Sei sulla pagina 1di 24

5 LA HERENCIA BIOLÓGICA

n e m á s p reguntas
tie
La ciencia stas...
que respue

LA VIDA
OTA
E N U NA G
1. Competencias clave . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 126

2. Competencias científicas de PISA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127

3. Recursos digitales. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127


l
7), A. Nicco
Gattaca (199
4. Programación de aula y orientaciones didácticas . . . . . . . . . . . . . . . . . . . . . . . . . . . 128

5. Banco de actividades. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132


3.
ería éti co
Actividades de refuerzo. . . . . . . . . . . . .2... . . . . . n. . lo . . . . . . . . . . . . . . . r. . . . . . . . 132
. . . . . . . . . . . . . ¿S
s odifica
1. ¿Qué so poder m
zan
¿Qué anali porcentaje
s
los genes . . . .
Actividades de consolidación
sa c an .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .r
e . . . . . . . 133
cuando que lee la para obten
ta d e ? on
una go enfermera personas . . . . c
Actividades de ampliación
sangre del
pie. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .ic as . . . . . . . 134
característ
del beb é ?
elegidas?
Mapa conceptual. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 135

6. Evaluación. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 136

7. Solucionario. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 138

Solucionario del libro del alumno. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 138

Solucionario de la propuesta didáctica: banco de actividades .. . . . . . . . . . . 143

Solucionario de la evaluación. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14514/04/16


BG4 U05 2015.indd 100 16.38

37-232 PD BG4 CAST Cap3_2016.indd 125 10/05/16 12.11


Unidad 5 • La herencia biológica

1 Competencias clave

La ciencia tiene más preguntas que CD: Trabajar con un documento colgado en la Red.
respuestas…: CA: Plantearse preguntas.
Formulamos hipótesis. CL: Elaborar respuestas.
Me sitúo CC: Comprender la ciencia a partir del cine.
¿Lo recuerdo?: CA: Plantearse preguntas.
Evaluación inicial. CL: Elaborar respuestas.
CC: Comprender textos literarios.
1. La herencia de los caracteres biológicos CL: Comprender diferentes tipologías textuales y redactar
respuestas.
2. Las leyes de la herencia
CS: Reflexionar de forma crítica sobre hechos y problemas sociales.
3. La teoría cromosómica de la herencia CI: Hacer predicciones y realizar esquemas.
4. Cálculo de probabilidades aplicado a la genética CA: Plantearse preguntas y realizar esquemas.
CD: Usar las TIC para obtener y procesar información.
5. La herencia del sexo
Contenidos 6. La herencia ligada al sexo
7. La herencia de los grupos sanguíneos
8. La genética molecular
9. Las mutaciones
10. Los aspectos preventivos: el diagnóstico prenatal
11. La biotecnología
Practica: Proyecto Genoma Humano CS: Reflexionar de forma crítica sobre hechos y problemas sociales.
La clonación terapéutica y la clonación reproductiva CL: Comprender diferentes tipologías textuales (científica,
Transgénicos, ¿a favor o en contra? periodística, etc.) y redactar respuestas.
Investiga tus Aprendo a investigar: ¿Se puede averiguar la CA: Planificar las fases de un experimento.
competencias dominancia de algunos caracteres mediante la CI: Llevar a cabo una investigación de planteamiento propio
simple observación? siguiendo el método científico.
Evalúa: Los clones del ternero CA: Aprender a realizar evaluaciones.
CL: Comprender textos científicos y redactar respuestas.

Competencias y actividades: ¿LO TENGO CLARO? y ¿LO SÉ APLICAR?

Actividad Nivel Competencias clave Actividad Nivel Competencias clave


1 B CL 20 B
2 B 21 B
3 B 22 B
4 B 23 B
5 B 24 B
6 B 25 B
7 B CL 26 B
8 B 27 B
9 R CL 28 B
10 B 29 B
11 A CL 30 A
12 B 31 B CL
13 B CL 32 B
14 B CA 33 B
15 B CA 34 B CL
16 B 35 B CS
17 B 36 B CS
18 B 37 A CL
19 B 38 B CL

B: básica. A: avanzada. R: reto.

126

37-232 PD BG4 CAST Cap3_2016.indd 126 10/05/16 12.11


Unidad 5 • La herencia biológica

Actividad Nivel Competencias clave Actividad Nivel Competencias clave


39 B 50 A
40 B CL 51 B
41 B 52 B
42 B 53 A
43 A 54 A
44 B 55 B
45 B 56 B
46 B 57 B
47 A 58 B
48 B 59 B
49 B B: básica. A: avanzada. R: reto.

2 Competencias científicas de PISA

Contexto Procesos mentales


Categoría implicados en la
Situación Área de contenido resolución de preguntas
Practica: Proyecto Genoma Humano Sistemas vivos:
células (ADN)
La clonación terapéutica y la clonación
Global Salud
reproductiva Identificar cuestiones
Sistemas vivos:
Transgénicos, ¿a favor o en contra? seres humanos científicas
Aprendo a investigar: ¿Se puede  xplicar fenómenos
E
averiguar la dominancia de algunos Sistemas vivos: Fronteras de la ciencia científicamente
Personal
caracteres mediante la simple seres humanos y la tecnología
 tilizar pruebas
U
observación?
científicas
Sistemas Fronteras de la ciencia
Evalúa: Los clones del ternero Social
tecnológicos y la tecnología

3 Recursos digitales
Libro del alumno
en formato
impreso
La teoría cromosómica de la herencia. Editorial Casals
Descripción: animación que ayuda a entender la recombinación de cromosomas homólogos.
110
Finalidad: visualizar la recombinación de cromosomas homólogos y comprender qué genera
variabilidad genética.
La ciencia tiene más preguntas que respuestas…
Descripción: fragmento de la película Gattaca, en la cual los médicos analizan una gota de sangre
100
de un recién nacido para pronosticar la probabilidad de que desarrolle diversas características.
Finalidad: cuestionar si la manipulación genética es algo bueno o malo, y crear un debate al respecto.
El experimento de Mendel
Descripción: fragmento de un documental de National Geographic sobre el trabajo desarrollado
106
por Mendel con los guisantes.
Finalidad: comprender mejor cómo fue su trabajo y la importancia de sus resultados.
Duplicación del ADN
Descripción: fragmento de un documental sobre la duplicación del ADN. 114
Finalidad: entender mejor y de una manera mucho más visual la duplicación del ADN.
Tabla de caracteres dominantes y recesivos. Editorial Casals
Descripción: tabla con los caracteres dominantes y recesivos para distintos rasgos humanos. 124
Finalidad: realizar la actividad propuesta en el apartado «Aprendo a investigar».

127

37-232 PD BG4 CAST Cap3_2016.indd 127 10/05/16 12.11


Evaluación*

128
Competencias
Sesión Objetivos Contenidos Actividades Criterios de Estándares de
Bloque clave**
evaluación aprendizaje
S1 1. Formular hipótesis sobre un hecho biológico o Formulación de hipótesis 1, 2, 3 1 12, 13 14.1 CD, CA, CL,
geológico a partir de un vídeo. CC
2. Constatar conocimientos previos sobre la unidad. Evaluación inicial 1, 2, 3, 4, 5 1 12, 13, 14 14.1 CA, CL, CC

37-232 PD BG4 CAST Cap3_2016.indd 128


S2 3. Comprender el significado de gen, genoma, La herencia de los caracteres 1, 2, 3, 4, 5, 38 1 7 7.1 CL, CS, CI, CA,
S3 herencia biológica, especie, carácter biológico, biológicos CD
S4 cuantitativo, cualitativo, hereditario y adquirido.
S5
4. Comprender cómo se heredan los genes y qué Las leyes de la herencia 6, 7, 8, 9, 10, 11, 1 9 9.1
interviene en su herencia. 12, 13, 14, 15, 39,
5. Entender las leyes de Mendel y saber aplicarlo a 40, 41, 42, 43, 44,
casos prácticos. 45, 54
6. Entender el concepto de cromosomas homólogos La teoría cromosómica de la herencia 17, 18 1 6, 7 6.1, 7.1
Unidad 5 • La herencia biológica

y recombinación genética.
7. Usar las matemáticas para calcular probabilidades Cálculo de probabilidades aplicado a 19, 20, 51, 52, 1 9, 10 9.1, 10.1
y comprender que también forman parte de la la genética 53, 57
biología.
8. Entender que el hecho de ser hombre o mujer La herencia del sexo 20, 21, 22, 46, 49 1 10 10.1
viene determinado por los genes X e Y.
9. Entender que hay caracteres que van ligados a La herencia ligada al sexo 23, 24, 47, 48, 49, 1 10, 11 10.1, 11.1
estos genes, y que solo se pueden tener si se es 55, 56, 58
hombre o si se es mujer.
10. Comprender que los grupos sanguíneos se La herencia de los grupos sanguíneos 25, 59 1 10, 11 10.1, 11.1
heredan.
11. Ser capaz de explicar la duplicación del ADN. La genética molecular 1 5, 6, 7 5.1, 6.1, 7.1
12. Entender qué es una mutación y saber qué tipos Las mutaciones 1 8 8.1
existen.
4 Programación de aula y orientaciones didácticas

13. Ver qué medidas se pueden tomar para evitar Los aspectos preventivos: el 1 11 11.1
tener un hijo con problemas genéticos. diagnóstico prenatal
14. Saber las aplicaciones de la ingeniería genética. La biotecnología 1 12,13, 14 12.1, 13.1,
y 15 14.1, 15.1
S6 Investiga tus competencias Práctica: Proyecto Genoma Humano 1 14 14.1 CS, CL
La clonación terapéutica y la clonación 1, 2, 3
reproductiva
Transgénicos, ¿a favor o en contra? 1, 2, 3, 4
S7 Aprendo a investigar: ¿Se puede 1, 2, 3 1 9 9.1 CA, CI
averiguar la dominancia de algunos 1, 2, 3, 4, 5
caracteres mediante la simple
observación?
S8 Evalúa: Los clones del ternero 1, 2, 3, 4, 5, 6 1 13 13.1 CA, CL

* La numeración de los criterios de evaluación y la de los estándares de aprendizaje se corresponde con el apartado 2, «Programaciones», de esta propuesta didáctica.
** Las competencias clave de cada apartado están desarrolladas en el apartado 3, «Desarrollo de las unidades», de esta propuesta didáctica.

10/05/16 12.11
Unidad 5 • La herencia biológica

Orientaciones didácticas

Este es un tema que genera mucha curiosidad en los alumnos, ya que les afecta de una manera directa. Ellos son
como son porque han heredado genes paternos y maternos, y estos han dado un resultado fenotípico, que es el
que ven de sí mismos. Muchos de los contenidos de la unidad no se han trabajado nunca, por eso es necesario
plantear el tema de un modo acertado. Una buena manera puede ser con el vídeo que se propone al principio de
la unidad. Es un fragmento de la película Gattaca. A partir de ese fragmento se puede empezar un debate en el
que se discuta si la manipulación genética es buena o mala y empezar a generar interés para saber cómo funciona
el mundo de la genética. A continuación, se leerá en clase la lectura del apartado «¿Lo recuerdo?» y se continuará
con el debate iniciado con la visualización del vídeo. Después responderán las preguntas relacionadas y así podre-
mos comprobar qué saben acerca de los contenidos de esta unidad.
Debemos ser muy cuidadosos y respetuosos al tratar estos temas, ya que afectan directamente a los alumnos y
sus relaciones familiares.

La herencia de los caracteres biológicos


Se puede empezar con una pregunta abierta sobre en qué se parecen a algunos miembros de la familia, y por qué
creen ellos que es así. A partir de este punto, se trabajarán las definiciones de gen, genoma, herencia biológica,
especie, carácter biológico, cuantitativo, cualitativo, hereditario y adquirido. Este contexto nos permite enlazar
unas definiciones con otras e introducir el tema. Para consolidar los conceptos, realizar las actividades 1 a 5.

Las leyes de la herencia


Trabajar la ley de la uniformidad a partir del ejemplo de Mendel, y explicarlo a través de sus experimentos con los
guisantes. Explicar que cuando se juntan dos razas puras la generación que sale va a ser toda igual y demostrarlo.
Explicar la diferencia entre herencia dominante, recesiva y herencia intermedia. Después, tomar como ejemplo el
experimento de Mendel y demostrar la F1, y realizar las actividades de la 6 a la 12.
Plantear qué pasaría si esta primera generación se cruzara entre sí, siguiendo el mismo razonamiento que hizo
Mendel, y así llegar a los mismos resultados.
Intentar elaborar una tabla con las conclusiones a las que la clase ha llegado y después compararla con la tabla
de conclusiones de la página 107. Así, los alumnos podrán tener la experiencia de llegar a unas conclusiones
analizando los resultados que han conseguido. Para consolidar los conceptos, realizar las actividades 13 y 14.
Por último, se explicará la ley de la independencia y se demostrará la proporción 9:3:3:1.
Se recomienda visualizar el vídeo de la página 106 sobre los experimentos de Mendel tras la explicación de las
tres leyes que llevan su nombre, aunque también se puede usar como introducción al tema. Para consolidar los
conceptos, realizar las actividades 15, 16 y 42.

La teoría cromosómica de la herencia


Trabajar los conceptos de cromosomas homólogos y de recombinación genética con la animación de la página
110, y a partir de aquí entender que los genes se heredan de manera independiente siempre y cuanto estén
alejados el uno del otro o estén situados en distintos cromosomas. Para consolidar los conceptos, realizar las
actividades 17 y 18.

Cálculo de probabilidad aplicado a la genética


Se puede hacer un juego a partir del ejemplo, leerlo y realizar la actividad número 19. Después, calcular la probabi-
lidad de tener hijos, por ejemplo, con ojos de color azul con el compañero de al lado. Se puede hacer con distintos
casos: pelo negro, rizado, rubio, ojos verdes, marrones, y consolidar un poco la idea de probabilidad que hay de
heredar un carácter en concreto. Para consolidar los conceptos, realizar las actividades 51, 52, 53 y 57.

129

37-232 PD BG4 CAST Cap3_2016.indd 129 10/05/16 12.11


Unidad 5 • La herencia biológica

La herencia del sexo


Siguiendo con el mismo contexto planteado al inicio de la unidad, podemos preguntar qué determina el sexo de un
embrión y qué relación tiene este hecho con la genética. A continuación, explicar que hay 23 parejas de cromoso-
mas y que todas son iguales, pero hay una de ellas que es distinta, que es en la que se define el sexo. Podemos
volver a trabajar el apartado 4, planteando qué probabilidades tienen un padre y una madre de tener un niño o una
niña. Realizar y corregir en clase las actividades 20, 21 y 22.

La herencia ligada al sexo


A partir de lo explicado en el apartado anterior, explicar que hay enfermedades que tienen diferentes probabilida-
des de aparecer en un sexo que en el otro, debido a que solo están presentes en el cromosoma X o en el cromo-
soma Y, como la hemofilia y el daltonismo. Realizar y corregir en clase las actividades 23 y 24.

La herencia de los grupos sanguíneos


Se explicará que los grupos sanguíneos también se heredan y que, dependiendo del grupo sanguíneo que tengan
nuestros padres, nosotros tendremos uno u otro. Podemos pedir que pregunten a los padres su grupo sanguíneo,
y ver de qué grupo sanguíneo son ellos. En casa realizarán las actividades 25 y 59.

La genética molecular
Se puede empezar visualizando el vídeo de la página 114 y explicar el mecanismo de duplicación del ADN. Des-
pués, explicar cómo se sintetizan las proteínas. Realizar y corregir en clase la actividad 26.

Las mutaciones
Se puede empezar el apartado preguntando qué es una mutación y si conocen ejemplos. A partir de sus respues-
tas, hacer la exposición teórica y explicar los tipos de mutaciones que existen. Podemos poner en la clasificación
los ejemplos que ellos hayan dado en clase. Hacer y corregir en clase la actividad 27. Se recomienda realizar las
actividades 28, 29 y 30, ya que reforzarán los conceptos del apartado 8.2, que se deben practicar para poder
afianzar los conocimientos.

Los agentes preventivos: el diagnóstico prenatal


Relacionaremos la genética con la medicina para que vean la importancia de las pruebas prenatales, ya que pue-
den detectar enfermedades genéticas graves.

La biotecnología
Es un apartado que puede dar mucho de sí, y al que se pueden dedicar varias clases. E incluso pueden elaborar
pequeños proyectos relacionados. Leerán en casa las páginas 118 y 119 y les pediremos que realicen las activida-
des 34 a 37, que corregiremos en clase. A partir de las respuestas se explicarán los contenidos haciendo hincapié
en las implicaciones éticas del tema.
Se puede iniciar un debate moderado sobre la lectura de la sección «Practica», de la página 123, en la que unos
grupos defenderán una postura y el resto, la otra. En casa realizarán las actividades relacionadas con la lectura.

130

37-232 PD BG4 CAST Cap3_2016.indd 130 10/05/16 12.11


Unidad 5 • La herencia biológica

El «Banco de actividades» servirá para consolidar los conocimientos adquiridos en la unidad. Se pueden alternar
con las de los diferentes apartados de la unidad para realizar en casa o en clase.
En el apartado «Practica», de «Investiga tus competencias», se ofrecen dos lecturas sobre el genoma humano y la
clonación con actividades asociadas, similares a las de las prueba PISA.
En el apartado «Aprendo a investigar», los alumnos realizarán una práctica para trabajar los conceptos de carac-
teres dominantes y recesivos.
Finalmente, podrán realizar la adaptación de una prueba PISA en el apartado «Evalúa», con la que trabajarán la
lectura sobre la clonación. Podrán poner en práctica los conocimientos adquiridos en esta unidad.

131

37-232 PD BG4 CAST Cap3_2016.indd 131 10/05/16 12.11


Unidad 5 • La herencia biológica

5 Banco de actividades

Refuerzo

1. En el siguiente esquema se muestra el fenotipo (ne- Los dos factores que informan sobre
gro o blanco) de la herencia de un determinado ca- un mismo carácter se separan durante la formación
rácter encontrado en el cruce entre dos individuos de los y cada uno va a parar a un ga-
de diferentes razas puras. Indica: meto diferente. Después, mediante la ,
a Si se trata de una herencia dominante, codomi- se combinan para dar lugar a la información bioló-
nante o intermedia y el porqué. gica de los descendientes.
b Utilizando las letras M y m, indica el genotipo de Los factores hereditarios no antagónicos se here-
cada uno de los individuos. dan unos de los otros.

4. Relaciona los siguientes términos con su definición.


1. Heterocigótico
2. Genotipo
3. Dominante
4. Recesivo
5. Fenotipo
A. Individuo que no tiene los dos factores heredita-
rios para un carácter iguales.
B. Carácter hereditario que no se manifiesta en el
fenotipo de un individuo, pero que puede trans-
mitir a su descendencia.
2. Clasifica las siguientes fases según pertenezcan al C. Carácter hereditario que se manifiesta en el feno-
proceso de duplicación, al de transcripción o al de tipo.
traducción: D. Conjunto de genes de un individuo.
E. Características que manifiesta un individuo.
A. La doble cadena de nucleótidos se separa.
B. Se sintetiza una molécula de ARN mensajero.
5. ¿Cuál es la probabilidad de que una mujer y un
C. La cadena de ADN sirve de molde.
hombre de aspecto normal, pero ambos portado-
D. Se utilizan nucleótidos de uracilo.
res del gen recesivo del albinismo, tengan un hijo
E. Los ribosomas leen los tripletes de nucleótidos
albino?
del ARN mensajero.
Editorial Casals, S. A. • Material fotocopiable

F. El ARN de transferencia transporta aminoácidos


6. Relaciona cada término con su definición.
hacia los ribosomas.
G. Las nuevas cadenas también adoptan la estruc- 1. Mutación puntual
tura de doble hélice. 2. Mutación cromosómica
3. Mutación genómica
3. Completa el siguiente texto, en el que se definen las A. Alteración en la secuencia de genes de un cro-
leyes de Mendel. Después, identifica a cuál corres- mosoma.
ponde cada una. B. Alteración en el número de cromosomas de un
 Cuando se cruzan dos razas , toda individuo.
la descendencia es uniforme, ya sea mostrando C. 
Alteración de la secuencia de nucleótidos del
una de las dos características o una característica ADN.
.

132

37-232 PD BG4 CAST Cap3_2016.indd 132 10/05/16 12.11


Unidad 5 • La herencia biológica

Consolidación

1. En el siguiente esquema se adjunta el fenotipo de la b Un gen es cada uno de los aspectos anatómicos
herencia del carácter color (blanco o negro) y del ca- y fisiológicos heredables que se pueden distin-
rácter forma (cuadrada o rectangular) en el cruce en- guir en una especie.
tre dos individuos de diferentes razas puras. Indica: c Los caracteres que se manifiestan por medio de
a El genotipo de cada uno de los individuos, utili- rasgos claramente diferenciados se llaman ca-
zando la letra B para el carácter color y la letra C racteres cuantitativos.
para el carácter forma. d Los caracteres que no están determinados por la
b La proporción que habrá entre los cuatro tipos información genética contenida en las células se
de fenotipos encontrados en F2. llaman caracteres cualitativos.

5. ¿Qué probabilidad hay de obtener guisantes de se-


millas amarillas rugosas a partir del cruce entre una
planta de semillas amarillas híbridas y lisas homo-
cigóticas con una planta nacida de semillas verdes
y lisas heterocigóticas? Recuerda que el carácter
amarillo es dominante sobre el verde, y el carácter
liso lo es sobre el rugoso.

6. ¿Cómo será la descendencia de un hombre de gru-


po A heterocigoto y una mujer de grupo AB? ¿Qué
probabilidad hay de que tengan un hijo del grupo 0?

2. Ordena las siguientes frases para obtener una ex- 7. Si una mujer daltónica tiene un hijo con un hombre
plicación de la síntesis de una proteína. daltónico, ¿cuál es la probabilidad de que el niño no
A. El ARNm se une a un ribosoma, donde por cada presente daltonismo? Razona tu respuesta.
tres nucleótidos seguidos (triplete) se añade un
aminoácido. 8. Relaciona cada término con su definición.
B. La hebra de ADN que contiene el gen que codifi-
1. Biotecnología
ca dicha proteína sirve de molde para la síntesis
2. Ingeniería genética
de una molécula de ARNm.
3. Especie transgénica
C. Este aminoácido es aportado por un ARNt.
4. Clonación
D. La síntesis finaliza cuando se llega a un triplete
de parada. A. Obtención de un nuevo individuo con la informa-
Editorial Casals, S. A. • Material fotocopiable

E. Para sintetizar una proteína, en primer lugar, se ción genética de otro ya existente.
separan las dos hebras del ADN. B. Transferencia de genes de una especie a otra o
de un individuo a otro de la misma especie.
3. A partir de esta secuencia de ADN escribe el ARN C. Conjunto de técnicas que se aplican a los pro-
mensajero y la proteína resultantes. cesos en los que intervienen seres vivos para
ADN ... 3’ GACGTTATTCACTTAGGCAGGACT 5’... obtener productos nuevos o bien individuos mo-
dificados genéticamente.
4. Indica si las siguientes frases son verdaderas o fal- D. Organismo modificado genéticamente.
sas; en este último caso, corrígelas.
a El conjunto de individuos que se pueden repro- 9. Si se pudiese cruzar un individuo con su clon, ¿serían
ducir entre sí y tener una descendencia fértil se los descendientes genéticamente idénticos a los pro-
llama especie. genitores? ¿Por qué no se pueden cruzar dos clones?

133

37-232 PD BG4 CAST Cap3_2016.indd 133 10/05/16 12.11


Unidad 5 • La herencia biológica

Ampliación

1. Los rasgos diferenciales de los rostros nos resul- c En otra ocasión, la alteración es que se pierde la
tan relativamente fáciles de establecer, puesto que primera T. ¿Cuáles serán ahora los tripletes?
constantemente estamos observando las caras de
las personas, pero no pasa lo mismo cuando se 4. Existen tres tipos de mutaciones en función de la
trata de identificarlas a través, por ejemplo, de las cantidad de material genético afectado: las muta-
manos, y más difícil es distinguir los individuos de ciones puntuales, las mutaciones cromosómicas y
otras especies animales o vegetales. las mutaciones genómicas, que pueden dar lugar a
a Observa diez manos derechas de diez compañe- diferentes enfermedades. Busca información sobre
ros o compañeras, fíjate en la forma de las uñas, ellas y explica alguna enfermedad provocada por
la presencia o no de pelos en el dorso, en las for- cada uno de los tres tipos.
mas de los pliegues palmares, etc. Haz un dibujo
de cada una de ellas, anota sus rasgos más ca- 5. Busca información sobre la amniocentesis y realiza
racterísticos e indica su nombre. Después, para un pequeño informe o una presentación en Power-
comprobar tu capacidad de observación, intenta Point sobre ella. Los puntos que se deben tratar
identificar a dos o tres personas, sin mirarlas, a son: qué es, en qué consiste, en qué casos está in-
partir de sus manos. dicada, cuándo se realiza, cómo se practica y qué
b Observa un grupo de palomas, de periquitos o riesgos presenta.
de gaviotas, o de peces de acuario de la misma
especie, intenta descubrir qué rasgos caracterís- 6. ¿Pueden ser peligrosas las especies transgénicas
ticos tiene cada individuo y anótalos. Invéntate para el equilibrio ecológico? ¿Por qué?
algún nombre para cada uno de ellos. Al cabo
de unos días, con la ayuda de tus apuntes, com- 7. El mes de enero de 2011 se publicaron dos noticias
prueba si eres capaz de identificarlos. sobre el cultivo de maíz transgénico en España. Una
decía que, según los datos del Ministerio de Medio
2. Un jardinero ha encontrado una extraña variedad Ambiente y Medio Rural y Marino, «la superficie cul-
de flor de color rosa. Esta flor es heterocigótica tivada de maíz transgénico en el Estado español
para el carácter color de los pétalos. El jardinero había disminuido desde 79 269 ha en el año 2008
quiere obtener una flor roja a partir de dos flores hasta 67 726 ha en el 2010, es decir, un 15%». En
rosas. otra noticia se decía que el 93% de los agricultores
a ¿Cuál es la probabilidad de que en F1 se obten- que habían cultivado maíz transgénico en España
gan flores de color rojo? en 2010 «lo volverá a hacer en 2011» y que nin-
b Si además el jardinero quiere que las flores sean gún encuestado había tenido ningún problema a
moteadas, siendo el carácter patrón moteado la hora de vender su cosecha y que tampoco se
Editorial Casals, S. A. • Material fotocopiable

recesivo, y siendo las flores de la generación P había registrado ningún problema de coexistencia
carentes de patrón moteado y heterocigóticas con los cultivos convencionales. Consulta Internet
para él, ¿cuál es la probabilidad de que en F1 las y comenta cómo está la situación de los cultivos
flores sean rojas y además moteadas? de alimentos transgénicos en España, en Europa y
en el mundo, las causas de estas diferencias y tu
3. En una célula de la piel, un gen presenta la secuen- opinión sobre ello.
cia 5’-ATACCATCGTGCAGA-3’. Responde las si-
guientes preguntas: 8. Hay caracteres que tienden a heredarse de manera
a ¿Cuáles serán los tripletes de dicha secuencia? conjunta. Busca información y explica por qué su-
b Debido a una insolación excesiva, la primera T cede y cómo se llama este fenómeno.
es sustituida por una C. ¿Cuáles serán ahora los
tripletes?

134

37-232 PD BG4 CAST Cap3_2016.indd 134 10/05/16 12.11


Unidad 5 • La herencia biológica

9. Repasa las leyes de Mendel. 11. Has estudiado que el gen que caracteriza el co-
a ¿Qué resultado permitió a Mendel descubrir lor de ojos marrón es dominante, mientras que
que al menos había dos informaciones para el azul y el verde son recesivos. ¿Cómo explicas
cada carácter? entonces que existan diferentes tonalidades de
b ¿Qué resultado le permitió descubrir que los color marrón, azul o verde, o que incluso encon-
distintos caracteres –por ejemplo, el color y la tremos ojos que según cómo les dé la luz parez-
forma de las semillas– se heredan indepen- can de un color u otro?
dientemente?

10. La herencia de los grupos sanguíneos es un tipo


de herencia codominante. Busca información y
explica qué significa este término. ¿Qué diferen-
cia hay con la herencia intermedia?

Editorial Casals, S. A. • Material fotocopiable

135

37-232 PD BG4 CAST Cap3_2016.indd 135 10/05/16 12.11


Unidad 5 • La herencia biológica

Mapa conceptual

Completa este mapa conceptual con los siguientes términos: fenotipo, ADN, genes, Mendel, genotipo, ley de la
segregación, dominantes, ley de la uniformidad, codominantes y ley de la independencia.

LA HERENCIA BIOLÓGICA

es la herencia de los

son pueden se heredan siguiendo el conjunto de genes el conjunto de características


segmentos de ser las leyes de se denomina que manifiesta un individuo
se llama

Recesivos

que son

Cuando se cruzan dos Los factores antagónicos se mantienen Los factores no antagónicos
razas puras, toda la separados y se reparten al azar se heredan de forma
descendencia es uniforme. entre los descendientes. independiente unos de otros.
Editorial Casals, S. A. • Material fotocopiable

136

37-232 PD BG4 CAST Cap3_2016.indd 136 10/05/16 12.11


Unidad 5 • La herencia biológica

6 Evaluación

1. ¿Qué es un gen? 6. Un alelo es:


a Una sección de un cromosoma con informa- a Un sinónimo de gen
ción genética. b Un homocigoto
b Cada una de las informaciones para un deter- c Un heterocigoto
minado carácter. d Una de las posibles formas de un gen
c Lo que determina las características físicas de
cada organismo. 7. ¿Qué diferencia hay entre fenotipo y genotipo?
d Un trozo de ADN. a Fenotipo es la manifestación de un carácter y
genotipo es el conjunto de alelos del organis-
2. Decimos que dos individuos son de la misma es- mo.
pecie cuando… b Genotipo es la manifestación de un carácter y
a Se pueden reproducir entre sí y tener descen- fenotipo son todos los alelos del organismo.
dencia fértil. c Fenotipo son todos los alelos que no se mani-
b Son iguales entre sí. fiestan y genotipo son todos los alelos que se
c Se pueden reproducir. manifiestan.
d Son iguales entre sí y se pueden reproducir. d Fenotipo es el caso en que ambos alelos son
iguales y genotipo en el que son diferentes.
3. Si un organismo tiene dos alelos iguales para
un mismo gen, que suelen estar enmascarados 8. Saber montar en bicicleta es...
por otro tipo de alelo, decimos que el organismo a Un carácter cualitativo, que por lo tanto no se
es... hereda.
a Heterocigoto b Un carácter cualitativo, que por lo tanto se he-
b Homocigoto dominante reda.
c Homocigoto recesivo c Un carácter adquirido, que por lo tanto se he-
d Genéticamente defectuoso reda.
d Un carácter adquirido, que por lo tanto no se
4. ¿Cómo se espera que sea la descendencia de hereda.
un animal alto heterocigoto (Bb) que se aparea
con un homocigoto recesivo (bb)? 9. La ley de la uniformidad propuesta por Mendel
a Cuatro hijos altos dice que…
b Tres hijos altos y uno bajo a Al cruzar dos razas puras para un determinado
c Dos hijos altos y dos bajos carácter, todos los descendientes tienen una
d Cuatro hijos bajos mezcla de los caracteres de los padres.
Editorial Casals, S. A. • Material fotocopiable

b Al cruzar dos razas puras para un determinado


5. Respecto a los padres de un niño enano (ee) po- carácter, todos los descendientes son iguales
demos decir que… entre sí.
a Ninguno es portador de enanismo. c Al cruzar dos razas puras para un determinado
b Un progenitor puede ser portador, pero el otro carácter sale una descendencia igual a los pa-
puede no serlo. dres.
c Ambos tienen que ser enanos. d Al cruzar dos razas puras para un determinado
d Ambos son portadores de enanismo. carácter, la mitad es igual a un progenitor y la
otra mitad igual al otro progenitor.

137

37-232 PD BG4 CAST Cap3_2016.indd 137 10/05/16 12.11


Unidad 5 • La herencia biológica

10. Herencia intermedia significa que… 16. En una pareja en que tanto el hombre como la
a Se heredan la mitad de las características de mujer son del grupo sanguíneo B, ¿cuál es la
un progenitor y la otra mitad de las del otro. probabilidad de que tengan un hijo del grupo 0?
b 
Se heredan unas características intermedias a Ninguna
entre las de los progenitores. b 25%
c No se heredan las características opuestas. c 50%
d Al cruzar un ratón blanco con uno negro sale d Falta información para determinarlo.
uno gris.
17. Un hombre, cuyo padre era hemofílico (herencia
11. Si el genotipo para un determinado carácter pre- ligada al sexo), no tiene problemas de coagula-
senta un alelo dominante y un alelo recesivo, el ción sanguínea. Su pareja es una mujer normal
fenotipo será: y sin antecedentes familiares de esta anomalía.
a Dominante ¿Cuál es la probabilidad de tener descendientes
b Recesivo con la anomalía?
c Ninguno de los dos a Ninguna
d El dominante y un poco del recesivo b 25%
c 50%
12. La idea de que los diferentes caracteres se here- d Todos los hijos varones
dan por separado corresponde a la ley de...
a La independencia 18. Si representamos un alelo dominante por R y el
b La segregación recesivo por r, y las proporciones genotípicas de
c La uniformidad un determinado cruzamiento son 1 RR / 2 Rr / 1
d La combinación rr, ¿cuál será la representación genética de los
padres?
13. La idea de que el par de alelos que determina a RR × Rr
un mismo carácter en cada progenitor se separa b RR × RR
y solo uno de los alelos pasa a la descendencia c Rr × Rr
corresponde a la ley de... d Rr × RR
a La independencia
b La segregación 19. La ecografía es...
c La uniformidad a Un procedimiento de ingeniería genética.
d La combinación b Una técnica de diagnóstico prenatal no inva­
siva.
14. La herencia del sexo está determinada por... c Una técnica de diagnóstico prenatal invasiva.
a El sexo femenino d Ninguna de las respuestas anteriores es cierta.
b El sexo masculino
c El cromosoma Y 20. ¿Cuál de estos conceptos es incorrecto?
d Los cromosomas sexuales a El genoma es todo el material genético presen-
te en una célula.
15. La herencia ligada al sexo… b El código genético es la relación que hay entre
a Es lo mismo que la herencia del sexo. tripletes de nucleótidos y aminoácidos.
Editorial Casals, S. A. • Material fotocopiable

b Se refiere a caracteres que se encuentran en el c El fin de la ingeniería genética es crear indivi-
cromosoma X. duos perfectos.
c Se refiere a caracteres que se encuentran en d El código genético indica la relación que hay
los cromosomas sexuales. entre genes y proteínas.
d Se presenta con mayor frecuencia en los hom-
bres.

138

37-232 PD BG4 CAST Cap3_2016.indd 138 10/05/16 12.11


Unidad 5 • La herencia biológica

7 Solucionario duos. Con el tiempo, esto nos llevaría a bancos


de óvulos y de espermatozoides de gran calidad
y a aconsejar a las parejas que no corran riesgos
Solucionario del libro del alumno e implanten en el útero de la madre un cigoto de
alta calidad, es decir, a quitarles a los individuos la
La ciencia tiene más preguntas que respuestas… capacidad de tener hijos sin una autorización del
1. Sus genes, para detectar enfermedades de tipo gobierno en base a su calidad biológica.
genético. 3. Que las empresas, los bancos y las compañías
2. La probabilidad que tiene de sufrir diversas pato- de seguro tendrían derecho a pedir un informe de
logías o disfunciones. la calidad genética de los individuos antes de fir-
3. La respuesta a esta pregunta no se puede dar mar un contrato. Y como la información genética
desde la ciencia, ya que esta no hace valoracio- no se puede cambiar, estos individuos no podrían
nes éticas, sino solo valoraciones de si técnica- hacer nada para cambiar su situación, por lo que
mente es o no posible y, en el caso de que lo fue- quedarían excluidos de la sociedad, pese a su es-
ra, si habría daños biológicos colaterales. En este fuerzo por adquirir conocimientos y su capacidad
sentido, cabe indicar que el éxito de la vida se ha de trabajo.
basado en generar individuos muy diferentes (bio-
diversidad), por tanto unos más preparados para ¿Lo recuerdo?
sobrevivir que otros, pero algunos de estos, ante 1. Es un organismo idéntico a otro, ya que tiene la
un cambio en las condiciones ambientales, posi- misma información genética.
blemente podrían sobrevivir; es decir, que algunos 2. Un clon tiene el 100% de los genes iguales y, en
de los que tenían una baja capacidad de super- cambio, un hijo, solo el 50%.
vivencia serían los que permitirían que la especie 3. Porque heredan sus genes. Como para cada
no se extinguiera ante las nuevas condiciones. En carácter hay dos informaciones (genes), una he-
este sentido, actuar para que los hijos tuvieran las redada del padre y otra heredada de la madre,
mejores características llevaría a una homogenei- que pueden ser diferentes y que una se imponga
dad biológica de la población y, por lo tanto, a una sobre la otra, es posible que heredemos muchas
menor posibilidad de supervivencia de la especie informaciones (genes) que en nuestros padres
ante un cambio ambiental. no se manifiestan pero en nosotros sí, por lo que
Desde el campo de la ética aplicada a la biología, mostramos algunos rasgos de los abuelos o de
es decir, desde la bioética, no sería ético modificar los tíos que no tienen nuestros padres.
los genes simplemente para obtener determina- 4. 
No, hay características que se adquieren del am-
das características si estas no son imprescindi- biente. Por ejemplo, una piel morena puede de-
bles para poder vivir. La justificación de esta res- berse al grado de insolación recibida.
puesta se basa en los siguientes aspectos: 5. 
Respuesta abierta. Ejemplo: No, no lo es porque
1. Que una acción hecha con la intención de evitar todas las personas, por el simple hecho de serlo,
una enfermedad es absolutamente correcta. En tienen una dignidad que impide utilizarlas, mani-
cambio, si fuera por un motivo que no comporta pularlas y mucho menos matarlas, aunque el fin
una mejora, sino solo un gusto de los padres, no sea bueno, como es el de curar a otras personas.
sería correcto, ya que los gustos vienen influidos
Actividades ¿Lo tengo claro? y ¿Lo sé aplicar?
Editorial Casals, S. A. • Material fotocopiable

por las modas y estas dependen del número de


personas que las siguen, por lo que esto irreme- 1. 
Un carácter biológico heredable es cada una de
diablemente nos llevaría a una pérdida de biodi- las cualidades morfológicas o fisiológicas que se
versidad en la población humana, con los peligros pueden distinguir en una especie y que pueden
antes mencionados. ser transmitidas de padres a hijos. Por ejemplo,
2. Que hacer cambios en los genes nos lleva a el color de los ojos, la concentración de glucosa
una sociedad en la que los individuos con más en sangre, etc.
posibilidades de obtener buenas notas en sus es- La manifestación de un carácter biológico es la
tudios, encontrar trabajo y tener hijos son los que forma de presentarse un carácter en un individuo
han nacido con una información biológica mejor, concreto. Por ejemplo, una persona tiene los ojos
por lo que serían los centros de reproducción los azules, es del grupo sanguíneo A, su concentra-
que más influirían en cómo son los nuevos indivi- ción media de glucosa en sangre es de 1 g/L, etc.

139

37-232 PD BG4 CAST Cap3_2016.indd 139 10/05/16 12.11


Unidad 5 • La herencia biológica

2. Caracteres cualitativos: grupos sanguíneos (A, 7. Fecundación.


B, AB o 0), capacidad de doblar la lengua, forma A una célula llamada cigoto que contiene la infor-
de cruzar los brazos y las piernas, capacidad de mación biológica de ambos gametos.
mover las orejas, grupo Rh. 8. La flor se trasforma en un fruto.
 Caracteres cuantitativos: peso, índice cefálico 9. Utilizando especies que se reproducen en poco
(relación entre la anchura y la longitud del crá- tiempo, como insectos, ratones, peces tropicales
neo), fuerza en las manos, altura, inteligencia, de acuario, etc.
color de la piel. 10. Encontró que todas las semillas hijas eran de co-
3. Deben poder reproducirse entre sí y dar lugar a lor amarillo.
una descendencia que también sea fértil, es de- 11. Respuesta abierta. Ejemplo de respuesta: Cruza-
cir, capaz de generar nuevos individuos, esto es, ría un ratón de la variedad orejas grandes y otro
de poder reproducirse. de la variedad orejas pequeñas y observaría la
4. descendencia. Si el carácter orejas grandes fuese
Caracteres Caracteres heredados por los hijos dominante, toda la descendencia tendría que pre-
anatómicos del José Marta Luis Elena sentar las orejas grandes.
padre y de la
madre 12. Que las semillas hijas tendrían un color verde
Forma de la cara M M P P amarillento.
Forma del M P M P 13. – Dominante. Factor hereditario de un organismo
mentón que tapa el otro factor hereditario que posee este
Forma del M M P P organismo sobre el mismo carácter biológico.
nacimiento del – Recesivo. Factor hereditario de un organismo
cabello en la
frente que no se expresa por la presencia en este or-
Color y forma del Color: M P M Color: P ganismo de un factor hereditario sobre el mismo
pelo Forma: P Forma: M carácter de tipo dominante.
Forma de las M P – Homocigótico. Relativo al organismo que pre-
cejas senta dos factores hereditarios iguales para un
Forma del lóbulo P M carácter determinado.
de la oreja
– Heterocigótico. Relativo al organismo que pre-
Forma de la nariz M P
senta dos tipos diferentes de factores hereditarios
Color de ojos P M
para un carácter determinado.
Forma de los M P
labios
– Genotipo. Conjunto de factores hereditarios (ge-
Necesidad de Hasta que no lleguen a la edad de los padres
nes) de un organismo.
gafas para vista no se puede saber. – Fenotipo. Conjunto de manifestaciones que pre-
cansada senta un individuo en cada una de sus caracterís-
Cicatriz en la cara Este carácter no es hereditario, se debe a un ticas biológicas.
accidente.
14.
Agujeros en las Este carácter no es hereditario, se debe a una
orejas para los intervención quirúrgica. GENOTIPOS
pendientes
Grado de La piel muy bronceada en parte es debida a Gametos
insolación los caracteres heredados, pero en gran parte (células sexuales)
al grado de insolación recibido durante los
últimos días.

5. No se observa que haya dos o más caracterís-


ticas de los individuos que tiendan a heredarse Autofecundación
conjuntamente, ni que alguna de estas caracte-
Gametos
rísticas se dé solo en las mujeres o solo en los
hombres.
6. Las masculinas están contenidas en los granos
de polen que se producen en los estambres. Las
femeninas se producen en el interior de los pisti-
los.
3 lisos 1 rugoso

140

37-232 PD BG4 CAST Cap3_2016.indd 140 10/05/16 12.11


Unidad 5 • La herencia biológica

15. VvLl x vvLL Los hijos no serán daltónicos. Las hijas no serán
F1 Proporciones genotípicas → F1 Proporciones daltónicas, pero serán portadoras del gen del
fenotípicas daltonismo.
1/8 VvLL, 2/8 VvLl → 3/8 amarillos lisos 24. La mitad de los hijos varones serán hemofílicos
1/8 Vvll → 1/8 amarillos rugosos y la otra mitad no. Las hijas serán normales. La
1/8 vvLL, 2/8 vvLl → 3/8 verdes lisos mitad de las hijas serán portadoras del gen de la
1/8 vvll → 1/8 verdes rugosos hemofilia.
16. Habría nueve tipos diferentes de fenotipos que
presentan las proporciones siguientes:
1/16 amarillos lisos
2/16 amarillos semirrugosos
2/16 verdes claro lisos
4/16 verdes claro semirrugosos
1/16 amarillos rugosos
1/16 verdes lisos
2/16 verdes claro rugosos
2/16 verdes semirrugosos
No hemofílica No hemofílico No hemofílica Hemofílico
1/16 verdes rugosos pero portadora
17. a Hay dos genes señalados: V/v y N/n.
 b Un quiasma que ha dado lugar a un entrecru- 25. 1/4 serán de grupo AB, 1/4 serán de grupo A,
zamiento. 1/4 serán de grupo B y 1/4 serán de grupo 0.
18. Dos cromosomas homólogos son aquellos que 26. a AND: 5’– A T G G C A C G A T G G T A T T A G – 3’
contienen genes, iguales o diferentes, sobre los b ARNm: 5’– A U G – G C A – C G A – U G G –
mismos caracteres. – U A U – U A G – 3’
19. Dos plantas nacidas de guisantes amarillos hete- c Proteína: Met – Ala – Arg – Trp – Tyr
rocigotos son dos plantas Aa. Si estas se cruzan 27. a Las células somáticas tendrán 47 cromosomas.
entre sí, la probabilidad de que aparezcan gui-  b Será de sexo masculino, ya que contiene un
santes verdes, es decir, aa, es de 1/4. cromosoma Y, que es el que determina la forma-
20. Porque como los hombres tienen los cromosomas ción de los testículos.
XY en sus células, producen la mitad de sus es-  c Esta persona no producirá gametos, es decir,
permatozoides con el cromosoma X y la otra mi- será estéril, ya que la meiosis quedará paralizada
tad con el cromosoma Y, por tanto, como todos en la primera profase, cuando el cromosoma Y
los óvulos contienen un cromosoma X, se generan de más no encuentre su pareja para intercam-
tantos individuos XX (niñas) como XY (niños). biarse fragmentos.
21. Las mujeres tienen 23 tipos de cromosomas: tie- 28. ARNm: 5’– A U G G U C G G G C G U A A U U
nen el tipo X y 22 tipos más. Los hombres tienen G A –3’
24 tipos de cromosomas: tienen el tipo X, el tipo Y ARNm: 5’– A U G – G U C – G G G – C G U –
y 22 tipos más. – A A U – U G A –3’
22. El sexo se define exclusivamente por el esper- Proteína: Met – Val – Gly – Arg – Asn
matozoide. Si contiene un cromosoma X, el nue- 29. a ARNm: 5’– A U G G U C G G G C G U A G U
vo individuo será niña; en cambio, si contiene un U G A –3’
cromosoma Y, el nuevo individuo será niño. ARNm: 5’– A U G – G U C – G G G – C G U – A G U –
23.  – U G A – 3’
b Proteína: Met – Val – Gly – Arg – Ser
30.  a ARNm: 5’– A U G – U C G – G G C – G U A – A
U U– G A ? – 3’
b Proteína: Met – Ser – Glu – Val – Ile – ?
Será una mutación mucho más importante por-
que, al cambiar todos los tripletes después del
nucleótido perdido, cambian todos los aminoá-
No daltónica No daltónico cidos y cambiará el lugar de la señal de parada.
pero portadora

141

37-232 PD BG4 CAST Cap3_2016.indd 141 10/05/16 12.11


Unidad 5 • La herencia biológica

31. El código genético es la equivalencia existente pura, se observa que todos los descendientes
entre cada tres nucleótidos de un ácido nucleico son iguales entre sí, concretamente todos ellos
(denominado ARN mensajero) y los diferentes ti- presentan semillas de color amarillo.
pos de aminoácidos, que son las moléculas que La ley de la uniformidad dice: cuando se cruzan
constituyen las proteínas. dos razas puras, toda la descendencia es unifor-
El genoma es el conjunto de secuencias de nu- me, ya sea mostrando una de las dos caracterís-
cleótidos existente en una célula. ticas o una característica intermedia.
Así pues, el texto para traducir equivaldría al geno- 40. Al cruzar guisantes de la variedad amarilla raza
ma y el diccionario equivaldría al código genético. pura con guisantes de la variedad verde raza
32. Cuando la mujer tiene más de 40 años, o el hom- pura y dejar que los descendientes (todos de
bre tiene más de 50 años, cuando están empa- semillas de color amarillo) se crucen entre sí, se
rentados o cuando uno de ellos o los dos son observa que la descendencia presenta guisantes
portadores de enfermedades genéticas. con semillas de color amarillo y guisantes con
Se pueden realizar las siguientes pruebas: eco- semillas de color verde. De esto se deduce que
cardiografía del feto, amniocentesis y biopsia de la información para el color verde no había des-
corion. aparecido, sino que estaba oculta y, durante la
33. Un doppler para comprobar si el flujo sanguíneo generación de las células reproductoras, se ha
del feto es normal y, en caso de que no lo sea, separado de la otra información.
una ecocardiografía del feto para valorar si se ha La ley de la segregación se enuncia así: los dos
de intervenir quirúrgicamente. factores hereditarios que informan sobre un mis-
34. La ingeniería genética es la técnica de elimina- mo carácter se separan y se reparten (se se-
ción de genes propios y de inserción de genes gregan) entre las células sexuales y, después,
externos. mediante la fecundación, se unen al azar para
La terapia génica es la aplicación de la ingeniería generar los descendientes.
genética para la curación de enfermedades. 41. El genotipo es el conjunto de genes de un orga-
35. Podrían provocar desastres ecológicos si se nismo, mientras que el fenotipo es el conjunto
constituyeran en plagas difíciles de controlar. de manifestaciones o rasgos de un individuo. El
36. Podrían acentuar los desequilibrios económicos fenotipo depende del genotipo y de la influencia
entre los pueblos si solo los pueden utilizar los del ambiente. Por ejemplo, el genotipo Vv da lu-
países ricos. Además, la ingeniería genética mal gar al fenotipo guisantes de color amarillo.
utilizada permitiría la inserción de genes en hu- 42. Al cruzar guisantes de la variedad amarilla-lisa
manos para que pudieran realizar determinadas raza pura con guisantes de la variedad verde-
actividades, aunque no fuesen beneficiosas para rugosa raza pura y dejar que los descendientes
el individuo. se entrecrucen entre sí, se observa que no todos
37. Hacer la clonación a partir de individuos recién los guisantes amarillos son, además, lisos, sino
nacidos. que aparecen guisantes amarillos y rugosos; por
38. Llamamos caracteres cualitativos a aquellos que tanto, deducimos que el color de la semilla es un
se manifiestan con rasgos claramente diferentes carácter que se hereda independientemente de
entre sí; por ejemplo, el carácter sexo del indivi- la forma de la semilla.
duo, que puede manifestarse como masculino o La ley de la independencia dice: los factores he-
como femenino, y el carácter grupo sanguíneo, reditarios no antagónicos, por ejemplo los del
que puede ser A, B, AB o 0, el carácter capaci- color y los de la forma de la semilla, se heredan
dad de doblar la lengua, que puede manifestarse independientemente los unos de los otros.
como capaz o como no capaz, etc. 43. En que al cruzar los híbridos amarillos obteni-
 Llamamos caracteres cuantitativos a aquellos dos en la generación filial primera aparecieron un
que se manifiestan con un solo tipo de rasgo, 25% de guisantes verdes, carácter que habían
pero que pueden presentar un valor cualquiera heredado de sus progenitores, pese a que estos
dentro de un intervalo; por ejemplo, la altura, el eran amarillos. Por tanto, los progenitores de-
peso, el color de la piel, la inteligencia, etc. bían tener, como mínimo, dos informaciones, la
39. Al cruzar guisantes de la variedad amarilla raza amarilla que ellos exhibían, y la verde que habían
pura con guisantes de la variedad verde raza transmitido a parte de su descendencia.

142

37-232 PD BG4 CAST Cap3_2016.indd 142 10/05/16 12.11


Unidad 5 • La herencia biológica

44. AAbbccDDEEE corresponde a una raza pura o cromosomas. Así pues, en las células somáticas
individuo homocigótico y AaBbCcDdEe corres- de los hombres hay más tipos de cromosomas
ponde a un híbrido o individuo heterocigótico. que en las células somáticas de las mujeres.
Para obtener y mantener razas puras el ser hu- 49. La herencia del sexo es la herencia biológica
mano escoge entre los descendientes aquellos que determina el sexo del nuevo individuo. Por
individuos que tienen los caracteres deseados y ejemplo, en los humanos, si en las células hay un
solo utiliza a estos individuos como progenitores cromosoma X (aportado por la madre) y un cro-
de la siguiente generación. Este proceso se repi- mosoma Y (aportado por el padre), el individuo
te, generación tras generación, hasta conseguir es un hombre, y si hay dos cromosomas X, el
individuos con las características deseadas. individuo es una mujer.
45. En cambio, la herencia ligada al sexo se refiere
Enunciado Ley a aquellos caracteres que dependen de genes
Los dos factores hereditarios que Ley de la que se encuentran en los segmentos de los cro-
informan de un mismo carácter se segregación mosomas sexuales, que son diferentes según se
separan y se reparten (se segregan)
entre las células sexuales y, después, trate del cromosoma X o del cromosoma Y. En
mediante la fecundación, se unen al azar la práctica, se sospecha que un carácter puede
en los descendientes. estar ligado al sexo del individuo cuando se pre-
Cuando se cruzan dos razas puras, toda Ley de la senta más frecuentemente en un sexo que en el
la descendencia es uniforme, ya sea por uniformidad
las características de una de las razas, otro. Esto se debe al hecho de que si es recesivo
ya sea por una característica intermedia. y, por ejemplo, está en el cromosoma X, como
Los factores hereditarios no antagónicos Ley de la las hembras tienen dos cromosomas X, en ellas
(como los del color y la forma de una independencia no se expresará si el otro cromosoma X tiene el
semilla) se heredan independientemente
unos de los otros. gen dominante, mientras que como los machos
solo tienen un cromosoma X, aunque sea rece-
46. La similitud entre la separación de los cromoso- sivo, sí se expresará, y por tanto el macho mani-
mas homólogos durante la meiosis y su unión festará este carácter.
posterior durante la fecundación, y la separación 50. a Sí, ya que podrían ser más eficaces que otras
de los genes y su unión posterior durante las di- especies semejantes y por competencia elimi-
ferentes combinaciones que proponía el modelo narlas, o ser resistentes a sus depredadores na-
de Mendel. turales y por ello multiplicarse sin límite y formar
La teoría cromosómica dice que los genes están plagas, o ser resistentes a nuestras defensas na-
en los cromosomas. turales y producirnos enfermedades graves, etc.
Se confirmó al observar que algunos organismos Antes de dejar en libertad una especie transgéni-
que al crecer presentaban una anomalía determi- ca hay que comprobar que no haya ningún tipo
nada siempre mostraban una misma alteración de peligro. Incluso es mejor conseguir que sean
en sus cromosomas. muy sensibles a un agente determinado, por si
47. Porque se trata de características recesivas que hubiera que eliminarlas.
han quedado ocultas en los padres pero que se  b Sí, es correcto cambiar la información gené-
han podido manifestar en los nietos al no estar tica de una persona si el objetivo es curarla. En
acompañadas de genes dominantes. Por ejem- cambio, no es correcto pedir un análisis de la
plo, los progenitores AA y aa tienen descendien- calidad de la información genética antes de con-
tes Aa pero estos al tener descendencia generan tratar a una persona, hacerle un seguro médico
la mitad de individuos Aa, un cuarto de indivi- o concederle un préstamo bancario, ya que esto
duos AA y un cuarto de individuos aa. atenta contra la dignidad del ser humano, que
48. En las células somáticas humanas hay 46 cromo- incluye el derecho a que se respete su intimidad,
somas y en los gametos humanos hay 23 cromo- es decir, a que los temas personales se manten-
somas. En las células somáticas de las mujeres gan en el ámbito privado.
hay 23 tipos de cromosomas y en sus óvulos 51. Una probabilidad del 0,25, es decir, un 25%.
también hay 23 tipos de cromosomas. En las cé- 52. En la primera generación todos los individuos se-
lulas somáticas de los hombres hay 24 tipos de rían Rr, es decir, serían dondiegos de flores rosa.
cromosomas, ya que en lugar de dos cromoso- Al cruzarse entre sí habría un 0,25 de probabili-
mas X tienen un cromosoma X y un cromosoma dades de obtener individuos rr, es decir, un 25%
Y. En los espermatozoides hay solo 23 tipos de de obtener dondiegos de flores blancas.

143

37-232 PD BG4 CAST Cap3_2016.indd 143 10/05/16 12.11


Unidad 5 • La herencia biológica

53. En la primera generación saldrían las siguientes 58. La abuela materna sería XDX? y el abuelo ma-
proporciones genotípicas: terno sería XdY, por tanto, como su madre es
1/4 AA, 1/2 Aa y 1/4 aa. A continuación se ex- daltónica, su madre es XdXd. De aquí se deduce
pone la probabilidad de obtener descendientes que su abuela materna es XDXd. Si su padre no
verdes en todos los cruces posibles entre los es daltónico es que tiene el genotipo XDY. Por
descendientes de la F1. Entre paréntesis se indi- todo ello este hombre es XdY, y por tanto es dal-
ca la probabilidad de que se dé el cruce y fuera tónico. Sus hermanas serán XdXD. Por eso, sus
de los paréntesis se indica la probabilidad de que hijos varones tienen una probabilidad de 0,5 de
en dicho cruce aparezcan descendientes de color ser daltónicos (serán XdY) y una probabilidad
verde, es decir, descendientes aa. La probabilidad de 0,5 de no serlo (serán XDY). Sus hijas tienen
total es la suma de todas estas probabilidades. una probabilidad de 0,5 de ser daltónicas (se-
rán XdXd) y una probabilidad de 0,5 de no serlo
1/4 AA 1/2 Aa 1/4 aa
(serán XDXd).
1/4 AA 0 0 0
59. El 50% de la descendencia será de grupo A, el
1/2 Aa 0 (1/2 · 1/2) 1/4 aa (1/2 · 1/4) 1/2 aa 25% será de grupo AB, y el 25% de grupo B. No
1/4 aa 0 (1/4 · 1/2) 1/2 aa (1/4 · 1/4) 1 aa hay ninguna posibilidad de que tengan un hijo
del grupo 0.
La probabilidad de obtener descendientes ver-
Hombre Mujer
des en la F2 es 1/16 + 1/16 + 1/16 + 1/16 = 1/4
54. a Los progenitores son RRNN y rrnn. En la F1 to- A0
dos los genotipos serán RrNn y, por tanto, todos
los fenotipos serán rizados y negros.
b En la F2 los genotipos serán: 1/16 RRNN, 2/16
RRNn, 1/16 RRnn, 2/16 RrNN, 4/16 RrNn, 2/16
Rrnn, 2/16 rrNn, 1/16 rrNN y 1/16 rrnn.
 c Los fenotipos serán: 9/16 rizados y negros,
3/16 rizados y blancos, 3/16 lisos negros y 1/16 A0 B0
lisos y blancos.
55. El 75% de los hijos serán normales y el 25%
serán albinos. Si se quiere más información se
puede decir que 2/3 de los hijos normales serán
portadores del gen del albinismo.
Hombre Mujer
Investiga tus competencias

Practica. El proyecto Genoma Humano


1. Entre 40 000 y 50 000 genes.
2. d No, porque los óvulos y los espermatozoides
tienen la mitad de genes.
3. El derecho de las personas a tener progenitores
humanos y no una empresa, una corporación o
una entidad estatal, a ser querido por sí mismo
y no por ser la copia de otra persona, y a tener
Normal Albino
una información genética propia y no diseñada
por otros.
75% 25%
56. a La probabilidad de obtener descendientes albi- Practica. Transgénicos, ¿a favor o en contra?
nos en el primer cruce es cero. 1. Un OMG es un organismo modificado genética-
b Es de 0,5, es decir, un 50%. mente. Se consigue alterando el genoma del or-
57. La madre sería XHXH y el padre sería XhY, por tan- ganismo mediante la ingeniería genética.
to, la probabilidad de obtener un hijo XhY es nula, 2. a Los agricultores que los quieren utilizar y las
es decir, es imposible. La probabilidad de que empresas productoras de organismos transgé-
nazca una niña XhXh también es nula. nicos. Se quejan por motivos económicos.

144

37-232 PD BG4 CAST Cap3_2016.indd 144 10/05/16 12.11


Unidad 5 • La herencia biológica

3. La mayoría de los grupos ecologistas, los defen- Ejemplos de respuestas correctas:
sores de la agricultura natural y los que se opo- – Confirmar si era posible clonar terneros, es de-
nen a que sean unas pocas empresas grandes cir, conseguir individuos con la misma informa-
las que controlen el mercado de la alimentación. ción genética.
Lo hacen porque temen que los organismos – Saber qué proporción de los intentos de clo-
transgénicos puedan convertirse en plagas o nación acababan con éxito. En este experimento
que se mezclen con las especies naturales y las hubo cinco éxitos de treinta intentos.
perjudiquen o que originen sustancias tóxicas 4. Todas las afirmaciones son correctas.
para el entorno o para los consumidores, y tam- 5. 5 / 30 · 100 = 16,66%. Es un porcentaje bajo.
bién porque la agricultura no estaría controlada También podría decirse que es un éxito elevado,
por los diferentes países, sino por empresas su- ya que normalmente los resultados son mucho
praestatales. peores.
4. La situación no es aceptable, ya que para la sos- 6. a Científica. b Ética. c Ética. d Científica.
tenibilidad económica de Europa se deben im-
portar constantemente alimentos transgénicos
producidos en otros lugares del mundo, cuando Solucionario de la propuesta didáctica
se podrían producir en la misma Europa. Ade-
más, científicamente Europa se está quedando Banco de actividades
atrás en el desarrollo de esta tecnología. Lo que
se debería hacer es aumentar las medidas de se- Refuerzo
guridad ecológica, por ejemplo, dedicando más 1. 
Se trata de una herencia dominante, ya que si
años a la experimentación en recintos cerrados fuera herencia codominante o intermedia los
con resultados positivos, y las medidas de segu- descendientes no tendrían el mismo fenotipo
ridad sanitaria, dedicando también más años a la que uno de los progenitores.
comprobación de que no hay efectos secunda- Los genotipos de los descendientes son:
rios. Con ello se podría conseguir su aceptación P mm MM
por parte de los grupos más críticos. Sobre la 1 2
objeción al hecho de que esta tecnología esté
en manos de las empresas, se podría seguir el
mismo modelo que actualmente tienen las em- F1 Mm Mm Mm Mm
presas petroleras en las que los Estados tienen 1 2 3 4
poder de veto en los consejos de administración.

MM o MM o
Aprendo a investigar. Analizo F2 mm mm
Mm Mm
Respuesta abierta. 1 2 3 4

Aprendo a investigar. Conclusión 2. Duplicación: A, C, G. Transcripción: B, C, D. Tra-


Respuesta abierta. ducción: E, F.
3. 
Cuando se cruzan dos razas puras, toda la des-
Evalúa cendencia es uniforme, ya sea mostrando una
1. b Un organismo idéntico a otro desde el punto de las dos características o una característica
de vista genético. intermedia. Ley de la uniformidad.
2. d A ninguna. La explicación de esta respuesta Los dos factores hereditarios que informan so-
es que la información genética se encuentra en bre un mismo carácter se separan durante la for-
el ADN del núcleo, y el núcleo de cada célula del mación de los gametos y cada uno va a parar
embrión que albergaba la vaca Blanca 2 no solo a un gameto diferente. Después, mediante la fe-
contiene la mitad de los genes de la vaca madre, cundación, se combinan al azar para dar lugar
Blanca 2, sino también la mitad de los genes del a la información biológica de los descendientes.
toro que actuó como padre, es decir, del toro Ley de la segregación.
cuyos espermatozoides fecundaron los óvulos Los factores hereditarios no antagónicos se he-
de Blanca 2. redan independientemente unos de los otros.
3. Respuesta abierta. Ley de la independencia.
4. 
1-A, 2-D, 3-C, 4-B, 5-E

145

37-232 PD BG4 CAST Cap3_2016.indd 145 10/05/16 12.11


Unidad 5 • La herencia biológica

5. Los padres serán Aa y Aa. 5. Los padres son VvLL y vvLl. La descendencia
A a sería:
A AA Aa vL vl
a Aa aa VL VvLL VvLl

Por lo tanto, la probabilidad de que tengan un vL vvLL vvLl


hijo albino será de 0,25 o 25%.
6. 1-C, 2-A, 3-B Por lo tanto, no hay ninguna probabilidad de ob-
tener guisantes amarillos rugosos.
Consolidación 6. Los padres serán IAi y IAIB.
1. a. IA IB

P BBCC IA IAIA IAIB


bbcc
1 2 i iIA iIB

Las proporciones genotípicas serán 1/4 IAIA, 1/4


F1 BbCc BbCc BbCc BbCc IAIB, 1/4 iIA y 1/4 iIB.
1 2 3 4 Las proporciones fenotípicas serán 1/2 de grupo
A, 1/4 de grupo AB y 1/4 de grupo B. Por lo tan-
to, no existe ninguna probabilidad de que tengan
B-cc bbcc
F2 B-C- bbC- un hijo del grupo 0.
1 2 3 4 7. No hay ninguna probabilidad de que el niño no
sea daltónico, ya que el daltonismo es un carác-
b. Las proporciones serán 9 de F2-1 por cada 3

ter recesivo y ambos progenitores presentan la
de F2-2, 3 de F2-3 y por cada 1 de F2-4, como se
enfermedad; esto significa que la madre presen-
puede deducir de los siguientes datos.
ta el genotipo XdXd y el padre el genotipo XdY, es
BC Bc bC bc decir:
BC BBCC BBCc BbCC BbCc XdXd × XdY
Bc BBCc BBcc BbCc Bbcc (daltónica) (daltónico)

bC BbCC BbCc bbCC bbCc


bc BbCc Bbcc bbCc bbcc XdXd + XdY
(daltónica) (daltónico)
1/2 1/2
2. E-B-A-C-D
3. ADN … 3’ GAC-GTT-ATA-CAC-TTA-GGC-AGG- Todos los descendientes serán daltónicos.
ACT5’… 8. 1-C, 2-B, 3-D, 4-A
ARN m 5’ CUG-CAA-UAU-GUG-AAU-CCG-UCC- 9. No serían idénticos debido a la recombinación
-UGA3’… génica. No se pueden cruzar dos clones, ya que
Proteína: Leu-Gln-Tyr-Val-Asn-Pro-Ser-Stop. si son clones, son del mismo sexo.
4. a V.
 b F. Cada uno de los aspectos anatómicos y fi- Ampliación
siológicos heredables que se pueden distinguir 1. Respuesta experimental.
en una especie es un carácter biológico. Un gen 2. a La flor de color rosa es heterocigótica para el
es cada una de las informaciones sobre un ca- carácter color de los pétalos, es decir, contiene
rácter biológico. un alelo dominante (R: rojo) y un alelo recesivo
 c F. Los caracteres que se manifiestan por medio (r: blanco). Si cruzamos dos flores de color rosa,
de rasgos claramente diferenciados se llaman el resultado será:
caracteres cualitativos. Rr × Rr
 d F. Los caracteres que no están determinados (Rosa) (Rosa)
por la información genética contenida en las cé-
lulas se llaman caracteres adquiridos.
RR + Rr + rr
(Rojo) (Rosa) (Blanco)
1/4 1/2 1/4

146

37-232 PD BG4 CAST Cap3_2016.indd 146 10/05/16 12.11


Unidad 5 • La herencia biológica

La probabilidad de que en F1 las flores sean de En la UE se dio libertad para que cada país de-
color rojo (RR) es de 1/4. cidiera y los que lo tenían, exceptuando Espa-
b Si el carácter patrón moteado es recesivo (mm) ña, han decidido prohibirlo aduciendo que MON
y las flores de la generación P no poseen dicho 810 supone un riesgo para el medio ambiente.
carácter, siendo heterocigóticas para él (Mm), el Pese a que no hay pruebas que demuestren que
resultado será: perjudica, como no hay una seguridad absoluta
Mm × Mm
de que no generará ningún problema en el futu-
(no moteado) (no moteado) ro, han decidido prohibirlo. Algunos agricultores
y las empresas que producen transgénicos los
acusan de que toman decisiones por motivos
simplemente electoralistas, dadas las campañas
MM + Mm + mm
(no moteado) (no moteado) (moteado) en contra de los grupos ecologistas.
1/4 1/2 1/4 En otros países del mundo sí se cultiva este tipo
La probabilidad de que en F1 las flores sean rojas de maíz, lo consumen y lo venden a otros lugares
y además moteadas es de 1/16 (1/4 de que sean que también lo comen. Respecto a la posición de
rojas multiplicado por 1/4 de que sean motea- cada alumno, lo importante no es que opine una
das). cosa o la otra, sino que sepa argumentar la idea.
3. a 5’-ATA-CCA-TCG-TGC-AGA-3’ 8.  Se trata del fenómeno de ligamiento génico.
b 5’-ACA-CCA-TCG-TGC-AGA-3’ Cada cromosoma porta más de un gen, forman-
c 5’-AAC-CAT-CGT-GCA-GA…3’ do los grupos de ligamiento, que se transmiten
4. Respuesta abierta. Algunos ejemplos son: juntos durante la formación de gametos. No
– Mutaciones puntuales: espina bífida, fenilceto- cumplen la segunda ley de Mendel.
nuria, fibrosis quística… 9. a Que de individuos amarillos nacían individuos
– Mutaciones cromosómicas: síndrome de X frá- verdes. Esto indica que los progenitores han de
gil, síndrome de Prader-Willi… tener la información para amarillo y la informa-
 – Mutaciones genómicas: síndrome de Down, ción para verde, aunque no la exhiban. Por tanto,
síndrome de Turner… para cada carácter como mínimo ha de haber
5. Respuesta abierta. dos informaciones.
6. Sí, ya que podrían ser más eficaces que otras b Que las proporciones fenotípicas que se ob-
especies parecidas y por competencia eliminar- tendrían si se mezclaran al azar los genes, de
las o ser resistentes a sus depredadores natu- forma totalmente independiente los unos de los
rales y por ello multiplicarse indefinidamente otros, serían las mismas que se habían obtenido
constituyendo plagas o ser resistentes a nues- en el jardín.
tras defensas naturales y producirnos graves en- 10. La herencia codominante es aquella en la que
fermedades, etc. Antes de dejar en libertad una los alelos que van juntos en cromosomas homó-
especie transgénica debe comprobarse que no logos dominan por igual, de modo que el indivi-
hay ningún tipo de peligro. Todavía es mejor con- duo manifiesta los dos alelos a la vez, pero sin
seguir que sean muy sensibles a un determinado mezclarse. En la herencia intermedia, el individuo
agente, por si fuera necesario eliminarlas. manifiesta una mezcla de los dos alelos.
7. España es, en la actualidad, el único país de la UE 11. Porque hay varios genes que determinan el co-
donde se cultiva maíz transgénico, concretamen- lor, no solo uno. Además se puede dar herencia
te el maíz transgénico de Monsanto MON 810. intermedia, como en las flores dondiego.

147

37-232 PD BG4 CAST Cap3_2016.indd 147 10/05/16 12.11


Unidad 5 • La herencia biológica

Mapa conceptual

LA HERENCIA BIOLÓGICA

es la herencia de los

Genes

son pueden se heredan siguiendo el conjunto de genes el conjunto de caracte-


segmentos de ser las leyes de se denomina rísticas que manifiesta un
individuo se llama

Dominantes
ADN
Mendel Genotipo Fenotipo
Recesivos

Codominantes que son

Ley de la Ley de la Ley de la


uniformidad segregación independencia

Cuando se cruzan dos Los factores antagónicos se mantie- Los factores no antagónicos
razas puras, toda la nen separados y se reparten al azar se heredan de forma
descendencia es uniforme entre los descendientes independiente unos de otros

Solucionario de la evaluación

1. b Cada una de las informaciones para un deter- 10. b Se heredan unas características intermedias
minado carácter. entre las de los progenitores.
2. a Se pueden reproducir entre ellos y tener des- 11. a Dominante.
cendencia fértil. 12. a La independencia.
3. c Homocigoto recesivo. 13. b La segregación.
4. c Dos hijos altos y dos bajos. 14. d Los cromosomas sexuales.
5. d Ambos son portadores de enanismo. 15. c Se refiere a caracteres que se encuentran en
6. d Una de las posibles formas de un gen. los cromosomas sexuales.
7. a Fenotipo es la manifestación de un carácter y 16. d Falta información para determinarlo.
genotipo es el conjunto de alelos del organismo. 17. a Ninguna.
8. d Un carácter adquirido y por lo tanto no se hereda. 18. c Rr × Rr.
9. b Al cruzar dos razas puras para un determina- 19. b Una técnica de diagnóstico prenatal no invasiva.
do carácter, todos los descendientes son iguales 20. c El fin de la ingeniería genética es crear indivi-
entre sí. duos perfectos.

148

37-232 PD BG4 CAST Cap3_2016.indd 148 10/05/16 12.11