CSIRO PUBLISHING

Invertebrate Systematics, 2012, 26, 213–229

http://dx.doi.org/10.1071/IS11012

Molecular phylogeny of earthworms (Annelida : Crassiclitellata)

based on 28S, 18S and 16S gene sequences

Samuel W. James A,C and Seana K. Davidson B

A
Department of Biology, 143 Biology Building, University of Iowa, Iowa City, IA 52242-1324, USA.
B
Department of Civil and Environmental Engineering, University of Washington, Benjamin Hall Building,
616 Northlake Place, Seattle, WA 98195-5014, USA.
C
Corresponding author. Email: samuel-james@uiowa.edu

Abstract. Relationships among, and content of, earthworm families have been controversial and unstable. Here we analyse
molecular data from 14 Crassiclitellata families represented by 54 genera, the non-crassiclitellate ‘earthworms’ of the
Moniligastridae, plus several clitellate outgroups. Complete 28S and 18S gene sequences and a fragment of the 16S gene
analysed separately or in concatenated Bayesian analyses indicate that most previously proposed suprafamilial taxa
within the Crassiclitellata are para- or polyphyletic. There is strong support for the Metagynophora, which consists of
the Crassiclitellata and Moniligastridae. The most basal within-Clitellata branch leads to the small families Komarekionidae,
Sparganophilidae, Kynotidae, and Biwadrilidae, found in widely separated areas. A clade composed of Lumbricidae,
Ailoscolecidae, Hormogastridae, Criodrilidae and Lutodrilidae appears near the base of the tree, but Criodrilidae
and Biwadrilidae are not closely related because the former is sister to the Hormogastridae + Lumbricidae clade. The
Glossoscolecidae is here separated into two families, the Glossoscolecidae s.s. and the Pontoscolecidae (fam. nov.). The
Megascolecidae is monophyletic within a clade including all acanthodrilid earthworms. There is strong support for
the Benhamiinae (Acanthodrilidae s.l.) as sister to Acanthodrilidae + Megascolecidae, but taxon sampling within other
acanthodrilid groups was not sufficient to reach further conclusions. The resulting trees support revised interpretations of
morphological character evolution.’

Received 31 March 2011, accepted 6 March 2012, published online 6 August 2012

Introduction history of intuitive and formal phylogenetic arguments in the

Over the last 120 years, various classifications of earthworms
have been proposed and debated using morphological characters,
sometimes in an evolutionary context, but rarely with any
explicit analysis of character data, resulting in intuitive
conclusions (e.g. Michaelsen 1900; Stephenson 1930; Gates
1972). This, coupled with the lack of a fossil record, has led
workers in the field to reach diverse conclusions from the same
basic data, and to generally dismiss any character set thought
to be ‘adaptive,’ or subject to selection based on environmental
characteristics. In contrast, Struck et al. (2011) found that a
fundamental lifestyle difference within Annelida was congruent
with their Expressed Sequence Tag (EST)-based phylogeny.
However other ecological differences have not yet been
confirmed at shallower branching points. Such a project does
not look promising in the context of the current paper, because
most earthworm families span a range of ecological niches.
The history of family and suprafamilial concepts in the
Crassiclitellata Jamieson, 1988 (earthworms in general) reveals
recurrent problems in homology assumptions and ad hoc
hypotheses of the importance of certain characters or suites of
characters, all complicated by the fact that different sets of
characters give conflicting signals. Erséus (2005) critiqued the
Clitellata Michaelsen, 1919, and reached conclusions with which
we agree: modern techniques of phylogenetic research have had
insufficient impact on the approaches used with Clitellata. Some
exceptions are Jamieson (1988) and Jamieson et al. (2002), in
which morphological and molecular data, respectively, were
formally analysed and the results applied to define higher taxa
within earthworms.
Recent work has also attempted to reconsider morphological
character states in relation to (palaeo)biogeography to help
define families and classifications within the earthworms, such
as that of Omodeo (1998, 2000), Sims (1980), Gates (1972), and
Blakemore (2000, 2008). Gates (1972) did a considerable
service by criticising the classical system (Michaelsen 1900;
Stephenson 1930) for its dependence on reproductive characters,
its denigration of somatic characters, and its fallacious
evolutionary reasoning. Sims (1980) proposed definitions of
the superfamilies Megascolecoidea (Acanthodrilidae,
Megascolecidae, Octochaetidae, Ocnerodrilidae, Eudrilidae),
Lumbricoidea (Lumbricidae, Hormogastridae, Lutodrilidae,
Ailoscolecidae and Sparganophilidae) and Glossoscolecoidea
(Glossoscolecidae, Kynotidae Almidae, and Microchaetidae)
based largely on ovarian morphology and the budding of the

Journal compilation
CSIRO 2012 www.publish.csiro.au/journals/is

214 Invertebrate Systematics
oocytes (Gates 1976). Two other superfamilies, Criodriloidea and
Biwadriloidea, are monogeneric, while the Komarekionidae are
placed by Sims (1980) in the Ailoscolecidae and the Tumakidae had
not yet been discovered.
Omodeo (2000) proposed a Lumbricoidea containing
Lumbricidae, Hormogastridae, Lutodrilidae, Glossoscolecidae,
Kynotidae (as within Microchaetidae), Ailoscolecidae and
Criodrilidae (which included Sparganophilidae, Lutodrilidae,
Komarekionidae, and maybe Biwadrilidae), Almidae and
Glyphidrilidae. He placed the Eudrilidae in its own
superfamily Eudriloidea, and his Megascolecoidea consisted
of Acanthodrilidae, Megascolecidae, Octochaetidae, and
Ocnerodrilidae. Omodeo’s (2000) detailed but informal
analysis of character evolution concluded that Crassiclitellata
are polyphyletic, stemming from 2 or 3 different non-
crassiclitellate ancestors. He derived Eudriloidea from
Alluroididae-like ancestors based on a hypothesised homology
of euprostates present in both groups, and considered the
Moniligastridae (terrestrial non-crassiclitellates of earthworm
dimensions) as belonging to this lineage. The Lumbricoidea
are derived from something resembling modern Haplotaxidae,
a more or less classical position, and the Megascolecoidea could
be derived from the same ancestor as the Eudriloidea or a different
but related ancestor.
An enduring problem within the Megascolecoidea is that
of multiple nephridia (meronephry) in earthworms of the
families Acanthodrilidae and/or Octochaetidae (which family
is used depends on the interpretation of the nephridia). The
Octochaetidae (type genus Octochaetus Beddard, 1892 from
New Zealand) includes only meronephric species with
acanthodrilin male terminalia. The acanthodrilin male
terminalia are composed of male pores and separate prostatic
pores in the same or adjacent segments, generally in the range
of segments 17–20. Prostate glands are usually tubular.
Classically, the Octochaetidae had only tubular prostates,
but Exxus wyensis Gates, 1959 and Neotrigaster rufa
(Gates, 1962) introduced genera with racemose prostates, a
characteristic previously associated only with some genera of
Megascolecidae. Blakemore (2000, 2008) proposed the Exxidae,
which became the home of octochaetid genera with racemose
prostates.
Lee (1959) made a fairly clear case for multiple independent
origins of acanthodrilin meronephry by pointing out the
morphological similarities between members of New Zealand
genus pairs in which one member was meronephric and the
other not; the set of pairs included Octochaetus. This argument
did not get the traction it deserved. Lee’s conclusions have
since gained support from Jamieson et al. (2002) and Dyne
and Jamieson (2004), which demonstrated that the
Octochaetidae was polyphyletic. Other acanthodrilid genera
with multiple nephridia, and therefore classically assigned to
the Octochaetidae, are found in Africa, the north Neotropics and
South Asia. The Octochaetidae concept has survived in one
form or another to this day, albeit with recognition that
modifications are probably needed (Blakemore 2005). One
such modification is that of Csuzdi (1996), who proposed the
Benhamiinae to accommodate the acanthodrilid genera with
stalked calciferous glands in some or all of segments 14–17,
but including holonephric genera with the same gland type. This
S. W. James and S. K. Davidson
mirrors Lee’s hypothesis that meronephry is not phylogenetically
informative within the New Zealand acanthodrilids.
The above review of earthworm systematics is provided to
assist those unfamiliar with the history of the debates and the
diversity of forms to follow our results. We do not intend this as an
exhaustive review, but only as an introduction that can be used as
a starting point for further study of the role of morphology in
the classification of earthworms. For purposes of the current
paper, we would like to evaluate Crassiclitellata phylogeny
with molecular data and subsequently reconsider morphology
in light of the molecular phylogenetic results. The present paper
is an attempt to build on the earlier molecular phylogenies of
Clitellata (particularly that of Jamieson et al. 2002) by expanding
the sequence length and the breadth of taxonomic coverage
within the Crassiclitellata. The nuclear genes encoding the 28S
and 18S rRNAs, the mitochondrial 12S and 16S rRNAs, and the
cytochrome oxidase subunit I (COI) genes have proven useful
for phylogenetic analyses of the Clitellata (Jamieson et al. 2002;
Bely and Wray 2004; Erséus and Källersjö 2004). However, the
mitochondrial genes are less appropriate to resolution of
deep branching in the group, so we devoted more effort to the
28S and 18S genes. We will use these genes plus a short section
of the mitochondrial 16S gene to infer relationships among all
families of the Crassiclitellata. The 18S gene will be used to infer
relationships among Crassiclitellata and several oligochaetous
Clitellata (sensu Erséus 2005) outgroups including the
Moniligastridae and Enchytraeidae.
Materials and methods
Taxon sampling
Material was collected from several genera each (except the
monogeneric families) in all Crassiclitellata families plus the
Moniligastridae, following the taxonomies of Jamieson et al.
(2002) and Blakemore (2000, 2008). The families and species
represented are shown in Table 1. We collected in the USA,
France, Spain, Andorra, Romania, Hungary, Gabon, Kenya,
South Africa, Madagascar, Thailand, the Philippines, Brazil,
Fiji, the Antilles, Japan, and Australia. Where it was possible,
samples were obtained across geographic disjunctions
in families. 18S gene sequences from the oligochaetous
Clitellata families Tubificidae, Haplotaxidae, Capilloventridae,
Phreodrilidae, Enchytraeidae, and Lumbriculidae, plus
representatives of the Hirudinida, Acanthobdellida and
Branchiobdellida, were retrieved from GenBank.
The taxa sampled and GenBank accession numbers for the
sequences are shown in Table 1. All diverse families were
represented by several species and in most cases by several
genera, while the monotypic families Ailoscolecidae,
Komarekionidae, Lutodrilidae, and Biwadrilidae were
represented by their only known species. We were unable to
obtain material of the monotypic Syngenodrilidae, the
Alluroididae, Criodrilidae and the monotypic Tumakidae. The
first two are not Crassiclitellata, and the Syngenodrilidae is
morphologically close to the Moniligastridae, which we were
able to obtain. The Kenyan type locality of Syngenodrilus
lamuensis (Smith & Green, 1917) no longer exists in natural
form, and nearby locations had only Eudrilidae and Dichogaster
spp. Ten-year-old tissues of Lutodrilus multivesiculatus
Molecular phylogeny of earthworms Invertebrate Systematics 215

Table 1. Taxon sample and GenBank accession numbers

Asterisks indicate taxa belonging to the Octochaetidae of some authorities

Family Individual number, taxon ID Location 18S 28S 16S

Acanthodrilidae 0113 Dichogaster sp. FJ22* Fiji HQ728872 HQ728984 JF267864
Acanthodrilidae 0120 Dichogaster sp. Mart2sA18s* Martinique HQ728870
Acanthodrilidae 0145 Dichogaster sp.* Dominica HQ728990 JF267865
Acanthodrilidae 0147 Dichogaster sp. DomMM18s* Dominica HQ728871
Acanthodrilidae 0225 Neotrigaster rufa* Puerto Rico HQ728887 HQ728982 JF267866
Acanthodrilidae 0339 Dichogaster saliens* Brazil HQ728874 HQ728988 JF267867
Acanthodrilidae 0414 Dipocardia conoyeri USA HQ728888 HQ728983 JF267868
Acanthodrilidae 0828 Acanthodrilidae sp. MG Madagascar HQ728890 HQ728986 JF267870
Acanthodrilidae 0904 Diplotrema sp. Australia HQ728889 HQ728987 JF267871
Acanthodrilidae 1042 Benhamiona sp. Gh* Ghana HQ728991 JF267872
Acanthodrilidae 1058 Benhamia sp. Gh* Ghana HQ728880 HQ728992 JF267873
Acanthodrilidae 1062 Millsonia sp. Gh* Ghana HQ728881 HQ728993 JF267874
Acanthodrilidae 1127 Dichogaster sp. Ke3_5* Kenya HQ728873 HQ728989 JF267875
Acanthodrilidae 1212 Dichogaster sp. Ga5_2* Gabon HQ728875 HQ728994 JF267876
Ailoscolecidae 0662 Ailoscolex lacteospumosus France HQ728907 HQ728934 JF267908
Almidae 0881 Glyphidrilus sp. Thailand HQ728894 HQ728961 JF267919
Almidae 1112 Almidae sp. Ke Kenya HQ728895 HQ728997 JF267921
Biwadrilidae 0589 Biwadrilus bathybates Japan HQ728920 HQ728949 JF267906
Criodrilidae Criodrilus lacuum AY365461 AY048492 GU901783
Eudrilidae 1060 Hyperiodrilus sp. Gh Ghana HQ728925 HQ728960 JF267877
Eudrilidae 1115 Polytoreutus finni Kenya HQ728926 HQ728958 JF267878
Eudrilidae 1117 Eudriloides sp. Ke Kenya HQ728924 HQ728959 JF267879
Eudrilidae 1221 Hyperiodrilus africanus Gabon HQ728927 HQ728995
Glossoscolecidae 0222 Estherella sp. EY2 Puerto Rico HQ728896 HQ728951 JF267882
Glossoscolecidae 0234 Pontoscolex spiralis Puerto Rico HQ728898 HQ728954 JF267883
Glossoscolecidae 0315 Andiorrhinus sp. PG Brazil HQ728897 HQ728953 JF267884
Glossoscolecidae 0320 Fimoscolex sp. PG Brazil HQ728891 HQ728966 JF267885
Glossoscolecidae 0322 Urobenus brasiliensis Brazil HQ728899 HQ728955 JF267886
Glossoscolecidae 0327 Goiascolex sp. Brazil HQ728952 JF267887
Glossoscolecidae 0329 Rhinodrilus sp. Brazil HQ728956
Glossoscolecidae 0330 Glossoscolex paulistus Brazil HQ728892 HQ728967 JF267888
Glossoscolecidae 0855 Atatina sp. Brazil HQ728900 HQ728957 JF267890
Glossoscolecidae 0862 Glossodrilus sp. Ecuador HQ728893 HQ728968 JF267889
Hormogastridae 0598 Hormogaster gallica Spain HQ728912 HQ728932 JF267891
Hormogastridae 0622 Vignysa popi France HQ728911 HQ728933 JF267892
Hormogastridae 0632 Hemigastrodrilus monicae France HQ728908 HQ728935 JF267893
Komarekionidae 0844 Komarekiona eatoni USA HQ728922 HQ728944 JF267913
Kynotidae 0821 Kynotus sp. r1 Madagascar HQ728947 JF267909
Kynotidae 0823 Kynotus sp. w Madagascar HQ728917 HQ728945 JF267910
Kynotidae 0825 Kynotus sp. lgW Madagascar HQ728918 HQ728946 JF267911
Kynotidae 0826 Kynotus sp. r2 Madagascar HQ728919 HQ728948 JF267912
Lumbricidae 0399 Bimastos zeteki USA HQ728901 HQ728940 JF267922
Lumbricidae 0405 Eisenoides_carolinensis USA HQ728903 HQ728939 JF267923
Lumbricidae 0592 Zophoscolex zhangi France HQ728906 HQ728937 JF267924
Lumbricidae 0717 Lumbricus polyphemus Hungary HQ728904 HQ728938 JF267925
Lumbricidae 0781 Allolobophora mehadiensis Romania HQ728905 HQ728936
Lumbricidae 0813 Octodrilus complanatus Cyprus HQ728902 HQ728941 JF267926
Lumbricidae Lumbricus terrestris AJ272183
Lutodrilidae 0957 Lutodrilus multivesiculatus USA HQ728910
Megascolecidae 0004 Archipheretima pandanophila Philippines HQ728882 HQ728975 JF267894
Megascolecidae 0007 Pheretima sp. 092_1 Philippines HQ728883 HQ728976 JF267927
Megascolecidae 0244 Perionyx excavatus USA HQ728977 JF267900
Megascolecidae 0389 Arctiostrotus sp. USA HQ728884 HQ728979 JF267895
Megascolecidae 0391 Toutellus sp. USA HQ728981 JF267896
Megascolecidae 0835 Perionyx sp. MG Madagascar HQ728978 JF267899
Megascolecidae 0903 Terriswalkerius sp. Australia HQ728886 HQ728974 JF267897
Megascolecidae 0917 Driloleirus sp. USA HQ728885 HQ728980 JF267898
Microchaetidae 0500 Tritogenia lunata USA HQ728916 HQ728950 JF267880
(continued next page )
216 Invertebrate Systematics S. W. James and S. K. Davidson

Table 1. (continued )

Family Individual number, taxon ID Location 18S 28S 16S

Microchaetidae 0506 Proandricus thornvillensis South Africa HQ728915 HQ728996 JF267881
Microchaetidae 0508 Parachilota sp. South Africa HQ728985 JF267869
Microchaetidae 0511 Microchaetus papillatus South Africa HQ728914 HQ728999
Microchaetidae 0516 Geogenia pandoana South Africa HQ728913 HQ729000 JF267901
Moniligastridae 0868 Drawida sp. bl Thailand HQ728930 HQ728964 JF267916
Moniligastridae 0871 Drawida sp. w Thailand HQ728928 HQ728962 JF267917
Moniligastridae 0873 Drawida sp. br Thailand HQ728929 HQ728963 JF267918
Ocnerodrilidae 0233 Ocnerodrilidae sp. PR Puerto Rico HQ728876 HQ728969 JF267905
Ocnerodrilidae 0240 Gordiodrilus elegans USA HQ728879 HQ728973 JF267902
Ocnerodrilidae 0341 Nematogenia sp. Brazil HQ728877 HQ728971 JF267903
Ocnerodrilidae 0343 Kerriona sp. Brazil HQ728878 HQ728970 JF267904
Ocnerodrilidae 0555 Ocnerodrilidae sp. South Africa HQ728972
Sparganophilidae 0411 Sparganophilus sp. GA USA HQ728921 HQ728942 JF267907
Sparganophilidae 0846 Sparganophilus sp. G2 USA HQ728943 JF267914
Sparganophilidae 0848 Sparganophilus sp. LA USA HQ728923 HQ728998 JF267915
Clitellata outgroup taxa
Enchytraeidae 0892 Enchytraeidae sp. USA HQ728931 HQ728965 JF267920
Enchytraeidae Grania variochaeta AY365459
Enchytraeidae Grania americana AY040686
Enchytraeidae Buchholzia fallax AF411895
Enchytraeidae Fridericia tuberosa AF209453
Enchytraeidae Marionina sublitoralis AY365458
Lumbriculidae Stylodrilus heringianus AF411907
Lumbriculidae Eclipidrilus frigidus AY040692
Lumbriculidae Rhynchelmis tetratheca AY365464
Lumbriculidae Lumbriculus variegatus AF209457
Haplotaxidae Haplotaxis gordioides AY365456
Tubificidae Tubificoides bermudae AF209467
Tubificidae Smithsonidrilus hummelincki AF209465
Tubificidae Thalassodrilides gurwitschi AF209466
Tubificidae Nais communis AF411878
Tubificidae Pristina longiseta AF411875
Tubificidae Heterodrilus decipiens AF209455
Tubificidae Pectinodrilus molestus AF209462
Tubificidae Bathydrilus litoreus AF209452
Tubificidae Heronidrilus heronae AF209454
Tubificidae Bothrioneurum vejdovsky AF411908
Phreodrilidae Antarctodrilus proboscidea AY365465
Phreodrilidae Insulodrilus bifidus AF411906
Propappidae Propappus volki AY365457
Capilloventridae Capilloventer australis AY365455
Branchiobdellidae Cirrodrilus sapporensis AF310698
Acanthobdellidae Acanthobdella peledina AY040680
Cambarincolidae Cambarincola pamelae AF310695
Branchiobdellidae Branchiobdella parasita AF310690
Erpobdellidae Erpobdella japonica AF116000
Glossiphoniidae Glossiphonia complanata AF099943
Glossiphoniidae Helobdella stagnalis AF115986
Haemopidae Haemopis caeca AY040687

McMahan, 1974 did not yield full 28S sequences, and we could
not locate new material.
Specimens of each field-distinguishable species were
preserved at the time of collection with fixatives appropriate
for preserving DNA and morphology of the earthworms.
Voucher specimens were fixed in neutral buffered 4%
formaldehyde – 0.17 M NaCl (PFA: Koshiba et al. 1993)
before being transferred to 80% ethanol for transport and
long-term storage at 20C. Specimens collected for DNA
extraction were preserved in 95% ethanol, 3 volumes per
volume of earthworm, which was changed two or three times
until the material was stiff. Vouchers were deposited in the
Kansas University Natural History Museum and/or repatriated
to institutions of other nations as required by their laws.
DNA extraction, gene amplification and sequencing
Body wall tissue samples of earthworms were extracted by one of
three methods: (1) DNAeasy TissueKit (Qiagen) according to the
Molecular phylogeny of earthworms Invertebrate Systematics 217

manufacturer’s instructions, (2) by sending tissues to the
Canadian Centre for DNA Barcoding for extraction and
purification according to their protocols (Ivanova et al. 2006a,
2006b), or (3) lysis in 300 mL of a solution of 100 mM NaCl,
100 mM Tris-Cl, 25 mM EDTA, 0.5% SDS at pH 8 plus 2 mL
proteinase-K (20 mg mL–1), followed by protein precipitation
with 100 mL 4 M guanidine thiocyanate in 0.1 M Tris-Cl pH 7.5,
centrifugation (5 min., 13 000 rpm), and precipitation of the
DNA from the supernatant with 300 mL cold isopropanol
( 20C), recentrifugation and a wash with 300 mL 70%
ethanol. The DNA was air-dried at ambient temperature and
resuspended in 10 mM Tris–Cl pH 8.0.
The nuclear 18S and 28S rRNA genes and a section of the
mitochondrial 16S gene were amplified with PCR primers (*)
(listed in Table 1), using 1 mL of DNA template, 2 mL of 4 mg mL–1
Bovine Serum Albumin Fraction V (Fisher BP1605), 1 mL of
DMSO, 0.58 mL of each primer solution (10 p.m. mL–1), 1.4 mL
ultrapure water and 7.29 mL Qiagen HotStarTaq master mix with
1.17 mL CoralLoad dye in a total reaction volume of 15 mL. The
thermocycle profile consisted of 4 min at 94C, then 35 cycles of
20 s at 94C, 20 s at 47C and 105 s at 72C, followed by 7 min of
final extension at 72C. The 28S gene was copied in two
overlapping sections of 1800–2000 bp using two primer pairs
listed in Table 2 using an initial denaturation of 4 min at 94C,
then 35 cycles of 30 s at 94C, 30 s at 60C and 90 s at 72C,
followed by 10 min at 72C. The ~460-bp 16S gene fragment
used the following profile: initial denaturation of 4 min at 95C,
then 35 cycles of 60 s at 94C, 60 s at 48C and 60 s at 72C,
followed by 7 min at 72C.
All primers used in sequencing are given in Table 1. All
sequencing was done at the University of Kansas Biodiversity
Institute Molecular Phylogeny Laboratory on an ABI 3730
Applied Biosystems genetic analyser or on the ABI 3130xl
machine. Sequence assembly was done manually from trace
files viewed in FINCHTV 1.4.0 (Geospiza, Inc.), assembled as
text files, strand reads aligned in CLUSTAL 2.0 (Larkin et al.
2007) and checked for errors and ambiguities by revisiting the
trace files. The resulting consensus sequences were aligned
in CLUSTAL 2.0 with default settings and manually edited
in BIOEDIT 7.0 (Hall 1999) to remove length/alignment
ambiguous regions and singleton one-base indels (these could
be the result of base call errors not detected earlier in the process).
Stringent editing of length-variable regions was applied to
sequences such that unalignable regions were eliminated from
the data matrix.
Phylogenetic analyses
We used a standard procedure for all analyses, unless otherwise
noted. Substitution models were selected by the Akaike
Information Criterion (AIC: Akaike 1973) as implemented in
JModeltest 0.1 (Posada 2008) with use of PHYML (Guindon and
Gascuel 2003). The best models all contained invariant site and
gamma parameters, and the GTR + I + G model was chosen for

Table 2. Primers used for PCR (*) and sequencing (all)

Primer Sequence Source

18sA* AAC CTG GTT GAT CCT GCC AGT Medlin et al. (1988)
18sL AGT TAA AAA GCT CGT AGT TGG Medlin et al. (1988)
18sC CGG TAA TTC CAG CTC CAA TAG Medlin et al. (1988)
18sY GTT GGT GGA GCG ATT TGT CTG Medlin et al. (1988)
18sB* AGG TGA ACC TGC GGA AGG ATC Medlin et al. (1988)
18sO AAG GGC ACC ACC AGG AGT GGA G Medlin et al. (1988)
28sC* ACCCGCTGAATTTAAGCAT Jamieson et al. (2002)
28sD2 TCCGTGTTTCAAGACGG Jamieson et al. (2002)
Po28F1 TAAGCGGAGGAggaAAAGAAAC Struck et al. (2006), modified with gga insert
28F5 CAAGTACCGTGAGGGAAAGTTG Passamaneck et al. (2004)
Po28F2 CGACCCGTCTTGAAACACGG Struck et al. (2006)
28R6 CAACTTTCCCTCACGGTACTTG Passamaneck et al. (2004)
Po28R5 CCGTGTTTCAAGACGGGTCG Struck et al. (2006)
28F1 GGGACCCGAAAGATGGTGAAC Passamaneck et al. (2004)
Po28R4 GTTCACCATCTTTCGGGTCCCAAC Struck et al. (2006)
28ee ATCCGCTAAGGAGTGTGTAACAACTCACC Hillis and Dixon (1991)
28ff* GGTGAGTTGTTACACACTCCTTAGCGG Hillis and Dixon (1991)
Po28R3* GCTGTTCACATGGAACCCTTCTCC Struck et al. (2006)
28F4 CGCAGCAGGTCTCCAAGGTGAACA GCCTC Passamaneck et al. (2004)
28R2 GAGGCTGTKCACCTTGGAGACCTG CTGCG Passamaneck et al. (2004)
28v AAGGTAGCCAAATGCCTCGTCATC Hillis and Dixon (1991)
28R3 GATGACGAGGCATTTGGCTACC Passamaneck et al. (2004)
Po28R2 CCTTAGGACACCTGCGTTA Struck et al. (2006)
28F6 CAGACCGTGAAAGCGTGGCCTATC GATCC Passamaneck et al. (2004)
Po28R1 GAACCTGCGGTTCCTCTCG Struck et al. (2006)
R3264.2 TTCTGACTTAGAGGCGTTCAG Passamaneck et al. (2004), modified here
28MSR* ACTTTCAATAGATCGCAG Mallatt and Sullivan (1998)
16sAr* CGCCTGTTTATCAAAAACAT Palumbi (1996)
16sBr* CCGGTCTGAACTCAGATCACGT Palumbi (1996)
218 Invertebrate Systematics
all genes, given the model options available in MrBayes 3.1
(Ronquist and Huelsenbeck 2003). All gene trees and
concatenated analyses were done in MrBayes 3.1 with default
priors and three heated, one cold Markov chains, running
each analysis from two random starting points for 20  106
generations, sampling trees every 10 000 generations and
discarding the first 20% as burn-in. The temperature was set to
0.10 in order to improve chain mixing. Each analysis was repeated
and the outputs combined in TRACER 1.5 (Rambaut and
Drummond 2009), with which we evaluated sampling of the
parameter distributions and convergence of the Bayesian runs.
MrBayes jobs were run on the CIPRES server (http://www.phylo.
org/portal2/).
18S gene trees were used to check the monophyly of the
Crassiclitellata with broad taxon sampling within the Clitellata.
A duplicate set of 18S analyses using the less stringent
alignment editing was performed. 28S gene sequences were
analysed separately to confirm consistency of the tree
topologies (Crassiclitellata + Moniligastridae only) between the
18S and 28S datasets.
The 18S and 28S sequences were concatenated and run in
partitioned Bayesian analyses, as were the three gene sequences
(18S, 28S, 16S). In both cases the partitions were unlinked and the
GTR + I + G model’s parameters were estimated separately by
gene. For the three-gene dataset we ran a Maximum Likelihood
(ML) 1000 bootstrap resampling analysis in RAxML (Stamatakis
2006) as implemented on the CIPRES server, using the GTR + G
substitution model and three data partitions. Maximum
parsimony analysis of the 18S + 28S + 16S dataset was done in
PAUP* (Swofford 2002) using TBR and 500 bootstrap
resamplings. We also did several Maximum Parsimony (MP)
analyses in TNT (Goloboff et al. 2003, 2008), implementing
sectorial search (RSS and XSS options), ratchet, and tree fusing
(3 rounds, TBR) in various combinations. The final analysis used
these three search types and 1000 symmetric resamplings.
In order to test Sims’ (1980) hypotheses of monophyly of
his Lumbricoidea and Glossoscolecoidea suprafamilial groups,
and Omodeo’s (2000) hypotheses of Lumbricoidea and
Eudrilidae + Moniligastridae, we ran separate Bayesian
analyses of the 18S plus 28S data matrix with topological
constraints for monophyly of the respective taxon sets for each
author’s concept of higher classification. Thus there was a ‘Sims
constraint’ run and an ‘Omodeo constraint’ run. Except for the
topological constraints, all other settings were the same as in the
main analyses, but with only 2  106 generations each. Finally,
an unconstrained analysis of 2  106 generations was also run.
The constrained trees’ statistics and the short unconstrained tree
statistics were compared with Bayes factors (Kass and Raftery
1995; Nylander et al. 2004).
Results
Phylogenies
The 18S and 28S genes of Clitellata are GC-rich, as expected from
other animal taxa. Length-variable regions were not numerous or
complex, and alignments of the 18S (1748 bp) and 28S (3170 bp)
gene sequences were straightforward. The 16S fragment had
proportionately more length-variable regions and substitutions,
leading to reduction during editing to 454 total nucleotides.
S. W. James and S. K. Davidson
All MrBayes runs converged well and, with sufficient
generation numbers, produced nearly normally distributed
parameter estimates via TRACER (Rambaut and Drummond
2009). The ML and MP analyses are summarised in
conjunction with the three gene dataset results below. The
separate 18S and 28S gene analyses (Figs 1 and 2
respectively) returned similar topologies, differing in only one
or two placements. The 18S gene tree (Fig. 1) indicates that the
Crassiclitellata (clade posterior probability PP = 0.80) is sister to
the Moniligastridae (PP = 1.0), and that these two groups form a
clade (PP = 1.0) (the Metagynophora of Jamieson 1988) nested
within the other Clitellata. Haplotaxis gordioides (Hartmann,
1821) is the sister to this clade, but with no support (PP = 0.53), so
it is better to consider the basal relationships within Clitellata
as unresolved.
In a compromise dictated by our having full data for an
enchytraeid, but not Haplotaxis, all other trees were rooted
with the Enchytraeidae. In the following summary of results,
all node labels refer to the same bipartitions across the trees.
The 28S gene tree (Fig. 2) has a modestly well supported
Crassiclitellata (node A, PP = 0.94). In the 18S + 28S combined
analysis (Fig. 3) the main body of Crassiclitellata,
Moniligastridae, and the Sparganophilidae + Komarekionidae +
Biwadrilidae + Kynotidae clade formed a basal tritomy, but all
internal nodal posterior probabilities were high (>0.95) with a few
exceptions. Nodal support was slightly higher with 18S alone and
28S alone. Weak nodes within the Crassiclitellata, regardless of
the inclusion of the 16S gene (included in Fig. 4), were the same.
Node B, connecting Sparganophilidae + Komarekionidae to
Biwadrilidae + Kynotidae, has no support (PP < 0.80) in all
combined analyses but has weak support in the 28S gene tree
(PP = 0.88). The sister group relationship of Sparganophilidae
and Komarekionidae is strong (node K, PP = 1.0) in all analyses.
The sister-group relationship of Biwadrilidae and Kynotidae is
strongly supported in the 28S gene tree (Fig. 2; PP = 1.0) but is
unsupported in the combined analyses and the 18S gene tree.
The Hormogastridae + Lumbricidae clade (Node D) has strong
support in the 28S gene tree and the 18S + 28S combined analysis
(Figs 2 and 3 Node D; PP = 1.0) in which Hemigastrodrilus is the
sister taxon to the Lumbricidae (Figs 2 and 3; PP > 0.98). In these
two trees the Hormogastridae is paraphyletic, but in Fig. 4 the
placement of Hemigastrodrilus is unresolved. The only other
node with PP < 0.9 in all analyses is node G connecting the
Almidae as sister taxon to all higher-branching clades.
Except for the basally placed branches leading to the
Sparganophilidae + Komarekionidae + Biwadrilidae + Kynotidae
group and the Lumbricidae + Hormogastridae + Criodrilidae,
most other nodes (E to J) lead to a single-family lineage split
from the main lineage, with uppermost diverging families
Megascolecidae, Acanthodrilidae and ‘Octochaetidae’ (marked
with asterisks) and Benhamiinae grouping as closely related. The
Acanthodrilidae is paraphyletic by the nesting of Megascolecidae
within an Acanthodrilidae (s.l.) clade. The 28S gene tree (Fig. 2)
had a monophyletic Megascolecidae (Node M, PP = 1.0) and
a paraphyletic Acanthodrilidae composed of a polytomy.
Within the acanthodriline worms a more resolved topology
was obtained from the combined analyses (Fig. 3, 18S + 28S;
Fig. 4, 18S + 28S + 16S), consisting of the Benhamiinae (Node L,
PP = 0.87 or PP = 1.0 respectively in Figs 3 and 4), a New World
Molecular phylogeny of earthworms Invertebrate Systematics 219

Phreodrilidae (Fig. 4), with one exception, that Biwadrilus was placed as the
Proppapus volki sister to the clade (Kynotus (Komarekiona (Sparganophilus)))
1.0 rather than as sister to Kynotus. However, in both ML and
Hirudinida
Bayesian analyses the nodes involved (node B and
0.57 Lumbriculidae
0.61 0.74 neighbouring node) are unresolved. In all other nodes on the
Acanthobdellida
ML tree support values are comparable to or lower than those
1.0 Branchiobdellida of the Bayesian analysis, and are included on Fig. 4.
MP analyses in PAUP* and TNT returned a topology strongly
1.0 Enchytraeidae supportive of the Crassiclitellata (Fig. 5; 99.8% and 100%,
PAUP* and TNT respectively) and of the family-level groups
indicated in Fig. 4, but with poor resolution of the basal
1.0 relationships among families or sets of families. The PAUP*
Tubificidae tree was 6906 steps long, compared to the 6834 steps from TNT
but the topologies were the same, allowing for consensus tree
collapse of nodes of <50% support. The Almidae is weakly placed
1.0 Eudrilidae as sister to the Pontoscolecidae rather than in an intermediate
position between the latter family and the Glossoscolecidae,
while the Glossoscolecidae is sister (~80%) to the clade
Benhamiinae
indicated at Node I of Fig. 4. The Criodrilus–Hormogastridae–
0.86
Ocnerodrilidae Lumbricidae clade (99%) is supported but internal relationships
0.99
are not, with even the Lumbricidae at a feeble 70% or 49%
support. Although the Megascolecidae has strong support,
relationships among the Acanthodrilidae and Megascolecidae
1.0
represented here are unresolved, the two sets of Acanhthodrilidae
1.0
Acanthodrilidae
are moderately supported (70–86%) and the combined clade of
these two families plus the Benhamiinae is 84% or 94%. The
1.0
Megascolecidae MP analyses agree with the ML analysis on the placement of
Biwadrilus, with similar support levels.
0.64 1.0
Glossoscolecidae Tests of phylogenetic hypotheses using constrained
1.0
Almidae
topologies
Bayes Factor (BF) calculations (Kass and Raftery 1995; Nylander
"Glossoscolecidae"
0.83
et al. 2004) indicate very strong support (BF > 150: Kass and
Raftery 1995) for the null hypothesis given by the unconstrained
Lutodrilidae trees (Table 3) compared with the trees given by the analyses
0.80
Criodrilidae constrained for the classifications of Sims (1980) and Omodeo
1.0 Lumbricidae
(2000). Omodeo’s superfamily Lumbricoidea includes
Hormogastridae
Ailoscolecidae
Glossoscolecidae among others in the Sims Glossoscolecoidea,
0.80
as well as his expanded Criodrilidae (Omodeo 2000). The other
1.0 constraint in the Omodeo trees was to enforce monophyly of the
Microchaetidae
Eudrilidae + Moniligastridae, in keeping with his hypothesis
1.0 1.0
Kynotidae (Omodeo 2000) that the Crassiclitellata is polyphyletic at least
0.67Komarekionidae by the independent origin of the Eudrilidae from Moniligastridae-
1.0
0.90 Sparganophilidae like ancestors. With a BF of 68.52, Omodeo’s concept is strongly
0.53 Biwadrilus bathybates
1.0 Moniligastridae
rejected in favour of that of Sims, but both are inferior to the
Haplotaxis gordioides unconstrained tree.
Capilloventer australis
0.03 Discussion
Fig. 1. 18S gene tree Bayesian phylogram showing relationships among Clitellata relationships
earthworm families. Branch lengths are drawn proportional to the expected
The resolution of the Crassiclitellata based on our expanded set
number of substitutions per site and measured with the scale bar. Numbers
above nodes are posterior probabilities.
of gene characters also contributed a little to understanding of
the broader Clitellata relationships. The 18S rRNA gene
tree offers strong support for the Moniligastridae as the sister
acanthodriline clade (PP = 1.0; Diplocardia, Neotrigaster) taxon to the Crassiclitellata, and thus for the monophyly of
and a Southern Hemisphere acanthodriline clade (PP = 1.0; the Metagynophora of Jamieson (1988). Erséus and Källersjö
Diplotrema, Acanthodrilidae sp. from Madagascar). (2004) and Siddall et al. (2001) had essentially the same result,
The ML analysis of the full dataset in RAxML returned a monophyly of Metagynophora, without any moniligastrids in
topology virtually identical to that of the Bayesian analysis their datasets. Erséus and Källersjö (2004) and Siddall et al.
220 Invertebrate Systematics S. W. James and S. K. Davidson

1.0 Drawida sp. w

1.0
Drawida sp. bl
Drawida sp. br
K 1.0 Sparganophilus sp. G1
1.0 Sparganophilus sp. G2
1.0 Sparganophilus sp. L
K
Komarekiona eatoni
0.88 1.0 Kynotus sp. w1
B 0.95 Kynotus sp. r1
1.0 Kynotus sp. r2
1.0 Kynotus sp. w2
Biwadrilus bathybates
Tritogenia lunata
1.0 Proandricus thornvillensis
0.64
Microchaetus papillatus
1.0 Geogenia pandoana
1.0
Estherella sp.
0.55
Goiascolex sp.
0.64
1.0 Andiorrhinus sp.
1.0 Urobenus brasiliensis "Glossoscolecidae"
1.0
Rhinodrilus sp.
Pontoscolex spiralis
Atatina sp.
0.92

0.72
Polytoreutus finni
1.0 Hyperiodrilus africanus
E 1.0 Eudriloides sp.
A Hyperiodrilus sp.
0.94
0.90 Ocnerodrilidae sp.
1.0 Kerriona sp.
1.0 Nematogenia sp.
0.95
0.99 Ocnerodrilidae sp.
Gordiodrilus elegans
I Terriswalkerius sp.
0.99 Archipheretima pandoana
1.0
Pheretima sp.
1 .0

M
1.0 Perionyx excavatus
F Perionyx sp. MG
1.0 0.78
0.94

J 0.96 Arctiostrotus sp.

Driloleirus sp.
1.0 Toutellus sp.
1.0
Neotrigaster rufa*
Diplocardia conoyeri
0.89 Dichogaster sp. Fiji*
H 1.0 Dichogaster sp. Dom*
0.75
0.93
C Dichogaster saliens*
0.59 0.99
Dichogaster sp. Kenya* Benhamiinae
L
0 .72

0.52 Dichogaster sp. Gabon*

Benhamia sp.*
1.0
Millsonia sp.*
Parachilota sp.
G 0.97
Diplotrema sp.
0.74 0.95 Acanthodrilidae sp. MG

Benhamiona sp.* Benhamiinae

1.0 Fimoscolex sp.
1.0 Glossoscolex paulistus Glossoscolecidae
Glossodrilus sp.
1.0 Glyphidrilus sp.
Alma sp.
Hemigastrodrilus monicae
Allolobophora mehadiensis
0.85

0.98 Lumbricus polyphemus

1.0 0.91
Eisenoides carolinensis
1.0

1.0 Bimastos zeteki

D
1.0

Octodrilus complanatus
Zophoscolex zhangi
Hormogaster gallica
1.0 Vignysa popi
0.95 Ailoscolex lacteospumosus
Enchytraeidae sp.
0.04

Fig. 2. 28S gene tree Bayesian phylogram showing relationships among earthworm families. Branch lengths are drawn
proportional to the expected number of substitutions per site and measured with the scale bar. Numbers above nodes are posterior
probabilities. Node labels are consistent across Figs 2–4. Taxa marked with an asterisk (*) are the Octochaetidae of some authorities.
Molecular phylogeny of earthworms Invertebrate Systematics 221

1.0 Sparganophilus sp. G

1.0
K Sparganophilus sp. L
Komarekiona eatoni
0.6 Kynotus sp. w
B 1.0
1.0 Kynotus sp. r
0.81 Kynotus sp. wl
Biwadrilus bathybates
1.0 Drawida sp. w
1.0 Drawida sp. br
Drawida sp. bl
Tritogenia lunata
1.0
Proandricus thornvillensis
1.0
Microchaetus papillata
0.95 Geogenia pandoana
1.0 Estherella sp.
0.98 1.0 Andiorrhinus sp.
E
1.0
Pontoscolex spiralis
0.91
Urobenus brasiliensis
Atatina sp.
1.0 Glyphidrilus sp.
F Alma sp.
0.99 1.0 Fimoscolex sp.
1.0 Glossoscolex paulistus
G Glossodrilus sp.
0.86
1.0
Polytoreutus finni
Eudriloides sp.
1.0
0.67 Hyperiodrilus sp.
H Hyperiodrilus africanus
1.0
0.89 Ocnerodrilidae sp.
1.0 Kerriona sp.
1.0 Nematogenia sp.
I Gordiodrilus elegans
1.0
Terriswalkerius sp.
1.0
1.0 Archipheretima pandanophila
C 1.0
M Pheretima sp.
0.98
1.0 1.0 Arctiostrotus sp.
J 0.79
Driloleirus sp.
0.99 Neotrigaster rufa*
1.0
Diplocardia conoyeri
Acanthodrilidae sp. MG
1.0
Diplotrema sp. AUS
0.88 Dichogaster sp. Fiji*
0.88 Dichogaster saliens*
1.0
Dichogaster sp. Kenya*
0.70
0.87 L Dichogaster sp. Gabon*
Benhamia sp. Ghana*
1.0
Millsonia sp. Ghana*
Hemigastrodrilus monicae
Allolobophora mehadiensis
0.93

1.0 Lumbricus polyphemus

0.98
1.0 Eisenoides carolinensis
1.0 Bimastos zeteki
1.0
D1.0 Octodrilus complanatus
Zophoscolex zhangi
Hormogaster gallica
1.0 Vignysa popi
1.0 Ailoscolex lacteospumosus
Enchytraeidae sp.
0.03

Fig. 3. 18s + 28S partitioned analysis Bayesian phylogram showing relationships among earthworm families.
Branch lengths are drawn proportional to the expected number of substitutions per site and measured with the scale
bar. Numbers above nodes are posterior probabilities. Taxa marked with an asterisk (*) are the Octochaetidae of
some authorities.
222 Invertebrate Systematics S. W. James and S. K. Davidson

Atatina sp.
1.0 0.66/ 65
Urobenus brasiliensis
100 1.0 Estherella sp. PONTOSCOLECIDAE
1.0
100
100 Andiorrhinus sp.
1.0/69 Pontoscolex spiralis
F 1.0 Glyphidrilus sp.
Alma sp. ALMIDAE
100
1.0 Glossodrilus sp.
100 11.0 Glossoscolex paulistus GLOSSOSCOLECIDAE
G 100 Fimoscolex sp.
0.90/65 Hyperiodrilus sp.
0.98/76 Polytoreutus finni
1 .0
H
1.0 Eudriloides sp. EUDRILIDAE
98 100
Hyperiodrilus africanus
1.0 Gordiodrilus elegans
100 1.0 Nematogenia sp. OCNERODRILIDAE
100 Kerriona sp.
1.0/ I
94
0.57/56 Ocnerodrilidae sp.
1.0/86 Neotrigaster rufa*
Diplocardia conoyeri ACANTHODRILIDAE
1.0/60 E 0.90/
1 .0 46 1.0 Driloleirus sp.
100 J 100 Arctiostrotus sp.
1.0/ MEGASCOLECIDAE
M 1.0 Pheretima sp.
92
1.0/ 86 100 Archipheretima pandanophila
1.0/ 84 Terriswalkerius sp.
Acanthodrilidae sp. MG
0.99/77
Diplotrema sp. AUS ACANTHODRILIDAE
1.0/89 Dichogaster sp. Gabon*
0.92/58 Dichogaster sp. Fiji*
1.0/
97 Dichogaster saliens* BENHAMIINAE*
1.0/94
1.0/90 L
Dichogaster sp. Kenya*
1.0/59 1.0 Millsonia sp. Ghana*
C 100 Benhamia sp. Ghana*
1.0 Geogenia pandoana
1.0 100 0.97/68
Microchaetus papillatus MICROCHAETIDAE
100
Proandricus thornvillensis
Tritogenia lunata
Ailoscolex lacteospumosus
0.84/52
Vignysa popi
0.90/54 HORMOGASTRIDAE
Hormogaster gallica
0.63/ Hemigastrodrilus monicae
0.52/16 42
A 0.93/ 60
Bimastos zeteki
Lumbricus polyphemus LUMBRICIDAE
1.0 0.99/92
1.0 100 Eisenoides carolinensis
100
D Octodrilus complanatus
1.0/70
Allolobophora mehadiensis
1.0/ 85
Zophoscolex zhangi
Criodrilus lacuum CRIODRILIDAE
1.0 Komarekiona eatoni KOMAREKIONIDAE
100
K Sparganophilus sp. G
1.0/97 SPARGANOPHILIDAE
Sparganophilus sp. L
B 0.64/na
1.0 Kynotus sp. wl
100 1.0/100 Kynotus sp. r KYNOTIDAE
0.58/na Kynotus sp. w
Biwadrilus bathybates BIWADRILIDAE
1.0 Drawida sp. bl
100 1.0 Drawida sp. br
MONILIGASTRIDAE 99 Drawida sp. w
Enchytraeidae sp.
0.07

Fig. 4. 18S + 28S + 16S partitioned analysis Bayesian phylogram showing relationships among earthworm families. Branch lengths are
drawn proportional to the expected number of substitutions per site and measured with the scale bar. Numbers above nodes are posterior
probabilities/bootstrap support from RAxML analysis. Taxa marked with an asterisk (*) are the Octochaetidae of some authorities.

(2001) found the Enchytraeidae to be the sister to Crassiclitellata, sampling within earthworms. In our trees including additional
based on 18S rRNA and mt COI genes. However, these analyses Clitellata we see that Enchytraeidae are nested within a clade that
did not include the Moniligastridae, nor did they have broad joins a basal polytomy in the Clitellata. However, this is not a
Molecular phylogeny of earthworms Invertebrate Systematics 223

Enchytraeidae sp.
96 Drawida sp. w
100 97 Drawida sp. br
100 Drawida sp. bl
100 Glyphidrilus sp.
100 Alma sp.
64 99 Estherella sp.
82 99 Andiorrhinus sp.
52 94 77 Urobenus brasiliensis
99 94 Pontoscolex spiralis
100
Atatina sp.
Hormogaster gallica
Vignysa popi
Hemigastrodrilus monicae
99 Ailoscolex lacteospumosus
99 Allolobophora mehadiensis
71 Zophoscolex zhangi
49 87 Lumbricus polyphemus
51 87 Eisenoides carolinensis
100 5 Bimastos zeteki
100
Octodrilus complanatus
Criodrilus lacuum
100 Sparganophilus sp. G
100 100 Sparganophilus sp. L
54 100
80 Komarekiona eatoni
49 Kynotus sp. w
72 77
100 83 100 70 Kynotus sp. r
100 67 100 Kynotus sp. wl
Biwadrilus bathybates
82 Proandricus thornvillensis
100 71 Microchaetus papillatus
98 100 Geogenia pandoana
98 Tritogenia lunata
73 Eudriloides sp.
100 49 62 Hyperiodrilus sp.
100 44 Polytoreutus finni
Hyperiodrilus africanus
100
Ocnerodrilidae sp.
100 100 62 Nematogenia sp.
50 54 Kerriona sp.
100
33 Gordiodrilus elegans
97 Archipheretima pandanophila
88 98 Pheretima sp.
94 88 Terriswalkerius sp.
100 97 100 Arctiostrotus sp.
100 100 Driloleirus sp.
62 76 87 Neotrigaster rufa
54 79 83 Diplocardia conoyeri
79 71 Acanthodrilidae sp. MG
80 85 68 Diplotrema sp. AUS
94 52 Dichogaster sp. Fiji
83 32 Dichogaster sp. Gabon
93 96 Dichogaster saliens
68
97 Dichogaster sp. Kenya
76
99 Benhamia sp. Ghana
100 Millsonia sp. Ghana
100 Fimoscolex sp.
98 100 Glossoscolex paulistus
98 Glossodrilus sp.

Fig. 5. 18S + 28S + 16S maximum parsimony analysis in PAUP* and TNT. Branch lengths are not to scale. Nodal support values are bootstrap
percentages (PAUP*) above the branches and symmetric resampling percentages (TNT) below the branches.

definitive placement of the Enchytraeidae, and the relationships
within Clitellata are quite unresolved. This analysis also provides
no support for the classical hypothesis that the Crassiclitellata are
derived from the Haplotaxidae. The ordinal taxon Haplotaxida, as
presently understood, could be polyphyletic and should be
provisionally abandoned in favour of the Metagynophora,
which is supported.
Relationships within the Crassiclitellata
The superfamilies
The phylogenetic hypotheses presented here (Figs 2–5)
support some long-held relationships within earthworms, and
reject others, while providing support for one new family-level
taxon discussed below. Omodeo’s (2000) hypothesis, based on
224 Invertebrate Systematics
Table 3. Bayes factor comparisons of 18S + 28S trees constrained for
suprafamilial concepts of Sims (1980) or the suprafamilial concepts and
Crassiclitellata polyphyly of Omodeo (2000)
Each cell value was calculated by subtracting the total harmonic mean
likelihood score of the row constraint analysis (null hypothesis) from a
column constraint analysis. Only positive values are shown
Alternate hypothesis
Null hypothesis Sims Omodeo Unconstrained
constraints constraints
Sims constraints 0 68.52 – (1988). Given the large geographic disjunction between Japan
Omodeo constraints – 0 –
Unconstrained 165.55 234.14 0
morphological features, that Crassiclitellata are polyphyletic
and originated from three non-crassiclitellate ancestors, is not
supported, but neither is it firmly rejected given that support for
the Crassiclitellata node is PP = 0.80 in Bayesian analysis, but
near 100% in MP. Nevertheless it would be hard to reconcile
Omodeo’s hypothesis with the strongly supported internal nodes
of the Crassiclitellata. There are only a few cases for ranks above
family level. Sims’ Megascolecoidea is a monophyletic group,
and includes Eudrilidae, Ocnerodrilidae, Megascolecidae,
Acanthodrilidae and Octochaetidae. Two of the polyfamilial
superfamilies defined by Sims (1980) were rejected by Bayes
Factor comparisons with an unconstrained tree. Unsupported
superfamilies included the Glossoscolecoidea, which grouped
Almidae, Glossoscolecidae, Kynotidae and Microchaetidae
by ovarian morphology. Instead, the Kynotidae appear
basally (Bayes) or unresolved (ML, MP) in a group with
the Komarekionidae, Sparganophilidae and Biwadrilidae. The
Microchaetidae is closest to the Lumbricidae/Hormogastridae
clade and does not appear within the Glossoscolecoidea
regardless of ovarian morphology. If mapped onto the trees
given in Fig. 3 or 4, the defining state of the ovarian
morphology must have been lost three times, or evolved
independently twice and lost once. The two scenarios are
equally parsimonious. Sims’ Lumbricoidea included the
Sparganophilidae and Komarekionidae, which by
unconstrained analyses are not in a clade with the Lumbricidae
and his other Lumbricoidea. A revised Lumbricoidea should
include the Lumbricidae, Hormogastridae, Ailoscolecidae,
Criodrilidae and Lutodrilidae. The superfamily Criodriloidea
is nested within the revised Lumbricoidea, and the
Biwadriloidea has an unresolved position close to Kynotidae,
Sparganophilidae and Komarekionidae. Therefore these two very
small superfamilies should be disregarded.
Small basal crassiclitellate families
The Sparganophilidae, Komarekionidae, Biwadrilidae and
Kynotidae (Node B) form a group of relict families that
appears as sister to all other earthworms, although the sister
relationship is without strong support in any analyses except
the 18s gene tree (Fig. 1, PP = 0.92). The node is absent in the ML
and MP analyses because Biwadrilidae is placed as sister to the
remaining three. If this holds up in future analyses, it refutes
several previous placements of these families. A notable example
S. W. James and S. K. Davidson
is the placement of the monotypic Japanese Biwadrilidae as sister
taxon of Kynotidae (a Madagascar endemic), which previously
was hypothesised to be allied to Microchaetidae and
Glossoscolecidae. Kynotidae is excluded from a close
relationship with Microchaetidae by the strong support
(PP = 1.0) for Nodes C and E, but its placement in relation to
the Biwadrilidae is unresolved, as is the placement with regard to
the clade composed of Sparganophilidae and Komarekionidae
(Node K, PP = 1.0). Biwadrilidae and Kynotidae were
considered close in the morphological analysis of Jamieson
and Madagascar, Biwadrilidae and Kynotidae could be relicts
of taxa long vanished from other land areas. Consistently, but with
no support, they are close to the families Sparganophilidae and
Komarekionidae. Biwadrilus was moved from the Criodrilidae
to its own family Biwadrilidae by Jamieson (1971), and later
returned to the Criodrilidae by Blakemore (2006). According
to our molecular data analyses, the Criodrilidae is sister to the
Lumbricidae + Hormogastridae clade. Therefore we remove
Biwadrilidae from the synonymy of Criodrilidae.
The placement of the Sparganophilidae as the sister taxon
of Komarekionidae is strongly supported by our data and by
Jamieson et al. (2002). Sparganophilidae are mud-dwelling
worms of fresh water margins and lake bottoms, while
Komarekiona eatoni Gates, 1974 lives in mesic forest soils of
the central Appalachian Mountains. Sparganophilidae has
variously been placed in an expanded concept of the
Glossoscolecidae (e.g. Jamieson 1971) or within a superfamily
Lumbricoidea (Sims 1980; Qiu and Bouché 1998; Omodeo
2000). However, these placements are not supported by the
molecular data, and neither is the hypothesised synonymy of
Komarekionidae and Ailoscolecidae by Sims (1980) and Qiu
and Bouché (1998). Instead, Komarekionidae is quite
phylogenetically distant from Ailoscolecidae (their common
ancestor is the common ancestor of the Crassiclitellata clade),
the latter nested within the Hormogastridae with strong support
(Node D; PP = 1.0).
Certain morphological similarities of Komarekiona eatoni to
Ailoscolex lacteospumosus Bouché, 1969, have contributed to
ambiguity in estimating the relatedness of these two families.
K. eatoni differs in the location of its single esophageal gizzard
as compared to the two of Ailoscolex, but is similar in having
many small prostatoid glands (possibly non-homologous to the
Ailoscolex glands) associated with the ventral setae in the
reproductive segments. Many other earthworms have glands
associated with setae used in copulation, so this could be
parallel evolution and not a uniting character. The two species
are completely unlike one another in general aspect and ecology.
K. eatoni is an unpigmented earthworm of unremarkable
appearance and lives as an epiendogeic in forest soils, while
A. lacteospumosus is very delicate, short and thick, and appears
to inhabit deeper soil layers exclusively.
A revised Lumbricoidea
As mentioned above, a new concept of Lumbricoidea
should include Ailoscolecidae, Lumbricidae, Hormogastridae,
Criodrilidae and, tentatively, Lutodrilidae. The inclusion of
Ailoscolecidae within the Lumbricidae–Hormogastridae–
Molecular phylogeny of earthworms
Criodrilidae (Node D), instead of being allied with
Komarekionidae, is strongly supported by the molecular data.
There is morphological support for this placement as well, the
Ailoscolecidae and Hormogastridae differing mainly in the
presence of prostatoid glands in the former, and of a
rudimentary intestinal gizzard in the latter (Sims 1980;
Omodeo 2000). Hormogastridae and Lumbricidae are usually
considered closely related and both are European (except for two
North American lumbricid genera, Eisenoides and Bimastos, both
in the taxon sample). The hormogastrid genus Hemigastrodrilus
is placed as sister to the Lumbricidae, with weak nodal support,
but consistently across many analyses. This placement would
render the Hormogastridae paraphyletic, and so would the
retention of family status for the Ailoscolecidae. On the basis
of our results, we advocate placing Ailoscolecidae in the
synonymy of Hormogastridae.
Stephenson (1930) suggested a relationship between the
Lumbricidae and Criodrilidae, which is consistent with the
molecular data analysis placing Criodrilidae as sister to
the Hormogastridae + Lumbricidae (Figs 3 and 4), but conflicts
with placement of Criodrilus in Almidae (Jamieson 1988). Qiu
and Bouché (1998) considered Criodrilus lacuum Hoffmeister,
1845 a hormogastrid secondarily adapted to aquatic life. The
topology does not support the implied evolutionary history
because Criodrilus is placed basal to the Hormogastridae.
With only partial sequence data for C. lacuum, the grouping of
C. lacuum with the Lumbricidae and Hormogastridae is tentative,
but strongly supported and unlikely to change with additional
sequence data.
The South African Microchaetidae is most closely related to
the Lumbricoidea as defined here and sister to all higher-placed
families. Within the Microchaetidae, Tritogenia is basal to the
other sampled genera, and is morphologically distinct from other
Microchaetidae by having multiple nephridia per segment
(meronephric) and having an unusually short, thick body form.
A revised Megascolecoidea
The superfamily Megascolecoidea (sensu Sims 1980),
containing the Megascolecidae, Octochaetidae, Acanthodrilidae,
Eudrilidae and Ocnerodrilidae, is a monophyletic group (nodal
support >0.9 except in MP analyses) but with internal
relationships that demand further consideration. The only
character known to be constant across the Megascolecoidea is
the shape of the ovaries (Sims 1980). This could be a
synapomorphy uniting the families in Sims’ concept of the
superfamily but we prefer to examine the morphological
and genetic data independent of any superfamily concept.
Stephenson (1930) considered the Eudrilidae to have been
derived from megascolecoid ancestors, but several
morphological features and the phylogenies strongly suggest
that the reverse is true (Figs 2–4). The findings indicate that
ancestors of the Eudrilidae diverged before the emergence of
the Megascolecidae + Acanthodrilidae + Ocnerodrilidae clade,
undermining the doubtful homology of certain eudrilid
features to those of the Megascolecoidea. The eudrilid
euprostates, for example, are implied as homologous to the
prostates of other megascolecoid families, but have a distinct
structure from the other prostate glands found in the rest of
Invertebrate Systematics 225
the Megascolecoidea. In contrast to the megascolecid and
acanthodrilid glandular prostates connected to the exterior by a
duct, the eudrilid euprostates have large muscular ejaculatory
bulbs with resemblance to the copulatory sacs or pouches in
Glossoscolex of Glossoscolecidae. These ejaculatory structures
of Eudrilidae and Glossoscolecidae both have the male ducts
joining the muscular bulb. Their similarities indicate a close
relationship between the Glossoscolecidae and the Eudrilidae,
as noted by Benham (1895). The more likely hypothesis is
that the prostate glands of Acanthodrilidae, Octochaetidae,
Megascolecidae and Ocnerodrilidae are an innovation arising
on the way to Node J.
In addition to the euprostates, paired dorsal calcium carbonate
glands are found in one of segments 12 or 13 in both Eudrilidae
and Glossoscolecidae. In both families the glands have
complex internal tubules. Furthermore, there are structures in
Glossoscolex and Fimoscolex that have possible homologues of
the complex ovarian and spermathecal systems of Eudrilidae,
including modified septa surrounding segment 13, with pouches
containing spermatozoa-like material (Bartz et al. in press),
and flat subneural sacs on the body wall in segments 13–14
of a Fimoscolex sp. These morphological data complement
the molecular data, suggesting a close relationship of the
Glossoscolecidae to the Eudrilidae.
As would be expected from the phylogenies, the
Ocnerodrilidae shares morphological characters with the
Eudrilidae, but also with the megascolecid–acanthodrilid
group. The Eudrilidae (Paraeudrilinae) lacks the paired dorsal
esophageal glands in the area of segments 12 and 13, as does
the Ocnerodrilidae, a possible indication of affinity. Both the
Eudrilidae and Ocnerodrilidae have suboesophageal sacs in
some or all of segments 9–11, of very similar form. These are
paired in most, but not all, Ocnerodrilidae, and unpaired in the
Eudrilidae. Beddard (1895) thought there might be a close
relationship between these two taxa. However, Eudriloides,
the one paraeudriline genus in the taxon sample, is no closer
to the Ocnerodrilidae than the other Eudrilidae included. It is
possible that the Paraeudrilinae is polyphyletic, and by chance
we obtained a genus that is more distant to the Ocnerodrilidae.
Additional sampling is needed to test the hypothesis that
the Ocnerodrilidae is sister taxon to at least some of the
Paraeudrilinae. The Ocnerodrilidae and Eudrilidae are likely to
have diverged long ago. The Ocnerodrilidae occur naturally in
South America, Africa and India, suggesting that the family
diverged from the common ancestor with Eudrilidae well
before the break-up of Gondwana.
As was the case in Stephenson’s (1930) derivation of the
Eudrilidae from megascolecoids, Michaelsen’s (1935)
hypothesis that the Eudrilidae is derived from Ocnerodrilidae
is rejected by the placement of Eudrilidae basal to the
Ocnerodrilidae–Megascolecidae–Acanthodrilidae clade, a
placement in agreement with recent and traditional phylogenies.
A more limited Megascolecoidea consisting of Ocnerodrilidae,
Octochaetidae, Acanthodrilidae and Megascolecidae was
proposed by Omodeo (2000). Here we support Omodeo’s
limited concept of Megascolecoidea, but with the elimination of
the Octochaetidae. Besides the ovarian morphology cited by Sims
(1980), an apparent synapomorphy of this superfamily is the
presence of prostate glands associated with the male pores, and
226 Invertebrate Systematics
together present a variety of male genital fields characterised as
acanthodrilin (plus the reduced versions microscolecin and
balantin) or megascolecin. The Ocnerodrilidae is separated from
the other three families by the latter having a pair of hearts in
segment 12 (and often 13), the relocation of the segment of
intestinal origin to 15 or later, and the loss of the ocnerodrilin
calciferous glands.
The problematic Acanthodrilidae, Megascolecidae
and Octochaetidae
The remaining three megascolecoid families have been
problematic in the history of earthworm systematics. From
here on, let it be clear that we advocate an Acanthodrilidae
sensu latu that corresponds to the Acanthodrilinae sensu
Jamieson (2000, 2001) and Jamieson and Ferraguti
(2006). This concept of Acanthodrilidae combines the
Acanthodrilidae, Octochaetidae and Exxidae Blakemore, 2000.
In the taxon sample, Octochaetidae is indicated by asterisks (*) in
Table 1 and the figures. The Exxidae is a subset of these, here
represented by Neotrigaster rufa. Both the Octochaetidae and
Exxidae will be lumped into the Acanthodrilidae in the following
discussion.
The Megascolecidae is either sister to the Acanthodrilidae
(Jamieson et al. 2002; Buckley et al. 2011) or nested within the
Acanthodrilidae (Figs 2–5). Within the megascolecid and
acanthodrilid genera, Figs 3 and 4 show four well supported
clades, one composed of meronephric Benhamiinae (sensu
Csuzdi 1996), one composed of the Megascolecidae (sensu
Blakemore 2000) or Megascolecinae sensu Jamieson and
Ferraguti (2006), and two others being variously composed of
other Acanthodrilidae and either Octochaetidae or Exxidae. Even
though we did not have material from the diverse ‘Octochaetidae’
of the Indian subcontinent, it is clear that the Octochaetidae,
as usually defined, is polyphyletic, and the family was rejected
by Dyne and Jamieson (2004). Within the taxon set of this
paper, Octochaetidae is represented by the Benhamiinae
(Node L, PP 0.87) and Neotrigaster rufa (unless one places
it in the Exxidae), which falls in a sparsely sampled New
World clade (PP = 1.0) with Diplocardia conoyeri Murchie,
1961 (Acanthodrilidae s.l.). Buckley et al. (2011) has a
polyphyletic Octochaetus, the type genus of the (meronephric)
Octochaetidae, placed within a clade of holonephric New
Zealand Acanthodrilidae. Therefore, if the Octochaetidae is to
be retained, it could be restricted to a part of Octochaetus.
Neotrigaster has been transferred by Blakemore (2000) to
Exxidae, a family erected to remove acanthodrilin worms
with racemose prostates and multiple nephridia from the
Octochaetidae. We will return to the Exxidae question below.
Buckley et al. (2011) had the same placement of
Benhamiinae in relation to the other Acanthodrilidae as we
have here, as the sister taxon to all other Acanthodrilidae (plus
Megascolecidae in the present case) (Figs 3, 4), though the
node was not supported by the less extensive dataset of
Buckley et al. (2011). It may be premature to include the
holonephric genera Neogaster, Omodeona, Pickfordia,
Wegeneriella and Wegeneriona in Benhamiinae, because we
do not have them represented in the taxon sample. Blakemore
(2005) considers this inclusion by Csuzdi ‘unacceptable’ but
gives no reasons for preferring the condition of the nephridia over
S. W. James and S. K. Davidson
the condition of the calciferous glands as indicators of phylogeny.
The calciferous gland structure of these five genera is very similar
to that of the meronephric genera in Benhamiinae. Multiplication
of nephridia has taken place in several acanthodrilid and
megascolecid lineages, suggesting that the character is not as
stable as one might prefer for the basis of a classification. Given
the consistent support for the monophyly of Benhamiinae, we
favour the use of this subfamily name and it may merit elevation
to family rank.
There are two clades within the remaining sampled
Acanthodrilidae, one of which is represented here by
Australian, South African (Parachilota: Fig. 2 only) and
Malagasy taxa, and the other by North American taxa.
Neotrigaster rufa is a Puerto Rican endemic with multiple
nephridia per segment and two pairs of racemose prostates
discharging separately from the male pores, at the ends of
seminal grooves (the acanthodrilin male field configuration).
The nephridial character has been used to place Neotrigaster
in the Octochaetidae, a decision our data do not support, because
N. rufa is in a strongly supported (PP = 1.0) clade with
Diplocardia. Blakemore (2000), in an attempt to deal with the
combined acanthodrilin male field plus racemose prostate
‘problem’ posed by Exxus wyensis, erected the family Exxidae
and transferred N. rufa and other acanthodrilid worms (mostly
Neotropical) with racemose prostates to the Exxidae. Racemose
prostates were a problem because they were previously known
only from (some or all, depending on whose) Megascolecidae.
It seems simpler to afford racemose prostates less weight, in
recognition that evolution of complex prostates from simple ones
has taken place several times in the history of megascolecoid
earthworms. Therefore we propose to remove Neotrigaster and
the related genera Trigaster and Zapatadrilus from the Exxidae,
perhaps transferring them to a revived Diplocardiinae (the revival,
though differently constituted, also suggested by Blakemore
(2005) – see below) and leave the status of the Exxidae until
such time as someone actually finds a specimen of Exxus wyensis
and obtains molecular data from it.
A taxonomic solution suggested by Blakemore (2005) might
be to resurrect the Diplocardiinae, which could include the
North American Acanthodrilidae with multiple gizzards,
including Diplocardia, but we would add at least the
trigiceriate Neotrigaster and Trigaster (see Figs 3, 4 and
Buckley et al. 2011). This leaves the question of what to do
with the numerous, unsampled Acanthodrilidae of Mexico
and central America, some of which do (e.g. Zapatadrilus,
Zapotecia and Protozapotecia) and some of which do not
(e.g. Larsonidrilus, Balanteodrilus, Ramiellona) have multiple
gizzards. The Diplocardiinae concept we support includes
meronephric and holonephric genera, in contrast to that
indicated by Blakemore (2005), who would restrict it to
holonephric genera. However the lack of data on
Acanthodrilidae makes us cautious about further taxonomic
rearrangements of acanthodrilid earthworms, pending sampling
of more taxa, particularly Acanthodrilus.
The Megascolecidae representatives in the taxon set were
collected in the Philippines, Australia, and North America, each
being endemic to its location. The attempts to provide stable
diagnostic characters for the Megascolecidae have been fraught
with problems. Sims (1980) and Csuzdi (2010) based the family
on the racemose prostate glands without a central lumen, but this
Molecular phylogeny of earthworms
is not universally adopted nor is it supported here. One section of
the Megascolecidae clearly does have racemose prostates, an
Australasian clade including Pheretima, but its North American
sister group does not. What they have in common is male and
prostatic ducts united on segment 18, a character state that is not
universal among the racemose prostate genera of Australasia.
Several genera not included here (among them New Zealand
Megascolides and Spenceriella) have tongue-shaped prostates
without a central lumen but do not have externally evident
branching, as is seen among the pheretimoid genera (Sims
and Easton 1972) and some others. Gates (1972) advocated a
distinction between racemose prostates of mesodermal origin
(his Megascolecidae) and non-racemose prostates of ectodermal
origin (his Acanthodrilidae + Octochaetidae). For the present we
agree with Blakemore’s (2000) and Jamieson and Ferraguti’s
(2006) Megascolecidae (-inae) concept, which includes diverse
prostate gland types, whose ducts generally are joined by the
sperm ducts in combined male and prostatic pore(s) on segment
18 or nearby. It seems rather obvious that the evolution of
prostate glands in the Megascolecidae and Acanthodrilidae
(s.l.) has been more complex than convenient to taxonomists.
Any modifications of the Megascolecidae are prevented by
our lack of material from South Asia, where there are many
Megascolecidae, including the type genus Megascolex.
Revising the Glossoscolecidae
A salient departure from traditional classification is the strong
support for a polyphyletic Glossoscolecidae, indicated in Figs 2
and 3 with the family containing the type genus, Glossoscolex
Leuckart, 1835, remaining as Glossoscolecidae, but the other
glossoscolecid clade indicated as ‘Glossoscolecidae’. The
Almidae, removed from the Microchaetidae by Jamieson
(1988), is closely related to both the Glossoscolecidae and
the ‘Glossoscolecidae’, but the topology obtained in all
analyses is one of two most parsimonious solutions to the
evolution of calcium carbonate glands and male terminalia
in the Glossoscolecidae (s.s) and the Eudrilidae. The
Glossoscolecidae type of calcium carbonate gland and male
terminalia are lacking in the Almidae and ‘Glossoscolecidae’.
An equally parsimonious dichotomous tree would have the
‘Glossoscolecidae’ as sister taxon to the Almidae. The two
divisions of the former Glossoscolecidae are distinct, well
supported clades (nodal support values > 0.99), as is the
Almidae. This division is supported by morphological
distinctions as well. The Glossoscolecidae sensu strictu
share the form and placement of paired esophageal calcium
carbonate glands plus the presence of conspicuous male pores,
usually with muscular ejaculatory bulbs commonly called
copulatory pouches. Typhlosolar development typically does
not involve a very deep simple lamina, but complex folding
of a more compact lamina. The ‘Glossoscolecidae’ is more
diverse in esophageal calcium carbonate gland number and
structure, the male pores are minute and superficial, or within
an intramural invagination, and never with the muscular bulbs.
If a typhlosole is present it typically consists of an S-curved
(in transverse section) lamina that can exceed the intestinal
diameter in depth. For these reasons we propose a new family
as follows:
Invertebrate Systematics 227
Family PONTOSCOLECIDAE James, 2012, fam. nov.
Type genus: Pontoscolex Schmarda, 1861.
Type species: Lumbricus corethrurus Müller, 1857.
Definition
Crassiclitellata with one oesophageal gizzard in vi; paired,
extramural calciferous glands in some or all of segments
vii–xiv; typhlosole ribbon-shaped, variously folded or
pouched. Vascular system, with dorsal and ventral trunks,
supraoesophageal trunk, paired extraoesophageal trunks
median to the hearts, subneural vessel adherent to body wall.
Holonephrida stomate, vesiculate in intestinal region. Dorsal
pores lacking. Spermathecae, adiverticulate, in front of the
gonadal segments. Male pores behind female pores,
microscopic if primary; or if macroscopic then connected to
intramural copulatory chambers.
Included genera
Aicodrilus, Alexidrilus, Andiodrilus, Andiorrhinus, Andioscolex,
Annadrilus, Anteoides, Anteus, Aptodrilus, Atatina, Aymara,
Botarodrilus, Bribri, Chibui, Cirodrilus, Diachaeta,
Estherella, Eudevoscolex, Goiascolex, Hexachyloscolex,
Inkadrilus, Langioscolex, Maipure, Martiodrilus, Meroscolex,
Nouraguesia, Onoreodrilus, Onychochaeta, Opisthodrilus,
Periscolex, Perolofius, Pontoscolex, Pseudochibui, Quimbaya,
Randdrilus, Rhinodrilus, Tairona, Tamayodrilus, Thamnodriloides,
Thamnodrilus, Tuiba, Tupinaki, Urobenus, Zongodrilus.
Pontoscolex is the oldest described genus in the family and
contains the most common member of the family, P. corethrurus.
This species is among the most common earthworms in tropical
climates, having been introduced accidentally to all tropical
climate regions.
Family GLOSSOSCOLECIDAE Michaelsen, 1900; emend.
James 2012
Type genus: Glossoscolex Leuckart, 1835
Type species: Glossoscolex giganteus Leuckart, 1835
Definition
Crassiclitellata with one esophageal gizzard in vi; a single pair of
extramural calciferous glands of intertwined tubular type in
segment xi or xii, typhlosole topologically a blade, but with an
anterior section in which zig-zag folds have been ventrally fused
and folded over to form lateral pockets. Vascular system, with
dorsal and ventral trunks, a supraoesophageal trunk, paired
extraoesophageal trunks median to the hearts, and a subneural
adherent to the body wall. Holonephrida stomate, vesiculate in
intestinal region. Dorsal pores lacking. Spermathecae, when
present, adiverticulate and in front of the gonadal segments.
Male pores, behind female pores, macroscopic and then
connected to intracoelomic muscular ejaculatory bulbs that
receive the vasa deferentia.
Included genera
Diaguita, Enantiodrilus, Fimoscolex, Glossodrilus, Glossoscolex,
Holoscolex, and Righiodrilus.
This restricted sense of Glossoscolecidae is exclusively South
American except for a few Glossodrilus outliers in Central
228 Invertebrate Systematics
America and the Caribbean islands Dominica and Martinique
(Fragoso et al. 1995).
Conclusion
The following observation made over 50 years ago deserves wider
circulation:
‘L’évolution n’a aucune raison de faciliter notre travail de
classement’ – F. Grandjean (1954) (Evolution has no
reason to facilitate our work of classification.)
The molecular phylogenies we present here are a work in
progress. We were fortunate to obtain reasonably well supported
topologies with a few genes and a limited but broad taxon sample.
Within each of the diverse families, as opposed to the
monogeneric ones, considerable additional taxon sampling is
necessary to develop hypotheses about the phylogeny and
patterns of morphological evolution within each group. Across
all families, it will be useful to obtain additional sequence data
from genes appropriate to the resolution of relatively deep
branching points. The 28S gene appears to be quite useful in
this regard but needs additional support from other loci. We have
no easy way to calibrate a molecular clock for earthworms, there
being no fossil record and only the coarse resolution of major
tectonic movements of the last 200 million years. Regardless, it is
apparent from a few pre- and post-Gondwanan vicariance events
that most of the divergences in earthworms are quite old: Buckley
et al. (2011) found that within–New Zealand clades were as old as
most continental clades, so minimally ~70 million years within
the New Zealand Acanthodrilidae. Therefore for resolutions
among family levels, gene choice should focus on conserved
protein-coding regions of the nuclear genome. This will be the
focus of our future work on phylogeny of the Clitellata.
Acknowledgments
This research was funded by United States National Science Foundation
Award DEB-0516439 (James) and 0516520 (Davidson). At the University of
Kansas, Mike Grose of the Biodiversity Institute Molecular Phylogeny
Laboratory gave us his full cooperation, as did Paulyn Cartwright, who
generously provided laboratory space, and Daphne Fautin, who provided
logistical support and leadership in the Division of Invertebrate Zoology.
Danuta Plisko, Victor Pop, Csaba Csuzdi, Marcel Bouché, Robert Blakemore,
Tomas Pavlicek, Raylton Sumrall, Somsak Panha, Munir Abdullah Dawood,
Alfonso Alonso of The Smithsonian Institution’s Gamba Protected Areas
Project, Malalatiana Razafrindrakoto, George Brown, Nicolas Pinel, Pattana
Somniyam, Barrie Jamieson and numerous other people provided assistance
in diverse ways, such as organising and guiding collection trips, collecting
specimens for us, or participating in field work with the first author in the
extensive travel necessary to complete this research. All collecting was done
under appropriate permits for the countries involved. Charlène Briard alerted
us to the Grandjean (1954) quote. We dedicate this paper to Pietro Omodeo,
with whose phylogenetic conclusions we respectfully disagree, but who is
among the most kindly, generous and knowledgeable of men.
References
Akaike, H. (1973). Information theory as an extension of the Maximum
Likelihood principle. In ‘Second International Symposium Information
Theory’. (Eds N. Petrov and F. Csaki.) pp. 267–281. (Akademiai Kiado.)
Bartz, M. L. C., James, S. W., Pasini, A., and Brown, G. G. (in press). New
species of Glossoscolex Leuckart, 1835 and Fimoscolex Michaelsen, 1900
(Clitellata: Glossoscolecidae) from Northern Paraná, Brazil. Zootaxa.
S. W. James and S. K. Davidson
Beddard, F. E. (1895). ‘A Monograph of the Order Oligochaeta.’ xii + 769
pp. (Clarendon Press: Oxford.)
Bely, A. E., and Wray, G. A. (2004). Molecular phylogeny of naidid
worms (Annelida: Clitellata) based on cytochrome oxidase I.
Molecular Phylogenetics and Evolution 30, 50–63. doi:10.1016/
S1055-7903(03)00180-5
Blakemore, R. J. (2000). ‘Tasmanian Earthworms.’ CD-ROM Monograph
with Review of World Families. (VermEcology Kippax: Canberra.)
Blakemore, R. J. (2005). Whither Octochaetidae? – its family status
reviewed. In ‘Advances in Earthworm Taxonomy. II. Proceedings of
the 2nd International Oligochaete Taxonomy Meeting’. (Eds A. A. and
V. V. Pop.) pp. 63–84. (Cluj University Press: Romania.)
Blakemore, R. J. (2006). Review of Criodrilidae (Annelida: Oligochaeta)
including Biwadrilus from Japan. Opuscula Zoologica Budapest 37,
11–22.
Blakemore, R. J. (2008). ‘Cosmopolitan Earthworms – an Eco-Taxonomic
Guide to the Species.’ 3rd edn. (VermEcology: Yokohama, Japan.)
Buckley, T. R., James, S., Allwood, J., Bartlett, S., Howitt, R., and Prada, D.
(2011). Phylogenetic analysis of New Zealand earthworms (Oligochaeta:
Megascolecidae) reveals ancient clades and cryptic taxonomic diversity.
Molecular Phylogenetics and Evolution 58, 85–96. doi:10.1016/
j.ympev.2010.09.024
Csuzdi, C. (1996). Revision der Unterfamilie Benhamiinae Michaelsen, 1897
(Oligochaeta: Acanthodrilidae). Mitteilungen aus dem Museum für
Naturkunde in Berlin. Zoologisches Museum und Institut für Spezielle
Zoologie (Berlin) 72, 347–367. doi:10.1002/mmnz.19960720219
Csuzdi, C. (2010). A monograph of the Paleotropical Benhamiinae
earthworms (Annelida: Oligochaeta, Acanthodrilidae). Pedozoologica
Hungarica 6, Hungarian Natural History Museum, Budapest.
Dyne, G. R., and Jamieson, B. G. M. (2004). Native earthworms of Australia
II (Megascolecidae, Acanthodrilinae). ABRS, Australian Government
Department of Environment and Heritage. CD-ROM.
Erséus, C. (2005). Phylogeny of oligochaetous Clitellata. Hydrobiologia
535/536, 357–372. doi:10.1007/s10750-004-4426-x
Erséus, C., and Källersjö, M. (2004). 18S rDNA phylogeny of Clitellata
(Annelida). Zoologica Scripta 33, 187–196. doi:10.1111/j.1463-6409.
2004.00146.x
Fragoso, C., James, S. W., and Borges, S. (1995). Native earthworms of
the north Neotropical region: current status and controversies. In
‘Earthworm Ecology and Biogeography in North America’. (Ed.
P. Hendrix.) pp. 67–115. (CRC Press: Boca Raton, FL.)
Gates, G. E. (1972). Burmese earthworms, an introduction to the systematics
and biology of megadrile oligochaetes with special reference to south-east
Asia. Transactions of the American Philosophical Society 62(7), 1–326.
doi:10.2307/1006214
Gates, G. E. (1976). On earthworm ovaries and their importance in megadrile
systematics. I. Megadrilogica 2(12), 1–2.
Goloboff, P. A., Farris, J. S., and Nixon, K. C. (2003). Tree analysis using new
technology. Willi Hennig Society version, available at www.zmuc.dk/
public/phylogeny/tnt [verified June 2012]
Goloboff, P. A., Farris, J. S., and Nixon, K. C. (2008). TNT, a free program
for phylogenetic analysis. Cladistics 24, 774–786. doi:10.1111/j.1096-
0031.2008.00217.x
Grandjean, F. (1954). Essai de classification des Oribates (Acariens). Bulletin
de la Societe Zoologique de France 78, 421–446.
Guindon, S., and Gascuel, O. (2003). A simple, fast, and accurate algorithm to
estimate large phylogenies by maximum likelihood. Systematic Biology
52, 696–704. doi:10.1080/10635150390235520
Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment
editor and analysis program for Windows 95/98/NT. Nucleic Acids
Symposium Series 41, 95–98.
Hillis, D. M., and Dixon, M. T. (1991). Ribosomal DNA: molecular
evolution and phylogenetic inference. Quarterly Review of Biology 66,
411–453.
Molecular phylogeny of earthworms
Ivanova, N. V., deWaard, J. R., and Hebert, P. D. N. (2006a). An inexpensive,
automation-friendly protocol for recovering high-quality DNA.
Molecular Ecology Notes 6, 998–1002. doi:10.1111/j.1471-8286.2006.
01428.x
Ivanova, N. V., deWaard, J. R., and Hebert, P. D. N. (2006b). CCDB DNA
Extraction. http://www.dnabarcoding.ca/CCDB_DOCS/CCDB_DNA_
Extraction.pdf [Verified June 2012]
Jamieson, B. G. M. (1971). Glossoscolecidae. In ‘The Aquatic Oligochaeta of
the World’. (Eds R. O. Brinkhurst and B. G. M. Jamieson.) pp. 147–199.
(Oliver and Boyd: Edinburgh, Toronto.)
Jamieson, B. G. M. (1988). On the phylogeny and higher classification of
the Oligochaeta. Cladistics 4, 367–401. doi:10.1111/j.1096-0031.1988.
tb00520.x
Jamieson, B. G. M. (2000). The native earthworms of Australia
(Megascolecidae Megascolecinae). (Science Publishers: Enfield, NH.)
(CD-ROM).
Jamieson, B. G. M. (2001). The native earthworms of Australia
(Megascolecidae Megascolecinae). Supplement. (B. G. M. Jamieson,
Department of Zoology and Entomology, University of Queensland,
Brisbane.) (CD-ROM).
Jamieson, B. G. M., and Ferraguti, M. (2006). Non-leech Clitellata. In
‘Reproductive biology and phylogeny of Annelida’. (Eds G. Rouse,
and F. Pleijel.) pp. 235–392. (Science Publishers: Enfield, NH.)
Jamieson, B. G. M., Tillier, S., Tillier, A., Justine, J.-L., Ling, E., James, S.,
MacDonald, K., and Hugall, A. F. (2002). Phylogeny of the
Megascolecidae and Crassiclitellata (Annelida, Oligochaeta): combined
versus partitioned analysis using nuclear (28S) and mitochondrial (12S,
16S) rDNA. Zoosystema 24, 707–734.
Kass, R. E., and Raftery, A. E. (1995). Bayes factors. Journal of the American
Statistical Association 90, 773–795. doi:10.2307/2291091
Koshiba, M., Ogawa, K., Hamazaki, S., Sugiyama, T., Ogawa, O., and
Kitajima, T. (1993). The effect of formalin fixation on DNA and the
extraction of high-molecular weight DNA from fixed and embedded
tissues. Pathology, Research and Practice 189, 66–72.
Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A.,
McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R.,
Thompson, J. D., Gibson, T. J., and Higgins, D. G. (2007). Clustal W
and Clustal X version 2.0. Bioinformatics (Oxford, England) 23,
2947–2948. doi:10.1093/bioinformatics/btm404
Lee, K. E. (1959). The earthworm fauna of New Zealand. New Zealand
Department of Scientific and Industrial Research Bulletin, Vol. 130.
Mallatt, J., and Sullivan, J. (1998). 28S and 18S ribosomal DNA sequences
support the monophyly of lampreys and hagfishes. Molecular Biology and
Evolution 15, 1706–1718.
Medlin, L., Hille, J. E., Shawn, S., and Sogin, M. L. (1988). The
characterization of enzymatically amplified eukaryotic 16S-like
rRNA-coding regions. Gene 71, 491–499. doi:10.1016/0378-1119(88)
90066-2
Michaelsen, W. (1900). Oligochaeta. Tierreich 10, xxix + 1–575.
Michaelsen, W. (1919). Über die Beziehungen der Hirudineen zu den
Oligochaeten. Mitteilungen aus dem Naturhistorischen Museum
Hamburg 36, 131–153.
Michaelsen, W. (1935). Oligochaten von Belgisch-Kongo. III. Revue de
Zoologie et de Botanique Africaines 29, 37–74.
www.publish.csiro.au/journals/is
Invertebrate Systematics 229
Nylander, J. A. A., Ronquist, F., Huelsenbeck, J. P., and Nieves Aldrey, J. L.
(2004). Bayesian phylogenetic analysis of combined data. Systematic
Biology 53, 47–67. doi:10.1080/10635150490264699
Omodeo, P. (1998). History of Clitellata. The Italian Journal of Zoology
65, 51–73. doi:10.1080/11250009809386726
Omodeo, P. (2000). Evolution and biogeography of megadriles (Annelida,
Clitellata). The Italian Journal of Zoology 67, 179–201. doi:10.1080/
11250000009356313
Palumbi, S. R. (1996). Nucleic acids II: the polymerase chain reaction. In
‘Molecular Systematics’. (Eds D. M., Hillis, C. Moritz, and B. K. Mable.)
pp. 205–247. (Sinauer & Associates: Sunderland, MA.)
Passamaneck, Y. J., Schander, C., and Halanych, K. M. (2004). Investigation
of molluscan phylogeny using large-subunit and small-subunit nuclear
rRNA sequences. Molecular Phylogenetics and Evolution 32, 25–38.
doi:10.1016/j.ympev.2003.12.016
Posada, D. (2008). jModelTest: phylogenetic model averaging. Molecular
Biology and Evolution 25, 1253–1256. doi:10.1093/molbev/msn083
Qiu, J.-P., and Bouché, M. B. (1998). Révisions des taxon supraspécifiques
de Lumbricoidea. Documents Pédozoologiques et Intégrologiques 3,
179–216.
Rambaut, A., and Drummond, A. J. (2009). MCMC Trace Analysis Tool,
Version v1.5.0. http://beast.bio.ed.ac.uk/ [verified June 2012]
Ronquist, F., and Huelsenbeck, J. P. (2003). MrBayes3: Bayesian
phylogenetic inference under mixed models. Bioinformatics 19,
1572–1574.
Siddall, M. E., Apakupakul, K., Burreson, E. M., Coates, K. A., Erséus, C.,
Källersjö, M., Gelder, S. R., and Trapido-Rosenthal, H. (2001). Validating
Livanow: molecular data agree that leeches, branchiobdellidans and
Acanthobdella peledina are a monophyletic group of oligochaetes.
Molecular Phylogenetics and Evolution 21, 346–351. doi:10.1006/
mpev.2001.1021
Sims, R. W. (1980). A classification and the distribution of earthworms,
suborder Lumbricina (Haplotaxida: Oligochaeta). Bulletin of the British
Museum (Natural History). Zoological Series 39, 103–124.
Sims, R. W., and Easton, E. G. (1972). A numerical revision of the
earthworm genus Pheretima auct. (Megascolecidae: Oligochaeta) with
the recognition of new genera and an appendix on the earthworms
collected by the Royal Society North Borneo Expedition. Biological
Journal of the Linnaean Society 4, 169–268.
Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood–based
phylogenetic analyses with thousands of taxa and mixed models.
Bioinformatics 22, 2688–2690. doi:10.1093/bioinformatics/btl446
Stephenson, J. (1930). ‘The Oligochaeta.’ (Clarendon Press: Oxford.)
Struck, T. H., Purschke, G., and Halanych, K. M. (2006). Phylogeny of
Eunicida (Annelida) and exploring data congruence using a Partition
Addition Bootstrap Alteration (PABA) approach. Systematic Biology 55,
1–20.
Struck, T. H., Paul, C., Hills, N., Hartmanns, S., Hösel, C., Kube, M., Liebs, B.,
Meyers, A., Tiedemann, R., Purschke, G., and Bleidorn, C. (2011).
Phylogenomic analyses unravel Annelida evolution. Nature 471,
95–98. doi:10.1038/nature09864
Swofford, D. L. (2002). ‘PAUP*. Phylogenetic Analysis Using Parsimony
(*and Other Methods). Version 4.’ (Sinauer Associates: Sunderland,
MA.)