Received: 31 July 2017 | Accepted: 30 April 2018

DOI: 10.1002/jcp.26788

ORIGINAL RESEARCH ARTICLE

Estrogen inhibits osteoclasts formation and bone resorption

via microRNA‐27a targeting PPARγ and APC

Lei Guo1* | Kaizhe Chen1* | Jun Yuan1* | Ping Huang1 | Xing Xu1 | Changwei Li1 |
Niandong Qian1 | Jin Qi1 | Zhiliang Shao1 | Lianfu Deng1 | Chuan He1 | Jiping Xu2
1
Shanghai Key Laboratory for Bone and Joint
Diseases, Shanghai Institute of Orthopaedics Abstract
and Traumatology, Shanghai Ruijin Hospital, Inhibition of osteoclasts formation and bone resorption by estrogen is very important in
Shanghai Jiaotong University School of
Medicine, Shanghai, China the etiology of postmenopausal osteoporosis. The mechanisms of this process are still not
2
Orthopedic Sevice, Shanghai Fengxian fully understood. Recent studies implicated an important role of microRNAs in estrogen‐
District Center Hospital, Shanghai Jiaotong
mediated responses in various cellular processes, including cell differentiation and
University Affiliated Sixth People’s Hospital
South Campus, Shanghai, China proliferation. Thus, we hypothesized that these regulatory molecules might be implicated
in the process of estrogen‐decreased osteoclasts formation and bone resorption. Western
Correspondence
Jiping Xu, Shanghai Fengxian District Center blot, quantitative real‐time polymerase chain reaction, tartrate‐resistant acid phosphatase
Hospital, Shanghai Jiaotong University School
staining, pit formation assay and luciferase assay were used to investigate the role of
of Medicine, No. 6600, The Nanfeng Road,
Fengxian District, Shanghai, 201499, China. microRNAs in estrogen‐inhibited osteoclast differentiation and bone resorption. We found
Email: xujiping2001@yahoo.fr
that estrogen could directly suppress receptor activator of nuclear factor B ligand/
Chuan He and Lianfu Deng, Ruijin Hospital,
Shanghai jiaotong University School of macrophage colony‐stimulating factor‐induced differentiation of bone marrow‐derived
Medicine, No.197, The Second Ruijin Road,
macrophages into osteoclasts in the absence of stromal cell. MicroRNA‐27a was
Luwan District Shanghai 200025, P. R. China.
Email: drhechuan@sina.com (C.H.); significantly increased during the process of estrogen‐decreased osteoclast differentiation.
lfdeng@msn.com (L.D.)
Overexpressing of microRNA‐27a remarkably enhanced the inhibitory effect of estrogen
Funding information on osteoclast differentiation and bone resorption, whereas which were alleviated by
The National Science Foundation of China,
microRNA‐27a depletion. Mechanistic studies showed that microRNA‐27a inhibited
Grant/Award Number: 81300713; Research
project of Shanghai municipal health and peroxisome proliferator‐activated receptor gamma (PPARγ) and adenomatous polyposis
Family Planning Commission, Grant/Award
coli (APC) expression in osteoclasts through a microRNA‐27a binding site within the
Numbers: 201640190, 201640105,
201540156; The Natural Science Foundation 3′‐untranslational region of PPARγ and APC. PPARγ and APC respectively contributed to
of Shanghai, Grant/Award Number:
microRNA‐27a‐decreased osteoclast differentiation and bone resorption. Taken together,
17ZR1425900
these results showed that microRNA‐27a may play a significant role in the process of
estrogen‐inhibited osteoclast differentiation and function.

KEYWORDS
estrogen, microRNA‐27a (miR‐27a), osteoclast, osteoporosis

1 | INTRODUCTION reductions in trabecular bone volume, density and strength, as well as

Estrogen deficiency‐induced osteoporosis is the most common metabolic
bone disease, characterized by structure alternations, including
*Lei Guo and Kaizhe Chen contributed equally to this work.
a shift in tissue microenvironment with increasing proinflammatory
cytokine levels in bone marrow and the serum (Zaidi, 2007). In
osteoporosis, estrogen deficiency leads to increased bone turnover with
enhanced bone formation and even greater rates of bone resorption,
resulting in a net bone loss (Raisz, 2005). Thus, exploring the mechanisms

J Cell Physiol. 2018;1–14. wileyonlinelibrary.com/journal/jcp © 2018 Wiley Periodicals, Inc. | 1

2 |
by which estrogen decreases bone resorption is critical for understanding
the pathogenesis of postmenopausal osteoporosis and may lead to the
development of new therapeutic targets for the treatment of the disease.
Normal bone remodeling maintains constant bone mass by an
orchestrated balance between the destruction of old bone by
osteoclasts and rebuilding by osteoblasts (Yu et al., 2014). Osteoclasts,
arising from hematopoietic stem cells, are the sole bone‐resorbing cells.
Osteoclasts undergo differentiation and fusion, resulting in large
multinucleated cells in the presence of receptor activator of nuclear
factor B ligand (RANKL) and macrophage colony‐stimulating factor
(M‐CSF), both of them produced by stromal cells/osteoblasts (Shi et al.,
2014). Previous studies showed that 17β‐estradiol opposes the
differentiating effects of M‐CSF and RANKL and reduces the formation
of osteoclast‐like cells from undifferentiated precursors (Shevde,
Bendixen, Dienger, & Pike, 2000). Furthermore, estrogen acts directly
on fully differentiated osteoclasts to regulate the osteoclast bone
resorbing activity (Nakamura et al., 2007). However, the exact
mechanisms by which estrogen inhibits osteoclast differentiation and
bone resorption need to be further explored.
Recently, noncoding microRNAs (miRNAs) have emerged as key
regulators of diverse physiological and pathological processes, includ-
ing cell proliferation, apoptosis, and cancer (Couzin, 2007). MiRNAs
affect gene expression through the inhibitory engagement of compli-
mentary “seed sequences” within the 3′‐untranslational region
(3′‐UTR) of the target messenger RNAs (mRNAs), resulting in
translational inhibition and/or mRNA degradation (Zeng, 2006). Many
studies have elucidated the important roles of miRNAs in estrogen‐
mediated responses in various cellular processes, including cell
proliferation, apoptosis, and differentiation (Midgley, Morris, Phillips,
& Steadman, 2016). Furthermore, miRNAs have been confirmed to
associate with osteoclast formation (Ji, Chen, & Yu, 2016). However,
very few studies have investigated the role of miRNAs in estrogen‐
mediated osteoclast differentiation and bone resorption.
In this study, we examined the role of microRNA‐27a
(miR‐27a) in the repression of osteoclast differentiation and bone
resorption by estrogen. We profiled the genome‐wide miRNA
expression during estrogen‐inhibited osteoclast differentiation.
Several altered miRNAs were suggested, in which miR‐27a was
identified as a strong candidate responsible for osteoclast
differentiation. Furthermore, further studies found that miR‐27a
was also involved in estrogen‐decreased osteoclasts bone resorp-
tion. Therefore, miRNAs and miRNA‐mediated gene silencing may
contribute to the inhibition effects of estrogen on osteoclast
differentiation and bone resorption.
2 | MATERIALS AND METHODS
2.1 | Animal models
Generation of ovariectomy (OVX) mice was accomplished according to
previous reports (Sang et al., 2016). Two‐month‐old female C57BL/6J
mice were divided into an OVX group (the bilateral ovaries of mice
were removed) and a SHAM group (the bilateral ovaries of mice were
GUO ET AL.
exposed but left intact). MiR‐27a‐carrying chitosan (miR‐27a‐CH) and
miRNAs negative control‐CH (miR‐NC‐CH; Sigma‐Aldrich, St Louis)
nanoparticles were delivered by intravenous injections at 5 mg per
mouse twice a week (Krzeszinski et al., 2014). We established a
sample size of at least six mice per group. After eight weeks, the
femurs and tibia were acquired from SHAM, OVX, OVX + miR‐27a‐CH
and OVX + miR‐NC‐CH mice for micro computed tomography
(micro‐ CT), tartrate‐resistant acid phosphatase (TRAP) staining, and
cell culture. We collected blood samples and isolated serums for
serology. Serum enzyme linked immunosorbent assay was performed
with a mouse TRAP5b assay kit (Westang, Shanghai, China). All animal
care and experimental procedures were approved by the Shanghai
Jiaotong University Animal Study Committee and were carried out in
accordance with the guide for laboratory animals’ use.
2.2 | Skeletal phenotyping
The distal ends of intact femurs from SHAM, OVX, OVX + miR‐27a‐CH,
and OVX + miR‐NC‐CH mice were scanned using micro‐CT (GE Locus,
London, UK) to assess bone mass, density, and trabecular microarch-
itecture. The sample parameters computed from these data include
bone mineral density (BMD), bone volume against tissue volume
(BV/TV), trabecular thickness (Tb.Th), and trabecular number (Tb.N).
2.3 | Bone marrow‐derived macrophages isolation
and osteoclast culture
Primary bone marrow‐derived macrophages (BMMs) were isolated
from the long bones of 8‐week‐old C57BL/6J mice as previously
reported (Shi et al., 2014). The cells then were cultured with
complete alpha minimum essential medium (α‐MEM, Invitrogen,
Grand Island, NY) in the presences of 10 ng/ml M‐CSF (Peprotech,
Rocky Hill, NJ) for 24 hr. Nonadherent cells were harvested and
cultured with fresh medium containing 50 ng/ml M‐CSF for 3 days to
acquire osteoclast precursors (preosteoclasts). Then the preosteo-
clasts were seeded and further cultured with complete α‐MEM
medium containing M‐CSF (20 ng/ml) and RANKL (50 ng/ml) (Pepro-
tech) for 7 days. Cell culture media were replaced every two days
until mature osteoclasts were formed.
2.4 | Rhodamine phalloidin and TRAP staining
After culture, the cells were fixed in 4% paraformaldehyde. The
localization of F‐actin was observed to confirm differentiation to the
active form of osteoclasts. The fixed cells were incubated with 0.1%
Triton X for 5 min. Then, the solution was replaced with rhodamine
phalloidin solution, and the tissues were kept stationary in a dark
room for 30 min, followed by F‐actin staining. The fluorescence signal
was detected by confocal laser scanning microscopy (Carl Zeiss,
Oberkochen, Germany), and the number of osteoclasts with a
fluorescent ring was counted. For TRAP staining, TRAP solution
was added to the well and incubated with the cells at 37°C for
15 min. The number of cells with three or more nuclei was counted
under an optical microscope.
GUO ET AL.
2.5 | Pit formation assay
Bone resorption activity was measured by pit formation assay
according to the method of Chen, Ni, Yang, Ye, and Chen (2014) with
slight modifications. Purified mononuclear cells were cultured on
bovine cortical bone slices in 24‐well plates, followed by induction of
RANKL and M‐CSF. After 7 days, the slices were placed for 10 min
in 1 M NH4OH and were sonicated to remove the cells. The cell‐free
slices were stained in 1% toluidine blue in 1% sodium borate for
1 min. The experiment was repeated three times. The resorption pits
appeared dark blue and were viewed by light microscopy. The
percentage of pit area to a “random field of view” was calculated.
Three fields were counted for each group. All data are expressed as
mean ± standard deviation (SD; n = 3).
2.6 | MiRNA microarray analysis
Primary BMMs were isolated from the long bones of SHAM and OVX
mice. Cells then cultured with complete α‐MEM medium containing
M‐CSF (20 ng/ml) and RANKL (50 ng/ml) for 7 days to acquire
mature osteoclasts. Five microgram of total RNA from cell samples
was labeled and hybridized on miRNA microarray chips as previously
described (Dore et al., 2008). The Aksomics Company performed the
miRNA microarray assay. The fragmentation mixtures were hybri-
dized to an Agilent 2100 (Agilent Technologies). Total RNAs were
tailed with Poly A and then labeled with Biotin. After that, the labeled
RNAs were hybridized onto the microarray. After washing and
staining the slides, the arrays were scanned by Affymetrix Scanner
3000 (Affymetrix). Affymetrix GeneChip Command Console software
(version 4.0, Affymetrix) was used to analyze array images to get raw
data and then offer RNA normalization. Next, Genespring software
was applied to precede the following data analysis. Differentially
expressed miRNAs were then identified through the fold change as
well as the P value calculated using the t‐test.
2.7 | RNA extraction and quantitative real‐time
polymerase chain reaction
Quantitative polymerase chain reaction (PCR) assay was accom-
plished to measure specific gene expression during osteoclast
differentiation. Preosteoclasts were seeded in 6‐well plates at a
density of 1 × 105 cells per well and cultured in complete α‐MEM
medium containing 20 ng/ml M‐CSF and 50 ng/ml RANKL. Total RNA
was isolated from the cells using Trizol reagent (Invitrogen, Carlsbad,
CA) according to the manufacturer’s instruction. Next, complemen-
tary DNA (cDNA) was synthesized from 1 μg of total RNA using
T A B L E 1 Premiers for qRT‐PCR analysis
Gene Forward primer
TRAP 5′‐CACTCCCACCCTGAGATTTGT‐3′
c‐fos 5′‐CGGGTTTCAACGCCGACTA‐3′
β‐actin 5′‐GGCTGTATTCCCCTCCATCG‐3′
Note. qRT‐PCR, quantitative real‐time polymerase chain reaction; TRAP, tartrate‐resistant acid phosphatas.
| 3
reverse transcriptase (TaKaRa Biotechnology, Japan). Quantitative
real‐time PCR (qRT‐PCR) was performed to amplify the cDNA using
the SYBR Premix Ex Tag kit (TaKaRa Biotechnology) and an ABI 7500
Sequencing Detection System (Applied Biosystems, Foster City, CA).
The mouse primer sequences for TRAP (Accession number:
NM_011611), c‐fos (Accession number: NM_010234) and β‐actin
(Accession number: NM_007393) are described in Table 1.
2.8 | Quantification of miRNA levels
The mirVanaTM qRT‐PCR miRNA Detection Kit (Ambion, TX) was
used in conjunction with qRT‐PCR with SYBR Green I for quantifica-
tion of miR‐27a transcript, as detailed elsewhere (Luo et al., 2007).
2.9 | Western blot analysis
Preosteoclasts were seeded in 6‐well plates at a density of 1 × 105
cells per well, followed by various treatments under M‐CSF and
RANKL. Cell proteins were harvested according to previous reports
(Kang et al., 2016). Protein concentrations were determined by a
bicinchoninic acid (BCA) protein assay kit (Pierce Biotechnology,
Rockford, IL). Equal amounts of protein lysates were resolved using
sodium dodecyl sulphate‐polyacrylamide gel electrophoresis
(SDS‐PAGE) on 10% gels, and transferred to polyvinylidene difluoride
(PVDF) membranes (Millipore, Bedford, MA). Afterwards, the
membranes were blocked with 5% skimmed milk solution for 1 hr
and then probed overnight with the following primary antibodies:
anti‐peroxisome proliferator activated receptor gamma (PPARγ),
anti‐adenomatous polyposis coli (APC), and anti‐β‐actin (Abcam,
Cambridge, UK). The membranes were incubated with a horseradish
peroxidase‐conjugated secondary antibody (Boster, Wuhan, China).
The antibody reactivity was visualized using the enhanced chemilu-
minescence detection system as recommended by the manufacturer.
2.10 | Cell transfection
The overexpression plasmid vector for mouse PPARγ and APC gene were
created by Genechem (Shanghai, China). Preosteoclasts were inoculated
into 6‐well tissue culture plates at a density of 1 × 105 cells in complete
α‐MEM medium containing 20 ng/ml M‐CSF and 50 ng/ml RANKL
and incubated for 24 hr prior to transfection. Once preosteoclasts
reached approximately 70% confluence, the cells were transfected with
miR‐27a, anti‐miRNA oligonucleotides (AMO)‐27a or plasmid DNA
using Lipofectamine 3000 reagent (Invitrogen, Paisley, UK) according to
the manufacturer’s protocols. Cells infected with miR‐NC or empty
vector (Mock) worked as control, separately.
Reverse primer
5′‐CATCGTCTGCACGGTTCTG‐3′
5′‐TTGGCACTAGAGACGGACAGA‐3′
5′‐CCAGTTGGTAACAATGCCATGT‐3′
4 | GUO ET AL.

2.11 | Dual luciferase reporter assay reporter vector (Ambion, Inc.) to generate pMIR‐PPARγ, pMIR‐APC.
After 24 hr starvation in serum‐free medium, HEK293 cells (1–105
The 3′‐UTR sequences of PPARγ and APC predicted to interact with
per well) were transfected with pMIR‐PPARγ, pMIR‐APC, and
miR‐27a were identified using TargetScan (http://www.targetscan.
cotransfected with 100 nM miR‐27a mimic or miR‐NC using
org). DNA fragments of the 3′‐UTRs of PPARγ and APC mRNA
Lipofectamine 3000 reagent. The cells were also transfected with
containing the putative miR‐27a binding sequence were synthesized
50 ng pRL‐TK vector as an internal standard. Luciferase activities
by Invitrogen. These fragments were then respectively cloned into
were measured 48 hr after transfection with a dual luciferase
the multiple cloning sites downstream the luciferase gene (HindIII
reporter assay kit (Promega) on a luminometer (Lumat LB9507).
and SpeI sites) in the pMIR‐REPORTTM luciferase miRNA expression

F I G U R E 1 Effect of estrogen deficiency on osteoclasts formation and bone resorption in vivo. (a) Representative micro‐CT
three‐dimensional reconstructed images from SHAM mice and OVX mice. (b–e) BMD, BV/TV, Tb.Th and Tb.N in the region of interest were
measured. n = 6 mice per group, **P < 0.01. (f,g) TRAP staining showed that the number of osteoclasts was significantly increased in BMMs from
OVX mice, which were induced with 20 ng/ml M‐CSF and 50 ng/ml RANKL for 7 days. n = 6, **P < 0.01. (h) BMMs from SHAM mice and
OVX mice were induced with 20 ng/ml M‐CSF and 50 ng/ml RANKL for 7 days, followed by staining with F‐actin ring. n = 3. (i) Resorption
pit formation in BMMs, derived from SHAM mice and OVX mice, were induced with 20 ng/ml M‐CSF and 50 ng/ml RANKL for 7 days.
(j) Summarized data showed that estrogen deficiency induced osteoclasts bone resorption. n = 3, **P < 0.01. BMD, bone mineral density;
BMMs, bone marrow‐derived macrophages; BV/TV, bone volume/tissue volume; micro computed tomography (micro‐CT); M‐CSF, macrophage
colony‐stimulating factor; OVX, ovariectomized; RANKL, receptor activator of nuclear factor B ligand; Tb.N, trabecular number; Tb.Th,
trabecular thickness; TRAP, tartrate‐resistant acid phosphatase [Color figure can be viewed at wileyonlinelibrary.com]
GUO ET AL. | 5

2.12 | Statistical analysis 3.2 | Altered miRNA expression in the

Data were collected from three or more independent experiments
and expressed as mean ± SD. A two‐sided Student t test was used to
analyze the difference for experiments with two subgroups. One‐way
analysis of variance was performed to show the difference for
experiments with more than two subgroups.
3 | RES U LTS
3.1 | Effect of estrogen deficiency on osteoclasts
formation and bone resorption in vivo
Micro‐CT analysis showed that BMD, BV/TV, Tb.Th, and Tb.N were
decreased in femurs from OVX mice compared with SHAM control,
indicating that estrogen deficiency significantly induced bone loss
(Figure 1a–e). Next, BMMs isolated from SHAM and OVX mice were
induced with 20 ng/ml M‐CSF and 50 ng/ml RANKL to acquire
mature osteoclasts. We found that estrogen deficiency could
promote osteoclast differentiation by TRAP staining and F‐actin
staining (Figure 1f–h). In addition, pits formation assay revealed that
osteoclasts from OVX mice produced a significant increase of pits
area, suggesting that estrogen deficiency promoted osteoclasts bone
resorption (Figure 1i,j).
processes of estrogen deficiency‐induced
osteoclast differentiation
MiRNA expression was analyzed with a RNA/cDNA‐based micro-
array screening. BMMs from SHAM and OVX mice were induced
with 20 ng/ml M‐CSF and 50 ng/ml RANKL for 7 days to acquire
mature osteoclasts.
Our results showed that the majority of the miRNAs were
repressed, and only four miRNAs were induced in osteoclasts from
OVX mice compared to the SHAM control (Figure 2a). To confirm the
results of microarray‐based screening, we measured the expressions
of these identified miRNAs using qRT‐PCR. Two of these (miR‐23a,
miR‐27a) were found to be downregulated by more than four fold,
whereas four (miR‐21, miR‐539, miR‐26a, and miR‐574) were
upregulated by approximately two fold. Among these differentially
expressed miRNAs, miR‐27a was significantly repressed in osteo-
clasts from OVX mice (Figure 2b). Next, we examined the expression
of miR‐27a in BMMs from SHAM and OVX mice. The results showed
that miR‐27a expression was significantly lower in BMMs from OVX
mice compared with SHAM mice (Figure 2c). To further examine the
effect of estrogen on miR‐27a expression, BMMs from SHAM and
OVX mice were induced with 20 ng/ml M‐CSF and 50 ng/ml RANKL
and treated with or without 10−7 M estrogen for different time

F I G U R E 2 Altered miRNA expression in the processes of estrogen deficiency‐induced osteoclasts formation. (a) Heat map representation of
miRNAs differentially expressed in BMMs from SHAM mice and OVX mice, which were induced with 20 ng/ml M‐CSF and 50 ng/ml RANKL
for 7 days. Red indicates miRNAs induced, and green indicates miRNAs repressed. n = 3. (b) Gene chip results were validated with qRT‐PCR in
BMMs from SHAM mice and OVX mice, which were induced with 20 ng/ml M‐CSF and 50 ng/ml RANKL for 7 days. n = 3, **P < 0.01.
(c) Expression of miR‐27a was measured by qRT‐PCR in BMMs from SHAM mice and OVX mice. n = 3, **P < 0.01. (d) Expression of miR‐27a
was measured by qRT‐PCR in BMMs from SHAM mice and OVX mice treated with or without 10−7 M estrogen under 20 ng/ml M‐CSF and
50 ng/ml RANKL for different time points. n = 3. BMMs, bone marrow‐derived mononuclear phagocytes; E2, estrogen; M‐CSF, macrophage
colony‐stimulating factor; miRNA, microRNA; OVX, ovariectomized; qRT‐PCR, quantitative real‐time polymerase chain reaction; RANKL,
receptor activator of nuclear factor B ligand [Color figure can be viewed at wileyonlinelibrary.com]
6 |
points. The results showed that compared with osteoclast from the
SHAM group, the level of miR‐27a expression was decreased in
osteoclast from OVX mice, which could be obviously alleviated by
estrogen. In addition, treatment of estrogen could markedly promote
miR‐27a expression in osteoclast from SHAM mice in a time‐
dependent manner (Figure 2d). Taken together, we concluded that
estrogen could promote miR‐27a expression during the process of
osteoclast differentiation.
3.3 | Involvement of miR‐27a in
estrogen‐inhibited osteoclast differentiation
To investigate whether miR‐27a was involved in osteoclast
differentiation, we performed loss‐of‐function and gain‐of‐function
experiments, in which we decreased and increased the expressions
of miR‐27a with AMO‐27a and miR‐27a in preosteoclasts, respec-
tively. Then, preosteoclasts transfected with either AMO‐27a or
miR‐27a were induced with RANKL and M‐CSF for 7 days.
Inhibition of miR‐27a with AMO‐27a significantly enhanced
osteoclast differentiation, which was indicated by an obvious
increase of TRAP positive staining osteoclasts number and TRAP
activity. In contrast, miR‐27a could obviously inhibit osteoclast
differentiation (Figure 3a–c). Furthermore, qRT‐PCR analysis
revealed that the levels of the osteoclast‐specific genes TRAP and
c‐Fos were higher in the preosteoclasts transfected with AMO‐27a
compared with the cells transfected with AMO‐NC, whereas
overexpression of miR‐27a significantly inhibited these osteoclast‐
specific genes expression (Figure 3d,e).
To further investigate the effect of miR‐27a on estrogen‐
inhibited osteoclast differentiation in vitro, miR‐27a was over-
expressed or silenced in preosteoclasts, which were then cultured
with 50 ng/ml RANKL and 20 ng/ml M‐CSF for 7 days in the presence
of 10−7 M estrogen. TRAP staining and TRAP activity assay showed
that miR‐27a could further enhance the inhibitory effect of estrogen
on osteoclast differentiation. However, AMO‐27a could attenuate
estrogen‐inhibited osteoclast differentiation (Figure 3f–h). Similar
results were further confirmed by testing the expression of TRAP and
c‐Fos (Figure 3i,j). Taken together, these results implicated that miR‐
27a was a critical factor for estrogen‐inhibited osteoclast differ-
entiation.
3.4 | MiR‐27a inhibited osteoclastic bone
resorption and the formation of osteoclastic
F‐actin ring
Even though miR‐27a could impair osteoclasts formation, it was
unclear whether miR‐27a could inhibit osteoclast activity. Therefore,
we performed pit formation assay to estimate the effect of miR‐27a
on osteoclastic bone resorption. Preosteoclast transfected with miR‐
27a or AMO‐27a were cultured on bone slices, and induced by M‐CSF
and RANKL for 7 days. We found that miR‐27a could significantly
decrease pit formation. However, the resorption area was markedly
increased in the AMO‐27a group (Figure 4a,b). In addition, a well‐
polarized F‐actin ring was required for efficient bone resorption. We
GUO ET AL.
found that clear F‐actin ring structures were observed in the miR‐NC
group. However, overexpression of miR‐27a significantly disrupted
the F‐actin ring structure (Figure 4c). These results further demon-
strated that miR‐27a could inhibit osteoclastic bone resorption. Next,
we test whether miR‐27a was involved in estrogen‐inhibited
osteoclastic bone resorption. We found that miR‐27a could enhance
the inhibitory effect of estrogen on resorption pit formation by
osteoclasts, whereas AMO‐27a alleviated estrogen‐inhibited bone
resorption, indicating that miR‐27a was involved in estrogen‐
decreased osteoclast bone resorption (Figure 4d,e).
3.5 | Molecular targets of miR‐27a involved
in estrogen‐decreased osteoclastogenesis and
bone resorption
Based on the above observations, miR‐27a was involved in
estrogen‐decreased osteoclastogenesis and bone resorption. It is
possible that miR‐27a targets several regulatory factors associated
with osteoclastogenesis and bone resorption. To address this issue,
we used a computation and bioinformatics‐based approach to
predict the putative targets through TargetScan, which is hosted by
the Wellcome Trust Sanger Institute. These explorations led to the
identification of candidate targets of miR‐27a: PPARγ and APC,
which were confirmed to involve in osteoclast differentiation and
osteoclastic bone resorption, respectively. The unique sites of
miRNA::mRNA complementarity of miR‐27a targeting PPARγ or
APC are shown in Figure 5a,b. Western blot analysis showed that
PPARγ and APC expression were increased in the osteoclasts from
OVX mice compared to SHAM mice (Figure 5c,d). MiR‐27a lowered
markedly the levels of PPARγ and APC protein in osteoclasts,
whereas AMO‐27a could significantly increase PPARγ and APC
protein expressions (Figure 5e,f). In addition, miR‐27a enhanced
the inhibitory effect of estrogen on PPARγ and APC protein
expressions, whereas AMO‐27a alleviated estrogen‐inhibited
PPARγ and APC protein expression (Figure 5g,h). To further
investigate whether miR‐27a binds to the 3′‐UTR of PPARγ and
APC, we performed a luciferase reporter assay. We placed the
3′‐UTRs of PPARγ and APC into the 3′‐UTR of a luciferase reporter
plasmid to construct chimeric vectors. Luciferase activity was
diminished in the reporter containing the 3′‐UTR of PPARγ or APC
treated with miR‐27a compared with pMIR‐PPARγ or pMIR‐APC
alone, suggesting that PPARγ and APC were the target genes of
miR‐27a (Figure 6a,b).
3.6 | Involvement of PPARγ and APC in osteoclast
differentiation and bone resorption
To further test whether PPARγ and APC were involved in miR‐27a‐
mediated osteoclast differentiation and bone resorption, we
performed gain‐of‐function experiments in which PPARγ and APC
were respectively overexpressed in preosteoclasts. TRAP staining
and TRAP activity assay showed that miR‐27a significantly decreased
osteoclast differentiation, whereas overexpressing of PPARγ
obviously alleviated the inhibitory effect of miR‐27a on osteoclast
GUO ET AL. | 7

F I G U R E 3 Involvement of miR‐27a in estrogen‐inhibited osteoclast differentiation. (a) TRAP staining was showed in preosteoclasts
transfected with either AMO‐27a or miR‐27a under RANKL and M‐CSF for 7 days. (b) Summarized data showed that overexpression of miR‐27a
significantly decreased osteoclast differentiation. However, miR‐27a depletion significantly increased osteoclastogenesis. n = 6, **P < 0.01.
(c) TRAP activity assessment was accomplished in preosteoclasts transfected with either AMO‐27a or miR‐27a under RANKL and M‐CSF for
7 days. n = 4, **P < 0.01. (d,e) QRT‐PCR analysis of osteoclasts formation specific genes, TRAP and c‐Fos, in preosteoclasts transfected with either
AMO‐27a or miR‐27a under RANKL and M‐CSF for 7 days. n = 4, **P < 0.01. (f) TRAP staining was showed in preosteoclasts treated with
10−7 M estrogen and transfected with either AMO‐27a or miR‐27a under RANKL and M‐CSF for 7 days. (g) Summarized data showed that
overexpression of miR‐27a significantly promoted estrogen‐inhibited osteoclast differentiation. However, miR‐27a depletion significantly
alleviated estrogen‐decreased osteoclastogenesis. n = 6, **P < 0.01. (h) TRAP activity assessment was accomplished in preosteoclasts treated
with 10−7 M estrogen and transfected with either AMO‐27a or miR‐27a under RANKL and M‐CSF for 7 days. n = 4, **P < 0.01. (i,j) QRT‐PCR
analysis of osteoclasts formation specific genes, TRAP and c‐Fos, in preosteoclasts treated with 10−7 M estrogen and transfected with either
AMO‐27a or miR‐27a under RANKL and M‐CSF for 7 days. n = 4, **P < 0.01. AMO‐27a, anti‐microRNA oligonucleotides‐27a; E2, estrogen;
M‐CSF, macrophage colony‐stimulating factor; NC, negative control; qRT‐PCR, quantitative real‐time polymerase chain reaction; RANKL,
receptor activator of nuclear factor B ligand; TRAP, tartrate‐resistant acid phosphatase [Color figure can be viewed at wileyonlinelibrary.com]

differentiation (Figure 7a–c). QRT‐PCR analysis revealed that the significantly alleviated miR‐27a‐decreased osteoclast‐specific genes
levels of the osteoclast‐specific genes TRAP and c‐Fos were lower in expression (Figure 7d,e), suggesting that PPARγ was involved in
the osteoclasts overexpressing miR‐27a compared with the cells miR‐27a‐inhibited osteoclast differentiation. In addition, we found
transfected with the miR‐NC, whereas overexpression of PPARγ that miR‐27a could significant decrease pit formation, whereas
8 | GUO ET AL.

F I G U R E 4 MiR‐27a inhibited osteoclastic bone resorption and F‐actin ring formation. (a) Resorption pit formation was showed in preosteoclasts
transfected with either AMO‐27a or miR‐27a under RANKL and M‐CSF for 7 days. (b) Summarized data showed that overexpression of miR‐27a
significantly decreased resorption pit formation by osteoclasts. However, miR‐27a depletion significantly increased resorption pit formation by
osteoclasts. n = 6, **P < 0.01. (c) F‐actin ring staining was showed in preosteoclasts transfected with either AMO‐27a or miR‐27a under RANKL
and M‐CSF for 7 days. (d) Resorption pit formation was showed in preosteoclasts treated with 10−7 M estrogen and transfected with either
AMO‐27a or miR‐27a under RANKL and M‐CSF for 7 days. (e) Summarized data showed that overexpression of miR‐27a significantly promoted
estrogen‐decreased resorption pit formation. However, miR‐27a depletion significantly alleviated estrogen‐decreased osteoclasts bone resorbing.
n = 6, **P < 0.01. AMO‐27a, anti‐microRNA oligonucleotides‐27a; E2, estrogen; M‐CSF, macrophage colony‐stimulating factor; miR‐27a,
microRNA‐27a; NC, negative control; RANKL, receptor activator of nuclear factor B ligand [Color figure can be viewed at wileyonlinelibrary.com]

overexpression of APC alleviated miR‐27a‐decreased resorption pit
formation by osteoclasts (Figure 7f,g). Taken together, these results
indicated that PPARγ and APC were functional target genes for
miR‐27a‐mediated osteoclast differentiation and bone resorption.
3.7 | Overexpression of miR‐27a in vivo alleviates
OVX‐induced osteoporosis
OVX mouse model and miR‐27a‐CH were applied to further
investigate the effect of miR‐27a on OVX‐induced osteoporosis in
vivo. Micro‐CT analysis of distal femurs metaphysic revealed that the
BMD, BV/TV, Tb.Th and Tb.N were significantly lower in OVX mice
compared to SHAM control mice. However, injection of miR‐27a‐CH
significantly improved the trabecular bone structures in OVX mice
(Figure 8a–e). To examine whether miR‐27a‐CH compounds could
enter the bone marrow, we measured the levels of miR‐27a in the
bone marrow of mice from different groups 72 hr post injection with
miR‐27a‐CH or miR‐NC‐CH. QRT‐PCR analysis showed that miR‐27a
level in the bone marrow was increased five folds by miR‐27a‐CH,
indicating an efficient miR‐27a delivery (Figure 8f). Next, TRAP
staining in the metaphyseal area of femurs bone sections derived
from different groups was applied to observe the effects of miR‐27a
on osteoclastogenesis (Figure 8g). Quantification of the TRAP
staining showed a significantly increased osteoclast number and
surface area in OVX mice, whereas it was markedly alleviated in OVX
mice injected with miR‐27a‐CH (Figure 8h). Furthermore, compared
to OVX mice, the serum levels of TRAP5b (bone resorption marker)
were significantly lower in OVX mice injected with miR‐27a‐CH,
suggesting that miR‐27a could alleviate OVX‐induced bone resorp-
tion in vivo (Figure 8i).
4 | D I S C U SS I O N
Estrogen has been shown to exert direct antiosteoclastic effects at
several stages of osteoclastic differentiation and function, namely
osteoclastogenesis and resorption (Nakamura et al., 2007; Srivastava
et al., 2001). However, the exact mechanisms by which estrogen
GUO ET AL. | 9

F I G U R E 5 Molecular targets of miR‐27a involved in estrogen‐decreased osteoclastogenesis and bone resorption. (a) The sequences showed
that the unique sites of miRNA::mRNA complementarity between miR‐27a and PPARγ. (b) The sequences showed that the unique sites of miRNA::
mRNA complementarity between miR‐27a and APC. (c,d) PPARγ and APC expression were examined by western blot in BMMs from SHAM mice
and OVX mice, which were induced with 20 ng/ml M‐CSF and 50 ng/ml RANKL for 7 days. n = 3, **P < 0.01. (e,f) Western blot analysis of PPARγ
and APC expression in preosteoclasts transfected with miR‐27a mimics and blocker, followed by induction of 20 ng/ml M‐CSF and 50 ng/ml
RANKL for 7 days. n = 3, *P < 0.05, **P < 0.01. (g,h) Western blot analysis of PPARγ and APC expression in preosteoclasts treated with 10−7 M
estrogen and transfected with either AMO‐27a or miR‐27a under RANKL and M‐CSF for 7 days. n = 3, *P < 0.05, **P < 0.01. APC, adenomatous
polyposis coli; AMO‐27a, anti‐microRNA oligonucleotides‐27a; BMMs, bone marrow‐derived macrophages; E2, estrogen; M‐CSF, macrophage
colony‐stimulating factor; miR‐27a, microRNA‐27a; mRNA, messenger RNA; NC, negative control; OVX, ovariectomy; PPARγ, peroxisome
proliferator‐activated receptor gamma; RANKL, receptor activator of nuclear factor B ligand [Color figure can be viewed at wileyonlinelibrary.com]

inhibited osteoclast differentiation and bone resorption were not
fully elucidated. In this study, we identified that miR‐27a, a
posttranscriptional regulator, was upregulated by estrogen during
the process of osteoclastogenesis. Furthermore, we demonstrated
that estrogen might respectively decrease osteoclast differentiation
and bone resorption via miR‐27a targeting PPARγ and APC.
The increasing of osteoclast differentiation caused by estrogen
deficiency may be due to many mechanisms. First, estrogen with-
drawal following menopause led to an increase in the production of
the proinflammatory cytokines interleukin‐1 (IL‐1), IL‐6, and tumor
necrosis factor, which could stimulate the differentiation of myeloid
precursor cells into osteoclasts (McLean, 2009). Second, estrogen‐
mediated suppression of osteoclasts involves the regulation of the
RANKL/osteoprotegerin (OPG) ratio. Estrogen has been shown to
increase the transcription of OPG and to affect RANKL localization
and expression in osteoblasts, osteocytes or bone lining cells, resulting
in decrease of osteoclastogenesis (Bord, Ireland, Beavan, & Compston,
2003; Streicher et al., 2017). However, estrogen was also confirmed to
suppress RANKL and M‐CSF‐induced differentiation of myelomono-
cytic precursors into multinucleated TRAP‐positive osteoclasts
through an estrogen receptor (ER) dependent mechanism that does
not require mediation by stromal cells (Shevde et al., 2000). Three ERs
10 | GUO ET AL.

F I G U R E 6 Verification of PPARγ and APC as cognate targets of miR‐27a. (a) HEK293 cells were transfected with the construct containing
the 3′‐UTR of PPARγ (pMIR‐PPARγ) and cotransfected with miR‐27a mimic or miR‐NC for 48 hr. The luciferase activity of the reporter
containing the 3′‐UTR of PPARγ treated with miR‐27a mimic decreased significantly compared with that with pMIR‐PPARγ alone. n = 6,
**P < 0.01. (b) HEK293 cells were transfected with the construct containing the 3′‐UTR of APC (pMIR‐APC) and cotransfected with miR‐27a
mimic or miR‐NC for 48 hr. The luciferase activity of the reporter containing the 3′‐UTR of APC treated with miR‐27a mimic decreased
significantly compared with that with pMIR‐APC alone. n = 6, **P < 0.01. APC, adenomatous polyposis coli; miR‐27a, microRNA‐27a;
NC, negative control; PPARγ, peroxisome proliferator‐activated receptor gamma; UTR, untranslational region

were expressed in osteoclasts. Estrogen, via ERs activation, affects
gene transcription and expression, leading to decreased osteoclasto-
genesis (Martin‐Millan et al., 2010). In the current study, our results
demonstrated that estrogen could decrease osteoclast differentiation
and osteoclast bone resorption via a stromal cell independent
pathway. These results were consistent with previous studies (Shevde
et al., 2000).
Osteoclast differentiation is regulated by transcriptional, post-
transcriptional, and posttranslational mechanisms. MiRNAs, as
fundamental posttranscriptional regulators of gene expression, play
critical roles in osteoclastogenesis (Ji et al., 2016). Many miRNAs
have been demonstrated to involve in osteoclastogenesis and the
bone‐resorbing activity of osteoclasts, such as miR‐34a‐5p,
miR‐26a‐5p, miR‐21‐5p, miR‐31, and miR‐29 (Lopes et al., 2016).
Several recent reports have suggested that estrogen exerted
posttranscriptional control through the regulation of miRNAs
processing and expression (Wu et al., 2017). However, very few
studies explored the role of miRNAs in estrogen‐inhibited osteo-
clast differentiation and bone resorption. Only Sugatani and Hruska
(2013) reported that miR‐21‐5p was involved in estrogen‐
decreased osteoclastogenesis. In this study, we present for the
first time results of screening the miRNAs associated with estrogen
deficiency‐induced osteoclastogenesis and demonstrate that
miR‐27a targeting PPARγ and APC contribute to estrogen‐mediated
osteoclasts formation and bone resorption.
Our results identified that miR‐27a was significantly repressed in
osteoclasts from OVX mice. Furthermore, overexpression of miR‐27a
decreased osteoclast formation and bone resorption. The inhibition
of miR‐27a with AMO‐27a resulted in increase of osteoclast numbers
and the bone‐resorbing activity of osteoclasts. Recent studies also
confirmed that miR‐27a was one of the most strongly downregulated
miRNAs in the serum of patients with postmenopausal osteoporotic
(You, Pan, Chen, Gu, & Chen, 2016). Indeed, evidence suggests that
miR‐27a appears to play an important role in the mountains of bone
homeostasis. Wang and Xu (2010) reported that miR‐27a promoted
osteoblast differentiation through activation of Wnt signaling. Pan,
Wang, Jianwei, and Ye (2014) found that miR‐27a targeting MAP2K4
via JNK/p38 signaling pathway contributed to the development of
osteosarcoma. Lin, Gao, Alarcon, Ye, and Yun (2009) demonstrated
that miR‐27a was essential for the shift of mesenchymal stem cells
from osteogenic differentiation to adipogenic differentiation in
osteoporosis by targeting Mef2c. However, to our knowledge, our
study is the first to elucidate the role of miR‐27a in osteoclasto-
genesis.
PPARγ, which is a member of the nuclear receptor superfamily of
transcription factors, induces target gene expression by binding to
PPAR response elements in the promoter regions (Tontonoz &
Spiegelman, 2008). Growing evidence suggests that PPARγ could
function as a key regulator of skeletal homeostasis by directly
regulating the differentiation of bone cells. Akune et al (2004) found
that PPARγ negatively affected osteoblast differentiation and bone
formation (Wei et al., 2010). PPARγ activation by thiazolidinedione
(TZD) treatment inhibited osteoblast differentiation but promoted
adipocyte differentiation (Rzonca, Suva, Gaddy, Montague, & Lecka‐
Czernik, 2004). However, the role of PPARγ in osteoclast differentia-
tion or function remains controversial. Many studies showed that
activation of PPARγ could stimulate osteoclastogenesis (Wei et al.,
2010), whereas a few studies demonstrated that osteoclast differ-
entiation and function were not affected in PPARγ‐haploinsufficient
mice (Akune et al., 2004). In this study, we found that the expression
GUO ET AL. | 11

F I G U R E 7 Involvement of PPARγ and APC in osteoclast differentiation and bone resorption. (a) TRAP staining was showed in preosteoclasts
overexpressing PPARγ and miR‐27a under RANKL and M‐CSF for 7 days. (b) Summarized data showed that miR‐27a significantly decreased
osteoclast differentiation. However, overexpression of PPARγ significantly alleviated miR‐27a‐decreased osteoclastogenesis. n = 6, *P < 0.05,
**P < 0.01. (c) TRAP activity assessment was accomplished in preosteoclasts overexpressing PPARγ and miR‐27a under RANKL and M‐CSF for
7 days. n = 4, **P < 0.01. (d,e) QRT‐PCR analysis of osteoclasts formation specific genes, TRAP and c‐Fos, in preosteoclasts overexpressing PPARγ and
miR‐27a under RANKL and M‐CSF for 7 days. n = 4, **P < 0.01. (f) Resorption pit formation was showed in preosteoclasts overexpressing APC and
miR‐27a under RANKL and M‐CSF for 7 days. (g) Summarized data showed that overexpression of miR‐27a significantly decreased the activity of
osteoclasts bone resorption. However, overexpression of APC significantly alleviated miR‐27a‐decreased the bone resorbing activity of osteoclasts.
n = 6, **P < 0.01. APC, adenomatous polyposis coli; miR‐27a, microRNA‐27a; M‐CSF, macrophage colony‐stimulating factor; NC, negative control;
PPARγ, peroxisome proliferator‐activated receptor gamma; qRT‐PCR, quantitative real‐time polymerase chain reaction; RANKL, receptor activator of
nuclear factor B ligand; TRAP, tartrate‐resistant acid phosphatase [Color figure can be viewed at wileyonlinelibrary.com]

of PPARγ was higher in the osteoclasts from OVX mice compared to
SHAM control mice. Further study confirmed that PPARγ was a
functional target gene for miR‐27a‐mediated osteoclast differentia-
tion. The molecular mechanism by which miR‐27a targeting PPARγ
decreased osteoclast formation needs to be further explored.
APC is classified as a tumor suppressor gene, and its mutations
are known to cause familial adenomatous polyposis (Polakis, 1997).
Previous studies showed that APC could stabilize microtubules
through interacting with microtubules with its microtubule‐binding,
or through interacting with end‐binding protien 1 (EB1) (Wen et al.,
2004). APC was confirmed to be important for the formation of
stable microtubules in many cells (Matsumoto et al., 2013). The
inhibition of APC binding to microtubules in osteoclast could lead to
decreased microtubule stability, resulting in a decrease in bone‐
resorbing activity along with reduced sealing zone formation
(Matsumoto et al., 2013; Zumbrunn, Kinoshita, Hyman, & Nathke,
2001). Consistent with previous studies, our results confirmed that
APC was involved in miR‐27a‐mediated F‐actin ring formation and
the bone resorbing activity of osteoclasts.
Estrogen regulates diverse physiological effects through geno-
mic and nongenomic mechanisms involving ERα, ERβ. Estrogen
leads to a conformational change of ER, resulting in increase of ER
affinity for DNA. In this conformation, E2‐ER compound binding to
specific genes in the nucleus affects their transcription and de novo
protein synthesis (Condliffe, Doolan, & Harvey, 2001). In addition
to this genomic response, estrogen also elicits rapid responses
independent of genome interaction and protein synthesis within
seconds to minutes through some signaling pathways, such as
cAMP‐dependent protein kinase (PKA) signaling pathway and
protein kinase C signaling pathway (Chen, Ouyang, Ye, Ni, &
Chen, 2014; Condliffe et al., 2001). In this study, our results
showed that estrogen obviously increased the expression of
12 | GUO ET AL.

F I G U R E 8 Overexpression of miR‐27a in vivo alleviates OVX‐induced osteoporosis. (a) Representative figures of micro‐CT analysis of the distal end
of intact femurs of SHAM mice, OVX mice, OVX + miR‐27a‐CH mice, and OVX + miR‐NC‐CH mice. (b–e) BMD, BV/TV, Tb.Th, and Tb.N in the region of
interest were measured. n = 6 mice per group, *P < 0.05, **P < 0.01. (f) The levels of miR‐27a were measured by qRT‐PCR in the bone marrow from
different group mice after 72 hr post injection with or without miR‐27a‐CH and miR‐NC‐CH. n = 6 mice per group, **P < 0.01. (g) TRAP staining was
showed in the metaphyseal area of femurs bone sections derived from different groups. n = 4. (h) The area of TRAP‐positive staining was counted. n = 4,
**P < 0.01. (i) The serum levels of TRAP5b (bone resorption marker) were measured by ELISA in different groups. n = 6 mice per group, **P < 0.01. BMD,
bone mineral density; BV/TV, bone volume/tissue volume; micro computed tomography (micro‐CT); CH, chitosan; ELISA, enzyme linked immunosorbent
assay; miR‐27a, microRNA‐27a; NC, negative control; OVX, ovariectomized; qRT‐PCR, quantitative real‐time polymerase chain reaction; Tb.N, trabecular
number; Tb.Th, trabecular thickness; TRAP, tartrate‐resistant acid phosphatase [Color figure can be viewed at wileyonlinelibrary.com]

miR‐27a. Further, we found that ER binding sites existed in the
promoter region of miR‐27a (data not shown). Future studies will
be accomplished to explore the exact mechanisms of estrogen‐
regulated miR‐27a expression.
In conclusion, our data provided new evidence that miR‐27a was
essential for estrogen‐inhibited osteoclast differentiation and the
bone resorbing activity of osteoclasts. Upregulation of miR‐27a by
estrogen leads to PPARγ and APC targeting and inhibition of
osteoclasts formation and bone resorption. This study is an effort
to establish a molecular mechanism of estrogen deficiency‐induced
bone loss, and to provide insights into the potential contribution of
miRNA in the regulation of osteoclast differentiation and bone
resorption by estrogen.
AC KNO WL EDG M EN TS
The authors thank Dr. Lei Zhang for expert technical assistance in
carrying out cells transfection and western blotting analysis.
GUO ET AL.
Contract grant sponsor: The National Science Foundation of China;
Contract grant number: No. 81300713. Contract grant sponsor: The
Natural Science Foundation of Shanghai; Contract grant number: No.
17ZR1425900. Contract grant sponsor: Research project of Shanghai
Municipal Health and Family Planning Commission; Contract grant
number: No. 201640105, 201640190, 201540156.
CO NFLICTS OF INTE RES T
The authors have no conflicts of interest to declare.
A UT HO R C ONT RI BU TIO NS
All authors contributed to the design of the study. L.G., K.C., J.Y., P.H.,
L.D., C.H., and J.X. collected the data and performed the analysis. L.G.
led the draft of the manuscript. All authors interpreted the findings,
revised the manuscript and approved the final version. C.H. and J.X.
take responsibility for the integrity of this work.
OR CID
Lei Guo http://orcid.org/0000-0001-5143-3234
Xing Xu http://orcid.org/0000-0003-3690-4004
REFERENC ES
Akune, T., Ohba, S., Kamekura, S., Yamaguchi, M., Chung, U. I.,
Kubota, N., … Kawaguchi, H. (2004). PPARgamma insufficiency
enhances osteogenesis through osteoblast formation from bone
marrow progenitors. The Journal of Clinical Investigation, 113(6),
846–855.
Bord, S., Ireland, D. C., Beavan, S. R., & Compston, J. E. (2003). The effects
of estrogen on osteoprotegerin, RANKL, and estrogen receptor
expression in human osteoblasts. Bone, 32(2), 136–141.
Chen, F., Ni, B., Yang, Y. O., Ye, T., & Chen, A. (2014). Knockout of TRPV6
causes osteopenia in mice by increasing osteoclastic differentiation
and activity. Cellular Physiology and Biochemistry: International Journal
of Experimental Cellular Physiology, Biochemistry, and Pharmacology,
33(3), 796–809.
Chen, F., Ouyang, Y., Ye, T., Ni, B., & Chen, A. (2014). Estrogen inhibits
RANKL‐induced osteoclastic differentiation by increasing the expres-
sion of TRPV5 channel. Journal of Cellular Biochemistry, 115(4),
651–658.
Condliffe, S. B., Doolan, C. M., & Harvey, B. J. (2001). 17beta‐oestradiol
acutely regulates Cl− secretion in rat distal colonic epithelium. The
Journal of Physiology, 530(Pt 1), 47–54.
Couzin, J. (2007). Genetics. Erasing microRNAs reveals their powerful
punch. Science, 316(5824), 530.
Dore, L. C., Amigo, J. D., Dos Santos, C. O., Zhang, Z., Gai, X., Tobias, J. W.,
… Weiss, M. J. (2008). A GATA‐1‐regulated microRNA locus essential
for erythropoiesis. Proceedings of the National Academy of Sciences of
the United States of America, 105(9), 3333–3338.
Ji, X., Chen, X., & Yu, X. (2016). MicroRNAs in osteoclastogenesis and
function: Potential therapeutic targets for osteoporosis. International
Journal of Molecular Sciences, 17(3), 349.
Kang, H., Yan, Y., Jia, P., Yang, K., Guo, C., Chen, H., … Deng, L. (2016).
Desferrioxamine reduces ultrahigh‐molecular‐weight polyethylene‐
induced osteolysis by restraining inflammatory osteoclastogenesis via
heme oxygenase‐1. Cell Death & Disease, 7(10), e2435.
| 13
Krzeszinski, J. Y., Wei, W., Huynh, H., Jin, Z., Wang, X., Chang, T. C., …
Wan, Y. (2014). miR‐34a blocks osteoporosis and bone metastasis
by inhibiting osteoclastogenesis and Tgif2. Nature, 512(7515),
431–435.
Lin, Q., Gao, Z., Alarcon, R. M., Ye, J., & Yun, Z. (2009). A role of miR‐27
in the regulation of adipogenesis. The FEBS Journal, 276(8),
2348–2358.
Lopes, H. B., Ferraz, E. P., Almeida, A. L., Florio, P., Gimenes, R., Rosa, A. L.,
& Beloti, M. M. (2016). Participation of MicroRNA‐34a and RANKL on
bone repair induced by poly(vinylidene‐trifluoroethylene)/barium
titanate membrane. Journal of Biomaterials Science, Polymer Edition,
27(13), 1369–1379.
Luo, X., Xiao, J., Lin, H., Li, B., Lu, Y., Yang, B., & Wang, Z.
(2007). Transcriptional activation by stimulating protein 1 and
post‐transcriptional repression by muscle‐specific microRNAs of
IKs‐encoding genes and potential implications in regional hetero-
geneity of their expressions. Journal of Cellular Physiology, 212(2),
358–367.
Martin‐Millan, M., Almeida, M., Ambrogini, E., Han, L., Zhao, H., Weinstein,
R. S., … Manolagas, S. C. (2010). The estrogen receptor‐alpha in
osteoclasts mediates the protective effects of estrogens on cancellous
but not cortical bone. Molecular Endocrinology, 24(2), 323–334.
Matsumoto, T., Nagase, Y., Hirose, J., Tokuyama, N., Yasui, T., Kadono, Y.,
… Tanaka, S. (2013). Regulation of bone resorption and sealing zone
formation in osteoclasts occurs through protein kinase B‐mediated
microtubule stabilization. Journal of Bone and Mineral Research:
The Official Journal of the American Society for Bone and Mineral
Research, 28(5), 1191–1202.
McLean, R. R. (2009). Proinflammatory cytokines and osteoporosis.
Current Osteoporosis Reports, 7(4), 134–139.
Midgley, A. C., Morris, G., Phillips, A. O., & Steadman, R. (2016). 17beta‐
estradiol ameliorates age‐associated loss of fibroblast function by
attenuating IFN‐gamma/STAT1‐dependent miR‐7 upregulation. Aging
Cell, 15(3), 531–541.
Nakamura, T., Imai, Y., Matsumoto, T., Sato, S., Takeuchi, K., Igarashi, K., …
Kato, S. (2007). Estrogen prevents bone loss via estrogen receptor
alpha and induction of Fas ligand in osteoclasts. Cell, 130(5), 811–823.
Pan, W., Wang, H., Jianwei, R., & Ye, Z. (2014). MicroRNA‐27a promotes
proliferation, migration and invasion by targeting MAP2K4 in human
osteosarcoma cells. Cellular Physiology and Biochemistry: International
Journal of Experimental Cellular Physiology, Biochemistry, and Pharma-
cology, 33(2), 402–412.
Polakis, P. (1997). The adenomatous polyposis coli (APC) tumor
suppressor. Biochimica et Biophysica Acta, 1332(3), F127–F147.
Raisz, L. G. (2005). Pathogenesis of osteoporosis: Concepts, conflicts, and
prospects. The Journal of Clinical Investigation, 115(12), 3318–3325.
Rzonca, S. O., Suva, L. J., Gaddy, D., Montague, D. C., & Lecka‐Czernik, B.
(2004). Bone is a target for the antidiabetic compound rosiglitazone.
Endocrinology, 145(1), 401–406.
Sang, C., Zhang, Y., Chen, F., Huang, P., Qi, J., Wang, P., … Guo, L. (2016).
Tumor necrosis factor alpha suppresses osteogenic differentiation of
MSCs by inhibiting semaphorin 3B via Wnt/beta‐catenin signaling in
estrogen‐deficiency induced osteoporosis. Bone, 84, 78–87.
Shevde, N. K., Bendixen, A. C., Dienger, K. M., & Pike, J. W. (2000).
Estrogens suppress RANK ligand‐induced osteoclast differentiation
via a stromal cell independent mechanism involving c‐Jun repression.
Proceedings of the National Academy of Sciences of the United States of
America, 97(14), 7829–7834.
Shi, C., Qi, J., Huang, P., Jiang, M., Zhou, Q., Zhou, H., … Deng, L. (2014).
MicroRNA‐17/20a inhibits glucocorticoid‐induced osteoclast differ-
entiation and function through targeting RANKL expression in
osteoblast cells. Bone, 68, 67–75.
Srivastava, S., Toraldo, G., Weitzmann, M. N., Cenci, S., Ross, F. P., &
Pacifici, R. (2001). Estrogen decreases osteoclast formation by down‐
regulating receptor activator of NF‐kappa B ligand (RANKL)‐induced
14 | GUO
JNK activation. The Journal of Biological Chemistry, 276(12),
8836–8840.
Streicher, C., Heyny, A., Andrukhova, O., Haigl, B., Slavic, S., Schuler, C., …
Erben, R. G. (2017). Estrogen regulates bone turnover by targeting
RANKL expression in bone lining cells. Scientific Reports, 7(1), 6460.
Sugatani, T., & Hruska, K. A. (2013). Down‐regulation of miR‐21
biogenesis by estrogen action contributes to osteoclastic apoptosis.
Journal of Cellular Biochemistry, 114(6), 1217–1222.
Tontonoz, P., & Spiegelman, B. M. (2008). Fat and beyond: The diverse
biology of PPARgamma. Annual Review of Biochemistry, 77, 289–312.
Wang, T., & Xu, Z. (2010). miR‐27 promotes osteoblast differentiation by
modulating Wnt signaling. Biochemical and Biophysical Research
Communications, 402(2), 186–189.
Wei, W., Wang, X., Yang, M., Smith, L. C., Dechow, P. C., Sonoda, J., … Wan, Y.
(2010). PGC1beta mediates PPARgamma activation of osteoclastogenesis
and rosiglitazone‐induced bone loss. Cell Metabolism, 11(6), 503–516.
Wen, Y., Eng, C. H., Schmoranzer, J., Cabrera‐Poch, N., Morris, E. J., Chen,
M., … Gundersen, G. G. (2004). EB1 and APC bind to mDia to stabilize
microtubules downstream of Rho and promote cell migration. Nature
Cell Biology, 6(9), 820–830.
Wu, J., Xu, L., Sun, C., Zhang, B., Li, J., Sun, J., … Sun, D. (2017). Paeonol
alleviates epirubicin‐induced renal injury in mice by regulating Nrf2 and
NF‐kappaB pathways. European Journal of Pharmacology, 795, 84–93.
You, L., Pan, L., Chen, L., Gu, W., & Chen, J. (2016). MiR‐27a is essential for
the shift from osteogenic differentiation to adipogenic differentiation
ET AL.
of mesenchymal stem cells in postmenopausal osteoporosis. Cellular
Physiology and Biochemistry: International Journal of Experimental
Cellular Physiology, Biochemistry, and Pharmacology, 39(1), 253–265.
Yu, B., Chang, J., Liu, Y., Li, J., Kevork, K., Al‐Hezaimi, K., … Wang, C. Y.
(2014). Wnt4 signaling prevents skeletal aging and inflammation by
inhibiting nuclear factor‐kappaB. Nature Medicine, 20(9),
1009–1017.
Zaidi, M. (2007). Skeletal remodeling in health and disease. Nature
Medicine, 13(7), 791–801.
Zeng, Y. (2006). Principles of micro‐RNA production and maturation.
Oncogene, 25(46), 6156–6162.
Zumbrunn, J., Kinoshita, K., Hyman, A. A., & Nathke, I. S. (2001). Binding of
the adenomatous polyposis coli protein to microtubules increases
microtubule stability and is regulated by GSK3 beta phosphorylation.
Current Biology, 11(1), 44–49.
How to cite this article: Guo L, Chen K, Yuan J, et al. Estrogen
inhibits osteoclasts formation and bone resorption via
microRNA‐27a targeting PPARγ and APC. J Cell Physiol.
2018;1–14. https://doi.org/10.1002/jcp.26788