Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
SOIL-BORNE PATHOGENS
JAYALAKSHMI K.
MAY, 2014
ii
Doctor of Philosophy
in
Plant Pathology
By
JAYALAKSHMI K.
MAY, 2014
iii
Approved by :
Chairman : ____________________________
(S. LINGARAJU)
Members :
1. __________________________
(S. T. NAIK)
2. __________________________
(M. M. JAMADAR)
3. __________________________
4. __________________________
(RAMESH BHAT)
iv
Acknowledgement
I am highly grateful to the Rajeev Gandhi National Fellowship for SC/ST students,
university grants commission (UGC), New Delhi for providing me financial assistance in the
form of Senior Research Fellowship (SRF) and University of Agricultural Sciences, Dharwad
for providing me an opportunity to pursue my Doctoral programme.
Diction is not enough to express my deep and profound sense of gratitude and
indebtedness, reverence and heartfelt thanks to my major advisor and Chairman of Advisory
Committee Dr. S. LINGARAJU, Professor of Plant Pathology and Head, Institute of Organic
Farming, University of Agricultural Sciences, Dharwad. I accomplish his constructive criticism,
inspiration, insightful suggestion with privilege and heartfelt gratitude, without which I could
not have completed this work. For his meticulous guidance, transcendent suggestions and
inspiring guidance at every step, constant supervision, this not only moulded my research
work in a right form but also my overall personality. I confess that, it has been a rare privilege
for me to be associated with him during my Doctoral programme. I feel proud to have him as
my chairman of advisory committee, who treated me as a daughter rather than as student. I
seek his blessings forever.
I owe heartfelt sense of gratitude to my best friend Raju, brother Raghu, and my
lovely sisters Reena and Roopa who have given sound and fruitful advice and helped me in
my research work and without them I would have not finished research work.
On a personal note, I am very glad to mention sincere mental support and words of
encouragement of my beloved friends Rajani, Nethra, Savitha, Nagashree, Veena, Gunjan,
Poornima, Smitha, Sowmya, Pavithra, Kumuda, Harish, Ranganath, Prashanth, Ganesh,
Yogesh, Pradeep P. E, Vinod , sisters Uma, Ashwini, Divya, Basamma, Shwetha, Renuka,
Kumari and brothers Shreeshail, Sachin, Ravichandran and Shivakumar.
I will be failing in my duty if I do not mention the help, their valuable suggetions and
co-operation during research of my class mate Yogesh Bhagat and my seniors Sagar D,
Madhu Giri.
I have been highly fortunate in having many friends in whose company; I never felt
the burden of my studies. Their helping hand was evident at every stage of tension, anxiety
and achievement. To mention the names of only a few petals this together as a flower
scented my life with an elegant fragrance. I must begin with my classmates Arun Kumar,
Hemachandra, Gurupad and Suresh, juniors Sumangala, Vinamratha, Pushpa, Veena,
Rajalaxmi, Anusha, Kavya, Sangeetha, Ramya, Sukrutha, Nazia, Rohini Kolekar,
Santhoshreddy, Ranganath Swamy, Nagaraj, Huligappa, Anil, Pradeep Manyam, Madhu,
Druva, Anand, Chidananda, Swamy and my seniors Tippesh, Shadakshari, Yogesh Gowda
who have helped me in one way or the other for which I am ever greatful to them.
I would like to thank the non-teaching staff Shri Nadaf, Shri S. N. Patil, Shri
Gangadhar, Shri Barigidad, Shri. Arvind, Shri Hazarat, Smt. Shobha Nargund, Shri Manju
(Biotech) for their help during my research.
As a matter of external compliance, at the outset, I bow to thank Lord Ganesha, one
of the incarnations of Almighty who enabled me through his liberal blessings to accomplish
this venture.
I convey my whole hearted thanks to Mr. Arjun and Mr. Kalmesh (M/s. Arjun
Computers), for their meticulous typing of the manuscript neatly, timely and more vitally his
cooperation and affection towards me and Mr. Kumbar, for the neat binding of the manuscript.
Finally I share my sincere thanks and inspirations to all those seen and unseen hand
and minds.
DHARWAD
MAY, 2014 (JAYALAKSHMI K.)
vi
Affectionately Dedicated
to
My beloved parents
Shri. Krishnappa, Smt. Puttamma,
Brother Yogesh and Sister Sudha
vii
CONTENTS
Sl.
Chapter Particulars
No.
CERTIFICATE
ACKNOWLEDGEMENT
LIST OF TABLES
LIST OF FIGURE
LIST OF PLATES
1. INTRODUCTION
2. REVIEW OF LITERATURE
2.1 Sources of lectins
2.2 Plant lectins
2.3 Fungal lectins
2.4 Lectins in plant defence
2.5 Evaluation of plant and fungal lectins for in vitro suppression of
some common soil-borne pathogens
2.6 Influence of lectins on biocontrol agents in the suppression of
soil-borne pathogens in vitro
2.7 Evaluation srl1 and rvl1 transgenics and non-transgenics for the
suppression of tomato soil-borne pathogens
2.8 Mechanism of action of lectins in the suppression of soil-borne
pathogens
3. MATERIALS AND METHODS
3.1 Collection and isolation soil-borne pathogens
3.2 Expression of RVL1 and SRL1 in E. coli and its isolation
3.3 Raising polyclonal antibodies against SRL1 (anti-SRL1)
3.4 Evaluation of plant and fungal lectins for the in vitro suppression
of some common soil-borne pathogens
3.5 Influence of lectins on biocontrol agents in the suppression of
soil borne pathogens in vitro
3.6 Evaluation srl1 and rvl1 transgenics and non-transgenics for the
suppression of tomato soil-borne pathogens
3.7 Evaluation srl1 and rvl1 transgenics and non-transgenics lines
for root infection by Meloidogyne incognita and its development
3.8 Mechanism of action of lectins in the suppression of soil-borne
pathogens
4. EXPERIMENTAL RESULTS
4.1 Collection and isolation of soil-borne pathogens
4.2 Expression of RVL1 and SRL1 in E. coli
4.3 Raising polyclonal antibodies against SRL1 (anti-SRL1)
4.4 Evaluation of plant and fungal lectins for the in vitro suppression
of some common soil-borne pathogens
4.5 Influence of lectins on biocontrol agents in the suppression of
soil borne pathogens in vitro
viii
4.6 Evaluation srl1 and rvl1 transgenics and non-transgenics for the
suppression of tomato soil-borne pathogens
4.7 Evaluation of rvl1 and srl1 transgenics and non-transgenics for
root infection by M. incognita and its development and
reproduction
4.8 Mechanism of action of lectins in the suppression of soil-borne
pathogens
5. DISCUSSION
5.1 Collection and isolation of soil-borne pathogens affecting
tomato
5.2 Expression of RVL1 and SRL1 in E. coli
5.3 Raising polyclonal antibodies against SRL1 (anti-SRL1)
5.4 Evaluation of plant and fungal lectins for the in vitro suppression
of some common soil-borne pathogens
5.5 Influence of lectins on biocontrol agents in the suppression of
soil borne pathogens in vitro
5.6 Evaluation srl1 and rvl1 transgenics and non-transgenics for the
suppression of tomato soil-borne pathogens
5.7 Evaluation of rvl1 and srl1 transgenics and non-transgenics for
root infection by M. incognita and its development and
reproduction
5.8 Mechanism of action of lectins in the suppression of soil-borne
pathogens
6. SUMMARY AND CONCLUSION
REFERENCES
ix
LIST OF TABLES
Table
No. Title
LIST OF FIGURE
Figure
No. Title
LIST OF PLATES
Plate
Title
No.
1 Tomato root diseases from which the pathogens were isolated
2a Root pathogens and the growth in vitro
2b Their hyphae and spores
3 Ralstonia solanacearum: growth in vitro, morphology, biochemical
charecterisation and hypersensitivity
4 Meloidogyne incognita: Eggmass and perineal pattern
5 Mass multiplication (Giant culture)
6 Heamagglutination assay of E. coli-expressed RVL1 and SRL1
7 SDS-PAGE analysis of E. coli-expressed RVL1 and SRL1
8 Titre of polyclonal antibody against SRL1antigen determined by
DAC-ELISA
9 In vitro evaluation of SRL1 and RVL1 against F. oxysporum,
S. rolfsii and R. solani using poison food technique
10 In vitro evaluation of SRL1 and RVL1 against F. oxysporum,
S. rolfsii and R. solani using spread plate method
11 Evaluation of SRL1 and RVL1 against F. oxysporum, S. rolfsii and
R. solani employing inhibition zone assay
12 Germination of mature and immature sclerotia on Byrde’s medium
13 Germination of micro-sclerotia on Byrde’s medium
14 In vitro evaluation of plant and fungal lectins against
R. solanacearum through well diffusion assay
15 Determination of Minimum inhibitory concentration of SRL1 and
RVL1 against R. Solanacearum
16 Evaluation of SRL1 and RVL1 against R. solanacearum
17 Activity of SRL1 and RVL1 on R. solanacearum
18 Paecilomyces lilacinus: growth in vitro and spores and sporophores
19 In vitro evaluation of antagonists against S. rolfsii, R. solani and F.
oxysporum (without lectins)
20 In vitro evaluation of SRL1 and RVL1 on T. viride and
P. lilacinus
21 In vitro evaluation of bacterial and fungal bioagents against Ralstonia
solanacearum (without lectins)
22 Determination of Minimum inhibitory concentration for bacterial
biocontrol agents
23 Effect of SRL1 and RVL1 on P. fluorescens and B. subtilis strains
24 Influence of bacterial and fungal antagonists’ in combination with
SRL1 And RVL1 on R. solanacearum
xiii
LIST OF APPENDIX
Appendix
Title
No.
I Composition of different growth media/reagents/indicators used
1. INTRODUCTION
Protecting the crop plants from pests and pathogens is one of the most important
aspects in reaping higher crop productivity. Soil-borne pathogens are important in the
context of Indian agriculture as they cause high crop yield losses. Various soil-borne
pathogens are known to cause reduction in crop yields. For instance, Fusarium
oxysporum, an ubiquitous and polyphagous soil-bone fungus brings down the yield in
tomato in the range of 5 to 94 per cent. Similarly ubiquitous soil-borne bacterium
Ralstonia solanacearum and nematode Meloidogyne incognita cause respectively, yield
reduction of 10 to 100 and 5 to 95 per cent in the same crop. Despite the fact that a
number of management options are employed by crop growers, crop yield losses are
mounting. Alternate management strategies will have to be environmentally non-
hazardous. In this direction, researches involving lectins for suppression of soil-borne
pathogens damage will be worthwhile.
Stillmark in 1888 while investigating the toxic effects of castor bean extract
(Ricinus communis) on blood noticed that the red blood cells (RBCs) agglutinated: the
protein from castor beans called “ricin” capable of agglutinating the RBCs of human and
animals were identified. Initially, the ‘agglutinins’ were found only in plants. Later, when
they were found in other organisms and agglutinating cells other than erythrocytes, the
term “lectin” was proposed by William Boyd (Boyd and Slapeigh, 1954). Present definition
of lectins states that they are "proteins /glycoproteins possesing at least one non-catalytic
domain which bind reversibly to a specific mono or oligosaccharide" (Goldstein et al.,
1980). They are ubiquitous and have been isolated from plants, viruses, bacteria, animals
(Weis and Drickamer, 1996; Fang et al., 2010) and fungi (Gold and Balding, 1975). Their
detection and quantification are based on the agglutinating property and purification uses
specific immobilized sugar affinity columns (Gabius et al., 1993; Goldstein and Poretz,
1986; Lis and Sharon, 1986).
pathogens. The amino acid sequences of several lectins are reported. Since lectins have
been implicated in several disease conditions, they have applications in diagnosis and
biomedical research. Lectins with specific carbohydrate specificity have been purified
from various plant tissues and other organisms. They can be classified on the basis of
their carbohydrate specificity. They can also be categorized according to the overall
structures into merolectins, hololectins, chimerolectins and superlectins, or be grouped
into different families (legume lectins, type II ribosome-inactivating proteins, monocot
mannose-binding lectins and other lectins). Some of them include GNA (Galanthus nivalis
agglutinin), PSA (Pisum sativum agglutinin), ConA (Canavalia ensiformis agglutinin), PHA
(Phaseolus vulgaris agglutinin), WGA (Triticum vulgaris agglutinin). Also, many lectins
have been identified and isolated from fruiting body-forming fungi of the phyla
Basidiomycota and Ascomycota (Guillot and Konska 1997; Wang et al., 1998; Dam and
Brewer 2007). Some of these lectins which have been characterized biochemically and
structurally include Agaricus campestris lectin, Agaricus bisporus lectin (Goldstein and
Poretz, 1986), Botrytis cinerea lectin (Kellens et al., 1992); Pleurotus ostreatus lectin
(Chattopadhyay et al., 1999); and Rhizoctonia solani lectin (Candy et al., 2001).
Characteristic features of this type of lectins are their water solubility, synthesis in the
cytoplasm and composition of one or more subunits of low molecular weight.
Lectins consumed in the diet may be innocuous, since most of them are usually
denatured by cooking and proteolytically digested upon consumption. Further, the lectins
from vegetable(s) are expected to contain “safe lectins”, which can have immense
application in transgenic research. During the last few years, lectins from
Monocotyledonaceae have attracted greater attention because of their anti-insect, anti-
nematode and anti-pathogen properties. Mannose-binding lectins and the gene encoding
them have been extensively studied from many plant families like Amaryllidaceae,
Araceae, Alliaceae and Orchidaceae.
in morphogenesis and development (Guillot and Konska, 1997; Rosen et al., 1997). The
latter functions are based on the temporal and spatial regulation of gene expression
during fungal development. The synthesis of these lectins is often restricted to
reproductive structures such as fruiting bodies or sclerotia, in which these proteins
represent a high percentage of the total soluble protein content (Boulianne et al., 2000;
Candy et al., 2001; Nowrousian and Cebula, 2005; Walti et al., 2008).
Whereas, lectins from plants have been extensively studied; many plant lectins
have been demonstrated to interact with carbohydrates of other organisms either in
symbiosis or in defence processes (Peumans and Van Damme, 1995; Van Damme et
al., 2004; De Hoff et al., 2009). One of the most important functions of plant lectins is
their role as effectors in the defence against parasites and herbivores (Murdock and
Shade, 2002; Vasconcelos and Oliveira, 2004). It has been shown that plant lectins
possess fungicidal, insecticidal and nematicidal properties and are also toxic to higher
animals (Peumans and Van Damme, 1995; Oka et al., 1997; Macedo et al., 2002). The
expression of these lectins is regulated both temporally and spatially. It can be tissue-
specific or systemic, constitutive or induced upon stress, herbivory or pathogen infection
(Qin et al., 2003; Chen, 2009; Subramanyam et al., 2008; Vandenborre et al., 2009).
Genes encoding plant lectins have even been used in transgenic crops to
confer resistance against insect pests, plantpathogenic nematodes and fungi (Burrows
et al., 1998; Powell et al., 1998 and Ripoll et al., 2003). A well-studied example is the
snowdrop lectin (GNA) that binds to terminal mannose residues on glycoproteins in the
gut of aphid larvae and other insects (Trebicki et al., 2009). Because fungi are similar to
plants with regard to their non-motile nature, it is likely that they have evolved similar
mechanisms to defend themselves against predators and parasites (Spiteller, 2008;
Rohlfs and Churchill, 2011). Fungivory plays a significant role in shaping the structure
and function of natural fungal communities and represent a strong selective force for the
evolution of chemical defence systems in fungi (McGonigle, 2007). Accordingly, a wide
variety of chemical compounds, either constitutively produced or wound-activated, have
been identified in fungi (Wicklow, 1988; Spiteller, 2008), and many of these secondary
metabolites are believed to have evolved to protect saprophytic fungi
4
from being used as a food source by amoebozoa, nematodes and other invertebrates
(Rohlfs et al., 2007; Fox and Howlett, 2008). On the other hand, it has been shown that
proteins are responsible for most of the insecticidal activity of mushrooms (Wang et al.,
2002). Accordingly, entomotoxic effects have been demonstrated for Xerocomus
chrysenteron lectin (XCL) and Rhizoctonia solani agglutinin (when added to the artificial
diet of Drosophila melanogaster and Acrythosiphon pisum) and the cotton leafworm
Spodoptera littoralis, respectively (Trigueros et al., 2003; Hamshou et al., 2009), as well
as for the Sclerotinia sclerotiorum agglutinin (SSA) fed to Acrythosiphon pisum
(Hamshou et al., 2010).
Recently Remusatia vivipara (Roxb.) Schott, lectin (RVL1) has been purified
from its tubers (Bhat et al., 2010a). It is a mannose-binding lectin which agglutinates only
rabbit erythrocytes and possesses specificity for mucin and asialofetuin. The possibility
that it is cooked and therefore is non-toxic to human beings can be ruled out because of
the fact that the tuber lectin of R. viviapara (RVL1) is heat stable even at 80˚C for 30 min
under wide range of pH (2.0–9.3). Therefore, the gene coding for tuber lectin of R.
vivipara could be considered for transgenic development. rvl1 gene coding for RVL1 was
5
cloned for the first time at the Department of Biotechnology, University of Agricultural
Sciences, Dharwad (Neekhra, 2009).
Sclerotium rolfsii, a soil borne plant pathogenic fungus produces lectins that act as
signaling molecule in interaction with antagonists (Barak et al., 1985; Barak and Chet,
1990; Inbar and Chet, 1994) and germination of sclerotial bodies (Swamy et al., 2004).
Till date, 45 kDa (Inbar and Chet, 1994), 55 kDa (Barak and Chet, 1990), 60 kDa (Barak
and Chet, 1990) and 17 kDa lectins have been purified from S. rolfsii (Swamy et al.,
2001). Considering the use of such fungal lectins in pharmaceutical and crop
improvement applications, a lectin coding gene was cloned from S. rolfsii at the
Department of Biotechnology, University of Agricultural Sciences, Dharwad
(Chandrashekar, 2007; Bhat et al., 2010b). The gene was named as srl1 and the
deduced protein as SRL1. For functional validation, srl1 was cloned and expressed in E.
coli. SRL1 expressed in E. coli showed nematicidal effect on second-stage juvenile (J2) of
Meloidogyne incognita (Bhat et al., 2010b).
Of the several means of managing the pests, genetic engineering of crop plants is
considered promising for several reasons. Six transgenic events that were developed in
Department of Biotechnology, University of Agricultural Sciences, Dharwad using
Agrobacterium-mediated tomato transformation with pNR68 binary vector carrying srl1
and rvl1 gene in pHS100 (Bhagat, 2010; Patil, 2011) were used in the present study.
Expression of SRL1 and RVL1 was confirmed by agglutination assay with rabbit
erythrocytes. Agglutination activity of SRL1 and RVL1 were inhibited by only mucin
among various sugars and their derivatives tested. Transgenic tomato were analysed for
the toxicity of srl1and rvl1 to common root-knot nematode (Meloidogyne incognita).
Bioassay with J2 of M. incognita showed that the transgenics were moderately resistant
as against highly susceptible control plants.
With this background, the present investigation was carried out to know the effect
of E. coli-expressed Remusatia vivipara lectin (a plant lectin) and Sclerotium rolfsii lectin
(a fungal lectin) on the development and inhibition of some soil-borne pathogens like
Sclerotium rolfsii, Rhizoctonia solani, Fusarium oxysporum, Ralstonia solanacearum,
Meloidogyne incognita with the following objectives.
6
Objectives
1. Evaluation of plant and fungal lectins for the in vitro suppression of some common
soil-borne pathogens.
3. Evaluation srl1 and rvl1 transgenics and non-transgenics for the suppression of
tomato soil-borne pathogens.
Lectins were first described by Stillmark (1888) working with castor bean
protein extracts, which were referred to as haemagglutinins or phytoagglutinins
(ricin) because of their ability to agglutinate erythrocytes. Later, a number of
haemagglutinins from various plant seeds were described. Screening of such
proteins for blood group-specific agglutinating activity led to the general concept
that each plant haemagglutinin binds specifically to erythrocytes of a particular
human blood group within the ABO system. Later, such haemagglutinins were
termed “lectin”, subsequently lectins were also shown to agglutinate blood cells
of rabbit, sheep, goat etc. because of their specific sugar binding activity. As
mentioned already, they are shown to protect plants from different pathogens.
This could be due to; a) the presence of lectins at the potential invasion sites by
infectious agents, b) the binding of lectins to various fungi inhibiting their growth
and germination; and c) lectins binding to the chemoreceptors and glycoproteins
present in the digestive tract of nematode have either antifeedant effect or result
in mortality or retarded growth.
location of plant lectins is inside protein bodies, but lectins also occur in the
cytoplasm and in the intercellular space. Plant lectins have been subdivided on
the basis of their carbohydrate-binding specificity into mannose-,
mannose/glucose-, mannose/maltose-, Gal/GalNAc-, GlcNAcc/ (GlcNAc)n-,
fucose-, and sialic acid-binding lectins. The rapid progress in the structural
analysis of lectins and the molecular cloning of lectin genes have provided
detailed sequence information of over 100 lectins. Analysis of available
sequences distinguishes seven families of evolutionarily related proteins. Four of
these families, namely, the legume lectins, the type 2 ribosome-inactivating
proteins (RIP), the chitin-binding lectins containing hevein domains and the
monocot mannose-binding lectins are considered to be 'large' families. The
amaranthins, the cucurbitaceae phloem lectins and the jacalin related lectins
comprise only a small number of individual lectins and accordingly are
considered 'small' families. Several lectin genes have been cloned on the basis
of structural similarity. Most of the monocot mannose-binding lectins have been
cloned and characterized from families of angiosperms such as Amaryllidaceae,
Araceae, Alliaceae, Orchidaceae, Liliaceae, Iridaceae, Bromeliaceae and
Taxaceae families of gymnosperms. Recently tarin1 lectin isolated from
Colocasia esculenta L. Schott is well characterized mannose binding type plant
lectin, mainly expressed in corm storage parenchyma cells.
Occurrence of lectin in fungi is known for long time (Gold and Balding,
1975) that had been isolated and characterized from different fungi. Many of
them play a biological role in antitumour, immunomodulatory and insecticidal
activities. The first lectin to be purified from fungus (including mushroom and
yeast) was from the fruiting bodies of the meadow mushroom, Agaricus
campestris and the common (commercial) mushroom, Agaricus bisporus. Lectins
have also been found in phytopathogenic fungi such as Botrytis cinerea,
Pleurotus ostreatus, Rhizoctonia solani, in different members of Sclerotiniaceae,
in the nematode trapping fungus Arthrobotrys oligospora, and in few species of
yeasts like Saccharomyces cerevisiae and Kluyveromyces bulgaricus.
Traditionally, some fungi have been used to control insects. For example,
Lycoperdon spores have been used to anaesthetize bees, Amanita muscaria will
kill houseflies when added to sugar solution, and the powder of Trametes
odorata keeps insects away from clothing. These observations suggest that
some fungi could contain repellent, antifeedant or even toxic compounds,
possibly active against a wide range of insects. Mier et al. (1996) screened 175
fungal species, and showed that nearly half of them were toxic. Wang et al.
(2002) further analyzed 14 most toxic species and found that mushroom fruit
body proteins were responsible for most of the insecticidal activity. A 15 kDa
lectin was purified from Xerocomos chrysenteron, an edible mushroom which
was found to be most toxic to the insects (Trigueros et al., 2003). In the recent
past several fungal lectins were purified and characterized (Kellens et al., 1989;
Pemberton, 1994; Kawagishi, 1995; Guillot and Konska, 1997; Wang et al.,
1998). Majority of the fungal lectins were isolated from the fungal fruiting bodies
and rarely from the vegetative mycelia (Kellens et al., 1992; Giollant et al., 1993;
Wang et al., 1998; Oda et al., 2003).
the mycelia at the time of sclerotial body formation and facilitates the aggregation
of the mycelium to form sclerotial bodies by interacting with its endogenous
glycosyl ceramide receptor(s), which have specific carbohydrate moieties. SRL is
a monomer under acidic conditions (pH 4.3) and all experimental evidences so
far suggest that it forms a dimer at neutral or basic pH (Swamy et al., 2001). SRL
displays a clear specificity for Galβ1-3GalNAc-α- (TF, Thomsen-Friedenreich
antigen) and GalNAc-α- (Tn antigen) glycan structures (Wu et al., 2001).
Immunolocalization and expression studies on SRL have lead to the identification
of putative endogenous glycosphingolipid receptor, which recognizes and
interacts with SRL during the functional role of development and morphogenesis
of S. rolfsii (Swamy et al., 2004). Both the crystal structure and the amino acid
sequence have been reported to explain structural basis of carbohydrate
recognition (Leonidas et al., 2007). The crystal structure of SRL in its free form
and in complex with N-acetyl-D-galactosamine (GalNAc) and N-acetyl-D-
glucosamine (GlcNAc) was determined at 1.1 Å, 2.0 Å, and 1.7 Å resolution,
respectively. The data for the free SRL were the highest resolution data for any
protein of this family. The protein structure was composed of two β-sheets, which
consisted of four and six β-strands, connected by two α-helices. The crystal
structures of the SRL in complex with two carbohydrates, GalNAc and GlcNAc,
which differ only in the configuration of a single epimeric hydroxyl group,
provided the structural basis for its carbohydrate specificity. SRL has two distinct
carbohydrate-binding sites, a primary and a secondary. GalNAc binds at the
primary site, whereas GlcNAc binds only at the secondary site.
Thus, SRL has the ability to recognize and probably bind at the same time
two different carbohydrate structures. Further, sequence ambiguities were
resolved using mass spectrometry (Sathisha et al., 2008). Both the crystal
structure and the amino acid sequence of SRL revealed that SRL is similar to
fungal lectin XCL (Birck et al., 2004). Cloning a lectin gene from S. rolfsii
revealed an open reading frame (ORF) of 429 bp corresponding to a polypeptide
of 142 residues with molecular weight of 16 kDa. Deduced polypeptide had
76.1% sequence similarity with SRL. Despite 34 amino acid mismatches, both
primary and secondary carbohydrate-binding sites remained unchanged
(Chandrashekar, 2007; Bhat et al., 2010b). It acts as signaling molecules in
13
interaction with antagonists (Barak et al., 1985; Barak and Chet, 1990; Inbar and
Chet, 1994). Immunolocalization and expression studies on SRL have lead to the
identification of putative endogenous glycosphingolipid receptor, which
recognizes and interacts with SRL during the functional role of development and
morphogenesis of S. rolfsii (Swamy et al., 2004).
Recent studies show that lectins are involved in the defense mechanisms
of the plant against viruses, bacteria, fungi, nematodes and insect pests (Van
Damme et al., 1994a). This is primarily based on the fact that lectins bind to
glycoconjugates of other organisms. Although many plant lectins are able to bind
simple sugars such as glucose, mannose or galactose, they have a much higher
affinity for oligosaccharides, which are not common or totally absent in plants.
For instance, chitin-binding plant lectins recognize a carbohydrate that is typical
constituent of the cell wall of fungi and the exoskeleton of invertebrates. A
circumstantial argument in favour of a defense role of plant lectins is their marked
stability under a wide range of pH, heat and exposure to proteases. However, the
direct evidence that lectins play a role in plant defense was obtained using
purified protein in artificial diet or by using transgenic plants.
14
2.5.1 Fungi
Under in vitro the zoospores adhere to the root region behind the cap
cells, germinate and penetrate the epidermis and cortex. When the root surface
carbohydrate was modified by oxidation, it completely destroyed the root’s
capacity for zoopore adhesion (Green and Northcote, 1978).
Lis and Sharon (1981) showed inhibition of fungal growth can occur
through lectin binding to hyphae resulting in poor absorption of nutrients as well
as by interference on spore germination process.
Amaranthus viridis (AML) Asialofetuin, fetuin, T- Botrytis cinerea, Fusarium oxysporum (Kaur et al., 2006)
antigen, N-acetyl-D-
lactosamine, N-acetyl-D-
galactosamine
Annona muricata (AML) Glucose/mannose Fusarium solani, F. oxysporum, Colletotrichum musae (Damico et al., 2003)
Artocarpus incisa (AIL) GlcNAc Fusarium moniliformae, Saccharomyces cerevisiae (Santi-Gadelha et al.,
2006)
Artocarpus integrifolia (AIL) GlcNAc Fusarium moniliformae, S. cerevisiae (Trindade et al., 2006)
Astragalus mongholicus Lactose/D-Gal Botrytis cincerea, Fusarium oxysporum, Colletorichum sp., (Yan et al., 2005)
(AMML) Drechslera turcicum
Bauhinia monandra (BmoRoL) Carbohydrate Fusarium solani, F. oxysporum (Souza et al., 2011)
Complex
Capsicum frutescens (CFL) D-mannose, glucose Aspergillus flavus, Fusarium Moniliformae (Ngai and Ng, 2007)
Curcuma amarissima (jackin N-acetylglucosamine Fusarium oxysporum, Exserohilum turcicum, Colectrotrichum (Kheere et al., 2010)
and frutackin) cassiicola
Contd…
16
Gastrodia data (GNA) α-Man/ GlcNAc Botrytis cinerea, Ganoderma lucidum, Gibberella zeae, (Xu et al., 1998)
Rhizoctonia solani, Valsa ambiens
Hevea brasiliensis (Hevien) Chitotriose Botrytis cinerea, Fusarium culmorum, F. oxysporum f. sp. pisi, (Van Parjis et al., 1991)
Phycomyces blakesIeeanus, Pyrenophora triticirepentis,
Pyricularia oryzae, Septoria nodorum, Trichoderma hamatum
Indigofera heterantha Seeds Carbohydrate Aspergillus niger, A. oryzae and Fusarium oxysporum (Sakeena et al., 2013)
(IHL)
Complex
Myracrodruon urundeuva (MUL) GlcNAc Fusarium solani, F. oxysporum, F. moniliformae, F. (Sa et al., 2009a)
decemcellulare, F. lateritium, F. fusarioides, F. verticiloide
Ophiopogon japonicus Man Gibberella saubinetii, Rhizoctonia solani (Tian et al., 2008)
Opuntia ficus indica (OFL) Glc/Man Colletrotrichum gloesporioides, Candida albicans, Fusarium (Santana et al., 2009)
oxysporum, F. solani
Phaseolus coccineus (PCL) Sialic acid Helminthosporium maydis, Gibberell sanbinetti, Rhizoctonia (Chen et al., 2009)
solani, Sclerotinia sclerotiorum
Pisum sativum (PSA) Man Aspergillus flavus, Fusarium oxysporum, Trichoderma viride (Sitohy et al., 2007)
Complex
Contd…
17
Sebastiania jacobinensis (SBL) Glycan complex Fusarium moniliforme, F. oxysporum (Vaz et al., 2010)
carbohydrate
Sophora alopecuroides (SAL) Carbohydrate Penicillium digitatum, Alternaria alternata (Li et al., 2012)
Complex
Talisia esculenta (TEL) Man Colletotrichum lindemuthianum, Fusarium oxysporum, (Freire et al., 2002)
Sacchromyces cerevisiae
Talisia esculenta (TEL) N-acetylglucosamine Sacchromyces cerevisiae, Fusarium moniliforme and (Damico et al., 2003)
Colletotrichum lindemuthianum
Talisia esculenta (TEL) N-acetylglucosamine Fusarium oxysporum, Colletotrichum lindemuthianum and (Maria et al., 2002)
Sacharomyces cerevisiae
Urtica dioica (UDA) GlcNAc Botrytis cinerea, Colletotrichum lindemuthianum, Phoma (Broekaert et al.,
betae, Phycomyces blakesleeanus, Septoria nodorum, 1989)
Trichoderma hamatum, T. viride
Urtica dioica L. isolectin I (UDA- GlcNAc Botrytis cinerea, Trichoderma viride, and Colletotrichum (Does et al., 1999)
1) lindemuthianum
18
Lectins have a role in the plant defense against bacteria, it may be through
an indirect mechanism that is based on interaction with cell wall carbohydrate or
extracellular glycans. For instance, the potato lectin (which is considered as a cell
wall protein) immobilized virulent bacterial strains of Pseudomonas solanacearum
by agglutinating the cells (Sequeira and Graham, 1977).
Iris et al. (2005) reported that Zuccagnia punctata leaf extract was active
against all assayed bacteria (Escherichia coli, Klebsiella pneumoniae, Proteus
mirabilis, Enterobacter cloacae, Serratia marcescens, Morganella morganii,
Acinetobacter baumannii, Pseudomonas aeruginosa, Stenotrophomonas
maltophilia) with minimal inhibitory concentration (MIC) values ranging from 25 to
200 µg/ml. Minimal bactericidal concentration (MBC) values were identical or two-
fold higher than the corresponding MIC values.
Oliveira et al. (2008) reported that purified EuniSL (Eugenia uniflora seed
lectin) strongly inhibited the growth of Staphylococcus aureus, Pseudomonas
aeruginosa and Klebsiella sp. with a minimum inhibitory concentration (MIC) 1.5
µg/ml and moderately inhibited the growth of Bacillus subtilis, Streptococcus sp.
and Escherichia coli with a MIC of 16.5 µg/ml.
Silva et al. (2009) reported antibacterial activity of leaf, root and fruit extracts
of Bixa orellana against Mycobacterium tuberculosis, Salmonella typhimurium,
Proteus mirabilis, Bacilus cereus, Staphyloccocus aureus and Pseudomonas
aeruginosa. MIC was assessed by diffusion and colorimetric analysis.
Selvi et al. (2011) reported that seed extract of Bixa orellana was
comparatively less efficacious against most of the tested pathogens except
20
Brucella sp. that was inhibited (15±0.1 mm) appreciably. Minimum inhibitory
concentration (MIC) of leaf extract was determined as 15.62 µg/ml against
Staphylococcus aureus and 31.25 µg/ml for Klebsiella pneumoniae, Pseudomonas
aeruginosa, Enterococcus fecalis and Staphylococcus typhi, on average. Among
the dermatophytes 78.2 per cent inhibition was seen in Trychophyton
mentagrophytes and Trychophyton rubrum.
Rich et al. (1989) reported that ricin from castor bean inhibited more than 90
per cent of the mobility of M. incognita. Wheat germ agglutinin (WGA), pokeweed
(Phytolacca americana L.) and Bauhinia purpurea lectins were lethal at low
concentrations to juveniles of corn borer and root worms (Czapla and Lang, 1990).
This interaction of lectins with the receptors could result in anti-feedant effect, or
retarded growth or mortality (Peumans and Van Damme, 1995). Similar effects
were seen with antibodies, which on binding to the surface coat antigens of M.
javanica J2 affected both penetration and movement of nematode in Arabidopsis
thaliana roots (Sharon et al., 2002).
Bhat et al., (2010) showed efficacy (1:25, 1:50, 1:75 and 1:100 dilutions) of
tarin 1 (Colocasia esculenta L. Schott) on the activity of M. incognita juveniles.
21
Mirelman et al. (1975) showed wheat germ aggglutinin (WGA) inhibited the
growth of Trichoderma viride mycelium and spore germination by interacting with
fungal wall. WGA has a secificity for chitin oligomers of β-(1-4)-N-acetyl-D-
glucosamine and it interfered with chitin synthesis that lead to inhibition of fungus
growth. Successful biological control of Sclerotium rolfsii was achieved by applying
antagonistic species of Trichoderma. The interaction between S. rolfsii and
Trichoderma spp. was found to be mediated by the adsorption of S. rolfsii lectin (55
and 60 kDa) to conidia of Trichoderma (Elad et al., 1982).
Lectins of R. solani and S. rolfsii were found to be essential for the recognition
and adhesion of their mycoparasite, Trichoderma (Elad et al., 1983; Barak et al.,
1985; Barak and Chet, 1990).
2.7 Evaluation srl1 and rvl1 transgenics and non-transgenics for the
suppression of tomato soil-borne pathogens
Virulent strains were not recognized by the lectin, escaped attachment to the
cell wall and therefore were able to multiply and spread over the plant. Another
indirect defense mechanism is the blocking of the movements of normally motile
bacteria at the air-water interface by the thorn apple (Datura stramonium) seed
lectin (Broekaert and Peumans, 1986).
Marban-Mendoza et al. (1987) provided the first indication that lectins may
have anti-nematode activity when application of concanavalin A lectin (Con A) to
the roots of tomato plants reduced the amount of galling inflicted by M. incognita by
75% compared with control plants. Similarly, Mannose-/glucose-specific lectin
Concanavalin A (Con A) reduced ability Globodera rostochiensis to locate host
diffusates on agar plates and (McCulloch et al., 1989).
Pusztai et al. (1990) showed the effect of the expressed lectins in Phaseolus
vulgaris on non-target organisms that feed on or live in the surroundings of the
plants i.e toxic to human and animal consumers of raw beans. Canola plants
carrying the 35S-chitinase-gene exhibit increased resistance to infection by the root
and stem rot pathogen Rhizoctonia solani. Seedlings constitutively expressing the
bean chitinase gene showed delayed development and progression of disease
symptom (Broglie et al., 1991).
peptidoglycans indicated that several legume seed lectins strongly interact with
muramic acid, N-acetylmuramic acid and muramyl dipeptide, the involvement of
lectins in the plant's defense against microbes may have been underestimated
(Ayouba et al., 1994).
Several efforts have been made to check toxic effect of lectins when
expressed in transgenic plants. Potato or oilseed rape expressing Galanthus nivalis
lectin (GNA) were shown to be partially resistant to Pratylenchus neglectus and
cyst-nematodes Globodera pallida and Heterodera schachtii (Burrows et al., 1998).
Griffiths et al. (2000) have done tests with transgenic potatoes expressing
GNA and ConA. Both in pot and field experiments no changes in the
decomposition of organic matter or negative consequences for plants in the
following growing season were observed. The effect of lectins on non-target soil
organisms and the processes in which they are involved, like nitrification and
decomposition of organic matter. Hevein lectin gene carrying Brassica juncea
plants showed increased resistance to Alternaria brassicae infection (Kanrar et al.,
2002).
The expression of Gastrodia elata lectins in the vascular cells of roots and
stems was strongly induced by the fungus Trichoderma viride, indicating that lectin
is an important defense protein in plants (Sa et al., 2009b).
Bhagat (2010) found that rvl1 and srl1 gene carrying transgenic tomato
plants showed moderately resistance to Meloidogyne incognita. rvl1-transgenic
tomato plants had significantly reduced gall formation due to M. incognita infection
compared to srl1-transgenic tomato plants. srl1 expressed SRL1-T0(7), SRL1-
T0(10), SRL1-T0(21) transgenic tomato line reduced the root galling as 33.6, 43.2
and 40.8 galls/plant compared to controlled plants (Patil, 2011). rvl1 expressed
RVL1-T0(11) and RVL1-T0(28) transgenic tomato plants showed moderate
resistance to Meloidogyne incognita reduced 40.00 and 34.48 per cent of root
galling compared to control (Kolekar, 2012).
2.8.1 Fungi
Mirelman et al. (1975) found that wheat germ agglutinin (WGA), a lectin
specific for chitin oligosaccharides binds to hyphal tips and hyphal septa of
Trichoderma viride and inhibits hyphal growth and spore germination of this chitin
fungus. Lectins recognise and bind to sugar residues on fungal membranes or cell
walls (Horisberger and Vonlanthen, 1977).
Galun et al. (1976) examined the binding of FITC labelled WGA, ConA,
PNA, SBA, LFA and WBA with different sugar specificities, to the hyphal wall and
septum of three mycobionts isolated from lichens (Xanthoria parietina, Tornabenia
intricata and Sarcogyne sp.) and free living fungi (Trichoderma viride and
Phytophthora citrophthora). FITC-SBA (soybean agglutinin) and FITC-PNA (Peanut
agglutinin) bound to young conidiophores, metulae, vesicles, sterigmata and young
spores of the Penicillium and Aspergilli (Golan et al., 1978).
2.8.2 Bacteria
For bacteria and fungi the cell wall hampers any interaction of lectins with
glycoconjugates on the cell membrane as well as the entrance of lectins into the
cytoplasm. Through an indirect mechanism, such as interaction with sugar moieties
of the cell wall or extracellular glycans, lectins might have an influence on the
mobility of bacteria or cell-wall synthesis in fungi in the case of chitin-binding plant
lectins (Peumans et al., 1995). Araucaria angustifolia lectin promoted
morphological alterations including presence of pores in the Clavibacter
michiganensis membrane and bubbling on the Xanthomonas axanopodis cell wall
(Santi-Gadelha et al., 2006).
2.8.3 Nematode
The lectin may exert its effect either through interaction with glycoproteins
present in the intestine or through binding to glycoproteins present externally on
the nematode. Interaction with glycoproteins associated with chemoreception, on
the amphid sensory organs themselves or in their secretions, could disrupt sensory
perception and compromise the nematode’s ability to establish feeding sites
(Zuckerman, 1983). Utilizing a Concanavalin A (ConA) hemocyanin conjugate, the
majority of cuticular ConA binding sites were shown to be localized on the head
region of Caenorhabditis elegans and Meloidogyne incognita. Secretions which
apparently emanated from the amphids and inner labial papillae did not label
(McClure and Zuckerman, 1982) as well as specific localization of sialic acid
residues on the head region of Xiphinema index suggest a logical line of
speculation as the mode of action of Con A on M. incognita. Binding of the ligand
27
Aumann and Wyss (1989) detected specific binding sites of Con A, WGA
(Wheat germ agglutinin), PNA (Pean nut agglutinin), LFA (Limax flavus agglutinin)
and HPA (Helixa pomatia) in the region of the amphidial apertures, of Con A, WGA,
PNA and HPA on the spicule tips, and of HPA in the region of the excretory pore
opening of Heterodera schachtii male because the exudates of the main
chemoresceptors thus consist most like protein backbone to which oligosaccharide
chains are coupled superficially (Roberts and Goldstein, 1983; Aumann and Wyss,
1991).
Forrest and Robertson (1986) found specific binding sites of WGA on the
amphidial exudate of second stage juveniles (J2) of Globodera rostochiensis and
Forrest (1985) showed that lectin binding sites on this exudate can be reduced by
the protease pronase E. In another electron microscopic study McClure and Stynes
(1988) found UEA 1 binding sites on the amphidial exudate of Meloidogyne
incognita J2.
Davis et al. (1988) also report that the binding of ConA and WGA to the
amphidial secretions of secondary juveniles of Meloidogyne is not inhibited by the
specific sugars of either lectin. ConA and WGA have broader sugar specificity, or
their affinity for sugars in nematode secretions is too strong to be inhibited. A third
explanation is the affinity of certain lectins for other ligands than sugars. Binding of
WGA to the amphids, the amphidial secretions and the excretion pore of
Radopholus similis is specific. This means that the binding is inhibited by N-
acetylglucosamine oligomers. Non-specific binding of ConA and WGA observed at
vulval and anal region of Longidorus sp. (Robertson et al., 1989).
Lectins would also have opportunity to bind to the surface/cuticle and to the
primary chemosensory structures, the amphids. Lectin studies have revealed the
28
ConA, contain a conserved hydrophobic binding site, and WGA and HPA
can also bind hydrophobic ligands. So non-specific interactions between lectins,
cell surfaces and secretions can occur results in binding to the vulva, spicules and
other body pores of R. similis (Wuyts et al., 2004). Trichoderma asperellum-203
and T. atroviride involved in M. javanica attachment and parasitic process which
mediated by chrbohydrate-lectin like interactions involved in attachment of conidia
to the nematodes (Sharon et al., 2007).
Tomato plants showing typical symptoms of Fusarium wilt, Sclerotium wilt and
Rhizactonia root rot were used for isolation of pure cultures of respective pathogens.
Standard tissue isolation procedure was followed for isolation of pathogen. The infected
parts were surface sterilized with 0.1 % sodium hypochlorite solution for 40 seconds and
washed serially in distilled water to remove the traces of sodium hypochlorite and then
transferred to sterilized Petri plate containing Potato Dextrose Agar. The Petri plates
were incubated at room temperature (27 ± 1oC) and observed periodically for the growth
of pathogens’ colonies. The colonies which developed from the bits were transferred to
PDA slants and incubated at 27 ± 1oC and they were purified by using hyphal tip
technique (Rangaswami, 1972). Such pure culture tubes were preserved in a refrigerator
at 4°C and used for further studies. Subculturing was performed once in a month.
.
30
Sand-corn meal medium was prepared in the proportion of 90:10 in order to get
maximum inoculum of the fungus. About 400 g of sand-corn meal medium was taken in
1000 ml flasks and watered to 20 per cent of its weight and sterilized at 1.1 kg/cm²
pressure for one hour. The pure cultures of R. solani and S. rolfsii were inoculated
separately in different flasks under aseptic conditions and incubated at 27±1°C for 20
days. The flasks were shaken on alternate days to get uniform growth. The giant cultures
so obtained were used for further studies.
The multiplication of the pathogen on large scale was achieved by inoculating the
isolated pathogen into the flasks containing sterilized sorghum seeds. Sorghum grains
were soaked in water for overnight and excess of water was removed. Then about 200-
250 g seeds were placed in each 1000 ml conical flasks. These flasks were double
sterilized at 1.1 kg/cm2 pressure for an hour. The contents of the flasks were shaken
after sterilization to prevent clumping. A 5-mm colony disc of F. oxysporum was
aseptically inoculated to the cooled flasks. The flasks were incubated at 27 ± 1°C for 15
days. To obtain uniform growth, the contents of the flasks were shaken periodically.
Obtained giant culture was used for further studies.
31
3.1.5 Pathogenicity
Sterilized soil was taken in 30 cm earthen pots. Fifteen to twenty days old giant
culture was thoroughly mixed with soil at the rate of four per cent to get sick soil. Then
apparently healthy seedlings of tomato (cv. Pusa Ruby) were planted in pots filled with
sick soil. Seedlings planted in pots without inoculum served as control. Soil moisture
was maintained at 25 per cent moisture holding capacity of soil by adding sterilized
water on weight basis throughout the period. After 30 days of inoculation the plants
showing the typical wilting symptoms were observed. Reisolation was made from such
affected portion of the plant tissue and compared with that of original culture.
The identification of the bacterium isolated from tomato plants was made based
on its morphological, physiological, cultural and biochemical characteristics besides
pathogenicity studies based on reports of Kelman (1954) and Schaad (1992). Well
separated virulent colonies of R. solanacearum on TZC medium were picked up and
streaked on the surface of TZC medium. The virulent colonies of R. solanacearum were
32
irregular, dull white, mucoidal, slimy with slight pink center. For the purpose of
purification, the well separated typical virulent colony was picked up and streaked on the
surface of TZC medium and plates were incubated at 29 ± 1oC for 48 h. Three to four
loopful of the bacterial culture picked up from the well separated colonies from streaked
TZC medium was suspended into 2 ml sterilized distilled water contained in eppendorf
tubes and stored at 4oC in refrigerator for further use as stock culture. For long term
preservation a loopful bacterium was suspended in 600 µl of sucrose peptone broth in
1.5 or 2 ml eppendorf tube to which 600 µl of glycerol (50 per cent) was added. The
ependorf tubes were stored at -80 oC for further use.
Sucrose peptone broth for R. solanacearum was used to study the growth phase
at different incubation period. Five ml of broth was dispensed in individual test tubes and
sterelized at 1.1 kg/cm2 for 15 min. The 48 h old inoculum was suspended in sterile
distilled water containing 2x106 cfu/ml used at the rate of 50 µl per test tube. The test
o
tubes were incubated at temperature 29±1 C. The growth was recorded
turbidometrically at 8h interval upto 168 h using Systronics PC based double beam
spectrophotometer 2202 at 600 nm. The increase in the turbidity of culture broth
indicated increase of microbial cell mass. The experiment was conducted with three
replications using Completely Randomized Design for statistical interpretations.
3.1.10 Pathogenicity
Inocula for pathogenicity tests were prepared with 48 h old cultures grown on
TZC medium at 29±1oC. Colonies were suspended in sterilized water to get 1x108
cfu/ml using a spectrophotometer transmission at A600=0.1 and were used for
inoculation immediately after preparation. The soil mixtures used in the research were
steam sterilized for 2 h. Fourteen days old seedlings of Pusa Ruby (Susceptible check
cultivar) were grown in the pot containing sterilized soil mixture as one plant per pot
and maintained under green house conditions. Root inoculation was done at
preferably third true leaf stage or slightly older root zone was damaged using a
sterilized scalpel and 50 ml of inoculum culture was introduced to each plant. Control
plant was applied with sterilized water.
33
To the pre-sterilized nutrient gelatin deep tubes, the test culture was inoculated
and tubes were incubated at 29±1oC for 24 h. The tubes were later kept in a refrigerator
at 4 °C for 30 min. The tubes with cultures that remained liquefied were taken as positive
and those that solidified on refrigeration were taken as negative for the test (Blazevic and
Ederer, 1975).
Bacterial culture (24 h old) was spotted on the starch agar plates and incubated at
o
29±1 C for 24 h. After incubation the plates were flooded with Lugols Iodine solution.
Formation of clear zone around the colony was taken as positive for the test (Eckford,
1927).
A loopful of 24 h old bacterial culture was taken on a clean slide to which a drop of 3
per cent KOH (Potassium hydroxide) was added and stirred it circularly for 2-3 min. and
lifted the culture from inoculation loop and observed the thread form of bacteria.
34
The hypersensitive reaction test was carried out to know the pathogenic nature of
the R. solanacearum. A loopful of the bacterial culture from the stock culture stored at
4oC was streaked onto Petri plates with sterelized sucrose peptone agar. The plates
were incubated at 29±1oC for 48 h. Individual bacterial colonies were picked and
inoculated into conical flasks containing 100 ml of sucrose peptone broth and incubated
at 29±1oC for 48 h in a rotary shaker incubator at 120 rpm.
The bacterial suspension (2 x 106 cfu) was injected into the intercellular spaces of
the intact tobacco leaves (Nicotiana tabaccum L.) by holding the barrel of the
hypodermic syringe against the bottom of the leaf. A water soaked area developed as
the suspension infiltrated the mesophyll. The leaves were then washed with sterile
distilled water and tagged. Observations were made for development of chlorotic lesions
followed by confluent necrosis in the injected regions after 24 h incubation.
Root-knot nematode infected plants along with soil were collected from the tomato
infected field in polythene bags. Root portion was carefully removed from the soil and
washed gently under running tap water. Eggmasses were picked and kept for hatching in
water in a Petri plate. After 24 - 48 h, hatched juveniles were used to inoculate tomato
grown in sterilized soil: sand (1: 1) mixture in greenhouse. These plants served as
culture plants. After giving sufficient time so as to complete 3-4 generations of the
nematode, the plants were depotted carefully. The root system was washed free of soil
the galls containing eggmasses were used to get inoculum of the nematode for further
studies throughout.
Soil samples (200 g) were washed thoroughly and processed using combined
Cobb’s sieving and decanting and Baermann’s funnel method as given below.
• 200 g of soil was taken in 1000 ml beaker and sufficient quantity of water was
added to make a soil solution.
35
• This was stirred thoroughly and the heavier particles were allowed to settle down.
• Hard particles and stones if any, were removed and then the soil solution was
passed through a set of sieves of 60, 250 and 325 µm mesh size.
• The sievates from 325 µm mesh sieve were collected and poured over tissue
paper spread over a coarse mesh placed in a petri plate (Baermann’s funnel).
• The level of water in the Baermann’s funnel was maintained to keep the tissue
paper wet and kept undisturbed for 48 h.
• The contents from the Petri plate were emptied into a beaker, diluted to a suitable
volume and population counts were taken with the help of counting dish
(Fenwick’s), using research stereobinocular microscope.
The root-knot nematode present in the suspension was identified to genus level
by observing different morpho-anatomical characters. Root-knot nematodes were picked
separately to inoculate tomato grown in sterilized soil: sand (1: 1) mixture in green house
which served as culture plants.
The galled root system was immersed in a beaker containing boiling 0.1 per cent
acid fuchsin in lactophenol and left overnight for clearing (Southey, 1986). The females
of root-knot nematode were dissected out from the well developed galls of the roots
under the stereobinocular microscope and were transferred to a drop of lactophenol
taken on a clean glass slide. The posterior portion of the females was cleaned. The
perineal region was trimmed and mounted for observation under oil immersion objective
of a compound microscope (100 X). The identification of the species was made on the
basis of characters of perineal pattern described by Eisenback et al. (1981).
3.1.15 Pathogenicity
The egg masses of M. incognita extracted from tomato plants were transferred
carefully to a wire gauze sieve containing two layers of facial tissue paper and kept in a
Petri dish holding sufficient water. After 24 h, the contents of a Petri dish were
transfered into a beaker diluted to a suitable volume and juveniles population counts
36
were made with the help of Fenwick’s multi chamber counting dish. Based on the
requirement, the suspension was diluted with sterile water and a known number of
nematodes were inoculated to tomato plants.
One plant tuber lectin (RVL1) from Remusatia vivipara and one fungal fruiting
body specific lectin (SRL1) from Sclerotium rolfsii (both previously characterized) were
selected. Both the lectin genes were cloned into pET vector (Invitrogen) under the
control of the isopropyl-b-D-thiogalactopyranoside (IPTG)-inducible T7-promoter.
Cloning of rvl1 and srl1 was described previously (Bhat et al., 2010; Neekhra et al.,
2011). E. coli strain BL21 (DE3) pLysS transformants containing rvl1 and srl1 were
cultivated in LB medium containing 50 µg⁄ml kanamycin at 37oC to OD600 =1, induced
with 1mM IPTG and incubated overnight at 23oC. Solubility of the recombinant lectins
was tested by disrupting the E. coli cells in PBS using a sonicator instrument and
checking the lectin content in the supernatant after centrifugation (16,000 g for 20 min)
by haemagglutination assay and SDS-PAGE.
The activity of both R. vivipara lectin and S. rolfsii lectin expressed in E. coli was
determined by haemagglutination assay (Lis and Sharon, 1998) using trypsinised
rabbit erythrocytes. Haemagglutination activity was assayed in an ELISA microtiter
plate by the serial two fold dilution technique of (Liener and Hill, 1953) with some
modifications. Phosphate buffer saline (PBS; 50 µl of 150 mM NaCl) was added to 12
wells in the first row and lectin sample (50 µl) was added only to the first well of the
assay plate. The contents of the first well (100 µl) were mixed well and 50 µl of it was
transferred to the second well and the process was repeated serially for the remaining
wells. Thus the lectin extract was serially two fold diluted to which 50 µl of trypsinized
erythrocytes suspension was added and gently mixed on a rotary shaker. After
incubation for 1 h at 37°C, the plates were visually examined for haemagglutination.
The highest dilution of the extract causing visible haemagglutination was regarded as
the 'titre'. The protein content in the highest dilution causing visible agglutination was
referred to as ‘one unit’ of haemagglutination activity. It was otherwise expressed as
37
Crude protein (50 µl containing 0.4 mg) was mixed with 2 X SDS gel loading
buffer (50 µl). The mixture was heated at 98°C for 5 min and thoroughly mixed. Protein
(20 µl) was loaded on 12 per cent polyacrylamide gel along with suitable control
protein. The gel was run at 60 V for 1 h and subsequently at 120 V for 3 h. After
staining with commassie brilliant blue, the excess dye was removed by repeated
washing every 2-3 h with de-staining solution till blue colour band appeared. The gel
was sealed in polyethylene bag and stored at 4°C.
The antiserum against SRL1 was produced by immunizing the six months old
two Newzealand white rabbit with purified SRL1. It was injected intramuscularly with
increasing dose of purified SRL1. An equimolar suspension of SRL1 and Freund’s
incomplete adjuvant (in 100 µl) containing different concentration of protein (25, 100,
500 and 1000 µg in PBS) was injected at an interval of one week. A booster dose with
complete Freund’s adjuvant containing 2 mg of protein was given at sixth week.
Antiserum was collected after 7 days of booster dose injection by bleeding the rabbit
ear vein.
38
Blood was allowed to clot in the refrigerator overnight and later serum was
collected. It was centrifuged at 1000 rpm for 10 min to separate serum from the blood
constituents. The antiserum thus obtained was stored in -20oC for further studies.
Antibodies for SRL1 were partially purified according to the method of Livingston
(1974). Serum was subjected to ammonium sulphate precipitation (50%), and the
precipitate was collected and dissolved in 10 mM potassium phosphate buffer of pH
6.8, the volume being equivalent to that of original serum sample prior to salt addition.
This solution was once again subjected to ammonium sulphate precipitation under
similar conditions and the resulting protein precipitate was again dissolved as earlier.
The solution was dialized against 10 mM potassium phosphate buffer of pH 6.8, stored
at 4oC and used as anti-SRL1 for further studies.
Microprecipitin test
To prepare lectin dilutions, ten microfuge tubes were placed in a rack, with the
first one containing purified lectin suspension. The tubes were marked with the lectins
dilution factors as 1, 2, 4, 8, 16, 32, 64, 128, 256 and 512. Later 120 µl of saline
(0.85%) buffer was added to each of the tubes from 2 to 8, 120 µl of virus suspension
was added from tube one to tube two and mixed thoroughly. With a clean pipette tip,
120 µl suspension was transferred from tube two to tube three. This was repeated until
all tubes contained successive two-fold protein dilutions.
buffer was pipetted into tube one and 120 µl in the other six tubes. 15 µl of undiluted
serum was transferred into tube one and mixed thoroughly. 120 µl from tube one to
tube two was transferred. This was repeated until all tubes contained successive two-
fold serum dilutions. Ten vertical columns with the lectin dilution factors (1, 2, 4….) and
nine horizontal rows with the serum dilution factors (starting with 16) were labelled on a
drawing sheet. The last column and the last row were labelled B (buffer). The same
plan was drawn inside the clean lower lid of Petri plate with the help of a marker pen by
placing the lower lid of Petri plate on the marked drawing sheet (Fig. 1). 12 µl of saline
buffer was placed in the centre of the squares of the column labelled B. Similarly 12 µl
droplets of virus dilutions were placed in all squares of correspondingly labelled
columns. The same procedure was followed for antiserum dilutions in appropriate
rows. Finally the petri plate was incubated at 37oC for 2 h.
++ : Moderate precipitate
+ : Slight precipitate
- : No precipitate
3.3.4 Direct Antigen Coating Enzyme Linked Immuno Sorbent Assay (DAC ELISA)
Direct antigen coating (DAC) ELISA was performed as per the procedure of
Hobbs et al. (1987).
• Purified SRL1 (antigen) was prepared in PBS using different dilutions of 1: 2048
and 1: 4096. The dilution was dispensed into each well of ELISA plate at the rate of
100 µl using microplate and the plate was incubated at 37oC for one hour.
• The contents of the plate was poured off and rinsed with PBS-Tween (Washing
buffer). Washing was carried out for three times allowing three minutes time interval
for each wash.
• Empty spaces in the wells were blocked with skimmed milk protein (blocking
buffer). 100 µl of this solution was dispensed into each well. The plate was then
incubated for one hour at 37oC.
• The contents of the plate was poured off and rinsed with PBS-Tween. Washing was
carried out for three times allowing three minutes time interval for each wash.
41
• The contents of the plate was poured off and rinsed with PBS-Tween. Washing was
carried out for three times allowing three minutes time interval for each wash.
• The contents of the plate was poured off and rinsed with PBS-Tween. Washing was
carried out for three times allowing three minutes time interval for each wash.
• Note: pH of diethanolamine was adjusted to 9.8 later PNP and magnesium chloride
was added to prepare the substrate.
• Absorbance values were recorded using ELISA reader (Compaq Imaging System)
at 405 nm.
3.4 Evaluation of plant and fungal lectins for the in vitro suppression of some
common soil-borne pathogens
treated and untreated) were tested at different protein concentration viz. 1.2 mg/ml, 2.4
mg/ml, 3.6 mg/ml and 4.8 mg/ml.
The poisoned food technique (Shravelle, 1961) was followed to evaluate the
efficacy of lectins in inhibiting the mycelial growth of F. oxysporum, S. rolfsii and R.
solani. These fungi were grown on PDA for 3 to 10 days prior to setting up the
experiment. Different lectins were added to the molten PDA taken in sterilized Petri
plates. Suitable check was maintained without addition of lectins. 5-mm mycelial disc
taken from the periphery of three to ten days-old colony was placed in the center of
Petri plates and incubated at 27±1o C for 3 to 12 days. Five replications were
maintained for each treatment. The diameter of the colony was measured in two
directions and average was recorded. Per cent inhibition of mycelial growth of the
fungus was calculated using the formula given by Vincent (1947).
(C-T)
I = -------------- X 100
C
Where,
Fifteen ml of PDA was poured into the sterile Petri plates and allowed to solidify.
One ml different concentrations of lectins and bacterial control BL21 and PBS were
spread uniformly on agar plate. A 5-mm mycelial disc of F. oxysporum, S. rolfsii and R.
solani taken from the periphery of 3 to10 days old colony was placed in the center of
petri plates and incubated at 27±1oC for 12 days and five replications were maintained
for each treatment. The diameter of the colony was measured in two directions and
43
average was recorded. Per cent inhibition mycelial growth of the fungus was calculated
by using the formula of Vincent (1947).
The assay for antifungal activity against F. oxysporum, S. rolfsii and R. solani
was executed using 90 mm Petri plates containing 10 ml of PDA. After the mycelial
colony had developed, sterile blank paper discs (6 mm in diameter) were placed
around and at a distance of 1 cm away from the rim of mycelial colony. An aliquot (40
µl) of different concentrations of the lectins in PBS buffer was introduced to a disc. The
plates were incubated at 27±1oC for 72 h until mycelial growth had enveloped
peripheral discs containing the control (buffer, sterile distilled water). Inhibition zones in
cm around the disc were recorded.
Fusarium spores were harvested from well sporulating colonies and suspended
in sterile water. The concentrations of the spore suspensions were determined in a
heamocytometer and adjusted to 1.0 to 2.5 x 106 spores per ml depending on the
fungus to be tested. The freshly prepared suspensions (0.5 ml for plates with dia. of 90
mm) were plated out on Petri plates containing the potato dextrose agar used for
maintenance of the test fungus. To allow for spore germination and initial vegetative
growth the plates were incubated for 20 to 24 h at room temperature. At this time
sterile filter paper discs (5 mm dia.) were laid on the agar surface, and 40 µl of the
different concentrations of lectins (1.2, 2.4, 3.6 and 4.8 mg/ml) to be tested were
applied to the discs. The plates were further incubated at room temperature for 72 h.
The observations for the production of inhibition zone around the filter paper discs was
calculated and analyzed statistically.
Mature and immature sclerotial bodies and sclerotia collected from a fresh
culture of Sclerotium rolfsii and Rhizoctonia solani were incubated for 30 min at 27±1oC
with different concentrations (1.2, 2.4, 3.6 and 4.8 mg/ml) of anti-SRL, SRL1, RVL1
and BL21 in screw-capped vials separetly. Treated sclerotial bodies were allowed to
germinate in a Petri plate containing Byrde’s (Appendix I) medium with 1.5 per cent
agar at 27±1oC for 72 h. For control, sclerotial bodies that was treated with normal
rabbit serum, PBS, and sterile distilled water was inserted in another well of the plate.
Experiment was conducted with five replications. Germination of the sclerotial bodies in
the plate was observed and inhibition of mature and immature sclerotia germination
and radial growth were recorded.
Well diffusion assay was performed as described by Cole (1994) with some
modifications as follows. The bacterium was grown in Luria-Bertania agar (LBA) for
overnight. 50 µl of overnight culture were added to 5 ml of nutrient broth and incubated
at 29±1oC (with shaking at 120 rpm until reaching the mid-exponential phase). Then one
ml of appropriate dilution of this culture was added to 5 ml warm melted LBA. After
mixing, the overlay gel was poured over sterile 90 mm glass Petri plates containing 15 ml
LBA. 5 mm well was made using sterile cork borer on medium. 20 µl of crude protein
extract of RVL1 (6 mg/ml), SRL1 (6 mg/ml), Positive control BL21 (6 mg/ml) and a
negative control (1 mM PBS and sterile distilled water) were applied onto each different
wells. 10 µl of streptocycline (500 ppm/ml) were also loaded onto a disc and used as
antibacterial positive control. The plates were incubated for 48 h at 29±1oC. After
incubation the diameters of the inhibition zone surrounding the well were measured.
Three replications were maintained.
45
3.4.2.1 Determination of the minimum inhibitory concentration (MIC) and the minimum
bactericidal concentration (MBC)
Antibacterial activity of crude protein of SRL1 and RVL1 was investigated by the
disc diffusion method (Cole, 1994). R. solanacearum was obtained from stock culture in
nutrient agar. One-hundred millilitres of warm NA and 0.5 ml of bacterial suspension
(1 x 105 cfu/ml) were spread on sterile Petri plates and allowed to solidify. Sterile blank
paper discs (6 mm dia.) impregnated with 40 µl of solution of SRL1, RVL1 and positive
control BL21 (0.6, 1.2, 2.4 and 3.6 mg/ml) and negative control 1 mM PBS and sterile
distilled water, were added on the agar plates. Plates were incubated at 29±1oC for 48 h.
A transparent ring around the paper disc revealed antimicrobial activity. Zones of growth
inhibition around discs were measured in centimetres.
46
Luria Bertani’s broth was used for the lectins’ sensitivity test against R.
solanacearum. Five ml of LB broth was dispensed in individual test tubes and sterelized
at 1.1 kg/cm2 pressure for 15 min. The inoculum consisted of 48 h old culture,
suspended in sterile distilled water containing 1 x 105 cfu/ml used at the rate of 50 µl per
test tube. Then, the test tubes were inoculated with different concentrations (0.6, 1.2, 2.4
and 3.6 mg/ml) of SRL1, RVL1 and positive control Bl21) and negative control 1 mM
PBS and one untreated check, incubated at 29±1oC. The growth was recorded
turbidometrically after 48 h of inubation using Systronics PC based double beam
spectrophotometer 2202 at 600 nm.
Number of live and dead nematodes from each lectin concentration set was counted at
different time intervals (6, 12, 18, 24, 36 and 48 h) under the stereobinocular
microscope. Each treatment was replicated three times and percentage mortality of
nematodes was calculated.
Collection of six bacterial and four fungal antagonists from different sources
Bioagents Source
Tomato roots and rhizosphere soils were collected from tomato field in UAS
Dharwad Campus, where root-knot infestation was prevalent. Root pieces were
washed in gentle running tap water for 5 min. The standard tissue isolation procedure
was followed for isolation of the fungal pathogen. The infected parts were surface
sterilized with 0.1% sodium hypochlorite solution for 40 seconds and washed serially in
distilled water to remove the traces of sodium hypochlorite and then transferred to
sterilized Petri plate containing PDA, before transfering to Petri plate PDA was
amended with 0.01 per cent chloramphenicol and 3 per cent sodium chloride.
For isolation of fungus from soil, serial dilution and pour plate technique was
employed (Johnson and Curl, 1972). After thorough mixing 10 g of soil sample was
transfered aseptically to 100 ml sterile distilled water and mixed thoroughly by shaking
for 30 min. 1 ml sample was drawn from the suspension and transferred to 9 ml sterile
distilled water blank. The suspension thus obtained in dilution process was shaken for
one minute before it was further diluted. 1 ml suspension from each of the appropriate
dilution of 102 and 103 was transferred aseptically into sterile Petri plates.15 ml of
appropriate molten medium (and cooled to 45°C) was transferred to Petri plates and
gently rotated clockwise and anticlockwise direction to get uniform mixing. The plates
were incubated at room temperature (27±1°C) for 7 days. Axenic (Pure) cultures were
obtained by single spore isolation. These were maintained on PDA slants.
Growth phase studies for Pseudomonas fluorescens and Bacillus subtillis strains
were done by following the procedure described in 3.1.8
49
3.5.3 In vitro screening of plant fungal lectins against bacterial and fungal
antagonists
Plant (RVL1) and fungal (SRL1) lectins expressed in E. coli were evaluated
against bacterial and fungal biocontrol agents to analyse the antimicrobial properties of
a lectins in vitro.
Six bacterial (Pseudomonas fluorescens and Bacillus subtilis strains) and five
fungal antagonists (Trichoderma viride, T. virens, T. koningii, T. harzianum and
Paecilomyces lilacinus) were evaluated against Fusarium oxysporum, Sclerotium rolfsii
and Rhizoctonia solani for their efficacy employing dual culture technique. The bioagents
and the test fungus were inoculated side by side on a single Petri plate containing
solidified PDA. Five replications were maintained for each treatment with one control by
maintaining only pathogen separately. They were incubated for 3 to 10 days. The
diameter of the colony of both bioagents and the pathogen was measured in two
directions and average was recorded. Per cent inhibition of growth of the test fungus was
calculated by using the formula of Vincent (1947).
3.5.4.2 In vitro screening of plant and fungal lectins against fungal antagonists
P. fluorescens and B. subtilis strains were grown in Luria Bertani’s agar medium
for overnight. One-hundred millilitres of warm LB agar and 0.5 ml of bacterial suspension
(1 x 106 cfu/ml) were spread on sterile Petri plates and allowed to solidify. The sterile
discs (6 mm in diameter) were then placed on plates. 40 µl of crude protein extract of
RVL1 (6 mg/ml), SRL1 (6mg/ml), Positive control BL21 (6 mg/ml) and a negative control
(1 mM PBS and sterile distilled water) were applied onto each different disc. 20 µl of
streptocycline (500 ppm/ml) were also loaded onto a disc and used as antibacterial
positive control. The plates were incubated for 48 h at 29±1oC. After incubation, the
diameters of the inhibition zone surrounding the disc were measured. The experiments
were carried out in triplicate.
Four P. fluorescens strains, two B. subtilis strains and four Trichoderma spp.
were evaluated for their efficacy against the growth of Ralstonia solanacearum by
inhibition zone assay method. A heavy suspension of R. solanacearum multiplied in
nutrient broth (20 ml) was mixed with luke warm nutrient agar medium (100 ml). The
inoculated flasks were incubated at 29±1oC for 48 h. The bacterial suspension was
then seeded to the luke warm nutrient agar medium (100 ml). The seeded medium was
poured into the sterilized Petri plates and plates were allowed to solidify. Loopful
culture of the antagonistic organism was dissolved in sterile distilled water to make
suspension. In case of fungal antagonists, culture filtrates of antagonists were taken
from fresh antagonists culture. Then, 20-40 µl bacterial suspension and fungal culture
filtrates were spotted on the medium. The inoculated plates were then incubated at
29±1oC for 48 h. The observations for the production of inhibition zone around the
antagonistic microorganisms was calculated and analyzed statistically.
3.5.6 In vitro screening of bacterial and fungal antagonists in combination with lectins
against R. solanaceaarum
3.5.7 In vitro screening of bacterial and fungal antagonists against nematode with
lectins
A single colony of each bacterial strain was cultured in a screw-capped test tubes
containing 10 ml of sterilized nutrient broth incubated at 29±1oC in shaker at 150 rpm for
48 h. The culture was subsequently passed through sterilized Whatman filter papers
No.1 and 42 and concentrated by centrifugation at 10,000 rpm for 10 min. The
supernatant was collected and finally passed through Millipore filter of 0.22 µm. This was
designated as undiluted standard cell free filtrate of cent per cent concentration. The cell
free extract was further diluted to 75, 50 and 25 per cent, respectively and these dilutions
were added with lectins (3.6 mg/ml) and appropriate positive and negative control
maintained to study their effect on nematodes. In vitro evaluation of P. fluorescens and
B. subtilis strains against root-knot nematode was carried out on egg hatching and
juveniles mortality.
Egg masses were collected from culture plants maintained in Nematology glass
house, Department of Plant Pathology, College of Agriculture, University of Agricultural
Sciences, Dharwad. Egg masses were picked up and treated with NaOCl (0.5%) to
dissolve the egg matrix and to separate the individual eggs. A known number of eggs
(50) was carefully transferred to each vial containing lectins and bacterial control with cell
free culture filtrate of P. fluorescens and B. subtilis strains of 100, 75, 50 and 25 per cent
concentrations. Inoculated vials are incubated at room temperature (27±1ºC) for 48 h.
Four controls were maintained by transferring 50 eggs to a vial containing cell free
extracts of strains without lectins, sterilized nutrient broth, Phosphate buffer saline and
water. After 12, 24 and 48 h the number of juveniles hatched was counted under stereo
binocular microscope and per cent inhibition of egg hatching in different dilutions in each
vial was calculated.
53
A known number (50) of eggs was carefully transferred to each vial containing
different concentrations of lectins and bacterial control (1.2, 2.4, 3.6 and 4.8 mg/ml) with
1 x 105 spore suspension of P. lilacinus and T. viride. Inoculated vials were incubated at
room temperature (27±1ºC) for 48 h. Three controls were maintained by transferring 50
eggs to a vial containing, spore suspension without lectins, Phosphate buffer saline and
water. After 12, 24 and 48 h, the number of juveniles hatched was counted under stereo
binocular microscope and per cent inhibition of egg hatching in different dilutions in each
vial was calculated.
3.6 Evaluation srl1 and rvl1 transgenics and non-transgenics for the
suppression of tomato soil-borne pathogens
3.6.1 Analysis of transgenic and nontransgenic plants
Genomic DNA was extracted from the leaf tissues by following a modified CTAB
method (Sambrook and Russell, 2001). A forward primer (5' CTAGTCTAGA
ATGGCCAAGCTGCTCCTCTT 3') and a reverse primer (5' GGCGGATCCGC
CCATCATCTTCTCCTA 3') were used to amplify rvl1 gene. Similarly, a forward primer
(5' ATGGATCCATGACTTATAAGATTACCGT 3') and a reverse primer (5'
CGAGCTCTCACCCGATAATGACGTT 3') were used to amplify srl1 gene. A forward
primer (5' ATGGATCCATGACTTATAAGATTACCGT3') and a reverse primer
(5'CGAGCTCTCACCCGATAATGACGTT3') were used to amplify a 430 bp uidA gene.
PCR products were electrophoresed on a 1.2 per cent agarose gel.
3.6.1.3 SDS-PAGE
SDS-PAGE was done for both crude protein and partially purified protein
isolated from rvl1- and srl1-transgenic plants. SDS-PAGE was performed under
alkaline conditions (pH 8.3) in 12% (w/v) polyacrylamide gel according to the method
55
described by Laemmli (1970) and electrophoresis was carried out at constant voltage
(100 V) for 4-5 h. After the run, gel was stained with 0.1 per cent Coomassie Brilliant
Blue (R250, HIMEDIA) prepared in destaining solution (1: 3: 6 acetic acid: methanol:
water v/v).
Haemagglutination assay was carried out by following the protocol of Lis and
Sharon (1998). Sodium citrate treated rabbit erythrocytes were washed extensively
with phosphate buffer saline (PBS, pH 7.4) and finally resuspended in the required
volume of PBS to generate 1 per cent (v/v) erythrocyte suspension. Agglutination
assays were performed in microtiter plates in a total volume of 150 µl containing 50 µl
of erythrocyte suspension per well with addition of serially diluted measured amount of
protein samples. The agglutination reaction was monitored visually after one hour
incubation at 37oC temperature. The highest dilution of the extract, causing visible
haemagglutination was regarded as the 'titre'. The protein content in the highest
dilution causing visible agglutination was referred to as ‘one unit’ of haemagglutination
activity or expressed as Minimum concentration of protein required for agglutination
(MCA). Based on MCA, total activity of lectin (in units) in the protein sample was
calculated. The specific haemagglutination activity was expressed as units of activity
per mg of protein.
3.6.2 Evaluation of rvl1 and srl1 transgenic and non transgenic tomato lines
against individual and combination of vascular pathogens of tomato under
glasshouse conditions
A glasshouse study was conducted to test the efficacy of srl1 and rvl1 genes
expessed homozygous T3 generation transgenic tomato plants, non transgenics
without lectin and control tomato plants against F. oxysporum, R. solanacearum and
M. incognita individually and in combinations of pathogens. RVL1 and SRL1
transgenics seeds were collected from the Department of Biotechnology, UAS,
Dharwad.
56
Three weeks-old PCR confirmed transgenic plants and non-transformed (in vitro
regenerated) control seedlings were transplanted in 30 cm earthen pots, containing
sterile pot mixture (soil: sand in 1: 1). After ten days of their establishment, the above
said pathogens were inoculated into the individual pots in the root zone (at 50 g
sorghum grain medium of F. oxysporum, 50 ml NB of 48 h R. solanaceanum (1.00 OD
at 600 nm) and 200 Meloidogyne juveniles/pot), by making three holes around the
plant at root zone and covered with sterilized soil.
The following treatments were maintained with five replications and the pots
were arranged in completely randomized design.
Treatment
Transgenic lines Treatment details
no.
SRL1-T0(3) SRL1-T0(3)-T1(9)-T2(7) F R M F+R F+M R+M F+R+M
SRL1-T0(7) SRL1-T0(7)-T1(3)-T2(6)
SRL1-T0(21) SRL1-T0(21)-T1(3)-T2(7)
SRL1-T0(32) SRL1-T0(32)-T1(7)-T2(9)
SRL1-T0(10) SRL1-T0(10)-T1(2)-T2(9)
SRL1-T0(90) SRL1-T0(90)-T1(2)-T2(3)
SRL1-T0(95) SRL1-T0(95)-T1(7)-T2(4)
SRL1- SRL1-T0(116)-T1(5)-
T0(116) T2(8)
RVL1-T0(12) RVL1-T0(12)-T1(8)-T2(2)
RVL1-T0(11)-T1(4)- -do-
RVL1-T0(11)
T2(10)
RVL1-T0(28) RVL1-T0(28)-T1(5)-T2(7)
RVL1-T0(2) RVL1-T0(2)-T1(2)-T2(9)
RVL1-T0(33) RVL1-T0(33)-T1(2)-T2(6)
RVL1-T0(48) RVL1-T0(48)-T1(3)-T2(7)
RVL1-T0(20)-T1(9)-
RVL1-T0(20)
T2(11)
RVL1-T0(50) RVL1-T0(50)-T1(3)-T2(6)
Control Non-transgenic
Control Non-transgenic No pathogens
57
Where,
Observations were recorded on plant growth parameters like shoot length, root
length, fresh shoot weight, fresh root weight, dry shoot weight, dry root weight, gall
index, disease incidence, recovery of Ralstonia and Fusarium propagules from soil,
final nematode population in soil, number of egg masses per root, female fecundity and
reproduction factor at 90 days after inoculation. Whereas rating of root-knot index was
done following the scale suggested by Bridge and Page (1980) as given below:
0 No galls
The disease incidence was recorded by 0-4 scale as described by Weitang et al.
(2004) where zero represents no infection and four denotes complete infection. Five
58
replications were maintained for each treatment in two separate experiments. The 0–4 scale of the
disease severity was classified as follows:
0 - No infection.
2 - Moderate infection, two or three leaves turned yellow, 50% of leaves wilted.
3 - Extensive infection, all the leaves turned yellow, 75% of leaves wilted and growth is
inhibited
4 - Complete infection, the leaves of the whole plant turned yellow, 100% of leaves
wilted, and the plants died.
The percentage of disease severity was determined using the formula given by
Weitang et al. (2004)
The soil sample collected from treated pots was subjected to serial dilution with
following steps. After thorough mixing, 10 g of soil sample from each treatment was
transferred aseptically to 250 ml flask containing 100 ml sterile distilled water
separately and mixed thoroughly by hand shaking for 30 min. 1ml sample was drawn
from the suspension and transferred to 9 ml of sterile distilled water blank. The
suspension thus obtained in dilution process was shaken for one minute before it was
further diluted. One ml suspension from each of the appropriate dilution was
transferred aseptically into sterile Petri plates. Fifteen ml of specific medium for
Fusarium FSM (Fusarium specific medium) and for Ralstonia used sucrose peptone
agar melted and cooled to 45°C was transferred to Petri plates and gently rotated
clockwise and anticlockise direction to get uniform mixing. The plates were incubated
59
at room temperature. Microbial counts were assessed on the second day for bacteria
and seven days for fungi and counted colony forming units.
Cobb’s sieving and decanting technique was followed to extract nematodes from
soil for which 200 cc of the samples was collected from treated pots and the sample
taken in a container and mixed thoroughly with water. Hard particles and stones if any,
were removed by stirring the suspension and were then passed through a set of sieves
of 60, 250 and 325 µm pore size. The sievates were collected on a tissue paper spread
over a coarse mesh, which was then placed in a Petri plate containing enough water so
as to keep the tissue paper just wet. The nematode suspension collected in the Petri
plate was examined using stereo binocular microscope. The root-knot nematodes
present in the suspension were identified by observing different morphological
characters.
At 90 dpi, the root systems were washed free of soil and weighed. Egg masses
were stained with a 0.05% of acid fuchsin and recorded. Eggs from the entire root
system were extracted by maceration in a blender containing a 0.5% NaOCl solution
for 10 min (Hussey and Barker, 1973) and counted to determine final population (Pf).
Both non-hatched eggs and empty eggs (egg shells) were recorded and the hatching
rate was estimated. The fecundity of the females and reproduction factor was
calculated by using formula,
The leaf samples collected from the inoculated tomato plants were immediately
homogenized with liquid nitrogen. One g of powdered sample was extracted with 2 ml
of sodium phosphate buffer, 0.1 M (pH 7.0) at 4ºC. The homogenate was centrifuged
for 20 min at 10,000 rpm. Protein extracts prepared from tomato leaf tissues were used
for estimation of defense enzymes like peroxidase (PO), polyphenol oxidase (PPO),
phenylalanine ammonia lyase (PAL) and total phenols.
Phenol content was estimated as per the procedure given by Zieslin and Ben-
Zaken (1993). One g of sample was homogenized in 10 ml of 80% methanol with
61
pestle and mortar and agitated for 15 min. One ml of the methanolic extract was added
to 5 ml of distilled water and 250 µl of Folin-Ciocalteau reagent (1 N) and the solution
was kept at 25±1oC. After 3 min one ml of saturated solution of sodium carbonate and
one ml of distilled water was added and the reaction mixture was incubated for 1 h at
25±1oC. The absorption of the developed blue colour was measured using UV-visible
spectrophotometer at 725 nm. The content of the total soluble phenols was calculated
according to a standard curve obtained from a Folin-Ciocalteau reagent with a phenol
solution (C6H6OH) and expressed as catechol equivalents mg/g tissue weight.
3.7 Evaluation srl1 and rvl1 transgenics and non-transgenics lines for root
infection by Meloidogyne incognita and its development
The PCR-confirmed eight srl1 and rvl1 homozygous T3 transgenic plants and
non-transformed control were screened to compare penetration and reproduction of
root-knot nematode on lectins carrying transgenic tomato lines by following the method
of Gaofu et al. (2008). Three-week old seedlings were transplanted in earthen pots,
surface sterilized with 70% alcohol and filled with sterile potting mixture (soil: sand in 1:
1). After a week, the pots were inoculated with 200 freshly hatched J2 (less than 72 h-
old) 5 ml of water. The pots were maintained in the greenhouse and regularly watered
with tap water.
The following treatments were maintained with 24 replications and the pots were
arranged in completely randomized design.
Treatments details
SRL1-T0(95) SRL1-T0(95)-T1(7)-T2(4)
SRL1-T0(116) SRL1-T0(116)-T1(5)-T2(8)
RVL1-T0(12) RVL1-T0(12)-T1(8)-T2(2)
RVL1-T0(11) RVL1-T0(11)-T1(4)-T2(10)
RVL1-T0(28) RVL1-T0(28)-T1(5)-T2(7)
RVL1-T0(2) RVL1-T0(2)-T1(2)-T2(9) Nematode-alone
RVL1-T0(33) RVL1-T0(33)-T1(2)-T2(6)
RVL1-T0(48) RVL1-T0(48)-T1(3)-T2(7)
RVL1-T0(20) RVL1-T0(20)-T1(9)-T2(11)
RVL1-T0(50) RVL1-T0(50)-T1(3)-T2(6)
Control Non-trnagenic
Control Non-transgenic Uninoculated
At each harvesting time (1, 3, 5, 7, 11, 15, 21, 25, 30 and 45 dai), three plants/
treatment were carefully removed from the pots and the root system washed free of
soil. Roots were stained with acid fuchsin 0.05 per cent (Bridge and Page, 1982), and
examined under a stereo binocular microscope to determine infection percentage
Nematodes were categorized according to their developmental stages as J2
vermiform, J2 sausage-like) and adults (Taylor and Sasser, 1978).
At 45 dpi, the root systems were washed free of soil and fresh shoot and root
length, fresh shoot and root weight and dry shoot and root weight were recorded. Egg
masses were stained with a 0.1 g/ml acid fuchsin for 2 h (Byrd et al., 1983) and
recorded. Eggs from the entire root system were extracted by maceration in a blender
containing a 0.5% NaOCl solution for 10 min (Hussey and Barker, 1973) and counted
63
to determine Pf. Both non-hatched eggs and empty eggs (egg shells) were recorded
and the hatching rate was estimated. The fecundity of the females and Reproduction
factor was calculated using the formula as mentioned above.
3.7.4.1 Sampling
The root samples of the above treatments were taken 21 days after inoculation.
Lateral or feeder infected (galled) roots from different treatments were cut into 1-
1.5 cm. They were then washed with tap water to remove soil particles and were
sepeartely fixed in formalin acetic acid-alcohol fixative (two parts of ethyl alcohol 70% +
one parts of formaldehyde +one part of acetic acid) for overnight.
Further, they were washed in ethyl alcohol and subjected to dehydration using
graded series of ethyl alcohol (50, 70, 80, 90 and 100%) with 3 h in each step. Further,
samples were subjected to ethyl alcohol: butanol mixture (75: 25, 50: 50, 25: 75) and
100% butanol with 3 h in each step. This was followed it with one change in butanol for
2-3 h.
Transfer the specimens to small glass vials containing little butanol to which
molten paraffin wax was added later. Which were incubated at room temperature for
overnight after that transfer the vials to oven for 12 h at 62-65oC. Finally the specimens
64
were given changes with fresh molten, pure paraffin wax at 60oC in oven then replacing
the last traces of butanol with paraffin. The specimens were subsequently embedded in
paraffin wax taken in glass lids of coplin jar which were previously smeared with
glycerol. The specimens in paraffin wax was properly oriented before it got solidified.
The lids with solidified wax were plunged into iced water to seprate the solidified wax.
Rectangular blocks were then cut, trimmed and attached to the block holder of a
rotary Microtome (Leica). The block holder along with mounted wax square/block were
kept in cold water in fridge overnight. Then the block were fixed to microtome, to cut
uniform thin sections of 10-12 µm. Then the paraffin ribbons were carefully taken from
the microtome using foreceps. The paraffin ribbons were cut into convenient lengths
with the help of a blade and placed on a clean glass slide previously flodded with
gelatin adhesive (1 g gelatin dissolved in 90 ml water to which 10 ml formaldehyde
added later). Further, ensure proper expansion of sections by keeping the slides for a
little while on hot plate at 50-55oC. Drain off the excessive adhesive keep the slides
overnight at 40 oC for drying in oven.
Paraffin wax was removed from the sections by placing the slide in xylene
followed by one change in it for 5 min.
Procedure
• The xylene and all other solutions were kept in coplin jars in which slides were
held.
• The sections were washed in distilled water for 5 min then rapidly passed
through graded alcohol series (30, 50, 70, 90 and 100%) with 5-10 min at each
step.
• Sections were counter stained with fast green (in clove oil) for 1 min.
• Excess stain was cleared by palcing it in a carbol-xylene for 10 min before the
sections are brought to xylene (10 min).One more bathing in xylene for 10 min.
• Mount the sections DPX mountant upon carefully slides to be left for a couple of
days before they are examined under compound microscope.
labelled lectins and appropriate controls on fungal mycelium was observed and
photographed under fluorescence microscope (Zeiss Axioscope A1) using excitation
filter 450-490 nm in the path of excitation light and barrier filter 515 nm in the path of
emitted light.
BSA was subjected to periodate oxidation, to get itself freed from associated
glycoproteins and converted to p-BSA. Periodate treated BSA was prepared according
to the method of Glass et al. (1981). BSA in 0.1M sodium acetate buffer, pH 4.5 (4
g/100 ml) was treated with 10 mM periodic acid for 6 hours at room temperature. Then
excess of periodate was eliminated by adding glycerol to afinal concentration of 10 mM
and later solution was dialyzed extensively against 10 mM PBS and lastly against
water and freeze dried.
bodies of S. rolfsii during development was carried out by immunolabeling the lectin
sites with FITC anti-SRL1 (Swamy et al., 2004). Vegetative mycelial mass from the S.
rolfsii culture broth of 10 days was washed repeatedly by centrifugation at 8000 rpm.
Washed mycelial filaments were suspended in phosphate buffered saline (PBS)
67
containing p-BSA (3%) and incubated for 30 min at 37oC to block nonspecific binding
by lectin antibodies, followed by extensive washing with PBS. Subsequently the
filaments were incubated with FITC anti-SRL1 in PBS (50 mg/ml) for 30 min with gentle
shaking. Excess unbound antibodies were removed by washing with PBS on
centrifugation. Essentially the same procedure was adopted for lectin localization on
sclerotial bodies. Interaction of FITC anti-SRL1 on vegetative mycelia and sclerotial
bodies was observed and photographed under fluorescence microscope (Zeiss
Axioscope A1) with an excitation filter 450-490 nm in the path of excitation light and
barrier filter 515 nm in the path of emitted light.
The above same procedure used for anti-SRL1 lectin binding assay for
mycelium and sclerotia of R.solani.
Interaction of RVL1 and BL21 with M. incognita was investigated using FITC-
RVL1 and FITC-BL21 by fluorescent microscopy. Nematodes (10) were suspended in
68
1.0 ml solution of RVL1 (4.8 mg/ml) and BL21 (4.8 mg/ml) incubated at 27±1°C in the
dark. At different intervals of time (6 and 12 h), 200 µl aliquots were drawn and washed
thrice by centrifugation (1000 rpm for 2 min) with PBS to remove excess FITC-RVL1.
Nematodes were finally collected on a membrane sieve (25 µm), mounted on glass
slides and observed under a fluorescent microscope (Zeiss, Axioscope A1) with an
excitation filter 450-490 nm in the path of excitation light and barrier filter 515 nm in the
path of emitted light. Receptor-mediated RVL1 binding to nematode was confirmed by
using FITC-RVL1 complexed with mucin.
FITC-RVL1 (4.8 mg/ml) was incubated with mucin (125 µg) in 1.0 ml of PBS for
1 h at room temperature. To this lectin-sugar complex solution, 10 nematodes were
added and incubated as described earlier. After 48 h nematodes were observed for the
fluorescence label under the florescent microscope.
For the binding experiment with SRL1, nematodes were washed twice in
phosphate-buffered saline (PBS), pH 7. Fluorescein isothiocyanate (FITC) conjugated
lectin of pure SRL1 (30 µg/ml PBS) was added to the nematode suspension (10
juveniles) and incubated in the dark at room temperature for 4 h. Nematodes were
washed with PBS, followed by an extensive rinse with distilled water. Nematodes were
then collected with distilled water and mounted on glass microscope slides for
observation under a fluorescent microscope (Zeiss, Axioscope A1) with an excitation
filter 450-490 nm in the path of excitation light and barrier filter 515 nm in the path of
emitted light.
The experimental data collected were analyzed statistically for its significance of
difference by the normal statistical procedure adopted for Completely Randomized
Design and Factorial Completely Randomized Design (two-way and three way anova)
and interpretation of data was carried out in accordance with Walter (1997). The level
of significance used in ‘F’ and ‘T’ test was P=0.01. Critical differences were calculated
wherever ‘F’ test was significant. The values of per cent disease incidence were
subjected to angular transformation according to the table given by Sundarraj et al.
(1974) before they were analyzed.
4. EXPERIMENTAL RESULTS
Experiments were conducted on various suppression activities of plant and fungal lectins on
soil-borne pathogens during the period 2010 to 2013. Expression of rvl1 and srl1 in transgenic
tomato was checked. Toxicity of transgenic tomato plants on soil borne pathogens was assayed. An
attempt was also made to elucidate the mechanism of action of lectins. The results obtained with
various experiments are presented here.
Tomato plant samples affected by different soil-borne pathogens were collected from fields of
Main Agricultural Resarch station, UAS, Dharwad. From the wilted plants, pathogens like Sclerotium
rolfsii, Rhizoctonia solani, Fusarium oxysporum and Ralstonia solanacearum were isolated (Plate 1).
Galled tomato roots and rhizosphere soil were also collected to isolate Meloidogyne
incognita. These cultures were used for further investigations.
Standard tissue isolation technique was followed to obtain causal agents from the diseased
tomato plants showing typical symptoms. Repeated isolations yielded F. oxysporum, S. rolfsii, R.
solani. The infected specimens were cut into small bits and washed in running water. These bits
were surface sterilized with one per cent sodium hypochlorite solution for one minute, then
aseptically transferred to PDA slants and were incubated at 27±1oC for three to ten days. Same
procedure was followed to obtain the pure culture of F. oxysporum, S. rolfsii and R. solani. Such
pure culture tubes were preserved in a refrigerator at 4°C and used for further studies. They were
sub-cultured every month.
70
Plant 1. Tomato root diseases from which the pathogens were isolated
71
On the basis of morphological and cultural characteristics, the pathogen were identified as
Fusarium oxysporum, Sclerotium rolfsii and Rhizoctonia solani (Plate 2).
The fungus was identified based on colony morphology, mycelial character, spore production
and pigmentation on PDA: Fusarium on Potato Dextrose Agar put-forth rapid growth covering the
Petri plate in 7-10 days. The mycelium was sparse to dense, white to light pinkish in colour. It
produced both micro- and macroconidia. The microconidia formed abundantly on the aerial
mycelium from elongated phialides and were abundant hyaline and cylindrical to fulcate. They
measured 10.8 to 13.8 x 3.3 to 6.6 µm. The macroconidia developed in 6 days from well developed
conidiophores. They were sparse to abundant, hyaline, fusoid-subulate with 2-5 septa and measured
29.7 to 43.8 x 3.8 to 5.5 µm. Apex of macroconidia were pointed and beaked. Chlamydospores
formed 12 to 14 days after incubation in cultures. They were globose to oval, single celled, smooth to
rough walled, measured 8.25 to 11.5 x 6.60 to 9.90 µm and seen terminally or intercalary in the
hyphae.
The fungus produced white, dense, radiating mycelial growth on PDA. In the early stages, the
fungus produced silky white mycelium and gradually lost its luster and became dull in appearance.
Sclerotial initials were observed from seventh day onwards. Initially, the sclerotial bodies were
spherical and white, later became chocolate brown to dark brown at maturity. Matured sclerotia were
spherical to ellipsoidal.
Fungus produced dull white, sparse, radiating mycelium on PDA. Later, mycelium became
raised, light brown and powdery. Irregular to round, brown colored sclerotia were seen in the plates
after seven days of incubation. Microscopic observations revealed hyphae were branched at right
angles, were septate and hyaline.
72
The pathogenicity of F. oxysporum, S. rolfsii and R. solani conducted on tomato revealed that
the fungi were pathogenic.
Isolation of R. solanacearum was made from infected tomato plants showing typical wilt
symptoms on Sucrose Peptone Agar containing tetrazolium chloride. The bacterial colonies
appeared fluidal, irregular to round, convex, smooth, dull white with light pink center.
The virulent colonies which appeared as dull white with light pink centre after 36 h incubation
at 27±1oC were picked and purified by single colony isolation technique on Sucrose Peptone Agar
medium and suspended in polypropylene tubes containing sterile distilled water and preserved at
4oC. These served as stock culture for further studies.
There was a gradual increase in the growth of bacterium at different interval (Table 1, Fig. 2).
The growth started after 16 h (0.119 OD) and maximum growth was observed at 112 and 120 h after
inoculation with OD value with 1.847. After 120 h, there was gradual decrease in growth. The
dynamics of the bacterial growth was studied by plotting the cell growth (absorbance) versus the
incubation time. The curve thus obtained was a sigmoid curve and was taken as a standard growth
curve of the bacterium.
The results of the various morphological, physiological and biochemical tests are given in
Table 2, Plate 3. The bacterium is a rod shaped, strictly aerobic, gram negative, oxidase positive and
amphitrichously flagellated. It was positive for starch hydrolysis, liquefaction of gelatin and produced
hydrogen sulphide.
74
8 0.082
16 0.119
24 0.458
32 0.634
40 0.854
48 1.007
56 1.176
64 1.220
72 1.394
80 1.489
88 1.517
96 1.514
104 1.740
112 1.817
120 1.847
128 1.840
136 1.840
144 1.840
152 1.840
160 1.840
168 1.840
Mean 1.328
S.Em ± 0.004
CD at 1% 0.14
75
76
4.1.3.4 Pathogenicity
4.1.4.1 Pathogenicity
Expression of RVL1 and SRL1 was checked with total protein isolated from
induced E. coli BL21(DE3)pLysS. Total protein induced from cell mass of E. coli
recombinant clones was compared with their respective controls (clones without srl1 and
rvl1 gene) upon induction. Recombinant E. coli clones had a total protein content of
77
12 mg/ml compared to 10.00 mg/ml in control. The isolated protein was subjected for
haemagglutination assay and SDS–PAGE.
4.2.1 Haemagglutination
The crude extracts of plant tuber lectin Remusatia vivipara lectin (RVL1) and
fungal lectin Sclerotium rolfsii lectin (SRL1) were prepared from E. coli BL21(DE3)pLysS
cells carrying respective recombinant expression vectors and plain expression vectors
(control) and the presence of lectin was confirmed by haemagglutination assay (Table 4,
Plate 6). It strongly agglutinated trypsinised rabbit erythocytes, indicating blood specificity.
Minimum concentration required for agglutination (MCA) was 1.37 µg and 2.73 µg for SRL1
and RVL1, respectively. For SRL1, the total activity was 0.87 × 104 and the specific activity
was 7.29 × 102. Likewise, for RVL1, the total activity was 0.43 ×104 and the specific activity
was 3.66 × 102 with rabbit erythocytes. In general, the concentration of lectin was more in
partially purified protein.
4.2.2 SDS-PAGE
Expression of SRL1and RVL1 was checked with total protein isolated from induced
E. coli BL21(DE3)pLysS cells carrying respective recombinant expression vectors and plain
expression vectors (control). The induced protein was subjected to SDS–PAGE. The gels
stained with Commassie brilliant blue showed an extra protein band corresponding to
molecular weight of 28.2 kDa for RVL1 and 19.5 kDa for SRL1 (Plate 7).
Test Inference
Colony morphology on sucrose peptone agar with TZC medium
Configuration Round
Margin Entire
Elevation Convex
Surface Smooth
Pigment Pink at the centre
Biochemical characterization
Shape Rod
Arrangement Single
Gram reaction Negative
Starch hydrolysis Positive
Gelatin liquefaction Positive
H2S production Positive
Tobacco hypersensitivity Positive
Original description
Feature Characters observed
(Eisenback et al., 1981)
Lateral field Lateral ridges absent, marked Lateral ridges absent, marked by
by breaks and forks in striae breaks and forks in striae
Tail terminus Often with distinct whorl Often with distinct whorl
showed a single band with molecular weight of 19.5 kDa, which was in agreement with the
calculated molecular weight of DP-SRL1.
Antiserum against SRL1 was prepared using 3-month old female albino rabbit by
giving four (weekly) intramuscular injections with purified preparation of the SRL1
suspended at different concentrations of 25, 100, 500 and 1000 µg in PBS. Finally blood
was collected and processed by following the procedure described in “Material and
Methods”. The antiserum thus produced was used for further studies.
Slide agglutination test was performed to know the efficacy of antibodies raised
against SRL1 by mixing a drop of antiserum with SRL1 and PBS. The results revealed that
there was agglutination in SRL1. No agglutination was observed in PBS which indicated
that antiserum was active.
Titre of antisera was determined by two-fold serial dilutions of antiserum from 100 to
204800 and purified SRL1 used as an antigen. The titre of antisera against antigen was
determined by DAC- ELISA. Antisera was detectable up to 262174 dilution and this was
found out based on colour changes in the substrates at optical density value of 405 nm
wave length, using ELISA reader.
1: 16384, 1: 32768 and 1: 65536 dilutions. The results showed that the antigens at
1: 2048 and antiserum 1: 8192 (and above) showed positive reaction (Table 6). The buffer
and BL21 controls gave negative results.
4.4 Evaluation of plant and fungal lectins for the in vitro suppression of some common
soil-borne pathogens
Antifungal activity of different amounts of plant and fungal lectins from Remusatia
vivipara and Sclerotium rolfsii was determined for soil borne fungal pathogens like F.
oxysporum, S. rolfsii and R. solani as described in “Material and Methods”. Screening of
different concentrations of RVL1 and SRL1 Lectins with bacterial control (BL21) were
evaluated against F. oxysporum, S. rolfsii and R.solani in laboratory each at four
concentrations (1.2, 2.4, 3.6 and 4.8 mg/ml) by poisoned food technique, spread plate,
inhibition zone assay and spore or sclerotia germination methods. In order to get double
confirmation of results used different methods for evaluation of these lectins.
4.4.1.1a F. oxysporum
The efficacy of the two lectins, concentrations and their interaction on per cent
inhibition of mycelial growth of F. oxysporum differed significantly (Table 7a). Maximum per
cent inhibition (25.28%) of F. oxysporum was recorded in RVL1 plant lectin which was
significantly superior to SRL1 (22.52%). Least per cent inhibition of 15.56 per cent was
noticed in SRL1 at a low concentration (1.2 mg/ml). However, the maximum per cent
inhibition of mycelial growth was observed at 4.8 mg/ml concentration of lectins.
85
Negative control
1:2048 0.089 0.083 0.080 0.080
(PBS)
Table 7. Evaluation of plant and fungal lectins against F. oxysporum and S. rolfsii
through poison food technique
SRL1 15.56 (23.24)* 22.78 (28.52) 25.00 (30.02) 26.73 (31.15) 22.52 (28.34)
RVL1 21.11 (27.37) 22.22 (28.14) 27.78 (31.82) 30.00 (33.23) 25.28 (30.20)
Control (BL21) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00)
At all tested concentrations of 4.8, 3.6, 2.4 and 1.2 mg/ml RVL1 recorded highest
per cent inhibition of mycelial growth of 30.00, 27.78, 22.22, and 21.11 per cent
respectively which was significantly superior to SRL1. SRL1 recorded 26.73, 25.00, 22.78
and 21.11 per cent inhibition of the mycelial growth. There was no inhibition in mycelia
growth of fungus which is treated with bacterial control (BL21 extract). At all the tested
concentrations among plant and fungal lectin, plant lectin recorded highest inhibition at all
concentrations.
4.4.1.1b S. rolfsii
Differences in mycelial growth in different treatments were seen two days after
inoculation of the pathogen on PDA. Both RVL1 and SRL1 treated plates showed smooth,
pure white, sparse radiating mycelium. But in respective controls, luxurious radiating and
aerial growth of the fungus was noticed. All lectin treated PDA plates as well as control
plates without lectins, covered the petriplate on 3rd day.
In SRL1 treated plates, it was found that pre-sclerotial bodies formation started on
second day of inoculation. On fourth day, white pre-sclerotial bodies formation was seen in
all lectin treated plates except that of control. In both control PDA plates, sclerotial bodies
started forming on 7th day of inoculation. On 6th day of inoculation, colour of sclerotial
bodies turned to dark brown in PDA plate treated with 3.6 mg/ml and 4.8 mg/ml of E. coli
protein containing SRL1. Formation of dark brown sclerotial bodies was observed on 7th
day of inoculation in PDA plate treated with 1.2 mg/ml and 2.4 mg/ml of E. coli protein
containing SRL1 and PDA plate treated with 1.2 mg/ml, 2.4 mg/ml, 3.6 mg/ml and 4.2
mg/ml of E. coli protein containing RVL1. Compared to SRL1 and RVL1 treated PDA
plates, control plates took 12 days for formation of dark brown sclerotial bodies (Table 7b,
Plate 9).
Plate 9. In vitro evaluation of SRL1 and RVL1 against F. oxysporum, S. rolfsii and
. R.Solani using poison food technique
90
Plate 9. contd….
91
4.4.1.1c R. solani
4.4.1.2a F. oxysporum
Effect of RVL1, SRL1 and anti - SRL1 on the fungal growth was
significant (Table 8a, Plate 10). Among the lectins, maximum per cent inhibition of growth
92
of F. oxysporum was observed in RVL1 (40.69%) which was significantly superior to SRL1
(29.35%) and anti-SRL1 (0.00%). Among the four tested concentrations, 4.8 mg/ml
concentration was significantly superior to 3.6, 2.4 and 1.2 mg/ml. Maximum per cent
inhibition of mycelial growth (54.81%) of the fungus was recorded in RVL1 at 4.8 mg/ml
followed by SRL1 (42.96%). There was no inhibition of mycelial growth of the fungus by
anti-SRL1 and BL21. At 3.6 mg/ml, maximum per cent inhibition of mycelial growth
(43.48%) of the fungus was recorded in RVL1. Further, RVL1 of 2.4 mg/ml (36.30%) and
3.6 mg/ml of SRL1 (31.11%) were effective in inhibiting the pathogen. At 1.2 mg/ml
concentration, maximum per cent inhibition of mycelial growth of the fungus was recorded
in RVL1 (28.15%). Similarly SRL1 at 2.4 and 1.2 mg/ml showed 22.96 and 20.37 per cent
inhibition of the mycelial growth respectively.
4.4.1.2b S. rolfsii
Maximum per cent inhibition of growth of the fungus was recoreded in anti-SRL1
(37.81 %) than RVL1 (32.78%) and presented in Table 8b, Plate 10. Among tested lectins,
anti-SRL1 at 4.8 and 3.6 mg/ml showed maximum per cent inhibition of 44.44 and 44.07
per cent against S. rolfsii and they remained onpar with each other. Further, 43.33 and
40.00 per cent inhibition of mycelial growth was recorded in RVL1 at 4.8 and 3.6 mg/ml
concentration. At 2.4 mg/ml, maximum percent inhibition of mycelial growth was recorded
in anti-SRL1 (35.37%). Further, 28.15 and 27.59 per cent inhibition was recorded in RVL1
and anti-SRL1 at 2.4 and 1.2 mg/ml concentrations respectively, and they remained on par
with each other. Least per cent inhibition was recorded at 1.2 mg/ml of RVL1 (19.63%).
There was no inhibition of mycelial growth of fungus in SRL1 and controls.
4.4.1.2c R. solani
Maximum per cent inhibition of mycelia growth was recoded in anti-SRL1 (49.63%)
followed by RVL1 (27.31%). There was no inhibition of mycelial growth in SRL1 and BL21
treatments. Between the concentrations of lectins, efficacy was significant from lower to
higher concentrations with greater efficacy at higher concentration (Table 8c, Plate 10).
Anti-SRL1 at 4.8, 3.6, 2.4 and1.2 mg/ml concentrations gave maximum per cent inhibition
of mycelial growth of 55.55, 50.37,
93
Table 8. Evaluation of plant and fungal lectin against F. oxysporum, S. rolfsii and R.
solani through spread plate technique
Table 8a. Fusarium oxysporum
SRL1 20.37 (26.84)* 22.96 (28.65) 31.11 (33.92) 42.96 (40.98) 29.35(32.60)
Anti-SRL1 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00)
RVL1 28.15 (32.06) 36.30 (37.07) 43.48 (41.28) 54.81 (47.79) 40.69 (39.55)
Control 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00)
(BL21)
SRL1 0.00 (0.00)* 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00)
Anti-SRL1 27.59 (31.47) 35.37 (36.51) 44.07 (41.62) 44.44 (41.83) 37.87 (37.69)
RVL1 19.63 (26.18) 28.15 (32.06) 40.00 (39.25) 43.33 (41.18) 32.78 (34.72)
BL21 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00)
SRL1 0.00 (0.00)* 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00)
Anti-SRL1 44.81 (42.04 ) 47.77 (43.74) 50.37 (45.23) 55.55 (48.21) 49.63 (44.81)
RVL1 21.85 (27.88) 24.81 (29.89) 28.51 (32.29) 34.07 (35.73) 27.31 (31.45)
Control (BL21) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00)
Plate10. In vitro evaluation of SRL1 and RVL1 against F. oxysporum, S. rolfsii and
R.solani using spread plate menthod
96
47.77 and 44.81 per cent, respectively. Further, RVL1 showed 34.07, 28.51, 24.81, and
21.85 per cent inhibition of mycelial growth of the fungus.
Antifungal activity of the plant and fungal lectins was tested under in vitro condition
by inhibition zone assay as described in “Material and Methods”. Lectins, concentrations
and their interaction differed significantly with respect to inhibition of the mycelial growth of
fungus. Between the concentrations of lectins, efficacy was significant from lower to higher
concentrations with greater efficacy at higher concentration.
4.4.1.3a F. oxysporum
4.4.1.3b S. rolfsii
Antifungal activity of lectins was evident at higher concentrations and results are
presented in Table 9b, Plate 11. Anti-SRL1 recorded highest mean inhibitory zone of 0.98
cm which is significantly higher than that of RVL1 (0.84 cm). Anti-SRL1 recorded maximum
inhibition zone of mycelial growth of 1.60 and 1.36 cm at 4.8 and 3.6 mg/ml concentrations
and it was followed by 1.20 and 1.06 cm inhibition zone in RVL1 (4.8 and 3.6 mg/ml),
respectively. Further, at 2.4 and 1.2 mg/ml concentrations of RVL1 recorded 0.69 and 0.48
cm inhibition zone. Least inhibition zone was recorded at 2.4
97
Table 9. Evaluation of plant and fungal lectin against F. oxysporum and S. rolfsii
through inhibition zone assay
SRL1 1.41 (1.55)* 1.64 (1.62) 1.74 (1.65) 1.94 (1.71) 1.68 (1.64)
RVL1 1.16 (1.47 ) 1.61(1.62) 1.93 (1.71) 2.24 (1.80) 1.73 (1.65)
Anti-SRL1 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00)
Control (BL21) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00)
SRL1 0.00 (1.00)* 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00)
RVL1 0.48 (1.22) 0.61 (1.27) 1.06 (1.44) 1.2 (1.48) 0.84 (1.36)
Anti-SRL1 0.38 (1.17) 0.56 (1.25) 1.36 (1.54) 1.6 (1.61) 0.98 (1.41)
Control (BL21) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00)
and 1.2 mg/ml concentrations of anti-SRL1 (0.56 and 0.38 cm). SRL1, BL21, buffer and
sterile distilled water controls did not show inhibition zone.
4.4.1.3c R. solani
Maximum inhibition around the disc in RVL1 (1.02 cm) was observed at higher
concentration than anti-SRL1 (0.74 cm). SRL1 and controls did not show inhibition (Table
9c, Plate 11). At 4.8 mg/ml, highest zone of inhibition of mycelial growth of 1.45 cm was
observed in RVL1 followed by 1.40 cm of inhibition zone in anti-SRL1 treatment. Further,
RVL1 and SRL1 recorded 1.08 cm and 0.93 cm at 3.6 mg/ml and 0.88 and 0.63 cm at 2.4
mg/ml, respectively. At 1.2 mg/ml, 0.69 cm inhibition zone of mycelial growth of the fungus
recorded in RVL1 treatment. But anti-SRL did not show inhibition zone of mycelia growth
at 1.2 mg/ml.
Data presented in Table 9d, Plate 11 indicated that strong antifungal activity was
shown by protein towards F. oxysporm spore suspension (1.0 to 2.5 x 106 spores /ml)
spread on medium as explained in “Material and Methods”. Results revealed that among
the tested lectins and bacterial control, RVL1 recorded highest mean inhibitory zone of
1.64 cm which was significantly superior to SRL1 (1.25 cm). RVL1 recorded maximum
inhibition zone of 2.45 cm at 4.8 mg/ml, 1.95 cm at 3.6 mg/ml, 1.25 cm at 2.4 mg/ml and
0.92 cm at 1.2 mg/ml concentrations, respectively. Further, SRL1 recorded 1.76, 1.59,
1.10 and 0.55 cm inhibition zone at 4.8, 3.6, 2.4 and 1.2 mg/ml concentrations. BL21
extract (bacterial control), buffer and sterile distilled water controls did not show inhibition
zone.
SRL1 0.00 (1.00)* 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00(1.00)
RVL1 0.69 (1.30) 0.88 (1.37) 1.08 (1.44) 1.45 (1.56) 1.02 (1.42)
Anti-SRL1 0.00 (1.00) 0.63 (1.27) 0.93 (1.39) 1.40 (1.54) 0.74 (1.30)
Control (BL21) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00(1.00)
Table 9d. Evaluation of SRL1 and RVL1 against F. oxysporum (disc diffusion assay)
SRL1 0.55 (1.24)* 1.10 (1.45) 1.59 (1.61) 1.76 (1.66) 1.25 (1.49)
RVL1 0.92 (1.38) 1.25 (1.50) 1.95 (1.72) 2.45 (1.86) 1.64 (1.61)
Control (BL21) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00)
Plate11. Evaluation of SRL1 and RVL1 against F. oxysporum, S. rolfsii and R.solani
employing inhibition zone assay
101
between treatment and concentration was significant which indicated that an increase in
concentration tended to modify the effect of other in a significant manner. RVL1 and
SRL1 at 4.8, 3.6, 2.4 and 1.2 mg/ml concentrations significantly inhibited the
germination of macro and microconidia. The greatest decrease in inhibition of spore
germination was noticed with RVL1 in treatment concentration interaction (55.26%)
followed by SRL1 (42.26%) at 4.8 mg /ml.
Interstingly sclerotia treated with SRL, Bl21, buffer and normal rabbit serum
germinated with lavish growth. Not only anti-SRL1, but also RVL1 inhibited the
germination of sclerotial bodies. SRL1 did not inhibit the sclerotial bodies germination.
Cent per cent inhibition of mature and immature sclerotial germination was found at all
concentrations (4.8, 3.6, 2.4 and 1.2 mg/ml) of anti-SRL1 treatment. In all, 51.01, 45.84,
21.03 and 15.73 per cent inhibition of mature sclerotial bodies and 74.61, 63.82, 55.54
and 51.69 per cent inhibition of immature sclerotial bodies was noticed by RVL1 at
sequential concentration in dcreasing order.
Plate 12. Effect of lectins on sclerotial (mature and immature) germination inhibition
on Byrde’s medium
inhibition was recorded in anti-SRL1 and RVL1 at 3.6 mg/ml and they remained on par
with each other. This was followed by 67.08 and 78.82 per cent inhibition of anti-SRL and
RVL1 at 2.4 mg/ml. Least per cent inhibition was recorded at 1.2 mg/ml of 60.05 and 48.93
per cent in anti-SRL1 and RVL1.
In vitro antibacterial assays demonstrated that the plant lectin (RVL1) and fungal
lectin (SRL1) exhibited antibacterial activity against the bacterium R.solanacearum as
shown by inhibition haloes using well method (Table 13a, Plate 14).
Both SRL1 and RVL1 exhibited dose dependent antimicrobial activity against R.
solanacearum which was found to be more sensitive to RVL1 (2.85 cm) followed by
Streptocycline control (2.59) and SRL1 (2.35 cm). RVL1 was the most potent against the
bacterium.
4.4.2.2 Determination of the minimum inhibitory concentration (MIC) and the minimum
bactericidal concentration (MBC)
Antibacterial activity of SRL1 and RVL1 against R. soalnacearum, MIC and MBC
values are presented in Table 13b, Plate 15.
The antibacterial efficacy of the protein was found to be moderate against the
bacterium. No antibacterial activity was noticed in the control set (BL21, PBS and sterile
distilled water). It was significant that the MIC which corresponds to the minimum lectin
concentration capable to inhibit the visible growth of the R. solanacearum was 0.625
mg/ml for both SRL1 and RVL1 with 1.87 and 1.56 mg/ml of MBC which corresponds to
the minimum concentration of the lectin capable to reduce the number of cfu for 0.1% of
the initial inoculum respectively MBCs determined by agar diffusion were higher than the
ones obtained by MICs.
Interaction effect of lectins and their concentrations indicated that RVL1 (3.6
mg/ml) was significantly superior to SRL1 with an inhibition zone of 2.62 cm. The effect of
SRL1 and RVL1 were on par with each other at 3.6 and 2.4 mg/ml concentrations,
respectively. They showed maximum inhibition zone of 2.07 cm (3.6 mg/ml) and 2.35 cm
(2.4 mg/ml) concentrations respectively. Inhibition zones of 1.33 and 1.23 cm produced in
RVL1 and SRL1 at 1.2 and 2.4 mg/ml respectively, followed by 1.00 cm inhibition zone in
RVL1 at 0.6 mg/ml. SRL1 at 0.6 mg/ml showed least inhibition zone (0.85 cm).
Table 13. In vitro evaluation of plant and fungal lectins against R. solanacearum
SRL1 2.07 (1.75)* 1.60 (1.61) 1.23 (1.49) 0.85 (1.36) 1.44 (1.55)
RVL1 2.62 (1.90) 2.35 (1.83) 1.33 (1.53) 1.00 (1.41) 1.83 (1.67)
Control (BL21) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00) 0.00 (1.00)
Control (PBS) 0.00 (1.00)
Control (S.W.) 0.00 (1.00)
OD (absorbance) at 600 nm
Concentration (mg/ml)
Treatment
0.6 1.2 2.4 3.6
48 h 96 h Mean 48 h 96 h Mean 48 h 96 h Mean 48 h 96 h Mean
SRL1 1.000 1.450 1.225 0.896 1.280 1.088 0.800 1.200 1.000 0.730 1.000 0.865
RVL1 1.000 1.291 1.146 0.830 1.130 0.980 0.750 0.803 0.777 0.715 0.983 0.849
Control
1.350 1.650 1.500 1.350 1.650 1.500 1.350 1.650 1.500 1.350 1.650 1.500
(BL21)
Control
1.000 1.590 1.295
(PBS)
Control 1.200 1.590 1.395
1.7
1.5
1.3
OD (Absorbance) at 600 nm
1.1
0.9
0.7
0.5
SRL1 RVL1 BL21
Treatments
hatching and juveniles were not regaining activity after moving them in to water for 2 h
and results of survival of the nematodes as function of time are presented in Table 14-15.
Both SRL1 and RVL1 showed nematicidal activity against root-knot nematode and
the egg hatching inhibition was observed periodically at 12, 24 and 48 h. Inhibition of egg
hatching was noticed after 12 h of incubation, it increased with time and concentration.
Maximum inhibition of 86 and 82 per cent was noticed with 1: 25 dilution after 48 h in
RVL1 and SRL1. Maximum of more than 80% inhibition of egg hatching was seen in 1: 25
dilution after 48 h and the eggs placed in BL21, water and PBS did not show any
inhibition.
These results were the average values of triplicate sets; each containing second
stage 50 juveniles. Lectins showed concentration dependent toxicity on M. incognita. Even
at a dilution of 1: 100, more than 25 per cent mortality was observed after 48 h. Juvenile
mortality was observed periodically at 6, 12, 18, 24, 36 and 48 h. The mortality was found
later than 3 h (at 6 h) and from then on it increased with increase in time and lectin
concentration.
Highest mortality of 92.67 and 82.67 per cent was found at 1: 25 dilution in SRL1
and RVL1 after 48 h incubation demonstrating the potential nematicidal activity
112
Table 14. Effect of SRL1 and RVL1 on inhibition of egg hatching of M. incognita
71.11 68.33 74.00 71.15 74.44 78.33 78.00 76.93 74.44 80.83 84.00 79.76 81.11 83.33 86.00 83.48
RVL1
(57.52) (55.78) (59.37) (57.40) (59.66) (62.29) (62.06) (61.32) (59.66) (64.07) (66.46) (63.30) (64.27) (65.94) (68.06) (66.05)
Contro 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
l
(BL21) (0.00) (0.00) (0.00) (0.00) (0.00) (0.00) (0.00) (0.00) (0.00) (0.00) (0.00) (0.00) (0.00) (0.00) (0.00) (0.00)
S.Em± CD at 1%
90
80
70
% Egg hatching inhibition
60
50
40
30
20
10
0
SRL1 RVL1 BL21 PBS S.W
Treatments
Plate 18. Paecilomyces lilacinus : growth in vitro and spores and sporophores
115
S.Em± CD at 1%
Treatment (T) 0.31 1.02
Dilutions (D) 0.27 0.91
TxD 0.16 0.56
Hour (H) 0.22 0.74
TxH 0.13 0.33
DxH 0.11 0.29
TxDxH 0.06 0.17
60
50
40
Per cent mortality
30
20
10
0
SRL1 RVL1 BL21 PBS S.W
Treatments
of lectins. However, other dilutions (1: 50, 1: 75 and 1: 100) also showed high mortality in
SRL1 (74.67, 53.67 and 34.67%) followed by RVL1 (59.67, 47.67 and 29.67%)
respectively, after 48 h.
Efficacy of six bacterial and five fungal antagonists was screened against F.
oxysporum, S. rolfsii and R. solani by dual culture technique as described in ‘Material and
Methods’. The per cent inhibition over control was worked out based on the fungal growth in
control plate.
4.5.2 .1 F. oxysporum
4.5.2 .2 S. rolfsii
There were significant differences between the fungal bioagents tested with respect
to per cent inhibition of mycelial growth of S. roflsii. T. viride showed the maximum
inhibition of S. rolfsii (52.78%) and it was significantly superior to rest of the bioagents
tested (Table 16, Fig. 6, Plate 19). This was followed by T. harzianum (49.44%), P.
fluorescens strain HM439968 (45.00%), P. fluorescens 50 (43.89%), P. fluorescens TN
(42.78%), T. virens (40.56%), T. koningiii (39.44%), P. fluorescens 30 (38.33%), B. subtilis
HQ162493 (29.44%) and B. subtilis (27.22%). P. lilacinus showed least per cent inhibition
(23.33%).
4.5.2.3 R. solani
There were significant differences among all the tested bioagents. T. koningii
(46.30%) was found to be significantly superior in inhibiting the mycelial growth of R.
solani followed by T. viride (42.96%), T. harzianum (38.52%). Further T. virens and P.
lilacinus (28.52%) were on par with each other. The least inhibition of mycelial growth of
(5.19%) was recorded in all P. fluorescens strains and B. subtilis strains they were on par
with each other (Table 16, Fig. 6, Plate 19).
Different concentrations of SRL1 and RVL1 with bacterial and buffer control were
used against T. viride and P. liacinus in vitro condition by inhibition zone or disc diffusion
method. Inhibition zone produced across the antagonistic microorganisms was recorded
(Table 17, Plate 20). The results indicated that SRL1 resulted in maximum inhibition of the
P. lilacinus with an inhibition zone of 1.90 cm which was found significantly higher than
other treatments followed by RVL1 (1.82 cm) at 4.8 mg/ml. The efficacy of SRL1 and
RVL1 decreased with decrease in concentrations. RVL1 did not show any inhibition at 1.2
mg/ml concentration against P. lilacinus. SRL1 and RVL1 were less and moderately
effective among concentrations against T. viride with slight inhibition zone of 0.47 to 0.65
and 0.50 to 0.98 cm, respectively.
119
60
50
Per cent inhibition
40
30
20
10
0
T. viride T. harzianum T. virens T. koningii P. lilacinus P. fluorescens P. fluorescens P. fluorescens P. fluorescens B. subtilis B. subtilis
30 50 HM439968 TNAU HQ162493
Biocontrol agents
Fig. 6: Evaluation of antagonists' against S. rolfsii, R. solani and F. oxysporum (without lectins)
121
Plate 19. In vitro evaluation of antagonists against S. rolfsii, R. solani and F. oxysporum
(without lectins)
122
Table 17. In vitro evaluation of SRL1 and RVL1 lectin on T. viride and P. lilacinus
Concentration (mg/ml)
Treatment
4.8 3.6 2.4 1.2 Mean
P. lilacinus T. viride P. lilacinus T. viride P. lilacinus T. viride P. lilacinus T. viride P. lilacinus T. viride
SRL1 1.90 0.65 1.37 0.58 1.05 0.50 0.63 0.47 1.24 0.55
RVL1 1.82 0..98 1.43 0.95 0.95 0.85 0.00 0.50 1.05 0.82
Control
0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
(BL21)
Control
0.00 0.00
(PBS)
Control
0.00 0.00
(S.W)
123
Paecilomyces lilacinus
Plate 20. In vitro evaluation of SRL1 and RVL1 on T. viride and P. lilacinus
124
Least per cent inhibition of 4.35 to 11.19 per cent of T. viride spore germination in
SRL1 at 2.4 and 3.6 mg/ml followed by no inhibition of T. viride spore germination at1.2
mg/ml. SRL1 showed no inhibition of P. lilacinus spore germination at 1.2 2.4 and 3.6
mg/ml concentration (Table 18, Fig. 7).
Table 18. Effect of SRL1 and RVL1 on inhibition spore germination of P. lilacinus and T. viride
Concentration (mg/ml)
Treatment
4.8 3.6 2.4 1.2
SRL1+ P. lilacinus 0.00 15.97 9.40 2.23 6.90 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
SRL1+ T. viride 23.33 19.23 13.68 10.00 16.56 15.56 13.85 10.00 7.74 11.79 6.67 3.85 5.26 1.61 4.35 0.00 0.00 0.00 0.00 0.00
RVL1+ P. lilacinus 0.00 43.28 41.28 16.20 25.19 0.00 28.99 19.46 7.82 14.07 0.00 21.01 13.09 2.51 9.15 0.00 5.46 0.00 0.00 1.37
RVL1+ T. viride 66.67 53.85 34.21 19.35 43.52 50.00 30.77 18.42 9.68 27.22 30.00 16.92 8.95 3.87 14.94 15.56 6.92 2.11 0.00 6.15
Control (BL21) + P. lilacinus 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
Control (BL21) + T. viride 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
Control (PBS)+ P. lilacinus 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
Control (PBS)+ T. viride 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
4.5.4.3 Determination of the minimum inhibitory concentration (MIC) and the minimum
bactericidal concentration (MBC)
Antibacterial activity of SRL1 and RVL1 against P. fluorescens strains 30, 50,
HM439968 and TNAU and B. subtilis, B. subtilis strain HQ162493 and the MIC (minimum
inhibitory concentration), MBC (minimum bactericidal concentration) values as described
in “Material and Methods” are presented in Table 21, Plate 22.
No antibacterial activity was noticed in the control set (BL21, PBS and Sterile
distilled water. It was significant to find that the MIC which corresponds to the minimum
lectin concentration capable to inhibit the visible growth of the bacteria ranges from 0.63 to
2.50 and 0.63 to 1.25 mg/ml of SRL1 and RVL1 respectively with 1.94 to 3.14 and 1.78 to
3.08 mg/ml of MBC which corresponds to the minimum concentration of the lectin capable
to reduce the number of cfu for 0.1% of the initial inoculums respectively and MBCs
determined by agar diffusion were higher than the ones obtained by MICs.
128
Table 19. Growth phase studies of Pseudomonas fluorescens and Bacillus subtilis
OD (absorbance) at 600 nm
Hours after inoculation
P. fluorescens B. subtilis
8 0.667 0.110
16 0.857 0.728
24 1.267 0.925
32 1.755 1.065
40 1.841 1.225
48 1.907 1.522
56 1.912 1.715
64 1.942 1.772
72 1.962 1.860
80 1.968 1.963
88 1.967 1.960
96 1.967 1.960
104 1.967 1.960
112 1.967 1.960
120 1.967 1.960
128 1.960 1.960
Mean 1.742 1.540
S.Em ± 0.02 0.03
CD at 1% 0.08 0.12
Table 20. In vitro evaluation of bacterial and fungal bioagents against Ralstonia
solanacearum
Table 21. Antimicrobial activity, MIC, MBC and MAC of SRL1 and RVL1 against bacterial biocontrol agents
P. fluorescens TNAU 1.25 1.25 3.08 2.88 0.15 0.30 1.69 1.72
P. fluorescens HM439968 0.63 0.63 1.94 2.71 0.15 0.30 0.87 1.63
NT- Not determined MIC - Minimum inhibitory concentration MBC - Minimum bactericidal concentration
Plate 21 In vitro evaluation of bacterial and fungal bioagents against Ralstonia solanacearum
(without lectins)
SRL1 and RVL1 showed good activity on P. fluorescens strains (MIC values: 0.63 to
1.25 mg/ml and MBC values: 1.94 to 3.08 and 1.78 to 2.78 mg/ml) followed by B. subtillis
strains (MIC values: 1.25 to 2.25 and 0.63 to 1.25 mg/ml and MBC values: 2.56 to 3.14 and
1.94 to 3.08 mg/ml), respectively.
SRL1 and RVl1 demonstrated broad spectrum activity against all tested bacterial
strains with inhibition zones in the range of 0.87 to 1.79 cm. However, the lectins showed
selective activity against tested bacteria compared to the controls. The most potent lectin was
RVL1 (1.63 to 1.79 cm inhibition zone) followed by SRL1 (0.87 to 1.67 cm). RVL1 showed
maximum inhibition zone of 1.79 cm against P. fluorescens 50, followed by P. fluorescens
TNAU (1.72 cm), B. subtillis HQ162493 (1.72 cm) P. fluorescens 30 (1.69), P. fluorescens
HM439968 (1.63) and B. subtilis (1.63 cm) which remained on par with each other.
Correspondingly, less inhibition zone recorded in SRL1.
4.5.4.6 Plant and fungal lectin activity against P. fluorescens and B. subtilis
Table 22. Effect of SRL1 and RVL1 lectin on P. fluorescens and B. subtilis strains
3.6 2.4 1.2 0.6 Mean 3.6 2.4 1.2 0.6 Mean 3.6 2.4 1.2 0.6 Mean (PBS) (S.W)
2.37 2.00 1.83 0.00 1.55 2.47 2.30 2.03 1.10 1.98 0.00 0.00 0.00 0.00 0.00 0.00 0.00
P. fluorescens 30 (1.83)* (1.73) (1.68) (1.00) (1.56) (1.86) (1.82) (1.74) (1.45) (1.72) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00)
2.22 2.05 1.38 0.60 1.56 2.42 2.35 1.98 1.30 2.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00
P. fluorescens 50 (1.79) (1.75) (1.54) (1.26) (1.59) (1.85) (1.83) (1.73) (1.52) (1.73) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00)
2.17 2.10 2.08 1.10 1.86 2.57 2.20 2.03 0.70 1.88 0.00 0.00 0.00 0.00 0.00 0.00 0.00
P. fluorescens TNAU (1.78) (1.76) (1.76) (1.45) (1.69) (1.89) (1.79) (1.74) (1.30) (1.68) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00)
2.12 1.75 1.18 0.60 1.41 1.82 1.80 1.23 0.00 1.21 0.00 0.00 0.00 0.00 0.00 0.00 0.00
P. fluorescens HM439968 (1.77) (1.66) (1.48) (1.26) (1.54) (1.68) (1.67) (1.49) (1.00) (1.46) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00)
1.92 1.90 1.23 0.75 1.45 2.52 2.25 1.68 0.95 1.85 0.00 0.00 0.00 0.00 0.00 0.00 0.00
B. subtilis (1.71) (1.70) (1.49) (1.32) (1.56) (1.88) (1.80) (1.64) (1.40) (1.68) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00)
2.17 1.92 1.68 0.90 1.67 2.33 2.03 1.48 1.00 1.71 0.00 0.00 0.00 0.00 0.00 0.00 0.00
B. subtilis HQ162493 (1.78) (1.71) (1.64) (1.38) (1.63) (1.82) (1.74) (1.58) (1.41) (1.64) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00) (1.00)
Similar results were found for B. subtilis (Table 23b). Maximum OD values were
recorded in 0.6 mg/ml concentration of SRL1 and RVL1 (1.635 and 1.452 OD) respectively.
Further, 1.329 and 1.169, 1.236 and 1.082 and 1.160 and 0.943 OD values were recorded in
SRL1 and RVL1 at 1.2, 2.4 and 3.6 mg/ml concentrations respectively.
Further, growth of the bacteria measured in terms of colony forming units (Table 23c).
Compared to control, SRL1 and RVL1 lectins reduced the colonies of P. fluorescens and B.
subtilis as concentration of the lectins increased the number of colony forming units (CFU)
reduced from 23 to 11x106 and 17 to 4 and 22 to 7 and 20 to 3x106 respectively.
Table 23. Activity of SRL1 and RVL1 lectin on P. flourescens and B. subtilis
OD (absorbance) @ 600 nm
Concentration (mg/ml)
Treatment
0.6 1.2 2.4 3.6
48 h 96 h Mean 48 h 96 h Mean 48 h 96 h Mean 48 h 96 h Mean
SRL1 1.360 1.815 1.587 1.263 1.644 1.454 1.163 1.561 1.362 1.091 1.363 1.227
RVL1 1.265 1.553 1.409 1.094 1.395 1.245 1.014 1.204 1.109 0.971 1.064 1.018
Control (BL21) 1.712 1.855 1.785 1.716 1.870 1.791 1.870 1.866 1.869 1.712 1.915 1.813
Control (PBS) 1.505 1.953 1.729
Control 1.564 1.952 1.758
OD (absorbance) @ 600 nm
Concentration (mg/ml)
Treatment
0.6 1.2 2.4 3.6
48 h 96 h Mean 48 h 96 h Mean 48 h 96 h Mean 48 h 96 h Mean
SRL1 1.410 1.860 1.635 1.306 1.356 1.329 1.178 1.295 1.236 1.160 1.160 1.160
RVL1 1.306 1.597 1.452 1.136 1.186 1.161 1.056 1.109 1.082 0.933 0.954 0.943
Control (BL21) 1.760 1.805 1.785 1.760 1.832 1.796 1.760 1.842 1.801 1.795 1.946 1.870
Control (PBS) 1.550 1.923 1.736
Control 1.590 1.923 1.756
138
6
Colony forming units (10 /ml)
Concentration (mg/ml)
Treatment
0.6 1.2 2.4 3.6
SRL1 23 22 20 17 16 12 11 7
RVL1 17 20 12 15 9 11 4 3
Control
25 23 27 29 28 31 32 36
(BL21)
Control (PBS) 32 35
Control 33 36
139
Table 24. Influence of bacterial and fungal antagonists’ in combination with lectins on R. solanacearum
Plate 24 Influence of bacterial and fungal antagonists in combination with SRL1 And RVL1 on R. solanacearum
142
4.5.5 In vitro screening of bacterial and fungal antagonists against nematode with lectins
The culture filtrates of P. fluorescens and B. subtilis strains at highest 100, 75, 50 and
25 per cent significantly inhibited the hatching of eggs. The decrease in egg hatching was
recorded with the P. fluorescens strains 30, 50, HM439968 and TN in treatment
concentration interaction (71.69, 69.07, 63.76 and 61.24 per cent), respectively. Whereas,
B. subtillis strains HQ162493 and B. subtilis inhibited per cent egg hatching, to the tune of
50.80 and 45.57 respectively.
Maximum inhibition of egg hatching of 94.17, 84.17, 80.17 and 78.17 per cent was
recorded in SRL1 when combined with P. fluorescens 30, 50, HM439968, and TNAU
followed by B. subtilis HQ162493 and B. subtilis (70.17 and 66.17 per cent) at cent per cent
concentration after 48 h. In case of RVL1 comibined with P. fluorescens and B. subtilis
strains culture filtrtates, cent per cent egg hatching inhibition was recorded in P. fluorescens
30 at cent per cent concentration followed by P. fluorescens 50 (96.56%), P. fluorescens
HM439968 (90.17%) and P. fluorescens TNAU (88.17%) respectively. Further, 80.17 and
76.17 per cent inhibition was recorded in B. subtilis HQ162493 and B. subtilis at cent
percent concentration. There was no inhibition in bacterial control (BL21) alone with respect
to egg hatching but in combination with
143
Table 25. Effect of bacterial antagonists’ culture filtrates with lectins on eggs hatching of M. incognita
% Egg hatching inhibition
Bacterial concentration
Treatment 100% 75% 50% 25%
12 h 24 h 48 h Mean 12 h 24 h 48 h Mean 12 h 24 h 48 h Mean 12 h 24 h 48 h Mean
33.22 47.33 56.17 45.57 30.17 44.83 53.67 42.89 19.83 37.33 48.33 35.17 16.44 35.33 46.00 32.59
B. subtilis
(35.22)* (43.49) (48.57) (42.48) (33.33) (42.06) (47.13) (40.93) (26.46) (37.68) (44.07) (36.39) (23.93) (36.49) (42.73) (34.83)
B. subtilis 39.89 52.33 60.17 50.80 43.50 54.83 61.67 53.33 33.17 47.33 56.33 45.61 29.78 45.33 53.83 42.98
HQ162493 (39.19) (46.36) (50.89) (45.48) (41.29) (47.80) (51.77) (46.94) (35.18) (43.49) (48.66) (42.50) (33.09) (42.34) (47.22) (40.99)
66.56 72.33 76.17 71.69 63.50 69.83 73.67 69.00 49.83 59.67 66.33 58.61 36.44 50.33 58.33 48.37
P. fluorescens 30
(54.70) (58.29) (60.81) (57.88) (52.86) (56.71) (59.16) (56.20) (44.93) (50.60) (54.56) (49.98) (37.15) (45.21) (49.82) (44.09)
63.22 69.83 74.17 69.07 56.83 64.83 69.67 63.78 46.50 57.33 64.33 56.06 36.44 50.33 57.67 48.15
P. fluorescens 50
(52.69) (56.71) (9.48) (56.24) (48.95) (53.66) (56.61) (53.02) (43.01) (49.24) (53.36) (48.50) (37.15) (45.21) (49.44) (43.96)
P. fluorescens 53.22 62.33 68.17 61.24 43.50 54.83 61.67 53.33 29.83 44.83 54.33 43.00 23.11 40.33 50.00 37.81
TNAU (46.87) (2.17) (55.68) (51.52) (41.29) (47.80) (51.77) (46.94) (33.12) (42.06) (47.51) (41.00) (28.75) (39.45) 45.02) (37.97)
P. fluorescens 56.44 64.67 70.17 63.76 53.50 62.33 67.67 61.17 43.17 54.67 62.33 53.39 33.11 47.83 56.33 45.76
HM439968 (48.73) (53.56) (56.92) (53.01) (47.03) (52.17) (55.37) (51.48) (41.09) (47.70) (52.17) (46.97) (35.15) (43.78) (48.6) (42.59)
49.89 59.83 66.17 58.63 46.83 57.50 63.67 56.00 36.50 49.67 58.33 48.17 33.11 47.67 55.67 45.48
SRL1+ B. subtilis
(44.96) (50.70) (54.46) (49.99) (43.21) (49.34) (52.96) (48.47) (37.19) (44.83) (49.82) (43.97) (35.15) (43.68) (48.28) (42.43)
SRL1+ B. subtilis 56.56 64.83 70.17 63.85 60.17 67.33 71.67 66.39 49.83 59.67 66.33 58.61 46.44 57.67 63.67 55.93
PDBC (48.79) (53.66) (56.92) (53.07) (0.89) (55.17) (57.87) (54.59) (44.93) (50.60) (54.56) (49.98) (42.98) (49.44) (52.96) (48.43)
SRL1+ P. 90.33 92.33 94.17 92.28 86.84 89.83 91.67 89.45 66.50 72.33 76.33 71.72 53.06 62.83 68.00 61.30
fluorescens 30 (71.92) (73.96) (76.06) (73.90) (68.76) (71.44) (73.26) (71.08) (54.66) (58.29) (60.92) (57.90) (46.78) (52.46) (55.58) (51.55)
SRL1+ P. 79.67 82.33 84.17 82.06 73.50 77.3 3 79.67 76.83 63.17 69.67 74.33 69.06 53.11 62.33 67.67 61.04
fluorescens 50 (63.23) (65.18) (66.59) (64.97) (59.05) (61.60) (63.23) (61.26) (52.66) (56.61) (59.59) (56.23) (46.81) (52.17) (55.37) (51.40)
SRL1+ P. 69.89 74.83 78.17 74.30 60.17 67.33 71.67 66.39 46.50 57.33 64.33 56.06 39.67 52.67 59.67 50.67
fluorescens TNAU (56.75) (59.92) (62.17) (59.57) (50.89) (55.17) (57.87) (54.59) (43.01) (49.24) (53.36) (48.50) (39.06) (46.55) (50.60) (45.41)
SRL1+ P.
73.22 77.33 80.17 76.91 70.17 74.83 77.67 74.22 59.83 67.33 72.33 66.50 49.67 60.27 66.33 58.76
fluorescens
(58.87) (61.60) (63.59) (61.31) (56.92) (59.92) (61.83) (59.52) (50.70) (55.17) (58.29) (54.66) (44.83) (50.95) (54.56) (50.07)
HM439968
Contd…
144
66.56 72.33 76.17 71.69 63.50 69.83 73.67 69.00 53.17 62.33 68.33 61.28 49.67 60.00 65.67 58.44
RVL1+ B. subtilis
(54.70) (58.29) (60.81) (57.88) (52.86) (56.71) (59.16) (56.20) (46.84) (52.17) (55.78) (51.54) (44.83) (50.79) (54.16) (49.89)
RVL1+ B. subtilis 73.22 77.33 80.17 76.91 76.83 79.83 81.67 79.44 66.50 72.33 76.33 71.72 63.11 70.33 73.67 69.04
HQ162493 (58.87) (61.60) (63.59) (61.31) (61.26) (63.35) (64.68) (63.07) (54.66) (58.29) (60.92) (57.90) (52.63) (57.03) (59.16) (56.22)
100.00 100.00 100.00 100.00 99.67 99.83 100.00 99.83 83.17 84.67 86.33 84.72 69.78 75.17 78.33 74.43
RVL1+ P. fluorescens 30
(90.05) (90.05) (90.05) (90.05) (86.73) (87.70) (90.05) (87.70) (65.81) (66.98) (68.34) (67.03) (56.68) (60.14) (62.29) (59.65)
94.17 94.83 96.56 95.19 90.17 89.83 89.67 89.89 79.83 82.33 84.33 82.17 69.67 75.33 78.00 74.33
RVL1+ P. fluorescens 50
(76.06) (76.90) (79.35) (77.36) (71.76) (71.44) (71.29) (71.50) (63.35) (65.18) (66.72) (65.05) (56.61) (60.25) (62.06) (59.59)
RVL1+ P.fluorescens 86.44 87.33 88.17 87.31 76.83 79.83 81.67 79.44 63.17 69.67 74.33 69.06 56.44 65.17 70.33 63.98
TNAU (68.43) (69.19) (69.91) (69.17) (61.26) (63.35) (64.68) (63.07) (52.66) (56.61) (59.59) (56.23) (48.73) (53.86) (57.03) (53.15)
RVL1+ P. fluorescens 89.67 89.83 90.17 89.89 86.83 87.33 87.67 87.28 76.50 79.67 82.33 79.50 66.44 72.33 76.33 71.70
HM439968 (71.29) (71.44) (71.76) (71.50) (68.76) (69.19) (69.48) (69.14) (61.03) (63.23) (65.18) (63.11) (54.63) (58.29) (60.92) (57.89)
39.89 52.33 60.17 50.80 36.83 49.83 57.67 48.11 26.50 42.33 52.33 40.39 23.06 40.33 49.83 37.74
BL21+ B. subtilis
(39.19) (46.36) (50.89) (45.48) (37.38) (44.93) (49.44) (43.94) (31.00) (40.61) (46.36) (39.48) (28.71) (39.45) (44.93) (37.92)
BL21+B. subtilis 46.56 57.33 64.17 56.02 50.17 59.83 65.67 58.56 39.83 52.33 60.33 50.83 36.44 50.30 57.67 48.14
HQ162493 (43.05) (49.24) (53.26) (48.48) (45.12) (50.70) (54.16) (49.95) (39.15) (46.36) (50.99) (45.50) (37.15) (45.19) (49.44) (43.95)
73.22 79.83 84.17 79.07 70.17 74.83 77.67 74.22 56.50 64.67 70.33 63.83 43.22 55.17 62.33 53.57
BL21+ P. fluorescens 30
(58.87) (63.35) (66.59) (62.81) (56.92) (59.92) (61.83) (59.52) (48.76) (53.56) (57.03) (53.06) (41.13) (47.99) (52.17) (47.07)
70.33 74.83 78.17 74.44 63.50 69.83 73.67 69.00 53.17 62.33 68.33 61.28 43.11 55.33 62.00 53.48
BL21+ P. fluorescens 50
(57.03) (59.92) (62.17) (59.66) (52.86) (56.71) (59.16) (56.20) (46.84) (52.17) (55.78) (51.54) (41.06) (48.09) (51.69) (47.02)
BL21+ P. fluorescens 59.67 67.33 72.17 66.39 50.17 59.83 65.67 58.56 36.50 49.67 58.33 48.17 29.67 45.17 54.33 43.06
TNAU (50.60) (55.17) (58.19) (54.59) (45.12) (50.70) (54.16) (49.95) (37.19) (44.83) (49.82) (43.97) (33.02) (42.25) (47.51) (41.03)
BL21+ P. fluorescens 63.22 69.83 74.17 69.07 60.17 67.33 71.67 66.39 49.83 59.67 66.33 58.61 39.83 52.67 60.33 50.94
HM439968 (52.69) (56.71) (59.48) (56.24) (50.89) (55.17) (57.87) (54.59) (44.93) (50.60) (54.56) (49.98) (39.15) (46.55) (50.99) (45.56)
0.00 0.00 0.00 0.00
Control (PBS)
(0.00) (0.00) (0.00) (0.00)
0.00 0.00 0.00 0.00
Control (S.W)
(0.00) (0.00) (0.00) (0.00)
S.Em± CD at 1%
Treatment (T) 0.40 1.04
Concentration (C ) 0.99 2.45
TxC 0.20 0.72
Hour (H) 1.14 2.95
TxH 0.23 0.79
CxH 0.57 1.96
TxCxH 0.12 0.30
145
culture filtrates of antagonist, egg hatching inhibition ranged from 60.17 to 84.17 per cent at
cent per cent concentration after 48 h.
Cell-free culture filtrates of four P. fluorescens strains and two B. subtilis strains and
also in combination with SRL1, RVL1 and BL21 (bacterial control) were tested in vitro for
their nematicidal action on M. incognita (Table 26). Data indicated that combination of
lectins to various concentrations of P. fluorescens, and B. subtilis strains culture filtrates
were highly deleterious to the nematode. In general, juvenile mortality increased with
increase in exposure period and increase in concentration of antagonoists strains. No
nematode mortality was recorded in control (BL21, Buffer and distilled water). Cent per cent
nematode mortality was observed in 100 per cent concentration of all the strains which are
combined with SRL1 and RVL1. The lowest juvenile mortality was recorded in SRL1 with B.
subtillis (40.33 %) at 25 per cent concentration.
Interaction between concentration and time at 100 per cent concentration with 12, 24
and 48 h exposure time recorded the 100 per cent mortality of juveniles in RVL 1 with P.
fluorescens 30 followed by 24 and 48 h exposure time in SRL and RVL1 combinations with
P. fluorescens strains 30, 50, TNAU and HM439968 and B. subtilis HQ162493. The lowest
mortality of 39.67 per cent was observed in 25 per cent concentration with 12 and 24 h
exposure period in SRL1 with B. subtillis.
A maximum nematode mortality (60% and above) were observed in 100 per cent
concentration of strains P. fluorescens 30, 50, HM439968, TNAU, B. subtilis HQ162493,
and B. subtilis without any lectins. The lowest juvenile mortality was recorded in B. subtilis
HQ162493 (9.67%) at 25 per cent concentration and B. subtilis showed no inhibition at 25
per cent concentration.
146
Table 26. Effect of bacterial antagonists’ culture filtrates with lectins on juvenile mortality of M. incognita
Per cent mortality
Bacterial concentration
Treatment 100% 75% 50% 25%
12 h 24 h 48 h Mean 12 h 24 h 48 h Mean 12 h 24 h 48 h Mean 12 h 24 h 48 h Mean
15.67 50.33 60.00 42.00 10.17 36.17 39.80 28.71 0.00 5.67 5.67 3.78 0.00 0.00 0.00 0.00
B. subtilis
(23.33)* (45.21) (50.79) (40.42) (18.60) (36.99) (39.13) (32.42) (0.00) (13.78) (13.78) (11.21) (0.00) (0.00) (0.00) (0.00)
B. subtilis 21.67 59.67 70.00 50.44 14.17 46.17 49.80 36.71 5.67 15.67 16.33 12.56 0.00 8.00 9.67 5.89
HQ162493 (27.76) (50.60) (56.82) (45.28) (22.12) (42.82) (44.91) (37.31) (13.78) (23.33) (23.85) (20.76) (0.00) (16.44) (18.12) (14.05)
50.33 80.17 86.00 72.17 36.17 70.17 83.80 63.38 27.67 49.67 63.67 47.00 14.33 35.67 44.33 31.44
P .fluorescens 30
(45.21) (63.59) (68.06) (58.19) (36.99) (56.92) (66.30) (52.79) (31.75) (44.83) (52.96) (43.30) (22.26) (36.69) (41.77) (34.13)
42.17 65.67 66.00 57.94 26.17 16.17 25.80 22.71 11.67 20.33 19.67 17.22 0.00 6.33 10.33 5.56
P. fluorescens 50
(40.51) (54.16) (54.36) (49.60) (30.78) (23.72) (30.54) (28.48) (19.98) (26.82) (26.34) (24.53) (0.00) (14.58) (18.76) (13.64)
P. fluorescens 39.67 65.83 76.00 60.50 20.17 52.17 55.80 42.71 13.67 21.67 22.33 19.22 6.33 14.33 16.33 12.33
TNAU (39.06) (54.26) (60.70) (51.09) (26.70) (46.27) (48.36) (40.83) (21.71) (27.76) (28.22) (26.02) (14.58) (22.26) (23.85) (20.57)
P. fluorescens 44.17 70.33 80.00 64.83 28.17 60.17 69.80 52.71 24.33 35.67 45.67 35.22 18.33 28.33 30.33 25.67
HM439968 (41.67) (57.03) (63.47) (53.66) (32.07) (50.89) (56.69) (46.58) (29.57) (36.69) (42.54) (36.42) (25.36) (32.18) (33.44) (30.45)
55.67 90.00 100.00 81.89 50.17 76.17 79.80 68.71 43.67 49.67 50.33 47.89 39.67 39.67 40.33 39.89
SRL1+ B. subtilis
(48.28) (71.60) (90.05) (64.85) (45.12) (60.81) (63.32) (56.02) (41.38) (44.83) (45.21) (43.81) (39.06) (39.06) (39.45) (39.19)
SRL1+ B. subtilis 61.67 95.67 100.00 85.78 54.17 86.17 89.80 76.71 50.33 59.83 60.33 56.83 40.33 47.67 49.67 45.89
HM439968 (51.77) (78.02) (90.05) (67.88) (47.41) (68.20) (71.41) (61.18) (45.21) (50.70) (50.99) (48.95) (39.45) (43.68) (44.83) (42.66)
SRL1+ P. 89.67 100.00 100.00 96.56 76.17 100.00 100.00 92.06 72.33 90.33 95.67 86.11 54.33 76.33 84.33 71.67
fluorescens 30 (71.29) (90.05) (90.05) (79.34) (60.81) (90.05) (90.05) (73.67) (58.29) (71.92) (78.02) (68.15) (47.51) (60.92) (66.72) (57.87)
SRL1+ P. 81.67 100.00 100.00 93.89 66.17 76.17 85.80 76.04 55.67 64.07 64.33 61.36 40.33 45.67 50.33 45.44
fluorescens 50 (64.68) (90.05) (90.05) (75.73) (54.46) (60.81) (67.90) (60.73) (48.28) (53.20) (53.36) (51.59) (39.45) (42.54) (45.21) (42.41)
SRL1+ P. 79.67 100.00 100.00 93.22 60.17 92.17 95.80 82.71 58.33 66.00 66.33 63.56 46.33 54.33 56.33 52.33
fluorescens TNAU (63.23) (90.05) (90.05) (74.95) (50.89) (73.78) (78.21) ) (65.46) (49.82) (54.36) (54.56) (52.89) (42.92) (47.51) (48.6) (46.36)
SRL1+ P.
83.67 100.00 100.00 94.56 68.17 100.00 99.80 89.32 65.00 80.17 90.33 78.50 58.33 68.00 70.33 65.56
fluorescens
(66.20) (90.05) (90.05) (76.55) (55.68) (90.05) (87.48) (70.96) (53.76) (63.59) (71.92) (62.41) (49.82) (55.58) (57.03) (54.09)
HM439968
61.67 100.00 100.00 87.22 56.17 82.17 85.80 74.71 50.33 55.67 56.33 54.11 45.67 45.67 46.33 45.89
RVL1+ B. subtilis
(51.77) (90.05) (90.05) (69.09) (48.57) (65.05) (67.90) (59.84) (45.21) (48.28) (48.66) (47.38) (42.54) (42.54) (42.92) (42.66)
Contd…
147
RVL1+ B. subtilis 67.67 100.00 100.00 89.22 60.17 92.17 95.80 82.71 56.33 65.67 66.33 62.78 46.33 54.33 55.67 52.11
HQ162493 (55.37) (90.05) (90.05) (70.87) (50.89) (73.78) (78.21) (65.46) (48.66) (54.16) (54.56) (52.43) (42.92) (47.51) (48.28) (46.23)
RVL1+ P. fluorescens 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 78.33 96.17 100.00 91.50 60.33 82.33 90.33 77.6761.
30 (90.05) (90.05) (90.05) (90.05) (90.05) (90.05) (90.05) (90.05) (62.29) (78.75) (90.05) (73.09) (50.99) (65.18) (71.92) 83)
RVL1+ P. fluorescens 87.67 100.00 100.00 95.89 72.17 82.17 91.80 82.04 62.33 70.00 70.07 67.47 46.33 52.33 56.33 51.67
50 (69.48) (90.05) (90.05) (78.34) (58.19) (65.05) (73.40) (64.96) (52.17) (56.82) (56.86) (55.25) (42.92) (46.36) (48.66) (45.98)
RVL1+ P. fluorescens 85.67 100.00 100.00 95.22 66.17 98.17 100.00 88.11 63.67 71.93 72.00 69.20 52.33 60.33 62.33 58.33
TNAU (67.79) (90.05) (90.05) (77.41) (54.46) (82.26) (90.05) (69.87) (52.96) (58.04) (58.08) (56.32) (46.36) (62.33) (52.17) (49.82)
RVL1+ P. fluorescens 89.67 100.00 100.00 96.56 74.17 100.00 100.00 91.39 73.67 86.30 96.00 85.32 64.33 74.33 76.33 71.67
HM439968 (71.29) (90.05) (90.05) (79.34) (59.48) (90.05) (90.05) (72.97) (59.16) (68.31) (78.50) (67.51) (53.36) (59.59) (60.92) (57.87)
21.67 55.67 66.00 47.78 16.17 42.17 45.80 34.71 5.67 11.83 12.33 9.94 5.67 5.67 6.33 5.89
BL21+ B. subtilis
(27.76) (48.28) (54.36) (43.75) (23.72) (40.51) (42.61) (36.12) (13.78) (20.13) (20.57) (18.39) (13.78) (13.78) (14.58) (14.05)
BL21+B. subtilis 27.67 65.67 76.00 56.44 20.17 52.17 55.80 42.71 11.67 22.30 22.33 18.77 6.33 14.33 15.33 12.00
HQ162493 (31.75) (54.16) (60.70) (48.73) (26.70) (46.27) (48.36) (40.83) (19.98) (28.19) (28.22) (25.68) (14.58) (22.26) (23.06) (20.28)
BL21+ P.fluorescens 55.67 85.67 92.00 77.78 42.17 76.17 89.80 69.38 33.67 55.97 70.33 53.32 20.33 42.33 50.33 37.67
30 (48.28) (67.79) (73.61) (61.91) (40.51) (60.81) (71.41) (56.43) (35.48) (48.45) (70.33) (46.93) (26.82) (40.61) (45.21) (37.88)
BL21+ P.fluorescens 47.67 72.00 72.17 63.94 32.17 22.17 31.80 28.71 17.67 26.27 26.33 23.42 6.33 12.33 16.33 11.67
50 (43.68) (58.08) (58.19) (53.12) (34.57) (28.10) (34.34) (32.42) (24.87) (30.85) (30.89) (28.96) (14.58) (20.57) (23.85) (19.98)
BL21+ P. fluorescens 45.67 71.67 82.00 66.44 26.17 58.17 61.80 48.71 19.67 28.33 28.33 25.44 12.33 20.33 21.67 18.11
TNAU (42.54) (57.87) (64.93) (54.63) (30.78) (49.73) (51.85) (44.28) (26.34) (32.18) (32.18) (30.31) (20.57) (26.82) (27.76) (25.20)
BL21+ P. fluorescens 49.67 75.67 86.00 70.44 34.17 66.17 75.80 58.71 29.67( 41.83(4 52.33 41.28 24.33 34.33 35.67 31.44
HM439968 (44.83) (60.47) (68.06) (57.10) (35.79) (54.46) (60.56) (50.04) 33.02) 0.32) (46.36) (40.00) (29.57) (35.89) (36.69) (34.13)
0.00 0.00 0.00 0.00
Control (PBS)
(0.00) (0.00) (0.00) (0.00)
0.00 0.00 0.00 0.00
Control (S.W)
(0.00) (0.00) (0.00) (0.00)
*Figures in the parenthesis are square root (√X+1) transformed values
S.Em± CD at 1%
Treatment (T) 0.27 0.91
Concentraion (C ) 0.66 2.09
TxC 0.13 0.37
Hour (H) 0.76 2.24
TxH 0.15 0.40
CxH 0.38 1.08
T x C xH 0.08 0.20
148
The immobile/inactive nematodes were randomly picked and placed in sterile water.
None of the juveniles regained their activity, indicating that the nematicidal action of the
SRL1, RVL1 and P. fluorescens and B. subtilis strains was long lasting.
In order to determine the growth inhibitory role of E. coli expressed RVL1 and SRL1
and also eggs and juvenile parasites of T. viride and P. lilacinus on the juveniles and eggs of
Meloidogyne incognita, an in vitro bioassay was conducted using different concentrations
(4.8, 3.6, 2.4 and 1.2 mg/ml) of lectins with 1 x 105 spores/ml spores suspension of T. viride
and P. lilacinus with BL21 (bacterial control), buffer and sterile water control.
Both the lectins (SRL1 and RVL1) showed varying degrees in colonizing eggs and
juveniles with P. lilacinus and T. viride spores as observed periodically at 12, 24 and 48 h.
Maximum per cent inhibition of egg hatching of 93.00 and 89.33 per cent was
recorded in P. lilacinus with SRL1 followed by SRL1 and RVL1 alone (89.00 and 85.33%) at
4.8 mg/ml concentration after 48 h (Table 27, Fig. 11, Plate 25). Further, with T. viride with
SRL1 and RVL1, 77.33 and 71.00 per cent egg hatching inhibition was recorded at 4.8
mg/ml.
There was no egg hatching inhibition in bacterial control (BL21) alone, PBS and
sterile water control but in combination with BL21 and P. lilacinus and T. viride were
recorded 69.33 and 57.33 per cent inhibition. Similar results were obtained in P. lilacinus
and T. viride-alone treatments.
Mortality was found later than 6 h and from then on it increased with increase in time
and lectins and concentration in all combinations (Table 28, Fig. 12). Maximum mortality
observed was 92.33 and 88.33 per cent with in SRL1 and RVL1-alone,
149
Table 27. Effect of lectins and fungal antagonists’ on inhibition of egg hatching of M. incognita
Concentration (mg/ml)
Treatment
4.8 3.6 2.4 1.2
SRL1 + P. lilacinus 88.89 91.67 93.00 91.18 82.22 84.17 85.33 83.91 65.56 71.67 75.33 70.85 48.89 59.17 65.33 57.80
RVL1 + P. lilacinus 88.89 89.17 89.33 89.13 75.56 79.17 81.33 78.69 55.56 64.17 69.33 63.02 38.89 51.67 59.33 49.96
SRL1 + T. viride 68.89 74.17 77.33 73.46 58.89 66.67 71.33 65.63 38.89 51.67 59.33 49.96 15.56 34.17 45.33 31.69
RVL1 + T. viride 58.89 66.67 71.00 65.52 48.89 59.17 65.33 57.80 25.56 41.67 51.33 39.52 12.22 24.17 37.33 21.24
Control (BL21) + P. lilacinus 55.56 64.17 69.33 63.02 55.56 64.17 69.33 63.02 55.56 64.17 69.33 63.02 55.56 64.17 69.33 63.02
Control (BL21) + T. viride 35.56 49.17 57.33 47.35 35.56 49.17 57.33 47.35 35.56 49.17 57.33 47.35 35.56 49.17 57.33 47.35
SRL1 85.56 86.67 89.00 87.07 75.56 79.17 81.33 78.69 45.56 56.67 63.33 55.19 32.22 46.67 55.33 44.74
RVL1 82.22 84.17 85.33 83.91 68.89 74.17 77.33 73.46 35.56 49.17 57.33 47.35 15.56 36.67 45.33 32.52
Control (BL21) 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
Plate 25 Swollen invaded egg bearing a conidiophore and chains of conidia (400 X)
152
Table 28. Effect of lectins and fungal antagonists on juvenile mortality of M. incognita
Concentration (mg/ml)
Treatment
4.8 3.6 2.4 1.2
SRL1 + P. lilacinus 72.22 79.17 83.33 78.24 65.56 71.67 75.33 70.85 48.89 59.17 65.33 57.80 32.22 46.67 55.33 44.74
RVL1 + P. lilacinus 72.22 76.67 79.33 76.07 58.89 66.67 71.33 65.63 38.89 51.67 59.33 49.96 22.22 39.17 49.33 36.91
SRL1 + T. viride 48.89 59.17 65.33 57.80 35.56 49.17 57.33 47.35 25.56 41.67 51.33 39.52 18.89 36.67 47.33 34.30
RVL1 + T. viride 62.22 69.17 73.33 68.24 48.89 59.17 65.33 57.80 35.56 49.17 57.33 47.35 32.22 46.67 55.33 44.74
Control (BL21) + P. lilacinus 38.89 51.67 69.00 53.19 38.89 51.67 69.00 53.19 38.89 51.67 69.00 53.19 38.89 51.67 69.00 53.19
Control (BL21) + T. viride 18.89 36.67 47.33 34.30 18.89 36.67 47.33 34.30 18.89 36.67 47.33 34.30 18.89 36.67 47.33 34.30
SRL1 82.56 88.67 92.33 87.85 68.89 74.17 79.33 74.13 28.89 44.17 53.33 42.13 15.56 34.17 45.33 31.69
RVL1 77.89 83.17 88.33 83.13 65.56 71.67 75.33 70.85 18.89 36.67 47.33 34.30 0.00 24.17 35.33 19.83
Control (BL21) 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
4.6 Evaluation srl1 and rvl1 transgenics and non-transgenics for the suppression of tomato
soil-borne pathogens
Eight srl1 and rvl1 transgenic events grown in controlled condition were used.
Further, for confirmation PCR was employed for srl1 and rvl1 transgenic events. All srl1 and
rvl1 transgenic events showed 410 and 412 bp amplicons (Palte 26).
The protein content in the crude extract from leaves of non-transformed control
tomato plant was 5.4 mg/10 ml. The protein content in SRL1 transgenic lines varied from
5.00 to 7.0 mg/10 ml. Similarly, RVL1 transgenic lines contained 4.50 to 7.00 mg/10 ml
protein (Table 29).
4.6.1.1b SDS-PAGE
Crude proteins of srl1 and rvl1-transgenic tomato were run on SDS-PAGE. Both
these samples showed 16 and 26.2 kDa bands, whereas the control plants failed to show
155
Table 29. Heamagglutination activity of srl1 and rvl1 expressed transgenic events
Protein concentration
Transgenic lines MCA (µg) Total activity (unit) Specific activity (unit/mg)
(mg/10 ml)
Non-transformed 5.40 0 0 0
3 2
RVL1-T0(50)-T1(3)-T2(6) 5.00 27.50 0.80×10 0.36×10
the band. However, SDS-PAGE with crude and partially purified protein from srl1-transgenic
plant did not reveal the expected band of 16 kDa (Plate 28 and 28a).
4.6.1.2 Haemagglutination activity for srl1 and rvl1 expressed in transgenic tomato
Crude protein extracts of eight rvl1 and srl1-transgenic tomato plants showed
haemagglutination with rabbit erythrocytes indicating the expression of rvl1 and srl1.
Whereas control plants did not show any activity, minimum concentration of protein required
for agglutination (MCA) varied from 15 to 55.0 µg and 12.5 to 55.0 µg rvl1 and srl1
transgenic lines respectively. The crude extract of protein obtained from rvl1 and srl1
transgenic tomato plants contained a total lectin activity of 0.40 to 1.60 x 103, whereas srl1-
transgenic plant contained 0.40 to 1.61 x 103. The specific activity was 0.18 to 0.40 x 102
units for rvl1 and 0.18 to 0.76 x 102 units for srl1 (Table 29, Plate 27).
4.6.2 Evaluation of rvl1 and srl1 transgenic and non transgenic tomato lines against
individual and combination of vascular pathogens of tomato under glasshouse conditions
The perusal of data (Table 30-g, Plate 29) indicated that disease appeared only in
those treatments where F. oxysporum, R. solanacearum were inoculated either singly or in
combinations with root- knot nematode.
157
Plate 27 Haemagglutination assay with rvl1 and srl1 expressed in transgenic tomato
lines
158
Significant differences in plant height were observed among the treatments and
transgenic lines. Highest reduction of plant height of 76.20 and 63.83 cm was observed
in treatments transgenic SRL1-T0(116) and RVL1-T0(20) which were inoculated with
Meloidogyne + Fusarium+ Ralstonia. This was followed by Meloidogyne + Fusarium,
Ralstonia alone, Meloidogyne + Ralstonia, and Fusarium-alone in the same events.
Correspondingly highest plant height of 140.25 and 124.33 cm recorded in transgenic
events of SRL1-T0(21) and RVL1-T0(28) inoculated with Meloidogyne-alone.
There was a significant reduction in fresh (fresh shoot root weight) and dry (dry
shoot and root weight) biomass in inoculated plants compared to uninoculted control in
general. The highest percentage reduction in fresh (23.20 and 18.73 g) and dry (16.87
and 8.42 g) biomass was observed with the treatment which had all the three pathogens
inoculated to transgenic lines of SRL1-T0(116) (94.06 and 29.70 g) and RVL1-T0(20)
(85.10 and 27.57 g), respectively.
Maximum disease severity of 50.07, 40.31, 36.60, 32.80, 30.22, 27.75 and
21.58 per cent were observed in SRL1-T0(116) (Meloidogyne + Fusarium+ Ralstonia),
SRL1-T0(116) (Fusarium + Ralstonia), SRL1-T0(32) Meloidogyne + Fusarium, SRL1-
T0(116) (Meloidogyne + Ralstonia), SRL1-T0(116) (Ralstonia alone) and SRL1-T0(116)
(Fusarium alone), in srl1 transgenics whereas, in case of rvl1 transgenics, maximum
disease severity (53.97, 41.54, 37.83, 34.03 30.22 and 27.75%) were recorded in
RVL1-T0(20) (Meloidogyne + Fusarium+ Ralstonia), RVL1-T0(20) (Fusarium +
Ralstonia), RVL1-T0(20) Meloidogyne + Fusarium, RVL1-T0(20) (Meloidogyne +
Ralstonia), RVL1-T0(20) (Ralstonia alone) and RVL1-T0(20) (Fusarium alone) followed
by RVL1-T0(33) and RVL1-T0(48), i.e., in control, disease severity was more (>60%).
160
4.6.2.8 Egg masses per root system, eggs per root system, female fecundity, final
population and reproduction factor of M. incognita
Significant differences were observed in respect of eggmass per root, eggs per
root, female fecundity, final population and reproduction factor of the M. incognita in
different transgenic lines treated with Meloidogyne-alone and in combination of
Fusarium and Ralstonia. Maximum eggmass per root, eggs per root, female fecundity,
final population and reproduction factor was noticed in SRL1-T0(116) and RVL1-T0(20)
plants. Correspondingly minimum values were recorded in SRL1-T0(21) and RVL1-
T0(28) events.
In the present study, increased plant height, fresh and dry weight of the plant as
well as less disease severity, root-knot index, less recovery of Fusarium, Ralstoinia and
nematode populations were observed in transgenic plants compared to control
(inoculated). Protection of the plants from infection depended on lectin gene carrying
tomato plants. Even in individual or combinations of pathogens treated in transgenics
SRL1-T0 (21) and RVL1-T0 (28) recorded maximum plant height, more fresh and dry
weight with least disease severity, as well as root-knot indices. It was clear that the
disease severity was more when the nematode, M. incognita interacted with other
pathogens Fusarium and Ralstonia in combination.
Assay of peroxidase activity in RVL1 and SRL1 transgenic plants inoculated with
different pathogens showed differences among the various treatments. Increased
activity of PO was observed with the treatment RVL1-T0(28) and SRL1-T0(21) plants
upon challenge inoculation with individual and combination of pathogens, when
compared to control.
In RVL1-T0(28) and SRL1T0 (21) plants, PO activity varied from 0.151 to 0.331
and 0.134 to 0.254, respectively. Lowest PO activity was observed in RVL1-T0(20) and
SRL1-T0 (116) over control plants.
All the SRL1 and RVL1 events tested indicated significant increase in the activity
of PPO when compared to control plants. However, accumulation of polyphenol oxidase
was higher in RVL1-T0(28) and SRL1-T0 (21) plants challenged with Fusarium,
Ralstonia and Meloidogyne individually and also in combinations.
PPO activity varied from 0.011 to 0.032. Maximum PPO activity was noticed in
RVL1-T0(28) with Meloidogyne+Fusarium and Meloidogyne alone (0.035) over control
followed by SRL1-T0(21) challenged with Meloidgyne + Ralstonia (0.031). Lowest PPO
activity was observed in RVL1-T0(20) and SRL1-T0(116) when challenged with
Meloidgyne and Ralstonia alone.
Increase in accumulation of total phenols was observed in all the SRL1 and
RVL1 transgenic events (Table). Phenol accumulation varied from 0.28 to 2.72. Highest
phenol accumulation was noticed in SRL1 transgenic plants challenged with
Meloidogyne (2.72 mg/g) alone followed by Fusarium alone (2.35 mg/g) and with
Ralstonia (1.94 mg/g), respectively. Lowest phenol accumulation recorded in
Meloidogyne+ Fusarium+ Ralstonia (0.57) in SRL1-T0(116) and RVL1-T0(20)
Meloidogyne + Ralstonia (0.28 mg/g) respectively.
163
Table 30. Biocontrol potentiality of srl1 and rvl1 expressed transgenic events against different pathogens (alone and in combinations)
Control (Uninoculted) 157.56 105.85 33.61 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
SE.m± 0.50 0.25 0.35 0.29 0.18
CD at 1% 1.14 0.95 1.35 1.12 0.67
167
SRL1-T0(7) 100.43 54.63 24.37 24.84 4.33 70.33 338.67 15319.67 10319.67 51.60 267.33 7.27
SRL1-T0(21) 102.23 59.88 24.32 24.14 3.77 68.00 324.67 13578.33 8578.33 42.89 255.00 6.60
SRL1-T0(32) 84.10 35.73 18.50 31.47 6.00 74.33 380.67 19795.00 14795.00 73.98 295.33 14.27
SRL1-T0(10) 90.73 40.58 19.92 28.07 5.22 73.67 351.67 17405.33 12405.33 62.03 295.33 10.77
SRL1-T0(90) 95.90 44.83 20.57 26.37 5.00 73.00 349.67 17025.33 12025.33 60.13 286.33 9.87
SRL1-T0(95) 85.60 37.53 19.60 27.82 5.44 70.67 359.67 16916.33 11916.33 59.58 295.00 11.07
SRL1-T0(116) 81.80 34.03 18.53 32.80 6.22 75.00 400.67 21548.33 18350.67 91.75 379.00 14.30
RVL1-T0(12) 79.40 55.13 17.97 28.73 5.40 90.67 374.67 19469.67 14469.67 72.35 362.33 11.83
RVL1-T0(11) 85.32 62.73 19.77 27.32 5.00 90.67 372.67 19288.33 14288.33 71.44 340.33 10.60
RVL1-T0(28) 91.40 66.23 21.73 24.77 4.33 88.67 347.67 16326.33 11326.33 56.63 324.33 8.12
RVL1-T0(2) 89.30 64.43 20.97 25.97 4.33 90.67 361.67 18291.00 13291.00 66.46 337.33 8.12
RVL1-T0(33) 75.17 47.83 13.77 32.80 6.22 90.67 403.67 22099.00 17099.00 85.50 364.33 14.30
RVL1-T0(48) 76.53 50.33 14.37 28.73 6.00 90.67 383.67 20285.67 15285.67 76.43 368.33 11.83
RVL1-T0(20) 74.20 46.03 12.97 34.03 6.44 90.67 423.67 23912.33 18912.33 94.56 483.00 15.53
RVL1-T0(50) 82.23 57.53 18.57 27.85 5.22 90.67 372.67 19288.33 14288.33 71.44 356.33 10.60
Control (Inoculated) 59.27 27.80 9.13 74.97 8.33 92.67 474.67 24485.67 19485.67 97.43 619.33 26.70
Control (Uninoculted) 157.56 105.85 33.61 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
SE.m± 0.20 0.46 0.35 0.27 0.19
CD at 1% 0.78 1.78 1.35 1.05 0.74
168
Table 30h. Activity of defense enzymes in srl1 and rvl1 transgenic events inoculated with different pathogens (alone and in combinations)
Total Phenols (mg/g of leaf) Peroxidase (unit/mg protein/g of leaf) Polyphenol oxidase (unit/mg protein)
Transgenic
lines M+F+ M+F+
M F R M+F M+R F+R M+F+R M F R M+F M+R F+R M F R M+F M+R F+R
R R
SRL1-T0(3) 2.54 2.17 1.84 1.72 1.55 1.79 1.43 0.210 0.117 0.153 0.166 0.105 0.151 0.144 0.037 0.016 0.037 0.022 0.022 0.022 0.023
SRL1-T0(7) 2.36 2.08 1.85 1.63 1.46 1.84 1.48 0.231 0.150 0.146 0.161 0.099 0.187 0.125 0.027 0.020 0.027 0.020 0.020 0.020 0.024
SRL1-T0(21) 2.72 2.35 1.94 1.72 1.64 1.93 1.57 0.254 0.238 0.134 0.231 0.158 0.240 0.184 0.025 0.016 0.025 0.029 0.031 0.029 0.028
SRL1-T0(32) 1.91 1.71 1.21 1.18 0.82 0.93 0.60 0.142 0.116 0.138 0.154 0.062 0.102 0.118 0.028 0.022 0.028 0.024 0.022 0.024 0.027
SRL1-T0(10) 2.09 1.89 1.57 1.36 0.91 1.29 0.93 0.192 0.075 0.223 0.146 0.072 0.126 0.118 0.005 0.023 0.005 0.020 0.022 0.020 0.025
SRL1-T0(90) 2.18 1.98 1.75 1.54 1.00 1.57 1.20 0.127 0.172 0.125 0.133 0.065 0.098 0.099 0.028 0.021 0.028 0.029 0.022 0.029 0.026
SRL1-T0(95) 1.91 1.80 1.66 1.27 0.82 1.02 0.66 0.086 0.074 0.082 0.090 0.068 0.091 0.095 0.011 0.019 0.011 0.021 0.019 0.021 0.025
SRL1-T0(116) 1.91 1.44 1.12 0.82 0.82 0.84 0.57 0.083 0.071 0.079 0.087 0.065 0.088 0.092 0.008 0.016 0.008 0.018 0.016 0.018 0.022
RVL1-T0(12) 1.72 1.44 0.85 1.03 0.74 1.12 0.76 0.200 0.180 0.188 0.210 0.190 0.223 0.125 0.029 0.021 0.029 0.030 0.024 0.030 0.022
RVL1-T0(11) 1.82 1.62 1.21 1.03 0.92 1.21 0.85 0.160 0.188 0.202 0.209 0.160 0.185 0.144 0.031 0.019 0.031 0.029 0.047 0.029 0.024
RVL1-T0(28) 2.00 1.80 1.39 1.12 1.10 1.58 1.21 0.308 0.331 0.201 0.196 0.153 0.151 0.184 0.035 0.030 0.035 0.033 0.031 0.033 0.027
RVL1-T0(2) 1.91 1.71 1.30 1.21 1.01 1.39 1.03 0.209 0.187 0.154 0.162 0.281 0.142 0.099 0.028 0.023 0.028 0.029 0.027 0.029 0.022
RVL1-T0(33) 1.45 1.17 0.66 0.57 0.56 0.85 0.48 0.273 0.193 0.129 0.137 0.222 0.120 0.118 0.013 0.024 0.013 0.027 0.028 0.027 0.025
RVL1-T0(48) 1.63 1.26 0.75 0.75 0.47 1.03 0.67 0.213 0.180 0.171 0.137 0.135 0.140 0.130 0.011 0.021 0.011 0.028 0.026 0.028 0.029
RVL1-T0(20) 1.36 1.08 0.57 0.48 0.28 0.85 0.48 0.151 0.158 0.144 0.172 0.165 0.079 0.095 0.029 0.024 0.029 0.030 0.028 0.030 0.023
RVL1-T0(50) 1.82 1.53 0.94 0.94 0.92 1.21 0.85 0.151 0.158 0.144 0.172 0.165 0.079 0.095 0.026 0.021 0.0263 0.027 0.0254 0.027 0.020
Control
0.25 0.14 0.15 0.13 0.11 0.14 0.13 0.077 0.065 0.073 0.081 0.059 0.082 0.086 0.016 0.011 0.0163 0.017 0.0154 0.017 0.010
(Inoculated)
Meloidogyne-alone
Plate 29. Contd…
173
Ralstonia- alone
Plate 29 contd…
174
Meloidogyne + Ralstonia
Meloidogyne + Fusarium
Fusarium +Ralstonia
Plate 29 contd…
175
4.7 Evaluation of rvl1 and srl1 transgenics and non-transgenics for root infection
by M. incognita and its development and reproduction
Root sections of both rvl1 and srl1 transgnics lines and control were observed
one day after inoculation and root infection followed a similar pattern on all transgenic
lines and control. J2 invaded RVL1-T0(20) (12.33, 24.67, 50.6 and 70.67) and SRL1-
T0(116) (8.33, 18.33, 41.00 and 61.67) rapidly and highest in number at one, three, five
and seven days after inoculatrion than other events. Infective second stage juveniles
were observed only in the cortex of tomato roots and some of the roots showed that
juveniles had entered only partially into the root tissue. Several juveniles had penetrated
the root tips and oriented in various directions vertical or parallel to the longitudinal axis
of the root.
from 7.33 to 44.33 and 5.33 to 41.67 in SRL1-T0(116) and RVL1-T0(20) at 21, 25, 30
and 45 dai. Main results from this comparative study were; high root penetration and
reproduction of nematode in control plants and reduced invasion and delay in post-
embryonic development in transgenic plants.
At 45 dai, plants were uprooted. The egg masses per root, eggs per root system,
final population, female fecundity and reproduction factor were estimated (Table 31a).
Among the transgenic lines, number of egg masses/root was significantly lowest
in SRL1-T0(21) (39.00) and RVL1-T0(28) (49.00) followed by 42.00 and 51.00 of SRL1-
T0(7) and RVL1-T0(2). However, highest number of egg masses per root 59.00
177
4.7.4.2 Eggs/root
The fecundity of the females was estimated by dividing final population by egg
masses. SRL1-T0(21) and RVL1-T0(28) significantly reduced the fecundity of the
females 280.67 and 315.67, followed by SRL1-T0(7) (298.67) and RVL1-T0(2) (321.67)
respectively. Whereas, highest female fecundity of 387.67 and 364.67 was recorded in
RVL1-T0(20) and SRL1-T0(116), respectively over the control.
Maximum shoot and root length were recorded in SRL1-T0(21) (60.20 and 21.25
cm) and RVL1-T0(28) (48.63 and 19.20 cm) plants followed by SRL1-T0 (7) (59.73 and
20.70 cm) and RVL1-T0(2) (47.73 and 18.00 cm) respectively. Whereas, highest
178
reduction in shoot and root length was recorded in SRL1-T0(116) and RVL1-T0(20)
plants.
There was significant difference in total biomass (fresh and dry) of the plants.
Maximum fresh biomass (fresh shoot and root weight) and dry biomass (dry shoot and
root weight) was recorded in SRL1-T0(21) (37.88 and 20.00 g) and RVL1-T0 (28) (20.33
and 8.80 g) plants. Correspondingly, less biomass of the plants recorded in SRL1-
T0(116) (35.33 and 20.33 g) and RVL1-T020) (17.43 and 5.07 g).
rvl1 and srl1 transgenic events had significantly reduced root-knot index which
was accounted to be 3.67 and 4.33 in SRL1-T0(21) and RVL1-T0(28) event followed by
SRL1-T0(7)(4.33) and RVL1-T0(2) and RVL1-T0(11) of 5.33 over control (9.67).
Correspondingly, highest root-knot index were recorded in RVL1-T0(20) (7.33) and
SRL1-T0(116) (6.33).
With respect to all transgenic lines and control, significantly lowest number of
149.67 and 176.23 juveniles were recorded in SRL1-T0(21) and RVL1-T0 (28)
respectively, followed by SRL1-T0(7) (155.00) and RVL1-T0(2) (181.13) these
treatments differed among themselves. However RVL1-T0(20) and SRL1T0(116)
recorded higher number of juveniles 215.10 and 189.40 per 200 cc of soil over the
control respectively.
SRL1, anti-SRL1 and RVL1 interact mostly with chitin oligomers. So using FITC-
SRL1, FITC- RVL1 with appropriate controls to locate lectin sites for soil-borne fungal
pathogens was done and summarized in Table 33.
179
Table 31. Infection and development of M. incognita in srl1 and rvl1 expressed transgenic events
Table 31a. Plant growth and nematode parameters as influenced by M. incognita infection in srl1 and rvl1 expressed transgenic events
Control
62.82 23.90 25.97 11.97 14.45 8.28 40.42 20.25 0.00 0.00 0.00 0.00 0.00 0.00 0.00
(Uninoculated)
S.Em± 0.34 0.16 0.22 0.14 0.34 0.21 0.54 0.26 0.9
wild type
G-Giant cell
In order to get an insight in to the mode of SRL1, anti-SRL1 and RVL1 toxicity effect on
S. rolfsii, R. solani, F. oxysporum, P. lilacinus and T. viride, determined the binding of lectins
after incubating the fungus in FITC-lectin solution. Binding pattern of lectins differed between
the fungus observed by fluorescent microscopy. SRL1 and RVL1 bound to all fungus,
primarily to the hyphal wall and septa and to a lesser extent lined to the hyphal tips and weak
fluorescence was exhibited in T. viride spores. Details of anti-SRL binding to the S. rolfsii and
R. solani are explained in immunolocalization studies.
FITC-RVL1 strongly bound to all five pathogens, but its binding pattern differed vastly
from that FITC-SRL1, in that it was more or less even along the hyphal wall with little binding
to hyphal tips and strong binding to the branching points, septa and spores of the fungus.
S. rolfsii with extensively branched filaments was seen with densly localized
fluorescence at branching points and hyphal wall. Binding sites were also seen on mature and
immature sclerotial bodies that indicated the strong binding FITC-RVL1 on sclerotia and
mycelial filaments (Plate 32).
The pattern of FITC-RVL1 binding to F.oxysporum was similar to some extent to the
FITC-SRL1 and anti-SRL1, i.e. hyphal wall but to the lesser extent RVL1 bound to
chlamydospores, micro and macroconidia (Plate 34).
The binding pattern of RVL1 to hyphal wall, septum, spore wall and phialides wall of
T.viride was similar to SRL1 but differed with pattern of binding. RVL1 strongly bound over the
entire surface of the spores and phialides on the other hand, bound in descrete patches over
the whole mycelium (Plate 35).
Plate 32. FITC -conjugated SRL1, anti SRL1 and RVL1 labelling of Sclerotium rolfsii
186
Plate 33. FITC -conjugated SRL1, anti-SRL1 and RVL1 labelling of Rhizoctonia solani
187
Septa
FITC-RVL1 (400X)
FITC SRL1
Plate 34 FITC -conjugated SRL1, anti SRL1 and RVL1 labelling of Fusarium oxysporum
189
FITC-RVL1
Plate 35. FITC -conjugated SRL1, anti SRL1 and RVL1 labeling of Trichoderma viride
190
Plate 36. FITC -conjugated SRL1, anti SRL1 and RVL1 labelling of Paecilomyces
lilacinus
191
S. rolfsii mycelia with extensively branched hyphal filaments were seen with descrete
intense spots of fluorescence densely localized at the branching regions and strong
fluorescence along the mycelia indicating the occurrence of high levels of lectin at the
branching points. However uniformly distributed fluorescent binding pattern was found on
young hyphal filaments suggesting high levels of lectin. Immature sclerotial bodies in the final
stage of formation still associated with highly branched mycelia around showed dense mass
of congregated lectin sites arising due to aggregation of mycelium, whereas in the completely
matured sclerotial bodies intense fluorescent label was seen indicating the uniform distribution
of lectin at very high levels when compared to mycelia.
Anti-SRL1 conjugated with FITC, showed extensive binding at branches and septum of
the R. solani and also to wall and tip of the hyphae seen with uniform fluorescence densely
localized inside the hyphae and strong fluorescence at branching point and septum indicating
the occurrence of high levels of lectins in mycelium. Lectin binding to sclerotia showed strong
fluorescence around the sclerotia indicating high level of lectin with strong and uniform
binding.
Different solutions of CBB-R were tested: (a) 1% CBB-R dissolved in water (b) 0.2%
CBB-R dissolved in 20% methanol (c) 0.2% CBB-R dissolved in 40% methanol and 10%
acetic acid, and (d) 0.1% CBB-R dissolved in 40% ethanol and 10% acetic acid. Solutions (c)
and (d) gave clear and reproducible staining of the secretions of M.incognita juveniles. It was
decided to proceed with solution (d). The secretion in the head region of juveniles was stained
as one big spot or as two distinct rays. These represent the secretions of the amphids and the
secretions of the excretory pore were
192
Immature sclerotia
Mature Sclerotia
Immature micro-sclerotia
Mature micro-sclerrotia
Nematode secretions
Dye
Amphids Excretory pore Phasmids
++ : Strong binding
+: Intermediate binding
- : No binding
194
also visible as one big spot or as a thin ray. Additionally, secretions were stained at the
phasmids region (Table 32, Plate 38).
In order to get an insight in to the mode of SRL1 and RVL1 toxicity effect on M.
incognita, the binding of lectins after incubating the nematodes in FITC-RVL solution was
observed. Binding of RVL in nematodes was observed by fluorescent microscopy (Table 33,
Plate 39).
Purified SRL1 and E. coli expressed RVL1 and lectins binding were found at many
regions of the nematode body and it was very clear that lectins were ingested by nematodes.
FITC-SRL1 and FITC-RVL1 treated juveniles exhibited epiflourescence in the head region,
mid gut of the alimentary-tract, excretory pore and extended to the posterior regions
(phasmids) but the principal lectin-binding sites were the pores or the secretions of the
amphids and excretory pore. Binding was not observed in nematode gut incubated with FITC-
RVL1 complexed with mucin and FITC-BL21 (bacterial control).
196
++ : Strong binding
+ : Intermediate binding
- : No binding
197
Plate 39 Binding of FITC conjugated SRL1, anti SRL1 and RVL1 to the Meloidogyne incognita juveniles
5. DISCUSSION
Currently, some lectins of plant and fungal origin have been found toxic to a wide
range of important pathogens (Lam and Ng, 2011). Lectins have been engineered
successfully into a variety of crops including wheat, rice, tobacco, potato and tomato.
This approach could be used as a part of integrated disease management strategies
and caveat pathogens’ attack. In general, it seems that large-scale use of transgenic
fungicidal, nematicidal, insecticidal and herbicide-tolerant plants do not display
considerable negative effects on the environment. Moreover, some transgenic plants
can improve the corresponding environments and human health because their
production considerably reduces the load of chemical fungicides, bactericides and
nematicides (Velkov et al., 2005; Bhagat, 2010). For effective management of the soil
borne pathogens, viz. Sclerotium rolfsii, Rhizoctonia solani, Fusarium oxysporum,
Ralstonia solanacearum and Meloidogyne incognita in tomato, there is a need to use
environmentally safe management practices. Hence, in the present study, an attempt is
made to screen E. coli-expressed RVL1 and SRL1 lectins to soil borne pathogens.
Remusatia vivipara, the tubers which are cooked and eaten worldwide contains a
lectin (RVL1) (Bhat et al., 2010a) that can be classified under monocot mannose-
binding lectins with tetrameric proteins. Further, studies also showed E. coli expressed
RVL1 lectin is nematicidal against a common root-knot nematode, M. incognita (Bhat et
al., 2010a). Fungal lectin SRL1 from Sclerotium rolfsii showed nematicidal
199
properties (Bhat et al., 2010b). S. rolfsii lectin (SRL1) is also involved in development
and morphogenesis of the fungus, rather than host parasite interactions (Swamy et al.,
2004) With this background, an effort was made to evaluate the E. coli-expressed SRL1
and RVL1 against common soil-borne pathogens of tomato for antimicrobial activity
against fungal and bacterial antagonists. Selected PCR positive T3 generation RVL1
and SRL1 transgenic lines were tested against Fusarium, Ralstonia and Meloidogyne to
study their plant growth effects and to elucidate their mechanism of biocontrol. The
results obtained during the experimentation are discussed here.
Crude protein induced from RVL1 and SRL1 expressed E. coli could agglutinate
trypsinized rabbit blood, indicating the presence of lectin (Chao et al., 1994). Minimum
concentration required for agglutination (MCA) was 1.37 µg and 2.73 µg for SRL1 and
RVL1, respectively. For SRL1, the total activity was 0.87×104 and the specific activity
was 7.29×102. Likewise, for RVL1, the total activity was 0.43×104 and the specific
activity was 3.66×102 with rabbit erythocytes. In general, the concentration of lectin was
enhanced in partially purified protein. Both SRL1 and RVL1 showed an expected band
of 19.5 and 28.2 kDa. The present results are conformity with Wu et al. (2001) who
showed that 17 kDa S. rolfsii lectin (SRL) agglutinated trypsinized rabbit and human
erythrocytes, and displayed a strong binding to disaccharide Gal β1-3 GalNAc-α-
(Thomsen Friedenreich antigen) that was over-expressed in human tumor cells. SRL
shared a common structural topology, glycan specificity, and carbohydrate-binding sites
(Leonidas et al., 2007; Sathisha et al., 2008) with XCL.
200
From the crude protein, SRL1 was purified by using His-tag purification kit. Upon
induction of the T7 polymerase by IPTG, fusion protein produced in various hosts allows
easy purification based on the His-tag affinity to Ni-NTA columns (Terpe, 2003).
Numerous studies in the past could successfully recover from hetereologous hosts the
His-tag fused functional lectins of GNA (Trung et al., 2006), Lablab purpureus (Kim et
al., 2007), Ricinus communis (Reed et al., 2005), Robinia pseudoacacia (Nishiguchi et
al., 1997), Zingiber officinale (Chen et al., 2005), Arisaema heterophyllum (Zhao et al.,
2006) and Phlebodium aureum (Tateno et al., 2003).
PAbs were raised in (six month old) white albino rabbit, using Puified SRL1 as
antigen similar method was conducted by Charudattan and De Vay, (1974); Swamy et
al. (2004). Because the antiserum obtained in this study appears to be specific for SRL1
and did not cross react with other proteins The micro-precipitation results indicated that
the antiserum produced against SRL1 was working (1: 65536 dilutions). Further
confirmation was done by DAC-ELISA technique. Titre of antisera was determined by
two-fold serial dilutions of antiserum from 100 to 65536. The titre of antisera against
antigen was determined by DAC - ELISA. It was sensitive enough to detect the antigen
up to 4096 dilutions.
5.4 Evaluation of plant and fungal lectins for the in vitro suppression of some
common soil-borne pathogens
5.4.1.1.1 F. oxysporum
With the insecticidal action of plant lectins, the spectrum of external functions is
certainly not completely covered yet. Binding to cell wall constituents in fungi can
interfere with their growth. Fungal cell walls contain chitin, the β1-4 linked polymer of
201
5.4.1.1.2 S. rolfsii
In vitro studies demonstrated that both RVL1 and SRL1 played a role in early
formation of sclerotial bodies rather than simply serving as reserve storage protein.
Germination of sclerotial bodies is another event in development of the fungus, which
was strongly inhibited by SRL1 and RVL1 lectins. In contrast to an endogenous
function, the cytoplasmic localization of fruiting body lectins is ideally suited for the
proposed role of these proteins in the defence of fungi against pathogen.
5.4.1.1.3 R. solani
Both SRL1 and RVL1 lectins showed no inhibitory activity against R. solani as
demonstrated by the growth of mycelia when cultured on medium containing variable
concentrations (1.2 to 4.8 mg/ml) of protein solution. It has been shown previously that
some plant lectins do exhibit fungicidal activity against R. solani, e.g. lectins isolated
from Phaseolus coccineus seeds (Chen et al., 2009) and Phaseolus vulgaris cv “red
kidney bean” seeds (Ye et al., 2001) both of which were active at a concentration of 330
µg/ml.
SRL1, RVL1 and anti SRL inhibited the growth of the fungi R. solani, S. rolfsii
and F. oxysporum at different concentrations (1.2 to 4.8 mg/ml) as seen by employing
the disc plate diffusion assay of Roberts and Selitrenikoff (1988). This technique
deirectly act on hyphal growth and does not indicate whether there is inhibition of spore
germination.
However, there was no such report about antifungal activity of RVL1 and SRL1
lectins. In the present investigation, these lectins displayed antifungal activity in broad
fungal species including F. oxysporum, S. rolfsii and R. solani.
203
E. coli expressed SRL1 and RVL1 lectins showed in vitro antifungal activity
against F. oxysporum. It strongly inhibited the growth of Fusarium at the higher
concentration of 4.8 mg/ml. Antifungal activity has been observed in other lectins where,
for example, Astragalus mongholicus root lectin revealed antifungal activity against
various species of phytopathogenic fungi (Yan et al., 2005). Similarly, the lectin from
Curcuma amarissima Roscoe rhizome inhibited the growth of F. oxysporum,
Colletotrichum cassiicola and Exserohilum turicicum (Kheere et al., 2010). In vitro
studies of two novel chitin-binding lectins from the seeds of Artocarpus integrifolia
inhibited the growth of Fusarium moniliforme and Saccharomyces cerevisiae (Trindade
et al., 2006). Many studies on plant and fungal lectins as antifungal protein have
showed that they are implicated in the host defense mechanism. However, to date, only
a small number of lectins have been reported to have actual antifungal activity, including
those from potato tubers, Amarnthus caudatus seeds, stinging nettle rhizomes, wheat
germ, and P. vulgaris seeds.
Growth inhibition by the plant lectin RVL1 and fungal lectin SRL1 was indicated
by their effect on fungal spore germination. Both the lectins caused a marked inhibition
at 1.2 mg/ml and more. It seems that the inhibition of spore germination occurs in a very
early stage of the germination process, after spores have been allowed to swollen and
before initiation of the germ tubes. Inhibition of germination was mainly expressed by
the prolongation of the latent period which precedes germination. However once
initiated, the rate of germination appeared quite normal and after 48 h of incubation, the
percent of lectin treated spores that germinated was almost the same as that of the
untreated ones. Inhibition of F. oxysporum spore germination by RVL1 and SRL1 clearly
indicated their inference with normal growth. These findings are in conformity with the
Mirelman et al. (1975); Golan et al. (1978); Broekaert et al. (1989) that lectins in plants
are part of their protection system, helping them to combat attack by fungal pathogens.
These results indicate that the macroconidia were able to adapt to chitinase (Sela-
Buurlage, 1996). It is possible that RVL1 and SRL1 altered the hyphal cell wall
architecture of F. oxysporum as exemplified in Phycomyces blakesleeanus, B.
204
cinerea, T. viride, and C. lindemuthianum germlings treated with UDA (Van Parijs et al.,
1992; Does et al., 1999). A change in cell wall composition might result in the resistance
of fungi to RVL1 and SRL1.
when the lectin is complexed with anti-SRL. Recently it was shown that the disruption of
the glucosyl ceramide synthesis using inhibitors of UDP-Glc, ceramide
glucosyltransferase, lead to inhibition of spore germination, cell cycle, and hyphal
growth in Aspergillus nidulans and Aspergillus fumigatus (Levery et al., 2002).
Membrane bound glycosyl ceramides are reported to be widely distributed in many fungi
during their syntheses, sugar moieties are added directly to ceramides, which are
referred to as glycosylinositol phosphorylceramides (GIPCs). This class of glycosyl
ceramides occurring in fungi (Lester and Dickson, 1993; Dickson, 1998) are mostly
glucosylceramides. However, there are also reports of galactosylceramides occurring in
some fungi (Levery et al., 2000; Toledo et al., 1999, 2000). GIPCs are believed to act as
signaling molecules and are implicated for their diversified roles in viability (Zhong et al.,
2000) and cell growth (Chung et al., 2001). Inhibition of spore germination by disrupting
the ceramide synthesis using inhibitors of glycosyl transferases in A. nidulans and A.
fumigates (Levery et al., 2002) is analogous to present study, inhibition of sclerotial
body germination by capping the lectin sites on sclerotial bodies.
Antibacterial activity of the SRL1 and RVL1 was assayed in vitro by the well
diffusion method. The E. coli expressed lectins SRL1 and RVL1 showed antibacterial
activity against R. solanacerum. The diameters of growth inhibition areas were in the
range of 2.35 and 2.85 cm. In view of the results obtained by the well diffusion method,
the MIC values of the SRL1 and RVL1 were determined. The MIC values obtained
confirmed the existence of a significant activity against the bacterium, which ranged
from 0.625 mg/ml. Simple radial diffusion assay is a method used for the qualitative
detection of lectin interactions with saccharide compounds being used to determine the
saccharide residues present in glycoproteins (Lima et al., 1997). RVL1 and SRL1
showed remarkable antibacterial activity against R. solanacearum. RVL1 has a high
antibacterial activity as demonstrated by the inhibition zone (1.65 cm).
The results describing the effect of RVL1 and SRL1 on the bacterial agglutination
was confirmed the interaction between the lectin and the bacterium. Ralstonia seemed
to be most sensitive to the RVL1. It is known that lectin binds not only with non-
reducing terminal sugars of glycoproteins, but some also react with internal components
of the carbohydrate chains or with non-carbohydrate ligands (Goldstein and Poretz,
206
1986). Inhibition of bacterial agglutination by RVL1 and SRL1 showed that lectin binding
occurs by interaction with bacterial surface carbohydrates. Similar to RVL1 and SRL1,
the lectin of Araucaria angustifolia exhibited antibacterial activity against Clavibacter
michiganensis and Xanthomonas axonopodis pv. passiflorae (Santi-Gadelha et al.,
2006). Although the mechanism of action of the lectins has not yet been elucidated in
detail, the presented data confirm the in vitro antibacterial activity of RVL1 and SRL1
against R. solanacearum. It has been proposed that the proteins with antibacterial
action form a channel on cell membrane and the cell dies as a result of the out-flowing
of cellular contents, this mechanism being different from that of antibiotics (Talas-Ogras
et al., 2005). The complex interaction between RVL1 and SRL1 and the bacterial
surface is further suggested by glycoprotein inhibition. This is the first report on the
antibacterial activity of RVL1 and SRL1 against R. solanacearum which needs
confirmation further against different hosts affected by same pathogen.
The antibacterial activity of RVL1 and SRL1 was very similar to the lectin of Morus
alba exhibited antibacterial activity against Pseudomonas syringae pv. mori. The bacterial
agglutination was also inhibited by the glycoproteins, fetuin and tyroglobulin (Ratanapo et
al., 2001). The sugar residues which serve as lectin binding site on surface of R.
solanacearum apparently exist for a limited period during exponential phase of bacterial
growth 1.225 and 1.146 to 0.865 and 0.849 OD of RVL1and SRL1 respectively. Similar
dynamic changes of bacterial surface during growth also have been demonstrated in the
case of Jackfruit, Bacillus thuringeinsis interaction (Prapanpoj, 1986) and monodin-Vibrio
vulnificus interaction (Ratanapo et al., 1992).
Production of functional RVL1 and SRL1 in E. coli allows preparation of pure and
homogeneous protein required for structural, biological and mechanistic studies.
E. coli expressed RVL1 and SRL1 was used for nematode bioassay. Since the RVL1
and SRL1 was not purified, total protein produced in E. coli was used for checking
nematicidal activity against Meloidogyne incognita. Total protein used for the bioassay
was quantified to be 12.00 mg and it was diluted to 1: 25, 1: 50, 1: 75 and 1: 100. Egg
hatching inhibition and mortality of juvenile nematodes was observed periodically at 3,
207
6, 12, 24 and 48 h. Egg hatching inhibition was found at 12 h and juvenile mortality was
found only after 3 h (at 6 h) and from then on it increased with increase in time and
lectins concentration.
Maximum egg hatching inhibition (86 and 82%) and juvenile mortality (92.67 and
82.67%) at 1: 25 dilution was observed in SRL1 and RVL1 after 12 and 48 h incubation,
respectively. However, other dilutions (1: 50, 1: 75 and 1: 100) also showed high
mortality in SRL1 followed by RVL1 after 48 h. It was evident that the less concentration
of SRL1 and RVL1 (based on the activity) caused fairly high egg hatching inhibition and
juvenile mortality. The mechanism of action of lectins has been ascribed to the ability of
lectins to bind glycoproteins and proteins localized on the surface coat of nematodes
(Marban-Mendoza et al., 1987; Ripoll et al., 2003). By and large, this was confirmed by
Bhat et al., 2010a; Bhat et al., 2010b, suggesting that binding of lectin to glycoprotein
receptor sites, local or systemic deleterious effects lead to mortality or reductions in
growth of the victims (Peumans and Van Damme, 1995). The receptor sites found along
with the digestive tract of the nematodes and as such, their guts directly exposed to the
content of the diet. Thus the luminal side of the gut has potential binding sites for dietary
lectin.
rate and these organisms once introduced into the soil survive for a longer period.
There is also circumstantial report that native antagonists are more efficient than
208
introduced antagonists (Kulkarni and Sagar, 2006). Use of bioagents, now a days, is
best and has been most emphasized and widely accepted practice as it is
environmentally safe and can overcome the residual problems associated with heavy
use of fungicides for the management of diseases. Hence, the present investigation was
taken up to screen the bioagents for effective management of root pathogens of tomato.
RVL1 and SRL1 exerted antifungal action against fungal antagonists T. viride and
P. lilacinus. SRL1 strongly inhibited the growth of P. liacinus at the higher concentration of
4.8 mg/ml followed by RVL1. SRL1 and RVL1 were less and moderately effective against
T. viride with slight inhibition zone around the disc and was concentration dependent. The
specificity of the effect was indicated by the normal growth of the fungus in controls, BL21
or buffer. The antifungal properties of chitin-binding lectins have been a matter of
controversy eversince the report of Mirelman et al. (1975) on the inhibitory effect of WGA
on fungal growth of T. viride. It is possible that SRL1 and RVL1 protect the plants against
chitin containing phytopathogens. Lectins with sugar specificities which differ from that of
SRL1 and RVL1 may inhibit the growth of other soil microorganisms like Trichoderma or
P. lialcinus, the surface of which are covered by polysaccharides. SRL1 and RVL1 may
be small enough to penetrate through the fungal cell wall and reach the plasma
membrane, where they may have an effect on the active sites involved in cell-wall
morphogenesis or these lectins
might interfere with growth by binding or cross-linking newly synthesized chitin chains. In
this way the "steady-state" model of hyphal growth proposed by Wessels (1988) is
209
disturbed. Alternatively, the delicate balance between chitin synthesis and selective
hydrolysis of preformed chitin chains might be interrupted (Cabib 1987). The evidence
presented above indicates the binding of SRL1 and RVL1 to hyphal tips inhibits chitin
synthesis, hyphal growth and spore germination. Although the mechanism of apical
growth is poorly understood, it has been suggested that the addition of newly synthesized
chitin for extension of the hyphal cell wall and the onset of germination in spores, require
the cleavage of pre-existing chitin in the hyphal tip by selective lysis (Bartnicki-Garcia,
1969 and Mirelman et al., 1975).
essentially the three growth constants i.e. total growth, exponential growth rate
and growth lag.
210
The study indicated that further increase in the incubation period resulted in
decrease in the growth of bacterium because of cell death or reduction in bacterial
multiplication due to exhaustion of nutrients in the medium after incubation for optimum
number of days.
SRL1 and RVL1 proteins showed interesting antibacterial activities which could
inhibit all the tested antagonistic bacterial strains. The bacterial inhibition activities
depended on bacterial strain. SRL1 and RVL1 lectin showed antibacterial activities
against different P. fluorescens strains (MIC 0.63 mg/ml) and B. subtilis strains (1.25
and 0.63 mg/ml), respectively, and MBC values: 2.56 to 3.14 and 1.94 to 3.08 mg/ml.
MBC which corresponds to the minimum concentration of the lectin capable to reduce
number of cfu for 0.1% of the initial inoculum: MBCs determined by agar diffusion were
higher than the ones obtained by MICs. A previous report (Sa et al., 2009a) has shown
that GlcNAc specific lectin from Myracrodruon urundeuva had a MIC and MBC of 0.58
and 8.1 µg/ml respectively for B. subtilis. These MIC and MBC values of SRL1 and
RVL1 are about four to five times higher than those MIC and MBC values of M.
urundeuva lectin, which shows a better antibacterial ability for B. subtilis. Similarly,
purified lectin EuniSL from seeds of Eugenia uniflora strongly inhibited the growth of
Escherichia coli with a MIC of 16.5 µg/ml (Oliveira et al., 2008). From the MIC and MBC
values obtained, it can be concluded that the ability to inhibit P. fluorescens and B.
subtilis strains was similar to Eugenia uniflora and M. urundeuva lectins. However,
crude extracts of SRL1 and RVL1 could inhibit P. fluorescens and B. subtilis better than
other lectins. In all cases, the MBC was always found to be similar or two-fold higher
than MIC values.
A good MIC and MBC value against the tested bacteria indicated that lectins
have a high potential for widespread applications. These lectins might be used for
control of plant pathogenic bacteria that are reported to be resistant to antagonists.
Inhibition zone with SRL1 and RVL1 against P. fluorescens and B. subtilis strains
confirmed the reports on utilization of EuniSL against B. subtilis, Pseudomonas
aeruginosa and Klebsiella sp. (Oliveira et al., 2008). In the diffusion test, SRL1 and
RVL1 showed an inhibition zone of 0.87 to 1.79 cm. Plant lectin RVL1 showed
maximum inhibition zone than fungal lectin SRL1. As reported in the literature,
variations can occur due to different concentration differences of antimicrobial proteins.
The results of the present study showed that SRL1 and RVL1 have similar antimicrobial
activity for P. fluorescens and B. subtilis strains which can be used for the biological
control of plant pathogenic bacterium.
5.5.3.5 Plant and fungal lectin activity against P. fluorescens and B. subtilis
The activity RVL1 and SRL1 was very similar to ethonolic extract of Zuccagnia
punctata which exhibited antibacterial activity against 47 strains of Gram positive and
Gram negative bacteria (Iris et al., 2005). This time-kill assay was performed to
determine the lectins are bactericidal. SRL1 and RVL1 exhibited bactericidal activities at
against P. fluorescens and B. subtilis for a limited period during exponential phase (96
h) of bacterial growth. Similar dynamic changes of bacterial surface during growth also
have been demonstrated by Alcaraz et al. (2000).
5.5.4 In vitro screening of bacterial and fungal antagonists in combination with lectins
212
against R. solanacearum
5.5.5 In vitro screening of bacterial and fungal antagonists in combination with lectins
against nematode
In the present study, in vitro bioassay with cell-free culture filtrates of four
P. fluorescens and two B. subtilis strains at different concentrations revealed an
increased juvenile mortality and egg hatching inhibition with increase in exposure period
as well as concentration. M. incognita juveniles and eggs were highly vulnerable to the
P. fluorescens and B. subtilis along with this combination of culture filtrates of bioagents
and lectins SRL1 and RVL1 at 4.8 mg/ml showed higher larvicidal and ovicidal action on
M. incognita juveniles and eggs. Reduction in mobility and viability of juveniles and eggs
of M. incognita are induced by secondary metabolites such as 2, 4-diacetylphlorglucinol,
pyrolnitrin, tropolone, pyocyanin, phenazines and lytic enzymes which are produced in
culture filtrates of P. fluorescens (Elsherif and Grossmann, 1996; Dunne et al., 1998).
Similar toxic property of P. fluorescens culture filterates was also reported on the
juvenile mortality of M. incognita and Heterodera cajani (Gokte and Swarup, 1988). The
juvenile mortality and egg hatching inhibition of M. incognita observed in the present
study might be due to antibiosis.
5.6 Evaluation srl1 and rvl1 transgenics and non-transgenics for the suppression of
tomato soil-borne pathogens
5.6.2 Evaluation of rvl1 and srl1 transgenic and non-transgenic tomato lines
against individual and combination of vascular pathogens of tomato under
glasshouse conditions
Synthetic chemical fungicides and bacteriacides are widely used against fungus
and bacteria. However, such chemicals can cause a series of problems including
environment pollution and long-term residue issues. As a result present attention has
been to develop biological control approaches (Siddiqui and Mahmood, 1996).
Developing transgenic plants expressing heterologous proteins with fungicdal and
bactericidal activity is considered important for reducing crop losses.
Pot culture tests were conducted to know the interaction among the pathogens
using srl1 and rvl1 transgenic tomato plants representing different events. In the present
investigation, eight homozygous T3 generation transgenic events of tomato expressing
SRL1 and RVL1 were evaluated for resistance to tomato wilt pathogens. F. oxysporum,
R. solanacearum and M. incognita are potential pathogens. Due to lectin activity in
transgenic plants severity of the disease of fore mentioned pathogens was reduced.
The plants inoculated simultaneously with the pathogens F. oxysporum + R.
solanacearum + M. incognita recorded high disease severity and pathogen population in
soil when compared with other combinations. Interaction of Meloidogne with Fusarium
and Ralstonia lead to synergistic effect. All the organisms were pathogenic in
independent inoculations. But combined infection resulted in rapid
215
drying of the shoot followed by root in control, which was further protected for long time
from infection and disease development in transgenic plants.
besides Fusarium and Ralstonia due to higher plant growth parameters and lesser
disease severity observed in srl1 and rvl1 transgenic plants.
5.7 Evaluation of rvl1 and srl1 transgenics and non-transgenics for root infection
by M. incognita and its development and reproduction
Ever since Marban-Mendoza et al. (1987) provided the first indication that ConA
may have anti-nematode activity on root-knot nematode M. incognita, several
217
reports have shown that lectins could be used to develop transgenics with the
objective of building resistance to nematodes. In fact, Leal-Bertioli (2003) observed that
transgenic tobacco plants that were expressing tarin1 a mannose-binding lectin from
Colocasia esculenta were on par with the control plants in inhibiting the reproduction
and root damage caused by M. javanica. However, Arabidopsis plants expressing GNA
were highly tolerant to root-knot nematode (M. incognita). This variable toxicity of
different lectins is attributable to amino acid differences leading to altered sugar
specificity, the differences in the receptors found in different species of Meloidogyne
(incognita or javanica) and the transformation event itself. Constitutive expression of a
snowdrop lectin (GNA) directed by the CaMV 35S promoter has been used to assess
antinematode activity in oilseed rape, potato and Arabidopsis (Burrows and de Waele,
1997; Burrows et al., 1998 and Ripoll et al., 2003). In the present investigation, eight
transgenic tomato lines expressing rvl1 and srl1 and non-transformed control plants
were evaluated for nematode resistance. Toxicity effects of transgenic tomato on
infection and development of J2 of M. incognita was checked. J2 invaded RVL1-T0 (20)
(12.33, 24.67, 50.6 and 70.67) and SRL1-T0(116) (8.33, 18.33, 41.00 and 61.67) rapidly
and significantly highest at one, three, five and seven dai than other events. Infective
second stage juveniles were observed only in the cortex of tomato roots and some of
the roots showed that juveniles had entered only partially into the root tissue. Several
juveniles had penetrated the root tips and oriented in various directions vertical or
parallel to the longitudinal axis of the root.
Rate of infection may not be influenced by toxicity of rvl1 and srl1, however, the
development and gall formation could be determined by srl1 and rvl1. Hence, gall index
was scored in transgenics after 45 days of nematode inoculation. Based on the 0 to 10
scale (Bridge and Page, 1980), average root gall index was 3 to 5 (30-50% moderately
resistant) for all the transgenic srl1 and rvl1 transgenic events as compared to gall index
218
Generally, nematode infection and gall formation leads to stunted plant growth
and reduced biomass. In the present study, significantly higher shoot and root biomass
(fresh and dry weight) was observed for SRL1-T0(21) (60.20 and 21.25 cm) and RVL1-
T0(28) (48.63 and 19.20 cm) compared to control plant. SRL1-T0(21) and RVL1-T0(28)
showed only marginally higher biomass compared to control plant and also these
events significantly reduced the nematode population in soil.
Interestingly, it was found that srl1 and rvl1 gene expressed plants did not affect
J2 penetration into roots and there was no evidence of early HR. Significantly, more
infection sites were found on RVL1-T0(20) and SRL1-T0(116) events infected by M.
incognita at 7 dai (days after inoculation) than in SRL1-T0(21) and RVL1-T0(28).
In this study, giant cell formation was well marked in the vascular region of both
SRL1 and RVl1 transgenic lines rather than in the cortex. 3 to 9 Giant cells observed at
25 dai in all transformed and control plants were thick-walled and had dense cytoplasm.
Vacuolated giant cells also were observed in the same region. Taylor (1976) observed
giant cells mostly in the region of phloem and few in the xylem and cortical tissues and
noted thin walls in the giant cells. Observations of this study were in agreement with
those of Siddiqui and Taylor (1970), who observed thick walled giant cells n the
vascular region of wheat and oat roots infected by M. naasi. Tandon and Praveen
219
Kumar (1979) observed clusters of giant cells, only in the vascular region and not in the
cortical tissue of tomato parasitized by M. lucknowica. In fact, the nematodes were able
to initiate and maintain healthy giant cells in resistant roots for about 21 days before
visible signs of deterioration occurred especially vacuolation and cell wall thinning,
leading to giant cell collapse. Tracking the movement of nematodes and formation of
giant cells within such plant is expected to reveal the nature/mechanism of rest to
nematode. The formation of giant cells in the proximity of each nematode causes
aberration of the vascular region. Consequently, the vascular region of smaller roots
were badly damaged due to the giant cell formation.
Though lectins-based resistance has been studied genetically and has been
used extensively in breeding, little was known about mechanism of lectin mediated
resistance. Mechanism of SRL1 and RVL1 gene mediated resistance in plants have
been reported (Bhagat 2010; Patil, 2011; Kolekar, 2012), post infection resistance in
which nematodes are able to penetrate roots but fail to develop. Post infection
resistance is often associated with an early hypersensitive reaction (HR) meadiated cell
death, in which rapid localized cell death in root tissue around the nematode prevents
formation of a developed feding site, leading to resistance. Tomato (Dropkin, 1969;
Williamson, 1999) plants that are resistant to show typical HR upon avirulent M.
incognita infection observed as early as 24 h post inoculation. Whereas in soybean,
pepper and coffee the HR was visible at one to six day after inoculation (Kaplan et al.,
1979; Pegard et al., 2005; Anthony et al., 2005).
Plant lectins can neither bind to glycoconjugates on the fungal membranes nor
penetrate the cytoplasm owing to the cell wall barrier (Horisberger and Vonlanthen,
1977). However, there may be indirect effects produced by the binding of lectins to
carbohydrates on the fungal cell wall surface of S. rolfsii, R. solani, F. oxysporum, T.
viride and P. lilacinus. Chitinase-free chitin-binding stinging nettle (Urtica dioica lectin)
impeded fungal growth. Cell wall synthesis was interrupted because of attenuated chitin
synthesis and/or deposition (Van Parijs et al., 1991; Broekaert et al., 1992).
Selitrennikoff (2001), reported that polysaccharide chitin is constituent of fungi cell wall
and chitin-binding lectins showed antifungal activity; impairment of synthesis and/or
deposition of chitin in cell wall may be the reasons of antifungal action. Inhibition of
fungal growth by the action of lectins appears to be due to inhibition of spore
germination as well as the growth of the mycelium. The exact mechanism of action has
not yet been elucidated.
In present investigation, it was observed that SRL1 and RVL1 lectins bound to
fungal cell, possibly due to modification of fungal membrane structure. It was found that
RVL1 and SRL1 lectin bound primarily to hyphal tips and septa. Moreover, exposure of
fungal mycelium to FITC-RVL1 and SRL1 inhibited hyphal extention, leading to the
suggestion that lectins from plant tuber and fungi have a role in protecting the soil
pathogens (Mirelman et al., 1975).
spore and phialides wall of T. viride. RVL1 strongly bound over the entire surface of the
spores and phialides on the other hand, bound in descrete patches over the whole
mycelium than SRL1. The observations are in agreement with the specific carbohydrate
metabolism of lichens revealed by Galun et al. (1976) indicating that the use of FITC-
conjugated lectins is a useful tool for probing hyphal wall components. The lack of WGA
binding to the chitin-less Phytophthora strongly supports the above indication.
The interpretation of binding patterns obtained to all fungi with FITC-RVL1 and
SRL1 is somewhat similar. But it also indicated that there were obvious differences
among the fungi tested in respect to hyphal wall structure. These lectins directly inhibit
fungal growth by modifying fungal membrane structure and or permeability. The lack of
RVL1 and SRL1 binding to any of the fungi serves as a negative control, indicating that
a lectin which binds specifically to a certain charbohydrates complex, sugar monomers.
It is therefore hoped that in future the availability of additional lectins with restricted
binding specificities will permit further characterization of the hyphal walls of pathogenic
fungi.
posterior region (phasmids). Wuyts, et al. (2009) showed binding of ConA and WGA in
the head region, at the excretion pore, the pores of the reproduction system and
phasmids of R. similis. WGA binds to the amphids or the head region in general, and to
the excretion pore. Aumann and Wyss (1989) mentioned the binding of ConA, WGA
and HPA to the spicule pores of H. schachtii. Coomans and De Grisse (1981) described
the spicules as chemoreceptors that produce secretions that can be labelled by lectins.
These chemoreceptors are, however, used only to test the surroundings of the vagina.
In long-distance migration towards a female nematode, sex pheromones are detected
by the amphids.
1. Identification of receptor sites for SRL1 and RVL1 involved in suppression of soil-
borne pathogens.
2. Detailed study for mode of toxicity of SRL1 and RVL1 on plant pathogenic fungi
and bacteria.
3. Screening of SRL1 and RVL1 against other plant pathogenic fungi, bacteria and
nematodes.
5. Evaluation of srl1 and rvl1 expressed transgenic tomato plants with other soil-
borne pathogens
6. SUMMARY AND CONCLUSIONS
The present investigation was undertaken during the period from 2010-2013 at
the Department of Plant Pathology as well as Department of Biotechnology,
University of Agricultural. Sciences, Dharwad, which included determining the efficacy
of E. coli-expressed SRL1 (a fungal lectin) and RVL1 (a plant lectin) against soil-
borne pathogens affecting tomato also against some fungal and bacterial antagonists.
The specific objectives were to screen the srl1 and rvl1 expressing transgenic tomato
plants of different events against species of Fusarium, Ralstonia and Meloidogyne
causing wilt complex in tomato and to elucidate their mechanisms of biocontrol. The
salient features of the findings are summarized below:
Expression of SRL1and RVL1 was checked with total protein isolated from
induced E. coli BL21(DE3)pLysS cells carrying respective recombinant expression
vectors. Recombinant E. coli clones had a total protein content of 12 mg/ml compared
to 10.00 mg/ml in control. Both RVL1 and SRL1 proteins showed 28.2 kDa and 19.5
kDa bands, respectively on SDS-PAGE.
E. coli expressed SRl1 lectin was purified through His-tag purification kit.
Purified SRL1 showed 19.5 kDa amplicon on SDS-PAGE. A polyclonal antibody was
raised against SRL1 by immunizing rabbits with pure antigen (SRL1). The specificity
of antiserum produced against SRL1 was tested by DAC- ELISA. It was sensitive and
precise enough to detect the antigen up to 65536 dilutions.
226
RVL1 and SRL1 were evaluated for antibacterial activity against Ralstonia
solanacearum by well diffusion and disc diffusion assay. RVL1 was found to be more
potent against the bacterium compared to SRL1. The antibacterial efficacy of the
RVL1 and SRL1 was found to be moderate against R. solanacearum. MIC which
corresponds to the minimum lectin concentration capable of inhibiting the visible
growth of the R. solanacearum was 0.625 mg/ml for both SRL1 and RVL1 with 1.87
and 1.56 mg/ml of MBC which corresponded to the minimum concentration of the
lectin capable of reducing the number of cfu for 0.1% of the initial inocula.
Interaction effect of lectins and concentrations showed RVL1 (3.6 mg/ml) was
significantly superior to SRL1 with an inhibition zone of 2.13 cm. RVL1 and SRL1
gradually reduced the growth of R. solanacearum from 1.225 and 1.146 to 0.865 and
0.849 OD, respectively.
protein, showed maximum egg hatching inhibition and juvenile mortality after 48 h of
incubation at 1: 25 dilution. However, other dilutions (1: 50, 1: 75 and 1: 100) also
showed high mortality and egg hatching inhibition.
Efficacy of six bacterial and five fungal antagonists was studied against
F. oxysporum, S. rolfsii and R. solani. Among eleven bioagents, T. viride and
P. fluorescens strains were found significantly superior in inhibiting the growth of
pathogens.
RVL1 and SRL1 were evaluated against P. fluorescens and B. subtilis strains
by disc diffusion assay. MIC and MBC values were determined. SRL1 and RVL1
showed good activity on P. fluorescens and B. subtillis strains with MIC of 0.63 to
2.50 and 0.63 to 1.25 mg/ml and MBC of 1.94 to 3.14 and 1.78 to 3.08 mg/ml.
SRL1 and RVL1 were found to possess broad spectrum activity against all
tested bacterial strains with inhibition zones in the range of 0.87 to 1.79 cm. RVL1
showed maximum inihibition zone against P. fluorescens strains than B. subtilis
strains. Sensitivity of SRL1 and RVL1 on P. fluorescens (1.227 and 1.018 OD) and B.
subtilis (1.635 and 1.452 OD) growth was gradually reduced.
The crude extract of protein obtained from rvl1 transgenic tomato plants
contained a total lectin activity of 0.40 to 1.60 x 103, whereas srl1-transgenic plant
contained 0.40 to 1.61 x 103. The specific activity was 0.18 to 0.40 x 102 units for rvl1
and 0.18 to 0.76 x 102 units for srl1.
Efficacy of eight PCR confirmed rvl1 and srl1 transgenic events for
suppression of vascular pathogens and their interactions were studied. Results
indicated a significant increase in plant height and biomass with less disease severity
and root-knot index in SRL1-T0(21) and RVL1-T0(28) events.
srl1 and rvl1 transgenic tomato plants, challenged with Fusarium, Ralstonia
and Meloidogyne individually and in combinations showed higher defense enzymes
activities of peroxidase, polyphenol oxidase, and total phenol.
Toxicity effects of RVL1 and SRL1 transgenic tomato lines on infection and
development of J2 of M. incognita was observed. Infective second stage juveniles
were observed only in the cortex of tomato roots, and some of the roots showed that
juveniles had entered only partially into the root tissue. Highest number of sausage
shaped juveniles varied significantly from 9.67 to 25.67 in RVL1-T0(20) and 9.33 to
24.67 in SRL1-T0(116) after 7, 11 and 15 dai observed in root tissue.
It was found that giant cells wall fragments are thickend and had dense cytoplasm.
Also, multinucleate condition was observed.
Plant height and plant biomass significantly increased with less gall index in
SRL1-T0(21) and RVL1-T0(28) transgenic events. In general, control plants showed
the gall index of 9 which fell under the highly susceptible category, whereas
transgenic lines were classified as moderately resistant with a gall index of 3 to 5.
Binding of SRL1 and RVL1 lectins in nematode was found at head region, mid
gut of the alimentary-tract, excretory pore and extended to the posterior regions
(phasmids). But the principal lectin-binding sites were the pores or the secretions of
the amphids and excretory pore. Binding was not observed in nematode gut
incubated with FITC-RVL1 complexed with mucin and FITC-BL21 (bacterial control).
This is the first report on the antifungal and antibacterial activity of RVL1 and
SRL1. However, further study is required to evaluate the toxicity of these compounds.
230
Conclusions
Expression of SRL1 and RVL1 was checked with total protein isolated from
induced E. coli BL21(DE3) pLysS.
E. coli expressed RVL1 and SRL1 showed 28.2 kDa and 19.5 kDa amplicons
on SDS-PAGE. SRL1 was purifeid through His-tag purification kit.
Polyclonal antibody was raised against SRL1 by immunizing rabbits with pure
antigen (SRL1) and the specificity of the antiserum (anti-SRL1) was
determined by DAC-ELISA.
SRL1 and RVL1 are more potent inhibitor for soil-borne pathogens.
SRL1 and RVL1 also showed inhibition agaisnts fungal and bacterial
antagonists.
Toxicity effects of rvl1 and srl1 transgenic tomato lines on infection and
development of J2 of M. incognita was studied.
Mode of action of SRL1, RVL1 and anti-SRL1 on soil borne fungi was
elucidated. FITC-labelled lectins bound to all fungi, primarily to hyphal wall,
septum, and spores of respective fungus.
Abd-Elmaksoud, M., Abd-Alkawy, S., El-Kousy, Rizk, N. and Al-Saman, M., 2005,
Extraction and purification of lectin from Jatropha curcas and its
application on banana root-knot nematode. Minufiya J. Agric. Res., 30(5):
1443-1456.
Alcaraz, L. E., Blanco, S. E., Puig, O. N., Tomas, F. and Ferreti, F. H., 2000,
Antibacterial activity of flavonoids against methicillin-resistant
Staphylococcus aureus strains. J. Theoretical Biol., 205: 231–240.
Amano, K., Katayama, H., Saito, A., Akikazu, A. and Yoshiho, N., 2012, Aleuria
aurantia lectin exhibits antifungal activity against Mucor racemosus.
Biosci. Biotechnol. Biochem., 76(5): 967-970.
Anthony, F., Topart, P., Martinez, A., Silva, M. and Nicole, M., 2005, Hypersensitive-
like reaction conferred by the Mex-1 resistance gene against Meloidogyne
exigua in coffee. Pl. Pathol., 54: 476–482.
Ashby, S. F., 1927, Macrophomina phaseolina (Maubl.) Comb. The pycnidial stage
of Rhizoctonia bataticola (Toub.) Butl. Trans. British Mycol. Soc., 12: 141-
147.
Aumann, J. and Wyss, U., 1989, Lectin binding sites on mobile stages of Heterodera
schachtii Schmidt (Nematoda: Heteroderidae). Nematologica, 33(4): 410-
418.
Aumann, J., Robertson, W. M. and Urs, W., 1991, Lectin binding to cuticle exudates
of sedentary Heterodera schachtii (Nematoda: Heteroderidae). Revue
Nematol., 14(1): 113-118.
233
Ayouba, A., Causse, H., Van Damme, E. J. M., Peumans, W. J., Bourne, Y.,
Cambillau, C. and Rouge, P., 1994, Interactions of plant lectins with the
components of the bacterial cell wall peptidoglycan, Biochem. Syst. Ecol.,
22: 153–159.
Barak, R. and Chet, I., 1990, Lectin of Sclerotium rolfsii: its purification and possible
function in fungal-fungal interaction. J. Appl. Bacteriol., 69: 101–112.
Barak, R., Elad, Y., Mirelman, D. and Chet, I., 1985, Lectins: a possible basis for
specific recognition in the interaction of Trichoderma and Sclerotium
rolfsii. Phytopathology, 75(4): 458-462.
Barre, A., Van Damme, E. J., Peumans, W. J. and Rouge, P., 1996, Structure-
function relationship of monocot mannose-binding lectins. Plant Physiol.,
112(4): 1531-1540.
Bhagat, Y. S., 2010, Expression of rvl1 and srl1 in transgenic tomato lines and their
toxicity to Meloidogyne incognita and Bemisia tabaci. M. Sc. (Agri.)
Thesis, Univ. Agril. Sci., Dharwad, Karnataka (India).
Bhanu Priya, D., Somasekhar, N., Prasad, J. S. and Kirti, P. B., 2011, Transgenic
tobacco plants constitutively expressing Arabidopsis NPR1 show
enhanced resistance to root-knot nematode, Meloidogyne incognita. BMC
Res. Notes, 4(1): 231-232.
234
Bhat, G. G., Shetty, K. N., Nagre, N. N., Neekhra, V., Lingaraju, S., Bhat, R. S.,
Inamdar, S. R., Suguna, K. and Swamy, B. M., 2010a, Purification,
characterization and molecular cloning of a monocot mannose binding
lectin from Remusatia vivipara with nematicidal activity. Glycoconj. J.,
27(3): 309-320.
Bhat, R. S., Chandrashekar, T. M., Basingi, S. M., Mallesh, S. B. and Lingaraju, S.,
2010b, Cloning of Sclerotium rolfsii lectin gene and its nematicidal activity.
Curr. Sci., 98(9): 1185-1186.
Bhat, R. S., Neekhra, V., Mallesh, S. B., Lingaraju, S., Bhat, G., Basingi, S. M.,
Swamy, B. M., Kuruvinashetti, M. S. and Chandrashekar, T. M., 2009,
Plant tuber and fungal lectins and their use in nematode control. Indian
Patent Application, 122/CHE/2009 (published in The Patent Office
Journal, 27/11/2009): 11123.
Bhat, R. S., Spurthi, N., Pradeep, S. M., Bhat, G., Mallesh, S. B., Lingaraju, S. and
Kuruvinashetti, M. S., 2010, Nematicidal activity of tarin1 from Colocasia
esculenta L. Schott. (Personal communication).
Birck, C., Damian, L., Marty-Detraves, C., Lougarre, A., Schulze-Briese, C., Koehl,
P., Fournier, D., Paquereau, L. and Samama, J. P., 2004, A new lectin
family with structure similarity to actinoporins revealed by the crystal
structure of Xerocomus chrysenteron lectin XCL. J. Mol. Biol., 344(5):
1409-1420.
Bird, A. F., Bonig, J. and Bacic, A., 1988. A role of the excretory system in
secernentea nematodes. J. Nematol., 20: 493-496.
Boleti, A. P., Freire, M. G., Coelho, M. B., Silva, W., Baldasso, P. A., Gomes, V. M.,
Marangoni, S., Novello, J. C. and Macedo, M. L., 2007, Insecticidal and
antifungal activity of a protein from Pouteria torta seeds with lectin-like
properties. J. Agric. Food. Chem., 55: 2653–2658.
235
Bonants, P. J. M., Fitters, H., Thijs, E. D., Belder, C., Waalwijik, J. W. and Henfling,
D. M., 1995, A basic serine protease from Paecilomyces lilacinus with
biological activity against Meloidogyne hapla eggs. Microbiololgy, 141:
775–784.
Booth, C., 1971, The genus Fusarium, Commonwealth Mycological Institute, Kew,
Surrey, England, p. 88.
Boulianne, R. P., Liu, Y., Aebi, M., Lu, B. C. and Kues, U., 2000, Fruiting body
development in Coprinus cinereus: regulated expression of two galectins
secreted by a non-classical pathway. Microbiology, 146: 1841–1853.
Bourne, Y., Ayouba, A., Rouge, P. and Cambillau, C., 1994, Interaction of a legume
lectin with two components of the bacterial cell wall, a crystallographic
study. J. Biol. Chem., 269: 9429-9435.
Boyd, W. C. and Shapleigh, E., 1954, Antigenic relations of blood group antigens as
suggested by tests with lectins. J. Immunol., 73(4): 226-231.
Bridge, J. and Page, S. L. J., 1982, The rice root-knot nematode, Meloidogyne
graminicola, on deep water rice (Oryza sativa subsp. indica). Revue
Nematol., 5: 225–232.
Broekaert, W. F. and Peumans, W. J., 1986, Lectin release from seeds of Datura
stramonium and interference of the Datura stramonium lectin with
bacterial
236
motility. In: Lectin Biol. Biochem. Clin. Biochem. Ed. Bog-Hansen, T. C. and Van
Driessche, E., Berlin, pp. 57–66.
Broekaert, W. F., Marien, W., Terras, F. R. G., De Bolle, M. F. C., Proost, P. and Van
Damme, J., 1992, Antimicrobial peptides from Amaranthus caudatus
seeds with sequence homology to the cysteine/glycine-rich domain of
chitin binding proteins, Biochemistry, 31: 4308–4314.
Broglie, K., Chet, I., Holliday, M., Cressman, R., Biddle, P., Knowlton, S., Mauvais,
C. J. and Broglie, R., 1991, Transgenic plants with enhanced resistance to
the fungal pathogen Rhizoctonia solani. Science, 254: 1194–1197.
Burrows, P. R., Barker, A. D. P., Newell, C. A. and Hamilton, W. D. O., 1998, Plant-
derived enzyme inhibitors and lectins for resistance against plant-parasitic
nematodes in transgenic crops. Pesticide Sci., 52(2): 176-183.
Byrd, D. W., Kirkpatrick, T. and Barker, K. R., 1983, An improved technique for
clearing and staining plant tissue for detection of nematodes. J. Nematol.,
15: 142–143.
Byrde, R. J., Harris, J. F. and Woodcock, D., 1956, Fungal detoxication, the
metabolism of (2-naphthyloxy)-n-alkylcarboxylic acids by Aspergillus
niger. Biochem. J., 64(1): 154–160.
Cabib, E., 1987, The synthesis and degradation of chitin. Adv. Enzymol., 59: 59-101.
Callow, J. A., 1977, Recognition, resistance, and role of plant lectins in hostparasite
interactions. Adv. Bot. Res., 4: 1-49.
237
Candy, L., Peumans, W. J., Menu-Bouaouiche, L., Astoul, C. H., Van Damme, J.,
Van Damme, E. J. M., Erard, M. and Rouge, P., 2001, The Gal/GalNAc-
specific lectin from the plant pathogenic Basidiomycete Rhizoctonia solani
is a member of the ricin-B family. Biochem. Biophys. Res. Commun.,
282(3): 655-661.
Chan, Y. L., Yang, A. H., Chen, J. T., Yeh, K. W. and Chan, M. T., 2010,
Heterologous expression of taro cystatin protects transgenic tomato
against Meloidogyne incognita infection by means of interfering sex
determination and suppressing gall formation. Pl. Cell Rep., 29(3): 231-
238
Chandrashekar, T. M., 2007, Molecular cloning and expression of lectin gene (srl)
from Sclerotium rolfsii Sacc. M. Sc. Thesis, Univ. Agril. Sci., Dharwad,
(India).
Chao, Q., Casalongue, C., Quinn, J. M. and Etzler, M. E., 1994, Expression and
partial characterization of Dolichos biflorus seed lectin in Escherichia coli.
Arch. Biochem. Biophys., 313(2): 346-350.
Chattopadhyay, D., Mukherjee, T., Pal, P., Saha, B. and Bhadra, R., 1998. Altered
membrane permeability as the basis of bactericidal action of methdilazine.
J. Antimicrobial Chemotheraphy, 42: 83–86.
Chattopadhyay, T. K., Lisgarten, J. N., Brechtel, R., Rüdiger, H. and Palmer, R. A.,
1999, Crystallization of Pleurotus ostreatus (oyster mushroom) lectin. Acta
Crystallogrphy Biol. Crystallogrphy, 55(9): 1589-1590.
238
Chen, J., Liu, B., Ji, N., Zhou, J., Bian, H., Li, C., Chen, F. and Bao, J., 2009, A novel
sialic acid-specific lectin from Phaseolus coccineus seeds with potent
antineoplastic and antifungal activities. Phytomedicine, 16: 352-360.
Chen, Z., Kai, G., Liu, X., Lin, J., Sun, X. and Tang, K., 2005, cDNA cloning and
characterization of a mannose-binding lectin from Zingiber officinale
Roscoe (ginger) rhizomes. J. Biosci, 30(2): 101-105.
Chrispeels, M. J. and Raikhel, N. V., 1991, Lectins, lectin genes, and their role in
plant defense. Plant Cell, 3(1): 1-9.
Chung, N., Mao, C., Heitman, J., Hannun, Y. A. and Obeid, L. M., 2001,
Phytosphingosine as a specific inhibitor of growth and nutrient import in
Saccharomyces cerevisiae. J. Biol. Chem., 276(38): 35614–35621.
Ciopraga, J., Gozia, O., Tudor, R., Brezuica, L. and Doyle, R. J. 2006, Fusarium sp.
Growth inhibition by wheat germ agglutinin. Biochimica et Biophysica
Acta. 1428: 424-432.
Cooper, D. N. W., Boulianne, R. P., Charlton, S., Farrell, E. M., Sucher, A. and Lu, B.
C., 1997, Fungal galectins, sequence and specificity of two isolectins from
Coprinus cinereus. J. Biol. Chem., 272(3): 1514-1521.
Courvalin, P., Goldstein, F., Philippon, A. and Sirot, J., 1985, L‘antibiogramme.
Paris, Bruxelles: MPC-Videocom.
Czapla, T. H. and Lang, B. A., 1990, Effect of plant lectins on the larval development
of European corn borer (Lepidoptera: Pyralidae) and southern corn
rootworm (Coleoptera: Chrysomelidae). J. Econ. Entomol., 83(6): 2480-
2485.
Damico, D. C. S., Freire, M. G. M., Gomes, V. M., Toyama, M. H., Marangoni, S.,
Novello, J. C. and Macedo, M. L. R., 2003, Isolation and characterization
of a lectin from Annona muricata seeds. J. Protein Chem., 22: 655-661.
Davis, E. L., Kaplan, D. T., Permar, T. A., Dickson, D. W. and Mitchell, D. J., 1988,
Characterization of carbohydrates on the surface of second-stage
juveniles of Meloidogyne spp. J. Nematol., 20(4): 609-619.
De Hoff, P. L., Brill, L. M. and Hirsch, A. M., 2009, Plant lectins: the ties that bind in
root symbiosis and plant defense. Mol. Gen. Genotype., 282: 1–15.
Does, M. P., Petra, M. H., Henk, L. D. and Ben, J. C. C., 1999, Processing, targeting
and antifungal activity of stinging nettle agglutinin in transgenic tobacco.
Pl. Physiol., 120: 421-431.
240
Domsch, K. H., Gams, W. and Anderson, T. H., 1980, Compendium of Soil Fungi
Vol. I., Academic Press, London, p. 859.
Doyle, R. J., Nedjat-Haiem, F., Keller, K. F. and Frasch, C. E., 1984, Diagnostic
value of interactions between members of the family Neisseriaceae and
lectins. J. Clin. Microbiol., 19(3): 383-387.
Dropkin, V. H., 1969, The necrotic reaction of tomatoes and other hosts resistant to
Meloidogyne: reversal by temperature. Phytopathology, 59: 1632–1637.
Dunne, C., Cronin, D. and Moknne–Loccoz, Gara, F. O., 1998, Biological control of
phytopathogens by phloroglucinol and hydrolytic enzyme producing
bacterial inoculants. Bull. OILB/SROP, 21: 19-25.
Edna, S., Ilan, C. and Yitzhak, S., 2009, Improved attachment and parasitism of
Trichoderma on Meloidogyne javanica in vitro. European J. Pl. Pathol.,
123: 291-299.
Elad, Y., Hadar, Y., Chet, I. and Henis, Y., 1982, Prevention, with Trichoderma
harzianum Rifai aggr., of reinfestation by Sclerotium rolfsii Sacc. and
Rhizoctonia solani Kühn of soil fumigated with methyl bromide, and
improvement of disease control in tomatoes and peanuts. Crop Prot., 1(2):
199-211.
Elad, Y., Rina, B. and Ilan, C., 1983, Possible role of lectins in mycoparasitism. J.
Bacteriol., 154(3): 1431-1435.
241
Elsherif, M. and Grossman, P., 1996, Role of biotic factors in the control of soil-borne
fungi by fluorescent psuedomonads. Microbiol. Res., 151: 351-357.
Etzler, M. E., 1985, Plant lectins: molecular and biological aspects. Ann. Rev. Pl.
Physiol., 36(1): 209-234.
Fang, E. F., Lin, P., Wong, J. H., Tsao, S. W. and Ng, T. B., 2010, A lectin with anti-
HIV-1 reverse transcriptase, antitumor, and nitric oxide inducing activities
from seeds of Phaseolus vulgaris cv. extralong autumn purple bean. J.
Agric. Food Chem., 58(4): 2221-2229.
Fargette., Phillipsm, S., Blok, V. C., Waughr and Trudgilld, L., 1996, An RFLP study
of relationships between species, populations and resistance-breaking
lines of tropical species of Meloidogyne. Fzindnrnerttd arid Applied
Neiitatol., 19: 193- 200.
Forrest, J. M. S., 1988, Changes in the structure of amphidial exudates and the
nature of lectin labelling on freshly hatched, invaded andemigrant second
stage juveniles of Globodera rostochiensis. Nematologica, 34: 422–431.
Fox, E. M. and Howlett, B. J., 2008, Secondary metabolism: regulation and role in
fungal biology. Curr. Opinion in Microbiol., 11: 481–487.
Freire, M. G. M., Gomes V. M., Corsini, R. E., Machado, O. L. T., De Simone, S. G.,
Novello, J. C., Marangoni, S. and Macedo, M. L. R., 2002, Isolation and
partial characterization of a novel lectin from Talisia esculenta seeds that
interferes with fungal growth. Pl. Physiol. Biochem., 40: 61-68.
Fuller, V. L., Lilley, C. J., Atkinson, H. J. and Urwin, P. E., 2007, Differential gene
expression in Arabidopsis following infection by plant-parasitic nematodes
Meloidogyne incognita and Heterodera schachtii. Mol. Pl. Pathol., 8(5):
595-609.
Gabius, H. J., Gabius, S., Zemlyanukhina, T. V., Bovin, N. V., Brinck, U., Danguy, A.,
Joshi, S. S., Kayser, K., Schottelius, J. and Sinowatz, F., 1993, Reverse
lectin histochemistry: design and application of glycoligands for detection
of cell and tissue lectins. Histol. Histopathol., 8(2): 369.
Galun, M., Braun, A., Frensdorif, E., Galun, E., 1976, Hyphal walls of isolated lichen
fungi. Autoradiographic localization of precursor incorporation and binding
of fluorescein-conjugated lectins. Arch. Microbiol. 108: 9-16.
Gaofu, Q., Shiqing, M., Fayin, Z., Zhiniu, Y. and Xiuyun, Z., 2008, In vitro
assessment of plant lectins with anti-pinwood nematode activity. J.
Invertebr. Pathol., 98(1): 40-45.
Giollant, M., Guillot, J., Damez, M., Dusser, M., Didier, P. and Didier, E., 1993,
Characterization of a lectin from Lactarius deterrimus (Research on the
possible involvement of the fungal lectin in recognition between
mushroom and spruce during the early stages of mycorrhizae formation).
Pl. Physiol., 101(2): 513-522.
Glass I. I. W. F., Briggs, R. C. and Hnilica, L. S., 1981, Use of lectins for detection of
electrophoretically separated glycoproteins transferred onto nitrocellulose
sheets. Anal. Biochem., 115(1): 219-221.
243
Gokte, N. and Swarup, 1988, On the potential of some bacterial biocides against
root-knot and cyst nematodes. Indian J. Nematol., 18: 152-153.
Golan, B. R., Mirelman, D. and Sharon, N., 1978, Studies on growth inhibition by
lctins of Penicillia and Aspergilli. Arch. Microbiol., 116: 119-124.
Gold, E. R. and Balding, P., 1975, Receptor-specific proteins: plant and animal
lectins, Amsterdam Elsevier, USA.
Goldhar, J., 1995, Erythrocytes as target cells for testing bacterial adhesins.
Methods Enzymol., 253: 43-50.
Goldstein, I. J., Hughes, R. C., Monsigny, M., Osawa, T. and Sharon, N., 1980, What
should be called a lectin? Nature, 285(5760): 66-66.
Gozia, O., Ciopraga, J., Bentia, T., Lungu, M., Zamfirescu, I., Tudor, R., Roseanu, A.
and Nitu, F., 1993, Antifungal properties of lectin and new chitinases from
potato tubers. C. R. Acad. Sci. III., 316(8): 788-792.
Green, J. R. and Northcote, D. H., 1978, The structure and function of glycoproteins
synthesized during slime-polysaccaride production by membrane of the
root cap cells of maize (Zea mays). Biochem. J., 170(3): 599-608.
Griffin, D. H., 1993, Fungal Physiology-2. Ed. Wiley-Liss, New York, p. 458.
Grison, R., Grezes-Besset, B., Schneider, M., Lucante, N., Olsen, L., Leguay, J. and
Toppen, A., 1996, Field tolerance to fungal pathogens of Brassica napus
constitutively expressing a chimeric chitinase gene. Nature Biotechnol.,
14: 643–646.
Guillot, J. and Konska, G., 1997, Lectins in higher fungi. Biochem. Syst. Ecol., 25:
203-230.
Hamshou, M., Van Damme, E. J. and Smagghe, G., 2009, Entomotoxic effects of
fungal lectin from Rhizoctonia solani towards Spodoptera littoralis. Mycol.
Res., 114(1): 34-40.
Hinch, J. M. and Clarke, A. E., 1980, Adehesion of fungal zoospores to root surfaces
is mediated by carbohydrate determinants of the root slime. Phisiol. Pl.
Pathol., 16: 303-307.
Hobbs, H. A., Reddy, D. V. R., Rajeshwari, R. and Reddy, A. S., 1987, Use of direct
antigen coating and protein A coating ELISA procedures for detection of
three peanut viruses. Pl. Dis., 71: 747-749.
Hogervorst, P. A., Ferry, N., Gatehouse, A. M., Wackers, F. L. and Romeis, J., 2006,
Direct effects of snowdrop lectin (GNA) on larvae of three aphid predators
and fate of GNA after ingestion. J. Insect Physiol., 52: 614–624.
Horisberger, M. and Vonlanthen, M., 1977, Location of mannan and chitin on thin
secretions of budding yeasts with gold marker. Arch. Micobiol., 115:1-6.
245
Hostetter, M. K., 1994, Adhesins and ligands involved in the interaction of Candida
spp. with epithelial and endothelial surfaces. Clin. Microbiol. Rev., 7(1):
29-42.
Huang, X., N. Zhao. and Zhang, K., 2004, Extracellular enzymes serving as
virulence factors in nematophagous fungi involved in infection of the host.
Res. Microbiol., 155: 811-816.
Inbar, J. and Chet, I., 1994, A newly isolated lectin from the plant pathogenic fungus
Sclerotium rolfsii: purification, characterization and role in mycoparasitism.
Microbiology, 140(3): 651-657.
Iris, C. Z., Marta, A. V. and Maria, I. I., 2005, Antibacterial activity of Zuccagnia
punctata ethanolic extracts. J. Ethnopharmacol., 102: 450–456.
Jammes, F., Lecomte, P., Almeida-Engler, J., Bitton, F., Martina Magniette, M. L.,
Renou, J. P., Abad, P. and Favery, B., 2005, Genome-wide expression
profiling of the host response to root-knot nematode infection in
Arabidopsis. Plant J., 44(3): 447- 458.
Jatala, P., 1986, Biological control of plant parasitic nematodes. Ann. Rev.
Phytopathol., 24: 453-489.
Johnson, L. F. and Curl, E. A., 1972, Methods of research on the ecology of soil
borne plant pathogens. Burges Publishing Company, Minnesota, USA.,
pp. 6–8.
Kamalakannan, A., Mohan, L., Amutha, G., Chitra, K., Pradhiba, V. K., Rajinmala, N.,
Moreeswari, P. and Angayarkanni, T., 2003, Effect of volatile and diffusible
246
Kaplan, D. T., Thompson, I. J. and Van Gundy, S. D., 1979, Histological study of
compatible and incompatible interaction of soybeans and Meloidogyne
incognita. J. Nematol., 11: 338–343.
Kaur, M., Singh, K., Rup, P. J., Kamboj, S. S., Saxena, A. K., Sharma, M., Bhagat,
M., Sood, S. K. and Singh, J., 2006, A Tuber Lectin from Arisaema
jacquemontii Blume with Anti-insect and Anti-proliferative Properties. J.
Biochem. Mol. Biol., 39(4): 432-440.
Kavitha, M., Gopal, K., Anandam, R. J. and Prasad Babu, G., 2004, Evaluation of
native isolates of Trichoderma in the control of dry root-rot in Acid Lime. J.
Mycol. Pl. Pathol., 34: 384-386.
Kawagishi, H., 1995, Mushroom lectins. Food Rev. Int., 11(1): 63–68.
Kheeree, N., Sangvanich, P., Puthong, S. and Karnchanatat, A., 2010, Antifungal
and antiproliferative activities of lectin from the rhizomes of Curcuma
amarissima Roscoe. Appl. Biochem. Biotechnol., 162(3): 912-925.
Kim, Y. H., Woloshuk, C., Cho, E., Bae, J., Song, Y. S. and Huh, G., 2007, Cloning
and functional expression of the gene encoding an inhibitor against
Aspergillus flavus - amylase, a novel seed lectin from Lablab purpureus
(Dolichos lablab). Pl. Cell Rep., 26(4): 395-405.
Kulkarni, S. and Sagar, S. D., 2006, Biological Control of Plant Diseases- An Indian
Perspective. In: Plant Protection in New Millennium. Vol. II. Ed. Ashok V.
Gadewar and B. P. Singh., Satish Serial Publishing, New Delhi, pp.163-
196.
Laemmli, U. K., 1970, Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature, 227(5259): 680-685.
Lam, S. K. and Ng, T. B., 2011, Lectins: production and practical applications. Appl.
Microbiol. Biotechnol., 10:1-11.
Levery, S. B., Toledo, M. S., Doong, R. L., Straus, A. H. and Takahashi, H. K., 2000,
Comparative analysis of ceramide structural modifications found in fungal
cerebrosides by electrospray tandemmass spectrometry with low energy
collision-induced dissociation of Liþ adduct ions. Rapid Commun. Mass
Spectrom., 14: 551–563.
Levery, S. B., Momany, M., Lindsey, R., Toledo, M. S., Shayman, J. A., Fuller, M.,
Brooks, K., Doong, R. L., Straus, A. H. and Takahashi, H. K., 2002,
Disruption of the glucosylceramide biosynthetic pathway in Aspergillus
nidulans and Aspergillus fumigatus by inhibitors of UDP Glc: ceramide
glucosyltransferase strongly affects spore germination, cell cycle, and
hyphal growth. FEBS. Lett., 525(1–3): 59–64.
Li, Tingting., Yin, Xiaoli., Liu, Dongliang., Ma, Xiaojin., Lv, Hui. and Sun, Surong.,
2012, Isolation and characterization of a novel lectin with antifungal and
antiproliferative activities from Sophora alopecuroides seeds. Acta
Biochimica et Biophysica Sinica, pp. 1-8.
Liener, I. E. and Hill, E. G., 1953, The effect of heat treatment of the nutritive value
and hemagglutinating activity of soybean oil meal: one figure. J. Nutr.,
49(4): 609 -620.
Lis, H. and Sharon, N., 1981, Lectins in higher plants. In: The Biochemistry of Plants.
Ed. Marcus, A., Academic Press, New York, 6: 371-447.
Lis, H. and Sharon, N., 1986, Lectins as molecules and as tools. Annu. Rev.
Biochem., 55(1): 35-67
Lis, H. and Sharon, N., 1998, Lectins: carbohydrate-specific proteins that mediate
cellular recognition. Chem. Rev., 98 (2): 637-674.
249
Liu, B., Peng, H., Yao, Q., Li, J., Van Damme, E.J.M., Balzarini, J. and Bao, J., 2009,
Bioinformatics analyses of the mannose-binding lectins from Polygonatum
cyrtonema, Ophiopogon japonicas and Liparis noversa with
antiproliferative and apoptosis-inducing activities. Phytomedicine 16: 601–
608.
Livingston, D. M., 1974, Methods in enzymology. Ed. Jakoby, W. B. and Wilchek, M.,
Academic Press, New York, 34: 723-724.
Longman, D. and Callow, J. A., 1987, Specific saccharide residues are involved in
the recognition of plant root surfaces by zoospores of Pythium
aphanidermatum. Physiol. Mol. Plant Pathol., 30: 139-150.
Macedo, M. L. R., Freire, M. D. M., Novello, J. C. and Marangoni, S., 2002, Talisia
esculenta lectin and larval development of Callosobruchus maculatus and
Zabrotes subfasciatus (Coleoptera: Bruchidae). Biochimica et biophysica
acta, 1571: 83–88.
Mallesh, S. B., 2008, Plant growth promoting rhizobacteria, their characterization and
mechanisms in the suppression of soil borne pathogens of coleus and
ashwagandha. Ph.D Thesis, Univ. Agril. Sci., Dharwad, Karnataka (India).
Manod, J., 1949, The growth of bacterial cultures. Annu. Rev. Microbiol., 3: 371-394.
Maria, G. F. M., Valdirene, M. G., Rosely, E. C., Olga, L. T. M., Salvatore , G. S.,
Jose, C. N., Srgio, M. and Maria, L. R. M., 2002, Isolation and partial
250
Mauch, F., Mauch-Mani, B., Boller, T., 1988, Antifungal hydrolases in pea tissue. II.
Inhibition of fungal growth by combinations of chitinase and β-1,3-
glucanase. Pl. Physiol., 88: 936-942.
Mayer, A. M., Harel, E. and Shaul, R. B., 1965, Assay of catechol oxidase a critical
comparisonof methods. Physiocheistry., 5: 783-789.
McClure, M. A. and Stynes, B. A., 1988, Lectin binding sites on the amphidial
exudates of Meloidogyne. J. Nematol., 20: 321-326.
McCulloch, L., Robertson, W. M. and Forrest, J. M. S., 1989, Effect of the lectin
concanavalin A on the localisation and parasitism of host plant roots by
Meloidogyne javanica and Globodera rostochiensis. Association of
Applied Biologists, 20th December, 1989, Imperial College London.
McGonigle, T. P., 2007, Effects of animals grazing fungi. In: Environmental and
Microbial Relationships. Ed. Kubicek, C. P. and Druzhinina, I. S.,
Springer-Verlag, Berlin, Heidelberg, pp. 201–212.
Melito, S., Heuberger, A., Cook, D., Diers, B., Macguidwin, A. and Bent, A., 2010, A
nematode demographics assay in transgenic roots reveals no significant
impacts of the Rhg1 locus LRR-kinase on soybean cyst nematode
resistance. BMC Plant Biol., 10(1): 104-108.
251
Mier, N., Canete, S., Klaebe, A., Chavant, L. and Fournier, D., 1996, Insecticidal
properties of mushroom and toadstool carpophores. Phytochemistry,
41(5): 1293-1299.
Mirelman, D., Galun, E., Sharon, N. and Lotan, R., 1975, Inhibition of fungal growth
by wheat germ agglutinin. Nature, 256: 414-417.
Mo, H. Q., Rice, K. G., Evers, D. L., Winter, H. C., Peumans, W. J., Van Damme, E.
J. M., Goldstein, I. J., 1999, Xanthomonas sagittifolium tubers contain a
lectin with two different types of carbohydrate binding sites. J. Biol.
Chem., 274: 33300–33305.
Movafagh, A., Ghanati, K., Amani, D., Mahdavi, S. M., Hashemi, M., Davood Zare
Abdolahi, Z., Darvish, H., Gholami, M., Hagh Nejad, L., Mosammami, S.,
Safari, S., Darehgazani, R., Rahimi, M., Naini, N. S., Motlagh, M. G. and
Zamani, M., 2013, the structure biology and application of
phytohemagglutinin (PHA) in phytomedicine: With special up-to-date
references to lectins. J. Paramedical Sci., 2013: 4-7.
Murdock, L. L. and Shade, R. E., 2002, Lectins and protease inhibitors as plant
defenses against insects. J. Agri. and Food Chemi., 50: 6605–6611.
Nagel, A. K., 2011, Understanding GAF-P, a plant lectin with broad spectrum
inhibitory activity. Ph. D. Thesis, Clemson University, Clemson.
Neekhra, V., 2009, Cloning lectin gene from Remusatia vivipara, and the nematicidal
activity of lectin expressed in Escherichia coli. M. Sc. Thesis, Univ. Agril.
Sci., Dharwad, Karnataka (India).
Neekhra, V., Bhat, G. G., Bhagat, Y. S., Lingaraju, S. and Bhat, R. S., 2011,
Nematicidal activity of Remusatia vivipara lectin expressed in Escherichia
coli. Curr. Sci, 101(2): 150-151.
Ngai, P. H. and Ng, T. B., 2007, A lectin with antifungal and mitogenic activities from
red cluster pepper (Capsicum frutescens) seeds. Appl., Microbial
Biotechnol., 74: 366–371.
Nishiguchi, M., Yoshida, K., Sumizono, T. and Tazaki, K., 1997, Studies by site-
directed mutagenesis of the carbohydrate-binding properties of a bark
lectin from Robinia pseudoacacia. FEBS Lett., 403(3): 294-298.
Nowrousian, M. and Cebula, P., 2005, The gene for a lectin-like protein is
transcriptionally activated during sexual development, but is not essential
for fruiting body formation in the filamentous fungus Sordaria macrospora.
BMC Microbiol., 5: 64–73.
Oda, Y., Senaha, T., Matsuno, Y., Nakajima, K., Naka, R., Kinoshita, M., Honda, E.,
Furuta, I. and Kakehi, K., 2003, A New fungal lectin recognizing {alpha}
(1-6)-linked fucose in the N-glycan. J. Biol. Chem., 278(34): 32439-32447.
Oka, Y., Chet. I. and Spiegel, Y., 1997, Accumulation of lectins in cereal roots
invaded by the cereal cyst nematode Heterodera avenae. Physiol. and
Mol. Pl. Path., 51: 333–345.
Pathak, K. N., Roy, S., Ojha, K. L. and Jha, M. M., 1999, Influence of Meloidogyne
incognita on the fungal and bacterial wilt complex of banana. Indian J.
Nematol., 29: 39-43.
Pegard, A., Brizzard, G., Fazari, A., Soucaze, O., Abad, P. and Djian-Caporalino, C.,
2005, Histological characterization of resistance to different root-knot
nematode species related to phenolics accumulation in Capsicum
annuum. Phytopathology, 95: 158–165.
Pemberton, R. T., 1994, Agglutinins (lectins) from some British higher fungi. Mycol.
Res., 98: 277-290.
Peumans, W. J. and Van Damme, E. J. M., 1995, Lectins as plant defense proteins.
Plant Physiol., 109: 347–352.
Powell, K. S., Spence, J., Bharathi, M., Gatehouse, J. A. and Gatehouse, A. M. R.,
1998, Immunohistochemical and developmental studies to elucidate the
mechanism of action of the snowdrop lectin on the rice brown
planthopper, Nilaparvata lugens (Stal). J. Insect Physiol., 44 (7-8): 529-
539.
Powell, K., Gatehouse, A., Hilder, V., Van Damme, E., Peumans, W., Boonjawat, J.,
Horsham, K. and Gatehouse, J., 1995, Different antimetabolic effects of
related lectins towards nymphal stages of Nilaparvata lugens. Entomol.
Exp. Appl., 75(1): 61-65.
Pramod, S. N. and Venkatesh, Y. P., 2006, Utility of pentose colorimetric assay for
the purification of potato lectin, an arabinose-rich glycoprotein. Glycoconj.
J., 23(7-8): 481-488.
Prapanpoj, P., 1986, Application of Jack fruit lectin. M.Sc. Thesis, Mahidol
University, Bangkok, Thailand, pp. 60–66.
Pusztai, A., Ewen, S. W., Grant, G., Peumans, W. J., Van Damme, E. J., Rubio, L.
and Bardocz, S., 1990, Relationship between survival and binding of plant
254
Qin, Q. M., Zhang, Q., Zhao, W.S., Wang, Y. Y. and Peng, Y. L., 2003, Identification
of a lectin gene induced in rice in response to Magnaporthe grisea
infection. Acta Botanica Sinica., 45: 76–81.
Raghu, S., 2011, Studies on management of rhizome wilt of ginger with special
reference to Ralstonia solanacearum (E. F. Smith) Yabuuchi et al. M. Sc.
(Agri.) Thesis, Univ. Agril. Sci., Dharwad, Karnataka (India).
Ramprasad, S. A. Y., 2005, Studies on collar rot complex of Coleus forskohlii (Wild.)
Brig. M. Sc. (Agri) Thesis, Uni. Agric. Sci., Dharwad (India).
Rangaswami, G., 1972, Diseases of Crop Plants in India, Prentice Hall of India Pvt.
Ltd., New Delhi, p. 520.
Reed, D. G., Nopo-Olazabal, L. H., Funk, V., Woffenden, B. J., Reidy, M. J., Dolan,
M. C., Cramer, C. L. and Medina-Bolivar, F., 2005, Expression of
functional hexahistidinetagged ricin B in tobacco. Pl. Cell Rep., 24(1): 15-
24.
Rich, J. R., Rahi, G. S., Opperman, C. H. and Davis, E. L., 1989, Influence of the
castor bean (Ricinus communis) lectin (ricin) on motility of Meloidogyne
incognita. Nematropica, 19(1): 99-103.
Ripoll, C., Favery, B., Lecomte, P., Van Damme, E., Peumans, W., Abad, P. and
Jouanin, L., 2003, Evaluation of the ability of lectin from snowdrop
(Galanthus nivalis) to protect plants against root-knot nematodes. Plant
Sci., 164: 517-523.
255
Roberts, W. K . and Selitrenikoff, C. P., 1988, Plant cell and bacterial chitinase differ
in antifungal activity. J. Gen. Microbiol., 134: 169-176.
Rohlfs, M., Albert, M., Keller, N. P. and Kempken, F., 2007, Secondary chemicals
protect mould from fungivory. Biol. Lett., 3: 523–525.
Rosen, S., Sjollema, K., Veenhuis, M. and Tunlid, A., 1997, Cytoplasmic lectin
produced by the fungus Arthrobotrys oligospora functions as a storage
protein during saprophytic and parasitic growth. Microbiol., 143:
2593–2604.
Rudiger, H., 1998, Plant lectins–More than just tools for glycoscientists. Occurrence,
structure and possible functions of plant lectins. Acta Anat., 161: 130-152.
Sa, R. A., Gomes, F. S., Napoleao, T. H., Santos, N. D. L., Melo, C. M. L., Gusmao,
N. B., Coelho, L. C. B. B., Paiva, P. M. G. and Bieber, L. W., 2009a,
Antibacterial and antifungal activities of Myracrodruon urundeuva
heartwood. Wood Sci. Technol., 43: 85-95.
Sa, R. A., Santos, N. D., Silva, C. S., Napoleyo, T. H., Gomes, F. S., Cavada, B. S.,
Coelho, L. C., Navarro, D. M., Bieber, L. W. and Paiva, P. M., 2009b,
Larvicidal activity of lectins from Myracrodruon urundeuva on Aedes
aegypti. Comp. Biochem. Physiol. Toxicol. Pharmacol., 149: 300–306.
256
Saile, E., McGarvey, J. A., Schell, M. A. and Denny, T. P., 1997, Role of extracellular
polysaccharide and endoglucanase in root invasion and colonization of
tomato plants by R. solanacearum. Phytopathology, 87: 1264-1271.
Sakeena, Q., Ishfak, H. W., Shaista, R., Showkat, A. G., Akbar, M. and Rabia, H.,
2013, Evaluation of antimicrobial activity of a lectin isolated and purified
from Indigofera heterantha. Adv. Biosci. Biotechnol., 4: 999-1006.
Santi-Gadelha, T., Gadelha, C. A. A., Aragao, K. S., Oliveira C. C., Mota, M. R. L.,
Gomes, R. C., Pires, A. F., Toyama, M. H., Toyama, D. O., Alencar, N. M.
N., Criddle, D. N., Assreuy, A. M. S. and Cavada, B. S., 2006, Purification
and biological effects of Araucaria angustifolia (Araucariaceae) seed
lectin. Biochem. Biophys. Res. Commu., 350: 1050-1055.
Schindler, A. F., Robert, N., Stewart. and Peter Semenuik., 1960, A synergistic
Fusarium - nematode interaction in carnations. Phytopathology, 51: 143-
145.
Schlumbaum, A., Mauch, F., Voegeli, V., Boller, T., 1986, Plant chitinases are potent
inhibitors of fungal growth. Nature, 324: 365-367.
Selvi, T. A., Dinesh, M. G., Satyan, R. S., Chandrasekaran, B. and Rose, C., 2011,
Leaf and Seed extracts of Bixa orellana L. exert anti-microbial activity
against bacterial pathogens. J. Appl. Pharmaceutical Sci., 1(9): 116-120.
Shangary, S., Singh, J., Kamboj, S. S., Kamboj, K. K. and Sandhu, R. S., 1995,
Purification and properties of four monocot lectins from the family
Araceae. Phytochem., 40(2): 449-455.
Sharma, H. C. and Ortiz, R., 2000, Transgenics, pest management, and the
environment. Curr. Sci., 79(4): 421-437.
Sharon, E., Chet, I., Viterbo, A., Bar-Eyal, M., Nagan, H., Samuels, G. J., 2007.
Parasitism of Trichoderma on Meloidogyne javanica and role of the
gelatinous matrix. European J. Plant Pathol., 118: 247–258.
258
Sharon, E., Spiegel, Y., Solomon, R. and Curtis, R., 2002, Characterization of
Meloidogyne javanica surface coat using antibodies and their effect on
nematode behaviour. Parasitology., 125: 177–185.
Sharvelle, E. G., 1961, The nature and use of modern fungicides. Burgess publishing
Co., Minnesota, USA, p. 308.
Silva, M. C., Angelita, D., Custódio, S., Flavia, C. A. M. and Celeste, M. P. A., 2010,
Partial purification of leaf lectin from Manihot esculenta and screening its
fungicidal activity. J. Agr. Biotechnol. Sustain. Devel., 2(8): 136-141.
Silva, R. B., Cristina, R. A., Juliana, M. C. and Jorge, K. C., 2009, Antimycobacterial
activity evaluation and MIC determination of liophilizated hydroalcoholic
extracts of Bixa orellana L., Bixaceae. Brazilian J. Pharmacognosy, 20(2):
171-174.
Singh, R. S., Bhari, R. and Kaur, H. P., 2010, Mushroom lectins: Current status and
future perspectives. Crit. Rev. Biotechnol., 30 (2): 99-126.
259
Singh, S. and Mathur, N., 2010, In vitro studies of antagonistic fungi against the
root-knot nematode, Meloidogyne incognita. Biocontrol Sci. Technol., 20:
275-282.
Sitohy, M., Doheim, M. and Badr, H., 2007, Isolation and characterization of a lectin
with antifungal activity from Egyptian Pisum sativum seeds. Food Chem.,
104: 971-979.
Sivan, A. and Chet, I., 1986, Biological control of Fusarium sp. in cotton, wheat and
muskmelon by Trichoderma harzianum. J. Phytopath., 166: 39-47.
Southey, J. F., 1986, Laboratory methods for work with plant and soil nematodes.
Tech. Bull. No. 6, Ministry Agriculture, Fisheries and Food, London, pp.
79-80.
Souza, J. D., Silva, M. B. R., Argolo, A. C. C., Napoleyo, T. H., Sa, R. A., Correia, M.
T. S., Paiva, P. M. G., Silva, M. D. C. and Coelho, L. C. B. B., 2011, A
new Bauhinia monandra galactose-specific lectin purified in milligram
quantities from secondary roots with antifungal and termiticidal activities.
Int. Biodeter. Biodegrad., 65(5): 696-702.
Spiegel, Y. and McClure, M. A., 1995, The surface coat of plant-parasitic nematodes:
chemical composition, origin and biological role - a review, J. Nematol.,
27: 127-134.
Spiegel, Y., Chon, E. and Spiegel, S., 1982, Characterization of Sialyl and galactosyl
residues on the body wall o different plant parasitic nematodes. J.
Nematol., 14: 33-39.
Spiegel, Y., Kahane, I., Cohen, L. and Sharon, E., 1997, Meloidogyne javanica
surface proteins: characterization and lability. Parasitology., 115: 513-519.
Spiteller, P., 2008, Chemical defence strategies of higher fungi. Chemistry., 14:
9100–9110.
Stillmark, H., 1888, Uber Rizin, ein giftiges Ferment aus dem Samen von Ricinus
communis L. und einigen anderen Euphorbiaceen. Ph. D. Thesis,
University of Dorpat, Schnakenburg, Germany.
260
Sumer Jan. and Khan, T. A., 2002, Interaction effect of Fusarium solani,
Rotylenchulus reniformis and Meloidogyne incognita on tomato. Indian J.
Nematol., 32: 135-138.
Sun, M. H., Gao, L., Shi, Y. X., Li, B. J. and Liu, X. Z., 2006, Fungi and
actinomycetes associated with Meloidogyne spp. eggs and in China and
their biocontrol potential. J. Invert. Pathol., 93: 22–28.
Sundarraj, N., Nagaraja, S., Venkataramu, M. S. and Jaganath, M. K., 1974, Design
and analysis of field experiments. Mysore (India).
Swamy, B. M., Bhat, A. G., Hegde, G. V., Naik, R. S., Kulkarni, S. and Inamdar, S.
R., 2004, Immunolocalization and functional role of Sclerotium rolfsii lectin
in development of fungus by interaction with its endogenous receptor.
Glycobiology, 14(11): 951-957.
Swamy, B. M., Hegde, G. V., Naik, R. S. and Inamdar, S. R., 2001, T-antigen binding
lectin from the phytopathogenic fungus Sclerotium rolfsii. Lect. Biol.
Biochem. Clin. Biochem., 15: 45-55.
Talas-Ogras, T., Ipekci, Z., Bajrovic, K. and Gozukirmizi, N., 2005, Antibacterial
activity of seed proteins of Robinia pseudoacacia. Fitoterapia, 76: 67–72.
Tateno, H., Winter, H. C., Petryniak, J. and Goldstein, I. J., 2003, Purification,
characterization, molecular cloning, and expression of novel members of
jacalin related lectins from rhizomes of the true fern Phlebodium aureum
(L) J. Smith (Polypodiaceae). J. Biol. Chem., 278(13): 10891-10899.
261
Taylor, A. L., 1971, Introduction of Research on Plant Nematology. FAO Guide to the
Study and control of plant parasitic nematodes. FAO, Rome, Italy.
Taylor, A. L. and Sasser, J. N., 1978, Biology, identi.cation, and control of root-knot
nematodes (Meloidogyne species). Raleigh, NC, USA, North Carolina
State Univ. Graphics. p. 111.
Terpe, K., 2003, Overview of tag protein fusions: from molecular and biochemical
fundamentals to commercial systems. Appl. Microbiol. Biotechnol., 60(5):
523-533.
Tian, Q., Wang, W., Miao, C., Peng, H., Liu, B., Leng, F., Dai, L., Chen, F. and
Bao, J., 2008, Purification, characterization and molecular cloning of a
novel mannose-binding lectin from rhizomes of Ophiopogon japonicus
with antiviral and antifungal activities. Pl. Sci., 175: 877-884.
Toledo, M. S., Levery, S. B., Straus, A. H. and Takahashi, H. K., 2000, Dimorphic
expression of cerebrosides in the mycopathogen Sporothrix schenckii. J.
Lipid Res., 41: 797–806.
Toledo, M. S., Levery, S. B., Straus, A. H., Suzuki, E., Momany, M., Glushka, J.,
Moulton, J. M. and Takahashi, H. K., 1999, Characterization of
sphingolipids from mycopathogens: factors correlating with expression of
2-hydroxy fatty acyl (E)-delta 3- unsaturation in cerebrosides of
Paracoccidioides brasiliensis and Aspergillus fumigatus. Biochemistry, 38:
7294–7306.
Trigueros, V., Lougarre, A., Ali-Ahmed, D., Rahbe, Y., Guillot, J., Chavant, L.,
Fournier, D. and Paquereau, L., 2003, Xerocomus chrysenteron lectin:
identification of a new pesticidal protein. Biochem. Biophys. Acta.,
1621(3): 292-298.
Trung, N. P., Fitches, E. and Gatehouse, J. A., 2006, A fusion protein containing a
lepidopteran-specific toxin from the South Indian red scorpion
(Mesobuthus tamulus) and snowdrop lectin shows oral toxicity to target
insects. BMC Biotechnol., 6: 18.
Tunlid, A. and Jansson, S., 1991, Proteases and their involvement in the infection
and immobilization of nematodes by nematophagous fungus Arthrobotrys
oligospora. Appl. Environ. Microbiol., 57: 2868–2872.
Urwin, P. E., Atkinson, H. J., Waller, D. A. and McPherson, M. J., 1995, Engineered
oryzacystatin-I expressed in transgenic hairy roots confers resistance to
Globodera pallida. Pl. J., 8: 121-131.
Urwin, P. E., Moller, S. G., Lilley, C. J., Mcpherson, M. J. and Atkinson, H. J., 1997,
Continual green-fluorescent protein monitoring of cauliflower mosaic virus
35S promoter activity in nematode-induced feeding cells in Arabidopsis
thaliana. Mol. Pl. Microbe Interact., 10(3): 394-400.
263
Van Damme, E. J. M., Allen, A. K. and Peumans, W. J., 1987, Isolation and
characterization of a lectin with exclusive specificity towards mannose
from snowdrop (Galanthus nivalis) bulbs. FEBS Lett., 215(1): 140-144.
Van Damme, E. J. M., Astoul, C. H., Barre, A., Rouge, P. and Peumans, W. J., 2000,
Cloning and characterization of a monocot mannose-binding lectin from
Crocus vernus (family Iridaceae). FEBS J., 267(16): 5067-5077.
Van Damme, E. J. M., Barre, A., Rouge, P. and Peumans, W. J., 2004, Cytoplasmic ⁄
nuclear plant lectins: a new story. Trends in Pl. Sci., 9: 484–489.
Van Damme, E. J. M., Balzarini, J., Smeets, K., Van Leuven, F. and Peumans, W. J.,
1994a, The monomeric and dimeric mannose-binding proteins from the
Orchidaceae species Listera ovata and Epipactis helleborine: sequence
homologies and differences in biological activities. Glycoconj. J., 11(4):
321-332.
Van Damme, E. J. M., Smeets, K., Torrekens, S., Leuven, F. and Peumans, W. J.,
1994b, Characterization and molecular cloning of mannose-binding lectins
from the Orchidaceae species Listera ovata, Epipactis helleborine and
Cymbidium hybrid. Eur. J. Biochem., 221(2): 769-777.
Van Damme, E. J., Goossens, K., Smeets, K., Van Leuven, F., Verhaert, P. and
Peumans, W. J., 1995, The major tuber storage protein of araceae
species is a lectin. Characterization and molecular cloning of the lectin
from Arum maculatum L. Pl. Physiol., 107(4): 1147-1158.
Van Elsas, J. D., Kastelein, P., Van Bekkum, J. M., Van der Wolf, P. M., De Vries.
and Van Overbeek, L. S., 2000, Survival of R. solanacearum Biovar 2, the
Causative Agent of Potato Brown Rot, in Field and Microcosm Soils in
Temperate Climates. Phytopathology., 90(12): 1358-1366.
Van Parijs, J., Broekaert, W. F., Peumans, W. J., Geuns, J. M. and Van Laere, A.J.,
1992, Effect of the lectin UDA (Urtica dioica agglutinin) on germination
and cell wall formation of Phycomyces blakesleeanus Burgeff, Arch.
Microbiol., 158: 19–25.
264
Van Parjis, J., Willem F. Broekaert., Irwin J. Goldstein and Willy J. Peumans., 1991,
Hevein: an antifungal protein from rubber-tree (Hevea brasiliensis) latex.
Planta, 183: 258-264.
Vaz, A. F. M., Costa, R. M. P. B., Melo, A. M. M. A., Oliva, M. L. V., Santana, L. A.,
Silva-Lucca, R. A., Coelho, L. C. B. B. and Correia, M. T. S., 2010,
Biocontrol of Fusarium species by a novel lectin with low ecotoxicity
isolated from Sebastiania jacobinensis. Food Chem., 119: 1507-1513.
Velkov, V. V., Medvinsky, A. B., Sokolov, M. S. and Marchenko, A. I., 2005, Will
transgenic plants adversely affect the environment? J. Biosci., 30 (4):
515-548.
Victoria, L. F., Catherine, J. L. and Urwin, P. E., 2008, Nematode resistance. New
Phytol., 180:27-44
Vijayan, M. and Chandra, N., 1999, Lectins. Curr. Opin. Struct. Biol., 9(6): 707-714.
Vlodavsky, I. and Sachs, L., 1975, Lectin receptors on the cell surface membrane
and the kinetics of lectin-induced cell agglutination. Exp. Cell Res., 93(1):
111-119.
265
Walti, M. A., Walser. P. J. and Thore, S., 2008, Structural basis for chitotetraose
coordination by CGL3, a novel galectin-related protein from Coprinopsis
cinerea. J. Mol. Biol., 379: 146–159.
Walter, P. F., 1997, Experimental design theory and application. 3rd Edition, New
York.
Wang, H., Ng, T. and Ooi, V. E. C., 1998, Lectins from mushrooms. Mycol. Res.,
102(8): 897-906.
Wang, M., Triguéros, V., Paquereau, L., Chavant, L. and Fournier, D., 2002,
Proteins as active compounds involved in insecticidal activity of
mushroom fruitbodies. J. Econ. Entomol., 95(3): 603-607.
Weitang, S., Lingang, Z., Chenzong, Y., Xiadong, C., Liqun, Z. and Xilli, L., 2004,
Tomato fusarium wilt and its chemical control strategies in a hydropinic
system. Crop protec., 23:243-247.
Wessels, J. G. H., 1988, A steady-state model for apical wall growth in fungi. Acta
Bot. Neerl. 37: 3-16.
Wicklow, D. T., 1988, Metabolites in the coevolution of fungal defense systems. In:
Coevolution of Fungi with Plants and Animals. Ed. Pirozynski, K. A. and
Hawksworth, D. L., Academic Press Limited, London, p. 29.
Williamson, V. M., 1999, Plant nematode resistance genes. Curr. Opinion in Pl. Biol.,
2: 327–331.
Wohlschlager, T., Alex, B., Katrin, A., Sibulle, C. V., Ulrich auf dem, K., Peter, G.,
Silvia, B. M., Michael, O H., Markus, A. and Markus, K., 2011,
Nematotoxixity of Marasmius oreades agglutinin (MOA) depends on
glycolipid binding and cysteine protease activity. J. Biol. Chem., 286(35):
30337-30343.
266
Wong, J. H., Wong, C. C. T. and Ng, T. B., 2006, Purification and characterization of
a galactose specific lectin with mitogenic activity from pinto beans.
Biochem. Biophysi. Acta. 1760: 808–813.
Wu, A. M., Wu, J. H., Tsai, M. S., Hegde, G. V., Inamdar, S. R., Swamy, B. M. and
Herp, A., 2001, Carbohydrate specificity of a lectin isolated from the
fungus Sclerotium rolfsii. Life Sci., 69(17): 2039-2050.
Wuyts, N., Elsen, A., Van Damme, E. J. M. S, de Waele, D., Swennen, R., Sági L.,
2009, Lectin binding to the banana-parasitic nematode Radopholus
similis. Banana Improvement Programme Agriculture and Consumer
Protection, FAO Corporate Document Repository.
Xu, Q. Liu, Y. Wang, X. Gu, H. and Chen, Z., 1998, Purification and characterization
of a novel anti-fungal protein from Gastrodia elata. Pl. Physiol. Biochem.,
36: 899–905.
Yan, Q., Jiang, Z., Yang, S., Deng, W. and Han, L., 2005, A novel homodimeric
lectin from Astragalus mongholicus with antifungal activity. Arch. Biochem.
Biophys., 442(1): 72-81.
Ye, X. Y., Ng, T. B., Tsang, P. W. and Wang, J., 2001, Isolation of a homodimeric
lectin with antifungal and antiviral activities from red kidney bean
(Phaseolus vulgaris) seeds. J. Protein Chem., 20: 367–375.
Yun, D. J., Ibeas, J. I., Lee, H., Coca, M. A., Narasimham, M. L. and Uesono, Y.,
1998, Osmotin a plant antifungal protein subverts signal transudation to
enhance fungal cell susceptibility. Mol. Cell, 1: 807–817.
Zhao, X., Chen, Z., Lin, J., Kong, W., Sun, X. and Tang, K., 2006, Expression and
purification of Arisaema heterophyllum agglutinin in Escherichia coli. J. Pl.
Physiol., 163(2): 206-212.
Zieslin, N. and Ben-Zaken, R., 1993, Peroxidase activity and presence of phenolic
substances in peduncles of rose flowers. Pl. Physiol. Biochem., 31: 333-
339.
C. Starch agar
Peptone 5.00 g
Beef extract 3.00 g
Starch solution 10.00 ml
Agar 18.00 g
Distilled water 1000 ml
Adjust pH to 7.2
Eight transgenic tomato events carrying srl1 and rvl1 genes (T3 genertaion of
homozygous) showed moderately resistant reaction [SRL1-T0(21) and RVL1-T0(28)]
to Fusarium, Ralstonia and also Meloidogyne and to combination of all these three
pathogens. Histopathological and histochemical changes in transgenic and non-
transgenic tomato plants revealed reduced giant cell formation in srl1 and rvl1
transgenics. Elucidation of the mode of action of SRL1, RVL1 and anti-SRL1 on soil
borne pathogens and antagonists: FITC-labelled lectins bound to hyphal wall,
septum, and spores of respective fungi; localization of anti-SRL1 on sclerotia of S.
rolfsii and R. solani showed a dense mass of congregated lectin sites. Nematode
secretions were observed at amphidial, excretory pore and phasmidial region using
CBB-R histochemical dye. Binding of lectins in nematode was found at head region,
mid gut of the alimentary-tract, excretory pore which extended to the posterior region
(phasmids).