Sei sulla pagina 1di 171

PONTIFICIA UNIVERSIDAD JAVERIANA

FACULTAD DE CIENCIAS

DOCTORADO EN CIENCIAS BIOLÓGICAS

EVALUACIÓN DE UN BIORREACTOR PASIVO DURANTE LA

REMEDIACIÓN DE DRENAJES ÁCIDOS DE MINA DEL DISTRITO MINERO

DE ZIPAQUIRÁ (COLOMBIA)

TESIS
Presentada por
OLGA YANETH VÁSQUEZ OCHOA
Presentado como requisito parcial para optar al título de
DOCTOR EN CIENCIAS BIOLÓGICAS

Bogotá D.C., Colombia


(14 de Marzo de 2016)
NOTA DE ADVERTENCIA

"La Universidad no se hace responsable por los


conceptos emitidos por sus alumnos en sus trabajos de tesis.
Solo velará porque no se publique nada contrario al dogma y a
la moral católica y porque las tesis no contengan ataques
personales contra persona alguna, antes bien se vea en ellas el
anhelo de buscar la verdad y la justicia".

Artículo 23 de la Resolución No13 de Julio de 1946.


EVALUACIÓN DE UN BIORREACTOR PASIVO DURANTE LA

REMEDIACIÓN DE DRENAJES ÁCIDOS DE MINA DEL DISTRITO MINERO DE

ZIPAQUIRÁ (COLOMBIA)

OLGA YANETH VASQUEZ OCHOA

APROBADO:

Fabio Roldán, Ph.D Carmen Mihaela Neculita Ph.D


Director Co-directora

Carlos Ayora, Ph.D Carolina González Merchán, Ph.D


Jurado Jurado

Aura Marina Pedroza, Ph.D Elena González Toril, Ph.D


Jurado Jurado

Homero Enrique Urrutia, Ph.D


Jurado
EVALUACIÓN DE UN BIORREACTOR PASIVO DURANTE LA
REMEDIACIÓN DE DRENAJES ÁCIDOS DE MINA DEL DISTRITO MINERO DE
ZIPAQUIRÁ (COLOMBIA)

OLGA YANETH VASQUEZ OCHOA

APROBADO

Alba Alicia Trespalacios, Ph.D Concepción Judith Puerta, Ph.D

Director de Posgrado Decana


Facultad de Ciencias Facultad de Ciencias
DEDICATORIA

A mi Esposo Jorge Arturo y a mi hijo Jorge Andrés: gracias por su amor infinito y
apoyo incondicional en cada momento de mi vida.

Yaneth Vásquez Ochoa

14 de marzo de 2015
AGRADECIMIENTOS
Quiero expresar mi gratitud a las instituciones y personas que con su ayuda y colaboración
permitieron que esta tesis doctoral pudiera realizarse:

A la Universidad Central, quien por medio del Programa de Apoyo a Estudios de


Posgrado de los Profesores financió mis estudios y al Departamento de Ciencias Naturales
quien financio parte de mi investigación.

A la Pontificia Universidad Javeriana, por el apoyo financiero y logístico en la ejecución


de este proyecto (convocatoria de Apoyo a los Programas de Doctorado año 2012).

A mi tutor, el Dr. Fabio Roldán, por permitirme participar en su grupo de investigación del
cual hizo parte esta tesis, y por todos los conocimientos que me compartió durante mis
estudios, por sus consejos y amistad.

I would like to thank to Dr. Carmen Neculita my co-advise, who provided me the
opportunity to visit her laboratory in Quebec University (Abitibi-Témiscamingue) and who
guided me through my research and data analyses, thanks for your excellent academic
guidance, encouragement gave me during my studies.

A María Camila Escobar por su aporte en el desarrollo de este trabajo y su ayuda, en los
duros y buenos momentos.

A los profesores Ziv Arbely y Sandra Baena, por sus consejos y orientación.

A todos los integrantes de USBA (Hernan, Luisa, Yaris, Ivan, Carolina y Ginna) por la
buena energía que me transmitieron y especialmente a Johan Saenz por su aporte y
orientación con la bioinformatica.

A Carlos Diaz, Leonor Hernendez y Virgilio Sierra por su apoyo y colaboración.

A mi Familia por su apoyo y amor durante los duros momentos que pasamos.
TABLA DE CONTENIDO

1 INTRODUCCIÓN.......................................................................................................... 4

2 MARCO TEORICO........................................................................................................ 7

2.1 Formación de drenajes ácidos de minas (DAM)...................................................... 7

2.2 Microorganismos involucrados en la generación del DAM.....................................9

2.3 Selección de un sistema de tratamiento pasivo para el tratamiento de DAM..........9

2.4 Biorreactores pasivos para tratamiento de DA M .................................................. 11

2.4.1 Mezcla reactiva............................................................................................... 12

2.4.2 Propiedades hidráulicas de los biorreactores pasivos.....................................17

2.5 Factores que afectan la eficiencia de los biorreactores pasivos.............................19

2.6 Comunidades microbianas presentes en los reactores pasivos.............................. 21

3 OBJETIVOS..................................................................................................................25

3.1 Obj etivo General..................................................................................................... 25

3.2 Objetivo Específicos..............................................................................................25

4 METODOLOGIA......................................................................................................... 26

4.1 Descripción del área de estudio.............................................................................. 26

4.2 Caracterización fisicoquímicadel DAM.................................................................27

4.3 Muestreo de la materia orgánica y del sedimento (inóculo).................................. 28

4.4 Caracterización fisicoquímica y microbiológica de los sustratos orgánicos........ 29

4.5 Ensayo de lixiviación de metales y sulfatos en los substratos orgánicos............... 30

4.6 Preparación de las mezclas reactivas y del DAM sintético....................................30

4.7 Determinación de la eficiencia de las mezclas reactivas........................................31

i
4.8 Determinación de la conductividad hidráulica y la porosidad de las mezclas
reactivas............................................................................................................................ 32

4.9 Montaje y operación de los biorreactores pasivos................................................. 33

4.10 Efecto del TRH sobre la eficiencia de los biorreactores pasivos.......................... 34

4.11 Remoción de sulfuro, Fe+2 y Mn+2 de los efluentes del biorreactorcon 1 d de TRH
por aireación...................................................................................................................... 35

4.12 Sacrificio de los biorreactores............................................................................... 36

4.13 Efecto del TRH sobre la composición de la mezcla reactiva post-tratamiento.....37

4.13.1 Determinación del carbono orgánico total (COT)..........................................38

4.13.2 Determinación del sulfuro ácido volátil (SAV) y de los metales extraídos
simultáneamente (MES) ............................................................................................... 38

4.13.3 Determinación de metales totales...................................................................39

4.14 Muestreo, extracción y cuantificación del ADN metagenómico........................... 40

4.15 Amplificación de la región V4 del gen 16S rARN...............................................40

4.16 Calidad, ensamblaje y limpieza de las secuencias................................................. 42

4.17 Asignación de OTUS.............................................................................................42

4.18 Efecto del TRH sobre la composición y diversidad de las comunidades


microbianas.......................................................................................................................42

4.19 Análisis estadístico................................................................................................43

5 RESULTADOS Y DISCUSIÓN.................................................................................. 45

5.1 Caracterización fisicoquímica del DAM................................................................45

5.2 Caracterización fisicoquímica y microbiológica de los sustratos orgánicos........ 46

5.3 Ensayo de lixiviación de metales y sulfatos en los substratos orgánicos..............48

5.4 Composición de las mezclas reactivas................................................................... 51

ii
5.5 Determinación de la eficiencia de las mezclas reactivas..................................... 52

5.6 Determinación de la conductividad hidráulica y la porosidad de las mezclas


reactivas ........................................................................................................................... 56

5.7 Efecto del TRH sobre la eficiencia de los biorreactores pasivos.........................57

5.8 Calidad de los efluentes de los biorreactores pasivos.......................................... 66

5.9 Remoción de sulfuros, Fe+2 y Mn+2 de los efluentes de la columna con 1 d de TRH
por aireación...................................................................................................................... 67

5.10 Efecto del TRH sobre la composición de la mezcla reactiva post-tratamiento.....69

5.10.1 Contenidode nutrientes y pH......................................................................... 70

5.10.2 Metales, sulfuro y sulfato............................................................................... 72

5.11 Efecto del TRH sobre la diversidad de las comunidades microbianas..................76

5.11.1 Extracción ycuantificación del ADN metagenómico..................................... 76

5.11.2 Amplificación de la región V4 del gen 16S rARN.........................................76

5.11.3 Calidad, ensamblaje y limpieza de las secuencias..........................................77

5.11.4 Asignación de OTUS......................................................................................78

5.11.5 Estimación de la abundancia relativa de taxones........................................... 80

5.11.6 Análisis general de la diversidad microbiana en los biorreactores pasivos ... 83

5.11.7 Cambios de las comunidades microbianas de los biorreactores pasivos


durante la remedición del DAM.................................................................................... 85

5.11.8 Modelo biogeoquímicode los reactores pasivos........................................... 104

6 CONCLUSIONES..................................................................................................... 109

7 REFERENCIAS ........................................................................................................ 111

iii
INDICE DE FIGURAS
Figura 1 Etapas de generación química de DAM.................................................................. 8
Figura 2 Diagrama de flujo para la selección de los biorreactores pasivos como sistema de
tratamiento del DAM.............................................................................................................11
Figura 3 Degradación de materia orgánica en ambientes anaerobios y en presencia de
sulfato.................................................................................................................................... 16
Figura 4 Distrito minero de Zipaquirá y los municipios que lo conforman....................... 26
Figura 5 Montaje batch para evaluación de eficiencia de las mezclas reactivas................ 31
Figura 6 Montaje de los biorreactores pasivos.................................................................. 34
Figura 7 Montaje de columnas con diferentes TRH (1, 2 y 4 d) para el tratamiento de DAM
sintético................................................................................................................................ 35
Figura 8 Montaje de aireación para remoción de sulfuro, Fe+2 y Mn+2 de los efluentes del
biorreactor con 1 d de TRH.................................................................................................. 36
Figura 9 Etapas del sacrificio de los biorreactores pasivos................................................. 37
Figura 10 Montaje empleado para la determinación de sulfuros ácidos volátiles............... 39
Figura 11 Primers para la construcción de los amplicones de la región V4 del gen 16S
rRNA.................................................................................................................................... 41
Figura 12 Fraccionamiento de Fe, Zn, y Mn por extracción secuencia en los substratos
orgánicos............................................................................................................................... 50
Figura 13 Determinación de la eficiencia de las mezclas reactivas durante el tratamiento de
DAM en reactores batch....................................................................................................... 53
Figura 14 Remoción de metales (Fe+2, Zn+2 y Mn+2) durante el tratamiento de DAM en
reactores batch...................................................................................................................... 55
Figura 15 Evolución del pH, ORP y alcalinidad durante el tratamiento de DAM en
biorreactores pasivos.............................................................................................................58
Figura 16 Evolución del sulfato, sulfuros y BSR durante el tratamiento de DAM en
biorreactores pasivos............................................................................................................ 60
Figura 17 Evolución de metales (Fe+2, Zn+2 y Mn+2) durante el tratamiento de DAM en
biorreactores pasivos............................................................................................................ 63

iv
Figura 18 Índice de saturación de algunos minerales formados durante la biorremediación
del DAM en biorreactores pasivos...................................................................................... 65
Figura 19 Remoción de metales (Fe+2 y Mn+2) y sulfuros de los efluentes del biorreactor
con 1 d de TRH por aireación.............................................................................................. 68
Figura 20 ACP de las variables fisicoquímicas evaluadas durante el tiempo de operación
del reactor con 2 y 4 d de TRH............................................................................................ 70
Figura 21 Tamaño de los amplicones de la región V4 del gen 16S rARN........................ 77
Figura 22 Número de secuencias necesarias para considerar un OTU...............................78
Figura 23 Curvas de rarefacción de las muestras obtenidas de la mezcla reactiva post­
tratamiento ............................................................................................................................ 79
Figura 24 Distribución filogenética de las secuencias asignadas a phylum....................... 80
Figura 25 Abundancia relativa (> 0,1%) de las familias asignadas al phylum proteobacteria
en el total de las muestras.................................................................................................... 81
Figura 26 Abundancia relativa (> 0,1%) de las familias asignadas al phylum Bacteroidetes
y cloroflexi en el total de las muestras................................................................................ 82
Figura 27 Distancias de las comunidades microbianas en el espacio y el tiempo de
operación del reactor con tresTRH.......................................................................................84
Figura 28 Abundancia relativa de géneros dominantes (> 0,5%) presentes en la mezcla
reactiva utilizada durante el montaje de los biorreactores pasivos...................................... 86
Figura 29 Análisis de coordenadas principales (ACoP) de muestras de mezcla reactiva
post-tratamiento en la semana 8 .......................................................................................... 88
Figura 30 Abundancia relativa de géneros dominantes (> 0,5%) presentes en los reactores
pasivos en la semana 8.......................................................................................................... 89
Figura 31 Análisis de correspondencia canónica (CCA) entre las variables fisicoquímicas
y los géneros (abundancia relativa > 0,5%) encontrados en la mezcla reactiva post­
tratamiento de dos biorreactores pasivos con diferentes TRH (2 y 4 d) que operaron durante
8 semanas...........................................................................................................................91
Figura 32 Análisis de coordenadas principales (ACoP) de muestras de mezcla reactiva
post-tratamiento en la semana 1 7 ....................................................................................... 93

v
Figura 33 Abundancia relativa de géneros dominantes (> 0,5%) presentes en los reactores
pasivos en la semana 17...................................................................................................... 95
Figura 34 Comparaciones de la abundancia de los géneros significativamente diferentes en
la semana 17....................................................................................................................... 96
Figura 35 Análisis de correspondencia canónica (CCA) entre las variables fisicoquímicas
y los géneros (abundancia relativa > 0,5%) encontrados en la mezcla reactiva post­
tratamiento de dos biorreactores pasivos con diferentes TRH (2 y 4 d) que operaron durante
17 semanas............................................................................................................................ 97
Figura 36 Análisis de coordenadas principales (ACoP) de muestras de mezcla reactiva
post-tratamiento en lasemana 3 6 .......................................................................................... 99
Figura 37 Abundancia relativa de géneros dominantes (> 0,5%) presentes en los reactores
pasivos en la semana 36...................................................................................................... 101
Figura 38 Comparaciones de la abundancia de los géneros significativamente diferentes en
la semana 36........................................................................................................................ 102
Figura 39 Análisis de correspondencia canónica (CCA) entre las variables fisicoquímicas
y los géneros (abundancia relativa > 0,5%) encontrados en la mezcla reactiva post­
tratamiento de tres biorreactores pasivos con diferentes TRH (1,2 y 4 d) sacrificados en la
semana 36........................................................................................................................... 104
Figura 40 Modelo biogeoquímico propuesto en los reactores pasivos en la semana 36 .. 107

vi
INDICE DE TABLAS
Tabla 1 Microorganismos reportados en biorreactores pasivos..........................................22
Tabla 1 Microorganismos reportados en biorreactores pasivos (Continuación)..................23
Tabla 2 Análisis fisicoquímicos y microbiológicos realizados a los substratos orgánicos . 29
Tabla 3 Análisis fisicoquímicos realizados a la mezcla reactiva post-tratamiento..............38
Tabla 4 Caracterización fisicoquímica del DAM presente en cinco minas activas del
distrito minero de Zipaquirá..................................................................................................45
Tabla 5 Propiedades fisicoquímicas de los substratos orgánicos...................................... 47
Tabla 6 Contenido de metales (Fe, Zn y Mn) en los substratos orgánicos (El valor
corresponde a la suma de las fracciones)............................................................................. 49
Tabla 7 Composición de las cinco mezclas reactivas evaluadas durante el ensayo batch .. 52
Tabla 8 Calidad de los efluentes de reactores pasivos comparados con el DAM y con los
valores máximos permitidos en la legislación colombiana...................................................67
Tabla 9 Caracterización fisicoquímica y microbiológica de la mezcla reactiva post­
tratamiento ............................................................................................................................ 71
Tabla 10 Concentración de metales totales y sulfato en la mezcla reactiva post­
tratamiento........................................................................................................................... 73
Tabla 11 Concentración SAV, MES y relación molar MES/SAV determinados en la
mezcla reactiva pos-tratamiento...........................................................................................74

vii
INDICE DE ANEXOS

Anexo A Curvas de calibración de los análisis de metales, sulfatos y sulfuros................126


Anexo B Physicochemical and microbiological characterization of organic substrates ... 127
Anexo C Evaluation of the effectiveness of reactive mixture in batch testing................ 135
Anexo D Set-up and operation of column bioreactors for the passive treatment of AMD 138
Anexo E Microbiological characterization for Illumina® sequencing............................ 143
Anexo F Caracterización fisicoquímica del DAM presente en siete minas activas del
distrito minero de Zipaquirá.............................................................................................. 147
Anexo G Representación gráfica de la calidad de las secuencias.....................................148
Anexo H Comunidad microbiana total encontrada los reactores pasivos que operaron
durante 36 semanas con tres TRH (1, 2 y 4 d).................................................................. 149

viii
RESUMEN

El Drenaje Ácido de Mina (DAM) es actualmente el principal contaminante en las


áreas mineras. Los biorreactores pasivos son una tecnología sostenible para remediar el
DAM; sin embargo, se desconoce como el tiempo de retención hidráulica (TRH), el espacio
y el tiempo de operación del reactor pueden afectar las comunidades microbianas
implicadas en la biorremediación. Para contribuir con este conocimiento primero se diseño
un biorreactor pasivo, con base en las propiedades del DAM y de la materia organica
presente en el distrito minero de Zipaquira. Inicialmente se determinó que la mezcla
reactiva compuesta por estiércol (15%), compost de champiñón (10%), aserrín de sajo
(25%), gravilla (20%), sedimento como inóculo (15%) y carbonato de calcio (15%) era una
opción promisoria para ser empacada en reactores de flujo continuo. Posteriormente, se
evaluo el efecto del TRH (1, 2, y 4 d) sobre la eficiencia de los biorreactores para
incrementar el pH y la alcalinidad, reducir el sulfato y remover los metales (Fe+2, Mn+2 y
Zn+2) del DAM sintético. También, se determinó el efecto (temporal y espacial) del TRH
sobre la mezcla reactiva post-tratamiento y sobre la comunidad microbiana (Illumina
MiSeq) en las semanas 8, 17 y 36.

Todos los biorreactores fueron eficientes en incrementar el pH y reducir la


concentración del sulfato y metales del DAM; sin embargo, se observó que TRH largos
(4d) favorecieron la acumulacion de sulfuros y de la alcalinidad, deteriorando la calidad de
los efluentes y creando un efecto adverso sobre las bacterias sulfato-reductoras (BSR). Por
otro lado, TRH cortos (1d) lavaron la biomasa y facilitaron el ingreso de oxígeno en el
reactor reduciendo la capacidad de remover los metales. El TRH mostró un efecto
significativo sobre la mezcla reactiva post-tratamiento, los nutrientes fueron consumidos en
mayor cantidad en los biorreactores con 4 d de TRH, mientras que los metales y el sulfuro
se acumularon en la parte baja de las columnas con 2 d de TRH. Se observó que la
comunidad microbiana varía a través del espacio y tiempo durante la biorremediación del
DAM. Al inicio del estudio las comunidades más abundantes fueron las degradadoras de
materia orgánica sin diferencia entre las alturas del biorreactor, mientras que al final del
estudio los microorganismos de celulolíticas y fermentativas incrementaron en la parte

ix
media y alta de los biorreactores y los de BSR en la parte baja. El TRH tiene efecto
significativo sobre la mezcla reactiva de los biorreactores y esto crea una presión de
selección sobre los microorganismos funcionales que participan en la biorremediación del
DAM.

x
ABSTRACT

The major type of contaminated generated by the mining industry is acid mine
drainage (AMD). A sustainable approach to remediate AMD is passive bioreactors;
however there is need for information to assess if hydraulic retention time (HRT), space
and operation time could affect the microbial community involved in the bioremediation.
During the study one reactive mixture containing 15% cow manure, 10% mushroom
compost, 25% sajo sawdust, 20% gravel, 15% limestone, and 15% sediment was selected
for use in continuous-flow column experiments. Seven passive reactors (10 cm diameter x
73 cm height) operated under upward flow during 36 weeks were used to evaluate the
effect of HRT (1, 2 and 4 days) on the efficiency to increase pH and alkalinity, as well as,
enhancing sulfate reduction and metal removal of the synthetic AMD. Moreover, the effect
(temporal and spatial) of HRT on reactive mixture post-treatment and microbial community
(Illumina MiSeq) was evaluated in 8, 17 and 36 weeks.

All bioreactors were efficient in remediate the AMD, but longer HRT (4 days)
increased residual sulfides which deteriorated the quality of treated effluent and entailing
adverse impacts on sulfate reducing bacteria (SRB). Short HRT (1 day) washed out
biomass and increased input of dissolved oxygen in the reactors, leading higher redox
potential and decreased efficient metal removal. HRT had significant effects on changes in
the reactive mixture and microbial community. The nutrients were consumed rapidly at the
bottom layer of the bioreactors of 4 days HRT and metal sulfide were accumulate in bottom
layer of the bioreactors of 2 days HRT. The microbial community change temporal and
spatial in the bioreactor. At the beginning of study, the communities were abundant in
organic matter degraders, but then there was a shift towards the increase of cellulolytic and
fermentative taxa in middle and top layer of bioreactors, while SRB were located at the
bottom layer. The HRT present effect on physicochemical composition of reactive mixture
post-treatment and it created a selection pressure on functional taxas.

1
LISTA DE PUBLICACIONES Y ASISTENCIA A EVENTOS

Artículos

Vasquez Y., Escobar M.C., Neculita C.M., Arbeli Z., Roldal F. (2015). Selection of
reactive mixture for biochemical passive treatment of acid mine drainage. (Environmental
Earth Sciences DOI: 10.1007/s12665-016-5374-2)

Vasquez Y., Escobar M.C., Neculita C.M., Arbeli Z., Roldal F. (2015). Biochemical
passive reactors for treatment of acid mine drainage: Effect of hydraulic retention time on
changes in efficiency, composition of reactive mixture, and microbial activity.
(10.1016/j.chemosphere.2016.03.052)

Vasquez Y., Escobar M.C., Neculita C.M., Saenz J., Arbeli Z., Roldal F. (2015).
Biochemical passive reactors for treatment of acid mine drainage: Effect of hydraulic
retention time, space and opetation time on diversity of microbial community.
(Sometimiento previsto para octubre de 2016).

Eventos

Vasquez Y., Escobar M.C., Neculita C.M., Arbeli Z., Roldal F. Efecto del tiempo de
retención hidráulico (TRH) sobre eficiencia de un biorreactor sulfato reductor durante la
remediación de drenajes ácidos de minas (DAM). XXII Congreso Latinoamericano de
Microbiología ALAM 2014. 5 al 8 de noviembre 2014.Cartagena Colombia.

Escobar M.C., Vasquez Y., Neculita C.M., Arbeli Z., Roldal F. Efecto del tiempo de
retención hidráulico (TRH) sobre la actividad microbiana y el sustrato orgánico de un
biorreactor sulfato reductor durante la biorremediación de drenajes ácidos de minas
(DAM). XXII Congreso Latinoamericano de Microbiología ALAM 2014. 5 al 8 de
noviembre 2014. Cartagena Colombia.

2
Roldan F., Vasquez Y., Escobar M.C., Neculita C.M., Arbeli Z. Biorremediación de
drenajes ácidos de minas (DAM). SUMA, Convención Científica Colombiana. Julio 2 de
2014. Cartagena Colombia.

3
1 INTRODUCCIÓN

Durante la explotación minera el suelo es removido, dejando expuestos al oxígeno y


al agua los minerales sulfurados. Esta reacción genera drenajes ácidos de mina (DAM), que
se caracterizan por un bajo pH (< 4.5), alta concentración de iones metálicos disueltos
(Fe+2, Al+3, Mn+2, Zn+2, Pb+2, Cd+2) y sulfato. (Johnson y Hallberg, 2005). El principal
problema del DAM es la alta concentración de los metales que pueden alcanzar cientos de
mg por litro (Nancucheo et al., 2014). Además, cuando estos son vertidos en la superficie
destruyen la capa vegetal, erosionan el suelo y contaminan los cauces de los ríos,
eliminando los organismos bentónicos e interrumpiendo la cadena trófica (Younger, 2002;
Johnson y Hallberg, 2005). El DAM es actualmente el principal contaminante en las áreas
mineras a nivel mundial (Nordstrom et al., 2015). En Colombia, se ha detectado su
presencia en todos los distritos mineros, pero sólo en el de Zipaquirá se ha estimado que
aproximadamente 600 pequeñas minas generan cerca de 74.000 m3 de drenaje al mes con
pH entre 2,0 y 8,0 afectando directamente la cuenca del río Ubaté y laguna de Fúquene
(FENALCARBÓN, 2006). Actualmente, los drenajes se remedian con la adición de
sustancias químicas neutralizantes (p.e., cal, carbonato de calcio, hidróxido de sodio) que
elevan el pH, aceleran la oxidación del ión ferroso y ocasionan que muchos metales
disueltos precipiten. El resultado de esta práctica es la producción de lodos que puede
contener metales en altas concentraciones (Johnson y Hallberg, 2005; Nevatalo et al.,
2010). El alto volumen y la generación de DAM por largos períodos de tiempo implican
que los tratamientos químicos tengan un elevado costo para el gremio minero (Johnson y
Hallberg, 2005).

Una opción viable para la remediación del DAM son los biorreactores pasivos con
un bajo costo de mantenimiento, facilidad de operación en áreas remotas y
aprovechamiento de desechos agroindustriales de la región (Doshi, 2006). Los biorreactores
pasivos son columnas empacadas con una mezcla reactiva conformada por sustratos
orgánicos y celulósicos como fuentes de carbono y energía para los microorganismos, un
componente inorgánico (piedra caliza, arena, gravilla) como material de soporte y un
inóculo microbiano. Durante el funcionamiento, el DAM pasa a través de la mezcla

4
reactiva bajo un tiempo de retención hidráulico (TRH), con el fin de incrementar la
alcalinidad y el pH, reduciendo los sulfatos y generando sulfuro que reacciona con los
metales disueltos para forman minerales insolubles y así lograr su remoción (Luptakova et
a l, 2010).

Estudios previos han reportado que la cuidadosa selección de una mezcla reactiva
capaz de suministrar carbono y nitrógeno orgánico a los microorganismos a corto y largo
plazo, asegura mayor eficiencia al biorreactor (Neculita et al., 2011; Ayora et al., 2013;
Yim et al., 2014). Además, la mezcla reactiva se prepara con sustratos orgánicos de la
región minera, por lo cual no existe una “receta” para un buen diseño y es necesario realizar
estudios en batch y a escala de laboratorio que aseguren el futuro funcionamiento del
reactor en campo (Gusek, 2008). Por otro lado, la eficiencia y el funcionamiento del
biorreactor a largo plazo también dependen de la composición química del DAM, las
variaciones en el flujo y las propiedades hidráulicas, especialmente del TRH (Adams et al.,
2015). Younger et al. (2002) estimó que el TRH es el objetivo de diseño más importante y
el más difícil de lograr cuando se implementan los biorreactores en campo. A la fecha el
efecto del TRH sobre la eficiencia de los biorreactores pasivos ha sido evaluado durante la
remediación del DAM con alta carga de metales (Chang et al., 2000; Neculita et al., 2008);
sin embargo, el efecto del TRH sobre DAM con alta concentración de sulfato y baja
concentración de metales como el caracterizado en el distrito minero de Zipaquirá, aún no
ha sido estudiado.

Aunque los efectos de los parámetros de diseño sobre la eficiencia de los reactores
han sido descritos, todavía no se entiende bien la relación entre los parámetros de operación
y la comunidad microbiana presente durante el funcionamiento de los biorreactores. Este
tipo de estudios son esenciales para asegurar el funcionamiento de los biorreactores y
ayudar a mejorar su diseño y rendimiento a largo plazo (Lu et al., 2011). Hasta ahora la
mayoría de investigaciones se han enfocado en correlacionar la eficiencia de los
biorreactores con el número de bacterias sulfato-reductoras (BSR) a través de la técnica del
número más probable (NMP) dejando de lado las bacterias celulolíticas y fermentadoras,
que son las encargadas de degradar fuentes de carbono complejas, haciéndolas disponibles

5
a las BSR. Además el NMP es una técnica de recuento que limita el conocimiento de las
comunidades microbianas, mientras que técnicas moleculares modernas permiten
cuantificar y entender la dinámica de las comunidades en diferentes ambientes.

Se considera que la actividad de las bacterias sulfato-reductoras (BSR) es la clave


para la biorremediación del DAM (Neculita et al., 2007). Sin embargo, las BSR no pueden
oxidar directamente fuentes complejas de carbono y dependen del metabolismo de otras
bacterias como fermentadoras y celulolíticas presentes en el reactor (Hiibel et al., 2008).
Esto implica que el número de bacterias degradadoras de fuentes complejas de carbono sea
otro factor crítico que afecte el rendimiento de los reactores a largo plazo (Burns et al.,
2012). No obstante, hasta ahora no se conoce la dinámica entre los grupos metabólicos
presentes en el reactor, ni como cambia a través del tiempo y el espacio del reactor. Aunque
los reactores pasivos son una opción efectiva para la remediación de los DAM no existen
estudios del efecto del TRH sobre la diversidad microbiana. Este tipo de estudios son
esenciales para asegurar el funcionamiento de los biorreactores y ayudar a mejorar su
diseño y rendimiento.

Teniendo en cuenta estas necesidades, se diseñaron siete biorreactores pasivos con


base en las características del DAM y de la materia orgánica disponible en el distrito
minero de Zipaquirá. Se evaluó el efecto de TRH sobre la eficiencia para remediar el DAM
durante 36 semanas y los biorreactores fueron sacrificados a diferentes intervalos de
tiempo. En la mezcla reactiva post-tratamiento se estudio el efecto del TRH y del gradiente
espacio/temporal sobre la diversidad microbiana. Esta investigación permitió elucidar la
dinámica (espacial y temporalmente) de las comunidades microbianas que participan en la
biorremediación del DAM y su relación con los parámetros de operación de los reactores
pasivos. También, contribuyo con la adaptación tecnologíca de los biorreactores pasivos a
las condiciones del distrito minero de Zipaquirá, optimizando el proceso para un futuro
tratamiento in situ, que beneficiará a las pequeñas empresas mineras.

6
2 MARCO TEORICO

2.1 Formación de drenajes ácidos de minas (DAM)

La generación de DAM es un proceso que combina la acción fisiscoquímica y


biológica (Sánchez-Andrea et al., 2014). La primera fase del proceso es química y ocurre
cuando los minerales sulfurados son expuestos al agua y oxígeno. El mineral sulfurado más
abundante es la pirita (FeS2) y es utilizada como ejemplo. A pH neutro la pirita se oxida
produciendo iones ferrosos (Fe+2), sulfatos (SO4-2) y protones (H+) ocasionando una
disminución del pH y provocando un incremento en los sólidos totales disueltos (Ec. 1).

FeS2+ 3 .5O2+H2O ------- ► Fe+2+ 2 SO4-2+ 2H+ (1)

Cuando el pH desciende (<4,0) se inicia el mecanismo biológico y la reacción puede


ser catalizada por microorganismos que incrementan la cinética de reacción en seis o siete
órdenes de magnitud descendiendo aún más el pH (Evangelou y Zhang, 1995). Durante esta
etapa la bacteria ataca al sulfuro mediante su adherencia al mineral y la posterior acción
enzimática que involucra transferencia de electrones desde la parte reducida del mineral al
oxígeno disuelto (Rodríguez et al., 2003). Si el ambiente es muy ácido, con un pH cercano
a 3,0 los iones ferrosos (Fe+2) se oxidan a iones férricos (Fe+3) (Ec. 2).

4Fe+2+ O2+ 4H+1 ------- ► 4Fe+3 + 2H2O (2)

Los iones férricos (Fe+3) son un poderosos agente oxidante de los minerales
sulfurados, incluso más activo que el oxígeno (entre 18 a 170 veces) (Sánchez-Andrea et
al., 2014). Cuando el pH decrece estos permanecen en solución y son reducidos por la pirita
generando más iones ferrosos (Fe+2) y mayor acidez (Ec. 3) (Johnson y Hallberg, 2005).

FeS2 + 14Fe+3 + 8H 2O --------► 15Fe+2 + 2 SO4-2 +16 H+ (3)

Si el ambiente próximo es muy oxidante y el pH es cercano a 3,0 muchos iones


ferrosos se oxidan a iones férricos que reaccionan con el agua, precipitando como hidróxido
y generando más acidez (Ec.4).

Fe+3 + 3H2O ------ ► Fe(OH)3 + 3H+1 (4)

7
Inicialmente la oxidación de la pirita es un proceso lento, pero a medida que la
capacidad de neutralizar del medio se pierde y el pH desciende, la capacidad del Fe+3 para
oxidar la pirita incrementa (Ec.3) siendo la causa de la rápida formación del DAM (Figura
1). Además la tasa de formación del DAM se ve afectado por factores como: oxígeno, agua,
microorganismos, textura (tamaño de grano y superficie), solubilidad del mineral y
concentración de elementos traza.

Figura 1 Etapas de generación química de DAM (Aubertin et al., 2001)

El DAM puede ser neutralizado por carbonatos, especialmente por calcita (CaCO3),
dolomita (CaMg(CO3)2) y menos común magnesita (MgCO3). Estos minerales producen
carbonatos (Ec. 5 y 6) que incrementa la alcalinidad y el pH, facilitando la precipitación de
los metales (Evangelou y Zhang, 1995).

CaCO3(s) + H+ 1(aq) ------ ► Ca+2 + HCO3- (5)

CaMg(CO3)2(s) + 4 H+ 1(a q ) ------- ► 2H CO3- + Mg+2 (6)

Aunque la neutralización por carbonatos es un proceso rápido, establecer un


equilibrio de disolución es difícil por el continuo cambio de la presión de CO2 , además el
Fe+2 y Mn+2 precipitan sobre la piedra caliza, reduciendo la superficie de contacto. Estos
factores pueden reducir la eficiencia de los sistemas de tratamiento y deben tenerse en
cuenta durante el diseño (Evangelou y Zhang, 1995).

8
2.2 Microorganismos involucrados en la generación del DAM

Las propiedades fisicoquímicas del DAM (pH, fuerza iónica, temperatura)


restringen el hábitad para unas pocas especies. Esto es atribuido al limitado número de
reacciones capaces de suministrar energía a los microorganismos en este ambiente
(Newman et al., 2003). Los microorganismos detectados en el DAM pertenecen a 11
linajes, entre ellos Proteobacteria, Nistrospira, Fermicutes y Acidobacteria. Sin embargo, el
más relevante en la generación del DAM es la especie Acidithiobacillus del phylum
Proteobacteria (Hallberg, 2010). El uso de las técnicas moleculares en el estudio en la
microbiología del DAM, ha incrementado el conocimiento de la diversidad de
microorganismos acidófilos. Estos incluyen, moderadamente termófilas (20°C a 35°C)
como Leptospirillum ferrooxidans, moderadamente acidófilas como Thiomonas y
Halothiobacillus spp y oxidadoras de hierro como la especie propuesta Ferrovum
myxofaciens que presenta una morfología similar a Gallionella ferruginea (Newman et al.,
2003; Hallberg, 2012). Recientemente, se han identificado otros microorganismos en el
DAM del río Tinto en la franja piritica de España, sin embargo aún se desconoce si estan
implicados en su generación. Los más relevantes son Alphaproteobacteria (Acidiphilium,
Acidocella, Acidisphaera), Betaproteobacteria (order Nitrosomonadales, Ferrovum
myxofaciens), Gammaproteobacteria (Bacterium WJ2), Acidobacteria, Firmicutes y
Actinobacteria (García-Moyano et al., 2012). Las arqueas involucradas en la generación del
DAM, han sido poco estudiadas y sólo se conocen algunas. La más relevante es
Ferroplasma acidiphilum aislada de la mina Richmond (Edwards et al., 2000) capaz de
realizar la oxido-reducción del hierro. Otras arqueas pertenecientes los grupos
Euryarchaeota y Thermoplasmatales han sido identificadas en ambientes impactados por
DAM (García-Moyano et al.,2012; Hallberg, 2012).

2.3 Selección de un sistema de tratamiento pasivo para el tratamiento de DAM

A finales de 1978, el grupo pionero de la universidad estatal de Wright identificó


que cuando el DAM ingresaba en un pantano natural, se reducia la concentración de
metales y sulfato, mientras incrementaba el pH de 2,5 hasta 5,0 (Huntsman et al., 1978).

9
Estas observaciones de campo permitieron desarrollar la idea de contruir humedales
artificiales para el tratamiento del DAM y el consecuente desarrollo de la tecnología de los
sitemas de tratamiento pasivos. Con base en las investigaciones desarrolladas por Tuttle et
al. (1969) sobre el metabolismo de las BSR y su potencial uso en el tratamiento DAM,
investigadores como Hedin (1989), Fukui (1990), Dvorak (1992), Bjorn et al. (1996) y
Cheong (1998), desarrollaron los biorreactores pasivos. Actualmente, la busqueda se ha
encaminado hacia el incremento de la eficiencia de remoción de los metales y hacia la
prolongación del tiempo de operación (Rose, 2010; Ayora et al., 2013; Yim et al., 2014).
Esto ha permitido el desarrollo de varios sistemas de tratamiento pasivos como son:
humedales aerobios y anaerobios, sistema sucesivo de producción de alcalinidad (SAPS),
drenaje anoxico de piedra caliza, canales abiertos de piedra caliza y biorreactores
sulfatoreductores. La selección del sistema depende de varios factores como la composición
química del DAM, el caudal y la geografía de la zona minera (Figura 2) (Watzlaf et al.,
2004)

Con el fin de seleccionar el sistema de tratamiento pasivo adecuado y las unidades


de operación que lo conforman se debe conocer a profundidad las propiedades
fisicoquímicas del DAM. Además, los caudales de algunas minas son muy consistentes
mientras que otras pueden variar considerablemente, por lo que se recomienda que la
composición y el caudal del DAM sean monitoreados durante un año (Watzlaf et al., 2004).
En general los humedales aerobios tratan vertimientos con alcalinidad neta, los drenajes
anóxicos de piedra caliza tratan DAM con bajo contenido de Al+3, Fe+2 y oxígeno disuelto
(< 1 mg/L). Los SAPS, los humedales anaerobios y los biorreactores sulfato reductores o
pasivos tratan DAM con alto contenido de metales o sulfato, bajo pH y bajo oxígeno
disuelto (Lopez et al., 2002). A partir de las propuestas elaboradas por Skousen (1994 y
1998), Watzlaf e Hyman (1995) y Hedin (1997), se ha elaborado un diagrama de flujo
(Figura 2) que permite seleccionar el tipo de tratamiento pasivo o la secuencia de pasos más
adecuados para tratar el DAM. Este propuesta es con base en la química del DAM
(concentración de metales, metaloides y sulfatos, pH, acidez, alcalinidad, sólidos solubles y

10
condiciones redox) y por lo general requiere de la sucesión de varios sistemas de
tratamiento o de la combinación de ellos (ITRC, 2013).

Determ inar el caudal.


Com posición quím ica del DAM.

alca i na acida

Determ inar OD
Fe*3. A l+3

OD < 1 m g /L y OD > 1 m g/L o


-e > 1 m g/L o
Al > 1 m g/L

Agua Drenaje anoxico Agua Estanque de


acahna de piedra caliza acida sedim entación

Estanque de Estanque de
sedim entación sedim entación
¿Metales
pesados ¡

Canal abierto
Sistema de piedra caliza
Biorreactor productor de
bioquím ico alcalinidad

Hum edal
aerobio Estanque de sedim entación Estanque de
y a ir e a c ió n sedim entación

¿Cumple con los estándares Reevaluar el


am bientales? diseño ¿Cum ple con los estándares
am bientales?

Descarga

Figura 2 Diagrama de flujo para la selección de los biorreactores pasivos como sistema de
tratamiento del DAM (Gusek, 2008).

2.4 Biorreactores pasivos para tratamiento de DAM

Una opción promisoria para la remediación de los DAM son los reactores pasivos
(Gusek, 2002) o biorreactores bioquímicos pasivos (ITRC, 2013). Los dos nombres definen
un sistema donde se remedia el DAM por medio de la remoción de los metales y el sulfato,
mientras se incrementa el pH y la alcalinidad. Este proceso se lleva a cabo por medio de
una serie de reacciones secuenciales que son mediadas por varios grupos de

11
microorganismos. Además no requiere la adición de sustancias químicas, ni de consumo de
energía durante su funcionamiento que puede ser hasta por 10 años. Los reactores son
columnas o pozos empacados con una mezcla reactiva conformada por sustratos orgánicos
como fuentes de carbono y energía, un componente inorgánico (piedra caliza, arena,
gravilla) como material de soporte y un inóculo microbiano con bacterias degradadoras de
celulosa, fermentativas y BSR. Por la mezcla reactiva empacada se hace pasar el DAM bajo
un TRH con el fin de favorecer la formación de minerales insolubles reduciendo así los
metales disueltos (Gusek, 2002).

2.4.1 Mezcla reactiva

La eficiencia del biorreactor pasivo para remediar el DAM depende de la actividad


bacteriana, la cual es controlada principalmente por la composición de la mezcla reactiva
(Pruden et al., 2007; Hiibel et al., 2011). Esta es una mezcla de substratos orgánicos
disponibles en la región con carbonato de calcio (incrementa la alcalinidad), gravilla
(incrementa la permeabilidad) y un inóculo microbiano (Adams et al., 2014). Los
substratos pueden ser compuestos orgánicos de bajo peso molecular o residuos orgánicos
lignocelulósicos. Entre los de bajo peso molecular encontramos alcoholes (metanol y
etanol), ácidos orgánicos (acetato, lactato, piruvato) y azúcares (glucosa), tienen la ventaja
de ser directamente utilizados por las BSR, pero implican altos costos que los hacen
inviables y algunos como los alcoholes involucran problemas de seguridad pública cuando
son almacenados en grandes cantidades. Entre los substratos lignocelulósicos encontramos
residuos orgánicos (compost, gallinaza, estiércol) y celulósicos (desechos de papel, aserrín,
paja, astillas), desechos de alimentos (papa, vino, melaza, queso) y aguas residuales con
alta carga orgánica. Aunque estos substratos son abundantes y económicos son de lenta
degradación y deben ser reducidos a compuestos de bajo peso molecular por los
microorganismos heterotróficos antes de ser utilizado por las BSR (Seyler et al., 2003). Si
se utilizan substratos lignocelulósicos estos deben permitir el arranque, el establecimiento y
la operatividad del biorreactor por largos períodos de tiempo, para esto deben contener: a)
sustancias fácilmente disponibles (azúcares solubles, aminoácidos, algunas proteínas,
almidón), b) celulosa y hemicelulosa, c) lignina (Gibert et al., 2004). El primer grupo es

12
utilizado rápidamente durante la puesta en marcha del reactor por las BSR y los
microorganismos que los consumen durante el establecimiento del sistema de tratamiento
(Place et al., 2005). La celulosa es degradada lentamente hasta moléculas simples, por
degradadores de celulosa y su tasa de descomposición determina a largo tiempo la tasa de
sulfato-reducción (Adams et al., 2014). Finalmente, la lignina que se considera no
degradable por los microorganismos anaerobios y se recomienda en baja concentración en
la mezcla reactiva (Gibert et al., 2004).

Los primeros trabajos establecieron mezclas reactivas compuestas sólo por un


sustrato orgánico y un material inerte (Christensen et al., 1996; Waybrant et al., 1998;
Prasad et al., 1999). Los substratos orgánicos que usaron fueron compost de champiñon o
estiércol de vaca, pero estos presentaron problemas de conductividad hidráulica
ocacionando taponamiento (URS, 2003). Estudios más recientes utilizan una combinación
entre carbonato, aserrín y alfalfa porque suministra alcalinidad, alta permeabilidad y es una
buena fuente de energía para la comunidad bacteriana a largo plazo (Adams et al., 2014).
Diferentes estudios han concluido que un sólo sustrato no es suficeinte para mantener las
condiciones de sulfato reducción por largos períodos de tiempo y que la remoción de
sulfato es mas alta cuando se realizan mezclas entre sustratos orgánicos y celulosicos
(Cocos et al., 2002; Zagury et al., 2006; Neculita et al., 2008a). La correcta selección del
sustrato orgánico es un paso critico dentro del diseño y operación del biorreactor, porque de
el depende la disponibilidad de los nutrientes para la comunidad de microoganismos. Por lo
tanto, es necesaria una caracterización previa que prediga su biodegradabilidad y favorezca
su aplicación (Gibert et al., 2004). Debido a que diferentes substratos orgánicos son usados
en la preparación de la mezcla reactiva, no existe una “receta” para el diseño de los
biorreactores, en su lugar se recomiendan ensayos batch y en continuo en el laboratorio, así
como a nivel piloto en campo que puedan incrementar el éxito del diseño, especialmente en
minas con drenajes de química compleja (Gusek, 2008).

La mezcla reactiva debe contener un inóculo de microorganismos que favorezcan la


degradación de celulosa y el establecimiento de las condiciones sulfatoreductoras. En
estudios batch se ha determinado que cuando se utiliza un buen inóculo la remoción de

13
sulfato y la producción de sulfuros se realiza en períodos más cortos (Pruden et al., 2007).
Como inóculo se puede utilizar sedimentos de lagos y de rios contaminados con DAM en
donde se encuentren microorganismos aerobios que favorezcan el rápido consumo de
oxígeno y nitrato así como organismos anerobios que se establescan en el reactor (ITRC,
2013). Diferentes estudios indican que en gran medida el rendimiento y longevidad de los
biorreactores depende de la actividad de las BSR (Hiibel et al., 2008; Pereyra et al., 2008).
Sin embargo, las BSR no pueden oxidar directamente fuentes complejas de carbono y
dependen del metabolismo de otras bacterias como las fermentadoras y celulolíticas. Esto
implica que el número de bacterias degradadoras de fuentes complejas de carbono presentes
en el inóculo es otro factor crítico (Hiibel et al., 2008). La inoculación con bacterias de
precultivos o con estiércol suple el sistema con BSR, pero estos microorganismos son
obligados a pre-adaptarse a los metales lo que puede demorar el arranque del biorreactor
(Pruden et al., 2007; Sánchez-Andrea et al., 2014). Las BSR se encuentran en variedad de
ambientes como suelos, sedimentos, desechos industriales y mineros. Adicionalmente,
tienen la capacidad de acoplar su crecimiento a la oxidación de compuestos orgánicos o al
hidrógeno molecular y a la reducción de sulfatos (Muyzer y Stams, 2008).

Las BSR son anaerobios estrictos; sin embargo, pocas especies pueden tolerar e
incluso resistir el oxígeno por períodos de tiempo muy limitados (Muyzer et al., 2008).
Algunas pueden utilizar el sulfito (SO32-), tiosulfato (S2O32-) o el azufre (S0) como
aceptores de electrones alternativos, y reducirlos de igual manera, a sulfuro (Rabus et al.,
2006). Por último, también se ha observado que las BSR pueden usar compuestos orgánicos
como el fumarato o el dimetilsulfóxido, como aceptores finales de electrones para su
crecimiento (Hao et al., 2014). Estos microorganismos no pueden oxidar directamente
moléculas orgánicas de alto peso molecular como celulosa, hemicelulosa, lípidos y
proteínas, por lo cual habitan en sinergismo con bacteria celulolíticas, fermentativas y
acidogénicas (Figura 3) (Pereyra et al., 2010). La degradación de los sustratos orgánicos
debe llevarse a cabo en condiciones anaeróbicas, donde la primera etapa es la hidrólisis de
biopolimeros por acción de enzimas celulolíticas, proteolíticas y lipoliticas (Madigan et al.,
2002). La etapa hidrolítica puede ser el proceso limitante en la degradación anaerobia,

14
sobre todo cuando se trata de sustratos orgánicos porque depende varios factores como:
contenido de biopolimeros, temperatura, pH y concentración final de los productos de la
hidrólisis (Cook et al., 2008). Al finalizar la etapa hidrolítica los compuestos deben ser
fermentados para producir otros que puedan ser metabolizados por las bacterias
acetogénicas para producir acetato e H2 , productos que puede ser utilizado por las BSR para
reducir el sulfato hasta sulfuro (Madigan et al., 2002).

La presencia de materia orgánica en los reactores permite que los microorganismos


anaerobios sean metabólicamente activos e incrementen el pH y la alcalinidad del DAM
bajo las siguientes reacciones químicas (Zagury et al., 2006):

2 CH2 O + SO4-2 > S-2 + 2CO2 + H2 O


microorganismos (7)
S-2 + 2CO2 + -------------► 2HCO3-2 + H2 S (8)
H2 S + M+2 ________ ^ MS + 2H+ (9)

En donde CH2 O (Ec. 7) representa la materia orgánica (donadora de electrones) en


presencia de los microorganismos que facilitan la trasferencia de electrones hacia el sulfato
(SO4-2) (aceptor de electrones). El CO2 (Ec. 8) permite la formación del ión bicarbonato
(HCO3-2), el cual neutraliza el pH y favorece la reacción entre los sulfuros (S -2) libres y los
metales para formar sulfuros metálicos (MS) que finalmente precipitan (Ec. 9). Los dos
protones producidos (Ec. 9) son neutralizados por la alcalinidad generada a partir del CO2
(Ec. 8) (Ñancucheo et al., 2014).

En presencia de sulfato las BSR pueden competir con las metanogénicas por los
productos de la acetogénesis, pero bioquímicamente las BSR presentan una mayor afinidad
por el hidrógeno, cuando las concentraciones de este gas son menores de 5-10 pM, las
metanogénicas no son capaces de crecer a esas concentraciones, sin embargo las BSR
pueden sobrevivir. En cuanto al acetato, la afinidad de las BSR es diez veces superior que
la de las metanogénicas y esta diferencia es mayor cuando el acetato se encuentra en
niveles limitantes, lo cual impide la metanogénesis (Muyzer y Stams, 2008).

15
Macromoléculas orgánicas
(proteínas, polisacáridos y lípidos)
V_______________________________________ J
Hidrólisis

Monomero (aminoácidos, azucares


y largas cadenas de ácidos grasos

Fermentación

Compuestos reducidos
Reducción de
(lactato, butirato y propionato)
su Ifatos

Reducción de
sulfates

W
Reducción de
Acetato
sulfatos

Reducción de
su fatos

Figura 3 Degradación de materia orgánica en ambientes anaerobios y en presencia de


sulfato (Muyzer, 2008).

En cuanto al material de soporte o componente inorgánico (arena, gravilla) se


reporta que las mayores tasas de reducción de sulfatos en biorreactores se logran cuando los
microorganismos tienen acceso a una superficie porosa, especialmente si el poro es grande
con un buen volumen vacío porque esto reduce el taponamiento (Costello, 2003). El
diámetro recomendado es de aproximadamente 0,6 mm pero no menor, de lo contrario el

16
sustrato tiende a compactarse y disminuye la conductividad hidráulica (Neculita et al.,
2007; Haakensen et al., 2015). El material de soporte dentro del biorreactor permite que los
microorganismos se puedan establecer y llevar a cabo los procesos metabólicos.
Adicionalmente cuando se presentan poros o espacios entre la mezcla reactiva se favorece
el flujo y se evita la compactación (Tsukamoto et al., 2004). En los biorreactores
empacados con sustratos orgánicos es común la compactación debido a la precipitación de
sulfuros metálicos y del incremento de la biomasa microbiana, debido a esto se han
evaluado diferentes soportes físicos (gravilla, arena cuarzo disco de cerámica, plástico
peletizado, piedra pomez) que permitan una buena conductividad hidráulica y el
funcionamiento de los biorreactores por décadas (Lyew y Sheppard, 1997).

2.4.2 Propiedades hidráulicas de los biorreactores pasivos

La eficiencia y el funcionamiento a largo plazo de un biorreactor dependen de sus


propiedades hidráulicas, especialmente de la conductividad hidráulica, la porosidad de la
mezcla reactiva, el TRH y el caudal (ITRC, 2003). La conductividad hidráulica (Ksat)
representa la mayor o menor facilidad con la que la mezcla reactiva deja pasar el DAM a
través de ella y esta gobernada por la ley de Darcy que puede expresarse de la siguiente
manera (Bolis et al, 1992):

„ * Ah
Q- KSat A

Donde Q es el caudal (cm3/seg), A es el area tranversal (cm2), Ah/AL es el gradiente


hidráulico (cm/cm). Estimar correctamente Ksat previene problemas futuros de reducción de
porosidad y permeabilidad causados por los solidos suspendidos (oxi-hidroxidos,
carbonatos, sulfuros metálicos y biomasa) en el reactor, que pueden afectar la eficiencia y
finalmente causar su fracaso (Neculita et al., 2007). El Ksat de la mezcla reactiva debe ser
cercano a 1 * 10"2 cm/seg y ajustar su composición en busca de este valor favorece el
dimensionamiento de sistema piloto (Costello, 2003). En los biorreactores pasivos que
utilizan compost como único substrato el Ksat tiene un valor cercano a 1 * 10"4 cm/seg y se
han observado problemas de compactación y sedimentación en los primeros meses de

17
operación. Por lo tanto, se recomienda una mezcla reactiva con diferentes substratos
orgánicos (cascaras de nuez, astillas de madera) y en especial con aserrín, debido a su alta
conductividad hidráulica (10-2a 10-3 cm/seg) que previene el taponamiento (URS, 2003).

La porosidad de la mezcla reactiva es otro importante parámetro hidráulico y debe


ser estimada antes de establecer el TRH (URS, 2003). Este parámetro aumenta con el
porcentaje de aserrín o de astillas de madera presentes en la mezcla reactiva. Estos
substratos pueden ocupar los huecos entre la gravilla y separar los componentes de la
mezcla reactiva, incrementando los caminos de flujo (Amos y Younger, 2003). En
laboratorio el rango de porosidad debe estar entre 0,35 hasta 0,63, mientras que en campo
se recomienda entre 0,15 hasta 0,35. La porosidad es un parámetro que debe tenerse en
cuenta durante la selección de la mezcla reactiva y en el dimensionamiento de los
biorreactores en campo (Younger, 2002; Neculita et al., 2008 a/b; Ayora et al., 2013).

Una vez seleccionada la mezcla reactiva el siguiente paso es la evaluación de la


eficiencia del reactor en flujo continuo y para esto se debe establecer el TRH. Este
parámetro hidráulico se define como el tiempo promedio que una gota de DAM que ingresa
al biorreactor se demora en salir (Gibert et al., 2004). En estudios de campo se ha
encontrado que el TRH de los biorreactores pasivos debe ser minimo 1,5 d y máximo 4 d,
su elección depende de la carga de los metales y el pH del DAM (Younger et al., 2002). Sin
embargo, hay reportes que indican que los sulfuros metálicos requieren entre 3 a 5 d para
formarse (URS, 2003). En reactores pasivos se ha encontrado que después de la elección de
la apropiada mezcla reactiva, el TRH es el parámetro hidráulico más difícil de lograr
(Younger et al., 2002). Esto se debe a que un corto TRH no permite que la actividad
bacteriana neutralice la acidez y precipite los metales, mientras que un largo TRH puede
ocasionar el crecimiento excesivo de los microorganismos que consumen los substratos
orgánicos agotando la mezcla reactiva (Neculita et al., 2007): sin embargo, largos TRH son
usualmente utilizados en el tratamiento de DAM con alta concentración de metales (Chang
et al., 2000; Neculita et al., 2008a/b).

18
El TRH tiene influencia directa sobre la eficiencia de los reactores pasivos (Bolis et
al., 1992; Younger et al., 2002; Neculita et al., 2008a) y es dependiente del flujo o caudal
que ingresa al reactor y puede calcularse de la siguiente forma:

VT x 9
v TRH

Donde Q es el caudal (cm3/seg), VT es el volumen total de la mezcla reactiva (cm3) y 9 la


porosidad de la mezcla reactiva. El caudal que ingresa al reactor tiene impacto directo sobre
la eficiencia, si es muy alto puede colmatar el biorreactor sobresaturando la mezcla reactiva
e inhibiendo la actividad de los microorganismos, por el contrario si es muy bajo el sustrato
puede oxidarse y liberar los metales que ya habían sido precipitados y disminuir la
comunidad microbiana (Gusek, 2002). Los biorreactores pasivos pueden ser de flujo
descendente o ascendente. Estudios de campo muestran que biorreactores con flujo
ascendente tienden a durar más que los descendentes, por que en los primeros el DAM es
obligado entrar en contacto con la mezcla reactiva en forma homogénea contrarrestando la
compactación y limitando los problemas de flujo resultantes de la formación de trayectorias
preferenciales (URS, 2003). Si el caudal incrementa significativamente por encima del
caudal de diseño, la comunidad microbiana puede sufrir un efecto de lavado reduciendo la
eficiencia del reactor y requiriendo mantenimiento adicional (Doshi, 2006).

2.5 Factores que afectan la eficiencia de los biorreactores pasivos

La eficiencia de un reactor pasivo para remediar el DAM se determina por el


incremento del pH y la alcalinidad, así como por la remoción de sulfatos y metales. El pH
del DAM debe incrementarse antes y durante el tratamiento hasta un valor cercano a la
neutralidad (Neculita et al., 2007). Un pH > 7,0 asegura una óptima remoción de sulfatos y
metales mientras que a valores < 5,0 se inhibe la sulfato reducción y se incrementa la
solubilidad de los sulfuros metálicos (Dvorak et al., 1992). Además, a bajo pH la presencia
de ácidos orgánicos producidos durante la fermentación pueden inhibir el proceso de
sulfato-reducción. Los ácidos orgánicos a bajo pH pueden difundir a través de la membrana
celular y una vez dentro el pH intracelular (neutro) favorece la disociación del ácido,

19
liberando protones que terminan afectando el pH celular (Sánchez-Andrea et al., 2014). La
adición de carbonato de calcio a la mezcla reactiva durante el montaje del reactor favorece
el incremento del pH durante los primeros meses, pero durante el tratamiento la alcalinidad
es generada por la actividad de las BSR (Waybrant et al., 1998; Cocos et al., 2002; Zagury
et al., 2006).

Otro factor que reduce la eficiencia de los biorreactores pasivos es la concentración


de sulfuros disueltos en el caudal, el cual inhibe los microorganismos cuando una de sus
formas (H2S, HS- o S-2) dependiendo del pH ingresa a la célula y se combina con el hierro
de la ferrodoxina, los citocromos u otras enzimas con centros catalíticos metálicos,
causando inhibición en la cadena transportadora de electrones; sin embargo, se ha reportado
que esta inhibición es reversible (Okabe et al., 2002). El efecto tóxico de los sulfuros ha
sido reportado en concentraciones entre 477 hasta 617 mg/ L (Okabe et al., 2002). Estas
concentraciones de sulfuro son mayores que las observadas en los efluentes de los
biorreactores pasivos, por que el sulfuro libre se une a los metales, precipitando como
sulfuros metálicos (Neculita et al., 2007). Sin embargo, los sulfuros metálicos también
pueden causar toxicidad e inhibir los microorganismos por recubrimiento de las células
causando dificultad para acceder a la materia orgánica (Utgikar et al., 2002). El efecto de
los sulfuros sobre los microorganismos presentes en los reactores pasivos depende del pH,
la temperatura, tipo de fuente de carbono y concentración de hierro y sulfato (Hao et al.,
2003). En un biorreactor pasivo se espera que el potencial de oxido reducción (ORP) sea
negativo (<-100 mV) para proveer un ambiente sustentable para los microorganismos
anaerobios (Posgate et al., 1984). Sin embargo cuando ingresa oxígeno disuelto al reactor a
través del DAM, el ORP aumenta afectando los microorganismos y reduciendo la eficiencia
(Neculita et al., 2007). La concentración de oxígeno disuelto en el DAM para que el
proceso de sulfato-reducción no sea inhibido debe estar entre 0,1-1,0 mg/L, pero cuando
hay materia orgánica presente se pueden formar micronichos donde los microorganismos
están protegidos (Hao et al., 2003).

Durante la puesta en marcha y la etapa de aclimatación del reactor el principal


mecanismos de remoción de sulfato es la adsorción y la precipitación como yeso (Waybrant

20
et al., 1998), pero durante la etapa de operación la sulfato reducción es un indicador de la
actividad de las BSR. La tasa de remoción de sulfato se ve afectada por el área disponible
de la mezcla reactiva, el TRH, el número de BSR y las variaciones en la concentración de
sulfato en el DAM (Chang et al., 1999). Diferentes compuestos del azufre presentes en la
mezcla reactiva durante la etapa de operación pueden causar toxicidad sobre los
microorganismos en el siguiente orden: sulfato, tiosulfato, sulfito y sulfuros (Reis et al.,
1992). Los estudios de toxicidad de los metales sobre los microorganismos son reportados
con base en la concentración inicial en el DAM, pero no se tiene en cuenta su remoción
cuando ingresan al reactor (Hao et al., 2003). Los metales pueden ser removidos del DAM
por varios mecanismos: a) cuando incrementa el pH en el biorreactor algunos metales
precipitan por formación de hidróxidos (Fe , Cr y Al ) o carbonatos (Fe y Mn ), b)
adsorción en la materia orgánica, c) precipitación como sulfuros metálicos (Pb+2, Co+2,
Cd+2, Cu+2, Ni+2, Fe+2 y Zn+2) (Neculita et al., 2007). Aunque la precipitación por
hidróxidos y carbonatos es ampliamente usada en la industria para la remoción de metales,
la precipitación por sulfuros presenta algunas ventajas, como son: baja solubilidad,
potencial recuperación de los metales, rápida tasa de reacción, ligera decantación y
recuperación de los metales por fundición (Lewis, 2010). Además, factores como la
cantidad de materia orgánica, las condiciones ambientales (pH, carga iónica y temperatura)
y la cantidad de biomasa influyen sobre la absorción de los metales en la mezcla reactiva
(Martins et al., 2009).

2.6 Comunidades microbianas presentes en los reactores pasivos

Se ha observado que en biorreactores pasivos alimentados con moléculas de bajo


peso molecular (etanol, metanol, lactato) la población microbiana esta conformada en su
mayoría (95%) por BSR. Sin embargo en biorreactores empacados con material
lignocelulosico se ha evidenciado mayor diversidad y las BSR se encuentran en baja
proporción (5%) con respecto a las celulolíticas y fermentativas. Este balance, representa
una importante ventaja en términos de estabilidad y resiliencia al estrés por parte de la
comunidad (Hallberg et al., 2009; Hiibel et al., 2011). Se ha establecido que la comunidad

21
microbiana en los reactores pasivos está relacionada con factores como el inoculo (Pruden
et al., 2007; Pereyra et al., 2010), el tipo de substrato (Hiibel et al., 2011; Schmidtova y
Baldwin, 2011) y el tiempo de operación (Pereyra et al., 2008).

Los phylum dominantes en los reactores pasivos empacados con material ligno-
celulosico corresponden a Chloroflexi, Chlorobi, Proteobacteria, Firmicutes,
Actinobacteria, Planctomycetes, Spirochaetes, Acidobacteria, Bacteroidetes,
Verrucomicrobia, Gemmatimonadetes, Synergistetes y Caldiserica (Mirjafari et al., 2012;
Sánchez-Andrea et al., 2014). Se han reportado más de 100 géneros (Tabla 1), siendo los
microorganismos heterótrofos que degradan celulosa y otros polisacáridos los más
abundantes (25 al 30%) del total de la comunidad (Pereyra et al., 2010). Los géneros
celulolíticos de mayor abundancia reportados en estudios de biorreactores pasivos
corresponden a Bacteroides, Clostridium, Acetivibrio, Spirochaeta, Ruminococcus y
Cellullomonas. De igual manera, los fermentativos más reportados son Paludibacter,
Clostridium, Devosia y Treponema (Pruden et al., 2007; Hiibel et al., 2008; Lindsay et al.,
2011; Baldwin et al., 2015).

Tabla 1 Microorganismos reportados en biorreactores pasivos


Phylum Clase Género Referencia
C orynebacterium

R hodococcus
Hiibel e t al., 2008
Actinobacteria Actinobacteria C ellulom onas
Nancucheo e t al., 2012
M icrobacterium

A rth ro b a cter

B acteroides Pruden e t al., 2007


A lka liflexu s Hiibel e t al., 2008
P aludibacter Dann e t al., 2009
P arabacteroides Lindsay e t al., 2011
Bacteroidetes Bacteroidia P roteiniphilum Hiibel e t al., 2011
P revotella Bijmans et al., 2012
F lavobacterium Mirjafari e t al., 2012
M u ricauda Sánchez-Andrea e t al., 2013
F erruginibacter Baldwin e t al., 2015

22
Tabla 1 Microorganismos reportados en biorreactores pasivos (Continuación).
Phylum Clase Género Referencia
Chlorobi Chlorobi Ignavibacterium Kaksonen et al., 2004

Chloroflexi Chloroflexi Longilínea Mirjafari e t al., 2012


B revundim onas Hiibel e t al., 2008
B radyrhizobi um Bijmans et al., 2012
Alphaproteobacteria N itrobacter Sánchez-Andrea e t al., 2013
D evosia Baldwin e t al., 2015
P usillim onas
A lb id ifera x
R h odoferax Kaksonen et al., 2004
A cid o vo ra x Hiibel e t al., 2008
Betaproteobacteria D elftia Hiibel e t al., 2011
P o la ro m o n a Sánchez-Andrea e t al., 2012
P elom onas Mirjafari e t al., 2012
Janthinobacterium
P usillim onas
D esulfobacterium
D esulfobulbus
Kaksonen et al., 2004
D esulfom icrobium
Pruden e t al., 2007
D esulfovibrio
Hiibel e t al., 2008
Deltaproteobacteria D esu lfu rella
Hiibel e t al., 2011
Proteobacteria G eobacter
Sánchez-Andrea e t al., 2012
D esu lfo b a cca
D esulfom onile
D esulforhabdus
E nterobacter
Serratia
A cin eto b a cter
P seudom onas Pruden e t al., 2007
Gammaproteobacteria Steroidobacter Hiibel e t al., 2008
A ren im o n a s
Luteim onas
P seudoxanthom onas
P seudoxanthom onas
Sulfuricurvum
Kaksonen et al., 2004
Sulfurovum
Hiibel e t al.,2008
Epsilonproteobacteria A licyclo b a cillu s
Bijmans et al., 2009
Sporosarcina
Sánchez-Andrea e t al., 2012
A to p o stip es
A cetobacterium
Hiibel e t al., 2008
C lostridium
Hiibel e t al., 2011
Firmicutes Clostridia A n a ero fu stis
Martins e t a l., 2011
L u tisp o ra
Sedim entibacter
Sánchez-Andrea e t al., 2012
Hiibel e t al., 2008
S p irochaeta Hiibel e t al., 2011
Spirochaetes Spirochaetes T reponem a Mirjafari e t al., 2012
Baldwin et al., 2015

23
Con el desarrollo de las técnicas moleculares se han reconocido 40 géneros que han
sido agrupados por su fisiología y rol ecológico en completas (22 géneros) e incompletas
(16 géneros) oxidadoras de compuestos orgánicos y un remanente formado por
Desulfotomaculum y Desulfomonile, que presentan las dos características (Hao et al.,
2014). Diversos géneros han sido encontrados en los biorreactores pasivos, pero los de
mayor abundancia son Desulfovibrio, Desulfobulbus, Desulfomicrobium que pertenecen al
grupo de las incompletas oxidadoras y Desulfobacter que es el género dominante de las
completas oxidadoras (Sánchez-Andrea et al., 2014). Aunque se han realizado importantes
estudios sobre la diversidad microbiana asociada a la biorremediación del DAM,
investigaciones recientes utilizando técnicas de secuenciación masiva han detectado nuevos
grupos sin asignación taxonómica, sugiriendo que el potencial metabólico involucrado en la
degradación de la materia orgánica y de la biotransformación de metales es más diverso de
lo conocido hasta ahora ( Baldwin et al., 2015).

24
3 OBJETIVOS

3.1 Objetivo General

Evaluar un biorreactor pasivo durante la remediación de drenajes ácidos de mina (DAM) de


carbón del distrito minero de Zipaquirá.

3.2 Objetivo Específicos

• Diseñar un biorreactor pasivo teniendo en cuenta las caracteristicas del DAM y de la


materia orgánica disponible en el distrito minero de Zipaquirá.
• Evaluar el efecto del TRH sobre la eficiencia del biorreactor pasivo para remediar el
DAM.
• Evaluar el efecto del TRH sobre las propiedades fisicoquímicas de la mezcla reactiva
y la comunidad microbiana durante la biorremediación del DAM.

25
4 METODOLOGIA

4.1 Descripción del área de estudio

El distrito minero de Zipaquirá (3.400 km2), esta localizo al norte de la ciudad de


Bogotá (Colombia) y lo conforman ocho municipios (Figura 4); siete ubicados en el
departamento de Cundinamarca (Cogua, Cucunubá, Guachetá, Lenguazaque, Sutatausa,
Tausa, Zipaquirá) y uno en el departamento de Boyacá (Samacá). La región presenta una
geografía de montaña correspondiente a sub-paramos con altitud entre 2.000 y 3.000 metros
sobre el nivel del mar. La temperatura promedio es de 12°C con una precipitación de 500­
1.000 mm/año con alta humedad relativa y baja evapotranspiración (Prieto y Duitama,
2004).

Figura 4 Distrito minero de Zipaquirá y los municipios que lo conforman

El distrito Minero de Zipaquirá es el mayor productor de carbón coque del país y en


los últimos tres años ha incrementado su producción en un 23,8% (Ministerio de Minas y
Energía, 2014). Sin embargo, la mayoría de la actividad minera se basa en la explotación

26
artesanal con bajas condiciones tecnológicas. Este tipo de minería se caracteriza por baja
inversión, inadecuados canales de comercialización y deficiente infraestructura (Prieto y
Duitama, 2004). En la región hay 525 minas activas, 27 inactivas y 47 abandonadas, de las
cuales 452 explotaciones tienen un grado de tecnificación bajo. Las minas artesanales de
carbón no producen daños ambientales de manera individual, pero la acumulación de
pequeñas operaciones puede generar ~ 70.400 m3 de Drenajes/mes (FENALCARBON,
2006). Además se han contabilizado 772 hornos de coquización que consumen altas
cantidades de agua para el apague y generan vertimientos ácidos con residuos metálicos. De
acuerdo con el estudio realizado por la Corporación Autónoma Regional de Cundinamarca
(2010), el 55% de las minas realiza tratamiento de DAM por adición de sustancias
alcalinas, el 27% no realiza ningun tratamiento y en un 18% no se conoce. En cuanto a los
vertimientos el 10% de las minas lo hace en fuentes de agua y el 90% a campo abierto.

4.2 Caracterización fisicoquímica del DAM

Las características fisicoquímicas del DAM en el distrito minero de Zipaquirá


fueron establecidas por el monitoreo de 12 minas de carbón durante un año (n = 120
muestras). In situ se midió pH, potencial de óxido-reducción (ORP) y oxígeno disuelto
(OD) utilizando una sonda multiparamétrica, previamente calibrada (HI 9828, Hanna
Instruments; Woonsocket, RI). En cada mina se colectaron cuatro muestras en botellas de
polipropileno (100 mL); dos para cuantificación de metales disueltos que se filtraron (0,45
pm; Sartorius, Goettingen; Germany) y preservaron con HNO3 (pH 2,0) y dos para
determinación de sulfatos con pH al natural, todas fueron refrigeradas a 4°C hasta el
análisis. En el laboratorio 5 mL de cada muestra fueron diluidos hasta 100 mL con agua
destilada y deionizada. Los metales disueltos (Al+3, Ca+2, Cd+2, Fe+2, Mg+2, Mn+2, Pb+2 y
Zn+2) previamente reportados (Prieto y Duitama, 2004), fueron cuantificados por
espectrometría de absorción atómica (AA), (Varian 240 FS, Agilent Technologies; Santa
Clara, CA) usando el método 7000B (USEPA, 2007), con un límite de detección entre
0,03-1,00 mg/L (AnexoA).

27
Para la medición del sulfatos a 10 mL de muestra filtradas (0,45 |im) se les adicionó
2 mL de solución Buffer (30 g de MgCl2*6H2O, 5 g de CH3COONa*3H2O, 1 g de KNO3 y
20 mL de CH3COOH (99%), aforado a 1 L con agua destilada) y una punta de espátula de
cristales de BaCl2. Finalmente, se agitó a velocidad constante durante 60 ± 2 s y se
cuantifico por espectrofotometría UV-VIS a 420 nm (Genesys 10, Thermo Scientific,
Waltham, MA) por el Método 4500-SO4 (APHA 2005).

4.3 Muestreo de la materia orgánica y del sedimento (inoculo).

Un factor fundamental en el diseño de los biorreactores pasivos es la composición


de la mezcla reactiva y para su preparación se recomienda el uso de materiales orgánicos,
abundantes y económicos presentes en la región minera (Doshi, 2006; Haakensen et al.
2015). Por esta razón, seis sustratos orgánicos (estiércol vacuno, compost de champiñón,
ensilaje, residuos de la producción de papel, gallinaza compostada y aserrín de Sajo) fueron
seleccionados y colectados en el distrito minero de Zipaquirá. El estiércol y el ensilaje
fueron colectados en granjas locales, el compost de champiñón, la gallinaza y el aserrín
fueron comprados en una fábrica localizada en el municipio de Lenguazaque y los residuos
de papel fueron obtenidos en la fábrica de papel Familia Ltda. Se colectaron 5 kg de cada
substrato que se refrigeraron a 4°C hasta su uso. Previo a cada análisis el ensilaje fue
cortado en pequeñas piezas (~3 cm).

El sedimento utilizado como inóculo fue colectado en un humedal artificial utilizado


para tratamiento de DAM ubicado en la mina el Roble (4°13'30” latitud norte y 79°0'20”
longitud oeste) de la empresa Uniminas Ltda del municipio de Guachetá. El humedal fue
dividido en cuatro secciones y en cada una de ellas se colectaron dos muestras compuestas
en recipientes plásticos estériles (200 mL). Los frascos se abrieron dentro del agua y la
muestra fue colectada en el fondo del humedal con ayuda de una pala evitando contacto con
el aire y los frascos fueron cerrados sin espacio de cabeza. Inmediatamente, se refrigero a
4°C hasta su uso y luego se realizó una mezcla homogénea en cabina de anaerobiosis que
posteriormente fue caracterizada por triplicado para el conteo BSR por la técnica del
número más probable (NMP), Método D4412-84 (ASTM, 2009), (Anexo B).

28
4.4 Caracterización fisicoquímica y microbiológica de los sustratos orgánicos

Los substratos orgánicos fueron caracterizados fisicoquímicamente para determinar si


podían servir como fuente de carbono y nitrógeno, a corto y largo plazo, para la comunidad
microbiana durante el tratamiento del DAM. Los análisis se realizaron por duplicado con
métodos estándar (Tabla 2; Anexo B) en muestras húmedas y los resultados se expresaron
en peso seco (ps). Los análisis microbiológicos para el conteo de BSR por el NMP se
realizaron en 1 g de muestra antes de 24 h de almacenamiento. Para tener en cuenta el
conteo como positivo (después de 25 d) se observó un precipitado negro en el fondo del
tubo de amorfos sulfuros de hierro como p.e., greigita o makinawita (Gibert et al., 2005).
Cuando el precipitado no fue claro se adicionó al tubo cinco gotas de cloruro férrico
hexahidratado (0,005M) y tres gotas de N-N-dimethyl-p-phenylenediamine dihydrochloride
(0,005 M) para la formación de azul de metileno. Los tubos que adquirieron una coloración
azul se contaron como positivos.

Tabla 2 Análisis fisicoquímicos y microbiológicos realizados a los substratos orgánicos

Parámetro Análisis Método Referencia


pH 4972 - 01 ASTM (1995a)
Fisicoquímicos
% de humedad D 2216 - 98 ASTM (1995b)
COT 5310B APHA (2005)
Análisis elemental
TKN 4500-Norg APHA (2005)
COD 5310B APHA (2005)
Fácil degradación SFD Zagury et al. (2006)
STV 1684 USEPA (2001)
Celulosa
Difícil degradación Harper y Lynch (1981)
Lignina
Metales totales Neculita et al. (2008b)
No orgánicos Ceniza D2974 ASTM (1987)
Sulfato soluble Sección 3.2.6 Sobek et al. (1978)
Microbiológicos NMP- BSR D4412-84 ASTM (2009).
COT: carbono orgánico total STV: sólidos totales volátiles
TKN: nitrógeno orgánico total SFD: sustancias fácilmente disponibles
NMP: número más probable BSR: bacterias sulfato-reductoras
COD: carbono orgánico disuelto

29
4.5 Ensayo de lixiviación de metales y sulfatos en los substratos orgánicos.

Para determinar si los substratos orgánicos tenían la capacidad de lixiviar metales y


sulfato durante los ensayos en batch y en columna, se realizó el procedimiento de
extracción secuencial de metales desarrollado por Zagury et al. (1997). Además, se realizó
la cuantificación del sulfato solubilizado en condiciones ácidas propuesto por Sobek et al.
(1978). Los dos procedimientos se realizaron con 1 g de substrato húmedo y en triplicado.
La extracción secuencial consiste en la separación de los metales a través de cinco
fracciones: Fi metales solubles e intercambiambiables, extraídos con MgCl2 (0,5 M) a pH
7; F2 metales unidos a carbonatos extraídos, con buffer de NaOAc/HOAc (1 M) a pH 5; F3
metales reducidos o unidos a óxidos de Fe-Mn extraídos, con NH2OH: HCl (0,04 M) en
25% (v/v) HOAc; F4 metales unidos a la materia orgánica, extraídos con HNO3*H2O2 y
NH4OAc; y F5 fracción residual de metales unidos a minerales, extraídos con los ácidos
HNO3, HF, and HClO4. Finalmente los metales de cada fracción fueron cuantificados por
AA y el sulfato solubilizado con HCl (37%; reactivo analitico) fue cuantificado por UV-
VIS (Anexo B).

4.6 Preparación de las mezclas reactivas y del DAM sintético

Se preparó 1 kg de cada mezcla reactiva por triplicado a partir de los substratos


frescos, cada uno se pesó (ps) de acuerdo con los porcentajes establecidos (Tabla 7) y se
colocó en una cubeta plastica junto con la gravilla y el carbonato de calcio. La mezcla se
homogenizo y se empacó en una bolsa plástica que fue sellada y almacenada (4 - 6 °C) por
12 h. A cada mezcla reactiva se le determinó el porcentaje de humedad por diferencia entre
la muestra húmeda y seca después de un calentamiento a 105 ± 5 °C por 12 h.

El DAM sintético se preparó con el procedimiento establecido por Zagury et al.


(2006) y ajustado al mínimo pH y la máxima concentración de metales y sulfato encontrada
en cinco minas de carbón previamente caracterizadas en el distrito minero de Zipaquirá
(Tabla 4). En un recipiente plástico se dejaron en reposo 28 L de agua del grifo por 24 h a
temperatura ambiente, luego se adicionaron 15 g de CaCO3 y la mezcla se agitó

30
mecánicamente durante 12 h. Posteriormente, se adicionaron las sales de sulfato de acuerdo
con los metales encontrados en el drenaje (1,6 g MnSO4*5H2O, 1,3 g ZnSO4, y 4,5 g
MgSO4) se agitó fuertemente y luego se agregaron 30 g FeSO4*7H2O disueltos en un 1 L de
H2SO4 (1,25 N), se agitó nuevamente por 1 h y se dejó en reposo por 24 h para la completa
disolución de las sales. Finalmente, el pH se ajustó a ~3,0 usando 1 L de NaOH (1,6 N),
(Anexo C).

4.7 Determinación de la eficiencia de las mezclas reactivas.

Para seleccionar una mezcla reactiva para la construcción del biorreactor de flujo
continuo se evaluó la efieciencia de cinco mezclas previamente preparadas, cada una se
evaluó por triplicado durante 45 d, teniendo en cuenta la capacidad para incrementar el pH
y la alcalinidad así como de remover el sulfato y los metales del DAM. Se colocaron 250 g
(ps) en una botella de vidrio (2 L) junto con 1 L de DAM sintético. Las botellas se agitaron
fuertemente para mezclar los componentes y se taparon con un tapón de caucho con dos
puertos de fácil acceso para los muestreos. Por uno de los puertos se adicionó nitrógeno
gaseoso (N2 ) durante 10 min mientras el otro permanecía abierto, este procedimiento
pretendía crear condiciones anaerobias en el espacio de cabeza de la botella y así favorecer
el establecimiento de las BSR. Finalmente los puertos fueron sellados, las botellas se
envolvieron en papel aluminio para prevenir el crecimiento de bacterias fototróficas y los
biorreactores se dejaron en aclimatación por 9 d (Figura 5).

Figura 5 Montaje batch para evaluación de eficiencia de las mezclas reactivas.

31
El fondo de las botellas fue revisado diariamente y nueve días después se observó la
presencia de sulfuros metálicos (precipitado negro), que indicaba la reducción de sulfato a
sulfuro producido por el establecimiento de BSR en el biorreactor. Los eventos de muestreo
se realizaron los días 9, 16, 23, 30, 37 y 45 en cada uno de ellos, se extrajo por uno de los
puertos y con ayuda de una jeringa 50 mL de DAM tratado, mientras se aplicaba nitrógeno
por el otro puerto. El pH y el ORP fueron inmediatamente medidos con sonda
multiparamétrica, la alcalinidad fue determinada por titulación (TitroLine alpha plus 20,
Schott) de 10 mL de muestra sin filtrar por el método 2320B (APHA, 2005). El resto de la
muestra fue centrifugada a 8.000 x g for 10 min y filtrada (0,45 pm) y se utilizó para
cuantificar sulfatos por UV-VIS y metales solubles por AA.

4.8 Determinación de la conductividad hidráulica y la porosidad de las mezclas


reactivas

Se determinó la conductividad hidráulica y la porosidad a las dos mezclas reactivas


que presentaron mayor eficiencia para tratar el DAM en los ensayos batch. Para determinar
la conductividad hidráulica se utilizó el método de cabeza constante D2434 (ASTM, 2000)
en un permeámetro de flujo descendente por triplicado. Se empacaron 300 g de mezcla
reactiva fresca, luego se abrió la valvula superior del permeámetro y se dejó fluir agua a
través de la mezcla manteniendo el espacio de cabeza constante. Cuando el volumen de
agua que salía de la valvula inferior del permeámetro fue constante se determinó el caudal.
Además se midió la altura y el diámetro de la mezcla reactiva en el permeámetro y el
espacio de cabeza. A partir de los datos obtenidos y utilizando la ley de Darcy se estableció
la conductividad hidráulica de las mezclas reactivas, (Anexo D).

A la mezcla reactiva que presentó mayor conductividad hidráulica se le determinó la


porosidad utilizando el método de densidad aparente. La mezcla que se encontraba en el
permeámetro se extrajo y se depósito sobre un recipiente de aluminio con peso conocido, se
calentó a 105 ± 5 °C por 12 h y se determinó el peso seco. Posteriormente, se calculó la
densidad aparente de la mezcla reactiva y se dividió entre la gravedad especifica de la turba
(0,7) como valor de referencia (Neculita et al., 2008a). El valor obtenido de la división fue

32
restado de la unidad y el producto de la diferencia fue considerado como la porosidad,
(Anexo D).

4.9 Montaje y operación de los biorreactores pasivos

Se construyeron siete biorreactores utilizando columnas de acrílico (10 cm de


diametro x 73 cm de alto) con tapa de acrílico en los dos extremos. La tapa inferior tenía
una válvula para el ingreso del DAM y la tapa superior tenía dos válvulas; una para la
salida del DAM tratado y otra para el muestreo. En la parte inferior interna de la columna
se encontraba un plato poroso recubierto con un geomembrana (malla 25) que servía de
soporte al material empacado. Sobre el plato poroso se colocó una capa de gravilla (0,6 -
1,0 mm) de 7 cm para evitar perdida de materia orgánica y taponamiento de la válvula de
entrada del DAM. Luego se empacó la mezcla reactiva en capas de 10 cm que fueron
suavemente compactadas hasta alcanzar una altura de 63 cm. Finalmente, se colocó otra
capa de gravilla de 3 cm, la geomembrana, el plato poroso y la tapa superior. La columna
fue saturada de manera ascendente con DAM sintético, se envolvió en papel aluminio y
plástico negro y se dejó dos semanas en periodo de aclimatación (Figura 6).

Durante la etapa de aclimatación, dos veces a la semana se extrajeron 20 mL de


muestra para monitorear si las condiciones eran favorables para el establecimiento de BSR
(pH: 5 - 8, ORP < -100mV). Cuando las condiciones se lograron, se inició el flujo continuo
de DAM sintético (preparado semanalmente) a través de los biorreactores (Fig 7). Se
establecieron tres columnas con un flujo de 0,74 mL/min para 2 d de TRH y cuatro con un
flujo de 0,37 mL/min para 4 d de TRH. Después de las primeras 17 semanas de operación
se observó un fuerte incremento de sulfuros en los efluentes de los biorreactores de 4 d.
Con el fin de evaluar si un menor TRH podía reducir la generación de sulfuros, una
columna de 4 d de TRH fue conmutada a 1d por incremento del flujo hasta 1,48 mL/min. El
TRH fue seleccionado de acuerdo con el tiempo minimo (2 d) recomendado para la
formación de sulfuros en un reactor pasivo (URS, 2003). El flujo fue continuo durante 36
semanas de operación utilizando bombas peristálticas de precisión calibradas previamente
(Masterflex L/S, Cole Parmer).

33
Figura 6 Montaje de los biorreactores pasivos: A) mezcla reactiva; B) capa de gravilla y 10
cm de mezcla reactiva; C) plato poroso y geomembrana; D) tapa superior del biorreactor;
E) saturación del biorreactor con DAM sintético; F) aclimatación de los biorreactores.

4.10 Determinación del efecto del TRH sobre la eficiencia de los biorreactores pasivos

Semanalmente se colectaron 50 mL de efluente por el puerto ubicado en la tapa


superior del biorreactor (Figura 7). El pH y el ORP fueron medidos inmediatamente con
sonda multiparamétrica y la alcalinidad se determinó en 10 mL de muestra sin filtrar por
titulación automática. La muestra remanente fue filtrada (0,45 pm) y en ella se
determinaron sulfatos por UV-VIS, metales por AA y sulfuros por el método azul de
metileno (4500 D; APHA, 2005). Además, se realizó el conteo de BSR una vez al mes por
la técnica del NMP.

34
Figura 7 A) Montaje de columnas con diferentes TRH (1, 2 y 4 d) para el tratamiento de
DAM sintético B) toma de muestra para analisis

Para identificar el mecanismo de remoción asociado a los cambios de los efluentes,


se calcularon los índices de saturación (IS) usando el software de modelación geoquímica
Visual MINTEQ versión 3,0 (Gustafsson, 2011). Para la modelación se utilizaron las
propiedades fisicoquímicas de los efluentes en las semanas 8, 18, 26, 32 y 36. Este modelo
considera la distribución química de las especies presentes de acuerdo con varios procesos
geoquímicos como son: disolución/precipitación, oxidación/reducción, iones
intercambiables y complexación. Sin embargo, el modelo VMINTEQ no considera la
actividad de las BSR (Waybrant et al., 2002; Zagury et al., 2006).

4.11 Remoción de sulfuro, Fe+2 y Mn+2 de los efluentes del biorreactor con 1 d de
TRH por aireación.

Durante una semana se colectaron 250 mL de los efluentes del reactor de 1 d de


TRH en un frasco de vidrio (0,5 L) tapado con un tapón de goma y con un puerto para
colecta del DAM tratado (Figura 8). El pH y el ORP fueron medidos con sonda
multiparamétrica y la alcalinidad se determinó en 10 mL de muestra por titulación
automatica. Además se determinaron sulfatos por UV-VIS, metales por AA y sulfuros por

35
el método azul de metileno. Posteriormente, uno de los extremos de la manguera fue
conectado a una bomba de aire (power life p-500) y el efluente fue sometido a un flujo de
1,5 L/min durante 300 min. Se realizaron 8 eventos de muestreo, los 6 primeros cada 30
min y los dos últimos cada 60 min. En en los efluentes aireados se analizaron nuevamente
los parámetros fisicoquimicos y se determino la calidad con base en la legislación
Colombiana para vertimientos mineros (Resolución 0631 de 2015).

Figura 8 Montaje de aireación para remoción de sulfuro, Fe+2 y Mn+2 de los efluentes del
biorreactor con 1 d de TRH.

4.12 Sacrificio de los biorreactores

Los biorreactores pasivos fueron sacrificados a diferentes intervalos de tiempo; en


las semanas 8 y 17 se sacrificaron columnas para 2 y 4 d de TRH y en la semana 36 se
sacrificaron columnas para 1, 2 y 4 d de TRH. Los biorreactores fueron desconectados de la
línea de alimentación del DAM y se dejaron desaguar toda la noche a través de la válvula
inferior. Posteriormente, se les retiro la tapa superior, la geomembrana y el plato porosos.
Sobre una superficie previamente esterilizada se extrajo la mezcla reactiva en tres capas (10
cm de ancho x 20 cm de alto), que se denominaron alto (A), medio (M) y bajo (B) de
acuerdo con la base del reactor. Cada capa fue manipulada por separado retirando
manualmente la gravilla y homogenizando la mezcla reactiva post-tratamiento (Figura 9).

36
Figura 9 Etapas del sacrificio de los biorreactores pasivos; A) columna de 4 d de TRH en
la 17 semana; B) plato poroso; C) mezcla reactiva post tratamiento; D) capa de la parte
baja; E) homogenización y muestreo; F) muestras fisicoquímicas y biológicas.

4.13 Determinación del efecto del TRH sobre la composición de la mezcla reactiva
post-tratamiento.

De cada capa de mezcla reactiva post-tratamiento previamente homogenizada se


tomaron al azar seis muestras de ~100 g cada una. En total se tomaron 126 muestras
correspondientes a 7 biorreactores, con tres capas cada uno y 6 muestras por capa. La mitad
de las muestras se preservaron en nevera a 4°C hasta su uso y la otra mitad se secaron al
aire por 48 h sobre papel absorbente, y posteriormente fueron maceradas y tamizadas (No
50; 0,297 mm). El pH y él % de humedad se determinaron inmediatamente en muestra
húmeda, mientras que el nitrógeno orgánico y la celulosa se determinaron en muestra seca
al aire. Todos los análisis fueron corregidos con peso seco y se realizaron por triplicado.
Los análisis se realizaron utilizando los métodos estándar (Tabla 3; Anexo B) que se habían

37
utilizado previamente durante la caracterización de los substratos orgánicos. Además, para
la mezcla reactiva post-tratamiento se realizaron análisis de carbono orgánico total (COT),
metales totales y metales extraídos simultáneamente (MES) que junto con sulfuros ácidos
volátiles (SAV), permitieron determinar los mecanismos de remoción durante el tiempo de
operación de los biorreactores.

Tabla 3 Análisis fisicoquímicos realizados a la mezcla reactiva post-tratamiento


Análisis Método Referencia
pH 4972 - 01 ASTM (1995a)
% de humedad D 2216 - 98 ASTM (1995b)
COT Walkley-Black Schumacher (2002)
TKN 4500-Norg APHA (2005)
SAV Di Toro et al. (2005)
Celulosa Harper y Lynch (1981)
SFD Zagury et al. (2006)
Zagury et al. (1997)
Metales totales Neculita et al. (2008b)
Sulfato soluble Sección 3.2.6 Sobek et al.(1978)
NMP- BSR D4412-84 ASTM (2009).
COT: Carbono orgánico total SAV: Sulfuros ácidos volátiles
TKN: Nitrógeno orgánico total SFD: Sustancias fácilmente disponibles
NMP: Numero más probable BSR: Bacterias sulfato-reductoras

4.13.1 Determinación del carbono orgánico total

Se preparó una mezcla oxidante con 0,2 g de mezcla reactiva, 5 mL de dicromato de


potasio (1N) y 10 mL ácido sulfúrico concentrado (grado analítico). La mezcla se calentó a
150 ± 5 °C por 30 min y se dejó toda la noche a temperatura ambiente en cabina de
extracción. Luego se aforó a 50 mL con agua desionizada y se extrajo una alícuota de 10
mL a la cual se le adicionó 5 gotas de ácido fosfórico (grado analítico) y 2 gotas de
indicador de difenilamina. Finalmente, el dicromato de potasio residual se tituló con sulfato
ferroso amoniacal (0,5M; pH 2,0) hasta obtener una coloración verde (Schumacher, 2002).

4.13.2 Determinación del sulfuro ácido volátil y de los metales extraídos


simultáneamente

Los sulfuros ácidos volátiles (SAV) y los metales extraidos simultaneamente (MES)
se determinaron por el método de purga y trampa utilizando HCL (6M) modificado por

38
Neculita et al. (2008b) y en triplicado. Antes de iniciar la extracción se preparó la solución
buffer sulfuro antioxidante compuesta por NaOH (2 M), ácido ascórbico (0,1 M) y EDTA
(0,1 M). En el fondo del erlenmeyer se colocó 1 g de mezcla reactiva húmeda y en el vial
adherido a una de las paredes del erlenmeyer se colocó 2 ml de solución buffer sulfuro
antioxidante (Figura 10). Posteriormente, el sistema se tapó y lentamente se adicionaron 20
mL de HCL (6M) a través de una manguera instalada en el tapón teniendo cuidado de no
salpicar el vial y de sellar rápidamente el sistema para evitar la perdida de gases. El sistema
se colocó en agitación durante 1 h a 150 rpm y el contenido del vial fue retirado para
análisis de sulfuros, por el método azul de metileno. La solución del fondo del erlenmeyer
fue filtrada (0,45 pm) para cuantificar los metales (Fe+2, Mn+2 y Zn+2) por AA.

Figura 10 Montaje empleado para la determinación de sulfuros ácidos volátiles.

4.13.3 Determinación de metales totales

La concentración total de Fe, Zn y Mn acumulados en la mezcla reactiva post­


tratamiento fue determinada de acuerdo con la metodología empleada por Zagury et al.
(1997) y en triplicado. En un tubo de polipropileno de 50 mL se pesó 0,5 g de muestra
humeda y se le adicionó 10 mL de HCl (grado analítico), la mezcla se dejó en cabina de
extracción por 24 h a temperatura ambiente. Posteriormente, se adicionó 15 mL de HNO3
(grado analítico) y se calentó al baño maría 75±3oC por 50 min. Luego se adicionó 10 mL

39
de HCLO4y 1 mL de HF (grado analítico) y se continuó con el calentamiento a baño maría
por 2,5 h más. Finalmente la mezcla se dejó enfriar y se diluyó a 100 mL con agua
deionizada para luego filtrarse (0,45 pm). Los metales disueltos fueron cuantificados por
AA.

4.14 Muestreo, extracción y cuantificación del ADN metagenómico.

Para los análisis moleculares se colectaron 63 muestras de mezcla reactiva post­


tratamiento, que corresponden a 7 biorreactores, 3 capas por reactor y 3 muestras por capa.
Además, se analizaron tres muestras de la mezcla reactiva inicial empleada durante el
montaje de los biorreactores. Las muestras fueron colectadas en frascos de polipropileno de
50 mL (9400 RCF; Corning Costar) estériles y se conservaron a -80°C hasta su analisis. La
extracción del ADN se realizó con el kit comercial PowerMax®Soi DNA Isolation Kit (MO
BIO; Carlsbad, CA), utilizando 10 g de muestra y siguiendo las recomendaciones del
protocolo establecido por el fabricante. El ADN metagenómico fue cuantificando utilizando
el método fluorométrico Qubit® (Invitrogen GmbH, Karlsruhe, Germany) y su integridad
se visualizó en gel de agarosa al 1,5% p/v.

4.15 Amplificación de la región V4 del gen 16S rARN

La amplificación de la región V4 se realizó utilizando los primers 515F y 806 R


para bacterias y arqueas modificados por Caporaso et al. (2011), para la plataforma
Illumina HiSeq/MISeq (Figura 11). El protocolo utiliza cinco primers; dos para la PCR
(forward y reverse) y tres para la secuenciación (adaptador, linker y pad). El primer
adaptador es para la plataforma illumina, el linker es un fragmento enlazador no homólogo
a ninguna secuencia del 16S rARN y el pad es una región encargada de evitar dímeros con
los adaptadores modificados. Además el primer 806R contiene un barcode de 12 pares de
bases que permite la identificación de cada muestra, (Anexo E).

Cada uno de los extractos fue amplificado por triplicado en 30 pL: 1,2 ng DNA
molde, buffer (1X), dNTP (0,2 mM de cada uno), MgSO4 (2 mM), primers (0,2 pM de

40
cada uno) y polimerasa (Platinum Taq DNA Polimerasa High Fidelity-Hot Start,
Invitrogen) (0,02 U/pL). Las condiciones de amplificación fueron las siguientes:
denaturación inicial 94°C por 3 min; 30 ciclos de denaturación a 94°C por 45 seg,
anillamiento a 50°C por 60 seg y extensión a 72°C por 90 seg; y un ciclo de extensión final
a 72°C por 10 min. El tamaño del producto (400 pb) se verificó en gel de agarosa al 1,5%
P/V. Las tres amplificaciones de cada extracto fueron unidas en un sólo tubo y purificadas
utilizando el kit UltraClean® PCR Clean-Up Kit (MO BIO; Carlsbad, CA). Finalmente,
una sola muestra compuesta fue preparada por combinación equi-molar de los productos de
PCR de todas las muestras y verificada en gel de agarosa al 1,5% P/V, donde debía estar
presente una sola banda, (Anexo E).

Primer 806R
< ------------ T AAT CTWT GGGVH CAT CAGG CCGACTGACTGATTGCGATCCCTA TAGAGCATACGGCAGACGAAC'5
Am plicon prim er Reverse Linker Pad Barcode Adaptador ¡ilumina

Primer 515F
5'AATGATACGGCGACCACCGAGACGTACGTACGGT GTGCCAGCMGCCGCGGTAA ------------
Adaptador ¡ilumina Pad linker prim er Forward Am plicon

Figura 11 P rim ers para la construcción de los amplicones de la región V4 del gen 16S
rRNA, (Caporaso e t a l ., 2012).

En la preparación de la muestra compuesta se incluyeron como controles tres


librerías de la región V4 del gen 16s rARN; dos de cepas puras P seu d o m o n a s d enitrificans
y A gro b a cteriu m sp y de una de mezcla de 12 cepas denominada comunidad artificial
(A zo m o n a s sp, P seudom onas sp, P seu d o xa n th o m o n a s sp (x2), Stenotrophom onas sp (x3),
R h izo b iu m sp (x2), A rth ro b a cter sp, B revu n d im o n a sp, R a lsto n ia sp) obtenidas del
laboratorio USBA (Universidad Javeriana). El servicio de secuenciación se llevó a cabo
en DNA Facilities (Universidad de Iowa) con la plataforma MiSeq de Illumina (2*250 pb)
siguiendo las recomendaciones del protocolo de secuenciación de Caporaso e t a l . (2012).
Este protocolo permite aprovechar los 250 ciclos de secuenciación ya que los p r im e r s de
secuenciación fueron diseñados para hibridar adelante de los adaptadores, con lo cual estos
no se secuencian.

41
4.16 Calidad, ensamblaje y limpieza de las secuencias

La calidad de los datos crudos recibidos de la secuenciación fue analizada con el


programa FASTQC (Andrews, 2010). El ensamblaje fue realizado empleando la
herramienta Fast Length Adjusment of Short Reads (FLASH) (Magoc y Salzberg, 2011).
Durante el ensamblaje se estableció un solapamiento mínimo de 240 pb, un máximo de 255
pb y un porcentaje de error de coincidencia (mismatch) del 30%. Las secuencias
ensambladas de forma exitosa fueron filtradas con la herramienta QIIME 1.7 (Caporaso et
al., 2010). Los parámetros de calidad aplicados fueron: el 75% de las bases de las
secuencias debían ser de alta calidad (q > 25), si se encuentran 3 bases consecutivas de baja
calidad se trunca la secuencia (r = 3) y no se permitió ninguna base ambigua (N = 0)
(Bokulich et al., 2013). Además, no se permitió ningún error en las secuencias de los
barcodes, las secuencias que no cumplieron con estos parámetros fueron descartadas.

4.17 Asignación de OTUS

La asignación de los OTUS se realizó mediante el proceso denominado pick open


reference OTUs que consiste de los siguientes pasos: primero para eliminar quimeras se
descartaron las secuencias con menos de 60% de similitud con las secuencias del set de
referencia de Greengenes. Luego se realizó el agrupamiento en OTUS de las secuencias
con un 97% de similitud calculado con UCLUST (Edgar, 2010), utilizando la base de datos
de referencia de 16S rARN de Greengenes (DeSantis et al., 2006). Finalmente se
construyeron las tablas de OTU en formato BIOM (McDonald et al., 2012) y se
normalizaron de acuerdo con los resultados de una de las muestras y una de las cepas
control.

4.18 Determinación del efecto del TRH sobre la composición y diversidad de las
comunidades microbianas

La estimación de la abundancia relativa (%) de phylum y género se realizó por


comparación entre el número de secuencias asignadas a un taxón específico dividido entre

42
el número total de secuencias obtenidas o normalizadas por muestra. Los análisis de
diversidad se llevaron a cabo utilizando la herramienta QIIME 1.7 y el sofware Phyloseq
1.5.21 a través de Rstudio version 3.0 (McMurdie y Holmes, 2013) con matrices de
distancias calculadas con el método de UniFrac teniendo en cuenta la ausencia/presencia y
la abundancia de los OTUS (Lozupone y Knight, 2005).

4.19 Análisis estadístico

Para los análisis estadísticos se determinó si los datos presentaban distribución


normal (Shapiro-Wilk), y homogeneidad de varianzas (Levene). Las variables que no
siguieron una distribución normal (p<0,05) fueron normalizadas con log x, cos x o Vx. Se
realizó un análisis de varianza multifactorial (ANOVA), para identificar las diferencias
significativas entre las variables evaluadas y posteriormente se realizaron pruebas de
comparaciones múltiples (Tukey). Los análisis permitieron determinar si existían
diferencias significativas entre el TRH (1, 2 y 4 d), el tiempo de operación (semanas 8, 17 y
36) y las alturas en el reactor (alto, medio y bajo). Para buscar las variables fisicoquímicas
que se relacionan linealmente, se realizó una correlación de Pearson, los análisis se
desarrollaron con SPSS Statistics versión 19 (IBM SPSS; Armonk, NY).

Los índices de diversidad de Shannon y de riqueza de Chao1 fueron analizados con


el test de Montecarlo (número de permutaciones = 999 y a = 0,05). La P-diversidad fue
comparada con UniFrac utilizando las matrices de distancias filogenéticas para
presencia/ausencia (Unweithing) y abundancia (weithing) (Lozupone y Knight, 2005). Los
resultados fueron presentados en gráficas de análisis coordinado de componentes (ACoP)
realizadas con R phyloseq 1.5.21 (McMurdie y Holmes, 2013). Además, se evaluó el efecto
de los factores sobre la diversidad microbiana mediante el test no paramétrico ANOSIM
(número de permutaciones = 999 y a = 0,05). Las diferencias estadísticas de la abundancia
de los géneros a través de las alturas en el biorreactor se evaluaron mediante pruebas
pareadas del t -test Welch's corregido mediante Benjamini Hochberg (p = 0,05), utilizando
la herramienta STAMP versión 2.01. Para evaluar el efecto de las variables fisicoquímicas
sobre la diversidad se realizó un análisis multivariado de correspondencia canónica (ACC)

43
usando el software CANOCO fBraak y Smilauer, 1998). Las variables fisicoquímicas
utilizadas en el CCA fueron estandarizadas con ((x+1)/sd) (Ramette, 2007).

44
5 RESULTADOS Y DISCUSIÓN

5.1 Caracterización fisicoquímica del DAM

Las características fisicoquímicas del DAM, presente en el distrito minero de


Zipaquirá fueron establecidas por el monitoreo de 12 minas de carbón durante un año. Se
encontró que siete minas activas generaban efluentes neutros con pH entre 6,5 - 7,0 (Anexo
F), mientras que cinco minas generaban DAM con pH entre 3,0 - 4,5 (Tabla 4). La
presencia de DAM había sido previamente reportada en este distrito, especialmente en los
municipios de Tausa y Cucunuba (Prieto y Duitama, 2004). El carbón de este distrito
presenta bajo contenido de azufre total (0,84%), sin embargo, en algunas franjas se
encuentra acompañado de pirita (24-61%) que favorece la generación del DAM (Pérez et
al., 1987). Por otro lado, el distrito se encuentra sobre la formación Guaduas que se
caracteriza por la presencia de minerales alcalinos como calcita (CaCO3), ankerita
[Ca(Fe,Mg,Mn)(CO3)2], y dolomita [CaMg(CO3)2] que pueden participar en la
neutralización de los drenajes y corresponder con los altos contenidos de Ca+2 y Mg+2
encontrados durante la caracterización.

Tabla 4 Caracterización fisicoquímica del DAM presente en cinco minas activas del
distrito minero de Zipaquirá.

Parámetro Unidad min max Promedio ± SD


pH 3,0 4,5 3,3±0,6
Conductividad pS/cm 1.740 3.788 2.896±105
OD 0,6 5,2 2,3±3,0
Fe+2 55,6 200,5 164,4±92,6
Mn+2 11,4 31,5 29,2±14,5
Zn+2 mg/L 1,1 18,0 14,3±11,0
Ca+2 180,8 214,0 230,5±14,4
Mg+2 18,6 128,0 130,5±63,2
SO4 - 2 811 2.500 2.345±208

Las concentraciones de los metales y el sulfato, fueron muy variables debido a las
condiciones climáticas de los muestreos. Durante los últimos cuatro muestreos se presentó
un fuerte invierno (alta precipitación) que ocasiono inundaciones en la región (año 2011).

45
Los contenidos de metales Fe+2, Mn+2 y Zn+2 presentaron correlación con el sulfato (0,98,
0,66 y 0,62; p < 0,05, respectivamente), esto es debido a la composición del DAM, donde
el bajo pH ocasionado por la presencia de ácido sulfúrico incrementa la disolución de
minerales. Otros metales (Al+3, Cd+2, Pb+2) no fueron detectados, aunque han sido
reportados en las cenizas del carbón y en estudios previos (Pérez et al., 1987; Prieto y
Duitama, 2004).

5.2 Caracterización fisicoquímica y microbiológica de los sustratos orgánicos

Los substratos orgánicos presentaron valores de pH entre 6,5 y 9,7. El aserrín de


sajo fue levemente ácido (6,5), mientras que la gallinaza compostada fue fuertemente
básica (9,7), los otros substratos fueron neutros (Tabla 5). Estos substratos pueden
contribuir con la generación de un pH (5,0 - 8,0) óptimo para el crecimiento de BSR
(Postgate, 1984). El COD fue mayor en el compost de champiñón y en el ensilaje (1.752 y
1.369 mg/L, respectivamente), estos substratos pueden ser buenos donadores de electrones
y una fuente de carbono para los microorganismos durante la etapa de aclimatación, pero
no a largo plazo como fue observado por Schmidtova y Baldwin (2011). El más bajo
contenido de COD fue para la gallinaza compostada; sin embargo, presentó el mayor
contenido de SFD que corresponden a la fracción biodegradable conformada por azúcares,
amino ácidos, almidón y hemicelulosa que son consumidas rápidamente durante la etapa de
aclimatación (Zagury et al., 2006). La gallinaza compostada presentó la mayor
concentración de nitrógeno orgánico, seguida del compost de champiñón y el estiércol
vacuno, haciendo estos substratos esenciales en la composición de todas las mezclas
reactivas. El contenido de carbono y su relación con nitrógeno son factores que afecta el
crecimiento de las BSR y por lo tanto la eficiencia de los biorreactores pasivos (Cocos et
al., 2002; Waybrant et al., 2002; Zagury et al., 2006). Se recomienda una relación de C:N
cercana 10 para la degradación biológica (Reinertsen et al., 1984) y el compost de
champiñón presentó la relación más cercana (11,7), mientras que el aserrín de sajo el más
lejana (294,5), esto indica una alto contenido de COT con respecto al nitrógeno. Sin
embargo, no todo el COT presente en el aserrín es disponible para las BSR, porque se

46
encuentra en forma de celulosa (50,2 ± 0,1%) y lignina (5,5 ± 0,5%) y este debe ser
degradado hasta moléculas de bajo peso molecular antes de ser utilizado. El análisis de
STV se utiliza para estimar la biodegradabilidad de un material sólido durante largos
periodo de tiempo (Matthiessen et al., 2005). Los mayores porcentajes de STV fueron para
el aserrín, el ensilaje y el estiércol (96,3; 82,0 y 82,5%, respectivamente), indicando que
estos substratos pueden ser utilizados en el reactor como fuente de carbono a largo plazo. El
más alto contenido de lignina fue para el residuo de papel y la gallinaza (24,0 ± 0,5%) esto
puede dificultar la biodegradabilidad y la capacidad de desarrollar la actividad microbiana,
porque la lignina no es fácilmente disponible para las BSR (Cocos et al., 2002; Waybrant et
al., 2002; Gibert et al., 2004).

Tabla 5 Propiedades fisicoquímicas de los substratos orgánicos


Compost Residuo Aserrín
Parámetro Estiércol Gallinaza Ensilaje
Champiñón de papel de Sajo
pH 7,0±0,2 9,7±0,2 7,6±0,1 6,9±0,7 8,2±0,3 6,1±0,3
Humedad % 70,5±0,6 20,4±0,5 21,3±0,6 80,6±0,4 30,0±0,1 10,8±0,4
COD mg/ L 444,0±8,5 40,4±0,4 1.751,5±13,4 1.369,0±16,6 234,7±0,5 97,0±0,9
STV 82,5±0,7 32,3±2,6 46,0±3,2 82,0±3,2 43,2±0,1 96,3±0,3
SFD 25,6±0,5 63,0±0,2 48,6±0,5 27,2±0,2 22,0±0,1 9,0±0,5
TKN 2,2±0,1 3,3±0,2 2,3±0,9 0,13±0,1 0,14±0,1 0,22±0,1
COT % w/Wps 43,3±1,2 24,5±0,1 27,0±0,7 54,2±0,3 35,0±0,7 55,0±0,2
Celulosa 31,3±0,7 52,4±0,7 42,1±0,9 34,5±0,5 64,3±0,9 50,2±0,1
Lignina 12,5±0,3 22,0±0,7 17,0±0,7 5,7±0,3 24,0±0,5 5,5±0,5
Ceniza 24,6±0,1 68,3±1,0 54,1±0,2 26,0±5,0 43,4±0,8 1,0±0,1
C/N 19,4 7,4 11,7 420,0 248,6 249,5
SRB Células/100 mL 6.5x102 8.3X101 5.2X101 2 .6 x 103 <20 <20
STV (sólidos totales volátiles) COD (carbono orgánico disuelto)
SFD (sustancias fácilmente disponibles) COT (carbono orgánico total)
TKN (Nitrógeno total Kjeldahl) SRB (Bacterias sulfato-reductoras)

En resumen, el compost y el estiércol son una buena fuente de carbono y nitrógeno


orgánico que pueden sustentar el crecimiento de los microorganismos a corto y largo plazo.
Por otro lado, el aserrín de sajo presenta un porcentaje alto de solidos volatiles y de
celulosa, con bajo contenido de lignina y cenizas, favoreciendo su biodegradación y
haciéndolo una fuente de carbono a largo plazo. Aunque la gallinaza ha sido utilizada en
reactores pasivos con buenos resultados (Zhang y Wang, 2014), el alto porcentaje de

47
cenizas y lignina, así como la baja concentración de COD encontrados en este estudio la
hace un sustrato no recomendado para ser utilizado a largo plazo, además Zagury et al.
(2006) encontraron que este substrato lixivia amoníaco, contaminando el efluente y
perdiendo rápidamente el nitrógeno orgánico. El COD, C/N, SFD y lignina son indicadores
de la fracción biodegradable y permiten evaluar la habilidad de los sustratos orgánicos para
promover sulfato-reducción en los tratamientos de DAM (Zhang y Wang, 2014). Bajo esta
premisa, se propone un clasificación de los substratos orgánicos como donadores de
electrones y fuente de carbono y nitrógeno para las BSR: estiércol> compost de
champiñon> ensilaje> gallinaza> aserrín> residuos de papel.

Los substratos fueron caracterizados microbiológicamente para BSR, encontrandose


mayores recuentos en el ensilaje y en el estiércol. Estos resultados coinciden con los
reportados por Schmidtova y Baldwin, (2011) donde los sustratos con mayor COD
presentaron mayor número de BSR, posiblemente por la presencia de moleculas de carbono
de bajo peso moléculas (lactato y ácidos grasos) en la fracción soluble cuantificada. Los
menores recuentos de BSR fueron para el aserrín y los residuos de papel, esto es debido al
bajo porcentaje de SFD, COD y humedad, que no favoreció el crecimiento de
microorganismos. El ensilaje y el estiércol pueden contribuir con la inoculación de BSR en
los biorreactores pasivos aunque estas no se encuentran adaptadas a los metales como si
ocurre con los microorganismos presentes en el sedimento del humedal.

5.3 Ensayo de lixiviación de metales y sulfatos en los substratos orgánicos

En previos estudios se ha reportado la lixiviación de metales y sulfato de los


substratos orgánicos durante la etapa de aclimatación de los biorreactores pasivos (Cocos et
al., 2002; Neculita et al., 2011; Song at al., 2012). Se encontraron altos contenidos de
metales en la gallinaza compostada, el compost de champiñón y el estiércol, mientras que la
concentración más baja fue para el ensilaje, los residuos de papel y el aserrín (Tabla 6). La
concentración de los metales, presentó correlación con la concentración de ceniza (r = 0,96;
p < 0,05), esto ha sido reportado en estudios de compostaje donde se presentan cambios
químicos, físicos y biológicos durante la mineralización. Además, el porcentaje de ceniza

48
es un indicador del contenido de minerales, donde se incluyen los metales (Hsu y Lo, 1999;
Zorpas et al., 2003).

Tabla 6 Contenido de metales (Fe, Zn y Mn) en los substratos orgánicos (El valor
corresponde a la suma de las fracciones)

mg/kgDs
Substrato
Fe Zn Mn
Gallinaza 9.846,7±16,0 258,6±5,0 162,6±7,0
Compost de champiñón 8.240,5±92,5 185,6±4,0 285,5±9,0
Estiércol 1.325,5±15,0 190,0±9,0 385,2±2,8
Ensilaje 759,7±10,0 76,4±7,8 76,9±3,0
Residuos de papel 537,0±10,0 152,8±9,3 111,4±9,0
Aserrín 132,3± 17,0 23,0±1,5 25±0,4

El alto contenido de metales encontrado en el estiércol probablemente se debe a la


adición de minerales como suplemento de la alimentación del ganado, una práctica común
en la región. Además, el alto contenido de materia orgánica en el estiércol (75,4% por
diferencia con la ceniza), puede retener los metales por la formación de complejos con las
sustancias húmicas (Halim et al., 2003; Clemente et al., 2006). La retención de metales en
substratos orgánicos es dependiente del pH, cuando es básico se generan mayores sitios de
carga negativa incrementando la adsorción de los metales (Park et al., 2011). El más alto
pH fue para la gallinaza (9,7) generando una mayor posibilidad de formar enlaces con los
metales. Las propiedades químicas de los substratos (sustancias húmicas, ceniza y pH)
influyen sobre la especiación, transformación y distribución de los metales (Pérez-Esteban
et al., 2014).

Todos los substratos pueden lixiviar Mn+2 durante la etapa de aclimatación del
reactor o ante un descenso de pH. El Mn+2 fue el metal más abundante en las fracciones
solubles (F1) y de carbonatos (F2), especialmente en estiércol (86%), compost de
champiñón (50%) y residuos de papel (94%) (Figura 12). La capacidad de lixiviar del Mn+2
se debe a que se encuentra en su forma reducida, facilitando su movilidad al medio acuoso
(Tessier et al., 1979). Por otro lado, el Fe+2 puede lixiviar desde la gallinaza porque se
encuentra en un 66% unido a los carbonatos, pero en estudios previos donde la gallinaza ha

49
sido utilizada en reactores pasivos no se ha observado lixiviación de este metal,
posiblemente por su capacidad de co-precipitar con la materia orgánica (Zagury et al.,
2006; Zhang y Wang, 2014). El Zn+2 se encontró en la fracción F3 del estiércol (48%),
ensilaje (42%) y aserrín (40%) donde los metales están unidos a óxidos de Fe-Mn. Además,
su porcentaje fue alto en la F4 del aserrrin (92%) donde se encuentra unido a la materia
orgánica y donde se presentan condiciones reducidas (Okoro et al., 2012). Por último, el
Fe+2 se encontró en la fracción oxidable (F4) y en la residual (F5) de todos los substratos
(Figura 12), esto sugiere que este metal será retenido durante los ensayos en batch y en
continuo, porque se encuentran asociados a sulfuros o sustancias húmicas formando fuertes
enlaces (Zagury et al., 1997).

Figura 12 Fraccionamiento de Fe, Zn, y Mn por extracción secuencia en los substratos


orgánicos (F1 = solubles, F2 = unidos a carbonatos, F3 = reducidos o unidos a óxidos de Fe
y Mn, F4 = oxidados o unidos a materia orgánica, F5 = fracción residual de metales).

50
Por otro lado, el análisis de sulfato solubilizado con HCl (37%), mostró que el
compost de champiñón (28,0 ± 0,7 mg/kg), la gallinaza compostada (17,0 ± 1,0 mg/kg), el
estiércol (11,0 ± 0,5 mg/kg), y el ensilaje (6,5 ± 0,3 mg/kg) pueden lixiviar sulfato durante
la etapa inicial de los ensayos batch o en continuo. La lixiviación de sulfatos durante la
puesta en marcha de los reactores pasivos ha sido observada en previos estudios donde se
utiliza compost como parte de la mezcla reactiva (Neculita et al., 2011; Song et al., 2012a).
En general, durante la etapa de aclimatación de los ensayos batch y continuo es posible
observar la lixiviación de Mn+2 y sulfato desde las mezclas reactivas que contengan
compost y estiércol; sin embargo, se recomienda el uso de estos substratos por su capacidad
para donar electrones y ser fuentes de carbono y nitrógeno para las BSR.

5.4 Composición de las mezclas reactivas

Las mezclas reactivas fueron preparadas teniendo en cuenta los siguientes


requerimientos: substratos con compuestos de rápida y lenta degradación (STV, lignina,
COT, celulosa); buenos donadores de electrones (COD, SFD); relación C:N y
conductividad hidráulica. Se prepararon cinco mezclas reactivas compuestas en un 50% por
sustratos orgánicos y 50% por materiales inorgánicos e inóculo (Tabla 7). La gravilla fue
adicionada a la mezcla reactiva como material de soporte para los microorganismos y para
mejorar la conductividad hidráulica, mientras que el carbonato de calcio incremento el pH y
creo condiciones buffer en la mezcla reactiva durante la etapa de aclimatación cuando entra
en contacto con el DAM. Por otro lado, se incremento el porcentaje de aserrín con el fin de
mejorar la conductividad hidráulica y evitar la compactación producida por el compost y el
estiércol que se observó en los primeros estudios de biorreactores pasivos (URS, 2003).

51
Tabla 7 Composición de las cinco mezclas reactivas evaluadas durante el ensayo batch

Componentes Mezclas reactivas (% p/Pp.)


v 1 2 3 4 5
Estiércol 10 15 10 10 10
Gallinaza compostada 10 10
Compost de champiñón 10 10 10 10
Ensilaje 5 5 5 5
Residuos de papel 5 5
Aserrín de Sajo 25 25 25 10 20
Sedimento 15 15 15 15 15
Gravilla (0.6-1cm) 20 20 20 20 20
Carbonato de calcio 15 15 15 15 15

5.5 Determinación de la eficiencia de las mezclas reactivas

Después de la etapa de aclimatación (9 d) se encontró que el pH incrementó en


todos los biorreactores batch desde 3,0 ± 0,6 hasta 6,8 ± 0,1 incluso en el control (DAM +
sedimento). Luego, el pH de los biorreactores se mantuvo relativamente constante, mientras
que el control descendió hasta 5,7 ± 0,9 (18 d) y continuo descendiendo (3,7 ± 0,7) hasta el
final del estudio (45 d) (Figura 13). El incremento del pH durante la etapa de aclimatación
fue causado por la disolución del carbonato de calcio adicionado a las mezclas reactivas
(15%), así como a los grupos hidroxilos y carbonatos presentes en el sedimento y los
substratos orgánicos. Por otro lado, la alcalinidad de DAM tratado también incremento
desde 2.500 hasta 3.700 mg/ L CaCO3 y se mantuvo relativamente constante durante los 45
d del estudio. Sin embargo, en el control se observó un leve incremento (300 ± 32 mg/ L
CaCO3 ) en los primeros 25 d, debido a la presencia de carbonatos en el sedimento de
humedal, utilizado como inóculo. El análisis de comparación (Tukey) indicó que la mezcla
reactiva 1 (MR1) fue la mejor en incrementar y mantener la alcalinidad (3.820 mg
CaCO3/L). Este incremento es debido a la presencia de estiércol y ensilaje en la mezcla
reactiva, substratos con alto COD, SFD y BSR (Tabla 6) que favorecen la reducción
biológica de sulfato siendo la alcalinidad un indicador (Christian et al., 2010; Lindsay et
al., 2011). Además, Zagury et al. (2006) demostró que el estiércol lixivia amoníaco
contribuyendo al incremento de la alcalinidad y el pH.

52
4000

Tiempo (días) Tiempo (días)

------ O MR1 MR3 MR5


V MR2 — O— MR4 DAM + sedimento

Figura 13 Determinación de la eficiencia de las mezclas reactivas durante el tratamiento de


DAM en reactores batch.

Desde el inicio hasta el final del estudio se presentó un descenso del ORP (-25 hasta
-350 mV, respectivamente) favoreciendo el establecimiento de las BSR y por lo tanto la
reducción de sulfato (Figura 13). Se presentó una reducción de sulfato en todos los

53
tratamientos durante los primeros 9 d, la cual ha sido previamente descrita y se le atribuye a
la adsorción de la mezcla reactiva y/o a la precipitación en forma de yeso (CaSO4*2H2O)
(Amos et al., 2003; Gibert et al., 2004). Al terminar la etapa de aclimatación la
concentración de sulfato incremento en todos los tratamientos por lixiviación desde los
substratos como había sido previsto en los ensayos de lixiviación. Este sulfato lixiviado fue
posteriormente removido por la actividad de las BSR que simultáneamente incrementaron
la alcalinidad, considerada como un indicador de la sulfato-reducción en los biorreactores
pasivos (Lindsay et al., 2011).

La remoción de sulfato presentó diferencias significativas (p < 0,05) entre las


mezclas reactivas, las cuales conformaron dos grupos (Tukey): el primero con alta
eficiencia en la remoción de sulfato e integrado por MR1, MR2 y MR3 (73, 77, y 75%,
respectivamente) y el segundo con menor eficiencia conformado por MR4 y MR5 (63 y
59%, respectivamente). La principal diferencia entre estos dos grupos se encuentra en la
cantidad de lignina presente en las mezclas reactivas (~11 y ~19, respectivamente). Altos
contenidos de lignina reducen la biodegradabilidad de los substratos y la capacidad de
desarrollar actividad bacteriana, porque el carbono orgánico de la lignina no es fácilmente
disponible para los microorganismos (Cocos et al., 2002; Waybrant et al., 2002; Gibert et
a l, 2004).

Durante el ensayo en batch se logró remover el Fe+2 presenete en el DAM en todos


los tratamientos, mientras que el control permaneció constante. La remoción de Fe+2
presentó diferencias significativas (p < 0,05) entre los tratamientos: MR1 removió el 80%
entretanto las otras MRs removieron más del 97%. El Zn+2 fue completamente removido
sin diferencias significativas entre las mezclas reactivas; sin embargo, Mn+2 sólo fue
parcialmente removido en MR2 y MR3 (69% y 77%, respectivamente). En los tratamientos
pasivos la precipitación de Mn+2 es inhibida si la relación Fe/Mn es mayor de 2,0
(Karathanasis et al., 2010; Song et al., 2012) como en nuestro estudio (relación: 6,5) o si la
concentración de Fe+2 (201,0 mg/L) es mayor el el DAM que se esta tratando (Yoo et al.,
2004).

54
Tiempo (días)

— • — MR1
— V — MR2
------ □ — MR3
MR4
.......A ....... MR5
------ ☆ ------ DAM+Sedimento

Figura 14 Remoción de metales (Fe+2, Zn+2 y Mn+2) durante el tratamiento de DAM en


reactores batch

En general, todos los tratamientos fueron eficientes en incrementar el pH y la


alcalinidad, así como en remover sulfato, Fe+2 y Zn+2, pero sólo los tratamientos MR2 y
MR3 removieron parcialmente el Mn+2. Estos tratamientos contenían estiércol, compost de
champiñón y gallinaza, que son substratos con alto COD que facilita el establecimiento de
las BSR. Estos resultados indican que la presencia de donadores de electrones en la mezcla
reactiva determina el éxito de los procesos microbianos durante el tratamiento del DAM.

55
Los otros tratamientos mostraron sulfato reducción, pero no remoción de Mn+2, incluso
MR1 mostró un incremento de Mn+2 al final del estudio. MR4 y MR5 presentaron el ORP
más alto y la menor remoción de sulfato, posiblemente por la presencia de residuos de
papel que contenía alta concentración de Mn+2, sulfato y Fe+2. Además, en algunos residuos
de papel se ha reportado la presencia de compuestos organoclorados que inhiben la
actividad enzimática (Nakamata y Ohi, 2003).

5.6 Determinación de la conductividad hidráulica y la porosidad de las mezclas


reactivas seleccionadas en el ensayo batch.

Con el fin de seleccionar una mezcla reactiva con propiedades hidráulicas que
garanticen el flujo homogeneo del DAM a través del reactor, se determinó la conductividad
hidráulica y la porosidad a MR2 y MR3. Estas mezclas fueron seleccionadas por su
capacidad para remediar el DAM incluyendo la remoción parcial de Mn+2 (> 69%). MR2
presentó una mayor conductividad hidráulica (4,5 ± 2,3 x 10-2 cm/s) con respecto a MR3
(9,5 ± 6,2 x 10-3 cm/s) y las dos medidas presentaron una alta variabilidad debido a la
heterogeneidad de las muestras. La baja permeabilidad de MR3 posiblemente se debe a la
ceniza (68,3 ± 1.0%) presente en la gallinaza que se deposita en los espacios vacios que
deja la gravilla y la materia orgánica causando problemas de compactación. Bolis et al.
(1992), observó que mezclas reactivas que continene substratos compostados con alto
contenido de cenizas presentan baja conductividad hidráulica afectando el tratamiento a los
pocos meses de operación. En cuanto a la conductividad hidráulica de MR2 se encuentra en
el rango recomendado (1x10-2 cm/seg) para biorreactores pasivos con flujo continuo en
laboratorio y en campo (Costello, 2003; URS, 2003).

La porosidad sólo fue calculada para MR2 y se encontró entre 0,49 y 0,53. Este
valor es considerado adecuado para los reactores pasivos en laboratorio por que permite el
paso del DAM a través de la mezcla reactiva evitando compactación y la formación de
caminos preferenciales de flujo a través de la mezcla reactiva (Bolis et al., 1992). La
mezcla reactiva MR2 es una opción promisoria para ser empacada en reactores pasivos de
flujo continuo. Esta mezcla presenta la suficiente permeabilidad para asegurar el flujo

56
continuo del DAM a través de la columna y su porosidad permite prevenir problemas de
taponamiento y compactación durante el tiempo de operación.

5.7 Efecto del TRH sobre la eficiencia de los biorreactores pasivos

Se evaluó el efecto del TRH sobre la eficiencia de los reactores pasivos para
incrementar el pH y la alcalinidad así como de remover el sulfato y los metales del DAM.
Siete biorreactores fueron empacados con la mezcla reactiva MR2 (estiércol 15%, compost
de champiñón 10%, aserrín de Sajo 25%, sedimento 15%, gravilla 20% y carbonato de
calcio 15%), se saturaron de manera ascendente con DAM sintetico y se dejaron en
climatación durante 2 semanas. Posteriormente, se inicio el flujo continuo de DAM
sintético con 2 y 4 d de TRH y en la semana 16 un reactor de 4 d fue conmutado a 1 d de
TRH manteniendo tres TRH (1, 2 y 4 d) hasta el final del estudio en la semana 36.

Durante la etapa de aclimatación se observó un incremento del pH desde 3,0 ± 0,8


hasta 7,0 ± 0,5 en los efluentes de todos los biorreactores. Luego, durante la etapa de flujo
continuo el pH se mantuvo relativamente constante (6,5 - 7,0) sin diferencias significativas
(p > 0,05) entre los TRHs (Figura 15). Esta observación estuvo relacionada con el
incremento de alcalinidad en la etapa de aclimatación (950 ± 15 mg CaCO3/L) pero no en la
etapa del flujo continuo donde se presentó constante variación. En la semana 3 se presentó
un abrupto incremento de la alcalinidad, especialmente en las columnas con 4 d de TRH
(1.500 ± 54 y 2.400 ± 32 mg CaCO3/L para 2 y 4 d de TRH, respectivamente). Esta
excesiva alcalinidad fue reducida a partir de la semana 4 y permaneció relativamente
constante hasta la semana 22 con diferencias significativas (p < 0,05) entre los TRHs (800
± 28 y 1.200 ± 60 mg CaCO3/L, para 2 d y 4 d de TRH, respectivamente). Luego, la
alcalinidad incremento de nuevo en los reactores con 4 d de TRH (1.800 ± 108 mg
CaCO3/L) y se mantuvó variando hasta el final del estudio (Figura 15). El incremento del
pH y de la alcalinidad en la etapa de aclimatación es ocasionado por la disolución de
carbonatos y/o iones hidroxilo presentes en la mezcla reactiva al contacto con el DAM,
pero las variaciones en la alcalinidad durante el flujo continuo es atribuido a la capacidad
buffer del carbonato que se genera durante la sulfato reducción a través del metabolismo de

57
las BSR (Waybrant et al., 2002; Neculita et al., 2008a; Robinson-Lora y Brennan, 2009;
Song et al., 2012).

Figura 15 Evolución del pH, ORP y alcalinidad durante el tratamiento de DAM en


biorreactores pasivos (En la semana 17 una columna de 4 d de TRH fue conmutada a 1 d de
TRH).

Los reactores desarrollaron condiciones reducidas durante la aclimatación, el ORP


inicialmente decreció a -260 mV y luego continúo disminuyendo hasta -360mV
manteniéndose relativamente constante sin diferencias significativas entre 2 y 4 d de TRH.
Estos resultados indican que la etapa de aclimatación permitió la generación de un
ambiente adecuado para las bacterias anaerobias, incluyendo las BSR. Durante el flujo

58
continuo el incremento de la alcalinidad y el pH, así como el reducido ORP contribuyeron
con el rápido desarrollo de la comunidad microbiana formada por bacterias celulolíticas,
fermentativas y sulfato-reductoras (Robinson-Lora y Brennan, 2009).

La concentración del sulfato en el DAM sintético usado para saturar las columnas
fue 2.500 ± 170 mg/L, sin embargo cuando inicio el flujo continuo la concentración de
sulfato en el efluente incremento hasta y 2.800 ± 32 y 3.382 ± 31 mg/L para 2 y 4 d of
TRH, respectivamente (Figura 16). Este incremento fue ocasionado por la lixiviación de
sulfato desde substratos (estiércol y compost de champiñón) presentes en la mezcla
reactiva, como había sido observado durante los ensayos de lixiviación y batch. La
liberación de sulfato desde substratos orgánicos ha sido previamente reportada (Neculita et
al., 2008; Neculita et al., 2011; Song et al., 2012). Sin embargo, después de iniciar el flujo
continuo la concentración de sulfato en los efluentes decreció (1.300 ± 50 y 1.000 ± 32 mg
/L para 2 y 4 d de TRH, respectivamente) y se mantuvo constante hasta la semana 16, sin
diferencias significativas (p > 0,05) entre los TRHs. Posteriormente, un nuevo incremento
de sulfato fue observado en los efluentes (1.700 ± 98 mg/L), producido por el aumento en
la concentración del sulfato en el DAM sintetico ocacionado por un error durante la
preparacion y a la disminución en el conteo de BSR, causado por el aumento de sulfuros
solubles (H2S o HS" y S-2) en los efluentes (1.952 ± 52 y 2.826 ± 185 mg H2S/L para 2 y 4 d
de TRH, respectivamente). Finalmente, entre las semanas 23 hasta la 36 la remoción de
sulfato incremento, siendo más alta en las columnas con 4 d de TRH, mientras que no se
encontró diferencias entre 1 y 2 d de TRH.

La remoción de sulfato se ve afectada de manera significativa (p < 0,05) por el


TRH. La baja velocidad del flujo en los reactores con 4d de TRH favorecio la permanencia
de las BSR dentro de la columna permitiendo así, una mayor remoción de sulfato. Esto fue
confirmado a través del conteo de BSR (7,35±4,9 x102 celulas/100 mL) en el efluente entre
las semanas 20 a la 36, donde la menor cantidad de BSR correspondió a los biorreactores
con 4 d de TRH (Figura 16) mientras que en la mezcla reactiva post-tratamiento de los
mismos reactores se encontró una mayor cantidad de BSR (28,5 ± 7,2 x103 celulas/Kg (ps);
Tabla 9).

59
3500 3000

3000 2500

2500
2000
h 2000
1500
500

1000

500 500

Tiempo (semanas)
Tlempo (semanas)

4x103
800

3x10J 750

700
ü 2x103

O 650
1x103

Tiempo (semanas) Tiempo (semanas)

DAM

Figura 16 Evolución del sulfato, sulfuros y BSR durante el tratamiento de DAM en


biorreactores pasivos (En la semana 17 una columna de 4 d de TRH fue conmutada a 1 d de
TRH)

Los sulfuros fueron detectados a partir de la semana 4 en todos los reactores, pero
sólo presentaron diferencia significativa en losTRHs a partir de la semana 8 (Figura 16). La
concentración de sulfuros fue más alta en los reactores con 4 d de TRH, debido al bajo flujo
y largo tiempo de residencia que promovió una mayor oxidación del carbono orgánico

60
disponible y mayor reducción de sulfato por parte de las BSR. Después, de la semana 16 la
concentración de sulfuros incremento significativamente en los dos TRHs (1.952 ± 52 y
2.826 ± 185 mg H2S/L para 2 y 4 d de TRH, respectivamente), este repentino incremento
en la concentración de sulfuros fue causado por la actividad de las BSR que removieron el
sulfato previamente lixiviado desde los substratos orgánicos. El excesivo sulfuro creó un
efecto adverso sobre el conteo de BSR (1,34 ± 0,98 *102 celulas/100 mL) que declino
considerablemente en la semana 20 sin diferencias significativas entre los TRHs (Figura
16). En estudios previos realizados por Sáez-Navarrete et al. (2009) se encontró que los
sulfuros solubles (H2S o HS- y S-2; dependiendo del pH) pueden reducir el tamaño celular y
el crecimiento de los microorganismos cuando están presentes en concentraciones > 108
mg H2S/L. En adición, Okabe et al. (2002) encontró que la producción de células se redujo
ligeramente a una concentración de 100 mg H2S/L, mientras que a 180 mg H2S/L el
crecimiento de la biomasa declino rápidamente. A partir de la semana 21 la concentración
de sulfuros decreció en todos los biorreactores (357 ± 12 y 1.822 ± 67 mg H2S/L para 2 d y
4 d de TRH, respectivamente) y continuo decreciendo en la columna con 2 d de TRH hasta
218 ± 37 mg H2S/L al final del estudio. La reducción en la concentración de sulfuros
favorecio el incremento del número de BSR en los efluentes de los reactores de 2 d de TRH
(8,32 ± 1,9 x103 celulas/100 mL), mientras que en la de 4 d de TRH continuo siendo bajo
(7,35 ± 4,9 x102celulas/100 mL).

La concentración de COD en los efluentes al inicio del flujo continuo fue de 740
mg/L, pero luego decreció hasta ~10 mg/L en la semana 8, y se mantuvo constante hasta el
final del estudio sin diferencia entre los TRHs (Figura 16). No obstante la baja
concentración de COD (~10 mg/L), se observó continua remoción de sulfato (~1.000 mg
SO4/L) a lo largo del estudio. Esto puede explicarse por la presencia de los substratos en la
mezcla reactiva que liberan carbono orgánico que no puede ser cuantificado por el análisis
de COD (Neculita et al., 2008a). Además, la presencia de carbono inorgánico en forma de
carbonatos interfiere con la cuantificación del COD (APHA, 2005). Estos resultados son
consistentes con los encontrados por Schmidtova y Baldwin (2011), que observaron que el
COD se pierde de manera significativa al inicio del flujo continuo en los biorreactores

61
pasivos. Una posible fuente de carbono adicional para las BSR son las SFD que
corresponden a la fracción biodegradable conformada por azúcares, aminoácidos, almidón
y hemicelulosa.

En la semana 17 de operación de los reactores, una columna de 4 d fue conmutada a


1d de TRH. Como se esperaba, después del cambio el reactor mostró una reducción en la
producción de alcalinidad desde 767 a 510 mg CaCO3/L y fue mantenida hasta el final del
estudio (Figura 15). Además, la excesiva producción de sulfuros fue reducida en la semana
20 y continuo decreciendo hasta la semana 36 (23 ± 4 mg H2S/L). El incremento del flujo y
el consecuente incremento de la carga de oxígeno en el biorreactor, afectó las condiciones
anaerobias y subsecuentemente la capacidad de las BSR para producir sulfuros. El
incremento de flujo no afecto el pH, pero si afecto el ORP que rápidamente incremento
desde -375 a -108 mV debido a la introducción de oxígeno disuelto (OD) en el biorreactor
por un ingreso más rápido de DAM. El nuevo flujo (1,48 mL/min) causo una significativa
liberación de sulfatos (3.115 mg/L) que se encontraban retenidos por adsorción en la
mezcla reactiva posiblemente como como yeso (CaSO4^2H2O) (Figura 16). Otra fuente del
sulfato liberado podría ser la re-oxidación de los sulfuros previamente precipitados en el
reactor cuando tenía un TRH de 4 d (Dvorak et al., 1992). En la etapa entre las semanas 26
a la 33, el biorreactor mostró estabilidad y el ORP decreció de nuevo (desde -189 mV a -
270 mV), pero en las últimas tres semanas del estudio, el ORP incremento de nuevo
afectando la eficiencia de remoción de sulfatos y metales. En adición, el incremento del
flujo causo el lavado de la mezcla reactiva en el reactor y el arrastre de las BSR, causando
taponamiento en la tubería del efluente por lixiviación de biomasa y sulfuros metálicos,
haciendo necesario el cambio de la tubería.

62
250

20
200 t - W w▼
▼ V*
▼t

40

20

Tiempo (semanas) Tiempo (semanas)

1 d TRH

2 d TRH

DAM

Tiempo (semanas)

Figura 17 Evolución de metales (Fe+2, Zn+2 y Mn+2) durante el tratamiento de DAM en


biorreactores pasivos (En la semana 17 una columna de 4 d de TRH fue conmutada a 1 d de
TRH).

Los metales (Fe+2 y Zn+2) fueron completamente removidos del DAM durante las
36 semanas de operación de las columnas, sin diferencias significativas entre 2 y 4 d de
TRH (Figura 17). Durante el periodo de aclimatación, la remoción de metales ocurrió
principalmente por precipitación en forma de hidróxidos y carbonatos, así como por la
adsorción en los substratos orgánicos frescos. Sin embargo, durante el flujo continuo los

63
metales también fueron removidos como minerales sulfurados. Esto es confirmado por el
modelo VMINTEQ (Figura 18) y ha sido observado en previos estudios (Neculita et al.,
2011; Zhang y Wang, 2014). La remocion de metales en los reactores pasivos, es
dependiente de del ORP, en la columna conmutada de 1 d de TRH la eficiencia en la
remocion de Fe+2 y Zn+2 decrecio (75% y 67%, respectivamente), cuando el ORP
incremento desde-360 a -108 mV en la semana 23. El ORP es dependiente de la presencia
de OD y de especies redox activas como el sulfato y el Fe+3 (Yim et al., 2014). Por otro
lado, las reacciones que remueven los metales en los biorreactores pasivos son sensibles a
las condiciones redox y estas son reversibles (Cheong et al., 2010).

Durante la etapa de aclimatación, el Mn+2 fue removido por adsorción de los


substratos orgánicos. Lewis (2010), encontró que la adsorción fue el mecanismo
predominante en la remoción de Mn+2durante esta etapa. Sin embargo, después de iniciar el
flujo continuo la concentración de Mn+2 en el efluente incremento (77 ± 4 mg/L para 4 d of
TRH y 60 ± 2 mg/L para 2 d of TRH) excediendo la concentración del DAM (31 mg/L).
Posteriormente, en la semana 21 la concentración de Mn+2 disminuyo de nuevo (eficiencia
de remoción > 60%), sin diferencias significativas entre los tres TRHs evaluados. Esta
remoción de Mn+2 probablemente se debe al incremento de la alcalinidad, condición
necesaria para asegurar la tasa de oxidación de Mn+2 a pH < 8 (Mariner et al., 2008). La
baja remoción de Mn+2 en los biorreactores pasivos ha sido atribuida a la alta solubilidad de
MnS con respecto a otros metales (Cheong et al., 2010) y a la inhibición de su precipitación
como hidróxidos si la concentración de Fe+2 y Zn+2 es alta (Yoo et al., 2004). En el presente
estudio, después de remover los otros metales del DAM, la remoción de Mn como sulfuro
podría verse favorecida, especialmente en presencia de altas concentraciones de sulfuros
solubles, sin embargo, los resultados de Visual MINTEQ no indican la formación de MnS,
pero si la formación de rodocrosita (MnCO3 ) a partir de la semana 26 y hasta el final del
estudio. El Mn+2 ha si do reconocido como el metal más problemático para ser removido en
los biorreactores pasivos, bajo condiciones reducidas (Chang et al., 2000; Neculita et al.,
2007; Robinson-Lora y Brennan, 2011).

64
El índice de saturación (IS) de los minerales formados en los biorreactores fue
calculado con el modelo VMINTEQ usando las características fisicoquímicas de los
efluentes de diferentes semanas (Figura 18). El mineral amorfos de Zn y Fe, Spharelita
[(Zn,Fe)S] mostro super saturación (IS> 1) a lo largo del estudio, siendo más alto en las
columnas con 1 d de TRH. Este minerale indican que las concentraciones de Zn pueden ser
controladas por la solubilidad del sulfuro de Zinc (Waybrant et al., 2002). El IS de calcita
(CaCO3), muestra que este mineral fue alto a partir del flujo continuo y hasta el final del
estudio. Mackinawita (FeS) y pirita (FeS2) estuvieron presentes en las columnas de 4 y 1 d
de TRH. La presencia de estos minerales sugiere que la sulfato reducción y la precipitación
de sulfuro de hierro fue el principal mecanismo para la remoción de Fe+2. La presencia de
rodochrosita (MnCO3 ) sólo fue estimada en la columna de 1 d de TRH al final del estudio.
La precipitación de Mn como carbonato puede ser uno de los mecanismos para la remoción
de este metal en biorreactores pasivos (Waybrant et al., 2002; Neculita et al., 2007).

, A) B)

T ie m p o (s e m a n a s )

„ C)
S p h a re lita
S id e rita
M a c k in a w ita
C a lc ita
E q u ilib rio
R o d o c ro s ita

T ie m p o (s e m a n a s )

Figura 18 Índice de saturación de algunos minerales formados durante la biorremediación


del DAM en biorreactores pasivos, determinados con VMINTEQ. A) 2d de TRH; B) 4d de
TRH; C) 1 d de TRH (En la semana 17 una columna de 4 d de TRH fue conmutada a 1 d de
TRH).

65
El TRH, tiene un fuerte efecto sobre la evolución de la eficiencia de los
biorreactores pasivos, durante el tratamiento del DAM con alto contenido de sulfato.
Largos TRH (4d) tienen baja velocidad en el flujo favoreciendo el crecimiento y la
actividad de BSR. Como resultado, se genera alta alcalinidad y exceso de los sulfuros
solubles que contaminan los efluentes. Por otro lado, el excesivo contenido de sulfuros
producido por el proceso biológico de sulfato-reducción afecta el crecimiento y el
desarrollo de las BSR ocasionando fallas eventuales en los reactores pasivos. En el caso
contrario, cortos TRH (1d) lavan la biomasa e inducen el ingreso del OD en el reactor
incrementando el ORP, afectando las condiciones anaerobias y creando efectos adversos
sobre la actividad, como resultado la remoción de metales fue reducida en un 30%.

5.8 Calidad de los efluentes de los biorreactores pasivos

La caracterización fisicoquímica de los efluentes de los reactores pasivos indica que


los tres TRH mejoraron la calidad del DAM, pero los valores obtenidos no cumplen en su
totalidad con los parámetros establecidos por la legislación colombiana para vertimientos
mineros (resolución 0631 de 2015). Los efluentes de los biorreactores tienen pH y
concentración de sulfatos por debajo de los valores máximos permitidos, pero exceden la
concentración de sulfuros (Tabla 8). La presencia de sulfuros en vertimientos por encima de
1,0 mg/L puede ocasionar problemas de salud pública además, de corrosión en tuberías por
su posterior oxidación a ácido sulfúrico (Hao et al., 2014). También, la concentración de
Fe+2 y Zn+2 en el efluente de 1 d de TRH es superior a la permitida por la normatividad y
aunque la legislación colombiana no establece valores máximos permitidos para el Mn+2, la
USEPA (2015) establece 0,05 mg/L sin riesgo para la salud humana. El Fe+2 y Mn+2 no
representan un riesgo para la salud en bajas concentraciones, pero por encima del valor
máximo permitido pueden causar intoxicación con fallas cardiacas, problemas respiratorios
y coma (Burbano y Sánchez, 2007). También, contribuyen a la formación de biopeliculas
en las redes de colecta de vertimientos incrementando el crecimiento de microorganismos.

Aunque los efluentes de las columnas no cumplen a cabalidad con los valores
máximos permitidos en la legislación colombiana, los biorreactores se consideran eficientes

66
en el tratamiento del DAM por su capacidad de incrementar el pH y remover el sulfato. La
remoción de iones sulfato de los vertimientos industriales es considerada como el mayor
desafío de un sistema de tratamiento debido a su alta solubilidad que incrementa los costos
por el uso de sustancias precipitantes (Cadorin et al., 2007). Por otro lado, aunque los
efluentes de la columna con 1 d de TRH exceden los valores máximos permitidos para los
metales, se considera como una opción viable para posteriores estudios porque tiene menor
concentración de sulfuros que pueden ser oxidados a sulfatos sin reducir el pH y la
alcalinidad.

Tabla 8 Calidad de los efluentes de reactores pasivos comparados con el DAM y con los
valores máximos permitidos en la legislación colombiana.
Efluentes de Biorreactores pasivos
Resolución
Parámetro Unidad DAM (TRH)
0631
1d 2d 4d
pH 6,0-9,0 3,0-4,5 7,1±0,1 7,0±0,3 7,3±0,2
Alcalinidad NE NA 531±50 835±96 1.306±13
Sulfato li 1,500 2,500 1.170±129 1.045±108 760±70
Sulfuros ll 1,0 NA 34±13 211±17 1.150±183
Fe mg/L 2,0 200 31±2 0,9±0,1 0,6±0,1
Mn 1i NE 31 29±0 31±2 31±1
Zn 1 3,0 18 6±1 0,3±0,0 0,6±0,1
Los valores de los efluentes son presentados con el promedio ± SD de los parámetros
fisicoquímicos determinados en la semana 30. NE: no especifica; NA: no aplica; TRH: tiempo de
retención hidráulica.

5.9 Remoción de sulfuros, Fe+ 2 y Mn+ 2 de los efluentes de la columna con 1 d de


TRH por aireación.

Después de someter los efluentes de la columna de 1 d de TRH a un flujo de aire de


1,5 L/min durante 300 min, se observó que la concentración de Fe+2 fue reducida en un
>99% en los primeros 80 min, mientras que la de Mn+2 requirió de 240 min para reducirse
en un 50% (Figura 19). También, durante el proceso de aireación se observó la formación
de sólidos naranja en el fondo del recipiente, estos posiblemente corresponden a oxi-
hidróxidos de hierro (FeOOH^H20) y bióxido de manganeso (MnO2). La aireación es un
tratamiento convencional utilizado para mejorar la calidad de vertimientos anaerobios con

67
alta eficiencia para la remoción de Fe+2, pero no de Mn+2 cuando está presente materia
orgánica (Ellis et a l 2000). Sin embargo, en este ensayo se observó la remoción de los dos
metales, posiblemente por co-precipitación debido a que los oxi-hidróxidos presentan
cargas positivas bajo condiciones alcalinas, lo cual facilita la adsorción de Mn+2 (Vymaza,
1998). Pero este fenómeno sólo es posible cuando se incrementa el ORP y el pH es superior
a 7,0 con capacidad de neutralizar la acidez que se generan durante la reacción, estas fueron
condiciones observadas en este estudio. No obstante, esta remoción de metales no es
estable a largo tiempo porque los óxidos de hierro y manganeso son sensibles a los cambios
en el ORP y a la concentración de oxígeno.

Figura 19 Remoción de metales (Fe+2 y Mn+2) y sulfuros de los efluentes del biorreactor
con 1 d de TRH por aireación.

Posterior a la remoción de Fe+2 y Mn+2 fue posible remover los sulfuros solubles
(Figura 19). La remoción inicial de sulfuros (15%) en los primeros 90 min posiblemente se
debe a la difusión del H2S (gaseoso) ocasionada por la agitación del efluente durante el
burbujeo, mientras que la remoción del 50% en los 150 min posteriores es producida por la

68
oxidación de HS" hasta sulfato. La aireación es un tratamiento usado para tratamiento de
efluentes contaminados con sulfuros; sin embargo, solamente elimina la parte de los
sulfuros que está presente como HS- debido a que es la forma más reactiva frente al
oxígeno. La calidad de los efluentes de la columna de 1 d de TRH mejoro durante la
aireación y cumple con la normatividad colombiana para efluentes mineros. Este
tratamiento permitio precipitar el Fe+2 (>99) y posiblemente co-precipitar el Mn+2 (50%) así
como oxidar el sulfuro (65%) hasta sulfato manteniendo constante el pH (7,0). La aireación
de los efluentes es una opción viable que debe ser tenida en cuenta en estudios posteriores
en campo.

5.10 Determinación del efecto del TRH sobre la composición de la mezcla reactiva
post-tratamiento.

Para evaluar el efecto del TRH sobre composición de la mezcla reactiva post­
tratamiento se sacrificaron 7 reactores y la mezcla reactiva de cada uno fue dividida en tres
capas (alto, medio y bajo). En las semas 8 y 17 se sacrificaron biorreactores con TRH de 2
y 4 d y en la semana 36 se sacrificaron tres biorreactores con TRH de 1, 2 y 4 d. La
composición de la mezcla reactiva post-tratamiento (Figura 20) se diferencia en mayor
medida (76,6%, eje 1) por tres características: contenido de nutrientes (TKN, COT,
celulosa), pH y Zn, mientras que en menor medida (12,6%, eje 2) por SAV y Fe. Sin
embargo la tendencia más fuerte de separación está dada el tiempo de operación del reactor.
El EM realizado de la semana 8 se agrupa a la izquierda del primer eje cerca del contenido
de nutrientes y del pH, parámetros considerados esenciales para el establecimiento de los
microorganismos en el reactor (Neculita et al., 2008), A partir de la semana 17 se observa
una mayor separación entre las partes del reactor para los dos TRH (2 y 4 d). Los sulfuros
(SAV) y el Fe+2 afectan la parte baja de los biorreactores sin diferencias significativas,
mientras que el sulfato afecta la parte media y alta de los reactores con 4 d de TRH. Esto se
debe a la configuración de flujo ascendente del reactor debido a que al ingresar el DAM, en
la parte baja se reduce la mayor cantidad de sulfato a sulfuro y además se produce
precipitación del Fe en forma de oxi-hidróxido en pH neutro. Finalmente, en la semana 36

69
el Zn tiene un efecto significativo sobre la composición de la mezcla reactiva post­
tratamiento, este metal presentó mayor remoción en forma de ZnS sin diferencias
significativas en el espacio de los reactores con TRH de 1, 2 y 4 d.

Figura 20 ACP de las variables fisicoquímicas evaluadas durante el tiempo de operación


del reactor con 2 y 4 d de TRH. Se muestra entre paréntesis el porcentaje de varianza
explicada para cada componente principal.

5.10.1 Contenido de nutrientes y pH

El análisis de la mezcla reactiva post-tratamiento mostró un alto incremento del pH


(> 8,0) con tendencia similar en todas las capas del reactor (Tabla 9). Sin embargo, en la
semana 36 decreció, especialmente en la parte baja del biorreactores con 1 d de TRH. Esta
variación es debida a consumo de las sustancias neutralizantes causado por constante
ingreso del DAM en forma ascendente en los biorreactores. No obstante el decline del pH
en la mezcla reactiva no afecto la actividad de las BSR porque ellas requieren un óptimo
entre 5,0 a 8,0 para su crecimiento (Postgate, 1984).

70
La concentración de nitrógeno y carbono orgánico fue significativamente mayor (p
< 0,05) en la parte alta de los biorreactores que operaron con 2 d de TRH, mientras que en
la parte media y baja de los biorreactores con 4 d de TRH se observó una menor
concentración (Tabla 9). Este comportamiento está relacionado con un mayor número de
BSR en la parte media y baja de reactor con 4 d de TRH ocasionando un mayor consumo
de la fuente de carbono y nitrógeno.

Tabla 9 Caracterización fisicoquímica y microbiológica de la mezcla reactiva post­


tratamiento
c TRH % w/w ps BSRx 103
Semana (células/100 mL)
(d) Altura pH SFD TKN COT Celulosa
MR 6,3±0,1 51,8±0,6 7,1±0,1 60,8±1,3 60,9±0,3 7,0
A 8,1±0,6 27,0±0,5 6,0±0,2 34,5±2,1 55,8±2,5 6,0
2 M 8,3±0,1 29,8±0,1 6,6±0,1 33,8±1,6 52,0±0,8 20,0
8 B 8,1±0,4 23,1±0,1 6,0±0,1 32,7±0,8 50,7±1,4 89,0
A 8,5±0,2 30,8±1,2 5,3±0,5 35,5±1,0 56,0±0,2 8,3
4 M 8,5±0,1 26,3±0,5 5,6±0,2 37,1±1,1 51,1±0,4 14,5
B 8,3±0,1 28,3±0,6 5,4±0,2 35,4±1,6 59,4±0,6 122,0
A 7,5±0,5 62,6±5,6 5,6±0,8 31,3±1,2 43,5±0,3 2,0
2 M 7,3±0,9 64,2±0,4 5,3±0,2 29,9±2,1 45,8±1,6 3,7
B 7,5±0,2 63,7±4,0 5,1±0,2 30,2±1,0 42,0±1,8 0,19
17
A 7,5±0,2 58,6±2,1 4,3±0,1 22,8±1,7 41,4±3,6 2,2
4 M 8,0±0,1 55,1±2,0 4,6±0,2 25,7±0,4 43,2±0,5 3,5
B 8,0±0,1 60,0±0,6 4,3±0,1 23,3±1,9 40,2±1,5 2,5
A 7,2±0,7 70,3±3,8 3,9±1,0 27,7±2,7 33,2±3,4 13,4
2 M 7,1±0,3 76,0±1,8 3,5±0,2 22,2±1,0 34,8±2,6 17,5
B 6,3±0,1 70,4±4,2 3,1±0,2 22,4±4,1 29,4±2,1 13,7
36
A 7,4±0,3 65,0±1,2 2,7±0,1 15,3±2,1 36,4±2,4 182,2
4 M 7,4±0,2 61,5±1,0 2,6±0,2 17,3±0,5 31,1±3,4 350,0
B 6,5±0,1 64,5±1,9 2,1±0,1 16,3±0,6 26,5±1,9 99,2
A 7,1±0,3 61,1±1,2 3,4±0,1 22,6±2,5 31,6±0,4 15,3
1 M 6,5±0,9 60,2±1,5 3,4±0,1 25,0±1,6 34,8±0,9 9,3
B 5,2±0,3 62,6±1,3 3,5±0,3 18,9±3,9 19,2±1,4 109,0
TKN: Nitrógeno total TRH: Tiempo de retención hidráulica BSR: Bacterias sulfato-reductoras
COT: Carbono orgánico total SFD:Sustancias fácilmente disponibles A: Alto M: Medio B: Bajo
MR: Mezcla reactiva inicial

Se observó una correlación positiva entre el consumo de carbono y nitrógeno (0,764


a p < 0,01), afectando la relación C:N que se reduce durante el tiempo de operación del
reactor desde un valor 8,5 hasta aproximadamente 5,5. Aunque la relación C: N sustentable
para la biodegradación de sustratos orgánicos complejos ha sido establecida en 10
(Reinertsen et al., 1984) se ha encontrado que valores cercanos a 3,0 permiten que los
biorreactores sean eficientes durante la biorremediación del DAM (Zagury et al., 2006).

71
Esto puede deberse a que no todo el carbono orgánico en la mezcla reactiva es
biodegradable o disponible para los microorganismos por lo que la relación C:N podría ser
mayor a la calculada (Gibert et al., 2004). El carbono orgánico y el nitrógeno presentaron
una fuerte correlación con pH (0,762 y 0,723 a p < 0,01, respectivamente), esto ha sido
observado en otros estudios donde encontraron que la relación C: N (10) es sustentable para
la biodegradación cuando el pH es mayor a 5,0 (Adams et al, 2014; Hakensen et al., 2015).
El contenido de carbono orgánico y nitrógeno están entre los principales factores que
afectan la eficiencia de los biorreactores pasivos durante el tratamiento del DAM y su
rápido consumo puede afectar la eficiencia del reactor a largo plazo (Choudhary et al.,
2011).

El análisis de SFD permite cuantificar la fracción biodegradable que pueden


consumir fácilmente los microorganismos compuesta por azúcares solubles, almidón,
pequeñas proteínas y hemicelulosa (Prasad et al., 1999). Los resultados de las SFD (Tabla
9), muestran un rápido consumo en las primeras 8 semanas. Luego las SFD incrementan en
las semanas 17 y 36 mostrando una correlación negativa con nitrógeno y celulosa (-0,672 y
-0,754, respectivamente, p < 0,01) indicando que a medida que la celulosa es degradada por
los microorganismos, las SFD aumentan en el reactor. Aunque la celulosa ha sido
catalogada como una sustancia resistente a la degradación microbiana que puede ser
utilizada a largo plazo en el reactor (Prasad et al., 1999), en este estudio se encontró que fue
rápidamente degradada (> 50%) durante las 36 semanas de operación de los biorreactores.

5.10.2 Metales, sulfuro y sulfato

Los metales totales en la mezcla reactiva post-tratamiento fueron concentrados en la


parte baja de los biorreactores (Tabla 10), con un incremento significativo (p < 0,05) en los
biorreactores con 2 d de TRH, debido al ingreso de un mayor caudal en un menor tiempo.
Desde el inicio del flujo continuo se observó la formación de precipitados de coloración
negra (sulfuros metálicos) y café (oxi-hidroxidos de hierro) en la parte baja de los
biorreactores. Posteriormente, la coloración negra fue extendose en la mezcla reactiva a lo
largo de los biorreactores, mientras que la café se mantuvo en la parte baja. Esta

72
observación está relacionada con el comportamiento de los metales, donde la concentración
de Fe fue mayor en la parte baja mientras, que la de Zn fue similar a lo largo del reactor
durante el tiempo de operación. Observaciones similares han sido hechas en otros estudios
de la mezcla reactiva y su análisis posterior a la etapa de operación (Zaluski et al., 2003).
La alta concentración de los metales en la mezcla reactiva post-tratamiento indica que los
biorreactores fueron eficientes en su remoción desde el DAM.

Tabla 10 Concentración de metales totales y sulfato en la mezcla reactiva post­


tratamiento.

TRH Metales totales (mg/Kg ps) Sulfato


Semanas Altura
(d) Fe Mn Zn (mg/Kg ps)
A 7,3±0,9 0,5±0,0 0,3±0,0 3,6±0,4
2 M 12,0±2,8 0,4±0,1 0,3±0,0 5,7±0,4
B 29,0±2,5 0,1±0,0 0,7±0,1 28,3±1,8
8
A 7,4±0,4 0,6±0,0 0,2±0,0 5,2±0,8
4 M 15,7±1,5 0,5±0,0 0,2±0,0 9,0±0,4
B 26,0±3,1 0,5±0,0 0,4±0,0 21,8±1,5
A 25,4±1,2 0,9±0,1 7,6±0,0 20,6±1,5
2 M 33,5±0,4 0,6±0,0 9,0±0,1 18,3±1,0
B 85,7±2,0 0,6±0,1 22,5±0,0 40,6±0,3
17
A 11,2±1,7 0,8±0,0 7,4±0,0 18,7±0,9
4 M 15,5±0,7 0,2±0,1 8,0±0,3 25,7±1,0
B 51,5±0,1 0,7±0,0 16,2±0,3 47,3±1,1
A 31,1±6,2 0,7±0,0 26,1±0,3 67,4±1,2
2 M 43,1±2,8 0,5±0,0 34,3±1,7 75,7±0,6
B 87,0±3,0 0,2±0,1 64,6±0,2 253,7±4,1
A 32,5±0,0 0,6±0,0 20,1±0,6 35,0±0,6
36 4 M 38,0±1,0 0,9±0,1 19,7±2,1 59,4±1,5
B 61,1±2,8 0,3±0,1 33,3±1,7 222,0±2,0
A 36,2±5,5 0,4±0,1 30,1±1,2 21,6±2,2
1 M 61,7±5,2 0,4±0,0 27,0±0,1 15,7±0,8
B 40,3±1,0 0,6±0,0 21,1±2,5 13,6±2,3
TRH: Tiempo de retención hidráulico ps: Peso seco A:Alto M: Medio B: Bajo

La concentración de Mn fue similar en todas las capas del reactor sin diferencias
significativas. Su remoción sólo ocurrió en la etapa inicial del reactor cuando fue adsorbido
por la mezcla reactiva o cuando incremento el pH y precipita como rodocrosita (Jong y
Parry, 2003). Mientras que la concentración de Fe y Zn incrementan a lo largo de las 36
semanas, probablemente por la formación de sulfuros metálicos. La concentración de
sulfato incremento en la mezcla reactiva durante el tratamiento y de manera significativa en
la parte baja de los reactores de 2 y 4 d de TRH, sin embargo es mucho menor en la

73
columna de 1 d de TRH debido a que el incremento repentino de flujo ocasiono el
desprendimiento del sulfato previamente inmovilizado, aumentando la concentración en los
efluentes en la semana 21. Además la concentración del sulfato en la parte baja de los
reactores de 2 y 4 d presenta correlación positiva con los metales (Fe: 0,421; Zn: 0,750 y
Mn: 0,381; p < 0,01) y negativa con el pH (-0,773; p < 0,01) observación que puede ser
explicada por la composición química del DAM y la configuración de flujo ascendente del
reactor.

Tabla 11 Concentración SAV, MES y relación molar MES/SAV determinados en la


mezcla reactiva pos-tratamiento
TRH MES (mg/kg, p s ) SAV MES/SAV
Semanas Altura (mg/kg, ps)
(d) Fe Mn Zn (molar)
A 0,1±0,0 0,1±0,0 0,2±0,0 0,2±0,0 4,8±0,1
2 M 0,1±0,0 0,1±0,0 0,1±0,0 0,2±0,0 4,8±0,1
B 26,1±4,0 0,2±0,0 0,4±0,2 1,3±0,1 12,0±1,8
8
A 0,7±0,1 0,2±0,0 0,1±0,0 0,2±0,0 4,8±0,1
4 M 0,8±0,1 0,2±0,0 0,1±0,0 0,2±0,0 4,8±0,1
B 23,5±3,0 0,1±0,0 0,2±0,0 4,1±0,5 3,4±0,1
A 6,7±1,3 0,1±0,0 6,6±0,0 3,7±0,1 2,8±0,3
2 M 14,1±0,7 0,6±0,0 7,0±0,1 3,9±0,1 3,1±0,2
B 38,6±9,3 0,7±0,4 12,5±0,0 6,9±0,1 8,6±0,2
17
A 5,0±0,8 0,9±0,0 7,4±0,0 1,9±0,3 3,0±0,0
4 M 5,7±2,2 0,6±0,0 7,0±0,3 3,7±0,3 2,4±0,6
B 42,4±2,8 0,9±0,0 12,7±0,3 9,3±0,6 4,5±1,0
A 6,3±2,0 0,4±0,0 27,7±0,2 5,4±0,1 1,3±0,2
2 M 35,2±0,4 0,5±0,0 31,8±0,4 5,7±0,3 3,3±0,9
B 51,9±1,7 0,1±0,1 34,4±0,0 15,0±0,9 6,2±1,2
A 1,6±0,7 0,6±0,0 20,0±0,0 5,8±0,3 0,7±0,1
36 4 M 5,9±0,1 0,5±0,1 20,1±0,3 5,0±0,3 2,2±0,0
B 16,4±3,7 0,2±0,0 25,0±3,4 17,1±0,2 3,2±0,1
A 13,9±1,9 0,3±0,0 31,3±0,2 3,2±0,5 3,4±0,1
1 M 32,4±1,0 0,3±0,0 25,2±0,0 3,5±0,0 6,3±0,0
B 20,6±0,5 0,7±0,0 20,1±0,5 5,2±1,1 3,3±1,6
MES: Metales extraídos simultáneamente SAV: Sulfuros ácidos volátiles Alto M: Medio B: Bajo

La interpretación de la relación molar MES/SAV (> 1,0) indica que en todas las
capas de los reactores la precipitación de oxi-hidróxidos y minerales de carbonato fue el
principal mecanismo de remoción de los metales y que la remoción por formación de
sulfuros sólo se estableció al final del estudio (Tabla 11). La relación molar MES/SAV fue
significativamente (p < 0,05) mayor en la semana 8, cuando las BSR no se han establecido
completamente, pero en las siguientes semanas la relación molar decrece debido al inicio de

74
la formación de sulfuros metálicos. La relación molar MES/SAV (> 1,0) también indica la
movilidad de los metales en condiciones ácidas, siendo significativamente altas en la
semanas 8 y 17, sin embargo durante la semana 36 la relación molar decrece especialmente
para el Zn que es el metal que primero forma sulfuros debido a que su producto de
solubilidad (-28,39) mucho más bajo que el de FeS (-22,39) y MnS a (-13,34) (Jong y
Parry, 2003). Una vez que las condiciones de sulfato reducción se han establecido la
precipitación de sulfuros incrementa en todos los biorreactores, pero no llega a ser el
principal mecanismo de remoción de los metales. La precipitación de sulfuros es el
mecanismo deseado para remover metales desde el DAM, por que los sulfuros metálicos
son altamente insolubles y menos biodisponibles comparados con los carbonatos
(Wildeman y Updegraff, 1997; Neculita et al., 2007).

El Fe y Zn presentaron correlación negativa con el carbono orgánico (-0,448 y


0,725, p < 0,01, respectivamente), debido a la disponibilidad de la materia orgánica para
formar enlaces con los metales, lo cual puede reducir su movilidad e incrementar la
estabilidad (Zhuang et al., 2013). Sin embargo, sulfato, Fe y Zn mostraron una fuerte
correlación con el radio molar SEM/AVS (0,556; 0,682 y 0,631, respectivamente; p < 0,01)
sugiriendo que el sulfuro producido por las BSR, participa en la remoción de los metales
como un importante mecanismos (Neculita et al., 2007).

El TRH presenta un efecto sobre la mezcla reactiva post-tratamiento y de manera


significativa en la parte baja de los biorreactores con 1 y 2 d de TRH, debido a un mayor
flujo de DAM tratado. Sin embargo, la columna con 1 d de TRH mostró las menores
concentraciones de sulfuros en la parte baja posiblemente por el repentino cambio de flujo
que facilito la salida de los sólidos retenidos en el reactor. Además, la configuración de los
biorreactores provocó que los metales, sulfatos y sulfuros se acumularan en la parte baja de
los reactores, siendo una de las posibles causas de fallas a largo plazo.

75
5.11 Determinación del efecto del TRH sobre la diversidad de las comunidades
microbianas

5.11.1 Extracción y cuantificación del ADN metagenómico

La concentración de ADN fue mayor en la semana 36 para todos los biorreactores


con diferencias significativas (p < 0,05) entre los tres TRH (79,7 ± 42,3; 97,6 ±27,6; 89,5 ±
20,3 ng/pL para 1, 2 y 4 d deTRH, respectivamente). La mayor concentración correspondió
a la parte baja de los reactores de 4 d de TRH (112,3 ± 5,3 ng/pL), mientras que la menor
fue para la parte baja de los reactores con 1 d de TRH (33,5 ± 0,9 ng/pL). Estos resultados
estuvieron relacionados con el conteo de BSR encontradas en los biorreactores con 4 d de
TRH (Tabla 9). También, se encontró baja concentración de ADN en la muestras de mezcla
reactiva inicial (7,56 ± 2,07 ng/pL), donde el conteo de BSR fue muy bajo. Durante la
extracción del ADN se presentó una alta variabilidad de los resultados debida a la
heterogeneidad de la mezcla reactiva.

5.11.2 Amplificación de la región V4 del gen 16S rARN

Se prepararon 225 librerías de la región V4 del gen 16S rARN que corresponden a:
7 biorreactores, cada uno uno dividido en 3 partes (alto, medio y bajo) y cada parte dividida
en 3 muestras (63 muestras); 3 muestras de mezcla reactiva inicial, 6 muestras de cepas
puras y 3 muestras de la comunidad artificial, todas amplificadas por triplicado. En el gel
de agarosa se observó que las librerías tenían un tamaño aproximado de 400 pb, valor
confirmado mediante BioAnalyzer que reportó un tamaño de 389 pb para los amplicones
(Figura 21). La mezcla preparada por combinación equi-molar de los productos de PCR
presentó una concentración de 59,3 ng/ul y una relación 260/280 igual a 1,93 y de 260/230
igual a 2,11. Estos valores confirmaron la pureza del ADN e indicaron que no había
impurezas (proteínas y/o fenol) que absorbieran a 230 y 280 nm (Figura 21).

76
Figura 21 Tamaño de los amplicones de la región V4 del gen 16S rARN evaluado
mediante BioAnalyzer (A) y gel de agarosa (B).

5.11.3 Calidad, ensamblaje y limpieza de las secuencias

Con la secuenciación por illumina (miseq) se obtuvieron un total de 12.986.079


paire-endreads (secuencias) de 251pb y con un 53% de C:G. El puntaje de calidad (q) para
el Forward se encontró entre 28 a 36 y para Reverse entre 24 a 30 de un máximo de 40
(Anexo G). Durante el ensamblaje se tuvo en cuenta un solapamiento mínimo de 240 pb, un
máximo de 255 pb y un porcentaje de error para la coincidencia (mismatch) de 0,3. Se
lograron ensamblar 9.165.545 secuencias correspondientes al 70%. El total de las
secuencias ensambladas presentaron valores de calidad por base > 25 de un máximo de 40.

Durante la filtración se eliminaron 1.934.658 secuencias que tenían menos del


tamaño establecido para buena calidad (180 pb), 42.073 secuencias que contenían bases no
resueltas (N ^ 0) y 1.792.329 secuencias que tenían errores en los barcodes. Finalmente
quedaron 5.739.500 secuencias de las cuales el 40% pertenecían a las 75 muestras
obtenidas en este estudio y el otro 60% correspondía a otro trabajo que se envió a
secuenciar simultáneamente. Para el análisis de la diversidad en los biorreactores se
conservó un set de 2.376.000 con un promedio de secuencias por muestra entre 10.000 y
36.000. En otros estudios se han utilizado promedios desde 16.000 hasta 141.000
secuencias por muestra lo que indica que este valor es único por estudio (Gibbons et al.,
2013; Ta§ et al., 2014). Las secuencias descartadas son el 58% de la información de
secuenciación total y se encuentraron en rango promedio de pérdida para esta tecnología,

77
establecido entre 40 a 70% (Gloor et al., 2010; Caporaso et al., 2011; Degnan y Ochman
2012).

5.11.4 Asignación de OTUS

Utilizando las secuencias de los controles empleados: dos cepas puras y una
comunidad artificial (12 cepas), se determinó que el número mínimo de secuencias que
debía contener un OTU era 100. Este valor se determinó después de evaluar la
conformación de OTUS con 2, 10 y 50 secuencias; sin embargo, los resultados obtenidos
con estos valores excedían los OTUS esperados en los controles (Figura 22). Con la
inclusión de estos controles de secuenciación se busco determinar los parámetros de calidad
que permitieron la eliminación de los errores producidos durante la amplificación y
secuenciación del ADN (Kunin et al., 2011).

Figura 22 Establecimiento del número de secuencias necesarias para considerar un OTU.

78
Utilizando 100 secuencias para definir un OTU y teniendo en cuenta que el gen 16S
rARN es un gen multicopia y que sobreestima la diversidad mínimo 2,5 veces (Acinas e t a l ,
2004), se esperaba encontrar en 2,5 OTUS para las cepas puras y 30 OTUS para la
comunidad artificial. Los resultados de los controles fueron: P seu d o m o n a s d enitrificans 25
OTUS, A g robacterium sp 12 OTUS y comunidad artificial 38 OTUS (Figura 22). Aunque
los valores encontrados son mayores a los esperados se decidió seleccionar 100 secuencias
para definir un OTU, porque emplear valores demasiado astringentes para obtener los
OTUS teóricos de los controles resulta en una disminución dramática en el número de
filotipos de las muestras ambientales (Kunin e t a l ., 2010).

Figura 23 Curvas de rarefacción de las muestras obtenidas de la mezcla reactiva post­


tratamiento de 7 biorreactores pasivos que operaron con tres TRH (1, 2 y 4 d),
normalizadas a 10.000 secuencias por muestra y utilizando 100 secuencias como valor
mínimo para la asignación de un OTU.

Las tablas de OTUS en formato BIOM fueron normalizadas a un umbral de 10.000


secuencias por muestra para los análisis de diversidad. El anterior parámetro se estableció
con base en el menor número de secuencias obtenidas en las muestras y en el control de
P seu d o m o n a d e n itrific a n s . Además, Las curvas de rarefacción indicaron que con el umbral
seleccionado de 10.000 secuencias por muestra, el número de OTUS se aproxima al plato
(Figura 23). Esto significa que el número de secuencias obtenidas con la plataforma
illumina, representa una fracción significativa de la comunidad microbiana presente en los
biorreactores y que se logró una buena cobertura de la diversidad en cada muestra.

79
5.11.5 Estimación de la abundancia relativa de taxones

El agrupamiento de las secuencias en OTUS con un porcentaje de similitud del 97%


permitió observar 21 phylum (Anexo H) de los cuales 13 tenían una abundancia relativa >
0,5% (Figura 24). El phylum más abundante en todas las muestras fue Proteobacteria
(33,7%), seguido por Bacteroidetes (24,3%), Firmicutes (10,5%), Spirochaetes (9,5%) y
Chloroflexi (5,7%). Los phylum encontrados han sido reportados en investigaciones previas
para tratamientos de DAM y son reconocidos por su actividad en transformaciones de
celulosa y procesos fermentativos (Prudent et al., 2007; Hiibel et al., 2008; Hiibel et al.,
2011; Sánchez et al., 2012). El phylum candidato WWE1 (NCBI número de registro
CU918805.1) no ha sido reportado en reactores pasivos y fue encontrado en lodos de un
digestor anaerobio para tratamiento de vertimientos domésticos (Rakia et al., 2005).

Proteobacteria (33,7%)

Bacteroidetes (24,3%)

Firmicutes (10,5%)

Spirochaetes (9,5%)

Chloroflexi (5,7%)

Fibrobacteres (4,8%)

Sin asignación (2,3%)

WWE1 (1,3%)

Actinobacteria (1,2%)

Verrucomicrobia (1,0%)

Synergistetes (0,8%)

Chlorobi (0,7%)

Tenericutes (0,5%)

Samples

Figura 24 Distribución filogenética de las secuencias asignadas a phylum con abundancia


relativa > 0,5% (MR: mezcla reactiva inicial; TRH (2 y 4 d), altura en la columna (A: alto;
M: medio; B: baja, evento de muestreo (semana 8,17 y 36).

80
En el p h y lu m proteobacteria, la familia con mayor abundancia (6,0%) fue
Sphingomonadaceae, pero sólo los géneros Sp h in g o m o n a s (0,12%) y Sph in g o p yxis (0,08%)
pudieron ser clasificados hasta género en todas las muestras (Figura 25). Las familias
asociadas con el proceso de sulfato-reducción como Desulfobacteraceae, Desulfobulbaceae,
Desulfovibrionaceae, Syntrophobacteraceae y Desulfarculaceae presentaron una
abundancia relativa del 10%, pero sólo fue posible la clasificación hasta género de un 6%.
Las familias de menor abundancia que pertenecieron a las clases Epsilonproteobacteria y
Betaproteobacteria.

Figura 25 Abundancia relativa (> 0,1%) de las familias asignadas al p h y lu m proteobacteria


en el total de las muestras.

Treponem a (7,5%) fue el único género que pudo ser asignado en el p h y lu m


Spirochaetes, donde la familia más abundante fue Spirochaetaceae (8.5%). Estos resultados
coinciden con los encontrados por Baldwin e t a l . (2015) en reactores pasivos para
tratamiento de As, Zn y sulfato. En el p h y lu m Bacteroidetes la familia con mayor
abundancia fue Bacteroidaceae con los géneros B a ctero id es y B F 311 como los más
representativos (Figura 26). Esta familia se caracteriza por ser un grupo presente en

81
muestras de suelo y en su mayoría acetogénicas (Pruden et al., 2007). La segunda familia
en abundancia fue SB-1, común en lodos activos y aguas domesticas, por lo general
asociada a ambientes ricos en materia orgánica (Hesham et al., 2011).

Figura 26 Abundancia relativa (> 0,1%) de las familias asignadas al phylum Bacteroidetes
y cloroflexi en el total de las muestras.

La familia Anaerolinaceae fue abundante en el phylum Cloroflexi (Figura 26) con


los géneros candidatos WCHB1-05 y T78 como los más representativos. El género
candidato WCHB1-05 (NCBI número de registro AF050562.1) es un clon Eubacterium
encontrado en acuíferos contaminados con hidrocarburos (Dojka et al., 1998), mientras que
T78 representa un grupo de bacterias encontradas en sedimentos con alto contenido de
materia orgánica (Gich et al., 2001).

En general, el promedio de OTUS no asignados en las muestras del reactor y de la


mezcla reactiva fueron de 2,5%. Estas secuencias podrían ser nuevas y por lo tanto no
asignadas a los linajes conocidos o pueden pertenecer a linajes menos estudiados. En las
muestras se observó un alto porcentaje de OTUS (23%) que sólo fueron asignados hasta
familia y no se llego a género, esto es una limitante de la plataforma illumina que reduce la

82
resolución taxonómica cuando las secuencias son cortas como en nuetro caso que se
encontraban entre 180 a 250 pb (Bartram et al., 2011).

5.11.6 Análisis general de la diversidad microbiana en los biorreactores pasivos

La P-diversidad presente en el espacio (alturas en el reactor) y el tiempo (36


semanas) de siete biorreactores pasivos que operaron diferentes TRH (1, 2 y 4 d), se
exploró y evaluó por medio de un análisis filogenético basado en Pairwise-Unifrac,
utilizando secuencias de alta calidad derivadas de la región V4 del 16S rARN. El análisis se
realizó a través de mediciones cualitativas (unweighted) basadas en la presencia/ausencia
de los taxones y por mediciones cuantitativas (weighted) de acuerdo con el número de
veces que cada taxón fue observado (Luzupone et al., 2007). Mediante la prueba estadística
no paramétrica de Adonis se estimó la significancia entre las distancias encontradas por
Pairwise-Unifrac y el análisis se visualizó en gráficas de coordenadas principales (ACoP).

Se encontraron diferencias significativas (Adonis; p <0,01) entre las comunidades


microbianas presentes en las diferentes alturas de los biorreactores. Los linajes de las
comunidades microbianas de la parte baja y alta fueron más distantes, mientras que en la
parte alta y medio fueron filogenéticamente más relacionados (Figura 27A). Esta tendencia
es más clara cuando se tiene en cuenta las distancias en la gráfica presencia/ausencia, donde
se observa que los linajes de las partes alta, media y baja son filogenéticamente distintos
(Figura 27B). También, se observaron diferencias significativas (p < 0,01) entre los linajes
de las comunidades microbianas presentes a lo largo del tiempo de operación de los
biorreactores. Las comunidades microbianas de la mezcla reactiva inicial y de la semana 8
son filogenéticamente diferentes de las presentes en las semanas 17 y 36, las cuales se
encuentran más cercanas entre sí (Figura 27C). Además, cuando se observa la matriz de
presencia/ausencia hay una mayor separación entre las comunidades en la semana 8
especialmente en algunas muestras de las partes alta y media (Figura 27D). En cuanto al
efecto del TRH, no se encontraron diferencias significativas (p > 0,05) entre las
comunidades microbianas presentes en 1, 2 y 4 d. En las mediciones cualitativas y
cuantitativas no se observa separación entre las muestras (Figura 27 E).

83
Figura 27 Distancias de las comunidades microbianas en el espacio y el tiempo de
operación del reactor con tres TRH, calculadas mediante el análisis de Pairwise-Unifrac.
Los ordenamientos de la izquierda fueron elaborados con matrices de abundancia
(Weighted) y las de la derecha con matrices de ausencia/presencia (Unweighted).

El análisis de coordenadas principales (PCoA) basado en las distancias filogenéticas


calculadas mediante UniFrac, nos muestra que el espacio y el tiempo tienen un efecto
significativo sobre la abundancia y la presencia/ausencia de los taxones en el reactor. El
espacio en el reactor está determinado por la química de los minerales que se han
depositado durante el tiempo de operación. En previos estudios por medio del análisis
cualitativo se ha encontrado que existe una fuerte correlación entre la química y la
abundancia de los linajes microbianos. Además, se ha encontrado que la química del

84
ambiente explica la variabilidad genética entre muestras (Luzapone et al., 2007). Por otro
lado, el TRH no mostró efecto sobre las distancias de los taxones, pero este parámetro debe
ser evaluado durante cada uno de los eventos de muestreo dado su estrecha relación con la
química de la mezcla reactiva y el espacio en los reactores. Es conocido en los estudios de
ecología que la tasa de equilibrio de las comunidades se ve limitada por el espacio. En
amplios espacios se presenta una mayor diversidad y existe una menor tasa de migración
por parte de los organismos (Diamond, 1975). En biorreactores para tratamientos de
vertimientos domésticos se ha encontrado efecto del TRH sobre la composición de la
comunidad microbiana, pero este efecto se encuentra correlacionado otros parámetros de
diseño como la carga de carbono orgánico, el tamaño y la forma del reactor (Pholchan et al
2010; Li et al., 2015; Shu et al., 2015; Traversi et al., 2015).

5.11.7 Cambios de las comunidades microbianas de los biorreactores pasivos durante


la remedición del DAM.

5.11.7.1 Inoculo

Durante el montaje de los biorreactores pasivos se utilizó una mezcla reactiva


compuesta en un 50% por materiales orgánicos (15% estiércol, 10% compost de champiñón
y 25% aserrín) y 50% por materiales inorgánicos (15% sedimento, 15% carbonato de calcio
y 10% gravilla). Los substratos orgánicos y el sedimento del humedal sirvieron como
inóculo para los reactores y presentó una amplia diversidad microbiana (Figura 28). Los
índices de Shannon (9,2±1,0) y Chao 1 (854,2±115,3) evidenciaron que el inóculo tuvo alta
diversidad y riqueza microbiana favoreciendo la puesta en marcha de los biorreactores. Un
inóculo con alta diversidad microbiana contribuye en el rendimiento de los biorreactores
haciéndolo su comunidad más resilentes frente a cambios ambientales (Prudent et al.,
2007).

85
Figura 28 Abundancia relativa de géneros dominantes (> 0,5%) presentes en la mezcla
reactiva utilizada durante el montaje de los biorreactores pasivos.

En la muestra de mezcla reactiva fue posible asignar los OTUS a 115 géneros, de
los cuales un 50% tiene una abundancia relativa mayor al 0,5% (Figura 28). El género más
abundante fue Devosia, reconocida por su capacidad de degradar celulosa y otros
polisacáridos como peptina y almidón, así como de fermentar los productos de la hidrolisis
(Pruden et al., 2007). Otro género de importancia en la ruta de degradación anaerobia de
compuestos orgánicos presente en el inóculo fue Clostridium. Este género ha sido reportado
en ambientes anaerobios ricos en materiales lignocelulósicos por su capacidad para
degradar azúcares y almidón, así como para fermentar los productos de la hidrólisis (Pruden
et al., 2007). El género Clostridium contienen especies capaces de romper compuestos
orgánicos a través de la fermentación dando origen a una mezcla de intermediarios
incluyendo acetato e hidrógeno (Martins et al., 2009). Además, algunas bacterias de este

86
género hidrolizan ensilajes generando butirato y han sido encontradas en el rumen del
ganado vacuno (Baldwin e t a l ., 2015; Mirjafari e t a l ., 2014). Los género C lostridium y
B a ctero id es son eficientes degradadores de celulosa y su presencia en el inoculo asegura la
eficiencia del biorreactor (Pereyra e t a l ., 2008). Además, se encontraron los géneros
Sphingobacterium y S phingom onas que producen P-glucósidasa durante su metabolismo,
indicando que son capaces de degradar polímeros de celulosa (Jiménez e t a l ., 2014). Otro
género presente en el inóculo fue B a ctero id es que está conformado por microorganismos
sacarolíticos capaces de utilizar una amplia variedad de fuentes de carbón y energía. El
mecanismo de degradación de B a ctero id es es altamente eficiente (Dworkin, 2000; Prudent
e t a l ., 2007). Además, en el inóculo se encontraron BSR, consideradas claves en la
inmovilización de los metales en el reactor. Con una abundancia > 0,5% se encontraron
D esulfovibrium y D esulfom icrobium conocidos por oxidar los sustratos de manera
incompleta hasta acetato (Sánchez-Andrea e t a l ., 2014). Estos géneros de BSR por lo
general están asociados con Trep o n em a en muestras de biorreactores pasivos, debido a que
son co-dependientes para obtener carbono y energía (Mirjafari e t a l ., 2014).

Los substratos orgánicos y el sedimento sirvieron como inóculo al reactor aportando


una amplia diversidad y riqueza microbiana que influyeron sobre el establecimiento y la
eficiencia de los reactores durante la remediación del DAM. En el inóculo se encontraron
los grupos funcionales claves para degradación de celulosa, fermentativos y sulfato-
reductores.

5.11.7.2 Semana 8

En la semana 8 las condiciones de operación de los reactores con 2 y 4 d de TRH se


habían establecido (pH ~ 7,0; ORP -375 mV) y los metales (Mn+2, Zn+2 y Fe+2) estaban
siendo removidos (> 99%), así como parte del sulfato (> 60%). Además, la concentración
de SFD, celulosa y la relación C/N había disminuido con respecto a la mezcla reactiva
inicial (Tabla 9). Estas nuevas condiciones ocasionaron una reducción en los indices de
diversidad (Shannon: 7,5±0,2) y aumento del índice de riqueza (Chao 1: 950,3±141,9) en
las muestras de mezcla reactiva post-tratamiento con respecto al inóculo e indicaron que

87
grupos microbianos específicos se establecieron en los biorreactores (p,e., T78, Treponema,
Clostridium). Sin embargo, durante este periodo no se encontraron diferencias
significativas (Adonis p> 0,05) entre los linajes presentes en las diferentes alturas de los
reactores, ni tampoco entre en los TRHs. Lo anterior se puede visualizar utilizando las
matrices de abundancia y de presencia/ausencia en el análisis de coordenadas principales
(ACoP) donde no se observó separación de los linajes microbianos en las alturas ni entre
los TRHs (Figura 29). Estos resultados estan relacionados con las propiedades
fisicoquímicas de la mezcla reactiva post-tratamiento que tampoco presentó diferencias
significativas entre las alturas durante en la semana 8. En esta semana las comunidades
microbianas, aún se encuentraban en establecimiento y no hubo una clara diferenciación
entre los taxones presentes en el reactor. Estudios previos han reportado que durante la
etapa de establecimiento hay una sucesión ecológica antes de llegar a una relativa
estabilidad y que estos períodos de cambios dinámicos no afectan la eficiencia del reactor
(Bagchi et al., 2015; Shu et al., 2015).

Núcleos
• Bajo

A Medio

■ Alto

TRH (d)
♦ 2

♦4

Figura 29 Análisis de coordenadas principales (ACoP) de muestras de mezcla reactiva


post-tratamiento en la semana 8 basados en las distancias calculadas mediante UniFrac. A)
ausencia/presencia; B) abundancia

En la mezcla reactiva post-tratamiento obtenida en la semana 8 de dos reactores


pasivos con diferente TRH (2 y 4 d), la comunidad microbiana estuvo representada por los
géneros capaces de degradar celulosa como Treponema (6,8%), T78 (6,0%), Clostridium
(2,0%) y Devosia (2,0%) (Figura 30). Estos géneros han sido reportados en biorreactores

88
pasivos empacados con material lignocelulósico debido a que contienen bacterias que
metabolizan compuestos orgánicos hasta acetato el cual es utilizado por las BSR (Mirjafari
e t a l ., 2014; Baldwin e t a l ., 2015). Además, los géneros propuestos VadinC A 02 y B F 311 se
encontraron en todas las alturas del reactor y han sido reportados en reactores para
tratamiento de aguas domésticas y en ambientes ricos en materia orgánica (Goodon e t a l .,
1997; Gich e t a l ., 2001; Baldwin e t a l ., 2015).

■ 77 8
3 T reponem a
■ C lostrídium
1 D e vo sia
3 N o a sig n a d o s
c 3 D e su lfo vib rio
B F 311
[T m B a cte roide s
i i T rabulsiella
I I va d in C A 0 2
m m A rco b a cte r
i i C o p ro th e rm o b a cte r
Leadb e tte re lla
L u te im o n a s
A g ro b a cte riu m
] S p h in g o m o n a s
I S p h in g o b a cte h u m
] D e su lfo m icro b iu m
I S ten o tro p h o m o n a s
S p h in g o b a cte riu m
M e th y lib iu m
P a lu d ib a c te r
Pseudom onas
C □ S p h in g o p yxis
l i l i D e su lto b a cte r

Figura 30 Abundancia relativa de géneros dominantes (> 0,5%) presentes en los reactores
pasivos en la semana 8 (2 y 4 d de TRH; A: alto, M: medio y B: bajo).

En la semana 8 también, se encontraron géneros de BSR como: D esulfovibrio


(1,8%), D esulfom icrobium (0,85%) y D e su lfo b a cter (0,5%), que incrementaron su
abundancia con respecto al inóculo. Aunque los porcentajes de OTUS asignados a géneros
de BSR fueron bajos (3,2%), no ocurrió lo mismo con el porcentaje asignado hasta familias
(9%), lo que posiblemente indica que pueden estar presentes otros géneros de BSR, pero su
asignación estuvo limitado por la técnica de secuenciación.

89
La relación de las variables fisicoquímicas evaluadas con la abundancia de los Fila
fue significativa (p = 0,01). En este modelo se excluyeron las variables fisicoquímicas:
sulfuro ácido volátil (SAV) y celulosa por que su valor de inflación del modelo superaba el
24%. Los demás párametros explican 89,2% % de la varianza de la relación entre las
variables fisicoquímicas y biológicas (Figura 31). Esto indica que aproximadamente 10 %
de la varianza restante esta explicada por otras variables que no fueron medidas. Se
encontró que las SFD y los sulfatos (Monte Carlo, p < 0,05) son las variables ambientales
que pueden estar influenciando en mayor medida sobre la variación de la comunidad
microbiana, mientras que pH tiene menor efecto. Durante las primeras 8 semanas, el
porcentaje de SFD en la mezcla reactiva decreció rápidamente sugiriendo riqueza de los
microorganismos que utilizan fuentes de carbono fácilmente disponibles. Por otro lado, en
esta primera etapa los principales mecanismos de remoción fueron la adsorción en la
materia orgánica y la precipitación de carbonatos, sulfatos y oxi-hidroxidos. En este
tiempo, aún no se habia establecido completamente la remoción biológica de sulfatos lo que
implica su acumulación en la mezcla reactiva y posterior efecto sobre el crecimiento
microbiano, como lo demuestra Saenz-Navarrete e t a l . (2009), cuando utiliza
concentraciones mayores a 2.200 mg SO4/L durante el crecimiento de BSR.

En la gráfica del análisis canónico, se puede observar que algunos de los géneros
estuvieron asociados directamente con las variables fisicoquímicas, como: Treponem a,
C oprotheobacter y P a lu d ib a cter con el nitrógeno, A rco b a cter con pH, D esu lfo vib rio y
D esu lfo b u lb u s con sulfato y Zn, B acteroides, C lostridium , Luteim onas, A grobacterium , y
B revu n d im o n a s al carbono orgánico total, mientras que los géneros candidatos ( T78 ,
VadinC A 02 y B F 3 1 1 ) y T rabulsiella están separados de las variables fisicoquímicas
evaluadas en la mezcla reactiva, indicando que estas variables no explican su presencia en
los reactores. Previas investigaciones reportan que el pH (Kuang e t a l ., 2012), seguido por
el contenido de nitrógeno y carbono orgánico (Jangid e t a l ., 2008) son las varibles
ambientales que más influyen sobre la comunidad. Sin embargo, en la semana 8 donde el
pH es igual en todas las alturas del reactor, esta variable no presenta un efecto significativo

90
(p > 0,05) sobre la diversidad, pero la concentración de nitrógeno y carbono orgánico si
afectan de manera significativa (p > 0,05) la comunidad microbiana, observándose varios
géneros relacionados con ellas.

Figura 31 Análisis de correspondencia canónica (CCA) entre las variables fisicoquímicas


y los géneros (abundancia relativa > 0,5%) encontrados en la mezcla reactiva post­
tratamiento de dos biorreactores pasivos con diferentes TRH (2 y 4 d) que operaron durante
8 semanas. (TKN: nitrógeno, COT: carbono orgánico total, SFD: sustancias fácilmente
disponibles).

Durante el sacrificio de las columnas con 2 y 4 d de TRH en la 8 semana se observó


una amplia diversidad microbiana en las muestras de mezcla reactiva post-tratamiento. Esta
se ha caracterizado por la presencia de géneros degradadores de celulosa y fermentativos,
así como de géneros propuestos encontrados en ambientes ricos en materia orgánica. Sin
embargo, la abundancia relativa de los géneros de BSR no fue representativa reflejándose

91
en la acum ulación de sulfatos en la m ezcla reactiva post-tratam iento. E n com paración con

el inóculo se observó una fuerte reducción de diversidad m icrobiana m ientras se increm ento

la riqueza debido al establecim iento de grupos m icrobianos capaces de adaptarse a las

condiciones de los reactores.

5.11.7.3 Sem ana 17

El segundo evento de m uestreo se realizó en la sem ana 17, cuando los reactores se

encontraban rem oviendo > 99% de los m etales (Fe+2 y Zn+2) y > 65% de sulfatos del D A M .

E n esta etapa los reactores se encontraban estables, sin cam bios significativos en el pH y el

ORP. Sin em bargo, la concentración de Mn+2 en los efluentes era el doble (60 ± 2 m g/L

para 2 d H R T y 77 ± 4 m g/L para 4 d H R T ) de la que ingresaba en el rea c to r (31 m g/L) y

los sulfuros disueltos habían increm entado significativam ente en los dos T R H (2,526 ± 52 y

2,926 ± 185 m g H 2S/L para 2 y 4 d de TR H ). E stas nuevas condiciones redujeron

significativam ente (p < 0,05) la diversidad (S hannon: 6,3 ± 0,2) y aum entaron la riq u eza de

m icroorganism os capaces de adaptarse (C hao 1: 1114,3±33,6), reflejándose en u n m enor

núm ero de géneros con abundancia relativa > 0,5% .

E n la sem ana 17 se encontraron diferencias significativas (A donis; p < 0,05) entre

las com unidades m icrobianas presentes en las alturas de los reactores y entre los T R H (2 y

4 d). E n el análisis P C o A utilizando las m atrices de presencia/ausencia y abundancia se

observó que la com unidad m icrobiana se separó en cuatro grupos definidos (Figura 3 2 ). Las

m ayores distancias filogenéticas se observaron entre los taxoness de la parte baja del

reacto r con 2 d de T R H y los de la parte alta del rea c to r con 4 d de TR H , m ientras que las

m enores distancias fueron entre los taxoness de la parte m edia de los reactores con 2 d y los

de la parte baja del reacto r con 4 d de T R H así com o entre los taxoness de la parte alta de 2

d de T R H y los del m edio del reacto r 4 d de TR H . E sta tendencia es debida a la

configuración de flujo ascendente de los reactores que facilitó la acum ulación de sulfuros

m etálicos en la parte baja de los reactores, especialm ente en la colum na con 2 d de T R H

p o r que esta podía tra ta r m ayor flujo de A M D en m enor tiem po. L os cam bios observados

en las variables fisicoquím icas de la m ezcla reactiva durante la operación de los reactores

92
incremento la abundancia de los taxones funcionales capaces de obtener energía a partir del
proceso redox de los metales.

/ • i '" * 0 0-1 N ú c le o s
o to ~¡
• B a jo
■ *. 'T - 0 .0 2
• : A M e d io
c •■■ ■ / » A ’«
- 0 0 5 " +*.„.**•
2 , \ . . y “ o .o o ■ A lto
CM
<D /A
: A i
¡xr
0 .0 0 - y
^ -0 .0 2 \ f y
: i T R H (d )
\ ♦ \ -0 .0 4 ♦ 2

■ 0 .0 5 - \ * \ A ♦ A
\ A ■ :
‘••A A
i * ,t i i i

-o.t o.o 0.1 -0.10 -0.05 0.00 005 0.10

Eje 1(28,7) Eje 1(66,5)

Figura 32 Análisis de coordenadas principales (ACoP) de muestras de mezcla reactiva


post-tratamiento en la semana 17 basados en las distancias calculadas mediante UniFrac. A)
ausencia/presencia; B) abundancia.

Los phylum más abundantes durante la semana 17 continuaron siendo


Proteobacteria (31,0%), Bacteroidete (27,96%), Spirochaetes (9,4%), Fermicutes (8,5%) y
Cloroflexi (3,4%), no obstante el porcentaje de abundancia de los phylum Fibrobacteres
WWE1y Chlorobi incremento (7,4; 1,5 y 1,6%, respectivamente) con respecto a la semana
8 (Figura 33). A nivel de género, la mayor asignación de OTUS fue para Treponema
(10,8%) seguida por los OTUS no asignados (2,3%). La mayoría de género asignados a
especies degradadoras de celulosa y fermentativos como Devosia (1,26%) , Bacteroides
(1.1%), Clostridium (2,0%) y Sphingobacterium (0,9%) redujeron su porcentaje de
abundancia, mientras que los géneros Desulfovibrio (1,5%), WCHB1-0,5 (1,3%),
Sulfuricurvum (1,2%) y Desulfomicrobium (1,14%) incrementaron su porcentaje con
respecto a la semana 8 (Figura 33). Los géneros que redujeron drásticamente su abundancia
relativa (<0,04%), fueron aquellos que no se relacionaban con ninguna de las variables
fisicoquímicas evaluadas en la mezcla reactiva post- tratamiento en la semana 8 y que
habían sido previamente reportados en reactores ricos en materia orgánica (T78,
VadinCA02 y BF311 Trabulsiy Coprotheobacter).

93
El cambio en la abundancia relativa de los géneros posiblemente se encuentra
asociado a la reducción de materia orgánica y al incremento de la toxicidad causada por la
alta concentración de sulfuros en los efluentes, entre la semana 8 a la 17. En este mismo
periodo, en la mezcla reactiva post-tratamiento se observó un incremento del porcentaje de
las SFD, mientras que la concentración de celulosa disminuyó. Estos resultados indicaron
que aunque el porcentaje de bacterias degradadoras de celulosa y fermentativas disminuyó,
la cantidad que había en los reactores fue suficiente para degradar fuentes de carbono
complejas como la celulosa, mientras que los géneros que utilizan fuentes de carbono
fácilmente disponibles redujeron su abundancia a < 0,04%. En estudios previos realizados a
15 sistemas de tratamiento de aguas residuales Johnson e t a l . (2014), observaron este
mismos patrón durante los cambios de concentración de carbono y nitrógenos en los
vertimientos. Además, en un sistema ecológico la disponibilidad de nutrientes afecta la
diversidad y la riqueza de las comunidades (Saikaly y Oerther, 2005).

La abundancia total de los géneros de BSR fue del 3,0% y sólo cinco de los diez
géneros encontrados (D esulfovibrio, D esulfom icrobium , D e su lfo b u lb o s , D esu lfo b a cter y
D esu lfo cco cu s ) mostraron una abundancia > 0,5% (Figura 33). Este bajo porcentaje de
BSR fue suficiente para reducir el sulfato en un 60% e incrementar el sulfuro en los
efluentes en >90%, especialmente en los reactores con 4 d de TRH. Estos géneros de BSR
han sido reportados en sistemas donde el ORP es bajo y hay abundantes fuentes de carbono,
también D e su lfo vib rio ha sido clasificado como el sulfato-reductor más abundante en los
sistemas de tratamiento para DAM (Hallberg y Johnson, 2005; Pruden e t a l ., 2007;
Mirjafari e t a l ., 2014). Otro género que incremento su abundancia relativa fue G eobacter ,
su metabolismo se encuentra asociado a la oxidación acetato acoplado a la reducción de
F e 3 en combinación con BSR que consumen el H2(Koschorreck, 2010).

94
Figura 33 Abundancia relativa de géneros dominantes (> 0,5%) presentes en los reactores
pasivos en la semana 17 (2 y 4 d de TRH; A: alto, M: medio y B: bajo).

Se encontró diferencias significativas (t -test Welch's < 0,01) entre la abundancia


relativa de los géneros en las alturas de los reactores (Figura 34) independientemente del
TRH. El género Sulfuricurvum fue significativamente más abundante en la parte alta, este
género es quimiolitotrófico y utiliza sulfuro, tiosulfato e H2 como donadores de electrones y
nitrato como aceptor en condiciones anaerobias. Además contiene algunas especies que son
facultativas, que en condiciones microaerobias puede utilizar oxígeno como aceptor final de
electrones (Zheng e t a l ., 2014). Su incremento en la parte alta de los reactores puede estar
relacionado con la presencia del puerto de muestreo que se encontraba en la parte superior
de los biorreactores y permitió la formación de regiones microaerobias. La abundancia de
los géneros D esu lfo b u lb u s , D esu lfo vib rio y Syn tro p h o b a cter fueron significativamente (t -
test Welch's; p < 0,05) mayor en la parte baja de los reactores (Figura 34). En sistemas
anaerobios con alto contenido de sulfato es común encontrar una relación sintrófica entre
estas especies. El género S yntrophobacter puede oxidar propionato utilizando sulfato como
aceptor final de electrones y producir acetato e hidrógeno que son los substratos del

95
metabolismo de las BSR (Shade e t a l ., 2013; Sánchez-Andrea e t a l ., 2014). Los géneros
D esu lfo b a cter y S edim entibacter fueron más abundantes en la parte media con respecto a la
parte baja de los reactores. Sedim entibacter es un fermentador de aminoácidos a etanol o
ácido acético y ácido butírico, también puede participar en la reducción de Fe+3 en co­
cultivo con BSR (Burkhard e t a l ., 2011).

Figura 34 Comparaciones de la abundancia de los géneros significativamente diferentes


entre los capas alto (A), medio (M) y bajo (B) de los biorreactores en la semana 17. La
significancia se determinó mediante la prueba t-test Welch's paramétrica corregida por
Benjamin-FDR

La relación de las variables fisicoquímicas evaluadas con la abundancia de los Fila


fue significativa (p = 0,001). Los demás párametros evaluados explican el 91,9% % de la
varianza de la relación entre las variables fisicoquímicas y biológicas (Figura 35). Esto
indica que aproximadamente 8 % de la varianza restante esta explicada por otras variables
que no fueron medidas. Se encontró que el COT, el Fe+2 y el Mn+2 (Monte Carlo, p < 0.05)
son las variables ambientales que afectan en mayor medida la la comunidad microbiana en
la semana 17. Los géneros de BSR (D esulfom ona, D esulfovibrio, D esu lfo b o lb u s y

96
Desulfoccocus), Geobacter y el género propuesto WCHB1-05 se agruparon en el segundo
eje donde el Fe y el AVS tienen mayor efecto. Por otro lado, los géneros celulolíticos y
fermentativos como Paludibacter, Luteimonas, Clostridium, Devosia y Agrobacterium se
agrupan sobre el COT que es la variable con mayor influencia, mientras que el género
Sulfuricurvum se encuentra separado de las variables fisicoquímicas, lo que significa que
ellas no explican su presencia en el reactor. En la semana 17 la remoción de los metales
(Fe+2 y Zn+2) por formación de sulfuros metálicos ya se encontraba establecida; sin
embargo, la precipitación de oxi-hidróxidos de hierro continuaba siendo un mecanismo
importante de remoción. Esto favoreció la acumulación de metales en la mezcla reactiva
permitiendo que el hierro fuera una de las variables fisicoquímicas con mayor influencia
sobre la comunidad microbiana durante esta etapa del sistema de tratamiento.

Figura 35 Análisis de correspondencia canónica (CCA) entre las variables fisicoquímicas


y los géneros (abundancia relativa > 0,5%) encontrados en la mezcla reactiva post­
tratamiento de dos biorreactores pasivos con diferentes TRH (2 y 4 d) que operaron durante
17 semanas.

97
La diversidad en la semana 17 se caracterizó por la reducción de la riqueza de los
taxones que utilizan fuentes de carbono fácilmente disponibles y de los taxones funcionales
capaces de utilizar fuentes de carbono complejas. Además, la abundancia de los géneros de
BSR incremento favoreciendo la remoción biológica del sulfato y los metales. Se
observaron diferencias significativas en la diversidad de las alturas del reactor. Los géneros
capaces de reducir sulfato y metales fueron significativamente más abundantes en la parte
baja, mientras que los géneros oxidadores de azufre se ubicaron en la parte alta de los
reactores. El género Treponema continúo siendo el más abundante, sin diferencias
significativas entre las alturas. Por otro lado, el COT, el Fe+2 y el Mn+2 fueron las variables
fisicoquímicas con mayor impacto sobre la comunidad microbiana, esto se encuentra
relacionado con los parámetros de operación del reactor que acumuló Fe en la mezcla
reactiva mientras lixivió Mn en los efluentes.

5.11.7.4 Semana 36

En la semana 36 se sacrificaron tres biorreactores con diferente TRH (1, 2 y 4 d).


Los reactores de 2 y 4 d de TRH habían operado durante 36 semanas, pero en la semana 17
un reactor con 4 d de TRH fue conmutado a 1 d de TRH con el fin de evaluar si era posible
controlar la generación de sulfuros. Los reactores con 2 y 4 d de TRH estaban removiendo
> 99% de Fe+2 y Zn+2, pero el reactor con 1 d de TRH sólo removía el 70% y ningún
reactor removía Mn+2. El pH y la alcalinidad de los efluentes permanecieron sin diferencias
significativas, pero el ORP de la columna con 1 d de TRH incremento desde -375 hasta -
108 mV. Al final del estudio la concentración de sulfuro en los reactores de 4 d de TRH era
de 1,866 ± 19 mg H2S/L mientras que en la columna con 2 d de TRH fue reducido a 218 ±
37 mg H2S/L y en la de 1 d de TRH a 23 ± 4 mg H2S/L. El COD en los efluentes se
mantuvo relativamente constante (~10 mg/L) entre la semana 17 y 36. En la mezcla
reactiva post-tratamiento el cambio más representativo fue la disminución del pH en la
parte baja de todos los reactores con diferencia significativa (p < 0,05) en la columna de 1 d
de TRH (5,2). Además, se presentó alta acumulación de sulfuros metálicos en la parte
media y baja de las columnas. Estas nuevas condiciones redujeron la diversidad (Shannon;

98
5,5 3 ± 1,3) y favorecieron el aumento de la riqueza (Chao 1; 1249,4±60,7), en las muestras
de la mezcla reactiva post-tratamiento, sin diferencias entre los TRHs.

En la semana 36, se presentó efecto significativo (adonis; p < 0,05) del TRH y de
las alturas de los reactores sobre las comunidades microbianas. En el análisis PCoA
utilizando las matrices de presencia/ausencia y abundancia se observó que la comunidad
microbiana se separó en grupos definidos (Figura 36). Las mayores distancias filogenéticas
se observaron entre los taxones de la parte baja del reactor con 1 d de TRH y los de la parte
baja de los reactores con 2 y 4 d de TRHs, mientras que las menores distancias fueron entre
los taxones de la parte alta y media de los tres reactores sin diferencias entre los TRH.
Cuando se utilizaron las matrices de abundancia para el análisis de distancias, se
observaron cinco grupos, cuatro de ellos similares a los del análisis anterior y uno nuevo
conformado por la comunidad de la parte alta de la columna con 4 d de TRH. La diferencia
entre las comunidades de la parte baja de los reactores estuvo asociada a factores
ambientales que afectan la presencia/ausencia de los taxones como el pH y las condiciones
redox, mientras que los microorganismos presentes en la parte alta de las columnas fueron
sensibles a factores que afectan la abundancia como la disponibilidad de nutrientes y la
concentración de metales.

Figura 36 Análisis de coordenadas principales (ACoP) de muestras de mezcla reactiva


post-tratamiento en la semana 36 basados en las distancias calculadas mediante UniFrac. A)
ausencia/presencia; B) abundancia.

99
El mayor número de OTUS que pudo ser asignado a género en las columnas con 2 y
4 d de TRH fue para Treponem a (8,2%) que redujo su abundancia en la parte baja de los
reactores en comparación con la semana 17 (10,8%), seguido de los OTUS no asignados
(2,0%). En la columna con 1 d de TRH el género más abundante fue A cid ith io b a cillu s
(10,5%) y su presencia estuvo relacionada con el descenso del pH (5,2) de la mezcla
reactiva post-tratamiento en la parte baja del reactor (Figura 37). Las bacterias
pertenecientes a este género son acidófilas, autotróficas que utilizan Fe+2 y S0 como fuente
de energía y son responsables de la disolución y movilización de metales en condiciones
ácidas (Natarajan e t a l ., 2006; Sánchez-Andrea e t a l ., 2014). También, es común
encontrarlas junto con bacterias del género P a lu d ib a cter reconocido como termentador y
presente en ambientes ácidos (Zheng e t a l ., 2014). En la semana 36, también se encontraron
géneros degradadores de celulosa y fermentativos como D evosia, C lostridium , A rtro b a cter
y B a ctero id etes , pero el principal cambio fue el incremento en el porcentaje de abundancia
de los géneros de BSR. Se encontraron ocho géneros de BSR con abundancia relativa >
0,5% pertenecientes al p h y lu m Proteobacteria (Figura 37). El promedio de abundancia
relativa de BSR en las muestras fue de 3,8% y este valor fue consistente con estudios
previos en biorreactores empacados con material ligno-celulósico, donde el porcentaje de
abundancia estuvo entre 2,0 a 5,0% (Hiibel e t a l ., 2011). Sin embargo, el porcentaje de
OTUS asignados a la familia Deltaproteobacteria durante este muestreo fue del 11% y sólo
el 3,8% pudo ser asignado a género, esto indica que tal vez la cantidad de BSR fue mayor y
no fue posible identificarlas por limitación de la técnica illumina. Aunque, en sistemas de
tratamiento de DAM a escala piloto con material lignocelulosico se ha observado que las
BSR representan una baja proporción de la comunidad microbiana (Hallberg y Johnson,
2005).

100
i i Treponema
I I No asignados
WCHB1-05
Desutfovibno
Devosia
Desulfomicrobium
Clostridium
Arthrobacter
Bacteroides
Desulfobulbus
Desulfococcus
Geobacter
Desulfobacca
Desulfomonile
Desulfobacter
Acidithiobacilius
Paludibacter
W22
Luteimonas
i i Agrobacterium
Sphingopyxis

Semana 36

Figura 37 Abundancia relativa de géneros dominantes (> 0,5%) presentes en los reactores
pasivos en la semana 36 (2 y 4 d de TRH; A: alto, M: medio y B: bajo).

La abundancia relativa de los géneros presentó diferencias significativas (t -test


Welch's < 0,05) entre las alturas de los reactores (Figura 38) sin diferencias entre los TRH.
En la parte alta de los reactores con 2 y 4 d de TRH los géneros con mayor abundancia
fueron D esulfobacter, Sulfuricurvum , S edim entibacter y W C H B 1-05 . El género no
cultivado W C H B 1-05 es un clon encontrado en acuíferos contaminados con hidrocarburos y
se encuentra relacionado con las comunidades de sulfato reductores, pero aún se desconoce
su metabolismo (Dojka e t a l ., 1998). Mientras que en la parte media el género con mayor
abundancia fue Treponem a seguido de W C H B 1-05 y D esu lfo m ic ro b iu m . En la parte baja
los géneros con abundancia significativa (p < 0,05) fueron G eobacter , D e su lfo b u lb u s y
D e su lfo b a ca junto con el género P a lu d ib a cter . Además, en la parte alta se observó la
presencia del género C om am onas que utiliza el oxígeno como aceptor de electrones y es
capaz de reducir nitrato (Sánchez-Andrea e t a l ., 2011). Su presencia posiblemente se
encuentra relacionada con con el puerto de muestreo ubicado en la parte superior.

101
Figura 38 Comparaciones de la abundancia de los géneros significativamente diferentes
entre los capas alto (A), medio (M) y bajo (B) de los biorreactores con 2 y 4 d de TRH en la
semana 36. La significancia se determinó mediante la prueba t-test Welch's paramétrica
corregida por Benjamin-FDR

El análisis de correspondencia canónica presentó alta correlación (r = 1,0) entre los


géneros y los parámetros fisicoquímicos evaluados (Figura 39). Los dos primeros ejes del
análisis explicaron el 25,2% y el 74,3%, de la variabilidad del analisis. Se encontró que pH,
Fe y SAV (Monte Carlo, p < 0,05) son los párametros ambientales que afectan en mayor
medida la variación de la comunidad microbiana. El análisis de la mezcla reactiva post­
tratamiento mostró fuerte descenso del pH (6,3; 6,1; 5,2 para 4, 2 y 1 d de TRH), en la parte
baja de los reactores. En los biorreactores pasivos se debe mantener un rango de pH que
permita el funcionamiento de los diferentes grupos de microorganismos. Las bacterias
celulolíticas y fermentadoras requieren un rango optimo entre 5,2 - 6,5 (Rousk et al.,
2010; Kuang et al., 2012), los acetogénicos entre 6,6 - 8,0 (Boaro et al., 2014) y las BSR
entre 5,0 - 8,0 (Postgate 1984), fuera de estos rangos su actividad es inhibida. Cambios en

102
el pH también afectan la proporción de compuestos producidos en los biorreactores,
Horiuchi e t al. (2002) encontró que en biorreactores anaerobios para tratamientos de lodos
a pH entre 5,0 - 6,0 se generaba acetato y butirato, mientras que a pH > 7,0 se producía
propionato y acetato, beneficiando a las BSR. Con respecto a los SAV, en la semana 36 los
reactores se encuentran formando sulfuros metálicos que depositados sobre la superficie de
los microorganismos previenen el contacto de la célula con el carbono orgánico, inhibiendo
los aceptores de electrones y la actividad enzimática (Utgikar e t al., 2002).

En el ACC (Figura 39) se observa que los géneros de BSR (D esulfococcus,


D esulfobulbus, D esulfom ona, D esu lfo b a cter y D esulfovibrio) se encuentran relacionados
con la concentración de SAV, sulfato Zn y Fe. Estos géneros son los más abundantes en las
muestras de la parte baja de los biorreactores y en estudios previos se ha encontrado que
presentan alta tolerancia a metales y son promisorias en procesos de remediación (Hao et
al., 2014; Muyzer y Stams, 2008). Estos géneros han sido encontrados en biorreactores que
funcionan a pH < 5,0 y que han sido inoculados con sedimento proveniente de sitios ácidos
(Sánchez e t al., 2014). Los géneros fermentativos como D evosia, Treponem a y

B acteroides, así como el sulfato-reductor D esulfom icrobium se encuentran separados de los


parámetros fisicoquímicos evaluados en la mezcla reactiva, posiblemente su abundancia no
dependa de las variables fisicoquímicas evaluadas durante la semana 36.

La diversidad en las columnas de 2 y 4 d de TRH se caracterizó por el incremento


de la riqueza de los taxones que utilizan el sulfato como aceptor final de electrones, así
como de los géneros capaces de establecer relaciones sintróficas. Por otro lado, en la
columna con 1 d de TRH el género con mayor abundancia fue A cidithiobacillus que es
capaz de utilizar Fe+2 y S0 como fuente de energía y a la vez acidificar el medio. Esta
modificación del pH puede causar el cambio en el número de oxidación de los metales que
han sido previamente inmovilizados, favoreciendo su desplazamiento a la parte media y
alta de los reactores afectando las comunidades microbianas. Además, el descenso de pH
redujo la abundancia de las bacterias del género Treponem a en la parte baja de los reactores
lo que puede afectar la generación de acetato y finalmente el proceso de sulfato-reducción.
La comunidad microbiana cambia durante el tiempo de operación de los reactores y se

103
encuentra relacionada con los parámetros de operación, la disponibilidad de nutrientes y los
mecanismos de remoción de metales y sulfato.

Desu ¡fomicrobium

COI
Arthrobt

WCHB1-05

Desulfovibrio Desmfobacca
Desulfobacter Otros
Sulfato,

D esuM bcoccusJ^ Geobacter Treponema


-" ' ' A A Devos xa
Desiilfobuibus C elulosa Bacteroidetes

SFD

Eje 1 (25,2)

Figura 39 Análisis de correspondencia canónica (CCA) entre las variables fisicoquímicas


y los géneros (abundancia relativa > 0,5%) encontrados en la mezcla reactiva post­
tratamiento de tres biorreactores pasivos con diferentes TRH (1,2 y 4 d) sacrificados en la
semana 36.

5.11.8 Modelo biogeoquímico de los reactores pasivos

En este estudio la composición química de la mezcla reactiva post-tratamiento de


siete biorreactores pasivos de flujo ascendente con diferentes TRH (1, 2 y 4 d) fue
correlacionado con la comunidad microbiana implicada en la remediación del DAM. Los
resultados observados en la semana 36 permitiron sugerir un modelo biogeoquimico de los
reactores pasivos teniendo en cuenta el espacio en el reactor (alto, medio y bajo) y los

104
géneros con una abundancia relativa > 0,2% identificados con la técnica de secuenciación
de illumina (Figura 40).

La semana 36 fue seleccionada por las diferencias fisicoquímicas encontradas en las


alturas de los reactores. Durante esta etapa el pH de la mezcla reactiva en la parte baja de
todos los reactores había disminuido llegando a ser levemente ácido (5,2 - 6,3), mientras
que en las partes media y alta era neutro (7,1 - 7,4). Como resultado, cuando el DAM
ingresaba al reactor se encontraba con un mayor pH que promovía la precipitación química
de Fe+2 como oxi-hidroxidos (Johnson y Hallberg, 2005). Además, el OD en el DAM (6,2
mg/L) junto con las bacterias oxidadoras de hierro (A c id ith io b a cillu s ) permitieron la
acumulación de Fe+3 mientras contribuían con el descenso del pH de la mezcla reactiva de
la parte baja del biorreactor. Un poco más arriba en el reactor donde no había OD, el Fe+3
pudo ser reducido de nuevo a Fe+2 por bacterias del género G eobacter cuando oxidaban
acetato o por bacterias del género P seu d o m o n a s cuando oxidaban H2, completando así el
ciclo del hierro (Lovley e t a l ., 2004; Koschorreck e t a l ., 2010). Finalmente, el Fe 2 presente
en el reactor fue inmovilizado en forma de sulfuro ferroso (FeS) por un proceso químico.

Otra importante característica de la semana 36 fue la alta alcalinidad (506,2 -


1.368,5 mg CaCO3/L) de los efluentes producto de la actividad de las BSR, estos
carbonatos y bicarbonatos facilitaron la formación de rodocrosita (MnCO3) y la remoción
parcial de Mn+2 a través de un proceso quimico. Sin embargo en la parte baja de las
columnas las bacterias del género P seu d o m o n a s en presencia del oxigeno disuelto en el
DAM oxidaron el Mn+2 y facilitaron la formación de óxidos (MnO2), que posteriormente
sirvieron como aceptor de electrones para el crecimiento de BSR (Lovley e t a l ., 2004; Hao
e t a l ., 2014).

Los biorreactores pasivos fueron empacados con una mezcla de substratos organicos
(estiércol, compos de champiñón y aserrín) que fueron degradados en condiciones
anerobias para producir compuestos de bajo peso molecular La primera etapa fue la
hidrólisis de biopolimeros (p.e., celulosa, hemicelulosa, ácidos nucleicos, grasa, proteinas)
por acción de enzimas celulolíticas, proteolíticas y lipoliticas presentes en microorganismos

105
degradadores e hidroliticos de géneros como: C lostridium , B a ctero id es , P a lu d ib a cter ,
L u teim o n a s A g ro b a cter y Spingobacterium . Durante esta etapa se generaron monómeros
(p.e., celobiosa, glucosa, aminoácidos) que fueron fermentados por bacterias de los géneros
A cetobacter, Treponem a, Syntrophobacter, Syntrophom onas, Syntrophobotulus y
C oproterm obacter para originar ácidos grasos (acetato, propionato, butirato, succinato),
alcoholes (etanol y metanol), H2 y CO2. Inmediatamente todo el H2 producido fue
consumido por las BSR, favoreciendo la presencia de géneros sintrofos (Syntrophobacter,
Syntrophom onas, Syntrophobotulus ) que oxidaron los ácidos grasos hasta acetato e H 2
(Madigan e t a l ., 2002; Muyzer y Stams, 2008).

El sulfato ingresó a las columnas en una concentración de 2.500 mg/L y fue


removido en > 65%, por precipitación como yeso (CaSO4*2H2O) en la parte baja de los
reactores y a través de la fase reductiva del ciclo del azufre por la actividad de las BSR. Los
compuestos producidos durante la fermentación de los substratos organicos fueron
utilizados por las BSR como donadores de electrones, mientras reducian el sulfato hasta
sulfuro (23 ± 4; 218 ± 37; 1.866 ± 19 mg H2S/L para 1, 2 y 4 d de TRH, respectivamente).
La reducción de sulfato a sulfuro fue mediada por géneros de BSR, que se clasifican en
oxidadoras incompletas de materia orgánica como: D esulfovibrio, D esulfobulbus,
D esulfom icrobium y D esulfom aculum o en completas oxidadoras de materia orgánica
como: D esulfom onile, D esulfoccocus, D esu lfo b a cter y D e su lfo b a cca (Hao e t a l ., 2014). El
CO2 producido durante la oxidación de la materia orgánica permitio la formación del ión
bicarbonato (HCO3-2), el cual neutralizo el pH y favorecio la reacción entre los sulfuros y
los metales. Posteriormente, el sulfuro soluble (H2S, HS- y S-2) reacciono espontáneamente
con los metales para formar sulfuros metálicos (FeS y ZnS) que precipitaron en la mezcla
reactiva. Por otro lado, en la parte alta de los reactores la presencia del puerto de muestreo
permitió el ingreso de aire favoreciendo la oxidación de sulfuro (HS-) hasta azufre
elemental. Posteriormente, las bacterias del género Sulfuricurvum y C om am onas oxidaron
de manera quimiolitotrófica el sulfuro a expensas del oxígeno hasta la convertirlo de nuevo
en sulfato, completando así, el ciclo del azufre. La oxidación de azufre elemental hasta
sulfato, mediada por Sulfuricurvum ha sido previamente reportada en biorreactores pasivos

106
para tratamiento de DAM y en sistemas bioelectroquimicos acoplados a sulfato (Burns et
al., 2012; Zheng et al., 2014).

Puerto de muestreo

6 cm
G ravi a
7 ,4 1 0 ,3
NO

S u lfu ric u rv u m \
Comámonos
S u lfu n c u rv u m

no 2

(C r^ O Jn
H,0
D e su lfo m a cu lu m C ostridium
D e su ífo vib rio Bacteroides
D esu lfo b u ib u s Pa u d tb o c te r
L u te jm o n a s
S p h in g o b a c te riu m
63 c m 7,1 Í 0 , 9
M e z c la
Monomeros
R ea ctiv a
Desulfomonile ’A ceto b a cte r
D esulfococcus
J Syn trob acter
D esulfom icrobium
Treponem o
D esu lfobacter
C oproterm obocter
D esulfobacca
Acetato

FeS
DAM
pH 3,0 - 3,5 P seudom onaj
MnCU
G e o b a c te r
Fe 200 mg/L
Zn 18 mg/L
A c id io th io b a c i us
Mn 31,5 mg/L
OD 6,2 mg/L
Sulfatos 2500 mg/L 7 cm 5,810,9
Gra vi a

Figura 40 Modelo biogeoquímico propuesto en los reactores pasivos en la semana 36, los
géneros con una abundancia relativa >0,2% implicitos en el ciclo del azufre y carbono

107
(azul), hierro (café), se indican junto a las flechas, las reacciones químicas no mediadas por
microorganismos se representan en rojo.

La identificación de los microorganismos en este estudio y su correlación con los


parámetros fisicoquímicos de la mezcla reactiva post-tratamiento y los efluentes de siete
reactores pasivos que operaron con tres TRH (1, 2 y 4 d), nos permite sugerir un modelo
biogeoquímico donde se encuentran implicados los ciclos del hierro, el azufre y el carbono.
Este modelo nos permite un mejor entendimiento de los procesos implicados en la
remediación del DAM del distrito minero de Zipaquirá

108
6 CONCLUSIONES

El presente estudio logró con éxito los objetivos propuestos. Basándose en los resultados se
obtuvieron las siguientes conclusiones:

Diseñar un biorreactor pasivo teniendo en cuenta las condiciones del DAM y materia
orgánica disponible en el distrito minero de Zipaquirá.

- Se encontró que la mezcla reactiva compuesta por estiércol (15%), compost de


champiñón (10%), aserrín de Sajo (25%), sedimentos (15%), gravilla (20%), y
carbonato de calcio (15%) fue la opción mas promisoria para usar en reactores pasivos
de flujo continuo durante la biorremediación del DAM en el distrito minero de
Zipaquirá. Esta mezcla fue eficiente incrementando el pH y la alcalinidad, así como
removiendo los metales (69% de Mn+2, > 99% de Zn+2 y Fe+2) y el sulfato (70%) del
DAM sintético. Además, la mezcla reactiva presentó propiedades hidráulicas que
favorecieron el flujo continuo del DAM a través de la columna y evitaron el
taponamiento y la compactación del reactor durante el tiempo de operación.

Evaluar el efecto del TRH sobre la eficiencia del biorreactor pasivo para remediar el
DAM del distrito minero de Zipaquirá.

- El TRH ejerce un efecto significativo sobre la eficiencia de los reactores pasivos


durante la remediación del DAM. Todos los biorreactores fueron eficientes en
incrementar el pH y la alcalinidad, así como en reducir la concentración de sulfato (>
60%) y los metales (> 70%). Sin embargo, largos TRH (4d) tienen baja velocidad en el
flujo favoreciendo el crecimiento y la actividad de BSR. Como resultado, se genera alta
alcalinidad y exceso de los sulfuros solubles que contaminan los efluentes y ocacionan
un efecto adverso sobre las BSR. En el caso contrario, cortos TRH (1d) lavan la
biomasa e inducen OD en el reactor incrementando el ORP, afectando las condiciones
anaerobias y creando efectos adversos sobre la actividad de los microorganismos, como
resultado la remoción de metales se reduce hasta en un 30%.

109
Evaluar el efecto del TRH sobre la mezcla reactiva post-tratamiento durante la
biorremediación del DAM.

- El TRH mostró un efecto significativo sobre la mezcla reactiva de los biorreactores


pasivos. Los metales removidos (Fe y Zn), el sulfato y los sulfuros fueron concentrados
en la parte baja de todos los reactores, con diferencia significativa en los que operaron
con 2 d de TRH. Por otro lado, el bajo flujo (4 d de TRH) favoreció el crecimiento de
microorganismos que rápidamente consumieron el nitrógeno y el carbono orgánico
disponible en la parte baja la mezcla reactiva.

Evaluar el efecto del TRH sobre la diversidad microbiana durante la biorremediación


del DAM.

- El TRH en función del tiempo de operación mostró un efecto significativo sobre la


diversidad microbiana presente en los biorreactores pasivos. A lo largo del estudio se
observó la reducción de los microorganismos que utilizan fuentes de carbono
fácilmente disponibles, mientras que aumentó la riqueza de los taxones funcionales
capaces de utilizar fuentes de carbono más complejas como la celulosa. La diversidad
se caracterizo por la abundancia de géneros celuloliticos y fermentivos, mientras que
los géneros de las BSR estuvieron presentes en poca abundancia (3,5%); sin embargo,
esto no afecto la eficiencia de los reactores para remover sulfato y metales.
- La concentración y disposición de los metales, sulfatos y sulfuros metalicos, así como
la disponibilidad de nutrientes determinó la distribución espacial de los
microorganismos dentro de los reactores. Los géneros microbianos capaces utilizar
compuestos inorgánicos reducidos como sustratos y las BSR fueron más abundantes en
la parte baja de los reactores, mientras que los géneros capaces de degradar celulosa y
de fermentar compuestos organicos fueron más abundantes en la parte media y alta
- Esta investigación contribuyó con la elucidación de los procesos biogeoquimicos que
ocurren en los biorreactores pasivos durante la biorremediación del DAM del distrito
minero de Zipaquirá, donde se encuentran implicitos los ciclos del hierro, el azufre y el
carbono.

110
7 REFERENCIAS

Acinas, S., Sarma-Rupavtarm, R., Klepac-Ceraj V., Polz M.F. (2005). PCR-induced sequence error
and bias: insights from comparison of two16S rRNAclone libraries constructed from the
same sample. A p p lie d a n d E n v ir o n m e n ta lM ic r o b io lo g y 71: 8966- 8969.

Adams, B., Anderson, R., Bless, D., Butler, B., Conway, B., Dailey, A., Zownir, A., 2014.
Reference guide to treatment technologies for mining-influenced water, vol. 542-R-14-
001.USEPA- OSRTI. Washington, DC. 94.

Amos, P., y Younger, P. (2003). Substrate characterisation for a subsurface reactive barrier to treat
colliery spoil leachate. W a te r R e s e a r c h , 3 7 , 108-120.

Andrews S. (2010). FastQC: a quality control tool for high throughput sequence data. Available
online at: http://www.bioinformatics.babraham.ac.uk/proj ects/fastqc

APHA (2005). S ta n d a r d m e th o d s f o r th e e x a m in a tio n o f w a te r a n d w a s te w a te r (2 1 s t e d . ) . L.S.


Clesceri, A.E. Greenberg, A.D. Eaton (Eds.), American Public Health Association
Washington, D.C.

ASTM (1987). S ta n d a r d te s t m e th o d f o r M o is tu r e , A sh , a n d O r g a n ic M a tte r o f P e a t a n d O th e r


O r g a n ic S o ils . In: Annual book of ASTM standards, Section D 2974, ASTM International,
West Conshohocken, PA, pp. 39-42.

ASTM (1995a). S ta n d a r d te s t m e th o d f o r p H o f s o ils . In: Annual book of ASTM standards, Section


D4972- 95a, ASTM International, West Conshohocken, PA, pp. 27-28.

ASTM (1995b). S ta n d a r d te s t m e th o d f o r la b o r a to r y d e te r m in a tio n o f w a te r (m o istu re ) c o n te n t o f


s o il and r o c k . In: Annual book of ASTM standards, Section D2216-92, ASTM
International, West Conshohocken, PA, pp. 178-181.

ASTM (2000). S ta n d a r d te s t m e th o d f o r p e r m e a b ility o f g r a n u la r s o ils . In: Annual book of ASTM


Standards, Section D 2434-68, ASTM International, West Conshohocken, PA, pp. 1-5.

ASTM (2009). S ta n d a r d m e th o d s f o r s u lfa te -r e d u c in g b a c te r ia in w a te r a n d w a te r - fo r m e d d e p o sits.


In: Annual book of ASTM Standards, Section D4412-84, ASTM International, West
Conshohocken, PA.

Aubertin, M., y Bussie're B. (2001). Meeting environmental challenges for mine waste
management. G e o te c h n ic a l N e w s 19:21-26.

Ayora, C., Caraballo, M. A., Macias, F., Rotting, T. S., Carrera, J., & Nieto, J. M. (2013). Acid
mine drainage in the Iberian Pyrite Belt: 2. Lessons learned from recent passive remediation
experiences. E n v ir o n m e n ta l S c ie n c e a n d P o llu tio n R e s e a r c h , 20(11), 7837-7853.

Bagchi, S., Tellez, B.G., Rao, H.A., Lamendella, R., y Saikaly, P.E. (2014). Diversity and dynamics
of dominant and rare bacterial taxa in replicate sequencing batch reactors operated under
different solids retention time. A p p lie d M ic r o b io lo g y a n d B io te c h n o lo g y , 1-10.

111
Baldwin, S.A., Khoshnoodi, M., Rezadehbashi, M., Taupp, M., Hallam, S., Mattes, A., y Sanei, H.
(2015). The Microbial Community of a Passive Biochemical Reactor Treating Arsenic,
Zinc, and Sulfate-Rich Seepage. Frontiers in Bioengineering and Biotechnology, 3 doi 1­
13. doi:10.3389/fbioe.2015.00027

Bartram, A. K., Lynch, M. D. J., Stearns, J. C., Moreno-Hagelsieb, G., Neufeld, J. D., y Reads, P. I.
(2011). Generation of multimillion-sequence 16S rRNA gene libraries from complex
microbial communities by assembling paired-end illumina reads. Applied and
EnvironmentalMicrobiology, 77(11), 3846-52.

Bijmans, M., Vries, E., Yang, C., Buisman, C., Lens, L., Dopson, M. (2010) Sulfate reduction at pH
4.0 for treatment of process and wastewaters. Biotechnology Progress, 26 1029-1037

Boaro, A.A., Kim, Y.M., Konopka, A.E., Callister, S.J.,y Ahring, B.K. (2014). Integrated ‘omics
analysis for studying the microbial community response to a pH perturbation of a cellulose-
degrading bioreactor culture. FEMSMicrobiology Ecology. 90(3), 802-815.

Bokulich, N., Subramanian, S., Faith J., Gevers, D., Gordon, I., Knight, R., Mills, D., Caporaso, J.
(2013). Quality-filtering vastly improves diversity estimates from Illumina amplicon
sequencing, Nature Methods. 10(1). 57-59.

Bolis, J., Wildeman, T., y Dawson, H. (1992). Hydraulic conductivity of substrates used for passive
acid mine drainage treatment. In: Proceedings of the National Meeting of the American
Society for Surface Mining and Reclamation, Duluth, MN, pp. 10-20.

Braak, C. J., y Smilauer, P. (1998). CANOCO reference manual and user's guide to Canoco for
Windows: software for canonical community ordination (version 4).

Burbano, L., y Sánchez, L. D. (2007). 28. Remoción de hierro y manganeso por oxidación-filtración
para agua potable. Avances en Investigación y Desarrollo en Agua, 288 pp. 45-51.

Burkhardt, E.M., Bischoff, S., Akob, D.M., Büchel, G., y Küsel, K. (2011). Heavy metal tolerance
of Fe(III)-reducing microbial communities in contaminated creek bank soils. Applied and
Environmental Microbiology, 77(9),

Burns, A.S., Pugh, C.W., Segid, Y.T., Behum, P.T., Lefticariu, L., y Bender, K.S. (2012).
Performance and microbial community dynamics of a sulfate-reducing bioreactor treating
coal generated acid mine drainage. Biodegradation, 23(3), 415-429.

Cadorin, L., Carissimi, E., y Rubio, J. (2007). Avances en el tratamiento de aguas ácidas de minas.
Scientia et Technica, 1(36).

Caporaso, J., Lauber, C., Walters, W., Berg-Lyons, D., Lozupone, C., Turnbaugh, P., Fierer, N.,
Knight, R. (2011). Global patterns of 16S rRNA diversity at a depth of millions of
sequences per sample. Proceeding of the National Academy of Sciences of the United States
of America. U. S. A., 108:4516-22.

Caporaso, J., Stombaugh, J., Bittinger, K., Bushman, F., Costello, E., Fierer, N.,Peña, A., Goodrich,
J., Gordon, J., Huttley, G., Kelley, S., Knights, D., Koenig, J., Ley, R., Lozupone, C.,

112
Mcdonald, D., Muegge, B., Pirrung, M., Reeder, J., Sevinsky, J., Tumbaugh, P., Walters,
W., Widmann, J., Yatsunenko, T., Zaneveld, J., Knight R.(2010). QIIME allows analysis of
high- throughput community sequencing data Intensity normalization improves color
calling in SOLiD sequencing. National Journal, 7:335-336.

Chang, I., Kyun, P., y Hong, B. (1999). Biological treatment o f acid mine drainage under sulphate
reducing conditions with solid waste materials as substrate. Pergamon, 34(4), 1269-1277.

Chockalingam, E., y Subramanian, S. (2009). Utility o f Eucalyptus tereticornis (Smith) bark and
Desulfotomaculum nigrificans for the remediation o f acid mine drainage. Bioresource
Technology, 100(2), 615-621.

Christensen, B., Laake, M., y Lien, T. (1996). Treatment of acid mine water by sulfate-reducing
bacteria; results from a bench scale experiment. Water Research, 1354(96),

Cocos, I., Zagury, G., Clement, B., y Samson, R. (2002). Multiple factor design for reactive mixture
selection for use in reactive walls in mine drainage treatment. Water Research, 32, 167­
177.

Coggon, M., Becerra, C.A., Nüsslein, K., Miller, K., Yuretich, R., y Ergas, S.J. (2012).
Bioavailability o f jarosite for stimulating acid mine drainage attenuation. Geochimica et
Cosmochimica Acta, 78, 65-76.

Cook, K.L., Whitehead, T.R., Spence, C., y Cotta, M.A. (2008). Evaluation o f the sulfate-reducing
bacterial population associated with stored swine slurry. Anaerobe, 14(3), 172-180.

Corporación Autónoma Regional de Cundinamarca (CAR), Gobernación de Cundinamarca (2012).


Lineamientos para el ordenamiento de la minería en los municipios carboníferos del
departamento de Cundinamarca. pag 80.

Costello, C. (2003). Acid mine drainage: innovative treatment technologies. W ashington DC: US
Environmental Protection Agency Office o f Solid W aste and Emergency Response.

Dann, A. L., Cooper, R. S., y Bowman, J. P. (2009). Investigation and optimization o f a passively
operated compost-based system for remediation o f acidic, highly iron-and sulfate-rich
industrial waste water. Water Research, 43(8), 2302-2316.

De Santis, T., Hugenholtz, P., Larsen, N., Rojas, M., Brodie, E., Keller, K., Huber, T., Dalevi, D.,
Hu, P., Andersen, G. (2006). Greengenes, a chimera-checked 16S rRNA gene database
andworkbench compatible with ARB. Applied and Environmental Microbiology, 72:5069-
72.

Degnan P., Ochman, H., (2012). Illumina-based analysis o f microbial community diversity. ISME
Journal, 6:183-94.

Di Toro, D., McGrath, J., Hansen, D., Berry, W., Paquin, P., Mathew, R., Wu, K., Santore, R.
(2005). Predicting sediment metal toxicity using a sediment biotic ligand model:
methodology and initial application. Environmental Toxicology and Chemistry, 24 (10),
2410-2427.

113
Diamond, J.M. (1975). The island dilemma: lessons o f modern biogeographic studies for the design
o f natural reserves. Biological Conservation, 7(2), 129-146.

Díaz, A., Arias, J., y Maldonado, A. (2003). Biosorción de Fe, Al y Mn de drenajes ácidos de
mineria de carbon, empleando algas marinas en procesos continuos. Revista Facultad de
Ingeniería Universidad de Antioquia, 30, 34-48.

Dojka, M.A., Hugenholtz, P., Haack, S.K., y Pace, N.R. (1998). Microbial diversity in a
hydrocarbon-and chlorinated-solvent-contaminated aquifer undergoing intrinsic
bioremediation. Applied and EnvironmentalMicrobiology, 64(10), 3869-3877.

Doshi, S.M. (2006). Bioremediation o f acid mine drainage using sulfate-reducing bacteria. US
Environmental Protection Agency, Office o f Solid W aste and Emergency Response and
Office o f Superfund Remediation and Technology Innovation, 65.

Dvorak, D.H., Hedin, R.S., Edenborn, H.M., McIntire, P.E., (1992). Treatment of metal-
contaminated water using bacterial sulfate reduction: results from pilot-scale reactors.
Biotechnology and Bioengineering. 40, 609-616.

Edgar, R. (2010). Search and clustering orders o f magnitude faster than BLAST. Bioinformatics,
26:2460-1.

Ellis, D., Bouchard, C., y Lantagne, G. (2000). Removal o f iron and manganese from groundwater
by oxidation and microfiltration. Desalination, 130(3), 255-264.

Environmental Protection Agency. (EPA) National Primary Drinking W ater Regulations. Database.
2 June 2015. http://water.epa.gov/drink/contaminants/#List. Path: Regulatory Agencies

Evangelou, V., y Zhang, Y.L. (1995). A review: pyrite oxidation mechanisms and acid mine
drainage prevention. Critical Reviews in Environmental Science and Technology, 25(2),
141-199.

FENALCARBON (2006). Acuerdo de concertación para la producción más limpia de la minería de


carbón subterráneo. Federación Nacional de Carboneros, UPME, Bogotá.
http://www.sigob.gov.co/met/meta.hist.aspx?m=217. Accessed 25 October 2014

García-Moyano, A., Gonzalez-Toril, E., Aguilera, Á., y Amils, R. (2012). Comparative microbial
ecology study o f the sediments and the water column o f the Río Tinto, an extreme acidic
environment. FEMSMicrobiology Ecology, 81(2), 303-314.

Gelvez, G.A., Laverde, D. y Escalarte, H. (2008). Remoción de metales pesados de drenajes ácidos
de minas de carbón usando bacterias sulfato-reductoras. Revista ION (Universidad
Industrial de Santander) 21, 71 -78

Gibert, O., De Pablo, J., Cortina, J., y Ayora, C. (2004). Chemical characterisation o f natural
organic substrates for biological mitigation of acid mine drainage. Water Research, 38(19),
4186-4196.

114
Gibert, O., de Pablo, J., Cortina, J. L., & Ayora, C. (2005). Municipal compost-based mixture for
acid mine drainage bioremediation: Metal retention mechanisms. A p p lie d G e o c h e m is tr y ,
20(9), 1648-1657.

Gich, F., Garcia-Gil, J., y Overmann, J. (2001). Previously unknown and phylogenetically diverse
members o f the green nonsulfur bacteria are indigenous to freshwater lakes. A r c h iv e s o f
M ic r o b io lo g y , 177(1), 1-10.

Gloor, G, Hummelen, R., Macklaim, J., Dickson, R., Fernandes A., MacPhee R., Reid G., (2010).
Microbiome profiling by illumina sequencing of combinatorial sequence-tagged
PCRproducts. P L o S O n e 5:15406.

Godon,J.J., Zumstein,E., Dabert,P., Habouzit,F. and Moletta,R. Molecular microbial diversity o f an


anaerobic digestor as determined by small-subunit rDNA sequence analysis. A p p lie d a n d
E n v ir o n m e n ta l M ic r o b io lo g y , 63 (7), 2802-2813 (1997)

Greben, H. A., Baloyi, J., Sigama, J., y Venter, S. N. (2009). Bioremediation o f sulphate rich mine
effluents using grass cuttings and rumen fluid microorganisms. J o u r n a l o f G e o c h e m ic a l
E x p lo r a tio n , 100(2), 163-168.

Gusek, J.J. (2002). Sulfate-reducing bioreactor design and operating issues: Is this the passive
treatment technology for your mine drainage. National Association o f Abandoned Mine
Land Programs, Park City, Utah.

Gusek, J.J., (2008). Passive Treatment 101: An Overview o f the Technologies, in: U.S.
EPA/National Groundwater Association’s Remediation o f Abandoned Mine, Lands.
Denver, CO, pp. 1-13

Gustafsson, J.P., 2011. Visual MINTEQ, v.3.0. Royal Institute o f Technology, Department o f Land
and W ater Resources Engineering, Stockholm.
http://www2.lwr.kth.se/English/OurSoftware/Vminteq/index.htm> .

Haakensen, M., Pittet, V., Spacil, M. M., Castle, J. W., & Rodgers Jr, J. H. (2015). Key Aspects for
Successful Design and Implementation of Passive W ater Treatment Systems. J o u r n a l o f
E n v ir o n m e n ta l S o lu tio n s f o r O il, G as, a n d M in in g , 1(1), 59-81.

Halim, M., Conte, P., Piccolo, A., 2003. Potential availability o f heavy metals to phytoextraction
from contaminated soils induced by exogenous humic substances. C h e m o s p h e r e , 52, 265­
275.

Hallberg, K.B. (2010). New perspectives in acid mine drainage microbiology. H y d r o m e ta llu r g y ,
104(3), 448-453.

Hallberg, K.B., y Johnson, D.B. (2005). Microbiology o f a wetland ecosystem constructed to


remediate mine drainage from a heavy metal mine. S c ie n c e o f th e T o ta l E n v ir o n m e n t,
338(1), 53-66.

Hao, T.W., Xiang, P.Y., Mackey, H.R., Chi, K., Lu, H., Chui, H.K y Chen, G.H. (2014). A review
o f biological sulfate conversions in wastewater treatment. W a te r R e s e a r c h , 65, 1-21.

115
Harper, S., y Lynch, J. (1981). The chemical components and decomposition o f wheat straw leaves,
intemodes and nodes, Journal of the Science of Food and Agriculture, 32, 1057-1062.

Hesham, A., Qi, R., y Yang, M. (2011). Comparison o f bacterial community structures in two
systems of a sewage treatment plant using PCR-DGGE analysis. Journal of Environmental
Sciences, 23(12), 2049-2054.

Hiibel, S.R., Pereyra, L.P., Breazeal, M.V., Reisman, D.J., Reardon, K.F., y Pruden, A. (2011).
Effect of Organic Substrate on the Microbial Community Structure in Pilot-Scale Sulfate-
Reducing Biochemical Reactors Treating Mine Drainage. Environmental Engineering
Science, 25(8), 563-572.

Hiibel, S.R., Pereyra, L.P., Inman, L.Y., Tischer, A., Reisman, D.J., Reardon, K.F., y Pruden, A.
(2008). Microbial community analysis o f two field-scale sulfate-reducing bioreactors
treating mine drainage. Environmental Microbiology, 10(8), 2087-2097.

Horiuchi, J.I., Shimizu, T., Tada, K., Kanno, T., y Kobayashi, M. (2002). Selective production of
organic acids in anaerobic acid reactor by pH control. Bioresource Technology, 82(3), 209­
213.

Hsu, J., Lo, S.L. (1999). Chemical and spectroscopic analysis o f organic matter transformations
during composting o f pig manure. Environmental Pollution, 104, 189-196

IBM (2010). IBM SPSS Statistics for Windows, Version 19.0. IBM, Armonk, NY

ITRC (Interstate Technology and Regulatory Council), 2012. Biochemical reactors for mining-
influenced waste. BCR-1. Washington, D.C.: Interstate Technology and Regulatory
Council, Biochemical Reactors for Mining-Influenced W aste Team. www.itrcweb.org

Jangid, K., Williams, M., Franzluebbers, A., Sanderlin, J., Reeves, J., Jenkins, M., Endale,D.,
Coleman, D., Whitman, W. (2008). Relative impacts o f land-use, management intensity and
fertilization upon soil microbial community structure in agricultural systems. Soil Biology
andBiochemistry. 40:2843-2853.

Jameson, E., Rowe, O.F., Hallberg, K.B., y Johnson, D.B. (2010). Sulfidogenesis and selective
precipitation o f metals at low pH mediated by Acidithiobacillus spp. and acidophilic
sulfate-reducing bacteria. Hydrometallurgy, 104(3), 488-493.

Jiménez, D., Dini-Andreote, F., y Van Elsas, J. (2014). Metataxonomic profiling and prediction of
functional behaviour of wheat straw degrading microbial consortia. Biotechnology for
Biofuels, 7(1), 1-18.

Johnson, D.B. (2014). Recent developments in microbiological approaches for securing mine
wastes and for recovering metals from mine waters. Minerals, 4(2), 279-292.

Johnson, D.R., Lee, T.K., Park, J., Fenner, K., y Helbling, D.E. (2014). The functional and
taxonomic richness o f wastewater treatment plant microbial communities are associated
with each other and with ambient nitrogen and carbon availability. Environmental
Microbiology, doi:10.1111/1462-2920.12429

116
Johnson, D., y Hallberg, K. (2005). Acid mine drainage remediation options: a review. S c ie n c e o f
T h e T o ta l E n v ir o n m e n t, 555(1-2), 3-14.

Jong, T. y Parry, D. (2003). Removal o f sulfate and heavy metals by sulfate reducing bacteria in
short-term bench scale upflow anaerobic packed bed reactor runs. W a te r R e s e a r c h , 37(14),
3379-89.

Kaksonen, A. H., Plumb, J. J., Franzmann, P. D., y Puhakka, J. A. (2004). Simple organic electron
donors support diverse sulfate-reducing communities in fluidized-bed reactors treating
acidic metal-and sulfate-containing wastewater. F E M S M ic r o b io lo g y E c o lo g y , 47(3), 279­
289.

Karathanasis, A., Edwards, J., y Barton, C.D. (2010). Manganese and sulfate removal from a
synthetic mine drainage through pilot scale bioreactor batch experiments. M in e W a te r a n d
th e E n v ir o n m e n t, 29(2), 144-153.

Koschorreck, M., Geller, W., Neu, T., Kleinsteuber, S., Kunze, T., Trosiener, A., y W endt-Potthoff,
K. (2010). Structure and function o f the microbial community in an in situ reactor to treat
an acidic mine pit lake. F E M S m ic r o b io lo g y e c o lo g y , 73(2), 385-395.

Kuang, J.L., Huang, L.N., Chen, L.X., Hua, Z.S., Li, S.J., Hu,M., y Shu, W.S. (2013).
Contemporary environmental variation determines microbial diversity patterns in acid mine
drainage. T h e I S M E J o u r n a l, 7(5), 1038-1050.

Kunin, V, Engelbrektson, A, Ochman, H, Hugenholtz, P. 2010. Wrinkles in the rare biosphere:


pyrosequencing errors can lead to artificial inflation o f diversity estimates. E n v ir o n m e n ta l
M ic r o b io lo g y , 12:118-23

Lerm, S., Westphal, A., Miethling-Graff, R., Alawi, M., Seibt, A., Wolfgramm, M., y Würdemann,
H. (2013). Thermal effects on microbial composition and microbiologically induced
corrosion and mineral precipitation affecting operation of a geothermal plant in a deep
saline aquifer. E x tr e m o p h ile s , 17(2), 311-327.

Lewis, A.E. (2010). Review of metal sulphide precipitation. H y d r o m e ta llu r g y , 104(2), 222-234.

Li, L., He, Q., Ma, Y., Wang, X., y Peng, X. (2015). Dynamics of microbial community in a
mesophilic anaerobic digester treating food waste: Relationship between community
structure and process stability. B io r e s o u r c e T e c h n o lo g y , 1 8 9 , 113-120.

Lindsay, M., Wakeman, K., Rowe,F., Grail, B., Ptacek, C., Blowes, D., Johnson, D. (2011)
Microbiology and geochemistry of mine tailings amended with organic carbon for passive
treatment o f pore water. G e o m ic r o b io lo g y J o u r n a l .28 229-241.

Lovley, D.R., Holmes, D.E., y Nevin, K.P. (2004). Dissimilatory Fe(III) and Mn(IV) reduction.
A d v a n c e s in M ic r o b ia l P h y s io lo g y , 49(2), 219-86.

Lozupone, C, Knigh,t R. (2005). UniFrac a New Phylogenetic Method for Comparing Microbial
Communities. A p p lie d a n d E n v ir o n m e n ta l M ic r o b io lo g y , 71:8228-8235.

117
Lyew, D., y Sheppard, J.D. (1997). Effects o f physical parameters o f a gravel bed on the activity of
sulphate-reducing bacteria in the presence of acid mine drainage. Journal of Chemical
Technology andBiotechnology, 70(3), 223-230.

Madigan, M.T., Martinko, J.M., Parker, J., Fernández, M.G., Fernández, C. R., y Pérez, M. S.
(2012). Brock Biología de los microorganismos (Vol. 13). prentice hall.

Magoc, T, Salzberg, SL. 2011. FLASH : Fast Length Adjustment o f Short Reads to Improve
Genome Assemblies. Bioinformatics, 1-8.

Martins, M., Faleiro, M.L., Barros, R.J., Veríssimo, A.R., Barreiros, M.A., y Costa, M.C. (2009).
Characterization and activity studies of highly heavy metal resistant sulphate-reducing
bacteria to be used in acid mine drainage decontamination. Journal of Hazardous Materials,
166(2-3), 706-713

Martins, M., Santos, E.S., Faleiro, M.L., Chaves, S., Tenreiro, R., Barros, R.J. y Costa, M. (2011).
Performance and bacterial community shifts during bioremediation o f acid mine drainage
from two Portuguese mines. International Biodeterioration Yamp; Biodegradation, 65(7),
972-981.

Matthiessen, M.K., Larney, F.J., Selinger, L.B., Olson, A.F. (2005). Influence of loss-on- ignition
temperature and heating time on ash content o f compost and manure. Communications in
Soil Science and Plant Analysis. 36, 2561-2573.

Mathur, J., Bizzoco, D.G., Ellis, D.A., Lipson, A.W ., Poole, R., Levine, and Kelley, S. (2007).
Effects o f abiotic factors on phylogeneticdiversity o f bacterial communities in acidic
thermal springs. Applied and EnvironmentalMicrobiology, 73(8), 2612-2623.

McCune, B. y Mefford. M.J. (1999), PC-ORD. Multivariate analysis o f ecological data. Version 4
for Windows. MjM Software Design, Gleneden Beach, Oregon

McDonald, D., Clemente, J., Kuczynski, J., Rideout, J., Stombaugh, J., Wendel, D., Wilke, A.,
Huse, S., Hufnagle, J., Meyer, F., Knight, R., Caporaso, J. (2012). The Biological
Observation M atrix (BIOM) format or: how I learned to stop worrying and love the ome-
ome. Gigascience 1:7.

McMurdie, P. y Holmes, S. (2013). Phyloseq: An R Package for Reproducible InteractiveAnalysis


and Graphics o f Microbiome Census Data. PLoS One 8:e61217.

Ministerio de Minas y Energía. (2014). Política Nacional para la formalización de la mineria en


Colombia. Boletín Unilibre. Bogotá D.C.

Mirjafari, P., Rezadehbashi, M., y Baldwin, S. (2012). Microbial Communities Associated with
Passive Treatment o f Sulphate and Selenium Containing Water. 9th International
Conference on Acid Rock Drainage.

Mohanty, S.S., Das, T., Mishra, S.P., y Chaudhury, G.R. (2000). Kinetics o f SO 4-2 reduction under
different growth media by sulfate reducing bacteria. Biometals : An International Journal on
the Role o f Metal Ions in Biology, Biochemistry, and Medicine, 13(1), 73-76.

118
Montoya, J., Celis, L., Gallegos-García, M., Razo-Flores, E., Alpuche-Solís, G. (2013) Consortium
diversity o f a sulfate-reducing biofilm developed at acidic pH influent conditions in a
down-flow fluidized bed reactor. Engineering in Life Sciences, 13 302-311.

Muyzer, G., y Stams, A.J. (2008). The ecology and biotechnology of sulphate-reducing bacteria.
Nature Reviews Microbiology, 6 (6 ), 441-454.

Nakamata, K., y Ohi, H. (2003). Examination of polychlorinated dibenzo-p-dioxins and


polychlorinated dibenzofurans in process water o f kraft pulp bleaching mill using chlorine
dioxide from the aspect o f environmental water quality. Journal of Wood Science, 49(6),
525-530.

Nancucheo, I., y Johnson, D. B. (2012). Selective removal o f transition metals from acidic mine
waters by novel consortia o f acidophilic sulfidogenic bacteria. Microbial Biotechnology,
5(1), 3 4 -4 4 .

Nancucheo, I., y Barrie Johnson, D. (2014). Removal of sulfate from extremely acidic mine waters
using low pH sulfidogenic bioreactors. Hydrometallurgy. 150, 222-226

Natarajan, K.A. (2008). Microbial aspects of acid mine drainage and its bioremediation.
Transactions of Nonferrous Metals Society of China, 18(6), 1352-1360.

Neculita, C.M., Zagury, B. (2007). Passive treatment o f acid mine drainage in bioreactors using
sulfate-reducing bacteria: critical review and research needs. Journal of Environmental
Quality, 36(1), 1-16.

Neculita, C.M., Zagury, G.J., y Bussiere, B. (2007). Passive treatment of acid mine drainage in
bioreactors using sulfate-reducing bacteria. Journal of Environmental Quality, 36(1), 1-16.

Neculita, C.M., y Zagury, G.J. (2008a). Biological treatment o f highly contaminated acid mine
drainage in batch reactors: Long-term treatment and reactive mixture characterization.
Journal Hazardous Materials, 157(2-3), 358-366.

Neculita, C.M., Zagury, G.J., y Bussiere, B. (2008b). Effectiveness o f sulfate-reducing passive


bioreactors for treating highly contaminated acid mine drainage: I. Effect of hydraulic
retention time. Applied Geochemistry, 23(12), 3442-3451.

Neculita, C.M., Zagury, G.J., Bussiere, B., (2008c). Effectiveness o f sulfate-reducing passive
bioreactors for treating highly contaminated acid mine drainage: II. Metal removal
mechanisms and potential mobility. Applied Geochemistry, 23(12), 3545-3560.

Neculita, C.M., Yim, G.J., Lee, G., Ji, S.W., Jung, J.W., Park, H.S., y Song, H. (2011). Comparative
effectiveness o f mixed organic substrates to mushroom compost for treatment o f mine
drainage in passive bioreactors. Chemosphere, 83(1), 76-82.

Newman, D.K., y Banfield, J.F. (2002). Geomicrobiology: how molecular-scale interactions


underpin biogeochemical systems. Science, 296(5570), 1071-1077.

119
Okabe, S., Santegoeds, C.M., De Beer, D., 2003. Effect of nitrite and nitrate on in situ sulfide
production in an activated sludge immobilized agar gel film as determined by use of
microelectrodes. Biotechnology and Bioengineer. 81(5), 570-577.

Okoro, H.K., Fatoki, O.S., Adekola, F.A., Ximba, B.J., y Snyman, R.G. (2012). A review of
sequential extraction procedures for heavy metals speciation in soil and sediments. Open
Access Scientific Reports, 1(3), 1-9.

Park, J.H., Lamb, D., Paneerselvam, P., Choppala, G., Bolan, N., Chung, J.W., 2011. Role of
organic amendments on enhanced bioremediation of heavy metal(loid)contaminated soils.
Journal of Hazardous Materials, 185, 549-574.

Pereyra, L.P., Hiibel, S.R., Pruden, A., y Reardon, K.F. (2008). Comparison o f microbial
community composition and activity in sulfate-reducing batch systems remediating mine
drainage. Biotechnology andBioengineering, 101(4), 702-13.

Pereyra, L.P., Hiibel, S.R., Riquelme, M.P., Reardon, K.F., y Pruden, A. (2010). Detection and
quantification o f functional genes of cellulose-degrading, fermentative, and sulfate-reducing
bacteria and methanogenic archaea. Applied and Environmental Microbiology, 76(7), 2192­
2202.

Perez, F.H., Valderrama, G., Blanco, G., González, L.M., y García, F. (1987). Caracterización de
carbones colombianos zona checua - lenguazaque. Boletín Geológico - INGEOMINAS,
28(2), 3-218.

Pholchan, M.K., Baptista, J.D., Davenport, R.J., y Curtis, T.P. (2010). Systematic study of the effect
o f operating variables on reactor performance and microbial diversity in laboratory-scale
activated sludge reactors. Water Research, 44(5), 1341-1352.

Place, D., Claveau, E., y Figueroa, L. (2005). Tracking organic substrate alterations in passive
reactive zones for planning and monitoring. In 22nd Meeting of the American Society of .
p p .921-934.

Postgate, J. R. (1984) The sulphate-reducing bacteria. Cambridge University Press, Cambridge, UK

Prasad, D., Wai, M., Berube, P., Henry, J. G. (1999). Evaluating substrates in the biological
treatment o f acid mine drainage. Environmental Technology, 20(5), 449-458.

Prieto, G., y Duitama, L. (2004). Acid Drainage o f Coal Mining in Cundinamarca Department,
Colombia. In Environmental Geochemistry in Tropical and Subtropical Environments. L.
D. de Lacerda et al., (eds.) pp. 125-134.

Pruden, A., Hong, H., Inman, L.Y., Logan, M.V., Sans, C., Ahmann, D.y Reardon, K. (2005).
Microbial characterization of sulfate-reducing columns remediating acid mine drainage. In
Proceedings o f the 2005 National Meeting o f the American Society o f Mining and
Reclamation (ASMR) (pp. 935-944).

120
Pruden, A., Messner, N., Pereyra, L., Hanson, R. E., Hiibel, S. R., y Reardon, K. F. (2007). The
effect of inoculum on the performance of sulfate-reducing columns treating heavy metal
contaminated water. Water Research, 41(4), 904-914.

Rabus, R., Hansen, T. A., y Widdel, F. (2006). Dissimilatory Sulfate and Sulfur-Reducing
Prokaryotes. In F. T. Edward F. DeLong, Stephen Lory, Erko Stackebrandt, Eugene
Rosenberg (Ed.), The Prokaryotes (fourth., pp. 659-768). Berlin: Springer Verlag.

Ramette A. Multivariate analyses in microbial ecology. FEMS Microbiology Ecology 2007; 62 (2):
142-160.

Reinertsen, S., Elliott, L., Cochran, V., y Campbell, G. (1984). Role of available carbon and
nitrogen in determining the rate of wheat straw decomposition. Soil Biology and
Biochemistry, 16(5), 459-464.

Rinke, C., Schwientek, P., Sczyrba, A., Ivanova, N.N., Anderson, I.J., Cheng, J.F.y Woyke, T.
(2013). Insights into the phylogeny and coding potential of microbial dark matter. Nature,
499(7459), 431-437.

Robinson-Lora, M.A., Brennan, R.A., 2009. Efficient metal removal and neutralization of acid mine
drainage by crab-shell chitin under batch and continuous-flow conditions. Bioresource
Technology 100(21), 5063-5071.

Rodríguez, Ballester, A., Blázquez, M., González, F., y Muñoz, J. (2003). New information on the
chalcopirite Hydrometallurgy, 71(1-2), 47-56.

Rojas, H., Guerrero, D.C., Vásquez, O.Y. y Valencia, J.S. (2012). Aplicación del Modelo de Bohart
y Adams en la Remoción de Mercurio de Drenajes de Minería por Adsorción con Carbón
Activado. Información tecnológica 23, 21-32

Rose, A.W. (2010). Advances in passive treatment of coal mine drainage 1998-2009. Joint Mining
Reclamation Conference, ASMR, 847-892.

Rousk, J., Baath, E., Brookes, P.C., Lauber, C.L., Lozupone, C., Caporaso, J.G., y Fierer, N. (2010).
Soil bacterial and fungal communities across a pH gradient in an arable soil. The ISME
Journal, 4(10), 1340-1351.

Sáez-Navarrete, C., Zamorano, A., Ferrada, C., Rodríguez, L., 2009. Sulphate reduction and
biomass growth rates for Desulfobacterium autotrophicum in yeast extract - Supplemented
media at 38°C. Desalination 248(1-3), 377-383.

Saikaly, P.E., Stroot, P.G., y Oerther, D.B. (2005) Use of16S rRNA gene terminal restriction
fragment analysis toassess the impact of solids retention time on the bacterial diversity of
activated sludge Applied and EnvironmentalMicrobiology 71: 5814-5822.

Sánchez-Andrea, I., Rodríguez, N., Amils, R., y Sanz, J.L. (2011). Microbial diversity in anaerobic
sediments at Río Tinto, a naturally acidic environment with a high heavy metal content.
Applied and Environmental Microbiology, 77(17), 6085-6093.

121
Sánchez-Andrea, I., Sanz, J.L., Bijmans, M., y Stams, A. (2014). Sulfate reduction at low pH to
remedíate acid mine drainage. Journal of Hazardous Materials, 269(3), 98-109.

Santofimia, E., González-Toril, E., López-Pamo, E., Gomariz, M., Amils, R., y Aguilera, Á. (2013).
Microbial diversity and its relationship to physicochemical characteristics o f the water in
two extreme acidic pit lakes from the Iberian Pyrite Belt (SW Spain). PloS one, 8 (6 ),
66746.

Schmidtova, J., y Baldwin, S. (2011). Correlation o f bacterial communities supported by different


organic materials with sulfate reduction in metal-rich landfill leachate. Water Research,
45(3), 1115-1128

Schumacher, B.A., 2002. Methods for the determination o f total organic carbon (TOC) in soils and
sediments. NCEA-C-1282, EMASC-001. Ecological Risk Assessment Support Center,
Office of Research and Development, U.S. Environmental Protection Agency, Las Vegas,
NV.

Seyler, J., Figueroa, L., Ahmann, D., Wildeman, T. R., y Robustelli, M. (2003). Effect o f solid
phase organic substrate characteristics on sulfate reducer activity and metal removal in
passive mine drainage treatment systems. In Proceedings o f National Meeting of the
American Society of Mining and Reclamation and the 9th Billings Land Reclamation
Symposium, Billings MT.

Shade, A., Caporaso, J. G., Handelsman, J., Knight, R., y Fierer, N. (2013). A meta-analysis of
changes in bacterial and archaeal communities with time. The ISME Journal, 7(8), 1493­
1506.

Shu, D., He, Y., Yue, H., y Wang, Q. (2015). Microbial structures and community functions o f
anaerobic sludge in six full-scale wastewater treatment plants as revealed by 454 high-
throughput pyrosequencing. Bioresource Technology, 186, 163-172.

Sobek, A., Schuller, W.A., Freeman, J.R., Smith, R.M. (1978). Field and laboratory methods
applicable to overburdens and minesoils E PA -600/2-78-054.

Song, H., Yim, G.J., Ji, S.W., Nam, I.H., Neculita, C.M., Lee, G., 2012. Performance o f mixed
organic substrates during treatment o f acidic and moderate mine drainage in column
bioreactors. Journal of Environmental Engineering and Science. 138(10), 1077-1084

Ta§, N., Prestat, E., McFarland, J., Wickland, K., Knight R., Berhe A., Jorgenson T., Waldrop M.,
Jansson J.(2014). Impact o f fire on active layer and permafrost microbial communities and
metagenomes in an upland Alaskan boreal forest. ISME Journal, 1-16.

Tessier, A., Campbell, P., y Bisson, M. (1979). Sequential extraction procedure for the speciation of
particulate trace metals. Analytical Chemistry, 51(7), 844-851.

Traversi, D., Romanazzi, V., Degan, R., Lorenzi, E., Carraro, E., y Gilli, G. (2015). Microbial-
chemical indicator for anaerobic digester performance assessment in full-scale wastewater
treatment plants for biogas production. Bioresource Technology, 186, 179-191.

122
Tsukamoto, T.K., y Miller, G.C. (1999). Methanol as a carbón source for microbiological treatment
o f acid mine drainage. Water Research, 33(6), 1365-1370.

Tsukamoto, T.K., Killion, H. y Miller, G. (2004). Column experiments for microbiological


treatment o f acid mine drainage: low-temperature, low-pH and matrix investigations. Water
Research, 38(6), 1405-18.

Tuttle, J.H., Dugan, P.R., Macmillan, C.B., y Randles, C.I. (1969). Microbial dissimilatory sulfur
cycle in acid mine water. Journal of Bacteriology, 97(2), 594-602.

Ueki, A., Akasaka, H., Suzuki, D., y Ueki, K. (2006). Paludibacter propionicigenes gen. nov., sp.
nov., a novel strictly anaerobic, Gram-negative, propionate-producing bacterium isolated
from plant residue in irrigated rice-field soil in Japan. International Journal of Systematic
and Evolutionary Microbiology, 56(1), 39-44.

United States Environmental Protection Agency (USEPA), 2001. Flame atomic absorption
spectrophotometry. Method 7000b, US Environmental Protection Agency, Washington,
D.C.

URS (2003). Passive and semi-active treatment of acid rock drainage from metal mines-state of the
practice. Prepared for US Army Corps o f Engineers, United Registrar o f Systems, Portland,
ME.

Utgikar, V.P., Harmon, S.M., Chaudhary, N., Tabak, H.H., Govind, R., y Haines, J.R. (2002).
Inhibition o f sulfate-reducing bacteria by metal sulfide formation in bioremediation of acid
mine drainage. Environmental Toxicology, 17(1), 40-48.

Utgikar, V.P., Tabak, H H., Haines, J.R., y Govind, R. (2003). Quantification of toxic and
inhibitory impact o f copper and zinc on mixed cultures of sulfate-reducing bacteria.
Biotechnology andBioengineering, 82(3), 306-312.

Valentín-Vargas, A., Toro-Labrador, G., y Massol-Deya, A. (2012). Bacterial community dynamics


in full-scale activated sludge bioreactors: operational and ecological factors driving
community assembly and performance . PloS one, 7(8), 42524.

Vymazal, J., Brix, H., Cooper, P. F., Haberl, R., Perfler, R., y Laber, J. (1998). Removal
mechanisms and types o f constructed wetlands. Constructed wetlands for wastewater
treatment in Europe, 17-66.

Waybrant, K.R., Ptacek, C.J., y Blowes, D.W. (2002). Treatment of mine drainage using permeable
reactive barriers: column experiments. Environmental science y technology, 36(6), 1349­
1356.

Waybrant, K., Blowes, D., y Ptacek, C. (1998). Selection o f reactive mixtures for use in permeable
reactive walls for treatment o f mine drainage. Environmental Science y Technology, 32(13),
1972-1979.

123
Wildeman, T.R. y D.M. Updegraff. 1997. Passive bioremediation o f metals and inorganic
contaminants. p. 473-495. In D.L. Macalady (ed.) P e r s p e c tiv e in e n v ir o n m e n ta l c h e m istry .
Oxford Univ. Press, New York

Yim, G., Ji, S., Cheong, Y., Neculita, C. M., y Song, H. (2014). The influences of the amount o f
organic substrate on the performance o f pilot-scale passive bioreactors for acid mine
drainage treatment. E n v ir o n m e n ta l E a r th S c ie n c e s . doi: 10.1007/s12665-014-3757-9

Yoo, K., Sasaki, K., Hiroyoshi, N., y Tsunekawa, M. (2004). Fundamental study on the removal o f
Mn +2 in acid mine drainage using sulfate reducing bacteria. M a te r ia ls T r a n s a c tio n s , 45(7),
2422-2428.

Younger, P.L., Banwart, S.A., Hedin, R.S. (Eds.), 2002. Mine water, Hydrogeology, pollution,
remediation. Kluwer Academic Publishers, Dordrecht, the Netherlands.

Zagury, G.J., Colombano, S.M., Narasiah, K.S., y Ballivy, G. (1997). Neutralization o f acid mine
tailings by addition o f alkaline sludges from pulp and paper industry. E n v ir o n m e n ta l
T e c h n o lo g y , 18(10), 959-973.

Zagury, G.J., Kulnieks, V.I., y Neculita, C. M. (2006). Characterization and reactivity assessment of
organic substrates for sulphate-reducing bacteria in acid mine drainage treatment.
C h e m o s p h e r e , 64(6), 944-954.

Zagury, G., Neculita, C.M., y Bussiere, B. (2007). Passive treatment of acid mine drainage in
bioreactors: short review, applications, and research needs. O tta w a G e o 2 0 0 7 , 1439-1446.

Zaluski, M.H.y Trudnowski, J.M., Harrington-Baker, M.A., Bless, D.R., 2003. Post-mortem
findings on the performance o f engineered SRB field- bioreactors for acid mine drainage
control. In: Proc. Sixth Internat. Conf. Acid Rock Drainage. Cairns, QLD, pp. 845-853.

Zhang, M., y Wang, H. (2014). Organic wastes as carbon sources to promote sulfate reducing
bacterial activity for biological remediation of acid mine drainage. M in e r a ls E n g in e e r in g ,
6 9 , 81-90.

Zhang,T., Liu,H. y Fang,H.H. (2002). Microbial analysis of a phototrophic sludge producing


hydrogen from acidified wastewater B io te c h n o lo g y L e tte r s . 24 (21), 1833-1837

Zhao, Y.G., Wang, A.J., y Ren, N.Q. (2010). Effect o f carbon sources on sulfidogenic bacterial
communities during the starting-up o f acidogenic sulfate-reducing bioreactors. B io r e s o u r c e
T e c h n o lo g y , 101(9), 2952-2959.

Zheng, Y., Xiao, Y., Yang, Z.H., Wu, S., Xu, H.J., Liang, F.Y., y Zhao, F. (2014). The bacterial
communities o f bioelectrochemical systems associated with the sulfate removal under
different pHs. P r o c e s s B io c h e m is tr y , 49(8), 1345-1351.

Zhuang, W., y Gao, X. (2013). Acid-volatile sulfide and simultaneously extracted metals in surface
sediments o f the southwestern coastal Laizhou Bay, Bohai Sea: Concentrations, spatial
distributions and the indication o f heavy metal pollution status. M a r in e P o llu tio n B u lle tin ,
76(1), 128-138.

124
Zorpas, A., Inglezakis, V., y Loizidou, M. (2008). Heavy metals fractionation before, during and
after composting of sewage sludge with natural zeolite. Waste Management, 28:2054-2060

125
AnexoA C urvas de calibración de los análisis de m etales (Fe, M n y Z n), sulfatos y sulfuros.
Hierro Total Manganeso
Absorbancia (248.3 nm)

Sulfatos Zinc
Absorbancia (420 nm)

Sulfuros solubles
A b s o rb a n c ia (6 6 4 n m )

S u lfu ro (m g /L )

126
Anexo B Physicochemical and microbiological characterization of organic substrates

Objective
• Characterize organic substrates for their potential ability as organic carbon sources
(electron donors) for the sulfate-reducing bacteria community (SRB) during
treatment of acid mine drainage (AMD) in passive bioreactors.
• Characterize the sulfate reduction bacteria during the treatment of acid mine
drainage in passive bioreactor.

For this purpose, cellulosic wastes (Sajo sawdust, Kikuyu silage, paper industry) and
organic wastes (mushroom compost, cow manure, poultry manure) will be thoroughly
analyzed in terms of physicochemical parameters, elemental analysis, biodegradability and
metal operational speciation. All of the analysis will be performed in duplicate.
Sampling of organic substrates
• Collect cellulosic substrates (Sajo sawdust, Kikuyu silage, and paper industry) and
organic substrates (mushroom compost, cow manure and chicken manure) on
available locations (e.g. local farms and/or furniture factory).
Storage of organic substrates
• Cut kikuyu silage and into small pieces (less than1cm), and sieve the other
substrates a No 10 sieve (2 mm).
• Pack the substrates in Ziploc bags.
• Identify the bags with the following data:
o Substrate class
o Project name
o Responsible person
o Collect date
o Storage date
o Type of analysis
• Store the substrates in refrigerator before their analysis.
pH Method 4972 - 01 (ASTM, 1995)
• Caliber the pH meter with buffer solutions (pH 4.0, 7.0 and 10.0).
• Weight 20.0 g of substrate into a beaker.
• Add 20 mL of deionized water (18.8 MQ cm).
• Mix thoroughly for 5 min and let stand for 1 h.
• Place the pH electrode into the partially settled suspension.
• Record the data when the measurement is stable
Moisture Method D 2216 - 98 (ASTM, 1995)
• Preparation of material
o Select a porcelain evaporating dish and identify it correctly.

127
o Place porcelain evaporating dish in the oven for 15 min at 105±5°C.
o Place porcelain evaporating in the desiccator and allow the cooling for 1h.
• Analysis the substrate
o Weight 20.0 g of substrate and place it on the porcelain evaporating dish.
o Place the porcelain evaporating with substrate in the drying oven.
o Dry the substrate at least 20 h maintains temperature at 105± 5°C.
o Place the porcelain evaporating with dry substrate in the desiccator and allow
the cooling.
o Determine the mass.
o Repeat heating for 1 h and allow the cooling in the desiccator.
o Determine the mass (the change in the weight must be less than 4% or 50 mg,
otherwise it repeat again heating for 1 h.)
o Conserve the residue in order to determine Total Volatile Solids.
Total organic carbón (TOC) Method 5310 B (APHA, 2005)
• Sample preparation
o Crush in a mechanical mill 10.0 g of substrate and sieve it through mesh No
100
o Pack the substrates in Ziploc bags and identify the bags as in section 3.2
o Store the bags in refrigerator before their analysis
• Send to a private laboratory for analysis by high temperature combustion to 680°C.
Total Kjeldal Nitrogen (TKN) Method 4500-Norg (APHA (2005)
• Place 0.2 g of substrate in a Kjeldahl digestion tube (dry)
• Add 50 mL of reactive digestion reagent (134g K2SO4, 7.5 g CuSO4,134 ml H2SO4
and complete with distilled water 1L)
• Mix content (carefully) and place the flask on Kjeldahl rack and add 2mL of H2SO4.
• Set temperature moderate (180°C) for boiling a digestion of the substrate for aprox
1h: 30 minutes (observe the appearance of white smoke).
• Increase heat (less than 338°C) to a rapid boil until complete digestion of the
substrate, approximately 20 min.
• Allow mixture to cool at room temperature.
• Add (carefully) 50 ml deionized water into flask, swirl to dissolve crystals.
• Add 25 mL of solution the NaOH (50%) and Na2S2O3(5%) into flask and swirl.
• Place the flask on distillation rack with stopper securely.
• Add in an Erlenmeyer flasks 20 mL de H 3BO3 with 4% containing Tashiro
indicator.
• Place the Erlenmeyer flasks on Kjeldahl distillation rack.
• Start the distillation with moderate boiling (less than 100°C) until obtaining 50 ml
the distillate (color should be green or dark blue).
• Allow distillate to cool.
• Titrate with 0.1N H2SO4 until solution becomes clear and then turns pink.
• Prepare and treat a blank the same manner except that Kjeldahl digestion flask must
be free of sample.

128
Dissolved organic carbón (DOC) Method 5310 B (APHA, 2005)
• Preparation of material
o Wash an amber bottle glass with cap with 5% soap biodegradable and lots of
water.
o Place the amber bottle glass and the cap submerged in solution 1% HNO3
into plastic container for 24h.
o Rinse the bottle and the cap with lots deionized water.
o Dry the bottle in oven at 400°C for 1 h.
o Wrap the cap with aluminum foil and dry in oven at 100°C for 1 h.
• Preparation in aqueous extract, as per Zagury et al., (2006)
o Weight 20.0 g of substrate into the beaker.
o Add 200 mL of deionized water (18.8 MQ cm).
o Shake the suspension for 2 h at room temperature.
o Centrifuge the suspension (10000g) for 10 min.
o Filter (0.45 pm) the supernatant and place into the amber bottle glass.
o Add to sample 1 mL of H2SO4 for preservation.
o Preserve samples that cannot be analyzed immediately by conserving them
at 4°C.
• Send to a private laboratory for analysis by high temperature combustion to 680°C.
Lignin and Cellulose Method of successive extractions as per Harper y Lynch (1981)
• Sample preparation
o Prepare a gooch crucible as described in the section 3.3.2 (preparation of
material)
o Place into a beaker 1.0 g of substrate and add 80 mL of deionized water.
o Boil the beaker gently (75°C) for 1 h, preventing dry.
o Change the water and boiled again (less than 100°C) for 1 h.
o Transfers all of the content of beaker into the gooch crucible.
o Rinse the substrate once with cold water.
o Dry the gooch crucible in the over for 20 h a 60± 5°C.
o Place the gooch crucible a desiccator allow the cooling.
o Determine the mass.•

• Lignin
o Transfer all of substrate the gooch crucible into the beaker.
o Add 30 mL water, 2 mL 10 % aqueous acetic acid and 0.6 g sodium chlorite.
o Boil the beaker gently (75°C) for 1 h, preventing dry.
o Add again 2 mL 10 % aqueous acetic and 0.6 g sodium chlorite.
o Boils (at less than 100°C) the beaker with the mixture for 1 h.
o Remove the substrate from beaker and transfer it the gooch crucible.
o Rinse with deionized water (five times), acetone (twice) and ether (once).
o Dry in the oven at 105±5°C for 2 h.
o Place the gooch crucible a desiccator allow the cooling.
o Determine the mass.

129
o Preserve the residue in order to determine cellulose.

• Cellulose
o Transfer all of substrate the gooch crucible into the beaker.
o Add 20 mL 24% KOH and leave it at room temperature for 2 h.
o Transfer of substrate into the gooch crucible.
o Rinse with deionized water (five times), 5% aqueous acetic acid (once),
acetone (once) and ether (once).
o Dry in the oven at 105±5°C for 2 h.
o Cool the gooch crucible in a desiccator.
o Determine the mass.
Total volatile solids (TVS) Method 1684 (USEPA, 2001)
• Place a crucible in the muffle furnace at 550± 50°C for 1 h.
• Place the crucible in a desiccator and allow the cooling for 1h.
• Determine the mass.
• Transfer into crucible the dry substrate (obtained in section 3.3.2)
• Determine the mass.
• Place the crucible with dry substrate in the muffle furnace.
• Heat at 550°C±50°C for 2 h.
• Place the gooch crucible a desiccator allows the cooling for 1h.
• Determine the mass.
• Repeat heat 550°C±50°C for 30 min.
• Cool the gooch crucible in a desiccator.
• Determine the mass.
• Repeat steps until the weight change is less than 4% or 50 mg.
Easily available substances (EAS) Method forage fiber analysis as per Zagury e t a l .
(2006) modified from Prasad e t a l . (1999).
• Prepared a gooch crucible as described in the section 3.2.2 (preparation of material)
• Weight 1.0 g of substrate.
• Transfer the substrate into gooch crucible.
• Determine the mass.
• Rinse the substrate with acetone (twice) and water (once).
• Dry in the oven at 105 ±5°C for 12 h.
• Cool in a desiccator.
• Determine the mass.
• Transfer the dry substrate into the beaker.
• Add 30 mL 5% Hydrochloric acid.
• Boiled gently (less than 100°C) for 1 h, preventing dry.
• Transfers all of the content the beaker into the gooch crucible.
• Rinse with cold water (five times).

130
Place the gooch crucible in the oven for 12 h a 60± 5°C.
• Place the gooch crucible a desiccator allow the cooling
• Determine the mass.
• Consider the mass loss as EAS fraction.
Metal operational speciation Method sequential extraction procedure (SEP) as per Zagury
et al. (1997) modified from Tessier et al. (1979).
• Sample preparation
o Prepare the evaporating dish as described in the section 3.2.2 (preparation of
material).
o Weight 1.0 g of substrate and place it on the porcelain evaporating dish.
o Dry the substrate for 2 h maintains temperature at 105± 5°C.
o Place the evaporating dish with dry substrate in the desiccator and allow the
cooling.
o Determine the mass.
• Fraction 1. Soluble and exchangeable metals
o Transfer the dry substrate in centrifuge tubes (50 mL),
o Add 8 mL 1M MgCl2 and adjust the pH 7.0 with HCl.
o Leave the mixture at room temperature (21±2°C) for 1 h.
o Centrifuge the mixture (10,000g) for 30 min.
o Transfer the supernatant in a vial (50 mL) and retain the residue (i).
o Add in centrifuge tubes 8 mL deionized water
o Centrifuge (10,000g) for 30 min.
o Transfer the supernatant into the vial with initial extract.
• Fraction 2. Bound to Carbonates
o Add on residue (i) 8 mL of 1 M NaOAc.
o Adjust the pH 5.0 with HOAc.
o Shake for 5 h at room temperature (21±2°C).
o Centrifuge, wash the residue and retain the supernatant as the fraction 1.
• Fraction 3. Bound to Iron and Manganese Oxides
o Add on residue (ii) 20 mL of 0.04M NH2OH-HCl in 25% (v/v) HOAc.
o Heat at 96±3°C and agitate occasionally for 6 h.
o Centrifuge, wash the residue and retain the supernatant as the fraction 1.
• Fraction 4. Bound to organic matter
o Add on residue (iii) 3 mL of 0.02 M HN03 and 5 mL of 30% (v/v) H2O2.
o Adjust to pH 2.0 with HN03.
o Heat at 85°C±3°C for 2h with occasional agitation.
o Add again 30 mL of 30% (v/v) H2O2.
o Adjust to pH 2.0 with HOAc.
o Heat at 85°C±3°C for 3h with occasional agitation.
o Allow cool to room temperature.
o Add 5 mL 3.2M NH4OAC in 20% (v/v) of HN03 and 20 mL the deionized
water.
o Centrifuge, wash the residue and retain the supernatant as the fraction 1.

131
• Fraction 5. Residual
o Add on residue (iv) 15 mL of HNO3 .
o Heat at 75°C±3°C for 50 min.
o Add 20 mL HCLO4 and 1 mL HF.
o Heat at 75°C±3°C for 2.5 h.
o Allow cooling and dilute the supernatant to 100 mL
• Analysis the fractions
o Filter (0.45 pm) of supernatants the each fraction.
o Adjust pH 2.0 with 1 mL of HN03 .
o Preserve samples that cannot be analyzed immediately by conserving them at
4°C.
o Analyze Fe, Zn, Mn, Ca, and Mg by flame atomic absorption
spectrophotometry.
Soluble Sulfate Use the method of the S extracted in HCl (37%, v/v) as per Sobek et al.
(1978)
• Sample preparation
o Crush 5 g of each substrate and sieve in mesh 60 (0.25 mm)
o Pack the substrates in Ziploc bags and identify the bags as in section 3.2.
o Store in refrigerator before its analysis.
• Analyzing the substrate
o Weight 1.0 g the substrate and place it into an erlenmeyer (100 mL)
o Add 50 mL the HCL 40%.
o Shake during 1 h at room temperature.
o Filter (0.45 mm) with empty, rinsing with 75 mL of deionized water
o Transfer the fíltrate into a ball volumetric (500 mL)
o Adjust the volume up to the mark (the concentration will be 10% HCL).
o Analyze soluble sulfate by indirect atomic absorption spectrophotometry
(Galindo, 1969).
Most probable number (MPN) Method D4412 - 84 for Sulfate-reducing bacteria (SRB)
in water and water formed deposits (ASTM, 2009).
• Sterilization of materials at 170 ° C for 2 h
o Pipets (1mL and 5mL)
o Test tubes with screw caps (16 by 150 mm and 20 by 150 mm)
o Lab bottle, screw top blue lid (500 mL and 1000 mL)
o Pipette tips
o Erlenmeyer of 1 L
• Sterilization of materials by UV
o Flow chamber
o Micropipettes (0,25 mL, 0,5mL and 1mL)
o Vortex
• Preparation distilled water anoxic

132
o Place 1.25 L of distilled water into the erlenmeyer
o Cover with a aluminum foil and make two holes with a needle
o Allow water boils until the volume is 1L
o Bubble N2(g) until the water is cold.
o Keep covered the Erlenmeyer with the aluminum foil.
• Preparation of saline solution
o Add 8.5 g of NaCl, 0.5 g of cisteína-HCl in 1.25 L of distilled water
o Repeat the procedure for the anoxic water
• Preparation of the Starkey’s médium
o Adding the following reagents in lab bottle, screw top blue lid
■ 1L of anoxic water
■ Sodium lactate (C3H5NaO3) 3.5 g
■ Ammonium chloride (NH4Cl) 1.0 g
■ Dipotassium, hydrogen orthophosphate (K2HPO4) 0.5 g
■ Magnesium sulfate (MgSO4 7H2O) 2.0 g
■ Sodium sulfate (Na2SO4) 0.5 g
■ Calcium chloride (CaCl2 2H2O) 0.1 g
■ Thioglycollic acid 0.1 g
■ Ammonium ferrous sulfate ((NH4)2SO4 FeSO4 6H2O) 0.001 g
o Sterilize in autoclave at 121°C for 15 min
o Adjust to pH 7.0 with (KOH) 1N
• Preparation of test tubes with screw caps (work within the flow chamber)
o Dispense 9 mL of Starkey’s médium in 5 tubes (A )
o Dispense 9.9 mL of Starkey’s médium in 5 tubes (B )
o Dispense 9.99 mL of Starkey’s médium in 5 tubes (C )
o Dispense 10 mL of Starkey’s medium in 1 tube (blank).
o Correctly mark each series of tubes
o Keep capped tubes
• Preparation of sample
o Reactive mixture sample (work within the anaerobic chamber)
■ Weight 1.0 g of substrate in anaerobic conditions
■ Place the sample into the sterile glass bottles and screw caps (50 mL)
and Bubble N2(g) for 5 min.
■ Add 9 mL of saline solution and Bubble N2(g) for 5 min and cap the
bottle.
■ Shake the suspension for 2 h at room temperature.
o Effluent sample (work within the anaerobic chamber)
■ Filter (1.2 pm) 10 mL of sample.
■ Place into the sterile tube and Bubble N2(g) for 5 min.
• Inoculation (work within the flow chamber)
o Add 1 mL the sample into of the tubes mark with A

133
o Bubble N2(g) into tube for 5 min and cap.
o Add 0.1 mL the sample into of the tubes mark with B .
o Bubble N2(g) into tube for 5 min and cap.
o Add 0.01 mL the sample into of the tubes mark with C .
o Bubble N2(g) into tube for 5 min and cap.
• Incubation
o Place of tubes in incubate at 20°C for 21 days
o Positive reaction is indicated by the deposit of a black precipitate (sulfide).
• verification (When the presence of the precipitate was not obvious)
o Ferric Chloride Solution
■ Weight 13.5 g of ferric chloride
■ Add 250 mL of water and 250 mL of HCl
■ Store in a bottle amber.
o p-Aminodimethylaniline Dihydrochloride Solution
■ Weight 1.0 g of p-aminodimethylaniline dihydrochloride
■ Add 500 mL of 6 N HCl
■ Store in a bottle amber.
o Confirm (tube with dubious results)
■ Add in the bottom of the tube 0.5 mL of solution ferric chloride and
0.5 mL of p-aminodimethylaniline
■ Wait for 10 minutes and see a positive reaction, blue color indicating
that H2S is present.
Summary of methods

Summary of methods for physicochemical characterization of organic substrates


Parameter Analysis Preservation Method of analysis Reference
pH Immediate 4972 - 01 (ASTM, 1995)
Physicochemical
Moisture Immediate D 2216 - 98 (a s t m , 1995)
TOC aRneafrliygseirsation 5310 B (APLHA, 2005)
Elemental analysis
TKN Immediate 4500-Norg (APHA (2005)
DOC i mL of H2 SO4 5310 B (APLHA, 2005)
Cellulose Refrigeration Harper y Lynch
Biodegradability Lignin Refrigeration (1981)
TVS Refrigeration 1684 (USEPA, 2001)
EAS Refrigeration Sobek et al. (1978)
Metal operational speciation 1mL of HNO3 Tessier et al. (1979)
Frozen or at 4°C Zagury et al. (1997)
Soluble Sulfate Refrigeration Section 3.2.6 Sobek et al. (1978)
Microbiological MPN D4412 - 84 (ASTM, 2009)

134
Anexo C Evaluation of the effectiveness of reactive mixture in batch testing

Objective

Evalúate different organic carbón sources (mushroom compost, cow manure, poultry
manure, Sajo sawdust, Kikuyu silage) for their capacity to promote pH and alkalinity
increasing, sulfate reduction, and metal precipitation in synthetic acid mine drainage
(AMD).

The study is performed with five reactive mixtures in batch bioreactors, made in glass
bottles (2L) and operated under anaerobic conditions for 44 days. Treatment is based on
chemical and biological processes, the late relying on sulfate-reducing bacteria (SRB)
ability to catalyze sulfate reduction (to hydrogen sulfide) in AMD and organic carbon
oxidation (to bicarbonate). Metals removal mechanisms include the precipitation as bio-
sulfides, hydroxides and carbonates, in addition to sorption. All of the analysis will be
performed in triplicate.

Preparation of synthetic AMD

Synthetic AMD is prepared as per Zagury et al. (2006), the quality is based on data
collected from different sites located in the mining district of Zipaquirá (Colombia).

• Add 15.0 g of CaCO3in a plastic containers and then pour 28 L of water


• Agitate mechanically for 12h.
• Leave the solution to equilibrate for 8h
• Add into the solution 1,6 g of MnSO4.5H2O, 1,3 g of ZnSO4, 4.5 g of MgSO4
• Bubble the solution with N 2(g) for 24 h.
• Dissolve 30,0 g of FeSO4.7H2O in 1L 1,25 N of H 2SO4
• Mix the two solutions and agitate for 24 h.
• Adjust the pH 3.0 using 1L of NaOH 1,6 N
• Complete the volume to 30 L with water (18.8 MQ cm).
• Confirm the concentration of metals in AMD by Atomic absorption spectrometry
and of sulfate by UV-VIS spectrometry.

135
Batch testing preparation

The reactive mixtures (250 g wet basis) with synthetic AMD (1L) in proportion for a
solid to liquid 1:4 are placed in glass bottles (2L), sealed with a rubber stopper and valve
with two sampling ports and left under a nitrogen atmosphere at room temperature (20-
25°C), in the dark during 44 d. The inoculum with sulfate-reducing bacteria (SRB) is
collected from a local artificial wetland used for AMD treatment in the mining district of
Zipaquirá.

The following steps are suggested:

• Start the preparation of artificial AMD two day before the batch bioreactors set-up.
• Prepare glass bottles wrapping with aluminum foil and with rubber stopper and
valve with two sampling ports.
• Clearly label each batch bioreactors with the mixture number, replica and date.
• Weight the components the reactive mixture #1.
• Place the components in the plastic container and mix them trying to homogenize.
• Place the reactive mixture #1into a bottle (2L).
• Add 1L of artificial AMD and close with the rubber stopper.
• Apply N2 (g) for one sampling ports during 15 min leaving the other sampling ports
slightly open.
• Close the sampling ports and shake the bottles for the thorough mixing of
components.
• Repeat the same steps for every reactive mixture.
• Leave the reactors in the dark at room temperature to promote the development of
BSR.
• Review daily the reactors until feel a strong smell of H2S.
• Start sampling and analysis.
Sampling and analysis

Sampling is performed during six weeks in each batch bioreactors under anaerobic
conditions N2 (g).

• Connect the syringe to the one sampling port and the N2(g) in other port.
• Open the nitrogen valve and simultaneously remove the sampling into the syringe
(50mL).

136
• Place 20 mL into the beaker for determínate pH, ORP, and DO.
• Filter 10 mL of sample to determine sulfides for spectrometry UV-VIS.
• Filter (0.45pm) 10 mL and add 200 pL the HNO3 for analysis of metals (Fe+2/+3,
Mn+2, Zn+2, Ca+2, Mg+2) by Atomic absorption spectrometry.
• Filter (0.45pm) 10 mL for analysis of sulfate by spectrometry UV-VIS.
• Place 10 mL into the into the glass tube for the determinate alkalinity.
• Repeat the same steps for every bioreactor.
Summary of methods

Parameters used for evaluation of reactive mixture effectiveness in batch testing


Volume
Parameter Filter Preservation Method of analysis Reference
(mL)
pH, D1293 (ASTM, 1995)
ORP 10 No Immediate analysis 2580A (APHA, 2005)
DO Multiparameter probe (APHA, 2005)
Alkalinity 10 No Immediate analysis 2320 B (APHA, 2005)
200 pL the HNO3
Metals 10 Yes 7000B (USEPA, 2007)
refrigerated at 4 ° C
SO42- 10 Yes refrigerated at 4 ° C 9038 (USEPA, 2007)
Sulfides 10 Yes Immediate analysis 4500-D (APHA, 2005)

137
Anexo D Set-up and operation of column bioreactors for the passive treatment of AMD

Objective

Evaluate the efficiency of a reactive mixtures to promote pH neutralization, sulfate


reduction, and metal removal in synthetic acid mine drainage (AMD) under two hydraulic
retention time (HRT) in laboratory column bioreactors.
The study will be performed in seven sulfate reducing bioreactors made in Plexiglas
columns, (length 72 cm, with inner diameter 10 cm, volume 6 L), three for each HRT (2 d
and 4 d), with downward flow, for at least 36 weeks. The columns will be packed with the
same reactive mixture as chosen based on batch test results, as well as hydraulic
conductivity and porosity.A column for each THR will be dismantled, at end of period of
establishment, during steady state along of 36 weeks, in order to identifying the microbial
community and the changes in the composition of the reactive mixture.
Reactive mixture preparation

The constituents and their proportion in the composition of the reactive mixtures are based
on batch test results, as well as on additional literature (Neculita et al., 2011, Neculita and
Zagury, 2008).
• Reactive mixture preparation
o Prepare 300.0g the reactive mixtures (table 1) into the plastic container
according to the instructions of the protocol # 2.
o Weight the metallic container.
o Place the reactive mixture into the metallic container.
o Dry the reactive mixture at 105± 5°C for 24 h.
o Place the metallic container with reactive mixture in the desiccators and
allow the cooling for 2h.
o Determine the mass (W¡).
o Blend the reactive mixture with a sufficient quantity of distilled water that
the mixture is wet.
Hydraulic Permeability and conductivity measurement Method for Permeability of
Granular Soils (Constant Head) D2434 (ASTM, 2000).
• Assembly the permeameter
o Measure the inside diameter of upper and lower chambers (five times).
o Calculate the average inside diameter of the permeameter (D).
o Place one porous stone on the inner support ring in the base of the chamber.
o Place a filter paper on top of the porous stone.
o Place the wet reactive mixture into the lower chamber using a scoop to fill it
to a depth of 1.5 cm.
o Compact the gravel layer slightly with a metallic pestle.

138
o Continué placing layers of mixture until cylinder to the mark.
o Use the tamping device to compact always put a new layer.
o Place a filter paper in level the top surface of the mixture and then the upper
porous stone.
o Measure the reactive mixture length into of the permeameter (five times).
o Record this data as the reactive mixture length (H).
o Place the compression spring on the porous stone.
o Secure the cap firmly with the cap nuts.
o Connect the vacuum pump in the inlet tube the permeameter with the outlet
valve closed.
o Turn on and adjust vacuum pump at 500 mm Hg 15 min (remove air trapped
in the reactive mixture).
o Connect the outlet valve with water dispenser.
o Open the outlet valve and turn on back the vacuum pump at 500 mm Hg.
o Keep the connection until the reactive mixture has been saturated and the
permeameter is full of water.
o Close the outlet valve and disconnect the vacuum.
o Fill slightly the piezometer tubes with water from the constant-head tank.
o Connect the piezometer tubes of the permeameter.
o Close the inlet valve and open the outlet valve
o Allow the water in the piezometer tubes to reach their stable water level
under zero head.
Measure the permeability
o Open inlet valve (slightly) until the water load is stable in the piezometer
tubes.
o Check the difference the difference in level the water in the piezometer
tubes and record (h).
o Open the outlet valve and collected the water in the test tube while
measuring the time.
o Determine the flow (Q) and measure water temperature.
o Determine distance between piezometer tubes (L).
o Calculate the hydraulic permeability with of Darcy’s law
Porosity measurement
• Place the reactive mixture leftover in the assembly the permeameter in the oven at
105± 5°C for 24 h.
• Place the metallic container with reactive mixture in the desiccator and allow the
cooling.
• Determine the mass dry (W2)
• Determine the mass the reactive mixture dry used in the assembly the permeameter
(Wi- W2).
• Calculate the volume of the mixture reactive wet used in the assembly the permeameter
with diameter (D) and height (H).
• Determine the void volume considering a specific gravity (Gs) of 0.7, similar to peat.

139
• Determine porosity as the ratio between void volume and total volume of the reactive
mixture wet.
Columns set-up Protocol as per Neculita et al. (2008).
• Previous activities
o Calculate flow of AMD that enters the column according to HRT of 2 d and 4 d
(consider the porosity and volume of reactive mixture).
o Calibrate peristaltic pumps collecting a volume or mass of deionized water per
unit of time.
o Start the preparation of 5L of AMD for each column artificial two day before
the column set-up, according to protocol #2.
o Determine the moisture of organic and cellulosic substrates one day before,
according section 3.3.2 of the protocol #1.
o Prepare 10 kg the reactive mixtures for each column into the plastic container
according to the instructions of the protocol # 2.
o Homogenize the reactive mixture thoroughly.
o Fill with water the columns and check leaks.
o Adapt the place where they will be placed within the next 6 months.

• Assemble of the column


o Place the porous plates at the bottom of the column.
o Place the fine-mesh geotextil on the porous plates.
o Place a gravel layer of 5 cm of high on the fine-mesh geotextil.
o Compact the gravel layer slightly with a metallic pestle.
o Place a reactive mixture layer into the column to fill it to a depth of 10 cm.
o Compact the reactive mixture layer slightly with a metallic pestle.
o Repeat the same manipulations until a height of 68 cm the reactive mixture.
o Place a gravel layer of 3 cm in level the top surface of the mixture.
o Compact the gravel layer slightly with a metallic pestle.
o Place the fine-mesh geotextil on the gravel layer.
o Place the porous plates on the fine-mesh geotextil.
o Seal the column and secure the cap firmly with the cap nuts.
• Saturation of the column
o Place the synthetic AMD in a plastic container equipped with a valve and plastic
tube.
o Connected of plastic tube with the bottom valve of the column.
o Open the top valve of the column.
o Open the plastic container valve.
o Open the bottom valve of the column.
o Regulate the flow of the liquid for a slow saturation until total column filled.
o Close the valves of the column.
• Incubate of the column
o Wrap-up the column in aluminum foil, to prevent light access to reactive
mixture.

140
o Leave the reactors in the dark at room temperature to promote the development
of sulfate-reducing bacteria (SRB).
o Check the ORP once a week until the value is <-150 mV
• Repeat same manipulations for each column.
Column operation
• Prepare synthetic AMD volume for a week with based in flow calculated in the section
3.2.2 (previous activities).
• Connected the peristaltic pumps with the top valve of the column.
• Connected the AMD reservoir with the peristaltic pump.
• Connected the bottom valve with the plastic container where will collect the treated
AMD.
• Start the column feed through the peristaltic pump.
• After the establishment of reducing conditions, columns will be operated during at least
6 months.
Sampling and analysis
The sampling will be performed through a second bottom valve that allows the collection
50 mL of AMD for instantaneous analysis at room temperature, the frequency is presented
in Table 2.

• Place 20 mL into a beaker to determine pH, ORP and conductivity.


• Filter (0.45pm) 10 mL of sample to determine sulfides by spectrometry UV-VIS.
• Filter (0.45pm) 10 mL and prepare the sample (by adding 200 pL of concentrated
HNO3) for analysis of metals (Fe+2/+3, Mn+2, Zn+2, Ca+2, Mg+2) by Atomic absorption
spectrometry.
• Filter (0.45pm) 10 mL for sulfate analysis by spectrometry UV-VIS.
• Place 10 mL into a glass tube for alkalinity determination.
• Filter (0.45pm) 20 mL and prepare the sample (by adding 200 pL of concentrated
H2SO4) for DOC analysis. Send the samples to a private laboratory for analysis by high
temperature combustion to 680°C. (Prepare of material as described in the section 3.5.1,
protocol #1).
• Collect 15mL in sterile plastic containers for SRB counts, according to protocol #4.
• Repeat the same steps for every bioreactor.
Column dismantlement

The suggested steps are as follows:


• Disconnect the AMD supply system.
• Open the bottom valve and allow the column to drain for 2 h (until no drops of
liquid exit the column).
• Carefully open the column at the top.
• Remove the porous plates, the geotextile and the first layer of gravel.

141
• Remove carefully the first 20 cm of the reactive mixture
• Divide the sample into six parts randomly and place them in Ziploc bags.
• Identify the bags as described in section 3.2 of the protocol #1.
• Store threes bag at -80°C for biomolecular analyses for duplicate (Sequencing-
Ilumina and SRB for q-PCR) according to protocol #4.
• Store threes bag at 4°C for physicochemical analyses for duplicate (TOC, N-TKN,
EAS, cellulose and lignin) according to protocol #1.
• Repeat same manipulations for the middle and bottom layer the reactive mixture.
• Remove the porous plates, the geotextile and the last layer of gravel.
• Dispose residues properly according to laboratory safety norms.

Parameters determined during columns’ operation


Volume Filter Frequency
Parameter Conservation
(mL) (0.45 pm) (Week)
pH
ORP 20 No Immediate analysis 1
Conductivity
Alkalinity 5 No Immediate analysis 1
Sulfides (S2-) 1 Yes Immediate analysis 2
Sulfate (SO42-) 1 Yes Refrigerated at 4 ° C 2
DOC 20 Yes 1mL the H2SO4 4
Refrigerated at 4 ° C
Metals 10 Yes 200 pL the HNO3 2
Refrigerated at 4 ° C
SRB counts 15 No Refrigerated at 4 ° C 4

142
Anexo E Microbiological characterization for Illumina® sequencing

OBJETIVOS

Characterize the microbial community during the treatment of acid mine drainage in
passive bioreactor.

The study will be performed in six sulfate reducing bioreactors made in Plexiglas columns,
(length 72 cm, with inner diameter 10 cm, volume 6 L), under two HRT (2 d and 4 d), for at
least 24 weeks. The sulfate reducing bacteria (SRB) will be monitored in the effluent
through the technique of most probable number (MPN) and Real-time quantitative PCR
(qPCR) once a month. Furthermore a column for each THR will be dismantled, at end of
period of establishment, during steady state and stage decline along of 24 weeks in order to
characterize in the reactive mixture SRB by q-PCR and the bacterial community for
technique Illumina® Solexa Sequencing.
Illumina® sequencing

Caporaso et al. (2012) and lecture notes provided from Saenz J. (2103)
The principle is based on a small fragment of DNA are sequentially identified from signals
emitted as each fragment is re-synthesized from a DNA template strand. This advance
enables rapid sequencing of large stretches of DNA base pairs spanning entire genomes,
with the latest instruments capable of producing hundreds of gigabases of data in a single
sequencing run. (www.illumina.com/NGS).

Preparation of sample
• Remove a bags sample stored at -80°C for molecular analyses.
• Allow come to room temperature.
• Weight 10 g de sample for DNA extraction.

DNA extraction
The extraction will be performed using the Max Power Soil DNA Isolation Kit (MO BIO,
Carlsbad, CA), according to the manufacturer’s protocol.
o Storing DNA frozen at-80°C.

Quantification of DNA

The quantification will be performed using the Qubit™ dsDNA BR Assay Kit (introvigen),
according to the manufacturer’s protocol.

143
• Preparation of Qubit™ working solution (for one DNA extract and two standards)
o Add into the Qubit™ assay tubes 597 pL of Qubit™ buffer and 3 pL of
Qubit™ reagent plus.
o Add 199 pL of Qubit™ buffer working solution into each of the tubes used
for two standards.
o Add 1 pL of each Qubit™ standard to the appropriate tube.
o Label the tubes lids.
o Add 197 pL of Qubit™ working solution into tube used for DNA extract.
o Add 3 pL of DNA extract to the appropriate tube.
o Label the tube lid.
o Mix all tubes in vortex during 3 sec (not to create bubbles).
o Allow all tubes to incubate at room temperature for 2 minutes.
• Determine the DNA concentration and standards by the Qubit® 2.0 Fluorometer.
• Storing DNA frozen at-80°C

Normalization of DNA concentration


• Prepare in a tube Eppendorf a stock of the sample the DNA with a concentration of
3 ng/uL and total volume of 25 uL, according to quantification of DNA (section
2.3.3).
• Storing DNA frozen at-20°C.

Amplification the V4 region of the 16S rRNA gene.

The V4 region of the 16S rRNA gene will be amplified using 515F and
806Rprimers, developed as per Caporaso y Lauber, (2011). The PCR will be made
in two steps (Table 2) according to the number of thermocycler wells (96) and for
each DNA sample must perform three amplifications.
• Preparation of the Polymerase Chain Reaction (PCR) mixture for 20 sampling with
three amplifications for sample.
o Add into the Eppendorf tube of 2 ml the reagents for sixty amplifications
(Table 3), maintain in ice bath.
o Mix the contents of the tube and ensure it is all in the bottom
o Mark the tubes of PCR (0,2 mL) for 20 samples each with three
amplifications
o Divide mixture (1620 pL) in 60 tubes of PCR in equal amounts (26.1 pL
either one)
o Check that the content of the tube is at the bottom.

144
o Add 3.3 pL of ADN sample (normalized according 2.3.4) to each tube of
the three amplifications, the final concentration of ADN in the mixture is
10 ng.
o Add 0.6 pL of forward primer (mixture of 3' Illumina adapter/ Golay
barcode / reverse primer pad / reverse primer linker/ reverse primer) to
each tube of the three amplifications.
o The final volume for each PCR tube is 30 pL, maintain in ice bath
o Place the tubes in the thermocycler.

Table 3. PCR mixtures composition


Amount for
Initial Final
Reagents sixty samples
concentration concentration
(pL)
Buffer 10X 1X 162
MgSO4 25mM 2mM 129.5
dNTPs 10mM 0.2mM 32.38
Primers* 10mM 2x10-4 mM 0.030
Enzyme** 5U/pL 0.02U 6.45
H2O milliQ -- -- 1289.64
Total 1620
* Mixture of 5'Illumina adapter /forward primer pad/forward primer linker/forward primer
* *Platinum® Taq DNA Polymerase High Fidelity

• Amplification
o Program the thermocycler with the following information
■ Denature the DNA held at 94°C for 3 min
■ Amplification proceeding for 30 cycles at 94 °C for 45 s, 50 °C
for 60 s, and 72 °C for 90 s
■ Final extension for 10 min at 68 °C.

Confirmation of amplification the PCR


• Preparation standard 1.5% agarose gel
o Weight 1.5 g of agarose.
o Add 100 mL of buffer TAE 1X and mix.
o Place the mixture in microwave for 1-3min (until the agarose is
completely dissolved and there is a nice rolling boil).
o Let agarose solution cool down for 5min.
o Add 1 pL of SYBR SAFE® and mix (safety standards check)
o Pour the agarose into a gel tray with the well comb in place.
o let sit at room temperature for 20-30 minutes, until it has completely
solidified

145
• Loading Samples
o Mix 2 pL of loading buffer dye with 3 pL of samples PCR amplified.
o Place the agarose gel into the gel box (electrophoresis unit with 25
wells).
o Fill gel box with TAE 1X until the gel is covered.
o Carefully load a molecular weight ladder into the first lane of the gel.
o Carefully load your samples into the additional wells of the gel.
• Run the gel at 80-150V until the dye line is approximately 75-80% of the way
down the gel.
• Disconnect the electrodes from the power source.
• Remove the gel from the gel box.
• Using UV light to visualize DNA fragments.
• Check that the three amplicons are the same size (about 350 pb), otherwise it
repeat amplification for this sample.
• Mixing the three tubes of each amplification.

Amplicons cleaning

The mixture of amplicons cleaning will be performed using the UltraClean®


PCR Clean-Up Kit (MO BIO, Carlsbad, CA), according to the manufacturer’s
protocol.

Combining equimolar ratios of amplicons


• Quantify the amount of clean DNA, according to section 2.3.3
• Combine an equal amount (240 ng of DNA) of amplicon from each sample into
a single, sterile tube.
• Store the tube at -20°C.

Quality of V4 region of the 16S rRNA gene


• Measure concentration and quality by UV 260/280 of final pool that has been
cleaned
• Send an aliquot for sequencing for MiSeq platform.

146
Anexo F C aracterización fisicoquím ica del D A M presente en siete m inas activas del
distrito m inero de Zipaquirá.

P arám etro U nidad m in m ax Prom edio ± SD


pH 6,7 7,8 7,2±0,5
C onductividad pS/cm 290,0 876,5 706±115
OD 0,63 4,8 3,61±3,0
F e +2 2,6 21,4 14,4±3,2
M n +2 1,5 3,5 2,7±4,3
Z n +2 m g/L 0,9 5,0 3,6±1,0
C a +2 15,6 142,0 90,3± 22,6
M g +2 18,2 34,8 10,0±2,8
SO 4-2 128,0 512,8 541,5±98,2

147
Anexo G R epresentación gráfica de la calidad de las secuencias.

L as secuencias de 250 pb, obtenida de 180 librerías secuenciadas en la plataform a M iseq de

Illum ina para la evaluación del efecto del T R H sobre la diversidad m icrobiana. El

parám etro de calidad se presenta en u n intervalo de 0-40 gráficado en el eje Y. Se m uestran

las secuencias en sentido

A. F o r w a r d

B. R e v e r s e

148
Anexo H C om unidad m icrobiana total encontrada los reactores pasivos que operaron
durante 36 sem anas con tres T R H (1, 2 y 4 d).

Phylum Class Order Family Genus


Archaea Euryarchaeota Methanobacteria Methanobacteriales Methanobacteriaceae Methanobrevibacter
Acidobacteriaceae
Acidobacteriia Acidobacteriales Candidatus
Acidobacteria Koribacteraceae
Koribacter
Holophagae Holophagales Holophagaceae
Solibacteres Solibacterales Solibacteraceae
AKIW874
Acidimicrobiia
Acidimicrobiaceae
Actinomycetaceae Actinomyces
Cellulomonas
Cellulomonadaceae
Oerskovia
Dietziaceae Dietzia

Acidimicrobiales Microbacteriaceae
Actinobacteria
Actinobacteria Micrococcaceae Arthrobacter
Micromonosporaceae
Mycobacteriaceae Mycobacterium
Nocardiaceae Rhodococcus
Nocardioidaceae
Yaniellaceae Yaniella
Bacteria WCHB1-81 At425 EubF1
Coriobacteriia Coriobacteriales Coriobacteriaceae
BA008

Bacteroidaceae BF311
Bacteroides
Marinilabiaceae
Bacteroidia Bacteroidales
Porphyromonadaceae
Paludibacter
Rikenellaceae Blvii28
Bacteroidetes SB-1
p-2534-18B5
Cyclobacteriaceae
Cytophagia Cytophagales
Cytophagaceae
Leadbetterella

Cryomorphaceae Fluviicola
Flavobacteriia Flavobacteriales
Flavobacteriaceae
Flavobacterium

149
Phylum Class Order Family Genus
Flavobacteriaceae Gelidibacter

Flavobacteriia Flavobacteriales
[Weeksellaceae] Chryseobacterium
Wautersiella
Bacteroidete
Sphingobacteriia Sphingobacteriales Sphingobacteriaceae Pedobacter
Sphingobacterium
[Saprospirae] [Saprospirales] Chitinophagaceae
Ignavibacteriaceae
Chlorobi Ignavibacteria Ignavibacteriales [Melioribacteraceae]
lheB3-7

Anaerolinea
C1_B004
Anaerolineales Anaerolinaceae Longilinea
Anaerolineae SHD-231
Chloroflexi
T78
WCHB1-05
A4b
SBR1031
SHA-31
Bacteria
Dehalococcoidetes Dehalococcoidales Dehalococcoidaceae
Fibrobactere TG3 TG3-1 TSCOR003-O20
Alicyclobacillaceae

Bacillaceae
Bacillus
Bacillales Lysinibacillus
Planococcaceae
Solibacillus
Bacilli Sporolactobacillaceae Sporolactobacillus
[Exiguobacteraceae]

Firmicutes Lactobacillales Carnobacteriaceae Desemzia


Trichococcus
Turicibacterales Turicibacteraceae Turicibacter
Christensenellaceae

Clostridia Clostridiales
Clostridiaceae Clostridium
Proteiniclasticum
SMB53

150
Phylum Class Order Family Genus
Dehalobacteriaceae Dehalobacterium

Eubacteriaceae Acetobacterium
Anaerofustis
Gracilibacteraceae Gracilibacter

Lachnospiraceae
Coprococcus
Dehalobacter
Syntrophobotulus
Peptococcaceae
Desulfosporosinus
Desulfurispora
Clostridiales Peptostreptococcaceae
Clostridia

Firmicutes Ruminococcaceae
Oscillospira

Veillonellaceae Megasphaera
Pectinatus
Bacteria Phascolarctobacter
ium

[Mogibacteriaceae]
Anaerovorax
[Tissierellaceae] Sedimentibacter
Thermoanaerobacter
Thermodesulfobiaceae Coprothermobacter
ales

Erysipelotrichi Erysipelotrichales Erysipelotrichaceae PSB-M-3


RFN20
Fusobacteria Fusobacteriia Fusobacteriales Leptotrichiaceae
Victivallales Victivallaceae
Lentisphaerae [Lentisphaeria]
Z20 R4-45B
[Leptospirillaceae] Leptospirillum
Nitrospirae Nitrospira Nitrospirales
[Thermodesulfovibrionaceae] LCP-6
Phycisphaerae Phycisphaerales Phycisphaeraceae
Planctomycetes
Planctomycetia Pirellulales Pirellulaceae

Brevundimonas
Alphaproteobacte Caulobacterales Caulobacteraceae
Proteobacteria Mycoplana
ria
Phenylobacterium
Rhizobiales Beijerinckiaceae

151
Phylum Class Order Family Genus
Balneimonas
Bradyrhizobiaceae
Bosea
Devosia
Hyphomicrobiaceae Hyphomicrobium
Rhodoplanes
Methylobacteriaceae Methylobacterium
Methylocystaceae Pleomorphomonas
Rhizobiales

Phyllobacteriaceae Aminobacter
Mesorhizobium
Nitratireductor

Rhizobiaceae Agrobacterium
Kaistia
Hyphomonadaceae

Rhodobacterales
Alphaproteobacteria Rhodobacteraceae
Amaricoccus
Bacteria Proteobacteria Paracoccus

Acidiphilium
Acetobacteraceae
Acidocella
Roseococcus
Rhodospirillales

Rhodospirillaceae
Magnetospirillum
Telmatospirillum
Erythrobacteraceae

Kaistobacter
Sphingomonadales
Sphingomonadaceae Novosphingobium
Sphingobium
Sphingomonas
Sphingopyxis

Betaproteobacteria Burkholderiales Alcaligenaceae


Achromobacter

152
Phylum Class Order Family Genus
Burkholderiaceae Burkholderia

Comamonadaceae Comamonas
Burkholderiales
Limnohabitans
Betaproteobacteria Methylibium

Oxalobacteraceae

Methylophilales Methylophilaceae Methylotenera

Rhodocyclales Rhodocyclaceae Dechloromonas


Thauera
Bdellovibrionales Bacteriovoracaceae

Desulfarculales Desulfarculaceae
Desulfarculus

Desulfobacteraceae
Desulfobacter
Desulfobacterales
Desulfococcus
Bacteria Proteobacteria
Desulfobulbaceae
Desulfobulbus
Desulfomicrobiaceae Desulfomicrobium
Desulfovibrionales
Desulfovibrionaceae
Deltaproteobacteria Desulfovibrio
Geobacteraceae Geobacter
Desulfuromonadales
Pelobacteraceae
Haliangiaceae
Myxococcales
Myxococcaceae Anaeromyxobacter

Desulfobacca
Syntrophaceae
Desulfomonile
Syntrophobacterales Syntrophus
Syntrophobacteraceae
Syntrophobacter
Syntrophorhabdaceae
Arcobacter
Campylobacteraceae
Sulfurospirillum
Epsilonproteobacteria Campylobacterales
Helicobacteraceae
Sulfuricurvum

153
Phylum Class Order Family Genus
Acidithiobacillales Acidithiobacillaceae Acidithiobacillus
Aeromonadales Aeromonadaceae
211ds20

Alteromonadaceae
Alteromonadales Cellvibrio
HTCC2188 HTCC
Shewanellaceae Shewanella
Chromatiales Ectothiorhodospiraceae

Enterobacteriales Enterobacteriaceae Citrobacter


Klebsiella
Trabulsiella
Proteobacteria Gammaproteobacteria
Legionellales Coxiellaceae
Oceanospirillales Halomonadaceae
Moraxellaceae Acinetobacter
Pseudomonadales
Pseudomonadaceae
Pseudomonas

Sinobacteraceae
Bacteria Steroidobacter

Xanthomonadales
Luteibacter
Xanthomonadaceae
Luteimonas
Lysobacter
Stenotrophomonas

Spirochaetes Spirochaetales Spirochaetaceae Treponema


Spirochaetes za29

[Leptospirae] [Leptospirales] Sediment-4


SJA-88

Anaerobaculaceae
Anaerobaculum
Aminobacterium
Dethiosulfovibrionaceae HA73
Synergistetes Synergistia Synergistales
PD-UASB-13

Synergistaceae
vadinCA02
TTA_B6 E6

154
Phylum Class Order Family Genus

Opitutae Opitutales Opitutaceae


Opitutus
RFP12
Verruco-5 WCHB1-41
WCHB1-25
Verrucomicrobia
Verrucomicrobiae Verrucomicrobiales Verrucomicrobiaceae Luteolibacter
Ellin515
[Pedosphaerae] [Pedosphaerales]
auto67_4W
Bacteria
[Spartobacteria] [Chthoniobacterales] [Chthoniobacteraceae]
heteroC45_4W
WS3 PRR-12 GN03 KSB4
CW-1
SHA-116
WWE1 [Cloacamonae] [Cloacamonales]
[Cloacamonaceae]
W22
[Thermi] Deinococci Deinococcales Trueperaceae B-42

155