Journal of Virological Methods 182 (2012) 1–8

Contents lists available at SciVerse ScienceDirect

Journal of Virological Methods

journal homepage: www.elsevier.com/locate/jviromet

Development of an in vitro system to measure the sensitivity to the antiviral Mx

protein of fish viruses
Katherine Lester, Malcolm Hall, Katy Urquhart, Suresh Gahlawat 1 , Bertrand Collet ∗
Marine Scotland, Marine Laboratory, 375 Victoria Road, Aberdeen AB11 9DB, United Kingdom

a b s t r a c t

Article history: Mx is a structural protein, induced by type I interferon (IFN), with direct antiviral properties. In fish
Received 18 November 2011 the inherent contribution of Mx protein to viral protection is unknown. The transgenic Chinook salmon
Received in revised form 12 January 2012 embryonic (CHSE)-TOF cell line was genetically modified to express the rainbow trout Mx (rbtMx1) pro-
Accepted 16 January 2012
tein under the control of the tetracycline derivative, doxycycline (DOX). Two clones CHSE-TOF-MX8 and
Available online 1 March 2012
CHSE-TOF-MX10 were isolated and characterised by qPCR. The level of resistance to Infectious Pancreatic
Necrosis Virus (IPNV), Salmon Alphavirus (SAV), Infectious Haematopoietic Necrosis Virus (IHNV) and
Keywords:
Epizootic Haematopoietic Necrosis Virus (EHNV) of the CHSE-TOF, CHSE-TOF-MX8 and CHSE-TOF-MX10
Mx protein
Interferon
cell lines cultivated with and without DOX was measured. A novel method was established to measure
Salmon accurately the level of sensitivity of any given viral isolate to Mx protein. IPNV and SAV viruses were
Tet-Off highly sensitive to the presence of rbtMx1 in the cells whereas IHNV and EHNV showed partial resistance
Viral resistance suggesting contrasting viral evasion strategies between these categories of viruses.
Crown Copyright © 2012 Published by Elsevier B.V. All rights reserved.

1. Introduction range of RNA viruses. It accumulates in the cytoplasm of IFN-treated

Mx is an antiviral protein that was discovered initially as an
agent conferring protection to myxoviridae (Haller et al., 1979,
1980; Horisberger et al., 1980; Lindenmann, 1964; Staeheli et al.,
1986). In mice, disruption of the single Mx1 gene causes complete
loss of innate immunity against mouse-adapted influenza virus,
leading to overwhelming infection and rapid death (Haller, 1981;
Haller et al., 1998).
The Mx gene is induced by type I interferon (IFN) the main
cytokine regulating innate antiviral immune functions (see for
review, Arnheiter et al., 1990; Haller et al., 2007a,b). In fish, IFN
activity has been detected for decades and a gene encoding IFN
was isolated for the first time in 2003 in zebrafish (Altmann et al.,
2003). Before the discovery of the IFN genes, Mx was used as a
marker of the presence of IFN by measurement of the induction of
its gene. Mx is a member of dynamin superfamily of large GTPase
characterised by a large molecular weight (75 kDa), and the abil-
ity to self-assemble (Haller et al., 2007a,b; Lee and Vidal, 2002). In
humans, MxA was found to have antiviral activity against a wide
∗ Corresponding author at: Immunology and Infection, Marine Scotland, Marine
Laboratory, PO Box 101, 375 Victoria Road, Aberdeen AB11 9DB, United Kingdom.
Tel.: +44 01224 425512; fax: +44 01224 295511.
E-mail address: Bertrand.Collet@scotland.gsi.gov.uk (B. Collet).
1
Permanent address: Department of Biotechnology, Chaudhary Devi Lal Univer-
sity, Sirsa-125055, India.
cells, associating partly with the endoplasmic reticulum. It inter-
feres with the transport of the Bunyavirus nucleocapsid protein
(N) to the Golgi apparatus where the virus assembles naturally
and also prevents the incoming Thogoto virus nucleocapsids from
being transported into the nucleus, the site of viral transcription
and replication (Kochs and Haller, 1999a,b). However, the contri-
bution of the Mx protein to the general IFN-dependent protection
against viruses is not clear and very little is known on the inher-
ent ability of teleost Mx protein to prevent viral replication. The
artificial over expression of Mx gene in mammalian and fish cells
has been shown to confer resistance to a wide range of viruses. In
fish, over expression of the Mx gene has provided different levels
of resistance to Infectious Pancreatic Necrosis Virus (IPNV), Infec-
tious Salmon Anaemia Virus (ISAV), and sole aquabirnavirus in the
Chinook salmon embryonic (CHSE) cell line (Larsen et al., 2004;
Fernández-Trujillo et al., 2008; Kibenge et al., 2005), reovirus in
rare minnow (Su et al., 2009), Hirame rhabdovirus (HIRRV) and
Viral Hemorrhagic Septicaemia Virus (VHSV) in the Hirame Natu-
ral Embryo (HINAE) cell line (Caipang et al., 2003), Yellow Grouper
Nervous Necrosis Virus (YGNNV) in grouper brain 3 (GB3) cells
(Lin et al., 2006), and nodavirus in grouper fin cells GF-1 (Chen
et al., 2008). In contrast, it does not provide good protection against
Infectious Haematopoietic Necrosis Virus (IHNV) in CHSE cells
(Trobridge et al., 1997) or against iridovirus in a baramundi cell line,
cBB (Wu and Chi, 2007). Silencing experiments have also demon-
strated the involvement of Mx protein in protection against viral
nervous necrosis (VNN), nodavirus and IPNV in cBB cells (Wu et al.,

0166-0934/$ – see front matter. Crown Copyright © 2012 Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.jviromet.2012.01.014
2 K. Lester et al. / Journal of Virological Methods 182 (2012) 1–8

Table 1
Names and sequences of all primers used in this study.

Name Function Sequence 5 –3 % efficiency

MX1F1 GCAGTGGGCATCAGATAGCAGAAA
MX1F2 CTTGCTTTTTATTTAGGTTGTATC
Amplification of the full length Mx ORF
MX1R1 CAGCAGGAATATAAGCCACAAGTT
MX1R2 TTATCAGGCAGGTTCCCACTCCAC
MX1MLUIF GGGGGGACGCGTATGAATAATACGCTCAACCAA
Subcloning into pTRE2-hyg
MX1SALIR GGGGGGTCGACTAGAACTCAACTAGGTAGCT
TRE2F AAAGTGAAAGTCGAGCTCGGTACC
Sequencing
TRE2R CACCCTGAAAACTTTGCCCC
ELF-F CCCCTCCAGGACGTTTACAAA 98.3
ELF-R qPCR housekeeping control CACACGGCCCACAGGTACA
ELF-p (MGB) 6FAM-ATCGGTGGTATTGGAAC
tMX-F GATGCTGCACCTCAAGTCCTACTA 87.7
qPCR verification of level of MX expression in
tMX-R CGGATCACCATGGGAATCTGA
CHSE-TOF-MX clones
tMX-p (MGB) 6FAM-CTGGATATCCAGTCAGCGTC

2010; Wu and Chi, 2007). These independent studies are based on
different fish species, cellular systems and methods. It is therefore
difficult to compare the levels of resistance against different viruses
conferred by Mx.
In rainbow trout, three Mx isoforms have been isolated among
which is rbtMx1. When over-expressed in CHSE-214 cells, rbtMx1
is located in the cytoplasm (Trobridge and Leong, 1995; Trobridge
et al., 1997). It shares 99% sequence identity with the rbtMx3 iso-
form and relates to the Atlantic salmon Mx1 and Mx2, respectively
(Robertsen et al., 1997) and its gene has been used as a marker
for IFN activity in fish for many years (Collet et al., 2003; McBeath
et al., 2007). Based on their sub cellular localisation, rbtMx1 and 3
and Atlantic salmon Mx1 and Mx2, are more related to the human
MxA, than to the MxB (Altmann et al., 2004).
In order to study the inherent role of Mx protein in the cellular
protection against a wide range of viruses, a CHSE inducible cell
line expressing the rainbow trout Mx1 gene encoding for the rain-
bow trout Mx1 isoform (rbtMx1) was established. The comparison
of viral sensitivity of these new cell lines gives some novel infor-
mation on the contribution of Mx protein to the viral resistance in
salmonids.
2. Materials and methods
2.1. Cell culture
The recombinant cell line CHSE-TOF (Collet and Lester, 2011a)
was grown as monolayer in Eagle’s Minimum Essential Medium
(Life Technologies, Paisley, UK) supplemented with 10% foetal
bovine serum (FBS, PAA Laboratories, Pasching, Austria), 20 mM
l-glutamine (Life Technologies, Paisley, UK) and 500 ␮g/ml G418
(Life Technologies, Paisley, UK). Stable cell lines CHSE-TOF-MX8
and CHSE-TOF-MX10 were selected and maintained in the above
medium supplemented with 16 ␮g/ml Hygromycin (Sigma, Irvine,
UK) and 1 ␮g/ml DOX (Sigma, Irvine, UK). To induce Mx protein in
CHSE-TOF-MX8 or CHSE-TOF-MX10 DOX was omitted.
2.2. Construction of the pTRE2hyg-rbtMx1 plasmid
The full coding region from the rbtMx1 was obtained by 3
rounds of PCR amplification using the high fidelity antibody-based
Hot Start KOD DNA PCR kit (Takara Bio Europe/Clontech, Saint-
Germain-en-Laye, France). The reaction mix was as follows in a
25 ␮l reaction: 2.5 ␮l 10× buffer for KOD Hot Start DNA poly-
merase, 1.5 ␮l 25 mM MgSO4 , 2.5 ␮l 2 mM each dNTP, 0.75 ␮l
10 ␮M each primer, 1 ␮l template, 0.5 ␮l 1 U/␮l KOD Hot Start
DNA polymerase and 15.5 ␮l PCR grade water. The sequences of
primers used (designed from Genbank OMU30253) and cycling
condition are given in detail in Tables 1 and 2, respectively.
The template for the first round PCR was a pool of cDNA made
from RNA purified from kidney from two rainbow trout infected
with VHSV. The first round of PCR was carried out with MX1F1
and MX1R1 primers generating a 2.2 kb fragment that was sepa-
rated on a 1% Agarose–Ethidium Bromide gel, excised and purified
using MiniElute purification kit according to the manufacturer’s
instructions (Qiagen, Crawley, UK). The second round of PCR was
performed with MX1F2 and MX1R2 primers on un-diluted purified
first round PCR product as template, generating a 2.1 kb fragment
that was separated and purified as described above. The third
round was carried out on un-diluted second round PCR product
as template and with the primers MX1MLUIF and MX1SALIR con-
taining a MluI and SalI restriction site, respectively. It generated a
1.8 kb fragment that was separated and purified as described above.
Two microlitres of purified PCR product was digested overnight at
37 ◦ C with MluI and SalI (Promega, Southampton, UK) alongside the
pTRE2hyg plasmid (Takara Bio Europe/Clontech, Saint-Germain-
en-Laye, France). Both digested fragments were separated, purified
from gel as described above and ligated using the T4 DNA ligase
and 2× ligation mix (Promega) at 16 ◦ C for 16 h. TOP10 compe-
tent cells (Life Technologies, Paisley, UK) were transformed using
5 ␮l of the ligation mix and plated on LB-Agar 100 ␮g/ml Ampi-
cillin plates. In parallel, TOP10 cells were transformed with 1 ␮l of
pTet-Off and pTRE2hyg-Luc vectors (Takara Bio Europe/Clontech,

Table 2
Primer combinations and cycling protocols used in this study for plasmid construction and sequence verification.

Use Primers Cycling protocol

Forward Reverse 1 cycle 35 cycles 1 cycle 1 cycle

Round I PCR MX1F1 MX1R1 95 ◦ C 95 ◦ C 53.7 ◦ C

Round II PCR MX1F2 MX1R2 2 min 30 s 10 s 70 ◦ C 70 ◦ C 4 ◦C
Round III PCR MX1MLUIF MX1SALIR 60 ◦ C 10 s 45 s 10 min hold
Screening PCR TRE2F MX1SALIR 55.7 ◦ C 10 s

Sequencing TRE2F TRE2R According to manufacturer’s instructions (Beckman Coulter)

 K. Lester et al. / Journal of Virological Methods 182 (2012) 1–8
Saint-Germain-en-Laye, France). Colonies were screened by PCR
(Biotaq PCR kit, Bioline, London, UK) with the primers and condi-
tions given in Tables 1 and 2, respectively. Plasmids were purified
from 3 ml of LB medium containing 100 ␮g/ml Ampicillin with the
Miniprep kit (Qiagen, Crawley, UK) according to the manufacturer’s
instructions. The inserts were partially sequenced with primers
given in Tables 1 and 2 and using the GenomeLabTM DTCS Quick
Start Kit (Beckman Coulter, High Wycombe, UK). Sequencing reac-
tions were run on a QE8000 capillary sequencer (Beckman Coulter,
High Wycombe, UK).
After sequence verification, a clone was used to inoculate 300 ml
LB broth with 100 ␮g/ml Ampicillin. A solution of plasmid free of
endotoxins (pTRE2hyg-rbtMx1, pTet-Off and pTRE2hyg-Luc) was
produced using the Endofree Maxiprep kit (Qiagen, Crawley, UK)
according to the manufacturer’s instructions.
2.3. Isolation of CHSE-TOF-MX8 and CHSE-TOF-MX10 cell lines
CHSE-TOF cells were detached by Trypsin–EDTA (Life Technolo-
gies, Paisley, UK) action and pelleted by centrifugation at 4200 × g
for 5 min, washed once with culture medium and twice with phos-
phate buffered saline (PBS, Life Technologies, Paisley, UK). The
pellet was drained and re-suspended in solution R (Neon kit,
Life Technologies, Paisley, UK) at a density of 1.5 × 107 cells/ml.
pTRE2hyg-rbtMx1 plasmid was added to half of the cell suspension
at a concentration of 0.2 ␮g/␮l and the other half was left without
any DNA as a mock-transfected control. Two transfections were car-
ried out in a Neon® Transfection System (Life Technologies, Paisley,
UK) using a Neon® Transfection System 10 ␮L Kit (Life Technolo-
gies, Paisley, UK) set to 2 pulses for 20 ms at 1300 V, according to
prior optimisation trials for CHSE (data not shown). The two sets
of transfected cells were added to 5 ml of medium supplemented
with 16 ␮g/ml hygromycin (Sigma, Irvine, UK) and 1 ␮g/ml DOX
(Sigma, Irvine, UK) in a 20 cm diameter Petri dish (Nunc, Roskilde,
Denmark).
2.4. Quantitative real-time PCR (qPCR) characterisation of
transgenic cell lines
The transcription activity of the transgene was measured by
qPCR. Each CHSE-TOF-MX clone was seeded and cultured with or
without DOX in a 6-well plate for 72 h. The total RNA was purified
using the RNA/DNA/Protein purification kit (Qiagen, Crawley, UK).
The Mx expression levels relative to elongation factor 1 ␣ gene (ELF)
were measured by qPCR in CHSE-TOF-MX clones.
RNA was reverse transcribed to cDNA using the TaqMan®
Reverse Transcription Reagent kit (Life Technologies, Paisley,
UK) with oligo-d(T)16 as follows: 9.625 ␮l of total RNA (approx.
0.5 ␮g) and 1.25 ␮l 50 ␮M oligo-d(T)16 were mixed and heated
to 70 ◦ C for 10 min and chilled on ice. The final volume was
adjusted to 25 ␮l by adding Master mix comprising the fol-
lowing: 1× RT buffer (25 mM Tris–HCl pH 8.3, 37.5 mM KCl,
5.5 mM MgCl2 ), 0.5 mM each dNTP, 0.4 U RNase inhibitor and
1.25 U Multiscribe Reverse Transcriptase. Reactions were incu-
bated at 48 ◦ C for 90 min, heat inactivated at 95 ◦ C for 5 min
and stored at −80 ◦ C until use. For each sample, a mock reac-
tion “no RT” control was made by omitting the Multiscribe
Table 3
Taxonomy information on the viruses used in this study.
Full name
Infectious Pancreatic Necrosis Virus
Salmon Alpha Virus
Infectious Haematopoeitic Necrosis Virus
Epizootic Haematopoietic Necrosis Virus
3
Reverse Transcriptase to correct for direct amplification from plas-
mid DNA potentially carried over during the RNA preparations.
Real-time PCR assays were performed on a LC480 96-well plate
real time PCR machine (Roche, Burgess Hill, UK). The sequences
of the primers and TaqMan® probes to amplify the ELF or rbtMx1
genes are presented in Table 1. One microlitre of cDNA was added
to the following mix contained in individual wells of a 96-well opti-
cal plate (Life Technologies, Paisley, UK): 10 ␮l of TaqMan® 2× PCR
mix with UNG (Life Technologies, Paisley, UK), 8 ␮l of dH2 O and 1 ␮l
of a 20× mix containing forward primer (18 ␮M), reverse primer
(18 ␮M) and probe (5 ␮M). The standard cycling conditions were
50 ◦ C for 2 min, 95 ◦ C for 10 min followed by 50 cycles of 95 ◦ C for
15 s and 60 ◦ C for 1 min. The fluorescence output for each cycle
was measured and recorded upon the completion of the entire run.
Absolute quantification of transcripts was carried out.
For each qPCR assay, a standard curve was generated using a
10-fold serial dilution of plasmid (calibrator) containing the tar-
get sequence. A linear statistical regression between crossing point
(Cp) and log(concentration calibrator) was used to estimate the
expression level of the corresponding gene from its measured Cp
value. The percentage efficiency was also calculated (Table 1). The
expression level of the gene relative to ELF was calculated by divid-
ing the gene expression level by ELF expression level. To correct for
potential genomic DNA carry-over of a given sample, the expres-
sion level of the “no RT” control was subtracted from the cDNA
expression level.
2.5. Viral titration in CHSE-TOF-MX8, CHSE-TOF-MX10 and
CHSE-TOF
CHSE-TOF, CHSE-TOF-MX8 or CHSE-TOF-MX10 cells were
seeded on 96-well plates (Nunc, Roskilde, Denmark) at a density of
20,000 cells/cm2 (approx. 50% confluency) in culture medium with
or without DOX supplemented with 25 mM HEPES buffer (Life Tech-
nologies, Paisley, UK) and incubated at 15 ◦ C for 24 h and during the
following infection. Six to 8 wells were left empty. Tenfold dilu-
tions of virus inoculums (approx. 106 –107 TCID50 /ml) were added
in six replicate wells from dilution 10 to 1012 . IPNV isolate A2 or A5,
Salmon Alphavirus (SAV) isolates F93-125 or 4640, IHNV and Epi-
zootic Haematopoietic Necrosis Virus (EHNV, Langdon et al., 1988)
were used (Table 3). Sixteen to 18 wells were left un-infected.
The cells were checked regularly for onset of cytopathic effect
(CPE). After 14 days, the cells were washed with PBS, fixed for
10 min with 10% saline formalin, washed with PBS and incubated
for 30 min with 0.1% crystal violet (Sigma, Irvine, UK), washed with
distilled water, drained and dried at room temperature. After the
plates were photographed under a light box, the crystal violet dye
was redissolved in 100 ␮l 1% SDS solution (Sigma, Irvine, UK) and
the optical density (OD) was read on a 96 well plate at 590 nm with
a PowerWave X spectrophotometer (BioTek, Potton, UK).
2.6. Statistical analysis
Analysis was intended to characterise the response of selected
combinations of cell lines and medium (referred to as treatment
combinations) to different dilutions (referred to as doses) of a viral
strain. The response of each treatment combination to the log10
Family Genus genome
Birnaviridae Aquabirnavirus dsRNA
Togaviridae alphavirus ssRNA Pos
Rabdoviridae Novirabdovirus ssRNA Neg
Iridoviridae Ranavirus dsDNA
 4 K. Lester et al. / Journal of Virological Methods 182 (2012) 1–8
dose of the viral strain was measured as an optical density. Further
statistical analysis was conducted using version 2.12.0 of the R
statistical computing environment (R Development Core Team,
2010). Mean optical densities and 95% confidence intervals for
defined treatment combinations at each dose were calculated and
plotted. An un-weighted four-parameter logistic dose–response
curve was then fitted to the individual optical densities for the
selected treatment combinations using the supplementary R
package drc 2.0-1 (Ritz and Streibig, 2005). The statistical fit was
assessed by comparing the residual sums of squares obtained from
the model to the residual sums of squares from a one way analysis
of variance. Two parameters are of particular interest. The first is
the TCID50 , a measure of the sensitivity of a treatment combination
to a viral strain. The second is the lower asymptote, a measure of
the maximum sensitivity of the treatment combination to the viral
strain. The predicted values were plotted using a monotone Her-
mite spline. Differences in response between cell lines cultivated
with or without DOX and virus strain combinations were evaluated
by comparing the residual variance of the dose–response curve
for each cell line and virus strain combination assuming that there
was either no difference between responses between DOX or dif-
ferences between responses for DOX. The residual variance of the
dose–response curve assuming no difference in responses to DOX
will be greater than the residual variance of the dose–response
curves assuming a difference in responses to DOX when there is a
difference in response to DOX. The difference in response between
presence and absence of DOX was regarded as statistically signifi-
cant when the probability of the variance ratio occurring by chance
alone was ≤5%. This approach evaluates differences between
curves rather than comparing the specific parameters.
3. Results
3.1. Isolation of CHSE-TOF-MX8 and CHSE-TOF-MX10
After transfection with pTRE2hyg-rbtMx1, five clones were
characterised by qPCR. Among those, the clone CHSE-TOF-MX8
showed the highest level of Mx induction with a fold increase upon
DOX removal of 27.95 (Fig. 1). No induction of IFN gene could be
detected by qPCR in any of the cell lines established in the present
report (CHSE-TOF, CHSE-TOF-MX clones, data not shown).
3.2. Resistance tests to IPNV, SAV, IHNV and EHNV
There was no significant difference in the titres of IPNV isolates
A2 or A5, SAV isolates 4640 or SAV F93-125 in the parental cell line
35
0.78
1.63
33
Cp DOX
31 Cp NO DOX
29
Average Cp
8.70
27
1.07
25 27.95
23
21
19
17
15
TOF TOF-MX4 TOF-MX7 TOF-MX8 TOF-MX9
CHSE-TOF-MX clones
Fig. 1. Level of expression of Mx in CHSE-TOF and clones CHSE-TOF-MX4, 7, 8, 9 and
10. The average fold increase relative to the control cultivated in absence of DOX is
indicated above the bars. Data represent average Cp values (N = 3) ± SE.
CHSE-TOF with or without DOX. This can be seen visually (Fig. 2)
and was confirmed by statistical analysis (Table 4).
CHSE-TOF-MX10 and CHSE-TOF showed the same level of sen-
sitivity against IPNV isolates A2 and A5 and against SAV isolate
F93-125 irrespective of presence or absence of DOX in the cul-
ture medium (Fig. 2). In contrast, CHSE-TOF-MX10 was completely
resistant to the SAV isolate 4640 irrespective of presence or absence
of DOX in the culture medium (Fig. 2).
There was a clear effect of the DOX removal on the resistance
of CHSE-TOF-MX8 cells to IPNV isolates A2 and A5 (Fig. 3 – lines
1 and 2). The cell lines exhibited complete resistance to IPNV iso-
lates A2 and A5 in the absence of DOX whereas in presence of DOX,
the sensitivity was similar to the parental line CHSE-TOF. This was
confirmed by statistical analysis (p < 0.001; Table 4; Fig. 4A and B).
However, CHSE-TOF-MX8 cells were completely resistant to SAV
isolates F93-125 and 4640 even in the presence of DOX (Table 4;
Fig. 3 – lines 3 and 4).
Both parental CHSE-TOF and Mx-expressing CHSE-TOF-MX8 cell
lines were sensitive to EHNV infection. A significant effect of DOX
on the resistance to EHNV infection could be observed in the CHSE-
TOF-MX8 cell line (p < 0.001; Table 4; Fig. 3 – line 5).
A partial resistance to IHNV was observed when comparing the
parental CHSE-TOF with and without DOX (Fig. 3 – line 6). This
was confirmed by quantification and statistical analysis (p < 0.05;
Table 4; Fig. 4C and D).
4. Discussion
This is the first report on the production of a tetracycline
inducible expression system for salmon through the production of
a double recombinant fish cell line. The principle of tetracycline
dependent expression systems was investigated in 2005 in carp
cells (Munoz et al., 2005) but has never been applied since. Single
recombinant cell lines producing a reporter gene such as luciferase
have been established in the past as a tool to study specific gene
regulatory sequences, monitor toxicity of samples to fish cells or
study signalling mechanisms (see for review Martin et al., 2008).
In this study, the biological function of rbtMx1 was investigated in
the Tet-Off Chinook salmon cell line CHSE-TOF recently established
(Collet and Lester, 2011b).
In fish, the Mx gene has been shown to be induced by many
viruses (McBeath et al., 2007; Fernández-Trujillo et al., 2011) and
related to early viral protection (McLauchlan et al., 2003). However,
the significance of this induction is difficult to evaluate because
virus infection induces the production and release of type I and/or
II IFN which in turn induces not only the Mx gene expressing the
Mx protein but also many other molecules with direct or indirect
antiviral properties, most of which have never been fully charac-
terised in mammalian or other vertebrates (Boo and Yang, 2010).
5.75 Therefore, the exact contribution of Mx protein to the overall viral
protection in fish cells is not known.
It was observed that the Mx protein was less able to confer resis-
tance to IHNV than to other viruses such as SAV or IPNV. This is in
agreement with previous work where it was reported that Mx was
unable to inhibit IHNV nucleoprotein (N) production in CHSE cells
(Trobridge et al., 1997) but its effect on viral replication is unknown.
The accumulation of Mx protein conferred complete resistance
to IPNV infection which is in agreement with previous data (Larsen
et al., 2004), where it was associated with an inhibition of viral
protein production. In Larsen’s study a stable cell line of CHSE
TOF-MX10
over-expressing Mx was generated and demonstrated that Mx
conferred a higher degree of protection to IPNV when compared to
the parental cell line and control cell line. However, the expression
of Mx protein declined with increasing passage number making
it difficult to compare the level of resistance against a panel of
 K. Lester et al. / Journal of Virological Methods 182 (2012) 1–8 5

Fig. 2. Resistance level of CHSE-TOF and CHSE-TOF-MX10 cultivated with or without DOX. The cells were plated in a 96-well plate with or without DOX. Twenty four hours
later, they were infected with serial 10-fold dilutions of virus inoculum, incubated 14 days at 15 ◦ C, fixed, stained and photographed. The viruses tested were IPNV (isolates
A2 and A5) and SAV (isolates F93-125 and 4640).

different viruses and isolates. The authors hypothesised that there number currently reaching 35. As a matter of fact, a decrease in
was a detrimental effect of artificially high levels of Mx expression. the rate of cell division (data not shown) was observed upon DOX
The inducible system presented here would allow long term main- removal suggesting that the unregulated over expression of Mx
tenance of such a cell line with stable properties over high passage gene is indeed affecting the cell growth. In the presence of DOX,

Table 4
Relevant parameters of combination cell line–culture condition–virus.

Cell line Virus DOX TCID50 p Lower asymptote

Mean St dev Mean St dev

+ 4.95 0.14 −0.04 0.13

IPNV A2 NS
− 5.20 0.60 0.00 0.11
+ 6.02 0.07 0.01 9
IPNV A5 NS
− 5.56 0.25 0.02 0.09
+ Poor model fit Poor model fit
SAV 4640 No test
− 5.10 0.22 0.00 0.14
CHSE-TOF5
+ 6.52 0.12 0.03 0.08
SAV F93-125 NS
− 6.46 0.10 0.02 0.08
+ 6.49 0.14 −0.04 0.11
IHNV NS
− 6.03 0.2 −0.05 0.11
+ 6.09 0.05 0.06 0.03
EHNV NS
− 6.08 0.05 0.12 0.03

+ 2.90 0.13 0.29 0.20

IPNV A2 <0.001
− −0.18 38.67 3.02 2.48
+ 4.57 0.15 0.01 0.12
IPNV A5 <0.001
− −2.72 1216.2 2.83 6.34
+ 0.39 ND 1.14 ND
SAV 4640 NS
− 2.30 1.26 2.75 0.14
CHSE-TOF5-MX8
+ −0.79 8.99 0.20 26.47
SAV F93-125 NS
− 2.39 1.08 3.13 0.05
+ 5.50 0.13 −0.07 0.09
IHNV 0.015
− 4.87 0.21 −0.06 0.10
+ 4.91 0.08 −0.02 0.04
EHNV <0.001
− 5.02 0.06 −0.02 0.04

+ 3.49 0.42 2.33 0.11

SAV 4640 <0.001
− 3.68 0.21 1.59 0.09
CHSE-TOF5-MX10
+ Poor model fit No Poor model fit
SAV F93-125
− 5.25 0.16 test 0.06 0.13
6 K. Lester et al. / Journal of Virological Methods 182 (2012) 1–8

Fig. 3. Resistance level of CHSE-TOF and CHSE-TOF-MX8 cultivated with or without DOX. The cells were plated in a 96-well plate with or without DOX. Twenty four hours
later, they were infected with serial 10-fold dilutions of virus inoculum, incubated 14 days at 15 ◦ C, fixed, stained and photographed. The viruses tested were IPNV (isolates
A2 and A5), SAV (isolates F93-125 and 4640), EHNV and IHNV.

in spite of a leakage in Mx expression, the cells showed a normal
rate of division very similar to the parental cell line.
In a cell line constitutively expressing Mx1 but IFN-deficient,
it was demonstrated that different isolates of the influenza virus
were affected differently by the over-expression of Mx1 (Dittmann
et al., 2008). To date no fish cell lines deficient in IFN production
are available. In this study, the production effect of large amounts
of rbtMx1 proteins induced a range of levels of protection against
several fish virus types and isolates. This cellular system is therefore
a good model to compare the early protection conferred by rbtMx1
proteins against different virus types and isolates.
A clear difference could be seen on the resistance level
of CHSE-TOF-MX10 cells against SAV isolates 4640 and F93-125.
CHSE-TOF-MX10 was found to express a relatively lower amount of
rbtMx1 when compared to CHSE-TOF-MX8 which exhibited a com-
plete resistance to both isolates irrespective of the presence of DOX.
The parental CHSE-TOF cell line showed similar sensitivity levels to
both isolates. These results demonstrated that isolate 4640 is more
sensitive to the antiviral effect of rbtMx1 than isolate F93-125. SAV
isolate 4640 produced a fast and strong induction of the Mx gene
whereas isolate F93-125 gave a delayed and lower response in a
fish macrophage-like cell line (unpublished results). Cytopathic
effect was observed for isolate F93-125 but not for isolate 4640. The
relatively high rbtMx1 sensitivity and high Mx gene inducing abil-
ity of SAV isolate 4640 contrast with the low rbtMx1 sensitivity and
the low Mx gene inducing ability of isolate F93-125. In addition,
viral gene nsP1 expression levels were much higher in cells infected
with isolate F93-125 rather than with isolate 4640 (unpublished
results). It is likely that the relative resistance of isolate F93-125
results in an excess of viral protein that could not be neutralised
by rbtMx1 in CHSE-TOF-MX10. CHSE-TOF-MX8 cells produce a
larger amount of rbtMx1 protein, even in presence of DOX, capable
of neutralising viral proteins from the two isolates. A given virus
isolate can be characterised in vitro by its ability to induce the Mx
gene and to resist to the rbtMx1 protein in CHSE-TOF-MX8/10.
Whether this correlates accurately with the virulence measured in
vivo remains to be established but it can potentially constitute a
method of prediction that does not require the use of animals.
Unlike SAV, IPNV was able to propagate in cells expressing mod-
erate levels of rbtMx1. This was observed in CHSE-TOF-MX8 cells
cultured in the presence of DOX expressing a leakage level of Mx
protein and showing sensitivity to IPNV but not to SAV (Fig. 2). This
 K. Lester et al. / Journal of Virological Methods 182 (2012) 1–8 7

A 3.0 B

3.0
2.5

2.5
TCID50 = 2.9±0.13
Lower asymptote = 0.29±0.2
optical density

optical density
2.0

2.0
1.5

1.5
1.0

1.0
TCID50 = -0.18±38.67
Lower asymptote = 3.02±2.48
0.5

0.5
0.0

0.0
1 2 3 4 5 1 2 3 4 5
Log10 dilution Log10 dilution

C D
3.0
3.0

2.5
2.5

TCID50 = 4.87±0.21 TCID50 = 5.5±0.13

Lower asymptote = -0.06±0.1 Lower asymptote = -0.07±0.09
2.0
2.0

optical density
optical density

1.5
1.5

1.0
1.0

0.5
0.5

0.0
0.0

1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8
Log10 dilution Log10 dilution

Fig. 4. Comparative resistance levels of CHSE-TOF-MX8 against IPNV isolate A2 with (A) or without (B) DOX, or against IHNV with (C) or without (D) DOX. Data are average
optical density (ROD) ± SE and the 4-parameter logistic model.

suggests that IPNV propagation is less affected by rbtMx1 protein
than SAV since the moderate leakage expression of Mx protein is
sufficient to provide protection against SAV but not against IPNV.
This can be explained by a lack of affinity of the Mx oligomers for
IPNV proteins or the ability of IPNV to counteract the viral protein
sequestration by Mx through an active viral evasion mechanism
(Versteeg and Garcia-Sastre, 2010). Although this result agrees
with past observations that IPNV is capable of inhibiting IFN action
(Collet et al., 2003), this study demonstrates a direct interaction
between IPNV and rbtMx1 protein whilst previous work empha-
sised the effect of IPNV on the regulation of Mx gene expression.
A wider comparison showed that the presence of Mx protein in
the cell confers a range of resistance levels to different viruses. In
this study SAV is the virus found to be most sensitive to the Mx pro-
tein, followed by IPNV and IHNV. The ability of EHNV to induce IFN
has not been reported and very little is known about the immune
response to this virus in fish. It is interesting to note that of all the
viruses tested, EHNV is the only one showing complete resistance
to rbtMx1 and the only one having a nuclear genome replication.
Other fish iridoviruses such as the Orange-spotted Grouper virus
have been shown to induce Mx protein (Chen et al., 2006).
These results give valuable information on the type of strategy
employed by different categories of viruses to escape the effect of
IFN. For example, IPNV which is highly sensitive to rbtMx1, has
developed strategies to limit the production of Mx by blocking steps
of the IFN signalling pathway (Collet et al., 2007). It is likely that SAV
has a similar strategy, as documented in other alphaviruses such as
the Semliki Forest virus (SFV), where nsP2 has been described as a
strong inhibitor of IFN production (Breakwell et al., 2007).
The use of optical densities to characterise the cellular response
to a viral isolate combined to a model-based analysis is a method-
ological innovation. It contributes to reduce the subjectivity of
8 K. Lester et al. / Journal of Virological Methods 182 (2012) 1–8
scoring by eye, facilitates the estimation of parameters character-
istic of the response and allows identification of partially resistant
cell responses. It is reasonable to suggest that this approach is
promising but is not necessarily problem free. The reliance on a
statistical modelling approach to generate results means that the
results are only as good as the model. Whilst there is no evidence
that the models presented in this report are not satisfactory two
possible improvements can be envisaged. One is a form of weight-
ing which takes into account the different amounts of variation
in optical densities for given doses. The second is the use of a
five-parameter logistic dose–response curve which would correct
for any asymmetry in the relationship if present. Despite these
shortcomings there is no evidence that these more sophisticated
methods would affect the conclusions of this report.
The isolation of the novel cell lines CHSE-TOF-MX8/10 has pro-
vided an opportunity to study the intimate relationship between
viral proteins and the rbtMx1 protein in fish. More specifically, it
allows understanding how diverse group of viruses have developed
ways to successfully evade the effect of IFN (see for review Versteeg
and Garcia-Sastre, 2010). Further studies are being undertaken to
test a wider range of SAV isolates and establish correlates between
in vivo virulence and rbtMx1 sensitivity using CHSE-TOF-MX8/10
cell lines. In addition, in the absence of DOX, CHSE-TOF-MX8 cells
are completely resistant to IPNV or SAV making it the ideal material
to test for risk of emergence of virulence in vitro.
Acknowledgements
S.K. Gahlawat is grateful to the Department of Biotechnology,
Ministry of Science & Technology, and Government of India for
providing a fellowship under Biotechnology Overseas Associate-
ship and the authorities of CCS Haryana Agricultural University,
Hisar (India) for allowing uptake of the fellowship. Part of this work
was funded by EU FP6 IMAQUANIM project no. 7103. The authors
are grateful to the virology staff at Marine Scotland for providing
viruses.
References
Altmann, S.M., Mellon, M.T., Distel, D.L., Kim, C.H., 2003. Molecular and functional
analysis of an interferon gene from the zebrafish, Danio rerio. J. Virol. 77,
1992–2002.
Altmann, S.M., Mellon, M.T., Johnson, M.C., Paw, B.H., Trede, N.S., Zon, L.I., Kim,
C.H., 2004. Cloning and characterization of an Mx gene and its corresponding
promoter from the zebrafish, Danio rerio. Dev. Comp. Immunol. 28, 295–306.
Arnheiter, H., Skuntz, S., Noteborn, M., Chang, S., Meier, E., 1990. Transgenic mice
with intracellular immunity to influenza virus. Cell 62, 51–61.
Boo, K.H., Yang, J.S., 2010. Intrinsic cellular defenses against virus infection by antivi-
ral type I interferon. Yonsei Med. J. 51, 9–17.
Breakwell, L., Dosenovic, P., Karlsson Hedestam, G.B., D’Amato, M., Liljestrom, P.,
Fazakerley, J., McInerney, G.M., 2007. Semliki Forest virus nonstructural pro-
tein 2 is involved in suppression of the type I interferon response. J. Virol. 81,
8677–8684.
Caipang, C.M., Hirono, I., Aoki, T., 2003. In vitro inhibition of fish rhabdoviruses by
Japanese flounder, Paralichthys olivaceus Mx. Virology 317, 373–382.
Chen, Y.-M., Su, Y.-L., Lin, J.H.-Y., Yang, H.-L., Chen, T.-Y., 2006. Cloning of an orange-
spotted grouper (Epinephelus coioides) Mx cDNA and characterisation of its
expression in response to nodavirus. Fish Shellfish Immunol. 20, 58–71.
Chen, Y.-M., Su, Y.-L., Shie, P.-S., Lin, J.H.-Y., Yang, H.-L., Chen, T.-Y., 2008. Grouper
Mx confers resistance to nodavirus and interacts with coat protein. Dev. Comp.
Immunol. 32, 825–836.
Collet, B., McDonald, C., Secombes, C.J., 2003. The promoter for the Interferon Reg-
ulatory Factor (IRF)-2 in the rainbow trout Oncorhynchus mykiss: cloning and
reporter gene activity. Fish Shellfish Immunol. 15, 473–477.
Collet, B., Munro, E.S., Gahlawat, S., Acosta, F., Garcia, J., Roemelt, C., Zou, J., Sec-
ombes, C.J., Ellis, A.E., 2007. Infectious Pancreatic Necrosis Virus suppresses type
I interferon signalling in rainbow trout gonad cell line but not in Atlantic salmon
macrophages. Fish Shellfish Immunol. 22, 44–56.
Collet, B., Lester, K., 2011a. Isolation of an inducible expression cell line in Atlantic
salmon Salmo salar. J. Biotech. 154, 209–211.
Collet, B., Lester, K., 2011b. Establishment of a Chinook salmon cell line with an
inducible gene expression system? In vitro Cell. Dev. Biol. – Anim. 47 (10),
695–697.
Dittmann, J., Stertz, S., Grimm, D., Steel, J., Garcia-Sastre, A., Haller, O., Kochs, G., 2008.
Influenza A virus strains differ in sensitivity to the antiviral action of Mx-GTPase.
J. Virol. 82, 3624–3631.
Fernández-Trujillo, M.A., Novel, P., Manchado, M., Sepulcre, M.P., Mulero, V., Borrego,
J.J., Alvarez, M.C., Béjar, J., 2011. Three Mx genes with differential response to
VNNV infection have been identified in Gilthead seabream (Sparus aurata). Mol.
Immunol. 48 (9–10), 1216–1223.
Fernández-Trujillo, M.A., García-Rosado, M.E., Borrego, J.J., Alvarez, M.C., Béjar, J.,
2008. In vitro inhibition of sole Aquabirnavirus by recombinant Senegalese sole
Mx. Fish Shellfish Immunol. 24, 187–193.
Haller, O., 1981. Inborn resistance of ice to orthomyxoviruses. Curr. Top. Microbiol.
Immunol. 92, 25–52.
Haller, O., Staeheli, P., Kochs, G., 2007a. Interferon-induced Mx proteins in antiviral
host defense. Biochimie 89, 812–818.
Haller, O., Stertz, S., Kochs, G., 2007b. The Mx GTPase family of interferon-induced
antiviral proteins. Microbes Infect. 9, 1636–1643.
Haller, O., Frese, M., Kochs, G., 1998. Mx proteins: mediators of innate resistance to
RNA viruses. Rev. Sci. Tech. 17, 220–230.
Haller, O., Arnheiter, H., Lindenmann, J., Gresser, I., 1980. Host gene influences sen-
sitivity to interferon action selectively for influenza virus. Nature 283, 660–662.
Haller, O., Arnheiter, H., Gresser, I., Lindenmann, J., 1979. Genetically determined,
interferon-dependent resistance to influenza virus in mice. J. Exp. Med. 149,
601–612.
Horisberger, M.A., Haller, O., Arnheiter, H., 1980. Interferon-dependent genetic resis-
tance to influenza virus in mice: virus replication in macrophages is inhibited
at an early step. J. Gen. Virol. 50, 205–210.
Kibenge, M.J.T., Munir, K., Kibenge, F.S.B., 2005. Constitutive expression of Atlantic
salmon Mx1 protein in CHSE-214 cells confers resistance to Infectious Salmon
Anaemia virus. Virol. J. 2, 75.
Kochs, G., Haller, O., 1999a. Interferon-induced human MxA GTPase blocks nuclear
import of Thogoto virus nucleocapsids. Proc. Natl. Acad. Sci. U. S. A. 96,
2082–2086.
Kochs, G., Haller, O., 1999b. GTP-bound human MxA protein interacts with the nucle-
ocapsids of thogoto virus (Orthomyxoviridae). J. Biol. Chem. 274, 4370–4376.
Langdon, J.S., Humphrey, J.D., Williams, L.M., 1988. Outbreaks of EHNV-like iri-
dovirus in cultured rainbow trout, Salmo gairdneri Richardson, in Australia. J.
Fish Dis. 11, 93–96.
Larsen, R., Rokenes, T.P., Robertsen, B., 2004. Inhibition of infectious pancre-
atic necrosis virus replication by Atlantic salmon Mx1 protein. J. Virol. 78,
7938–7944.
Lee, S.H., Vidal, S.M., 2002. Functional diversity of Mx proteins: variations on a theme
of host resistance to infection. Genome Res. 12, 527–530.
Lin, C.H., Christopher John, J.A., Lin, C.-H., Chang, C.Y., 2006. Inhibition of nervous
necrosis virus propagation by fish Mx proteins. Biochem. Biophys. Res. Commun.
351, 534–539.
Lindenmann, J., 1964. Inheritance of resistance to influenza virus in mice. Proc. Soc.
Exp. Biol. Med. 116, 506–509.
McBeath, A.J., Snow, M., Secombes, C.J., Ellis, A.E., Collet, B., 2007. Expression kinetics
of interferon and interferon-induced genes in Atlantic salmon (Salmo salar) fol-
lowing infection with infectious pancreatic necrosis virus and infectious salmon
anaemia virus. Fish Shellfish Immunol. 22, 230–241.
McLauchlan, P.E., Collet, B., Ingerslev, E., Secombes, C.J., Lorenzen, N., Ellis, A.E.,
2003. DNA vaccination against viral haemorrhagic septicaemia (VHS) in rainbow
trout: size, dose, route of injection and duration of protection–early protection
correlates with Mx expression. Fish Shellfish Immunol. 15, 39–50.
Martin, S.A.M., Collet, B., MacKenzie, S., Evensen, O., Secombes, C.J., 2008. Genomic
tools for examining immune gene function in salmonid fish. Rev. Fish Sci. 16,
110–116.
Munoz, I., Carrillo, M., Zanuy, S., Gomez, A., 2005. Regulation of exogenous gene
expression in fish cells: an evaluation of different versions of the tetracycline-
regulated system. Gene 363, 173–182.
R Development Core Team, 2010. R: A Language and Environment for Statistical
Computing. R Foundation for Statistical Computing, Vienna, Austria, ISBN 3-
900051-07-0, http://www.R-project.org.
Ritz, C., Streibig, J.C., 2005. Bioassay analysis using R. J. Stat. Software 12, 5.
Robertsen, B., Trobridge, G., Leong, J.A., 1997. Molecular cloning of double-stranded
RNA inducible Mx genes from Atlantic salmon (Salmo salar L.). Dev. Comp.
Immunol. 21, 397–412.
Staeheli, P., Haller, O., Boll, W., Lindenmann, J., Weissmann, C., 1986. Mx protein:
constitutive expression in 3T3 cells transformed with cloned Mx cDNA confers
selective resistance to influenza virus. Cell 44, 147–158.
Su, J., Yang, C., Zhu, Z., Wang, Y., Jang, S., Liao, L., 2009. Enhanced grass carp reovirus
resistance of Mx-transgenic rare minnow (Gobiocypris rarus). Fish Shellfish
Immunol. 26, 828–835.
Trobridge, G.D., Leong, J.A., 1995. Characterization of a rainbow trout Mx gene. J.
Interferon Cytokine Res. 15, 691–702.
Trobridge, G.D., Chiou, P.P., Leong, J.A., 1997. Cloning of the rainbow trout
(Oncorhynchus mykiss) Mx2 and Mx3 cDNAs and characterization of trout Mx
protein expression in salmon cells. J. Virol. 71, 5304–5311.
Versteeg, G.A., Garcia-Sastre, A., 2010. Viral tricks to grid-lock the type I interferon
system. Curr. Opin. Microbiol. 13, 508–516.
Wu, Y.C., Lu, Y.-F., Chi, S.C., 2010. Anti-viral mechanism of barramundi Mx against
betanodavirus involves the inhibition of viral RNA synthesis through the inter-
ference of RdRp. Fish Shellfish Immunol. 28 (3), 467–475.
Wu, Y.C., Chi, S.C., 2007. Cloning and analysis of antiviral activity of a barramundi
(Lates calcarifer) Mx gene. Fish Shellfish Immunol. 23, 97–108.