Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The genetic composition of an individual is called its _____________.
Select one:
a. phenotype
b. genotype
c. hybrid
d. dominance
e. None of these choices are correct
Feedback
The correct answer is: genotype
Question 2
Correct
Mark 1.00 out of 1.00
Flag question
Question text
A variation of a gene is called a(n) _______.
Select one:
a. species
b. morph
c. genome
d. allele
e. proteome
Feedback
The correct answer is: allele
Question 3
Correct
Mark 1.00 out of 1.00
Flag question
Question text
A karyotype is a(n) __________.
Select one:
a. organelle of eukaryotic cells
b. stage of prophase I in meiosis
c. division of the cytoplasmic material following mitosis
Flag question
Question text
When studying a genetic cross, the second generation following the initial cross is identified by
which of the following?
Select one:
a. P generation
b. F1 generation
c. F2 generation
d. F3 generation
e. P3 generation
Feedback
The correct answer is: F2 generation
Question 5
Correct
Mark 1.00 out of 1.00
Flag question
Question text
During this phase of the cell cycle, the sister chromatids are formed.
Select one:
a. G1 phase
b. G2 phase
c. S phase
d. Prophase
e. Cytokinesis
Feedback
The correct answer is: S phase
Question 6
Correct
Mark 1.00 out of 1.00
Flag question
Question text
When Mendel crossed two plants that were heterozygous for a single trait, what was the
phenotypic ratio of their offspring?
Select one:
a. 1:2:1
b. 9:3:3:1
c. 3:1
d. 7:4
e. Varied depending on the trait
Feedback
The correct answer is: 3:1
Question 7
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Skin cells and nerve cells represent __________ cells, while a sperm cell is an example of a
________ cell.
Select one:
a. somatic ; somatic
b. somatic ; germ
c. germ ; germ
d. germ ; somatic
Feedback
The correct answer is: somatic ; germ
Question 8
Correct
Mark 1.00 out of 1.00
Flag question
Question text
During sexual reproduction, each parent contributes one set of chromosomes. Similar
chromosomes from each parent are called __________.
Select one:
a. karyotypes
b. sister chromatids
c. homologs
d. sex chromosomes
Feedback
The correct answer is: homologs
Question 9
Correct
Mark 1.00 out of 1.00
Flag question
Question text
In humans, patterns of inheritance are often studied using which of the following?
Select one:
a. Dihybrid testcrosses
b. Production of true-breeding lines
c. Pedigree analysis
d. Self-fertilization
e. None of these choices are correct
Feedback
The correct answer is: Pedigree analysis
Question 10
Correct
Mark 1.00 out of 1.00
Flag question
Question text
In a dihybrid cross using Mendelian inheritance, if both parents are heterozygous for both traits,
what will be the phenotypic ratio of their offspring?
Select one:
a. 3:1
b. 1:2:1
c. 1:1
d. 9:3:3:1
Feedback
The correct answer is: 9:3:3:1
Question 11
Correct
Mark 1.00 out of 1.00
Flag question
Question text
A true breeding line of green pod pea plants is crossed with a true-breeding line of yellow pod
plants. All of their offspring have green pods. From this information, it can be stated that the green
color is _____ to the yellow color.
Select one:
a. recessive
b. dominant
c. subservient
d. blended
e. None of these choices are correct
Feedback
The correct answer is: dominant
Question 12
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The basic unit of heredity is the ___________.
Select one:
a. individual
b. gene
c. macromolecule
d. trait
e. None of these choices are correct
Feedback
The correct answer is: gene
Question 13
Correct
Mark 1.00 out of 1.00
Flag question
Question text
During which phase the sister chromatids separate and head towards opposite poles of the cell?
Select one:
a. Metaphase
b. Prometaphase
c. Telophase
d. Anaphase
e. Prophase
Feedback
The correct answer is: Anaphase
Question 14
Correct
Mark 1.00 out of 1.00
Flag question
Question text
During which phase the chromosomes line up in the center of the cell?
Select one:
a. Metaphase
b. Prometaphase
c. Telophase
d. Anaphase
e. Prophase
Feedback
The correct answer is: Metaphase
Question 15
Correct
Mark 1.00 out of 1.00
Flag question
Question text
In a Punnett square diagram, the outside of the box represents the _________.
Select one:
a. diploid offspring
b. haploid offspring
c. diploid gametes
d. haploid gametes
Feedback
The correct answer is: haploid gametes
Question 16
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The end result of meiosis in animals is ______.
Select one:
a. two diploid cells
b. two haploid cells
c. four diploid cells
Flag question
Question text
Which of the following characteristics made the pea plant Pisum sativum an ideal organism for
Mendel's studies?
Select one:
a. It has the ability to self-fertilize
b. It was easy to cross-fertilize one plant with another
c. It has easily identifiable traits
Flag question
Question text
In animals, somatic cells are ________ and germ cells are __________.
Select one:
a. diploid ; diploid
b. diploid ; haploid
c. haploid ; diploid
d. haploid ; haploid
Feedback
The correct answer is: diploid ; haploid
Question 19
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The process of crossing over occurs during which of the following?
Select one:
a. Diakinesis
b. Diplotene
c. Pachytene
d. Zygotene
e. Leptotene
Feedback
The correct answer is: Pachytene
Question 20
Correct
Mark 1.00 out of 1.00
Flag question
Question text
During which phase the chromosomes start to condense?
Select one:
a. Metaphase
b. Prometaphase
c. Telophase
d. Anaphase
e. Prophase
Feedback
The correct answer is: Prophase
Question 1
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Sickle-cell anemia in humans is an example of ________________.
Select one:
a. codominance
b. incomplete penetrance
c. heterozygous advantage
d. multiple allele systems
e. None of these choices are correct
Feedback
The correct answer is: heterozygous advantage
Question 2
Correct
Mark 1.00 out of 1.00
Flag question
Question text
In the gene that affects snail coiling, the ______ is responsible for the phenotype of the offspring.
Select one:
a. mother's phenotype
b. father's phenotype
c. mother's genotype
d. father's genotype
Feedback
The correct answer is: mother's genotype
Question 3
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Dosage compensation offsets the problems associated with differences in the number of _______
chromosomes in many species.
Select one:
a. sex
b. autosome
c. somatic
d. nuclear
Feedback
The correct answer is: sex
Question 4
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Studies of X-linked inheritance and sex chromosomes provided the evidence for which of the
following?
Select one:
Flag question
Question text
Polydactyly in humans is an example of __________.
Select one:
a. simple Mendelian inheritance
b. incomplete dominance
c. incomplete penetrance
d. codominance
e. gene dosage
Feedback
The correct answer is: incomplete penetrance
Question 6
Correct
Mark 1.00 out of 1.00
Flag question
Question text
What is a disease associated with extra nuclear inheritance?
Select one:
a. Angelman Syndrome
b. Prader-Willi Syndrome
c. LHON
d. Muscular Dystrophy
Feedback
The correct answer is: LHON
Question 7
Correct
Mark 1.00 out of 1.00
Flag question
Question text
In human blood groups, the fact that an individual can have an AB blood type is an example of
___________.
Select one:
a. incomplete dominance
b. incomplete penetrance
c. sex-influenced trait
d. temperature-sensitive conditional allele
e. codominance
Feedback
The correct answer is: codominance
Question 8
Correct
Mark 1.00 out of 1.00
Flag question
Question text
In humans, which sex is considered to be the heterogametic sex?
Select one:
a. Male
b. Female
Feedback
The correct answer is: Male
Question 9
Correct
Mark 1.00 out of 1.00
Flag question
Question text
If a gene is located on the X chromosome, but not the Y, it is said to be an example of ________.
Select one:
a. autosomal inheritance
b. sex-linkage
c. reciprocal cross
d. pseudoautosomal inheritance
e. holandric
Feedback
The correct answer is: sex-linkage
Question 10
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
Huntington disease in humans is an example of ____________.
Select one:
a. essential genes
b. lethal alleles
c. semilethal alleles
d. nonessential genes
e. conditional lethal alleles
Feedback
The correct answer is: essential genes
Question 11
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Temperature-sensitive alleles are examples of _________.
Select one:
a. essential genes
b. lethal alleles
c. semilethal alleles
d. nonessential genes
Flag question
Question text
Where is extra nuclear DNA located in mammalian cells?
Select one:
a. Endoplasmic reticulum
b. Mitochondria
c. Ribosome
d. Plasma membrane
Feedback
The correct answer is: Mitochondria
Question 13
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
Red-green colorblindness is a X-linked recessive trait in humans. If a woman who is a carrier for red-
green colorblindness marries a normal male, what percent of their sons will be colorblind?
Select one:
a. 100%
b. 50%
c. 25%
d. 0%
Feedback
The correct answer is: 50%
Question 14
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
Brown spotting of the teeth in humans is caused by a dominant X-linked gene. If a man with normal
teeth marries a woman with brown teeth who had a father with normal teeth, then _______ of
their daughters will have brown teeth.
Select one:
a. 100%
b. 50%
c. 25%
d. 0%
Feedback
The correct answer is: 50%
Question 15
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
How many Barr bodies would an individual with a XXY genotype possess?
Select one:
a. 0
b. 1
c. 2
d. None of these choices are correct
Feedback
The correct answer is: 1
Question 16
Correct
Mark 1.00 out of 1.00
Flag question
Question text
In maternal effect, the _______ of the mother determines the _______ of the offspring.
Select one:
a. chloroplast; mitochondria
b. phenotype; genotype
c. genotype; phenotype
d. phenotype; sex
e. methylation; inheritance
Feedback
The correct answer is: genotype; phenotype
Question 17
Correct
Mark 1.00 out of 1.00
Flag question
Question text
If a geneticist describes a trait as being 70% penetrant, what would they mean?
Select one:
a. The expression of the trait varies by individual
b. It is lethal in 30% of the individuals who have the trait
c. Only 70% of the individuals who carry the trait express the trait
d. The trait is present in 70% of the population
Feedback
The correct answer is: Only 70% of the individuals who carry the trait express the trait
Question 18
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The coat color of calico cats is a result of _____.
Select one:
a. maternal inheritance
b. X-inactivation
c. imprinting
d. extra nuclear inheritance
Feedback
The correct answer is: X-inactivation
Question 19
Correct
Mark 1.00 out of 1.00
Flag question
Question text
If an allele is dominant in one sex and recessive in another, it is an example of ___________.
Select one:
a. sex-limited inheritance
b. sex-influenced inheritance
c. incomplete dominance
d. simple Mendelian inheritance
e. incomplete dominance
Feedback
The correct answer is: sex-influenced inheritance
Question 20
Correct
Mark 1.00 out of 1.00
Flag question
Question text
What is the molecular mechanism for imprinting a gene?
Select one:
a. Acetylation
b. Nitration
c. Phosphorylation
d. Methylation
Feedback
The correct answer is: Methylation
Question 1
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Klinefelter and Turner syndromes are examples of which of the following?
Select one:
Flag question
Question text
Two genes that are located on the same chromosome are said to be _______.
Select one:
a. linked
b. recombinant
c. parental-like
d. nonparental-like
Feedback
The correct answer is: linked
Question 3
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Chromosomes may be identified based on which of the following characteristics?
Select one:
a. Location of the centromere
b. Banding patterns
c. Size of the chromosome
Flag question
Question text
Edwards and Patau syndrome are examples of __________.
Select one:
a. aneuploidy
b. allopolyploidy
c. autopolyploidy
d. translocations
Feedback
The correct answer is: aneuploidy
Question 5
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following types of plants would usually be a seedless variety?
Select one:
a. Aneuploid
b. Diploid
c. Triploid
d. Tetraploid
Feedback
The correct answer is: Triploid
Question 6
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Gene duplications may be caused by which of the following?
Select one:
Flag question
Question text
Which of the following is not an example of euploidy?
Select one:
a. Tetraploid
b. Polyploid
c. Triploid
d. Diploid
e. Aneuploid
Feedback
The correct answer is: Aneuploid
Question 8
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following is not one of the principles of linkage that Morgan obtained from his
experiments?
Select one:
a. Genes that are on the same chromosome may be inherited together
b. Crossing over exchanges pieces of chromosomes and creates new allele combinations
c. The likelihood of crossing over occurring between two genes is dependent on the distance of the
genes from one another
d. Genes that are on the same chromosome are always transmitted together as a unit
Feedback
The correct answer is: Genes that are on the same chromosome are always transmitted together as
a unit
Question 9
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Crossing over is more likely to occur between genes that are ______ on a chromosome.
Select one:
a. close together
b. far apart
Feedback
The correct answer is: far apart
Question 10
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The polytene chromosomes of Drosophila are an example of _________.
Select one:
a. aneuploidy
b. polyploidy
c. translocations
d. inversion loops
e. None of these choices are correct
Feedback
The correct answer is: polyploidy
Question 11
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following would have the shortest p arm of the chromosome?
Select one:
a. Acrocentic
b. Metacentric
c. Telocentric
d. Submetacentric
e. All of the answers would be equal
Feedback
The correct answer is: Telocentric
Question 12
Correct
Mark 1.00 out of 1.00
Flag question
Question text
An inversion heterozygote contains which of the following?
Select one:
a. Two homologous chromosomes with inversions
b. Two normal chromosomes
Flag question
Question text
Familial Down syndrome is a result of which of the following?
Select one:
a. Inversion
b. Deficiency
c. Gene duplication
d. Translocation
Feedback
The correct answer is: Translocation
Question 14
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
Given the following sequence of genes on a chromosome, determine what change in chromosome
structure occurred. (the * indicates the centromere)
before A B C D * E F G H
after A B C D * E F E F G H
Select one:
a. Terminal deficiency
b. Interstitial deficiency
c. Inversion
d. Gene duplication
Feedback
The correct answer is: Gene duplication
Question 15
Correct
Mark 1.00 out of 1.00
Flag question
Question text
A translocation cross may occur in an individual which has which of the following?
Select one:
a. Reciprocal translocation
b. Unbalanced translocation
c. Simple translocations
d. All of these choices are correct
Feedback
The correct answer is: Reciprocal translocation
Question 16
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Human genetic diseases such a Cri-du-chat, Angelman syndrome, and Prader-Willi syndrome are
the result of which of the following?
Select one:
a. Translocations
b. Duplications
c. Deletions
d. Inversions
Feedback
The correct answer is: Deletions
Question 17
Correct
Mark 1.00 out of 1.00
Flag question
Question text
In humans, there are _______ autosomal linkage groups, plus an X and Y chromosome linkage
group.
Select one:
a. 23
b. 46
c. 22
d. 92
Feedback
The correct answer is: 22
Question 18
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following rarely has an effect on the phenotype of the individual who carries it?
Select one:
a. Robertsonian translocation
b. Unbalanced translocation
c. Balanced translocation
d. All of these choices are equally detrimental to the phenotype
Feedback
The correct answer is: Balanced translocation
Question 19
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The failure of chromosomes to separate during anaphase is called __________.
Select one:
a. synapsis
b. maternal effect
c. epistasis
d. nondisjunction
Feedback
The correct answer is: nondisjunction
Question 20
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following defines the principle of linkage?
Select one:
a. Two or more genes that are physically connected on a chromosome
b. Genes that are transmitted to the next generation as a group
c. The process by which genetic information is exchanged between homologous chromosomes
d. All of these choices are correct
e. Both two or more genes that are physically connected on a chromosome and genes that are
Question 1
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following may account for the process of gene conversion?
Select one:
Flag question
Question text
DNA polymerases add new nucleotides in what direction?
Select one:
a. 5' to 3'
b. 3 ' to 5'
c. Both directions
Feedback
The correct answer is: 5' to 3'
Question 3
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
DNA differs from RNA in which of the following ways?
Select one:
a. The structure of the nucleotide
b. The five-carbon sugar it uses
c. The size of the phosphate groups
d. The number of bases attached to the sugar
Flag question
Question text
A nucleosome is a combination of _______ and _______.
Select one:
a. histone proteins, scaffold proteins
b. RNA, transcription proteins
Flag question
Question text
Which of the following would introduce more twists into the DNA molecule of a bacterial cell?
Select one:
a. Negative super coiling
Flag question
Question text
One strand of DNA is 5' - AGGCCTTA - 3'. What is the opposite strand?
Select one:
a. 5' - AGGCCTTA - 3'
b. 5' - TCCGGAAT - 3'
c. 3' - AGGCCTTA - 5'
Flag question
Question text
The proofreading of the DNA occurs in the _________.
Select one:
a. 5' to 3' direction
Flag question
Question text
Which of the following is found at the end of a eukaryotic chromosome?
Select one:
a. Telomeres
b. Centromeres
c. Kinetochores
d. Origins of replication
Feedback
The correct answer is: Telomeres
Question 10
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Chemicals such as quinolones are anti-bacterial. How does it kill bacteria?
Select one:
Flag question
Question text
According to Chargaff's rule, if the DNA of a species contains 20% adenine, what percent of guanine
will it contain?
Select one:
a. 20%
b. 30%
c. 50%
d. 75%
Feedback
The correct answer is: 30%
Question 12
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which direction would you turn Z-DNA to introduce negative super coils?
Select one:
a. Right
b. Left
Feedback
The correct answer is: Right
Question 13
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following correctly depicts the directionality of the DNA molecule?
Select one:
a. Right to left
b. Top to bottom
c. 5' to 3'
d. 3' to 5'
e. All DNA molecules are different in their directionality
Feedback
The correct answer is: 5' to 3'
Question 14
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The formation of a D-loop is associated with which of the following models of recombination?
Select one:
Flag question
Question text
The building blocks of DNA are called _________.
Select one:
a. amino acids
b. codons
c. nucleotides
d. alleles
Feedback
The correct answer is: nucleotides
Question 16
Correct
Mark 1.00 out of 1.00
Flag question
Question text
What term is used to describe highly repetitive DNA?
Select one:
a. Heterochromatin
b. Homochromatin
c. Euchromatin
d. Prochromatin
Feedback
The correct answer is: Heterochromatin
Question 17
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The purpose of DNA replication is to produce ______.
Select one:
Flag question
Question text
DNA polymerases are unable to bind to what areas of the chromosome?
Select one:
a. Centromeres
Flag question
Question text
Which of the following best describes the mechanism of DNA replication in which both a parental
strand and daughter strand are combined following replication?
Select one:
a. Dispersive
b. Semi-conservative
c. Conservative
d. All of the answers are correct
Feedback
The correct answer is: Semi-conservative
Question 1
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Following transcription, the RNA has a complementary sequence of which of the following?
Select one:
a. Regulatory sequences
b. Termination sequences
c. The coding strand of DNA
Flag question
Question text
Proteins that are composed of two or more subunits or polypeptides are said the have quanternary
structure.
Select one:
True
False
Feedback
The correct answer is 'True'.
Question 3
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
Which of the following forms of RNA encodes the sequence of amino acids for a functional protein?
Select one:
a. tRNA
b. snRNA
c. mRNA
d. rRNA
e. scRNA
Feedback
The correct answer is: mRNA
Question 4
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
The closed promoter complex consists of all of the following, except___.
Select one:
a. RNA polymerase
b. Transcription factors
Flag question
Question text
What enables the splicing of group I and II introns?
Select one:
a. Spliceosomes
b. Ribozymes
c. snRNA
d. Poly-A tail
Feedback
The correct answer is: Ribozymes
Question 6
Correct
Mark 1.00 out of 1.00
Flag question
Question text
cDNA contains introns
Select one:
a. True
b. False
c. It varies from cDNA to cDNA
Feedback
The correct answer is: False
Question 7
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
How many polypeptides are coded for by the following mRNA:
5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'
Select one:
a. 7
b. 8
c. 10
d. 13
Feedback
The correct answer is: 8
Question 8
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The peptidyltransferase complex is a component of which of the following?
Select one:
a. DNA
b. tRNA
c. The ribosome
d. The functional protein
e. mRNA
Feedback
The correct answer is: The ribosome
Question 9
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
Alternative splicing allows an organism to ___________.
Select one:
a. Carry fewer genes
Flag question
Question text
In eukaryotic systems, which of the following typically stops the process of translation?
Select one:
a. Rho proteins
b. Aminoacyl tRNA synthase
c. rRNA
d. Stop codons
e. Introns
Feedback
The correct answer is: Stop codons
Question 11
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following is not a stop codon?
Select one:
a. UGA
b. UUA
c. UAG
d. UAA
Feedback
The correct answer is: UUA
Question 12
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following is the site for the start of transcription?
Select one:
a. Promoter
b. Terminator
c. Regulation sequences
d. Transcription factors
e. All of the answers may start transcription
Feedback
The correct answer is: Promoter
Question 13
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following processes is important for the initiation of translation?
Select one:
a. Alternative splicing
b. RNA editing
c. 5' capping
d. 3' polyA tailing
e. Trimming
Feedback
The correct answer is: 5' capping
Question 14
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Cotranslational import occurs where?
Select one:
a. In the Golgi
b. In the nucleus
Flag question
Question text
The primary structure of a protein is directly associated with ______.
Select one:
a. Regular repeating shapes, such as beta-sheets
b. The three-dimensional shape of the protein
Flag question
Question text
A functional protein would contain the information contained within which of the following regions
of DNA?
Select one:
a. Exons
b. Introns
c. Enhancers
d. Promoters
e. All of the answers are correct
Feedback
The correct answer is: Exons
Question 17
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Where are the ribosomal subunits assembled?
Select one:
a. Nucleus
b. Nucleoid
c. Nucleolus
d. Nuclear envelope
Feedback
The correct answer is: Nucleolus
Question 18
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following is not an example of a eukaryotic regulatory element?
Select one:
a. Enhancers
b. Silencers
c. Core promoters
d. Cis-acting elements
Flag question
Question text
A tRNA's anticodon is 5'GGC3'. What amino acid is attached to it?
Select one:
a. Glycine
b. Proline
c. Alanine
d. Arginine
Feedback
The correct answer is: Alanine
Question 20
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The C-terminal of a polypeptide always contains which of the following?
Select one:
a. A stop codon
b. A carboxyl group
c. An amino group
d. Carbon dioxide
e. None of the answers are correct
Feedback
The correct answer is: A carboxyl group
Question 1
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following is not a prion related disease?
Select one:
a. Phenylketonuria
b. Creutzfeldt-Jacob disease
c. Gerstmann-Straussler-Scheinker disease
d. Familial fatal insomnia
e. All of these choices are correct
Feedback
The correct answer is: Phenylketonuria
Question 2
Correct
Mark 1.00 out of 1.00
Flag question
Question text
CpG islands are associated with which of the following?
Select one:
a. Nucleosome location
b. DNA methylation
c. Steroid hormone activity
d. cAMP pathway
Feedback
The correct answer is: DNA methylation
Question 3
Correct
Mark 1.00 out of 1.00
Flag question
Question text
A gene that promotes the development of cancer is called an _______.
Select one:
a. clone
b. ACV
c. mutagen
d. carcinogen
e. oncogene
Feedback
The correct answer is: oncogene
Question 4
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
Translocations and inversions may cause which of the following?
Select one:
a. TRNE
b. Anticipation
c. Position effect
d. Genome mutations
e. All of the answers are correct
Feedback
The correct answer is: Position effect
Question 5
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
Which of the following is not associated with an autosomal dominant pattern of inheritance?
Select one:
Flag question
Question text
In the analysis of a family, you notice that males are more likely to contract a certain disease and
the daughters of affected males produce 50% of their sons affected with the disease. This disease is
displaying which of the following patterns of inheritance?
Select one:
a. X-linked recessive
b. Autosomal recessive
c. Autosomal dominant
d. None of these choices are correct
Feedback
The correct answer is: X-linked recessive
Question 7
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Trisomy-18, in which individuals have three copies of chromosome 18 is an example of a ______
mutation.
Select one:
a. Chromosome
b. Single-gene
c. Genome
d. All of the answers are correct
Feedback
The correct answer is: Genome
Question 8
Incorrect
Mark 0.00 out of 1.00
Remove flag
Question text
In which of the following scenarios would gene expression be the lowest?
Select one:
a. The CpG island upstream of the gene is unmethylated
Flag question
Question text
The majority of human cancers are caused by ______.
Select one:
a. viral infections
b. inherited mutations
c. spontaneous mutations
d. carcinogens
Feedback
The correct answer is: carcinogens
Question 10
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which is not an example of RNA processing regulation?
Select one:
a. RNA concentration
b. RNA editing
c. Alternative splicing
Flag question
Question text
An environmental agent that causes cancer is called a _______.
Select one:
a. carcinogen
b. malignant agent
c. invasive agent
d. metastatic agent
Feedback
The correct answer is: carcinogen
Question 12
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Is responsible for repairing damage from UV radiation.
Select one:
a. Recombinational repair
b. Direct repair
c. Base excision repair
d. Mismatch repair
e. Nucleotide excision repair
f. Nonhomologous end joining (NHEJ)
Feedback
The correct answer is: Nucleotide excision repair
Question 13
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The stability of mRNA is due mostly to which of the following?
Select one:
a. GC content of the message
Flag question
Question text
Translocations and inversions may cause which of the following?
Select one:
a. TRNE
b. Anticipation
c. Position effect
d. Genome mutations
e. All of the answers are correct
Feedback
The correct answer is: Position effect
Question 15
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
Which of the following provides the earliest indication of genetic problems in a fetus?
Select one:
a. Amionocentesis
b. Chorionic villus sampling
Flag question
Question text
Which mechanisms are used by miRNAs to regulate gene expression?
Select one:
Flag question
Question text
Which of the following can convert a proto-oncogene into an oncogene?
Select one:
a. Viral integration near the proto-oncogene
b. Missense mutations
c. Translocations
d. Gene amplification
Flag question
Question text
The wild-type eye color of Drosophila is red. A single-base mutation occurs that produces a white
eye color. Which of the following is correct regarding this mutation?
Select one:
Flag question
Question text
The term that indicates that cancer has begun to migrate to other parts of the body is ______.
Select one:
a. malignant
b. benign
c. metastatic
d. invasive
e. clonal
Feedback
The correct answer is: metastatic
Question 20
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following is an example of a base analog?
Select one:
a. EMS
b. Nitrous acid
c. 5BU
d. Nitrogen mustards
e. Acridine dyes
Feedback
The correct answer is: 5BU
Question 1
Incorrect
Mark 0.00 out of 1.00
Flag question
Question text
Hematopoietic stem cells are _________.
Select one:
a. Pluripotent
b. Totipotent
c. Unipotent
d. None of the answers are correct
Feedback
The correct answer is: Unipotent
Question 2
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following areas of genetics applies mathematical principles to genetic sequences in
order to better understand the genetic information?
Select one:
a. Structural genomics
b. Functional genomics
c. Proteomics
d. Bioinformatics
Feedback
The correct answer is: Bioinformatics
Question 3
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following is used to separate cellular proteins for analysis?
Select one:
a. Western blots
b. Subtractive cDNA libraries
Flag question
Question text
The process of in situ hybridization is used for which of the following?
Select one:
a. Cytogenetic mapping
b. Physical mapping
c. Linkage mapping
d. None of these choices are correct
Feedback
The correct answer is: Cytogenetic mapping
Question 5
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Bone marrow transplants typically use what type of cells?
Select one:
a. Embryonic stem cells
b. Embryonic germ cells
c. Embryonic carcinoma cells
d. Shuttle vector
e. None of the answers are correct
Feedback
The correct answer is: Shuttle vector
Question 7
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Restriction mapping may be used to ______.
Select one:
a. Determine the precise location of a gene on a chromosome
a. Proteomics
b. Functional genomics
c. Structural genomics
d. Genomics
Feedback
The correct answer is: Proteomics
Question 9
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following is needed for a PCR reaction?
Select one:
a. Template DNA
b. Primers
c. DNA polymerase
d. Deoxynucleotide triphosphates
c. Southern blotting
d. Eastern blotting
Feedback
The correct answer is: Southern blotting
Question 11
Correct
Mark 1.00 out of 1.00
Flag question
Question text
_________ make it possible for researchers to study how an entire genome responds to an
environmental stimuli.
Select one:
a. Bioinformatics
b. PCR reactions
c. DNA microarrays
d. Subtractive DNA libraries
Feedback
The correct answer is: DNA microarrays
Question 12
Correct
Mark 1.00 out of 1.00
Flag question
Question text
What is the origin of restriction endonucleases?
Select one:
a. They are part of DNA repair mechanisms in eukaryotic cells
Flag question
Question text
The first hormone to be made by recombinant bacteria was ____.
Select one:
a. Insulin
b. Glucagons
c. Somatostatin
d. Testosterone
e. None of the answers are correct
Feedback
The correct answer is: Insulin
Question 14
Correct
Mark 1.00 out of 1.00
Flag question
Question text
The origins of which of the following cell types creates the least amount of ethical debate?
Select one:
a. EG cells
b. EC cells
c. Hematopoietic stem cells
d. ES cells
e. All of the answers are equal
Feedback
The correct answer is: Hematopoietic stem cells
Question 15
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following can be used as a vector for gene therapy?
Select one:
a. Liposomes
b. Parvoviruses
c. Adenoviruses
d. Retroviruses
e. All of the answers are correct
Feedback
The correct answer is: Retroviruses
Question 16
Correct
Mark 1.00 out of 1.00
Flag question
Question text
A site that has variation within the members of the population is said to be ________.
Select one:
a. monomorphic
b. polymorphic
c. trimorphic
d. None of these choices are correct
Feedback
The correct answer is: polymorphic
Question 17
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following is not an advantage of a transgenic plant?
Select one:
Flag question
Question text
The first human diseases that was successfully treated using gene therapy was ______.
Select one:
a. Diabetes
b. Cystic fibrosis
d. RNA
Feedback
The correct answer is: RNA
Question 20
Correct
Mark 1.00 out of 1.00
Flag question
Question text
Which of the following is used to identify a specific protein in a library?
Select one:
a. Western blotting
b. Northern blotting
c. Southern blotting
d. Eastern blotting
Feedback
The correct answer is: Western blotting