Sei sulla pagina 1di 7

Process Biochemistry 46 (2011) 1951–1957

Contents lists available at ScienceDirect

Process Biochemistry
journal homepage: www.elsevier.com/locate/procbio

Production and structural characterization of surfactin (C14 /Leu7 ) produced by


Bacillus subtilis isolate LSFM-05 grown on raw glycerol from the biodiesel
industry
Andreia Fonseca de Faria a,∗ , Diego Stéfani Teodoro-Martinez b ,
Geraldo Nazareno de Oliveira Barbosa a , Boniek Gontijo Vaz b , Ísis Serrano Silva a ,
Jerusa Simone Garcia b , Marcos Rogério Tótola c , Marcos N. Eberlin b , Matthew Grossman d ,
Oswaldo Luiz Alves b , Lucia Regina Durrant a
a
Food Science Department, Food Engineering Faculty, University of Campinas, Rua Monteiro Lobato 80, Cidade Universitária Zeferino Vaz, 13083-862 Campinas, São Paulo, Brazil
b
Chemistry Institute, University of Campinas, Post Box 6154, Cidade Universitária Zeferino Vaz, 13083-970 Campinas, São Paulo, Brazil
c
Microbiology Department, Federal University of Viçosa, Av. PH Rolfs - Campus Universitário, 36570 000 Viçosa, Minas Gerais, Brazil
d
BioSage, 807 Eagles Chase Drive, Lawrenceville, NJ 08648, United States

a r t i c l e i n f o a b s t r a c t

Article history: The production of biosurfactant by Bacillus subtilis LSFM-05 was carried out using raw glycerol, obtained
Received 3 February 2011 from a vegetable oil biodiesel plant in Brazil, as the sole carbon source. Production of the biosurfactant was
Received in revised form 24 June 2011 carried out in a 15-L bench-top fermentor and the surfactant was obtained from the foam produced. The
Accepted 1 July 2011
crude surfactant was purified by silica gel column chromatography with a yield of 230 mg of the purified
biosurfactant per liter of foam. TLC, IR spectroscopy, 1 H and 13 C NMR and Fourier transform ion cyclotron
Keywords:
resonance mass spectrometry with electrospray ionization (ESI-FTMS) were used to characterize the
B. subtilis
purified surfactant. The isolated surfactant was identified as a surfactin lipopeptide. MS/MS data identified
Biosurfactant
Surfactin
the amino acid sequence as GluOMe-Leu-Leu-Asp-Val-Leu-Leu and showed that the fatty acid moiety
Raw glycerol contained 14 carbons in iso, anteiso or normal configurations. The critical micelle concentration of the
Biodiesel C14 /Leu7 surfactin was 70 ␮M, with emulsification efficiency after 24 h (E24 ) of 67.6% against crude oil.
Mass spectrometry Raw glycerol represents an abundant and renewable carbon source and provides an opportunity for
reducing the cost of biosurfactant production and may add value to biodiesel production by creating new
commercial applications for this by-product.
© 2011 Elsevier Ltd. Open access under the Elsevier OA license.

1. Introduction order to solve these problems, many studies have been car-
ried out using low-cost feedstock or agricultural byproducts as
Biosurfactants or microbial surfactants are surface active substrates for biosurfactant production. Low-cost carbon sources
molecules that are produced by a variety of microorganisms that have been used for biosurfactant production by microor-
including bacteria, yeast and filamentous fungus. Due to their ganisms include sludge palm oil [4], cassava wastewater [5],
amphipathic nature, these biomolecules reduce the interfacial vegetable oil refinery waste [6], molasses [7] and raw glycerol
tension between an aqueous phase and hydrophobic molecules, [8]. Raw glycerol is a by-product of biodiesel production [9].
thereby enhancing the solubility and bioavailability of hydropho- Biodiesel is produced by transesterification of fatty acids derived
bic organic compounds [1]. In comparison to synthetic chemical from vegetable oils and animal fats and the raw glycerol by-
surfactants, biosurfactants are of interest due to their high level product represents 10% (v/v) of the total biodiesel production
of activity, specific activity at extreme temperatures, pH and [9,10].
salinity, ability to be produced from renewable feedstock and The European Union has been the global leader in biodiesel pro-
high degree of biodegradability [2]. However, biosurfactants have duction [11]. According to the European Biodiesel Board [12], the
not yet been commercialized extensively due to low produc- overall biodiesel production in the EU has increased from 9.0 mil-
tion yields and high feedstock and purification costs [2,3]. In lion tonnes in 2009 to nearly 21.9 million tonnes in 2010. Brazil is
also among the largest producers and consumers of biodiesel in the
world with an annual production in 2010 of 2.4 billion liters and
∗ Corresponding author. Tel.: +55 19 35212173; fax: +55 19 35212173. an installed capacity in the same year of 5.8 billion liters, accord-
E-mail address: an.ffaria@gmail.com (A.F. de Faria). ing to the Brazilian National Agency for Petroleum, Natural Gas and

1359-5113 © 2011 Elsevier Ltd. Open access under the Elsevier OA license.
doi:10.1016/j.procbio.2011.07.001
1952 A.F. de Faria et al. / Process Biochemistry 46 (2011) 1951–1957

Biofuel (ANP) [13]. Considering the increasing demand for biodiesel comparing the profiles of the fatty acid methyl esters to those in the Aerobe reference
production, the production of raw glycerol will also increase, result- library database (TSBA, version 4.0).
ing in a further decrease in its price [10]. In contrast to the relatively
expensive purified glycerol, which is an important ingredient in 2.2. Media and culture conditions
food, drug, cosmetic and chemical production, raw glycerol con-
B. subtilis LSFM-05 was grown on nutrient agar (Difco) plates at 30 ◦ C for 24 h
tains impurities, such as salts and other organic compounds, and is a and transferred to 200 mL conical flasks containing 50 mL of Nutrient Broth (Difco),
potentially inexpensive carbon source for the microbial production followed by incubation at 32 ◦ C and 150 rpm for 48 h. The inoculum was prepared
of chemicals [10,14]. by centrifuging the culture for 10 min at 18,000 × g in a HITACHI-CR-21 centrifuge,
The use of raw glycerol as a feedstock for the production of and the cells were washed twice with a sterile NaCl solution 0.85% (w/v) and re-
suspended in the basal salts medium containing (per liter): 3 g of NaNO3 ; 1 g of
chemicals could provide the biodiesel industry with an added value
KH2 PO4 ; 0.1 g of NaCl; 0.5 of MgSO4 ·7H2 O; 1 mL of vitamin stock solution (0.002 g/L
outlet for the large quantities of raw glycerol by-product. One folic acid, 0.010 g/L pyridoxine, 0.005 g/L riboflavin, 0.005 g/L thiamine, 0.005 g/L
of the possible applications of raw glycerol is its use as a car- nicotinic acid, 0.005 g/L pantothenic acid, 0.001 g/L cyanocobalamin, 0.005 g/L ␳-
bon and energy source for biosurfactant production by Bacillus aminobenzoic acid, 0.005 g/L thioctic acid and 0.002 g/L biotin), at pH 6.8. The
fermentation was conducted using a 15-L bench-top fermentor (Bioflo 3000 New
and other microorganisms. Rooney et al. [15] previously isolated
Brunswick Scientific) with 10 L working volume. The organic substrate was added
rhamnolipid-producing bacteria from soils at a biodiesel facility, to basal salt medium in the concentration of 5% (v/v) as the sole carbon source. The
on the basis of their ability to grow on glycerol as the sole carbon glycerol sample was donated by the biodiesel industry Granol, Anápolis, Brazil and
source, and Morita et al. [8] described the use of waste glycerol stored at 4 ◦ C. According to the Granol industry, the raw glycerol sample contained
from biodiesel in the production of mannosylerythritol lipids by 80% glycerol, 5–8% water, 6% mineral salts, 5% unidentified organic compounds
other than glycerol and 0.3% methanol. The culture medium was inoculated with
Pseudozyma antarctica JCM 10317. Das et al. [16] demonstrated
106 CFU/mL giving an initial optical density at 600 nm of 0.1. The fermentation was
the production of crude biosurfactants by a marine microorgan- carried out at 32 ◦ C for 72 h, with agitation at 250 rpm, oxygenation at 0.5 vvm in
ism using glycerol as substrates. However, to our knowledge this the absence of a chemical antifoaming agent. The pH was not controlled during
is the first report on the production of surfactin by a Bacillus sub- the fermentation. The fermentative process was carried out in three independent
replicates. The glycerol consumption and microbial growth were determined from
tilis strain using raw glycerol (instead of the more costly purified
samples collected at 12-h intervals following inoculation. To remove the bacterial
glycerol) obtained from a biodiesel factory as feedstock. cells, the samples were centrifuged at 18,000 × g for 10 min at 4 ◦ C. The glycerol
B. subtilis strains produce a spectrum of lipopeptides that are concentration was determined by high performance liquid chromatography (HPLC)
powerful biosurfactants, and also have potent antimicrobial, antivi- using a Shimadzu Chromatograph model CR-21 equipped with a Supercogel C-610H
ral and antitumor activities [17]. The most studied lipopeptides column conditioned at 75 ◦ C and an isocratic mobile phase of 0.1% H2 SO4 (98% purity,
Synth, Brazil) at a flow rate of 1.0 mL/min [24]. To determine cellular growth the
family is the surfactins, which may also be the most powerful
samples were submitted to serial dilutions in saline solution (0.85%, w/v) and viable
biosurfactants known, and contain heptapeptides attached to a ␤- counts were performed by the spread plate technique. The results are expressed as
hydroxy fatty acid, with carbon numbers in the range from 13 to colony-forming units per milliliter (CFU/mL). The pH of the culture was measured
15 [18,19]. during the fermentation using a pH probe inserted into the fermentation broth.
The present work describes the production of surfactin by the B.
subtilis isolate LSFM-05, grown on raw glycerol as the sole carbon 2.3. Biosurfactant recovery
source. The surfactin produced was characterized by TLC, IR spec-
The surfactant was obtained by collecting the foam produced during fermen-
troscopy, 1 H NMR, 13 C NMR, and Fourier transform ion cyclotron tation. The fermentor was fitted with a collection vessel in the air-exhaust line to
resonance mass spectrometry with electrospray ionization (ESI- collect the foam overflow. The foam was allowed to settle in sterile flasks at room
FTMS) followed by collision-induced dissociation (CID) and infrared temperature, centrifuged to remove microbial cells (18,000 × g for 15 min, 4 ◦ C). The
multiPhoton (IRMPD) dissociation. surface activity of the cell-free foam collected was analyzed by measuring the sur-
face tension and critical micelle dilution (CMD−1 and CMD−2 ). The surface tension
was determined with a Du Nouy tensiometer-K10S (Krüss/Germany) using the ring
2. Materials and methods
method. The CMD−1 and CMD−2 were determined by measuring the surface tension
of the 10 and 100 times-diluted cell-free supernatant in distilled water. Crude bio-
2.1. Strain characterization
surfactant was precipitated from the cell-free foam by acidification to pH 2.0 using
37% HCl (Synth, Brazil) [25], followed by storage at 4 ◦ C for 24 h. The crude biosurfac-
The microorganism used in this study was isolated from soil with a history of
tant was separated from the supernatant by centrifugation at 18,000 × g for 15 min.
contamination with hydrocarbons located at a petroleum refinery in Paulínia, São
The precipitate was washed twice with acidified water at pH 2.0, re-dissolved in
Paulo State, Brazil, and is maintained in the Culture Collection of the Systematic and
distilled water at pH 7.0 and freeze-dried using the Dura Dry-FTS-System. The dry
Physiology Microbial Laboratory (FEA-UNICAMP).
weight of crude surfactant was calculated as grams crude surfactant per liter of foam
In addition to its morphological identification as a gram positive Bacillus,
volume (g/L).
the phylogeny of the strain was determined using sequence analysis of the
PCR amplified 16S rRNA gene and analysis of the fatty acid methyl ester pro-
file (FAME). The 16S rRNA gene was amplified by PCR in an Eppendorf thermal 2.4. Biosurfactant purification
cycler (Eppendorf Mastercycler Gradient) using the specific primers, 27f (5 -
AGAGTTTGATCCTGGCTCAG-3 ) and 1401r (5 -CGGTGTGTACAAGACCC-3 ) for the Crude biosurfactant was purified by absorption column chromatography using
universal Bacteria Domain. DNA sequencing was performed using a Mega Base a 40 cm × 5 cm column filled with silica gel Acros Organics (0.03–0.07 mm, 60 Å)
DNA Analysis System 1000 (GE Healthcare). The primers used for sequencing as the stationary phase. One gram of the raw biosurfactant was dissolved in chlo-
were p10f (5 GAGTTTGATCCTGGCTCAG3 ), 765f (5 ATTAGATACCCT GGTAG3 ), 782r roform/methanol (2:1) and added to the column. The sample was eluted using
(5 ACCAGGGTATCTAATCCTGT3 ) and p1100r (5 AGGGTTGGGGTG GTTG3 ). The par- a mixture composed of chloroform, methanol and an aqueous solution of 28%
tial sequences of the 16S ribosomal RNA gene obtained with the different primers (v/v) ammonium hydroxide (P.A. degree, Synth, Brazil) with increasing polarities as
were assembled into a contiguous sequence and compared to the GenBank follows: CHCl3 /CH3 OH/NH4 OH (80:20:4) (v/v/v), CHCl3 /CH3 OH/NH4 OH (75:25:4)
nucleotide collection (nr/nt) database, using the nucleotide blast (blastn) Basic Local (v/v/v) and CHCl3 /CH3 OH/NH4 OH (65:35:5) (v/v/v). Ten milliliters fractions were
Alignment Search Tool available through the National Center for Biotechnology collected, and the presence of biosurfactant monitored by TLC using silica gel 60
Information website (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The sequences were plates (Macherey-Nagel-Alugram-SilG/UV254 ) as the stationary phase, and chloro-
aligned using the CLUSTAL X program C [20] and the phylogenetic analysis was car- form, methanol and an aqueous solution of 28% (v/v) ammonium hydroxide in the
ried out using the MEGA program version 2.0 [21]. The evolutionary distance matrix proportion CHCl3 /CH3 OH/NH4 OH (65:35:5) (v/v/v) as the mobile phase.
was calculated using the model of [22] and the phylogenetic tree constructed from The compounds were detected by spraying distilled water on the TLC plates
the evolutionary distances using the neighbor-joining method [23], with bootstrap followed by warming/heating at 100 ◦ C. The presence of the biosurfactant was
values calculated from re-sampling, using the software included in the MEGA 2.0 detected by formation of white spots. The Rf (retention time) of the purified bio-
program. surfactant was compared with a standard surfactin (Sigma–Aldrich, purity >98%).
For the FAME analysis, the isolates were grown on trypticase soy agar (Difco, The organic fractions containing the purified biosurfactant were pooled together
Detroit, MI, USA) plates for 24 h. The fatty acids were saponified, methylated, in a round volumetric flask and the solvent was removed in a rotary evaporator
extracted and analyzed by gas chromatography using the Sherlock Microbial Iden- (Eyla-A-3S). The material remaining in the volumetric flask was re-suspended in
tification System (MIDI, Newark, DE, USA). The identification was performed by de-ionized water, transferred to a fresh vial and frozen and freeze dried (using the
A.F. de Faria et al. / Process Biochemistry 46 (2011) 1951–1957 1953

Dura Dry-FTS-System) to obtain the purified biosurfactant. The dry weight yield of 3.2. Biosurfactant production
purified biosurfactant is expressed as grams surfactant per liter of foam (g/L).
B. subtilis LSFM-05 was grown in 10 L of minimal medium con-
2.5. Infrared analysis (IR)
taining 5% (v/v) raw glycerol as the sole carbon source. Fig. 1 shows
The samples were prepared for infrared analysis by mixing approximately 1 mg the average values of cell growth (CFU/mL), glycerol consumption
of purified biosurfactant with 100 mg of KBr and pressing the mixture into the form (g/L), pH and biosurfactant yield (g/L) over the course of the fer-
of a pellet at 134 MPa for 2–3 min to obtain transparent pellets. The IR spectrum of mentation. The growth of B. subtilis LSFM-05 on raw glycerol was
the pellet was collected from 400 to 4000 wavenumbers (cm−1 ), and is an average
determined on culture medium samples collected from the fer-
of 32 scans obtained using a FTIR (FTLA2000) spectrometer.
mentor vessel every 12 h over a 72-h period. The microbial growth
2.6. 1
H and 13 C nuclear magnetic resonance (NMR) was characterized by a lag phase for 24 h followed by an exponen-
tial growth phase, which was complete after 48 h of incubation.
The 1 H and 13 C NMR analyses of the purified LSFM-05 biosurfactant were carried The maximum growth rate occurred between 24 and 36 h with a
out in a Buker INOVA 500 MHz (Varian) spectrometer. The spectra were obtained
max of 0.24/h. The maximum Log10 (CFU/mL) value achieved was
from 20 mg of purified biosurfactant dissolved in 500 ␮l deuterated chloroform
(Sigma Co.) at 500 MHz and 298.1 K. 7.63 ± 0.12 at 48 h of fermentation.
The pH of the culture medium increased from an initial value
2.7. Mass spectrometry analysis by ESI-FTMS of 6.9 ± 0.1 to a maximum of 8.0 ± 0.18 after 48 h of growth,
and declined slightly during the remainder of the fermentation
A sample of purified biosurfactant (1 mg) was dissolved in 1 mL of methanol.
period (Fig. 1). This increase in pH is consistent with the obser-
For analysis in the positive ion mode, a total of 1 ␮L of a 0.1% (v/v) aqueous solution
of formic acid was added to the final solution to facilitate protonation of the basic vation of Reis et al. [7] who reported an increase in pH values
nitrogen compounds yielding protonated molecules [M+H]+ . A direct infusion auto- from 6.8 to 7.7 for B. subtilis cultivated in mineral medium con-
mated chip-based nano-ESI Triversa NanoMate 100 system (Advion BioSciences, taining purified glycerol as the carbon source. An increase in
Ithaca, NY, USA) was used in both the positive and negative ion modes. The samples pH values from to 5.4 to 7.6 was also observed by Barros et al.
were loaded into 96-well plates (total volume of 100 ␮L in each well) and analyzed
[5] for B. subtilis LB5a cultivated in mineral medium containing
using a 7.2T LTQ FT Ultra mass spectrometer (ThermoScientific, Bremen, Germany).
The general conditions for ESI were: gas pressure of 0.0020 MPa and capillary volt- cassava wastewater as substrate. Maximum glycerol consump-
age of 1.55 kV. The mass spectra were the result of over 100 microscans processed tion occurred in the interval from 36 to 48 h and at the end
via the Xcalibur 2.0 software (ThermoScientific, Bremen, Germany). of the fermentation 52% of the raw glycerol had been con-
sumed.
2.8. Emulsification index (E24 ) and critical micelle concentration of the purified
The yield of biosurfactant in the foam reached a maximum value
biosurfactant
of 1.37 g/L at 60 h, whereas the overall foam production peaked
The emulsification activity was analyzed using tubes containing 3 mL of the at 2.4 ± 0.17 L at 48 h of fermentation (Table 1). Maximum surfac-
purified surfactant solution at concentration of 1.0 g/L and 2 mL of hydrocarbon tant and foam yield therefore correspond to the maximum growth
substrate. The synthetic surfactants Triton X and SDS (sodium dodecyl sulfate) were
phase of the culture, demonstrating a growth related production
also evaluated at a concentration of 0.1% (v/v) and 1 g/L, respectively. The test was
performed using the hydrocarbons toluene, pristane, kerosene, diesel oil, hexade- of surfactant. The productivity of surfactant corresponding to the
cane, tetradecane, tridecane, heptane, benzene and crude oil. The tubes containing maximum surfactant yield was 11.42 ± 1.1 mg/L/h.
the hydrocarbon and surfactant solution were mixed by vortexing at high speed for The foam was collected at 12-h intervals from 36 to 72 h and
2 min and maintained under static conditions at room temperature for 24 h [27]. The the surface activity was determined (surface tension, CMD−1 and
emulsion stability was determined after 24 h, and the emulsification index (E24 ) was
CMD−2 ) (Table 1). The surface tension of the culture broth at
calculated by dividing the measured height of emulsification layer by the mixture’s
total height and multiplying by 100. the beginning of the fermentation was 47.5 ± 1.2 mN/m. However,
The critical micelle concentration (CMC) was determined by measuring the sur- the surface tension of the cell free foam collected at 36 h was
face tension of serial dilutions of a purified biosurfactant solution (1 g/L). The purified 29.5 ± 0.7 mN/m, demonstrating the presence of surfactants. This
biosurfactant solution was prepared and diluted using Tris–HCl buffer, pH 8.
result agreed with the results obtained by Noah et al. [29], who
observed that the surface tension of the liquid was about 70 mN/m
3. Results and discussion whereas the surface tension of the foam produced was 30 mN/m.
The surface tension of 10 and 100 times-diluted cell-free foam at
3.1. Identification of the biosurfactant-producing bacterium 36 h was 29.8 ± 0.5 and 37.5 ± 1.0 mN/m, respectively, indicating
that the biosurfactant concentration in the foam was at least 10
The genus Bacillus is a heterogeneous group and members of this times its CMC. There was no decrease in surface activity in the
group share a great deal of morphological and biochemical sim- medium that remained in the vessel at the end of fermentation
ilarities [26]. Comparative 16S rDNA sequence analysis indicated indicating that virtually all the surfactant partitioned into the foam.
that the isolated bacterium was a member of the genus Bacillus, Surfactant was not isolated from the culture medium remaining in
but no exact matches to the databases were obtained to enable the fermentor.
identification at the species level (Fig. S1). Partitioning of the biosurfactant to the foam portion (foam
The fatty acid methyl ester (FAME) analysis has been shown to be fractionation) can simplify the product isolation process by con-
a useful tool in differentiating Bacillus species [27,28]. FAME analy- centrating the product into a smaller volume. In addition, when
sis enabled the classification of the isolate as a member of B. subtilis using foam fractionation the addition of costly chemical antifoam
subgroup D with a similarity index of 0.76. Based on these results, is not necessary, and this also eliminates problems associated with
the isolate was designated as B. subtilis LSFM-05. Table S1 shows reduced oxygen transfer rates and other adverse effects on the cell’s
the cellular fatty acid profile of B. subtilis LSFM-05. The branched physiology that can be caused by antifoam addition [30]. Cooper
chain fatty acids, iso-structure (methyl group at the penultimate et al. [25] and Makkar and Cameotra [31] reported that when B. sub-
carbon atom) or anteiso-structure (methyl group on the third car- tilis biosurfactant fermentation was carried out without removal of
bon from the end), comprised over 70% of the total fatty acids of the foam, there was a very poor biosurfactant yield. Moreover, pro-
the cell membrane. Iso and anteiso acids with 15 and 17 carbon duction in a continuous or fed batch processes could also improve
atoms were the major components. The predominance of termi- the biosurfactant production by B. subtilis LSFM-05 in a medium
nally methyl branched iso and anteiso fatty acids having 15 and containing raw glycerol as the sole organic substrate, offering the
17 carbons was a characteristic observed in the species of Bacillus benefits of high productivity, easier process control and more con-
studied [27,28]. sistent product quality. Chen et al. [32] demonstrated that foam
1954 A.F. de Faria et al. / Process Biochemistry 46 (2011) 1951–1957

Fig. 1. (--) Microbial growth (CFU/mL), (--) glycerol concentration (g/L), (-䊉-) pH values and (--) biosurfactant yield (g/L) registered during the growth of B. subtilis
LSFM-05 in a mineral salt medium supplemented with 5% (v/v) of raw glycerol as the sole carbon source at 32 ◦ C, 250 rpm, 0.5 vvm for 72 h.

Table 1
Surface properties (surface tension, CMD−1 and CMD−2 ) and biosurfactant yield on the foam samples collected at 12-h intervals. Critical micelle dilution CMD−1 and CMD−2
is the surface tension of the 10 and 100 times-diluted cell-free supernatant in distilled water, respectively.

Properties of foam collected

Time (h) Volume (L) Biosurfactant (g/L) Surface tension (mN/m) CMD−1 (mN/m) CMD−2 (mN/m)

36 0.55 ± 0.04 0.92 ± 0.15 29.5 ± 0.7 29.8 ± 0.5 37.5 ± 1.0
48 2.4 ± 0.17 0.7 ± 0.05 31.0 ± 1.0 33.8 ± 0.8 38.9 ± 0.8
60 0.78 ± 0.04 1.38 ± 0.13 31.2 ± 0.9 33.7 ± 0.9 40.8 ± 0.9
72 0.5 ± 0.06 1.36 ± 0.22 32.1 ± 1.4 33.5 ± 2.2 40.9 ± 0.5

fractionation could be successfully integrated with a culture of B. consistent with the presence of a peptide component at 1650 cm−1
subtilis BBK006 grown in a continuous culture (chemostat). resulting from the stretching mode of the CO–N bond, and at
A total volume of 3.91 ± 0.36 L of foam overflow was collected 1540 cm−1 from the deformation mode of the N–H bond combined
during the fermentative process and the overall crude biosurfactant with the C–N stretching mode. The presence of an aliphatic chain
yield in the acid precipitate of the colleted foam was 0.93 ± 0.4 g/L. was indicated by the C–H modes from 2970 to 2850 cm−1 and
The results obtained were similar to those of Cooper et al. [25], who 1450–1380 cm−1 . These results strongly indicate that the biosur-
collected 0.8 g/L of surfactant from the foam. Davis et al. [33] and factant contained aliphatic and peptide-like moieties. The band at
Barros et al. [5] reported the use of foaming as a method to recover 1730 cm−1 was due to lactone carbonyl absorption, corresponding
surface-active products, giving yields of 1.67 g/L and 2.4 g/L, using to an ester carbonyl group also observed by Joshi et al. [34] and
glucose and cassava waste as the carbon sources, respectively. The
results presented by Davis et al. [33] and Barros et al. [5] showed
higher biosurfactant yields, perhaps because the glucose and potato
substrates used were more efficient carbon sources than the resid-
ual glycerol used in the present work.
Following the initial isolation by acid precipitation, the sur-
factant was purified by column chromatography as described in
Section 2. The productivity of the purified surfactin was 230 mg of
the purified biosurfactant per liter of collected foam.

3.3. Characterization of the biosurfactant

3.3.1. Thin layer chromatography and Fourier


transformed-infrared (FT-IR) spectrum of the purified surfactin
Surfactants present in the organic fractions collected from col-
umn chromatography were analyzed by TLC. The surface-active
compounds were visualized by spraying the developed TLC plates
with distilled water, which produced white spots in the presence
of biosurfactant. The Rf (retention factor) value of the purified bio-
surfactant was identical to the commercially available surfactin
(Sigma–Aldrich).
Fig. 2. Transmission FT-IR spectrum of solid surfactant obtained after purification
As shown in Fig. 2, the FT-IR spectrum of the biosurfactant iso- by adsorption chromatography and sample preparation in KBr tablets from 400 to
lated from B. subtilis LSFM-05 contained strongly absorbing bands, 4000 cm−1 .
A.F. de Faria et al. / Process Biochemistry 46 (2011) 1951–1957 1955

Table 2 amino acid residues Leu/Leu/Asp/Val/Leu/Leu/GluOMe (Fig. 3a and


Assignments of surfactin isoforms ions detected by ESI-FTMS for surfactant species
b), indicating that the amino acid sequence present in the surfactin
produced by B. subtilis LSFM-05 after separation by adsorption chromatographya .
produced by B. subtilis LSFM-05 is similar to that present in the
Ion (m/z) Surfactant species surfactin obtained from Sigma–Aldrich (see Sigma–Aldrich product
1022.68 Leu/Ile7 C13 [M+H]+ information for surfactin from B. subtilis, Catalog Number S3523).
1036.69 Leu/Ile7 C14 [M+H]+ The fragmentations profile of the ion of m/z 1036.7 shows the loss
1044.66 Leu/Ile7 C13 [M+Na]+ of a 143 Da residue from the fragment of m/z 370 to that of m/z
1058.7 Leu/Ile7 C14 [M+Na]+
227. A mass of 143 Da corresponds to that of methylated glutamic
1046.66 Leu/Ile7 C13 [M+K]+
1060.0 Leu/Ile7 C14 [M+K]+ acid (Glu-OMe), confirming that the glutamic acid residue is the
a
methyl esterified amino acid (Fig. 3a and b). The ion of m/z 227 cor-
The surfactins were fractioned by using Acros Organics silica gel (0.03–0.07 mm,
60 Å) as the stationary phase and the mobile phase: CHCl3 /CH3 OH/NH4 OH (80:20:4) responds to an aliphatic fatty acid chain containing 14 carbons in
(v/v/v), CHCl3 /CH3 OH/NH4 OH (75:25:4) (v/v/v) and CHCl3 /CH3 OH/NH4 OH (65:35:5) the normal, iso or anteiso forms. This dissociation profile indicates
(v/v/v). The surfactin isoforms were collected in the organic fractions and identified that this lipopeptide is a seven-residue peptide with a Glu(O-Me)-
by ESI-FTMS. Leu-Leu-Val-Asp-Leu-Leu sequence with a lactone bond linking the
terminal Leu (position 7 on the peptide moiety) to the ␤-hydroxyl
Thaniyavarn et al. [35] in their studies on lipopeptide characteriza- fatty acid moiety containing 14 carbons [surfactin C14 /Leu7 ; M+H]+ ,
tion. creating a cyclopeptide. However, the dissociation would be unable
to distinguish it from Ile since Ile and Leu are isomers (identical
3.3.2. 1 H and 13 C NMR analysis molar masses). Calculating the proportion of each ion indicates that
The 1 H NMR results obtained for the purified biosurfactant the molar ratio of Glu:Asp:Val:Leu was 1:1:1:4, respectively. An
at 500 MHz clearly indicated that the purified surfactant was a identical amino acid sequence was designated by Snook et al. [19]
lipopeptide due to the presence of a long aliphatic chain (CH2 at for the surfactin obtained from the endophytic bacterium Bacil-
1.55–1.25 ppm), a peptide backbone (N–H at 8.0–7.2 ppm) and an lus mojavensis RRC 101. Liu et al. [18] reported the same amino
aliphatic carbon–hydrogen bond (C–H at 5.0–4.0 ppm) (Fig. S2a). acid sequence for the C15 -surfactin-O-methy-ester isolated from a
The chemical shift at 5.06 ppm was consistent with a proton cell culture of B. subtilis HSO 121. Li et al. [38] showed the struc-
attached to the C-3 of the hydroxyl fatty acid (3-HFA) residue, and tural characterization of lipopeptide methyl esters produced by B.
indicated that this carbon was attached to an amino acid residue licheniformis HSN 221, revealing a similar surfactin methyl ester iso-
by an ester bond. According to Tang et al. [36] the intense sin- C15 -␤-hydroxy fatty acid-MeGlu-Leu-Leu-Val-Asp-Leu-Ile. Other
glet at 3.67 ppm is similar to the 1 H NMR spectrum of lipopeptide researchers showed the characterization of surfactin isomers with
monoesters reported by other researchers, which suggests the exis- amino acid sequences analogous to that reported in the present
tence of a methoxy group on the Glu or Asp amino residues. The work. Liu et al. [39] reported the isolation and characterization of
1 H NMR analysis detected an ester carbonyl group at 5.2 ppm, a C12 -lipopeptide produced by B. subtilis HSO 121. The surfactant
indicating the presence of a lactone ring in the structure of the showed the presence of the amino acids Asp, Glu, Val and Leu in a
biosurfactant (Fig. S2a). The same resonance was reported by Liu molar ratio of 1:1:1:4. Tang et al. [40] also showed the same amino
et al. [18], who demonstrated the production and characterization acid sequence during a study of the characterization and online
of a C15 -surfactin-O-methyl ester by a lipopeptide producing strain detection of surfactin isomers based on HPLC–MS.
of B. subtilis HSO 121. The results presented in this work indicate that the chemical
The 13 C NMR analysis indicated that the lipid tail of the LSFM-05 structure of the C14 /Leu7 surfactin is very similar to that commercial
lipopeptide was present as a mixture of three different configura- standard surfactin from Sigma–Aldrich. However, some differences
tions, namely normal, anteiso and isobranched, with the different between these two biosurfactants were detected. First, the ESI-
CH3 positions being consistent with chemical shifts at (1) 11.44, (2) MS/MS data of the C14 /Leu7 surfactin indicates that a glutamic acid
14.15, (3) 19.19 and 22 ppm, respectively (Fig. S2b). Liu et al. [18] residue is esterified by a methyl group. The loss of Glu-OMe corre-
who also reported a mixture of the normal, iso and anteiso forms sponds to 143 Da, which represents the molar mass of methylated
in their compounds. A chemical shift at 49.15 ppm in the 13 C NMR glutamic acid (Fig. 3a and b). This result was reinforced by the
indicates a methoxy group attached to a Glu or Asp residue of the presence of chemical shifts at 3.66 and 49.15 ppm in the 1 H and
surfactant. 13 C NMR spectrums, respectively, which suggests the existence of

Similar results were demonstrated for surfactin in CDCl3 deute- one methoxy group in the surfactant produced by B. subtilis LSFM-
rochloroform [18] and for the anthiadhesin produced by Bacillus 05 (Fig. S2a and b). In addition, the fragment observed here in of
licheniformis [37]. There are two free carboxyl groups from the Glu m/z 370, containing a fatty acid chain plus Glu-OMe, indicates a
and Asp in the surfactin structure. Mass spectrometry using CID of 14 carbon unit as compared to that of the C15 -surfactin, due to the
the ion of m/z 1036 was able to establish the exact amino acid (Glu methylation of Glu in the peptide moiety [18]. The fatty acid chain of
or Asp) esterified. C14 /Leu7 surfactin contains therefore 14 carbons in the lipid moiety
and corresponds to the ion of m/z 227.
3.3.3. Mass spectrometry
The ESI mass spectra of the purified biosurfactant showed that 3.3.4. Surface activity characterization of the lipopeptides
the ions of greatest abundances in the sample were those of m/z The CMC of the purified lipopeptide was found to be approx-
1022, 1036, 1044 and 1058, whereas that of m/z 1036 was the most imately 70 ␮M in 0.1 M Tris–HCl buffer pH 8 and 20 ␮M for the
abundant (Fig. S3). The spectra also show likely the presence of pro- standard surfactin, while the ␥CMC varied from 30.4 for the
tonated molecules [M+H]+ of 1008, 1022, 1036 and of their sodium standard surfactin to 34.1 for the purified C14 /Leu7 surfactin. This
adducts [M+Na]+ of m/z 1044, 1058 and potassium adducts [M+K]+ result indicated that the differences in structure between the
of m/z 1046 and 1060 adducts (Table 2). standard and the C14 /Leu7 surfactin caused a small decrease in
Fig. 3a shows the MS/MS spectra of the [M+H]+ ion of m/z 1036.7 the surface activity power of the purified surfactin. Liu et al. [18]
using two fragmentation methods, IRMPD (left) for fragments of stated that the esterification of the Glu residue in a lipopetide
lower m/z value and CID (right) for fragments of higher m/z. Dis- increases its surface active power, and demonstrated that the
sociation produced ions of m/z 923, 810, 695, 596, 483, 370 and GluOME-C15 surfactin had a lower critical micellar concentration
227. These fragments correspond to the sequential losses of the of 9.78 ␮M than the un-methylated analogue, which had a CMC
1956 A.F. de Faria et al. / Process Biochemistry 46 (2011) 1951–1957

Fig. 3. (a) Fragmentation (ESI-MS/MS) of the m/z 1036.7 ion using the IRMPD (left) and CID (right) modes, showing the composition of the peptide and fatty acid moiety and
(b) simple cleavage of the lipopeptide showing a set of ions produced after fragmentation.

of 17.4 ␮M. The opposite behavior observed for the C14 /Leu7 and cosmetics industries as antitumor, antimicrobial and antiviral
surfactin may have been related to the difference in the number of agents.
carbon atoms in the fatty acid moiety. According to Peypoux et al. It was demonstrated that raw glycerol could be used as an
[41], a reduction in the carbon number of the lipid side chain of efficient and renewable carbon source for the production of
surfactin has been shown to induce significant modifications in surfactin by Bacillus and could provide a low cost feedstock for the
the arrangement of the lipopeptide at the interface. production of this powerful surfactant. Foam fractionation proved
Table 3 shows the emulsification index (E24 ) for the C14 /Leu7
surfactin and synthetic surfactants SDS and Triton X. The puri-
fied surfactant was able to produce emulsions slightly more stable Table 3
when compared to those produced by Triton X or SDS. Never- Emulsifying activity of the C14 /Leu7 surfactin, SDS and Triton X against different
hydrocarbons.
theless, the C14 /Leu7 surfactin demonstrated a high emulsifying
capacity, exhibiting E24 values of 67.6% and 59.1% against crude oil Emulsification index EI24 (%)
and kerosene, respectively. The C14 /Leu7 surfactin exhibited also Hydrocarbons Surfactin (C14 /Leu7 ) SDSa Triton Xb
good emulsifying capacity against the other hydrocarbons tested
Tridecane 56.8 ± 0.6 50.0 ± 0.5 49.5 ± 1.4
(Table 3). The results produced by the C14 /Leu7 surfactin were
Pristane 55.6 ± 1.9 52.8 ± 1.0 49.2 ± 0.8
similar to those by Haddad et al. [42], who reported that the bio- Diesel 55 ± 0.3 54.3 ± 0.6 49.5 ± 0.4
surfactant produced by B. subtilis HOB2 yielded an emulsification Kerosene 59.1 ± 0.4 50.1 ± 1.9 50 ± 0.9
index of 68% with kerosene, and Nitschke and Pastore [43], who Hexadecene 55 ± 0.8 50.0 ± 0.2 49.1 ± 0.9
Toluene 49.6 ± 1.4 49.5 ± 1.4 50 ± 0.3
reported the ability of a biosurfactant produced by B. subtilis LB5a to
Heptane 52.8 ± 1.6 52 ± 2.0 45.7 ± 0.9
emulsify various hydrocarbons, showing an E24 value of 69% against Benzene 53.2 ± 2.2 46.1 ± 0.9 46.8 ± 1.3
crude oil. The emulsification capacity observed for biosurfactants Tetradecane 58 ± 0.3 51 ± 1.0 49.5 ± 0.5
produced by B. subtilis LSFM-05 suggests its application in the oil Crude oil 67.6 ± 1.0 44.3 ± 0.7 46.5 ± 0.2
industry for cleaning the sludge in storage tanks, oil mobilization, a
Sodium dodecyl sulfate (0.1 g/L).
and MEOR (microbial enhanced oil recovery), or in the medical b
Triton X: concentration of 0.1% (v/v).
A.F. de Faria et al. / Process Biochemistry 46 (2011) 1951–1957 1957

to be an effective method for surfactin recovery. However, further [18] Liu X-Y, Yang S-Z, Mu B-Z. Production and characterization of a C15 -surfactin-O-
studies are needed to optimize the fermentation parameters to methyl ester by a lipopeptide producing strain Bacillus subtilis HSO121. Process
Biochem 2009;44:1144–51.
improve the rate and yield of surfactin production by B. subtilis [19] Snook ME, Mitchell T, Hinton DM, Bacon CW. Isolation and characteriza-
LSFM-05. The ESI-FTMS and NMR analyses demonstrated that the tion of leu7 -surfactin from the endophytic bacterium Bacillus mojavensis
C14 /Leu7 surfactin contained 14 carbons in its fatty acid chain and RRC 101, a biocontrol agent for Fusarium verticillioides. J Agric Food Chem
2009;l57:4287–92.
an esterified glutamic acid residue, differing from the commercially [20] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The clustral X
available surfactin obtained from Sigma–Aldrich. windows interface: flexible strategies for multiple sequence alignment aided
by quality analysis tools. Nucleic Acids Res 1997;24:4876–82.
[21] Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: molecular evolutionary
Acknowledgments genetics analysis software, Arizona State University, Tempe, Arizona, USA.
Bioinformatics 2001;17:1244–5.
This research was supported by a grant from CNPq (National [22] Kimura M. A simple model for estimating evolutionary rates of base sub-
stitutions through comparative studies of nucleotide sequences. J Mol Evol
Council for Technological and Scientific Development) and FAPESP
1980;16:111–20.
(São Paulo State Research Foundation). The authors are grateful to [23] Saitou N, Nei M. The neighbor-joining method: a new method for reconstruct-
Granol. Ltda – Industrial Unit at Anápolis-Goiás-Brazil, for donating ing phylogenetic trees. Mol Biol Evol 1987;4:406–25.
[24] López EF, Gómez EF. Simultaneous determination of the major organic acids,
the raw glycerol samples used in the development of this work.
sugar, glycerol and ethanol by HPLC in grape musts and white wines. J Chro-
matogr Sci 1996;34:254–7.
Appendix A. Supplementary data [25] Cooper DG, Macdonald CR, Duff SJB, Kosaric N. Enhanced production of surfactin
from Bacillus subtilis by continuous product removal and metal cation additions.
Appl Environ Microbiol 1981;42:408–12.
Supplementary data associated with this article can be found, in [26] Blackwood KS, Turenne CY, Harmsen D, Kabani AM. Reassessment of
the online version, at doi:10.1016/j.procbio.2011.07.001. sequence-based targets for identification of Bacillus species. J Clin Microbiol
2004;42:1626–30.
[27] Llarch À, Logan NA, Castellví J, Prieto MJ, Guinea J. Isolation and characteriza-
References tion of thermophilic Bacillus spp. from geothermal environmental on deception
island, south shetland archipelago. Microb Ecol 1997;34:58–65.
[1] Mulligan CN. Recent advances in the environmental applications of biosurfac- [28] De Clerck E, Rodrigues-Diaz M, Forsyth G, Lebbe L, Logan NA, DeVos P. Polypha-
tants. Curr Opin Colloid Interface Sci 2009;14:372–8. sic characterization of Bacillus coagulans strains, illustrating heterogeneity
[2] Banat IM, Frazetti A, Gandolfi I, Bestetti G, Martinotti MG, Fracchia L, et al. Micro- within this species, and emended description of the species. System Appl
bial biosurfactant production, applications and future potential. Appl Microbiol Microbiol 2004;27:50–60.
Biotechnol 2010;87:427–44. [29] Noah KS, Fox SL, Bruhn DF, Thompson DN, Bala GA. Development of continuous
[3] Makkar RS, Cameotra SS. Biosurfactant production by microorganism on surfactin production from potato process effluent by Bacillus subtilis in an airlift
uncoventional carbon sources. J Surfact Deterg 1999;2:237–41. reactor. Appl Biochem Biotechnol 2002;9:8–100, 803-813.
[4] Nawawi WMFW, Jamal P, Alam MdZ. Utilization of sludge palm oil as a novel [30] Koch V, Rüffner HM, Schügerl K, Innertsberger E, Menzel H, Weis J. Effect of
substrate for biosurfactant production. Bioresour Technol 2010;101:9241–7. antifoam agents on the medium and microbials cells properties and process
[5] Barros FFC, Ponezi AN, Pastore GM. Production of biosurfactant by Bacillus sub- performance in small an large bioreactors. Process Biochem 1995;30:435–46.
tilis LB5a on a pilot scale using cassava wastewater as substrate. J Ind Microbiol [31] Makkar RS, Cameotra SS. Synthesis of enhanced biosurfactant by Bacillus subtilis
Biotechnol 2008;35:1071–8. MTCC 2423 at 45 ◦ C by foam fractionation. J Surfact Deterg 2001;4:355–7.
[6] Sobrinho HBS, Rufino RD, Luna JM, Salgueiro AA, Campos-Takaki GM, Leite [32] Chen C-Y, Baker SC, Darton RC. Continuous production of biosurfactant with
LFC, et al. Utilization of two agroindustrial by-products for the production foam fractionation. J Chem Technol Biotechnol 2006;81:1915–22.
of a surfactant by Candida sphaerica UCP0995. Process Biochem 2008;43: [33] Davis DA, Lynch HC, Varley J. The application of foaming for the recovery of
912–7. surfactin from Bacillus subtilis ATCC 21332 cultures. Enzyme Microb Technol
[7] Reis FASL, Sérvulo EFC, de França FP. Lipopeptide surfactant production by 2000;28:346–54.
Bacillus subtilis grown on low-cost raw materials. Appl Biochem Biotechnol [34] Joshi S, Bharucha C, Desai AJ. Production of biosurfactant and antifungal
2004;115:899–912. compound by fermented food isolate Bacillus subtilis 20B. Bioresour Technol
[8] Morita T, Konishi M, Fukuoka T, Imura T, Kitamoto D. Microbial conver- 2008;99:4603–8.
sion of glycerol into glycolipid biosurfactants, mannosylerythitol lipids, by [35] Thaniyavarn J, Roongsawang N, Kameyama T, Haruki M, Imanaka T, Morikawa
a basidiomycete yeast, Pseudozyma antarctica JCM 10317T . J Biosci Bioeng M, et al. Production and characterization of biosurfactants from Bacillus licheni-
2007;104:78–81. formis F2.2. Biosci Biotechnol Biochem 2003;67:1239–44.
[9] Willke Th, Vorlop K-D. Industrial bioconversion of renewable resources [36] Tang J-S, Gao H, Hong K, Yu Y, Jiang M-M, Lin H-P, et al. Complete assign-
as an alternative to conventional chemistry. Appl Microbiol Biotechnol ments of 1 H and 13 C NMR spectra of nine surfactin isomers. Magn Reson Chem
2004;66:131–42. 2007;45:792–6.
[10] da Silva GP, Mack M, Contiero J, Glycerol: a promising and abundant carbon [37] Batrakov SG, Radionova TA, Esipov SE, Polyakov NB, Sheichenko VI,
source for industrial microbiology. Biotechnol Adv 2009;27:30–9. Shekhovtsova NV, et al. A novel lipopeptide, an inhibitor of bacterial adhe-
[11] Du W, Li W, Sun T, Chen X, Liu D. Perspectives for biotechnological production sion from the thermophilic and halotolerant subsurface Bacillus licheniformis
of biodiesel and impacts. Appl Microbiol Biotechnol 2008;79:331–7. strain 603. Biochim Biophys Acta 2003;1634:105–7.
[12] European Biodiesel Board, http://www.ebb-eu.org/stats.php [accessed May [38] Li Y, Yang S, Mu B. Structural characterization of lipopeptide methyl esters
2011]. produced by Bacillus licheniformis HSN 221. Chem Biodivers 2010;7:2065–75.
[13] Brazilian National Agency for Petroleum, Natural Gas and Biofuel (ANP), [39] Liu X-Y, Yang S-Z, Mu B-Z. Isolation and characterization of a C12 -lipopeptide
http://www.anp.gov.br/?pg=46827&m=&t1=&t2=&t3=&t4=&ar=&ps=&cache produced by Bacillus subtilis HSO 121. J Pept Sci 2008;14:864–75.
bust=1303320754755 [accessed May, 2011]. [40] Tang J-S, Zhao F, Gao H, Dai Y, Yao Z-H, Hong K, et al. Characterization and
[14] Pauchauri N, He B. Value-added utilization of crude glycerol from biodiesel online detection of surfactin isomers based on HPLC–MSn analyses and their
production: a survey of current research activities. In: American society of agri- inhibitory effects on the overproduction of nitric oxide and the release of TNF-␣
cultural and biologicals engineers meeting (ASABE), paper number: 066223. and IL-6 in LPS-induced macrophages. Mar Drugs 2010;8:2605–18.
2006. p. 1–16. [41] Peypoux F, Bonmatin J-M, Labbe H, Grangemard I, Das BC, Ptak M, et al.
[15] Rooney AP, Price NPJ, Ray KJ, Kuo T-M. Isolation and characterization of [Ala4]Surfactin, a novel isoform from Bacillus subtilis studied by mass and NMR
rhamnolipid-producing bacterial strains from a biodiesel facility. FEMS Micro- spectroscopies. Eur J Biochem 1994;224:89–96.
biol Lett 2009;295:82–7. [42] Haddad NIA, Wang J, Mu B. Identification of a biosurfactant producing strain:
[16] Das P, Mukherjee S, Sen R. Substrate dependent production of biosurfactants Bacillus subtilis HOB2. Protein Pept Lett 2009;16:7–13.
from a marine bacterium. Bioresource Technol 2009;100:1015–9. [43] Nitschke M, Pastore GM. Production and properties of a surfactant obtained
[17] Seydlová G, Svobodová J. Review of surfactin chemical properties and the from Bacillus subtilis grown on cassava wastewater. Bioresour Technol
potential biomedical applications. Cent Eur J Med 2008;3:123–33. 2006;97:336–441.