LifeSciencesPart-2 FifthEdition

Life Sciences
Fundamentals and Practice - II
Fifth edition
Pranav Kumar | Usha Mina

Life Sciences
Fundamentals and Practice – II
Fifth edition
Pranav Kumar
Former faculty,
Department of Biotechnology,
Jamia Millia Islamia,
New Delhi, India
Usha Mina
Senior Scientist,
CESCRA,
Indian Agricultural Research Institute (IARI),
New Delhi, India
Pathfinder Publication
New Delhi, India
Pranav Kumar
Former faculty,
Department of Biotechnology,
Jamia Millia Islamia,
New Delhi, India
Usha Mina
Senior Scientist,
CESCRA,
Indian Agricultural Research Institute (IARI),
New Delhi, India
Life Sciences Fundamentals and Practice, Fifth edition

ISBN: 978-81-906427-7-4 (paperback)
Copyright © 2015 by Pathfinder Publication, all rights reserved.
This book contains information obtained from authentic and highly

regarded sources. Reasonable efforts have been made to publish reliable data
and information, but the author and the publisher cannot assume responsibility
for the validity of all materials or for the consequences of their use.
No part of this book may be reproduced by any mechanical, photographic, or
electronic process, or in the form of a phonographic recording, nor it may be
stored in a retrieval system, transmitted, or otherwise copied for public or
private use, without written permission from the publisher.
Publisher : Pathfinder Publication

Production editor : Ajay Kumar
Copy editor : Jomesh Joseph
Illustration and layout : Pradeep Verma
Cover design : Pradeep Verma
Marketing director : Arun Kumar
Production coordinator : Murari Kumar Singh
Printer : Ronit Enterprises, New Delhi, India
Pathfinder Publication
A unit of Pathfinder Academy Private Limited, New Delhi, India.
www.pathfinderpublication.in
09350208235
Preface
Life Sciences have always been a fundamental area of science. The exponential increase in
the quantity of scientific information and the rate, at which new discoveries are made, require
very elaborate, interdisciplinary and up-to-date information and their understanding. This
fifth edition of Life sciences, Fundamentals and practice includes extensive revisions of the
previous edition. We have attempted to provide an extraordinarily large amount of information
from the enormous and ever-growing field in an easily retrievable form. It is written in clear
and concise language to enhance self-motivation and strategic learning skill of the students
and empowering them with a mechanism to measure and analyze their abilities and the confidence
of winning. We have given equal importance to text and illustrations. The fifth edition has
a number of new figures to enhance understanding. At the same time, we avoid excess
details, which can obscure the main point of the figure. We have retained the design elements
that have evolved through the previous editions to make the book easier to read. Sincere
efforts have been made to support textual clarifications and explanations with the help of
flow charts, figures and tables to make learning easy and convincing. The chapters have been
supplemented with self-tests and questions so as to check one’s own level of understanding.
We hope you will find this book interesting, relevant and challenging.
Acknowledgements
Our students were the original inspiration for the first edition of this book, and we remain
continually grateful to all of them, because we learn from them how to think about the life
sciences and how to communicate knowledge in most meaningful way. We thank, Neeraj
Tiwari, Diwakar Kumar Singh, Rahul Shukla and Ajay Kumar, reviewers of this book, whose
comment and suggestions were invaluable in improving the text. Any book of this kind requires
meticulous and painstaking efforts by all its contributors. Several diligent and hardworking
minds have come together to bring out this book in this complete form. This book is a team
effort, and producing it would be impossible without the outstanding people of Pathfinder
Publication. It was a pleasure to work with many other dedicated and creative people of
Pathfinder Publication during the production of this book, especially Pradeep Verma and
Rajnish Kumar Gupta.
Pranav Kumar
Usha Mina
iii
Contents
Chapter 01
Genetics
Classical genetics
1.1 Mendel’s principles 1
1.1.1 Mendel’s laws of inheritance 3
1.1.2 Incomplete dominance and codominance 7
1.1.3 Multiple alleles 8
1.1.4 Lethal alleles 10
1.1.5 Penetrance and expressivity 10
1.1.6 Probability 10
1.2 Chromosomal basis of inheritance 13
1.3 Gene interaction 14
1.3.1 Dominant epistasis 16
1.3.2 Recessive epistasis 17
1.3.3 Duplicate recessive epistasis 17
1.3.4 Duplicate dominant interaction 18
1.3.5 Dominant and recessive interaction 18
1.3.6 Genetic dissection to investigate gene action 20
1.3.7 Pleiotropy 21
1.4 Genetic linkage and gene mapping 21
1.4.1 Genetic mapping 25
1.4.2 Gene mapping from two point cross 27
1.4.3 Gene mapping from three point cross 27
1.4.4 Interference and coincidence 30
1.5 Tetrad analysis 31
1.5.1 Analysis of ordered tetrad 32
1.5.2 Analysis of unordered tetrad 34
1.6 Sex chromosomes and sex determination 35
1.6.1 Sex chromosome 35
1.6.2 Chromosomal basis of sex determination 36
1.6.3 Sex determination in humans 37
1.6.4 Genic balance theory of sex determination in Drosophila 38
1.6.5 Sex determination in plants 39
1.6.6 Non-chromosomal basis of sex determination 39
1.6.7 Mosaicism 39
1.6.8 Sex-linked traits and sex-linked inheritance 40
v
1.6.9 Sex-limited traits 41
1.6.10 Sex-influenced traits 41
1.6.11 Pedigree analysis 42
1.7 Quantitative inheritance 46
1.7.1 Quantitative trait locus analysis 49
1.7.2 Heritability 50
1.8 Extranuclear inheritance and maternal effect 50
1.8.1 Maternal effect 53
1.9 Cytogenetics 55
1.9.1 Human karyotype 55
1.9.2 Chromosome banding 56
1.9.3 Ploidy 57
1.9.4 Chromosome aberrations 59
1.9.5 Position effect 64
Molecular genetics
1.10 Genome 65
1.10.1 Genome complexity 66
1.10.2 Transposable elements 69
1.10.3 Gene 77
1.10.4 Introns 78
1.10.5 Acquisition of new genes 80
1.10.6 Fate of duplicated genes 80
1.10.7 Gene families 81
1.10.8 Human nuclear genome 83
1.10.9 Organelle genome 84
1.10.10 Yeast S. cerevisiae genome 85
1.10.11 E. coli genome 85
1.11 Eukaryotic chromatin and chromosome 85
1.11.1 Packaging of DNA into chromosomes 87
1.11.2 Histone modification 91
1.11.3 Heterochromatin and euchromatin 92
1.11.4 Polytene chromosomes 96
1.11.5 Lampbrush chromosomes 96
1.11.6 B-chromosomes 97
1.12 DNA replication 97
1.12.1 Semiconservative replication 97
1.12.2 Replicon and origin of replication 99
1.12.3 DNA replication in E. coli 101
1.12.4 Telomere replication 112
1.12.5 Rolling circle replication 113
1.12.6 Replication of mitochondrial DNA 114
1.13 Recombination 114
1.13.1 Homologous recombination 115
1.13.2 Site-specific recombination 120
vi
1.14 DNA repair 122
1.14.1 Direct repair 122
1.14.2 Excision repair 122
1.14.3 Mismatch repair 124
1.14.4 Recombinational repair 125
1.14.5 Repair of double strand DNA break 127
1.14.6 SOS response 128
1.15 Transcription 129
1.15.1 Transcription unit 130
1.15.2 Prokaryotic transcription 130
1.15.3 Eukaryotic transcription 136
1.15.4 Role of activator and co-activator 141
1.15.5 Long-range regulatory elements 142
1.15.6 DNA binding motifs 143
1.16 RNA processing 146
1.16.1 Processing of eukaryotic pre-mRNA 146
1.16.2 Processing of pre-rRNA 155
1.16.3 Processing of pre-tRNA 158
1.17 mRNA degradation 159
1.18 Regulation of gene transcription 160
1.18.1 Operon model 160
1.18.2 Tryptophan operon system 167
1.18.3 Riboswitches 171
1.19 Bacteriophage lambda : A transcriptional switch 172
1.20 Regulation of transcription in eukaryotes 175
1.20.1 Influence of chromatin structure on transcription 175
1.20.2 DNA methylation and gene regulation 177
1.20.3 Post-transcriptional gene regulation 179
1.21 RNA interference 180
1.22 Epigenetics 182
1.23 Genetic code 184
1.24 Protein synthesis 188
1.24.1 Incorporation of selenocysteine 201
1.24.2 Cap snatching 202
1.24.3 Translational frameshifting 202
1.24.4 Antibiotics and toxins 202
1.24.5 Post-translational modification of polypeptides 203
1.25 Mutation 206
1.25.1 Mutagen 211
1.25.2 Types of mutation 214
1.25.3 Fluctuation test 218
1.25.4 Replica plating experiment 219
1.25.5 Ames test 220
1.25.6 Complementation test 220
vii
1.26 Developmental genetics 222
1.26.1 Genetic control of embryonic development in Drosophila 222
1.26.2 Genetic control of vulva development in C. elegans 228
Chapter 02
Recombinant DNA technology
2.1 DNA cloning 235
2.2 Enzymes for DNA manipulation 237
2.2.1 Template-dependent DNA polymerase 237
2.2.2 Nucleases 237
2.2.3 End-modification enzymes 241
2.2.4 Ligases 243
2.2.5 Linkers and adaptors 243
2.3 Vectors 246
2.3.1 Vectors for E. coli 247
2.3.2 Cloning vectors for yeast, S. cerevisiae 252
2.3.3 Vectors for plants 253
2.3.4 Vectors for animals 257
2.4 Introduction of DNA into the host cells 257
2.4.1 In bacterial cells 257
2.4.2 In plant cells 257
2.4.3 In animal cells 260
2.5 Selectable and screenable marker 263
2.6 Selection of transformed bacterial cells 264
2.7 Recombinant screening 265
2.8 Expression vector 267
2.8.1 Expression system 268
2.8.2 Fusion protein 269
2.9 DNA library 269
2.10 Polymerase chain reaction 272
2.11 DNA sequencing 276
2.12 Genome mapping 280
2.12.1 Genetic marker 280
2.12.2 Types of DNA markers 281
2.12.3 Physical mapping 285
2.12.4 Radiation hybrids 287
2.13 DNA profiling 288
2.14 Genetic manipulation of animal cells 289
2.14.1 Transgenesis and transgenic animals 289
2.14.2 Gene knockout 291
2.14.3 Formation and selection of recombinant ES cells 293
2.15 Nuclear transfer technology and animal cloning 294
2.16 Gene therapy 295
viii
2.17 Transgenic plants 300
2.17.1 General procedure used to make a transgenic plant 300
2.17.2 Antisense technology 303
2.17.3 Molecular farming 304
2.18 Plant tissue culture 305
2.18.1 Cellular totipotency 305
2.18.2 Tissue culture media 305
2.18.3 Types of cultures 307
2.18.4 Somaclonal and gametoclonal variation 312
2.18.5 Somatic hybridization and cybridization 312
2.18.6 Applications of cell and tissue culture 313
2.19 Animal cell culture 316
2.19.1 Primary cultures 316
2.19.2 Cell line 316
2.19.3 Growth cycle 318
2.19.4 Culture media 319
Chapter 03
Plant Physiology
3.1 Plant-water relationship 325
3.1.1 Diffusion and osmosis 325
3.1.2 Chemical potential of water and water potential 327
3.1.3 Mass flow 329
3.2 Absorption and radial movement of water 329
3.2.1 Absorption of water 329
3.2.2 Soil water 331
3.2.3 Radial movement of water from root surface to the tracheary element 331
3.2.4 Root pressure 332
3.3 Ascent of sap 332
3.3.1 Xylem anatomy 333
3.3.2 Mechanism of ascent of sap 333
3.4 Transpiration 334
3.4.1 Mechanism of stomatal opening and closing 335
3.4.2 Factors influencing transpiration 337
3.4.3 Guttation 337
3.5 Absorption and radial movement of mineral nutrients 338
3.6 Mineral nutrition 339
3.6.1 Liebig’s law of the minimum 343
3.6.2 Nitrogen cycle 343
3.6.3 Nitrogen assimilation 344
3.6.4 Biological nitrogen fixation 346
3.7 Translocation in the phloem 349
3.7.1 Allocation and partitioning of photoassimilates 352
ix
3.8 Plant hormones 352
3.8.1 Auxin 353
3.8.2 Gibberellins 356
3.8.3 Cytokinins 359
3.8.4 Abscisic acid 360
3.8.5 Ethylene 361
3.8.6 Brassinosteroids 362
3.8.7 Strigolactones 363
3.8.8 Hormones signaling pathway 363
3.9 Photomorphogenesis 368
3.9.1 Phytochrome 368
3.9.2 Cryptochrome 371
3.9.3 Phototropin 372
3.9.4 Photoperiodism 373
3.9.5 Florigen 375
3.10 Vernalization 376
3.11 Flowering genes 376
3.12 Plants movements 379
3.13 Seed dormancy and Germination 382
3.14 Plant development 383
3.14.1 Pollination and Self-incompatibility 388
3.14.2 Asexual reproduction 389
3.14.3 Embryogenesis 390
3.15 Plant secondary metabolites 396
3.15.1 Terpenes 396
3.15.2 Phenolics 398
3.15.3 Glycosides 401
3.15.4 Alkaloids 401
Chapter 04
Human Physiology
4.1 Tissues 407
Epithelial tissue 407
Connective tissue 411
Nervous tissue 414
Muscular tissues 415
4.1.1 Organ systems of the human body 416
4.2 Nervous systems 417
4.2.1 Histology of nervous tissue 418
4.2.2 Structural organization of CNS 421
4.2.3 Major parts of the brain 423
4.2.4 Spinal cord 426
4.2.5 Peripheral nervous system 430
4.2.6 Autonomic nervous system 431
x
4.3 Sensory organs 435
4.3.1 Eye 435
4.3.2 Ear 441
4.4 Endocrine system 444
4.4.1 Hypothalamus 445
4.4.2 Pituitary gland 447
4.4.3 Pineal gland 449
4.4.4 Thyroid gland 449
4.4.5 Parathyroid gland 450
4.4.6 Thymus gland 450
4.4.7 Pancreas 450
4.4.8 Adrenal glands 453
4.4.9 Gonadal hormone 455
4.4.10 Hormones from kidney, heart, placenta and gastrointestinal tract 456
4.4.11 General mechanisms of hormone action 457
4.4.12 Hormones and diseases 459
4.5 Respiratory system 461
4.5.1 Respiratory organs 461
4.5.2 Mechanics and breathing 465
4.5.3 Respiratory volumes and capacities 467
4.5.4 Exchange of oxygen and carbon dioxide 469
4.5.5 Transport of oxygen and carbon dioxide 471
4.5.6 Control of respiration 475
4.5.7 Chemoreceptor 476
4.5.8 Disorders of respiratory system 476
4.6 Cardiovascular system 477
4.6.1 Blood 477
4.6.2 Heart 483
4.6.3 Blood vessels 490
4.6.4 Circulatory routes 494
4.6.5 Lymphatic system 497
4.6.6 Intracellular and extracellular fluid 498
4.6.7 Cardiovascular disorders 498
4.7 Digestive System 499
4.7.1 Gastrointestinal tract 499
4.7.2 Accessory digestive organs 508
4.7.3 Digestion of foods 511
4.7.4 Absorption of foods 514
4.7.5 Regulation of digestive function 516
4.8 Excretory System 517
4.8.1 Structure of the kidneys 518
4.8.2 Nephron 520
4.8.3 Urine formation 523
4.8.4 Atrial Natriuretic peptide 530
4.8.5 Countercurrent exchange 533
xi
4.9 Reproductive system 534
4.9.1 Male reproductive system 534
4.9.2 Female reproductive system 537
4.9.3 Female reproductive cycle 540
4.10 Embryonic development 543
4.10.1 Fertilization 543
4.10.2 A generalized pattern of early development 546
4.11 Regeneration 550
Chapter 05
Ecology
5.1 What is Ecology? 557
5.2 Environment 558
5.3 Adaptation and Acclimatization 560
5.4 Shelford’s law of tolerance 562
5.5 Ecological species concept 563
5.6 Habitat and niche 563
5.7 The ecosystem concept 565
5.7.1 Ecosystem components 565
5.7.2 Ecosystem function 566
5.7.3 Productivity 566
5.7.4 Energy flow 568
5.7.5 Concept of the trophic level 569
5.7.6 Food chains 570
5.7.7 Energy flow model 571
5.7.8 Transfer efficiencies 572
5.7.9 Ecological pyramid 573
5.7.10 Nutrient cycling 574
5.7.11 Decomposition 578
5.7.12 Controls on ecosystem function 578
5.7.13 Types of Ecosystems 579
5.8 Biomes 583
5.9 Population ecology 586
5.9.1 Population characteristics 587
5.9.2 Population growth 590
5.9.3 r-strategists and K-strategists 594
5.10 Biotic community 596
5.10.1 Ecological characteristics 597
5.10.2 Island biogeography 599
5.10.3 Nature and structure of community 600
5.10.4 Ecological interdependence and interactions 602
5.11 Succession 609
5.11.1 Types of succession 611
xii
5.11.2 Mechanism of succession 612
5.11.3 Theories interpreting climax 613
5.11.4 Model of succession 614
5.11.5 Hydrarch and Xerarch succession 615
5.12 Biodiversity 617
5.12.1 Levels of biodiversity 617
5.12.2 Components and gradients of biodiversity 617
5.12.3 Uses of biodiversity 618
5.12.4 Threats to biodiversity 619
5.12.5 Extinction of species 619
5.12.6 Conservation of biodiversity 622
5.12.7 Biogeographic classification of India 623
5.13 Behavioural ecology 625
5.14 Environmental pollution 629
5.14.1 Air pollution 629
5.14.2 Greenhouse effect 631
5.14.3 Stratospheric ozone 632
5.14.4 Acid rain 633
5.14.5 Water pollution 634
5.14.6 Bioaccumulation and biomagnification 634
5.14.7 Eutrophication 635
5.14.8 Soil pollution 635
5.15 Bioremediation 636
Chapter 06
Evolution
6.1 Origin of Life 641
6.2 Theories of evolution 646
6.2.1 Lamarckism 646
6.2.2 Darwinism 647
6.3 Evidences of evolution 651
6.4 Natural selection 653
6.5 Pattern of evolution 656
6.6 Population genetics 657
6.6.1 Calculation of allelic frequencies 658
6.6.2 Hardy-Weinberg Law 658
6.7 Species and speciation 665
6.8 Evolutionary forces involved in speciation 669
6.9 Pattern of evolutionary changes 671
6.10 Nature of evolution 671
6.11 Molecular phylogeny 672
Answers of self test 683
Index 684
xiii
Chapter 01
Genetics
All living organisms reproduce. Reproduction results in the formation of offspring of the same kind. However, the
resulting offspring need not and, most often, does not totally resemble the parent. Several characteristics may
differ between individuals belonging to the same species. These differences are termed variations. The mechanism
of transmission of characters, resemblances as well as differences, from the parental generation to the offspring,
is called heredity. The scientific study of heredity, variations and the environmental factors responsible for these,
is known as genetics (from the Greek word genno = give birth). The word genetics was first suggested to describe
the study of inheritance and the science of variation by prominent British scientist William Bateson.
Genetics can be divided into three areas: classical genetics, molecular genetics and evolutionary genetics. In
classical genetics, we are concerned with Mendel’s principles, sex determination, sex linkage and cytogenetics.
Molecular genetics is the study of the genetic material: its structure, replication and expression, as well as the
information revolution emanating from the discoveries of recombinant DNA techniques. Evolutionary genetics is the
study of the mechanisms of evolutionary change or changes in gene frequencies in populations (population genetics).
Classical genetics
1.1 Mendel’s principles
Gregor Johann Mendel (1822–1884), known as the Father of Genetics, was an Austrian monk. In 1856, he published
the results of hybridization experiments titled Experiments on Plant Hybrids in a journal “The proceeding of the
Brunn society of natural history” and postulated the principles of inheritance which are popularly known as Mendel’s
laws. But his work was largely ignored by scientists at that time. In 1900, the work was independently rediscovered
by three biologists - Hugo de Vries of Holland, Carl Correns of Germany and Erich Tschermak of Austria. Mendel did
a statistical study (he had a mathematical background). He discovered that individual traits are inherited as discrete
factors which retain their physical identity in a hybrid. Later, these factors came to be known as genes. The term
was coined by Danish botanist Wilhelm Johannsen in 1909. A gene is defined as a unit of heredity that may
influence the outcome of an organism’s traits.
Mendel’s experiment
Mendel chose the garden pea, Pisum sativum, for his experiments since it had the following advantages.
1. Well-defined discrete characters
2. Bisexual flowers
3. Predominant self fertilization
4. Easy hybridization
5. Easy to cultivate and relatively short life cycle
1
Genetics
Characters studied by Mendel
The characteristics of an organism are described as characters or traits. Traits studied by Mendel were clear cut and
discrete. Such clear-cut, discrete characteristics are known as Mendelian characters. Mendel studied seven characters/
traits (all having two variants) and these are:
Dominant Recessive
1. Stem length Tall Dwarf
2. Flower position Axial Terminal
3. Flower color Violet White
Seed coat color Grey White
4. Pod shape Inflated Constricted
5. Pod color Green Yellow
6. Cotyledon color Yellow Green
7. Seed form Round Wrinkled
Flower color is positively correlated with seed coat colors. Seeds with white seed coats were produced by plants
that had white flowers and those with gray seed coats came from plants that had violet flower.
Allele
Each gene may exist in alternative forms known as alleles, which code for different versions of a particular inher-
ited character. We may also define alleles as genes occupying corresponding positions on homologous chromo-
somes and controlling the same characteristic (e.g. height of plant) but producing different effects (tall or short).
The term homologous refers to chromosomes that carry the same set of genes in the same sequence, although
they may not necessarily carry identical alleles of each gene.
Wild-type versus Mutant alleles

Prevalent alleles in a population are called wild-type alleles. These alleles typically encode proteins that are made
in the right amount and function normally. Alleles that are present at less than 1% in the population and have been
altered by mutation are called mutant alleles. Such alleles usually result in a reduction in the amount or function of
the wild-type protein and are most often inherited in a recessive fashion.
Dominant and Recessive alleles

A dominant allele masks or hides expression of a recessive allele and it is represented by an uppercase letter. A
recessive allele is an allele that exerts its effect only in the homozygous state and in heterozygous condition its
expression is masked by a dominant allele. It is represented by a lowercase letter.
Homozygous and Heterozygous

Each parent (diploid) has two alleles for a trait — they may be:
1. Homozygous, indicating they possess two identical alleles for a trait.
a. Homozygous dominant genotypes possess two dominant alleles for a trait (T T ).
b. Homozygous recessive genotypes possess two recessive alleles for a trait (tt).
2. Heterozygous genotypes possess one of each allele for a particular trait (Tt).
2
This page intentionally left blank.
Genetics
1.2 Chromosomal basis of inheritance

In 1902, Walter S. Sutton and T. Boveri proposed the chromosomal theory of heredity. The theory provides a way
to explain how the cellular transmission or chromosomes passes genetic determinant (i.e. genes) from parent to
offspring. According to this view:
1. Chromosome contains the genetic material (genes) that is transmitted from parent to offspring.
2. Chromosomes are replicated and passed along generation after generation from parent to offspring.
3. The nuclei of most eukaryotic cells contain chromosomes that are found in homologous pairs (i.e. they are
diploid). One member of each pair is inherited from the mother, the other from the father. At meiosis, one of the
two members of each pair segregates into one daughter nucleus and the other segregates into different
daughter nucleus. Therefore, gametes contain one set of chromosomes (i.e. they are haploid) as shown in
figure 1.6.
4. During gamete formation, different types of chromosomes segregate independently of each other.
5. Each parent contributes one set of chromosomes to its offspring.
Hence, the chromosome theory of inheritance describes the relationship between Mendel’s Law and chromosomal
transmission.
Heterozygous (Yy) diploid cell

from a plant with yellow seeds
y y Y Y
Meiosis I
y y Y Y
y y Y Y
Meiosis II
y y Y Y
Possible haploid gametes
Figure 1.6 Segregation of homologous chromosome during meiosis explains Mendel’s law of segregation.
13
Genetics
r y
r y Heterozygous (YyRr) diploid cell

R Y from a plant with round yellow seeds
R Y
Meiosis I
r Y r y
r Y r y
R y R Y
R y R Y
r R r R
r R r R
Y y y Y
Y y y Y
Meiosis II
Y r Y r y R y R y r y r Y R Y R
Possible haploid gametes
Figure 1.7 Random alignment of bivalents during prophase of meiosis I explains Mendel’s law of independent
assortment.
1.3 Gene interaction

According to Mendel, genes are functioning independently of each other i.e. each of seven traits considered was
controlled by a single gene. But many traits of an organism are determined by the complex contribution of many
different genes. When two or more different genes (non-allelic) influence the outcome of single trait, this is known
as a gene interaction.
The first case of two different genes interacting to affect a single trait was discovered by William Bateson and
Reginald Punnett in 1906. They discovered an unexpected gene interaction when they studied crosses involving the
sweet pea, Lathyrus odoratus. When they crossed true breeding purple flowered plant to a true breeding white
flowered plant, the F1 generation was all purple flowered plants and the F2 generation (produced by self fertilization
of the F1 generation) contained purple and white flowered plants in a 3 : 1 ratio. But when they crossed two
different varieties of white flowered plants then all F1 generation plants had purple flowers. When these purple
flower plants were allowed to self fertilized, the F2 generation contained purple and white flowers in a ratio of
9 purple : 7 white. How can this unexpected result be explained? This surprising result was explained by Bateson
14
Genetics
Table 1.3 Comparison between dominance and epistasis

Dominance Epistasis
Allelic suppression. Non-allelic suppression.
It involves a single pair of alleles. It involves two pairs of alleles.
A gene suppresses the expression of its allele. A gene suppresses the expression of its non-allele.
The effect of a recessive allele is suppressed. Epistatic allele suppresses the effect of both dominant
and recessive non-allele.
The effect is only due to dominant allele. It may be due to dominant or recessive allele.
Now the term epistasis has come to be synonymous with almost any type of gene interaction that involves the
masking or modifying of one of the gene effects. When epistasis is operative between two gene loci, the number of
phenotypes appearing in the offspring will be less than four (normal F2 phenotypic classes in case of dihybrid
crosses is four, 9 : 3 : 3 : 1). Such bigenic (two genes) epistatic interactions may be of several types.
1.3.1 Dominant epistasis

When the dominant allele of one gene masks the effects of either allele of the second gene, it is termed as dominant
epistasis. When the dominant allele at one locus, for example, the A allele produces a certain phenotype regardless
of the allelic condition of the other locus, then the A locus is said to be epistatic to the B locus. Furthermore, since
the dominant allele A is able to express itself in the presence of either B or b, this is a case of dominant epistasis.
Only when the genotype of the individual is homozygous recessive at the epistatic locus (aa), can the alleles of the
hypostatic locus (B or b) be expressed. Thus the genotypes A-B- and A-bb produce the same phenotype, whereas
aaB- and aabb produce 2 additional phenotypes. The classical 9 : 3 : 3 : 1 ratio becomes modified into a 12 : 3 : 1 ratio.
Explanation : Let us take the following case, in which F2 phenotypic ratio is 12 Purple : 3 Red : 1 White.
Parent 1 Parent 2
AA bb aa BB
(Purple) (Red)
F1
AaBb
(Purple)
F2
12 Purple : 3 Red : 1 White
In this example, two non-allelic genes are interacting because the F2 phenotypic classes obtained is less than 4.
This phenotypic ratio can be explained by following consideration:
Enzyme A
Purple product
White substance
Red product
Enzyme B
In this case, enzymes A and B compete for the same substrate. Enzyme A, which converts the substrate to a purple
product, has much higher affinity for substrate than enzyme B, which converts the substrate to a red product. The
difference in the affinity for the substrate is so marked that enzyme B can only work effectively if no enzyme A is
present. So,
16
Genetics
AABB(1), AABb(2), AaBB(2) These have at least one functional allele A and convert all the substrates to
AaBb(4), AAbb(1), Aabb(2) purple product.
(Purple 12)
aaBB(2), aaBb(1) Lack any functional enzyme A, but have a functional enzyme B, which converts
(Red 3) the substrate to a red product.
aabb(1) Have no functional enzymes and cannot synthesize any colored pigment.
(White 1)
1.3.2 Recessive epistasis

In the case of recessive epistasis, in a pair of non-allelic genes, one produces its phenotypic effect independently
in a dominant state, but another cannot produce a phenotypic effect independently. However, the latter can produce
its effect when they are together in dominant state. For example, A and B are two non-allelic genes and A can
produce a phenotypic effect independently in dominant state, but second gene B cannot produce a phenotypic
effect independently. In this case, the recessive genotype aa suppresses the expression of alleles at the B locus.
But, in the presence of dominant allele at the A locus, the alleles of the B locus express. Thus the genotypes A-B-
and A-bb produce two additional phenotypes. The 9 : 3 : 3 : 1 ratio becomes a 9 : 3 : 4 ratio.
Explanation : Let us take the following case, in which F2 phenotypic ratio is 9 Purple : 3 Red : 4 White.
Parent 1 Parent 2
AA bb aa BB
(Red) (White)
F1
AaBb
(Purple)
F2
9 purple : 3 red : 4 white
In this example, the biochemical pathway would again be a simple chain, but the product of enzyme A would be red
in color.
Enzyme A Enzyme B
White substance Red product Purple product
AABB(1), AaBB(2), AABb(2), AaBb(4) have at least one functional copy of both A and B and therefore can
(Purple 9) synthesize the purple pigment.
AAbb(2), Aabb(1) have only functional enzyme A and produce red pigment but do not
(Red 3) convert it to purple pigment.
aaBB(2), aaBb(1) have no functional enzyme A and so cannot synthesize the red product
that is the substrate for enzyme B and will remain white.
aabb(1) have no functional enzymes and cannot synthesize the purple pigment.
(White 4)
1.3.3 Duplicate recessive epistasis

If two non-allelic genes are involved in a specific pathway and functional products from both are required for
expression, then one homozygous recessive allele at either allelic pair would result in the mutant phenotype. In
such case, the genotype aaBB, aaBb, AAbb and aabb produce one phenotype and genotype AABB, AaBB, AABb,
AaBb produce another phenotype (9 : 7). Because both dominant alleles complement each other for the correct
phenotype, these non-allelic genes are called complementary genes. Hence, this interaction is also termed as
complementary gene interaction.
17
Genetics
1.6.5 Sex determination in plants

Vascular plants show a variety of sexual arrangements. Dioecious species are the ones showing animal-like sexual
dimorphism, with female plants bearing flowers containing only ovaries and male plants bearing flowers containing
only anthers. Some, but not all, dioecious plants have a non-identical pair of chromosomes associated with (and
almost certainly determining) the sex of the plant. Of the species with non-identical sex chromosomes, a large
proportion have an XY system. For example, the dioecious plant Melandrium album has 22 chromosomes per cell:
20 autosomes plus 2 sex chromosomes, with XX females and XY males. Other dioecious plants have no visibly
different pair of chromosomes; they may still have sex chromosomes but not visibly distinguishable types.
1.6.6 Non-chromosomal basis of sex determination

Sex is also determined by environmental variables (such as temperature) and location. In many species, sex is
determined by the temperature at which the egg is incubated during a temperature sensitive period and cannot be
predicted by zygotic genotype. This peculiar mechanism is termed temperature-dependent sex determination.
The temperature dependent sex determination has been shown to exist in all crocodiles and the majority of turtles
along with a few species of lizards. In these reptiles, the temperature of the eggs during a certain period of
development is the deciding factor in determining sex, and small changes in temperature can cause dramatic
changes in the sex ratio. Often, eggs incubated at low temperatures produce one sex, whereas eggs incubated at
higher temperatures produce the other.
There are several hypotheses concerning the physiological control of sex determination by temperature, but there
is little conclusive evidence in support of molecular basis involved. In some species, sex steroid hormones serve as
an important factor for male and female sex determination. It appears that the enzyme aromatase (which can
convert testosterone into estrogen) is important in temperature dependent sex determination in turtle. The activity
of aromatase or its synthesis is temperature sensitive. Aromatase activity is higher at female- than at male-
producing temperatures.
1.6.7 Mosaicism
Mosaicism is a condition in which cells within the same individual have a different genetic makeup. Individuals
showing mosaicism are referred to as mosaics. Mosaicism can be caused by DNA mutations, epigenetic alterations
of DNA, chromosomal abnormalities (change in chromosome number and structure) and the spontaneous reversion
of inherited mutations. Mosaicism can be associated with changes in either nuclear or mitochondrial DNA. An
individual with two or more cell types, differing in chromosome number or structure is either a mosaic or a chimera.
If the two cell types originated from a single zygote, the individual is a mosaic, and when originated from two or
more zygotes that subsequently fused, the individual is a chimera.
Mosaicism can exist in both somatic cells (somatic mosaicism) and germ line cells (germline mosaicism). As their
names imply, somatic and germ line mosaicism refer to the presence of genetically distinct groups of cells within
somatic and germ line tissues, respectively. If the event leading to mosaicism occurs during development, it is
possible that both somatic and germ line cells will become mosaic. In this case, both somatic and germ line tissue
populations would be affected, and an individual could transmit the mosaic genotype to his or her offspring.
Conversely, if the triggering event occurs later in life, it could affect either a germ line or a somatic cell population.
If the mosaicism occurs only in a somatic cell population, the phenotypic effect will depend on the extent of the
mosaic cell population; however, there would be no risk of passing on the mosaic genotype to offspring. On the
other hand, if the mosaicism occurs only in a germ line cell population, the individual would be unaffected, but the
offspring could be affected.
How is somatic mosaicism generated? There are many possible reasons, including somatic mutations, epigenetic
changes in DNA, alterations in chromosome structure and/or number, and spontaneous reversal of inherited mutations.
In all of these cases, a given cell and those cells derived from it could exhibit altered function.
39
Genetics
1.6.8 Sex-linked traits and sex-linked inheritance

In an XY-chromosomal system of sex determination, both X and Y-chromosomes are sex chromosomes. In general,
genes on sex chromosomes are described as sex linked genes. However, the term sex linked usually refers to loci
found only on the X-chromosome; the term Y-linked is used to refer to loci found only on the Y-chromosome, which
control holandric traits (traits found only in males).
Cytogeneticists have divided the X and Y-chromosomes of some species into homologous and non-homologous
regions. The latter is called differential regions. These differential regions contain genes that have no counterparts
on the other sex chromosome. Genes in the differential regions are said to be hemizygous (half zygous). Genes
in the differential region of the X show an inheritance pattern called X-linkage; those in the differential region of
the Y show Y-linkage. Genes in the homologous region show what might be called X-and-Y linkage.
Another important feature of sex linked genes in XY-chromosomal system of sex determination is that females
have two X-chromosomes, they can have normal homozygous and heterozygous allelic combinations. But males,
with only one copy of the X-chromosome can be neither homozygous nor heterozygous. Hence the term hemizygous
is used for X-linked genes in males. Since only one allele is present, a single copy of a recessive allele can determine
the phenotype, a phenomenon called pseudodominance. This is the same way that one copy of a dominant
autosomal allele would determine the phenotype of a normal diploid organism; hence the term pseudodominance.
The genes on the differential regions of the sex chromosomes show patterns of inheritance related to sex. The
inheritance patterns of genes on the autosomes produce male and female progeny in the same phenotypic proportions,
as typified by Mendel’s data (for example, both sexes might show a 3:1 ratio). However, crosses following the
inheritance of genes on the sex chromosomes often show male and female progeny with different phenotypic
ratios. T.H.Morgan demonstrated the X-linked pattern of inheritance in Drosophila in 1910, when a white eyed male
appeared in a culture of wild type (red-eyed) flies.
Let’s look at an example from Drosophila. When white-eyed males are crossed with red-eyed females, all the
F1 progeny have red eyes, showing that the allele for white is recessive. Crossing the red-eyed F1 males and
females produces a 3:1 F2 ratio of red-eyed to the white-eyed flies, but all the white-eyed flies are males.
Female Male
Parents
Red eye × White eye
(wild type)
F1 generation Red eye Female and male
Crossing the red eyed F1 female and male
}
1
F2 generation All red eye Red eye
2
Male
Female 1
White eye
2
Figure 1.27 Pattern of inheritance of the white eye trait in Drosophila.
This inheritance pattern is explained by the alleles being located on the differential region of the X-chromosome;
in other words, by X-linkage.
In X-linked inheritance, the reciprocal cross gives a different result. A reciprocal cross between white-eyed females
and red-eyed males gives the F1 in which all the females are red eyed, but all the males are white eyed. The F2
consists of one-half red-eyed and one-half white-eyed flies of both sexes. Hence, in sex linkage, we see examples
not only of different ratios in different sexes, but also of differences between reciprocal crosses.
40
Genetics
1.9 Cytogenetics
A chromosome is an organized structure of DNA and protein that is found in the nucleus of a eukaryotic cell. The
study of the structure, function and abnormalities of chromosome is called cytogenetics, a discipline that combines
cytology with genetics.
1.9.1 Human karyotype

The number, sizes and shapes of the metaphase chromosomes constitute the karyotype or karyogram, which is
distinctive for each species. The useful karyotypic characteristics are: chromosome size, chromosome number, sex
chromosomes, centromere position, nucleolar organizer position, heterochromatin pattern, secondary constriction
and banding patterns. Karyotype consisting of a photograph or diagram of all the metaphasic chromosomes arranged
in homologous pairs according to decreasing length and position of centromere is described as idiogram.
Table 1.6 Symbol used in describing a karyotype

Symbol Meaning
p (petit) Short arm
q (queue) Long arm
13p Short arm of chromosome 13
13q Long arm of chromosome 13
del Deletion
del(2) Deletion in chromosome 2
dup Duplication
dup(1) Duplication in chromosome 1
inv Inversion
inv(4) Inversion in chromosome 4
t Translocation
t(2;5) Reciprocal translocation between a chromosome 2 and a chromosome 5
tel Telomere
cen Centromere
+ or – Indicate gain or loss of part of chromosome
2q– Deletion of the long arm of chromosome 2
Tijo and Levan (1956) of Sweden found that human cells have 23 pairs or 46 chromosomes. Of the 23 pairs, 22 are
perfectly matched in both males and females, and are called autosomes. The remaining pair, the sex chromosomes,
consists of two similar chromosomes in females and two dissimilar chromosomes in males. In human, females are
designated XX and males XY.
Denver system
According to ‘Denver system’ of classification, the 22 pairs of human chromosomes are placed in seven groups as;
Group Position of centromere Idiogram number
I (A) Metacentric or submetacentric 1, 2, 3
II (B) Submetacentric 4, 5
III (C) Submetacentric 6, 7, 8, 9, 10, 11, 12 and X
IV (D) Acrocentric 13, 14 and 15
V (E) Metacentric or submetacentric 16, 17 and 18
VI (F) Metacentric 19 and 20
VII (G) Metacentric 21, 22 and Y
55
Genetics
1.9.2 Chromosome banding

Chromosome banding is a cytological procedure of differential staining of mitotic chromosome along the longitudinal
axis. The differential staining reactions reflect the heterogeneity and complexity of the chromosome along its
length. The molecular mechanisms involved in producing the various banding patterns are not precisely defined.
Chromosome painting is different from banding. It refers to the hybridization of fluorescently labeled chromosome-
specific, composite probe pools to chromosome.
The most common methods of dye-based chromosome banding are G- (Giemsa), R- (reverse), C- (centromere)
and Q- (quinacrine) banding. Bands that show strong staining are referred to as positive bands; weakly staining
bands are negative bands. Features of commonly used banding techniques are described in the table 1.7.
Table 1.7 Chromosome banding techniques

Technique Procedure Banding pattern
G-banding Mild proteolysis with trypsin followed by staining Dark bands are AT-rich (gene poor)
with Giemsa (G stand for Giemsa). Pale bands are GC-rich (gene rich)
R-banding Heat denature followed by staining with Giemsa. Dark bands are GC-rich
Reverse of G-banding and R stand for Reverse. Pale bands are AT-rich
Q-banding Stain with Quinacrine mustard (a fluorescent stain). Dark bands are AT-rich
Q stands for Quinacrine. Pale bands are GC-rich
C-banding Denature with barium hydroxide and then stain with Dark bands contain constitutive
Giemsa. C stands for Constitutive heterochromatin. heterochromatin
Regions and bands

A region is an area that lies between two landmarks. Regions are divided into bands. A band is that part of a
chromosome that is distinctly different from the adjacent area by virtue of being lighter or darker in staining
intensity. Each band is approximately 5 to 10 megabase pairs of DNA that may include hundreds of genes. The
bands and the regions to which they belong are identified by numbers, with the centromere serving as the point of
reference for the numbering scheme. In designating a particular band, four items are required: the chromosome
number, the arm symbol, the region number and the band number within that region. A band within a region is
numbered in sequence with band 1 being nearest to the centromere.
p (Short arm)
Positive band
Negative band
Centromere
Variable band
Figure 1.36
q (Long arm)
Banding pattern of human

chromosome 1. Darkly staining regions
are called positive bands. Negative bands
do not stain and appear as light regions.
Some regions stain in chromosomes of
some individuals but not in others and
are called variable bands.
How do geneticists indicate the location of a gene? Geneticists use a standardized way of describing a gene’s
cytogenetic location. The combination of numbers and letters provides a gene’s address on a chromosome. This
56
Molecular genetics
1.10 Genome
Genome is the sum total of all genetic material of an organism which store biological information. The nature of the
genome may be either DNA or RNA. All eukaryotes and prokaryotes always have a DNA genome, but viruses may
either have a DNA genome or RNA genome. The eukaryotic genome consists of two distinct parts: Nuclear genome
and organelles (mitochondrial and chloroplast) genome. The nuclear genome consists of linear dsDNA. In a few
lower eukaryotes, double-stranded circular plasmid DNA (for example, 2-micron circle in yeast) is also present
within the nucleus.
The amount of DNA present in the genome of a species is called a C-value, which is characteristic of each species.
The value ranges from <106 bps as in smallest prokaryote, Mycoplasma to more than 1011 bps for eukaryotes such
as amphibians. The genomes of higher eukaryotes contain a large amount of DNA.
Flowering plants
Mammals
Reptiles
Birds
Amphibians
Fish
Echinoderms
Insects
Worms
Algae and fungi
6 7 8 9 10 11
10 10 10 10 10 10
Size of eukaryotic haploid genome (base pairs)
Figure 1.45 The DNA content of the haploid genome of a range of phyla. The range of values within a phylum
is indicated by the shaded area.
The DNA content of the organism’s genome is related to the morphological complexity of lower eukaryotes, but
varies extensively among the higher eukaryotes. In lower eukaryotic organisms like yeast, amount of DNA increases
with increasing complexity of organisms. However, in higher eukaryotes there is no correlation between increased
genome size and complexity. This lack of correlation between genome size and genetic complexity refers to
C-value paradox. For example, a man is more complex than amphibians in terms of genetic development, but
some amphibian cells contain 30 times more DNA than human cells. Moreover, the genomes of different species of
amphibians can vary 100-fold in their DNA contents.
65
Genetics
Table 1.9 Genome size in some eukaryotes

Organism Genome size (Mb)
S. cerevisiae (yeast) 12
A. thaliana (mustard plant) 120
D. melanogaster (fruit fly) 170
H. sapiens (human) 3,300
H. vulgare (barley) 5,300
1.10.1 Genome complexity

Genome complexity is the total length of different sequences of DNA. It can be measured through the renaturation
kinetics of denatured DNA. Renaturation of DNA occurs through complementary base pairing. Renaturation of DNA
depends on the random collision of the complementary strands, and follows second-order kinetics. A DNA renaturation
(reassociation) reaction is described by the Cot1/2. If large DNA is sheared into uniform fragments and allowed to
renature, then the rate of renaturation of denatured DNA is expressed as
dC 2
= − kC
dt
where k is the second-order rate constant. C is the concentration of single-stranded DNA at time t and the second
order rate equation for two complementary strands coming together is given by the rate of decrease in C.
Starting with a concentration, C0, of completely denatured DNA at t=0, the amount of single-stranded DNA remaining
at some time t is
C 1
=
C0 (1 + k.C0.t)
The time for half of the DNA to renature (when C/C0 = 0.5) is defined as t = t1/2. Then,
1
0.5 = and thus 1 + k.C0.t1/2 = 2, yielding
(1 + k.C0.t1 / 2 )
1
C0.t1 / 2 =
k
The product of C0 × t1/2 is called the Cot1/2. It is inversely proportional to the rate constant. Since the Cot1/2 is the
product of the concentration and time required to proceed halfway, a greater Cot1/2 implies a slower reaction. The
renaturation of DNA usually is followed in the form of a Cot curve. A graph of the fraction of single-stranded DNA
reannealed (1 – C/C0) as a function of Cot on a semilogarithmic plot is referred to as a Cot curve.
5 6
Genome size 1 3500 1.7×10 4.2×10 bp
100%
Poly U:polyA MS2 T4 E.coli
Fraction
reassociated
0 –6 –4 –2 2 Figure 1.46
10 10 10 1 10
Cot curve of dsDNA
–6
2×10 8×10
–3
3×10
–1
9 Cot1/2 from the indicated source.
66
Genetics
Solution
Extended length of DNA
Packaging ratio of DNA =
Packaging length
Genome size given = 2 × 107 bp
1 bp occupies = 0.34 nm
So, 2 × 107 bp occupy = 2 × 107 × 0.34 = 0.68 × 107 nm = 6800 μm
Packaged size of chromosome = 4 μm
6800
Hence, packaging ratio = = 1700
4
1.11.4 Polytene chromosomes

Polytene chromosomes (also known as giant chromosomes) were discovered by Balbiani in 1881 in larval salivary
glands of Chironomus. Polytene chromosomes are specialized interphase chromosomes present in certain insect
cells. Cells with polytene chromosomes differ from mitotically dividing cells. These cells undergo repeated rounds
of DNA replication without cell division (endomitosis). In this case the cell cycle consists of just two periods,
synthetic and intersynthetic. At the end of each replication period, daughter chromatids do not segregate, rather,
they remain paired with each other to different degrees.
Polyteny has been most studied in the salivary gland cells of Drosophila larvae, in which the DNA in each of the four
Drosophila chromosomes has been replicated through 10 cycles without separation of the daughter chromosomes,
so that 1024 (210) identical strands of chromatin are lined up side by side. When polytene chromosomes are viewed
in the light microscope after staining, distinct alternating dark bands and light interbands are visible. About 95% of
the DNA in polytene chromosomes is in bands, and 5% is in interbands. The chromatin in each band appears dark,
either because it is much more condensed than the chromatin in the interbands, or because it contains a higher
proportion of proteins, or both. Both bands and interbands in polytene chromosomes contain genes. Bands that are
sites of gene expression expand to give puffs (Balbiani rings). It consists of a region in which the chromosome
fibers unwind from their usual state of packing in the band. The puffs are sites where RNA is being synthesized. A
characteristic pattern of puffs is found in each tissue at any given time.
Organs containing cells with polytene chromosomes are, as a rule, involved in intense secretory functions
accomplished during a short time against a background of rapid growth. The features of polyteny provide the
conditions necessary to accomplish these functions.
1.11.5 Lampbrush chromosomes

Lampbrush chromosome was first observed by Flemming in 1882 in amphibian oocytes. It develops during the
diplotene stage of meiotic prophase during oogenesis in oocytes of many animal species (except mammals). The
lampbrush chromosomes are meiotic bivalent, each consisting of two pairs of sister chromatids held together by
chiasmata. The loop as shown in the figure 1.75 is an extruded segment of DNA that is being actively transcribed.
The lateral loops extend in pairs, one from each sister chromatid. The loops are surrounded by a matrix of
ribonucleoproteins that contain nascent RNA chains. Lampbrush chromosomes are thought to assist in fulfilling the
high demand for transcripts during oogenesis.
96
Genetics
Maternal chromosome
Paternal chromosome
Chromomere
Enlarged section of
a chromosome
Chromatin loop
Chromatin
loop
Chromatid
Chromatid
Chromomere
Figure 1.75 Lampbrush chromosome structure. Most of the DNA in each chromosome remains highly
condensed in the chromomeres. Each of the two chromosomes shown consists of two closely apposed sister
chromatids. This four stranded structure is characteristic of diplotene stage of meiosis.
1.11.6 B-chromosomes
The B-chromosomes (also referred to as supernumerary or accessory chromosomes) are additional (extra)
chromosomes that are present in some individuals in some species. In eukaryotic cells normal chromosomes are
termed as A-chromosomes. Most B-chromosomes are mainly or entirely heterochromatic and genetically inert.
They are thought to be selfish genetic elements with no defined functions. The evolutionary origin of B-chromosomes
is not clear, but presumably they must have been derived from heterochromatic segments of normal A-chromosomes.
1.12 DNA replication

Transmission of chromosomal DNA from generation to generation is crucial to cell propagation. This can only be
achieved when chromosomal DNA is accurately replicated, providing two copies of the entire genome for faithful
distribution into each daughter cell.
1.12.1 Semiconservative replication

It is crucial that the genetic material is reproduced accurately. When Watson and Crick worked out the double-helix
structure of DNA in 1953, they recognized that the complementary nature of the two strands - A paired with T and
G paired with C - might play an important role in its replication. Because the two polynucleotide strands are joined
97
Genetics
only by hydrogen bonds, they are able to separate without requiring breakage of covalent bonds. If the two strands
of a parental double helix of DNA are separated, the base sequence of each parental strand could serve as a
template for the synthesis of a new complementary strand, producing two identical progeny double helices. This
process is called semiconservative replication because the parental double helix is half conserved, each parental
single strand remaining intact. The alternative methods are conservative and dispersive. In conservative replication,
the whole original double helix acts as a template for a new one, one daughter molecule would consist of the
original parental DNA, and the other daughter would be totally new DNA. In dispersive replication, some parts of
the original double helix are conserved, and some parts are not. In this model, the parental double stranded helix
is broken into double-stranded DNA segments and just like conservative mode of replication the synthesis of new
double-stranded DNA segments occurs.
A. Conservative model B. Semiconservative model C. Dispersive model
Figure 1.76 A. In conservative model, after one round of replication two daughter dsDNA molecules form.
In which one daughter molecule contains both parental DNA strands and the other daughter molecule contains
two newly synthesized DNA strands. B. In semiconservative model, the two parental DNA strands separate
and each of those strands then serves as a template for the synthesis of a new DNA strand. The result is two
DNA double helices, both of which consist of one parental and one new strand. C. In dispersive model, the
parental double helix is broken into double-stranded DNA segments. The segments then reassemble into
complete DNA double helices, each with parental and all newly-synthesized dsDNA segments interspersed.
Meselson and Stahl experiment

Meselson and Stahl experimentally demonstrated the semiconservative replication of DNA in E. coli in 1958. They
grew E. coli cells in a medium in which the sole nitrogen source was 15N-labeled ammonium chloride (15N is a heavy
15 14
isotope of nitrogen). The N-containing E. coli cell culture was then transferred to a N medium and allowed to
14
continue growing ( N is a light isotope of nitrogen). Samples were harvested at regular intervals. The DNA was
extracted and its buoyant density determined by centrifugation in CsCl density gradients. The isolated DNA showed
14 15
a single band in the density gradient, midway between the light N-DNA and the heavy N-DNA bands. After two
14
generations in the N medium the isolated DNA exhibited two bands, one with a density equal to light DNA and the
other with a density equal to that of the hybrid DNA observed after one generation. After three generations in the
14
N medium the DNA still has two bands, similar to those observed after two generations. The results were exactly
those expected from the semiconservative replication hypothesis.
98
Genetics
1.15.1 Transcription unit

Transcription is a selective process. Each transcribed segment of DNA is called a transcription unit. In eukaryotes,
a transcription unit typically carries the information of just one gene and it is termed as monocistronic transcription
unit. In prokaryotes, a set of adjacent genes is often transcribed as a unit termed polycistronic transcription unit.
The immediate product of transcription is called the primary transcript. The eukaryotic transcription unit may be
simple or complex. The primary transcript produced from a simple transcription unit is processed to yield a single
type of mRNA, encoding a single protein. In the case of complex transcription units, which are quite common in
multicellular organisms, the primary RNA transcript can be processed in more than one way, leading to formation
of more than one type of mRNAs, encoding more than one type of polypeptides. Transcription starts from the first
base pair that is called the start point. From this point, RNA polymerase moves along the template, synthesizing
RNA, until it reaches a terminator sequence. Sequences prior to the startpoint are described as upstream of it;
those after the startpoint (within the transcribed sequence) are downstream of it.
During transcription, only one strand of the transcription unit is transcribed. Therefore, the transcript is identical in
sequence with one strand of the DNA, which is called the coding strand and complementary to the other strand,
called template strand. The coding strand is also known as the sense (+) strand while the template strand is the
antisense (–) strand. In principle, any region of the DNA double helix could be copied into two different RNA
molecules - one from each of the two DNA strands. In reality, only one DNA strand is used as a template in each
region.
5' A AT C G AT C T G C TA ATTTA G C TA G A C 3' Coding or sense strand

dsDNA
3' TTA G C TA G A C G ATTA A AT C G AT C T G 5' Template or antisense strand
RNA 5' AAUCGAUCUGCUAAUUUAGCUAGAC 3'
1.15.2 Prokaryotic transcription

RNA polymerase
DNA dependent RNA synthesis is catalyzed by the enzyme DNA dependent RNA polymerase (simply called RNA
polymerase). It was discovered by Samuel B. Weiss and Jerard Hurwitz in 1960. In prokaryotes, single type of RNA
polymerase appears to be responsible for the synthesis of all different types of RNA such as mRNA, rRNA and tRNA.
Eubacterial RNA pol is a multisubunit enzyme made up of five different polypeptides – α, β, β’, ω, σ. The holoenzyme
(α2ββ’ω σ) can be separated into two components, the core enzyme (α2ββ’ω) and the sigma factor (the σ polypeptide).
The complete enzyme or holoenzyme in E. coli has a molecular mass of ~465 kDa. The α subunit is required for
assembly of the core enzyme and plays a role in promoter recognition. The α subunit also plays a role in the
interaction of RNA polymerase with some regulatory factors. The β and β’ subunits together make up the catalytic
center. β subunit involves in chain elongation. The σ subunit is concerned specifically with promoter recognition. The
ω subunit facilitates assembly of RNA polymerase and stabilizes assembled RNA polymerase. The catalytic activity
of RNA pol is provided by core complex composed of β and β’ subunits, ω subunit and two copies of α subunit.
Table 1.22 RNA polymerase subunits and their functions

Subunits Gene Function
α rpoA assembly of the core enzyme and promoter recognition
β rpoB catalytic center
β’ rpoC catalytic center
ω rpoZ assembly of RNA polymerase
σ rpoD promoter recognition and transcription initiation
130
Genetics
Problem
Compare the RNA polymerase (eubacterial) and DNA polymerase III holoenzyme from E. coli.
Solution
Feature RNA polymerase DNA polymerase III
Molecular weight ~500,000 ~400,000
Number of subunit 6 ~10
Activated precursors ATP, GTP, UTP, CTP dATP, dGTP, dTTP, dCTP
Direction of synthesis 5’ → 3’ 5’ → 3’
Exonuclease activity None 3’ → 5’
Primer requirement None RNA or DNA primer
Configuration of preferred template DNA duplex Single-stranded DNA
Metal ion requirements Zn2+, Mg2+ Zn2+, Mg2+
Number of high-energy phosphate groups 2 2
consumed per nucleotide added
RNA-dependent RNA polymerase

Some viruses like f2 and R17 contain RNA genomes. The single-stranded RNA in these viruses are replicated in the
host cell by the action of enzymes called RNA-dependent RNA polymerases or RNA replicases. RNA replicase
requires RNA as a template and will not function with DNA. Synthesis of the new RNA strand proceeds in the 5' to 3'
direction, and the chemical mechanism is similar to that of DNA dependent transcription. RNA replicases are
specific for the RNA of their own virus; the RNAs of the host cell are not replicated.
Prokaryotic promoter
A promoter can be defined as the cis-acting, position dependent DNA sequence necessary for accurately and
efficiently initiating transcription of the gene. The DNA sequence of the promoter region is recognized by the RNA
polymerase. The best characterized prokaryotic promoters are those of the bacterium E. coli that is recognized by
σ70 (the superscript indicates molecular mass, 70kDa) of RNA pol. It contains two 6–base pairs of consensus
sequences (–10 and –35 sequence). The –10 sequence is also known as Pribnow box. The term consensus
sequence is applied to nucleic acid and protein. A consensus sequence is the one that reflects the most common
base or amino acid at each position when a series of related nucleic acid or protein sequences are compared.
Upstream +1 Downstream
5' 3'
3' 5'
–35 box –10 box
–35 box 16–18bp –10 box 6–7bp +1

5' TTGACA TATAAT A/G 3'
3' AACTGT ATATTA T/C 5'
Consensus Consensus
sequence sequence Transcription
initiation site
Figure 1.106 Bacterial promoters, such as that from E. coli shown here, share two regions of consensus
nucleotide sequence. These regions are located 35 and 10 bp upstream from the start site of transcription,
which is indicated as +1. By convention, all nucleotides upstream of the transcription initiation site (at +1)
are numbered in a negative sense. These elements function only in double-stranded DNA.
131
Genetics
Problem
What is the minimum length of time required by E. coli for the synthesis of an mRNA encoding a 110 kDa protein?
Solution
A 110 kDa protein contains about 1000 residues, which are encoded by 3000 nucleotides. At a maximal transcription
rate of about 50 nucleotides per second, the protein would be synthesized in 60 sec.
Problem
Why is RNA synthesis not as carefully monitored for errors as is DNA synthesis?
Solution
An error will only affect one molecule of mRNA of many synthesized from a gene. In addition, the errors do not
become a permanent part of the genomic information.
1.15.3 Eukaryotic transcription

Nuclear RNA polymerases
A single RNA polymerase is responsible for transcription of all different types of RNAs in prokaryotes. However,
eukaryotes have three different RNA polymerases: RNA pol I, RNA pol II and RNA pol III. An additional RNA
polymerase is found in mitochondria as well as in the chloroplast, which carry a small DNA molecule of their own.
RNA pol I is responsible for synthesizing most of the rRNA, pol II synthesizes mRNA and most of the snRNA, and pol
III synthesizes a variety of small stable RNAs including tRNA, 5S rRNA and U6 snRNA. All eukaryotic RNA polymerases
are large proteins, appearing as aggregates of >500 kDa. Each RNA pol is a multi-subunit protein (8 to 12 subunits).
Eukaryotic pol II consists of 12 subunits. The two largest subunits are homologous to the bacterial β and β’ subunits.
In addition to the increased number of subunits, eukaryotic pol II differs from its prokaryotic counterpart in that it
has a series of heptad repeats with the consensus sequence Tyr-Ser-Pro-Thr-Ser-Pro-Ser at the carboxyl terminal
of the largest pol II subunit. This Carboxyl Terminal Domain (CTD) is both a substrate for several kinases, including
the kinase component of TFIIH, and a binding site for a wide array of proteins. RNA pol in eukaryotes displays
differing sensitivities to a toxin called α-amanitin, a cyclic octapeptide that is produced by the poisonous mushroom
Amanita phalloides, which is also called the death cap or the destroying angel. The α-amanitin works by interfering
with the translocation process during RNA elongation. Pol II is the most sensitive to α-amanitin and pol I is completely
resistant.
Pol α-amanitin sensitivity
Pol I Resistant
Pol II Very sensitive
Pol III Moderately sensitive and species specific
Table 1.25 Eukaryotic RNA pol and their transcripts
RNA pol I product 5.8S, 18S and 28S rRNA
RNA pol II product mRNA, most of snRNA, LINE, miRNA
RNA Pol III product tRNA Translational adaptor

5S rRNA Ribosomal component
U6 snRNA mRNA splicing
H1 RNA RNase P component (tRNA processing)
MRP RNA rRNA splicing
7S L scRNA Signal recognition particle component
7S K scRNA Unknown
SINE transcripts Unknown
136
Genetics
In addition to the three RNA polymerases (Pol I, Pol II and Pol III) shared by all eukaryotic organisms, plant genomes
encode two additional RNA polymerases, RNA polymerase IV and V. However, their subunit compositions reveal that
they evolved from RNA polymerase II. These polymerases are required for the biogenesis of siRNAs or function of
siRNAs in the siRNA-directed DNA methylation pathway, in which siRNA direct the de novo cytosine methylation of
complementary DNA sequences. Pol IV is required for siRNA biogenesis and Pol V transcripts generate the target for
RNA-directed DNA methylation.
Mitochondrial RNA pol is encoded by nuclear genes. It is heterodimer and composed of two subunits. One subunit
is related to the monomeric RNA pol of bacteriophage T7 and the other subunit resembles σ-factor of eubacterial
RNA pol. In chloroplasts of higher plants, there are two types of RNA pol, chloroplast-encoded RNA pol and nuclear-
encoded RNA pol. Chloroplast-encoded RNA pol is a eubacteria-type multisubunit enzyme whose catalytic core
subunits are encoded by the chloroplast genome. The core subunits of the eubacterial-type enzyme, α, β, β’, and
ω subunits, are encoded by the chloroplast DNA, whereas σ-factors are encoded in the nuclear DNA. The nuclear-
encoded RNA pol is the nuclear encoded T7 phage-type single subunit enzyme.
Eukaryotic promoter
In eukaryotes, the term promoter is used to describe all the sequences that are important in the initiation of
transcription of a gene. For some genes, these sequences not only include the core promoter (sometimes also
called the basal promoter), which is the site at which the initiation complex is assembled, but also one or more
upstream promoter elements which, as their name implies, lie upstream of the core promoter. Initiation of transcription
in eukaryotes requires the enzyme RNA polymerase and transcription factors. The transcription factors, rather than
the RNA polymerase, are principally responsible for recognizing the promoter. This is different from the bacterial
RNA polymerase, where it is the RNA polymerase that recognizes the promoter sequences. The transcription
factors create a structure at the promoter to provide the target that is recognized by the RNA polymerase.
RNA pol I promoter
RNA polymerase I promoter consists of a core promoter spanning the transcription start point, between nucleotides
–45 and +20, and an Upstream Control Element (UCE) about 100 bp further upstream. The core promoter is
generally G·C-rich except a short A·T-rich sequence around the startpoint called the Inr.
RNA pol I promoter

Core
+1
UCE promoter
Ribosomal DNA
–180 –100 –45 +20
Figure 1.112 Transcription units for RNA Pol I have a core promoter separated by about 70 base pairs from
the upstream control element (UCE). RNA Pol I binds to the core promoter.
RNA pol III promoter
The most striking and unusual feature of the promoters used by pol III is that the majority includes important
sequence elements downstream of the transcription start site, within the transcribed region.
Type I promoter (found in the 5S rRNA genes) requires two internal elements for efficient transcription; an A-block
located between +50 and +70, and a C-block from +80 to +90.
Type II promoter (found in the tRNA genes) consists of two highly conserved sequence blocks, A- and B-, located
within the transcribed region.
Type III promoter (found in the U6 snRNA genes) consists of a TATA box, located between –30 and –25, a Proximal
Sequence Element (PSE) between –66 and –46, and a Distal Sequence Element (DSE) between –244 and –214.
137
Genetics
Type I internal
+1 Box A Box C
5S rRNA gene
+50 +70 +80 +90
Type II internal +1
Box A Box B
tRNA gene
+10 +30 +50 +70
Upstream type
Oct PSE TATA +1

U6 snRNA gene
–60 –30
Figure 1.113 Promoter of RNA pol III may consist of bipartite sequences downstream of the start point,
with box A separated from either box C or box B as well as upstream sequences. 5S rRNA genes have type I
promoters, tRNA genes have type II promoters, and U6 snRNA genes have upstream type promoters.
RNA pol II promoter
RNA polymerase II promoters are variable and can stretch for several kilobases upstream of the transcription start
site. The core promoter consists of two segments: the –30 or TATA box (consensus 5’-TATAXAX-3’, where X is A or T)
and the initiator (Inr) sequence (consensus 5’-Py2CAPy5-3’) located around nucleotide +1. Initiators are rich in
pyrimidines. Some genes transcribed by RNA polymerase II have only one of these two components of the core
promoter, and some, surprisingly, have neither. The latter are called null genes.
Apart from two core promoter elements, the TATA box and the Inr sequence, that serve as specific binding sites
for general transcription factors; other cis-acting sequences serve as binding sites for a wide variety of regulatory
factors that control the expression of individual genes. These cis-acting regulatory sequences are frequently,
though not always, located upstream of the TATA box. For example, two regulatory sequences that are found in
many eukaryotic genes are CAAT box and GGGCGG (called a GC box). CAAT box and GC box are orientation
independent i.e., function in either orientation. The CAAT box is recognized by the activators NF-1 and NF-Y,
whereas GC box is recognized by Sp1 activator. A few genes have a Downstream Promoter Element (DPE);
located at position +28 to +32. DPE has a variable sequence and binds TFIID.
The consensus sequence present in core promoter (the TATA box and Inr) primarily determines the location of the
startpoint, whereas the sequence elements farther upstream influence the frequency of initiation. The elements
found in any individual promoter differ in number, location and orientation. No element is common to all of the
promoters.
RNA pol II promoter

Core promoter
+1
GC box CAAT TATA DPE
mRNA gene
–30 INR
Figure 1.114 RNA pol II core promoter consists of TATA box (TATA) and initiator element (INR).
138
Genetics
Problem
Why gene regulation by the process of attenuation is absent in eukaryotic organisms?

Solution : The process of attenuation occurs when translation and transcription operates simultaneously. In eukaryotic
organisms, these two processes occur at two different times and two different places. Hence regulation of transcription
by attenuation does not occur in eukaryotes.
Problem
Bacterial cells can take up the amino acid tryptophan from their surroundings, or if the external supply is insufficient,
they can synthesize tryptophan from small molecules in the cell. The tryptophan repressor inhibits transcription of
the genes in the tryptophan operon, which encodes the tryptophan biosynthetic enzymes. Upon binding tryptophan,
the tryptophan repressor binds to a site in the promoter of the operon. What would you expect to happen to the
regulation of the tryptophan biosynthetic enzymes in cells that express a mutant form of the tryptophan repressor
that 1. cannot bind to DNA or 2. binds to DNA even when no tryptophan is bound to it?
Solution : In both scenarios, transcription of the genes encoding the tryptophan biosynthetic enzymes would no
longer be regulated by the absence or presence of tryptophan. Scenario 1 – because the repressor could not bind
to the DNA, hence the synthesis of enzymes would be permanently on. Scenario 2 – because the repressor would
always be bound to the DNA, the synthesis of enzymes would be permanently off.
1.18.3 Riboswitches
In bacteria, gene regulation by regulatory RNA is also widespread. In one common form of gene regulation by RNA,
bacteria use RNA sequences encoded within mRNA. These cis-acting regulatory elements are known as riboswitches.
These elements are defined as mRNA elements that bind metabolites or metal ions as ligands and regulate mRNA
expression by forming alternative structures in response to this ligand-binding. A variety of ligands are sensed by
riboswitches; the group includes magnesium ions, nucleic acid precursors, enzyme cofactors and amino acid residues.
Riboswitches are most often located in the 5' UTR of bacterial mRNA. However, not all riboswitches are at the 5' UTR.
The function of riboswitches is associated with the ability of RNA to form a diversity of structures. Riboswitches are
composed of two domains: the aptamer domain and the expression platform. The aptamer domain acts as a receptor
that specifically binds a ligand. The expression platform acts directly on gene expression in response to ligand binding.
Anti-terminator
5’ UUUUU 5’ RBS
Transcription Translation
continue on
Ligand Ligand
Terminator
5’ UUUUU Transcription 5’ RBS

{
stop No
Aptamer
translation
{
Expression platform
(a) (b)
Figure 1.149 Two different modes of riboswitch function. (a) pre-mature transcription termination
(b) inhibition of translation initiation. RBS = Ribosome binding site
171
Genetics
Riboswitches exist in two alternative conformations that have different stem and loop structures. Changes in the
conformation of riboswitches occur after binding of ligands with the aptamer domain. This in turn controls gene
expression by one of two related mechanisms, premature termination of transcription (i.e. attenuation) or translational
inhibition. In the attenuation mechanism, the riboswitch controls whether or not the mRNA for the biosynthetic
genes will be prematurely terminated. In the translational inhibition mechanism, the riboswitch controls whether or
not the mRNA will be translated.
1.19 Bacteriophage lambda : A transcriptional switch

Bacteriophage lambda (λ) is a temperate phage that infects the bacterium E. coli. Its genome is a linear dsDNA of
48.5 kbp and contains about 50 genes. After infecting host cells (E. coli), lambda phage can follow one of two
alternative cycles: lytic and lysogenic cycles.
In lytic cycle, the phage DNA enters the host bacterium, its genes are transcribed, the phage genetic material is
replicated and the protein components of the phage particles are produced. Finally, the host bacterium is broken
open (lysed) to release the assembled progeny particles by the process called lysis.
In the lysogenic state, phage DNA integrates with the bacterial genome. In this state, phage genome is present in
the bacterium in a latent form known as prophage. The lambda phage has an operon-type system controlling its
two functional states. The switch between these two states is mediated by proteins encoded by the bacteriophage
genome. At the heart of the system are two gene regulatory proteins synthesized by the virus: the CI repressor
(also called lambda repressor) and the Cro (Control for repressor and other thing) protein. These proteins repress
each other’s synthesis.
Table 1.29 Some lambda genes and their functions

Gene Function
Immediate early genes
N codes antitermination protein, early regulation
cro codes Cro protein inhibitor of CI synthesis, early regulation
Delayed early genes
cII codes activator of transcription of cI and int, early regulation
cIII codes protein that stabilizes CII, early regulation
int codes integrase; protein required for site-specific recombination with chromosome
xis codes excisase; protein forms a complex with Int and function is excision of prophage
O DNA replication
P DNA replication
Q codes antitermination protein, allows expression of the late genes from PR’
Late genes
A to J Head and tail synthesis
S and R Lysis genes
A-J sib attP int xis cIII N cI cro cII O P Q S R Genes
PI PL PRM PR PRE PR’ Promoters
Figure 1.150 Bacteriophage lambda: genetic map showing major genes and associated promoters.
When DNA of a lambda phage enters a new host cell, RNA polymerase binds promoters PL and PR (which stand for
Leftward and Rightward promoters, respectively). The promoters PL and PR lie on either side of the cI gene. PL and
PR are strong promoters. PR acts as promoter for cro and other rightward early genes. Product of cro gene (Cro
protein) is responsible for lytic cycle. PL acts as promoter for N and other leftward early genes. So the first event
172
Genetics
+1
TATA
RNA pol II
promoter
INR
Binding of transcription
activator protein
Binding of chromatin remodeling

complex and nucleosome remodeling
Binding of HAT and specific

pattern of histone acetylation
Binding of general transcription

factor plus RNA pol II
Transcription initiation
Figure 1.155 Histone acetylation and nucleosome remodeling generally render the chromatin DNA more
accessible to other proteins required for transcription initiation.
1.20.2 DNA methylation and gene regulation

In eukaryotes, DNA methylation occurs predominantly at CpG dinucleotides sequence. In CpG, the intervening ‘p’
represents the phosphodiester bond linking cytosine- and guanine-containing nucleotides. The enzyme DNA
methyltransferase mediates the transfer of a methyl group to cytosine, generating 5-methyl-cytosine. Cytosine
methylation is relatively rare in lower eukaryotes, but in vertebrates up to 10% of the total number of cytosine
bases are methylated and in plants up to 30%. Studies on the genome-wise distribution of DNA methylation
estimate that the majority of CpG sites are methylated in vertebrates.
Cytosine 5-methylcytosine
H H H H
N N
H3C
4 N Methylation N
5 3
6 2
1
N O N O
Figure 1.156 Methylation of cytosine.
DNA methylation is an important heritable epigenetic modification of the genome and is involved in the gene
regulation. The methylation of cytosine allows normal hydrogen bonding with guanine. The methyl groups project
into the major groove of DNA and changing the biophysical characteristics of the DNA. The regions of the genome
with a high number of methylated cytosine are usually transcriptionally inactive. Silencing is thought to be either
due to direct inhibition of transcription factors binding as a result of methylated cytosine or the binding of other
proteins with methyl-binding domain to the DNA.
In bacteria, both adenine and cytosine can be methylated. The main function of DNA methylation in bacteria is to
provide protection from own restriction endonucleases. It also plays an important role in the mismatch repair.
There are two types of methylation processes known in eukaryotic cells: maintenance methylation and de novo
methylation. In maintenance methylation, addition of methyl groups occurs in a newly synthesized strand of
DNA at positions opposite methylated sites on the parent strand. The maintenance activity ensures that the two
daughter DNA molecules retain the methylation pattern of the parent molecule. In de novo methylation, addition
of methyl groups occur at totally new positions.
177
Genetics
Maintenance
• • methylation
• •
A C G C G T A C G C G T
DNA T G C G C A T G C G C A
• • • •
5’ A C G C G T 3’ replication
3’ T G C G C A 5’ New strand
(a)
• • • •
A C G C G T A C G C G T
T G C G C A T G C G C A
• • • •
CH3 Parent strand
•
A C G C G T de novo • •
A C G C G T
(b)
T G C G C A T G C G C A
• • •
Figure 1.157 (a) Maintenance methylation and (b) de novo methylation. In case of maintenance methylation
addition of methyl groups occurs in a newly synthesized strand of DNA at positions opposite methylated
sites on the parent strand. In de novo methylation, addition of methyl groups occurs at totally new positions.
CpG islands
CpG dinucleotides are found unevenly distributed throughout the genome. It is present at only about one-fifth of its
randomly expected frequency in the vertebrate genome. It is presumably due to the deamination of 5-methylcytosines
to thymines during the evolution. Methylated cytosine strongly increases the rate of C→
→T transition mutations as a
result of deamination. But at some sites, CpG dinucleotides occur at higher frequency and referred to as CpG
islands. CpG islands are, on average, 1000 base pairs long and show an elevated G+C base composition.
CpG islands are often associated with the transcription start sites of genes. About 60% of human genes have CpG
islands at their promoters. CpG islands in the genome are also located within genes (intragenically) or in intergenic
locations. In vertebrates, over 80% of CpG dinucleotides located outside of CpG islands are commonly methylated
including those present in intragenic regions, repetitive sequences and mobile elements. In contrast, CpGs within
CpG islands are generally not methylated or have relatively low levels of methylation. CpG island methylation of
the transcription start sites is associated with stable long-term silencing (for example, X-chromosome inactivation,
imprinting, genes expressed predominantly in germ cells and some tissue-specific genes). We still do not completely
understand why a minority of CpG islands become methylated, whereas most do not.
Regulation of transcription by methylation

DNA methylation is persistent throughout genomes, and is missing only in regions such as CpG islands, promoters
and possibly enhancers. DNA methylation switches off eukaryotic gene expression, particularly when it occurs in the
promoter regions upstream of a gene’s transcribed sequences. The way in which DNA methylation prevents gene
expression is poorly understood. However, in many cases, DNA methylation is recognized by a family of proteins that
contain a conserved methyl-CpG binding domain (MBD). Since the methyl groups of m5C residues extend into
dsDNA’s major groove, MBDs can bind to them without perturbing DNA’s double helical structure. MBD-containing
proteins inhibit the transcription of their bound promoter-methylated genes by recruiting protein complexes that
induce the alternation of the local chromosome structure in a way that prevents the transcription of the associated gene.
An important regulatory role of DNA methylation has been established in the phenomenon known as genomic
imprinting (also called gametic or parental imprinting), which controls the expression of some genes involved in
the development of mammalian embryos. In most cases, both the paternal and maternal alleles of a gene are
expressed in diploid cells. However, there are a few imprinted genes whose expression depends on whether they
are inherited from the mother or from the father. In some cases, only the paternal allele of an imprinted gene is
expressed, and the maternal allele is transcriptionally inactive. For other imprinted genes, the maternal allele is
expressed and the paternal allele is inactive. This is a form of allelic exclusion. In such cells, the relevant gene is
said to exhibit functional hemizygosity. DNA methylation is involved in genomic imprinting. Imprinting is controlled
by imprint control elements, DNA sequences that are found within a few kilobases of clusters of imprinted genes.
These centers mediate the methylation of the imprinted regions. An example of an imprinted gene in humans is
Igf2 (insulinlike growth factor-2), which codes for a growth factor. Only the paternal copy of Igf2 is transcribed.
Igf2 is not expressed from the maternally inherited chromosome.
178
Genetics
1.21 RNA interference

RNA interference (abbreviated RNAi) is an evolutionarily conserved mechanism of gene regulation that is induced
by small silencing RNA in a sequence-specific manner. In 1998, Fire and Mello first established this in C. elegans.
Historically, RNA interference was known by other names, including post transcriptional gene silencing (PTGS),
transgene silencing and quelling. RNAi has been observed in all eukaryotes, from yeast to mammals. RNA interference
has an important role in post-transcriptional gene regulation, transposon regulation and defending cells against
viruses. Two types of small silencing RNA molecules – small interfering RNA (siRNA) and microRNA (miRNA) – are
central to RNA interference.
siRNAs mediated RNAi

In the siRNAs mediated RNAi pathway, the dsRNAs are processed into siRNAs duplexes comprised of two ~21
nucleotides long strands with two nucleotides overhangs at the 3’ ends by an enzyme called Dicer. Dicer is a
~200 kDa multidomain, an RNase III family enzyme that functions in processing dsRNA to siRNA. The Dicer includes
an ATPase/RNA helicase domain, catalytic RNase III domains, and dsRNA binding domain. Dicer and a dsRNA
binding protein (together form the RISC loading complex) then load the RNA duplex into RISC. The siRNA is thought
to provide target specificity to RISC through base pairing of the guide strand with the target mRNA. Only one of the
two strands, which is known as the guide strand, directs the gene silencing. The other anti-guide strand or passenger
strand is degraded during RISC activation. The active components of an RNA-induced silencing complex (RISC) are
endonucleases called argonaute proteins, which cleave the target mRNA strand complementary to their bound siRNA.
Long dsRNA
Dicer
Guide strand
siRNA duplex
Passenger strand
RISC
loading complex
pre-RISC
Figure 1.159 dsRNA precursors are

processed by Dicer to generate siRNA
Guide strand
duplexes containing guide and passenger
RISC
strands. RISC-loading complex loads the
duplex into RISC. The passenger strand is
later destroyed and the guide strand
Target cleavage
directs RISC to the target RNA.
miRNAs mediated RNAi

miRNAs (microRNAs) are small, non-coding RNA molecules encoded in the genomes of plants, animals and their
viruses. These highly conserved, 20–25 mer RNAs appear to regulate gene expression post-transcriptionally by
binding to the 3'-untranslated regions (3'-UTR) of specific mRNAs. Victor Ambros and colleagues identified the
first miRNA, lin-4, in C. elegans over a decade ago. The lin-4 gene was unusual in that it did not encode a protein
but rather a small RNA that imperfectly base-paired to complementary sequences on target mRNAs in order to
block gene expression. The lin-4 controls the expression of lin-14 gene. The lin-4 transcripts are complementary
to sequence present in the 3’ UTR of lin-14 mRNA. In 2000, a second miRNA, let-7, was discovered by Gary
Ruvkun’s group in C. elegans that works in a similar manner to lin-4. These small RNAs have been shown to play
critical roles in developmental timing, hematopoietic cell differentiation, cell death, cell proliferation and oncogenesis.
180
Genetics
miRNAs are synthesized in the nucleus as long (up to 1000 nts) RNA polymerase II transcripts, called pri-miRNAs,
that are characterized by imperfect hairpin structures. RNA polymerase III also transcribes some pri-miRNAs.
An RNase III enzyme, drosha acts as a dsRNA-specific endonuclease, in conjunction with a dsRNA-binding protein,
called pasha (in Drosophila) and DGCR8 (in mammal), processes the pri-miRNA into hairpin RNAs 70–100 nts in
length, called pre-miRNAs. Complex of DGCR8 or pasha with the enzyme drosha is called microprocessor complex.
Pre-miRNAs also derive from introns and known as mirtrons. However, mirtrons not involve processing by
microprocessor complex. Pre-miRNAs are transported to the cytoplasm. It is mediated by exportin-5.
1
Nucleus
pri-miRNA
2 Drosha
Cytosol
pre-miRNA
pre-miRNA
Dicer
3
miRNA
miRNA duplex
miRNA*
4
1 A miRNA gene is transcribed into

pre-RISC
pri-miRNA, that folds into a hairpin
structure.
2 Nuclear enzyme Drosha cleaves
pri-miRNA into pre-miRNA, which is
RISC miRNA exported from the nucleus.
3 In cytosol, dicer cleaves pre-miRNA
into miRNA.
4 Incorporation of miRNA into RISC.
Inhibition of translation
of target mRNA Figure 1.160 Translational silencing by miRNA.
In the cytoplasm, dicer processes the pre-miRNA into miRNA duplex (miRNA-miRNA*) and load it into the RISC.
Members of the Argonaute (Ago) protein family are central to RISC function. Argonautes are needed for miRNA-
induced silencing and contain two conserved RNA binding domains: a PAZ domain that can bind the single stranded
3’ end of the mature miRNA and a PIWI domain that structurally resembles ribonuclease-H.
miRNA biogenesis in plants differs from animal biogenesis mainly in the steps of nuclear processing and export.
First, in plants, single enzyme DCL1 present inside the nucleus fills the roles of both Drosha and Dicer, converting
pri-miRNAs to mature miRNA. Second, before plant miRNA-miRNA* duplexes are transported out of the nucleus, its
3' overhangs are methylated by a S-adenosyl methionine-dependent methyltransferase called HEN1.
Gene silencing may occur either via mRNA degradation or preventing mRNA from being translated. miRNAs function
via base-pairing with complementary sequences within target mRNA molecules. If there is complete complementation
between the miRNA and target mRNA sequence, Ago can cleave the mRNA and lead to direct mRNA degradation.
If there isn’t complete complementation, then silencing is achieved by preventing translation. Plant miRNAs usually
have perfect or near-perfect pairing with their target mRNA and induce gene repression through degradation of
181
Genetics
Loss- and gain- of function mutations
In principle, mutation of a gene might cause a phenotypic change in either of two ways:
• Loss of function (null) mutation : the product may have reduced or no function.
• Gain of function mutation : the product may have increased or new function.
Because mutation events introduce random genetic changes, most of the time they result in loss of function.
Generally, loss of function mutations are found to be recessive. In a wild type diploid cell, there are two wild type
alleles of a gene, both making normal gene product. In heterozygotes, the single wild type allele may be able to
provide enough normal gene product to produce a wild type phenotype. In such cases, loss of function mutations
are recessive. However, some loss of function mutations are dominant. In such cases, the single wild type allele in
the heterozygote cannot provide the enough amount of gene product needed for the cells to be wild type. Gain of
function mutations usually cause dominant phenotypes, because the presence of a normal allele does not prevent
the mutant allele from behaving abnormally.
1.25.3 Fluctuation test

The fluctuation test was invented by Luria and Delbruck in 1943 to determine the randomness of mutation in
bacteria. They grew a series of E. coli cultures in different flasks and then added T1 bacteriophage to each one.
Most of the bacteria were killed by the phage, but a few T1 resistant mutants were able to survive. Luria and
Delbruck measured the number of mutants resistant to bacteriophage T1 in a large number of replicate cultures of
E. coli. If mutants occur after the culture is exposed to the phage, then little variation should occur among cultures
in the number of mutants. However, if mutants arise at random during nonselective growth of cells, each culture
would contain different number of resistant mutant. The numbers depend on how early during the growth period the
first mutant cells arose. But the consequence of that mutation would depend on when during the growth of the
population the mutation occurred. Thus a mutation during the early generations gives rise to a large clone of
mutant cells, whereas a late mutation gives rise to a few mutant cells. Among a large set of identical cultures of
dividing cells, the few cultures in which the mutation happened in the early generations have a large number of
mutants, whereas the majority of the cultures have none or a few mutants. This is what Luria and Delbruck observed.
E. coli : Wild type
Normal receptor
Lysis
T1
Mutant type
Mutant receptor
T1 cannot bind
Figure 1.187 When bacteriophage T1 infects wild-type E. coli, it binds to a receptor in the outer membrane,
protein TonB. After phage replication, the E. coli cell is lysed and new phages are released. A mutation in the
tonB gene results in an altered receptor to which T1 can no longer bind and so the cells survive.
218
Genetics
Their test is known as the fluctuation test because it measures the degree of fluctuation in the number of mutants
found in replicate cultures. They proved that mutations occur before selection. The fluctuation test is also useful in
determining mutation rates during nonselective growth.
1.25.4 Replica plating experiment

Replica plating experiment suggests that the resistant cells are selected by the environmental agent rather than
produced by it (nonadaptive nature of mutation). The technique was developed by Joshua and Esther Lederberg in
1952. A population of bacteria was plated on nonselective medium that is, containing no phages and from each cell
a colony grew. This plate was called the master plate. A sterile piece of velvet was pressed down lightly on the
surface of the master plate, and the velvet picked up cells wherever there was a colony.
Replica plating
Master plate Replica plate Replica plate

(nonselective medium) (nonselective medium) (selective medium)
After incubation
Figure 1.188 Replica plating. For the detection of mutants, cells are transferred on to successive plates
containing either a selective medium or a non-selective medium. Colonies form on the non-selective plate
in the same pattern as on the master plate. Only mutant cells can grow on the selective plate; the mutant
colonies that are formed derive from colonies on the master plate that are mutant.
In this way, the velvet picked up a colony ‘imprint’ from the whole plate. On touching the velvet to replica plates
containing selective medium (that is, containing T1 phages), cells clinging to the velvet are inoculated onto the
replica plates in the same relative positions as those of the colonies on the original master plate. As expected, rare
Tomr mutant colonies were found on the replica plates, but the multiple replica plates showed identical patterns of
resistant colonies. If the mutations had occurred after exposure to the selective agents, the patterns for each plate
would have been as random as the mutations themselves. The mutation events must have occurred before exposure
to the selective agent.
Replica plating has become an important technique of microbial genetics. It is useful in screening for mutants that
fail to grow under the selective regime. The position of an absent colony on the replica plate is used to retrieve the
mutant from the master. For example, replica plating can be used to screen auxotrophic mutants in precisely this
way. In general, replica plating is a way of retaining an original set of strains on a master plate while simultaneously
subjecting replicas to various kinds of tests on different media or under different environmental conditions.
219
Genetics
1.25.5 Ames test

The Ames test, named for its developer, Bruce Ames, is a method to test chemicals for their cancer-causing
properties. The use of the Ames test is based on the assumption that any substance that is mutagenic may also
turn out to be a carcinogen; that is, to cause cancer.
The assay is based on the reversion of mutations in the histidine (his) operon in the genetically altered tester
strains of bacterium Salmonella typhimurium. The his operon encodes enzymes required for the biosynthesis of the
amino acid histidine. Strains with mutations in the his operon are histidine auxotrophs — they are unable to grow
without added histidine. However, this mutation can be reversed, a back mutation, with the gene regaining its
function. These revertants are able to grow on a medium lacking histidine. The tester strains are specially constructed
to have both frameshift and point mutations in the genes required to synthesize histidine, which allows for the
detection of mutagens acting via different mechanisms. The tester strains also carry mutations in the genes responsible
for lipopolysaccharide synthesis, making the cell wall of the bacteria more permeable, and in the excision repair
system to make the test more sensitive.
The Ames test can detect mutagens that work directly to alter DNA. In humans, however, many chemicals are
promutagens, agents that must be activated to become true mutagens. Activation, involving a chemical modification,
often occurs in the liver as a consequence of normal liver activity on unusual substances. Bacteria such as
S. typhimurium do not produce the enzymes required to activate promutagens, so promutagens would not be
detected by the Ames test unless they were first activated. An important part of the Ames test also involves mixing
the test compound with enzymes from rat liver that convert promutagens into active mutagens. These potentially
activated promutagens are then used in the Ames test. If the liver enzymes convert the agent to a mutagen, the
Ames test will detect it, and it will be labeled as a promutagenic agent.
Problem
In the Ames test, auxotrophic strains of Salmonella that are unable to produce histidine are mixed with a rat liver
extract and a suspected mutagen. The cells are then plated on a medium without histidine. The plates are incubated
to allow any revertant bacteria (those able to produce histidine) to grow. The number of colonies is a measure of
the mutagenicity of the suspected mutagen. Why is the rat liver extract included?
Solution
Most mutagens cannot act unless they are converted to electrophile by liver enzymes called mixed-function oxidase,
which include the cytochromes P-450s. The rat liver extract in the Ames test contains enzymes for converting
suspected mutagens to compounds that would be physiologically relevant mutation-causing agents in a mammal.
1.25.6 Complementation test

If two recessive mutations arise independently and both have the same phenotype, how do we know whether they
are both mutations of the same gene? The complementation test allows us to determine whether two mutations,
both of which produce a similar phenotype are in the same gene i.e. whether they are alleles or represent mutations
in separate genes, whose proteins are involved in the same function. In genetics, complementation occurs when
two strains of an organism with different homozygous recessive mutations that produce the same phenotype
produce offspring with the wild-type phenotype when mated or crossed. Complementation will occur only if the
mutations are in different genes.
In a diploid organism the complementation test of allelism (allelism test) is performed by intercrossing homozygous
recessive mutants two at a time and observing whether or not the progeny have a wild-type phenotype. If the two
recessive mutations are in separate genes and are not alleles of one another, then following the cross, all F1
progeny are heterozygous for both genes. Complementation is said to occur. Because each mutation is in a
separate gene and each F1 progeny is heterozygous at both loci, the normal products of both genes are produced.
If the two mutations affect the same gene and are alleles of one another. Complementation does not occur. Because
220
Genetics
Concept of cistron and genetic complementation

The word cistron was coined in 1956 by Seymour Benzer. He used the term to identify a segment of a genome that
is responsible for a single genetic ‘function’, as determined by the cis-trans complementation test. The underlying
idea of the test is that two mutations might produce similar phenotypic effects in several different ways. First, the
two mutations might alter the same gene and, consequently, affect the same enzymatically catalysed step in a
biochemical pathway. Alternatively, the two mutations might affect genes that encode enzymes for different steps
in a single biochemical pathway. A third possibility is that two mutations might block steps in two different biochemical
pathways that converge.
It is important to realize that a gene is not a point on a chromosome, but a segment of a chromosome. Mutations
within a single gene may occupy different sites (that is, different DNA bases) within the gene. Any two mutations
within a single gene are said to be ‘alleles’ in the sense that they affect the same genetic function. Mutations at
exactly the same site are called homoalleles; mutations at different sites within a gene are heteroalleles.
Problem
Seven arginine requiring mutants of E. coli were independently isolated. All pairwise matings were done to
determine the number of complementation groups involved. If a (+) in the following table indicates growth and a
(–) no growth on minimal medium, how many complementation groups are involved?
1 2 3 4 5 6 7
– + + + + – – 1
– + + – + + 2
– – + + + 3
– + + + 4
– + + 5
– – 6
– 7
Solution
A group of mutants which do not complement each other belongs to single complementation group. Thus, we
conclude that there are three complementation groups present: 1, 6 and 7 are mutually non-complementing, as
are 2 and 5 and 3 and 4.
1.26 Developmental genetics

A multicellular animal or plant arises from a single cell – a fertilized egg. During development, the cell divides
repeatedly to produce many different cells. The genetically identical cells come to differ from one another by
expressing distinct sets of genes during development. The differential gene expression controls cell proliferation,
cell specialization, cell interactions and cell movement. The strategies used to instruct genetically-identical cells to
express distinct sets of genes and thereby differentiate into diverse cell types are mRNA localization, cell-to-cell
contact and signaling through the diffusion of a secreted signaling molecule. In this section, we will encounter these
strategies during embryonic development in some model organisms.
1.26.1 Genetic control of embryonic development in Drosophila

Embryonic development in Drosophila is an orderly sequence of change and is controlled by the differential expression
of genes. Drosophila displays a holometabolous method of development, meaning that they have three distinct
stages of their post-embryonic life cycle, each with radically different body plans: larva, pupa and finally, adult (imago).
222
Genetics
Imago consists of a head followed by three thoracic segments (T1 to T3) and eight or nine abdominal segments
(A1 to A9). Segment T1 carries a pair of legs, T2 carries a pair of legs plus a pair of wings and T3 carries a pair of
legs plus a pair of halteres.
In Drosophila, after fertilization, the diploid nuclei undergo a series of nuclear divisions and forms a syncytium— a
group of nuclei without cell membranes. Most of nuclei then migrate from the middle of the egg toward the surface,
where they form a monolayer called the syncytial blastoderm. Later, plasma membrane encloses each nucleus and
thereby converting the syncytial blastoderm into a cellular blastoderm. A small subset of nuclei present in the
extreme posterior end of the egg are segregated into cells; these pole cells are the primordial germ cells that will
give rise to eggs or sperm.
Fertilized egg
Nine rounds of nuclear

divisions produce
multinucleated syncytium
Nuclei migrate to periphery

(syncytial blastoderm)
Nuclei become enclosed

in membranes, forming a
single layer of cells over
embryo surface
Pole cells (Cellular blastoderm)
(precursors to germ cells)
Figure 1.190 Early stages of embryonic development in Drosophila.
Three important classes of pattern-regulating genes specify the basic features and functions during embryonic
development: Maternal effect genes, Segmentation genes and Homeotic genes.
Maternal effect genes

Maternal effect genes are expressed during oogenesis by the mother (expressed prior to fertilization) and develop
the anterior-posterior and dorsal-ventral polarity of the egg. The anterior end of the egg becomes the head; the
posterior end becomes the tail. The dorsal side is on top; the ventral side is underneath. The products of maternal
effect genes, called maternal mRNAs, are produced by nurse cells and follicle cells and deposited in the egg cell
(oocyte). At the start of development, gradients of maternal mRNA and their products are established in the oocyte
along the anterior-posterior and dorsal-ventral axes.
About 30 maternal effect genes involved in pattern formation have been identified. In particular, products of four
maternal effect genes are critical to the formation of the anterior-posterior axis. The product of two maternal effect
genes, bicoid and hunchback, regulates the formation of anterior structures, while another pair of maternal effect
genes, nanos and caudal, specifies proteins that regulate the formation of the posterior parts of the embryo.
223
Chapter 02
Recombinant DNA technology (also known as genetic engineering) is the set of techniques that enable the DNA
from different sources to be identified, isolated and recombined so that new characteristics can be introduced into
an organism. The invention of recombinant DNA technology—the way in which genetic material from one organism
is artificially introduced into the genome of another organism and then replicated and expressed by that other
organism—was largely the work of Paul Berg, Herbert W. Boyer, and Stanley N. Cohen, although many other
scientists made important contributions to the new technology as well. Paul Berg developed the first recombinant
DNA molecules that combined DNA from SV40 virus and lambda phage. Later in 1973, Herbert Boyer and Stanley
Cohen develop recombinant DNA technology, showing that genetically engineered DNA molecules may be cloned in
foreign cells.
One important aspect in recombinant DNA technology is DNA cloning. It is a set of techniques that are used to
assemble recombinant DNA molecules and to direct their replication within host organisms. The use of the word
cloning refers to the fact that the method involves the replication of a single DNA molecule starting from a single
living cell to generate a large population of cells containing identical DNA molecules.
2.1 DNA cloning

DNA cloning is the production of a large number of identical DNA molecules from a single ancestral DNA molecule.
The essential characteristic of DNA cloning is that the desired DNA fragments must be selectively amplified resulting
in a large increase in copy number of selected DNA sequences. In practice, this involves multiple rounds of DNA
replication catalyzed by a DNA polymerase acting on one or more types of template DNA molecule. Essentially two
different DNA cloning approaches are used: Cell-based and cell-free DNA cloning.
Cell-based DNA cloning

This was the first form of DNA cloning to be developed, and is an in vivo cloning method. The first step in this
approach involves attaching foreign DNA fragments in vitro to DNA sequences which are capable of independent
replication. The recombinant DNA fragments are then transferred into suitable host cells where they can be propagated
selectively.
The essence of cell-based DNA cloning involves following steps:
Construction of recombinant DNA molecules

Recombinants are hybrid DNA molecules consisting of autonomously replicating DNA segment plus inserted elements.
Such hybrid molecules are also called chimera. Recombinant DNA molecules are constructed by in vitro covalent
attachment (ligation) of the desired DNA fragments (target DNA) to a replicon (any sequence capable of independent
DNA replication). This step is facilitated by cutting the target DNA and replicon molecules with specific restriction
endonucleases before joining the different DNA fragments using the enzyme DNA ligase.
235
Transformation
The recombinant DNA molecules are transferred into host cells (often bacterial or yeast cells) in which the chosen
replicon can undergo DNA replication independently of the host cell chromosome(s).
Selective propagation of cell clones

Selective propagation of cell clones involves two stages. Initially the transformed cells are plated out by spreading
on an agar surface in order to encourage the growth of well-separated cell colonies. These are cell clones (populations
of identical cells all descended from a single cell). Subsequently, individual colonies can be picked from the plate
and the cells can be further expanded in liquid culture.
Isolation of recombinant DNA clones

Isolation of recombinant DNA clones by harvesting expanded cell cultures and selectively isolating the recombinant
DNA.
Cloning
vector
Target DNA
Recombinant Non-recombinant
Introduction of cloning
vector into host
Transformed cell Transformed cell Non-transformed
Bacterial chromosome
Selection of transformed cells
Selection of transformed cell with recombinant
Amplification
Figure 2.1 An overview of DNA cloning in bacteria using a plasmid vector.
236
P1 vector and PAC

P1 bacteriophage has a much larger genome than lambda phage (in the range of 110 to 115 kb), and vectors have
been designed with the essential replication components of P1 incorporated into a plasmid. The P1-derived artificial
chromosome (PAC) are DNA constructs that are derived from the DNA of P1 bacteriophage. It is one type of vector
used to clone DNA fragments (100 to 300 kb insert size; average, 150 kb) in E. coli cells.
2.3.2 Cloning vectors for yeast, S. cerevisiae

Yeast S. cerevisiae has a genome of approximately 2 × 107 base pairs contained in 16 linear chromosomes, and
some strains possess a type of plasmid known as the 2-micron circle. This plasmid has 6,318 base pairs and is
present in a copy number of between 70 and 200 copies per cell.
Yeast vectors can be grouped into four general classes, based on their mode of replication in yeast: YIp, YRp, YCp,
and YEp. All of these plasmids can be maintained in E. coli as well as in S. cerevisiae and thus are referred to as
shuttle vectors. Shuttle vectors are capable of propagating between two different organisms. These vectors must
have unique origins of replication for each cell type as well as different markers for selection of transformed host
cells harboring the vector.
Yeast Episomal Plasmids (YEp)

YEp vectors are based on the endogenous yeast 2μ plasmid which contains genetic information for its own replication
and segregation. Some YEps contain the entire 2μ plasmid, others include only origin of replication of 2μ. They are
capable of autonomous replication and are present at 20–200 copies per cell.
Yeast Integrative Plasmid (YIp)

YIp is basically a bacterial plasmid carrying a yeast gene. It does not contain any parts of 2μ plasmid, and cannot
replicate as a plasmid. YIp vectors lack a yeast origin of replication and must be integrated into the yeast genome
in order to be maintained during cell division. They are normally present at one copy per cell and are very stable.
It consists of a segment of the E. coli plasmid pBR322 containing a selectable antibiotic resistance gene (Ampicillin)
and a bacterial replication origin, which facilitates selection and amplification in E. coli. YIps integrate by recombination
between homologous sequences on the YIp plasmid and the host genome.
Yeast Replicating Plasmids (YRp)

YRp vectors contain an Autonomous Replicating Sequence (ARS) of chromosomal origin in addition to the elements
found in YIp. YRps are capable of autonomous replication and are present at 3–30 copies per cell.
Yeast Centromeric Plasmids (YCp)

YCp vectors contain both an ARS and a yeast centromere. YCps are normally present at one copy per cell, can
replicate without integration into a chromosome and are stably maintained during cell division.
Yeast Artificial Chromosomes (YAC)

The major limitation of most of the vectors is the size limit of the DNA that can be cloned into them. YAC vectors
allow the cloning, within yeast cells, of fragments of foreign genomic DNA that can approach 500 kb in size. These
vectors are propagated in S. cerevisiae rather than in E. coli and are based on chromosomes, rather than on
plasmids or viruses. YAC is essentially pBR322 plasmid into which a number of yeast genes have been inserted.
The essential functional components of chromosomes are:
Centromeres: It is required for the disjunction of sister chromatids in mitosis and of homologous chromosomes at
the first meiotic division.
Telomeres: It is required for complete replication of linear molecules and for the protection of the ends of the
chromosome from nuclease attack.
Autonomous replicating sequence (ARS) elements: It acts as origin of replication.
Selectable marker: It is a gene for YAC selection in yeast. The vector has a functional copy of URA3, a gene
involved in uracil biosynthesis, and TRP1, a gene involved in tryptophan biosynthesis, that allow selection of yeast
cells that have taken up the vector.
252
Bacterial replication origin and a bacterial selectable marker: In order to propagate the YAC vector in bacterial
cells, YAC vectors usually contain the ColE1 ori and the ampicillin resistance gene for growth and analysis in E. coli.
R
amp
ori
TEL
TRP1 BamHI
ARS pYAC HIS3
CEN4 BamHI
TEL
SUP4
URA3
Figure 2.9 Schematic diagram of a YAC cloning vector, indicating prokaryotic gene for resistance to ampicillin
(AmpR), prokaryotic replication origin (ori), yeast auxotrophic markers (HIS3, TRP1), autonomous replicating
sequences (ARS1), yeast centromeres (CEN4), and telomeres (TEL).
Yeast selectable markers : All yeast vectors contain marker that allow selection of transformed yeast cells. The
most commonly used yeast selectable markers are genes which complement a specific auxotrophy (e.g. Leu-, His-,
Trp-, etc.) and thus require the host cell to contain a recessive, non-reverting mutation. The most commonly-used
auxotrophic selection markers for the selection of transformants are LEU2, TRP1, URA3 and HIS3 used in
corresponding mutant strains, which are auxotrophic for leucine, tryptophan, uracil and histidine, respectively.
Table 2.3 Maximum DNA insert possible with different cloning vectors
Vector Host Insert size
M13 E. coli 1–4 kb
Plasmid E. coli 1–5 kb
λ phage E. coli 5–25 kb
Cosmids E. coli 35–45 kb
P1 phage E. coli 70–100 kb
PACs E. coli 100–300 kb
BACs E. coli ≤ 300 kb
YACs S. cerevisiae 200–2000 kb
Source – Principle of gene manipulation by S.B.Primrose, R.M.Twyman and R.W.Old (modified).
2.3.3 Vectors for plants

Vectors for plants are based on either plasmid or viral genome.
Plasmid based vector
Ti and Ri plasmids present in the Agrobacterium species are used as vectors for plants. Agrobacterium is a naturally
occurring, Gram negative, soil bacteria with two common species, viz. A. tumefaciens and A. rhizogenes. These are
being considered as natural genetic engineers for their ability to transform plants. The Ti (tumor-inducing) plasmids
present in A. tumefaciens whereas Ri (root-inducing) plasmids present in A. rhizogenes.
In nature, wild type A. tumefaciens causes a crown gall disease primarily in dicot plants by transferring a defined
segment of DNA (called T-DNA, transferred DNA) from its Ti plasmid into the nuclear genome of plant cells.
A. rhizogenes causes hairy-root disease in plants and this is induced by Ri plasmids which are analogous to the Ti
plasmids.
253
The Agrobacterium DNA transfer system is a powerful vector system used for plant transformation. Any genes put
in the T-DNA region, gets transferred to the plant genome. The DNA is inherently stable once in the plant genome
since neither the border nor the virulence genes are transferred. Agrobacterium has been proved to be incredibly
useful for the transfer and insertion of genes into plants, but its scope is limited to plants that can be infected by the
bacteria.
Monocots are not the natural hosts of A. tumefaciens. Hence, most monocot plants are generally resistant to
Agrobacterium infection. It has been argued that Agrobacterium infection of monocots is inefficient because wounded
monocot tissues do not produce phenolics, such as acetosyringone, at sufficient levels to induce vir gene expression.
In the laboratory, it proved possible to induce tumours in certain monocot species, such as asparagus and yam. In
recent years, amazing progress has been made in the transformation of cereals using Agrobacterium. The first
species to be transformed was rice. The breakthrough in cereal transformation using Agrobacterium reflected the
recognition of a number of key factors required for efficient infection and gene transfer to monocots.
Ti-plasmid
Bacterial
chromosome
Vacuole
Agrobacterium tumefaciens
Plant cell
Figure 2.12 Schematic representation of the Agrobacterium T-DNA transfer process. Agrobacterium mediated
T-DNA transfer can be viewed as a three-step process. During the first step, bacterial attachment to plant
cell facilitates interactions between plant inducers, including low molecular weight phenolic compounds and
the signal-sensing VirA protein. The latter then activates the transcription activator VirG. The activated VirG
induces transcription of the rest of the vir genes located on the Ti plasmid. In the second step, a T-strand
containing a single-strand copy of T-DNA is cut out from the Ti plasmid by the VirD2 protein and transferred
from bacterial cell to plant cell through coordinated action of a variety of other vir genes product, including
the single-strand DNA binding protein, VirE2. In the final step, T-DNA is introduced into the nucleus and
subsequently integrated into the plant cell chromosome.
Viral vectors
The potential of a few plant viruses as vectors has been explored. One major problem with the vast majority of
plant viruses is that they have RNA genome and not DNA genome. RNA viruses are not useful as potential vectors.
Two classes of plant DNA viruses, caulimoviruses (dsDNA) and geminiviruses (ssDNA), have been used as vectors
to introduce foreign DNA into plants and neither is ideally suited for gene cloning. Caulimoviruses such as cauliflower
mosaic virus have very limited capacity for carrying inserted DNA and also an extremely narrow host range.
256
2.3.4 Vectors for animals

For Insects
P element, a transposon, is used as a vector in Drosophila. The P element is 2.9 kb in length and contains three
genes flanked by short inverted repeat sequences at either end of the element. The genes code for transposase,
the enzyme that carries out the transposition process. The inverted repeats form the recognition sequences that
enable the enzyme to identify the two ends of the inserted transposon. The vector is a plasmid that carries two
P elements, one of which contains the insertion site for the DNA that will be cloned. Insertion of the new DNA into
this P element results in disruption of its transposase gene. But the second P element carried by the plasmid has an
intact version of the transposase gene that provides transposase enzyme to carry out transposition.
Vectors for insects based on viral DNA are not common. However, dsDNA of baculoviruses is used as cloning
vector for many insects. Baculoviruses have rod-shaped capsids and large, dsDNA genomes.
For mammal
The genome of many viruses are used as cloning vectors for mammals. The first vector used for mammalian cell
was based on SV40 virus genome. SV40 is a small virus that infects monkey (simian). Now genome of many
viruses such as adenoviruses and papillomaviruses which have a relatively high insert capacity are used as vectors
for cloning/expression of genes in mammalian cells. At present, retroviruses are the most commonly used vectors.
2.4 Introduction of DNA into the host cells

2.4.1 In bacterial cells
The process by which bacterial cells take up naked DNA molecules is called transformation. There are basically two
general methods for transforming bacteria.
Chemical transformation method : Bacteria which are able to uptake DNA are called ‘competent’ and are made
so by chemical treatment. Competency is a physiologic state, which changes the structure and permeability of the
cell membrane so the naked DNA can enter the cell. The chemical transformation method utilizing CaCl2 and heat
shock to promote DNA entry into cells. The chemical method uses bacteria that are incubated with DNA on ice cold
salt solution containing CaCl2 followed by a brief heat shock at 42°C. Exactly how this treatment works is not
understood. Possibly CaCl2 causes the DNA to precipitate onto the surface of the cells, or perhaps the salt is
responsible for some kind of change in the cell wall that improves DNA binding.
Electroporation : Competency can also be achieved through the use of electrical pulses called electroporation. It
uses a short pulse of electric charge to facilitate DNA uptake. Electroporation induces formation of microscopic
pores within a biological membrane. These pores, called electropores, allow molecules, ions and water to pass from
one side of the membrane to the other.
2.4.2 In plant cells

The process of transferring exogenous DNA into plant cells is called transformation. Gene transfer to plant cells is
achieved using two different methods:
A. Vector-mediated methods
The vector-mediated methods (or indirect gene transfer methods) exploit the natural ability of certain bacteria
(Agrobacterium species) and viruses to naturally transfer DNA to the genomes of infected plant cells.
Agrobacterium-mediated transformation
Members of the genus Agrobacterium are also known as natural genetic engineers of plants since these bacteria
have ability to transfer T-DNA of their plasmid (Ti and Ri) into plant genome upon infection of cells at the wound site.
In the natural environment, Agrobacterium introduces its T-DNA into compatible host plant cells and via highly
evolved molecular mechanisms stably integrates the new DNA into the plant genome.
257
Problem
Which of the following partial amino acid sequences from a protein whose gene you wish to clone would be most
useful in designing an oligonucleotide probe to screen a cDNA library?
P. Met–Leu–Arg–Leu
Q. Met–Trp–Cys–Trp
Explain why?
Solution
Q is the best choice for reverse translation into a DNA sequence because it contains fewer amino acid residues having
multiple codons; Trp and Met have one codon each and Cys has two. In contrast, Leu and Arg each have six codons.
Colony and plaque hybridization
Once a library has been prepared, a number of procedures can be employed for identification of the desired
clone. Since a genomic library lacks an index, it must be screened for the presence of a particular gene. This is
done by a process known as colony or plaque hybridization. In colony and plaque hybridization, the DNA in
plaque or colony is transferred to a nylon or nitrocellulose membrane. The colonies or plaques transferred to the
membrane are subjected to alkali hydrolysis and detergent treatment to release the DNA content from the
bacterial cells or viral capsids, which would then bind to the membrane. The DNA on the membrane is denatured
with an alkali to produce single strands which are bound to the membrane by baking or UV irradiation. The
membrane is then immersed in a solution containing a nucleic acid probe, which is usually radioactively labeled and
incubated to allow the probe to hybridize to its complementary sequence. After hybridization, the membrane is
washed extensively to remove unhybridized probe, and regions where the probe has hybridized are then visualized.
This is carried out by exposure to X-ray film (autoradiography) if the probe was radioactively labeled, or by using
a solution of antibody or enzyme and substrate if the probe was labeled with a modified nucleotide. By comparing
the membrane with the original dish and lining up the regions of hybridization, the original group of colonies or
plaques can be identified.
Addition
of probe
Bacterial colonies are The filter is treated The filter is then Filter is rinsed and
transferred from the with detergent to lyse incubated with nucleic subjected to autoradiography
surface of an agar the bacteria and alkali acid probe radioactively which will make visible only
culture plate onto to denature their DNA labeled, ssDNA or RNA those colonies containing
nitrocellulose paper. which attach by base DNA that is complementary
pairing to complementary in sequence to the probe.
DNA present on the filter.
2.10 Polymerase chain reaction

PCR is a rapid and versatile in vitro method for amplifying defined target DNA sequences present within the source
of DNA. This technique was formulated in 1985 by Kerry Mullis. Usually, the method is designed to permit selective
amplification of a specific target DNA sequence(s) within a heterogeneous collection of DNA sequences (e.g. total
genomic DNA or a complex cDNA population). To permit such selective amplification, some prior DNA sequence
information from the target sequences is required. This information is used to design two oligonucleotide primers
(amplimers) which are specific for the target sequence and which are often about 15–25 nucleotides long. After the
primers are added to denatured template DNA, they bind specifically to complementary DNA sequences at the
target site. In the presence of a suitably heat-stable DNA polymerase and DNA precursors (the four deoxynucleoside
272
triphosphates, dATP, dCTP, dGTP and dTTP), primer initiates the synthesis of new DNA strands which are
complementary to the individual DNA strands of the target DNA segment, and which will overlap each other.
Primer design
To permit selective amplification, some prior DNA sequence information from the target DNA is required. The information
is used to design two primers (amplimers), which are specific for sequences flanking the target DNA sequence.
So, for most PCR reactions, it is very important to reduce the chance of the primers binding to other locations in the
DNA than the desired one. Hence, certain rules for primer design are important to consider. These rules follow:
1. Primer length : Length of the primers should not be very short or long. If the primers are too short, they might
hybridize to non-target sites and give undesired amplification products. Similarly, long primer influences the
rate at which it hybridizes to the template DNA; long primers hybridize at a slower rate.
2. Base composition : The GC content should be between 40 and 60% with an even distribution of all four nucleotides.
3. Nature of sequences : Inverted repeats or any self-complementary sequences >3bp in length is to be avoided.
4. Melting temperature : Tm values for two primers used together should not differ by >5°C and the Tm of the
amplification product should not differ from those of the primers by >10°C.
Degenerate primers
In order to make the PCR primers, some sequence information is required. Degenerate primers are used when
partial sequence information is available, but the complete sequence is unknown. A degenerate primer is a mixture
of primers, all of similar sequence but with variations at one or more positions. Degenerate DNA primers are
generally used if only a protein sequence is available. In this case, the protein sequence is translated backwards to
give the corresponding DNA sequence. Due to the degeneracy of the genetic code, several possibilities will exist for
the sequence of DNA that corresponds to any particular polypeptide sequence. Again, most of the ambiguity is in
the third codon position. This ambiguous sequence may be used to make degenerate primers.
Reaction cycle
The PCR is a chain reaction because newly synthesized DNA strands will act as templates for further DNA synthesis
in subsequent cycles. It consists of a series of cycles of three successive reactions:
• Denaturation, typically at about 93–95°C for human genomic DNA.
• Primer annealing at temperatures usually from about 50°C to 70°C depending on the Tm of the expected
duplex (the annealing temperature is typically about 5°C below the calculated Tm). Annealing temperature
must be low enough to enable hybridization between primer and template, but high enough to prevent mismatched
hybrids from forming. This temperature can be calculated by determining the melting temperature or Tm of the
primer–template hybrid. The Tm can be determined experimentally or calculated from the simple formula:
Tm = (4×[G + C]) + (2×[A + T])°C
• DNA synthesis, typically at about 70–75°C.
These three steps constitute one cycle of the PCR amplification and can be carried out repetitively just by changing
the temperature of the reaction mixture. The thermostability of the polymerase makes it feasible to carry out PCR.
Suitable heat-stable DNA polymerases have been obtained from microorganisms whose natural habitat is hot
springs. For example, the widely used Taq DNA polymerase is obtained from Thermus aquaticus and is thermostable
up to 94°C, with an optimum working temperature of 80°C. Other thermostable DNA polymerase currently used in
PCR are Pfu (Pyrococcus furiosus), Bst E (Bacillus stearothermophilus) and Tth (Thermus thermophilus).
After each cycle, the number of templates doubles, so that if one starts with a single double-stranded DNA molecule,
after 20 cycles, the number of molecules synthesized by the PCR is 1 × 106, and after 30 cycles the number of
molecules increases to 1 × 109. This number can be calculated by applying the following formula:
Mf = Mi × 2n
273
2.12 Genome mapping

Genome mapping is a method used to identify the locations of genetic markers (which can be genes and other DNA
sequences) and the relative distances between genetic markers on genome. There is a difference between a
genome map and a genome sequence. A genome sequence spells out the order of every nucleotide in the genome,
while a map simply identifies a series of landmarks in the genome. A genome map is less detailed than a genome
sequence. There are three kinds of maps - genetic, cytological (or cytogenetic) and physical map.
The genetic map gives the relative position of genetic markers according to the frequency of recombination,
expressed in term of centimorgans (cM). Genetic maps illustrate the order of genetic markers on a chromosome
and the relative distances between those markers.
The cytological map depicts the locations of genetic markers in a chromosome relative to visible landmarks. In
most cases, each chromosome has a characteristic banding pattern, which may be either naturally present, (e.g. in
polytene chromosomes of Drosophila) or more commonly generated by specific staining protocols (e.g. in case of
human chromosomes); the genetic markers are mapped cytologically relative to these band locations. Fluorescent in
situ hybridization (FISH) is widely used to map the cytological locations of genes and other DNA sequences within
large eukaryotic chromosomes.
The physical maps describe the absolute distance between two genetic markers in term of base pairs.
2.12.1 Genetic marker

A gene or DNA sequence having a known location on a chromosome and associated with a particular trait or gene
is used as a genetic marker. Genes were the first markers to be used to prepare the first genetic maps of fruit fly.
Genetic markers used in genetics and plant breeding can be classified into two categories: classical markers and
DNA markers.
Classical markers include morphological markers, cytological markers and biochemical markers.
Morphological markers : Morphological (or visible) markers are usually visually characterized phenotypic traits
or characters such as flower color, seed shape, growth habits or pigmentation. However, morphological markers
are very limited, and many of these markers are not associated with important economic traits (e.g. yield and
quality). These markers are also influenced by environmental factors or the developmental stages.
Cytological markers : Cytological markers are the unique structural features of chromosomes such as bands,
secondary constrictions. These chromosome features are used not only for characterization of normal chromosomes
and detection of chromosomal mutation, but also widely used in mapping and linkage group identification. However,
direct use of cytological markers has been very limited in genetic mapping.
Biochemical markers are gene products that can be detected easily by electrophoresis and specific staining.
Enzyme variants such as isozymes and allozymes are commonly used as biochemical markers. Allozymes are
enzymes encoded by different alleles of a gene but have the same catalytic activity or function. Allozymes can be
separated by electrophoresis and other separating techniques on the basis of differences in molecular size, shape
and electrical charge. Isozymes are different from allozymes. Isozymes are enzymes that perform the same
catalytic function, but are encoded by different nonallelic genes located at different loci. Allozymes reflect the
products of different alleles of a gene rather than different nonallelic genes located at different loci. Biochemical
markers are also called as protein markers. The major disadvantages of biochemical markers are that they are
limited in number.
A DNA marker is defined as a particular segment of DNA that is representative of the differences at the genome
level. DNA marker is also called as molecular marker. Strictly speaking, protein markers and DNA markers are
both molecular markers, but the current uses of the term is limited to DNA markers. DNA markers should not be
considered as normal genes, as they usually do not have any biological effect, and instead can be thought of as
constant landmarks in the genome. They are identifiable DNA sequences, found at specific locations of the genome,
280
and transmitted by the standard laws of inheritance from one generation to the next. An ideal DNA marker should
have the following criteria:
1. High level of polymorphism,
2. Even distribution across the whole genome,
3. Provide adequate resolution of genetic differences,
4. Co-dominance in expression (so that heterozygotes can be distinguished from homozygotes),
5. Have linkage to distinct phenotypes,
6. Genome-specific in nature.
2.12.2 Types of DNA markers

Various types of DNA markers have been described in the literature. They can be broadly divided into two classes
based on the method of their detection: Hybridization-based (such as RFLP) and PCR based (such as RAPD, AFLP,
SSLP). PCR-based techniques can further be subdivided into two subcategories: arbitrarily primed PCR-based
techniques or sequence nonspecific techniques (such as RAPD, AFLP) and sequence targeted PCR-based tech-
niques (such as SSLP, SNP). The molecular markers can also be classified on the basis of sequence variation
(e.g. RFLP) and length variation (e.g. SSR). DNA markers may be described as codominant or dominant. This
description is based on whether markers can discriminate between homozygotes and heterozygotes. Codominant
markers indicate differences in size whereas dominant markers are either present or absent.
P1 P2 F1 P1 P2 F1
AA aa Aa BB bb Bb
(a) (b)
Figure 2.27 Comparison between (a) codominant and (b) dominant markers. Codominant markers can
clearly discriminate between homozygotes and heterozygotes whereas dominant markers do not. Genotypes
at two marker loci (A and B) are indicated below the gel diagrams.
RFLPs
RFLP (Restriction Fragment Length Polymorphisms) is the most widely used hybridization-based molecular marker.
RFLP markers were first used in 1975 to identify DNA sequence polymorphisms for genetic mapping. RFLPs arise
because mutations can create or destroy the sites recognized by specific restriction enzymes, leading to variations
between individuals in the length of restriction fragments produced from identical regions of the genome. Although
two individuals of the same species have almost identical genomes, they will always differ at a few nucleotides due
to point mutation and insertion/deletion. Some of the differences in DNA sequences at the restriction sites can
result in the gain, loss or relocation of a restriction site.
A single base change within a restriction site is a readily detectable genetic marker because the mutated site is no
longer cleaved by the enzyme in question. Two chromosomes that differ by such a mutation are then distinguish-
able on the basis of a restriction fragment length polymorphism (RFLP), which arises because a particular cleavage
site is present in only one of the two DNA molecules. A mutation that gives rise to an RFLP, thus represents a genetic
marker. RFLPs have only two alleles: the site is present or absent. The maximum heterozygosity is 0.5. The RFLP
markers are codominantly inherited and highly reproducible.
281
Table 2.10 List of industrially important plant secondary metabolites produced through tissue culture
Product Plant source Uses
Azadirachtin Azadirachta indica Insecticidal
Berberine Coptis japonica Antibacterial
Digoxin Digitalis lanata Cardiac medicine
Diosgenin Dioscorea deltoidea Antifertility
Taxol Taxus baccata Anticarcinogenic
Codeine Papaver sp. Analgesic
2.19 Animal cell culture

Cells in animals exist in an organized tissue matrix which require for their controlled growth and differentiation.
These cells from intact organisms may be isolated, maintained and grown in vitro in culture media aseptically
containing a suitable mixture of nutrients and growth factors. This process is called animal cell culture.
2.19.1 Primary cultures

A primary cell culture is prepared by inoculating cells directly from tissues of an organism into culture media (that
is, without cell proliferation in vitro). With the exception of some cells derived from tumors, most primary cell
cultures have a limited lifespan. After a certain number of divisions, cells undergo the process of senescence and
stop dividing. In these cells, the limited proliferation capacity reflects a progressive shortening of the cell’s telomeres,
the repetitive DNA sequences and associated proteins that cap the ends of each chromosome.
The primary cell culture is of two types depending on the kind of cells in culture – attachment culture and suspension
culture. Attachment culture involves the adherent or anchorage dependent cells. To survive and grow, most cells
require a surface to which they can attach, thus they are anchorage dependent. Without the surface attachment,
these cells cannot survive. These adherent cells are usually derived from tissues of organs such as kidney, where
they are immobile and embedded in connective tissue. Suspension culture involves non-adherent or anchorage
independent cells which do not require attachment for growth or do not attach to the surface of the culture vessels.
It is a culture in which cells will multiply when suspended in growth medium. Lymphocytes are anchorage independent
cells commonly grown in suspension culture.
2.19.2 Cell line

When a primary cell culture is subcultured, it becomes a cell line. It is a propagated culture after the first subculture.
Subculture (or passage) refers to the transfer of cells from one culture vessel to another. The cell lines may be finite
cell line or infinite cell line. A finite cell line (or normal cell line) is a line of cells that will undergo only a finite number
of divisions in cell culture and eventually undergoes senescence. It has a limited number of possible subcultures or
passages. Normal mammalian cells generally have a finite life span in culture; that is, after a number of divisions
characteristic of the species and cell type, the cells stop dividing. These cell lines exhibit the property of contact
inhibition, density limitation and anchorage dependence.
Some cell lines may avoid senescence and give rise to continuous cell lines. A cell line that has the potential to be
subcultured indefinitely is termed infinite (or continuous) cell line. Continuous cell lines are usually aneuploid.
Infinite cell lines are also known as transformed cell lines due to altered growth properties of immortalized cells. A
permanent alteration of the cell phenotype as a result of an irreversible genetic change is called transformation. It
may occurred spontaneously or may be induced by chemical carcinogens or viruses. Transformed cells do not
necessarily mean cancer or tumor cells. Transformed cell lines do not exhibit the property of contact inhibition,
density-dependent inhibition of proliferation and anchorage dependence. They have a reduced requirement for
serum or growth factors for optimal growth. A transformed cell line often has an abnormal chromosome number
316
(aneuploid) and overproduces different proteins. Cancer cells are naturally immortal. Thus all cancerous cell lines
are transformed, although it is not clear whether all transformed cell lines are cancerous.
Transformation characteristics
Genetic abnormalities
Chromosome abnormality
Aneuploidy
Telomerase activity
Growth characteristics
Loss of contact inhibition
Anchorage-independent growth
Reduced growth factor requirements
Biochemical changes
Increased glucose transport
Increased lactate production
20
10
Continuous
18 Primary cell line
10 culture Finite cell line
Cumulative cell number
16
10 Transformation
14
10 Senescence
and death
12
10
2nd subculture
1st subculture
10
10
Explantation
8
10
Subculture interval
6
10
4
10
0 2 4 6 8 10 12 14 100
Weeks in culture
Figure 2.45 Graph showing the salient features of cell culture with evolution of a cell line. Although a
continuous cell line is depicted as arising at 14 weeks, with different cells it could arise at any time. Likewise
senescence may occur at any time.
Table 2.11 Differences between normal and transformed cells

Normal Transformed
Anchorage dependent Anchorage independent
Mortal; finite number of divisions Immortal or continuous cell lines
Contact inhibition; monolayer culture No contact inhibition; multilayer culture
Dependent on external growth factor May not need an external source of growth factor
Retention of differentiated cellular function Typically loss of differentiated cellular function
Display typical cell surface receptors Cell surface receptor display may be altered
The first cell line—the mouse fibroblast L cell—was derived from cultured mouse subcutaneous connective tissue
by exposing the cultured cells to a chemical carcinogen. Another important cell line, the HeLa cell, was derived
from a 31-year-old black woman named Henrietta Lacks, who died of cervical cancer in 1951. Since these early
cell lines, hundreds of cell lines have been established.
317
Table 2.12 Animal cell lines commonly used in culture

Cell line Origin
BHK Syrian baby hamster kidney
CHO Chinese hamster ovary
HeLa Human cervical carcinoma
IMR-90 Human embryonic lung
L Mouse connective tissue
MDCK (Madin Darby) canine kidney
MRC-5 Human embryonic lung
MPC-11 Mouse myeloma
Namalwa Human lymphoblastoid (Burkitt’s lymphoma)
WI-38 Human embryonic lung
WISH Human amnion
Vero African green monkey
2.19.3 Growth cycle

Animal cell growths in culture have a characteristic growth pattern similar to bacteria. As cells grow and divide in a
monolayer or in suspension, they usually follow a characteristic growth pattern composed of three phases: Lag
phase, log phase and plateau (stationary) phase.
6
10
Cells/ml
5
10
Subculture
and seeding
Lag Log Plateau

4
10
0 2 4 6 8 10
Figure 2.46 Each time that a cell line is subcultured it will grow back to the cell density that existed before
subculture. This process can be described by plotting a growth curve from samples taken at intervals throughout
the growth cycle, which shows that the cells enter a latent period of no growth, called the lag phase, immediately
after reseeding. This phase lasts from a few hours up to 48 hr, but is usually around 12-24 hr. They then enter
exponential growth in what is known as the log phase, during which the cell population doubles over a definable
period, known as the doubling time and characteristic for each cell line. As the cell population becomes crowded
when all of the substrate is occupied, the cells become packed, spread less on the substrate, and eventually
withdraw from the cell cycle. They then enter the plateau or stationary phase, where the growth fraction
drops to close to zero. Some cells may differentiate in this phase; others simply exit the cell cycle into G0 but
retain viability.
318
Chapter 03
Plant Physiology
3.1 Plant-water relationship

Water is essential for life. The most abundant substance of the living cell is water. It accounts for about 70% of a
cell’s weight. It is essential for all physiological activities of the plant. It provides the medium in which most
substances remain dissolved. Water (H2O) is made up of two hydrogen atoms and one oxygen atom, with a total
atomic mass of 18 daltons. It is a polar molecule. Although water is electrically neutral, it has a partial positive
charge on each hydrogen and a partial negative charge on oxygen.
Water acts as an excellent solvent. It dissolves more substances than any other liquid. This is because it has very
high value of dielectric constant, which is a measure of the capacity to neutralize the attraction between electrical
charges. Because of this property, water is an especially powerful solvent for electrolytes and polar molecules such
as sugars.
Water has a high specific heat (the amount of energy required to raise the temperature of a unit mass of a
substance by 1°C is called its specific heat). The high specific heat of liquid water is caused by the arrangement of
its molecules, which allows the hydrogen and oxygen atoms to vibrate freely, almost as if they were free ions. Thus,
they can absorb large quantities of energy without much temperature increase. That’s why plants can resist large
fluctuations in temperature.
Water has a high heat of vaporization (the energy necessary to go from a liquid to a gas). 586 cal are required to
convert 1 g of water at 20°C to 1 g of water vapour at 20°C. Thus, evaporation from leaves cools the plant.
The extensive hydrogen bonding in water gives rise to the property known as cohesion. Cohesion gives water a
high tensile strength which is the ability to resist stretching (tension) without breaking. Cohesion among water
molecules also accounts for surface tension.
3.1.1 Diffusion and osmosis

Diffusion is the random movement of molecules along the concentration gradient (from an area of higher
concentration to an area of lower concentration) by their own kinetic energy. It is a spontaneous and passive
process. The rate of diffusion depends on several factors such as concentration difference, size of molecules and
temperature. The rate of diffusion of molecules down a concentration gradient is given by the Fick’s law:
⎛ ΔC ⎞
J = −D⎜ ⎟
⎝ Δx ⎠
Where J is the flux per unit area, D is the diffusion coefficient (usually expressed as cm2/sec) and ΔC is the
difference in concentration between two regions separated by a distance Δx. The negative sign accounts for the fact
that diffusion is toward the lower concentration.
Osmosis is a specialized case of diffusion that involves the passive transport of water (i.e. solvent). In osmosis,
water moves through a semipermeable membrane from a region of its higher concentration to a region of its lower
325
Plant Physiology
concentration. Semipermeable membrane selectively allows the passage of a solvent while restricting the movement
of solutes. Plasma membranes of plant cells are selectively permeable not semipermeable membrane because
they allow the movement of solvent (water) as well as solutes. The selective permeability is due to the presence of
the discriminating barrier of the lipid bilayer and the specific transport proteins.
Semipermeable membrane
Low solute High solute

concentration concentration
Direction of flow of solvent
Figure 3.1 Osmosis is the diffusion of water (solvent) across a semipermeable membrane.
In osmosis, selective diffusion of solvent is driven by the internal energy of the solvent molecules. It is convenient
to express the available energy per unit volume in terms of osmotic pressure. It is defined as the pressure required
to completely stop the entry of water into an osmotically active solution across a semipermeable membrane. It is
also defined as the minimum pressure needed to stop osmosis. It is measured in atmospheres or bars (1 bar equal
to 100 kilopascals). The osmotic pressure is directly proportional to the difference in the concentration of the total
number of solute molecules on each side of the membrane.
Semipermeable membrane Osmotic pressure

required to prevent
net water flow
Low solute High solute Solution B

concentration concentration Solution A Solution B
Solution A
Solution A Solution B
CA CB
Direction of flow of solvent
Figure 3.2 Osmotic pressure. Solutions A and B are separated by a semipermeable membrane. If the total
concentration of solutes in solution B is greater than solution A, water will tend to flow across the membrane
from solution A to solution B. The osmotic pressure between the solutions is the minimum pressure that
would have to be applied to solution B to stop osmosis. From the van’t Hoff equation, osmotic pressure is
given by π = RT(CB–CA), where R is the gas constant and T is the absolute temperature.
Tonicity
Tonicity is the measure of the osmotic pressure gradient of two solutions separated by a semipermeable mem-
brane. There are three types of tonicity that one solution can have relative to another: hypertonic, hypotonic
326
Plant Physiology
Osmotic potential
Osmotic potential (also called solute potential) represents the effect of dissolved solutes on water potential. Pure
water at atmospheric pressure has a solute potential of zero. Addition of solutes reduces the free energy of water.
After addition, the solutes bind water molecules reducing the number of free water molecules and lowering the
capacity of water to move and do work. Thus, adding solutes always lowers water potential. The solute potential
depends on the concentration of dissolved solutes in the water and is independent of the specific nature of the
solute.
Pressure potential
The pressure potential is the effect of hydrostatic pressure on the potential energy of a solution. If a pressure
greater than atmospheric pressure is applied to pure water or a solution, its water potential increases. It can be
positive or negative relative to the atmospheric pressure. Positive pressures raise the water potential; negative
pressures reduce it. The positive value of pressure potential within cells is referred to as turgor pressure. The value
of pressure potential is usually positive, but can also be negative as is the case in the xylem under large tension
(negative hydrostatic pressure). The value of pressure potential for pure water in an open beaker is 0 MPa.
Gravitational potential
Gravitational potential depends on the position of water in a gravitational field. It is the effect of height of a system
above sea level. Its value is 0 MPa at sea level. Gravitational potential depends on the height of water above sea
level and the acceleration due to gravity. Thus, raising a system vertically 10 metres will increase its water potential
energy by 0.1 MPa. At the cell level, value of gravitational potential is negligible compared to pressure potential and
solute potential, so it is generally omitted.
Matric potential
Matric potential depends on the adsorptive forces that bind water to a dry matrix. It manifests the tenacity with
which water is held by the dry matrix.
As the matric potential is very much limited in living cells and also at cell level, value of gravitational potential is
negligible, the water potential expression simplifies to:
ψ = ψs + ψp
Example
Let us take, a flaccid plant cell (i.e. a cell with no turgor pressure) which has an osmotic potential (ψs) of –0.5 MPa.
Because the cell is flaccid, the internal pressure is the same as atmospheric pressure, so the pressure potential (ψp)
is 0 MPa and the water potential of the cell is –0.5 MPa. Now suppose, this cell is placed in the beaker containing
sucrose solution which has a water potential (ψ) of –0.2 MPa. This value is greater (less negative) than the water
potential of the cell (ψ = –0.5 MPa), water will move from the sucrose solution in to the cell (from high to low water
potential).
Flaccid cell
Flaccid cell
dropped into
sucrose
solution
Yp = 0 Mpa Yp = 0 Mpa At equilibrium,
Ys = –0.5 Mpa Ys = –0.5 Mpa Ysol = Ycell = –0.2 Mpa
Y = –0.5 Mpa Ycell = –0.5 Mpa
Ysol = –0.2 Mpa
328
Plant Physiology
As water enters the cell, the protoplast beings to press against the cell wall. The wall resists pressure by applying
an equal but opposite inward pressure on protoplast. This increases the pressure potential (ψp) of the cell.
Consequently, the cell water potential increases, and the difference between inside and outside water potential is
reduced. Eventually, cell pressure potential increases enough to raise the cell water potential to the same value as
the water potential of the sucrose solution. At this point, equilibrium is reached (Δψ = 0 MPa), and net water
transport ceases.
At equilibrium, ψ(cell) = ψ(solution). Because the volume of the beaker is much larger than that of the cell, the tiny
amount of water taken up by the cell does not significantly affect the solute concentration of the sucrose solution.
Hence, ψs, ψp and ψ of the sucrose solution are not altered. Therefore, at equilibrium, ψ(cell) = ψ(solution) = –0.2 MPa.
Calculation of cell ψp and ψs requires knowledge of change in cell volume. Due to entry of water, cell volume
increases but the number of solutes within the cell remain constant. Thus, final concentration of solutes will decrease.
By calculating the change in solute concentration, ψs and ψp of cell can be determined.
3.1.3 Mass flow

Diffusion is an efficient process for short distance transport within a cell and between cells. However, this process is
too slow to function in long-distance transport within a plant. Mass flow (or bulk flow) is the movement of matters
in bulk or en masse from one point to another as a result of pressure differences between the two points. Pressure-
driven bulk flow of water and dissolved solutes is the predominant mechanism responsible for long-distance
transport in the tracheids and vessel elements of the xylem and within the sieve-tube elements of the phloem.
Pressure-driven bulk flow is different from diffusion. In case of diffusion, different substances move independently
depending on their concentration gradients. Bulk flow is independent of solute concentration gradients.
3.2 Absorption and radial movement of water

3.2.1 Absorption of water
Root is the primary site for absorption of water. Upon seed germination, the embryonic root, called the radicle,
grows and develops into the first root. A developing root has three zones of development- meristematic zone,
elongation zone and maturation zone. The maturation zone is sometimes also called the zone of differentiation or
root-hair zone. Root hairs are extensions of the epidermis that serve to increase surface area and aid in absorption
of water and soil nutrients.
Absorption of water by roots is a passive, pressure driven process. The actual movement of water through a cell
membrane is the result of two processes: diffusion and bulk flow. The size of a water molecule permits it to pass
through the bilayer of the plasma membrane. This would be largely a diffusion movement subject to Fick’s law. The
membrane also possesses transport proteins; the one involved with water transport is called an aquaporin. The
aquaporin protein serves as a water-filled channel. The flow through this channel is accomplished by submicroscopic
bulk flow. In some cases, aquaporins also allow transport of small neutral solutes across a cellular membrane.
Recent data indicate that plant aquaporin activity might be regulated by gating mechanisms. The factors affecting
the gating behaviour possibly involve phosphorylation, pH, calcium, pressure and temperature. Regulation of
aquaporin trafficking may also represent a way to modulate membrane water permeability.
329
Plant Physiology
3.7 Translocation in the phloem

The movement of the photoassimilates (products of photosynthesis) over long distances through the phloem is
known as translocation. Photoassimilates translocate from site of photosynthesis to the areas of growth and storage.
The cells of the phloem, through which photoassimilates move throughout the plant, are called sieve elements.
Sieve elements include both the highly specialized sieve tube elements typical of the angiosperms and the relatively
less specialized sieve cells of gymnosperms. Sieve tube elements (or sieve-tube members) are elongated living
cells. As they mature, they undergo a series of progressive changes that result in the breakdown and loss of the
nucleus, the tonoplast, Golgi bodies and ribosomes. At maturity, these cells have a functional plasma membrane
and modified mitochondria, plastids and smooth endoplasmic reticulum. The sieve tube elements of most
angiosperms also contain phloem protein called P-protein. P-protein appears to function in sealing off damaged
sieve elements by plugging up the sieve plate pores. Sieve elements are joined end to end; with pore-filled sieve
plates between, to make a sieve tube. In gymnosperm, sieve elements are called sieve cells. In sieve cells there
is no sieve plate and all sieve areas are similar. Pores in sieve areas appear blocked with membranes. Alongside
each sieve-tube element is a nonconducting cell called a companion cell which is connected to the sieve-tube
element by numerous channels, plasmodesmata. Companion cells (albuminous cells in gymnosperms) have a
dense cytoplasm, mitochondria, nucleus, Golgi, ER, and chloroplasts. Although their function is not well understood,
they can be considered nurse cells to the sieve tube elements. These cells are derived from the same cambial initial
cell as the sieve tube elements. There are three different types of companion cells: ordinary companion cells,
transfer cells and intermediary cells. All three cell types have dense cytoplasm and abundant mitochondria.
Ordinary companion cells have smooth walls and few or no plasmodesmata connections to cells other than the
sieve tube. Transfer cells are like ordinary companion cells, but have much folded walls that are adjacent to non-
sieve cells, allowing for larger areas of transfer. Intermediary cells have smooth walls and numerous plasmodesmata
connecting them to other cells. Transfer cells transfer sugars from the apoplast to the symplast of the sieve
elements and companion cells in the source. Intermediary cells, on the other hand, function in the symplastic
transport of sugars from mesophyll cells to sieve elements in plants.
Girdling experiment demonstrates that translocation of organic solutes occurs through phloem. In this classic
experiment, the bark of a tree was removed in a ring around the trunk (called girdling). Bark describes all tissues
external to the vascular cambium, consisting mainly of the secondary phloem and layers of periderm. With this
experiment it has been observed that girdling has no immediate effect on transpiration. However, transport of
organic solutes in the trunk is blocked at the site where the bark has been removed. Organic solutes accumulate
above the girdle. Eventually the bark below the girdle dies, while the bark above swells and remains healthy.
Bark
Girdle
{ Wood
Accumulated
materials
Patterns of translocation
Materials are translocated in the phloem from source to sink. An organ or tissue that produces more assimilate
than it requires for its own metabolism and growth is a source. Mature leaves, exporting storage organ such as beet
or carrot roots in second year and cotyledons and endosperm cells of seed are sources. On the other hand, an
organ or tissue that imports photoassimilate is a sink. Any growing, storing or metabolizing tissues or organs such
349
Plant Physiology
as root, developing fruits act as sinks. But, the source and sink may be reversed depending on the season, or the
plant’s needs. Since the source-sink relationship is variable, the direction of movement in the phloem can be
upwards or downwards, i.e. bi-directional. This contrasts with that of the xylem where the movement is always
unidirectional, i.e. upwards.
Materials translocated in the phloem

The translocated solutes are mainly carbohydrates, and sucrose is the most commonly translocated sugar. The
translocated carbohydrates are mostly nonreducing sugars. Some families, in addition to sucrose, translocate
oligosaccharides of raffinose series (Raffinose, stachyose and verbascose). Sucrose is a disaccharide made up of
one glucose and one fructose molecule. Raffinose, stachyose and verbascose contain sucrose bound to one, two or
three galactose molecules, respectively.
Phloem sap also contains protein, amino acids, organic acid such as malate, plant hormones (such as auxin, ABA,
gibberellins, cytokinins) as well as inorganic ions (such as potassium, magnesium, phosphate and chloride). The
predominant amino acids are glutamic acid and aspartic acid. Nitrogen is transported in the sieve tubes almost
exclusively in the organic form as amino acids. Among various ions, potassium is the most abundant. A variety of
proteins and RNAs (such as mRNAs and small regulatory RNAs) occur in phloem sap. A predominant protein called
P-protein is also present in the phloem sap. Rates of movement in the phloem are quite rapid. The average velocity
is about 1 mh–1 (range from 0.3 to 1.5 mh–1).
Mechanism of translocation
The pressure-flow hypothesis, first proposed by E. Munch in 1926, is the most accepted mechanism of phloem
translocation. It states that the flow of solution in the sieve elements is driven by an osmotically generated pressure
gradient between source and sink tissue. The gradient is a consequence of phloem loading at the source and phloem
unloading at the sink.
Companion
cell
Water
Source
(leaf cell)
Sucrose
molecule
Sink
(root cell)
Water
Companion
cell
Vessel Sieve tube
(Xylem) (Phloem)
Figure 3.14 Diagram showing the pressure-flow model of translocation in the phloem. At the source, sugar
is actively loaded into the sieve element. Water enters the phloem cells osmotically, building up a high turgor
pressure. At the sink, as sugars are unloaded, water leaves the phloem cells and a lower pressure results.
Water and its dissolved solutes move by bulk flow from the area of high pressure (source) to the area of low
pressure (sink).
350
Plant Physiology
3.7.1 Allocation and partitioning of photoassimilates

Allocation refers to fate of fixed carbon either newly assimilated in the source or delivered to a sink. Allocation of
carbon in source includes the storage, utilization and export to other parts of the plant. In sinks, transported sugars
are allocated to growth processes or to storage.
Partitioning is the differential distribution of photoassimilates within the plant. Partitioning mechanisms determine
the quantities of fixed carbon delivered to different sink tissues. In general, sinks are competitive and photoassimilate
is partitioned to all active sinks. If the number of sinks is less, a higher proportion of the photoassimilate is directed
to each of the sinks. Partitioning of assimilate between competing sinks depends primarily on three factors: the
nature of vascular connections between source and sinks, the proximity of the sink to the source and sink strength.
The sink strength is a measure of the capacity of a sink to accumulate metabolites. It is given as the product of sink
size and sink activity. Sink size is the total mass of the sink and sink activity is the rate of uptake of photoassimilates
per unit weight of sink tissue.
3.8 Plant hormones

Plant growth and development involve the integration of many environmental and endogenous signals that, together
with the intrinsic genetic program, determine plant form. Fundamental to this process are several growth regulators
collectively called the plant hormones or phytohormones. According to a standard definition, plant hormones are
small organic compounds, synthesized by specific plant cells/tissues, active in low concentration and promote or
inhibit growth and developmental processes. The definition of a hormone used in animal physiology does not apply
to plant hormones. Although like animal hormones, plant hormones are naturally occurring organic substances that
profoundly influence physiological processes at low concentration. The site of synthesis and mode of transport for
plant hormones, however, is not always so clearly localized. Although some tissues may be characterized by higher
hormones level than others, synthesis of plant hormones appears to be much more diffuse and not always localized
to discrete organ or tissue. Plant hormones are able to exert their action locally or at a distance (e.g., some are
transported from one organ to another organ to produce their physiological effect, and some others bring about
changes in the same tissue, or within the same cell where they are synthesized). These characteristics have led to
consider that transport is not an essential property of a plant hormone.
Growth in plants is defined as an irreversible increase in size or volume. This is mainly driven by turgor pressure.
During this process, cells increase in volume and become highly vacuolate. Growth also can be measured in
terms of change in living biomass over a particular period of time. However, the living biomass of plants
fluctuates in response to changes in water status, so this criterion may be a poor indicator of actual growth. In
these situations, measurements of dry weight are often more appropriate. The cell number is commonly used
to measure the growth of unicellular organisms such as the green alga Chlamydomonas. In multicellular plants,
however, cell number can be a misleading growth measurement because cells can divide without increasing
in volume.
Types of plant hormones

The concept of plant hormones originates from a classical experiment on phototropism, the bending of plants
toward light, carried out by Charles Darwin and his son Francis in 1880. The Darwins studied the bending of canary
grass (Phalaris canariensis) coleoptile in response to unidirectional light. They demonstrated that a signal produced
at the shoot apex travels downward and causes differential cell elongation in the lower parts of the coleoptile that
resulted in it bending toward light source. This signal was subsequently shown to be IAA, the first known plant
hormone. A small number of plant hormones have been shown to influence the plant growth and development.
Tremendous progress has been made in the identification of plant hormones, discovery of their effects on plants
and elucidation of their chemical structures. For some of the plant hormones considerable knowledge about their
352
Plant Physiology
biosynthetic pathways has been obtained. Based on function or chemical structure, there are five major groups of
plant hormones. These groups are: auxins, gibberellins, cytokinins, abscisic acid and ethylene. In addition, there
is a variety of other plant hormones including the brassinosteroids, polyamines, jasmonic acid, salicylic acid and others.
3.8.1 Auxin
Auxin, the first plant hormone was discovered by Frits Went as a growth promoting chemical in the tip of oat
(Avena sativa) coleoptiles. Because the chemical isolated by Went promoted the elongation of the coleoptile, it was
eventually named auxin (derived from the Greek word auxein, meaning to increase).
Biosynthesis and transport

Various naturally occurring auxins are known, namely IAA (indole 3-acetic acid), IBA (indole 3-butyric acid) and
PAA (phenyl acetic acid). Indole-3-acetic acid is the principal naturally occurring auxin in higher plants. There are
more than 200 auxin analogs with different chemical structures known to have the common auxin activity. The only
common features shared by these compounds are an unsaturated planar aromatic ring structure and a carboxyl
side chain.
CH2 COOH CH2 CH2 CH2 COOH
N N
H H
Indole-3-acetic acid Indole-3-butyric acid
(IAA) (IBA)
Major (primary) sites for IAA synthesis are the shoot apical meristem, young leaves and developing fruits and
seeds. Intracellularly IAA is found in the chloroplast as well as cytosol. In plants, IAA occurs in both conjugated and
free forms. It has been found to be conjugated to both high (such as glycoproteins) and low-molecular-weight
compounds (such as glucose). IAA conjugates are located exclusively in the cytosol. There are multiple pathways
for the biosynthesis of IAA. However, two major routes for the production of IAA can be:
Tryptophan-dependent pathways
The similarity of chemical structure of IAA and tryptophan suggested a connection between these. Considerable
research has shown that tryptophan, one of the protein amino acids, is a precursor of auxin biosynthesis. The
indole-3-pyruvic acid pathway is the most common tryptophan dependent pathway. Overall, the conversion of
tryptophan to IAA involves:
1. Deamination of tryptophan, (catalyzed by trp transaminase).
2. Decarboxylation of indole-3-pyruvic acid (catalyzed by indole-3-pyruvic acid decarboxylase).
3. Oxidation of indole-3-acetaldehyde (catalyzed by indole-3-acetaldehyde dehydrogenase).
Tryptophan Indole-3-pyruvic acid Indole-3-acetaldehyde Indole-3-acetic acid
COOH COOH
COOH
NH2 O O
N N N N
H H H H
Figure 3.16 Tryptophan-dependent pathways of IAA biosynthesis.
Tryptophan-independent pathway
In addition to the tryptophan-dependent pathways, recent genetic studies have provided evidence that plants can
synthesize IAA via one or more tryptophan-independent pathways. This route doesn’t involve tryptophan directly
as a precursor to the formation of auxin. The precise pathway for tryptophan-independent IAA synthesis is not known.
353
Plant Physiology
in the companion cells of the phloem of leaves and stems during the light period. The product of CO gene, CO
protein, activates the transcription of FT gene. FT protein moves from the leaves to the apical meristem. Once in the
apical meristem, the FT protein enters the nucleus and forms a complex with FLOWERING D (FD), a basic leucine
zipper (bZIP) transcription factor that is expressed in the meristem. The complex of FT and FD then activates floral
meristem identity genes. Since the 1930s, there have been many unsuccessful attempts to isolate and characterize.
Thus florigen remained a physiological concept rather than a chemical entity. However, the FT protein exhibits all the
properties that would be expected of florigen.
3.10 Vernalization
Plants have evolved the ability to alter their developmental programme in response to environmental stimuli. A
major switch in the developmental programme is the transition to flowering. In many plant species, the timing of
this transition is determined by seasonal changes that are sensed by the plant. Photoperiod and temperature are
two of the main environmental cues that plants monitor to determine the correct time to flower. Vernalization
describes the promotion of flowering after exposure to cold (0-5°C). Vernalization (term vernalization is derived
from the Latin word vernus, meaning of the spring) results in the acquisition of competence to flower. After
vernalization, plants do not necessarily initiate flowering, but acquire the competence to do so. It is reversible and
can be lost as a result of exposure to devernalizing conditions, such as high temperature. The vernalized state can
also be maintained through tissue culture.
Studies involving grafting and localized cooling have shown that the apical meristem is the site of cold perception
during vernalization, and that vernalization causes the meristem to become competent to flower. Thus, dividing
cells (or perhaps cells in which DNA replication is occurring) are a prerequisite for vernalization. After grafting
experiment in case of henbane plant, G. Melcher postulated the existence of a hypothetical compound vernalin for
vernalization stimulus. When Melcher grafted a vernalized henbane plant to another non-vernalized plant that has
never experienced low temperature, it flowered. It suggests that some substance found in the vernalized plant is
transported to non-vernalized plant and that is responsible for the induction of flowering in the latter plant. The
substance is now termed as vernalin. Attempts to isolate and identify vernalin have failed. Whether the vernalin is
same as florigen or a precursor of florigen is not known. Later, Anton Lang found that gibberellins applied to certain
biennials induced them to flower without a low temperature treatment. It means gibberellins can substitute vernalization.
Mechanism of floral induction in vernalized plants

Genetic and physiological studies of the vernalization pathway in Arabidopsis have identified some of the genes that
are involved in this process. Vernalization involves epigenetic changes in the expression of gene, FLC (flowering locus C).
FLC encodes a MADS-box transcription factor that represses flowering. It is expressed predominantly in mitotically
active regions. In Arabidopsis, FLC works by directly repressing the expression of FT gene in leaves and SOC1 and
FD genes at the shoot apical meristem.
In response to vernalization, the amount of FLC mRNA and protein is reduced. The reduction in FLC expression by
vernalization involves chromatin remodeling of FLC that requires the VIN3 (vernalization insensitive 3) protein. The
products of two other genes, VRN1 (VERNALIZATION1) and VRN2, are also responsible for repression of FLC gene
but in a very different manner. Its products are needed for maintenance but not for initiation of FLC silencing. In this
way vernalization promotes flowering by reducing FLC expression.
3.11 Flowering genes

Genetic analysis have identified two classes of genes that regulate floral development: floral meristem identity and
floral organ identity genes. The transition from shoot vegetative meristem to floral meristem requires floral meristem
identity genes that both specify the floral organs and cause the termination of the production of stem cells. This
group of genes includes LEAFY (LFY), APETALA1 (AP1) and CAULIFLOWER (CAL), which are expressed in early floral
stages and responsible for their floral fate. Floral organ identity genes directly control floral identity. The proteins
376
Plant Physiology
encoded by these genes are transcription factors that likely control the expression of other genes, whose products
are involved in the formation and/or function of floral organs. In Arabidopsis, these genes include APETALA1 (AP1),
APETALA2 (AP2), APETALA3 (AP3), PISTILLATA (PI) and AGAMOUS (AG).
The transition to flowering is tightly controlled by both endogenous programmes and environmental signals. The
ability to flower is attained when the plant has reached a certain age or size. In some plants, the transition to
flowering then occurs independently of the environment (autonomously). Other plants require exposure to appropriate
environmental conditions. The transition to flowering is regulated by multiple signals and multiple pathways. In
Arabidopsis, flowering is controlled by the photoperiodic, vernalization, autonomous and gibberellin pathways.
All of these pathways converge to regulate the meristem identity genes. The photoperiod and vernalization pathways
mediate the response to environmental cues and the autonomous and the gibberellic acid pathways act largely
independently from these external signals. A large number of genes are involved in these pathways.
Four major pathways (photoperiodic, autonomous, vernalization and gibberellin) converge on the meristem identity
genes such as LFY and AP1. A floral integrator genes such as SOC1 (SUPPRESSOR OF OVEREXPRESSION OF
CONSTANS1), FT and others integrate signals from the different converging pathways. Under appropriate conditions,
then, their activities lead to increased LFY and AP1 synthesis, which then mediate the transition from shoot vegetative
meristem to floral meristem.
The CONSTANS (CO) gene plays an important role in the photoperiodic pathway. Both the light and the internal
clock precisely regulate the accumulation of product of CO gene. CO protein directly activates the transcription of
the FT gene. In the floral meristem, the FT protein enters the nucleus and forms a complex with FD protein. After
being activated by the FT protein, FD triggers the expression of SOC1 and AP1. SOC1 and AP1 encode transcription
factors. Both of these activate LFY gene.
Autonomous pathway
Photoperiodic pathway
CO FRI FLC Vernalization
Floral pathway
integrators Gibberellic acid
Figure 3.33 Main pathways reaching floral pathways integrators.
A central gene in the autonomous and vernalization pathways is FLOWERING LOCUS C (FLC), which represses
several loci that promote flowering. The autonomous pathway acts by reducing the expression of the FLC gene, an
inhibitor of SOC1 expression. Vernalization also represses FLC gene, but by epigenetic mechanism.
It has been established that FLC expression is promoted by the gene FRIGIDA (FRI), although the exact biochemical
basis of the function of FRI remains unknown.
The gibberellic acid pathway is required for flowering under non-inductive short days. Gibberellin appears to
promote flowering in Arabidopsis by activating expression of the LEAFY gene.
377
Plant Physiology
The expression of genes A and C is postulated to be mutually antagonistic, so that expression of C in whorls 3 and
4 prevent expression of A. The products of the A, B and C homeotic genes are transcription activators. All except
the APETALA2 protein contain the same DNA-binding MADS domain. All homeotic genes that have been identified so
far, in both plants and animals, encode transcription factors. However, unlike animal homeotic genes, which contain
homeobox sequences, most plant homeotic genes called MADS box genes contain MADS box sequences. The
MADS box encodes the DNA-binding MADS domain.
Development of the ABC model contributed greatly to our understanding of floral development. The model has
recently been expanded to include five gene classes (A, B, C, D, E) and is therefore known as the ABCDE model
of flower development. In Arabidopsis the class D gene is SEEDSTICK (STK), which is involved in ovule development.
The class E genes are required for the functioning of A-, B- and C- class genes.
Sepal Petal Stamen Carpels

Whorl
1 2 3 4
B
A C
Genes
E
D
Figure 3.35 The ABCDE model of floral organ determination in Arabidopsis. In addition to the A-, B- and
C-function genes of the ABC model, this model includes two additional gene classes, D and E. In the ABCDE
model, class A + E genes specify sepals; class A + B + E, petals; class B + C + E, stamens; class C + E,
carpels; and class C + D + E, ovules.
In Arabidopsis, class E genes or SEPALLATA (SEP) genes consist of four members, SEP1, SEP2, SEP3 and SEP4.
According to the ABCDE model, class A + E genes specify sepals; class A + B + E, petals; class B + C + E, stamens;
class C + E, carpels; and class C + D + E, ovules. The sep1, sep2, sep3 triple mutant produces sepals in all floral
whorls. Addition of the sep4 mutation results in conversion of all floral organs into leaves, and hence a complete
loss of floral organ identity.
3.12 Plants movements

Unlike animals, plants (except few unicellular plants) are incapable of locomotion i.e. unable to move from one
place to another. However, plants show bending or curvature movements of individual organs (such as stem, root
and leaf). The bending or curvature movements can be autonomic and paratonic movement. Movement which
occur due to external stimuli are known as paratonic movements and the movements which occur due to internal
factors in the absence of external stimuli are known as autonomic movements. Plant movements (bending or
curvature) can be turgor movement and growth movement. Turgor movements are caused by changes in the
turgidity of cells and are reversible. Growth movements occur as a result of differential growth. Differential growth
occurs either due to enlargement of cells or increase in number of cells. The growth movements are irreversible i.e.
the plant parts cannot come back to the original position.
Types of plant movements

Depending on the direction and types of response, plant movements are classified into the following categories:
1. Tropic movements and
2. Nastic movements.
379
Plant Physiology
1. Tropic movements
Tropic movements are directional movements of bending or curvature that occur in response to an external stimulus
and the direction of movement is dependent on the direction of the stimulus. Tropism can be positive or negative.
A tropic response toward the stimulus is said to be positive; a response away from the stimulus is negative. Based
on nature of stimulus, tropic movements can be phototropism (stimulus is light), thigmotropism (stimulus is
touch) and gravitropism (stimulus is gravity).
Phototropism is a tropic response to unidirectional light. It is the most commonly observed tropic response in
plants in which plant stems grow towards light. In general, shoots grow toward light and hence are positively
phototropic; roots grow away from light and are negatively phototropic. Plant hormone auxin is responsible for this
tropic movement. Well-known and often-repeated experiments with oat seedlings have shown that the auxin IAA,
which causes elongation of cells, migrates to the shaded side of oat coleoptiles when irradiated unidirectionally.
Once the auxin reaches the shaded side of the shoot tip, it transported basipetally to the elongation zone, where it
stimulates cell elongation. The subsequent differential growth on the two sides causes the coleoptiles to bend
toward the light. Different wavelengths of light cause differing growth responses. The blue wavelength is the most
effective in producing a phototropic response and flavoprotein phototropin acts as a blue light photoreceptor.
Phototropins are autophosphorylating protein kinases whose activity is stimulated by blue light. In the presence of
unidirectional blue light, phototropin displays a lateral gradient in phosphorylation. According to the current hypothesis,
the gradient in phototropin phosphorylation induces the movement of auxin to the shaded side of the coleoptile.
Several possible biochemical pathways from phototropin activation to changes in auxin transport can be postulated.
First, a direct phototropin-dependent phosphorelay involving currently unidentified protein kinases that lead to an
altered auxin transport activity.
Second, phototropins might modulate auxin transport through an indirect pathway that utilizes calcium as a second
messenger. In this scenario, phototropin-dependent increase in cytosolic calcium levels might lead to activation of
a calcium-dependent protein kinase, which would in turn phosphorylate an auxin transport complex and thus alter
its activity.
A third possible outcome of phototropin activation is the modulation of auxin transporter localization, rather than
the activity. For example, relocalization of auxin efflux carriers (PIN1 proteins) from a basal to lateral region of a
cell would result in a shift from basipetal to lateral auxin transport.
Gravitropism is a tropic movement in response to gravity. Plant organs which grow in the direction of gravity
exhibit positive gravitropism. Organs which grow away from the direction of gravity exhibit negative gravitropism.
Organs which grow at right angles to the direction of gravity, are said to be diagravitropic. Organs oriented at some
intermediate angle (between 0° to 90°) are said to be plagiogravitropic. The process of gravitropic response
includes sensing gravity direction and subsequently converting it into internal signals. These signals are then
transferred to the responding tissues, resulting in organ bending. In higher plants, the site of gravity perception in
primary roots is the root cap. The intracellular gravity sensors in the root cells are the large, dense amyloplasts
called statoliths, and the specialized gravity-sensing columella cells in which they occur are called statocytes.
Removal of the root cap from roots abolishes root gravitropism without inhibiting growth. Statoliths sense the
stimulus of gravity (starch–statolith hypothesis). When the orientation of the cells changes, the high density of
the statoliths relative to the cytosol causes them to sink to the lower end of the cell. Precisely how the statocytes
sense their falling statoliths is still poorly understood. According to one hypothesis, contact or pressure resulting
from the amyloplast resting on the endoplasmic reticulum on the lower side of the cell triggers the response. A
variety of experiments suggest that localized changes in pH and calcium ions gradients are part of the signaling that
occurs during gravitropism. These signals cause change in the distribution of auxin.
Several auxin efflux carriers designated as PIN proteins are essential for auxin distribution. PIN1 and PIN4 mediate
vertical transport of auxin from the shoot apex to the columella cells of root apex. PIN3 and PIN7 are responsible for
lateral redistribution of auxin in the root columella. Within a vertically growing root, the PIN3 and PIN7 are localized
380
Plant Physiology
Apical cell
Basal cell
2-cell stage Globular stage
Cytokinin also plays a major role in regulating meristem function. The STM gene (a member of KNOX gene family)
encodes STM protein which induces cytokinin biosynthesis in the shoot apical meristem. KNOX genes fall into two
subclasses – Class I KNOX genes and Class II KNOX genes. STM gene belongs to Class I KNOX genes. The product
of KNOX genes also represses the biosynthesis of the gibberellin to maintain normal meristem function. Cytokinin
also stimulates the expression of genes involved in gibberellin catabolism to reinforce the low-gibberellin levels
established by the KNOX proteins within the shoot apical meristem. Thus, KNOX proteins are essential for meristem
development by simultaneously activating cytokinin and repressing gibberellin biosynthesis.
Root apical meristems

Root apical meristems (RAM) are populations of cells at the root tip that divide and form all the tissues of the root.
Root apical meristems are populations of dividing cells, but not all cells in the meristematic region divide at the
same rate. Typically, the central cells divide much more slowly than the surrounding cells. These slow dividing cells
form the quiescent (organizing) center of the root apical meristem. The quiescent center of Arabidopsis consists
of only four cells. At the very tip of most roots is the root cap, which serves to protect the underlying root meristem.
With the exception of a few species, such as the Podostemaceae, a root cap is otherwise always present.
In many species such as Arabidopsis, a discrete boundary is present between the root cap and the root apical
meristems. Roots maintaining this type of architecture are said to show closed organization. In other species such
as pea, there is no sharp boundary between the root cap and the root proper. This type of architecture is termed
open organization. An organizational state that is intermediate between open and closed, is called intermediate open.
Epidermis Endodermis
Stele
Quiescent center
Lateral root cap
Columella
Figure 3.41 Schematic diagram of a young Arabidopsis root tip showing the principal regions of the
root apical meristem.
Auxin contributes to the formation and maintenance of the RAM. The position of the quiescent center coincides with
high auxin concentration. Cytokinin is also required for normal root development. Auxin is largely synthesized in
393
Plant Physiology
the shoot and transported rootward via ABCB and PIN auxin efflux carrier protein, while cytokinin synthesized in
the root moves shootward in the xylem. Molecular and genetic analysis suggest that cytokinin signaling begins
early in root development in the hypophysis of the globular embryo. Upon division of the hypophysis, cytokinin
expression is lost in the basal cell but is retained in the apical cell, which divides further to form the quiescent
center. At the same time, auxin shows an inverse pattern of expression, suggesting that auxin and cytokinin have
opposing activities. The loss of cytokinin activity in the basal cell causes changes in the organization of the RAM.
Shoot apical meristem

Meristems are populations of small living cells with embryonic characteristics. They retain the capacity for cell
division. Undifferentiated cells that retain the capacity for cell division indefinitely are said to be stem cells. The
shoot apical meristem is a functional unit of the shoot apex. The shoot apical meristem is typically a small dome-
shaped group of 800 to 1200 cells. Both the size and shape of shoot apical meristems vary tremendously at
different points in development and among various species. The shoot apex consists of the apical meristem plus the
leaf primordia.
Shoot apical meristem may be vegetative meristems or floral meristems. The vegetative shoot apical meristem
usually is indeterminate in its development. Vegetative meristem may be converted directly into floral meristems
when the plant is induced to flower. Floral meristems differ from vegetative meristems in that instead of leaves they
produce floral organs: sepals, petals, stamens and carpels. In addition, floral meristems are determinate.
Two different concepts have been used to define regions of the shoot apical meristem. One concept is that of layers.
According to this concept, shoot apical meristems have three cell layers (L1, L2 and L3). The L1 is the outermost
layer, and cell divisions in this layer are restricted to the anticlinal plane (perpendicular to the surface). The L1
forms the epidermis in differentiated parts of the shoot. Cells in the second layer, or L2, divide predominantly in the
anticlinal plane but also divide in the periclinal plane (parallel to the surface) when organs are forming. Cells in the
third layer from the surface, the L3, divide in both anticlinal and periclinal planes and provide cells for the interior
portion of organs and stems. Each layer has its own stem cells, and all three layers contribute to the formation of
the stem and lateral organs.
A second idea used to define regions of the shoot apical meristem is that of zones. According to this concept, there
are three meristem zones: the central zone, the peripheral zone and the rib zone. The central zone, which is a
group of cells located at the distal end of the apical meristem, includes cells from all three layers. Cells in the
central zone divide less frequently and have prominent nuclei. Peripheral zone consists of cytoplasmically dense
cells and gives lateral organ (mainly leaf primordia). A rib zone lies underneath the central cell zone and gives rise
to the internal tissues of the stem.
Leaf primordium
Shoot
apical
meristem
}
L1
L2
Central L3
zone
Peripheral Peripheral
zone Rib zone zone
Figure 3.42 Longitudinal section through the center of the shoot apex. Shoot apical meristem having three
cell layers (L1, L2, and L3). The outermost, L1 layer, generates the shoot epidermis; the L2 and L3 layers
generate internal tissues. The shoot apical meristem also has cytohistological zones. The central zone contains
the stem cells, which divide slowly but are the ultimate source of the tissues that make up the plant body. The
peripheral zone, in which cells divide rapidly, surrounds the central zone and produces the leaf primordia. A
rib zone lies below the central zone and generates the central tissues of the stem.
394
Plant Physiology
3.15 Plant secondary metabolites

Plants are capable of synthesizing diverse types of organic molecules, which may be divided into two major groups:
primary and secondary metabolites. Primary metabolites are metabolic intermediates or products found in all living
systems, essential to growth and life, and biosynthesized by a limited number of biochemical pathways. These
metabolites are involved in a primary metabolic process such as respiration and photosynthesis. Secondary metabolites
are metabolic intermediates or products which are not essential to growth and life of the producing plants but rather
required for the interaction of plants with their environment and produced in response to stress. Plant secondary
metabolites can be divided into four major classes: terpenes, phenolics, glycosides and alkaloids.
3.15.1 Terpenes
Terpenes constitute a large class of natural products built up from isoprene units. There is a difference in terpenes
and terpenoids. Terpenes are technically only hydrocarbons, while terpenoids are oxygenated hydrocarbons. The
basic molecular formulae of terpenes are multiples of (C5H8)n where ‘n’ is the number of linked isoprene units
(isoprene rule). Thus, terpenes are also termed as isoprenoid compounds. One isoprene unit is termed as hemiterpene,
C 5H 8.
Isoprene Isoprene unit
Classification of terpenes:
The classification of terpenes is based on the number of isoprene units present in their structure.
Number of isoprene units Name Carbon atoms
2 unit Monoterpenes C 10
3 unit Sesquiterpenes C 15
4 unit Diterpenes C 20
6 unit Triterpene C 30
8 unit Tetraterpene C 40
More than 8 Polyterpenes
Biosynthesis
There are two biosynthetic pathways for terpenes– MVA (mevalonic acid) pathway and MEP (methylerythritol
phosphate) pathway. In a MVA pathway, acetyl-coenzyme A acts as precursor. Three molecules of acetyl-CoA are
joined together to form mevalonic acid. This key six-carbon molecule is then pyrophosphorylated, decarboxylated
and dehydrated to yield isopentenyl pyrophosphate (IPP). IPP isomerizes to dimethylallyl pyrophosphate (DMAPP).
DMAPP acts as the prenyl donor to a molecule of IPP producing geranylpyrophosphate (GPP) by a head-to-tail
condensation reaction. GPP can then link to another molecule of IPP to give the 15-carbon compound farnesyl
pyrophosphate (FPP), the precursor of nearly all the sesquiterpenes.
The addition of yet another molecule of IPP gives the 20-carbon compound geranylgeranyl pyrophosphate (GGPP),
the precursor of the diterpenes. FPP and GGPP can also dimerize in a head-to-head fashion to form the precursors
of the C30 and the C40 terpenes respectively. The C10–C20 pyrophosphates undergo a wide range of cyclizations and
rearrangements to produce the parent carbon skeletons of each terpene class. Finally as a result of variety of
oxidations, reductions, isomerizations, conjugations and other transformations, the parent skeletons of each terpene
class are converted to thousands of distinct terpene metabolites.
396
Chapter 04
Human Physiology
Like all multicellular animals, human body is composed of different types of cells. Groups of cells similar in structure
and function are organized into tissues. Different tissues grouped together into a structural and functional unit called
organs. An organ system is a group of organs that function together to carry out the principal activities of the body.
4.1 Tissues
A tissue is a group of similar cells that usually have a common embryonic origin and functions together to carry out
specialized activities. On the basis of structure and fucntion, animal tissues can be classified into four basic types:
1. Epithelial tissue
2. Connective tissue
3. Nervous tissue
4. Muscular tissue
1. Epithelial tissue
An epithelial tissue or epithelium consists of cells that form membranes, which cover and line the body surfaces
and glands, which are derived from these membranes. Epithelial cells arranged in continuous sheets, in either
single or multiple layers. Because the cells are closely packed and are held tightly together by many cell junctions,
there is little intercellular space between cells. Three types of cell junctions are found in the epithelium and other
tissues. These cell junctions are called as tight, anchoring (adherens junction and desmosome) and gap junctions.
Epithelial tissue has its own nerve supply, but is avascular; that is, it lacks its own blood supply. The blood vessels
that bring in nutrients and remove wastes are located in the adjacent connective tissue. Exchange of substances
between epithelium and connective tissue occurs by diffusion. Epithelial tissue plays many roles such as protection,
filtration, secretion, absorption and excretion. Because epithelial tissue subjected to wear and tear and injury, it has
high capacity for renewal.
Epithelial tissue may be divided into two types:
A. Covering and lining epithelium forms the outer covering of the skin and some internal organs. It also forms the
inner lining of blood vessels, ducts and body cavities, and the interior of the respiratory, digestive, urinary and
reproductive systems.
B. Glandular epithelium makes up the secreting portion of glands such as the thyroid gland, adrenal glands and
sweat glands.
A. Covering and lining epithelium

The covering and lining epithelial tissue is further classified according to the two characteristics like the arrangement
of cells into layers and the shapes of the cells.
407
Human Physiology
According to the arrangement of cells into layers

The cells are arranged in one or more layers depending on the functions. It may be:
Simple epithelium
It is a single layer of cells.
Pseudostratified epithelium
It is a single layer of cells but appears to have multiple layers of cells because the cell nuclei lie at different levels
and not all cells reach the apical surface.
Stratified epithelium
It consists of two or more layers of cells.
According to the shapes of the cells

The shapes of the cells may be: squamous, cuboidal and columnar.
Squamous cells are arranged like floor tiles and are thin.
Cuboidal cells are as tall as they are wide and are shaped like cubes or hexagons.
Columnar cells are much taller than they are wide, like columns.
Combining the both characteristics i.e. arrangement of cells into layers and cell shapes, the covering and lining
epithelia are of following types:
Simple epithelium
a. Simple squamous epithelium
Description: Single layer of flat cells; centrally located nucleus.
Location: Lines the heart, blood vessels, lymphatic vessels, air sacs of lungs, Bowman’s capsule of kidneys and
inner surface of the tympanic membrane (eardrum); forms epithelial layer of serous membranes, such as the
peritoneum.
Function: Filtration, diffusion, osmosis and secretion in serous membranes.
b. Simple cuboidal epithelium
Description: Single layer of cube-shaped cells; centrally located nucleus.
Location: Covers the surface of ovary, lines the anterior surface of the capsule of the lens of the eye, forms the
pigmented epithelium at the posterior surface of the eye, lines the kidney tubules and smaller ducts of many
glands, and makes up the secreting portion of some glands such as the thyroid gland and the ducts of some
glands such as the pancreas.
Function: Secretion and absorption.
Basement
membrane
Simple squamous epithelium
Nucleus
Simple cuboidal epithelium
c. Simple columnar epithelium (nonciliated and ciliated)

Nonciliated
Description: Single layer of column-like cells with nuclei near to the base. It contains two types of cells –
columnar epithelial cells with microvilli at their apical surface and goblet cells. Microvilli, fingerlike cytoplasmic
projections, increase the surface area of the plasma membrane. Goblet cells are modified columnar epithelial
cells that secrete mucus, a slightly sticky fluid, at their apical surfaces. Before it is released, mucus accumulates
in the upper portion of the cell, causing it to bulge out and making the whole cell resemble a goblet. Secreted
408
Human Physiology
c. Stratified columnar epithelium

Description: Several layers of irregularly shaped cells; only the apical layer has columnar cells.
Location: Lines the part of urethra, large excretory ducts of some glands, such as esophageal glands and small
areas in anal mucous membrane.
Function: Protection and secretion.
Stratified columnar epithelium
d. Transitional epithelium
Description: Appearance of cell is variable (transitional); shape of cells in apical layer ranges from squamous
(when stretched) to cuboidal (when relaxed). In its relaxed or unstretched state, transitional epithelium looks
like stratified cuboidal epithelium. But in stretched state, its cells become flatter, giving the appearance of
stratified squamous epithelium.
Location: Lines urinary bladder and portions of ureters and urethra.
Function: Permits distension.
B. Glandular epithelium
The function of glandular epithelium, secretion, is accomplished by glandular cells that often lie in clusters deep to
the covering and lining epithelium. A gland may consist of a single cell or a group of cells that secrete substances
into ducts (tubes), into a surface or into the blood. All glands of the body are classified as either endocrine or exocrine.
Endocrine glands
Description: The secretions of endocrine glands enter the interstitial fluid and then diffuse directly into the
bloodstream without flowing through a duct (i.e. ductless).
Location: Pituitary gland at base of brain, pineal gland in brain, thyroid and parathyroid glands near larynx
(voice box), adrenal glands superior of kidneys, pancreas near stomach, ovaries in pelvic cavity,
testes in scrotum and thymus in thoracic cavity.
Function: Produce hormones that regulate various body activities.
Exocrine glands
Description: The secretions of exocrine glands released their products into the ducts. The secretions of exocrine
glands include mucus, sweat, oil, earwax, saliva and digestive enzymes.
Location: Sweat, oil and earwax glands of the skin; digestive glands such as salivary glands, which secrete
into the mouth cavity, and pancreas, which secretes into the small intestine.
Function: Produce substance such as sweat, oil, earwax, saliva and digestive enzymes.
Classification of exocrine glands

Structural classification of exocrine glands
Structurally, exocrine glands are classified as unicellular or multicellular. As the name implies, unicellular glands
are single-celled. Goblet cells are important unicellular exocrine glands that secrete mucus directly into the apical
surface of a lining epithelium. Most glands are multicellular glands, composed of many cells that form a distinctive
microscopic structure of macroscopic organ. Examples include sudoriferous, sebaceous (oil) and salivary glands.
Multicellular glands are categorized according to two criteria: whether their ducts are branched or unbranched and
the shape of the secretory portions of the gland.
410
Human Physiology
Functional classification of exocrine glands

The functional classification of exocrine glands is based on how their secretions are released. Secretions of
merocrine glands are synthesized on ribosomes attached to rough ER; processed, sorted and packaged by Golgi
complex, and released from the cell in secretory vesicles via exocytosis. Most of the exocrine glands in the body
are merocrine glands. Examples include the salivary glands and pancreas. Apocrine glands accumulate their
secretory product at the apical surface of the secreting cells, then that portion of the cell pinches off from the rest
of the cell to release the secretion. The remaining part of the cell repairs itself and repeats the process. Mammary
gland is an example of apocrine glands. The cells of holocrine glands accumulate a secretory product in their
cytosol. As the secretory cell matures, it ruptures and releases the secretory product. The sloughed off cell is
replaced by a new cell. One example of a holocrine gland is a sebaceous gland of the skin.
Pinches off portions of

cell releasing
secretory product
A disintegrating
cell releasing
its contents
Merocrine gland Apocrine gland Holocrine gland
2. Connective tissue
Connective tissue is one of the most abundant and widely distributed tissues in the body. It protects and supports
the body and its organs. Various types of connective tissues bind organs together, store energy reserves as fat, and
provide immunity to disease-causing organisms.
Connective tissue consists of two basic elements: cells and extracellular matrix. It has relatively few cells but
abundant extracellular matrix. Mesenchymal cells give rise to the cells of connective tissue. The extracellular
matrix consists of protein fibers and ground substance, the material between the cells and the fibers. Three major
types of fibers are present in the extracellular matrix: collagen fibers (composed of collagen), elastic fibers (composed
of elastin and fibrillin) and reticular fibers (composed of type III collagen).
The extracellular matrix is usually secreted by the connective tissue cells and determines the tissue’s qualities.
Unlike epithelia, connective tissues usually are highly vascular; that is, they have a rich blood supply. Exception
includes cartilage, which is avascular.
Classification of connective tissues

Because of the diversity of cell and extracellular matrix and the difference in their relative proportions, the
classification of connective tissue is not always clear-cut. The following schemes can be offered:
1. Embryonic connective tissue
a. Mesenchyme
b. Mucous connective tissue
2. Mature connective tissue
a. Loose connective tissue
b. Dense connective tissue
c. Cartilage
d. Bone tissue
e. Liquid connective tissue
411
Human Physiology
called the limbic system. The prominent components of this region are the cingulate gyrus, which lies above the
corpus callosum, the hippocampus, which lies in the medial temporal lobe and the amygdala. There is no universal
agreement on the total list of structures, which comprise the limbic system. Along with the hypothalamus, it is
involved in the regulation of sexual behaviour, emotion (e.g. excitement, pleasure, anger and fear), long-term
memory and motivation. The limbic system is sometimes called the ‘emotional brain’ because it plays a primary
role in a range of emotions, including pleasure, pain, affection, fear and anger.
4.2.4 Spinal cord

The spinal cord extends from the base of the brain through a large opening in the skull called the foramen magnum
and into the vertebral canal formed by openings in the vertebrae. Paired spinal nerves emerge from the spinal cord
through spaces formed between the adjacent vertebrae. There are thirty-one pairs of spinal nerves. The spinal
nerves are named according to the region of the vertebral column from which they emerge. There are 8 pairs of
cervical nerves (C1 to C8), 12 thoracic nerves (T1 to T12), 5 lumbar nerves (L1 to L5), 5 sacral nerves (S1 to S5)
and 1 coccygeal nerve (Co1). Each spinal nerve is a mixed nerve composed of sensory and motor nerve fibers.
1
2
3
4 Cervical nerves
5
6
7
8
1
2
3
4
5
6
7 Thoracic nerves
8
9
10
11
12
3 Lumbar nerves
Cauda
equina 4
1
2 Sacral nerves
3
4
5
1 Coccygeal nerves
Figure 4.11 Spinal nerves. The 31 pairs of spinal nerves are named according to the region of the
vertebral column from which they emerge. Because the spinal cord is shorter than the vertebral column,
spinal nerve roots must descend along the cord before emerging from the vertebral column at the
corresponding intervertebral space, especially those beyond the level of the first lumbar vertebra (L1).
Collectively these rootlets are called the cauda equina, literally “horse’s tail.”
426
Human Physiology
There is a difference between a nerve and a nerve fiber. Nerve fiber is the axon of a neuron and a bundle of many
such fibers makes a nerve. A nerve fiber does not contain a complete nerve cell (or neuron), only the axonal
portions of many neurons. Hence, a nerve is an enclosed, cable-like bundle of axons (nerve fibers) in the peripheral
nervous system. In the central nervous system, the analogous structures are known as tracts.
Epineurium
Blood vessel
Perineurium
Endoneurium
Schwann cell
Fascicle
Myelinated axon
Figure 4.12 Structure of a nerve. Neuronal axons (both afferent and efferent nerve fibers) are bundled
together into connective tissue–wrapped fascicles. A nerve consists of a group of fascicles enclosed by a
connective tissue.
A cross section of the spinal cord shows a central canal, gray matter and white matter. The central canal contains
cerebrospinal fluid. The gray matter is centrally located and shaped like the letter ‘H’. In contrast to the brain,
where the gray matter forms an outer region capping an inner white core, the gray matter in the spinal cord forms
an inner butterfly-shaped region surrounded by the outer white matter. The gray matter on each side of the spinal
cord is sub-divided into a dorsal (posterior) horn, a ventral (anterior) horn and a lateral horn. The dorsal horn
contains cell bodies of interneurons (or association neuron) on which afferent (sensory) neurons terminate. The
ventral horn contains cell bodies of the efferent (motor) neurons supplying skeletal muscles. The lateral horns
contain cell bodies of autonomic motor neurons that regulate the activity of cardiac muscle, smooth muscle and
glands.
The white matter, like the grey matter, is organized into regions. The anterior and posterior grey horns divide the
white matter on each side into three broad areas called columns: anterior (or ventral) white columns, posterior (or
dorsal) white columns and lateral white columns. Each column, in turn, contains distinct bundles of axons having a
common origin or destination and carrying similar information. These bundles, which may extend long distances up
or down the spinal cord, are called tracts. The white matter contains ascending tracts taking information to the brain
(primarily located dorsally) and descending tracts taking information from the brain (primarily located ventrally).
Because the tracts cross just after they enter and exit the brain, the left side of the brain controls the right side of
the body, and the right side of the brain controls the left side of the body.
427
Human Physiology
4.2.5 Peripheral nervous system

The CNS communicates with the different parts of the body by means of nerves that exit from the brain (cranial
nerves) and spinal cord (spinal nerves). The 31 pairs of spinal nerves and the 12 pairs of cranial nerves that arise
from the CNS, together with aggregations of cell bodies located outside the CNS, constitute the peripheral nervous
system (PNS).
Cranial nerves
The cranial nerves are named because they arise from the brain inside the cranial cavity and pass through various
foramina in the bones of the cranium. There are 12 pairs of cranial nerves. Each cranial nerve has both a number
and a name. The numbers (designated by a roman numeral) indicate the order, from anterior to posterior, in which
the nerves arise from the brain. The names indicate the structures innervated by these nerves (e.g. facial) or the
principal function of the nerves (e.g. oculomotor).
Of the twelve pairs of cranial nerves, two pairs arise from neuron cell bodies located in the forebrain and ten pairs
arise from the midbrain and hindbrain.
Three cranial nerves (I, II and VIII) carry axons of sensory neurons and thus are called sensory nerves. The cell
bodies of sensory neurons are located in ganglia outside the brain. Five cranial nerves (III, IV, VI, XI and XII)
contain only axons of motor neurons as they leave the brain stem and are called motor nerves. The cell bodies of
motor neurons lie in nuclei within the brain. The four cranial nerves (V, VII, IX and X) are mixed nerves because
they contain axons of both sensory and motor neurons.
Table 4.1 Cranial nerves and their origin, nature and functions
No Name Origin Nature Functions
I Olfactory Olfactory lobe or bulb Sensory Smell
II Optic Optic lobe on midbrain Sensory Sight (Retina of eye)
III Oculomotor Floor of midbrain Motor Movement of eye-ball, iris, lens, eyelid and
constriction of pupil
IV Trochlear Floor of midbrain Motor Rotation of eyeball
V Trigeminal Ventral surface of pons varolii Mixed Movement of tongue, jaw muscles for chewing
Opthalmic,
Maxillary,
Mandibular
VI Abducens Lateral side of medulla Motor Rotation of eyeball
VII Facial Side and floor of medulla Mixed Taste, facial expression, chewing, neck
movement
VIII Auditory Lateral side of medulla oblongata Sensory Hearing and equilibrium
IX Glossopharyngeal Lateral side of medulla oblongata Mixed Taste and touch, movements of pharynx
X Vagus Lateral side of medulla oblongata Mixed Vocal cords (sound production), lungs,
respiratory reflexes, peristaltic movements,
speech, swallowing, secretion of gastric
glands, inhibition of heart beat
XI Spinal accessory Floor of medulla (lateral Motor Muscles of pharynx, larynx, neck, shoulder
nerves side of medulla oblongata) movements
XII Hypoglossal Floor of medulla (ventral Motor Movements of tongue
side of medulla oblongata)
Note: Vagus is the longest and trochlear is the smallest cranial nerve.
430
Human Physiology
Spinal nerves
There are 31 pairs of spinal nerves. These nerves are grouped into 8 cervical, 12 thoracic, 5 lumbar, 5 sacral and
1 coccygeal according to the region of the vertebral column from which they arise. Each spinal nerve is a mixed
nerve composed of both sensory and motor fibers. These fibers are packaged together in the nerve, but they
separate near the attachment of the nerve to the spinal cord. This produces two ‘roots’ to each nerve.
The dorsal root is composed of sensory nerve fibers, and the ventral root is composed of motor nerve fibers. An
enlargement of the dorsal root, the dorsal root ganglion, contains the cell bodies of the sensory neurons. The
motor neuron is a somatic motor neuron that innervates skeletal muscles; its cell body is not located in a ganglion
but instead is contained within the gray matter of the spinal cord. The cell bodies of some autonomic motor neurons
(which innervate involuntary effectors), however, are located in ganglia outside the spinal cord.
Table 4.2 Comparison of spinal and cranial nerves

Spinal nerves Cranial nerves
Designation C1-8, T1-12, L1-5, S1-5, Co1 Roman Numerals I-XII
Number 31 pairs 12 pairs
Origin Spinal cord Brain
Number of roots 2 (a dorsal and a ventral root) 1
Nature Mixed Mixed, motor and sensory
4.2.6 Autonomic nervous system

The PNS is subdivided into afferent and efferent divisions. The afferent division includes afferent nerve fibres
that carries information from tissues and organs to the CNS. Instructions from the CNS are transmitted through
efferent nerve fibres of the efferent division to effector organs - the muscles or glands that carry out the orders to
bring about the desired effect. The efferent division is further divided into the somatic nervous system and
autonomic nervous system .
Cardiac muscle, smooth muscle, most exocrine glands, some endocrine glands and adipose tissue are innervated
by the autonomic nervous system, the involuntary branch of the peripheral efferent division. Skeletal muscle is
innervated by the somatic nervous system, the branch of the efferent division subject to voluntary control.
Somatic nervous system
Effector
organ
CNS Somatic motor neuron Skeletal muscle

(Myelinated)
Autonomic nervous system Autonomic ganglion
Effector
organ
CNS Preganglionic neuron Postganglionic neuron

(myelinated) (unmyelinated)
Autonomic motor neurons
Figure 4.16 Comparison of somatic and autonomic nervous system. A single somatic motor neuron
passes from the CNS to the skeletal muscle. In an autonomic nervous system, a preganglionic autonomic
neuron passes from the CNS to an autonomic ganglion, where it synapses with a second postganglionic
neuron. It is postganglionic neuron that innervates the smooth muscle, cardiac muscle or gland.
431
Human Physiology
Table 4.5 Comparison of the somatic and the autonomic nervous system
Feature Somatic nervous system Autonomic nervous system
Effector organs Skeletal muscles Cardiac muscle, smooth muscle and glands
Control Voluntary control Involuntary control
Effect of nerve impulse on effector Excitatory only Either excitatory or inhibitory
Neurotransmitter Acetylcholine Acetylcholine, epinephrine and norepinephrine
Neuron Myelinated Myelinated (preganglionic neuron) or
unmyelinated (postganglionic neuron)
Number of neurons One somatic motor neuron Usually two autonomic motor neurons
(from CNS to effector)
4.3 Sensory organs

Sensory organs of the body are the windows of the brain because they keep the brain aware of what is going on in
the external world. There are five major senses: sight, hearing, taste, smell and touch. There are organs connected
with these senses that take in information that is sent to the brain so that the body can act on it - olfaction (the
sense of smell), taste or gustation (the detection of compounds and ions by the tongue), vision (the detection of
light), hearing (the detection of sound or pressure waves in the air) and touch (the detection of changes in pressure,
temperature, and other factors by the skin).
Sensory organs Senses Stimuli

Skin Touch Pain, cold, pressure
Nose Smell (olfaction) Chemicals
Tongue Taste (gustation) Chemicals
Ear Hearing Sound
Eye Vision Light
The sensory organs (or sensory system) detect changes in the environment and send appropriate signals to the
CNS. In the CNS, these signals are processed and combined with other information to yield a perception that may
trigger a change in response. By these means, our sensory organs allow us to detect changes in our environments
and to adjust our behavior appropriately.
4.3.1 Eye
The eyes are complex sense organs. They gather information about the environment; and the brain interprets this
information to form an image of what appears within the field of vision. Each eye has a layer of receptors, a lens
system that focuses light on these receptors, and a system of nerves that conducts impulse from the receptors to
the brain. The eye is often compared to a camera, with the cornea acting as the lens, the pupillary diameter
functioning like the aperture of the camera, and the retina serving as the film.
Anatomy of the eye

Each eye is a spherical, fluid-filled structure. Anatomically, the wall of the eye consists of three layers: fibrous tunic,
vascular tunic and retina. The fibrous tunic is the outer protective layer of the eyeball and consists of the anterior
cornea and posterior sclera. The sclera (the white of the eye), is a layer of dense connective tissue made up
mostly of collagen fibers and fibroblasts. It provides shape and protects inner parts. Through the sclera no light can
pass. It is modified anteriorly to form the transparent cornea, through which light rays enter the eye.
The cornea is a transparent coat that covers the colored iris. Because it is curved, the cornea helps focus light onto
the retina. Its outer surface consists of non-keratinized stratified squamous epithelium. The middle coat of the
cornea consists of collagen fibers and fibroblasts, and the inner surface is simple squamous epithelium.
The vascular tunic is the middle layer of the eyeball. It is composed of three parts: choroid, ciliary body and iris.
The iris, ciliary body and choroid are collectively called the uvea.
435
Human Physiology
The choroid is a vascular layer that provides oxygen and nutrients to the structures in the eye. It is the posterior
portion of the vascular tunic. It is deeply pigmented with melanin. It provides blood supply and absorbs scattered light.
Iris Optic disc
Cornea
Lens
Conjunctiva
Retina
Suspensory ligaments
Choroid
Ciliary body
Sclera
Figure 4.18 Schematic of a horizontal section of the eye.
The choroid layer forms the ciliary body and iris in the front of the eye. The iris is the pigmented and colored
portion of the eye. The round opening in the center of the iris through which light enters the interior portions of the
eye is the pupil. The iris contains circular muscle that constrict and radial muscle that dilate the pupil. It acts like
the diaphragm of a camera, dilating and constricting the pupil to allow more or less light into the eye (i.e. regulates
amount of light that enters eye). Iris muscles are controlled by the autonomic nervous system. Parasympathetic
nerve fibers innervate the circular muscle (causing pupillary constriction) and sympathetic fibers supply the radial
muscle (causing pupillary dilation).
Ciliary body is located behind the iris and produces aqueous fluid that fills the front part of the eye. The ciliary
body has two major components: the ciliary muscle and the capillary network that produces the aqueous humor.
The ciliary muscle is a circular ring of smooth muscle attached to the crystalline lens by suspensory ligaments
(or ciliary zonule). The crystalline lens is a transparent structure. It is made up of transparent cells that loose
their nucleus and organelles during development. Due to lack of DNA and protein-synthesizing machinery, mature
lens cells cannot regenerate or repair themselves. As a person grows older, the lens grows larger and thicker and
becomes far less elastic, partly because of progressive denaturation of the lens proteins. The ability of the lens to
change shape decreases with age.
The ciliary muscle regulates the strength of the lens. The ability to adjust the strength of the lens is known as
accommodation. The strength of the lens depends on its shape, which in turn is regulated by the ciliary muscle. When
the ciliary muscle is relaxed, the suspensory ligaments pull the lens and make it slightly flat. But when the muscle
contracts, lens becomes more spherical (convex). The greater curvature of the spherical lens increases its strength.
Object Image point
Lens
Object Image point
Lens
436
Human Physiology
In the normal eye, the ciliary muscle is relaxed and the lens is flat for far vision. When the eye is focused on a
distant object, the parallel rays coming into the eye are then focused on the retina and we see the object clearly. In
case of near vision, the muscle contracts which causes the lens to become more convex. When the eye is focused
on a near object, the ciliary muscles adjust the focal length in such a way that the image is again formed on the
retina and we see the object clearly. This process of adjusting focal length is called accommodation.
The interior surface of the eye, opposite the lens, is called the fundus. It includes the retina, optic disc, macula and
fovea, and posterior pole. An ophthalmoscope is used to view the fundus of the eye. The retina is a light-sensitive
inner layer of the eye that covers about 65 percent of its interior surface. It consists of three layers of excitable cells:
1. an outermost layer (closest to the choroid) containing the photoreceptor (or photosensitive) cells – rods and cones;
2. a middle layer of bipolar cells and associated interneurons; and
3. an inner layer of ganglion cells. Axons of the ganglion cells join to form the optic nerve. The point on the
retina at which the optic nerve leaves and through which blood vessels pass is the optic disc. This region is
often called the blind spot; no image can be detected in this area because it has no rods and cones.
A yellowish pigmented spot called the macula lutea is located at the center of the posterior portion of the retina,
at the visual axis of the eye. A small depression in the center of the macula lutea is called fovea centralis. In it,
the cones are densely packed. There are no blood vessels. Consequently, the fovea is the point where visual acuity
(sharpness of vision) is greatest.
Optic nerve
fiber Bipolar cell Cone Rod RPE
Ganglion cell
Choroid
Sclera
Direction
of light
Figure 4.19 The outermost region of the retina contains a supportive retinal pigment epithelium (RPE)
layer. There are three layers of cells: light-sensing rod and cone photoreceptors, a middle layer of bipolar
cells and the innermost layer of ganglion cells, which transmit signals originating in the photoreceptor
layer through the optic nerve and into the brain.
Chambers of eye
The human eye can also be divided into two main segments: the anterior segment and the posterior segment.
Aqueous humor fills the space within the anterior segment. Anterior segment has two chambers– anterior
chamber (between cornea and iris) and posterior chamber (between iris and lens). The aqueous humor is a
clear protein-free liquid that nourishes the cornea and iris; it is produced by a capillary network within the ciliary body.
Posterior segment includes vitreous chamber (between the lens and the retina). The vitreous humor fills the
vitreous chamber and it is a gelatinous mass. It helps maintain the spherical shape of the eyeball. The lens is
bathed on one side by aqueous humor and supported on the other side by vitreous humor. It has no blood supply,
but is metabolically active. It obtains nutrients from the aqueous humor.
437
Human Physiology
4.5.4 Exchange of oxygen and carbon dioxide

The purpose of breathing is to provide a continual supply of oxygen and to continuous removal of carbon dioxide.
In pulmonary and systemic gas exchange, oxygen and carbon dioxide diffuse from areas of higher partial pressures
to areas of lower partial pressures. The partial pressure of a gas is the pressure exerted by that gas in a mixture
of gases. In pulmonary gas exchange, the exchange of gases occurs between alveolar air and pulmonary blood
capillaries by the process of simple diffusion. In systemic gas exchange, the exchange of gases occurs between
systemic blood capillaries and tissue cells.
Alveolus
Right Left
O2
lung lung
CO2
Pulmonary
Pulmonary capillaries capillaries
Pulmonary gas exchange Pulmonary

circulation
Pulmonary arteries Pulmonary veins
PO2 = 40 mm Hg PO2 = 100 mm Hg
PCO2 = 46 mm Hg PCO2 = 40 mm Hg
LA
RA
LV
RV
Systemic veins Heart

carrying deoxygenated blood Systemic arteries
PO2 = 40 mm Hg carrying oxygenated blood

PO2 = 100 mm Hg
PCO2 = 46 mm Hg
Systemic PCO2 = 40 mm Hg
circulation
Systemic capillaries
Systemic capillaries
O2
Body tissue
CO2
Tissues cell
Systemic gas exchange
Figure 4.39 Oxygen and carbon dioxide exchange across pulmonary and systemic capillaries caused
by partial pressure gradients. The pulmonary gas exchange is the exchange of gases between alveoli
and pulmonary blood capillaries. The systemic gas exchange is the exchange of gases between systemic
blood capillaries and tissue cells. Blood acts as a transport system for oxygen and carbon dioxide between
the lungs and the tissues.
469
Human Physiology
Exchange of oxygen and carbon dioxide is governed by two gas laws – Dalton’s law and Henry’s law.
According to Dalton's law of partial pressure, each gas in a mixture of gases exerts a pressure, known as its
partial pressure, that is equal to the pressure the gas would exert if it were the only gas present. The total
pressure of the mixture is the sum of the partial pressures of all the gases present.
According to Henry’s law, the quantity of a gas that will dissolve in a liquid is proportional to the partial
pressure of the gas and its solubility (given that the temperature remains constant). Because solubility is a
constant and the temperature of the blood does not vary significantly, the concentration of a gas dissolved in a
fluid (such as plasma) depends directly on its partial pressure in the gas mixture.
Atmospheric pressure at sea level is 760 mm Hg. Since there is 21% oxygen by volume in the atmosphere, the
partial pressure of oxygen is 0.21 × 760 = about 160 mm Hg. This value is called the partial pressure of oxygen
(abbreviated PO2) because it is the portion of atmospheric pressure contributed by O2. Similarly, nitrogen
constitutes about 78% of the atmosphere, so its partial pressure is equal to 0.78 × 760 = 593 mm Hg.
The partial pressure of CO2, PCO2 , is much less, only 0.2 mm Hg at sea level.
Pulmonary gas exchange

As blood passes through the lungs, it picks up oxygen and gives up carbon dioxide simply by diffusion down partial
pressure gradients between blood and alveoli. Blood entering the pulmonary capillaries of lungs is pumped through
the pulmonary arteries. This blood, having just returned from the body tissues through systemic veins in to right
atrium, is relatively low in oxygen, with a PO2 of 40 mm Hg, and is relatively high in carbon dioxide, with a PCO2 of
46 mm Hg. As this blood flows through the pulmonary capillaries, it is exposed to alveolar air. Because the alveolar
PO2 at 100 mm Hg is higher than the PO2 of 40 mm Hg in the blood entering the lungs, oxygen diffuses down its
partial pressure gradient from the alveoli into the blood until no further gradient exists. As blood leaves the
pulmonary capillaries, it has a PO2 equal to alveolar PO2 at 100 mm Hg. The partial pressure gradient for carbon
dioxide is in the opposite direction. Blood entering the pulmonary capillaries has a PCO2 of 46 mm Hg, whereas
alveolar PCO2 is only 40 mm Hg. Carbon dioxide diffuses from the blood into the alveoli until blood PCO2 equilibrates
with alveolar PCO2. Thus, blood leaving the pulmonary capillaries has a PCO2 of 40 mm Hg. After leaving the lungs,
the blood, which now has a PO2 of 100 mm Hg and a PCO2 of 40 mm Hg, is returned to the heart and then pumped
out to the body tissues as systemic arterial blood.
PO2 = 150 mm Hg
PCO2 = 0.3 mm Hg } Inspired air
From To
pulmonary artery pulmonary vein
Alveolus
PO2 = 40 mm Hg PO2 = 100 mm Hg PO2 = 100 mm Hg
PCO2 = 46 mm Hg PCO2 = 40 mm Hg PCO2 = 40 mm Hg
Deoxygenated blood CO2 O2 Oxygenated blood
Capillaries
Figure 4.40 Pulmonary gas exchange. Transfer of O2 and CO2 between alveolar air and capillary blood.
470
Human Physiology
of the bronchi of the lungs. In more than 90% of cases the cause is a viral infection. Chronic bronchitis is defined as
a productive cough that lasts for three months or more per year for at least two years. Cigarette smoking is the
leading cause of chronic bronchitis.
Pneumonia
Pneumonia is an inflammation of the alveoli of lung. Typical signs and symptoms include a cough, chest pain, fever
and dyspnea (breathlessness). Its symptoms can vary from mild to severe. Many factors affect how serious
pneumonia is, such as the type of germ causing the infection and your age and overall health. Pneumonia is usually
caused by infection with viruses or bacteria and less commonly by other microorganisms. Bacteria are the most
common cause of pneumonia. Streptococcus pneumoniae is the most common cause of bacterial pneumonia.
Tuberculosis
Tuberculosis is an infectious disease usually caused by the bacterium Mycobacterium tuberculosis. Although several
Mycobacterium species can cause tuberculosis, M. tuberculosis is the principal causative agent. Tuberculosis generally
affects the lungs. Once the bacteria are inside the lungs, they multiply and cause inflammation, which stimulates
neutrophils and macrophages to migrate to the area and engulf the bacteria to prevent their spread. If the immune
system is not impaired, the bacteria remain dormant for life, but impaired immunity may enable the bacteria to
escape into blood and lymph to infect other organs. In many people, symptoms—fatigue, weight loss, lethargy,
anorexia, a low-grade fever, night sweats, cough, dyspnea, chest pain, and hemoptysis—do not develop until the
disease is advanced.
4.6 Cardiovascular system

In a multicellular organism, all living cells have to be provided with nutrients, oxygen and other essential substances.
Also, the waste or harmful substances produced, have to be removed continuously for healthy functioning of
tissues. It is therefore, essential to have efficient mechanisms for the transport of these substances to the cells and
from the cells. The cardiovascular system (also called circulatory system or blood vascular system) is responsible
for transporting gases, nutrients, hormones and cellular waste products throughout the body. It consists of three
interrelated components: blood, the heart and blood vessels.
4.6.1 Blood
Blood is a connective tissue composed of blood plasma (a liquid extracellular matrix) and formed elements (which
are cells and cell fragments). Blood is slightly alkaline (pH ranging from 7.3 to 7.4). It constitutes 20-30% of
extracellular fluid, amounting to 8% of the total body mass. The blood volume is 5 to 6 liters in an average–sized
adult male and 4 to 5 liters in an average–sized adult female.
Functions of blood
Blood performs following important functions:
1. Transportation of gases (oxygen and carbon dioxide), nutrients, hormones, heat and wastes.
2. Regulation of pH, body temperature and water content of cells.
3. Protection against blood loss through clotting and against disease through phagocytic activity with blood cells
and antibodies.
Components of blood
Blood has two components:
1. Blood plasma, a liquid extracellular matrix.
2. Formed elements, which are blood cells and cell fragments.
Blood plasma
Blood is about 45% formed elements and 55% blood plasma. When the formed elements are removed from blood,
a straw colored liquid called blood plasma (or simply plasma) is left. The separation can be either achieved by just
477
Human Physiology
leaving the blood undisturbed for some time leading to settling down of the cells or by centrifuging them. Blood
plasma is 90-92% water and 8-10% solutes, most of which (~7% by weight) are proteins. Some of the proteins in
blood plasma are also found elsewhere in the body but those confined to blood are called plasma proteins. Hepatocytes
synthesize most of the plasma proteins, which include the albumins (~54% of plasma proteins), globulins (~38%)
and fibrinogen (~7%). Fibrinogen is an important clotting factor produced by the liver. During the process of clot
formation, soluble fibrinogen is converted into insoluble threads of fibrin. Thus, the fluid from clotted blood, called
serum, does not contain fibrinogen, but it is otherwise identical to plasma.
Plasma also contains small amounts of minerals (like sodium, calcium, magnesium, bicarbonate, chloride, etc.),
glucose, amino acids, lipids, etc.
Table 4.13 Major constituents of plasma and their functions
Water (90–92% of plasma) Maintains blood volume; transports molecules

Plasma proteins (~7% of plasma) Maintain blood osmotic pressure and pH
Albumin Maintains blood volume and pressure
Globulins Transport; fight against infection
Fibrinogen Clotting
Salts (less than 1% of plasma) Maintain blood osmotic pressure and pH; aid metabolism
Gases (oxygen and carbon dioxide)
Nutrients (such as lipids, glucose, amino acids)
Hormones and vitamins
Nitrogenous wastes (urea and uric acid)
Formed elements
The formed elements of the blood include three principal components: erythrocytes (or red blood cells, RBCs),
leukocytes (or white blood cells, WBCs) and platelets. RBCs and WBCs are whole cells whereas platelets are cell
fragments. RBCs and platelets have just a few roles, but WBCs have a number of specialized functions. Several
distinct types of WBCs present in blood are neutrophils, lymphocytes, monocytes, eosinophils and basophils.
The percentage of total blood volume occupied by RBCs is called the hematocrit or packed cell volume. A
hematocrit of 40 indicates that 40% of the volume of blood is composed of RBCs. The normal range of hematocrit
for adult females is 38–46% and for adult males, it is 40–54%. In polycythemia, the percentage of RBCs is
abnormally high and the hematocrit may be 65% or higher. This raises the viscosity of blood, which increases the
resistance to flow.
The process by which the formed elements of blood develop is called hemopoiesis (or hematopoiesis). Before
birth, hemopoiesis first occurs in the yolk sac of an embryo and later in the liver, spleen, thymus and lymph nodes
of a fetus. Red bone marrow becomes the primary site of hemopoiesis in the last three months before birth and
continues as the main source of blood cells after birth and throughout life. In newborns, all bone marrow is red and
thus active in blood cell production. As an individual grows and in adulthood, the rate of blood cell formation
decreases; the red bone marrow in the medullary (marrow) cavity of long bones becomes inactive and is replaced
by yellow bone marrow, which is largely fat cells.
Red blood cells (RBCs)

RBCs are highly specialized for their oxygen transport. A healthy adult male has about 5.4 million and a healthy
adult female has about 4.8 million RBCs per microlitre of blood.
The cytosol of RBCs contains the oxygen-carrying protein hemoglobin, which is a pigment that gives red color to
the blood. It constitutes about 33% of the cell’s weight. A healthy individual has 12-16 gms of haemoglobin in every
100 ml of blood. Each RBC contains about 280 million hemoglobin molecules. The mature RBCs have no nucleus
and other membrane bound organelles. All their internal space is available for oxygen transport. RBCs have a
biconcave shape which offers at least two advantages:
478
Human Physiology
4.7 Digestive System

All living organisms require food for energy and organic matters for growth. Food is organic compound and usually
of plant or animal origin. The major components of our food are carbohydrates, proteins and fats. It also contains
vitamins and minerals in small quantities. The process of conversion of complex food substances to simple absorbable
forms is called digestion and is carried out by our digestive system by mechanical and biochemical methods. The
digestive system also absorbs water, vitamins and minerals, and eliminates wastes from the body.
The human digestive system includes the gastrointestinal tract (or alimentary canal or digestive tract) and the
associated glands. The gastrointestinal tract is a continuous tube that extends from the mouth to the anus. The
organs of the gastrointestinal tract include the mouth, pharynx, esophagus, stomach, small intestine and large
intestine. The associated glands include salivary glands, liver, gallbladder and pancreas.
The digestive system performs six basic digestive processes:

Ingestion Taking food into the mouth.
Secretion Release of acid, enzymes and bile into the lumen of the gastrointestinal tract.
Motility Refers to propulsive and mixing movements which cause propulsion and mixing of food through
the gastrointestinal tract.
Digestion Mechanical and chemical breakdown of food.
Absorption Assimilation of digested products from the gastrointestinal tract into the blood and lymph.
Defecation The elimination of feces from the gastrointestinal tract.
4.7.1 Gastrointestinal tract

The gastrointestinal tract is an organ system responsible for transporting and digesting food, absorbing digested
products and expelling waste. It is a large, muscular tube that extends from the mouth to the anus. Organs of the
gastrointestinal tract include the mouth, pharynx, esophagus, stomach, small intestine and large intestine. The
length of the alimentary canal is about 5–7 meters. In the gastrointestinal tract, several muscle rings known as
sphincters present, which restrict the flow of contents to optimize digestion and absorption.
Layers of the gastrointestinal tract

The gastrointestinal tract from the esophagus to the anal canal is composed of four layers (or tunics). Each tunic
contains a dominant tissue type that performs specific functions in the digestive process. The four tunics of the
gastrointestinal tract, from the inside out, are the mucosa (or mucous membrane), submucosa, muscularis propria
(smooth muscle layer) and serosa (serous membrane).
Mucosa : The mucosa is the inner lining of the lumen of the gastrointestinal tract. It is the absorptive and major
secretory layer. It is a mucous membrane composed of;
1. a layer of epithelium,
2. a layer of loose connective tissue known as the lamina propria and
3. a thin layer of smooth muscle known as muscularis mucosa.
Submucosa : A layer of dense irregular connective tissue that surrounds the mucosa. It has large blood vessels
and lymphatic vessels. A nerve network known as the submucosal plexus (Meissner’s plexus) lies within the
submucosa (plexus means ‘network’).
Muscularis propria (or muscularis externa) : It is dominated by smooth muscle cells in two layers - an inner
circular layer and outer longitudinal layer - that play an essential role in mechanical processing and in the movement
of materials along the gastrointestinal tract. Between inner circular layer and an outer longitudinal layer another
nerve network known as the myenteric plexus (Auerbach’s plexus), lies.
Serosa (serous membranes) : The outer connective tissue covering of the digestive tract is the serosa, which
secretes a watery, slippery fluid that lubricates and prevents friction between the digestive organs and the surrounding
viscera.
499
Human Physiology
Lumen
Mucosa
Muscularis mucosa
Submucosa
Circular layer
Longitudinal layer
Muscularis propria
Serosa
Figure 4.57 The wall of the gastrointestinal tract has four layers – mucosa, submucosa, muscularis
propria and serosa.
1. Mouth
The mouth (also referred to as the oral or buccal cavity) is formed by the cheeks, palates, lips and tongue.
Teeth
Teeth cut, tear and pulverize food to reduce solids to smaller particles for swallowing i.e. help in the physical
breakdown of food. The development of teeth and their type, number and arrangement in the mouth is called
dentitions. Majority of mammals including human forms two sets of teeth. During their life, a set of deciduous
teeth (also called primary teeth, milk teeth or baby teeth) is replaced by a set of permanent teeth (also called
secondary or adult teeth). This type of dentition is called diphyodont. All the deciduous teeth are lost—generally
between ages 6 and 12 years—and are replaced by the permanent teeth.
The deciduous teeth are the first sets of teeth and are twenty in number (10 in each jaw). It can be divided into
three categories in each jaw – four incisors, two canines or cuspid and four molars (two first molars and two second
molars).
An adult human has 32 permanent teeth (16 in each jaw) which are of four different types (heterodont dentition),
namely, incisors (I), canine or cuspid (C), premolars (PM) and molars (M). Arrangement of teeth in each half of the
upper and lower jaw in the order I, C, PM, M is represented by a dental formula which in human is 2123/2123.
Each tooth is embedded in a socket of jaw bone. This type of attachment is called thecodont. A typical tooth has
three major external regions: the crown, root and neck. The crown is the visible portion above the level of the
gums. Embedded in the socket are one to three roots. The neck is the constricted junction of the crown and root
near the gum line. Internally, dentin forms the majority of the tooth. Dentin consists of a calcified connective tissue
that gives the tooth its basic shape and rigidity. It is harder than bone because of its higher content of calcium salts.
500
Human Physiology
The peritubular capillaries surrounds the renal tubules. A specialized portion of the peritubular capillary system
called the vasa recta which descend into the medulla in parallel with the loops of Henle and then loop back along
with the loops of Henle and return to the cortex. Thus, there are two sets of capillaries in the kidneys – the
glomerular capillaries and the peritubular capillaries. Within each nephron, the two sets of capillaries are connected
to each other by an efferent arteriole. Blood from the peritubular capillaries is drained into the venous system. The
peritubular capillaries eventually reunite to form peritubular venules. Venous system starts with peritubular
venules and continues as interlobular veins, arcuate veins, interlobar veins and finally renal veins. Blood leaves the
kidney through a single renal vein that exits at the renal hilum and carries venous blood to the inferior vena cava.
Note that no segmental veins are present in the kidneys; the interlobar veins merge in the renal sinus to form the
large renal vein.
4.8.2 Nephron
Nephrons are the functional units of the kidneys. Each kidney consists of about 1 million nephrons, which are bound
together by connective tissue. A nephron consists of tubules and associated small blood vessels. The nephron’s
tubular component is a hollow, fluid-filled tube formed by a single layer of epithelial cells.
Each nephron consists of two parts: a renal corpuscle (or malpighian body), where blood plasma is filtered, and
a renal tubule into which the filtered fluid passes.
A renal corpuscle has two components - the glomerulus (a tuft of capillaries formed by the afferent arteriole) and
the Bowman‘s (or glomerular) capsule (a double–walled epithelial cup that encloses the glomerulus).
The glomerular capillary membrane is similar to that of other capillaries, except that it has three layers (instead of
two) : the fenestrated endothelium (a layer of simple squamous cells, called endothelial cells), a basement membrane
and a layer of epithelial cells (podocytes) surrounding the outer surface of the capillary basement membrane.
Capillary endothelium
Basement membrane
Secondary
process
(pedicel)
Capillary
Podocyte
cell body
Primary
process
Filtration slit Foot

and slit diaphragm processes
of podocyte
Figure 4.71 A cross-section of the filtration membrane. A substance that is filtered passes first through
a fenestra in the capillary endothelium. Next, it passes across the glomerular basement membrane, which
consists of a network of collagen fibrils and other structural proteins. Finally, the substance passes through
the filtration slits that are found between the podocytes.
Blood plasma is filtered in the glomerular capsule, and then the filtered fluid passes into the renal tubule. The renal
tubule consists of a proximal tubule, loop of Henle (nephron loop) and distal tubule. A proximal tubule is divided into
520
Human Physiology
proximal convoluted tubule and proximal straight tubule. Convoluted means the tubule is tightly coiled rather than
straight. The distal tubules of several nephrons empty into a single collecting duct.
In a nephron, the loop of Henle connects the proximal tubule and distal convoluted tubule. The loop of Henle
consists of three functionally distinct segments: the thin descending segment, the thin ascending segment and the
thick ascending segment.
Proximal
tubule Distal
tubule
Afferent
arteriole
Glomerulus
Collecting
duct
Arcuate artery
and vein
Peritubular
capillaries
Loop
of Henle
To renal pelvis
Figure 4.72 A nephron. A nephron has three components – Vascular component, tubular component
and Juxtaglomerular apparatus. Vascular component includes afferent arteriole (carries blood into the
glomerulus), glomerulus (a tuft of capillaries that filters a protein-free plasma into the tubular component),
efferent arteriole (carries blood from the glomerulus) and peritubular capillaries (involved in exchanges
of fluid between blood and the tubular lumen of the nephron). Tubular component includes Bowman’s
capsule (collects the glomerular filtrate), proximal tubule, loop of Henle, distal tubule and collecting duct.
About 80–85% of the nephrons are cortical nephrons. In these nephrons, the renal corpuscles are located in the
outer renal cortex and have short loop of Henle that extend very little into the medulla. In some 20-30% of the
nephrons, the renal corpuscles lie deep in renal cortex (close to the medulla) and the loop of Henle are very long
and run deep into the medulla. These nephrons are called juxtamedullary nephrons.
521
Human Physiology
Thus, the urine concentrating ability is limited by the level of ADH and by the degree of hyperosmolarity of the renal
medulla. Fortunately, a large vertical osmotic gradient is uniquely maintained in the interstitial fluid of the
medulla of each kidney. The concentration of the interstitial fluid progressively increases from the cortical boundary
down through the depth of the renal medulla until it reaches a maximum of 1200 mOsm in humans at the junction
with the renal pelvis.
300
300
300
600
900
1200
Medulla Cortex
Figure 4.80 Vertical osmotic gradient in the renal medulla. All values are in mOsm. The osmolarity of
the interstitial fluid throughout the renal cortex is isotonic at 300 mOsm, but the osmolarity of the interstitial
fluid in the renal medulla increases progressively from 300 mOsm at the boundary with the cortex to a
maximum of 1200 mOsm at the junction with the renal pelvis.
Let us first discuss the process responsible for building and maintaining this osmotic gradient. This process involves
the operation of the countercurrent mechanism. The countercurrent mechanism depends on the special anatomical
arrangement of the loops of Henle and the vasa recta. In the human, about 25% of the nephrons are juxtamedullary
nephrons, with loops of Henle and vasa recta that go deeply into the medulla before returning to the cortex. Flow in
the long loop of Henle is considered countercurrent because the flow in the two closely adjacent limbs of the loop
moves in opposite directions. Two types of countercurrent mechanisms exist in the kidneys: countercurrent
multiplication and countercurrent exchange.
300
Cortex The collecting ducts

of all nephrons use
300
the gradient to adjust
Medulla urine osmolality.
400
The long nephron loops of
juxtamedullary nephrons The osmolality of the
create the gradient. They 600
medullary interstitial
act as countercurrent
fluid progressively
multipliers.
increases from the
900 300 mOsm of normal
The vasa recta preserve body fluid to 1200 mOsm
the gradient. They act at the deepest part of
as countercurrent 1200 the medulla.
exchangers.
Figure 4.81 The three key players and their orientation in the osmotic gradient.
Countercurrent multiplication is the process by which a progressively increasing osmotic gradient is formed in
the interstitial fluid of the renal medulla as a result of countercurrent flow. Countercurrent multiplication involves
the long loops of Henle of juxtamedullary nephrons. The descending limb of the loop of Henle carries tubular fluid
from the renal cortex deep into the medulla, and the ascending limb carries it in the opposite direction. Since
countercurrent flow through the descending and ascending limbs of the long loop of Henle establishes the osmotic
532
Human Physiology
4.9 Reproductive system

The reproductive system of sexually reproducing animal consists of:
• Primary sex organs (called gonads) which produce gametes and hormones.
• Secondary sex organs which participate in reproduction but not form gametes.
• Accessory sex organs cause differences in the appearance of two sexes.
The primary reproductive organs, or gonads, consist of the ovaries and testes. These organs are responsible for
producing the egg and sperm cells and hormones. These hormones function in the maturation of the reproductive
system, the development of sexual characteristics, and have important roles in regulating the normal physiology of
the reproductive system. All other organs, ducts, and glands in the reproductive system are considered secondary,
or accessory, reproductive organs.
4.9.1 Male reproductive system

The male reproductive system consists of glands with their ducts and supporting structures
1. The glands include a pair of testes, a pair of seminal vesicles, a pair of bulbourethral (Cowper’s) glands, and
one prostate gland.
2. Ducts of testes include a pair of epididymis, a pair of vas deferens, a pair of ejaculatory ducts, and one urethra.
3. Supporting structures are divided into: Internal – a pair of spermatic cords and External - scrotum and penis.
Testes
The male gonads, testes, begin their development high in the abdominal cavity, near the kidneys. During the last
two months before birth, or shortly after birth, they descend through the inguinal canal into the scrotum, a pouch
that extends below the abdomen, posterior to the penis. Although this location of the testes, outside the abdominal
cavity, may seem to make them vulnerable to injury, it provides a temperature about 3°C below normal body
temperature. This lower temperature is necessary for the production of viable sperm. The incomplete descent of
testes on one or both sides in a newborn is called cryptorchidism, the testes remaining in the abdominal cavity or
inguinal canal.
Each testes is an oval structure. A tough, white fibrous connective tissue capsule, the tunica albuginea, surrounds
each testes and extends inward to form septa that partition the organ into lobules. There are about 250 lobules in
each testes. Each lobule contains 1 to 4 highly coiled seminiferous tubules that converge to form a single straight
tubule, which leads into the rete testes. Short efferent ducts exit the testes. Interstitial cells (cells of Leydig),
which produce male sex hormones, are located between the seminiferous tubules within a lobule.
Functions of testes
1. Production and storage of viable sperms.
2. Synthesis and secretion of the androgenic hormone, testosterone. Both these functions are under anterior
pituitary and hypothalamic control.
Ducts of the testes

Pressure generated by the fluid secreted by Sertoli cells pushes sperm and fluid along the lumen of the seminiferous
tubules and then into a series of very short ducts called straight tubules. The straight tubules lead to a network of
ducts in the testis called the rete testis. From the rete testis, sperm move into a series of coiled efferent ducts in the
epididymis that empty into a single tube called the ductus epididymis.
Epididymis : The epididymis is a comma-shaped organ about 4 cm (1.5 in.) long that lies along the posterior
border of each testis. Functionally, the epididymis is the site of sperm maturation, the process by which sperm
acquire motility and the ability to fertilize an ovum. This occurs over a period of about 14 days.
Ductus deferens : Within the tail of the epididymis, the ductus epididymis becomes less convoluted, and its
diameter increases. Beyond this point, the duct is known as the ductus deferens or vas deferens.
534
Chapter 05
Ecology
5.1 What is Ecology?

Ecology is the study of relationships between living organisms and their environments, the interaction of organisms
with each other and the pattern and cause of the abundance and distribution of organisms in nature. Thus, ecology
is the science that attempts to answer questions about how the nature works. The term ecology was coined by
German biologist Ernst Haeckel combining two Greek words, oikos (meaning ‘house’ or ‘dwelling place’) and logos
(meaning the study of) to denote such relationship between the organisms and their environment.
Atmosphere
Organisms Lithosphere
Hydrosphere
Figure 5.1 Organisms interact with physical environment comprised of atmosphere, hydrosphere
and lithosphere.
Level of organization
Ecological patterns and processes vary as a function of the scale at which they operate. The scales may be
biological, spatial and temporal. The biological scale includes individual organism, population and community. The
basic level of ecological organization starts with the individual (a single plant, insect or bird). The next level of
organization is the population. Populations are a collection of individuals of the same species within an area or
region. The next, more complex, level of organization is the community. Communities are made up of different
populations of interacting plants, animals and microorganisms within some defined geographical area.
The spatial scale in ecology includes ecosystem, biome and biosphere. An ecosystem consists of different
communities of organisms associated within a physically defined space. Terrestrial ecosystems can be grouped into
units of similar nature, termed biomes (such as a deciduous forest, grassland, coniferous forest, etc.). The biosphere
is the global sum of all ecosystems integrating all living beings and their relationships, including their interaction
with the elements of the lithosphere, hydrosphere, and atmosphere.
557
Ecology
Based on the level of organization ecology is classified into autecology and synecology. Autecology is the study of
interaction between organisms and their environments at the level of an individual, a population or an entire
species. Synecology is the study of a biotic community. It is also called community ecology. It is the synecology
which describes the biotic community as a whole, especially the links between organisms.
5.2 Environment
Organisms and their environments are dynamic and interdependent. The term environment etymologically means
surroundings. Thus, the environment includes everything (biotic as well as abiotic) that surrounds an organism and
all the abiotic components (like air, water, soil, radiations) affecting the biotic components described as environmental
factors or ecological factors.
Soil
Soil is the uppermost weathered layer of the earth’s crust. It is a mixture of weathered mineral rock particles,
organic matter (i.e. both living and dead), water and air. Soil is a biologically active matrix and home for plant roots,
seeds, animals, bacteria, fungi, algae and viruses. The study of soil is called pedology.
Soil composition
Soils are composed of mineral particles, organic matter, air and water. Soil mineral particles include sand
(0.05-2.0 mm), silt (0.002-0.05 mm) and clay (<0.002 mm). The relative proportions of sand, silt, and clay in a soil
are referred as soil texture. Soils are also composed of organic matter, which include living biomass, detritus
(dead tissue) and humus (non-living, non tissue). Humus is an amorphous and a colloidal mixture of complex
organic substances. It is made up of humic substances (comprise about 60 to 80% of the soil organic matter and
characterized by dark colored amorphous substance) and non-humic substances (refers to the group of identifiable
biomolecules that are mainly produced by microbial action and less resistant to breakdown). Soil air is the mixture
of gases that are present in soil pores that are not filled with water. Oxygen and carbon dioxide are important
constituents, and their concentration in the soil affects many processes (e.g. nitrification and denitrification). Soil
water can contribute up to 30% of soil volume, and is essential for the activity and physiological functioning of
organisms in the soil.
Soil profile
The mineral and organic components of soil are differentiated into horizons or strata of variable depth. Each
horizon differs in morphology, physical structure, and chemical and biological characteristics. These horizons are
evident when a vertical cut is made through the soil, revealing the soil profile. The widely accepted structure of the
soil profile is as follows:
O Organic litter of loose leaves and debris.
A1 Rich in humus and dark in color.
A2 Zone of maximum leaching of minerals; readily available minerals to plant roots present in this layer.
B Little organic material and chemical composition is largely that of the underlying rock; also referred to as
the zone of accumulation since minerals from above and below tend to concentrate here.
C Parent rock, which is weakly weathered.
D Unweathered bedrock.
The soil profile and the relative thickness of the horizons are generally characteristic for different climatic regions
and different topographical situations. For example, in grassland soil humification is rapid, but mineralization is
slow. In forest soil litter and root decay slowly. Hence humus layer is narrow, but mineralization is rapid so B
horizon is broad.
558
Ecology
Savanna biome
Distribution : Equatorial and subequatorial regions.
Precipitation : Average 30–50 cm annually.
Temperature : Average 24–29°C.
Tropical rain forests

Distribution : Equatorial and subequatorial regions.
Precipitation : About 200–400 cm annually.
Temperature : Average 25–29°C
Taiga biome
Distribution : 50 and 60° North latitudes.
Precipitation : 40–100 cm annually.
Temperature : Less than 0°C in winter to over 30°C in summer.
Climate
Climate is the long-term pattern of weather in a locality, region, or even over the entire globe. The terms
climate and weather have different meanings. Weather is the short term properties (such as temperature,
pressure, moisture) of atmospheric conditions for a specific place and time. Weather differ both spatially and
temporally. Two of the most important factors determining an area’s climate are air temperature and precipitation.
The climate of a region will determine which plants will grow there, and which animals will inhabit it.
We can describe climate patterns on two scales: macroclimate, patterns on the global, regional, and local
level; and microclimate, which represents the climatic conditions in areas of limited size such as the immedi-
ate surroundings of plants and animals. Microclimate generally differs from the prevailing regional climatic
conditions. For example, in a forest, dense foliage reduces the amount of light reaching the ground. This also
results in a changed air temperature profile in a forest.
Climatic zone
Climatic zone represents any of the geographical zones (regions on the surface of the Earth loosely divided
according to latitude or longitude) loosely divided according to the prevailing climate and latitude. On the basis
of variation in mean temperature along latitude, the main climatic zones are:
1. Tropical (0°–20° latitude)
2. Subtropical (20°–40° latitude)
3. Temperate (40°–60° latitude)
4. Arctic and Antarctic (60°–80° latitude).
The mean temperature declines as we move from tropical to arctic region. A similar climatic zonation occurs
with increasing altitude in the mountains. A mountain located in a tropical regions will successively have
tropical, subtropical, temperate and alpine zones with increasing altitude. Within each temperature-based
climatic zone, the annual precipitation (rainfall and /or snowfall) varies considerably.
5.9 Population ecology

A population is a collection of individuals of the same species that live together in a region. Population ecology is
the study of populations (especially population abundance) and how they change over time. It studies the spatial
and temporal patterns in the abundance and distribution of organisms and of the mechanisms that produce those
patterns.
586
Ecology
5.9.1 Population characteristics

A population has several characteristics or attributes which is a function of the whole group and not of the individual.
Different populations can be compared by measuring these attributes. These attributes are population density,
natality, mortality, growth forms, distributions, etc. The study of the group characteristics or parameters of the
human population, their changes over time and prediction of future changes is known as demography.
Population density
The size of the population is represented by its fundamental property called density. Density is expressed as the
total number of individuals per unit area or volume at a given time. Two types of densities are described - crude
density (it is the density per unit total space) and specific (ecological) density (it is the density per unit of habitat
space i.e. available area or volume that can actually be colonized by the population).
Determining population size : Usually population size is estimated by counting all the individuals from a smaller
sample area, then extrapolated over a larger area. Another common method is mark-recapture technique. Using
this method, a small random sample of the population is captured, marked, then released to disperse within the
general population. The marked individuals mix freely with unmarked individuals and within a short time are
randomly mixed within the population. The population is resampled and the numbers of marked and unmarked
individuals are recorded. We then assume that the ratio of marked to unmarked individuals in the second sample
taken is the same as the ratio of marked to unmarked individuals in the first sample. We can use a simple formula
for estimating total population size (N):
Total individuals marked in first sample × Size of second sample

N=
Number of marked individuals recaptures in second sample
Natality
Natality refers to the birth of individuals in a population. The natality rate (or birth rate) is expressed as the number
of individuals produced per female per unit time. To describe ‘rate’, we must specify time interval (such as one
year or one month) and a base population. Two bases are commonly used – Per capita or per individual (it is
equivalent to the number of births per individual per unit of time) or Per 1000 individuals.
Natality may be maximum natality or ecological natality. Maximum (sometimes called absolute or physiological)
natality is the theoretical maximum number of individuals produced under ideal environmental conditions (i.e. no
ecological limiting factors) and is a constant for a given population. Ecological or realized natality refers to number
of individuals produced under an actual or specific environmental condition. It is not a constant for a population but
may vary with the size and age composition of the population and the physical environmental conditions.
In ecology, fecundity and fertility is not same. The fecundity can be described as the maximum reproductive output
potential of an individual over its lifetime. The term ‘fertility’ differs from fecundity in that it describes the actual
reproductive performance of a female, and it is a generalization of the terms ‘birth rate’ and ‘natality’.
Mortality
Mortality refers to the death of individuals in a population. Like natality rate, mortality rate (death rate) may be
expressed as the number of individuals dying in a given period. Mortality may be minimum mortality or ecological
mortality. A theoretical minimum mortality, a constant for a population, represents the loss under ideal or non-
limiting conditions. Ecological or realized mortality is the loss of individuals, under a given environmental condition.
Like ecological natality, it is not a constant but varies with population and environmental conditions.
Information of the death and survivor of a population with respect to age is represented in the form of table known
as life table. It is simply an age-specific account of mortality.
What is really vital for the population is not which members die, but which member survives? Consequently specific
mortality rate of a population is expressed by survivorship curve. Survivorship curves plot the number of
surviving individuals to a particular age. Survivorship curves are of three general types:
587
Ecology
The logistic model of population growth produces a sigmoid (S-shaped) growth curve when population size is
plotted over time. In sigmoid growth form, the population increases slowly at first (establishment or positive
acceleration phase), then more rapidly (perhaps approaching a logarithmic phase), but it soon slows down gradually
as the environmental resistance increases in percentage (the negative acceleration phase), until equilibrium is
reached and maintained. The upper level, beyond which no major increase can occur, as represented by the constant
K, is the upper asymptote of the sigmoid curve and has been aptly called the maximum carrying capacity. The
maximum value of r is often called by the less specific but widely used expression biotic potential or reproductive
potential. It is the inherent property of an organism to reproduce, to survive i.e. to increase in number. Biotic
potential differs from one species to another e.g. bacterial populations can grow faster than population of oak trees.
The rate of reproduction of any individual can be increased in any or all of the three following ways:
• By producing a large number of offsprings each time it reproduces.
• By having a long reproductive life, and
• By reproducing as early in life as possible.
Population regulation
Population ecologists have identified a number of mechanisms by which populations could be regulated. Broadly
speaking, populations can be regulated by density-dependent or density-independent factors.
Density-dependent factors are those whose effects on the birth rate or death rate change as a function of the
population density. For example, a population of rabbits may increase exponentially until competitive intraspecific
interactions cause either the birth rate to decrease or the death rate to increase, leading to a net decline in
reproductive rate and subsequent decrease in population density. Density dependent influences often include
resources that are in limited supply such as space, water and nutrients.
As population size increases, either birth rate decline or mortality rate increase or both. It is a negative feedback.
However, not always density dependent factors are negatively related to population size. In some cases, growth
rate increase with population size. This phenomenon is referred to as the Allee effect (after W. Allee, who first
described it) and is an example of positive feedback.
Density-independent factors are usually associated with abiotic events – changes in the physical environment – that
either promote or repress population growth, but their effects are independent of population density. Density-independent
factors may include natural catastrophes such as hurricanes, floods, and seasonal variation in weather patterns.
Life table Age specific mortality and survival

The rate of population growth depends on both the survival and mortality. To obtain a clear and systematic age-
specific information of survivor and mortality within a population, ecologists construct life table. There are two
basic kinds of life tables. The one type is the cohort (or dynamic or horizontal) life table and other is static (or
time-specific or stationary or vertical) life tables. A cohort is a group of same-aged individuals. In cohort life table,
the fate of a group of same-aged individuals is followed from birth to death whereas a static life table is made from
data collected from all ages at one particular time—it assumes the age distribution is stable from generation to
generation.
A life table contains following information:
x = Age classes.
nx = Number alive at age x.
lx = Age specific survivorship (nx/n0 ).
dx = Age-specific mortality i.e. the number of individuals dying during the age interval x to x+1 (nx– nx+1).
qx = Age-specific mortality rate (dx /nx).
Fx = Age specific total reproductive output of entire population.
mx = Age specific mean number of offspring produced per individual (age specific birth-rates or fertility).
592
Ecology
The construction of a life table begins with a cohort, a group of individuals born in the same period of time. For
example, data presented below represent a cohort of 530 squirrels from a population in JNU, Delhi. The fate of
these 530 individuals was tracked until all had died some 6 years later. The first column of numbers labeled x
represents the age in units of years. The second column, nx, represents the number of individuals from the
original cohorts that are alive at the specified age (x). Of the original 530 individuals born (age 0), only 159
survived to an age of 1 year, while of those 159 individuals, only 80 survived to age 2. Only 5 individuals
survived to age 5, and none of those individuals survived to age 6 (that is why there is no age class 6).
The difference between the number of individuals alive for any age class (nx) and the number alive at the
beginning of the next age class (nx+1) is the number of individuals that have died during that time interval
represent the age-specific mortality (dx). The number of individuals surviving to any given age (i.e. age specific
survivorship) is calculated by taking ratio nx/n0, where n0 is the number alive at the start of the study. The
number of individuals that died during any given time interval (dx) divided by the number alive at the beginning
of that interval (nx) provides an age-specific mortality rate (qx).
Table Cohort life table from a hypothetical squirrels population

x nx dx (nx– nx+1) lx (nx /n0 ) qx (dx /nx)
0 530 371 1.00 (530/530) 0.70
1 159 79 0.30 (159/530) 0.50
2 80 32 0.15 (80/530) 0.40
3 48 27 0.09 (48/530) 0.55
4 21 16 0.04 (21/530) 0.75
5 05 05 0.01 (5/530) 1.00
Gross and net reproduction rate

In a sexually reproducing nonhermaphroditic population, only females within the population give birth. The
birth-rate of females generally varies with age. Therefore, a better way of expressing birth-rate is the number
of births per female of age x. For example, a life-table of age specific mean number of offspring produced per
individual (mx) of a squirrel population is presented below:
Age class (x) 0 1 2 3 4 5
mx 0 2 3 3 2 0
We assume that the female survives to the maximum age of 5 years. At age 0, females produce no young,
therefore the value of mx is 0. The average number of female offspring produced by a female of age 1 is 2. For
females of age 2 and 3, the mx value increases to 3, then declines to 2 at age 4. By age 5, the females no longer
reproduce, so the value of mx is 0. The sum (represented by Σ) of the mx value across all the age classes
provides an estimate of the average number of female offspring born to a female over her lifetime. It is termed
as gross reproductive rate. In this example, the gross reproductive rate is 10. However, this value assumes
that a female survives to the maximum age of 5 years. But survivorship of females also varies with age. Hence
when we include both age-specific fertility and age-specific survival, it gives net reproductive rate (R0).
In the following table, age-specific survivorship (lx) in each age-class has been considered together with the age-
specific fertility (mx). Although mx may initially increase with age, lx in each age-class declines. To adjust for
mortality, we multiply the mx value by the corresponding lx. The resulting value, lxmx, gives the mean number of
female offspring produced by females in each age-class. Thus for 1 year old females, the mx value is 2 but when
adjusted with lx, the lxmx value drops to 0.6. For age 2 the mx is 3, but lxmx drops to 0.45 and reflecting poor
survival of adult female. When the values of lxmx are summed over all ages at which reproduction occurs, it gives
net reproductive rate (R0). It is the average number of female that will be left during a lifetime by a new born
female. If R0 < 1, it indicates that the members of the population are not replacing themselves (i.e. the population
is declining). Similarly, if R0 > 1, it denotes an increasing population whereas, R0 = 1 indicates a stationary or
stable population.
593
Ecology
5.11.4 Model of succession

There are three models to explain the ecological processes of community change during succession. These models
are facilitation model, tolerance model and inhibition model.
Facilitation model
The classical model that explains the mechanisms of succession is the facilitation model. According to this model,
certain pioneer species with qualities ideal for early succession can colonize the newly exposed landforms after an
ecological disturbance. These initial species modify the site, making it more suitable for invasion by other species,
for example, by carrying out the earliest stages of soil development. Once established, the later-successional
species eliminate the pioneers through competition. This ecological dynamic proceeds through a progression of
stages in which earlier species are eliminated by later species, until the climax stage is reached. This model seems
to be most appropriate in explaining changes in many primary successions, but less so for secondary successions.
+ + +
A B C D
Figure 5.33 Facilitation model. It is based on the assumption that species of a previous stage are replaced
by the succeeding stage. And at each stage the species modify their own environment to make it progressively
less suitable for themselves and increasingly more suitable for succeeding species. (‘+’ indicates facilitation
and circular arrow indicates that the species replaces itself).
Tolerance model
According to tolerance model, new pioneer species neither inhibit nor facilitate the growth and success of other
species. All species in the succession are capable of establishing on a newly disturbed site, although with varying
successes in terms of the rapid attainment of a large population size and biomass. In contrast with the facilitation
model, the early occupants of the site do not change environmental conditions in ways that favour the subsequent
invasion of later-successional species. Rather, with increasing time, the various species sort themselves out through
their differing tolerances of the successionally increasing intensity of biological stresses associated with competition.
In the tolerance model, competition-intolerant species are relatively successful in early successional stages when
site conditions are characterized by a free availability of resources. However, these species are eliminated later on
because they are not as competitive as later species, which eventually develop a climax community.
0 0 0
ABCD BCD CD D
0 0
Figure 5.34 Tolerance model. In this model, the presence of early successional species is not essential,
that is, any species can start succession. Some species are competitively superior and they eventually
predominate in the climax community. Species that are more tolerant of limited resources, replace the other
species. Succession proceeds either by the invasion of later species or by a thinning out of the initial colonists,
depending on the starting conditions. In the figure, the capital letters A-D represent dominant species and
subscript(s) indicate that species are present as minor components. ‘0’ indicates no effect and circular arrow
indicates that the species replaces itself.
Inhibition model
A third suggested mechanism of succession is the inhibition model. As with the tolerance model, both early and
later-successional species can establish populations soon after disturbance. However, some early species make the
site less suitable for the development of other species. For example, some plants are known to secrete toxic biochemical
into the soil (these are called allelochemicals), which inhibits the establishment and growth of other species.
Eventually, however, the inhibitory species die, and this creates opportunities that later-successional species can
exploit. These gradual changes eventually culminate in the development of the climax community.
614
Ecology
5.12.6 Conservation of biodiversity

Biodiversity is a source of significant economic, aesthetic, health and cultural benefits which form the foundation for
sustainable development. However, there is general scientific consensus that the world is rapidly becoming less
biologically diverse in terms of genes, species and ecosystems. The reason for this is clearly anthropogenic. The scale
of human impact on biological diversity has been increasing exponentially primarily because of world-wide patterns
of consumption, production, trade; agricultural, industrial and settlement development; and human population growth.
Neither the economic nor the ecosystem value of biodiversity is as yet well understood. In particular, there is
insufficient knowledge of the interdependence of species within ecosystems and the impact of the extinction of one
species on others. Hence, reducing the rate of biodiversity loss and conserving still existing biodiversity as the basis
of sustainable development remain major global challenges.
Conservation is the protection, preservation, management or restoration of wildlife and natural resources such as
forests and water. Through the conservation of biodiversity, the survival of many species and habitats which are
threatened due to human activities can be ensured.
In-situ and ex-situ conservation

Conservation can broadly be divided into two types:
In-situ : The conservation of habitats and ecosystems where organisms naturally occur. Sacred groves, biosphere
reserves (terrestrial and marine), national parks, wildlife sanctuaries are all examples of in-situ conservation.
Ex-situ : The conservation of elements of biodiversity out of the context of their natural habitats is referred to as
ex-situ conservation. Zoos, botanical gardens and gene banks are all examples of ex-situ conservation.
in situ conservation
In the natural habitat and
production environment
Conservation
ex situ conservation
In an artificial environment
(zoo, botanical garden etc.)
Figure 5.36 Overview of basic conservation schemes.
Gene banks function as ex-situ conservation, where a sample of the genetic variability of a species is preserved in
an artificial environment, outside of its normal habitat. In general, the seeds of plant species are stored in environments
at low temperature and humidity. In these conditions, their viability can be preserved for several decades.
In-situ conservation strategies

The in-situ approach includes protection of a group of typical ecosystems through a network of protected areas.
These are areas of land and/or sea, especially dedicated to the protection and maintenance of biological diversity,
and of natural and associated cultural resources.
National parks are reserves of land, usually declared and owned by a national government, protected from most
human development.
Biosphere reserves are a special category of protected areas of land and/or coastal environments, where people
are an integral components of the system. These are representative examples of natural biomes and contain
unique biological communities. The concept of biosphere reserves was launched in 1971 as a part of UNESCO’s Man
and Biosphere programme. The first biosphere reserve of the world was established in 1979, since then the
network of biosphere reserves has increased to 531 in 105 countries across the world (MAB, 2008). Now, there are
18 biosphere reserves in India. These reserves are rich in biological and cultural diversity and encompass unique
features of exceptionally pristine nature. The goal is to facilitate conservation of representative landscapes and
their immense biological diversity and cultural heritage, foster economic and human development which is culturally
and ecologically sustainable and to provide support for research, monitoring, education and information exchange.
622
Ecology
Air quality standards

EPA has established two levels of national ambient air quality standards: primary and secondary. Primary standards
are required to be set at levels that will protect public health including the most sensitive individuals. Secondary
standards are established to protect public welfare (e.g. crops, animals, structures). Secondary standards are
meant to be more stringent than primary standards.
5.14.2 Greenhouse effect

The Earth receives energy from the Sun in the form of solar radiation. Various gases in the atmosphere absorb
incoming solar radiation. The ability of atmospheric gases to absorb radiation varies with the wavelength. All of the
incoming solar radiation with wavelengths less than 0.3 μm is absorbed by oxygen and ozone. This absorption
occurs in the stratosphere. Most of solar radiation passes through the atmosphere without being absorbed. Large
fraction of this radiation is absorbed at the Earth's surface. The Earth surface re-radiates longwave thermal radiation.
Most of the long wavelength radiation (greater than 4 μm) re-radiated by the Earth is absorbed by atmospheric
gases, most importantly water vapour, CO2, N2O and CH4. Radiatively active gases that absorb wavelengths longer
than 4 μm are called greenhouse gases. This absorption heats the atmosphere, which in turn, radiates energy back
to the Earth. The greenhouse gases act as a thermal blanket around the Earth, raising the Earth’s temperature. This
effect is known as greenhouse effect. Outgoing radiation between wavelength 7 and 12 μm easily passes through
the atmosphere. This region is referred to as the atmospheric radiative window. The greenhouse effect is a natural
phenomenon. It is responsible for Earth having an average near surface air temperature 33°C warmer than it
would have if it did not have greenhouse gases in the troposphere.
Sun
CO2, H2O, CH4, N2O, O3
Atmosphere
Earth
Figure 5.37 Greenhouse gases trap long wavelength energy from the earth's surface, heating the
atmosphere, which, in turn, heats the earth.
Global warming
Global warming is defined as the increase in the average temperature of the Earth. Over the last 100 years, the
average temperature of the air near the Earth’s surface has risen a little less than 1°Celsius (0.74 ± 0.18°C). The
rate of warming over the last 50 years is almost double that for the period 1906-2005 as a whole. Increasing
greenhouse gas concentrations resulting from human activity such as fossil fuel burning and deforestation is mainly
responsible for the observed temperature increase.
An increase in global temperature will cause sea levels to rise and will change the amount and pattern of precipitation,
probably including expansion of subtropical deserts. The continuing retreat of glaciers, permafrost and sea ice are
expected with warming being strongest in the Arctic. Other likely effects include increases in the intensity of
extreme weather events, species extinctions and changes in agricultural yields.
Global-warming potential of greenhouse gases

Global-warming potential is a relative measure of how much heat a greenhouse gas traps in the atmosphere. It is
based on the heat-absorbing ability of each gas relative to that of carbon dioxide, as well as the decay rate of each
gas (the amount removed from the atmosphere over a given number of years). It is calculated over a specific time
631
Ecology
interval, commonly 20, 100 or 500 years. For example, the 20 year global-warming potential of methane is 72,
which means that if the same mass of methane and carbon dioxide were introduced into the atmosphere, methane
will trap 72 times more heat than the carbon dioxide over the next 20 years.
Gases Global warming potential (100 years)

Carbon dioxide (CO2) 1
Methane (CH4) 23
Nitrous oxide (N2O) 296
Chlorofluorocarbons (such as CFC-11) 3400
Hydrofluorocarbons (such as HFC-23) 12000
Sulfur hexafluoride (SF6) 22200
Kyoto Protocol
The Kyoto Protocol is an international agreement linked to the United Nations Framework Convention on Climate
Change. The protocol was adopted in Kyoto, Japan, on 11 December, 1997 and entered into force on 16 February 2005.
The Kyoto Protocol is a legally-binding agreement under which industrialized countries will reduce their collective
emissions of greenhouse gases by 5.2% compared to the year 1990. The goal is to lower overall emissions of six
greenhouse gases – carbon dioxide, methane, nitrous oxide, sulfur hexafluoride, hydrofluorocarbons and
perfluorocarbons.
5.14.3 Stratospheric ozone

Stratospheric ozone formation : The process of ozone formation in the stratosphere first involves the formation of
atomic oxygen (O) from the photolytic decomposition of molecular oxygen (O2).
O2 O+O
The atomic oxygen, in turn, reacts with molecular oxygen to form ozone,
O + O2 O3 + M
Where M represents a third body (N2 or O2) necessary to carry away the energy released in the reaction. The
ozone that is formed in this process is also dissociated by solar radiation to form an oxygen atom and an oxygen
molecule. Ozone absorbs UV radiation in the 200 to 320 nm wavelength region and generates molecular oxygen as
a result of photodissociation.
O3 O2 + O
This cyclic process leads to a natural steady-state concentration of stratospheric ozone. These three reactions are
called the Chapman cycle, after the person who discovered them.
Levels of ozone are measured in Dobson Units (D.U.). The average amount of stratospheric ozone throughout the
world is about 300 D.U. Ozone concentrations over Antarctica during the period of greatest depletion usually fall
well below 200 D.U.
Stratospheric ozone depletion : Ozone is continuously being synthesized from molecular oxygen in the stratosphere
by the absorption of short-wavelength ultraviolet (UV) radiation, while at the same time it is continuously being
removed by various chemical reactions that convert it back to molecular oxygen. The rates of synthesis and destruction
at any given time determine the concentration of ozone in the stratosphere. This balance is being affected by
increasing stratospheric concentrations of chlorine, nitrogen and bromine, which increase the destruction process.
The most prominent type of ozone-destructive gases is the chlorofluorocarbons (CFCs). The possibility of stratospheric
ozone depletion caused by CFCs was proposed by F. Sherwood Rowland and Mario Molina. CFCs are inert molecules
and have residence time of over a hundred years in the troposphere. These gaseous molecules diffuse through the
troposphere to the stratosphere. In the stratosphere, CFC molecules can be broken by ultraviolet radiation, freeing
632
Chapter 06
Evolution
6.1 Origin of Life

Abiogenesis
Abiogenesis is the generation of life from non-living matter. Abiogenesis is now more precisely known as spontaneous
generation. This theory states that complex living organisms are generated from decaying organic substances e.g.
organism like mice spontaneously appears in stored grain or maggots spontaneously appear in meat.
Francesco Redi, an Italian physician, was the first who disproved the Theory of Spontaneous Generation by performing
a controlled experiment. In 1668, Redi performed an experiment to check whether maggots really came from
decaying meat. He did this by placing meat in a number of jars and covering half of them with fine gauze while
leaving the others uncovered. Maggots developed only on the meat in the uncovered jars. From this, Redi concluded
that the maggots did not come from the meat, but from tiny eggs that flies had laid on the meat. Since flies could
not land on the meat in the covered jars, they could not lay eggs on that meat, and no maggots formed. Therefore,
decaying meat could not produce maggots.
Later, Lazzaro Spallanzani (an Italian naturalist) performed a similar experiment with broth. He put broth into two
glass flasks and sterilized them by boiling the flask containing broth. One of the flasks was left open to the air. The
other flask was sealed up to keep out any organisms that might be floating in the air. Microorganisms developed
only in the uncovered flask. From this, Spallanzani concluded that the microorganisms did not come from the broth,
but were in the air that entered the flask.
Cool Wait
Broth heated Flask left open Growth
Open
Wait flask
Broth heated Flask sealed No growth Growth
Figure 6.1 Sterilized broth in open flask developed microbes whereas in sealed flask microbes
not developed.
641
Evolution
Unfortunately, many scientists were not convinced by his experiment. Louis Pasteur, a French chemist, finally
disproved the Theory of Spontaneous Generation in the mid 1800’s. He performed the same type of experiment as
Spallanzani. Louis Pasteur, however, allowed air to enter into the flask of sterile broth.
He performed experiments with two flasks – one with a straight neck and other with S-shaped neck. Flask with a
straight neck allowed both air and microorganisms to enter whereas the other flask with S-shaped neck allowed
only air to enter but not microorganisms. The broth in the straight neck flask became contaminated with
microorganisms but the broth in the flask with an S-shaped neck did not become contaminated. Therefore, Louis
Pasteur showed that even though air could get in the flask, the broth did not produce microorganisms.
Wait
Boil No growth
Wait
Boil Break stem Microbial growth
Figure 6.2 No microbial growth occurs in flask with an S-shaped neck whereas microbes growth occurs
in flask with broken stem.
Scientists finally were convinced that living things, no matter how small, do not come from nonliving things. The
present theory of where living things come from is called biogenesis. This theory states that living things come
only from other living things. For example, mice come only from mice, and microorganisms such as bacteria can
only come from other bacteria. Since spontaneous generation was now proved incorrect, many scientists began to
wonder how life started on the Earth. Oparin and Haldane attempted to answer this question. They proposed that
life had arisen from simpler molecules on the lifeless earth under much different atmospheric conditions than exist
today. However, instead of life arising suddenly, as previous spontaneous generation theories proposed, Oparin and
Haldane believed that it occurred over a very long period of time.
Chemical evolution
Our current understanding of conditions on prebiotic Earth and the idea of a gradual chemical evolution toward life
were first proposed independently by A.I. Oparin and J.B.S. Haldane. The Oparin-Haldane model suggested that
under the strong reducing conditions theorized to have been present in the atmosphere of the early Earth (between
4.0–3.5 billion years ago), inorganic molecules would spontaneously form organic molecules (simple sugars and
amino acids). Oparin argued that a primeval soup (or Primordial soup) of organic molecules could be created in an
oxygenless atmosphere through the action of sunlight. These would combine in evermore complex ways until they
formed coacervate droplets. These droplets would grow by fusion with other droplets, and reproduce through
fission into daughter droplets.
Around the same time in the year 1929, J.B.S. Haldane published a paper in which he proposed that the Earth's
prebiotic oceans would have formed a hot dilute soup in which organic compounds could have formed.
In 1953, Stanley Miller, along with his graduate advisor Harold Urey, tested this hypothesis by constructing an
apparatus that simulated the Oparin-Haldane early earth.
642
Evolution
6.3 Evidences of evolution

Species have evolved from a common ancestor, rather than created separately. Evidences supporting the evolu-
tion model come from multiple, distinct areas of biology and geology. These pieces of evidence can be grouped
into four categories:
• Direct observation of evolutionary change
• Homology and development
• Vestigial traits
• Fossil record and biogeography
Direct observation of evolutionary change

Small-scale evolution can be observed in nature or generated experimentally in the laboratory. The classic story of
the peppered moth in Britain during the industrial revolution is an example of microevolution. Grant and Grant have
recorded evolutionary change in beak shape within and among populations of Darwin’s finches, over periods as
short as two years.
We can also drive genetic change in laboratory populations of Drosophila and other model organisms in the
laboratory. By selecting certain phenotypic traits, we can generate directional change in characteristics such as
abdominal bristle number, lifespan and avoidance to certain chemicals. Artificial selection experiments are also the
foundation of agricultural improvement over the past 10,000 years.
Homology and development

One of the most compelling lines of evidence supporting the common ancestry of species is that of similar structural
elements across functionally diverse forms. It becomes evident from comparative anatomy. We find the same
bones in many different types of animals, but these bones are often modified to do different things. The hopping
legs of the frog contain the same bones as our own legs, but the frog’s legs are highly modified to fulfill a different
function (hopping). The wing of a bird and the forelimb of a bat contain exactly the same bones as the arm of a
human, but the size, shape, and even internal structure of these bones are all adapted to play a different role in
each animal.
We call structures like the wings of a bird and the forelimbs of a bat homologous structures. Homologous
structures are structures that are derived from a common ancestor. Even if they are superficially different, they are
developmentally related. Homology does not mean that these structures must share the same function. A character
shared between two species but not present in their common ancestor is called homoplasy.
Human Frog Bat Porpoise Horse
Figure 6.8 Homology between the forelimbs of four mammals and a frog, showing the ways in which the
proportions of the bones have changed in relation to the particular way of life of the organism.
651
Evolution
6.6.1 Calculation of allelic frequencies

If we consider an autosomal locus in a diploid, sexually reproducing species, allelic frequencies can be measured in
either of two ways. The first way is simply by counting genes:
Consider, for example, the genotypic distribution of A and a alleles among two hundred persons.
AA genotype = 114
Aa genotype = 76
aa genotype = 10
As the homozygotes have two of a given allele and heterozygotes have only one, and since the total number of
alleles is twice the number of individuals (each individual carries two alleles), we can calculate allelic frequencies in
the following manner.
Number of A alleles
Frequency of the A allele 
Total number of alleles
(2  number of AA homozygote)  (number of Aa heterozygote)


(2  total number of individuals)
The expression ‘frequency of’ can be shortened to f (). For example, the frequency of the A allele will be written as f (A).
2 (114)  76 304 2 (10)  76 96

Then, f (A)  p    0.76 and f (a)  q    0.24
2 (200) 400 2 (200) 400
Alternatively, because the frequencies of the two alleles, A and a, must add up to unity (p + q = 1), q = 1 – p (and
p = 1 – q), if we know that p = 0.76, then q = 1 – 0.76 = 0.24.
Another way of calculating allelic frequencies is based on knowledge of the genotypic frequencies, which in this
example are
114 76 10
f (AA)   0.57 f (Aa)   0.38 f (aa)   0.05
200 200 200
We derive an expression for calculating p and q based on genotypic frequencies as follows:
2  number of AA  number of Aa 2  number of AA number of Aa

p = f (A)   
2  total number 2  total number 2  total number
p = f (AA) + (1/2) f (Aa)
2  number of aa  number of Aa 2  number of aa number of Aa

q = f (a)   
2  total number 2  total number 2  total number
q = f (aa) + (1/2) f (Aa)
Thus, allelic frequencies can be calculated as the frequency of homozygotes plus half the frequency of heterozygotes
as follows:
p = f (A) = f (AA) + (1/2) f (Aa) = 0.57 + (1/2)0.38 = 0.76
q = f (a) = f (aa) + (1/2) f (Aa) = 0.05 + (1/2)0.38 = 0.24
Note: Allele and genotype frequencies must always be between 0 and 1.
6.6.2 Hardy-Weinberg Law

In 1908, G.H. Hardy, a British mathematician, and W.Weinberg, a German physician, independently discovered a
rule that relates allelic and genotypic frequencies in a Mendelian population (a natural, interbreeding unit of sexually
reproducing organisms sharing a common gene pool). The rule has three aspects:
1. The allelic frequencies at an autosomal locus in a population will not change from one generation to the next
(allelic-frequency equilibrium).
658
Evolution
2. The genotypic frequencies of the population are determined in a predictable way by the allelic frequencies
(genotypic-frequency equilibrium). If the allele frequencies in a population with two alleles at a locus are p and q,
then the expected genotype frequencies are p2, 2pq and q2. This frequency distribution will not change from
generation to generation once a population is in Hardy-Weinberg equilibrium.
3. The equilibrium is neutral, which means that a population deviated from its Hardy-Weinberg genotype frequencies,
will reach equilibrium after a single generation of random mating (if all the other requirements are maintained).
But, it will be a new equilibrium if allele frequencies have changed. This property distinguishes a neutral
equilibrium from a stable equilibrium, in which a perturbed system returns to the same equilibrium state.
Derivation of the Hardy-Weinberg Law

The Hardy-Weinberg law states that when a population is in equilibrium, the genotypic frequencies will be in the
proportions P2, 2pq and q2. To understand the basis of these frequencies at equilibrium, consider the alleles A and
a in a population whose allele frequencies are p and q, respectively (remember that p + q = 1). With random
mating (each individual of the population has equal opportunity of mating with any other individual of that population),
the relation between allele frequency and genotype frequency is particularly simple, because random mating of
individuals is equivalent to random union of gametes. Conceptually, we may imagine all the gametes of a population
to be present in a large container. To form zygote genotypes, pairs of gametes are withdrawn from the container at
random. The genotype frequencies expected with random mating in this case can be deduced from the given diagram:
pA p2 AA
pA
qa pq Aa
pA pq Aa
qa
qa q2 aa
The gametes at the left represent the sperm and those in the middle the eggs. The genotypes that can be formed
with two alleles are shown at the right, and with random mating the frequency of each genotype is calculated by
multiplying the allele frequencies of the corresponding gametes. However, the genotype Aa can be formed in two
ways—the A allele could have come from the father (top part of the diagram), or from the mother (bottom part of
the diagram). In each case, the frequency of the Aa genotype is pq; considering both possibilities, the frequency of
Aa is pq + pq = 2pq. Consequently, the overall genotype frequencies expected with random mating are:
AA: p2 Aa: 2pq aa: q2
The relationship between gene frequency and genotype frequency can be expressed as p2 + 2pq + q2 = 1 or
(p + q)2 = 1. It is known as the Hardy-Weinberg principle.
After random mating, the frequency of the A homozygote is p2 and the frequency of the heterozygote is 2pq. Thus
the frequency of the A allele, the frequency of its homozygote plus half the frequency of the heterozygotes, is
f (A) = f (AA) + (1/2) f (Aa) = p2 + (1/2)(2pq) = p2 + pq = p(p + q)
The Hardy-Weinberg law holds true for any frequencies of A and a, as long as the frequencies add to 1 and all the
assumptions are evoked. A population in which the allele frequencies remain constant from generation to genera-
tion and in which genotype frequencies can be predicted from the allele frequencies is said to be in a state of Hardy-
Weinberg equilibrium for that locus.
Genotype frequencies predicted by the Hardy—Weinberg equation can be summarized graphically. Figure 6.10
shows expected genotype frequencies on the y-axis for each genotype for any given value of the allele frequency
on the x-axis.
659
Index
Index
A Adrenal medulla 453, 454

Adrenocorticotropic hormone 448
Ammonification 576
Amniotic membrane 548
Adventitious roots 356 Amoeba 616
A complex 150
Adventive embryony 390 Amphidiploid 58
ABC excinuclease 123
Aedes 603 Amphipathic 644
ABC model 378
Afferent arterioles 518 Ampulla 444
ABCB proteins 355
Afferent division 417, 431 Amygdala 426
ABCDE model 379
Afferent fiber 420 Anagenesis 671
Abdominal A 226
Afferent nerve 417 Analogous structures 652
Abdominal B 226
Age pyramids 589 Anatomic dead space 468
Abiogenesis 641
Age structure 589 Anchor cell 228
Abiotic 565
Aggregation 612 Androgen 455
Abortive initiation 133
Agranular leukocytes 479 Anemia 482
Abscisic acid 360
Agrobacteria 300 Aneuploidy 57, 58
Abscission layers 362
Agrobacterium tumefaciens 359 Angina pectoris 486
Absorbing colon 515
Air pollution 629 Angiotensin I 456
Absorptive cells 505
Air quality standards 631 Angiotensin II 456, 494, 529
Abyssal zone 580
Albizia 381, 382 Angiotensin-converting enzyme
ACC oxidase 362
Aldosterone 454, 456, 494, 529 456, 494
Accessory digestive organs 508
Aleurone grains 387 Angiotensinogen 456
Accessory glands 535
Alkaline denaturation 245 Animal cell culture 316
Accumulation response 372
Alkaline phosphatase 242 Animal cloning 294
Acentric fragment 61
Alkaloids 401 Animal hemisphere 547
Acetylation 91
Alkylating agents 213 Animal pole 543
Acetylcholine 432
Allantoic 349 Anopheles 603
Acid growth hypothesis 356
Allantoin 349 Antarctic ozone hole 633
Acid rain 633
Allee effect 592 Antennapedia 226, 227
Acinar cells 510
Allele 2 Antennapedia complex 226
Acini 450
Allelic exclusion 178 Anterior chamber 437
Aconitase 179
Allelic-frequency equilibrium 658 Anterior pituitary 447
Acridine orange 213
Allelopathy 604 Anterior root 428
Acromegaly 459
Allen’s rule 562 Anther culture 310
Acrosome 536
Allochthonous 569 Anthropogenic extinction 620
Acrosome reaction 544
Allogenic succession 612 Anti silencing function 1 88
Actinomycin D 141
Allopatric speciation 667 Antibiotic resistance gene 247
Activation domain 141
Allopatry 667 Antibodies 479
Adamsia palliate 602
Allopolyploidy 57 Anticoagulant 482
Adaptation 560
Allozygous 662 Antidiuretic hormone
Adaptive radiation 649, 657
Alnus 616 448, 459, 494, 529
Adaptor 243
Alpha diversity 617 Anti-Mullerian hormone 37
Addison’s disease 460
Alphoid DNA 68, 85 Antipodal cells 385
Additive law 11
Alternate segregation 62 Anus 507
Adeno-associated viruses 297
Alternative splicing 152 Aorta 494
Adenohypophysis 447
Altruism 625 Aortic arch 493
Adenovirus 299
Alveolar ducts 463 Aortic bodies 476, 494
Adipocytes 412
Amanita phalloides 136 Aortic disease 498
Adipose tissue 412
Amber 200 Aortic valve 484
Adjacent segregation 62
Amber codon 200 AP endonucleases 123
A-domain 100
Ames test 220 AP sites 123
Adrenal androgen 454
Amine hormones 445 Apical cell 391
Adrenal cortex 453, 454
Aminoacyl-tRNA synthetases 192 Apical dominance 356
Adrenal gland disorders 460
Aminopeptidase 513 Apical foramen 501
Adrenal glands 453, 457
684
Index
Apneustic center 475 Autonomous 377 Behavioural ecology 625

Apocrine glands 411 Autonomous controlling element 73 Bell-shaped 589
Apomixis 390 Autonomous smooth muscle Benthic zone, 580
Apoplastic phloem loading 351 function 516 Bergmann’s rule 562
Aporepressor 167 Autonomously replicating sequences Bicarbonate ions 473
Aposematic coloration 609 100 Bicoid genes 225
Apospory 390 Autopolyploidy 57 Bicuspid valve 484
Appendicitis 507 Autorhythmic fibers 486 Bilayers 644
Apyrimidinic site 123 Autosomal dominant inheritance 43 Bile pigments 509
Aquatic ecosystem 579 Autosomal recessive inheritance 43 Bilirubin 510
Aqueous humor 437 Autotetraploid 57 Binary vector strategy 258
Arabidopsis 355, 365, 366, 372 Autotrophic 596 Binding motif 146
Arabidopsis thaliana 355, 375, 391 Autotrophic succession 612 Binomial expansion 12
Arachnoid mater 421 Autotrophs 565 Bioaccumulation 634
Arbor vitae 425 Autozygous 662 Biochemical methods 499
Areolar connective tissue 412 Autumn overturn 582 Biochemical oxygen demand 634
Argonaute 180 Auxin 353 Biodiversity 617
Arithmetic growth 590 Auxin binding protein-1 363 Biogenesis 642
ARS binding factor-1 100 Auxin efflux 355 Biogeochemical cycle 574
Arteries 491 Auxin influx 354 Biogeographic zones 623
Arterioles 490 Auxin response factors 363 Biogeography 652
Arteriosclerosis 498 Auxin signaling pathway 363 Biological diversity 617
Artificial media 319 AV node 487 Biological oxygen demand 634
Artificial seeds 315 Avascular 407 Biomagnification 634, 635
Artificial selection 653 Avena sativa 353 Biomes 557, 583
Ascaris lumbricoides 603 Avoidance response 372 Bioremediation 636
Ascending aorta 484 Avoiding predation 609 Bioremediation strategies 636
Ascending colon 507 Axial patterning 390 Biosphere 557
Asexual reproduction 389 Axon hillock 418 Biosynthesis 396
Asexual spores 389 Axon terminals 418 Biotic 565
ASF1 88 Axoplasm 418 Biotic community 596
A-site 195 Azorhizobium 347 Biotic potential 592
Aspection 601 Azurophilic granules 479 Biotic province 623
Assimilation efficiency 572 Bipolar cells 437
Association neurons 420 Bipolar neuron 419
Assortative mating 662
Asthma 476
B Bithorax complex 226
Bivalent 96
Astigmatism 441 Blastocoel 547
B1 complex 150
Astrocytes 421 Blastocyst 548
B2 complex 150
Asymmetric hybrids 313 Blastomeres 546
Bacterial artificial chromosome 248
Atherosclerosis 498 Blind spot 437
Bacterial mobile elements 70
Atherosclerotic plaque 498 Blood 477
Bacterial replication origin 253
Atmosphere 559 Blood clotting 481
Bacterial transposons 70
Atmospheric pressure 467 Blood colloid osmotic pressure 524
Bacteriophage lambda 172
Atmospheric radiative window 631 Blood flow 492
Bacteroids 348
Atresia 537 Blood plasma 477
Baculoviruses 257
Atrial natriuretic factor 456 Blood pressure 492
Balancing selection 669
Atrial natriuretic peptide Blood vessels 490
Bands 56
494, 529, 530 Blood-brain barrier 422
Baroreceptor reflexes 493
Atrial systole 489 Blue cones 439
Barr body 93
Atrioventricular bundle 487 Blunt ends 238
Barrier insulator 95
Atrioventricular valves 484 B-lymphocytes 479
Basal cell 391
Attachment culture 316 Body temperature 562
Basal metabolic rate 450
Auditory hair cells 442 Bohr effect 472
Basal transcription factors 139
Auditory ossicles 442 Bolus 502, 511
Base analogs 212
Autecology 558 Bone tissue 413
Base composition 273
Autochthonous 569 Bony labyrinth 442
Base-excision repair 122
Autoclaving 307 Bottleneck effect 670
Basilar membrane 442
Autogenic succession 612 Bottom-up control 578
Basophil 479
Autonomic ganglion 431 BPG 473
Batesian mimicry 609
Autonomic nervous system Brachial artery 493
B-chromosomes 97
417, 431, 432 Brackish mixture 581
Behavioral isolation 666
685
Index
Bradyrhizobium 347 Cardiovascular disorders 498 Choroids plexuses 422

Brain 417 Cardiovascular system 416, 477 Chromaffin cells 432, 454
Branching evolution 671 Carotid bodies 476, 494 Chromatin 87
Brassica napus 362 Carotid sinus 493 Chromatin assembly factor 1 88
Brassinolide 362 Cartilage 413 Chromatin modification complexes
Brassinosteroids 362 Catabolite gene activator protein 142
Bromeliaceae 362 166 Chromatin remodeling complexes
Bronchi 463 Catabolite repression 166 142, 176
Bronchial tree 463 Catecholamines 455 Chromodomain 91
Bronchioles 463 Cauda equina 426 Chromophore 368
Bronchitis 476 Caudal 224 Chromosomal map 25
Brunner’s glands 505 cDNA library 270 Chromosome 85
Brush border 505 Cecum 506 Chromosome aberrations 59
Brush-border enzymes 505 Cell body 418 Chromosome banding 56
Bulbourethral glands 535 Cell line 316 Chromosome painting 56
Cell-based DNA cloning 235 Chronic obstructive pulmonary
Cell-free DNA cloning 235, 237 disease 476
C Cell-suspension cultures 308

Cellular endosperm 387
Churning movement 512
Chylomicrons 515
CentiMorgan 25 Chyme 502, 512
C complex 150
Central chemoreceptors 476 Chymotrypsin 513
C. elegans 228
Central nervous system 417, 427 Ciliary body 435, 436
Caedobacter taeniospiralis 53
Centromere 85 Ciliary muscle 436
Caenorhabditis elegans 550
Cephalanthus 616 Ciliary zonule 436
CAF1 88
Cephalic phase 504 Cingulate gyrus 426
Cajal bodies 150
Ceratophyllum 615 Circulatory routes 494
Calcitonin 449, 450
Cerebellar cortex 425 Cis-trans test 221
Calcium phosphate crystals 414
Cerebellar hemispheres 425 Citrulline 349
Callus cultures 308
Cerebellum 425 Cladogenesis 671, 672
Calorigenic effect 450
Cerebral aqueduct 422 Classical genetics 1
Calyces 518
Cerebrospinal fluid 421 CLAVATA 395
Campesterol 362
Ceruminous glands 441 Cleavage 546
Canaliculi 414
Cervical nerves 426 Cleavage stimulation factor 147
Cap 0 147
Chaparral biome 585 Cleistogamy 388
Cap 1 147
Character displacement 605 Climacteric 360, 362
Cap 2 147
Chemical evolution 642 Climate 586
Cap binding protein 197
Chemical fertilizers 635 Climatic climax 613
Cap snatching 202
Chemical mutagens 212 Climatic savannas 584
Capacitation 544
Chemical oxygen demand 634 Climatic zone 586
Capillaries 490, 492
Chemical proofreading 201 Climax community 609
Capillary network 436
Chemical transfection techniques Climax pattern theory 613
Capillary water 559
261 Climax stage 616
Capsular hydrostatic pressure 524
Chemoreceptor 476 Clonal propagation 313, 389
Capsule 520
Chemoreceptor reflexes 494 Cloning vectors 246
Carbaminohemoglobin 473
Chemotrophs 565 Closed binary complex 132
Carbohydrates 514
Chenodeoxycholic acid 510 Closed population 590
Carbon cycle 575
Chiasmata 24 Clostridium 576
Carbon dioxide 612
Chief cells 504 Clumped dispersion 588
Carbon dioxide transport 473
Chimera 39 Coacervate 644
Carbon monoxide 630
Chironomus 96 Coat-imposed dormancy 382
Carbonic anhydrase 473
Chlamydomonas 352 Coccygeal nerve 426
Carboxyl terminal domain 136
Chloride shift 474 Cochlea 442
Carboxypolypeptidase 513
Chloroplast genome 84 Cochlear duct 442
Cardia 502
Cholecystokinin 456, 506 Coding strand 130
Cardiac arrest 498
Cholinergic neurons 432 Codominant 8
Cardiac circulation 486
Cholodny-Went hypothesis 381 Codon bias 185
Cardiac conduction system 486
Chondrocytes 413 Coeloblastula 548
Cardiac cycle 489
Chordae tendineae 484 Coevolution 656
Cardiac glycosides 401, 609
Chorioallantoic membrane 549 Cohesins 89
Cardiac muscle tissue 415
Chorioallantoic placenta 549 Cohesive ends 238
Cardiac output 490
Chorionic villi 549 Coincidence 30
Cardiac sphincter 502
Choroid 436 Colchicine 57
Cardioesophageal sphincter 502
686
Index
Colipase 514 Cortisol 454 Cytoplasmic inheritance 50, 51

Collateral ganglia 432 Cortisone 454 Cytoplasmic male sterility 53
Colloid 449 Corynebacterium diphtheriae 203 Cytosine hydrate 211
Colon 506 Cos ends 248
Columnar cells 408 Cos sites 248
Commensalism 602
Commitment complex 150
Cosmopolitan 652
Cot curve 66
D
Common descent 648 Coumarin 399
Dalton’s law 470
Community ecology 558 Coumaryl alcohol 400
Dark period 374
Community gradient 596 Countercurrent exchange 532, 533
Darwin’s finches 649
Community structure 610 Countercurrent exchanger 533
Darwinism 647
Compact bone 414 Countercurrent mechanism 532
Day-neutral plants 373
Comparative anatomy 651 Countercurrent multiplication 532
D-cells 504
Compensatory regeneration 552 Countercurrent multiplier 533
de novo gene origination 80
Competition 603, 612 Coupling 25
de novo methylation 177
Competitive exclusion 604 Covalent histone modifications
Deadenylase 159
Complementary DNA 270 175, 176
Deadenylation independent pathway
Complementary gene interaction 17 CpG islands 178
159
Complementary genes 17 Cranial meninges 421
Deciduous teeth 500
Complementation test 164, 220 Cranial nerves 417, 430
Decomposer 565
Complete linkage 23 Cranial reflex 429
Decomposition 578
Complex multigene families 81 Cranium 421
Degenerate 184
Complex traits 46 Crassinucellate 385
Degenerate primers 273
Complex transposons 70 Cre-loxP recombinant system 121
Deglutition 511
Composite transposons 71 Cretinism 459
Degradosome 159
Condensins 89 Crista ampullaris 444
Dehydroepiandrosterone 454
Conditional mutant 217 Critical day length 373
Delayed ripening 303
Conditional mutations 217 Critical night 374
Deletion 59
Cones 437, 439 Critical period 629
Demography 587
Congestive heart failure 498 Critical photoperiod 373
Denitrification 576
Coniferyl alcohol 400 Critically endangered 621
Dense connective tissue 412
Connective tissue 407, 411 Crossing over 24
Dense irregular connective tissue
Conservation function 623 Crossover hotspot instigator 117
413
Constitutive heterochromatin 93 Cross-pollinated 388
Dense regular connective tissue
Constitutive triple response1 367 Crown 500
413
Consumption efficiency 572 Crown gall 359
Dentin 500
Context dependent codons 184 Crude density 587
Dentitions 500
Contributing allele 46 Cryopreservation 315
Denver system 55
Controlling element 73 Cryptic coloration 609
Deoxycholic acid 510
Conventional pseudogene 83 Cryptochrome 371
Deoxyribonuclease 514
Convergent evolution 656 Cryptorchidism 534
Depurination 210
Cordycepin 134 Crystalline lens 436
Depyrimidination 210
Core histones 87 CsCl buoyant density gradient
Descending colon 507
Corepressor 167 centrifugation 245
Desert biome 584
Cornea 435 ctDNA 84
Destroying angel 136
Cornus 616 Cuboidal cells 408
Determinate organs 309
Corona radiata 544 Culex 603
Determining population size 587
Coronary veins 486 Culture media 319
Detritus 558
Coronary artery disease 498 Cumulus 544
Detritus feeders 565
Coronary heart disease 498 Cupula 444
Detritus food chains 571
Corpora bigemina 425 Cushing’s syndrome 460
Developing follicles 538
Corpora quadrigemina 425 C-value 65
Developmental genetics 222
Corpus luteum 455, 539, 541 C-value paradox 65
Diabetes insipidus 459, 530
Cortical granules 544 Cyanogenic glycosides 401
Diabetes mellitus 459
Cortical nephrons 521 Cybrids 313
Diaphragm 464
Cortical reaction 545 Cyclic AMP receptor protein 166
Diastole 489
Corticoids 454 Cyclobutyl dimer 211
Diastolic blood pressure 493
Corticosteroids 448 Cycloheximide 203
Diastolic pressure 492
Corticosterone 454 Cytidine deaminase 154
Diauxic growth 166
Corticotropin-releasing factor 446 Cytogenetics 55
Dicentric bridge 61
Corticotropin-releasing hormone Cytokinins 307, 359
Dicer 180
446 Cytokinins signaling pathway 365
Dichotomous replication 106
687
Index
Diencephalon 425 Dorsal root 431 Efferent 420

Differential survival 654 Dorsal root ganglion 428, 431 Efferent arteriole 519
Diffuse sources 634 Dorsoventral 225 Egg 538
Digestion 499 Dosage compensation 94 Egg coat 543
Digestive system 416, 499 Double fertilization 386 Egg polarity genes 225
Dihybrid cross 5 Double-strand break model 119 Ejaculatory ducts 535
Dihybrid test cross 7 Down syndrome 58 Elastic cartilage 413
Dimethylallyl pyrophosphate 396 Downstream promoter element 138 Elastic connective tissue 413
Diminishing population 589 Downstream RNA structure 202 Electrical excitability 418
Dinitrogenase reductase 346 Drosha 181 Electrocardiogram 487
Dionaea muscipula 382 Drosophila gynandromorph 38 Electrocardiograph 487
Dipeptidases 513 Drosophila melanogaster 94, 226 Electroporation 259
Diphtheria toxin 203 Duct cells 510 Elongation 106, 134, 193
Diphyodont 500 Ductus deferens 534 Elongation factor 201
Diplospory 390 Ductus epididymis 534 Embryo culture 309
Direct organogenesis 312 Duodenum 505 Embryo dormancy 382
Direct repair 122 Dup 489 Embryo rescue 310
Directional selection 654 Duplicate dominant interaction 18 Embryo sac 385
Disclimax 613 Duplicate recessive epistasis 17 Embryoblast 548
Discoblastula 548 Duplication 59 Embryogenesis 390
Discoidal cleavage 547 Dura mater 421 Embryonic connective tissue
Discontinuous variability 46 Dynamic equilibrium 444 411, 412
Dispersion 588 Dynamic stability hypothesis 570 Embryonic development 543
Displacement replication 114 Emigration 589
Disruptive selection 654 Emmetropic 440
Distal sequence element 137
Distal stomach 503
E Emphysema 476
Emulsification 513
Disturbance 599 Emulsion droplets 513
E complex 150
Divergent evolution 656 Enamel 501
Ear 441
Diversity index 597 Endangered 621
Eardrum 441
D-loop 117 End-diastolic volume 489
Early earth 642
DNA adenine methylase 124 End-modification enzymes 241
Early onset 10
DNA binding domains 141 Endocardium 483
Ecads 563
DNA binding motifs 143, 146 Endocrine glands 410, 444
Ecesis 612
DNA cloning 235 Endocrine system 416, 444
Ecological amplitude 563
DNA cytosine methylase 124 Endoderm 548
Ecological characteristics 597
DNA dependent protein kinase 128 Endolymph 442
Ecological compression 605
DNA glycosylase 122 Endomitosis 96
Ecological equivalents 564
DNA gyrase 103 Endonucleases 237
Ecological factors 558
DNA helicase 102 Endoparasites 603
Ecological isolation 666
DNA ligase 108 Endo-siRNA 182
Ecological mortality 587
DNA methylation 177 Endosperm 387
Ecological pyramid 573
DNA methyltransferase 177 Endosymbiont 53
Ecological species concept 563
DNA photolyase 122 Endosymbiotic theory 84
Ecology 557
DNA polymerase 103, 237 Endothelial cells 422
Ecospecies 563
DNA polymerase I 237 Endothermy 562
Ecosystem 557
DNA purification 244 End-systolic volume 489
Ecosystem components 565
DNA repair 122 Energy flow 568
Ecosystem concept 565
DNA replicases 104 Energy flow model 571
Ecosystem diversity 617
DNA replication 97 Engrailed 226
Ecosystem function 566
DNA synthesis 273 Enhancers 141, 142
Ecosystem services 618
DNA topoisomerase 102 Entamoeba histolytica 603
Ecotone 596
Dolly 294 Enteric nervous system 417, 516
Ecotype 563
Dominant allele 2 Enterochromaffin cells 504
Ectoderm 548
Dominant epistasis 16 Enterocytes 505
Ectoparasites 603
Dominant suppression 18 Enteroendocrine cells 456, 504, 506
Edaphic climax 613
Dominants 597 Enterokinase 513
Edaphic savannas 584
Dopamine 446 Environment 558
Edge effect 596
Dormin 360 Environmental factors 558
Edge species 596
Dorsal 225, 427 Environmental pollution 629
Editosome 155
Dorsal horn 427 Environmental resistance 591
Edward’s syndrome 58
Dorsal respiratory group 475 Eon 676
Effective population size 664
688
Index
Eosinophil 479 Exophthalmos 460 Flap endonuclease 109

Ependymal cells 421, 422 Exo-siRNA 182 Flatulence 514
Ephemeral annuals 561 Exosome 159 Flatus 514
Epicardium 483 Expanding population 589 Flavonoids 400
Epididymis 534 Expansins 356 Flavoproteins 371
Epigeal germination 383 Expiration 461, 466 Flexor motor cells 382
Epigenetics 182 Expiratory capacity 468 Floating stage 616
Epilimnion 581 Expiratory neurons 475 Floral meristem identity 376
Epimorphosis 551 Expiratory reserve volume 467 Floral meristems 394
Epinephrine 454 Exponential growth 590 Florigen 375
Epiphysis 449 Expression platform 171 Flowering genes 376
Epistasis 15 Expression vectors 246 FLP recombinase target 121
Epithalamus 425 Expressivity 10 FLP-FRT system 121
Epithelial tissue 407 Ex-situ 622 Fluctuation test 218
Epithelium 407 Ex-situ conservation 622 Folding 268
Epoch 676 Exteins 204 Follicle cells 537
Equilibrium species 599 Extensor motor cells 382 Follicle stimulating hormone
Equivalence group 228 External anal sphincter 507 445, 447, 535
Era 676 External intercostal muscles 465 Follicular cells 449, 544
Error-prone DNA polymerase 129 External nares 462 Follicular phase 541
Error-prone repair 129 External nose 462 Food 499
Erythrocytes 478 External urethral sphincter 530 Food chains 570
Erythromycin 203 Extinct 620 Food web 571
Erythropoietin 456 Extracellular matrix 411 Foramen magnum 426
Esophageal cardiac glands 502 Extraembryonic coelom 549 Formed elements 478
Esophageal gland proper 502 Extraembryonic endoderm 548 Fosmids 250
Esophagus 502 Extraembryonic membranes 548 Fossa ovalis 483
Estrogen 448, 455 Extraglomerular mesangial cells Fossil record 652
Estuary 580 522 Founder effect 670
Ethanol precipitation 245 Extranuclear 50 Fovea centralis 437
Ethidium bromide 213 Extrinsic nerves 516 Frameshift mutation 208
Ethyl methane sulfonate 213 Extrinsic pathway 481 Freshwater ecosystem 581
Ethylene 307, 362 Eye 435 Freshwater estuaries 581
Ethylene signaling pathway 367 Eyelashes 438 Fritillaria 386
Euchromatin 92 Eyelids 438 Frogs 616
Euglena 616 Functional hemizygosity 178
Eukaryotic chromatin 85 Functional residual capacity 468
Eukaryotic expression systems 268
Eukaryotic mRNA 159
F Fundamental niche 564
Fundus 502
Eukaryotic promoter 137 Fusarium fujikuroi 356
Facilitated diffusion 514
Eukaryotic transcription 136 Fusidic acid 203
Facilitation model 614
Eukaryotic transposons 72
Facultative heterochromatin 93
Eupagurus predeauxi 602
Facultative mutualism 602
Euploidy 57
Eusocial insects 627
Fats 512 G
Feeding level 569
Eustachian 441
Female gamete 543
Euthyroidism 460
Female gametophyte 385 GA insensitive dwarf1 365
Eutrophic lakes 635
Female reproductive cycle 540 GAL1 142
Eutrophication 635
Female reproductive system 537 Gal4 142
Evenness 617
Ferredoxin 347 Galapagos Islands 649
Evolutionary genetics 1
Fertilization 386, 543 Gallbladder 509
Evolutionary species concept 665
Fibrinogen 481 Gallstones 510
Ex situ bioremediation 636
Fibroblast growth factor 8 551 Gametophyte generation 385
Ex vivo gene transfer 296
Fibrocartilage 413 Gametophytic self-incompatibility
Excision repair 122
Fibrous pericardium 483 388
Excretory System 517
Fibrous tunic 435 Gamma diversity 617
Exit site 200
Filial imprinting 629 Ganglia 417, 418
Exocrine cells 503
Filter sterilization 307 Ganglion 428
Exocrine glands 410, 444
Finite cell line 316 Ganglion cells 437
Exon junction complex 160
First division segregation 32 Gap genes 225
Exons 78
Fisher-Wright population 664 Gaseous nutrient 574
Exonucleases 237
Flagship species 623
689
Index
Gastric glands 503

Gastric inhibitory peptide 456, 506
Glisson’s capsule 508
Global warming 631
H
Gastric juice 504 Globular stage 391
Habitat 563, 564
Gastric lipase 512 Globulins 478
Haemophilus influenzae 238
Gastric phase 504, 505 Glomerular capillaries 520
Hair bundle 444
Gastric pits 503 Glomerular filtration 523
Hair cells 444
Gastrin 456, 506 Glomerular filtration rate 523
Haldane effect 474
Gastro-esophageal sphincter 512 Glomerular hydrostatic pressure
Haldane’s rule 666
Gastrointestinal hormones 516 524
Hamilton’s rule 625
Gastrointestinal motility 507 Glomerulus 519, 520
Handicap theory 655
Gastrointestinal tract 456, 499 Glossina 603
Haplodiploid 627
Gastrula 548 Glottis. 462
Haplodiplontic 383
Gastrulation 548 Glucagon 451
Haploid culture 310
G-cells 504 Glucocorticoids 454
Haustral churning 516
Geitonogamy 388 Gluconeogenesis 452
Heart 456, 483
Gene 77 Glucose transporter 452
Heart attack 486, 498
Gene conversion 120 Glyceraldehyde-3-phosphate 397
Heart beat 487
Gene delivery system 296 Glycogenesis 452
Heart failure 498
Gene families 81 Glycogenolysis 452
Heart sounds 489
Gene interaction 14 Glycosides 401
Hedgehog 226
Gene mapping 21 Glycosuria 531
Hekistotherms 560
Gene order 29 Glyphosate 302
Helicase activities 117
Gene phylogeny 676 Goblet cells 408, 503, 505
Helicotrema 442
Gene-one polypeptide 77 Goiter 460
Helix-loop-helix motif 144
General recombination 115 Golden rice 302
Helix-turn-helix motif 144
General transcription factor 139 Gonadal hormone 455
Helobial endosperm 387
Generative apospory 390 Gonadotropin-releasing hormone
Helper phage 251
Genetic bottlenecks 670 445
Hematocrit 478
Genetic code 184 Gonadotropins 448
Hemizygous 40
Genetic diversity 617 Gonads 455, 457
Hemoglobin 471
Genetic drift 663, 669 Graafian follicles 455
Hemolytic jaundice 510
Genetic linkage 21 Gradients 618
Hemophilia 482
Genetic load 663 Gradualism 648
Hemopoiesis 478
Genetic map 280 Granular leukocytes 479
Henry’s law 470
Genetic mapping 25 Grassland ecosystems 579
Hepatic lobule 508
Genome 65 Gratuitous inducer 163
Hepatic portal 494
Genome complexity 66 Graves’ disease 460
Hepatic portal circulation 496
Genome organization 65 Gravitational equilibrium 444
Hepato-pancreatic duct 505
Genomic imprinting 178 Gravitational water 559
Hepatopancreatic sphincter 509
Genomic library 269 Gravitropism 380
Herbicidal resistance 302
Genotype 3 Green cones 439
Hereditary mutations 214
Genotypic-frequency equilibrium Greenhouse effect 631
Heredity 1
659 Greenhouse gases 631
Heritability 50
Geographic isolation 667 Gross primary productivity 566
Heterochromatin 92
Geological time scale 676 Gross reproductive rate 593
Heterocysts 347
Geometric growth 590 Ground finches 649
Heteroduplex model 115
Geranylpyrophosphate 396 Ground meristem 391
Heterogametic sex 36
Germ layers 548 Ground substance 411
Heterotrophic 596
Germinal epithelium 537 Group II introns 155
Heterotrophic succession 612
Germinal mutation 214 Group selection 627
Heterotrophs 565
Germination 382 Growth cycle 318
Heterozygous 2
Germ-line 295 Growth hormone 447
High blood pressure 493
Germline mosaicism 39 Growth hormone-inhibiting hormone
Highly concave curve 588
Giant chromosomes 96 446
Highly convex curve 588
Gibberella fujikuroi 356 Growth hormone-releasing hormone
Highly repetitive DNA sequences 67
Gibberellic acid pathway 377 446
Hippocampus 426
Gibberellin pathways 377 G-tetraplex 87
HIRs 370, 371
Gibberellin signaling pathway 364 Guide RNA 155
Histidine kinase 365
Gibberellins 356 Gynogenesis 311
Histone acetyl transferases 91, 176
Gigantism 459 Gyraulus 616
Histone acetylases 91
Glandular epithelium 407, 410
Histone chaperones 88
Glial cells 418, 420
Histone modification 91
690
Index
Histone tails 91 Hyperthyroidism 460 Insulin 451

Histones 87 Hypocalcemia 460 Integration host factor 120
Holliday structure 116 Hypodermal cells 228 Intein homing 206
Holoblastic 546 Hypogeal germination 383 Inteins 204
Holoblastic cleavage 547 Hypolimnion 582 Inter-atrial septum 483
Holocentric 86 Hypoparathyroidism 460 Interbands 96
Holocrine glands 411 Hypopharynx 462 Intercalary meristem 357
Holometabolous 222 Hypophysis 391, 447 Intercalated discs 415
Homeobox 227 Hypothalamus 425, 445 Intercalating agents 213
Homeodomain 144, 227 Hypothyroidism 459 Interference 30
Homeostasis 561 Interlobular arteries 518
Homeothermy 562 Intermediate disturbance hypothesis
Homeotic genes 223
Homeotic selector genes 226
I 599
Intermediate hosts 603
Homing 157 Internal anal sphincter 507
Idiogram 55
Homo sapiens 105 Internal branches 675
Ileocecal sphincter 505
Homogametic sex 36 Internal ear 442
Ileocecal valve 515
Homologous 2 Internal nose 462
Image formation 440
Homologous end joining 128 Internal ribosomal entry site 193
Immigration 589, 599
Homologous gene 82 Interneurons 420
Immobilization 578
Homologous recombination 115 Intersexual selection 628
Immunity 174
Homologous structures 651 Interspecific 612
Imprint control elements 178
Homology 651 Interspecific competition 603
Imprinting 629
Homoplasy 651, 656 Interspecific incompatibility 388
In vitro 88
Homopolymer tailing 241 Interstitial cell stimulating hormone
In vivo gene transfer 296
Homozygous 2 448
Inbreeding 662
Homozygous state 2 Interstitial cells 534
Inbreeding coefficient 662
Hormonal regulation 487 Interstitial cell-stimulating hormone
Inbreeding depression 663
Hormonal signaling 444 535
Inclusive fitness 625
Hormone balance theory 361 Interstitial fluid 497, 498
Incomplete dominance 7
Hormone-releasing factor 446 Inter-tidal zone 580
Incomplete linkage 23
Hormones 539 Interventricular foramina 422
Independent events 11
Hormones control 535 Interventricular septum 484
Indeterminate organs 309
Hormones signaling pathway 363 Intestinal juice 505
Indirect organogenesis 312
Hot hydrothermal vents 580 Intestinal phase 504, 505
Individual organism 557
Hotspots 623 Intestine 457
Indole 516
Housekeeping genes 160 Intracellular fluid 498
Inducible operon 162
Human genome project 83 Intragenic suppressor 215
Industrial melanism 653
Human karyotype 55 Intrapleural fluid 464
Inhibin 455, 535
Human nuclear genome 83 Intrapleural pressure 467
Inhibiting hormones 445, 447
Humus 558 Intrapulmonary 467
Inhibition model 614
Hunchback gene 224 Intrasexual selection 628
Initial complex 105
Hyaline cartilage 413 Intraspecific 612
Initiating tRNA 194
Hybrid dysgenesis 72 Intraspecific competition 604
Initiation 105, 132, 193
Hybrid inviability 666 Intraspecific incompatibility 388
Initiator sequence 138
Hybrid sterility 666 Intrinsic nerve plexuses 516
Innate 629
Hybrid zones 667 Intrinsic pathway 481
Inner cell mass 548
Hybridization 668 Intrinsic terminators 135
Inner cellular layer 413
Hybridization experiments 1 Intron splicing 148
Inner ear 441
Hydrarch 615 Introns 78
Insecticidal resistance 301
Hydrilla 615 Invasive species 619
Insertion λ vectors 248
Hydrogen sulfide 516 Inverse PCR 275
Insertion mutations 210
Hydrolyzable tannins 401 Inversions 60
Insertion sequences 70
Hydroxylamine 213 Inverted repeat 70
Insertion-deletion editing 154
Hygroscopic water 559 Inward-rectifying 361
In-situ 622
Hyper volume niche 564 Ionizing radiation 211
In-situ conservation strategies 622
Hypercalcemia 460 Ionosphere 559
Inspiration 461, 465
Hyperkalemia 488 Iron regulatory protein 179
Inspiratory capacity 468
Hypermetropia 440, 441 Iron-responsive element 179
Inspiratory muscles 465
Hyperparathyroidism 460 IS element 70
Inspiratory neurons 475
Hyperpolarization 440 Island biogeography 599
Inspiratory reserve volume 467
Hypersecretion 460 Isoaccepting tRNAs 190
Insulator 143
691
Index
Isocaudomers 239 Large intestine 506 Logistic growth 591

Isochromosome 64 Lariat structure 149, 157 Long day plants 373
Isopentenyladenine 359 Laryngopharynx 462, 502 Long interspersed nuclear elements
Isoprene rule 396 Larynx 462 75
Isoschizomers 239 Late onset 10 Long terminal repeats 74
Isovolumetric contraction 489 Lateral lobes 449 Long-range regulatory elements
Isovolumetric relaxation 489 Lateral ventricles 422 142
Isthmus 449, 539 Lateral white columns 427 Loose connective tissue 412
Iteroparous 588 Lathyrus odoratus 14 Lotic 579
IUCN 620 Lazzaro Spallanzani 641 Lotic ecosystem 581
Leading strand 107 Lotka-Volterra model 606
Left atrioventricular valve 484 Lower esophageal sphincter 502
J Left atrium 484

Left pulmonary artery 495
Lub 489
Lumbar nerves 426
Left ventricle 484 Luteinizing hormone
Jaundice 510
Leghemoglobin 347, 349 445, 447, 448, 535
Juxtaglomerular apparatus 522
Lentic 579 Lymnaea peregra 53
Juxtaglomerular cells 522, 525
Lentic ecosystem 581 Lymnea 616
Juxtamedullary nephrons 521, 532
Lesser sublingual ducts 508 Lymph 497
Lethal alleles 10 Lymphatic system 497, 498
Leucine zipper 146 Lymphatic vessels 497
K Leucine zipper motif 144 Lymphocytes 479
Leucopenia 480 Lyon hypothesis 94
Kappa particles 53 Leukocytes 478 Lysogenic cycles 172
Karyotype 55 Leukocytosis 480 Lysogenic pathway 172, 248
Keystone species 597 LexA repressor 128 Lysogenic state 172, 173
Kidney 456, 517 Leydig cells 37, 536 Lytic cycle 172
Kin selection 627 LFRs 370 Lytic pathway 248
Kinetic complexity 67 Life table 587, 592
Kinetic proofreading 201 Ligases 243
Kinetin 359
Kinetochore 85
Light 560
Lightning discharges 643
M
Kinocilium 444 Lignins 400
M. genitalium 78
Klenow fragment 104 Limbic system 425, 426
Macacus rhesus 9
Klinefelter syndrome 59 Limenitis archippus 609
Macroevolution 671, 672
Knirps 225 Limnetic zone 581
Macromeres 547
Kozak sequence 193 Limnology. 581
Macrophages 479
Krüppel 225 Linear tetrad 31
Macula densa 525
K-strategists 594 Lingual glands 501, 512
Macula densa cells 522
Kupffer cells 509 Lingual lipase 501, 512
Macula lutea 437
Kyoto Protocol 632 Lining epithelium 407
MADS box 379
Linkage equilibrium 662
Major groove 162
Linkage group 26
Major pseudoautosomal region 36
L Linkage map 25
Linked genes 22
Male gamete 543
Male reproductive system 534
Labial 226 Linker 243
Maltase 513
Lac operator 161 Linker DNA 88
Malus sylvestris 358
Lac repressor 162 Linker histone 88
Map unit 25
Lac structural genes 161 Lipids 515
Marine ecosystem 579
Lacrimal gland 438 Lipid-soluble hormones 445
Mark-recapture technique 587
Lactase 513 Lipofection 261
Marsh 583
Lactone 363 Lipogenesis 452
Mass extinction 620
Lactose 161 Lipolysis 452
Mass peristalsis 516
Lactose intolerance 513 Liposome encapsidation 259
Mast cells 479
Lactose operon 161 Liposomes 261
Master plate 219
Lactuca sativa 383 Liquid connective tissue 414
Mastication 511
Lacunae 414 Lithocholic acid 510
Mate competition 655
Lag phase 319 Littoral zone 581
Maternal effect genes 223
Lagging strand 107 Liver 508
Maternal inheritance 51, 52, 53
Lamarckism 646 Living biomass 558
Maternal mRNAs 223
Lamellae 414 Locus control region 143
Mating behaviour 627
Lampbrush chromosomes 96 Log phase 319
Mating systems 627
692
Index
Mature connective tissue 411, 412 Mimicry 609 Muscular tissue 407, 415
Maximum carrying capacity 592 Mimosa 381, 382 Muscularis propria 499
Maximum natality 587 Mineral particles 558 Mutagen 211
McClintock’s experiments 73 Mineralocorticoids 454 Mutagenesis 206
Mechanical isolation 666 Mini-chromosome maintenance 101 Mutant 206
Mechanoreceptors 443, 444 Minimum mortality 587 Mutant alleles 2
Mediator 141 Minisatellites 68 Mutation 206, 670
Medulla oblongata 425, 476 Mirabilis jalapa 7, 51 Mutualism 602
Medullary collecting duct 528 miRNA 182 Mutually exclusive events 11
Medullary rhythmicity center 475 Mirtrons 181 Mycobacterium 477
Megakaryocyte 480 Mismatch repair 124 Mycobacterium tuberculosis 477
Megasporogenesis 384 Mitochondrial genome 84 Mycoplasma 65
Megatherms 560 Mitral valve 484 Mycoplasma genitalium 80
Melandrium album 39 Mixed nerve 426 Myelin sheath 421
Melanocyte-stimulating hormones Mixed-function oxidase 220 Myelination 421
448 Mixing contractions 507 Myenteric plexus 516
Melatonin 449 Mixing waves 512 Myocardial infarction 486
Melting temperature 273 Moderately repetitive DNA Myocardium 483
Membranous labyrinth 442 sequences 67 Myogenic 487
Mendel’s experiment 1 Molecular clock 673 Myogenic constriction 525
Mendel’s laws 1 Molecular genetics 1, 65 Myometrium 539
Mendel’s principles 1 Molecular phylogeny 672 Myopia 440
Mendelian characters 2 Molybdenum-iron protein 347 Myxedema 459
Menopause 541 Monocarpy 588
Menstrual phase 541 Monocentric 86
Meristem 376
Meroblastic 547
Monoclimax theory 613
Monocolpate pollen 384
N
Merocrine glands 411 Monocytes 479
Nanos 224
Merozygotes 164 Monogamous 627
NAP1 88
Meselson-Radding modification 116 Monohybrid cross 3
Narrow-sense heritability 50
Mesenchyme 412 Monolignols 400
Nasal cavity 462
Mesoderm 548 Monoploid 57
Nasopharynx 462, 502
Mesosphere 559 Monopteros 392
Nastic movements 381
Mesotherms 560 Monorepliconic 99
Natality 587
Mesotrophic lakes 635 Monosiphonous 386
Natural ecosystem 579
Metalimnion 581 Monosporic 385
Natural extinction 620
Metaphase chromosomes 89 Monosynaptic reflex 429
Natural media 319
Metapopulation 594 Montreal protocol 633
Natural selection
Methyl methane sulfonate 213 Morgan’s work 24
648, 653, 663, 669
Methylation 91 Morphallaxis 550
Nature of sequences 273
Methyl-CpG binding domain 178 Morphological species concept 665
Near threatened 621
Microclimate 586 Mortality 587
Neck 500
Micrococcal nuclease 88 Mosaic 290
Negative allelopathy 604
Microevolution 671 Mosaicism 39, 58
Negative interaction 603
Microglia 421 Motor nerves 430
Negative regulation 160
Microinjection 262 Motor neurons 420
Negative regulator 162, 163
Micromeres 547 Mouth 500
Negative selection 669
Microprocessor 181 mRNA degradation 159
Neo-Darwinism 649
Micropropagation 313 mRNA surveillance 160
Neoschizomers 239
Microsatellites 68 Mu particles 53
Nephrogenic diabetes insipidus 459
Microsphere 644 Mucosa 499
Nephron 520
Microspore mother cell 384 Mucous connective tissue 412
Neritic zone 580
Microspore tetrads 384 Mucous neck cells 503
Nervous regulation 487
Microsporogenesis 384 Müllerian mimicry 609
Nervous system 416
Microtherms 560 Multicellular glands 410
Nervous tissue 407, 414
Microvilli 408 Multifurcating node 675
Nested PCR 275
Micturition 530 Multiple alleles 8, 661
Net community productivity 566
Micturition reflex 530 Multiple cloning site 246
Net filtration pressure 524
Midbrain 425 Multipolar neuron 419
Net reproductive rate 593
Middle ear 441 Multirepliconic 99
Neuroendocrine 445
Migration 589 Multistep phosphorelay system 365
Neuroglia 420
Miller-Urey experiment 643 Mung bean nuclease 237
Neurohormone 445
693
Index
Neurohypophysis 447 Null genes 138 Oxygen-hemoglobin dissociation

Neurolemma 421 Nutrient cycling 574 curve 472
Neurons 418 Nyctinasty 381 Oxyhemoglobin 472
Neurospora metabolism 77 Oxytocin 448
Neutral mutation 217
Neutrophil 479
O
Newt anterior gradient protein 551
Niche 563
P
Obligate mutualism 602
Niche overlap 564
Obligatory water reabsorption 527 P element 257
Niche width 564
Obstructive jaundice 510 P wave 487
Nicotiana glauca 312
Occipital lobes 424 Pacemaker 486
Nicotiana sylvestries 375
Ochre codon 200 Pair-rule genes 226
Night break 374
Octad 31 Pancreas 450, 457, 510
Nissl bodies 418
Octant stage globular embryo 391 Pancreatic amylase 511, 513
Nitrification 576
Oils 512 Pancreatic islet disorders 459
Nitrogen cycle 576
Okazaki fragments 107 Pancreatic juice 510
Nitrogen mustard gas 213
Oligodendrocytes 421 Pancreatic lipase 511, 513
Nitrogenase complex 346
Oligotrophic lakes 635 Pancreatic nuclease 511
Nitrosoguanidine 213
Omnivores 569 Panmictic population 662
Nod factors 348
Oogonia 537 Paracentric 60
Nodulation factors 348
Opal codon 200 Parafollicular cells 449, 450
Nomenclature 238
Open complex 105, 133 Parallel evolution 656
Non-autonomous controlling
Open population 590 Paralogous 82
element 73
Open reading frame 189, 202 Paramecium 616
Nonciliated 408
Operon model 160 Paramecium aurelia 53
Nonclimacteric 362
Ophthalmoscope 437 Paramicin 53
Noncoding RNA 183
Opsin 439 Parapatric speciation 668
Non-composite transposons 72
Optic disc 437 Paraplegia 429
Nondisjunction 58
Optic nerve 437 Parasite 566
Non-histone 87
Optimal foraging theory 628 Parasitism 603
Non-homologous 128
Organ culture 309 Parasitoid 603
Nonoverlapping 184
Organ system 407 Parasympathetic divisions 432
Non-parental ditype 34
Organelle genome 84 Parasympathetic nervous system
Nonrecurrent apomixis 390
Organic matter 558 417
Nonrepetitive DNA 67
Organogenesis 312, 548 Parasympathetic preganglionic nerve
Nonsense mediated decay 160
Origin recognition complex 100 fibers 432
Nonsense mediated mRNA decay
Orobanchol 363 Parathyroid gland 450
160
Oropharynx 462, 502 Parathyroid gland disorders 460
Nonsense mutation 217
Orthologous 82 Parathyroid hormone 450
Nonsense suppression 215
Osmolality 533 Parathyroid tetany 460
Nonstop mediated decay 160
Osmolarity 533 Parenchyma 518
Nonstop mediated mRNA decay 160
Osmoles 533 Parental ditype 34
Nonviral retrotransposons 75
Osmotroph 566 Parental imprinting 178
Noradrenaline 432
Osteoblasts 413 Parental investment 628
Noradrenergic 432
Osteoid 413 Parental type 23
Norepinephrine 432, 454, 524
Otolith organs 444 Parietal cells 504
Normal distribution 48
Otolithic membrane 444 Parietal lobes 424
Norman Myers 623
Otoliths 444 Parotid glands 508, 512
Nose 462
Outbreeding 662 Parthenocarpy 356
Nostrils 462
Outer ear 441 Partial diploids 164
Nuclear endosperm 387
Outer fibrous layer 413 Partial pressure 470
Nuclear receptor family 458
Oval window 442 Particle bombardment 260, 262
Nuclear receptors 458
Ovarian cycle 540 Particulate matter 630
Nuclear RNA polymerases 136
Ovarian medulla 537 Passive process 466
Nuclease 117, 237
Ovaries 537 Patau’s syndrome 58
Nucleosidases 514
Overexploitation 619 Paternal inheritance 51, 52
Nucleosome 87
Overhanging ends 238 Pedigree analysis 42
Nucleosome assembly protein 1 88
Ovulation 448 Pedology 558
Nucleosome remodeling 175, 176
Ovulatory phase 541 Pelagic zone 580
Nucleotide excision repair 123
Oxidative damage 210 P-element 72
Nudation 612
Oxidizing smog 630 Penetrance 10
Nulcear transfer technology
Oxygen transport 471 Pepsin 512
294, 295
694
Index
Peptic ulcer 504 Phototropism 380 Poly-A tail 147

Peptide hormones 445 Phyletic evolution 671 Poly-adenylate-binding protein 147
Peptidyl transferase 198 Phyletic gradualism 672 Polyadenylation 147
Pericardial cavity 483 Phylogenetic species concept 665 Polyadenylation specificity factor
Pericardial fluid 483 Phylogenetic tree 675 147
Pericardium 483 Physa 616 Polyclimax theory 613
Pericentric 60 Physical agent 211 Polycythemia 478
Perichondrium 413 Physical dryness 561 Polygenic traits 46
Perikaryon 418 Physical factors 565 Polygonum 385
Perilymph 442 Physical maps 280 Polylinker site 247
Period 676 Physiognomy 601 Polymerase switching 105
Periodicity 601 Physiological dryness 561 Polymorphic 653
Peripheral arterial disease 498 Physiological effects Polymorphonuclear leukocytes 479
Peripheral axon 420 357, 359, 361, 362 Polynucleotide kinase 159
Peripheral chemoreceptors 476 Phytochrome 368 Polynucleotide phosphorylase 185
Peripheral nervous system Phytochrome response 370 Polypyrimidine tract 149
417, 430 Phytochromobilin 368 Polysiphonous 386
Peristalsis 507, 516 Phytohormone 254, 352 Polyspermy 546
Peristaltic wave 502 Polysynaptic reflex 429
Peritubular capillaries 519, 520 Phytoplankton stage 615 Polytene chromosomes 90, 96
Peritubular venules 520 Phytoremediation 637 Pons 425
Permanent parasites 603 Phytostabilization 637 Population 557
Permanent teeth 500 Pia mater 421 Population characteristics 587
Pernicious anemia 504 Pielou’s evenness index 599 Population density 587
Petite 52 PIN auxin efflux carriers proteins Population dispersal 589
Phagemid vectors 251 355 Population ecology 586
Phagotroph 566 Pineal gland 449, 457 Population genetics 657
Phalaris canariensis 352 Pinealocytes 449 Population growth 590
Pharynx 462, 502 piRNA 182 Population regulation 592
Phenetic species concept 665 Pisum sativum 1, 3 Populus 616
Phenocopy 10 Pituitary dwarfism 459 Portal system 492
Phenolics 398 Pituitary gland 447, 457 Portal vein 492
Phenology 601 Pituitary gland disorders 459 Position effect 64
Phenotype 3 Placenta 456, 548 Position effect variegation 64
Phenylalanine ammonia lyase 399 Plagiogravitropic 380 Positive allelopathy 604
Phenylpropanoids 399 Plant development 383 Positive assortative 662
Phlebotomus 603 Plant germplasm conservation 315 Positive gravitropism 380
Phloem loading 351 Plant hormones 352 Positive interaction 602
Phloem unloading 351 Plant secondary metabolites 396 Positive regulation 160, 166
Phosphatase 159, 514 Plants movements 379 Positive selection 669
Phosphodiesterase 159 Plaque hybridization 272 Post transcriptional gene silencing
Phospholipase 514 Plasma proteins 478 180
Phosphorus cycle 576 Plasmid purification 245 Posterior chamber 437
Phosphorylation 92 Plateau phase 319 Posterior pituitary 448
Phot1 372 Platelets 478, 480 Posterior root ganglion 428
Phot2 372 Pleiotropy 21 Posterior segment 437
Photochemical oxidants 630 Pleural cavity 464 Postganglionic neuron 432
Photochemical smog 630 Ploidy 57 Post-replication repair 125
Photolyase 371 Pneumonia 477 Post-transcriptional 375
Photomorphogenesis 368 Pneumotaxic center 475 Potamogeton 615
Photonasty 381 Poikilothermic animals 562 PR interval 488
Photoperiodic pathway 377 Poikilothermy 562 PR segment 488
Photoperiodism 373 Point mutation 208 Prebiotic times 644
Photopigments 439 Polar mutation 70 Predation 608
Photopsins 439 Polar nuclei 385 Predator efficiency 608
Photoreactivation 122 Pollen culture 310 Preganglionic neuron 432
Photoreceptor cells 438 Pollen grains 384 Pregnancy hormone 455
Photosynthesis 565 Pollen mother cell 384 Pre-initiation complex 197
Photosynthetically active radiation Pollination 388 Preproinsulin 451
560, 569 Pollutant 629 Preprosomatostatin 446
Phototransduction 439 Poly(A) binding protein 197 Pre-spliceosome complex 150
Phototropin 372 Poly(A) polymerase 147 Pressure 467
695
Index
Prevertebral ganglia 432 Proteolytic cleavage 204 Radioactive pollutants 636

Prezygotic isolating mechanisms Proteolytic enzymes 511 Random dispersion 588
666 Prothrombinase 481 Random mating 662
Pribnow box 131, 132 Protocells 644 Raphanobrassica 58
Primary active transport 526 Protocooperation 602 Rapid ventricular depolarization 488
Primary bile acids 510 Protoderm 391 Reaction 612, 613
Primary bronchi 463 Protoplast 309 Reading frames 189
Primary cultures 316 Protoplast fusion 261 Realized niche 564
Primary endosperm nucleus 387 Provirus 74 RecBCD enzyme 117
Primary hypertension 493 Proximal centriole 546 Recessive allele 2
Primary metabolites 396 Proximal sequence element 137 Recessive epistasis 17
Primary oocytes 537 Proximal stomach 503 Reciprocal altruism 627
Primary parietal cell 385 Proximal tubule 528 Reciprocal cross 40
Primary productivity 566 Pseudoautosomal region 36 Recognition helix 144
Primary RNA transcript 78 Pseudodominance 40 Recognition sequence 238
Primary sporogenous cell 385 Pseudogenes 80, 82 Recombinant DNA technology 235
Primary succession 611 Pseudoknot 202 Recombinant type 23
Primary transcript 130 Pseudostratified columnar Recombination 114
Primase 102 epithelium 409 Recombinational repair
Primer annealing 273 Pseudostratified epithelium 408 125, 128, 130
Primer design 273 Pseudounipolar neurons 419 Rectum 506
Primer length 273 P-site 195 Recurrent apomixis 390
Primeval soup 642 Ptyalin 512 Red blood cells 478
Primordial follicle 537 Puffs 96 Red bone marrow 478
Primosome 102 Pulmonary circulation 485, 495 Red list category 620
Pro-anthocyanidins 401 Pulmonary gas exchange 461, 470 Red Queen hypothesis 657
Probability 10 Pulmonary trunk 484, 486, 495 Reduced height 365
Proboscipedia 226 Pulmonary valve 484 Reducing smog 630
Procambium 391 Pulmonary veins 484, 496 Reed–Swamp stage 616
Processed pseudogene 83 Pulmonary ventilation 465 Reflex 429
Procolipase 514 Pulp 501 Reflex arc 429
Producers 565 Pulp cavity 501 Refraction abnormalities 440
Production efficiency 572 Pulse pressure 492 Regeneration 550
Productivity 566 Pulvinus 382 Regeneration blastema 551
Proelastase 513 Punctuated equilibrium 672 Regional diversity 617
Proflavin 213 Punnett squares 3 Regular dispersion 588
Profundal zone 581 Pupil 436 Regulatory transcription factors 139
Progesterone 448, 455 Purkinje fibers 487 Relaxation period 489
Progressive succession 612 Puromycin 203 Relaxed plasmids 247
Project Tiger 623 Pyloric sphincter 503 Relaxin 455
Prokaryotes 158 Pylorus 502 Releasing hormones 445, 447
Prokaryotic mRNA 159 Pyrimidine dimer 122, 211 Renal capsule 518
Prokaryotic promoter 131, 132 Pyrophosphatase 106 Renal columns 518
Prokaryotic transcription 130 Pyrrhocoris apterus 35 Renal corpuscle 520
Prolactin 448 Renal cortex 518
Prolactin-inhibiting hormone 446 Renal medulla 518
Proliferating cell nuclear antigen
105
Q Renal pelvis 518
Renal pyramids 518
Proliferative phase 541 Renal tubule 520
QRS complex 488
Pronuclear microinjection 290 Renaturation kinetics 66
QT interval 488
Proofreading 111, 201 Renin 456, 529
Quadriplegia 429
Prophage 172 Renin–angiotensin–aldosterone
Quantitative inheritance 46
Propulsive movements 507 system 454
Quantitative trait locus analysis 49
Prosomatostatin 446 Repetitive DNA 67
Quantitative traits 46
Prostate glands 535 Repetitive sequences 67
Queen hypothesis 657
Protamine 88, 543 Replacement λ vectors 249
Quiescent center 391, 393
Protein bodies 358 Replica plating experiment 219
Protein fibers 411 Replication factor C 105
Protein hormones 445 Replication fork 101
Protein splicing 204 R Replicative transposition 70
Protein synthesis 188 Replicon 99
Proteinoids 644 Radial patterning 390 Reproductive cloning 294
Proteins 515 Radiant energy 612 Reproductive fitness 626
696
Index
Reproductive isolation 665 RNA processing 146 Seed sequence 182

Reproductive potential 592 RNA replicases 131 Segment polarity genes 226
Reproductive system 534 RNA splicing 148 Segmental arteries 518
Residual volume 467 RNA-dependent RNA polymerase Segmentation 507
Resilience 596 131 Segmentation genes 223, 225
Resistance 596 RNase A 237 Seismonasty 381, 382
Respiration 461 RNase H 237 Selectable marker 252, 263
Respiration defective mitochondrial RNase mechanism 388 Selection system 247
mutant 52 Robertsonian translocation 58, 62 Selective amplification 272
Respiratory bronchioles 463 Rods 438, 439 Selenocysteine insertion sequence
Respiratory organs 461 Rolling circle replication 113 202
Respiratory system 416, 461 Root apical meristems 393 Selfish DNA 69
Response regulator 365 Root canals 501 Self-pollinated 388
Restriction endonuclease 238 Roots 500 Semelparous 588
Restriction enzyme 238 Rotational equilibrium 444 Semicircular canals 444
Restriction fragment length rRNA 191 Semiconservative replication 97
polymorphisms 49, 281 R-strategists 594 Semi-discontinuous replication 108
Restriction mapping 285 Semilethal 10
Restriction sites 238 Semilunar valves 484
Restriction–modification system
240
S Seminal fluid 535
Seminal vesicles 535
Rete testes 534 Seminiferous tubules 534, 535
S. typhimurium 220
Reticular connective tissue 412 Senescence 360
S1 nuclease 237
Retina 437 Sensory nerves 430
Saccharomyces cerevisiae 52, 85,
Retinal 439 Sensory neurons 419, 429
121
Retrogressive succession 612 Sensory organs 435
Sacculus 444
Retrohoming 157 Sensory receptor 419
Sacral nerves 426
Retrotransposons 69, 74 Sequence ontology consortium 77
Salamanders 616
Retrovirus 298 Sequences 111
Salivary glands 508
Reverse transcriptase 104, 113, Seral community 610
Salivation 508
237 Seral stage 610
Salix 616
Rh blood group system 9 Serosa 499
Salmonella 220
Rhagoletis pomonella 668 Serous membranes 499
Salmonella typhimurium 220
Rhicadhesin 348 Serous pericardium 483
Saponins 401
Rhizobium 347 Sertoli cells 37
Saprotrophs 566
Rho-dependent termination 135 Sertoli’s cells 536
Satellite cells 420, 421
Rhodopsin 439 Serum 478
Satellite DNA 68
Rh-positive 9 Serum containing media 319
Scaffold 89
Ribonuclease 514 Serum-free media 319
Scaffold attachment regions 89
Ribosome binding site 193 Sex chromatin body 93
Scala tympani 442
Ribosome recycling factor 200 Sex chromosome 35
Scala vestibuli 442
Ribosomes 191 Sex combs reduced 226
Schwann cells 420, 421
Riboswitches 171 Sex determining region 37
Sclera 435
Ribozyme 198 Sex linked genes 661
Screenable marker 263, 264
Ribs 464 Sex linked recessive 44
Scrotum 534
Ricin 203 Sex-conditioned inheritance 41
Scutellum 358
Ricinus communis 203 Sex-influenced traits 41
Second division segregation 33
Rifampicin 141 Sex-lethal 152
Secondary active transport 354, 526
Rifamycins 141 Sex-limited traits 41
Secondary bile acids 510
Right atrioventricular valve 483 Sex-linked dominant inheritance 43
Secondary bronchi 463
Right atrium 483 Sex-linked inheritance 40
Secondary metabolites 315
Right pulmonary artery 495 Sex-linked recessive inheritance 43
Secondary nucleus 385
Right ventricle 484 Sex-linked traits 40
Secondary oocyte 538
Ring chromosome 64 Sexual dimorphism 655
Secondary pollutants 630
RNA binding protein mediated Sexual imprinting 629
Secondary productivity 566
attenuation 169 Sexual selection 628, 655
Secondary succession 611
RNA editing 154 S-glycoprotein mechanism 388
Secretin 456, 506
RNA interference 180 Shannon diversity index 598
Secretory phase 541
RNA pol I promoter 137 Shine-Dalgarno sequence 193
Sedge-Meadow stage 616
RNA pol II promoter 138 Shoot apical meristem 394
Sedimentary cycle 574
RNA pol III promoter 137 Short interspersed nuclear elements
Seed dormancy 382
RNA polymerase 130 75
Seed germination 383
697
Index
Short-distance transport 351 Somatostatin 446, 451 Stringent plasmids 247

Sickle cell hemoglobin 217 SOS response 128, 130 Stroke volume 490
Sigmoid 592 Speciation 667 STS mapping 287
Sigmoid colon 507 Speciation event 676 Subclimax 613
Silencer 142 Species composition 597 Sublingual glands 508
Silencing 77 Species diversity 597, 599, 617 Submandibular ducts 508
Silent mutation 217 Species phylogeny 676 Submandibular glands 508
Simple columnar epithelium 408 Species richness 597, 617 Submaxillary glands 508
Simple cuboidal epithelium 408 Spermatic cord 535 Submerged stage 615
Simple epithelium 408 Spermatogenesis 535 Submucosa 499
Simple multigene families 81 Spermatogonia 535 Submucosal plexus 516
Simple mutation 208 Sphygmomanometer 493 Substitution mutation 208
Simple passive diffusion 354 Spilogale putorius 666 Succession 609
Simple sequence repeats 49 Spinal cord 417, 426 Succus entericus 505
Simple squamous epithelium 408 Spinal meninges 421 Sucrase 513
Simpson’s diversity index 597 Spinal nerves 417, 426, 430, 431 Sulfur cycle 577
Simpson’s index 598 Spinal reflex 429 Sulfur dioxide 630
Sinapyl alcohol 400 Spirometer 468 Sulfurous smog 630
Single nucleotide polymorphisms Spliceosome 150 Superficial cleavage 547
49 Splicing apparatus 150 Superinfection 174
Single site mutation 208 Splicing reactions 158 Supporting cells 444
Single-strand-binding protein Spongy bone 414 Suppressive petites 52, 53
102, 106 Spontaneous generation 641 Suppressor mutations 214
Sinoatrial node 486 Sporogenesis 384 Survivorship curves 587
siRNA 182 Sporophyte generation 384 Suspension culture 316
siRNA versus miRNA 182 Sporophytic self-incompatibility 388 Suspensor 391
Sister chromatids 86 Spring overturn 582 Suspensory ligaments 436
Site specific base modification Squamous cells 408 Swamp 583
editing 154 SR protein 150 Symmetric hybrids 313
Site-specific recombination SSLPs 285 Sympathetic chain 432
115, 120 ST segment 488 Sympathetic ganglia 432
Size limitation 248 Stabilizing selection 654 Sympathetic nervous system 417
Skatole 516 Stable population 589 Sympathetic paravertebral ganglia
Skeletal muscle tissue 415 Standing crop 566 432
Slippery sequence 202 Staphylococcus aureus 88 Sympathetic preganglionic nerve
S-locus cysteine-rich protein 388 Starch–statolith hypothesis 380 fibers 432
S-locus receptor kinase 388 Start point 130 Sympathetic trunks 432
Small intestine 505 Static equilibrium 444 Sympatric speciation 667
Small nucleolar RNAs 155 Statocytes 380 Symplastic phloem loading 351
SMC 89 Statoliths 380 Synaptic terminal 438
Smooth muscle tissue 415 Stenothermal 562 Syncytial blastoderm 223
SNPs 285 Stereoblastula 548 Synecology 558
Sociability 601 Stereocilia 443, 444 Synonymous mutation 217
Soil 558 Steroid hormones 454 Systemic circulation 485, 494
Soil composition 558 Stomach 502 Systemic gas exchange 471
Soil pollution 635 Strand invasion 119 Systole 489
Soil profile 558 Stratified columnar epithelium 410 Systolic blood pressure 493
Soil texture 558 Stratified cuboidal epithelium 409 Systolic pressure 492
Soil water 559 Stratified epithelium 409
Solenoid model 88 Stratified squamous epithelium 409
Solution 220
Somaclonal variations 312
Stratosphere 559
Stratospheric ozone depletion 632
T
Somatic apospory 390 Stratospheric ozone formation 632
T wave 488
Somatic cell gene therapy 295 Stratum basalis 539
T4 polynucleotide kinase 242
Somatic embryogenesis 311 Stratum functionalis 539
Taenia solium 603
Somatic mosaicism 39 Streptococcus pneumoniae 477
Taiga biome 584
Somatic mutations 214 Streptomyces alboniger 203
Tannins 401
Somatic nervous system 417, 431 Streptomycin 202
Tapetum 384
Somatic reflex 429 Striga 363
Taq DNA polymerase 237
Somatic system 434 Strigol 363
Target cells 444
Somatic versus germinal mutations Strigolactone 356, 359
Target site duplication 71
214 Strigolactones 363
Taste buds 501
698
Index
TATA box 138 Thrombopoietin 480 Transposons 69, 70, 77

TATA-Binding Protein 139 Thymic factor 450 Trans-splicing 154
Tautomeric shift 207 Thymic humoral factor 450 Transverse colon 507
T-DNA 253, 254 Thymopoietin 450 Tree finches 649
Tears 438 Thymosin 450 Tricolpate pollen 384
Tectorial membrane 443 Thymus 457 Tricuspid valve 483, 484
Tectum 425 Thymus gland 450 Triiodothyronine 449
Teeth 500 Thyroid follicles 449 Triple response 362
Telodendria 418 Thyroid gland 449, 457 Triplet binding assay 187
Telomerase 112 Thyroid gland disorders 459 Trisomy 21 58
Telomere 85 Thyroid hormones 449 Triticum 58
Telomere replication 112 Thyroid stimulating hormone 447 tRNA 190
Telomeres 86 Thyroid-stimulating immunoglobulin tRNA nucleotidyltransferase 158
Temperate deciduous forest biome 460 Trophic transfer efficiency 572
585 Thyrotropin-releasing factor 445 Trophoblast 548
Temperate grasslands 584 Thyrotropin-releasing hormone 445 Tropic hormone 447
Temperature-dependent sex Thyroxine 449 Tropic movements 380
determination 39 Tidal volume 467 Tropical grassland 584
Temperature-sensitive mutants 217 Tissue culture 389 Tropical rain forests 584
Template strand 130 Tissue factor 481 Troposphere 559
Temporal isolation 666 Tissues 407 Trp RNA-binding attenuation protein
Temporal lobes 424 T-loop 87 169
Temporary parasites 603 T-lymphocytes 479 True reversion 214
Tendinous chords 484 Tolerance model 614 Trypanosomes 603
Tenuinucellate 385 Tongue 501 Trypsin 513
Terminal bronchioles 463 Top-down control 578 Tryptophan operon system 167
Terminal deoxynucleotidyl Topoisomerase 102 Tryptophan-dependent pathways
transferase 241 Topology 675 353
Terminal ganglia 432 Torpedo shape 391 Tryptophan-independent pathway
Terminal uridyl transferase 155 Torso 225 353
Termination 111, 135, 193, 200 Total lung capacity 468 Tube 441
Termination signal 132 Trabeculae 414 Tuberculosis 477
Terminator 135 Tracts 427 Tubular reabsorption 525
Ternary complex 133 Transcellular fluid 498 Tubular secretion 525, 527
Terpenes 396 Transcription 129 Tubuloglomerular feedback 525
Tertiary 463 Transcription factors 139 Tundra biome 584
Test cross 5 Transcription termination 141 Tunica albuginea 534
Testes 534 Transcription unit 130 Tunica externa 491
Testes determining factor 37 Transcription vectors 267 Tunica interna 491
Testosterone 448, 455 Transcriptional attenuation 168 Tunica media 491
Tetracyclic diterpenoid 356 Transducin 440 Turgor movement 379
Tetracyclines 203 Transduction 262 Turner syndrome 59
Tetrad 31 Transesterification 206 Tus 111
Tetrad analysis 31 Transesterification reactions 149 Two-component signaling systems
Tetrahymena 176 Transfection 261 365
Tetrahymena thermophila 156 Transfer efficiencies 572 Tympanic cavity 442
Tetraiodothyronine 449 Transferrin receptor 179 Tympanic membrane 441
Tetraspanin family 545 Transformation 257 Type I promoter 137
Thecodont 500 Transformation characteristics 317 Type I topoisomerases 102
Thermal pollution 634 Transgenesis 289 Type II promoter 137
Thermal stratification 581 Transgenic animals 289 Type II topoisomerases 102
Thermonasty 381 Transition zone 596 Type III promoter 137
Thermosphere 559 Transitional epithelium 410 Typological species concept 665
Thermus aquaticus 237 Translation mediated transcriptional Tyrosine recombinase family 120
Thigmonasty 381, 382 attenuation 168
Thigmotropism 380, 381 Translational frameshifting 202
Third ventricle 422
Thoracic cavity 464
Translesion replication 129
Translocation 62, 197
U
Thoracic nerves 426 Transpeptidation 197
Ultrabithorax 226
Thoracic vertebrae 464 Transport inhibitor response 1 363
Umbilical cord 549
Thorax 464 Transposable elements 69, 73
Umbrella species 623
Thrombin 481 Transposition 69, 115, 210
Unicellular glands 410
699
Index
Unidirectional 101 Vernalization pathways 377 Yeast integrative plasmid 252

Uninducible lac mutation 163 Vertebral column 421 Yeast replicating plasmids 252
Uniparental inheritance 51 Vertical osmotic gradient 532 Yeast S. cerevisiae genome 85
Unipolar neurons 419 Vestibular apparatus 442, 444 Yeast selectable markers 253
Universal code 184 Vestibular membrane 442 Yellow bone marrow 478
Unloading 351 Vestigial structures 652 Y-family 105
Unmyelinated 421 Vigour 601 Y-linkage 40
Unsaturated zone 636 Viral transposon 77 Y-linked inheritance 43
Unscaled 675 Viral vectors 256 Yolk 543
Upper esophageal sphincter 502 Virions 248 Yolk granules 543
Upper limit 562 Virus resistant plants 301
Upstream activator sequences 143 Visceral reflex 429
Upstream control element 137
Upstream promoter element 132
Vital capacity 468
Vitality 601
Z
Ureter 517 Vitamins 515
Zeatin 359
Urethra 535 Vitelline layer 543
Zigzag model 88
Uridyl exonuclease 155 Vitreous chamber 437
Zinc finger 146
Urinary bladder 517 Vitreous humor 437
Zinc finger motif 145
Urinary system 416 VLFRs 370
Zona fasciculata 454
Urine formation 523 Vocal cords 462
Zona glomerulosa 454
Uterine cycle 541 Vomiting 507
Zona pellucida 538, 544
Uterine tubes 539 Vomiting center 508
Zona reticularis 454
Uterus 539 Vulnerable 621
Zygote 546
Utricle 444 Vulva 540
Zymogen granules 511
Utricularia 615 Vulval precursor cells 228
Zymogens 204
Uvea 435
W
V
Wahlund effect 663
Vagina 539 Warbler finches 649
Vallisneria 615 Water pollution 634
Valves 491 Water-soluble hormones 445
Variable number tandem repeats Wavelength 560
68 Weather 586
Vas deferens 534 Wetlands 583
Vasa recta 520 White blood cells 479
Vascular tunic 435 White columns 427
Vasoconstriction 491 Wild-type alleles 2
Vasodilation 491 Wingless 226
Vasopressin 448, 494 Wobble hypothesis 187
Vectors 246 Woodland stage 616
Vegetal hemisphere 547 Wound epidermis 551
Vegetative meristems 394
Vegetative propagation 389
Veins 491
Venae cavae 494
X
Ventral horn 427
Xanthium 374
Ventral respiratory group 475
X-chromosome 35
Ventral root 428
Xerarch 615
Ventricles 422
Xerarch succession 615
Ventricular ejection 489
X-linkage 40
Ventricular filling 489
X-linked recessive inheritance 44
Ventricular repolarization 488
Ventricular system 422
Ventricular systole 489
Venules 491 Y
Verhulst-Pearl logistic growth 591
Vermiform appendix 506 Y-chromosome 36
Vermis 425 Yeast artificial chromosomes 252
Vernalin 376 Yeast centromeric plasmids 252
Vernalization 376, 377 Yeast episomal plasmids 252
700

LifeSciencesPart-2 FifthEdition

Caricato da

Informazioni sul documento

Titolo originale

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

LifeSciencesPart-2 FifthEdition

Caricato da

Copyright:

Formati disponibili

Life Sciences

Fundamentals and Practice - II

Pranav Kumar | Usha Mina

Life Sciences Fundamentals and Practice, Fifth edition

Copyright © 2015 by Pathfinder Publication, all rights reserved.

This book contains information obtained from authentic and highly

Publisher : Pathfinder Publication

Answers of self test 683

Characters studied by Mendel

Wild-type versus Mutant alleles

Dominant and Recessive alleles

Homozygous and Heterozygous

1.2 Chromosomal basis of inheritance

5. Each parent contributes one set of chromosomes to its offspring.

Heterozygous (Yy) diploid cell

Possible haploid gametes

r y Heterozygous (YyRr) diploid cell

Possible haploid gametes

1.3 Gene interaction

Table 1.3 Comparison between dominance and epistasis

1.3.1 Dominant epistasis

1.3.2 Recessive epistasis

1.3.3 Duplicate recessive epistasis

1.6.5 Sex determination in plants

1.6.6 Non-chromosomal basis of sex determination

1.6.8 Sex-linked traits and sex-linked inheritance

F1 generation Red eye Female and male

Crossing the red eyed F1 female and male

Figure 1.27 Pattern of inheritance of the white eye trait in Drosophila.

1.9.1 Human karyotype

Table 1.6 Symbol used in describing a karyotype

1.9.2 Chromosome banding

Table 1.7 Chromosome banding techniques

Regions and bands

Banding pattern of human

Algae and fungi

Size of eukaryotic haploid genome (base pairs)

Table 1.9 Genome size in some eukaryotes

1.10.1 Genome complexity

Poly U:polyA MS2 T4 E.coli

Genome size given = 2 × 107 bp

So, 2 × 107 bp occupy = 2 × 107 × 0.34 = 0.68 × 107 nm = 6800 μm

Packaged size of chromosome = 4 μm

1.11.4 Polytene chromosomes

1.11.5 Lampbrush chromosomes

1.12 DNA replication

1.12.1 Semiconservative replication

A. Conservative model B. Semiconservative model C. Dispersive model

Meselson and Stahl experiment

1.15.1 Transcription unit

5' A AT C G AT C T G C TA ATTTA G C TA G A C 3' Coding or sense strand

RNA 5' AAUCGAUCUGCUAAUUUAGCUAGAC 3'

1.15.2 Prokaryotic transcription

Table 1.22 RNA polymerase subunits and their functions

RNA-dependent RNA polymerase

–35 box 16–18bp –10 box 6–7bp +1

1.15.3 Eukaryotic transcription

Table 1.25 Eukaryotic RNA pol and their transcripts

RNA pol I product 5.8S, 18S and 28S rRNA

RNA pol II product mRNA, most of snRNA, LINE, miRNA

RNA Pol III product tRNA Translational adaptor

RNA pol I promoter

RNA pol I promoter