Sei sulla pagina 1di 57

Aulas teórico-práticas de Genética Humana MD

GENÉTICA HUMANA

PROBLEMAS E QUESTÕES PARA DISCUSSÃO

MD 2º
Ano letivo 2017 / 2018

Prof. Doutor Paolo De Marco


Profª Maria Begoña Criado

1
Aulas teórico-práticas de Genética Humana MD

ÍNDICE

Pág.

1. DIVISÃO CELULAR E CROMOSSOMAS (REVISÃO) 4

2. PADRÕES DE HEREDITARIEDADE 5

3. GENÉTICA MENDELIANA 19

4. EXTENSÕES DA GENÉTICA MENDELIANA 26

5. GENÉTICA QUANTITATIVA 30

6. CÁLCULOS DE RISCO EM FAMÍLIAS COM DOENÇAS HEREDITÁRIAS 33

7. VARIAÇÃO CROMOSSÓMICA E DETERMINAÇÃO SEXUAL 38

8. LIGAÇÃO, CROSSING-OVER E MAPEAMENTO GENÉTICO 42

9. MUTAÇÃO GÉNICA E REPARAÇÃO DO ADN 50

10. T ECNOLOGIA DO ADN RECOMBINANTE E APLICAÇÕES 54

11. GENÉTICA DE POPULAÇÕES 60

12. GENÉTICA DA EVOLUÇÃO 63

2
Aulas teórico-práticas de Genética Humana MD

Seleção de questões do final de cada um dos capítulos do livro "Concepts of


Genetics", de Klug et al., 2009 e do “Student Handbook and Solutions Manual
for Concepts of Genetics”, Klug et al., 2009.

O objetivo das aulas práticas de Genética é a resolução de alguns problemas-tipo


e discussão de questões selecionadas, que se relacionam diretamente com os
conceitos introduzidos nas aulas teóricas desta disciplina. Pretende-se que o
aluno resolva o restante dos problemas de cada ficha em casa, com a ajuda do
guia do aluno, aonde se podem encontrar todas as soluções às perguntas,
devendo essa resolução ser acompanhada da leitura atenta do(s) capítulo(s)
teórico(s) correspondente(s).

Aconselha-se os alunos a acompanharem desde o início do semestre as aulas


teóricas com a leitura da respetiva bibliografia e a resolução dos problemas e
questões aqui apresentados, pois só assim, de uma forma sequencial e com um
trabalho regular, poderão ir consolidando os conceitos básicos sobre Genética
cujo conhecimento lhes será exigido no exame final, para aprovação à disciplina.

O esclarecimento de dúvidas será feito nas horas de acompanhamento


pedagógico previamente estabelecidas, aconselhando-se os alunos a recorrerem
a este acompanhamento à medida que forem surgindo as dúvidas, e não apenas
na semana anterior ao exame.

3
Aulas teórico-práticas de Genética Humana MD

DIVISÃO CELULAR E CROMOSSOMAS (REVISÃO)

1. a) Discuta os conceitos: cromossomas homólogos, diploidia e haploidia, e a sua relação com a


reprodução sexuada.
b) Quais as características partilhadas pelos dois cromossomas designados homólogos?

2. Se dois cromossomas de uma espécie são do mesmo comprimento e têm o centrómero na


mesma posição, mas não são homólogos, o que difere entre eles? O que pode diferir entre
cromossomas homólogos?

3. Descreva os eventos que caracterizam cada etapa de uma divisão mitótica.

4. Se um organismo tem um número diploide de 16, quantas cromátidas são visíveis ao fim da
profase mitótica? Quantos cromossomas se movem para cada lado durante a anafase mitótica?

5. Defina e discuta os seguintes termos: a) sinapse, b) bivalente, c) quiasma, d) crossing-over (ou


sobrecruzamento), e) cromómeros, f) cromátidas-irmãs, g) tétradas, h) díadas, i) mónadas, j)
complexo sinaptonémico.

6. Durante a primeira profase meiótica (I).:


a) Quando ocorre o sobrecruzamento?
b) Quando ocorre a formação de sinapses?
c) Em que fase é que os cromossomas estão menos condensados?
d) Desde quando é que os quiasmata se tornam visíveis?

7. Estabeleça a diferença entre o resultado final da meiose e da mitose.

8. Contraste o conteúdo genético e a origem de cromátidas-irmãs e não-irmãs durante o seu


aparecimento na profase I da meiose. De que forma poderá o conteúdo genético destas ter
mudado na altura em que as tétradas se alinham no plano equatorial da célula, durante a Metafase
I?

9. Se um organismo tem um número diploide de 22


a) Quantas tétradas estão presentes na primeira profase da meiose?
b) Quantas díadas estão presentes na segunda profase meiótica?
c) Qual a probabilidade de cada gâmeta resultante conter apenas cromossomas paternos?

10. Durante a oogénese numa espécie com número haploide de 6 uma díada sofre não-disjunção
durante a divisão, surgindo assim a díada intacta no óvulo. Quantos cromossomas estarão
presentes:
a) No óvulo?
b) No segundo corpo polar?
c) Após a fertilização pelo espermatozoide, qual o tipo de anomalia cromossómica gerada?

11. Qual a probabilidade de que, num organismo com um número haploide de 10, se forme um
espermatozoide com 10 cromossomas cujos centrómeros sejam todos derivados dos homólogos
maternos?

4
Aulas teórico-práticas de Genética Humana MD

PADRÕES DE HEREDITARIEDADE

Um pedigree humano, árvore familiar ou heredograma, é uma forma concisa de mostrar as


relações numa família em que segrega um traço genético. A análise de pedigrees é uma das
formas mais diretas que temos de determinar o modo de transmissão de uma doença hereditária
em humanos. No entanto, nem sempre é possível chegar-se a uma conclusão definitiva, dado o
pequeno tamanho das famílias e a limitação na obtenção da história familiar na maioria dos casos.
Por vezes mais do que uma explicação é plausível, mas uma pode ser melhor (ou seja, mais
provável) do que outra.

I. Simbologia utilizada

As gerações são representadas por números romanos, os indivíduos são numerados da


esquerda para a direita dentro de cada geração.

Mulher normal 3 Três raparigas normais

Homem normal 2 Dois rapazes normais

Mulher afetada Sexo não especificado

Homem afetado

Propositus (pessoa afetada Acasalamento


que despertou atenção pela
primeira vez para a família)
Acasalamento consanguíneo

Gémeos dizigóticos Gémeos monozigóticos

Portador ou Portadora

Morte Aborto Gravidez


5
Aulas teórico-práticas de Genética Humana MD

II. Determinação do modo de hereditariedade de doenças em humanos: algumas regras


práticas

Embora não se possam, evidentemente, realizar cruzamentos experimentais para determinar o


modo de hereditariedade de um traço humano, pode-se usar o padrão da sua transmissão em
famílias para fazer previsões sobre a sua transmissão. Primeiro, é importante reconhecer que a
maioria dos casos encaixa em uma de poucas categorias: dominante ou recessivo, autossómico
ou heterossómico (ligado ao X ou au Y), completamente penetrante ou de penetrância incompleta.
O passo inicial é então classificar um traço desconhecido em termos destas categorias,
reconhecendo sempre que um só pedigree pode não nos proporcionar suficiente informação para
concretizar este objetivo de forma inequívoca.

Comece por determinar se o traço é dominante ou recessivo. As regras seguintes servem para
ajuda-lo a levantar as questões certas na análise de cada pedigree. Na ausência de provas em
contrário, considere que todos os indivíduos que casam com alguém da família (vindos de fora da
família) são homozigóticos normais.

1. Relações de dominância: um traço dominante é o mais facilmente reconhecível, por isso


comece por ver se o pedigree encaixa no que seria de esperar de um caso de hereditariedade
dominante. Se não encaixar, ou é recessivo ou apresenta algum aspeto mais complexo, tal
como penetrância incompleta.
A. Traços dominantes
- Invertendo a lógica mendeliana, lembre-se que um traço dominante não pode num
descendente sem ter aparecido primeiro em pelo menos um dos progenitores
(Exceções: nova mutação ou penetrância incompleta).
- Lembre-se de que um traço dominante não salta gerações. Por isso, surgirá com
bastante frequência num pedigree.
- Membros não afetados da família terão apenas filhos não afetados.
B. Traços recessivos
- Num casamento com dois indivíduos afetados, toda a descendência será afetada.
- As doenças recessivas encontram-se frequentemente em famílias com
casamentos entre parentes próximos (consanguinidade).
- Um traço recessivo salta frequentemente gerações, porque é mascarado nos
heterozigóticos.

2. Ligação: comece por procurar evidência de ligação ao X. Lembre-se que um só pedigree pode
não dar suficiente informação para fazer a identificação clara.
A. Hereditariedade ligada ao sexo
- Um traço ligado ao sexo (cromossoma X) nunca pode ser transmitido de um pai
para um filho, uma vez que o X do pai é transmitido apenas às filhas. Uma única
transmissão pai-filho é suficiente para excluir ligação ao cromossoma X. O
cromossoma Y possui muito poucos genes, pelo que, para além de alguns
polimorfismos moleculares, são muito raros os caracteres ligados ao Y
(holândricos).
- Se o traço for recessivo, todos os filhos de uma mulher que manifesta o traço são
afetados.
- Se for recessivo, o traço ocorrerá mais frequentemente em homens.
- Se for dominante, o traço ocorrerá um pouco mais frequentemente nas mulheres.
B. Hereditariedade autossómica
- Um traço autossómico pode passar de um pai para um filho.
- Aproximadamente o mesmo número de homens e mulheres serão afetados.

3. Situações mais complexas: apesar de as regras apresentadas acima nos poderem ajudar a
analisar pedigrees para doenças ou caracteres mendelianos simples, devemos sempre
6
Aulas teórico-práticas de Genética Humana MD

recordar que há muitos fatores que podem complicar os padrões de transmissão observados
na expressão génica. A penetrância incompleta, a expressão limitada ao sexo, o aparecimento
de novas mutações, dois loci diferentes que afetam o mesmo carácter, adoção, parentesco
errado e cruzamentos promíscuos podem confundir a interpretação de um pedigree.

-------------------------------------------------------------------------------------------------------------------------------
Ligação ao X:
Risco de recorrência (mãe portadora): 50%
Risco de recorrência (pai afetado): 100 % das filhas portadoras, 0% dos filhos
Transmissão de homem para homem: nunca
Consanguinidade: frequência não aumentada
Dominante: doença mais frequente nas mulheres
Recessiva: doença ocorre quase exclusivamente em homens
Nota: Expressão nos homens pode diferir da expressão em mulheres

Autossómica recessiva:
Risco de recorrência: 25%
Consanguinidade: frequente.
Doença presente em irmãos mas não nos pais.

Autossómica dominante:
Risco de recorrência: 50%
Consanguinidade: frequência não aumentada
Nota: Penetrância dependente da idade comum nas doenças mais sérias.

Mitocondrial:
Transmissão de pai para filho(a) - nunca
Transmissão de mãe para filho(a) - sempre
Consanguinidade: frequência não aumentada
Nota: Atenção à penetrância dependente da idade!

Ligação ao Y (holândrica):
Só afeta homens
Um homem afetado transmite o caracter a todos os filhos e a nenhuma das filhas

-------------------------------------------------------------------------------------------------------------------------------
Se num caso de transmissão autossómica ocorrer Imprinting:
a frequência da doença em homens e mulheres não difere, mas a proporção de pais/mães que
transmitem a doença não é 1:1.

III. Critérios de análise – resumo

1.a. Transmissão vertical: diz-se haver nos pedigrees que apresentam casos referidos em todas
as gerações. Sugere dominância do carácter. Exceções: os caracteres ligados ao Y (muito raros),
embora não sejam dominantes no sentido estrito do termo, manifestam sempre o carácter
apresentando transmissão vertical, por se encontrarem em hemizigotia.

1.b. Transmissão horizontal: os exemplos mais claros apresentam gerações totalmente livres de
doença, outros mostram uma alternância geração de indivíduos afetados – geração livre da
doença, mas não paralelamente em todas as linhas de descendentes. Sugere recessividade do
carácter: indivíduos que não o manifestam são capazes de o transmitir. Por vezes só se conhece
uma geração afetada, obrigando ao despiste de uma causa ambiental (ex. epidemia).

7
Aulas teórico-práticas de Genética Humana MD

2. Progenitor transmissor (independentemente da manifestação do carácter):


 Se o transmissor tanto pode ser a mãe como o pai independentemente do sexo do filho afetado,
o carácter é autossómico.
 Se há transmissão pai-filho o carácter não está, em princípio, ligado ao X.
 Se o carácter é raro, o que acontece na maioria das doenças genéticas, recessivo (alternância
de gerações) e só afeta homens é sugestivo de ligação ao X. Uma mulher afetada terá o pai
obrigatoriamente afetado se não houver mutação de novo.
 Caracteres dominantes na ausência de transmissão pai-filho sugerem ligação ao X. Confirma-
se se todas as filhas de homens afetados também o são.
 Se todos os homens na mesma linha de descendentes estão afetados e não há mulheres
afetadas trata-se de carácter ligado ao Y (casos muito raros).

3. Consanguinidade: em famílias com vários casos de doença rara e transmissão horizontal,


corrobora a hipótese de doença hereditária recessiva. Pode justificar situações de mulheres
afetadas por doença recessiva ligada ao X.

4. Proporção de cada sexo entre os afetados: este critério só é inteiramente válido para
grandes amostragens. Nas doenças autossómicas, o número de homens e mulheres afetados é
idêntico se não houver condicionamentos pelo sexo.

5. Exceções: exceções aos pontos anteriores podem dever-se a razões de ordem biológica.
 Penetrância incompleta ou dependente da idade.
 Ação de gene epistático; heterogeneidade genética.
 Condicionamento ou limitação ao sexo.
 Mutação de novo.
 Mosaicismo.
 Alterações cromossómicas.
Exceções surgem quando há dificuldade em determinar com rigor informação importante por
razões de ordem médica, social, pessoal ou outras: falsa paternidade ou paternidade incógnita,
consanguinidade oculta, critérios de diagnóstico não uniformizados, falecimento antes da idade
de apresentação da doença.

Nota: com alguma frequência vejo respostas do tipo “AR, porque …… porque é recessivo”. Ora,
se a vossa resposta é “recessivo”, não podem usar esta conclusão para demonstrar nada (é um
erro lógico chamado tautologia). Dêem então a resposta (ex. “AR”) só no fim do raciocínio,
depois de ter eliminado as outras opções.

8
Aulas teórico-práticas de Genética Humana MD

EXERCÍCIOS
Diga que tipo de hereditariedade é ilustrado nos seguintes pedigrees.

1.

2.

3.

9
Aulas teórico-práticas de Genética Humana MD

4.

5.

6.

10
Aulas teórico-práticas de Genética Humana MD

7.

8.

9.

11
Aulas teórico-práticas de Genética Humana MD

10.

11.

12.

12
Aulas teórico-práticas de Genética Humana MD

13.

14.

15.

13
Aulas teórico-práticas de Genética Humana MD

16.

17.

18.

14
Aulas teórico-práticas de Genética Humana MD

19.

20.

21.

22.

15
Aulas teórico-práticas de Genética Humana MD

23.

24.

16
Aulas teórico-práticas de Genética Humana MD

25.

26.

27.

Diabetes + problemas
auditivos
Diabetes

17
Aulas teórico-práticas de Genética Humana MD

28. Considere os três pedigrees seguintes, todos eles envolvendo um só traço humano.

A B C

a) Que condições, se existir alguma, podem ser excluídas?


 dominante e ligado ao X
 dominante e autossómica
 recessivo e ligado ao X
 recessivo e autossómico
b) Para uma qualquer das condições que excluiu, indique o indivíduo na geração II (ex.: II-1, II-
2,...) que lhe serviu de instrumento na sua decisão de excluir essa condição. Se todas forem
excluída, responda “nenhuma serve”.
c) Depois de chegar às conclusões acima indicadas, indique o genótipo dos indivíduos II-1, II-6 e
II-9. Se mais do que uma hipótese servir, registe todas as possibilidades. Use os símbolos a e A
para os genótipos.

29. A genealogia anexa refere-se a uma família com casos de


alcaptonúria, anomalia provocada por uma mutação AR.
Nesta genealogia os genótipos que não podem ser determinados
com certeza são os dos indivíduos…. Justifique. v

30. A distonia primária de início precoce apresenta-se com problemas nos movimentos
musculares, tremores, contração prolongada de músculos, etc. O pedigree ao lado mostra uma
família com 2 indivíduos doentes. Este traço parece seguir que tipo de hereditariedade?

18
Aulas teórico-práticas de Genética Humana MD

Genética mendeliana

Os problemas de genética mendeliana são em muitos aspetos similares aos de álgebra. O modo
de abordagem deverá ser idêntico: (1) analisar o problema cuidadosamente; (2) traduzir as
palavras em símbolos, definindo previamente cada uma delas; (3) escolher e aplicar a técnica
específica para resolver o problema. Os dois primeiros passos são os mais críticos. O terceiro
passo é quase mecânico.

Os problemas mais simples são aqueles que fornecem toda a informação necessária acerca da
geração P e pedem para indicar as proporções de cada um dos genótipos e/ou fenótipos F1 ou F2.
Os passos seguintes deverão ser sempre seguidos quando encontrar este tipo de problema:
1. Determine tanto quanto possível os genótipos dos indivíduos da geração P.
2. Determine que gâmetas podem ser formados pelos progenitores P.
3. Recombine os gâmetas, quer pelo método da tabela de Punnett, pelo método de
bifurcação, ou, se a situação for muito simples, por inspeção. Leia os fenótipos F 1
diretamente.
4. Repita o processo a fim de obter informação sobre a geração F2.

A determinação dos genótipos a partir da informação dada requer uma compreensão da teoria
básica da genética de transmissão. Por exemplo, considere o problema seguinte:

“Um alelo mutante recessivo, preto, é responsável por um corpo muito escuro na Drosophila,
quando homozigótica. A sua cor normal em estado selvagem é descrita como sendo cinzenta. Que
proporção fenotípica F1 se prevê quando uma fêmea preta é cruzada com um macho cinzento cujo
pai era preto?”

Para resolver este problema, é necessário compreender a dominância e a recessividade, assim


como o princípio da segregação. Para além disso, é necessário usar a informação sobre o pai do
macho. Pode resolver-se do seguinte modo:

1. Uma vez que a fêmea é preta, tem que ser homozigótica para o alelo mutante (bb).
2. O macho é cinzento; tem que ter, portanto, pelo menos um alelo dominante (B). Uma vez
que o seu pai era preto (bb) e ele recebeu os cromossomas que carregam esses alelos, o
macho tem que ser heterozigótico (Bb). A partir daqui, o problema é simples:

Bb x bb b b

  B Bb Bb

B,b b,b b bb bb

½ Bb  ½ cinzento
½ bb  ½ preto

Nota: Ao trabalhar em problemas de Genética, neste capítulo e nos seguintes,


parta sempre do princípio de que os membros da geração P são homozigóticos,
a não ser que a informação fornecida indique ou requeira outra coisa.

19
Aulas teórico-práticas de Genética Humana MD

Regras sobre probabilidades

P (a) pertence a 0,1

P (a) = 1, se a é um acontecimento certo

P (a) = 0, se a é um acontecimento impossível

P (a´) = 1- P = probabilidade complementar de a; probabilidade de que a não aconteça (prob. De


“não a”)

P (a U b) = P (a) + P (b) – P (ab) lê-se prob. de a ou b; representa a probabilidade de ocorrência


dos acontecimentos a, b, ou de ambos. O valor de P(a) já contempla a possibilidade de que a
ocorra simultaneamente a b; o valor de b contempla a mesma possibilidade, desta vez,
relativamente ao b; então, a probabilidade de que ocorra a e b em simultâneo seria considerada
duas vezes se não a subtraíssemos uma vez.

Se P (ab) = 0, então P (a U b) = P (a) + P (b), que acontece sempre que a e b são acontecimentos
mutuamente exclusivos, isto é, a ocorrência de um deles implica a impossibilidade de que ocorra
o outro.

P (ab), lê-se prob. de a e b; representa a prob. de ocorrência de a e b simultaneamente.

P (ab) = P (a) x P (b), se a e b são acontecimentos independentes, isto é, a ocorrência de cada


um dos eventos não afeta a ocorrência do outro.

P (a/b) = P (ab) / P (b) representa a prob. de ocorrência de a sob a condição que ocorreu (ou
ocorra) b; é a probabilidade relativa e condicionada dado que não representa a prob. de que ocorra
a em absoluto.

No caso de se querer calcular a probabilidade de combinações (não ordenadas) de eventos


genéticos (ex. s filhos doentes e t não doentes em n total) usa-se a fórmula derivada do teorema
da binomial:

P= n!  as  bt
s!  t!

n = número total de eventos


s = número de vezes que a ocorre
t = número de vezes que b ocorre
a = prob. do resultado de tipo (s) ocorrer a cada evento
b = prob. do resultado de tipo (t) ocorrer a cada evento

20
Aulas teórico-práticas de Genética Humana MD

Exercícios:

1. Os pombos podem apresentar um padrão de pigmentação das penas “liso” ou “aos quadrados”.
Numa série de cruzamentos controlados, obtiveram-se os seguintes dados:

Geração P Descendência F1
Quadrados Liso
a) quadrados x quadrados 36 0
b) quadrados x liso 38 0
c) liso x liso 0 35

A descendência F1 foi então seletivamente cruzada, com os resultados que se seguem. O


cruzamento P de que descendem os pombos F1 está indicado para cada caso entre parêntesis.

Cruzamento F1 x F1 Descendência
Quadrados Liso

d) quadrados (a) x liso (c) 34 0


e) quadrados (b) x liso (c) 17 14
f) quadrados (b) x quadrados (b) 28 9
g) quadrados (a) x quadrados (b) 39 0

Como são herdados os padrões liso e aos quadrados? Escolha e defina símbolos para os genes
envolvidos e determine os genótipos dos progenitores e da descendência de cada cruzamento.

2. Mendel cruzou ervilheiras de sementes verdes com ervilheiras de sementes amarelas. A


geração F1 exibia só sementes amarelas. Na F2, a descendência consistiu em 6022 plantas de
sementes amarelas e 2001 plantas de sementes verdes. Das plantas amarelas de F 2, 519 foram
autofertilizadas, com os seguintes resultados: 166 originaram só descendência amarela e 353
produziram uma proporção de 3:1 de amarelo:verde. Explique estes resultados, através do
diagrama dos cruzamentos.

3. Num estudo de porquinhos-da-índia de pelagem preta ou branca, 100 animais pretos foram
cruzados individualmente com animais brancos e cada cruzamento foi levado até à geração F 2.
Em 94 dos cruzamentos, os indivíduos F1 eram todos pretos e na F2 foi obtida uma proporção de
3 filhotes pretos para cada filhote branco. Nos outros 6 cruzamentos, metade dos animais F1 eram
pretos e a outra metade eram brancos. Porquê estas diferenças? Preveja os resultados F2 do
cruzamento dos porquinhos-da-índia da geração F1 dos seis casos diferentes.

4. Usando ervilheiras no seu trabalho, Mendel descobriu que as vagens cheias são dominantes
em relação a vagens segmentadas; do mesmo modo, as sementes lisas são dominantes em
relação às sementes enrugadas. Um destes cruzamentos foi entre plantas cheias e lisas, e plantas
segmentadas e enrugadas. Deste cruzamento, obteve uma F1, toda cheia e lisa. Na F2, Mendel
obteve a clássica proporção 9:3:3:1. Usando esta informação, determine os resultados F 1 e F2
esperados de um cruzamento entre plantas homozigóticas segmentadas e lisas com plantas
homozigóticas cheias e enrugadas.

5. Determine a probabilidade de uma planta com o genótipo Ss Ee ser produzida a partir de plantas
progenitoras de genótipos Ss Ee e Ss ee. E a probabilidade de obtermos plantas com vagem cheia
e semente enrugada?

21
Aulas teórico-práticas de Genética Humana MD

6. Noutro cruzamento, envolvendo plantas progenitoras de genótipo e fenótipo desconhecidos,


obteve-se a descendência abaixo descrita. Determine os genótipos e os fenótipos dos progenitores
(nota: as vagens cheias são dominantes em relação a vagens segmentadas; do mesmo modo, as
sementes lisas são dominantes em relação às sementes enrugadas).

Descendência: 3/8 cheias, lisas


3/8 cheias, enrugadas
1/8 segmentadas, lisas
1/8 segmentadas, enrugadas

7. Num cruzamento entre dois porquinhos-da-índia, todos os membros da geração F1 são pretos.
A geração F2 é constituída por aproximadamente ¾ de filhotes pretos e ¼ de filhotes brancos.
a) Faça um diagrama deste cruzamento, mostrando os genótipos e os fenótipos.
b) Como será a descendência, se dois porquinhos-da-índia F2 brancos forem cruzados?
c) Foram feitos dois cruzamentos diferentes entre membros pretos da geração F 2, com os
resultados evidenciados abaixo. Faça o diagrama de cada um dos cruzamentos.

Cruzamento Descendência
Cruzamento 1 Todos pretos
Cruzamento 2 ¾ pretos, ¼ brancos

8. Qual(is) dos postulados de Mendel são ilustrados pelo pedigree do problema anterior? Elabore
uma lista desses postulados e defina-os.

9. Discuta como, a partir dos resultados obtidos nos cruzamentos monohíbridos, Mendel terá
chegado a estabelecer os seus três primeiros postulados.

10. Que vantagens apresentou a escolha de Mendel de ervilheiras de cheiro nas suas
experiências?

11. Mendel cruzou ervilheiras que tinham sementes lisas e amarelas com ervilheiras que tinham
sementes enrugadas e verdes. Todas as plantas F1 tinham sementes lisas e amarelas.
Elabore um diagrama deste cruzamento até à geração F2 utilizando o método da tabela de Punnett
e o método da bifurcação (ou ramificação).

12. Com base no cruzamento acima, na geração F2, qual é a probabilidade de que um organismo
tenha sementes lisas e verdes e seja true-breeding (origine descendência sempre igual a si próprio
por autofertilização)?

22
Aulas teórico-práticas de Genética Humana MD

13. Com base nos mesmos caracteres e traços do problema 12, determine os genótipos das
plantas progenitoras envolvidas nos cruzamentos mostrados abaixo, analisando os fenótipos da
sua descendência.

Plantas progenitoras Descendência


a) lisas, amarelas x lisas, amarelas ¾ lisas, amarelas
¼ enrugadas, amarelas
b) enrugadas, amarelas x lisas, amarelas 6/16 enrugadas, amarelas
2/16 enrugadas, verdes
6/16 lisas, amarelas
2/16 lisas, verdes
c) lisas, amarelas x lisas, amarelas 9/16 lisas, amarelas
3/16 lisas, verdes
3/16 enrugadas, amarelas
1/16 enrugadas, verdes
d) lisas, amarelas x enrugadas, verdes ¼ lisas, amarelas
¼ lisas, verdes
¼ enrugadas, amarelas
¼ enrugadas, verdes

14. Qual dos cruzamentos do problema anterior é um cruzamento teste?

15. Qual dos postulados de Mendel só pode ser demonstrado em cruzamentos que envolvam pelo
menos dois pares de traços? Defina-o.

16. Correlacione os quatro postulados de Mendel com o que se conhece agora sobre
cromossomas homólogos, genes, alelos, e o processo da meiose.

17. Qual é a base de homologia entre cromossomas?

18. Distinga homozigotia de heterozigotia.

19. Na Drosophila, a cor corporal cinza é dominante em relação à cor corporal ébano, enquanto
as asas longas são dominantes em relação às asas vestigiais. Trabalhe os cruzamentos seguintes
até à geração F2 e determine as proporções genotípicas e fenotípicas para cada geração.
a) Cinza, longas x ébano, vestigiais
b) Cinza, vestigiais x ébano, longas
c) Cinza, longas x cinza, vestigiais

20. Quantos tipos de gâmetas podem ser formados por indivíduos com os seguintes genótipos: a)
AaBb; b) AaBB; c) AaBbCc; d) AaBbcc; e e) AaBbCcDdEe?

21. Usando o método da bifurcação, ou ramificação, determine as proporções genotípicas e


fenotípicas nestes cruzamentos: (a) AaBbCc x AaBBCC, (b) AaBBCc x aaBBCc, e (c) AaBbCc x
AaBbCc.

22. Mendel cruzou ervilheiras de sementes lisas e verdes com ervilheiras de sementes enrugadas
e amarelas. Todas as plantas F1 tinham sementes lisas e amarelas. Preveja os resultados de um
cruzamento teste destas plantas F1.

23
Aulas teórico-práticas de Genética Humana MD

23. O albinismo em seres humanos é herdado como um traço recessivo simples. Para as seguintes
famílias, determine os genótipos dos pais e da descendência. Quando forem possíveis dois
genótipos alternativos, registe os dois.
a) Dois progenitores normais têm cinco filhos, quatro normais e um albino
b) Um homem normal e uma mulher albina têm seis filhos, todos normais
c) Um homem normal e uma mulher albina têm seis filhos, três normais e três albinos.
d) Elabore um pedigree das famílias em b) e c) e do casamento entre uma das crianças normais
em b) com um dos descendentes albinos em c), casamento que resulta em oito filhos.

24. Se dois progenitores, ambos portadores heterozigóticos do alelo autossómico recessivo


causador da fibrose quística, tiverem cinco filhos, qual é a probabilidade de três serem normais?

25. A queratose (anomalia da pele) é devida a um alelo dominante Q. Uma mulher com
queratose, cujo pai era normal, casa-se com um homem com queratose, cuja mãe era normal.
Se esse casal tiver quatro filhos a probabilidade de todos eles apresentarem queratose é de:
a) 12,5%
b) 15,6%
c) 24,6%
d) 28,1%
e) 31,6%

26. O quadro abaixo apresenta os resultados F2 de dois dos cruzamentos monohíbridos de


Mendel. Construa uma hipótese nula para ser testada usando o teste 2. Calcule o valor do 2 e
determine o valor de p para ambos os resultados. Interprete os valores de p. Poderá o desvio em
cada um dos casos ser atribuído ao acaso ou não? Qual dos dois cruzamentos mostra um desvio
maior?

(a) Vagens cheias 882


Vagens segmentadas 299

(b) Flores violeta 705


Flores brancas 224

27. Numa experiência de genética com ervilheiras um aluno observou na geração F2 os seguintes
resultados para a forma e cor das sementes:

315 plantas com sementes lisas, amarelas


108 plantas com sementes lisas, verdes
101 plantas com sementes enrugadas, amarelas
32 plantas com sementes enrugadas, verdes
556 (nº total de plantas)

a) Qual foi a hipótese nula (H0)?


b) Terá a análise de 2 apoiado a hipótese? Justifique, indicando qual o valor de probabilidade
mais próximo para o valor de 2 encontrado.
c) Como interpreta os desvios registados entre os valores observados e os esperados?
Justifique.

24
Aulas teórico-práticas de Genética Humana MD

28. No laboratório, uma estudante de genética cruzou moscas com asas lisas normais, com
moscas mutantes com asas onduladas, que ela pensava ser um traço mendeliano recessivo. Na
geração F1 todas as moscas tinham asas lisas. Na F2 obtiveram-se os seguintes resultados:

792 moscas com asas lisas


208 moscas com asas onduladas

A estudante testou a hipótese de a asa ondulada ser herdada como um traço recessivo mendeliano
simples, realizando uma análise de 2 dos dados da F2.
a) Qual foi a hipótese nula (H0)?
b) Terá a análise de 2 apoiado a hipótese?
c) O que sugerem os dados acerca da mutação ondulada?

29. Verifique se os resultados dos cruzamentos nos exercícios 1 do próximo capítulo seguem as
proporções 1:1:1:1 e se os resultados do cruzamento 4 do exercício 13 seguem as proporções
9:3:3:1.

Tabelas do 2

25
Aulas teórico-práticas de Genética Humana MD

EXTENSÕES DA GENÉTICA MENDELIANA


1. As plantas de rabanete podem ter flores vermelhas, cor-de-rosa ou brancas. A parte comestível
(o rabanete) pode ser alongada ou oval. Quando se estuda só a cor da flor, o cruzamento branco
x vermelho só origina flores rosa. Se estas plantas com flores rosa F1 forem cruzadas entre si,
não há sinais de nenhuma dominância, e a geração F2 consiste em ¼ vermelhas:½ cor-de-rosa:¼
brancas. No que respeita à forma do rabanete, alongado é dominante em relação ao oval, segundo
padrões mendelianos normais.
a) Determine os fenótipos das F1 e F2 resultantes de um cruzamento entre uma planta com
rabanetes alongados e flores vermelhas e uma oval brancas (true breeding). Comece por definir
todos os símbolos dos genes.
b) Uma planta vermelha oval foi cruzada com uma planta de fenótipo e genótipo desconhecidos,
originando os resultados mostrados abaixo. Determine o fenótipo e o genótipo da planta
desconhecida.

Descendência: 103 vermelhos, alongados


101 vermelhos, ovais
98 rosa, alongados
100 rosa, ovais

2. A talassemia é uma forma de anemia hereditária nos seres humanos. Os indivíduos podem ser
completamente normais, podem apresentar uma anemia “ligeira”, ou podem apresentar uma
anemia “forte”. Partindo do princípio de que na hereditariedade destas condições estão envolvidos
apenas um gene com dois alelos, existe um fenótipo recessivo?

3. No gado caprino a cor da pelagem pode ser vermelha, branca ou ruão. Ruão é um fenótipo
intermédio entre vermelho e branco. Os seguintes resultados foram obtidos a partir de vários
cruzamentos.

Vermelho x vermelho todos vermelhos


Branco x branco todos brancos
Vermelho x branco todos ruão
Ruão x ruão ¼ vermelho: ½ ruão : ¼ branco

Como é transmitida a cor do pelo? Quais são os genótipos dos progenitores e da descendência
para cada cruzamento?

4. Estabeleça o contraste entre dominância incompleta e codominância.

5. Nas raposas, dois alelos de um só gene, P e p, podem originar letalidade (PP), pelagem
platinada (Pp), ou pelagem prateada (pp). Que proporção se obtém na descendência quando
raposas de pelagem platinada são cruzadas entre si? No que respeita à letalidade, o alelo P tem
um comportamento dominante ou recessivo? E no que respeita à cor da pelagem?

6. Elabore uma lista de genótipos possíveis para os fenótipos A, B e O. Será que o modo de
hereditariedade dos tipos de sangue ABO representa uma dominância? Ou uma recessividade?
Ou uma codominância?

7. Relativamente aos tipos de sangue ABO em humanos, determine o genótipo do pai e da mãe
indicados abaixo:

Pai: Tipo de sangue B Avó paterna tipo O


Mãe: Tipo de sangue A Avô materno tipo B

26
Aulas teórico-práticas de Genética Humana MD

Preveja os tipos de sangue da descendência que este casal possa ter e qual a proporção esperada
para cada tipo de sangue.

8. Num caso de disputa parental, a criança tem sangue tipo O, enquanto a mãe é tipo A. Que tipo
de sangue excluiria a possibilidade de um homem ser o pai da criança? Poderia algum dos outros
tipos de sangue provar que um homem em particular era o pai?

9. No quadro abaixo estão representados cinco casais com os grupos sanguíneos de cada
indivíduo (1-5). Cada combinação resultou numa das 5 descendências mostradas à direita (a-e).
Ligue as descendências aos progenitores corretos de modo a que os cinco casos sejam plausíveis
(não tenha em conta o fenótipo de Bombay). Haverá mais do que uma resposta correta?

Fenótipos dos progenitores Descendência


(1) A, M, Rh- x A, N, Rh- (a) A, N, Rh-
(2) B, M, Rh- x B, M, Rh+ (b) O, N, Rh+
(3) O, N, Rh+ x B, N, Rh+ (c) O, MN, Rh-
(4) AB, M, Rh- x O, N, Rh+ (d) B, M, Rh+
(5) AB, MN, Rh- x AB, MN, Rh- (e) B, MN, Rh+

10. Nos seres humanos, os antigénios A e B podem ser encontrados sob a forma solúvel em
secreções, incluindo a saliva, em alguns indivíduos (Se/Se e Se/se), mas não em outros (se/se).
Logo, a população contém secretores e não-secretores.
a) Determine a proporção de vários fenótipos (tipo de sangue e capacidade de secreção) em
cruzamentos entre indivíduos com sangue do tipo AB e O, ambos Se/se.
b) Como poderiam mudar os resultados de tais cruzamentos se ambos os progenitores fossem
heterozigóticos para o controle genético da síntese da substância H (Hh)?

11. Distinga entre epistase e hereditariedade poligénica, assim como entre variação contínua e
descontínua.

12. No que respeita à cor do pelo, os cavalos podem ser cremello (uma cor creme claro), chestnut
(uma cor acastanhada), ou palomino (uma cor dourada com branco na cauda e na crina). Destes
fenótipos só os palominos nunca originam descendência completamente igual a eles próprios.

a) Baseando-se nos resultados apresentados abaixo, determine o modo de hereditariedade,


assinalando os símbolos dos genes, e indicando que genótipos correspondem a que fenótipos.

Cremello x palomino ½ cremello


½ palomino
Chestnut x palomino ½ chestnut
½ palomino
Palomino x palomino ½ palomino
¼ chestnut
¼ cremello

b) Preveja os resultados F1 e F2 de vários acasalamentos iniciais entre cavalos cremello e


chestnut.

27
Aulas teórico-práticas de Genética Humana MD

13. Considere o problema da hereditariedade da forma da crista nas galinhas, nas quais se podem
observar diferentes fenótipos, sendo eles a forma de “noz”, de “ervilha”, de “rosa”, e “simples”.
Como é transmitida geneticamente a forma da crista (modo de hereditariedade), e quais são os
genótipos das gerações P e F1 de cada cruzamento? Utilize as informações seguintes para
responder a estas questões.

Cruzamento 1: “simples” x “simples” todas “simples”


Cruzamento 2: “noz” x “noz” todas “noz”
Cruzamento 3: “rosa” x “ervilha” todas “noz”
Cruzamento 4: (F1 x F1 do cruzamento 3)
“noz” x “noz” 93 “noz”
28 “rosa”
32 “ervilha”
10 “simples”

14. Nos ratos, a pigmentação só é produzida quando o alelo C está presente. Os indivíduos de
genótipo cc não têm cor. Se a cor estiver presente, pode ser determinada pelos alelos A e a. Os
genótipos AA e Aa resultam numa cor agouti, enquanto os aa resultam em pelagem preta.
a) Que proporções fenotípicas e genotípicas F1 e F2 se obtêm a partir de um cruzamento entre
ratos AACC e aacc?
b) Em três cruzamentos entre fêmeas agouti cujos genótipos eram desconhecidos e machos de
genótipo aacc, foram obtidas as seguintes proporções fenotípicas:

(1) 8 agouti (2) 9 agouti (3) 4 agouti


8 albino 10 preto 5 preto
10 albino
Quais são os genótipos destes progenitores fêmea?

15. Em algumas plantas, um pigmento vermelho, a cianidina, é sintetizado a partir de um precursor


incolor. A adição de um grupo hidroxilo (OH) à molécula de cianidina faz com que a cor passe a
roxa. Num cruzamento entre duas plantas com flores roxas selecionadas aleatoriamente,
obtiveram-se os seguintes resultados: 94 roxas:31 vermelhas:43 incolores. Quantos genes estão
envolvidos na determinação da cor nestas plantas? Que combinações genotípicas produzem que
fenótipos?

16. Numa espécie da família dos felinos, a cor dos olhos pode ser cinza, azul, verde ou castanho
e existem linhas puras de cada um dos 4 traços. Em cruzamentos separados envolvendo
progenitores homozigóticos, obtiveram-se os seguintes resultados:

Cruzamento P F1 F2
A verde x cinza todos verde ¾ verde: ¼ cinza
B verde x castanho todos verde ¾ verde: ¼ castanho
C cinza x castanho todos verde 9/16 verde
3/16 castanho
3/16 cinza
1/16 azul

a) Proceda a uma análise dos dados: quantos genes estão envolvidos? Defina os símbolos dos
genes e indique que genótipos correspondem a que fenótipos dos cruzamentos.
b) Num cruzamento entre um felino de olhos cinza e um de genótipo e fenótipo desconhecidos, a
geração F1 não foi observada. Contudo, a F2 resultou na mesma proporção F2 que no cruzamento
C. Determine os genótipos e os fenótipos dos felinos P e F1.

28
Aulas teórico-práticas de Genética Humana MD

17. No periquito, dois genes autossómicos (localizados em cromossomas separados) controlam a


produção do pigmento das penas. O gene B controla a produção de um pigmento azul, e o gene
Y controla a produção de um pigmento amarelo. Conhecem-se mutações recessivas em cada um
dos genes que interrompem a síntese dos respetivos pigmentos. Fez-se um cruzamento entre um
periquito azul de uma loja na Gandra e um periquito amarelo de uma loja em Lisboa. Ambos os
pássaros provêm de estirpes que originam descendência exatamente igual a eles próprios. Para
surpresa do criador amador, todos os periquitos F1 eram verdes. Após acasalamentos sucessivos,
uma geração F2 deu origem aos seguintes resultados:

92 verdes 31 azuis 29 amarelos 11 albinos

a) Explique o processo de hereditariedade da cor das penas, indicando que genótipos originaram
que fenótipos, assim como os genótipos dos indivíduos P, F1 e F2.
b) Preveja o resultado de um cruzamento-teste entre um pássaro verde de F1 e um pássaro albino.

18. Nos humanos, o daltonismo (verde/vermelho) é transmitido como um traço recessivo ligado ao
cromossoma X. Uma mulher com visão normal, mas cujo pai é daltónico, casa com um homem
com visão normal. Preveja o fenótipo da sua descendência do sexo feminino e masculino.

19. Duas mães deram à luz ao mesmo tempo num hospital central muito movimentado. O filho do
casal 1 sofre de hemofilia B, uma doença causada por um alelo recessivo ligado ao cromossoma
X, mas nenhum dos progenitores tem a doença. O casal 2 tem um filho normal, apesar de o pai
ter hemofilia. Alguns meses mais tarde, o casal 1 processou o hospital, afirmando que os dois
recém-nascidos teriam sido trocados na maternidade, logo após o nascimento. É-lhe pedido o seu
testemunho como perito em genética. Que informação pode fornecer ao juiz relativamente à
alegação?

20. O albinismo oculocutâneo de tipo III (OCA3) é recessivo e deve-se a mutações em 9p23. O
OCA5 é também um traço recessivo e deve-se a mutações em 4q24. Um senhor com OCA3 e
uma senhora com OCA5 casam: como serão os seus filhos?

29
Aulas teórico-práticas de Genética Humana MD

GENÉTICA QUANTITATIVA

1. Registaram-se os seguintes resultados quanto ao comprimento das folhas numa espécie de


planta:

Comprimento das folhas em cm

5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

Progenitores A 4 21 24 8
Progenitores B 3 11 12 15 26 15 10 7 2
F1 1 12 12 14 17 9 4

a) Para cada uma das estirpes de progenitores e para F1, calcule os valores médios para o
comprimento das folhas.
b) Compare a média de F1 com a de cada estirpe de progenitores. Que informações pode daí
retirar acerca da ação dos genes envolvidos?

2. Numa espécie de plantas, a altura varia entre 6 e 36 cm. Quando plantas de 6 cm e de 36 cm


são cruzadas, todas as plantas da F1 têm 21 cm. Na geração F2, cerca de 3 em cada 200 plantas
são tão baixas como o progenitor mais baixo (6 cm).
a) Que modelo de hereditariedade é ilustrado pelo exemplo e quantos pares de alelos estão
envolvidos?
b) Em que medida contribui cada alelo aditivo para a altura?
c) Enumere todos os genótipos que dão origem a plantas de 31 cm.
d) Num cruzamento independente do da F1 referido acima, uma planta de fenótipo e genótipo
desconhecidos foi sujeita a um cruzamento-teste com os seguintes resultados: ¼ 11 cm: 2/4 16
cm: 1/4 21 cm. A planta desconhecida só poderia ter um fenótipo, mas poderia ter um de três
genótipos. Quais eram fenótipo e genótipos?

3. Uma estirpe de plantas, quando cruzada entre si, tem uma altura média de 24 cm. Uma segunda
estirpe da mesma planta, vinda de outra região geográfica, também tem uma altura média de 24
cm. Quando plantas das duas estirpes são cruzadas, as plantas de F1 têm a mesma altura que as
plantas progenitoras. No entanto, a geração F2 mostra uma grande variedade de alturas; a maioria
das plantas têm 24 cm, mas cerca de 4 em 1000 têm apenas 12 cm de altura, e cerca de 4 em
1000 têm 36 cm de altura.
a) Que modo de hereditariedade está presente aqui?
b) Quantos pares de alelos estão envolvidos?
c) Em que medida contribui cada alelo para a altura das plantas?
d) Indique um conjunto possível de genótipos para os progenitores originais e plantas F1 que
pudessem dar estes resultados.

4. Nos seres humanos, a altura depende da ação aditiva dos genes. Parta do princípio de que este
traço é controlado pelos quatro loci R, S, T e U, e de que os efeitos ambientais são negligenciáveis.
a) Será que dois indivíduos de altura mediana podem originar descendentes muito mais altos ou
muito mais baixos do que si próprios (pais)? Como?
b) Se um indivíduo com a altura mínima especificada por estes genes casar com alguém de altura
intermédia ou moderada, poderá algum descendente deste casamento ser mais alto que o
progenitor mais alto? Porquê?

5. No oleandro (Nerium oleander), uma espécie de plantas ornamentais, a cor da flor de tipo
vermelho pode variar entre 7 tonalidades, vermelho intenso, vermelho, rosa escuro, rosa, rosa
claro, rosa pálido e branco. Um indivíduo com flores brancas, que origina descendência
exatamente igual a si próprio quando autofertlizado, foi cruzado com outro com flores rosa escuro
30
Aulas teórico-práticas de Genética Humana MD

que também origina descendência exatamente igual a si próprio quando autofertlizado. Quantos
pares de alelos estão envolvidos na determinação da cor destas flores? Que resultados F1 podem
ser previstos?

6. O comprimento médio e a variância do comprimento da corola em duas estirpes de Nicotiana


muito homogéneas, assim como da sua descendência, encontram-se expostos no quadro abaixo.
Uma das estirpes (P1) tem corola mais curta e a outra (P2) tem corola mais longa.

Estirpe Média (mm) Variância


P1 curto 40,47 3,12
P2 longo 93,75 3,87
F1 (P1 x P2) 63,90 4,74
F2 (F1 x F1) 68,72 47,70

Estime a hereditabilidade geral (H2) do comprimento da corola nesta planta.

7. Distinga entre variação contínua e descontínua.

8. Elabore uma lista com o máximo de traços humanos que conseguir, que tenham probabilidades
de estar sob controlo de um modo de hereditariedade poligénico.

9. Descreva a diferença entre penetrância e expressividade.

10. Defina e discuta a relevância genética dos seguintes termos:


a) Gémeos monozigóticos e dizigóticos
b) Concordância
c) Hereditabilidade

11. No quadro que se segue, são comparadas diferenças médias de altura e de peso entre pares
de gémeos monozigóticos (criados em conjunto ou separadamente), gémeos dizigóticos ou
irmãos, sempre do mesmo sexo. Tire o máximo de conclusões que conseguir no que diz respeito
aos efeitos da genética e do ambiente e à sua influência nestes dois traços humanos.

Traço MZ MZ DZ Irmãos
Criados juntos Criados Criados juntos Criados juntos
separadamente
Altura (cm) 1,7 1,8 4,4 4,5
Peso (kg) 1,9 4,5 4,5 4,7

12. Numa situação hipotética, o conteúdo de vitamina A e de colesterol dos ovos de uma grande
população de galinhas foi investigado em profundidade. As variâncias foram calculadas como se
mostra abaixo:
Traço
Variância Vitamina A Colesterol
VP 123,5 862,0
VE 96,2 484,6
VA 12,0 192,1
VD 15,3 185,3

a) Calcule a hereditabilidade restrita (h2) para ambos os traços.

31
Aulas teórico-práticas de Genética Humana MD

b) Se algum, qual deles tem maior probabilidade de reagir a uma seleção artificial?

13. Em estudos sobre a taxa de aprendizagem na Drosophila, as moscas podem ser treinadas a
evitar algumas pistas olfativas. Numa população registava-se uma média de 8,5 tentativas. Um
subgrupo desta população aprendia mais rapidamente (média = 6,0). Membros deste subgrupo
foram cruzados entre si e a sua descendência foi testada. Estas moscas apresentavam um tempo
de treino médio de 7,5 tentativas. Calcule e interprete a hereditabilidade restrita (h2) do treino
olfativo na Drosophila.

14. Estudou-se uma população de tomateiros cujos frutos tinham um peso médio de 60g: sabe-se
que, para este traço nesta população, h2 = 0,3. Se a partir da população original selecionarmos
plantas que produzem frutos de 80g e as cruzarmos entre si, preveja os resultados desta seleção
artificial (o peso médio dos tomates na descendência).

15. Os consumidores querem, cada vez mais, carne de porco menos gorda. Numa população de
porcos em estudo, a espessura média da camada de gordura é de 8 cm. Foram selecionados
indivíduos da população que apresentavam uma camada média de 5 cm. A F1 tem uma camada
de gordura de 7 cm: calcule a h2 para este traço. Como interpreta o valor de hereditabilidade para
este traço? Que consequências traz este resultado na estratégia de seleção?

32
Aulas teórico-práticas de Genética Humana MD

CÁLCULOS DE RISCOS EM FAMÍLIAS COM DOENÇAS HEREDITÁRIAS

Nota: no fim das vossas contas, convertam sempre o resultado da probabilidade num valor fácil
de perceber para um leigo, mesmo que aproximado (ex: 1/1024  “menos que 1 para mil”; ou
0,0023  “entre 2 e 3 para mil”; ou 0,47  47%)

1. No pedigree abaixo representa-se o traço autossómico dominante acondroplasia, uma forma


rara de nanismo. Assumindo penetrância completa, a probabilidade de que os indivíduos III-1 e III-
2 venham a ter uma criança afetada é de (a) zero, (b) ¼, (c) ½, (d) 1/16, (e) 1/32, (f) nenhuma
destas hipóteses.

2. Telmo e Sara (IV-3 e IV-4) desejam casar-se mas desconhecem que partilham de um
antepassado, neste caso a sua avó / bisavó (I-2) que era heterozigótica para uma doença
autossómica recessiva muito rara. A probabilidade de que a sua primeira criança seja afetada é
de: (a) 1/16, (b) 1/64, (c) 1/128, (d) 1/1024, (e) nenhuma destas hipóteses.

3. Dois indivíduos fenotipicamente normais casam-se. Embora o desconheçam, têm um bisavô


comum que sofria de uma doença rara na população geral, que é transmitida como um traço
autossómico recessivo (dd). Assuma que todos os cônjuges vindos de fora da família são DD, que
não houve consanguinidade prévia e que não houve previamente indivíduos afetados na família.
Qual é a probabilidade de que o seu primeiro bebé seja uma menina e seja afetada? Desenhe este
pedigree.

4. Laura e Miguel (II-5 e II-6) encontraram-se numa conferência sobre uma doença metabólica
rara, que é herdada de modo autossómico recessivo. Ambos têm pelo menos um irmão afetado
com esta doença. Apaixonaram-se, mas ficaram apreensivos no que respeita à possibilidade de
terem filhos, porque sabem que a probabilidade de que o seu primeiro filho venha a sofrer da
mesma doença é de (a) ½, (b) ¼, (c) 1/8, (d) 1/9, (e) 1/10, (f) 1/16, (g) 1/32.

33
Aulas teórico-práticas de Genética Humana MD

5. Considere o pedigree abaixo:

a) Qual o padrão de transmissão mais consistente com este pedigree?


1. Autossómico recessivo
2. Autossómico dominante
3. Ligado ao X recessivo
4. Ligado ao X dominante
b) Se a senhora V-2 se casar com um indivíduo normal, e se a doença tiver uma penetrância de
85%, qual é a probabilidade de que o seu filho seja afetado? c) Na terceira linha, o que significa o
losango com um 10 no meio? d) Calcule qual é o risco de a senhora V-2 e marido terem 3 filhos
doentes num total de 4 e compare-o com o caso em que a penetrância fosse completa.

6. O pedigree abaixo é para um traço com 100% de penetrância. O traço não é necessariamente
invulgar na população em geral, mas o indivíduo I-1 é homozigótico normal.

a) Qual é o modo mais provável de transmissão?


b) Qual é a probabilidade de que uma criança resultante do cruzamento entre irmãos (II-3 e II-4)
apresente o traço?
c) Qual é a probabilidade de que uma criança resultante do cruzamento entre os primos de primeiro
grau III-2 e III-3 apresente o traço?

34
Aulas teórico-práticas de Genética Humana MD

7. Que tipo de hereditariedade é ilustrada neste pedigree? Refira alguns traços seus conhecidos
que encaixem neste modo de hereditariedade. Qual é a probabilidade de os filhos de V-1
expressarem o traço? E os filhos de V-2? E V-3?

8. Considere o pedigree seguinte representando a segregação de um traço com 100% de


penetrância.

a) O modo mais provável de hereditariedade deste traço é:


1. Ligado ao X dominante
2. Ligado ao X recessivo
3. Autossómico recessivo
4. Autossómico dominante
b) Se o indivíduo V-2 se casar com uma senhora normal homozigótica, qual é a probabilidade de
o seu primeiro filho ter o traço? E de ser portador do alelo mutado?
c) E no caso da senhora V-4 casar com um homem de outra família, qual é a probabilidade de o
seu primeiro filho ter o traço? Se este casal quiser ter 4 filhos, qual é a probabilidade de nenhum
apresentar o traço?

9. Este pedigree representa um traço autossómico recessivo raro. A probabilidade de que um filho
de III-4 e III-5 apresente o traço é (a) ½, (b) ¼, (c) 1/8, (d)1/12, (e) 1/16, (f) 1/32, (g) 1/64, (h)
nenhuma destas hipóteses?

35
Aulas teórico-práticas de Genética Humana MD

10. Que padrão de hereditariedade é ilustrado na árvore familiar que se segue? Qual é a
probabilidade de que a descendência representada com um ponto de interrogação venha a
expressar o traço se for do sexo masculino? Qual é a probabilidade de expressar se o filho for do
sexo feminino?

11. O que pode dizer ao probando sobre a hereditariedade do traço que ele manifesta? Como
explicaria a entrada do alelo para a família? Calcule a probabilidade de os indivíduos VI-2, VI-4,
VI-5, VII-3 e VII-5 serem portadores.

12. Mostra-se aqui um pedigree para a polidactilia em humanos. Qual o modo de transmissão da
polidactilia? Diga que pistas lhe sugerem essa hipótese como a mais provável. Calcule a
probabilidade de o senhor II-8 ser portador do alelo. Qual é a probabilidade desse senhor ter um
filho com polidactilia com uma senhora de fora da família?

36
Aulas teórico-práticas de Genética Humana MD

13. O pedigree abaixo mostra o modo de transmissão de dois traços. Um, representado com linhas
diagonais, é a hereditariedade de um marcador de ADN, outro, representado com símbolos pretos,
é o daltonismo completo, em que os indivíduos afetados vêem os objetos apenas em sombras de
preto, cinzento e branco.

a) Como os dois traços segregam no mesmo pedigree, poderíamos classificar a expressão


genética como pleiotrópica? Porquê?
b) Qual o padrão de hereditariedade apresentado por cada um dos traços?
c) Se IV-5 casasse com IV-16, qual seria a probabilidade de o seu primeiro filho ter o marcador de
ADN?
d) Qual a probabilidade de o seu primeiro filho apresentar daltonismo completo?
e) Qual a probabilidade de a primeira criança ser portadora do daltonismo e apresentar o marcador
de ADN?

Nota: o daltonismo completo pode ser acromatópsia (ausência de cones) ou cone monochromacy
(só um tipo de cones – mais frequentemente só azuis > genes das opsinas verde e vermelho do
cr. X não funcionais).

37
Aulas teórico-práticas de Genética Humana MD

VARIAÇÃO CROMOSSÓMICA E DETERMINAÇÃO SEXUAL

1. Faça um esquema de meiose normal numa mulher de genótipo X1X2 e num homem X3Y e
preveja as combinações de gâmetas possíveis. Pense em todos os processo de não-disjunção
que, durante as meioses esquematizadas acima, deem origem a uma descendência com síndrome
a) de Klinefelter ou b) de Turner, ou c) uma filha XXX ou d) um filho XYY, após fertilização com um
segundo gâmeta normal.

2. Uma mulher com síndrome de Turner também exprime o traço, ligado ao cromossoma X, da
hemofilia, tal como o pai. Que progenitor passou por uma não-disjunção durante a meiose, dando
origem ao gâmeta responsável pela síndrome?

3. O antigénio de superfície celular Xg é codificado por um gene que está localizado no


cromossoma X. Não há nenhum gene equivalente no cromossoma Y. Dois alelos codominantes
deste gene foram identificados: Xg1 e Xg2. Uma mulher de genótipo Xg2/Xg2 casa com um
homem de genótipo Xg1/Y, e tem um filho com a síndrome de Klinefelter de genótipo Xg2/Xg1/Y.
Usando terminologia genética apropriada, explique sucintamente como foi gerado este indivíduo.
Em que progenitor e em que divisão meiótica ocorreu o erro?

4. Em humanos, sabe-se que a síndrome de Hunter é uma característica recessiva ligada ao


cromossoma X com penetrância completa. Na família A, dois progenitores fenotipicamente
normais tiveram um rapaz normal, uma filha com as síndromes de Hunter e de Turner, e um rapaz
com a síndrome de Hunter.
Na família B, dois progenitores fenotipicamente normais tiveram duas filhas fenotipicamente
normais e um rapaz com as síndromes de Hunter e Klinefelter. Para cada família, explique a origem
do cariótipo das crianças sublinhadas.

5. O que é um corpúsculo de Barr?

6. Indique o número esperado de corpúsculos de Barr nas células de interfase nos seguintes
indivíduos: síndrome de Klinefelter, síndrome de Turner, cariótipos 47, XYY, 47, XXX e 48, XXXX.

7. Defina a hipótese de Lyon.

8. Relacione o efeito potencial da hipótese de Lyon na retina de uma mulher heterozigótica para o
traço de daltonismo verde-vermelho, ligado ao cromossoma X.

9. Os criadores de gatos sabem que os gatinhos que exprimem a pelagem com padrão calico
(branco com manchas castanho-escuro e laranja), ligada ao cromossoma X, são quase sempre
fêmeas. Porquê?

10. Uma criança nasceu com síndrome de Klinefelter, filho de uma mulher fenotipicamente normal
e de um homem que tem um problema de pele chamado displasia ectodérmica anidrótica, uma
condição ligada ao cromossoma X. A pele da mãe é completamente normal sem quaisquer sinais
de problemas. Em contrapartida, o seu filho tem zonas de pele normal e zonas de pele anormal.
a) Qual dos progenitores contribuiu com o gâmeta anormal?
b) Usando a terminologia genética adequada, descreva o erro meiótico ocorrido. Não se esqueça
de indicar em que divisão ocorreu o erro.
c) Utilizando a terminologia genética adequada, explique o fenótipo da pele do filho.

11. Para o cr. X existem mecanismos de compensação de dosagem (a lyonização): o que é que
isto nos sugere acerca da expressão da informação genética contida no cr. X?
38
Aulas teórico-práticas de Genética Humana MD

12. Discuta as possíveis razões para a proporção machos/fêmeas à nascença ser tão alta em
humanos (1,06 a 1,25).

13. Foi sugerido que os genes determinantes do desenvolvimento sexual masculino existentes no
cromossoma Y nos seres humanos não deveriam estar localizados nas pequenas regiões que
entram em sinapse com o cromossoma X durante a meiose (regiões pseudoautossómicas, PARs).
Qual poderia ser o resultado se estes genes estivessem aí localizados?

14. O gene SRY está situado no cromossoma Y, muito próximo da região que recombina com o
cromossoma X durante a meiose (PAR). Partindo desta informação, proponha um modelo para
explicar a geração (muito rara) de homens XXSRY (com um pedaço do Y contendo SRY translocado
para o cromossoma X).

15. Defina e distinga entre os seguintes pares de termos:


a) aneuploidia/euploidia
b) monossomia/trissomia
c) síndrome de Patau/síndrome de Edwards
d) autopoliploidia/alopoliploidia
e) autotetraploide/anfidiploide
f) politenia/endopoliploidia
g) inversão paracêntrica/inversão pericêntrica

16. Compare o tempo de sobrevivência de indivíduos com síndrome de Down, síndrome de Patau
e síndrome de Edwards. Como são normalmente justificadas tais diferenças?

17. Que dado sugere que a síndrome de Down é mais vezes resultado de não-disjunção durante
a oogénese do que durante a espermatogénese?

18. Compare a síndrome de Down esporádica com a s. de Down familiar.

19. Existem indivíduos com trissomia 21 apenas em parte das células do seu corpo (mosaicismo)
que têm sintomas de síndrome de Down proporcionalmente mais leves. A trissomia 8 completa é
letal, leva a aborto espontâneo. No entanto existem indivíduos com trissomia 8 parcial (pode
consultar http://en.wikipedia.org/wiki/Trisomy_8). Explique como se originam estes casos de
mosaicismo.

20. Observe os esquemas dos slides da aula de Variações Cromossómicas acerca da


Translocação Robertsoniana. Este tipo de translocação pode acontecer da mesma forma entre
outros pares de cromossomas acrocêntricos. Também nestes casos, se a translocação for
recíproca e balançada, os portadores são saudáveis. No entanto os eventos possíveis na altura
de um portador ter filhos são um bocado diferentes do caso t(14;21): imagine o caso de um
portador com translocação (14;22) e preveja todas as combinações e as consequências.

21. Sabe-se que seres humanos com cariótipos aneuploides podem ocorrer, mas são
normalmente inviáveis. Quais são as razões desta falta de viabilidade?

22. Que conclusões foram tiradas sobre a aneuploidia em humano como resultado de análises
cariotípicas de abortos espontâneos?

23. Mostre o contraste existente entre a fertilidade de uma planta alotetraploide e a de uma
autotriploide e a de uma autotetraploide.
24. Quando duas plantas pertencentes ao mesmo género, mas a diferentes espécies, foram
cruzadas entre si, a geração híbrida F1 era mais viável e tinha flores mais ornamentadas.
39
Aulas teórico-práticas de Genética Humana MD

Infelizmente este híbrido era estéril e só podia ser propagado através de cortes vegetativos.
Explique a esterilidade do híbrido. Como pode um “horticultor experimental” tentar reverter a sua
esterilidade?

25. A Primavera, Primula kewensis, tem 36 cromossomas e um aspeto semelhante ao de duas


espécies do mesmo género, a Primula floribunda (2n=18) e a Primula verticillata (2n=18). Como
pode a Primula kewensis derivar destas espécies? Em termos genéticos, como descreveria a
Primula kewensis?

26. Conhecem-se variedades de crisântemos que contêm 18, 36, 54, 72 ou 90 cromossomas,
todos eles são múltiplos de um conjunto básico de 9 cromossomas. Como descreveria,
geneticamente, estas variedades? Que característica é partilhada pelos cariótipos de cada
variedade? Foi descoberta uma variedade com 27 cromossomas, mas era estéril. Porquê?

27. Para uma espécie com um número diploide de 14, indique quantos cromossomas estariam
presentes nos núcleos somáticos de indivíduos haploides, triploides, tetraploides, trissómicos e
monossómicos. Aplique a mesma ideia ao caso humano.

28. Preveja como podem aparecer as configurações sinápticas de pares homólogos de


cromossomas quando um membro é normal e o outro membro sofreu uma deleção ou uma
duplicação.

29. Diz-se que as inversões “suprimem o crossing-over”. Esta terminologia está tecnicamente
correta? Se não, reformule esta descrição com mais precisão.

30. Um casal, ao realizar o planeamento familiar, tomou consciência de que ao longo das três
gerações passadas, do lado do marido, havia um número substancial de abortos espontâneos e
nados-mortos, e tinham nascido vários bebés com malformações que viriam a morrer em criança.
A mulher tinha estudado genética e instigou o seu marido a visitar uma clínica de aconselhamento
genético, onde foi realizada posteriormente uma análise completa de cariótipo com bandeamento.
Embora se tenha descoberto que ele tinha um complemento normal de 46 cromossomas, a análise
do bandeamento revelou que um membro do par do cromossoma 1 (no grupo A) continha uma
inversão que cobria 70% do seu comprimento. O homólogo do cromossoma 1 e todos os outros
cromossomas mostravam uma sequência de bandeamento normal.
a) Como explica a alta incidência passada de abortos espontâneos?
b) Como procederia a fim de prever a probabilidade de normalidade/anormalidade dos seus futuros
descendentes?
c) Aconselharia a mulher a levar cada gravidez a termo para determinar se o feto era ou não
normal? Se não, o que a aconselharia a fazer?

31. Os genes contendo a informação relativa às proteínas de deteção das cores (opsinas)
vermelho e verde, no olho do ser humano, estão localizados um junto ao outro no cromossoma X
e provavelmente foram originados durante a evolução a partir de um gene pigmentar ancestral
comum. Os dois genes têm sequências com identidade elevada. Uma mulher normal com uma
cópia de cada gene em cada um dos seus cromossomas X tem um filho daltónico para vermelho
e verde, que evidenciou conter uma cópia do gene verde e nenhuma cópia do gene vermelho
(gene ausente). Elabore uma explicação ao nível cromossómico (durante a meiose) que explique
estas observações.

40
Aulas teórico-práticas de Genética Humana MD

32. Costuma dizer-se que quanto maior o cromossoma, piores os efeitos da trissomia. O cr. X é
um cromossoma humano bastante grande e no entanto uma mulher XXX tem geralmente poucos
problemas (muitas vezes nem sabe de ter a trissomia): como explica esta aparente contradição?

33. Um(a) senhor(a) é portador(a) saudável da translocação Robertsoniana 14:21. O(a)


senhor(a) quer ter um filho: qual é a probabilidade que a gravidez chegue a bom fim e que o
bebé tenha o mesmo cariótipo do progenitor? Agora imagine que o(a) senhor(a) já teve um filho
saudável: qual é a probabilidade dele(a) (o filho) ser portador da translocação?

34. No pedigree duma família com hemofilia B (XR*) repara que a doença num pedigree passou
de pai para filho: arranje todas as explicações possíveis (mesmo as menos prováveis) para
justificar este caso. (*não há dúvida: foi comprovada uma mutação no gene F7 no cr. X)

41
Aulas teórico-práticas de Genética Humana MD

LIGAÇÃO, CROSSING-OVER E MAPEAMENTO GENÉTICO

1. No que se refere à cor da pelagem nos coelhos, preto (B) é dominante em relação ao castanho
(b), enquanto o tipo liso (C) é dominante em relação ao chinchila (Cch). Os genes que controlam
estes traços estão ligados. Um coelho heterozigótico para ambos os traços, e exprimindo uma
pelagem preta e lisa, foi cruzado com um coelho castanho e chinchila, e em várias ninhadas
sucessivas, deu os seguintes resultados globais:
31 castanho, chinchila
35 preto, liso
16 castanho, liso
19 preto, chinchila

Demonstre estatisticamente que esta distribuição é diferente da 1:1:1:1 e determine as


combinações de alelos no progenitor heterozigótico e estime a distância entre os dois genes.

2. No milho, a aleurona colorida (no grão) é causada pelo alelo dominante R. O alelo recessivo r,
quando em homozigotia, produz aleurona incolor. A cor da planta (folhas) é controlada pelo par de
alelos Y e y. O alelo dominante Y resulta em cor verde, enquanto a presença homozigótica do
alelo recessivo y faz com que as folhas sejam amarelas. Num cruzamento-teste entre uma planta
de fenótipo e genótipo desconhecidos e uma planta homozigótica recessiva para ambos os traços,
obteve-se a seguinte descendência:

grão, folhas

Colorido, amarelas 88
Colorido, verdes 12
Incolor, amarelas 8
Incolor, verdes 92

Explique como se obtiveram estes resultados, determinando o fenótipo e o genótipo exatos da


planta desconhecida, incluindo o arranjo dos dois genes nos cromossomas homólogos.

3. Considere hipoteticamente dois genes autossómicos A e B. Quando se realiza um cruzamento-


teste entre um heterozigoto (AaBb) e um mutante homozigoto-duplo (aabb), preveja as proporções
fenotípicas na descendência sob as seguintes condições:
a) A e B estão localizados em autossomas separados;
b) A e B estão ligados ao mesmo autossoma, mas estão muito afastados;
c) A e B estão ligados ao mesmo autossoma, a uma distância de cerca de 10 cM um do outro;
d) A e B estão ligados ao mesmo autossoma, mas estão tão próximos que quase nunca ocorre
um crossing-over.

4. Suponha que investigamos os 50 filhos de 27 casais em que um dos dois membros do casal é
albino (mutação recessiva no gene TYR) e com audição normal, enquanto o outro tem surdez
causada por uma mutação dominante no gene MYO7A e é portador da mutação no gene TYR,
(ambas herdadas de um dos seus pais). Dos 50 filhos da amostra, 3 são normais, 21 são surdos,
22 são albinos e 4 são surdos e albinos. Estime a distância entre os 2 genes.

5. No tomateiro sabe-se que os genes m, d e p encontram-se nesta ordem no cromossoma 1. (M


= folhas normais uniformemente verdes; m = folhas com manchas claras; D = planta de altura
normal; d = planta anã; P = frutos normais; p = frutos mais achatados, como um pêssego). Foram
realizados os seguintes cruzamentos:
a) plantas heterozigóticas altas e com folhas verdes x anãs e manchadas

42
Aulas teórico-práticas de Genética Humana MD

Resultados altas, verdes 19


altas, manchadas 35
anãs, verdes 42
anãs, manchadas 22

b) plantas heterozigóticas altas e com frutos normais x anãs e com frutos achatados

resultados altas, normais 40


altas, achatados 11
anãs, normais 14
anãs, achatados 39
Escreva o esquema dos dois cruzamentos, deduza para ambos se os alelos dominantes estavam
em cis ou trans (arranjo dos alelos) e a distância entre os genes. Qual é a distância estimada entre
os genes m e p? Se fizesse um cruzamento teste com um dihíbrido Mm Pp, que percentagem de
recombinantes esperaria obter?

6. Numa série de cruzamentos para mapeamento two-point, envolvendo três genes ligados ao
cromossoma 3 na Drosophila, foram calculadas as seguintes distâncias:

cd-sr 13 cM
cd-ro 16 cM

a) É possível determinar a sequência e construir um mapa destes três genes? Porquê?


b) Que dados de mapeamento poderão esclarecer a situação?

7. Na Drosophila, os genes asa ondulada (dp), olho coagulado (cl) e sem asa (ap) estão ligados
no cromossoma 2. Numa série de cruzamentos para mapeamento two-point, foram determinadas
as seguintes distâncias genéticas (em cM):
dp-ap 42
dp-cl 3
ap-cl 39

Qual é a sequência (ordem) dos três genes?

8. Numa série de cruzamentos para mapeamento two-point, envolvendo cinco genes localizados
no cromossoma 2 na Drosophila, foram observadas as seguintes frequências de recombinantes
(crossing-overs simples):
%
pr-adp 29
pr-vg 13
pr-c 21
pr-b 6
adp-b 35
adp-c 8
adp-vg 16
vg-b 19
vg-c 8
c-b 27

a) Construa um mapa destes genes, partindo do princípio de que o gene adp está presente perto
do fim do cromossoma 2 (locus 83).
b) Numa outra série de experiências, um sexto gene, d, foi testado em relação a b e a pr.

43
Aulas teórico-práticas de Genética Humana MD

d-b 17%
d-pr 23%

Preveja os resultados de mapeamentos two-point entre d e c, d e vg, e d e adp.

9. Os genes b (black body) e rd (reduced bristles = cerdas curtas) estão em loci a 48,5 cM e 51,0
cM do mapa do cromossoma II de Drosophila melanogaster, respetivamente. Que frequências está
à espera de obter num cruzamento entre
fêmeas e machos
+ rd b rd ?
b + b rd

(deduza as 4 classes genotípicas, fenotípicas e as frequências). E se invertêssemos os sexos do


casal: macho + rd / b + e fêmea b rd / b rd?

10. Ao lado encontra um mapa do braço comprido do cromossoma 18


humano. Imagine que consegue encontrar 64 casais em que um dos
membros é heterozigótico no seu genótipo dos marcadores D18S1357
e D18S858 enquanto o outro é homozigótico e com alelos diferentes.
Estes 64 casais no seu conjunto têm 109 filhos. Em quantos filhos está
à espera de encontrar um cromossoma 18 igual a um dos cromossomas
18 do seu progenitor heterozigótico?

44
Aulas teórico-práticas de Genética Humana MD

MUTAÇÃO GÉNICA E REPARAÇÃO DO ADN

1. Classifique a mutação em cada um dos casos mostrados em baixo (1-5) utilizando os seguintes
termos: transição, transversão, silenciosa, neutra, missense, nonsense, deleção, inserção,
frameshift. (* = STOP; cada mutação pode admitir mais que um descritor)

sequência M D D Q S R M L Q T L A G V N L
originária ATG GAC GAT CAA TCC AGG ATG CTG CAG ACT CTG GCC GGG GTG AAC CTG

M D D Q S R M L P D S G R G E P
mut 1 ATG GAC GAT CAA TCC AGG ATG CTG CCA GAC TCT GGC CGG GGT GAA CCT

M D D Q S R M L Q T L A G V N L
mut 2 ATG GAC GAT CAA TCC AGG ATG CTG CAA ACT CTG GCC GGG GTG AAC CTG

M D D Q S R M L *
mut 3 ATG GAC GAT CAA TCC AGG ATG CTG TAG ACT CTG GCC GGG GTG AAC CTG

M D D Q S R M L K T L A G V N L
mut 4 ATG GAC GAT CAA TCC AGG ATG CTG AAG ACT CTG GCC GGG GTG AAC CTG

M D D Q S R M L H S G R G E P
mut 5 ATG GAC GAT CAA TCC AGG ATG CTG CAC TCT GGC CGG GGT GAA CCT G

2. Baseie-se na seguinte sequência de ADN para responder a estas perguntas:

5’ TCG TTT AAG GGC TTG TGC ... GCC ACG GAT 3’ Cadeia sense
3’ AGC AAA TTC CCG AAC ACG ... CGG TGC CTA 5’ Cadeia antisense
1 2 3 4

a) Um par de bases é acrescentado como resultado da exposição a corantes de acridina. Em que


posição (2 ou 4) esta substância teria um efeito mais prejudicial sobre o produto genético?
Explique.
b) Como se chama a mutação resultante?
c) Terá mais probabilidades de produzir uma substituição de aminoácido a substituição de uma
base na extremidade 3’ do codão ou na extremidade 5’? Explique usando com exemplo o codão
denominado 3 (caixa).
d) Um par de bases G:C foi acrescentado na posição 1 (seta). Que efeito terá esta mutação no
produto do gene?

3. No bacteriófago T4, uma mutação frameshift +1 (desvio da grelha de leitura por adição de um
nucleotídeo) é suprimida por uma outra mutação frameshift –1, noutra posição do gene. Os
primeiros 10 aminoácidos da proteína de tipo selvagem são:

Met Phe Trp Ala Leu Glu Ser Met Asp Pro

e os 10 aminoácidos da proteína resultante da dupla mutação de frameshift são:

Met Phe Cys Gly Val Gly Glu His Asp Pro
45
Aulas teórico-práticas de Genética Humana MD

Quais são e onde se encontram as alterações associadas às mutações + e -, e qual é a sequência


de ARNm para os primeiros 10 aminoácidos, tanto para a proteína inicial de tipo selvagem como
para a proteína duplamente mutante?

4. O aquecimento provoca a separação dos ácidos nucleicos de cadeia dupla nas suas cadeias
constituintes, e o arrefecimento permite o emparelhamento (por formação de pontes de hidrogénio)
de duas cadeias com sequências complementares. Parta do princípio que o ADN de cadeia dupla
de um gene codificante para um polipeptídeo específico nas galinhas é aquecido e separado.
a) Alguma desta substância é colocada juntamente com ARN do núcleo de certas células
especializadas que produzem uma grande quantidade deste polipeptídeo. A mistura é arrefecida,
a fim de permitir que as cadeias complementares se liguem. A observação ao microscópio
eletrónico das preparações mostra ácidos nucleicos de cadeia simples e de cadeia dupla. Existem
dois tipos de ácido nucleico de cadeia dupla.
1

O que representam estas duas configurações?

b) Se acrescentar, à mesma preparação de ADN, ARN do citoplasma destas mesmas células


especializadas, dando-se uma ligação de cadeias complementares, podem observar-se ácidos
nucleicos de cadeia simples e de cadeia dupla, e mais uma vez, existem dois tipos diferentes de
ácidos nucleicos de cadeia dupla.

O que representam estas duas configurações?

5. O diagrama seguinte descreve a sequência de nucleotídeos de ARNm de parte da proteína do


gene A e o princípio da proteína do gene B do bacteriófago X174.

363 364 365 366 367 368 369 370 371 372 373 374 375 ... 513
A Ala Lys Glu Trp Asn Asn Ser Leu Lys Thr Lys Leu Ser
GCU AAA GAA UGG AAC AAC UCA CUA AAA ACC AAG CUG UCG ...
B Met Glu Gln Leu Thr Lys Asn Gln Ala Val
1 2 3 4 5 6 7 8 9 10 ... 120

O gene B está completamente contido no gene A. Dadas as seguintes substituições de bases,


descreva as substituições de aminoácidos que vão ocorrer nas duas proteínas:
AAC na posição 368 é mutado para UAC
CUA na posição 370 é mutado para CCA
CAA na posição 8 na proteína B é mutado para CUA.

46
Aulas teórico-práticas de Genética Humana MD

6. O análogo de base 2-amino purina (2-AP) substitui


a adenina durante a replicação de ADN, mas pode
emparelhar com a citosina. O análogo de base 5-
bromo uracilo (5-BU) substitui a timidina, mas pode
emparelhar com a guanina. Siga a sequência de
trinucleotídeos de cadeia dupla apresentada na figura
abaixo, através de 2 ciclos de replicação (Round II e
Raound III), partindo do princípio de que no primeiro
ciclo, ambos os análogos estão presentes. No ciclos
de replicação a seguir já não estão presentes na
célula. Que sequências finais se produzem?

7. Foi estudada uma rara mutação dominante em seres humanos que se exprime à nascença. Os
registos demonstraram que em 40 000 nascimentos vivos tinham sido descobertos 6 casos. A
história familiar revelou que, em dois casos, a mutação já estava presente num dos progenitores.
Calcule a taxa de mutação espontânea para essa mutação (nº de muts novas por alelo do gene).

8. Considere as seguintes estimativas:


(i) Há 7x109 seres humanos a viver no planeta
(ii) Cada indivíduo tem 23 000 (2,3 x 104) genes codificantes
(iii) A taxa média de mutação por alelo em cada locus é 10-5

a) Quantas novas mutações espontâneas estão neste momento presentes na população humana?
b) Partindo do princípio de que estas mutações estão uniformemente distribuídas entre todos os
genes, quantos novos alelos apareceram neste última geração em cada locus?

9. Qual é a diferença entre uma aberração cromossómica e uma mutação génica?

10. Discuta a importância das mutações para o estudo da Genética.

11. Pensa-se que a maior parte das mutações são deletérias. Sendo assim, será razoável afirmar
que as mutações são essenciais ao processo evolutivo? Porquê?

12. Por que razão supõe que uma mutação aleatória tem mais probabilidades de ser deletéria do
que benéfica?

13. Muitas mutações num organismo diploide são recessivas. Porquê?

14. Qual é o significado de mutação letal condicional?

15. Compare as implicações da ocorrência de mutações em tecidos somáticos e gaméticos.

47
Aulas teórico-práticas de Genética Humana MD

16. Descreva o tautomerismo e a forma pela qual este evento químico poderá conduzir a mutação.

17. Contraste e compare os efeitos mutagénicos de agentes desaminantes, agentes alquilantes e


análogos de bases.

18. Os corantes de acridina induzem mutações de frameshift. Serão estas mutações mais
prejudiciais do que mutações pontuais em que uma pirimidina ou purina foi substituída?

19. Explique porquê é que os raios X são mais mutagénicos que a radiação UV e contraste a
indução de mutações pelos raios X e radiação UV.

20. Compare os vários tipos de mecanismos de reparação do ADN.

21. A mamografia é uma técnica de rastreio para a deteção precoce do cancro da mama. Uma vez
que esta técnica utiliza raios X no diagnóstico, tem sido muito controversa. Explique porquê. Quais
as razões que justificam o uso de raios X neste tipo de diagnóstico médico?

22. Descreva o teste de Ames para rasteio de potenciais mutagénios ambientais. Porque é que se
considera que um composto positivo para o teste da Ames poderá ser também carcinogénico?

23. Qual o defeito genético que provoca a doença xeroderma pigmentoso em humanos? Como se
relaciona este defeito com o fenótipo associado à doença?

24. Distinga transições de transversões. Usando as bases do ADN (A, T, G, C), faça uma listagem
com os quatro tipos de transições e os 8 tipos de transversões.

48
Aulas teórico-práticas de Genética Humana MD

T ECNOLOGIA DE ADN RECOMBINANTE E APLICAÇÕES

1. O local de reconhecimento para a enzima de restrição Sau3AI é GATC (ver figura página
seguinte). A sequência de reconhecimento para a enzima BamHI é GGATCC, onde as quatro
bases internas são idênticas à sequência Sau3AI. Podem verificar que as extremidades de cadeia
simples produzidas pelas duas enzimas são idênticas. Parta do princípio de que tem um vetor de
clonagem contendo um local BamHI, e um ADN desconhecido que cortou com Sau3AI.
a) Será que este ADN pode ser ligado ao local BamHI do vetor? Porquê?
b) Será que o segmento de ADN clonado neste local pode ser cortado com Sau3AI? E com
BamHI? Que problemas potenciais prevê quanto ao uso de BamHI?

2. Em estudos de ADN recombinante, qual é o papel desempenhado por: endonucleases de


restrição, vetores, cloreto de cálcio e células hospedeiras?

3. Distinga plasmídeo de vetor plasmídico.

4. Descreva as características necessárias a uma molécula de ADN para que possa ser utilizada
como vetor de clonagem.

5. Ao realizar uma sequenciação de ADN num segmento de ADN clonado, obteve-se a seguinte
sequência nucleotídica:

GCTCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTTACGGTTACCTTGTTACGACTTCACCCCAAT
CATTTGTCCCACCTTCGACGGCTAGCTCCATAAATGGTTACTCCACCGGCTTCGGGTGTTACAAACTCTCGTGGTGTGAC
GGGCGGTGTGTACAAGACCCGGGAACGTATTCACCGTAGCATGCTGATCTACGATTACTAGCGATTCCAGCTTCATGTAG
TCGAGTTGCAGACTACAATCCGAACTGAGAACAACTTTATGGGATTTGCT

Será que este segmento contém locais de reconhecimento para os enzimas de restrição EcoRI,
HindIII ou BamHI? Consulte a tabela da página a seguir, onde pode ver uma lista de locais de
reconhecimento para alguns enzimas de restrição. No entanto, hoje em dia estes estudos são
todos realizados no computador: experimente analisar a sequencia acima com o programa que
encontra em http://tools.neb.com/NEBcutter2/. Experimente também produzir um mapa de
restrição do cDNA da insulina humana (GenBank number: NM_000207. Use a opção “linear”).

6. A figura da página seguinte contém uma lista de enzimas de restrição que reconhecem
sequências de quatro bases ou de seis bases. Com que frequência média deverá ocorrer num
genoma equilibrado (conteúdo de GC = 50%) uma sequência de reconhecimento de quatro bases?
E de seis? Se a sequência de reconhecimento consistir de oito bases, com que frequência serão
encontradas tais sequências? Em que circunstâncias escolheria utilizar uma tal enzima?

7. Com que frequência média corta o enzima EcoRI num genoma com GC% = 70% ? e num
genoma com GC% = 40% ?

8. O enzima de restrição BsaJI corta a sequência CCNNGG (onde N é uma base qualquer). Com
que frequência média cortará este enzima (num genoma com G+C = 50%)?

49
Aulas teórico-práticas de Genética Humana MD

9. Descreva as etapas de cada ciclo de PCR (Reação em Cadeia da Polimerase).


a) Refira as vantagens e desvantagens desta técnica de análise de ácidos nucleicos.
b) Porquê é que a utilização da enzima Taq polimerase permitiu a automatização desta técnica?

10. Considere um plasmídeo que contém parte de um gene de Drosophila melanogaster. O


fragmento génico possui 303 pb. Imagine que se pretende amplificar este fragmento por PCR e
que são desenhados primers de 19 nucleotídeos de comprimento complementares às sequências
plasmídicas imediatamente adjacentes às 2 extremidades do local de clonagem.
Qual o tamanho exato do produto de PCR resultante?

50
Aulas teórico-práticas de Genética Humana MD

11. Diga em que consiste a deteção de STRs (short tandem repeats) pela técnica de PCR e quais
as aplicações desta tecnologia.

12. A figura seguinte representa o resultado obtido numa eletroforese de sequenciação automática
de ADN. Faça a leitura da sequência sabendo que os fluorocromos verde, vermelho, preto e azul
representam, respetivamente, as bases A, T, G e C.

Verde; Preto; Vermelho; Azul

13. Embora a captura e o comércio de grande símios tenha sido banida em 112 países desde
1973, estima-se que cerca de 1000 chimpanzés são removidos anualmente de África e vendidos
em contrabando para a Europa, Estados Unidos e Japão. Este comércio ilegal é frequentemente
disfarçado pelos proprietários privados (como jardins zoológicos e circos), simulando nascimentos
em cativeiro. Até há pouco tempo, não se utilizavam testes de identificação genética para colocar
a descoberto estas atividades ilícitas, devido ao difícil acesso a marcadores altamente
polimórficos, e à dificuldade em obter amostras de sangue de chimpanzé. Recentemente foi
divulgado um estudo em que se extraem amostras de ADN a partir de raízes de pelos de
chimpanzé acabados de arrancar, utilizados depois para reação em cadeia da polimerase. Os
primers utilizados nestes estudos flanqueiam posições altamente polimórficas no ADN humano
resultantes de repetições contíguas de nucleotídeos. Várias descendências suspeitas e os seus
supostos progenitores foram testados, a fim de determinar se a descendência era legítima ou
produto de comercialização ilegal, e não a descendência dos progenitores indicados como tal.
Uma amostra dos resultados encontra-se
evidenciada na figura seguinte. Examine os
dados cuidadosamente e escolha a
conclusão mais acertada.

O que pode concluir?


a) Nenhum dos descendentes é legítimo.
b) Os descendentes B e C não são produto
destes progenitores, e foram, provavelmente
adquiridos no mercado negro. Os dados
relativos ao descendente A são plausíveis,
indicando este como legítimo.
c) A descendência A e B é produto dos
progenitores declarados, mas C não é, e foi
provavelmente comprado no mercado negro.
d) Não existem dados suficientes para tirar conclusão alguma. Deveriam ser examinadas posições
polimórficas adicionais.
e) Não é possível tirar conclusões, uma vez que se utilizaram primers “humanos”.

51
Aulas teórico-práticas de Genética Humana MD

14. Atualmente, utilizam-se fingerprints de ADN para testar


espécimes forenses, para identificar suspeitos criminais, e
para resolver casos de imigração e disputas parentais. Os
primers para fingerprinting de ADN através de PCR são
normalmente derivados de vários (tipicamente 13) loci
minissatélites. A seguir encontram-se os resultados de
fingerprinting de uma mãe, filho e 2 possíveis pais, usando
estes primers.

a) Em que consiste o ADN minissatélite e qual a sua utilidade


no fingerprinting de ADN?
b) Descreva a técnica de fingerprinting.
c) Interprete os resultados.

15. Indique os passos envolvidos na clonagem e expressão


em E. coli de um gene humano (ex. hormona do crescimento,
para produção de hormona recombinante para terapia de substituição em indivíduos afetos por
nanismo). Ou de um gene do vírus (ex. da hepatite B) para produção de uma vacina de
subunidade.

16. A imagem mostra a sequência de ADN que rodeia o local da mutação na -globina de células
falciformes, em genes normais e mutantes.

5´ G A C T C C T G A G G A G A A G T 3´
3´ C T G A G G A C T C C T C T T C A 5´
ADN normal

5´ G A C T C C T G T G G A G A A G T 3´
3´ C T G A G G A C A C C T C T T C A 5´
ADN de eritrócitos falciformes

Cada tipo de ADN é amplificado por PCR, desnaturado e transferido para um filtro. O filtro é
híbridado a um ASO (oligonucleotídeo específico de alelo) da seguinte sequência: 5´-
GACTCCTGAGGAGAAGT– 3´.
a) Como se designa esta técnica?
b) Qual o resultado que seria de esperar após hibridação do filtro com o ASO?

52
Aulas teórico-práticas de Genética Humana MD

17. A hemofilia A, ligada ao cromossoma X, é causada por uma mutação no fator de coagulação
VIII. Várias mutações pontuais têm sido descritas neste gene, tornando a deteção de genes
mutantes por Southern blot ineficaz. Contudo, existe um padrão de RFLP (restriction fragment
length polymorphism) produzido pela enzima HindIII num intrão do gene que pode às vezes ser
usado no rastreio, como se evidencia na figura seguinte:

Uma mulher saudável cujo irmão tenha hemofilia corre


50% de risco de ser portadora desta doença. A fim de
testar a sua condição, obtém-se ADN do sangue de
membros da família, que é cortado com HindIII, e os
fragmentos são hibridados e visualizados por Southern
blotting. Os resultados são os que se seguem:

a) Determine se alguma das mulheres na geração II é portadora de hemofilia. Justifique.


b) Descreva a técnica de Southern blotting.
c) Imagine que o indivíduo II-4 casou e a esposa está grávida. Refira os métodos possíveis para
obtenção de células fetais a fim de se proceder ao diagnóstico pré-natal.

18. Os genes humanos contêm intrões. Apesar de as células bacterianas não excisarem os intrões
do ARNm, é possível produzir proteínas humana em E. coli e noutras bactérias: explique como.

19. Ao lado encontra-se um pedigree que


mostra a hereditariedade de uma doença
grave.

a) Que modo ou modos de hereditariedade


são possíveis ou excluídos por observação
deste pedigree?

Amostras de ADN das gerações II e III são obtidas e sujeitas a uma análise de ligação usando
RFLPs. Um RFLP refere-se a uma região do cromossoma 10 (detetado pela sonda A) e o outro
ao cromossoma 21 (detetado pela sonda B). Os resultados desta análise encontram-se
evidenciados na figura seguinte. Ao responder às perguntas, parta do princípio de que dados
adicionais foram obtidos desta família e de que eram coerentes com os dados mostrados e
estatisticamente significativos.

cr. 10 cr. 21 53
Aulas teórico-práticas de Genética Humana MD

b) Em que cromossoma está situado o gene da doença?


c) A senhora III-1 é casada com um homem normal cujo fenótipo RFLP é A1A2 e B2B3. Que tipo
de teste diagnóstico pré-natal pode ser realizado a fim de determinar se o filho que eles esperam
é normal? Descreva o que pode concluir a partir deste ou daquele resultado.
d) O senhor III-4 casa com uma mulher de genótipo B1B1. Têm um filho que é B1B1. O pai parte
do princípio de que a criança é ilegítima, mas a mãe, que estudou genética, argumenta que a
criança poderia ser o resultado de um evento ocorrido na formação dos gâmetas do pai e cita duas
possibilidades. Quais são elas?

54
Aulas teórico-práticas de Genética Humana MD

GENÉTICA DE POPULAÇÕES

1. Calcule a frequência dos alelos A e a numa população inicial com 0,15 AA, 0,6 Aa e 0,25 aa.
Qual será a frequência dos três genótipos depois de algumas rondas de reprodução (assuma que
a população passa a obedecer a todos os requisitos da lei de Hardy-Weinberg)?

2. Numa população em que as frequências alélicas são f(IA) = 0,3, f(IB) = 0,5 e f(i) = 0,2, calcule a
percentagem de indivíduos com antigénios A e B em situação de equilíbrio. Calcule também a
percentagem de indivíduos que não têm antigénio nenhum.

3. A capacidade de sentir o sabor do composto feniltiocarbamida (PTC) está sob o controlo de um


alelo dominante T (indivíduos tt são incapazes de sentir o sabor). Numa turma de estudantes de
genética de 125 alunos, 88 conseguem sentir o sabor da PTC e 37 não. Calcule a frequência dos
alelos T e t nesta população e a frequência dos genótipos.

4. Os albinos na Tanzânia correm sérios riscos de serem mortos para partes do seu corpo serem
comercializadas e usadas por curandeiros. Por alguma razão desconhecida, na Tanzânia há uma
concentração elevada de albinos (1/1400), enquanto na África em geral é cerca de 1/10 000 e na
Europa é 1/18 500. Assuma que o albinismo é causado por mutações recessivas num único gene
autossómico e calcule a frequência do alelo e dos portadores nas 3 populações.

5. Considere doenças raras, cada uma causada por uma mutação autossómica recessiva. Calcule
a frequência (ou percentagem) de indivíduos heterozigóticos a partir destas frequências do
fenótipo:
a. 0,0064 c. 0,09 e. 0,10
b. 0,000081 d. 0,01

Qual é a condição que tem de ser assumida para que as contas das perguntas 3 e 4 façam sentido?

6. Determine através da aplicação do teste do 2 se a seguinte é uma população em equilíbrio de


Hardy-Weinberg. Alelo selvagem da -globina (A) e alelo da anemia falciforme (S): AA, 75; AS, 25;
SS, 0 numa população com n = 100. Repita as contas para n = 1000 (AA, 750; AS, 250; SS, 0). O
resultado foi diferente? Como justifica esta diferença?

7. Se 4% de uma população em equilíbrio expressa um traço autossómico recessivo, qual é a


probabilidade que um descendente de dois indivíduos que não expressam o traço seja afetado?

8. Numa tribo de índios americanos encontraram-se as seguintes frequências de grupos


sanguíneos AB0: A = 0,06; B = 0,02: AB = 0,02; O = 0,90 e mediram-se as sequentes frequências
dos alelos p = f(IA) = 0,021; q = f(IB) =0,025; e r = f(i) = 0,954. A tribo está no equilíbrio esperado?
Se a resposta anterior foi não, quais razões poderão justificar o afastamento do equilíbrio? Que
teste estatístico utilizaria para determinar se as frequências reais estão em boa concordância com
os dados esperados? Compare a tribo com a situação numa população europeia normal em que
as frequências são: A = 0,53; B = 0,12: AB = 0,08; 0 = 0,26.

9. Pessoas sem antigénios A ou B do isoaglutinogénio na saliva têm maior probabilidade de ter


Candida albicans na sua microbiota (microflora) oral. Se numa população temos f(IA) = 0,26, f(IB)
= 0,06, f(H) = 0,9 e f(Se) = 0,8, calcular a frequência dos indivíduos na situação descrita acima.

10. A polidactilia é uma doença AD com penetrância incompleta (70%). Na população em estudo
a frequência do alelo é 0,012. Qual é a probabilidade de uma pessoa escolhida ao acaso nessa
população ser portador (heterozigótico) do alelo da doença? Qual a probabilidade de ser portador
55
Aulas teórico-práticas de Genética Humana MD

do alelo sem o expressar? Qual é a probabilidade do filho de um casal saudável aleatório herdar 1
alelo mutado e manifestar a doença?

11. Numa população humana de 53000 indivíduos existem 2 homens com hemofilia A. Assumindo
que a população é 48% homens e 52% mulheres, quantas portadoras haverá nessa população?
E quantas mulheres hemofílicas prevê?

12. Um rapaz que planeia casar-se tem uma irmã com fibrose quística (CF), uma doença
autossómica recessiva. Tanto ele como os seus pais são normais. O rapaz planeia casar com uma
rapariga que não tem história de CF na família. Qual é a probabilidade deles terem um filho
afetado? (ambos são Caucasianos e a frequência da CF na população Caucasiana é de 1 / 2500.
Assuma que a população está em equilíbrio.)

13. Em que circunstâncias acha que um alelo dominante letal se pode manter numa população?

14. Assuma que uma doença autossómica recessiva aparece em 1 em 10 000 indivíduos na
população geral e que nesta população 2% dos indivíduos são portadores. Estime a probabilidade
de dois primos terem um filho afetado. Compare esse resultado com a probabilidade para um casal
não consanguíneo.

15. Num programa de melhoramento de uma espécie de cultivo, quais dos seguintes sistemas
devem ser aplicados para produzir uma linha homozigótica no tempo mais breve possível?

Autofertilização Cruzamento entre irmãos


Cruzamento de primos Cruzamentos aleatórios

16. Se o albinismo acontece com uma frequência de 1 / 5 000 numa população em equilíbrio e é
causado por um alelo autossómico recessivo a, calcule a frequência de

o alelo a o alelo A
os indivíduos heterozigóticos os casais heterozigóticos

17. Um dos primeiros traços mendelianos descobertos em humanos foi o da braquidactilia


(fenótipo: dedos das mãos e/ou dos pés curtos). Na altura na comunicação social espalhou-se a
ideia que este traço dominante alastraria até atingir 75% da população (devido ao ratio 3:1 na
descendência de híbridos). Mostre que este tipo de raciocínio está incorreto.

18. A acondroplasia é um traço dominante que causa uma forma típica de nanismo. Numa
amostragem de 50 000 bebés, foram encontrados 5 afetados. Um deles tinha um pai afetado
enquanto 4 tinham pais normais. Calcule a taxa de mutação do gene expressando-a como número
de mutações por gâmeta. Calcule a frequência do alelo mutado nesta população de 50 000 bebés.
19. A incidência da doença de Tay-Sachs (AR) é de aproximadamente 1/3600 entre os judeus
asquenazitas dos EUA. Nos judeus sefarditas e nos não-judeus é cerca 100x menor. Assuma o
equilíbrio e calcule a frequência esperada de portadores em ambos os casos. Calcule a
frequência do alelo numa população composta por 3% de asquenazitas.

20. Imagine uma cidade com 130 000 habitantes em que 38 são albinos. Imagine que para esta
cidade migram 9700 pessoas doutra região do mundo e que no seio destes imigrantes há 20
albinos. Partindo do pressuposto que estes casos de albinismo são todos causados por uma única
mutação no mesmo gene, calcule as frequências e número de portadores nas duas populações e

56
Aulas teórico-práticas de Genética Humana MD

frequência e número de albinos e portadores na população resultante depois de algumas gerações


em condições de equilíbrio (assuma tamanho da população constante).

21. Imagine uma cidade com 130 000 habitantes em que 38 homens sofrem da hemofilia A (XR).
Imagine que para esta cidade migram 9700 pessoas doutra região do mundo e que no seio
destes imigrantes há 20 homens hemofílicos (sempre tipo A). Partindo do pressuposto que estes
casos de hemofilia são todos causados por uma única mutação no mesmo gene, calcule as
frequências e número de portadoras esperadas nas duas populações e frequência e número de
hemofílicos e portadoras na população resultante depois de algumas gerações em condições de
equilíbrio (assuma tamanho da população constante e composição 53% mulheres / 47%
homens).

22. Imagine 3 populações (a, b e c) que recebem imigração nas condições descritas em baixo.
Determine a frequência do alelo A (pf) depois de algumas rondas de replicação em condições de
equilíbrio:
a) freq. de A originária = pi = 0,6;
freq. de A nos imigrantes = pm = 0,1;
proporção dos imigrantes na população final = m = 0,2

b) pi = 0,2; pm = 0,7; m = 0,3

c) pi = 0,1; pm = 0,2; m = 0,1

23. Era uma vez numa terra longínqua…. um povo em que havia 2% de pessoas com cabelo ruivo
causado por uma única mutação recessiva num só gene autossómico. Ao analisar uma amostra
de pessoas não ruivas, uns cientistas ficaram surpreendidos ao descobrir que a frequência dos
heterozigotos na população era 5%. a) Porquê ficaram surpreendidos? b) O que pode indicar este
dado anómalo?

24. Um botânico que estuda nenúfares num charco isolado encontra 3 formas de margem da folha:
inteira, com pontas e crenada. Uma análise molecular mostra que as plantas com folhas inteiras
são homozigóticas para um alelo r1 enquanto as plantas com folhas pontiagudas são
homozigóticas para o alelo r2. As plantas com folhas crenada são heterozigóticas. A frequência
do alelo r1 é 0,81. Se o botânico em 125 plantas no charco contou 20 com folhas crenada, qual é
o coeficiente de inbreeding F para esta população?

25. Numa população isolada de 50 “ovelhas do deserto” encontrou-se um alelo mutante c que
causa pelagem encaracolada em ambos os sexos. O alelo normal dominante C produz pelagem
lisa. Ao estudar a população, um biólogo conta 4 indivíduos encaracolados e, através de análise
genética, 17 indivíduos heterozigóticos. Qual é o coeficiente de inbreeding desta população?

57