. Oral Dis 2002; 8:
147–159.
9. Shiotani A, Shibasaki Y, Sasaki T. Localization of receptor
activator of NFkappaB ligand, RANKL, in periodontal tissues
during experimental movement of rat molars. J Electron
Microsc (Tokyo) 2001; 50: 365–369.
10. Nishijima Y, Yamaguchi M, Kojima T, Aihara N, Nakajima R,
Kasai K. Levels of RANKL and OPG in gingival crevicular
fluid during orthodontic tooth movement and effect of com-
pression force on releases from periodontal ligament cells in
vitro. Orthod Craniofac Res 2006; 9: 63–70.
11. Kanzaki H, Chiba M, Arai K, Takahashi I, Haruyama N,
Nishimura M, Mitani H. Local RANKL gene transfer to the
periodontal tissue accelerates orthodontic tooth movement.
Gene Ther 2006; 13: 678–685.
12. Nakagawa M, Kukita T, Nakasima A, Kurisu K. Expression
of the type I collagen gene in rat periodontal ligament during

tooth movement as revealed by in situ hybridization. Arch Oral
Biol 1994; 39: 289–294.
13. Birkedal-Hansen H, Moore WG, Bodden MK, Windsor LJ,
Birkedal-Hansen B, Decarlo A, Engler JA. Matrix metal-
loproteinases: a review. Crit Rev Oral Biol Med 1993; 4: 197–
250.
14. Baker AH, Edwards DR, Murphy G. Metalloproteinase
inhibitors: biological actions and therapeutic opportunities.
J Cell Sci 2002; 115: 3719–3727.
15. Bolcato-Bellemin AL, Elkaim R, Abehsera A, Fausser JL,
Haikel Y, Tenenbaum H. Expression of mRNAs encoding for
alpha and beta integrin subunits, MMPs, and TIMPs in stret-
ched human periodontal ligament and gingival fibroblasts.
J Dent Res 2000; 79: 1712–1716.
16. Ingman T, Apajalahti S, Mantyla P, Savolainen P, Sorsa
T. Matrix metalloproteinase-1 and -8 in gingival crevicular fluid
during orthodontic tooth movement: a pilot study during
1 month of follow-up after fixed appliance activation. Eur
J Orthod 2005; 27: 202–207.
17. Kobayashi K, Takahashi N, Jimi E, Udagawa N, Takami M,
Kotake S, Nakagawa N, Kinosaki M, Yamaguchi K, Shima
N, Yasuda H, Morinaga T, Higashio K, Martin TJ, Suda T.
Tumor necrosis factor alpha stimulates osteoclast differentia-
tion by a mechanism independent of the ODF/RANKL–
RANK interaction. J Exp Med 2000; 191: 275–286.
18. Lian JB, Stein GS. The developmental stages of osteoblast
growth and differentiation exhibit selective responses of genes
to growth factors (TGF beta 1) and hormones (vitamin D and
glucocorticoids). J Oral Implantol 1993; 19: 95–105.
19. Conti P, Kempuraj D, Kandere K, Di Gioacchino M,
Barbacane RC, Castellani ML, Felaco M, Boucher W,
Letourneau R, Theoharides TC. IL-10, an inflammatory/
inhibitory cytokine, but not always. Immunol Lett 2003; 86:
123–129.
20. Lowney JJ, Norton LA, Shafer DM, Rossomando EF.
Orthodontic forces increase tumor necrosis factor alpha in the
human gingival sulcus. Am J Orthod Dentofacial Orthop 1995;
108: 519–524.
21. Uematsu S, Mogi M, Deguchi T. Interleukin (IL)-1 beta, IL-6,
tumor necrosis factor-alpha, epidermal growth factor, and beta
2-microglobulin levels are elevated in gingival crevicular fluid
during human orthodontic tooth movement. J Dent Res 1996;
75: 562–567.
22. Jager A, Zhang D, Kawarizadeh A, Tolba R, Braumann B,
Lossdorfer S, Gotz W. Soluble cytokine receptor treatment in
experimental orthodontic tooth movement in the rat. Eur
J Orthod 2005; 27: 1–11.
23. Yoshimatsu M, Shibata Y, Kitaura H, Chang X, Moriishi
T, Hashimoto F, Yoshida N, Yamaguchi A. Experimental
model of tooth movement by orthodontic force in mice and its
application to tumor necrosis factor receptor-deficient mice.
J Bone Miner Metab 2006; 24: 20–27.
24. Uematsu S, Mogi M, Deguchi T. Increase of transforming
growth factor-beta 1 in gingival crevicular fluid during human
orthodontic tooth movement. Arch Oral Biol 1996; 41: 1091–
1095.
25. Nagai M, Yoshida A, Sato N, Wong DT. Messenger RNA
level and protein localization of transforming growth factor-
beta1 in experimental tooth movement in rats. Eur J Oral Sci
1999; 107: 475–481.
26. Alhashimi N, Frithiof L, Brudvik P, Bakhiet M. Ortho-
dontic movement induces high numbers of cells expressing
IFN-gamma at mRNA and protein levels. J Interferon Cytokine
Res 2000; 20: 7–12.
27. Dudic A, Kiliaridis S, Mombelli A, Giannopoulou C.
Composition changes in gingival crevicular fluid during
orthodontic tooth movement: comparisons between tension
and compression sides. Eur J Oral Sci 2006; 114: 416–422.
28. Takahashi I, Onodera K, Nishimura M, Mitnai H, Sasano Y,
Mitani H. Expression of genes for gelatinases and tissue
inhibitors of metalloproteinases in periodontal tissues during
orthodontic tooth movement. J Mol Histol 2006; 37: 333–342.
29. Garlet GP, Martins W Jr, Fonseca BA, Ferreira BR, Silva
JS. Matrix metalloproteinases, their physiological inhibitors
Cytokines in orthodontic tooth movement 361
and osteoclast factors are differentially regulated by the cyto-
kine profile in human periodontal disease. J Clin Periodontol
2004; 31: 671–679.
30. Azuma Y, Kaji K, Katogi R, Takeshita S, Kudo A. Tumor
necrosis factor-alpha induces differentiation of and bone
resorption by osteoclasts. J Biol Chem 2000; 275: 4858–4864.
31. Wei S, Kitaura H, Zhou P, Ross FP, Teitelbaum SL. IL-1
mediates TNF-induced osteoclastogenesis. J Clin Invest 2005;
115: 282–290.
32. Garlet GP, Cardoso CR, Campanelli AP, Ferreira BR,
Avila-Campos MJ, Cunha FQ, Silva JS. The dual role of p55
tumour necrosis factor-alpha receptor in Actinobacillus actino-
mycetemcomitans-induced experimental periodontitis: host
protection and tissue destruction. Clin Exp Immunol 2007; 147:
128–138.
33. Nishikawa M, Yamaguchi Y, Yoshitake K, Saeki Y. Effects
of TNFalpha and prostaglandin E2 on the expression of MMPs
in human periodontal ligament fibroblasts. J Periodont Res
2002; 37: 167–176.
34. Rossa C Jr, Liu M, Patil C, Kirkwood KL. MKK3/6-p38
MAPK negatively regulates murine MMP-13 gene expression
induced by IL-1beta and TNF-a in immortalized periodontal
ligament fibroblasts. Matrix Biol 2005; 24: 478–488.
35. Long P, Hu J, Piesco N, Buckley M, Agarwal S. Low
magnitude of tensile strain inhibits IL-1beta-dependent induc-
tion of pro-inflammatory cytokines and induces synthesis of
IL-10 in human periodontal ligament cells in vitro. J Dent Res
2001; 80: 1416–1420.
36. Dresner-Pollak R, Gelb N, Rachmilewitz D, Karmeli F,
Weinreb M. Interleukin 10-deficient mice develop osteopenia,
decreased bone formation, and mechanical fragility of long
bones. Gastroenterology 2004; 127: 792–801.
37. Van Vlasselaer P, Borremans B, Van Gorp U, Dasch JR,
De Waal-Malefyt R. Interleukin 10 inhibits transforming
growth factor-beta (TGF-b) synthesis required for osteogenic
commitment of mouse bone marrow cells. J Cell Biol 1994; 124:
569–577.
38. Liu D, Yao S, Wise GE. Effect of interleukin-10 on gene
expression of osteoclastogenic regulatory molecules in the rat
dental follicle. Eur J Oral Sci 2006; 114: 42–49.
39. Zhang X, Teng YT. Interleukin-10 inhibits gram-negative-
microbe-specific human receptor activator of NF-kappaB
ligand-positive CD4+-Th1-cell-associated alveolar bone loss in
vivo. Infect Immun 2006; 74: 4927–4931.
40. Kradin RL, Sakamoto H, Jain F, Zhao LH, Hymowitz G,
Preffer F. IL-10 inhibits inflammation but does not affect
fibrosis in the pulmonary response to bleomycin. Exp Mol
Pathol 2004; 76: 205–211.
41. Demols A, Van Laethem JL, Quertinmont E, Degraef C,
Delhaye M, Geerts A, Deviere J. Endogenous interleukin-10
modulates fibrosis and regeneration in experimental chronic
pancreatitis. Am J Physiol Gastrointest Liver Physiol 2002; 282:
G1105–G1112.
42. Finnegan A, Kaplan CD, Cao Y, Eibel H, Glant TT, Zhang J.
Collagen-induced arthritis is exacerbated in IL-10-deficient
mice. Arthritis Res Ther 2003; 5: R18–R24.
43. Kobayashi Y, Hashimoto F, Miyamoto H, Kanaoka K,
Miyazaki-Kawashita Y, Nakashima T, Shibata M, Koba-
yashi K, Kato Y, Sakai H. Force-induced osteoclast apoptosis
in vivo is accompanied by elevation in transforming growth
factor beta and osteoprotegerin expression. J Bone Miner Res
2000; 15: 1924–1934.
44. Roberts AB, Sporn MB. Transforming growth factor beta.
Adv Cancer Res 1988; 51: 107–145.
45. Matsuda N, Lin WL, Kumar NM, Cho MI, Genco RJ.
Mitogenic, chemotactic, and synthetic responses of rat peri-
odontal ligament fibroblastic cells to polypeptide growth fac-
tors in vitro. J Periodontol 1992; 63: 515–525.
46. Ignotz RA, Endo T, Massague J. Regulation of fibronectin
and type I collagen mRNA levels by transforming growth
factor-beta. J Biol Chem 1987; 262: 6443–6446.
47. Chang YC, Yang SF, Lai CC, Liu JY, Hsieh YS. Regulation
of matrix metalloproteinase production by cytokines, phar-
macological agents and periodontal pathogens in human
362 Garlet et al.
periodontal ligament fibroblast cultures. J Periodont Res 2002;
37: 196–203.
48. Kwak HJ, Park MJ, Cho H, Park CM, Moon SI, Lee HC,
Park IC, Kim MS, Rhee CH, Hong SI. Transforming growth
factor-beta1 induces tissue inhibitor of metalloproteinase-1
expression via activation of extracellular signal-regulated kinase
and Sp1 in human fibrosarcoma cells. Mol Cancer Res 2006; 4:
209–220.
49. Janssens K, Ten Dijke P, Janssens S, Van Hul W. Trans-
forming growth factor-beta1 to the bone. Endocr Rev 2005; 26:
743–774.
50. Kanaan RA, Kanaan LA. Transforming growth factor beta1,
bone connection. Med Sci Monit 2006; 12: RA164–169.
51. Wisithphrom K, Windsor LJ. The effects of tumor necrosis
factor-alpha, interleukin-1beta, interleukin-6, and transforming
growth factor-beta1 on pulp fibroblast mediated collagen
degradation. J Endod 2006; 32: 853–861.
52. Li MO, Wan YY, Sanjabi S, Robertson AK, Flavell RA.
Transforming growth factor-beta regulation of immune
responses. Annu Rev Immunol 2006; 24: 99–146.
53. Itonaga I, Sabokbar A, Sun SG, Kudo O, Danks L, Fer-
guson D, Fujikawa Y, Athanasou NA. Transforming growth
factor-beta induces osteoclast formation in the absence of
RANKL. Bone 2004; 34: 57–64.
54. Pilkington MF, Sims SM, Dixon SJ. Transforming growth
factor-beta induces osteoclast ruffling and chemotaxis: poten-
tial role in osteoclast recruitment. J Bone Miner Res 2001; 16:
1237–1247.
55. Oreffo RO, Bonewald L, Kukita A, Garrett IR, Seyedin SM,
Rosen D, Mundy GR. Inhibitory effects of the bone-derived
growth factors osteoinductive factor and transforming growth
factor-beta on isolated osteoclasts. Endocrinology 1990; 126:
3069–3075.
56. Chua CC, Chua BH, Chen Z, Landy C, Hamdy RC. TGF-b1
inhibits multiple caspases induced by TNF-a in murine osteo-
blastic MC3T3–E1 cells. Biochim Biophys Acta 2002; 1593: 1–8.
57. Lovibond AC, Haque SJ, Chambers TJ, Fox SW. TGF-a-
induced SOCS3 expression augments TNF-a-induced osteo-
clast formation. Biochem Biophys Res Commun 2003; 309:
762–767.