Sei sulla pagina 1di 56

DIAGNÓSTICO MOLECULAR

DIAGNÓSTICO

• ENFERMEDADES GENÉTICAS

• ENFERMEDADES INFECCIOSAS
DIAGNÓSTICO DE ENFERMEDADES
GENÉTICAS

Detección del gen responsable:


• ausencia del gen
• defecto causado por deleción
• defecto causado por una mutación puntual
• defecto causado por translocación
• defecto causado por incremento de nucleótidos
repetitivos
DIAGNÓSTICO DE ENFERMEDADES
INFECCIOSAS

I. Detección directa del agente etiológico


- detección visual por microscopio
- cultivo del agente patogénico

Problemas / Desventajas :
- Algunos agentes son morfológicamente indistinguibles entre sí
- escondidos entre los tejidos
- baja sensibilidad
- patógenos difíciles de cultivar,
- contaminación de los cultivos
- toma mayor tiempo para que crezcan los patógenos en cultivo.
II. Detección indirecta por presencia de anticuerpos

Problemas / Desventaja

- no discrimina infección presente o pasada


- reacciones cruzadas (por determinantes
antigénicos compartidos por diferentes
microorganismos)
SISTEMA DE DIAGNOSTICO TRADICIONAL
DIAGNÓSTICO MOLECULAR

- Detección de DNA, RNA o Proteína específico


- De acuerdo a la metodología utilizada, puede ser
directo o indirecto.
- Actualmente son los sistemas de diagnóstico
con mayor especificidad, mayor sensibilidad,
y mayor rapidez.
-Se pueden utilizar para el diagnostico de
enfermedades genéticas e infecciosas
DIAGNOSTICO MOLECULAR : Tres niveles

I. Prenatal :
• enfermedades hereditarias
• Predisposición genética
II. Pre-sintomático:
• Enfermedad infecciosa (fase temprana)
• Predisposición a Enfermedades como el cáncer,
autoinmunes, degenerativa, trastornos
psicosomáticos (historia clínica familiar)
III. En tiempo real (monitoreo):

• Características del patógeno (identificación,


virulencia, resistencia a drogas)
• Estado inmunológico (carga antigénica, o cantidad
de anticuerpos)
• Estado de la enfermedad (detección de
marcadores)
• Monitoreo al tratamiento: marcadores, respuesta
al tratamiento, resistencia, etc…
DIAGNOSTICO MOLECULAR EN EL
FUTURO
Diagnóstico Molecular

TEST DIRECTOS
 El ADN se analiza directamente para saber si la secuencia de un gen es
normal o mutante (para ver si lleva o no una mutación patológica conocida)
 No siempre practicable

TEST INDIRECTOS
 Se utilizan para hacer screening de la población o familiar.
 Se detectan marcadores moleculares y no la secuencia directa.

MATERIALES
• Vellosidades coriales / Sangre de cordón / Una o dos células del embrión
• Muestras de sangre
• Muestras de tejido
• Tejidos incluidos en parafina
• Pelos, semen, saliva….
TÉCNICAS
• Generalmente ADN amplificado por PCR
• Southern-blot (X- frágil, distrofia miotónica)
• Restricción
Para qué sirve un marcador?
Un marcador es considerado como un carácter cuyo patrón de herencia
puede definirse en un nivel morfológico (fenotípico), bioquímico o molecular.
Se asocian marcadores con caracteres que se saben causantes de
enfermedades genéticas, estableciendo una probabilidad de relación entre un
locus genético defectuso y un marcador determinado
Lo mas importante: La herencia de los mismos es Mendeliana

Los marcadores moleculares son:


Cualquier señal o traza molecular que nos permite estudiar un carácter
(Fenotipo) o gen (Genotipo) asociado a estos, y que tiene herencia
mendeliana.
Desde el momento en que se conocen las secuencias de ADN, estas se
pueden usar para identificar a un organismo, a una especie, a una cepa o
características fenotípicas asociada a un individuo.
Representan los marcadores genéticos
Desde el punto de vista de un análisis de relación genética son marcadores
son puntos específicos fijados a un cromosoma
Los marcadores moleculares genéticos son
Segmentos o fragmentos de cromosoma que no codifican
necesariamente alguna característica. (o sea pueden ser zonas
no codificantes)

Se basa en la detección de AFLP


variabilidad a nivel de secuencias de
ADN. (polimorfismo genético)

Fuentes de origen de MM
1. ADN cromosómico (genómico)
ADN codificante RAPD SSR
ADN no codificante
ADN altamente repetido
2. ADN extracromosómico
ADN mitocondrial
ADN de cloroplastos
Polimorfismos genéticos
• Sólo 0.5% genoma difiere entre humanos
• Ese 0.5% responsable de la predisposición a
enfermedades y de la respuesta a agentes
ambientales y fármacos
• Se habla de polimorfismo, en vez de mutación,
cuando la variación del ADN está en más del 1%
de la poblacìón
Sistemas de marcadores moleculares genéticos
probe
*******
Basados en hibridación DNA

RFLP, VNTR,
oligonucleotide fingerprinting

Basados en amplificación DNA


RAPD, DAF, AFLP, SSR,
MP-PCR, ISSR, IRAP, REMAP,
STS, SCAR, CAPS

ATTAGTCTTACCTAGGAATCGATT
Basados en secuenciamiento TAATCAGAATGGATCCTTAGCTAA
EST, SNP,
DNA microarray
Procedimientos Generales en el uso de MM:

1. Extracción de DNA
2. Generación de polimorfismo
Enzimas de restricción
Reacción PCR
Combinación de los 2 anteriores (enzimas de
restricción y PCR)
3. Electroforesis (horizontal, y/o vertical)
4. Detección de fragmentos
Sondas marcadas (radioactivas o
quimioluminisencia)
Bromuro de etidio, UV
5. Revelado por autoradiografía y/o fotografía
6. Evaluación de los fragmentos
7. Análisis estadístico
Técnicas basadas en hibridación:
Variantes del Southern-blot

Southern-blot

Seguimiento Trasplante de Médula Ósea


(TMO)

D R

Hibridación sonda de locus único (MS1)

Tinción del gel Autoradiograma


con BrE Usando una sonda
RFLPs
(Polimorfismo de fragmentos de restricción de longitud
variable)
Esta técnica se vale de la capacidad que tienen las enzimas de restricción
para poder reconocer secuencias especificas a lo largo del genoma, de
modo que una mutación puntual dentro del sitio de restricción resultará en la
pérdida o ganancia de una secuencia de reconocimiento, dando origen a un
fragmento de restricción de diferente longitud a la del original.
Las mutaciones causadas por una inserción, deleción o inversiones en el
DNA también llevan a variación en la longitud de los fragmentos de
restricción.
Los fragmentos del genoma generados por las enzimas de restricción son
separados en un gel de agarosa para luego ser transferidos a un soporte
sólido.
Una vez que se encuentran en el soporte sólido, el DNA digerido y
separado, puede ser hibridado con una sonda.
Ej: Diagnóstico molecular de Anemia Falciforme:

GGATCC
Hb A Pro - Glu - Glu CCTAGG

CCT-GAG-GAG

Hb S Pro - Val - Glu

CCT GTG GAG

La enzima de restricción MstII reconoce la secuencia CCTNAGG


DNA
genómico
RFLP
+ Enzimas de restricción = digestión

Papel toalla
Electroforesis en
geles de agarosa Membrana
Gel

Esponja

Southern Blot

Perfil de polimorfismo
obtenido Hibridación Membrana con
con sonda DNA transferido
RESULTADOS
Técnicas basadas en amplficacion (PCR)
Secuencia Diana
5’ 3’

3’ 5’
1
Desnaturalización del ADN Genómico
1.- 94ºC
1993 5 minutos
2
3
Anillamiento
Extensión
Los Cebadores se sitúan
Elongación de los Cebadores flanqueando
con Taq polimerasa la Secuencia Blanco
2.- 50-60ºC
5’ 3’
3.- 72ºC 30 s.-1m
5’ 3’
3’ 5’ 30 s - 3 m
3’ 5’
5’ 3’
3’ 5’

CICLOS: 30
Copias ADN: 1.073.741.824
Copias diana: 1.073.741.764
2 copias
4 copias
8 copias

16 copias
PCR (reacción en cadena de la polimerasa)

PCR (Polymerase Chain Reaction): desarrollada en 1986 por


Kary Mullis.

OBJETIVO: generar un gran número de copias de un


fragmento de ADN específico.

Se puede partir de una única copia del ADN original (molde


o templado).
Condiciones
Se basa:

• en la propiedad de las ADN polimerasas para replicar


hebras de ADN.

• en la capacidad del ADN de desnaturalizarse


renaturalizarse (por calor)

• poder realizar ciclos (repeticiones) con altas y bajas


temperaturas alternadamente.
Requisitos
 Conocer las secuencias blanco.

 Diseñar oligonucleótidos (primers) que determinan los límites de la


región amplificada.

 DNA polimerasa termoresistente (Thermus aquaticus, una bacteria


termofílica). Nombre del enzima es Taq polimerasa.

 Un equipo que controle la temperatura en forma cuasi instantánea.

 Sistemas de visualización (geles agarosa, radiactivos, fotométricos,


colorimétricos).

 Principalmente mucho cuidado!!!!!


Diseño de los primers

• Los primers tienen que ser complementarios a los flancos


secuencia a amplificar.

• La longitud del primer determina la especificidad:


 8 nucleótidos: prob. 1/65536 pb. En el genoma humano hay 46000 sitios
distintos.
 18 nucleótidos: prob. 1/17179869184 pb. Un solo sitio!!!.

• Límites: longitud afecta a la velocidad de hibridación y la eficiencia


del proceso. (no mas de 30 nucleótidos).

• Hibridar el nucleótido 3´!!!!!!!!!


Pasos a seguir:
 1- Inicialización: desnaturalizar el ADN, llevando la temperatura de 94-95°C durante 5-9
minutos. (depende del DNA blanco)

CICLOS
 2- Desnaturalización calentamiento a 94-95 °C durante 30´´
 3- Annealing/Alineamiento/Unión del primer: se produce la hibridación del primer, es
necesario bajar la temperatura a 50-65°C. La temperatura óptima de annealing es
específica para cada primer; y depende de la secuencia.
Problemas
 Temperaturas altas impedirán la unión del primer
 Temperaturas bajas llevarán a una unión inespecífica.
• 4 - Extensión/Elongación de la cadena: se sintetiza la nueva hebra de ADN
complementaria en dirección 5'→ 3', uniendo el grupo 5'-P de los dNTPs con el grupo 3'-
OH libre . Para la Taq polimerasa, la temperatura optima de actividad es 72 °C. El tiempo
de extensión depende tanto de la longitud del fragmento de ADN que se va a amplificar. La
Taq polimerasa, polimeriza 1000 bases/minuto.
• Los pasos 2,3,4 se repiten unas 25-35 veces

• 5 - Elongación Final: cualquier ADN de cadena simple restante sea completada.


Etapa única que se lleva a cabo a una temperatura de 72 a 74 °C durante 5-15
minutos tras el último ciclo de PCR.
35 ciclos= 68 billones de copias
Temperatura de Hibridación
• Es el factor mas determinante en la hibridación. A
temperaturas demasiado altas, no tiene lugar. Temperaturas
demasiado bajas, tienden a favorecer hibridaciones
inespecíficas, alterando la especificidad de la reacción.
• La temperatura óptima tiene que ser lo suficientemente baja
para permitir la hibridación específica entre el primer y su
´secuencia complementaria, pero lo suficiéntemente alta,
como para impedir hibridaciones no específicas.
• Esta temperatura puede calcularse en base a la temperatura
de fusión (melting temperature) o Tm del híbrido.
Cálculo de la Tm
• La Tm se puede obtener experimentalmente,
pero es mas habitualmente calculada en base
a la siguiente ecuación:
• Tm= (4x[G+C])+(2x[A+T])ºC
• Donde G,C,A y T es el número de nucleótidos
de cada tipo en el primer.
Temperatura de Hibridación
• La temperatura de hibridación estará, por
tanto, 1-2ºC por debajo de la Tm (del primer
con menor Tm)
• Es importante tener en cuenta que la PCR
requiere el uso de dos primers, y que ambos
deben de tener una temperatura de
hibridación semejante. De lo contrario, la
reacción no procederá normalmente !
PCR-RFLP

• Restriction Fragment Length Polymorphism:


Amplificación por PCR de una secuencia,
digestión enzimática y comparación de los
fragmentos resultantes.
PCR-RFLP
• PASOS
1)Obtener ADN total
2)Amplificación de cierta región
( por ej. ITS1-ITS2)
3)Corte del ADN amplificado
Acción de enzimas
con enzimas de restricción de restricción

4)Observación de los fragmentos


por electroforesis en gel de agarosa
Fragmentos de restricción con Taq I
RAPD
Random Amplified
Random Amplified Polymorphic
Polymorphic DNA DNA
Amplificación de ADN anónimo con
cebadores de secuencia arbitraria

Fundamento: Amplificación de regiones


del genoma utilizando primers al azar.
Observación en gel del patrón de bandas
obtenido
RAPD:AMPLIFICA MULTIPLES REGIONES (MULTILOCI)
Amplificación mediante PCR de un ADN anónimo, utilizando para ello
un cebador de secuencia arbitraria
RAPD

• 1990, Welsh et al.


• Usa cebadores muy cortos (10 pb) para amplificar
fragmentos aleatorios de ADN.
• No se necesita ninguna información acerca del
genoma en estudio
• Marcador dominante: presente o ausente
RAPD
Reaccion PCR

Electroforesis

Tinción y visualización de los fragmentos de amplificación

Polimorfismo con la
técnica RAPD
Correspondencia entre fragmentos
amplificados y bandas en un gel

_
Ventajas
 Requiere baja cantidad de DNA
 Fácil de obtener
 Aplicabilidad a cualquier genoma
 Bajo costo
Desventajas
Problemas de reproducibilidad
Nivel de información limitada debido a su
naturaleza dominante (no se puede diferenciar
un heterocigoto de un homocigoto, el locus se
reduce a un solo alelo)
AFLPs
Amplified Fragment
Length Polymorphism
Obtención de marcadores
AFLP
Ventajas
 Reproducibles
 Elevado número de bandas obtenidas por gel
 No se necesita información previa para su desarrollo
(sondas o iniciadores específicos)
 Muchos loci estudiados al mismo tiempo
 No se necesita ninguna información anterior
 Alta variabilidad
)
Desventajas
 Nivel de información limitada debido a su naturaleza
dominante
 Protocolo es muy largo
ADN Repetitivo
Microsatélites o Secuencias Simples Repetidas
(Simple Sequence Repeats, SSRs)
- Mono-, di-, tri-, y tetra-nucleótidos

Minisatélites o Short Tandem Repeats (STRs)


- 5-10 bp

Variable Number of Tandem Repeats


- 14-100 bp
SSR
Simple Sequence Repeat
Sinónimos

Microsatélites
STR - Short Tandem Repeat
STMS - Sequence Tagged Microsatelite Site
SSLP - Simple Sequence Length Polymorphism
Se basa en los microsatélites
 Fragmentos de ADN formados por unidades repetitivas
de secuencia simple.
 Estas unidades o motivos se componen de 1 a 6 pares
de bases y su grado de repetición es relativamente bajo.

Mononucleotido TTTTTTTTTT = T10


Dinucleotido AGAGAGAGAGAG = AG6
Trinucleotido CATCATCATCATCATCAT = CAT6
Tetranucleotido TAGTTAGTTAGTTAGTTAGTTAGT = TAGT6
Tipos de SSR

n, m y r = número de
Perfectos: (CA)n repeticiones del
Imperfectos: (CA)n – CCA – (CA)m motivo

Compuestas: (CA)n (TG)m


Compuesta interrumpido: (CA)n –TG-(TG)m
Compleja: (CA)n –TG-(TG)m (TA)r

GTn los mas extendidos en genoma de mamíferos


Atn la mas extendida en genoma de vegetales
GAn mas abundante en cebada y arroz
Marcadores microsatélite 2. Electroforesis en geles
Etapas de la técnica SSR Poliacrilamida o agarosa
incluyen: (casos muy limitados)

1000 pb

1. Reacción
PCR, con dos 100 pb
iniciadores M P1 P2 1 2 3 4 5
stop
F1 F2
1
F3
2
F4
3
F5

6
especificos
4 5 6
7 8 9
Gene Amp enter 0 ce

IBT

para un locus
SSR

I I
I
II II
II

III III III


PCR en P1, 3 y 6 PCR en P2, 2 y 5 PCR en 1 y 4
Los SSR son marcadores codominantes

1
1 2 3 4 5

5
Ventajas
 Poseen alta variabilidad en sus loci, apropiado
para los análisis de diversidad genética.
 Se encuentran distribuidos por todo el genoma
permitiendo hacer un buen muestreo genético
del material en estudio.
 Muchos alelos por locus

Desventajas
Su identificación y puesta a punto es costoso.
 Requiere secuenciamiento de DNA