Sei sulla pagina 1di 73

Psicofisiologia e

Genética
Teórica 3
Relação genes-comportamento. Factos e Mitos.
A complexa rede de influências entre genes e ambiente.

Diana Prata
PL2
GATTACA (1979)

http://putlockers.ch/watch-gattaca-online-free-putlocker.html
Dúvidas da aula anterior
• Ribossoma: estrutura proteica e de RNA (organelo celular: 3), onde se
sintetizam proteinas a partir de RNA mensageiro.
Como surgem novas especies? (Especiação)
Mecanismos de especiação
Espécie: é constituída por grupos de populações naturais compostas de indivíduos interférteis, que produzem descendência
fértil e que estão reprodutivamente isolados de outros grupos semelhantes.

Alopátrica (alo=outra, pátria=local): Depende de isolamento geográfico (e.g. de um novo rio, deslocamentos geológicos,
etc), que advém de um grupo de organismos de uma espécie ter sido separada em duas, e não mais ter podido haver
acasalamento.

Peripátrica (peri=próxima, pátria=local), ou Efeito Fundador: um novo nicho surge, em que um dos subgrupos tem menos
indivíduos. Para esse novo nicho, desloca-se um sub-grupo do nicho maior, que leva consigo, ao acaso, certos alelos. Esses
alelos ganharão uma frequência maior no novo nicho, que no nicho original.

Parapátrica (para=perto, pátria=local). Ao contrário de ambas as últimas, aqui não surgem divisões físicas, mas o
comportamento de acasalamento nao é ao acaso. Os indovíduos têm mais propensão para copular com os vizinhos, o que
cria sub-grupos com frequências de alelos diferentes (mais, quanto mais afastadas estiverem).

Simpátrica (sim=same, pátria=local). Sem divisões físicas de nicho, surge um novo nicho ecológico dentro dum maior. Por
exemplo, alguns pássaros começam a comer milho em vez de minhocas; ou quanto existe alguma mutação que impede uns
indivíduos de acasalar com outros.
Gene
Explore: https://genome.ucsc.edu/

Regiões codificantes = 1.5% do genoma


Splicing alternativo: um gene pode codificar diferentes proteínas
Em muitas espécies, apenas uma pequena fracção da sequência total do genoma codifica uma proteína.

Por exemplo, apenas 1,5% do genoma humano consiste de exões (que codificam proteínas).

Contudo, sequências de ADN que não codificam proteínas podem ainda codificar moléculas de ARN
não-codificante funcional, que estão envolvidas na regulação da expressão génica.

Algumas sequências de ADN não-codificante têm um papel estrutural nos cromossomas:

Os telómeros e centrómeros contêm tipicamente poucos genes, mas são importantes para a função e
estabilidade dos cromossomas.

Uma forma abundante de ADN não codificante em humanos são os pseudogenes, que são cópias de
genes que foram desabilitados por mutação.

Estas sequências são usualmente apenas fósseis moleculares, apesar de poderem servir ocasionalmente
como material genético em bruto para a criação de novos genes por meio do processo de duplicação de
genes e divergência.
Entre 2 humanos, o genoma é 99.5 % idêntico. Variação genética de 0.5%.
Onde está?
Locus = “coordenadas” no genoma
Polimorfismo (~mutação ou marcador) = um locus no qual
individuos diferentes podem ter alelos diferentes.

Single Nucleotide Polymorphisms


Ocorre 1 em cada 300 nucleotidos, em média.
I.e. ~10 milhões no genoma humano
i.e. ~100 em cada gene

Ex. “rs123456” no locus ”7643210”:

C -> T (ou G -> A)

Indivíduo homozigótico (para este locus) tem genótipo CC ou TT


Indivíduo heterozigótico tem genótipo: AT
Se o polimorfismo for num exão, pode levar a mudança de aminoácido
Ex. Val123Met.
Anemia falciforme
SNP que leva a mudança de
aminoácido na proteína
hemoglobina (que faz transporte
oxigénio nos glóbulos vermelhos
do sangue):

A -> T

Glutamato-> Valina

Hemoglobina com pior estrutura,


afectando a estrutura dos glóbulos
vermelhos.
Modo de transmissão: recessivo (i.e. TT -> anemia)

A T
A AA AT
T AT TT

2 heterozigotas têm 25% de probabilidade de ter um filho


com anemia faciforme (TT)
Modo de transmissão: recessivo (i.e. TT -> anemia)

T T
T TT TT
T TT TT

2 Homozygotas TT têm 100% de probabilidade de ter um


filho com anemia faciforme (TT)
Modo de transmissão: recessivo (i.e. TT -> anemia)

T A
T TT AT
T TT AT

1 Homozygota TT e um heterozigota têm 50% de


probabilidade de ter um filho com anemia faciforme (TT)
Modo de transmissão: recessivo (i.e. TT -> anemia)

A A
A AA AA
T AT AT

1 Homozygota AA e um heterozigota têm 0% de


probabilidade de ter um filho com anemia faciforme (TT)
Modos de transmissão genética
• Transmissão de anomalias cromossómicas (duplicações, delecções, inversões de porções
de um cromossoma; ou alteração do número de cromossomas)

• Transmissão multifactorial (muitos genes e polimorfismos envolvidos e o ambiente)

• Transmissão mendeliana de polimorfismos genéticos:

Recessiva

Dominante

Co-dominante
Dominante ou recessivo?
A anemia falciforme predispões a infecções
bacterianas fatais, dores intensas, tonturas,
fadiga, falta de fôlego, derrames, ulcerações,
tromboses, etc e associada a 20-60% mortalidade
infantil.

Se o alelo para a anemia falciforme é prejudicial,


porquê ainda está presente no genoma humano
(bem como mais 2 alelos com a mesma função)?

Em especial na população africana sub-Sahariana:


~20% (com 8% tendo o genótipo recessivo)?
Frequência do alelo T (-> anemia falciforme)

Endemicidade da malária
Porquê a co-localização de anemia falciforme e malária?

A anemia falciforme é protectora contra a


malára (que aumentou dada a sedentarização
humana há 2000 anos na África Sub-
Sahariana).

Os parasitas da malária não se reproduzem


bem nos glóbulos vermelhos falciformes.

Homozygotas para alelo de risco para a anemia


-> em desvantagem

Homozygotas para alelo de risco para a malária


-> em desvantagem

Heterozygotas -> “o melhor dos 2 mundos”


-> em vantagem.
Os humanos estão a evoluir?
A tua orelha está ligada à cabeça?

ee EE
Ee
Consegues enrolar a tua língua?

RR rr
Rr
Homo Sapiens existe desde há
200.000 anos.
• Bipedalismo (há 6 milhoes de anos)
• Encefalização (do neo-cortex, sobretudo)
• Ovulação oculta
• Melhor visão (pior olfato)
• Intestino mais pequeno
• Glandulas sudoriparas
• Menos pêlo
• Laringe descida

Evolução humana acelerou desde a


sedentarizazção há 20.000 anos, e agricultura &
pastorícia, desde há 10.000 anos.
Digestão da lactose
• 75% dos adultos asáticos, mas apenas 10% na Europa do
Norte, são intolerantes à lactose.

• Défice da enzima lactase.

• Polimorfismo C ->T (rs4988235) num gene (MCM6) que veio


permitir a transcrição do gene que codifica a Lactase (LCT) em
adultos.

• Mutação na Europa e Norte de África há 7.500 years – após


início da pastorícia - permitiu a digestão da lactose em
adultos.

• Vantagem evolutiva na obtenção de calorias, vitaminas e


minerais, especialmente em climas mais frios, e de água.
Evolução humana
Digestão do álcool
• 36% dos Asiáticos com Leste ficam com
vermelhidão facial, taquicárdia e nausea
quando bebem alcool.

• Défice da enzima aldeído desidrogenase


2 (ALDH2).

• Polimorfismos no gene vieram permitir a


extracção de calorias apartir do alcool nos
Europeus, após início da agricultura (- há
10.000 anos).
Como se descobrem os polimorfismos associados
a fenótipos (inclusivé psicológicos)?

Quais os alelos mais frequentes ou menos frequentes na população com uma


doença mental (ou um traço comportamental ou de personalidade) comparada com
a população média normal (controlo)?

Que design?
Que teste estatístico?
Porquê estudar a genética do comportamento?

• Entender os mecanismos

• Guiar o desenvolvimento de novos fármacos

• Identificar os indivíduos que estão em risco para patologias, cedo, para


permitir intervenção precoce ou prevenção

• Estratificar ou personalizar o tratamento

• Melhorar a classificação das patologias

• Etc…
Tipos de estudos de genética
Quantitativa Molecular Funcional

Quão hereditário é um Que genes contribuem Quão expresso (ou


fenótipo? para o fenótipo? traduzido para proteína)
é um gene num
Estudos de: Estudos de: fenótipo?

Gémeos Associação Estudos de:


Família Linkage
Adopção Expressão génica
(Transcriptomics)
Proteomics

e.g. A esquizofrenia é e.g. O alelo A do da e.g. O gene da ZNF804A


80% hereditária SNP rs1344706 do está mais expresso (mais
gene da ZNF804A rMRNA ou proteína)
aumenta o risco de hipocampo de pacientes
esquizofrenia com esquizofrenia
O que é a hereditariedade genética?
Quanto é que as diferenças genéticas entre pessoas influenciam as diferençãs entre
elas em termos de um fenótipo
(ex, traço de personalidade, capacidade, patologia, etc).
- nível populacional -


Quanto é que os genes influenciam o fenótipo de uma pessoa.
- nível individual -

Exemplo:
Se toda a gente receber a mesma comida, as diferenças na altura que se detectarem entre as
pessoas será totalmente devido aos genes. Mas nao podemos dizer que os genes são os únicos
responsáveis pela altura (pois a comida é essencial!)
Heritabilidade

H2 = 2(rmz - rdz)

rmz = correlação entre gêmeos monozigóticos (MZ)


para o fénotipo

rdz =correlação entre gêmeos dizigóticos (DZ)


para o fénotipo
Nature or Nurture?
Estudos de gêmeos e de adopção: Ambiente ou Genética?
Personalidade: Ambiente ou Genética?
Nos casos de adopção…
… ao longo do tempo, os filhos ficam mais como os pais
biológicos ou adoptivos?

Biológicos! As influências genéticas tormam-se mais


aparentes com a idade.
Quais os factores de susceptibilidade desta doença?

• Dificuldade em prioritizar or focar nas tarefas


• Falta de flexibilidade cognitiva; tendencia de ficar “preso” num pensamento ou
acção
• Impulsividade, falta de controlo
• Prmiscuidade sexual
• Processamento cognitivo lento, dificuldade em “encontrar palavras” Difficulty in
learning new information
• Depressão, irritabilidade, apatia
• Falta de “drive social”
• Cansaço
• Tentativas de suicídio
Doença de Huntington
Huntington: uma doença mendeliana, autossómica dominante

• O tripleto CAG (cytosine-adenine-guanine), que codifica o aminoácido


glutamina, está normalmente repetido menos de 36 vezes no DNA -
mas em Huntington’s há mais do que 36 cópias.

• Produção de uma protéina (Huntingtina) anormal que prejudica o


funcionamento dos neurónios.

• 100% de penetrância dos alelos de > 40 cópias de CAG.


Quais os factores de susceptibilidade desta doença?

• Delírios: ideias falsas, com convicção absoluta.


• Alucinações: percepções falsas dos órgãos dos sentidos.
• Pensamento desorganizado
• Alterações da afetividade
• Apatia e isoalmento social
• Défice cognitvo (ex: memória de trabalho)
Esquizofrenia: uma doença multifactorial
Factores poligenéticos + Factores ambientais

Susceptibilidade (contínua)

Continuum: Esquisotipia
These may explain a paradox: how traits (e.g. SCZ)
Effect giving lower fecundity (in SCZ, 70% in males,
size 30% females) have remained in population.
Large
genes in few if any genes
up here
CNVs
O.R. up to
15

(~1/100
patients) SNPs, VNTRs
in genes
De novo
are O.R. up to 2
even (~30/100patients)
Very difficult to detect
rarer
Small
Rare Common Allele
frequency
Schizophrenia Genetics and Mens’ Cars
(Prof Sir Robin Murray’s analogy)

Ferraris have a big effect on individual girls...


but they are rare and thus explain only a small % of
overall male attractiveness.

CNVs may account for only 5% of schizophrenia.

Corollas have a small effect on individual


girls… but as they are so common overall, they explain
a bigger % of overall male attractiveness.

Common SNPs may account for up to 30% of


schizophrenia (Lee et al, 2012).
Quando a concordância entre gêmeos monozigóticos
nao é 100%.

O resto será o ambiente. Por exemplo, na


esquizofrenia:

Ø Complicações no parto
Ø Infecções pre-natais
Ø Consumo de drogas
Ø Stress
Ø Migração
Ø Urbanicidade
Interacção gene x ambiente
Cannabis x gene COMT
Indivídous que fumavam cannabis com
< 16 anos e tinham a versão menos
funcional do gene da COMT (enzima
que degrada a dopamina), com
aminoácido Valina em vez de
Metionina, a apartir de uma SNP com
G em vez de A), apresentavam mais
tarde maior incidência de doença
esquizofreniforme.
Tipos de estudos de genética
Quantitativa Molecular Funcional

Quão hereditário é um Que genes contribuem Quão expresso (ou


fenótipo? para o fenótipo? traduzido para proteína)
é um gene num
Estudos de: Estudos de: fenótipo?

Gémeos Associação Estudos de:


Família Linkage
Adopção Expressão génica
(Transcriptomics)
Proteomics

e.g. A esquizofrenia é e.g. O alelo A do da e.g. O gene da ZNF804A


80% hereditária SNP rs1344706 do está mais expresso (mais
gene da ZNF804A rMRNA ou proteína)
aumenta o risco de hipocampo de pacientes
esquizofrenia com esquizofrenia
Molecular Genetics: Linkage
(where in the genome should we look, broadly?)
Identifies broad regions in the genome that are co-transmitted with the phenotype
across families.
Molecular Genetics: Association
(where in the genome should we look, more precisely?)

Examines the correlation between a specific variation in the


DNA (i.e. a marker = polymorphism = mutation) and the
occurrence of a trait or illness.

Identifies the risk allele of the candidate gene. (May be the functional allele or
just very close to it.)

Ø With clues from Linkage studies


à We test positional candidate genes.

Ø With clues from Gene expression studies


à We test functional candidate genes.

Ø Without any clue: No candidate genes, hypothesis-free (Genome-Wide


Association Studies)
à We test (quasi-)random variations scattered in the whole genome.
Using Genetic Polymorphisms or markers
(Where in the gene should we look?)

Ø Variable Number Tandem Repeats (VNTRs)


Ø Minisatellites: ACGTACTGGTACTGàACGTACTGGTACACTGGTACTGCàetc

Ø Microsatellites (STRs): ACGTACACACACACTGCàACGTACACTGCàetc

Ø Insertion Deletions (In-Dels): ACTGATCAà ACT—TCA

Ø Copy Number Variations (CNVs): duplications/deletion/insertion of one gene or more.

Ø Single Nucleotide Polymorphisms (SNPs): ACTGGà ACAGG

Ø Non-coding:
Ø Intronic (in middle, excluding splice-sites)
Ø Transcribed but Untranslated - variation in mRNA, but not in protein.
Ø Coding:
Ø Synonymous – variation translated but causes no change in protein.
Ø Non-Synonymous - variation in mRNA and causes aminoacid change.
Ø Functional: alters the stability/activity of the protein.
Ø Non-functional.
Popular candidate genes associated with SCZ (1991-2008)
Gene Original study Positive Negative
1) Brain neurotransmission
COMT (Catechol-O-Methyltransferase) Daniels et al, 1996 (Neg.) 21 47
DAT (Dopamine Transporter) Li et al, 1994 (Neg.) 2 18
RGS4 (Regulator of G-protein Signaling-4) Chowdari et al, 2002 (Pos.) 14 11
DAO (D-amino acid Oxidase) Chumakov et al, 2002 (Pos.) 5 8
PRODH (Proline Dehydrogenase) Liu et al, 2002 (Pos.) 8 9
5HTT (Serotonin Transporter) Collier et al, 1996 (Neg.) 8 19
DAOA (G72) (D-amino acid Oxidase Activator) Chumakov et al, 2002 (Pos.) 24 7
DRD2 (Dopamine receptor D2) Comings et al, 1991 (Neg.) 17 41
2) Brain structure
DISC1 (Disrupted in Schizophrenia-1) Wilson-A et al, 1997 (Neg.) 13 5
OLIG2 (Oligodendrocyte lineage transcription factor 2) Georgieva et al, 2006 (Pos.) 2 3
BDNF (Brain Derived Neurotrophic Factor) Sasaki et al, 1997 (Neg.) 9 21
DTNBP1 (Dysbindin-1) Straub et al, 2002 (Pos.) 17 20
NRG1 (Neuregulin-1) Stefansson et al, 2002 (Pos.) 24 14
Dificuldade em encontrar os genes para o comportamento e
patologias do comportamento – porquê?

§ Difícil definir o fenótipo (QI, depressão, etc)

§ Continuum na população (esquizotipia, traços autistas, etc)

§ Etiologia heterogénea, multifactorial

§ Podem estar muitos genes envolvidos, de efeito pequeno, cada um.

§ Podem estar muitos factores ambientais envolvidos.


Teórico-Práctica 2
MAOA e agressividade
“A (MAOA) low-activity genotype (contributing to low dopamine
turnover rate) is associated with extremely violent behavior.”

• MAOA: monoamine oxidase – A; degrada dopamina, serotonina e noradrenalina


(neurotransmissores)

• Têm um polimorfimo do tipo 30-nucleotide VNTR (Variable Number Tandem Repeat): 4R


(“high-activity”) leva à produção de mais enzima que o alelo de 2 ou 3 repetições.

• Logo, “low-activity” MAOA - > Menor degradação de dopamina, serotonina e/ou


noradrenalina.

• (Curiosidade: Níveis da proteína MAOA mais elevados na depressão.)


Interacção Gene x Ambiente

• Low activity MAO-A associado


com comportamento anti-social

• APENAS em casos que sofreram


abuso/abandono na infância

• Logo, efeito de interacção entre


genótipo da MAO e
abuso/abandono na propensção
para o comportamento antisocial
Odds Ratio
O odds ratio (OR) (ou rácio/razão de probabilidade) é uma medida da magnitude da
associação entre uma variável independente (ex, o genótipo) e uma dependente (ex, o
fenótipo). Muito utilizada na genética após teste de Chi-quadrado.

E.g. é a probabilidade de um indíduo ter comportamento anti-social tendo o “low-activity


MAO”, comparada com a probabilidade de ter esse comportamento tendo “high-activity
MAO”.

Se >1: associação entre comportamento AS e low-activity MAO


Se <1: associação entre comportamento AS e high-activity MAO

Ex: Se OR=2, a probabilidade de o individuo ter comportamento AS tendo low-activity MAO


é duas vezes superior a se tiver high-acticity MAO.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2938757/
Genética do funcionamento e
estrutura cerebral
Imaging Genetics

Meyer-Lindenberg et al (2007)
Quantitative imaging genetics:
Estudos de gêmeos com neuroimagiologia funcional

A activação regional durante uma tarefa de memória de trabalho é mais similar


entre pares de gêmeos MZ do que pares de gêmeos DZ.

Vermelho:
hereditariedade: 80%

(Koten et al. Science 2009)


E neuroimagiologia estrutural
Densidade da matéria cinzenta é mais similar entre pares de gêmeos MZ do
que enter pares de gêmeos DZ.

Hereditariedade: até 90%, dependendo da região

Thompson et al, Nature Neuro, 4(12):1253-1258,.


2001
Glahn, Thompson, Blangero. Hum Brain Mapp
28:488-501, 2007
Imaging Genetics
to examine the impact of genetic variation on brain structure and function

Genotype Neuroimaging Behavioural


phenotype phenotype

Genes Cells Behaviour


DNA sequence
polymorphisms,
Subtle alterations in Brain (normal or
metabolism Discrete
each of small effect
(neurotransmission, changes in
abnormal)
on behavioural Complex interactions
neurodevelopment, brain structure
phenotype between systems
etc…) or function

Genetics

Imaging
Molecular Imaging Genetics:
Estudo de associação com APOE e imagiologia estrutural
Evidência prévia: ApoE e4 é um alelo de risco para doença de Alzheimer’s de onset tardio.
Doença também associada a redução do volume de matéria cinzenta.

Indivíduos com o genótipo ApoE e4/e4 têm volume da matéria cinzenta reduzido comparados com
e3/e3.

Thompson & Toga, Annals of Medicine 34(7-8):523-36, 2002


ZNF804A rs1344706 e imagiologia estrutural
Evidência prévia: Alello A associado com a esquizofrenia.
Doença também associada a redução da integridade da matéria branca (medido por FA).

A-carriers CC

Efeito de interacção: o cérebro de pacientes com esquizofrenia pode ser mais susceptível a este factor
genético.
Questões? diana.prata@medicina.ulisboa.pt

Dpratalab.wordpress.com
Porquê é que…
• … todas as sociedades evitam o incesto (mesmo as que não conhecem
as consequências)?
• … os humanos têm medo inato de altura, aranhas e cobras e não de
carros e electricidade?
• … os homens preferem juventude e as mulheres status?
• ... as mulheres são mais exigentes na escolha de uma relação do que os
homens?
• ... existe ovulação oculta nos humanos, e não nos outros primatas?
Porquê é que…
• ... as mulheres escolhem homens, pelo cheiro, que têm genótipos para o
sistema imunitário mais diferentes dos delas?
• … os asiáticos bebem menos alcool?
• … existe maior abuso de filhos adoptados que de biológicas?
• … gostamos de comida que nos prejudica a sáude?
• ... os pais se devotam aos filhos?
• … as grávidas ficam mal-dispostas?
• ... os gêmeos têm uma personalidade mais similar?
• ... há maior incidência de doença bipolar nos escritores e pintores?