Bioscience, Biotechnology, and Biochemistry

ISSN: 0916-8451 (Print) 1347-6947 (Online) Journal homepage: http://www.tandfonline.com/loi/tbbb20

Applicability of ribosome engineering to vitamin

B12 production by Propionibacterium shermanii

Yukinori Tanaka, Ken Kasahara, Masumi Izawa & Kozo Ochi

To cite this article: Yukinori Tanaka, Ken Kasahara, Masumi Izawa & Kozo Ochi (2017)
Applicability of ribosome engineering to vitamin B12 production by Propionibacterium
shermanii, Bioscience, Biotechnology, and Biochemistry, 81:8, 1636-1641, DOI:
10.1080/09168451.2017.1329619

To link to this article: https://doi.org/10.1080/09168451.2017.1329619

Published online: 22 May 2017.

Submit your article to this journal

Article views: 147

View related articles

View Crossmark data

Citing articles: 2 View citing articles

Full Terms & Conditions of access and use can be found at

http://www.tandfonline.com/action/journalInformation?journalCode=tbbb20
Bioscience, Biotechnology, and Biochemistry, 2017
Vol. 81, No. 8, 1636–1641
Applicability of ribosome engineering to vitamin B12 production by
Propionibacterium shermanii
Yukinori Tanaka1, Ken Kasahara2, Masumi Izawa1 and Kozo Ochi1,*
1
Department of Life Sciences, Hiroshima Institute of Technology, Hiroshima, Japan; 2Chitose Laboratory Corp.,
Biotechnology Research Center, Miyamae-ku, Japan
Received March 24, 2017; accepted May 3, 2017
https://doi.org/10.1080/09168451.2017.1329619
Ribosome engineering has been widely utilized for
strain improvement, especially for the activation of
bacterial secondary metabolism. This study assessed
ribosome engineering technology to modulate
primary metabolism, taking vitamin B12 production
as a representative example. The introduction
into Propionibacterium shermanii of mutations
conferring resistance to rifampicin, gentamicin, and
erythromycin, respectively, increased per cell
production (μg/L/OD600) of vitamin B12 5.2-fold,
although net production (μg/L) was unchanged, as
the cell mass of the mutants was reduced. Real-time
qPCR analysis demonstrated that the genes involved
in vitamin B12 fermentation by P. shermanii were
activated at the transcriptional level in the drug-
resistant mutants, providing a mechanism for the
higher yields of vitamin B12 by the mutants. These
results demonstrate the efficacy of ribosome engi-
neering for the production of not only secondary
metabolites but of industrially important primary
metabolites.
Key words: vitamin B12; ribosome engineering; drug
resistance mutation; Propionibacterium
shermanii
Drug resistance mutation technology, often called “ri-
bosome engineering,” has been widely utilized for
microbial strain improvement, especially in the over-
production of antibiotics and the activation of silent
genes involved in bacterial secondary metabolite pro-
duction.1–3) Ribosome engineering is characterized by
simplicity, consisting of the isolation of spontaneously
developed drug-resistant mutants. To date, however,
few reports have focused on utilization of ribosome
engineering in the production of primary metabolites.1)
The introduction of ribosome engineering into Strep-
tomyces strains isolated from soil samples was found to
activate the dormant abilities of these bacteria to
produce antibiotics.4) Furthermore, the bacterial alar-
mone ppGpp (guanosine 5′-diphosphate 3′-diphos-
phate), produced on ribosomes in response to nutrient
*Corresponding author. Email: k.ochi.bz@it-hiroshima.ac.jp
© 2017 Japan Society for Bioscience, Biotechnology, and Agrochemistry
starvation, was found to bind to RNA polymerase,
eventually initiating the production of antibiotics. These
observations led to the development of a ribosome
engineering technology targeting S12, RNA poly-
merase, and other ribosomal proteins and translation
factors, thus activating or enhancing the production of
secondary metabolites. Ribosome engineering technol-
ogy was found applicable to strain improvement and
silent gene activation, resulting in the identification of
novel secondary metabolites, as well as to the enhance-
ment of enzyme production and tolerance to toxic
chemicals (reviewed by Ochi1)).
The mechanisms underlying the generation of spon-
taneous drug-resistant mutants have been studied exten-
sively in Streptomyces and Bacillus. That is, both the
greater stability of the 70S ribosomes and the elevated
levels of ribosome recycling factor resulting from the
rpsL K88E mutation were responsible for enhanced
protein synthesis during the late growth phase, with the
latter being responsible for antibiotic overproduction
and silent gene activation (reviewed by Ochi1)). In con-
trast, the activation of silent genes by rifampicin resis-
tance (RifR) rpoB mutations in Streptomyces has been
attributed, at least in part, to the increased affinity of
mutant RNA polymerase for silent gene promoters.4) A
recent study showed the broad applicability of the RifR
rpoB mutation method to the expression of cryptic
secondary metabolite–biosynthetic gene clusters.5)
Vitamin B12 consists of compounds of the cobal-
amin group, including the natural forms adenosylcobal-
amin and methylcobalamin and the industrially
produced stable form cyanocobalamin. Because the
chemical synthesis of vitamin B12 is complicated and
expensive, this compound is produced industrially by
fermentation using Propionibacterium and Pseu-
domonas species, with a total production of 10 tons/
year.6–9) Propionibacteria species have the highest
potential to accumulate vitamin B12 intracellularly.
Cobalt (Co) is also important for optimum growth and
vitamin B12 production.10,11) Vitamin B12 biosynthetic
genes have been found in over one-third of the bacte-
rial species sequenced to date. The complete biosynthe-
sis of vitamin B12 requires approximately 30 gene
 Ribosome engineering and primary metabolism
7,8,12)
products. Escherichia coli and Bacillus subtilis
contain none of these genes, whereas Bacillus
stearothermophilus and Bacillus megaterium harbor
some or all of the vitamin B12 biosynthetic genes.13)
To enhance the production of vitamin B12, random
mutagenesis using UV light or mutagenic reagents has
been used to generate mutant strains producing vitamin
B12 in high yields.7,14–16)
Metabolic engineering strategies have been applied
to increase vitamin B12 production. A recombinant
Propionibacterium freudenreichii strain harboring a
plasmid containing hemA from Rhodobacter sphaer-
oides and homologs of hemB and cobA showed a
2.2-fold overproduction of vitamin B12.17) Recombi-
nant E. coli was also shown to produce vitamin B12,
showing the efficacy of synthetic biology approaches to
strain improvement.18) After 10 years of multiple
rounds of random mutagenesis, the vitamin B12 pro-
duction by a single Pseudomonas denitrificans strain
was increased approximately 100-fold.7) This study
assessed the applicability of ribosome engineering tech-
nology to improve primary metabolism, using vitamin
B12 production as a representative example because of
its industrial importance.
Materials and methods
Bacterial strains and culture conditions. The wild-
type strain Propionibacterium shermanii subsp. sher-
manii ATCC 13673 was used for vitamin B12 produc-
tion. P. shermanii was grown in inoculation medium,16)
and 20% (v/v) volume was inoculated into fermentation
medium, consisting of (per liter): 44-g glucose, 133-g
soytone, 1-g KH2PO2, 4-g (NH4)2HPO4, 6-mg FeS-
O4·7H2O, 40-mg CoCl2·6H2O, and 70-mg 5, 6-
dimethylbenzimidazole (adjusted to pH 7.0), followed
by incubation for 2 days at 30 °C under anaerobic con-
ditions in 6-well plates (Falcon Co.) in anaeropacks16)
with gentle shaking (100 rpm). Vitamin B12 produced
intracellularly or extracellularly was measured as
described below.
Determination of MICs. To determine MICs of
various drugs, 10 μL of full-grown cultures of P. sher-
manii were spotted onto inoculation plates, containing
various concentrations of drug. Plates containing P.
shermanii were incubated at 30 °C for 6 days. The
minimum drug concentration able to fully inhibit
growth was defined as the MIC.
Mutagenesis and screening procedure. The dispar-
ity mutagenesis cocktail (Chitose Laboratory Corp.),
which generates point mutations at higher efficiencies
on dispersive chromosome areas than general muta-
gens,19,20) was used to introduce mutations into P. sher-
manii. The disparity mutagenesis method allows
accumulation of the replication errors during the over-
night growth in liquid culture. Strains were cultivated
to full growth in 5 mL of culture medium containing
the mutagen cocktail. P. shermanii mutants resistant to
rifampicin, gentamicin or erythromycin were selected
by incubation at 30 °C for 10–14 days in inoculation
1637
medium containing each drug. Mutations in the rpoB
gene were determined by DNA sequencing using the
primers listed in Table 1.
Measurement of vitamin B12. Cells were disrupted
at 121 °C for 15 min in 0.2 M sodium acetate buffer
(pH 5.0) containing 0.1% KCN. The mixture was cen-
trifuged at 15,000 g for 5 min and the supernatant was
analyzed directly by ultra-performance liquid chro-
matography (UPLC). The analytical conditions were:
device, Waters Acquity UPLC H-class; column, Waters
Acquity UPLC ethylene-bridged hybrid amide (10 cm,
inner diameter 2.1 mm; particle size, 1.7 μm); column
temperature, 30 °C; gradient elution, solvent A (ace-
tonitrile : 10 mM ammonium acetate (pH 9.0) = 1:1),
solvent B (acetonitrile: 10 mM ammonium acetate (pH
9.0) = 9:1); gradient profile, 0–5.0 min, 0.1%–70% A,
99.9%–30% B; 5.0–5.1 min, 70%–0.1% A, 30%–
99.9% B; 5.1–12.0 min, 0.1% A, 99.9%B; flow rate,
0.5 mL/min; detection, ultraviolet monitor set at
367 nm.
Transcriptional analysis by real-time qPCR. Total
RNAs were extracted and purified from cells grown for
the indicated times using Isogen reagent (Nippon Gene)
according to the manufacturer’s protocol. Real-time
qPCR was performed as described.22) Following the
removal of contaminating DNA by incubation of 2-μg
total RNA with 2 U of DNase I (Invitrogen) for 15 min
at 25 °C, RNAs were reverse transcribed using a High-
Capacity RNA-to-cDNA Kit (ABI) according to the
manufacturer’s instructions. After terminating the reac-
tion by incubation for 5 min at 95 °C, samples were
analyzed using a CFX96TM Real-Time System (Bio-
Rad) and Thunder Bird Syber qPCR Mix (Toyobo).
Each transcription assay was normalized relative to the
corresponding transcriptional level of 16S rRNA gene.
Primers used for real-time qPCR are listed in Table 1.
Statistic treatment of data. The data from experi-
ments of transcriptional analysis were treated statisti-
cally, showing with p-values (n = 3). p-values lower
than 0.05 and 0.01 are shown by symbols * and **,
respectively, on each figure. p-values higher than 0.05
are without symbols.
Results
Improvement of vitamin B12 production by
sequential mutagenesis
To assess applicability of ribosome engineering to
primary metabolism, we attempted to improve the vita-
min B12 production by P. shermanii. Cells of P. sher-
manii wild-type strain 13673 were treated with the
mutagen cocktail, spread onto plates of inoculation
medium containing 10 μg/mL rifampicin, and incubated
at 30 °C. Fifteen mutants on the plates were assayed
for vitamin B12 production as a function of biomass
(μg/L/OD600). The strain with the highest yield, KO-
1260 (RifR) (Table 2), was subjected to a second-round
mutagen cocktail treatment, followed by incubation on
inoculation medium containing 300 μg/mL gentamicin.
1638 Y. Tanaka et al.
Table 1. Primers used in this study.

Application and purpose Primer name Oligonucleotide sequence (5′ → 3′) Gene producta
PCR and sequencing of 16S rRNA B12–16s-seqF GGGGAGAACACGGAGGAAC
of P. shermanii B12-16s-seqR CTCCTTGTTCGCTTGTCCTTC

PCR and sequencing of cbiF of cbiF-seq-F GTGAGCCAGTCGATCACCAT Precorrin-4

C11-methyltransferase
P. shermanii cbiF-seq-R GTTGATGGCCTTGGAACTGT

PCR and sequencing of cbiEGH of cbiJEGH-seq-F GAGTTGATCGTCGAGAAGCAC Precorrin methylase

P. shermanii cbiJEGH-seq-R CTCTTGAGGATGAGCTCCCAGT
PCR and sequencing of cbiL of cbiL-seq-F CTGCTGATGTCATCCTGGTG Precorrin-2
C20-methyltransferase
P. shermanii cbiL-seq-R CCTTGTAGATGGTCACCGAATC
PCR and sequencing of cobA of cobA-seq-F GAGATCAACCAACTGCTCGTC Uroporphyrinogen III
methyltransferase
P. shermanii cobA-seq-R GCTCGCATTGCTCACCAC
PCR and sequencing of cobS of cobS-seq-F ATCATGCGCCAATCAGACAT Cobalamin 5-phosphate
synthase
P. shermanii cobS-seq-R ACAATGCCAGGGTCAACAAATAG
PCR and sequencing of cobU of cobU-seq-F GTTCGACCACGTCGACTACAT Adenosylcobinamide kinase /
adenosylcobinamide-
phosphate guanylyltransferase
P. shermanii cobU-seq-R ACGCACAGCAGTACCTCGTC
PCR and sequencing of hemB of hemB-seq-F GATGTCTGCCTCGACGAGTT δ-Aminolevulinic acid
dehydratase
P. shermanii hemB-seq-R AGTACTCCCCCGAGACCACATAG
Real-time PCR of cbiF of B12-cbiL-RTF GCGTGTACTCCACCTTCAGC
P. shermanii B12-cbiL-RTR CACCTCGAAGGCGATGTC
Real-time PCR of cbiEGH of B12-cbiJEGH-RTF TGGTGCGTCATGCCAACCT
P. shermanii B12-cbiJEGF-RTR CGCACCTGACGCACATAG
Real-time PCR of cbiL of B12-cbiF-RTF CACCATGCGCGAACAC
P. shermanii B12-cbiF-RTR GACCCACGAGCACGAT
Real-time PCR of cobA of B12-cobA-RTF TCACGCTGGTGATCCTGAT
P. shermanii B12-cobA-RTR AATTCCGGCGCGATGTC
Real-time PCR of cobS of B12-cobS-RTF GGTTCAGGACACCTTGATGG
P. shermanii B12-cobS-RTR AGGATTCCCAGCCAGTCAC
Real-time PCR of cobU of B12-cobU-RTF CACCAACGAGGTCGGTTC
P. shermanii B12-cobU-RTR ATTGTCACCAGCAGCCAGA
Real-time PCR of hemB of B12-hemB-RTF ACACCGACACCGTGTTGATG
P. shermanii B12-hemB-RTR GGAAGGGCCCGAAGAAG
*Gene names are from Falentin et al.21).

Thirty strains on the plates were examined for vitamin
B12 production, and the isolate with the highest yield,
KO-1261 (RifR GenR), was subjected to mutagen cock-
tail treatment and selection on the plates containing
10 μg/mL erythromycin. The resulting 26 isolates were
tested for vitamin B12 production, and the strain with
the highest yield (304 μg/L/OD600), KO-1262 (RifR
GenR EryR), was selected. The single, double, and tri-
ple mutants thus obtained showed marked enhancement
of vitamin B12 yield (μg/L/ OD600), with 1.6-, 2.8-,
and 5.2-fold increases, respectively. However, vitamin
B12 titer (μg/L) as a function of culture volume was
not affected, ranging from 1490 to 1580 μg/L because
introduction of RifR, GenR, and EryR markedly reduced
the final biomass of the mutants (Table 2).
Identification of drug resistance mutations
We conducted DNA sequence analysis to identify
drug resistance mutations accompanied by the high
yield of vitamin B12. Strain KO-1260 with rifampicin
resistance was found to have a mutation (H447R; cor-
responding to H437R of S. coelicolor) in the rpoB
gene, whereas a second rifampicin-resistant mutant with
increased yield of vitamin B12 was found to have a
mutation, H447Y, in the rpoB gene (data not shown).
Mutations (GenR, EryR) responsible for resistance to
gentamicin and erythromycin were not determined.
Transcriptional analysis of genes involved in vitamin
B12 production
Due to its complex chemistry, vitamin B12 produc-
tion requires more than 30 genes. Two different vitamin
B12 biosynthetic routes exist in nature: (i) an aerobic
(oxygen-dependent) pathway, found in organisms such
as P. denitrificans and (ii) an anaerobic (oxygen-inde-
pendent) pathway, found in Propionibacterium sher-
manii (reviewed by Martens et al.7)). Genes encoding
enzymes involved in oxygen-dependent vitamin B12
biosynthesis are designated with the prefix cob,
whereas genes involved in the oxygen-independent
pathway are designated with the prefix cbi. A sche-
matic outline of vitamin B12 biosynthetic pathway is
shown in Fig. 1. As vitamin B12 yield (μg/L/OD600)
increased markedly along with introduction of RifR,
GenR, and EryR mutations, we analyzed gene expres-
sion in wild-type and mutant strains using real-time
 Ribosome engineering and primary metabolism 1639
Table 2. Characteristics of mutants of Propionibacterium shermanii.

Antibiotic Vitamin B12

concentration Resistance level (μg/mL) to:* produced
(μg/mL) Position of Final
used for mutation at biomass (μg/L/
Strain selection each step Rifampicin Gentamicin Erythromycin (OD660)† (μg /L)† OD660)†
13673 (WT) －‡ － 1 300 1 27.3 1580 ± 270 58 ± 8
KO-1260 (RifR) Rifampicin 1340A→G >300 300 1 16.4 1490 ± 160 91 ± 10
(10)
(from 13673) (His447→Arg)
KO-1261 (RifR GenR) Gentamicin ND§ >300 >500 1 10.6 1710 ± 110 161 ± 9
(300)
(from KO-1260)
KO-1262 (RifR GenR EryR) Erythromycin ND >300 >500 >200 5.1 1550 ± 10 304 ± 3
(10)
(from KO-1261)
*
After incubation for 6 days on solid inoculation medium.
†
After incubation for 2 days in fermentation medium.
‡
Not applicable.
§
Not determined.

qPCR. Strains were grown to mid-exponential phase Glutamic acid

(10–14 h) in fermentation medium, and after extraction Glycine
of total RNA, real-time qPCR analysis was performed, Glutamyl-tRNA +
focusing on seven representative genes (designated by
Succinyl-CoA
bold letters in Fig. 1). The products of those selected Glutamate 1-semialdehyde
genes are listed in Table 1. As summarized in Fig. 2,
hemL hemA
the expression of these genes was enhanced signifi-
cantly, with GenR mutation most effective for enhance- 5-Aminolevulinic acid
ment at the transcriptional level. In contrast, the
positive effect of the third mutation EryR was limited hemB
to only cbiL. Uroporphyrinogen III

cobA
Discussion
Ribosome engineering is characterized by its feasibil- Precorrin-2
ity, allowing the identification of antibiotic-overproduc- cysG
ing mutants among drug-resistant isolates at a high cbiK
frequency of 10–40%.1,3) Combined with the results of cbiX
previous studies on ethanol and butanol production,23–
25) Cobalt-precorrin-2
the present study demonstrated that ribosome engi-
cbiL
neering is effective in activating not only secondary
metabolism but primary metabolic activity, such as the cbiEGH
production of vitamin B12, especially when assessed cbiF
on a per cell activity basis (i.e. yield). In general, how- cbiJ cobT
ever, titer (μg/L) as a function of culture volume is cbiC cobD
more important industrial element than yield (μg/L/
cbiA cobC
OD600) as a function of cell mass. Although ribosome
engineering often results in somewhat reduced growth cbiP cobU
rate, enhancement of growth rate and final biomass of cbiT cobS
the mutants by fermentation technology or gene engi- Adenosylcobalamin
neering may further enhance the production of vitamin (Vitamin B12)
B12. In Nonomuraea terrinata strain S58, a strain with
a duplicated (rpoB(S) + rpoB(R)) rpoB showed much Fig. 1. Outline of the pathway for vitamin B12 production proposed
greater growth, sporulation, and antibiotic production in P. freudenreichii with the relevant genes.
than the strain S114 with a single (rpoB(R)), especially Note: The figure was drawn based on Piao et al.17). The gene
under stressful conditions, suggesting the physiological products are listed in Table 1.
significance of rpoB duplication.26) Construction of
merodiploids harboring both mutant-type and wild-type
rpoB (or rpsL) genes may therefore resolve this issue In the vitamin B12 fermentation, the GenR mutation
because the presence of the wild-type gene would over- conferring resistance to gentamicin was particularly
come the reduced growth rate and final biomass caused effective at increasing the levels of expression of genes
by the rpoB or rpsL mutation.1,27) involved in vitamin B12 production. Although
1640 Y. Tanaka et al.

Relative transcription intensity

*
6 *

5 13673 (WT)
** R
KO-1260 (Rif )
4 R R
KO-1261 (Rif Gen )
3 **
* KO-1262 (RifR GenR EryR)
* ** **
2 *
*
**
1

0
L
hem
B
cob
A cbi EG
H
c bi
F
cob
U
cob
S
cbi

Fig. 2. Transcription analysis of several representative genes involved in vitamin B12 production in P. shermanii.
Notes: Wild-type (13673) and mutant (KO-1260, KO-1261, and KO-1262) strains of P. shermanii were grown to mid-exponential phase (10–
14 h) in fermentation medium at 30 °C on a rotary shaker. Total RNA was prepared and real-time qPCR was performed as described in Materials
and methods. The gene products are listed in Table 1. The error bars indicate the standard deviations of the means of three samples. The asterisks,
* and **, show the p-values lower than 0.05 and 0.01, respectively.

introduction of certain GenR mutations often enhances Disclosure statement

antibiotic production in actinomycetes,3) the gene(s)
mutated have not been identified to date. Introduction No potential conflict of interest was reported by the authors.
of an EryR mutation, conferring resistance to ery-
thromycin in P. shermanii KO-1262 (RifR GenR EryR),
was recently reported to be effective in the overproduc- Funding
tion of antibiotics in Streptomyces, although the
mutated gene has not been identified.28) The signifi- This work was supported by grants to K. O. from the National
Agriculture and Food Research Organization (Program for Promotion
cantly increased yields of vitamin B12 in P. shermanii
of Basic and Applied Research for Innovations in Bio-oriented Indus-
are likely due, at least in part, to the increased levels of try) and the MEXT-Supported Program for the Strategic Research
expression of genes involved in their production, Foundation at Private Universities, 2014–2016 [grant number
although more detailed transcription analyses (e.g. anal- S1413002].
ysis at various growth phases) are required.
Of the RifR rpoB mutations conferring high level
resistance to rifampicin, two, i.e. H437Y (His437 → References
Tyr) and H437R (His437 → Arg), were most often [1] Ochi K. Insights into microbial cryptic gene activation and strain
associated with antibiotic overproduction.1) The finding improvement: principle, application and technical aspects. J Anti-
that the H447Y and H447R mutations (corresponding biot. 2017;70:25–40.
to the H437Y and H437R mutations of Streptomyces, [2] Ochi K, Tanaka Y, Tojo S. Activating the expression of bacterial
respectively) was associated with a high yield of vita- cryptic genes by rpoB mutations in RNA polymerase or by rare
min B12, was therefore not unexpected. Taken together, earth elements. J Ind Microbiol Biotechnol. 2014;41:403–414.
[3] Ochi K, Hosaka T. New strategies for drug discovery: activation
these findings emphasize the importance and efficacy
of silent or weakly expressed microbial gene clusters. Appl
of specific RifR mutations for the overproduction of Microbiol Biotechnol. 2013;97:87–98.
microbial metabolites, although establishment of casual [4] Hosaka T, Ohnishi-Kameyama M, Muramatsu H, et al. Antibac-
relationship between the identified mutations and the terial discovery in actinomycetes strains with mutations in RNA
observed higher yield of vitamin B12 is required. polymerase or ribosomal protein S12. Nat Biotechnol.
2009;27:462–464.
[5] Tanaka Y, Kasahara K, Hirose Y, et al. Activation and products
Author contributions of the cryptic secondary metabolite biosynthetic gene clusters by
rifampin resistance (rpoB) mutations in actinomycetes. J Bacte-
Y. T. conducted mutation work with P. shermanii riol. 2013;195:2959–2970.
and transcriptional analysis for gene expression. K. K. [6] Burgess CM, Smid EJ, van Sinderen D. Bacterial vitamin B2,
and M. I. conducted physiological analysis and assayed B11 and B12 overproduction: an overview. Int J Food Microbiol.
2009;133:1–7.
vitamin B12. K. O. designed the study and wrote the [7] Martens J-H, Barg H, Warren MJ, et al. Microbial production of
article. vitamin B12. Appl Microbiol Biotechnol. 2002;58:275–285.
[8] Murooka Y, Piao Y, Kiatpapan P, et al. Production of tetrapyr-
Acknowledgments role compounds and vitamin B12 using genetically engineering
of Propionibacterium freudenreichii: An overview. Lait.
2005;85:9–22.
We would like to thank Yutaka Hirose, Yu Mori- [9] Thierry A, Deutsch SM, Falentin H, et al. New insights into
moto, and Yasuko Tanaka for providing experimental physiology and metabolism of Propionibacterium freudenreichii.
assistance. Int J Food Microbiol. 2011;149:19–27.
 Ribosome engineering and primary metabolism
[10] Seidametova EA, Shakirzyanova MP, Ruzieva DM. Isolation of
cobalt-resistant strains of propionic acid bacteria, potent produc-
ers of vitamin B12. Appl Biochem Microbiol. 2004;40:560–562.
[11] Moore SJ, Mayer MJ, Biedendieck R, et al. Towards a cell
factory for vitamin B12 production in Bacillus megaterium:
bypassing of the cobalamin riboswitch control elements. New
Biotechnol. 2014;31:553–561.
[12] Warren MJ, Raux E, Schubert HL, et al. The biosynthesis of
adenosylcobalamin (vitamin B12). Nat Prod Rep. 2002;19:
390–v.
[13] Raux E, Schubert HL, Warren MJ. Biosynthesis of cobalamin
(vitamin B12): a bacterial conundrum. Cell Mol Life Sci.
2000;57:1880–1893.
[14] Kang Z, Zhang J, Zhou J, et al. Recent advances in microbial
production of δ-aminolevulinic acid and vitamin B12. Biotechnol
Adv. 2012;30:1533–1542.
[15] Survase SA, Bajaj IB, Singhal RS. Biotechnological production
of vitamins. Food Technol Biotechnol. 2006;44:381–396.
[16] Zhang Y, Liu J-Z, Huang J-S, et al. Genome shuffling of Propi-
onibacterium shermanii for improving vitamin B12 production
and comparative proteome analysis. J Biotechnol.
2010;148:139–143.
[17] Piao Y, Yamashita M, Kawaraichi N, et al. Production of vita-
min B12 in genetically engineered Propionibacterium freudenre-
ichii. J Biosci Bioeng. 2004;98:167–173.
[18] Li Y. Production of vitamin B12 in recombinant Escherichia
coli: an important step for heterologous production of
structurally complex small molecules. Biotechnol J. 2014;9:
1478–1479.
[19] Shiwa Y, Fukushima-Tanaka S, Kasahara K, et al. Whole-
genome profiling of a novel mutagenesis technique using
1641
proofreading-deficient DNA polymerase σ. Int J Evol Biol.
2012;2012:8,860797.
[20] Yano S. Breeding of the industrial yeast strains using the dispar-
ity mutagenesis (in Japanese). Seibutsu Kogaku Kaishi.
2011;89:524–526.
[21] Falentin H, Deutsch S-M, Jan G, et al. The complete genome of
Propionibacterium freudenreichii CIRM-BIA1, a hardy acti-
nobacterium with food and probiotic applications. PLoS One.
2010;5:e11748.
[22] Tanaka Y, Hosaka T, Ochi K. Rare earth elements activate the
secondary metabolite-biosynthetic gene clusters in Streptomyces
coelicolor A3(2). J Antibiot. 2010;63:477–481.
[23] Gao X, Zhao H, Zhang G, et al. Genome shuffling of Clostrid-
ium acetobutylicum CICC 8012 for improved production of ace-
tone–butanol–ethanol (ABE). Curr Microbiol. 2012;65:128–132.
[24] Chen L, Shang G, Yuan W, et al. Screening of Clostridium
strains through ribosome engineering for improved butanol pro-
duction (in Chinese). Chin J Biotech. 2012;28:1048–1058.
[25] Suzuki T, Seta K, Nishikawa C, et al. Improved ethanol toler-
ance and ethanol production from glycerol in a streptomycin-re-
sistant Klebsiella variicola mutant obtained by ribosome
engineering. Bioresour Technol. 2015;176:156–162.
[26] Tala A, Wang G, Zemanova M, et al. Activation of dormant bac-
terial genes by Nonomuraea sp. strain ATCC 39727 mutant-type
RNA polymerase. J Bacteriol. 2009;191:805–814.
[27] Alifano P, Palumbo C, Pasanisi D, et al. Rifampicin-resistance,
rpoB polymorphism and polymerase genetic engineering. J
Biotechnol. 2015;202:60–77.
[28] Imai Y, Fujiwara T, Ochi K, et al. Development of the ability to
produce secondary metabolites in Streptomyces through the acqui-
sition of erythromycin resistance. J Antibiot. 2012;65:323–326.