Cosmeticsandtoiletries201801 DL

20 Glover Avenue P: 203-822-9800
Norwalk, CT 06850 F: 203-822-9820

www.centerchem.com
CT16_ad_template.indd 1 12/19/17 11:49 AM

January 2018
Blue Light Rewriting

Protection the Skin Care Code
COLD STRESS DAMAGE

Banished
WANT MORE?
Check out our digital edition exclusives!
CT1801_Covers_fcx.indd 1 12/26/17 11:46 AM

otanical
®
Extracts
Are What We Do!
Bio-Botanica Inc.
R TM
A blend of Science, Innovation and Creativity

75 Commerce Drive, Hauppauge, New York 11788
Toll Free: 1-800-645-5720 | Local Tel: (631)231-5522 | Fax: (631) 231-7332 | www.bio-botanica.com
CT16_ad_template.indd 1 9/12/17 3:38 PM

Untitled-1 1 2/12/16 2:21 PM
Cover Story Contents | C&T
January 2018 | Volume 133, number 1
6 Editor’s Note: Testing the

®
34
Comfort Zone by R. Grabenhofer
8 Industry Insight: Probing Deeper to

Further Skin Aging Research
with T. Wang, Ph.D., Johnson & Johnson
8 [podcast] Probing Deeper to Further

DIGITAL
Skin Aging Research
with T. Wang, Ph.D., Johnson & Johnson
72 Ad Index
Market Intelligence
9 Technology Launches
10 Product Roundup:
12
Moisturizers & Emollients
DE1 Following the #Selfcaremovement

DIGITAL
3 Ways Brands Can Expand
Research
12 Into the Blue
Novel Test Reveals Blue Light Damage,
Protection Strategies
by C. Mendrok-Edinger, et al.
30 A Dermatological View:
Plant-based Hydrogels
Applications in Cosmetics

52
by H.I. Maibach, M.D., et al.
Testing
34 Cold Stress Damage, Banished
Daphne odora Extract Improves
Skin Moisture and Healing
by F. Apone, Ph.D., et al.
34 Author Commentary:
DIGITAL
Cold Stress Skin Damage
by F. Apone, Ph.D.

2 | www.CosmeticsandToiletries.com Vol. 133, No. 1 | January 2018
CT1801_TOC_Masthead_fcx.indd 2 12/26/17 4:35 PM

Advertorial
Sustainable Shea
Performance without compromise
Today’s consumers want innovative, high-performance products created with natural, sustainable and ethically
sourced ingredients. When choosing AAK’s technologically advanced shea-based emollients for your formulations, you
do more than just excel at meeting these challenges. You also make a positive difference to the social, environmental
and economic development of the communities that depend on shea for their livelihood.
Shea is renowned for its anti-inflammatory, anti-ageing and skin barrier strengthening properties and has come a long way
from a simple butter. AAK leads the way in developing shea-based ingredients for the beauty industry and opening up new
opportunities for both the cosmetic formulator and the estimated 16 million women in West Africa who rely on shea for an
income. Increasing demand from cosmetic manufacturers is helping to build a bigger, better shea industry and halt rural-urban
migration. Generating more earnings to empower the shea-collecting women, improving local livelihoods and securing
supplies for the future. A win-win situation all round.
Creating value and sustainability through direct sourcing. Streamlined supply chains give local women more negotiating
power, a higher income and greater independence. The AAK direct sourcing programme was introduced in Burkina Faso in
2009 and has recently been extended to Ghana. Based on fair trade principles, including access to pre-financing, education
and logistical support, the programme involves over 115,000 women and continues to grow.
Working with AAK has helped me become independent. We as women are stronger now and work together for the
community.” Kamboule Kibekoun
Sustainability is about empowering people, enabling prosperity and protecting the planet.
Our commitment to conserving energy and natural resources extends across the supply chain. Our Swedish manufacturing site
has been awarded an EcoVadis Gold ranking and initiatives include establishing Life Cycle Assessments to ensure that total
C02 emissions do not exceed the carbon absorbing capacity of the trees in Africa. We believe that by advancing innovations
in cosmetic formulations, changing perceptions of what is possible with shea technology and increasing demand from
consumers, we can make natural beauty a force for good.
Discover more at aakpersonalcare.com Technologically advanced innovations with shea
Contact:
aakpersonalcare.com
lipid@aak.com
At AAK we have pioneered new techniques to optimise the physical and sen-
sory characteristics of shea and allow increased functional use across the full
spectrum of cosmetic applications. From solid and semi-solid forms offering
high temperature stability, low odour and improved colour, to liquid versions
that eliminate crystallisation and enable clear, sprayable formulations.
CT1710_AAK_Advertorial.indd 1 9/18/17 5:28 PM

Editor’s note | C&T ®
Contents | C&T ®
2017 FOLIO: Award Winner
EDITORIAL
Editor in Chief Jeb Gleason-Allured | 1-630-344-6069/jallured@allured.com
Senior Managing Editor Katie Anderson | 1-630-344-6077/kanderson@allured.com
Managing Editor Rachel L. Grabenhofer | 1-630-344-6072/rgrabenhofer@allured.com
Assistant Editors Brooke Schleehauf | 1-630-344-6032/bschleehauf@allured.com
Jennifer Novoseletsky | 1-630-344-6045/jnovoseletsky@allured.com
Digital/Social Media Editor Audrey Latimer | 1-630-344-6067/alatimer@allured.com
ADVERTISING SALES
Business Development Manager Tom Harris | 1-201-445-4702/tharris@allured.com
Fragrance Sales Paige Crist | 1-630-344-6060/pcrist@allured.com
Advertising Coordinator Kasia Smialkowski | 1-630-344-6025/ksmialkowski@allured.com
66
AUDIENCE DEVELOPMENT
Marketing Lead Marie Galvan
Customer Service 1-888-355-5962/customerservice@cosmeticsandtoiletries.com
DESIGN
Graphic Design Manager Lisa Hede
Graphic Designer James Fergus
Production Manager
52 Sensory Insight Bryan Crowe
Emollient Profiling Accelerates Speed to Market CORPORATE

by C. Marque Partner & CEO George Fox
Partner & President Janet Ludwig
52 From the Vault: Controller Linda Getner
Director of Events Maria Prior
DIGITAL
Customizing Sensory Digital Products Director Rose Southard
Experience Executive Assistant Maria Romero
by J.M. Carey, Ph.D.
OTHER ALLURED PRODUCTS
Formulating
Cosmetics & Toiletries Bench Reference
Cosmetics & Toiletries magazine: Portuguese edition
Face & Body Midwest Spa Expo and Conference
Face & Body Northern California Spa Expo and Conference
58 Ingredient Profile: Examining Face & Body Southeast Spa Expo and Conference
Flavorcon
Tomorrow’s Surfactant Personalities Global Cosmetic Industry magazine
Perfumer & Flavorist magazine
Alpha Olefin Sulfonate in Personal Care Skin Inc. magazine
by S. Narasimhan, Ph.D., and J. Toliver World Perfumery Congress
66 A New Code for Skin Care, Part II For Subscriptions: Subscribe online: www.CosmeticsandToiletries.com/subscribe
In the US, telephone: 1-888-355-5962; outside the US, telephone: 1-847-559-7558
(8 AM–4:30 PM Central, Monday–Friday) Fax: 1-847-291-4816
Breakthroughs in the Delivery of RNAi Therapeutics E-mail: customerservice@cosmeticsandtoiletries.com
Address: Cosmetics & Toiletries, PO Box 3009, Northbrook, IL 60065-3009
by P. Lawrence, Ph.D., and J. Ceccoli Print subscriptions: Available free to qualified individuals located in the United States.
All other countries may subscribe to the digital edition.
Periodicals Postage paid at Carol Stream, Illinois, and additional mailing offices.
66 Author Commentary: Change of address: In ordering a change of address, give both the old and new addresses. Allow two months for change to
become effective. The publisher will attempt to handle unsolicited articles with care, but the magazine assumes no respon-
DIGITAL
Epigenetics in Cosmetics, sibility for them. Materials will be returned only if accompanied by a self-addressed envelope with return postage. Address
inquiries regarding editorial policy and writer guidelines to the editor. The acceptance of advertising does not necessarily
with Paul Lawrence, Ph.D. carry the endorsement of the publisher.
Cosmetics & Toiletries® (ISSN 0361-4387CTOIDG) is published ten times per year as Jan., Feb., March, April, May, June,
July/Aug., Sept., Oct. and Nov./Dec. by Allured Business Media.
Address: Cosmetics & Toiletries, 336 Gundersen Drive, Suite A, Carol Stream, IL 60188-2403.
Connect with us www.CosmeticsandToiletries.com
All correspondence regarding business, editorial, advertising and production should be sent to Cosmetic & Toiletries,
336 Gundersen Drive, Suite A, Carol Stream, IL 60188-2403. Periodicals postage paid at Carol Stream, IL 60188-2403 and
LinkedIn additional mailing offices.
Cosmetics & Toiletries POSTMASTER: Send address changes to Cosmetics & Toiletries, PO Box 3009, Northbrook, IL 60065-3009
Allured Business Media makes all attempts to publish accurate information; however, this publication may contain technical
Facebook inaccuracies or typographical errors. The reader assumes all risks concerning the suitability and accuracy of the information
within this publication. Allured Business Media assumes no responsibility for and disclaims all liability for any such
Cosmetics & Toiletries inaccuracies, errors or omissions in this publication and in other documentation referred to within or affiliated with
this publication.
Copyright 2018: Reproduction in whole or in part without permission is strictly prohibited.

Cosmetics & Toiletries and C&T are registered trademarks of Allured Publishing Corporation.
CT1801_TOC_Masthead_fcx.indd 4 12/28/17 11:34 AM

Densorphin™
17 31
Densorphin™
17 31
For a dense, sexy

62 836
For a dense, sexy

41 836
and happy skin

+ 41+62
and happy skin

Phone
Phone
Densorphin™ is a novel firming and lifting ingredient to combat hormone-

/ Switzerland,
Densorphin™
induced is a novel
skin aging. firming and
Densorphin™ is lifting
basedingredient to combat
on an extract hormone-
of monk’s pepper
/ Switzerland,
induced skin aging. Densorphin™ is based on an extract of

berries which was found to stimulate the synthesis of DHEA and to possessmonk’s pepper a
berries which was found
beta-endorphin-like to stimulate
activity. DHEA is the synthesis
precursorof
forDHEA and hormones,
both sex to possess a
beta-endorphin-like
the female estrogen activity.
and the DHEA is the precursor
male testosterone. for both sex hormones,
In placebo-controlled clinical
Buchs
the
trialsfemale estrogen
with women andand
men theover
male testosterone.
50, In placebo-controlled
the cream with Densorphin™ showed clinical
Buchs
atrials
clear with women andofmen
improvement skinover 50, the
elasticity andcream with Densorphin™ showed
skin density.
5033
a clear improvement of skin elasticity and skin density.

5033
• Increases the skin density after just one month

Biochemistry,
• Increases
Visibly fadesthe away
skin density
wrinklesafter just one month
Biochemistry,
• Visibly
Restores fades away
skin’s wrinkles
elasticity
• Restores skin’s elasticity
Densorphin™ is a preservative-free novel skin re-densifying active for
Densorphin™
menopause is aandropause
and preservative-free
skin. novel skin re-densifying active for
AGAG
menopause and andropause skin.

Mibelle
Mibelle
www.mibellebiochemistry.com
USA office: Mibelle Biochemistry
USA office: White Plains,
Mibelle NY 10604 / USA
Biochemistry
Phone Plains,
White +1 844NY64210604
3553 / USA
Phone +1 844 642 3553

Editor’s Note | C&T ®
Testing the Comfort Zone

Is it just me, or 10 years ago—perhaps even five—would we never have expected to see
epigenetics or visible light emerge in the context of cosmetics R&D? Yet here they are,
on the cover of Cosmetics & Toiletries and gaining traction from ingredient developers as
mechanisms to target these phenomena are uncovered.
In fact, MarketsandMarkets projects the global epigenetics market will reach US $1.6
billion between 2017 and 2022, with a CAGR of 13.5%.1 Likewise, Euromonitor predicts full
environmental protection claims will become central to beauty in the near future—driven by
awareness of the negative effects of UV, rising pollution levels and the growing use of devices
that emit blue and infrared light.2
Who knows what we will see in five more years? I just returned from the SCC Annual
Meeting where alongside basic formulation sessions were talks on Big Data analysis,
virtual and augmented reality, and even smart phones for imaging and analysis. This
may feel like it is outside our comfort zone, but the industry is clearly catching up with
tech-driven consumers.
In contrast, our top cover story this month, from Apone et al., targets a more obvious
area for cosmetics research: cold stress damage in skin; in fact, I’m amazed this topic hasn’t
surfaced sooner. We all know skin needs extra care during cold months, but these authors
stop to consider why—and offer a solution.
Finally, knowing how emollients affect the sensory traits of a
formula is a perpetual area of interest to product developers. Here,
Marque describes a process to more easily choose ingredients
that maintain consumer pleasure and comfort, while assuring
compatibility within formulas and increasing speed to market.
In the New Year, Cosmetics & Toiletries will continue to present
forward-thinking content to test the limits of the industry’s comfort
zone, but also provide the fundamentals necessary to build winning
products. Together, that’s a formula for success.
Rachel L. Grabenhofer
1. www.marketsandmarkets.com/PressReleases/epigenetics-technologies.asp Managing Editor
2. https://blog.euromonitor.com/2017/06/evolving-trends-hottest-ingredients-sun-protection.html
CT1801_Editors_Note_fcx.indd 6 12/26/17 1:06 PM

SURFACTANTS SILICONES EMOLLIENTS SOLUBILIZERS
ISELUX
®
inner freedom
Iselux® features a wide range of trending, sulfate-free
cleansing qualities and combines them with extra-mild
elements, resulting in all of the customizable,
easy-blend formulations you can imagine.
Iselux® Is Also Offered in Liquid Versions That

Accommodate Multiple Preservative Systems, and
Concentrated Blends for Ease of Manufacturing
Requires only water and an electrolyte, resulting in
Iselux® SFS
cost-effective, sulfate-free shampoos and body washes
Optimized blend delivers high levels of oils

Iselux® SLC
and/or silicones
Iselux® Extremely mild, tear-free concentrate for

Ultra Mild sensitive applications
Iselux® is the surfactant that combines

everything you want in one unique product,
exclusive to INNOSPEC.
Contact INNOSPEC to Add Iselux®

Inner Beauty to Your Brand or Product.
Visit www.innospecinc.com

Scientific Industry Insight | C&T ®
Advisory Board
Probing Deeper to Further

Skin Aging Research
Eric Abrutyn
TPC2 Advisors Ltd.
Zoe Diana Draelos, M.D.

Dermatology
Consulting Services Johnson & Johnson can see the future—of skin aging, that is.
How? Using a novel imaging technique. Tracy Wang, Ph.D.,
Angela R. Eppler, Ph.D.
Pfizer Consumer Healthcare presented it at the SID meeting last April and describes it
here, in an adaptation from our recent podcast interview.
Trefor Evans, Ph.D.
TA Evans LLC Hear more at CosmeticsandToiletries.com/multimedia.
S. Peter Foltis
L’Oréal C&T: What is this new imaging technique?
Mindy Goldstein, Ph.D. Wang: Multiphoton microscopy, sometimes called
Atlantic Coast Media Group
two-photon microscopy. Our first objective was to evalu-
Shuzo Ishidate, Ph.D. ate this technique for the field of skin aging. The second
Shiseido Research Center objective was to develop a new algorithm or methodology
to better characterize skin aging.
John Jiménez
Belcorp Colombia
C&T: How does it work?
Wang: We measure z-stacks of multiphoton micros-
Karl Laden, Ph.D.
Alpa Cosmetics
copy images taken from the surface and deep dermis
Prithwiraj Maitra, Ph.D.
Johnson & Johnson
layer of the skin. [Editor’s note: in microscopy terms,
z-stacks are calculated, three-dimensional representations
Jennifer Marsh, Ph.D. of a sample derived noninvasively from optical sections of
Procter & Gamble a specimen.] These volumetric images are collected via
two channels: two-photon fluorescence and harmonic
Marc Pissavini, Ph.D.
Coty-Lancaster generation. This allows us to look at the fiber orientation
distributions in the deeper dermis layers of the skin.
Luigi Rigano, Ph.D. Using a new algorithm we developed, we can then visual-
Industrial Consulting Research
ize how aligned (or not) collagen and elastic fibers are in
Sylvianne Schnebert, M.D. the skin, and how products affect this arrangement.
C&T: What insights can you share from your work?

LVMH Recherche
Ron Sharpe
Amway
Wang: Aged skin showed a more single-dominant
Leslie C. Smith, Ph.D. [less uniform] elastic fiber orientation, whereas younger
Consultant skin had a more multi-dominant [uniform] arrangement.
Interestingly, collagen fibers in aged vs. younger skin did
David C. Steinberg not look much different.
Steinberg & Associates
Peter Tsolis C&T: How is this technique an improve-

The Estée Lauder Companies ment over existing methods?
Russel Walters, Ph.D.

Johnson & Johnson Wang: The combination of the two Tracy Wang, Ph.D.
Senior Scientist,
channels allows us to differentiate between
Johnson & Johnson
Claudie Willemin the two types of fibers in the skin. There’s no
L’Oréal Consumer Companies
need to use dye labeling to see the contrast
between them. You also don’t need to touch
Shuliang Zhang, Ph.D.
Unilever the skin or use histology analysis.
Want More?
For more insight from Tracy Wang or others,
log onto www.CosmeticsandToiletries.com
CT1801_Industry_Insight_fcx.indd 8 12/28/17 9:16 AM

Technology Launches
Body Care Active Matte Technology
Photo Credit: Koel Colours

Naturally obtained from an eco-designed process, In partnership with Sandochem LLC, Koel Colours has
Hydronesis (INCI: Not Available) is a biotechnological introduced Koelex pigments, which provide a matte
body care active developed by Sederma to address common effect with color transparency and zero gloss for a range
skin imperfections. This active reduces keratosis pilaris—a of products. The Koelex collection includes: HM (INCI:
common, harmless skin condition that causes small, hard Alumina (and) Silica), NM (INCI: Alumina) and SM
bumps—and post-waxing redness, while moisturizing the (INCI: Not Available), each offering various matte effects.
skin and leaving it soft. www.koelcolours.com
www.sederma.com
Sensory Modifier Sustainable Biotech
Photo Credit: Givaudan Active Beauty

Photo Credit: INOLEX
INOLEX has launched LexFeel Vibrant (INCI: Palm Acid Givaudan Active Beauty has introduced BisaboLife
(and) Adipic Acid (and) Pentaerythritol Crosspolymer), a (INCI: Bisabolol), a sustainable molecule produced by a
sensory and texture modifying agent that helps to improve fermentation process. As a fully bio-sourced ingredient,
the vibrancy of pigments in color cosmetics. It is offered BisaboLife takes care of sensitive skin and the scalp by
as an alternative to typical oils, butters and waxes. The refreshing and soothing while restoring comfort. Its
ingredient responds to the consumer driver for cosmetics soothing action was also shown clinically to help reduce
in an array of colors, finishes and textures. redness after shaving by 81%, in comparison with a placebo.
www.inolex.com www.givaudan.com
Vol. 133, No. 1 | January 2018 Cosmetics & Toiletries® |9
CT1801_Tech_Launches_fcx.indd 9 12/28/17 3:52 PM

Roundup [Ingredients, Equipment & Services]
Moisturizers & Barrier Care

1. Firm’Act
1
Biosil Technologies, Inc.
www.biosiltech.com
Firm’Act (INCI: Water (Aqua) (and) Himanthalia Elongata Extract
(and) Fucus Vesiculosus Extract (and) Saccharomyces Cerevisiae
Extract) is a natural ingredient that targets the skin's adaptive
defense against stress known as hormesis. The ingredient
up-regulates the expression of unique gene markers involved in
cellular stress response to protect skin by: strengthening its dermal
structure, boosting extracellular matrix maintenance, increasing
skin antioxidant capacity and protecting against UV-induced
damage. Firm’Act also delays facial skin sagging and increases skin
firmness for more toned and better-protected skin.
2. Gransil SBG-11
Grant Industries
www.grantinc.com
Gransil SBG-11 (INCI: Dimethicone (and) Polysilicone-11 (and)
Butyrospermum Parkii (Shea) Butter) is a silicone elastomer butter
blend containing an advanced non-crystallizing shea butter for a
2
variety of personal care applications. With shea butter interspersed
within an elastomer network, Gransil SBG-11 offers improved
sensory and performance properties, compared to standard silicone
elastomer materials, while also delivering a lasting barrier function.
3. Zemea Propanediol
DuPont Tate & Lyle Bio Products
www.duponttateandlyle.com
With its skin-friendly performance, including no irritation,
enhanced moisturization and esthetics, Zemea Propanediol (INCI:
3 4
Propanediol) is ideal for skin care, hair care, deodorants, fragrances
and other cosmetic and personal care products. It can be used
as a humectant, preservative booster, emollient, natural solvent,
viscosity enhancer and hand-feel modifier, as well as for botanical
extraction and dilution. It can also serve as a carrier for actives,
botanical extracts and fragrances; in natural preservative systems;
and for developing natural esters and ethers.
4. MCT
Arista Industries, Inc.
www.aristaindustries.com
Arista Industries offers MCT (INCI: Medium Chain Triglycerides) and
various grades of coconut oil, including organic refined, bleached
5
and deodorized (RBD) and virgin as well as conventional grades
for use in food, nutritional and cosmetic formulations. These
ingredients may help improve heart, vascular, brain and immune
functions as well as enhance skin and hair health.
5. AquaCacteen
Mibelle Biochemistry
AquaCacteen (INCI: Opuntia Ficus-Indica Stem Extract (and)
Glycerin (and) Phenoxyethanol (and) Water (Aqua)) is an active
ingredient based on organic prickly pear cactus leaves that soothes
and hydrates sensitive and irritated skin. AquaCacteen was shown
to preserve skin firmness after exposure to UV and to increase skin
hydration even in a rinse-off shower gel formulation.
CT1801_Roundup_fcx.indd 10 12/26/17 1:41 PM

MELINOIL™
UNIQUE OIL-SOLUBLE
SKIN PHOTOPROTECTOR
NEW CLINICAL RESULT AT ONLY 2%
Stimulates the natural skin defense MelinOIL™ doubles the

system against SUN damage tanning intensity!
TANNING EFFECT AFTER UVB IRRADIATION UP TO

41%
1 2 3 30
Skin pigmentation variation
+25.4%
(% D5 vs D0)
20
x2
Increases skin Limits Reduces +12.5%
pigmentation photoaging sun erythema 10
0
Placebo MelinOILTM 2%
SOAK UP THE SUN WITH SERENITY!
www.lucasmeyercosmetics.com

Research | C&T ®
KEY POINTS
• The negative effects of visible or blue light
on skin are not fully understood. This article
describes a model to test for potential damage
and screen for compounds to suppress it.
• Results confirm blue light induces cutaneous

damage, and a 3-D strategy of UV filters,
vitamins and plant extracts suppresses it.
Reproduction in English or any other language of

12 | www.CosmeticsandToiletries.com all or part of this article is strictly prohibited. Vol. 133, No. 1 | January 2018
© 2018 Allured Business Media.
CT1801_Research_Mendrok-Edinger_fcx.indd 12 12/26/17 1:55 PM

Into the
Blue Novel Test Reveals
Blue Light Damage,
Protection Strategies
Christine Mendrok-Edinger, Remo Campiche,
Karolina Gadsinski and Rolf Schuetz
DSM Nutritional Products, Kaiseraugst, Switzerland
B
tion is considered the main contributor to skin
photoaging, leading to fine lines, sagging and
wrinkles, as well as thinning of the skin, hyper-
pigmentation and age spots. At a molecular
level, these events are caused by: extracellular
matrix degradation in the dermis, mainly of
lue light, or high the collagen and elastic fibers; decreased cellu-
energy visible (HEV) lar proliferation; and the disrupted regulation
light, is usually of pathways related to melanogenesis. These
defined as light major cellular events result in DNA damage,
emitted by the sun in inflammation, oxidative stress and apoptosis.
wavelengths ranging Also, over-exposure to UV irradiation is still
from 400–500 nm.1 Approximately 40% of the believed to be the main cause behind various
solar radiation reaching the earth’s surface is types of skin disorders with decreased barrier
infrared light (> 800 nm), while 55% is vis- function.7, 8 These can range from dry and
ible light (400–800 nm) and ~7% is UV light sensitive skin, to actinic keratosis and malig-
(290–400 nm).2 nant skin cancers.4, 9 On the other hand, little is
The damaging effects of UV on skin are as yet known about the effects of visible light—
well-studied and documented, as recent specifically, blue light—on the skin, which is
reviews illustrate.3–6 In particular, UV irradia- just adjacent to the UVA region.
Vol.Reproduction
133, No. in1 English
| January
2018language
or any other of all or part of this article is strictly prohibited. © 2018 Allured Business Media. Cosmetics & Toiletries® | 13

Into the Blue
Literature findings suggest full protection

against sun-induced aging requires
extending into the visible wavelengths.
Blue light is already known as a therapeutic only UVB and UVA are not able to prevent blue
treatment for cutaneous disorders such as light-induced oxidative stress in skin—only by
eczema,10 psoriasis11 and acne-like condi- adding antioxidants such as tocopherol was the
tions.12, 13 In combination with photosensitizers formation of ROS blocked.19
such as 5-aminolevulinic acid, blue light is Liebel et al. showed that blue light induced
also used to treat actinic keratosis.14, 15 In this the expression of MMP-1 and the pro-
context, short-term blue light irradiation at a inflammatory chemokine IL-8. However, there
low dose has been shown to have no detect- was no formation of pyrimidine dimers, as
able negative impact on skin in vivo, and has seen with UV light.19 Therefore, it seems that
been presumed to be safe.16 However, there is blue light contributes primarily to photoaging
a distinct lack of human studies with larger and inflammation.
subject panels investigating long-term exposure Skin has developed defense systems against
or accumulation of blue light doses over weeks oxidative stress, including the enzymes cata-
or months. lase, superoxide dismutase and glutathione
peroxidase,23 which reduce the adverse effects
Blue Light in the Literature of UV and visible light irradiation in skin.24 In
What evidence is there for blue light-induced addition, there are cutaneous antioxidants that
damage? Interestingly, Opländer et al. found cannot be synthesized by skin itself, such as
that visible light at wavelengths of 410 nm and vitamins C and E and carotenoids.25
420 nm led to cytotoxicity in human dermal However, these degrade rapidly upon oxida-
fibroblasts, while visible light at 453 nm and tive stress and must be replenished. Indeed,
480 nm did not.17 They speculated this was due using Raman spectroscopy, Vandersee et al.
mainly to the higher energy of wavelengths showed a significant decrease in cutaneous
closer to UV light. Other studies indicated that carotenoids (21%) directly after blue light irra-
blue light evokes similar effects to those of UV diation at 100 J/cm2.26 In relation, Herrling et al.
light, and therefore protection against solar stated that for complete protection, antioxida-
radiation should also include wavelengths tive substances must be added to sun filters.28
above 400 nm.1, 18 These findings suggest that to achieve full
A good literature basis can be found for blue protection against sun-induced skin aging, sun
light-induced skin damage via the formation of protection must extend beyond UV light into
reactive oxygen species (ROS).19–22 This shows the visible spectrum.27 Although so far, only
conventional sunscreens dedicated to absorbing titanium dioxide (TiO2), zinc oxide (ZnO) and
methylene bis-benzotriazolyl tetramethylbutyl-
phenol (MBBT) have shown absorbance spectra
reaching into visible light; and the protection
Consumers are gradually becoming aware of they provide is reportedly low.19, 29, 30
blue light risks, but of the 40,000 skin care When it comes to pigmentation pathways,
products launched in 2016, just nine claimed visible light can also induce hyperpigmentation
blue light protection. in vivo,31–34 presumably by inducing the melano-
genesis rate-limiting enzyme tyrosinase, as was
shown ex vivo.31 This suggests that visible light
Source: Global Cosmetic Industry
contributes to the formation of uneven skin tone
(www.GCImagazine.com)
or solar lentigines. And due to blue light’s longer

wavelength, compared with UV, it penetrates more deeply into the skin—
down to the subcutis1—but the damaging effects caused in these tissues are
currently unknown.
Furthermore, blue light emission stems from solar irradiation as well
as electronic devices such as computer screens, tablets and smartphones.
Blue light is particularly present in light-emitting diodes (LEDs), too. There
is evidence that this wavelength of light has adverse effects on the eyes,
including potential retinal damage and digital eye strain.35, 36
With respect to skin, blue light emitted from LEDs of 412–426 nm was
shown to lead to the apoptosis of keratinocytes in vitro.37 Another study
found that irradiation of dermal fibroblasts with blue light (415 nm and
350 J/cm2) from an LED source inhibited proliferation and migration speed,
and led to the generation of ROS.38 These studies suggest blue light irradia-
tion from LED-emitting devices may indeed have damaging effects on skin,
contributing to photoaging.
Taken together, this paper investigates the damage caused by blue light
using a convenient in vitro test model based on b-carotene. The potential of
UV filters to provide protection is assessed, as is the possibility for specific
vitamins to complete the array of protection. Further, a model of blue
light-induced protein damage was established ex vivo with a new marker of
protein carbonylation.
Results show how vitamins, in addition to an extract from the fresh
water microalga Scenedesmus rubescens, suppress blue light damage in
skin. S. rubescens was chosen as it has previously been found to protect
cells from UV irradiation in vitro (data not shown). It is also relatively easy
to grow under laboratory conditions and yields a high biomass.
In vitro Materials and Methods

Test compounds: The specific test compounds used in this study, includ-
ing sunscreens, vitamins and an algae extract, are detailed in Table 1.
b-carotene test: The b-carotene test (BCT) was performed as described
previously.39 Due to the light sensitivity of b-carotene, the test was per-
formed in a laboratory equipped with red light. Using a glass syringe,
Table 1. Test Compounds
Compound Trade Name, Supplier Relevant Figures

Titanium Dioxide Parsol TX, DSM 3, 4, 5
Methylene
bis-Benzotriazolyl Parsol Max, DSM 3, 4, 5
Tetramethylbutylphenol
Vitamin B3 Niacinamide PC, DSM 1, 2, 4, 5
Vitamin E dl-α-Tocopherol 4, 5
DL-α-Tocopherol
Vitamin E 1, 2
Acetate, Sigma
Pyridoxine Hydrochloride,
Vitamin B6 1, 2
DSM
S. rubescens extract Pepha-Age, DSM 1, 2
Vol. 133, No. 1 | January 2018 Cosmetics & Toiletries® | 15

Into the Blue
Table 2. O/W Formulas for BCT Tests
A B C D
Diisopropyl Sebacate 3.0% w/w 3.0% w/w 3.0% w/w 3.0% w/w
Dimethicone 2.0 2.0 2.0 2.0
Stearyl Alcohol 1.5 1.5 1.5 1.5
Potassium Cetyl Phosphate 2.0 2.0 2.0 2.0
Dicaprylyl Ether 2.0 2.0 2.0 2.0
Isopropyl Myristate 14.0 11.0 14.0 11.0
Titanium Dioxide (and) Silica (and) Dimethicone n/a 3.0 n/a 3.0
Phenoxyethanol (and) Ethylhexylglycerin 1.0 1.0 1.0 1.0
Hydroxyethyl Acrylate/Sodium Acryloyldimethyl
0.5 0.5 0.5 0.5
Taurate Copolymer
Polyacrylate Crosspolymer-6 0.5 0.5 0.5 0.5
Silica 3.0 3.0 3.0 3.0
Water (Aqua) 65.5 65.5 57.5 57.5
Propanediol 5.0 5.0 5.0 5.0
Methylene Bis-Benzotriazolyl
Tetramethylbutylphenol (and) Water (Aqua) (and)
n/a n/a 8.0 8.0
Decyl Glucoside (and) Propylene Glycol (and)
Gellan Gum
2 mLcm-2 of b-carotene (0.5% w/w) dissolved such kinetics only allowed for four formulas to
in o-xylene and applied to PMMA plates sand- be tested at once in order to avoid inconsisten-
blasted to a 2-mm roughness. The plates were cies due to auto-oxidation. Consequently, in one
then dried in the dark at room temperature for test set-up, the base formulation with and with-
10 min, to which 2 mLcm-2 of the test formu- out irradiation was always measured, together
lations were applied as a second layer and with a maximum of two sample formulations.
homogenously distributed by technicians using This, in the results shown, two test set-ups
their fingertips. combining six data measurements for the base
Full spectrum irradiation: The test formu- formulation and three data measurements for
las used were standard o/w emulsions based on the sample formulations are depicted.
the emulsifier potassium cetyl phosphate (see After calculating averages, the percent
Table 2). The plates were fixated in a xenon tes- of degradation of the irradiated b-carotene
tera and irradiated in the range of 290–800 nm was calculated for the base formulation (see
with a dose of 329 kJm-2. In the next step, both formula A in Table 2) and compared with the
the cream and b-carotene were dissolved off non-irradiated b-carotene base formulation.
the PMMA plates in 50 mL of isopropanol, then The irradiated base formula showed signifi-
placed in an ultrasonic bath for 1 min. The blue cant degradation of b-carotene, although not
light range absorption maximum of the b-caro- completely to zero. In order to compare results
tene was photometrically quantified at 452 nm. from the different test set-ups, the degradation
Measurements and calculations: For each of b-carotene in the base formulation was set
formulation, three plates were prepared and to 100% in each test set-up and the protection
their average values were calculated. Due to the values of samples were calculated in relation to
instability of b-carotene in presence of oxygen, that. Thus, the irradiated base formulation was
the tests were performed quite quickly. Indeed, normalized as base level protection and the test
samples were calculated relative to this value as
a
Atlas SunTester XLS+, Atlas Material Testing Technology GmbH added protection.

Effects of vitamins: In a second test, the Skin Viability
effect of different vitamins was determined in a
To assess skin viability, two skin punches for
formulation containing UVA and UVB filters and
each of the selected times, described next, were
providing an SPF 50 (see Table 3). Following
weighed and their dermal portion reduced as
the test procedure described, b-carotene was
necessary to obtain samples of approximately
again photometrically quantified at 452 nm. The
the same weight. The samples were washed
calculations were also performed in the same
and processed using methylthiazolyldiphenyl-
way, and again the degradation of b-carotene in
tetrazolium bromide (MTT), which converts
the base formulation—in this case, formula E
to water-insoluble, dark-blue colored MTT
(see Table 3)—was set to 100% and the protec-
formazan by mitochondrial dehydrogenases.
tion values of all samples were calculated in
The blue crystals were then solubilized and the
relation to that.
color intensity, which is directly proportional to
Visible light irradiation: A third test was
skin vitality, was measured with a plate reader
also performed based on the same formulas
at a wavelength of 570 nm. Three readings were
from the second test but this time, UV light cut-
taken with each test sample for both punches.
off filters were appliedb. These filters are dense
for wavelengths below 400 nm, thus only wave- Blue Light-induced ROS,
lengths of 400–800 nm reached the samples.
Here, the irradiation dose was 246 kJm-2 and the Ex vivo
measurements and calculations were performed To detect blue-light induced ROS ex vivo,
in the same manner as described. skin biopsies from abdominal plastic surgery
were collected from female donors of the ages
b
GG400, Schott AG 38 and 65, following Helsinki declaration

Into the Blue
Table 3. SPF 50 Test Formulas
E F G H I
Bis-Ethylhexyloxyphenol Methoxyphenyl
1.5% w/w 1.5% w/w 1.5% w/w 1.5% w/w 1.5% w/w
Triazine
Polysilicone-15 1.0 1.0 1.0 1.0 1.0
Butyl Methoxydibenzoylmethane 2.0 2.0 2.0 2.0 2.0
Ethylhexyl Salicylate 5.0 5.0 5.0 5.0 5.0
Octocrylene 1.5 1.5 1.5 1.5 1.5
Siisopropyl Sebacate 3.0 3.0 3.0 3.0 3.0
Dimethicone 2.0 2.0 2.0 2.0 2.0
Dicaprylyl Ether 2.0 2.0 2.0 2.0 2.0
Titanium Dioxide (and) Silica (and)
3.0 3.0 3.0 3.0 3.0
Dimethicone
Potassium Cetyl Phosphate 1.5 1.5 1.5 1.5 2.0
Stearyl Alcohol 3.15 3.15 3.15 3.15 1.5
Hydroxyethyl Acrylate/Sodium
0.4 0.4 0.4 0.4 0.5
Acryloyldimethyl Taurate Copolymer
Polyacrylate Crosspolymer 0.4 0.4 0.4 0.4 0.5
Phenoxyethanol (and) Ethylhexyl Glycerin 1.0 1.0 1.0 1.0 1.0
Silica 3.0 3.0 3.0 3.0 3.0
Water (Aqua) 56.1 55.1 53.1 52.1 52.6
Propanediol 5.0 5.0 5.0 5.0 5.0
Tromethamine 0.45 0.45 0.45 0.45 n/a
Methylene Bis-Benzotriazolyl
Tetramethylbutylphenol (and) Water (Aqua)
8.0 8.0 8.0 8.0 8.0
(and) Decyl Glucoside (and) Propylene
Glycol (and) Xanthan Gum
Pyridoxine Hydrochloride n/a 1.0 n/a 1.0 n/a
Niacinamide n/a n/a 3.0 3.0 3.0
Tocopherol n/a n/a n/a n/a 0.5
Scenedesmus Rubescens Extract n/a n/a n/a n/a 1.0
Chlorphenesin n/a n/a n/a n/a 0.2
Fragrance (Parfum) n/a n/a n/a n/a 0.2
guidelines and with the patients’ informed after blue light irradiation at the concentra-
consent. The tissue from the 38-year-old donor tions indicated in Figure 1. After changing the
was used to establish ROS detection after blue medium, blue light was applied at different
light irradiation. The tissue from the 65-year-old dosages; i.e., 10 J/cm2, 50 J/cm2 and 100 J/cm2
donor was used to investigate the protective irradiationc (380–470 nm; max at 420 nm).
activity of specific compounds. A radiometerd equipped with a blue light
As a detection probe 2',7'-dichlorodihydroflu- probee was used to monitor blue light irradia-
orescein diacetate (DCFH-DA) was incorporated tion. Twenty-four hours after irradiation, the
into the culture medium for 30 min before skin samples were harvested, cryo-fixed and cut
irradiation, following the method described by by cryostat for subsequent image acquisition
Marionnet et al,40 which the authors adapted for and analysis. For each image, the upper dermis
blue light. Compounds were administered topi-
cally to the skin tissue before and immediately
c
UV436 HF by Herbert Waldmann GmbH Co.
d
#HD2302.0 and e DeltaOhm #LP471BLUE, DeltaOhm

was analyzed by evaluating fluorescence using Once again, a radiometerd equipped with a
softwaref. The value obtained was then normal- blue light probee was used to monitor blue light
ized against the dimension of the selected area. irradiation. After harvesting, the frozen skin
samples were weighed and minced. The skin
Blue Light-induced Protein samples for each tested condition were pooled
Carbonylation, Ex vivo and processed using homogenization in cold
extraction buffer. Total cell lysates were then
Again, abdominal plastic surgery skin biop-
recovered by centrifugation.
sies from female donors, ages 38 and 65, were
Carbonylated proteins in skin samples were
used to assess protein carbonylation. Tissue
determined by Western blot and chemilumi-
from the 38-year-old was used to detect protein
nescence detection using a kitg according to
carbonylation after blue light irradiation, and
the manufacturer’s instructions. The range of
tissue from the 65-year-old was used investigate
the carbonyl content obtained for each sample
the protective activity of specific compounds.
was normalized against the actin protein
Compounds were administered topically
signal band.
to skin tissue at the concentrations indicated
in Figure 2. After administering compounds,
before and immediately following blue light
Statistical Analysis
irradiation, carbonylated proteins were For ex vivo results, all quantitative data was
extracted from the epidermal part of the skin summarized in terms of the mean score for each
tissues, as well as 48 hr after irradiationc with treatment and applied measures of variation
blue light (380–470 nm; max at 420 nm). including standard deviation and standard
f
Image-J application, National Institutes of Health, USA g
OxyBlot Protein Oxidation Detection Kit, Merck Millipore
Figure 1. Inhibition of blue light induced dermal ROS formation by several compounds;
*p < 0.05, **p < 0.01; ***p < 0.001; all vs. blue light irradiated vehicle control by
unpaired t-test

Into the Blue
Figure 2. Inhibition of blue light-induced epidermal protein carbonylation by several

compounds; *p < 0.05; **p < 0.01; all vs. blue light irradiated vehicle control by unpaired t-test
Figure 3. Spectroscopic measurement of protection of b-carotene after full spectrum

irradiation; grey bar = non-irradiated b-carotene; A = base formulation (see Table 2) with and
without irradiation; B = with 3% titanium dioxide; C = with 4% MBBT (active); D = with 3% titanium
dioxide and 4% MBBT (active)

error of mean (SEM) to the original scores. The ethylhexyloxyphenol methoxyphenyl triazine,
student’s t-test was used for unpaired samples. ethylhexyl methoxycinnamate, octocrylene,
polysilicone-15 or butyl methoxydibenzoyl
Results: Full Spectrum methane, no protection of b-carotene was
b-carotene Degradation detected (data not shown). This confirmed the
absorbance and scattering activity of titanium
As noted, a previously established BCT was
dioxide and MBBT above 400 nm is essential for
used to assess protection against b-carotene
the protection of b-carotene.
degradation by full-spectrum solar irradiationa.
When base formula A (see Table 2) was applied
to the b-carotene layer and irradiated with
Results: Vitamins vs.
329 kJm-2 of full-spectrum, solar simulated light, b-carotene Degradation
the b-carotene was degraded on average down to To determine whether the protection
29%. As stated, to compare results from differ- afforded by UV filters shown in Figure 3 could
ent test set-ups, this degradation was then set to be expanded upon, the authors hypothesized
100% and the protection values of all samples gaps in protection might occur from ROS
were calculated in relation to it (see Figure 3). induced either by UV light not fully absorbed
Titanium dioxide, a mineral UV filter capable by the UV filters, or by wavelengths generating
of absorbing and scattering light, when used at ROS above the main protection spectrum of
3% in the formulation, significantly protected titanium dioxide and MBBT. Therefore, vita-
b-carotene—maintaining 51%. MBBT, a broad- mins were added to a formulation containing
spectrum UV filter widely used in sunscreens, different oil-soluble UVB and UVA filters, as well
when used at 4% active substance in the as titanium dioxide and MBBT to ultimately
formulation, maintained 63% of b-carotene. reach an SPF 50.
The combination of 3% titanium dioxide and When the base formula (formula E in
4% MBBT, however, increased the protection Table 3) was applied to the layer of b-carotene
level of b-carotene to 86%. The ability to protect and irradiated with 329 kJm-2 of full-spectrum
b-carotene at 452 nm suggests that both tita- solar-simulated light (290-800 nm), the
nium dioxide and MBBT could effectively shield b-carotene was degraded, on average, down to
skin against not only UV light, but also against 60%. Once again, in order to ensure results from
blue light. different test set-ups were comparable, the deg-
In contrast, when oil-soluble UVB or UVA radation of base formula E was set to 100% and
filters are added to the formulation, e.g., bis- the protection values provided by test samples

Into the Blue
were calculated in relation to that (Figure 4). the additional b-carotene protection by vitamins
Adding 3% niacinamide (vitamin B3) B3 and E was due to the quenching of oxidative
enhanced b-carotene protection to 23% (see stress evoked by blue light; note that vitamin B6
Figure 4). Combining 3% niacinamide (vitamin was also included in this advanced test set-up.
B3) with 0.5% dl-a-tocopherol (vitamin E) in For this purpose, the UV light spectrum was
the formula increased protection to 63%. blocked using specialized filters. This way, only
The improved stability of the b-carotene wavelengths above 400 nm were irradiated.
is attributable to the antioxidant capacities Again, the SPF 50 base formulation (for-
of niacinamide and dl-a-tocopherol. Since mula E in Table 3) was applied on top of the
the formulation base already contained a UV b-carotene layer and irradiated with a dose of
filter combination to achieve an SPF of 50 246 kJm-2 within the 400–800 nm spectrum.
(see Table 3), which absorbed a significant Under these conditions, b-carotene was
amount of UVB and UVA radiation, it could be degraded, on average, down to 64%. As noted,
concluded that the vitamins provided added the degradation of the base formula (formula E)
protection against the adverse effects of oxida- was again set to 100% so that each test set-up
tive stress caused by visible light. and its results were comparable (see Figure 5).
Interestingly, adding 1% pyridoxine hydro-
Results: Blue Light chloride (vitamin B6) enhanced b-carotene
b-carotene Degradation protection by 19% (see Figure 5) and the addi-
Since the absorbance maximum of tion of 3% niacinamide (vitamin B3) enhanced
b-carotene falls at the blue light wavelength of b-carotene protection by 22%. However, when
452 nm, the BCT is particularly useful to assess both pyridoxine hydrochloride and niacinamide
blue light damage. Thus, as a next step, the (vitamins B6 and B3) were combined, protec-
authors sought to confirm the hypothesis that tion strongly increased to 50%. Since this
Figure 4. Spectroscopic measurement of protection of b-carotene after full spectrum

irradiation; grey bar = non-irradiated b-carotene; E = base formulation containing UVB and
UVA filters (see Table 3) with and without irradiation; G = with 3% niacinamide; I = with 3%
niacinamide and 0.5% dl-a-tocopherol

The addition of vitamins increased protection
against oxidative stress specifically caused by
visible light.
protective effect was greater than the sum of lations containing 1% pyridoxine hydrochloride
the two individual vitamin results, a synergistic (vitamin B6), 3% niacinamide (vitamin B3),
effect was identified. 0.5% dl-a-tocopherol (vitamin E) and combina-
Further, the combination of niacinamide tions thereof can protect b-carotene against the
(vitamin B3) and 0.5% dl-a-tocopherol (vita- harmful effects of blue light.
min E) provided b-carotene protection at 65%.
Notably, vitamins B3, E and the B6/B3 combi- Results: Blue Light vs.
nation provided nearly the same results as in
Figure 4, with full spectrum irradiation. Here,
Skin Viability, ROS and
the formulas contained an effective mixture of Protein Carbonylation
UV filters to shield against UVB and UVA but As described, to establish a skin model for
this did not provide 100% protection, and some blue light irradiation, skin tissue from a 38-year-
photons could still reach the skin. old female donor was exposed to blue light
As noted, to exclude any UV radiation from (380–470 nm) and assessed for oxidative stress
this test, an additional UV cut-off filter was by examining ROS formation19 and protein
used. Yet, even excluding UV light, significant carbonylation. ROS formation was previously
protection was provided by the tested vitamins. shown to increase markedly by visible and
A similar result with both full-spectrum and blue light.19, 20 Therefore, the authors used this
visible light confirmed the vitamins have the marker as a positive control to set up the model.
greatest impact above 400 nm. And since this As shown in Figure 6a, ROS formation
method used the absorbance maximum of increased significantly and dose-dependently
b-carotene at 452 nm, it also shows that formu- upon irradiation with 10 J/cm2, 50 J/cm2 and

Into the Blue
100 J/cm2 blue light (+6,088%; p < 0.01 vs. presence of these compounds (see Figure 1). A
control). Protein carbonylation can be caused significant reduction in blue light-induced ROS
by oxidative stress and induced by UV irradia- in skin ex vivo was observed in the presence of
tion.41 And since most in vitro skin damage 3% niacinamide (vitamin B3) (-48%; p < 0.01
found thus far resembled damage induced by vs. irradiated control) and 0.075% S. rubescens
UV irradiation, the authors speculated that dry extract (-35%, p < 0.05) (see Figure 1). No
protein carbonylation could also result from significant activity was observed for vitamin
blue light irradiation. B6 (see Figure 1) and none of the treatments
In Figure 6b, protein carbonylation was exhibited cytotoxic effects when combined with
indeed shown to increase significantly and dose- blue light irradiation, as assessed by the MTT
dependently (+40%; p < 0.05 vs. control at 100 J/ assay (data not shown).
cm2 blue light). This confirmed the hypothesis. Blue light-induced carbonylation vs. test
Concerning cytotoxic effects, an MTT compounds: Next, the compounds used in
assay42 was performed to assess tissue viability Figure 1 were tested for their ability to suppress
after irradiation with 100 J/cm2 blue light; no protein carbonylation induced by blue light
cytotoxic effect was observed. This suggested irradiation. Again, tissue from the 65-year-old
irradiation took place at tolerable fluencies donor was irradiated with 100 J/cm2 blue
(see Figure 7). light (380–470 nm). When normalized to the
non-irradiated vehicle control, a significant
Test Model in Practice 93% reduction in protein carbonylation was
Blue light-induced ROS vs. test com- observed with 3% niacinamide (vitamin B3) (p
pounds: Having established an ex vivo blue < 0.05 vs. irradiated control). With 0.25% and
light irradiation model, the authors next tested 0.75% S. rubescens dry extract, a significant
the protective activity of vitamins B3 and B6, 85% reduction (p < 0.05 vs. irradiated control)
and S. rubescens extract. Skin tissue from was observed (see Figure 2). Vitamin B6 also
the 65-year-old female donor was exposed showed a tendency to inhibit protein carbonyl-
to 100 J/ cm2 blue light (380-470 nm) in the ation (see Figure 2).
Figure 5. Spectroscopic measurement of protection of β-carotene after irradiation with wavelengths

≥ 400 nm; grey bar = non-irradiated β-carotene; E = base formulation containing UVB and UVA filters (see
Table 3) with and without irradiation; F = with 1% pyridoxine hydrochloride; G = with 3% niacinamide; H = with
3% niacinamide and 1% pyridoxine hydrochloride; I = with 3% niacinamide and 0.5% dl-a-tocopherol

Discussion age must go beyond UV irradiation,1, 27, 31 as UV
The damaging effects of UV irradiation on filters usually protect against wavelengths below
skin have been reported extensively, and its role 400 nm only. Few UV filters, e.g., titanium diox-
in cutaneous carcinogenesis and photoaging is ide, MBBT and ZnO, have absorption spectra
well-accepted.5, 43, 44 More recently, the possible into the visible range.18, 29 In this respect, Liebel
damaging effects of visible light have also come et al. showed the visible light induction of ROS
into focus.1, 45 As such, the described BCT is an could only be reduced significantly if antioxi-
effective in vitro test to screen for substances dants such as gamma-tocopherol were present
that are capable of protecting against or quench- alongside UVA/UVB-absorbing sun filters.19
ing blue light irradiation-induced ROS.39 In the present work, 3% titanium dioxide
b-Carotene is a particularly blue light-sensi- and 4% MBBT (active substance) in a formu-
tive molecule that rapidly quenches ROS, such lation were able to block 50% of blue light
as singlet oxygen and peroxides. Carotenoids are transmission between 400 nm and 500 nm (data
well-described antioxidants that are present in not shown). Surprisingly, using the BCT test,
many foods and plants, and protect skin from a formulation containing the two substances
light-induced damage.46 In addition, they have resulted in an 86% reduction in b-carotene
light-absorbance maxima in the visible range, degradation (see Figure 3). Obviously, shielding
mainly in the blue light spectrum, and could be light at wavelengths above 400 nm is important
considered biological protectants against solar to protect skin effectively not only against
irradiation via oral intake.47 the degradation of b-carotene—a significant
Accumulating evidence suggests protection antioxidant in the skin—but also for its apparent
from solar irradiation-induced cutaneous dam- benefits against oxidative stress.

Into the Blue
Adding niacinamide (vitamin B3) to the formula, which has previ-

ously been found to exhibit antioxidant and even DNA repair capacity,48, 49
provided further benefits with regard to solar irradiation-induced ROS
b-carotene degradation. In addition, vitamin E, in this case dl-a-tocopherol,
improved protection further, again confirming the previous findings that
vitamin E (gamma-tocopherol) improves protection against solar light-
induced skin damage19 (see Figure 4). By blocking UV light below 400 nm,
the authors also showed that the vitamin-dependent increase in protection
a)
b)
Figure 6a-b. Ex vivo model to study blue light-induced

oxidative damage; a) induction of ROS by blue light; b) induction
of protein carbonylation by blue light irradiation; *p < 0.05;
***p < 0.001; all vs. non-irradiated by unpaired t-test

against oxidative stress was visible light-spe- happened at blue light fluencies (380–495 nm)
cific (see Figure 5). of 100 J/cm2.26 Regarding the relevance of such
The results obtained with visible light- a dose, Hockberger et al. stated that blue light
irradiated formulas resembled those exposed at irradiation doses of 2–6 J/cm2 is equivalent to
to full-spectrum irradiation, confirming the 5–10 min of direct sunlight,21 meaning that 100
vitamins had their main impact above 400 nm. J/cm2 is approx. 250–500 min.
Especially good results were obtained with One marker of cutaneous oxidative stress
combinations of niacinamide (vitamin B3) and previously not investigated in the context
pyridoxine hydrochloride (vitamin B6), as well of visible or blue light irradiation is protein
as with niacinamide (vitamin B3) and dl-a- carbonylation. It has, however, been shown to
tocopherol (vitamin E). These results further result from UV irradiation.41 Protein carbonyl-
corroborate the usefulness of the BCT as a ation is the addition of reactive carbonyl groups,
screening tool for antioxidative agents the reach such as aldehydes and ketones, to proteins due
beyond UV. They also underline the need for to oxidative stress, which leads to protein oxida-
additional cutaneous protection that encom- tion.50, 51 The finding that blue light can cause an
passes the visible light spectrum. increase in protein carbonylation ex vivo (see
To show the relevance of BCT test findings in Figure 6b), presented here, is in line with the
skin, an ex vivo model of blue light skin dam- finding that blue light causes an increase in ROS
age was developed. As previously established, ex vivo (see Figure 6a). Interestingly, another
increased oxidative stress was observed when very recent study found that carbonylated pro-
measuring ROS with the DCFH-DA fluorescent tein exposed to blue light itself generates ROS.52
probe (see Figure 6a). Samples were irradiated Together with the results presented here,
using a devicec that has a wavelength range of this may suggest the formation of ROS and
380–470 nm, with a peak at 420 nm, which is protein carbonylation represents a kind of blue
therefore focused on the lower wavelengths of light-induced vicious cycle of oxidative damage
the blue light spectrum. Devices with similar in skin. Protein carbonylation and the glycation
wavelengths were
used previously
by others to study
visible or blue
light-dependent
skin damage.16
Lewis et al., for
example, used a
QTH light cham-
ber with a 380–500
nm wavelength.20
The fluencies used,
of up to 100 J/cm2
blue light, were
in the ranges of
those reported
by others. Using
a digital photo-
therapy deviceh,
for example,
Vandersee et al.
showed that maxi-
mum b-carotene
destruction in vivo
h
Skintrek PT3 device,
Figure 7. Measurement of cytotoxicity following blue light irradiation
Lumedtec GmbH

Into the Blue
of proteins correlate with an age-dependent 2. OV Dueva-Koganov et al, In vitro evaluation of potential

protection provided by topical products against full solar
increase in yellowish skin tone and skin tone and visible plus infrared radiation, Household and Personal
heterogenicity, as was shown in Japanese sub- Care Today 9(2) 37-43 (2014)
jects,53, 54 and this provides further evidence that 3. H Chen, QY Weng and DE Fisher, UV signaling pathways
blue light contributes to facial skin aging—and within the skin, J Invest Dermatol 134(8) 2080-5 (2014)
that protection from blue light irradiation helps 4. J D'Orazio et al, UV radiation and the skin, Int J Mol Sci
14(6) 12222-48 (2013)
prevent accelerated photoaging.
5. RE Watson et al, Damage to skin extracellular matrix
While the results shown in Figure 2 do not induced by UV exposure, Antioxid Redox Signal 21(7) 1063-
explain how vitamins prevented blue light- 77 (2014)
induced protein carbonylation, the authors 6. C Battie et al, New insights in photoaging, UVA induced
hypothesize they quench ROS and therefore damage and skin types, Exp Dermatol 23 suppl 1, 7-12
(2014)
suppress the downstream formation of protein
7. K Biniek, K Levi and RH Dauskardt, Solar UV radiation
oxidation, since anti-oxidative potential was reduces the barrier function of human skin, Proc Natl Acad
shown for all the vitamins tested.25, 48, 55 Niacina- Sci USA 109(42) 17111-6 (2012)
mide and the S. rubescens extract significantly 8. R Voegeli et al, Increased basal transepidermal water loss
inhibited both ROS and protein carbonylation leads to elevation of some but not all stratum corneum
serine proteases, Int J Cosmet Sci 30 435–442 (2008)
(see Figures 1 and 2).
9. FR de Gruijl, Skin cancer and solar UV radiation, Eur J
Finally, it is worth noting that vitamin B6 Cancer 35(14) 2003-9 (1999)
showed a tendency toward the inhibition of 10. K Keemss et al, Prospective, randomized study on the
carbonylated proteins but not ROS. It could efficacy and safety of local UV-free blue light treatment of
be speculated that this may involve alternative eczema, Dermatology 232(4) 496-502 (2016)
mechanisms, such as the activation of addi- 11. S Pfaff et al, Prospective randomized long-term study on
the efficacy and safety of UV-free blue light for treating mild
tional anti-oxidative enzymes, instead of direct psoriasis vulgaris, Dermatology 231(1) 24-34 (2015)
ROS quenching. Nevertheless, all three vitamins 12. S Ammad et al, An assessment of the efficacy of blue light
seemed to act in some way against blue light- phototherapy in the treatment of acne vulgaris, J Cosmet
induced oxidative stress in ex vivo skin samples. Dermatol 7(3) 180-8 (2008)
13. C Antoniou et al, A multicenter, randomized, split-face clini-
Conclusions cal trial evaluating the efficacy and safety of chromophore

gel-assisted blue light phototherapy for the treatment of
In summary, this data provides further evi- acne, Int J Dermatol 55(12) 1321-1328 (2016)
dence that visible light, particularly blue light, 14. DJ Piacquadio et al, Photodynamic therapy with ami-
nolevulinic acid topical solution and visible blue light in
can promote harmful effects such as oxidative
the treatment of multiple actinic keratoses of the face and
damage in skin. It can do so by decreasing the scalp: Investigator-blinded, phase 3, multicenter trials, Arch
skin’s own protective mechanisms, including Dermatol 140(1) 41-6 (2004)
b-carotene content. Protection beyond the UV 15. J Gandy et al, Photodynamic therapy effectively treats
actinic keratoses without pre-illumination incubation time,
spectrum of solar irradiation should therefore
J Drugs Dermatol 16(3) 275-278 (2017)
become paramount to protecting the skin 16. MM Kleinpenning et al, Clinical and histological effects of
against sun-induced aging. As a result of this blue light on normal skin, Photodermatology, Photoimmu-
study, the authors propose a three-dimensional nology & Photomedicine 26 16-21 (2010)
protection strategy for skin using: UV filters 17. C Oplander et al, Effects of blue light irradiation on human
dermal fibroblasts, J Photochem Photobiol B 103(2) 118-25
that reduce the transmission of blue light in the (2011)
range of 400 nm to 500 nm; vitamins such as 18. BH Mahmoud et al, Effects of visible light on the skin,
B3, B6 and E; as well as unique extracts such as Photochem Photobiol 84(2) 450-62 (2008)
S. rubescens to defend skin on different levels 19. F Liebel et al, Irradiation of skin with visible light induces
against damaging irradiation. reactive oxygen species and matrix-degrading enzymes,
J Invest Dermatol 132 1901-1907 (2012)
Acknowledgements: The authors wish to thank their colleagues, 20. JB Lewis et al, Blue light differentially alters cellular redox
properties, J Biomed Mater Res B Appl Biomater 72(2)
Thomas Rudolph, Anne Janssen, Jochen Klock, Juergen Vollhardt,
223-9 (2005)
Mathias Gempeler and Aline Huber, for their helpful comments.
21. PE Hockberger et al, Activation of flavin-containing oxidases
underlies light-induced production of H2O2 in mammalian
References cells, PNAS 96 6255-6260 (1999)
1. E Dupont, J Gomez and D Bilodeau, Beyond UV radiation: 22. Y Nakashima, S Ohta and AM Wolf, Blue light-induced oxi-
A skin under challenge, Int J Cosmet Sci 35 224-232 (2013) dative stress in live skin, Free Radic Biol Med 108 300-310
(2017)

23. TW Fischer et al, Melatonin enhances antioxidative enzyme 43. DL Narayanan, RN Saladi and JL Fox, Ultraviolet radiation
gene expression (CAT, GPx, SOD), prevents their UVR- and skin cancer, Int J Dermatol 49(9) 978-86 (2010)
induced depletion, and protects against the formation of 44. M Ichihashi et al, UV-induced skin damage, Toxicology
DNA damage (8-hydroxy-2’-deoxyguanosine) in ex vivo 189(1-2) 21-39 (2003)
human skin, J Pineal Res 54 303-312 (2013)
45. D Barolet, F Christiaens and MR Hamblin, Infrared and skin:
24. J Fuchs et al, Acute effects of near ultraviolet and visible Friend or foe, J Photochem Photobiol B 155 78-85 (2016)
light on the cutaneous antioxidant defense system, Photo-
chem Photobiol 50(6) 739-44 (1989) 46. E Fernandez-Garcia, Skin protection against UV light by
dietary antioxidants, Food Funct 5(9) 1994-2003 (2014)
25. F McArdle et al, Effects of oral vitamin E and beta-carotene
supplementation on ultraviolet radiation-induced oxidative 47. W Stahl and H Sies, beta-Carotene and other carotenoids
stress in human skin, Am J Clin Nutr 80(5) 1270-5 (2004) in protection from sunlight, Am J Clin Nutr 96(5) 1179S-84S
(2012)
26. S Vandersee et al, Blue-violet light irradiation dose depend-
ently decreases carotenoids in human skin, which indicates 48. JP Kamat and TP Devasagayam, Nicotinamide (vitamin B3)
the generation of free radicals, Oxid Med Cell Longev as an effective antioxidant against oxidative damage in rat
579675 (2015) brain mitochondria, Redox Rep 4(4) 179-84 (1999)
27. L Kolbe, How much sun protection is needed? Are we 49. BC Thompson, GM Halliday and DL Damian, Nicotinamide
on the way to full-spectrum protection? J Invest Dermatol enhances repair of arsenic and ultraviolet radiation-induced
132(7) 1756-7 (2012) DNA damage in HaCaT keratinocytes and ex vivo human
skin, PLoS One 10(2) e0117491 (2015)
28. T Herrling and K Jung, The radical status factor (RSF): A
novel metric to characterize skin products, Int J Cosmet Sci 50. M Fedorova, RC Bollineni and R Hoffmann, Protein carbon-
34(4) 285-90 (2012) ylation as a major hallmark of oxidative damage: Update of
analytical strategies, Mass Spectrom Rev 33(2) 79-97 (2014)
29. N Kollias, The absorption properties of "physical" sun-
screens, Arch Dermatol 135(2) 209-10 (1999) 51. E Cabiscol, J Tamarit and J Ros, Protein carbonylation: Pro-
teomics, specificity and relevance to aging, Mass Spectrom
30. B Herzog et al, In vivo and in vitro assessment of UVA Rev 33(1) 21-48 (2014)
protection by sunscreen formulations containing either butyl
methoxy dibenzoyl methane, methylene bis-benzotriazolyl 52. T Mizutani et al, Carbonylated proteins exposed to UVA and
tetramethylbutylphenol, or microfine ZnO, Int J Cosmet Sci to blue light generate reactive oxygen species through a
24(3) 170-85 (2002) type I photosensitizing reaction, J Dermatol Sci 84(3) 314-
321 (2016)
31. M Randhawa et al, Visible light induces melanogenesis in
human skin through a photoadaptive response, PLoS One 53. H Ohshima et al, Melanin and facial skin fluorescence as
10(6) e0130949 (2015) markers of yellowish discoloration with aging, Skin Res
Technol 15(4) 496-502 (2009)
32. BH Mahmoud et al, Impact of long-wavelength UVA and vis-
ible light on melanocompetent skin, J Invest Dermatol 130(8) 54. Y Ogura et al, Dermal carbonyl modification is related to the
2092-7 (2010) yellowish color change of photo-aged Japanese facial skin,
J Dermatol Sci 64(1) 45-52 (2011)
33. N Kollias and A Baqer, An experimental study of the changes
in pigmentation in human skin in vivo with visible and near 55. P Bilski et al, Vitamin B6 (pyridoxine) and its derivatives
infrared light, Photochem Photobiol 39(5) 651-9 (1984) are efficient singlet oxygen quenchers and potential fungal
antioxidants, Photochem Photobiol 71(2) 129-134 (2000)
34. MA Pathak, FC Riley and TB Fitzpatrick, Melanogenesis in
human skin following exposure to long-wave ultraviolet and
visible light, J Invest Dermatol 39 435-43 (1962)
35. PV Algvere, J Marshall and S Seregard, Age-related macu-
lopathy and the impact of blue light hazard, Acta Ophthalmol
Scand 84(1) 4-15 (2006)
36. M Kaido et al, Reducing short-wavelength blue light in dry
eye patients with unstable tear film improves performance on
tests of visual acuity, PLoS One 11(4) e0152936 (2016)
37. J Liebmann, M Born and V Kolb-Bachofen, Blue-light irradia-
tion regulates proliferation and differentiation in human skin C&T Daily Newsletter
cells, J Invest Dermatol 130(1) 259-69 (2010)
Get the latest from Cosmetics & Toiletries
38. A Mamalis, M Garcha and J Jagdeo, Light emitting diode-
delivered straight to your inbox every day!
generated blue light modulates fibrosis characteristics:
fibroblast proliferation, migration speed and reactive oxygen
species generation, Lasers Surg Med 47 210-215 (2015) http://www.CosmeticsandToiletries.com/newsletter
39. T Rudolph et al, State-of-the-art light protection against

reactive oxygen species, SOFW J 140(3) 10-14 (2014)
40. C Marionnet et al, Diversity of biological effects induced by
longwave UVA rays (UVA1) in reconstructed skin, PLoS One
9(8) e105263 (2014)
C&T Webcasts
41. CS Sander et al, Photoaging is associated with protein
oxidation in human skin in vivo, J Invest Dermatol 118(4) Find current and upcoming webcasts at
618-25 (2002) www.CosmeticsandToiletries.com
42. T Mosmann, Rapid colorimetric assay for cellular growth and

survival: Application to proliferation and cytotoxicity assays,
J Immunol Methods 65(1-2) 55-63 (1983)

Research | C&T ®
KEY POINTS
• Hydrogels provide high water content,
elasticity, softness and biocompatibility to
cosmetics and skin care products.
• This article reviews the main categories of

polysaccharides that form hydrogels for use
in the cosmetic industry.
–
A Dermatological View
Plant-
Based
Hydrogels
H
Applications in Cosmetics
Khashayar Modaresifar
Amirkabir University of Technology, Tehran, Iran
Shohreh Nafisi
Islamic Azad University Central Tehran Branch ydrogels are hydrophilic polymeric structures
(IAUCTB), Tehran, Iran that can be cross-linked through various
Howard I. Maibach, M.D. methods. They are widely used in cosmet-
University of California, San Francisco ics and skin preparation products and can
be formed from polysaccharides found in
natural plants. Here, the authors review
the main categories of polysaccharides and related products used in the
cosmetics industry.

CT1801_Research_Maibach_fcx.indd 30 12/26/17 2:03 PM

The unique properties of polymeric hydrogels
have drawn the attention of scientists in the
context of skin preparations.
The unique properties of polymeric hydro- the healing process by increasing growth of
gels—including biocompatibility, high water the epidermis. The two main types of alginate
content, elasticity and softness—have drawn dressings are calcium and silver. The former
the attention of scientists in the context of skin can slow bleeding and upon removal, causes
preparations.1, 2 Naturally derived hydrogels less pain in comparison with conventional
are usually based on protein chains or polysac- products. The latter can be effective for wounds
charides formed by single sugar molecules requiring autolytic debridement.6–8 Finally,
linked together. These possess great potential as alginate also is used in masks for beauty treat-
ingredients in cosmetics and skin care prepara- ments. Such masks typically include sodium
tions. Natural sources for polysaccharides also alginate and calcium sulfate.9
make them inexpensive and easily available.3 Carrageenan: Carrageenan is an esterified
The chemical industry is making huge galactose containing sulfuric acid, which can
efforts to modify polysaccharide structures be obtained from red seaweed. Its composition
and produce refined materials with specific consists of elements such as sodium, potas-
properties. As such, here, the main sources of sium, ammonium, magnesium, calcium and
plant-based hydrogels are reviewed in brief. sulfate esters of galactose and 3,6-anhydro-
galactose copolymers. The major application
Main Sources of of carrageenan is as a gelling agent in products
Polysaccharide Hydrogels such as lotions and creams.10
Cellulose: The most abundant polymer in
Agar: This natural polymer extracted from
nature is composed of β(1→4) linked D-glucose
the cell wall of marine red algae is composed
units and can be found in cell wall of green
of a galactose polymer and some sulfate
plants and many types of oomycetes and algae.
groups. Agar keeps the ingredients together in
Cellulose and its derivatives are used to stabilize
a formulation based on its stability and chemi-
thickeners and can also be applied as protective
cal properties, and it is used in applications to
and softening texturing agents.11, 12
condition hair and moisturize skin. Moreover,
Dextrin: Hydrolysis of starch results in the
it has been widely used in the formulation of
production of dextrin. Cyclodextrins are one
facial masks, shampoos, deodorants, lotions
type of dextrins that are used as active agent
and creams.1, 4
carriers due to their cylinder-shaped cavity; e.g.,
Alginate: Alginate, also known as alginic
they can release the perfumes slowly.13
acid, can be obtained from brown algae. Algi-
Glycogen: Mainly composed of glucose,
nate and its calcium salt have a high swelling
glycogen is a branched polysaccharide with
ratio, which makes them suitable for forming
applications for skin conditioning and as a
surface films that retain the skin’s moisture
with low tightening effects. Conversely, algi-
nate and its sodium/potassium salts are used
to stabilize oil phase cosmetics due to their
Natural has become less niche, as 40–50% of
solubility in water. They can hydrate and soften
women now seek natural or organic ingredients
the skin and, as such, have been incorporated
in their cosmetics and personal care products,
into formulas for soothing, moisturizing and
anti-wrinkle products.1, 5
according to The NPD Group.
Furthermore, alginate-based wound dress-
ings can prevent the wound from drying and Source: Global Cosmetic Industry
inhibit bacterial activity while absorbing high (www.GCImagazine.com)
amounts of exudate. They also can accelerate

Plant-based Hydrogels
The chemical industry is making huge efforts to modify polysaccharide structures and produce refined materials with specific properties.
humectant. Refined glycogen compounds may and hand products such as hair conditioners,
diminish cell degradation and aging, and hinder permanent waves, shampoos and cleansers use
sun damage in this way.14, 15 pectin in their formulations.19, 20
Guar gum: This gum is mainly produced Tragant (Shiraz gum): Finally, tragant natu-
from guar bean and is composed of galactose ral gum can be obtained from the tragant plant,
and mannose units. Properties of guar gum and consists of tragacanthin and bassorin poly-
such as its non-toxic nature, biodegradability, saccharides. Tragacanthin, the water-soluble
stabilizing and thickening benefits have resulted part of the gum, is composed of a main chain
in its vast application in pharmaceuticals. Guar of galacturonic acid with different branches
gum also has been used as a conditioner in of monosugars such as xylose, fucose and
shampoos and in toothpaste formulations.16, 17 galactose. Bassorin is composed of an elongated
Gum arabic: The Arab gum tree is the molecule consisting of arabinose, galactose,
source of gum arabic, a branched polysac- rhamnose and galacturonic acid methyl ester,
charide composed of galactose, arabinose and and swells when combined with water.
glucuronic acid. It can be used to increase Tragant has been used as emulsifier, binding
viscosity and emulsify o/w emulsions. Its alkali agent, thickener and stabilizer in personal care
and alkaline earth salts have also been used as products, pharmaceuticals and foods, and as a
thickening agents in cosmetics.1, 18 texture additive. It has also been employed as
Pectin: Pectin is a plentiful polysaccharide a topical treatment for burns. In Saudi Arabia,
in fruits and terrestrial plants. This gelling a natural hair shampoo consisting a mixture
agent thickens the aqueous component of gels. of hydrated tragacanth and ground and dried
It also keeps emulsions from separating into Ziziphus spina-christi is believed to promote
their oil and liquid phases. Numerous body hair growth.

References
1. H Lautenschläger, (Poly) Saccharides in cosmetic products—From
alginate to xanthan gum, Kosmetische Praxis 4 12–15 (2009)
2. E Calo and VV Khutoryanskiy, Biomedical applications of hydro-
gels: A review of patents and commercial products, Eur Poly J 65
252–267 (2015)
3. S Bhatia, Application of Plant based polysacharrides, in Natural
Polymer Drug Delivery Systems: Nanoparticles, Plants and Algae,
Springer, NY ch 4 (2016) pp 144–147
4. PW Williams and PO Glyn, Agar in Handbook of Hydrocolloids ch
2, Cambridge, Woodhead (2000) p 91
5. en.zhermack.com/Industrial/Cosmetic/Cosmetic_alginates.kl
(Accessed May 9, 2017)
6. J Timmons, Alginates as haemostatic agents: Worth revisiting?
Wounds UK 5(4) 122–125 (2009)
7. smith-nephew.com/professional/products/advanced-wound-
management/algisite-m (Accessed May 9, 2017)
8. woundsinternational.com/media/issues/567/files/content_10381.
pdf (Accessed May 9, 2017)
9. fao.org/docrep/x5822e/x5822e04.htm#TopOfPage (Accessed
Dec 4, 2017)
10. VL Campo, DF Kawano, DB da Silva and I Carvalho, Carrageen-
ans: Biological properties, chemical modifications and structural
analysis—A review, Carbohydr Polym 77 167–180 (2009)
11. D Klemm, B Heublein, HP Fink and A Bohn, Cellulose: Fascinat-
ing biopolymer and sustainable raw material, Angew Chem Int Ed
44(22) 3358–3393 (2005)
12. cosmeticsinfo.org/ingredient/cellulose-gum (Accessed May 9,
2017)
13. U Numano ğlu, T Sen, N Tarimci, M Kartal, OM Koo and
H Onyüksel, Use of cyclodextrins as a cosmetic delivery system for
fragrance materials: Linalool and benzyl acetate, AAPS PharmSci
Tech 8(4) E85 (2007)
14. cosmetics.specialchem.com/inci/glycogen (Accessed May 9,
2017)
15. cosmeticsdesign.com/Article/2016/10/26/Glycogen-sun-care-
ingredient (Accessed Dec 4, 2017)
16. fao.org/ag/agn/jecfa-additives/specs/monograph3/additive-218.
pdf (Accessed May 9, 2017)
17. theregreview.org/2012/08/08/8-narayan-guar-gum/ (Accessed
Dec 4, 2017)
18. SC Smolinske, Handbook of Food, Drug and Cosmetic Excipients,
Taylor and Francis, Abingdon, England (1992) p 7
19. JA Marlett, Content and composition of dietary fiber in 117 fre-
quently consumed foods, J Am Diet Assoc 92(2) 175–186 (1992)
20. P Sriamornsak, Application of pectin in oral drug delivery, Expert
Opinion on Drug Delivery 8(8) 1009–1023 (2011)
C&T Sponsored Webcast Videos

Find current and upcoming webcasts at
www.CosmeticsandToiletries.com

Testing | C&T ®
KEY POINTS
• Cold stress can affect the integrity of the
skin. In relation, compounds synthesized by
plants under environmental stress have been
characterized for their protective effects;
although limited data relates to cold stress.
• This article explores an extract from Daphne

odora cell cultures to address cold stress-
related damage including dryness, cutaneous
micro-lesions and inflammation.
Cold Stress Damage,

Banished Daphne odora Extract
Improves Skin Moisture and Healing
Marida Bimonte, Ph.D., Antonietta Carola, Annalisa Tito, Ph.D.,

Ani Barbulova, Ph.D., and Adriana De Lucia, Ph.D.
Arterra Bioscience srl, Naples, Italy
Fabrizio Del Piaz, Ph.D., University of Salerno, Dept. of Pharmacy, Fisciano, Italy
Fabio Apone, Ph.D., and Gabriella Colucci, Ph.D.
Vitalab srl and Arterra Bioscience srl, Naples, Italy
CT1801_Testing_Apone_fcx.indd 34 12/26/17 2:21 PM

occur in all the major lipids of the skin’s
T
hydrolipidic film, including fatty acids,
ceramides and cholesterol. These decreases
can be observed to the same extent in both the
hands and face.1–3 Furthermore, the fatty acid
composition and ratio are affected by the cold;
e.g., a greater degree of fatty acid unsatura-
tion and decreased levels of palmitic and
he human skin, as a physi- palmitoleic acids have been associated with an
cal barrier between the increase of lignoceric acid concentration.4
body and outside envi- These alterations have a direct effect on
ronment, is subjected to the structure of the stratum corneum, which
seasonal climate changes becomes less compact and loses its mechani-
that significantly affect cal properties. The whole of skin therefore
its protective functions. The hydrolipidic film becomes drier and more sensitive, causing
that coats the epidermis has key roles in the discomfort and tightness. Indeed, dermatitis
maintenance of the skin barrier integrity—it is more prevalent during cold months,5–8
lubricates and waterproofs the skin surface, characterized by skin barrier disruption
thus preserving an appropriate level of hydra- and the release of various pro-inflammatory
tion, and protects the inner skin layers from mediators, generating skin redness due to
microlesions due to both dehydration and inflammation and tissue lesions.9–11 At this
mechanical insults. point, the capacity of skin to repair lesions
In the cold winter season, typical of the mainly relies on the activation of coordinated
Northern Hemisphere, significant decreases events, including the migration of undamaged
2018 in English or any other language of all or part of this article is strictly prohibited. © 2018 AlluredCosmetics
Vol. 133, No. 1 | JanuaryReproduction Business Media.& Toiletries® | 35

Cold Stress Damage, Banished
Daphne odora cell culture extract stimulated

the production of hydrolipidic film components
by skin cells, reducing micro-lesions and
inhibiting inflammation.
cells from wound margins, the synthesis of new increase the natural supply of nutrients to the
extracellular matrix (ECM) components, as well skin, to prevent any slowing of cell metabolic
as ECM maturation and remodeling.12 activity and cell suffering. These attributes for
Another relevant consequence of cold skin treatment can take inspiration from sessile
temperatures is a decrease in the amount of plants living in cold environments, which have
blood that reaches the skin: at internal body evolved by producing defensive secondary
temperatures below 37°C (98°F), skin blood metabolites to survive.
flow is reduced as a physiological response by Daphne odora, belonging to the family
the body to reduce heat loss and protect against of Thymelaeaceae, is of particular interest
hypothermia.13 Blood delivery through the skin because it well-tolerates low temperatures, even
is guaranteed by a complex network of blood producing heavily perfumed blossoms during
vessels in the dermis and the hypodermis, the winter season when most of the plants are
which terminates in thin vascular structures quiescent. This is possible due to the presence
(capillaries). The membranes of the endothelial of specific secondary metabolites, which defend
cells forming these capillaries are responsible the cells against cold stress, prevent tissue dam-
for the correct exchange of substances between age and actively stimulate cell metabolism.15, 16
the skin cells and the blood. During cold Phytochemical studies have shown Daphne
exposure, however, the permeability of capillary species contain a wide range of compounds,
membranes in the skin is reduced, compro- including flavonoids, lignans and terpenoids,17
mising the supply of nutrients and oxygen to which have various biological activities includ-
skin cells.14 ing anti-inflammatory, antioxidant, analgesic,
As such, treatments aimed at the damage anticancerogenic and antimicrobial.18–23 Recent
in skin produced by cold stress must work on studies also demonstrate the wound-healing
multiple fronts. On one side, to hydrate the activity associated with certain Daphne extracts,
skin, making it more resistant and responsive mostly attributed to the presence of the active
to mechanical injuries; on the other side, to compound luteolin-7-O-glucoside.24
On the basis of these findings, cell suspen-
sion cultures from Daphne odora plants were
developed, from which a hydro-soluble extract,
containing lignans and flavonoids—particularly
flavons and flavans—was prepared. This extract
The global market for medicated skin care is was tested in vitro on skin cell cultures to deter-
projected to reach US $8 billion by 2022, with mine potential toxicity and effects on sebum
demand for products that maintain, protect, production, skin restructuring, wound healing,
nourish and enhance skin health. inflammation and blood flow; and in vivo on
human skin to assess its ability to counteract
the negative effects of cold stress.
Source: Global Industry Analysts
Test Materials
Callus production, cell cultivation and
extract preparation: Leaves of Daphne odora,

var. aureomarginata, were surface-sterilized in cells or small cell aggregates after 10 days. The
70% EtOH for 15 min and 1% bleach for an suspensions were then transferred into larger
additional 15 min, then washed three times volumes, where 50 mL of a dense culture was
with sterile water. Each leaf explant was cut used as the starting material to inoculate 1 L of
into 0.5 cm pieces, wounded with a scalpel culture medium.
blade and placed on Gamborg B5 mediuma, After seven days, the cells were collected,
supplemented with 500 mg/L myo-inositol, filtered and homogenized in PBS buffer
30g/L sucrose, 1 mg/L 2,4-dichlorophenoxy- (136 mM NaCl, 2.7 mM KCl, 12 mM NaH2PO4
acetic acid (2,4-D), 0.1 mg/L kinetin, 1 mg/L and 1.76 mM KH2PO4; pH 7.4) at a 1:1 ratio
adenine and 7.5 mg/L plant agar for callus (w/v). The resulting lysate was centrifuged at
induction. White and friable callus was 10,000 rpm to precipitate the particulate frac-
obtained after five weeks of cultivation in the tion and isolate the soluble components. The
dark. The callus cultures were maintained by supernatant was then collected and lyophilized
transferring the tissues onto fresh medium in order to obtain a stable powder (DoHE) that
every four weeks. was easy to dissolve in water or cell culture
To initiate stem cell liquid culture, 50 mg media for testing.
of 40/45-day-old callus was suspended in LC-ESIMS/MS analyses: To characterize the
25–30 mL of liquid medium. The culture was resulting extract, mass spectrometry analyses of
incubated at 27°C in the dark under constant DoHE were carried out on a hybrid quadrupole-
orbital stirring (110 rpm). The callus tissue time of flight (q-tof) premier instrumentb
gradually disintegrated and formed single equipped with an electrospray ion source—
a
Duchefa Biochemie, The Netherlands b
Waters Corporation

i.e., liquid chromatography-electrospray solubilized by the addition of a 100 µL of lysis

ionization-tandem mass spectrometry (LC-SEI solutionh and the plate was incubated for 4 hr
MS). Liquid chromatography separation was at room temperature. The number of healthy
achieved on a Luna C18 columnc and using cells was directly proportional to the level
0.1% formic acid in water (A) and acetoni- of the formazan product created. The devel-
trile (B) as eluents. Compounds elution was oped color was then quantified at 595 nm by
achieved using a linear gradient from 1% to spectrophotometerj.
50% of B over 45 min.
Mass spectra were acquired both in positive Gene Expression Studies for
and in negative ion mode over the 200–800 m/z Skin Benefits
range. The source temperature was set at
To determine the effects of the test mate-
120°C, with a capillary voltage of 3300 eV and
rial for potential skin benefits such as sebum
cone voltage of 50 eV. MS/MS spectra were
production, skin restructuring and wound
acquired for the four most abundant ions
healing, inflammation and blood flow, various
observed in each MS spectrum (independent
assessments were made in three cell types.
scan mode). Compounds identification was
5a-Reductase type 1 (5aR1; for sebum produc-
achieved on the basis of the MS and MS/MS
tion) and secreted protein acidic and cysteine
data, and by taking into account the available
rich (SPARC) expression (for skin maturation
chemical information.
and restructuring in wound healing) were
Skin cell cultures: For in vitro tests, immor-
analyzed in HDF; cytokine gene expression
tal human keratinocytesd and human dermal
was tested in HaCaT (for inflammation); and
fibroblastse were grown in Dulbecco's Modified
vascular endothelial growth factor (VEGF)
Eagle Medium (DMEM), containing 4 mM
gene expression was assessed in HUVEC (for
L-glutamine, 4.5 g/L glucose, 1 mM sodium
blood flow).
pyruvate and 1.5 g/L sodium bicarbonate,
For all three assessments, the respective
supplemented with 10% FBS, under 5% CO2
cells, i.e., HDF, HaCaT and VEGF, were incu-
humidiﬁed atmosphere at 37°C. Human umbili-
bated with DoHE for 6 hr, then processed for
cal vein endothelial cellsf were grown in the
RNA extraction using an RNA purification kit
endothelial growth medium and supplemented
according to the manufacturer’s instructionsk.
with the reagents provided by the MV2 Kitg.
For cytokine expression, the cells were incu-
bated with DoHE for 16 hr then infected with
Toxicity Assay via bacteria (S. epidermidis) for 3 hr to induce
Cell Vitality inflammation before being collected for total
To test for the potential toxicity of DoHE, RNA extraction.
the cell vitality (or MTT) assay was used, Reverse transcription polymerase chain
wherein 1 x 104 cells (HaCaT or HDF) were reaction (RT-PCR) was performed using
seeded in 96-well plates, grown for 16 hr and gene-specific primers and an oligo-nucleotide
treated for 48 hr with different concentrations internal standard kitm. The PCR products
of DoHE. After treatments, cells were washed obtained were visualized and quantified with an
with PBS and incubated with 100 µL/well of imaging systemn. The amplification band corre-
“reaction buffer” containing: 10 mM Hepes, sponding to the analyzed gene was normalized
1.3 mM CaCl2, 1 mM MgSO4, 5 mM glucose to the amplification band corresponding to 18S.
and 0.5 mg/mL of colorimetric substrate The values obtained were finally converted into
MTT [3-(4,5-dimethylthiazolyl)-2,5-diphen- percentage values by considering 100% as the
yltetrazolium bromide] in PBS buffer at pH measure for untreated cell samples.
7.4. After 3 hr at 37°C and 5% CO2, cells were The gene-specific primers used were:
c
150 x 2.1 mm, 2.5 µm Phenomenex h
10% TritonX-100, 0.1 N HCl in isopropanol
d
HaCaT, AddexBio No. T0020001 j
Multiwell Spectrophotometer (ELISA reader)
e
HDF, CellApplication No. 106-05n k
Sigma-Aldrich
f
HUVEC, Lonza No. No. 2519 m
QuantumRNATM 18S Ambion
g
Promocell GmbH n
Geliance 200 Perkin Elmer

Daphne cell culture extract reinforced the natural barrier and accelerated repair.
5a-Red1-Fw: 5'ATGTTCCTCGTCCACTACGG3' PBS washing. Culture medium containing 0.5%

5a-Red1-Rv: 5'GGAGGTACCACTCATGATGC3' FBS with DoHE or 2.5 ng/mL of TGFb1 (as a
SpO-Fw: 5'ATGAGGGCCTGGATCTTCTTTC3' positive control) was added, and the cells were
SpO-Rv: 5'CGCAGCTTCTGCTTCTCAGT3' incubated for 7 hr. Mytomycin C (10 mg/mL)
hVEGF fw: 5'TGCATTGGAGCCTTGCCTTG 3' was always included in the medium to prevent
hVEGF rv: 5'GAAGATGTCCACCAGGGTCT 3' cell proliferation. To estimate the relative
IL-1b Fw: 5'ATGGCAGAAGTACCTGAGCT3' migration of the cells, for each condition, the
IL-1b Rv: 5'AAGGACATGGAGAACACCAC3' unclosed cell-free areas were compared using
IL-8 Fw: 5'GCCACCGGAGCACTCCATAA3' software at time 0 and 7 hr after treatment.
IL-8 Rv: 5'CTCTTCAAAAACTTCTCCACAACC3' Actin polymerization: The migration of the
TNFa Fw: 5'ATGAGCACTGAAAGCATGATCC3' cells is mainly mediated by actin: By forming
TNFa Rv: 5'TCATACCAGGGCTTGGCCTCA3' polymers starting from the monomeric form,
actin drives the formation of cell membrane
Wound-healing Effects projections that propel the cell forward. To
Scratch assay: HDF were seeded in 6-well measure actin polymerization, HDF were
plates; 16 hr later, a line of cells across the middle seeded in 24 well-plates at a density of 2x105;
of the wells was traced by scratching the bottom 16 hr later, the cells were treated for 15–60 min
using a pipette tip. Floating cells were removed by with the extract or 2 mg/mL of phosphatidic acid

(PA; positive control). After treatments, the medium

was removed and cells were washed with cold PBS
1X, fixed in formaldehyde 4% for 10 min at 4°C and
permeabilized with 0.2% surfactant solutionh in PBS
for 30 min. The cells were then incubated for 1 hr in
the dark with 0.4 mM Rhodamin phalloidin in PBS 1X,
washed twice in PBS 1X and solubilized with 300 mL of
methanol. Fluorescence at 540 nm was measured by a
multi-well plate readerp.
Fibronectin ELISA: Besides actin, a crucial role in
the wound healing process is performed by fibronectin,
which coordinates the deposition of new extracellular
matrix proteins and promotes cellular adhesion and
communication. To measure fibronectin activity, HDF
were seeded in 96-well plates at density of 9 x 103 per
well and treated with extract or 5 ng/mL of TGFb1
Daphne odora cell culture

extract was shown to
counteract and treat cold
stress-related
skin discomfort.
(positive control) for 72 hr without changing the
medium. Each condition was repeated in triplicate.
After treatments, the medium was removed and the
cells were washed with PBS 1X, fixed in para-formalde-
hyde 4% for 10 min, washed three times with PBS, and
permeabilized with 1% surfactant solutionh for 30 min.
After permeabilization, the cells were treated for
30 min with 0.5% polysorbate-20, 5% bovine serum
albumin (BSA) in PBS, and incubated a 4°C with pri-
mary goat polyclonal antibody, raised against human
fibronectinq diluted 1:500 in PBS 1X, containing 0.5%
polysorbate-20 and 1% BSA. Samples were washed
three times 16 hr later with 0.5% polysorbate-20 in
PBS, and incubated with horseradish peroxidase (HRP)
labeled anti-goat secondary antibody, diluted 1:1000 in
PBS 1X, containing 0.5% polysorbate-20 and 1% BSA.
One hour later, plates were washed three times with
PBS 1X and the amount of fibronectin produced by the
cells was measured by a colorimetric reaction, using
a 0.5 mg/mL solution of o-phenylenediamine (OPD)
and 0.012% H2O2 in citrate buffer 50 mM. The plate
p
Victor 3, Perkin Elmer
q
Santa Cruz Biotechnology

was incubated at room temperature for 60 min entry, immediately before analysis began; and
until a yellow color developed. The absorbance at T1, T14 and T28—respectively 1 day, 14 days
of each sample was measured at 490 nm by a and 28 days after application. Corneometry is a
multi-well plate readerp. scientifically recognized method for the mea-
surement of skin hydration. It is based on the
Clinical Tests determination of the capacitance of the superfi-
Clinical tests were performed in 20 volun- cial stratum corneum, which is proportional to
teers, ages 18–65, selected for their particularly its aqueous content.25–28
dry and cracked facial skin due to cold weather Both types of measurements were carried
and not suffering from any facial skin diseases. out in duplicate on the treated areas for each
The studies were conducted in Montréalr during subject and at each experimental time. Results
a time of year averaging ambient temperatures were expressed as mean percentage differences
from -11°C (12.2°F) to -7°C (19.4°F). Twice at T1, T14 and T28, compared with T0. Statisti-
daily (morning and evening), for 28 days, each cal analyses (t-tests) were performed to confirm
volunteer applied a cream containing 0.002% of the significance of the observed differences.
DoHE on one side of the face, massaging until
absorbed; the other side was treated with the Results: Toxicity and Cell
placebo. This study was carried out in compli- Culture Characterization
ance with the most recent recommendations Toxicity: As noted, to evaluate the potential
of the World Medical Association Declaration toxicity of DoHE and determine the doses to
of Helsinki of ethical principles for medical use in cellular assays, a cytotoxicity test (MTT
research involving human subjects, and accord- assay) was performed using scalar concentra-
ing to the Colipa Guidelines for the evaluation tions of the extract, ranging from 0.05% to
of the efficacy of cosmetic products. 0.0004% w/v, on HaCaT keratinocytes and
To evaluate the efficacy of the extract, cor- HDF. After 48 hr, the cell vitality rates were
neometry was useds and transepidermal water determined. All tested doses resulted in negative
loss (TEWL) was investigatedt at T0—i.e., study cytotoxicity for both cell lines (data not shown).
Therefore, for convenience, the concentrations
r
Abich Cosmetic Lab of DoHE chosen for studies on skin cells were
s
Corneometer CM285 and
0.002% and 0.01%.
t
Tewameter TM300, Courage-Khazaka GmbH
Table 1. Major Compounds Identified in Daphne odora
Ret. time Positive ion Negative ion Main fragments Theoretical

Attempted ID
(min) mode (m/z) mode (m/z) (m/z)* MW
17.6 633.3 [M+Na]+ 609.1 447.1; 285.0 Luteolin diglucoside 610.2
17.7 594.1 432.1; 270.0 Apigenin diglucoside 594.1
20.1 471.2 [M+Na] +
447.1 285.0; 151.0 Luteolin monoglucoside 448.1
21.5 455.2 [M+Na] +
431.1 269.0; 151.0 Apigenin monoglucoside 432.1
23.6 375.2 373.1 355.1; 329.1 Wikstromol 374.1
24.9 357.1 325.1; 205.1 Pinoresinol 358.1
25.8 361.1 359.1 343.1; 329.0 Lariciresinol 360.1
27.1 285.1 268.1; 151.0 Kaempferol 286.1
30.2 565.2 [M+Na]+ 541.1 523.1 Daphnodorin B 542.1
33.0 549.2 [M+Na] +
525.1 - Daphnodorin A/C 526.1
33.7 549.2 [M+Na] +
525.1 - Daphnodorin A/C 526.1
* Negative ion MS/MS

Characterization: DoHE was analyzed for and lariciresinol, along with three main types
the presence of flavonoids and lignans, which of flavonoid compounds: flavonols, such
were previously described for Daphne odora as kaempferol and glucosidic derivatives;
and other Daphne species.22, 29 In the present flavon glucosides, including luteolin mono
study, chemical analysis revealed the pres- and di-glucosides; and flavans, in the form of
ence of the lignans wikstromol, pinoresinol daphnodorin A, B and C (see Table 1).
Lignans isolated from
similar Daphne species have
been characterized for their
anti-inflammatory activity.23
Also, flavonoids have long
been for known for their
multiple roles as therapeutic
and antioxidant agents;20
thus, they have been used in
different types of health care
products.30, 31
The results of this
chemical characterization
led to the exploration for the
potential role of DoHE as
a soothing and anti-inflam-
matory ingredient for skin,
particularly to alleviate cold
Figure 1. Gene expression analysis in fibroblasts
stress-related discomfort.
treated with DoHE; error bars = SD and asterisks indicate
significance at *p < 0.05 Results: Sebum
Production
Sebum comprises a
complex mixture of lipids
including triglycerides and
their derivatives, such as
wax esters, squalene, free
fatty acid and cholesterol.32
The production of sebum,
which is inhibited by cold
stress, is mainly regulated
by the enzyme 5aR1. This
enzyme is produced both by
fibroblasts and sebaceous
gland cells, and catalyzes the
conversion of testosterone
to dihydro-testosterone
(DHT)—the most active
androgen that stimulates
sebum biosynthesis.33
To investigate the capac-
ity of DoHE to stimulate
sebum production, fibro-
blasts were treated for 6
Figure 2. Scratch assay; error bars = SD and asterisks hr with the extract and
indicate significance at *p < 0.05 analyzed for the expres-
sion of the 5aR1 gene by

RT-PCR. The results, shown
in Figure 1, indicate treat- a)
ments with DoHE increased
the expression of 5aR1 gene
by approx. 50% and 48%, at
concentrations of 0.01% and
0.002%, respectively. This
suggested a potential role
in inducing sebum produc-
tion via the stimulation of
5aR1 expression.
Results: Wound
Healing
Scratch assay: As stated,
to test the ability of DoHE to
promote the wound healing
process, a scratch assay was
performed on fibroblasts
treated with the extract. In
the scratch assay, a “wound
gap” in a cell monolayer was
created by the scratching and
“healing” of this gap by cell b)
migration toward the center
of the gap was monitored
and quantitated. As shown in
Figure 2, the extract increased
the capacity of the cells to fill
in the wound by accelerating
cell migration by approx. 27%,
compared with the untreated
control. Notably, this effect
was even higher than that
produced by TGFb, the posi-
tive control.34
Actin polymerization:
As described, actin mediates
the migration of cells for
healing, thus newly polymer-
ized actin was measured in
fibroblasts treated with DoHE
by using a fluorescent peptide,
Rhodamine-phalloidin, which
binds specifically to F-actin.
As shown in Figure 3a, DoHE
treatment increased the
production of new polymer- Figure 3. Polymerized actin and fibronectin production
ized actin by 18% and 8%, in fibroblast cultures; a) cells treated with DoHE and PA, and
at respective concentrations
b) cells treated with DoHE and TGFb; error bars = SD and
of 0.01% and 0.002%. This
asterisks indicate significance at *p < 0.01.
Continued on Page 47

Daphne extract was effective in improving skin hydration and reducing water loss.
Figure 4. Gene expression in fibroblasts treated with DoHE or TGFb; error bars = SD and
asterisks indicate significance at *p < 0.05

Figure 5. Gene expression in keratinocytes treated with DoHE and T09001317 (positive
control) with/without S. epidermidis; error bars = SD; all measures of DoHE were significant,
compared with their control, at *p < 0.05
Formula 1. Cinical Test Formulas
Water (Aqua) 84.044% w/w

Caprylic/Capric Triglyceride 4.600
Stearic Acid 3.300
Glyceryl Stearate 2.400
PEG-100 Stearate 1.700
Cetearyl Alcohol 1.000
Phenoxyethanol 0.800
Glycerin 0.490
PEG-20 Stearate 0.350
Ethylhexyl Glycerin 0.300
Carbomer 0.260
Disodium ETDA 0.100
Sodium Hydroxide 0.096
Daphne Extract (absent in placebo) 0.002
100.000%

Figure 6. Gene expression analysis in fibroblasts treated with DoHE; error bars = SD and asterisks
indicate significance at *p < 0.05
a) b)
Figure 7. Clinical tests of 20 panelists; values are reported as average percentages of three
different measures and asterisks indicate significance at *p < 0.01

During cold stress, blood flow and the supply of nutrients to skin cells are reduced.
Continued from Page 43
suggests the capacity of the extract to stimulate test concentrations of DoHE increased SPARC
cell migration; PA, as the positive control, expression levels by 25%, confirming the extract
confirmed the reliability of these results.35 positively regulated ECM protein assembly.
Fibronectin ELISA: Since fibronectin also Taken together, these sebum-regulating and
plays a role in wound healing, after treating the wound-healing results indicated the Daphne cell
fibroblasts with DoHE, the amount of fibro- culture extract could potentially improve skin
nectin produced was measured using a goat integrity, both by reinforcing the natural hydro-
antibody that acts against it. Treatments with lipidic barrier and by accelerating the repair
DoHE increased fibronectin production by 15% of skin micro-lesions; even acting at different
at both test concentrations (see Figure 3b). The stages of the wound healing process.
increase was comparable to that produced by
the TGFb, used as the positive control.36 Results: Inflammation
Extracellular matrix (ECM) remodeling: Since damage to the skin barrier due to cold
The last key event in the wound healing process stress is often associated with an inflammatory
is the maturation and remodeling of the ECM. response, the potential of DoHE to inhibit the
After being secreted by cells, collagen fibers production of pro-inflammatory cytokines was
must be rearranged, cross-linked and correctly tested. This was carried out by treating kera-
aligned. To measure this, secreted protein tinocytes with the extract, and measuring the
acidic and cysteine rich (SPARC) protein—a expression level of interleukins IL-1b, IL-8 and
collagen-binding protein produced by fibro- the tumor necrosis factor alpha (TNF-a).39 Par-
blasts—can be assessed. This entity plays an allelly, in the same experiments, the synthetic
essential role in modulating collagen processing drug T0901317 was used as positive control.40
and assembly.37, 38 As shown in Figure 4, both As shown in Figure 5, at both concen-

Results indicate the extract could potentially

increase membrane permeability, in turn
increasing nutrient delivery to skin cells.
trations, DoHE significantly inhibited the cally significant, as compared with the placebo
expression of all the cytokines induced by (p < 0.05). An increase in hydration levels also
bacteria infection in the keratinocytes. At the was observed after the placebo treatment,
higher concentration of 0.01%, the expres- mainly due to the moisturizing activity of the
sion of IL-1b, IL-8 and TNF-a was reduced by cream components themselves, but it was much
approx. 73%, 22% and 43%, respectively. This lower than that produced by the DoHE cream.
suggested DoHE had good potential anti- In a parallel set of tests, TEWL was mea-
inflammatory activity for the skin. sured, which is directly related to skin integrity
and its capacity to retain water. As shown in
Results: Blood Flow Figure 7b, the TEWL decreased by an average
As explained above, during cold stress, blood of 2.52% after one day; 3.61% after 14 days;
flow and consequently the supply of nutrients and 8.04% (p < 0.05) after 28 days of product
and oxygen to skin cells is compromised due application, with respect to T0.
to the reduction of endothelial cell membrane A slight reduction in TEWL also was
permeability. To test the effects of DoHE on observed after the placebo application, but
membrane permeability in endothelial cells, the this variation was not statistically significant
gene expression of VEGF was measured.41, 42 As (p > 0.05). These results supported the in vitro
shown in Figure 6, the extract increased VEGF data and further suggested that DoHE was
expression in human primary endothelial cells. effective in improving skin hydration and
The highest 0.01% dose of DoHE up-regulated reducing water loss, particularly in skin
VEGF expression by 66%, suggesting a poten- exposed to cold conditions.
tial increase in membrane permeability and
therefore, possible increase in nutrient delivery Discussion and Conclusions
to skin cells. The present study identified the primary
active constituents in a hydrosoluble extract
Results: Clinical Tests obtained from Daphne odora cell cultures.
To confirm the data obtained by in vitro Then it tested their capacity to counteract
tests, the activities of DoHE were clinically negative effects in skin caused by cold stress, in
evaluated in 20 healthy volunteers as described particular those related to sebum production,
above. For 28 consecutive days, the volunteers inflammatory response, healing process and
applied a test cream containing 0.002% of the microcirculation. Indeed, species of the genus
extract to the left side of the face, and a placebo Daphne have been used for ages in traditional
emulsion to the right side of the face (see medicine in China, and in tropical parts of
Formula 1). To measure moisturizing efficacy Africa for the treatment of various skin condi-
and skin barrier enhancement, hydration levels tions including bruises, insect and snake bites,
and TEWL were measured before the product wounds, ulcers and infections.43
application (T0), and at T1, T14 and T28. In this study, the Daphne odora cell culture
As shown in Figure 7a, hydration increased extract (DoHE) was characterized and shown
on average by 21.45% after one day; 34.71% to contain lignans and flavonoids, as well as
after 14 days; and 62.17% after 28 days with their glucosidic derivatives, that have several
respect to T0. These increases were all statisti- beneficial properties for skin cells—especially

Skin cells can benefit from components within Daphne odora extract including lignans and flavanoids, and their glucosidic derivatives.
in relation to counteracting the negative effects lines,22 daphnodorins were previously tested for
of cold conditions on skin. As demonstrated inhibiting chymase-dependent angiotensin II
by clinical tests, the extract produced a faster formation,46 being that the isoforms A and B
hydration rate and higher protection against are the most active. Interestingly, this specific
moisture loss, compared with skin treated by a activity can be linked to the observed effect of
placebo cream only. The cellular assays indi- DoHE to increase endothelial cell permeability
cated this action was mostly mediated by: the through VEGF activation, which antagonizes
induction of the sebum regulator 5aR1 in fibro- the angiotensin effect of inducing skin capillary
blasts; an inhibition of inflammatory cytokines; vasoconstriction and reducing blood flow.47
an increase in the healing rate of epidermis Additionally, the wound healing capacity
cells; and stimulation of VEGF expression in observed in DoHE-stimulated fibroblasts can be
endothelial cells. associated with the presence of the luteolin-7-O-
While activity on 5aR1 by any of the glucoside, as found by other authors.24
components of DoHE has not specifically been Finally, particular attention is also deserved
measured, the observed anti-inflammatory by the glycoside derivatives of the flavonoids,
properties can be associated with lignans which have been studied as potential anti-
and daphnodorin bioflavonoids. Indeed, both inflammatory agents48 thanks to their higher
lignans and daphnodorins, isolated from skin permeation capacity, compared with
different Daphne species, have been studied the aglycated forms49 and ability to inhibit
for their capacity to inhibit nitric oxide pro- the NF-kB pathway in endothelial cells.50 In
duction in macrophages.23, 44, 45 Besides their agreement with these results, hesperetin-O-
anti-proliferative activity on different cell tumor glucuronides, flavonoid glycosides structurally

related to both luteolin and apigenin gly- 8. A Callahan et al, Winter season, frequent handwashing and
irritant patch test reactions to detergents are associated
cosides, have been characterized for their with hand dermatitis in health care workers, Dermatitis 24
ability to lower blood pressure and enhance 170–175 (2013)
endothelium-dependent vasodilation by act- 9. HY Lee, M Stieger, N Yawalkar and M Kakeda, Cytokines
ing through NO-mediated mechanisms and and chemokines in irritant contact dermatitis, Mediators
Inflamm ID 916497 (Nov 25, 2013)
inhibiting NADPH oxidase activity in vascular
10. HR Smith, DA Basketter and JP McFadden, Irritant derma-
endothelial cells.51 titis, irritancy and its role in allergic contact dermatitis, Clin
Plant cell cultures represent a valuable Exper Dermatol 27 138–146 (2002)
biotechnological tool to produce active com- 11. S Lisby and O Baadsgaard, Mechanisms of irritant contact
pounds for cosmetic application,52 thanks to dermatitis, in Contact Dermatitis, PJ Frosch, T Menne and
JP Lepoittevin, eds, Springer, Berlin (2006) pp 69–82
their versatility and capacity to adapt metabolic
12. AK Deodhar and RE Rana, Surgical physiology of wound
activities to different growing conditions. healing: A review, J Postgrad Med 43 52–56 (1997)
Several examples of the dermatological activi- 13. JM Johnsonm, CT Minson and DL Kellogg, Jr, Cutaneous
ties of plant cell culture-derived compounds vasodilator and vasoconstrictor mechanisms in temperature
have been published, each one showing differ- regulation, Compr Physiol 4 33–89 (2014)
ent effects on skin cells that depend mostly on 14. N Charkoudian, Skin blood flow in adult human thermoregu-
lation: How it works, when it does not, and why, Mayo Clin
the chemical prevalence of determinate active Proc 78 603–12 (2003)
molecules exerting specific biological effect on 15. A Theocharis, C Clément and EA Barka, Physiological and
gene expression and functions.53–55 Moreover, molecular changes in plants grown at low temperatures,
the chance to modulate the chemical composi- Planta 235 1091–105 (2012)
tion of the plant cell culture extracts by growing 16. C Lütz, Cell physiology of plants growing in cold environ-
ments, Protoplasma 244 53–73 (2010)
the cells in the presence of elicitors makes plant
17. WC Xu, JG Shen and JQ Jiang, Phytochemical and biologi-
tissue cultures unique in terms of flexibility cal studies of the plants from the genus Daphne, Chem
and applicability.56 Biodivers 8 1215–33 (2011)
18. F Cottiglia, G Loy, D Garau, C Floris, M Casu, R Pompei
Acknowledgements: The research was supported by the grant and L Bonsignore, Antimicrobial evaluation of coumarins
“FIT—Fondo speciale rotativo per l’Innovazione Tecnologica,” and flavonoids from the stems of Daphne gnidium L,
E03/00815/00/x17, program title: “Innovative natural active Phytomedicine 8 302–305 (2001)
ingredients for the cosmetic industry.” 19. CH Hong, SK Hur, OJ Oh, SS Kim, KS Nam and SK Lee,
Evaluation of natural products on inhibition of inducible
cyclooxygenase (COX-2) and nitric oxide synthase (iNOS)
References in cultured mouse macrophage cells, J Ethnopharmacol 82
1. R Vyumvuhore et al, Effects of atmospheric relative humidity 153–159 (2002)
on stratum corneum structure at the molecular level: Ex vivo 20. M Deiana, A Rosa, V Casu, F Cottiglia, L Bonsignore and
Raman spectroscopy analysis, Analyst 138 4103–4111 MA Dessi, Chemical composition and antioxidant activity of
(2013) extracts from Daphne gnidium L, J Amer Oil Chem Soc 80
2. SW Youn, JI Na, SY Choi, CH Huh and KC Park, Regional 65–70 (2003)
and seasonal variations in facial sebum secretions: A 21. E Kupeli, A Tosun and E Yesilada, Assessment of anti-
proposal for the definition of combination skin type, Skin inflammatory and antinociceptive activities of Daphne
Res Tech 11 189–95 (2005) pontica L. (Thymelaeaceae), J Ethnopharmacol 113
3. MD Cooper, H Jardine and J Ferguson, Seasonal influence 332–337 (2007)
on the occurrence of dry flaking facial skin, in R Marks and 22. W Zheng, X Gao, C Chen and R Tan, Total flavonoids of
G Plewig, eds. The Environmental Threat to the Skin vol Daphne genkwa root significantly inhibit the growth and
159, Martin Dunitz, London (1992) pp 159–164 metastasis of Lewis lung carcinoma in C57BL6 mice, Intern
4. J Rogers, C Harding, A Mayo, J Banks and A Rawlings, Immunopharmacol 7 117–127 (2007)
Stratum corneum lipids: The effect of aging and the 23. MY Lee et al, Anti-inflammatory activity of (−)-aptosimon
seasons, Arch Dermatol Res 288 765–70 (1996) isolated from Daphne genkwa in RAW264.7 cells, Intern
5. F Andersen, K Andersen and A Kligman, Xerotic skin of Immunopharmacol 9 878–885 (2009)
the elderly: A summer versus winter comparison based 24. I Süntar et al, Efficacy of Daphne oleoides subsp. kurdica
on biophysical measurements, Exog Dermatol 2 190–194 used for wound healing: Identification of active compounds
(2004) through bioassay guided isolation technique, J Ethnophar-
6. W Uter, O Gefeller and HJ Schwanitz, An epidemiologi- macol 141(3) 1058–70 (2012)
cal study of the influence of season (cold and dry air) on 25. C Couteau, LJ Coiffard and V Sébille-Rivain, Influence of
the occurrence of irritant skin changes of the hands, Br J excipients on moisturizing effect of urea, Drug Dev Ind
Dermatol 138 266–272 (1998) Pharm 32(2) 239–42 (2006)
7. AK Jha and D Gurung, Seasonal variation of skin diseases 26. U Heinrich et al, Multicenter comparison of skin hydration
in Nepal: A hospital based annual study of outpatient visits, in terms of physical, physiological and product-dependent
Nepal Med Coll J 8 266–268 (2006) parameters by the capacitive method (Corneometer CM
825), Int J Cosmet Sci 25 45–53 (2003)

27. GR Leonardi, LR Gaspar and PM Maia Campos, Application 48. M Antunes-Ricardo, JA Gutiérrez-Uribe, C Martínez-Vitela
of a non-invasive method to study the moisturizing effect and SO Serna-Saldívar, Topical anti-inflammatory effects of
of formulations containing vitamins A or E or ceramide on isorhamnetin glycosides isolated from Opuntia ficus-indica,
human skin, J Cosmet Sci 53, 263–8 (2002) Biomed Res Int 847320 (2015) doi: 10.1155/2015/847320
28. F Li, E Conroy, M Visscher and RR Wickett, The ability of 49. CF Lin, YL Leu, SA Al-Suwayeh, MC Ku and TL Hwang
electrical measurements to predict skin moisturization. I. and JY Fang, Anti-inflammatory activity and percutaneous
Effects of NaCl and glycerin on short-term measurements, absorption of quercetin and its polymethoxylated compound
J Cosmet Sci 52 13–22 (2001) and glycosides: The relationships to chemical structures,
29. M Taniguchi and K Baba, Three bioflavanoids from Daphne Eur J Pharm Sci 47 857–64 (2012)
odora, Phytochem 42 1447–1453 (1996) 50. D Fratantonio, A Speciale, D Ferrari, M Cristani, A Saija
30. C Manach, A Scalbert, C Morand, C Rémésy and L Jimé- and F Cimino, Palmitate-induced endothelial dysfunction is
nez, Polyphenols: Food sources and bioavailability, Am J attenuated by cyanidin-3-O-glucoside through modula-
Clin Nutr 79 727–47 (2004) tion of Nrf2/Bach1 and NF-kB pathways, Toxicol Lett 239
152–60 (2015)
31. OV Zillich, U Schweiggert-Weisz, P Eisner and M Kerscher,
Polyphenols as active ingredients for cosmetic products, Int 51. M Yamamoto et al, Hesperidin metabolite hesperetin-7-O-
J Cosmet Sci 37 455–64 (2015) glucuronide, but not hesperetin-3'-O-glucuronide, exerts
hypotensive, vasodilatory and anti-inflammatory activities,
32. RS Greene, DT Downing, PE Pochi and JS Strauss, Ana- Food Funct 4 1346–51 (2013)
tomical variation in the amount and composition of human
skin surface lipid, J Invest Dermatol 54 240–247 (1970) 52. A Barbulova, F Apone and G Colucci, Plant cell cultures as
source of cosmetic active ingredients, Cosmetics 1 94–104
33. FK Habib et al, The localization and expression of 5 alpha- (2014)
reductase types I and II mRNAs in human hyperplastic
prostate and in prostate primary cultures, J Endocrinol 156 53. M Bimonte, A Tito, A Carola, A Barbulova, J Hill, M Cuc-
509–17 (1998) chiara, F Apone and G Colucci, Dolichos cell culture extract
for protection against UV damage, Cosm & Toil 129 46–56
34. JM Carthy, TGFb signaling and the control of myofibroblast (2014)
differentiation: Implications for chronic inflammatory disor-
ders, J Cell Physiol (2017) doi: 10.1002/jcp.25879 54. A Tito, M Bimonte, A Carola, A De Lucia, A Barbulova, A
Tortora, G Colucci and F Apone, An oil-soluble extract of
35. KS Ha and JH Exton, Activation of actin polymerization by Rubus idaeus cells enhances hydration and water homeo-
phosphatidic acid derived from phosphatidylcholine in IIC9 stasis in skin cells, Int J Cosmet Sci 37 588–594 (2015)
fibroblasts, J Cell Biol 123 1789–96 (1993)
55. EK Lee et al, Cultured cambial meristematic cells as a
36. BA Hocevar, TL Brown and PH Howe, TGF-beta induces source of plant natural products, Nat Biotechnol 28 1213–7
fibronectin synthesis through a c-Jun N-terminal kinase- (2010)
dependent, Smad4-independent pathway, Embo J 18
1345–56 (1999) 56. A Tito at al, A tomato stem cell extract containing antioxi-
dant compounds and metal chelating factors protects skin
37. AD Bradshaw and EH Sage, SPARC, a matricellular protein cells from heavy metal induced damages, Int J Cosmet Sci
that functions in cellular differentiation and tissue response 33 543–552 (2011)
to injury, J Clin Invest 107 1049–54 (2001)
38. AD Bradshaw, The role of SPARC in extracellular matrix
assembly, J Cell Commun Signal 3 239–46 (2009)
39. GN Stamatas, AP Morello and DA Mays, Early inflammatory
processes in the skin, Curr Mol Med 13 1250–69 (2013)
40. D Wang et al, Synthetic LXR agonist T0901317 attenuates
lipopolysaccharide-induced acute lung injury in rats, Int
Immunopharmacol 11 2098–103 (2011)
41. N Ferrara, The role of VEGF in the regulation of physiological
and pathological angiogenesis, EXS 94 209–31 (2005)
42. P Carmeliet, VEGF as a key mediator of angiogenesis in
cancer, Oncology 69 suppl 3 4–10 (2005)
43. L Shih-Chen, Chinese Medicinal Herbs: A Modern Edition of C&T Daily Newsletter
a Classic Sixteenth-century Manual, Dover Publications Inc, Get the latest from Cosmetics & Toiletries
Mineola, NY (1973)
delivered straight to your inbox everyday!
44. S Liang et al, Bioflavonoids from Daphne feddei and their
inhibitory activities against nitric oxide production, Chem http://www.CosmeticsandToiletries.com/newsletter
Pharm Bull 56 1729–1731 (2008)
45. E Yesilada et al, In vitro inhibitory effects of Daphne
oleoides subsp. oleoides on inflammatory cytokines and
activity-guided isolation of active constituents, Cytokine 13
359–364 (2009)
46. S Takai, M Sakaguchi, J Denan, K Baba and M Miyazaki, C&T Webcasts
Effects of daphnodorin A, daphnodorin B and daphnodorin Find current and upcoming webcasts at
C on human chymase-dependent angiotensin II formation, www.CosmeticsandToiletries.com
Life Sci 64 1889–96 (1999)
47. DJ Campbell, Do intravenous and subcutaneous angioten-
sin II increase blood pressure by different mechanisms? Clin
Exp Pharmacol Physiol 40 560–70 (2013)

Testing | C&T ®
KEY POINTS
• Sensory science allows cosmetic chemists to
evaluate formulas by providing objective and
scientific data on the sensory properties raw
materials impart in formulations.
• This article describes a new sensory test
called “Oil Sensory Qualification,” which
provides formulators with a fast approach to
emollient selection using sensory science.

52 | www.CosmeticsandToiletries.com all or part of this article is strictly prohibited.
Reproduction in English or any other language of all or part of this article is strictly prohibited. © 2018 Allured Business Media.
Vol. 133, No. 1 | January 2018
CT1801_Formulating_Marque_fcx.indd 52 12/26/17 2:36 PM

Sensory
Insight Emollient Profiling Accelerates
Speed to Market
Celine Marque
Oriflame R&D, Bray, Ireland
C osmetic emollients, espe-

cially oils, are commonly
used in formulations for
their hydrating properties.1
In terms of their sensory
characteristics, however,
there is a gap in the literature for specific descrip-
tors as well as global standards that support their
characterization. One descriptive method, the Quan-
titative Descriptive Analysis profile (QDA profile), is
well-known and allows for the qualification and quan-
tification of sensory differences between products.2
The QDA profile is designed to provide results
when detailed sensory profiles of oils and other raw

Sensory Insight
Important to the success of this method were

the six attributes chosen for assessment.
materials are required for several products oped to replace QDA profiling. It involved
compared globally at different in-use steps— defining six key desired attributes for the nine
i.e., when opening products, gliding between oils, then evaluating each oil individually and
the fingers, at application and after application. choosing the best two attributes demonstrated
However, one disadvantage of the QDA profile is for a given oil. The oils were then mapped
the panel calibration process. according to their top attributes to speed the
During a long and intensive training period, emollient selection process.
panelists learn about different sensations and Here, chemists were recruited for their expe-
are taught to grade them similarly, providing rience with oils to evaluate the oil attributes
ratings for intensity on specific scales. This during and after application. The different steps
step challenges companies to collect consistent are described herein.
results, in addition to the calibration time it
takes to evaluate a product.3 Test Protocol:
Alternative sensory tests, including Flash Oil Sensory Qualification
Profiling, Projective Mapping and Sorting As stated, chemists (n = 10) were recruited
Tasks,4–8 were developed a couple of years ago to perform the Oil Sensory Qualification based
to produce the same results as QDA profiling on their experience in formulating with oils. A
but more efficiently. However, few of these short training session was performed, which
applications have been used in the cosmetic outlined standards to ensure the six attributes
industry.4, 7, 8 In current sensory testing, con- and evaluation protocols were understood
sumers are often recruited and one or two (see Table 1). [Editor’s note: For proprietary
sessions are necessary to gather global sensory reasons, the six attributes are generalized in the
perceptions about a product range. For these present article.]
alternative tests, final users are recruited in Ten samples in total were tested, with one oil
order to avoid training an expert panel. presented twice to measure the repeatability of
As such, the aim of the present study was to the panel (see Table 2). Samples were identi-
develop a means for the global sensory compar- cally packaged and presented by a random
ison of nine oils used in cosmetic formulations. three-digit numeric code, balanced following
This comparison would then allow the chem- the Latin Square plan.
ist to select an oil based on its standardized
sensory characterization.
The presented alternative methodology,
called “Oil Sensory Qualification,” was devel-
Table 1. Evaluation of Six Attributes
Attributes Evaluation step

Active personal care specialty ingredients Attribute 1 At application
are expected to reach US $6.5 billion by Attribute 2 At application
2024, attributable to demand for conditioning
Attribute 3 At application
polymers and emollients.
Attribute 4 At application
Attribute 5 Just after application
Source: Global Cosmetic Industry
Attribute 6 Just after application
(www.GCImagazine.com)

Oils are commonly used as emollients for their hydrating properties.
The formulation chemists tested the samples Axis description: On the horizontal axis,
one by one and to answer the sensory question- Attribute 3 corresponded to the bottom right
naire. They applied one drop of oil to the volar corner of the map, opposite Attributes 1 and 2.
forearm and evaluated, during 90 sec, four On the vertical axis, Attribute 4 rose to the top
attributes upon application and two attributes area of the sensory map, opposite of Attribute 3.
after application. Attributes 5 and 6 fell in the middle of the map.
At the end of the evaluation, the chemists Oil description: Two groups of oils were
chose the best two sensory attributes provided clearly differentiated on the horizontal axis:
by each oil during and after application and
recorded their choices in the sensory question-
naire. Assessments were performed under Table 2. Oil Samples
standard testing conditions; i.e., independently,
in a room having controlled temperature and
humidity, etc.9 Oil INCI Names Code on Graphs
Oil assessment data was collected for each 1 Diisopropyl Adipate DIPAD
sample. The preferred attributes chosen by
2 PPG-5-Laureth-5 PPG5
panelists were graded as “1,” while the others
were graded as “0.” The total results for each oil 3 Oleyl Alcohol OLAL(1)
were compiled in a global matrix to perform a 4 Isopropyl Palmitate IPP
multidimensional statistical analysis, referred 5 PPG-14 Butyl Ether PPG14
to as a Correspondence Analysis (CA).10 Statisti-
6 Dibutyl Adipate DIBA
cal analysis was performed using software.
7 Diisostearyl Malate DISMA
Mapping Results 8 Oleyl Alcohol OLAL(2)
A global representation of the sensory differ- Caprylyl Caprylate/
ences between the nine oils was obtained by CA 9 Caprate (and) CCT
(see Figure 1); here, 83% of the information is Tocopherol
represented on the two axes. 10 Phenethyl Benzoate PEB

Sensory Insight
IPP, DIBA, DIPAD and CCT, on the left side of Impressively, only one 45-min session was
the map. Clearly, these four oils can be discrimi- necessary to assess the nine raw materials using
nated from the others as they are more defined this method—use of the QDA profile and an
by Attributes 1 and 2. On the other hand, expert panel would have taken much longer to
PPG14 and DISMA rated at the lower-right side obtain consistent results and a global sensory
of this axis; therefore, PPG14 and DISMA are representation of the nine raw materials. The
more characterized by Attribute 3. outcome provided chemists with a quick sen-
Furthermore, two groups of oils were differ- sory qualification for these raw materials to aid
entiated on the vertical axis. PEB, OLAL(1) and with formulating decisions in cases where two
OLAL(2) rated at the top of the map, as they are raw materials provided similar pH and stability
well-represented in this second axis. They were results. Moreover, the Oil Sensory Qualification
more defined by Attribute 4 and different from enabled the development of an internal sensory
the other oils. classification for raw materials received from
different suppliers.
Discussion While the Oil Sensory Qualification method
As illustrated by this exercise, nine raw showed positive results, areas for improve-
materials could be evaluated and clearly ment were identified. For example, the OLAL
discriminated by experts thanks to this new assessed twice during the trial resulted in both
sensory approach. The CA represents the global samples in the same CA map group, validating
sensory differences between the nine oils. the consistency of the panel; however, this pre-
Important keys to the success of this method liminary study could be replicated to evaluate
were the six attributes chosen. Their selection consistency over time; i.e., one year later.4–8 This
and the outlined standards were important to method could also be extended to different raw
ensure the chemists could discriminate between material categories such as thickeners; or toi .
the oils and clearly understand the sensations In addition, future iterations could compare
each imparted. expert with consumer perceptions to under-
stand differences.
Indeed, research of
wine and fragrances
shows that oenolo-
gists and perfumers
can perceive small
sensory differ-
ences without test
panel training.11
Such insight
into the final user’s
sensory experience
of finish products,
e.g., facial oils and
other products,
could prove useful to
cosmetic companies.
Conclusions
This first trial
of the described
approach demon-
strated positive
results for the sen-
sory differentiation
Figure 1. Correspondence Analysis Map of a challenging raw
material. It could

The Oil Sensory Qualification method created quick comparisons between raw materials.
therefore provide cosmetic companies with 6. P Faye, D Bremaud and M Durand Daubin, Perceptive
free sorting and verbalization tasks with naıve subjects:
a quick and cost-effective means to evaluate An alternative to descriptive mappings, Food Quality and
raw materials to support chemists during the Preference 15(7–8) 781–791 (2004)
formulation process. 7. A Gambaro, ME Parente and A Gimenez, Free-choice pro-
file descriptive analysis with conditioning agents, J Cosmet
Sci (57) 455–63(2006)
Acknowledgements: The author would like to thank the
Oriflame R&D formulation chemists: Meltem Ozmus, Delphine 8. ME Parente, G Ares and AV Manzoni, Application of two
Wittenberg and Eve Merinville for their participation. She would consumer profiling techniques to cosmetic emulsions,
J Sensory Studies (25) 685–705 (2010)
also like to thank all reviewers for their constructive comments.
9. ISO 8589, Sensory analysis—General guidance for the
design of test rooms (2007)
References 10. B Escofier and J Pages, Multiple factor analysis, Computa-
1. AM Pensé-Lhéritier, Conception des produits-la formulation, tional Statistics & Data Analysis (18)121–140 (1994)
Coll Cosmetic Valley France, Lavoisier (2014) 11. M Nestrud and H Lawless, Perceptual mapping of citrus
2. H Stone and JL Sidel, Sensory evaluation practices, Global juices using projective mapping and profiling data from
Cosmetic Industry (2004) culinary professionals and consumers, Food Quality and
Preference 19(4) 431–438 (2008)
3. GV Civille and AS Szczesniak, Guidelines to training a
texture profile panel, J Texture Stud 4(2) 204–223 (1973)
4. M Santosa, H Abdi and JX Guinard, A modified sorting task
to investigate consumer perceptions of extrac virgin oils,
Food Quality and Preference (21) 881–892 (2010)
C&T Daily Newsletter
5. V Dairou and JM Sieffermann, A comparison of 14 jams
characterized by conventional profile and a quick original Get the latest from Cosmetics & Toiletries
method, the Flash Profile, Journal of Food Science 67(2) delivered straight to your inbox every day!
826–34 (2002)
http://www.CosmeticsandToiletries.com/newsletter

Formulating | C&T ®
KEY POINTS
• The use of alpha olefin sulfonate surfactants
is rising in personal care; most commonly,
sodium C14-16 olefin sulfonate.
• This article identifies the properties, applications

and composition of these surfactants for their
role in the industry’s future.
ExaminingSurfactant
Tomorrow’s
Ingredient Profile
Personalities
N
Alpha Olefin Sulfonate in Personal Care
Saroja Narasimhan, Ph.D.

and Jon Toliver on-sulfate anionic surfactants are often used in
Johnson & Johnson, cleansing products for personal care, hard sur-
Skillman, NJ USA faces, laundry and industrial applications.1, 2, 5, 7, 8
In personal care alone, they range in variety;
although notably, cleansers with added hair color-
retention benefits and formulas positioned for the
hair, scalp and body represent the segments in highest demand.2, 5, 7, 8 Due
to these broad product applications, customizable performance attributes
and biodegradability, the use of alpha olefin sulfonate (AOS) surfactants has
increased dramatically.27
CT1801_Formulating_JJ_fcx.indd 58 12/26/17 2:45 PM

Brains With
Beauty
Discover crucial R&D insights with peer reviewed scientific knowledge, trends,
and news from the trusted voice of the beauty and cosmetic industry.
Subscribe for FREE now!

www.CosmeticsandToiletries.com/BEAUTY
CT17_House_Ad_FP.indd 1 2/20/17 12:53 PM
Examining Tomorrow’s Surfactant Personalities
Due to broad product applications,

customizable performance attributes and
biodegradability, the use of AOS surfactants
has increased dramatically.
The most common AOS used in personal produce better foam, while those with higher
care is sodium C14-16 olefin sulfonate, which molecular weights have reduced solubility and
functions as a detergent, wetting agent and increased detergency. Therefore, AOS of two
emulsifier depending on the application.18 When different grades could lead to performance dif-
properly formulated, sodium C14-16 olefin sul- ferences in apparently similar products with all
fonate imparts viscosity, a consumer-acceptable other ingredients held constant. Foam volume,
foaming profile and quick flash foam to produce density and viscosity also vary depending on
a stable lather, among other benefits. parent olefin carbon chain lengths and ratios.
In addition, the surfactant maintains perfor-
mance at alkaline and acidic ranges, allowing Production and Manufacture
flexibility for formulators.9, 3, 10 This stability is Olefins are mainly produced by polymerizing
attributed to the sulfonate groups covalently ethylene through different synthetic pathways
bonded to a carbon; conversely, sulfate-based such as the Oxo process, Shell Higher Olefin
surfactants tend to hydrolyze below pH 4 due Process (SHOP) or refinery cracking; however,
to inorganic ester bonds that cleave and yield the Ziegler process is more common.6 The
a sulfate anion and an alcohol. The pH stabil- Oxo process produces a mixture of linear and
ity of C14-16 olefin sulfonate has generated branched a-olefin compositions, while Ziegler
additional interest over lauryl sulfates and lauryl and SHOP products have lower levels of branch-
ether sulfates for both claims and performance. ing within their structure.6
It also allows the material to be provided as a As noted, variations in olefin quality will
preservative-free aqueous solution, using excess transfer into the final composition, and may
alkalinity for preservation.3 cause differences in foam volume, density
AOS may be produced from several olefins wetting properties and viscosity due to effects
with differing performance characteristics. Typi- on surfactant micelle packing.6, 11 For example,
cal grades are derived from C14-16, C16-18 and long, single-branching and random internal
C14-18, and vary in product applications. Lower olefin bonds from the Oxo pathway may
molecular weight grades are more soluble and result in reduced surface activity in the final
sulfonate product.
The manufacturing process for AOS involves
the sulfonation of the a-olefin selected to create
the final surfactant. C14-16 a-olefin is the most
The global surfactant market is forecast to common olefin used for synthesis in personal
grow at a CAGR of 4.5% from 2015 to 2020, care applications due to its stable foam produc-
with a shift in demand from need-based to tion and detergency for the final AOS.18 The
lifestyle personal care products. sulfonation process may be carried out with
different types of sulfonating agents, such as
bisulfites or sulfur trioxide (SO3). The use of
Source: Lucintel bisulfites introduces the bisulfite ion into the
olefinic double bond in the presence of an oxi-
dant, yielding an alkyl sulfonate. The bisulfate
process, however, is not suitable for commercial

production due to low yields and the complex- time, temperature of addition and mole ratio
ity involved in the process.11, 14 The SO3 used (SO3:a-olefin) affect the quality, including color,
for the reaction is commonly derived from the byproduct levels and free-oil levels.10, 15 Signifi-
oxidation (burning) of sulfur. SO3 may also be cant differences can result depending on the
recovered from oleum stripping or stabilized process equipment and controls. The process is
sulfur trioxide; however, stabilized SO3 requires run continuously to handle production volumes
removal of the stabilizer prior to reaction, add- and for finer control.
ing an additional manufacturing step.15 Conditions for the digestion step affect the
The principal sulfonation method to produce type of sultones and isomerized intermediates
AOS is a continuous process called falling film such as 2-hydroxy sulfonate, which has very low
sulfonation, where a thin film of a-olefin is con- solubility compared with alkene sulfonates.11
tacted with gaseous SO3 to create olefin sulfonic The hydroxy sulfonate content may increase
acid, as depicted in Figure 1.15, 16 depending on conditions. Neutralization of
Typical manufacturing steps to produce the olefin sulfonic acid with sodium hydroxide
sodium C14-16 olefin sulfonate are comprised of creates the desired sodium a-olefin sulfonate in
a-olefin sulfonation, free-oil digestion, neutral- addition to undesired five- and six-membered
ization and hydrolysis.6, 11 Sulfonation reaction ring a- and d-sultone structures, as depicted
temperatures are controlled by feeding the C14- in Figure 2.11, 18 These sultones are known
16 a-olefin into the reactor as a thin film while sensitizers and are removed through additional
moderating contact of the gaseous SO3 vapor processing. Cosmetic grade AOS limits the g-sul-
using an inert gas between the reactants.12, 17 tone impurity for leave-on or rinse-off products
Variations in the reactant feed rate, contact to < 10 ppm for unsubstituted alkane sultones;
CH3-(CH2)13-CH=CH2 + SO3–––––––>CH3-(CH2)13-CH2CH2-SO3H
Figure 1. Sulfonation process
A) H2O
CH3-(CH2)13-CH2CH2-SO3H + NaOH–––––––>CH3-(CH2)13-CH2CH2-SO3Na
+ H2O
B)
R-CH2 CHCH2 -CH2 R-CH2 CH2CH2 -CH2
–
–
–
–
O–––––SO2 O–––––––––SO2
5-member sultone 6-member sultone
Figure 2. Sodium Alpha Olefin Neutralization (a) and Sultone Structures (b)

< 1 ppm chlorosultones and < 0.1 ppm unsatu- sulfonates.11, 10 The alkene sulfonate can rear-
rated sultones based on the safety assessment of range during sulfonation to an internal olefin,
AOS in the Cosmetic Ingredient Review.10 having isomer mixtures of 1-, 2-, 3- and 4-alkene
Hydrolysis reduces intermediate sultone sulfonates. The reaction and process conditions
content by opening the ringed structures, discussed control the surfactant product proper-
converting them to the olefin sulfonate. This ties such as color, clarity and performance in
also modifies the ratio of alkenesulfonate to formulation. The AOS-critical quality param-
n-hydroxyalkanesulfonate via addition of a eters impacting final performance are governed
hydroxyl group, further shifting the distribu- by chemistry, residuals and byproducts, as
tion of alkenesulfonate positional isomers.6, 11 shown in Table 1.
Acid hydrolysis can be used but lowers the
product pH and may cause discoloration.14 AOS Properties
Therefore, alkaline conditions are preferred Commercially, sodium C14-16 olefin sul-
for hydrolysis and final neutralization to make fonates are supplied as 30–40% w/w active
the AOS salt using caustic soda (NaOH) or solutions, which are clear to slightly yellow
sodium carbonate. and whose viscosity generally ranges from
The resulting composition of AOS is a 200–1000 cP. The residual impurities found in
mixture of isomeric alkenesulfonates (65–70%) AOS may include unsulfonated matter, disulfo-
and hydroxyalkanesulfonates (20–25%), along nate, NaCl, NaSO4 and g-, d- and chlorosultones,
with lesser amounts of disulfonated products all of which affect the material properties. As
(7–10%); alkene sulfonate and hydroxyalkane noted, d- and g-sultones are known sensitizers
Table 1. Alpha Olefin Sulfonate Critical Attributes: Feedstock, Composition,

Byproducts and Residuals
Critical Attribute Performance Impact

Variation between degrees of branching in the final AOS
may lead to differences in foam volume, density, wetting
Olefin degree of branching
properties and viscosity due to differences in surfactant
micelle packing in final formulation.
Olefin cut can shift the CMC and aspects of product such as
C-chain distribution
cleansing, foaming, viscosity, clarity and surfactant solubility.
Determines performance attributes of the material; related
Active level to total surfactant solids available for micellar formation,
cleansing and product attributes
Type of isomers formed and ratio of the alkene sulfonate:
hydroxyalkyl sulfonate can shift the CMC and aspects of
Sulfonate distribution
product such as cleansing, foaming, viscosity, clarity and
product texture
Unsulfonated matter and free Can shift the CMC and aspects of product such as cleansing,
oil content foaming, viscosity, clarity and product texture.
May cause inconsistency in formulation viscosity, affect clarity
and base texture, affect efficiency of any anionic polymers
Salt content and type
within the base; salt may act as a hydrotrope, reducing final
viscosity
Regulatory and toxicology concern for the material; delta,
Sultones types and levels gamma and chlorosultones may be produced and are known
sensitizers
May affect pH of final AOS product as well as sultone
Bleaching agent
production in product, affecting alkene sulfonate level

There are several benefits to formulating with
sodium C14-16 olefin sulfonate, including
broad pH stability and formulation versatility
to meet consumer needs.
with recommended levels not to exceed 34 ppm The presence of the -OH group in the hydroxy-
and 10 ppm, respectively.10 Manufacturing pro- alkane sulfonate structure increases solubility
cesses using sodium hypochlorite as a bleaching and lowers surface activity significantly more
agent may create additional unsaturated and than the presence of unsaturation in the
chlorosultones as byproducts and potent skin alkene sulfonate.
sensitizers.10, 19 Residual unsulfonated matter, As noted, there are several benefits to for-
disulfonate and the salts NaCl and NaSO4 may mulating with sodium C14-16 olefin sulfonate,
affect the Krafft point. Introductions of chain including broad pH stability and formulation
branching, unsaturation and polar segments versatility. C14-16 olefin sulfonate can be used
into the AOS structure also impact Krafft as a primary surfactant in combination with
temperature, through influence of the surfactant betaines or sarcosinates, as well as nonionic
unimer solubility. surfactants such as polyglucoside and poly-
The ratio of alkenesulfonate to n-hydroxy- sorbate and other nonionic derivatives. The
alkanesulfonate is also impactful due to their nonionic surfactants aid in building sufficient
solubility differences and can impact minimum packing of the micelles in the systems, conse-
storage conditions of approximately 20–27˚C.20 quently increasing the viscosity.18 Salt also can

be used to enhance the thickening of the system; cost targets for various segments; e.g., economy,
however, when using NH4Cl in place of NaCl, mass, premium and luxury. Further compari-
the product pH must be less than 7.0 to prevent sons of AOS vs. commonly used surfactants can
ammonia formation and off odor. be seen in Table 2.
Foam benefits also are noted in conjunction
with betaines and ethoxylated glucosides, which Advantages and Outlook
have synergy with AOS and improve foam AOS has been used in personal care mainly
quality.18, 21 Although higher surfactant loads of as a primary or secondary surfactant in rinse-off
C14-16 olefin sulfonate are generally necessary products including hand washes, facial washes,
to achieve enhanced foaming profiles,22 the bubble baths, shampoos and most commonly,
moderate cost for C14-16 olefin sulfonate offsets body washes. Concentrations exceeding
the need for higher concentrations. Levels also 10% w/w in personal care formulations are
can be reduced when used in combination with considered acceptable, with AOS use in sham-
ethoxylated glucosides, fatty alkanomides or poos and body washes generally at ~16% w/w as
fatty amidoalkyl betaines, which increase foam supplied and above.10
abundance stability and create a wetter foam As stated, the chemical stability of AOS and
for a creamier lather.21 The ability of AOS-based its ability to maintain efficacy under extremes
formulations to be customized for performance of pH enable broad applications. The low pH
with common secondary ingredients allows stability of AOS has advantages over sulfates in
product developers to readily meet design and specialized products for anti-acne treatments
Table 2. Commonly Used Surfactants vs. Alpha Olefin Sulfonates
Sulfate-free Relative Cost of Primary Anionic pH Stable General Formulation Associated

Surfactants Surfactant Surfactant Range Thickening Mechanism Formulation Cost
Alpha Olefin Secondary surfactant(s)/
$$ Yes 3–11 $–$$
Sulfonates electrolyte
Sarcosinates $$ Yes >7 External mechanism $$–$$$
Sulfosuccinates $ Yes 5.5–8.5 External mechanism $$
Carboxylates $$ Yes > 5.5 External mechanism $$–$$$
Secondary surfactant(s)/
Isethionates $$$ Yes 5.5–9.0 electrolyte and/or $$–$$$
external mechanism
Taurates $$$ Yes 3–11 External mechanism $$$
Glutamates $$$$ Yes >7 External mechanism $$$
Adds to final
cost when used
Betaines $$$ No >5 N/A
as a secondary
surfactant
Adds to final
cost when used
Alkanolamides $$$ No 5–11 N/A
as a secondary
surfactant
Adds to final
cost when used
Amine Oxides $ No 4–9 N/A
as a secondary
surfactant
Note: Final surfactant and formulation cost may fluctuate based on the market influence (i.e., oleochemical and petrochemical pricing)

that contain large amounts of salicylic acid.23 18. AJ O’lenick, Alpha olefin sulfonates, Surfactants: Strategic
Personal Care Ingredients, Allured Business Media, Carol
And again, this flexibility also allows for alkaline Stream, IL USA 47–48 (2014)
preservation, alleviating concerns over preserva- 19. US Pat 4052431, Process for the production of commercial
tive type and regulatory restrictions. alpha olefin sulfonates, TG Baker and RJ Shute, assigned to
All in all, sodium C14-16 olefin sulfonate Stepan Chemical Co (Oct 4, 1977)
can be effectively formulated in synergy with 20. K Holmberg, B Jonsson, B Kronberg and B Lindman,
Surfactant micellization, in Surfactants and Polymers in
secondary surfactants and electrolytes to meet Aqueous Solution, 2nd edn, Wiley, Oak Brook, IL USA
consumer-acceptable viscosity, aesthetics and 37–65 (2002)
foam quality. Its moderate price can positively 21. US Pat 4450090, Thickened alpha-olefin containing formu-
impact associated formulation costs due its lations, J Kinney, assigned to Clairol Incorporated (May 22,
1984)
versatility and broad application. The surfactant
22. cosmeticsandtoiletries.com/formulating/function/surfactant/
is also readily biodegradable, which is a highly premium-sulfate-vs-sulfate-free-information-to-make-a-
desirable feature.27 choice-214206751.html (Accessed Dec 1, 2017)
Taken together, the robust nature of this 23. personalcaremagazine.com/story/8753/encapsulated-
surfactant category, cost in use and tangible salicylic-acid-for-acne-treatment (Accessed Dec 1, 2017)
benefits as well as claims have advantages 24. ME Tuvell, GO Kuehnhanss, GD Heidebrecht, et al, AOS—
An anionic surfactant system: Its manufacture, composition,
for use in the future development of personal properties and potential application, J Am Oil Chem Soc
care products. 55(1) 70–80 (Jan 1978) doi: https://doi.org/10.1007/
BF02673393
25. stepan.com/uploadedFiles/Literature_and_Downloads/
References General_Lit/Personal_Care/StepanSulfateFreeSurfactantSo-
1. cosmeticsandtoiletries.com/formulating/function/surfactant/ lutionsGuide.pdf (Accessed Dec 1, 2017)
premium-sulfate-vs-sulfate-free-information-to-make-a- 26. US Pat 9622952, Internal olefin sulfonate composition,
choice-214206751.html (Accessed Dec 1, 2017) Y Doi, H Hori, Y Mitsuda and Y Yoshikawa, assigned to Kao
2. pureology.com/blog/lifestyle/everything-to-know-about- Corp (April 18, 2017)
sulfate-free-shampoo.html (Accessed Dec 1, 2017) 27. I Brierley-Green and J Gee, Recent studies on the produc-
3. stepan.com/uploadedFiles/Literature_and_Downloads/ tion of sodium alpha olefin sulfonates as concentrates and
Product_Bulletins/Surfactants/BIO-TERGE%C2%AE/ dry products, Chemithon Corp (2000)
BIOTERGEAS40.pdf (Accessed Dec 1, 2017) 28. DR Karsa, Surface Active Behavior of Performance Surfac-
4. http://bit.ly/2kiDNhR (Accessed Dec 18, 2017) tants, Taylor and Francis, Abingdon, England 14 (2000)
5. https://www.solvay.com (Accessed Dec 18, 2017) 29. www.thefreelibrary.com/Sulfate-free+personal+cleansers%3
a+more+marketers+are+trying+to+develop...-a0185167259
6. RJ Farn, Alpha olefin sulfonates, Chemistry and Technology
(Accessed Dec 1, 2017)
of Surfactants 119-121 (2006)
30. in-cosmetics.com/RXUK/RXUK_InCosmetics/2014-web-
7. http://bit.ly/2CAPgQx (Accessed Dec 1, 2017)
site/Documents/Innospec%20IS%20Presentation2ndApr.
8. cosmeticaitalia.it/documenti/a_centrostudi/Mintel-Cosmo- pdf?v=635340141445032079 (Accessed Dec 1, 2017)
prof-2015.pdf (Accessed Dec 1, 2017)
31. soynewuses.org/wp-content/uploads/MOS_Surfac-
9. www.rhodia.com/en/markets_and_products/product_finder/ tants2009.pdf (Accessed Dec 1, 2017)
product_details.tcm?productCode=90018371 (Accessed
Dec 18, 2017)
10. B Nair, Final report on the safety assessment of sodium
alpha-olefin sulfonates, Intl J Toxicol 17(5) 39–65 (1998)
11. R Bernhardt and G Dado, Sulfonation and sulfation, in Kirk
Othmer Encyclopedia of Chemical Technology, John Wiley
C&T Webcasts
& Sons Inc., DeKalb, IL USA, online (Sep 14, 2017)
12. NC Foster, Sulfonation and Sulfation Processes, The Find current and upcoming webcasts at
www.CosmeticsandToiletries.com
Chemithon Corp 1-36 (1997)
13. surfatech.com/pdfs/Sulfate%20Article.pdf (Accessed Dec 1,
2017)
14. US Pat 3409637, Sulfonating olefins with gaseous sulfur
trioxide and compositions obtained therby, RD Eccles,
JE Yates and TP Matson, assigned to Continental Oil
Company (Nov 5, 1968)
15. US Pat 531518, Process for the reaction of alpha-olefins C&T Daily Newsletter
and gaseous sulfur trioxide, RL Jacobsen and TH Ohren,
assigned to Proctor & Gamble Co (Sep 29, 1970) Get the latest from Cosmetics & Toiletries
delivered straight to your inbox everyday!
16. US3420875, Olefin sulfonates, WA Di Salvo and JS
Scharger, assigned to Colgate-Palmolive Co (Jan 7, 1969)
http://www.CosmeticsandToiletries.com/newsletter
17. L Yamane, Recent findings and experiences with alpha
olefin sulfonates, J A M Oil Chemists 17 81-86 (1978)

Formulating | C&T ®
KEY POINTS
• As described in Part I, the cosmetics industry
has been developing RNAi technologies for skin
care applications. However, a major stumbling
block has been their delivery into skin.
• This second installment briefly reviews new

delivery methods for the implementation and
commercialization of RNAi-based products.
A New Code
for Skin Care PART II:
Breakthroughs in the Delivery
of RNAi Therapeutics
Paul Lawrence, Ph.D., and Joseph Ceccoli

Biocogent, LLC, Stony Brook, NY
Editor’s note: Per the U.S. Food and Drug Administration, cosmetics are articles intended to beautify appearance and should not alter the structure or
function of the human body; those that do are considered drugs. The concepts presented here blur this line, although they reflect major advances in recent
skin care science.
This second in a three-part series briefly reviews the delivery of RNAi technologies into skin; Part I considered their utility in general and Part III, in March
Reproduction
2018, will cover the reverse of RNA interference—RNA activation in English or any other language of
(RNAa).
CT1801_Formulating_Lawrence_fcx.indd 66 12/26/17 2:52 PM

N ucleic acid-based
therapeutics have
received a consider-
able amount of
attention over recent
years, particularly
those based on RNA interference (RNAi). This
biological platform consists of small RNAs
called short interfering RNAs (siRNAs) and
microRNAs (miRNAs or miRs) that do not
code for any protein, but rather can regulate
the expression of proteins by targeting and
sequestering the messenger RNA (mRNA) that
encodes specific proteins for degradation and/
or repression.1–3
The sequence complementarity require-
ment between siRNAs and their cognate
mRNAs is rigid, giving great specificity, while
only partial complementarity is needed for
miRNAs—which allows the latter group to
affect multiple signaling pathways within
a cell.4 This has led to miRNA “profiling”
Vol. 133, No. 1 | January 2018 Cosmetics

Reproduction in English or any other language of all or part of this article is strictly prohibited. © 2018 & Toiletries
Allured Business Media. ® | 67

A New Code for Skin Care
Progress in elastic and peptide-modified

liposomes suggests RNAi delivery obstacles
could be surmounted.
efforts by some skin care groups to determine tive charge, whereas skin-permeable molecules
which miRNAs and their downstream signal- tend to be lipophilic and without a charge.
ing pathways are being affected by particular To overcome these issues, siRNAs and/
topical treatments (see “indirect approach” in or miRNAs require pairing with a delivery
Figure 1).5 vehicle that can shield them from degrada-
Alternatively, other research groups have tion, mask their hydrophilicity, and promote
attempted to utilize RNAi to treat a variety of skin and cellular penetration. Recent progress
skin conditions such as aberrant skin pigmen- with so-called elastic liposomes or liposomes
tation (see “direct approach” in Figure 1).6, 7 modified with cell-penetrating peptides suggests
However, the consistent stumbling block to these delivery obstacles could be surmounted,
more widespread applications of direct RNAi- potentially unleashing the full potential of
based approaches to treat skin conditions RNAi-based skin therapies.
has been the development of a robust topical
delivery vehicle. Elastic or Ultra-deformable
Liposomes
Delivery Barriers Classically, liposomes have been explored
What prevents naked siRNA or miRNA from for their ability to carry nucleic acids, whether
being administered directly into the skin? First, DNA or RNA, across the stratum corneum to
the skin is littered with enzymes called nucle- the viable cells of the epidermis. Liposomes are
ases that will chop unmodified nucleic acids vesicles composed of a phospholipid bilayer,
into pieces.8, 9 Second, siRNAs and miRNAs where the polar hydrophilic phospholipid
are relatively large compared to most skin- heads of the bilayer face outward, and the
permeable materials. Additionally, miRNAs are hydrophobic tails face inward. This produces a
hydrophilic molecules with an inherent nega- spherical structure with a hydrophilic exterior
and central core.
Some of the earliest attempts to adapt
liposomes as delivery vehicles for skin thera-
Read Part 1 of this series in the October 2017 peutics were in the 1990s, which resulted in the
issue of Cosmetics & Toiletries. Find them in your development of two different types of elastic or
digital edition (click on Back Issues) or online at ultra-deformable liposomes (UDLs) known as
www.cosmeticsandtoiletries.com/ ethosomes and transfersomes.10–13 Ethosomes
magazine/pastissues/2017/. are liposomes that incorporate ethanol in
their composition and allow for greater skin
penetration. Transfersomes, on the other hand,
are liposomes where the cholesterol compo-
nent has been replaced with what is known
as an edge activator, frequently in the form
The global epigenetics market is projected to of a single-chain surfactant molecule such as
reach US $1.6 billion by 2022, expanding at a polysorbate-80, which allows for the modified
CAGR of 13.5% from 2017. liposomes to circumvent the small pore sizes
of the skin via the pliability of the liposomes to
“squeeze” through the narrow skin pores.14–16
One earlier effort to develop UDLs specifi-
Source: Markets and Markets cally for the delivery of siRNA molecules to
the skin described so-called surfactant-ethanol-
cholesterol-osomes (SECosomes).16, 17 These

specialized liposome vehicles contain both with ethanol as a penetration enhancer and
ethanol and an edge activator surfactant—they sodium cholate as an edge activator in cat-
are essentially transethosomes—and they have ionic liposome formulations prepared with
shown improved efficiency for the delivery of 1,2-dioleoyl-3-trimethylammonium-propane
molecules to the skin.18 chloride (DOTAP). This modified formula
For enhanced delivery of siRNAs into augmented the penetration of the cationic
the skin, SECosomes were also formulated liposomes through the stratum corneum, to the
Figure 1. Two current approaches using miRNAs: indirect and direct
Figure 2. Amino acid sequences of the skin-penetrating TAT, magainin and SPACE
peptides. Here, the N-terminus (NH2) and C-terminus (COOH) are indicated. Amino acids
include: alanine (A), cysteine (C), aspartic acid (D), phenylalanine (F), glycine (G), histidine
(H), isoleucine (I), lysine (K), leucine (L), methionine (M), proline (P), asparagine (Q), arginine
(R), serine (S), threonine (T) and valine (V).

A New Code for Skin Care
viable cells of the upper epidermis and to the encoded by the human immunodeficiency virus
basal epidermal layer. Indeed, the effectiveness (HIV). Alternately, the peptides poly-arginine,
of siRNA delivery and the down-regulation of a magainin and TD-1 were all found to enhance
gene of interest was measured at approximately the cell-penetrating properties of liposomes.19–22
75% in an in vitro model.16, 17 Importantly, this The amino acid sequences for three of the more
observed effect was also observed in cell culture commonly studied peptides are shown in Fig-
and replicated in intact human skin. ure 2; TAT, magainin and the “SPACE” peptide.
Recently, the efficacy of SECosomes was Regarding the latter, in brief, the penetration
optimized with a new formulation, DDC642, of cationic liposomes with ethanol (ethosomes)
for the topical delivery of RNAi-based therapeu- was augmented via the inclusion of a peptide
tics.14, 15 While several improved formulations know as the Skin Permeating and Cell Entering
were tested, DDC642, which substituted (SPACE) peptide.23 Not only has the SPACE
1,2-dioleoyl-sn-glycero-3-phosphoethanolamine peptide proven effective at transfecting skin
(DOPE) in place of sodium cholate, provided cells in culture, it also has been shown in vivo
the best results for the topical delivery of both to topically deliver SPACE peptide-modified
siRNAs and miRNAs.14, 15 liposomes through animal and human skin.
As illustrated here, thoughtful changes to Comparing the SPACE peptide with several
classical liposome chemistry are realizing the of the other peptides investigated, it is notable
potential for RNAi-based skin therapeutics. that it has far fewer positively charged amino
acids (see Figure 2). Regardless of this distinc-
Peptide-decorated tion, liposomal delivery vehicles incorporating
Liposomes the SPACE peptide showed improved delivery of
Some research groups have embraced a dif- siRNA molecules in both cell culture and with
ferent approach: incorporating skin-penetrating mouse skin—with an in vivo gene of interest
peptides into the vesicle bilayer, in lieu of knockdown efficiency of approximately 63%.23
formulating meta-stable liposomes with novel These findings suggest that a combination of
vesicle chemistries. Early attempts utilized the modified liposome chemistries and the inclu-
trans-activator of transcription (TAT) peptide sion of skin penetrating peptides may produce

The industry is on the precipice of seeing
nucleic acid-based skin therapeutics
deployed on a large scale.
the breakthrough topical system required for 8. J Probst, S Brechtel et al, Characterization of the ribonucle-
ase activity on the skin surface, Genet Vaccines Ther 4
the deployment of therapeutic siRNAs and 4 (2006)
miRNAs for skin care applications. 9. J Tabachnick and R Freed, Demonstration of nucleases
on mammalian skin surface and in saline extracts of hair,
Concluding Remarks Nature 190 921–922 (1961)
The liposome-based delivery vehicles 10. G Cevc, Transfersomes, liposomes and other lipid suspen-
sions on the skin: Permeation enhancement, vesicle
described here show considerable promise penetration and transdermal drug delivery, Crit Rev Ther
for overcoming the delivery barrier of the Drug Carrier Syst 13 257–388 (1996)
stratum corneum. As such, the industry is on 11. G Cevc, D Gebauer, J Stieber, A Schatzlein and G Blume,
the precipice of seeing nucleic acid-based skin Ultraflexible vesicles, transfersomes, have an extremely
low pore penetration resistance and transport therapeutic
therapeutics deployed on a large scale. The amounts of insulin across the intact mammalian skin,
technology transfer of these discoveries to an Biochim Biophys Acta 1368 201–215 (1998)
industrial setting will also allow for scale-up 12. G Cevc and G Blume, Lipid vesicles penetrate into intact
design in production, and an evaluation of the skin owing to the transdermal osmotic gradients and hydra-
tion force, Biochim Biophys Acta 1104 226–232 (1992)
economic feasibility of these delivery vehicles
13. E Touitou, N Dayan, L Bergelson, B Godin and M Eliaz,
on a larger scale. Ethosomes—Novel vesicular carriers for enhanced delivery:
If any of these modified liposome carriers Characterization and skin penetration properties, J Control
prove to be economically viable, RNAi-based Release 65 403–418 (2000)
14. E Desmet et al, Characterization data on the topical carrier
skin therapeutics will rapidly be brought
DDC642, Data Brief 7 1204–1210 (2016)
to market. These RNAi topical treatments,
15. E Desmet et al, An elastic liposomal formulation for
whether incorporating siRNAs or miRNAs, are RNAi-based topical treatment of skin disorders: Proof-
likely to usher in a new generation of novel of-concept in the treatment of psoriasis, Int J Pharm 500
268–274 (2016)
approaches to combating skin diseases and
16. B Geusens, J Lambert, SC De Smedt, K Buyens, NN Sand-
disorders; where instead of supplying a thera-
ers and M Van Gele, Ultradeformable cationic liposomes for
peutic compound to repair skin cells, genetic delivery of small interfering RNA (siRNA) into human primary
instructions will be provided to the cells to melanocytes, J Control Release 133 214–220 (2009)
fix themselves. 17. B Geusens et al, Flexible nanosomes (SECosomes) enable
efficient siRNA delivery in cultured primary skin cells and
in the viable epidermis of ex vivo human skin, Advanced
References Functional Materials 20 4077–4090 (2010)
1. A Fire, S Xu, MK Montgomery, SA Kostas, SE Driver and 18. A Ascenso et al, Development, characterization and
CC Mello, Potent and specific genetic interference by skin delivery studies of related ultradeformable vesicles:
double-stranded RNA in Caenorhabditis elegans, Nature Transfersomes, ethosomes and transethosomes, Int J
391 806–811 (1998) Nanomedicine 10 5837–5851 (2015)
2. MK Montgomery and A Fire, Double-stranded RNA as a 19. H Kamada et al, Creation of novel cell-penetrating peptides
mediator in sequence-specific genetic silencing and co- for intracellular drug delivery using systematic phage display
suppression, Trends Genet 14 255–258 (1998) technology originated from TAT transduction domain, Biol
Pharm Bull 30 218–223 (2007)
3. MK Montgomery, S Xu and A Fire, RNA as a target of
double-stranded RNA-mediated genetic interference 20. YC Kim, PJ Ludovice and MR Prausnitz, Transdermal
in Caenorhabditis elegans, Proc Natl Acad Sci USA 95 delivery enhanced by magainin pore-forming peptide, J
15502–15507 (1998) Control Release 122 375–383 (2007)
4. JK Lam, MY Chow, Y Zhang and SW Leung, siRNA vs. 21. JB Rothbard et al, Conjugation of arginine oligomers to
miRNA as therapeutics for gene silencing, Mol Ther Nucleic cyclosporin A facilitates topical delivery and inhibition of
Acids 4:e252 (2015) inflammation, Nat Med 6 1253–1257 (2000)
5. cosmeticsandtoiletries.com/research/biology/Controlling- 22. X Yi, G Zhao et al, MITF-siRNA formulation is a safe
MicroRNAs-to-Fight-Skin-Senescence-367698261.html and effective therapy for human melasma, Mol Ther 19
(Accessed Dec 1, 2017) 362–371 (2011)
6. S Isaacman, M Isaacman and JM Holub, Silencing RNA for 23. M Chen et al, Topical delivery of siRNA into skin
cosmetic effects, Cosm & Toil 128 144–147 (2013) using SPACE-peptide carriers, J Control Release 179
33–41 (2014)
7. D Wu, JS Che, DC Chang and SL Lin, Mir-434-5p mediates
skin whitening and lightening, Clin Cosmet Investig Derma-
tol 1 19–35 (2008)

Advertiser Index | C&T ®
January 2018 | Volume 133, number 1
AAK Personal Care Grant Industries Sabinsa Corp.

3 1 C3
lipid@aak.com info@grantinc.com info@sabinsa.com
www.aakpersonalcare.com www.grantinc.com www.sabinsacosmetics.com
AMA Laboratories, Inc. Innospec Ltd. schülke, Inc.

37 7 26
www.amalabs.com americas-pc@innospecinc.com info@schuelke.com
www.innospecinc.com www.schuelke.com
Arista Industries, Inc.

33
info@aristaindustries.com Lucas Meyer Cosmetics Sytheon Ltd.
11 C3
www.aristaindustries.com info@lucasmeyercosmetics.com info@sytheonltd.com
www.lucasmeyercosmetics.com www.sytheonltd.com
Bio-Botanica, Inc.
C2
www.bio-botanica.com Mibelle AG Biochemistry Welch Holme & Clark
5 15
info@mibellebiochemistry.com Co., Inc.
www.mibellebiochemistry.com www.welch-holme-clark.com
Centerchem, Inc.
C4
cosmetics@centerchem.com
www.centerchem.com MMP, Inc.
40
sales.us@mmp.com
www.mmpinc.com
Dupont Tate & Lyle
21
BioProducts
www.duponttateandlyle.com
CT1801_Advertiser_Index_fcx.indd 72 12/26/17 3:24 PM

Innovation
behind the beauty
Business insights, data and news that empowers beauty
and personal care executives to anticipate the next trend.
www.GCImagazine.com/BEAUTY
GCI2017_HsAd_FullPg_V2.indd 1 1/3/18 10:33 AM

Market Intelligence | C&T ®
KEY POINTS
• The criteria for cosmetics as “affordable
luxuries” have expanded in response to
the demand for a better quality of life.
• Beauty brands can expect to find consumers

increasingly interested in content and products
promoted with a can-do mindset, and where
health and wellness are a whole-self effort.
Following
the #Selfcare
Movement
3 *Editor’s note: Adapted with permission from Global Cosmetic Industry; available at http://bit.ly/2oGzeSP (Accessed Nov 7, 2017)
Ways Brands Can Expand*
Dee Heffernan
Brand Consultant
DE1 | www.CosmeticsandToiletries.com
I t has been said that the beauty care industry is recession-
proof. In fact, nearly every category of the industry has seen
impressive growth over the past 10 years, and the future
outlook is, as always, promising.
Known as the lipstick effect, a term coined in 2001 by
Leonard Lauder, the idea is that even during economic down-
turns, consumers will prioritize “affordable luxuries” that make
them feel good about their appearance—such as haircuts, nail

all or part of this article is strictly prohibited.
Vol. 133, No. 1 | January 2018
CT1801_Mrkt_Rprt_fcx.indd 8 1/3/18 9:32 AM

Allowing consumers to become educated
about your products will elevate your
trust factor.
polish, lipstick and personal care—over other yoga and meditation, which reduce stress and
non-essentials. This concept was proven again improve emotional well-being. Interestingly,
after the 2008 economic crisis when the indus- 74% of all yoga practitioners in 2016 had been
try saw a dip in growth but still managed to eek practicing for less than five years, indicating a
out positive numbers before rebounding fully surge of new yogis. Corporate mindfulness and
in 2010. Since then, the industry has continued mindfulness retreats also have been trend-
to thrive, particularly in the premium sector, ing throughout 2016 and 2017, and show no
indicating a major shift in consumer preference signs of slowing down. To get a feel for these
from cheap, low-cost items to premium-quality conversations surrounding self care, check out
products at varying price points. hashtags related to: #innerbeauty, #naturalb
In other words, the criteria for what makes a eauty, #recharge, #metime, #mindfulness,
product an “affordable luxury” has expanded in #selfcare and #growthmindset. You’ll quickly
response to a widespread demand for an overall find there is real depth to many of these
higher quality of life. Popularly referred to as conversations.
the self-care movement, these mindset shifts To growth with this movement, start by
are changing the very foundation upon which opening up your brand’s website or blog to
beauty brands have traditionally marketed comments, and encourage site visitors to
to their audiences (primarily women), and engage in meaningful conversation. Consider
presents huge opportunities to re-engage, re- creating a private Facebook group where
imagine and re-revitalize the influence beauty consumers can discuss relevant topics openly,
care products have in the health and well-being and where you can act as a source of knowledge
of their users. and guidance around your topics of expertise.
This article briefly explores the rise of the Allowing consumers to connect with each other
#selfcaremovement and offers three tenets and to become more educated about what
beauty and personal care brands should con- they’re putting onto their skin, as well as how
sider to engage mindful consumers in relevant to incorporate better self-care routines, will
and authentic ways. (Hint: the answer has elevate your brand’s equity and trust factor
more to do with boosting their inner glow than and contribute to the self-care movement in a
promoting a perfect look.) meaningful way.
Awaken Their Inner

1 Self Care is a Movement,
Not a Trend 2 Glow
Becoming more self-accepting, authen-
In the wake of rising health costs and persis- tic and grateful—an age-old trio for manifesting
tent instability in the health care and political the good life—all stems from a person’s deliber-
systems, people have been paying increasingly ate efforts to be good to themselves. In an age
close attention to and taking more control of of uncertainty and instability, beauty brands
their whole health. From the food they eat and can expect to find consumers increasingly inter-
the amount they exercise, to the ingredients ested in products and content promoted with a
in their household cleaners and hours of sleep can-do mindset, where health and wellness are
they get in a night, people are making buying a whole-self effort.
decisions based on what’s most likely to keep Understand that self-care is holistic and
them and their loved ones out of the hospital. deeply personal. Pay especially close atten-
Many studies have reported growth across tion to millennial women, and engage them
the board in fitness and fitness tracking, with messaging that validates their courage,
organic food consumption, and activities like authenticity, intelligence and strength. Explore
Vol. 133, No. 1 | January 2018 Cosmetics & Toiletries® | DE2

these topics with an open mind and try not to
Be Real, Albeit Imperfect
“brands-plain” what it means to be a woman,
as growing trends indicate some marketing
fatigue around #femvertising that misses the
3 Finally, brands tend to be too reluc-
tant to share personal details, including
mark. Also, consider having more conversations leadership stories, corporate culture (beyond
on your blog, in podcasts and through videos the “about us” web page) and especially
around topics that serve up information aimed failures. Consumers want authenticity and are
at helping your consumers grow into more tired of hearing about how perfect your brand
confident, self-possessed individuals. is, or how perfect they need to be—and that
Furthermore, be sure to update your buyer your product will somehow perfect them.
personas and inbound sales funnels to consider With the advent of podcasting and the
more than gender, age, socio-economic status charming imperfection inherent in every home-
and locations where your consumers shop. grown effort, imperfection has become not
Writing narratives in the voice of your audience only acceptable, but admirable. The market is
will help crystallize and humanize the reality oversaturated with brand stories that paint the
of a person’s mindsets, beliefs, ambitions and perfect picture of pure, all-knowing expertise.
worries. Take the time to chart out the journey Dig deep to find what is most relevant about
they’re on, identifying places where self-doubt your brand. Underscore the failures, the almost-
and judgement are likely to creep in and then wins, the losses and the breakthroughs, and you
create brand experiences that advocate for their will come away with an authentic, meaningful
truest self to shine. story with which people can connect.
In relation, check out hashtags such as: This is not to say your products can’t be
#helpothers, #growthmindset, #notperfect, gorgeous, or you can’t toil over photos. Rather,
#strongisbeautiful, #lifegoals, #nofilter, consider adding dynamism to your story with
#confidentwoman, #feelconnected, #goodtomy- messaging and imagery that is both creatively
self and #togetherisbetter for inspiration. intentional and intentionally imperfect.
DE3 | www.CosmeticsandToiletries.com Vol. 133, No. 1 | January 2018

HydraSynol DOI ™
The Smart Skin Hydrator, Barrier Builder & More
Smart
Hydrator
Self-tanning
Barrier Builder
Extender
Solubilizer
Product: Green chemistry solution; Cost-effective; Patented – US 8,496,917 & multiple pending patents
Clinical: Multiple clinical studies; Long-lasting & controlled hydration: Moderately dry skin (+35% hydration)
& Severely dry skin (+133% hydration); Synergistic with glycerol; Intelligently, transports water where it is
needed; Restore & enhances skin’s internal hydration network; Boosts self-tanning effects in glow products
SYTHEON LTD. • 315 Wootton Street, Boonton, NJ 07005 • www.sytheonltd.com • info@sytheonltd.com • Tel.: +1 973.988.1075
SYTHEON SARL • 112 rue de Paris, 92100 Boulogne Billancourt • www.sytheonltd.com • sytheon@sytheonltd.com • Tel.: +33 (0)1.4110.8182

20 Glover Avenue P: 203-822-9800
Norwalk, CT 06850 F: 203-822-9820
www.centerchem.com
CT16_ad_template.indd 1 12/19/17 11:49 AM

Cosmeticsandtoiletries201801 DL

Caricato da

Informazioni sul documento

Titolo originale

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

Cosmeticsandtoiletries201801 DL

Caricato da

Copyright:

Formati disponibili

20 Glover Avenue P: 203-822-9800

Norwalk, CT 06850 F: 203-822-9820

CT16_ad_template.indd 1 12/19/17 11:49 AM

Blue Light Rewriting

COLD STRESS DAMAGE

CT1801_Covers_fcx.indd 1 12/26/17 11:46 AM

A blend of Science, Innovation and Creativity

CT16_ad_template.indd 1 9/12/17 3:38 PM

6 Editor’s Note: Testing the

8 Industry Insight: Probing Deeper to

8 [podcast] Probing Deeper to Further

DE1 Following the #Selfcaremovement

CT1801_TOC_Masthead_fcx.indd 2 12/26/17 4:35 PM

Discover more at aakpersonalcare.com Technologically advanced innovations with shea

CT1710_AAK_Advertorial.indd 1 9/18/17 5:28 PM

2017 FOLIO: Award Winner

Emollient Profiling Accelerates Speed to Market CORPORATE

OTHER ALLURED PRODUCTS

Copyright 2018: Reproduction in whole or in part without permission is strictly prohibited.

CT1801_TOC_Masthead_fcx.indd 4 12/28/17 11:34 AM

For a dense, sexy

For a dense, sexy

and happy skin

and happy skin

Densorphin™ is a novel firming and lifting ingredient to combat hormone-

induced skin aging. Densorphin™ is based on an extract of

a clear improvement of skin elasticity and skin density.

• Increases the skin density after just one month

menopause and andropause skin.

CT16_ad_template.indd 1 12/18/17 3:16 PM

Testing the Comfort Zone

6 | www.CosmeticsandToiletries.com Vol. 133, No. 1 | January 2018

CT1801_Editors_Note_fcx.indd 6 12/26/17 1:06 PM

Iselux® Is Also Offered in Liquid Versions That

Optimized blend delivers high levels of oils

Iselux® Extremely mild, tear-free concentrate for

Iselux® is the surfactant that combines

Contact INNOSPEC to Add Iselux®

CT16_ad_template.indd 1 12/19/17 3:40 PM

Probing Deeper to Further

Zoe Diana Draelos, M.D.

C&T: What insights can you share from your work?

Peter Tsolis C&T: How is this technique an improve-

Russel Walters, Ph.D.

8 | www.CosmeticsandToiletries.com Vol. 133, No. 1 | January 2018

CT1801_Industry_Insight_fcx.indd 8 12/28/17 9:16 AM

Photo Credit: Koel Colours

Sensory Modifier Sustainable Biotech

Photo Credit: Givaudan Active Beauty

Vol. 133, No. 1 | January 2018 Cosmetics & Toiletries® |9

CT1801_Tech_Launches_fcx.indd 9 12/28/17 3:52 PM

Moisturizers & Barrier Care

10 | www.CosmeticsandToiletries.com Vol. 133, No. 1 | January 2018

CT1801_Roundup_fcx.indd 10 12/26/17 1:41 PM

NEW CLINICAL RESULT AT ONLY 2%

Stimulates the natural skin defense MelinOIL™ doubles the

TANNING EFFECT AFTER UVB IRRADIATION UP TO

pigmentation photoaging sun erythema 10

SOAK UP THE SUN WITH SERENITY!

CT16_ad_template.indd 1 12/18/17 3:11 PM

• Results confirm blue light induces cutaneous

Reproduction in English or any other language of

CT1801_Research_Mendrok-Edinger_fcx.indd 12 12/26/17 1:55 PM