Accepted Manuscript

Monitoring of Trichoderma species in agricultural soil in response to application

of biopreparations

M. Oskiera, M. Szczech, A. Stępowska, U. Smolińska, G. Bartoszewski

PII: S1049-9644(17)30139-1
DOI: http://dx.doi.org/10.1016/j.biocontrol.2017.07.005
Reference: YBCON 3614

To appear in: Biological Control

Received Date: 3 April 2017

Revised Date: 1 June 2017
Accepted Date: 10 July 2017

Please cite this article as: Oskiera, M., Szczech, M., Stępowska, A., Smolińska, U., Bartoszewski, G., Monitoring
of Trichoderma species in agricultural soil in response to application of biopreparations, Biological Control (2017),
doi: http://dx.doi.org/10.1016/j.biocontrol.2017.07.005

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
 Monitoring of Trichoderma species in agricultural soil in response to application of

biopreparations

Oskiera M.*1, Szczech M.1, Stępowska A.2, Smolińska U.1, Bartoszewski G.3

*Corresponding author - Michał Oskiera - michal.oskiera@inhort.pl

Magdalena Szczech - magdalena.szczech@inhort.pl

Agnieszka Stępowska - agnieszka.stepowska@inhort.pl

Urszula Smolińska - urszula.smolinska@inhort.pl

Grzegorz Bartoszewski - grzegorz_bartoszewski@sggw.pl

1. Department of Microbiology, Research Institute of Horticulture, 96-100 Skierniewice,

Poland.

2. Department of Agricultural-Engineering, Research Institute of Horticulture, 96-100

Skierniewice, Poland.

3. Department of Plant Genetics Breeding and Biotechnology, Warsaw University of Life

Sciences (SGGW), Nowoursynowska 159, 02-776 Warsaw, Poland.

1
ABSTRACT

Strains of Trichoderma are used in crop plant production as plant growth promoters

and biological control agents. In this study, strains of T. atroviride and T. harzianum,

overgrown on organic material, were applied as biopreparations to the soil in open-field

lettuce cultivation, and their population levels were monitored over time. A newly

developed multiplex-PCR Trichoderma-identification technique was successfully used to

confirm the increased abundance of T. atroviride and T. harzianum in the soil after

biopreparations application, whereas these Trichoderma species were not detected in

untreated soil. The results of multiplex-PCR were confirmed by standard plating and

Trichoderma spp. colony counting of soil samples as well as by molecular identification

of representative strains. Indigenous Trichoderma species were identified in field soil,

however, their abundance was estimated to be relatively low 103 CFU, when compared to

105 CFU g-1 of dry soil, after biopreparations application, and these fungi persisted at this

level even after two years.

Keywords: biocontrol agent, monitoring, multiplex-PCR, PGPF, soil environment

2
INTRODUCTION

Overuse of pesticides in agriculture can have negative impacts on human health and

the environment, and it frequently results in the development of pesticide resistance in

plant pathogens (Aktar et al. 2009; Damalas and Eleftherohorinos, 2011). Thus, limiting

the use of chemical pesticides and implementing novel strategies for pathogen control are

critical for improvement of crop production. One of the most promising strategies to

minimize pesticide use is biological control that utilizes beneficial microorganisms. For

example, Trichoderma fungi are used worldwide as biological control agents (BCA) and

as plant growth-promoting fungi (PGPF). Trichoderma harzianum and Trichoderma

atroviride are frequent components of biocontrol formulations used in plant production

(Błaszczyk et al. 2014). Trichoderma biocontrol strains can effectively reduce

phytopathogens in agricultural soil through a variety of mechanisms, including:

mycoparasitism, secretion of antibiotics, competition for space and/or resources in the

rhizosphere (Harman, 2000, 2006). Selected Trichoderma strains can stimulate plant

growth, increase the root surface area to allow better access to nutrients, and enhance

plant resistance to pathogens (Harman et al. 2004; Djonović et al. 2007). Recently, a

functional genomics analysis showed that different Trichoderma lineages exert their

beneficial effects via distinct biocontrol-related mechanisms, and it was suggested that

application of different strain mixtures could improve biocontrol efficacy (Atanasova et al.

2013).

Many studies have aimed to increase the efficiency and safety of biocontrol fungi

application (reviewed by Błaszczyk et al. 2014). For example, several research groups

3
investigated the effectiveness of Trichoderma application in plant cultivation by studying

fungal application methods, dosages, survival rates, and the effects on plants and other

microbes (Abbasi et al. 1999; Hermosa et al. 2001; Dodd et al. 2004; Savazzini et al.

2008, 2009; Longa et al. 2009). High densities of Trichoderma spp. are typical for

suppressive composts (Nelson et al. 1983) and are associated with suppression of

pathogenic Rhizoctonia spp. (Kuter et al. 1983). Because BCA density is critical in

pathogen suppression, methods to trace and quantify these agents in the soil and in the

rhizosphere have become important subject areas in the crop science literature (Abbasi et

al. 1999; Geistlinger et al. 2015).

Traditional tools for fungal monitoring in soil require a cultivation step, if plating

techniques and colony forming unit counting are used. However, cell culturing can be

omitted or complemented by more accurate and sensitive PCR-based methods (Bowen et

al. 1996; Lübeck and Jensen, 2002). So far, several molecular markers have been

developed for Trichoderma spp. identification and detection in soil (Abbasi et al. 1999;

Hermosa et al. 2001; Dodd et al. 2004; Naeimi et al. 2011). Abbasi et al. (1999)

developed SCAR markers to differentiate T. hamatum strain 382 by analyzing individual

Trichoderma-like colonies grown on semi-selective medium. The developed SCAR

markers could be also used to detect particular BCA/PGPF Trichoderma strains in

complex environments such as field soil or compost (Abbasi et al. 1999). Species- or

even strain-specific PCR-based markers have also been developed based on genetic

variability of different coding or non-coding genomic regions, for example ITS1 and

ITS2, the 42-kDa endochitinase gene (ech42, actually chi18-5), the G protein α subunit

4
gene (tga3) and other regions (Hagn et al. 2007; Savazzini et al. 2008; Meincke et al.

2010; Naeimi et al. 2011; Friedl and Druzhinina, 2012; Skoneczny et al. 2015). Several

markers were used with quantitative Real-Time PCR to measure fungal DNA levels in

soil extracts (Rubio et al. 2005; Cordier et al. 2007; Savazzini et al. 2008, 2009;

López-Mondéjar et al. 2010).

The aim of this study was to detect and quantify active strains of T. atroviride

(TRS25 and TRS43) and T. harzianum sensu stricto (TRS59 and TRS85) which had been

introduced on organic carrier (i.e., ‘biopreparations’) to the soil in open-field plots of

cultivated lettuce. The methods employed included dilution plating (CFU counting),

multiplex-PCR, rep-PCR, and tef1 sequencing. New species-specific primers were

developed and combined in multiplex-PCR to detect Trichoderma strains in soil samples.

Survival of fungal strains applied in biopreparations was analyzed in three independent

field experiments of at least ten weeks’ duration, one of which was multi-seasonal, lasting

two years. The developed multiplex-PCR was demonstrated to be a reliable method to

detect and monitor T. atroviride and T. harzianum sensu stricto in the soil environment,

and could be used as an indicator of successful Trichoderma spp. biocontrol fungi

application to field soil.

MATERIALS AND METHODS

Trichoderma strains

Four Trichoderma strains, TRS25, TRS43, TRS59 and TRS85, were used in field

experiments with lettuce cultivation. Strains TRS25 and TRS85 were isolated from a

growing hall for mushroom production. They were confirmed as not pathogenic for the
5
cultivated mushroom as described by Szczech et al. (2008). Strain TRS43 was isolated

from forest soil and TRS59 from agricultural soil. Molecular classification of these

strains was carried out by DNA barcoding, based on the sequences of ITS1 and ITS2 of

the ribosomal RNA gene cluster and on the sequences of translation elongation factor 1

alpha (tef1), chitinase 18-5 (chi18-5), and RNA polymerase II subunit (rpb2) genes

(Oskiera et al. 2015). According to this classification, strains TRS25 and TRS43 belong

to T. atroviride clade A and strains TRS59 and TRS85 to T. harzianum sensu stricto.

These strains were applied as biopreparations to the soil, and their presence and density in

cultivated fields were monitored in the studies. Twenty taxa of Trichoderma were used

for testing multiplex-PCR (Supplemental Table S1). Detailed molecular identification of

all the strains has been performed and was described earlier by Oskiera et al. (2015).

Trichoderma preparation and field experiment design

Trichoderma strains TRS25, TRS43, TRS59 and TRS85 were prepared for soil

application in the form of a granulated carrier, overgrown with fungal biomass, as

described by Smolińska et al. (2014). Briefly, the carrier, composed of agricultural

organic waste (onion rind, apple and strawberry pomace, rapeseed meal), was granulated

and inoculated with spore suspensions of Trichoderma strains. Each strain was inoculated

separately at a density of 107 spores ml-1, and a dose of 5 ml l-1 of the granulate.

Inoculated granules were kept in plastic bags for 14 days at room temperature to

overgrow the carrier by Trichoderma. The final density of fungal propagules in the

preparations was about 107 CFU g-1. Prior to field application, the preparations were

6
mixed in equal portions (vol: vol). Two mixtures were prepared: mixture v1 consisting of

strains TRS25 and TRS59, and mixture v2 consisting of strains TRS43 and TRS85.

Three independent experiments (experiment I, experiment II and experiment III)

were performed in the years 2012–2014 at the experimental field of the Research Institute

of Horticulture in Skierniewice, Poland. The experiments were conducted at different

locations within the field to avoid cross-contamination of the soil by the various applied

Trichoderma preparations. Experiment I was conducted for two years at the same site,

from June 2012 to July 2014, to examine the Trichoderma population in the soil during

more than one vegetative season. In this experiment, after the lettuce harvest, the soil was

left fallow with only regular weed cutting. The duration of experiments II and III was

limited to the vegetative season for lettuce: May to July 2013 for experiment II and July

to September 2013 for experiment III.

The experiments consisted of four variants: c1 – control soil without amendments; c2

– soil amended with granulated carrier without Trichoderma; v1 – soil amended with v1

preparation; v2 - soil amended with v2 preparation. In experiment I, variant c2 was

omitted. Each variant was prepared in four replications – four plots of 4.5 m2 each. The

experimental scheme was a randomized complete block design.

The cultivation practices employed in the experiments were similar to those used in

commercial lettuce production. The soil (pseudopodzols) was fertilized according to

recommendations based on soil chemical analysis. Trichoderma preparations were

applied to the soil two weeks before lettuce planting, except for experiment I, where they

were added immediately before planting. The granulates were mixed with a 10-cm layer

7
of the soil. The dose of the preparations was 10 t ha-1. Fifty transplants of iceberg lettuce

cv. ‘Elenas’ (Rijk Zwaan BV, The Netherlands) were planted on each plot at a distance of

30 cm. The plants were cultivated for 8 weeks until harvest. Weeds were hand removed.

Plants were regularly watered.

Soil sampling and preparation

For each experiment, the first soil samples were collected before application of the

Trichoderma preparation (bpa). Afterwards, in experiment I, soil sampling was performed

two and nine weeks after lettuce planting (2 wpa, 9 wpa), after lettuce harvest (12 wpa),

at the end of growing season 2012 (October - 15 wpa), and then twice in the season 2013

(May - 45 wpa, October - 69 wpa), and finally two years after Trichoderma application in

July 2014 (106 wpa). In experiments II and III, soil samples were collected two weeks

after lettuce planting (6 wpa), and 1 - 2 weeks after lettuce harvesting (10-12 wpa). One

sample consisted of fifteen sub-samples of the upper soil layer (15 cm deep), collected

randomly from one plot using an agronomic soil tube sampler. The samples were briefly

air-dried, mixed and sieved through 1-mm mesh. For plate colony counting of

Trichoderma spp., the soil was analyzed immediately after sampling. For DNA isolation,

soil samples were stored at -80 °C until extraction. Ten grams of each representative soil

sample were dried at 105 °C to determine soil dry weight for subsequent calculations.

DNA isolation

For DNA isolation from Trichoderma, the fungi were grown in PDB liquid medium

(Sigma-Aldrich, USA) for one week on a shaking incubator (GFL 3031, Germany) at

25 °C with orbital motion speed 80 rpm. The fungal cells were collected and DNA was

8
isolated as described by Oskiera et al. (2015). For DNA isolation from soil, 500 mg of

soil samples were homogenized for 40 s, at a speed of 6 m/s, with a FastPrep-24

instrument (MP Biomedicals, USA) in Lysing MatrixE tubes (MP Biomedicals, USA).

DNA was isolated using a NucleoSpin®Soil kit (Macherey-Nagel, Germany). SL1 lysis

buffer with Enhancer SX was used according to the manufacturer’s instructions. DNA

concentration was measured with a NanoDrop8000 (Thermo Scientific, USA). DNA

concentration in the samples obtained from soil was also measured by using PicoGreen

reagent (Invitrogen, USA) according to the manufacturer’s instructions and a FLUOstar

Omega fluorometer (BMG Labtech, Germany). DNA concentrations were adjusted to 10

ng/µl.

Polymerase Chain Reaction (PCR)

PCR was performed in a Mastercycler EPgradient thermocycler (Eppendorf,

Germany). Standard PCR mixture (20 µl) contained: 1× PCR buffer, 1.5 mM MgCl2, 0.25

mM dNTPs, 0.5 µM of each primer, 1 U of DreamTaq polymerase (Fermentas, Vilnius,

Lithuania), and 20 ng of DNA template. Amplification was carried out with an initial

denaturation at 94 °C for 3 min, followed by 35 cycles each of 30 s denaturation at 94 °C,

annealing for 30 s at a temperature appropriate for the primer combination (Table 1 and

2), extension for 1 min at 72 °C, and a final extension for 10 min at 72 °C. Three methods

of repetitive PCR (rep-PCR), with slightly different cycling protocols (Supplemental

Table S2), were performed for identification of fungi isolated from soil samples.

Fingerprints were performed using the following primers: ERIC1R and ERIC2, a single

primer BOXA1R, and two primers REP1R-I and REP2-I (Louws et al. 1994; Versalovic

9
et al. 1991). The PCR mixture contained: 1× Dream Taq Green buffer, 0.25 mM dNTPs,

0.5 µM each primer, 4 µg bovine serum albumin (BSA), 1 U Taq DNA Polymerase

(Fermentas, Vilnius, Lithuania), and 20 ng of DNA template in a final volume of 20 µl.

The amplified products were separated by electrophoresis in the gel containing ethidium

bromide (0,4 µg/ml), and visualized under UV light.

Primer design and multiplex-PCR development

To design species-specific PCR primers, sequences of ITS1 and ITS2, tef1, rpb2 and

chi18-5, previously described by Oskiera et al. (2015), and SCAR sequences B07, Q01

and X18, described by Skoneczny et al. (2015), were mapped to publicly available

Trichoderma genome sequences (Supplemental Table S3). Our and matched genome

sequences were aligned and regions unique to T. atroviride and T. harzianum were

identified and used to design PCR primers. The sequences were mapped, aligned and

primers designed using CLC Genomics Workbench 7.5 (CLCBio, Denmark). Primers

specific to Trichoderma genus or generally to fungi described in literature (Chen et al.

1999; Kullnig-Gradinger et al. 2002; Bhat, 2007) were also used in this study and are

listed in Table 1. All primers were synthesized at Genomed S.A. (Warsaw, Poland).

Primer sets were tested for their species-specific DNA amplification to select the

best-performing primers, as follows. Firstly, PCR was performed with two annealing

temperatures (50 ºC and 60 ºC) and T. atroviride (IMI206040) and T. harzianum sensu

stricto (TRS59) DNA, and only the primer sets which produced a single amplicon of the

correct size were chosen for further evaluation. Next, optimal annealing temperatures

were defined for each primer pair based on the results of gradient PCR. Finally, the best

10
primer pairs were validated for specificity by PCR using as template DNA of 20

Trichoderma taxa (Supplemental Table S1) and their pooled DNA. Multiplex-PCR was

developed by combining primers specific for T. atroviride or T. harzianum, and control

ITS fungal universal primers, Trichoderma spp. endochitinase 42 kDa (chi18-5) or

beta-tubulin specific primers in one reaction. To validate multiplex-PCR specificity,

indigenous Trichoderma and non-Trichoderma strains, isolated from experimental field

soil, were tested.

Soil sample plating, colony counting and identification of recovered strains

For Trichoderma colony counting 10 g of soil samples were suspended in 100 ml of

0.85% NaCl solution, and shaken (150 rpm) for 20 minutes at room temperature on a

laboratory shaker type 358S (Elpin Plus, Poland). Then, ten-fold serial dilutions (10-2,

10-3 10-4 and 10-5) were made, and the aliquots (100 µl) were spread onto plates with Rose

Bengal agar medium containing streptomycin (Martin, 1950), in three replications. The

plates were incubated in the dark at 25 °C. Colonies showing the characteristics of

Trichoderma were counted after 3 and 6 days of incubation, and colony forming units

(CFU) were calculated for 1 g of dry weight of the soil. Representative fungal colonies

grown on the plates were transferred to fresh medium and were collected for further

molecular identification, which was performed by combining multiplex-PCR (developed

in this study) and rep-PCR. The identification was conducted as follows: in the first step

rep-PCR and multiplex-PCR were used to identify and to group genetically similar strains.

Grouping of the resulting rep-PCR profiles was made by visual inspection, implemented

with UPGMA clustering and computed using VisionWorks LS 6.7.4 software (UVP,

11
Upland, CA, USA). Further, tef1 sequences were obtained for detailed identification of

isolates representative for the soil samples and rep-PCR profiles. DNA/PCR preparations

and bioinformatic analyses were performed as described by Oskiera et al. (2015).

Sequences obtained in this study were deposited in NCBI GenBank

(www.ncbi.nlm.nih.gov/genbank) with accession numbers listed in Supplemental Tables

S5 and S6.

RESULTS

Development and evaluation of species-specific PCR markers

Alignment of ITS1 and ITS2, tef1, rpb2, chi18-5 and SCAR sequences revealed in

silico DNA polymorphisms, which allowed us to develop Trichoderma species-specific

PCR markers. The T. atroviride-specific markers Tatef and Tachi were developed based

on tef1 and chi18-5 gene sequences, respectively. Also, the markers TaB and TaQ, which

were designed based on published SCAR sequences (Skoneczny et al. 2015), allowed the

identification of T. atroviride isolates, whereas the marker TaX was specific to clade A

strains of T. atroviride. SCAR-based markers allowed T. atroviride clade A strains to be

distinguished from other T. atroviride strains (Figure 1, Table 1). Development of markers

specific to T. harzianum sensu stricto was challenging because there are many related

species and lineages in the T. harzianum species complex (Chaverri et al. 2015).

Alignments of ITS1 and ITS2, tef1, chi18-5, and rpb2 sequences of representatives of

these strains were not sufficient to distinguish specific primers for T. harzianum sensu

stricto. However, the ThQ marker specific to T. harzianum sensu stricto was identified

based on the T. atroviride SCAR Q01 sequence. Marker Tschi, specific to T. simmonsii,
12
was designed based on chi18-5 gene sequences. Marker Thstef, specific to T. harzianum

sensu stricto and T. simmonsii, was designed based on analysis of tef1 gene sequences.

The TVD marker, developed by Bhat (2007), was also tested in this study and found to be

specific for T. harzianum sensu stricto and T. atrobrunneum. Marker ThsaQ enabled T.

harzianum sensu stricto, T. simmonsii and T. atrobrunneum (which all belong to the same

clade of the T. harzianum species complex) to be distinguished from other Trichoderma

species (Figure 1, Table 1).

Development of multiplex-PCR

Multiplex-PCR was developed to increase the reliability of detection of T. atroviride

or T. harzianum sensu stricto. Primers unique to T. atroviride and T. harzianum sensu

stricto were combined with primer pairs specific to Trichoderma spp. or generally to the

fungi, in a single PCR. Many combinations of primers were tested in multiplex-PCR, and

the best ones for detection and identification of T. atroviride and T. harzianum are listed

in Table 2.

For identification of T. atroviride in laboratory cultures, four pairs of primers were

combined in a single multiplex-PCR CA1, allowing amplification of the TaX marker

specific to T. atroviride clade A, the TaB marker specific to T. atroviride species, the

chitinase gene fragment (Tachi) specific for Trichoderma spp., and the fungal ITS region.

Multiplex-PCR for T. harzianum identification in laboratory cultures (TH1-4) was

performed by combining control primers specific to the β-tubulin gene (tub) of

Trichoderma spp. and four primer pairs specific for T. harzianum (ThQ, ThsaQ, Thstef,

TVD).

13
 For T. atroviride detection in soil samples a maximum of three pairs of primers were

combined: primer pair TaX or TaQ specific to T. atroviride; chit42_1af/chit42_2ar

(Kullnig-Gradinger et al. 2002) specific to Trichoderma chitinase; and ITS specific to

fungi (multiplex-PCR SA1 and 2). For T. harzianum identification and its detection in

soil samples, only two primer pairs were combined in multiplex-PCR (SH1 and 2).

Primers specific to the β-tubulin gene of Trichoderma spp. were used as a control.

Multiplex-PCR-based Trichoderma detection in soil samples

Trichoderma spp. were not detected with the newly developed multiplex-PCR

technique in field soil, that had been sampled prior to application of the Trichoderma

preparations. However, specific amplification was obtained after the application of

Trichoderma strains TRS25, TRS43, TRS59 and TRS85 (Figure 2). Analysis revealed the

presence of T. atroviride and T. harzianum strains in soil samples after their application.

Monitoring of Trichoderma abundance based on CFU counting

The results of multiplex-PCR analysis were confirmed by dilution plating and colony

counting. The number of Trichoderma spp. that naturally inhabit the soil of the

experimental field reached up to 103-104 CFU g-1 soil (Figure 3). After soil amendment

with both preparation variants (v1 – TRS25+TRS59 and v2 – TRS43+TRS85), the

number of Trichoderma spp. colonies increased to 105-106 CFU g-1 soil. In all

experiments, application of v2 resulted in significantly higher number of Trichoderma

fungi in the soil compared to application of v1 (Figure 3 and Supplemental Table S4). At

the first soil sampling after lettuce planting, the numbers of Trichoderma spp. in the

experiment I were 7.8×105 and 11.9×105 CFU g-1 soil for v1 and v2, respectively. In the

14
experiment II they were 1.0×105 and 1.3×105 CFU g-1 soil, and in the experiment III

0.1×105 and 2.3×105 CFU g-1 soil (Supplemental Table S4). Similar levels of

Trichoderma in the amended soil were detected after lettuce harvest (10 – 12 wpa). In the

experiment I, immediately after post-harvest, the numbers of Trichoderma spp. were

3.4×105 and 3.9×105 CFU g-1 soil for v1 and v2, respectively. In the experiment II they

were 1.7×105 and 2.6×105 CFU g-1 soil, and in the experiment III 0.4×105 and 1.0×105

CFU g-1 soil (Supplemental Table S4). In the course of long-time monitoring, conducted

in the experiment I, decline of Trichoderma spp. abundance was observed after the

winters in 2012 and 2013 (between 15 - 45 wpa and 69 - 106 wpa). However, two years

after fungal application, Trichoderma soil population was still maintained at relatively

high level 8×104 and 9×104 CFU g-1 soil for v1 and v2, respectively (Figure 3).

Molecular identification of indigenous Trichoderma spp. inhabiting field soil

Three hundred fifty six fungal isolates obtained from soil samples, collected before

and after Trichoderma application in the three experiments, were subjected to the newly

developed typing procedures. Among these 267 isolates were identified as Trichoderma

spp. and the remaining 89 as members of other genera. Most of the fungal strains isolated

from soil before Trichoderma-preparation application were recognized as T. atroviride

(79 strains) or T. harzianum sensu stricto (49 strains). The remaining strains were much

less abundant. Tef1 sequence-based identification was performed for 117 representative

Trichoderma strains and 34 non-Trichoderma strains. In this analysis, 13 indigenous

Trichoderma species were identified in soil samples collected from the experimental field

before application of the Trichoderma preparations (Supplemental Table S5). Nearly all

15
strains isolated from soils amended with Trichoderma preparations were identified as T.

atroviride (41) and T. harzianum sensu stricto (32). Only two strains (among 75 studied

isolates) were classified as other Trichoderma species: T. afroharzianum (TRS835) and T.

virens (TRS897). The typing analyses (multiplex-PCR, rep-PCR, tef1) confirmed that

strains applied to the experimental field soil were present in the post-application soil

samples. The non-Trichoderma isolates obtained from the soil were mostly members of

the genera: Fusarium, Alternaria, Arthrinium, Aspergillus, Bionectriaceae, Penicillium,

Scopulariopsis and three strains with identical tef1 sequence were not identified

(Supplemental Table S6).

DISCUSSION

In this study, selected strains of T. atroviride and T. harzianum sensu stricto were

monitored under field conditions after their application to the soil in the form of

preparations based on organic waste materials. Two techniques, dilution plating on agar

media and molecular methods, were used to monitor the introduced fungi during the

period of lettuce cultivation, and in two subsequent vegetative seasons after lettuce

harvest. Species-specific markers for T. atroviride and T. harzianum sensu stricto were

developed and combined in multiplex-PCR together with markers universal for general

fungi and for Trichoderma spp. The method successfully detected these species in the

soil, when their abundance reached above 1×104 CFU g-1 soil. Moreover, the studies

showed that the proposed multiplex-PCR method can quickly reveal successful outcomes

of Trichoderma application in field soil. Indeed, increased abundance of T. atroviride or T.

harzianum could be confirmed with this approach in just one day and at compromised
16
cost. The method, therefore, should allow for efficient monitoring of alterations in the

populations of Trichoderma fungi introduced to soil. Quantification of the

microorganisms newly introduced to the environment is very important to better

understand their role and impact in nature (Jansson and Prosser, 1997). Expression of the

beneficial effects of these microorganisms requires their presence at sufficient density and

their ability to adapt to new conditions. Thus, data concerning the fate of inoculated

organisms are necessary for evaluating the activity and efficacy of biopreparations.

The effectiveness of the presented multiplex-PCR method was confirmed in this

study by dilution plating on fungal selective medium. The persistence of Trichoderma

strains in the soil was maintained at elevated levels of 105 - 106 CFU g-1 soil for at least

10 weeks after fungal application in all three experiments. In the v1 variant of the

experiment III, the granulate was less overgrown with Trichoderma compared to the other

variants, what could explain the lower population abundance detected in the amended soil

(1 - 4 ×104 CFU g-1 soil). In the control plots and before Trichoderma application, strains

of the species T. atroviride and T. harzianum sensu stricto were isolated from the soil as

indigenous fungi, but their abundance was low, and overall Trichoderma spp. population

was estimated at a maximum of 103 - 104 CFU g-1 soil. The limit of detection of the

developed multiplex-PCR method was determined to be above 1×104 CFU g-1 soil.

Efficient isolation of good quality DNA from the soil samples is crucial for successful

application of the method. For some types of soils difficulties with DNA isolation can

limit efficiency of the developed multiplex-PCR. Consequently, we could not detect

indigenous Trichoderma spp. with the new method. Cordier et al. (2007) monitored the

17
population dynamics of T. atroviride strain T1 in soil by using Real-Time PCR and

detected the strain at a concentration as low as 1×103 CFU g-1 soil. Similarly, Savazzini et

al. (2008) used Real-Time PCR to detect and quantify T. atroviride strain SC1 in soil, and

the limit of detection in their study ranged from 8.5×103 to 1.2×104 CFU g-1 soil.

Species-specific primers developed in the present study can be converted and used in

Real-Time PCR for detailed quantification of particular Trichoderma species in soil.

The long-term monitoring in the experiment I indicated good adaptation of the

introduced Trichoderma strains to the field soil environment and climatic conditions.

After two years, the fungi were detected in soil at concentrations of 8×104 and 9×104 CFU

g-1 soil for v1 and v2, respectively. These values were significantly higher than for control

soil (0.48×104 CFU g-1 soil). Applied strains maintained a fairly stable presence and

tolerated the winter temperatures, although a steady, nearly linear decline in population

size was evident beginning 9 weeks and ending 106 weeks after preparation application

(the Trichoderma spp. density decreased from 3.9×105 to 0.8×105 CFU g-1 soil for the v1

mixture and from 4.6×105 to 0.9×105 CFU g-1 soil for v2; Figure 3A). Nonetheless, the

Trichoderma counts were high compared to those for untreated soil. These results

confirmed the findings of Smolińska et al. (2014), who have shown that addition of

organic amendments (T-GRAN) supported the adaptation of Trichoderma spp. to soil

conditions. Longa et al. (2009) monitored T. atroviride SC1 in field soil for more than

two years and observed good adaptation of the applied strain to the environment.

However, after two years the concentration of T. atroviride SC1 in soil was only 103 CFU

g-1.

18
 In the present study, quantification of Trichoderma spp. with colony counting using

the dilution plating method was improved by molecular identification of fungal strains

isolated from soil samples, which combined multiplex-PCR, fingerprinting methods

(rep-PCR), and tef1 sequence analyses. Multiplex-PCR protocols allowed for fast and

inexpensive identification of T. atroviride, T. harzianum sensu stricto, T. simmonsii, and T.

atrobrunneum (Table 1). Rep-PCR was used for grouping strains, to select representatives

for tef1 sequencing, and for detailed identification. Thirteen indigenous Trichoderma spp.

(see Table 4) were identified in the experimental soil samples. The study also showed for

the first time that T. rossicum, T. brevicompactum, T. velutinum and T. cerinum inhabit

agricultural soils in Poland.

An interesting finding of our study is that the diversity of fungal species in the soil

appeared to be greatly reduced after application of the Trichoderma preparations v1 and

v2 (Supplemental Tables S4 and S5). The species recovered from the amended soil

samples were identified mainly as T. atroviride and T. harzianum sensu stricto, i.e., these

were the ones added to the biopreparations. However, Trichoderma fungi tend to

overgrow on artificial media, thus determination of their numbers using plating can be

challenging. At the same time, isolation and quantification of fungi of the other

‘under-represented’ genera could be difficult and their numbers underestimated. The

impact of Trichoderma spp. on the soil microbiota should be investigated further to

evaluate possible side effects. However, long-term monitoring of field-soil fungi after

Trichoderma preparations application showed, that overall fungal species diversity

increased over time, while the abundance of Trichoderma spp. decreased (data not

19
shown).

In conclusion, monitoring of Trichoderma spp. in soil can be performed by several

different approaches, including commonly used cultivation-based and molecular

PCR-based methods. However, both techniques have their own inherent limitations. For

example, the dilution plating technique lacks strain or species specificity. It is not

possible to discriminate between Trichoderma indigenous populations and those

artificially introduced, since Trichoderma spp. are soil-ubiquitous fungi. Moreover,

slow-growing organisms cannot be detected by plating because they are out-competed by

rapidly growing organisms (Feng et al. 2011). Some fungal cells such as chlamydospores

are viable but nonculturable on agar medium (Baek et al. 1998). Also, a single hypha

contains several nuclei, but may not form more than a single colony (Weaver et al. 2005;

Savazzini et al. 2009). Limitations of DNA-based methods are mainly related to

differences in DNA extraction efficiency for varied fungal structures, e.g., between spores

and mycelia (Fredricks et al. 2005). There is also no discrimination between DNA from

alive and dead cells in PCR (Carini et al. 2016), which may lead to an overestimation of

the live populations present in soil (Pujol et al. 2006). Conversely, inhibition of

amplification in PCR may lead to underestimation of populations (Cordier et al. 2007).

The protocols developed in the present study allow for fast detection and monitoring

of T. atroviride and T. harzianum sensu stricto biocontrol strains TRS25, TRS43, TRS59,

and TRS85, after they were introduced into the soil environment. Combining classic

colony counting with molecular identification of representative strains by multiplex-PCR

gives a fast and reliable procedure to identify fungal species composition in field soil.

20
Multiplex-PCR used with DNA obtained directly from soil samples can provide useful

estimates of the quantity of the applied beneficial fungi at detection levels ≥1×104

Trichoderma CFU per gram of dry soil. Progress in molecular biological techniques and

development of Next Generation Sequencing methods are creating important

opportunities for further study of the soil microbiome. With new sequencing methods and

metagenomics approaches, quantification of all fungal species in soil may be possible and

thus provide precise information about microbial species interactions and population

changes (Bálint et al. 2014), especially in the context of biocontrol fungi.

ACKNOWLEDGEMENTS

The authors thank Dominik Skoneczny of the School of Agricultural and Wine Sciences,

Charles Sturt University, Australia for critical reading of the manuscript, and Olga

Gawryś of the Laboratory of Renal and Body Fluid Physiology, M. Mossakowski

Medical Research Centre, Polish Academy of Sciences, Warsaw, Poland for help in

fluorometric DNA measurements. This work was conducted as part of the project “Polish

Trichoderma strains in plant protection and organic waste management” Priority 1.3.1,

subject area “Bio”, co-financed by the European Union through the European Regional

Development Fund within the Innovative Economy Operational Program, 2007-2013,

under project No. [UDA-POIG.01.03.01-00-129/09-00].

REFERENCES

Abbasi, P.A., Miller, S.A., Meulia, T., Hoitink, H.A., Kim, J.M., 1999. Precise detection
and tracing of Trichoderma hamatum 382 in compost-amended potting mixes by using
molecular markers. Applied and Environmental Microbiology 65, 5421-5426.

21
Aktar, M.W., Sengupta, D., Chowdhury, A., 2009. Impact of pesticides use in agriculture:
their benefits and hazards. Interdisciplinary Toxicology 2, 1-12.
Atanasova, L., Le Crom, S., Gruber, S., Coulpier, F., Seidl-Seiboth, V., Kubicek, C.P.,
Druzhinina, I.S., 2013. Comparative transcriptomics reveals different strategies of
Trichoderma mycoparasitism. BMC Genomics 14, 1.
Baek, J.M., Kenerley, C.M., 1998. Detection and enumeration of a genetically modified
fungus in soil environments by quantitative competitive polymerase chain reaction.
FEMS Microbiology Ecology 25, 419-428.
Bálint, M., Schmidt, P.A., Sharma, R., Thines, M., Schmitt, I., 2014. An Illumina
metabarcoding pipeline for fungi. Ecology and Evolution 4, 2642-2653.
Bhat, G., 2007. Cloning and functional characterization of endochitinase gene from
Trichoderma spp. Dissertation, University of Agricultural Sciences, Dharwad.
Błaszczyk, L., Siwulski, M., Sobieralski, K., Lisiecka, J., Jędryczka, M., 2014.
Trichoderma spp.–application and prospects for use in organic farming and industry.
Journal of Plant Protection Research 54, 309-317.
Bowen, J.K., Franicevic, S.C., Crowhurst, R.N., Templeton, M.D., Stewart, A., 1996.
Differentiation of a specific Trichoderma biological control agent by restriction fragment
length polymorphism (RFLP) analysis. New Zealand Journal of Crop and Horticultural
Science 24, 207-217.
Carini, P., Marsden, P.J., Leff, J.W., Morgan, E.E., Strickland, M.S., Fierer, N., 2016.
Relic DNA is abundant in soil and obscures estimates of soil microbial diversity. Nature
Microbiology 2, 16242.
Chaverri, P., Branco-Rocha, F., Jaklitsch, W., Gazis, R., Degenkolb, T., Samuels, G.J.,
2015. Systematics of the Trichoderma harzianum species complex and the
re-identification of commercial biocontrol strains. Mycologia 107, 558-590.
Chen, X., Romaine, C.P., Ospina-Giraldo, M.D., Royse, D.J., 1999. A polymerase chain
reaction-based test for the identification of Trichoderma harzianum biotypes 2 and 4,
responsible for the worldwide green mold epidemic in cultivated Agaricus bisporus.
Applied Microbiology and Biotechnology 52, 246-250.
Cordier, C., Edel-Hermann, V., Martin-Laurent, F., Blal, B., Steinberg, C., Alabouvette,
C., 2007. SCAR-based real time PCR to identify a biocontrol strain (T1) of Trichoderma
atroviride and study its population dynamics in soils. Journal of Microbiological Methods
68, 60-68.
Damalas, C.A., Eleftherohorinos, I.G., 2011. Pesticide Exposure, Safety Issues, and Risk
Assessment Indicators. International Journal of Environmental Research and Public
Health 8, 1402-1419.
Djonović, S., Vittone, G., Mendoza-Herrera, A., Kenerley, C.M., 2007. Enhanced
biocontrol activity of Trichoderma virens transformants constitutively coexpressing β‐1,
3‐and β‐1, 6‐glucanase genes. Molecular Plant Pathology 8, 469-480.
22
Dodd, S.L., Hill, R.A., Steward, A., 2004. Monitoring the survival and spread of the
biocontrol fungus Trichoderma atroviride (C65) on kiwifruit using a molecular marker.
Australasian Plant Pathology 33, 189-196.
Feng, X.M., Holmberg, A.I.J., Sundh, I., Ricard, T., Melin, P., 2011. Specific SCAR
markers and multiplex real-time PCR for quantification of two Trichoderma biocontrol
strains in environmental samples. Biocontrol 56, 903-913.
Fredricks, D.N., Smith, C., Meier, A., 2005. Comparison of six DNA extraction methods
for recovery of fungal DNA as assessed by quantitative PCR. Journal of Clinical
Microbiology 43, 5122-5128.
Friedl, M.A., Druzhinina, I.S., 2012. Taxon-specific metagenomics of Trichoderma
reveals a narrow community of opportunistic species that regulate each other’s
development. Microbiology 158, 69-83.
Geistlinger, J., Zwanzig, J., Heckendorff, S., Schellenberg, I., 2015. SSR Markers for
Trichoderma virens: their evaluation and application to identify and quantify
root-endophytic strains. Diversity 7, 360-384.
Hagn, A., Wallisch, S., Radl, V., Munch, J.C., Schloter, M., 2007. A new cultivation
independent approach to detect and monitor common Trichoderma species in soils.
Journal of Microbiological Methods 69, 86-92.
Harman, G.E., 2000. Myths and dogmas of biocontrol changes in perceptions derived
from research on Trichoderma harzinum T-22. Plant Disease 84, 377-393.
Harman, G.E., Howell, C.R., Viterbo, A., Chet, I., Lorito, M., 2004. Trichoderma
species-opportunistic, avirulent plant symbionts. Nature Reviews Microbiology 2, 43-56.
Harman, G.E., 2006. Overview of Mechanisms and Uses of Trichoderma spp.
Phytopathology 96. 190-194.
Hermosa, M.R., Grondona, I., Díaz-Mínguez, J.M., Iturriaga, E.A., Monte, E., 2001.
Development of a strain-specific SCAR marker for the detection of Trichoderma
atroviride 11, a biological control agent against soilborne fungal plant pathogens. Current
Genetics 38, 343-350.
Jansson, J.K., Prosser, J.I., 1997. Quantification of the presence and activity of specific
microorganisms in nature. Molecular Biotechnology 7, 103-120.
Kullnig-Gradinger, C.M,, Szakacs, G., Kubicek, C.P., 2002. Phylogeny and evolution of
the genus Trichoderma: a multigene approach. Mycological Research 106, 757-767.
Kuter, G.A., Nelson, E.B., Hoitink, H.A.J., Madden, L.V., 1983. Fungal populations in
container media amended with composted hardwood bark suppressive and conducive to
Rhizoctonia damping-off. Phytopathology 73, 1450-1456.
Longa, C.M.O., Savazzini, F., Tosi, S., Elad, Y., Pertot, I., 2009. Evaluating the survival
and environmental fate of the biocontrol agent Trichoderma atroviride SC1 in vineyards
in northern Italy. Journal of Applied Microbiology 106, 1549-1557.
23
López-Mondéjar, R., Antón, A., Raidl, S., Ros, M., Pascual, J.A., 2010. Quantification of
the biocontrol agent Trichoderma harzianum with real-time TaqMan PCR and its
potential extrapolation to the hyphal biomass. Bioresource Technology 101, 2888-2891.
Louws, F.J., Fulbright, D.W., Stephens, C.T., de Bruijn, F.J., 1994. Specific genomic
fingerprints of phytopathogenic Xanthomonas and Pseudomonas pathovars and strains
generated with repetitive sequences and PCR. Applied Environmental Microbiology 60,
2286-2295.
Lübeck, M., Jensen, D.F., 2002. Monitoring Trichoderma strains using dilution plating
and UP-PCR fingerprinting in glasshouses of nursery gardens that apply commercial
biocontrol agents. Biocontrol Science and Technology 12, 371-380.
Martin, J.P., 1950. Use of acid, rose bengal, and streptomycin in the plate method for
estimating soil fungi. Soil Science 69, 215-232.
Meincke, R., Weinert, N., Radl, V., Schloter, M., Smalla, K., Berg, G., 2010.
Development of a molecular approach to describe the composition of Trichoderma
communities. Journal of Microbiological Methods 80, 63-69.
Naeimi, S., Kocsubé, S., Antal, Z., Okhovvat, S., Javan-Nikkhah, M., Vágvölgyi, C.,
Kredics, L., 2011. Strain-specific SCAR markers for the detection of Trichoderma
harzianum AS12-2, a biological control agent against Rhizoctonia solani, the causal agent
of rice sheath blight. Acta Biologica Hungarica 62, 73-84.
Nelson, E.B., Kuter, G.A., Hoitink, H.A.J., 1983. Effects of fungal antagonists and
compost age on suppression of Rhizoctonia damping-off in container media amended
with composted hardwood bark. Phytopathology 73, 1457-1462.
Oskiera, M., Szczech, M., Bartoszewski, G., 2015. Molecular identification of
Trichoderma strains collected to develop plant growth-promoting and biocontrol agents.
Journal of Horticultural Research 23, 75-86.
Pujol, M., Badosa, E., Manceau, C., Montesinos, E., 2006. Assessment of the
environmental fate of the biological control agent of fire blight, Pseudomonas fluorescens
EPS62e, on apple by culture and real-time PCR methods. Applied and Environmental
Microbiology 72, 2421-2427.
Rademaker, J.L., de Bruijn, F.J., 1997. Characterization and classification of microbes by
rep-PCR genomic fingerprinting and computer assisted pattern analysis. DNA Markers:
Protocols, Applications and Overviews 1, 151-171.
Rubio, M.B., Hermosa, M.R., Keck, E., Monte, E., 2005. Specific PCR assays for the
detection and quantification of DNA from the biocontrol strain Trichoderma harzianum
2413 in soil. Microbial Ecology 49, 25-33.
Savazzini, F., Longa, C.M.O., Pertot, I., Gessler, C., 2008. Real-time PCR for detection
and quantification of the biocontrol agent Trichoderma atroviride strain SC1 in soil.
Journal of Microbiological Methods 73, 185-194.
Savazzini, F., Longa, C.M.O., Pertot, I., 2009. Impact of the biocontrol agent
24
Trichoderma atroviride SC1 on soil microbial communities of a vineyard in northern Italy.
Soil Biology Biochemistry 41, 1457-1465.
Skoneczny, D., Oskiera, M., Szczech, M., Bartoszewski, G., 2015. Genetic diversity of
Trichoderma atroviride strains collected in Poland and identification of loci useful in
detection of within-species diversity. Folia Microbiologica 60, 297-307.
Smolińska, U., Kowalska, B., Kowalczyk, W., Szczech, M., 2014. The use of
agro-industrial wastes as carriers of Trichoderma fungi in the parsley cultivation. Scientia
Horticulturae 179, 1-8.
Szczech, M., Staniaszek, M., Habdas, H., Uliński, Z., Szymański, J., 2008. Trichoderma
spp. – the cause of green mold on Polish mushroom farms. Vegetable Crops Research
Bulletin 69, 105-114.
Versalovic, J., Koeuth, T., Lupski, R., 1991. Distribution of repetitive DNA sequences in
eubacteria and application to finerpriting of bacterial genomes. Nucleic Acids Research
19, 6823-6831.
Weaver, M., Vedenyapina, E., Kenerley, C.M., 2005. Fitness, persistence, and
responsiveness of a genetically engineered strain of Trichoderma virens in soil
mesocosms. Applied Soil Ecology 29, 125-134.

25
FIGURE CAPTIONS

Figure 1. Amplification of different marker regions in Trichoderma spp. taxa: (1) T.

harzianum sensu stricto, (2) T. simmonsii, (3) T. atrobrunneum, (4) T. afroharzianum, (5)
T. lentiforme, (6) T. aggressivum, (7) T. pleuroticola, (8) T. cerinum, (9) T. tomentosum,
(10) T. velutinum, (11) T. spirale, (12) T. citrinoviride, (13) T. crassum, (14) T. virens, (15)
T. hamatum, (16) T. spp., (17) T. viridescens, (18) T. gamsii, (19) T. atroviride, (20) T.
atroviride clade A, (21) pooled DNA of samples of 1 to 20. Marker names are given on
the right side. M, DNA size markers.

Figure 2. Multiplex-PCR-based detection of T. atroviride and T. harzianum in soil in

open-field lettuce cultivation in experiment I. Results of multiplex PCR SA1 (upper
panels) and ST1 (lower panels). c- field plots without Trichoderma applications; v1 –
field plots amended with Trichoderma preparation based on TRS25 and TRS59; v2 - field
plots amended with Trichoderma preparation based on TRS43 and TRS85. M – 1kb DNA
marker size, bp – base pairs, bpa – before Trichoderma spp. preparation application, wpa
– weeks after preparation application.

Figure 3. Trichoderma spp. monitoring in the soil in open-field lettuce cultivation based
on colony counting. Y axis - Trichoderma cfu x 104 with standard deviation (bars); X axis
- date and sampling time: bpa – before Trichoderma-preparation application, wpa –
weeks after preparation application. Time plot computed with ggplot2 (R package).

26
Table 1. Description of the markers used in this study.
Marker Targeted Amplicon size Annealing
Marker specificity Primer name Sequence [5`-3`] References
name gene/region [≈bp] temperature [‐]
A_tef1f GACTGTTCCAATACCACC
Tatef tef1 450 55 This study
A_tef1r CGCTTTTCCTCATTGATACT
A2_chi2f GAGTACCCCGCCGATAATA
Tachi chi18-5 320 60 This study
A2_chi1r GAAAGCTCGTCCGTAGATG
B07_1F ACCAACACGCATTGCCTGACT
TaB SCAR B07 730 64 This study
B07_1R TTCCTGTCAACGACGGTCCTC
Q01_3F AAGCAAGGGGGTTGGCAAGTA
T. atroviride 760 60 This study
Q01_3R GAGAAGGGGTTCCCTGCAGAA
TaQ SCAR Q01
Q01_4F GCACACCAACTGCTGGAGCTT
1017 64 Skoneczny et al. 2015
Q01_4R CACGCTGACAATGACCGACAC
X18_1F GACTAGGTGGTCACAGACGAAA
SCAR X18 630 64 This study
X18_3R GGAAACTCCATCACAAATCCA
TaX
X18_4F ATGCTGCCGGGATTAATCTAT
SCAR X18 750 64 This study
X18_3R GGAAACTCCATCACAAATCCA
QTh_8F CATGGAAACACAGACGGA
T. harzianum sensu stricto ThQ SCAR Q01 200 64 This study
QTh_3R AGATAGAGATGGAGAGAAAG
H2_chi_4F32 ATTGATATCGACTGGGAGTA
T. simmonsii Tschi chi18-5 380 60 This study
H2_chi_1r GGTGTTCTGGAATGATCT
T. harzianum sensu stricto, H2_tef_1f AACCGTTCCAATACCACC
Thstef tef1 700 64 This study
T. simmonsii H2_tef_1r TCCCAGCCATCATTCAAC
T. harzianum sensu stricto, QTh_5F GGGTTGTTCGGATGGAAG
ThsaQ SCAR Q01 2000 60 This study
T. simmonsii, T. atrobrunneum QTh_4R GTTGGAGATGGGAGGAAGA
T. harzianum sensu stricto, TVD_If CGTTGGTTCCCATTCAGCGCTTC
TVD chit46 1500 68 Bhat, 2007
T. atrobrunneum TVD_Ir TCCAAGAGCATTTCCCCGCAACA
β-tub-F GTTGGTTCTGCCTTCTGG
Tub β-tub 369 60 Chen et al. 1999
β-tub-R AACAGCTGGCCAAAGGGG
Trichoderma spp.
chit42_1af AGCWAGCACSGATGCCAAC Kullnig-Gradinger et
chit42 chi18-5 800 64
chit42_2ar AGGTTCTGAGTYGWGTCCA al. 2002
ITS2 and 5.8SR TCGATGAAGAACGCAGCG
Fungi ITS 1400 64 Vilgalys lab
LSU LR6 CGCCAGTTCTGCTTACC
27
Table 2. The best primer pair combinations and PCR cycling conditions used in
multiplex-PCR for T. atroviride and T. harzianum sensu stricto identification and
detection.
Annealing
Type of Species Multiplex Amplicon
temperature Primer pairs
application detection PCR name
[‐]
TaX X18_4F/X18_3R
T. atroviride
TaB B07_1F/B07_1R
T. atroviride CA1 64
Chit chit42_1af/chit42_2ar
clade A
ITS 5.8SR/LR6
ThQ QTh_8F/ QTh_3R
CH1 64
Tub Btub_F/Btub_R
Fungal cultures
Thstef H2_tef_1f/ H2_tef_1r
CH2 60
Tub Btub_F/Btub_R
T. harzianum
ThsaQ QTh_8F/ QTh_4R
CH3 60
Tub Btub_F/Btub_R
TVD TVD_If/TVD_Ir
CH4 60
Tub Btub_F/Btub_R
TaX X18_1F/X18_3R
SA1 64 Tachi chit42_1af/chit42_2ar
ITS 5.8SR/LR6
T. atroviride
TaQ Q01_3F/Q01_3R
SA2 64 chit42 chit42_1af/chit42_2ar
Soil samples
ITS 5.8SR/LR6
TVD TVD_If/ TVD_Ir
SH1 60
Tub Btub_F/ Btub_R
T. harzianum
ThQ QTh_5F/ QTh_4R
SH2 60
Tub Btub_F/ Btub_R

28
29
30
31
Highlights

• Application of T. atroviride/T. harzianum as biopreparations in lettuce cultivation.

• Development of molecular markers for T. atroviride and T. harzianum
identification.
• Counting of Trichoderma spp. colonies in soil samples over time.
• Identification of strains collected before and after biopreparations application.
• Monitoring of Trichoderma population levels in soil over time with
multiplex-PCR.

32