Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
Version 1
Note: This product is covered by a Limited Label License (see Section 1.3).The consideration paid for
this product grants a Limited License with a paid up royalty to use the product pursuant to the
terms set forth in the accompanying Limited Label License. By use of this product, you accept
the terms and conditions of the Limited Label License.
Table of Contents
1. Notices to Customer…………………………………………………………………….…….….….. 1
1.1 Important Information…………………………………………………………………...……. 1
1.2 Precautions…………………………………………………………………………….…..….. 1
1.3 Limited Label License………………………………………………………………….…..…. 1
2. Overview…………………………………………………………………………………….……..… 3
2.1 Two Reactions Constitute the GATEWAY™ Cloning System………………………...…..….. 4
2.2 Basis of GATEWAY Recombination Reactions……………………………………………….. 5
2.3 Details of the GATEWAY Cloning Reactions……………………………………………………6
2.4 Entry Vectors and Entry Clones……………………………………………………..……….. 8
2.5 Destination Vectors………………………………………………………………….………..10
2.6 Protein Expression in the GATEWAY Cloning System……………………………….……… 11
2.7 Considerations in Designing Entry Clones………………………………………………….. 12
2.7.1 Location of Translation Start Sequences…………………………………………… 12
2.7.2 Reading Frame………………………………………………………………………. 13
2.7.3 Examples of Sequences for Different Protein Constructs…………………………... 13
2.7.4 Transcription from Entry Clones…………………………………………………… 15
2.8 Choosing the Right Entry Vector…………………………………………………….……… 15
2.8.1 Features of the Entry Vectors………………………………………………………. 15
2.8.2 Entry Vector pENTR™11………………………………………………………….. 16
2.9 GATEWAY Nomenclature………………………………………………………………..….... 17
3. Methods………………………………………………………………………………………...…… 18
3.1 General Comments………………………………………………………………...………… 18
3.2 Creating an Entry Clone…………………………………………………………....………... 19
3.2.1 Cloning Genes into Entry Vectors using Restriction Endonucleases and Ligase……19
3.2.2 Cloning cDNA Libraries into Entry Vectors using Restriction
Endonucleases and Ligase……………………………………………………………21
3.2.3 Transferring Genes from Expression Clones into Entry Vectors via the BP Reaction... 22
3.2.4 Cloning of attB-PCR Products via the BP Reaction……………………………….. 23
3.3 Creating Expression Clones (Transferring Genes from Entry Clones into Destination
Vectors via the LR Reaction).……………………………………………………...……….... 27
4. Troubleshooting………………………………..…………………………………………………… 29
5. Additional Information…………….………………………………..……………………………… 34
5.1 Converting a Vector into a GATEWAY Destination Vector………………………...………... 34
5.2 Protocol for Making a Destination Vector……………………………………………....…... 35
5.3 Using the Destination Vector in the GATEWAY Cloning System…………………….….…... 38
5.4 "One-tube" Protocol: A Protocol for Cloning attB-PCR products directly into
Destination Vectors …………………………………………………..………….….….…… 39
5.5 Transferring Clones from cDNA Libraries Made in GATEWAY Vectors…………..….…….. 40
5.6 Detailed Descriptions of the Vectors of the GATEWAY Cloning System………….….….….. 41
6. Related Products …………………………………………………………..………….….…………. 57
www.lifetech.com/gateway
Figure 4. Bacteriophage Lambda Recombination in E. coli. . .....................................................................6
Figure 5. GATEWAY Cloning Technology as an Operating System for Cloning and Subcloning Genes. .. 6
Figure 6. Sequences of attB1 and attB2 Sites Flanking a Gene after Subcloning into a Destination
Vector to Create an Expression Clone..........................................................................................7
Figure 7. DNA Molecules Participating in the LR Reaction. . ....................................................................8
Figure 8. Four Ways to Make Entry Clones.. ..............................................................................................9
Figure 9. Schematic of Available Entry Vectors. ......................................................................................10
Figure 10. Cloning A PCR Product by the BP Reaction............................................................................11
Figure 11. Examples of Different Protein Expression Constructs. ...........................................................13
Figure 12. Two Types of GATEWAY Protein Expression...........................................................................16
Figure 13. attB Sequences to Add to Primers for PCR Cloning into an Entry Vector. ............................24
Figure 14. Schematic of the GATEWAY Cloning System Reading Frame Cassettes. ................................34
Figure 15. Sequences at Ends of GATEWAY Reading Frame Cassettes. ...................................................36
Figure 16. Examples of How to Choose the Correct GATEWAY Reading Frame Cassette for N-Terminal
Fusions. . ...................................................................................................................................36
Figure 17. One-Tube Protocol for Cloning PCR Products Directly into Destination Vectors. ................39
Figure 18. Vector Map of Typical Entry Vector.……………………………………………………….. 41
Figure 19. Cloning Sites of the Entry Vector pENTR™1A……………………………………………...42
Figure 20. Cloning Sites of the Entry Vector pENTR2B……………………………………………..….42
Figure 21. Cloning Sites of the Entry Vector pENTR3C……………………………………………..….43
Figure 22. Cloning Sites of the Entry Vector pENTR4……………………………………………….….43
Figure 23. Cloning Sites of the Entry Vector pENTR11……………………………………………...….43
Figure 24. pDEST™8…………………………………………………………………………………….44
Figure 25. pDEST10……………………………………………………………………………………...45
Figure 26. pDEST12.2……………………………………………………………………………………46
Figure 27. pDEST14…………………………………………………………………………………….. 47
Figure 28. pDEST15…………………………………………………………………………………….. 48
Figure 29. pDEST17…………………………………………………………………………………….. 49
Figure 30. pDEST20…………………………………………………………………………………….. 50
Figure 31. pDEST26…………………………………………………………………………………….. 51
Figure 32. pDEST27…………………………………………………………………………………….. 52
Figure 33. pDONR™201…………………………………………………………………………………56
www.lifetech.com/gateway
1
1. Notices to Customer
1.1 Important Information
This product is authorized for laboratory research use only. The product has not been qualified or found
safe and effective for any human or animal diagnostic or therapeutic application. Uses for other than the
labeled intended use may be a violation of applicable law.
1.2 Precautions
Warning: This product contains hazardous reagents. It is the end-user’s responsibility to consult the
applicable MSDS(s) before using this product. Disposal of waste organics, acids, bases, and radioactive
materials must comply with all appropriate federal, state, and local regulations. If you have any questions
concerning the hazards associated with this product, please call the Life Technologies, Inc.
Environmental Health and Safety Chemical Emergency hotline at (301) 431-8585.
Academic and Not-For-Profit Institutions: The purchase price of this product includes limited,
nontransferable rights for non-profit and academic institutions to use only the purchased amount of the product
to practice recombinational cloning solely for internal research purposes, but does not provide rights to
perform amplification using primers containing recombination sites or portions thereof. Rights for performing
amplification using primers containing att recombination sites or portions thereof solely for internal research
purposes may be obtained by purchasing such primers from LTI or from a licensed supplier of such primers.
LTI reserves all other rights and in particular, the purchaser of this product can not transfer or otherwise sell
this product or its components to a third party and no rights are conveyed to the purchaser to use the product or
its components for commercial purposes as defined below. Academic and non-profit institutions must obtain a
license from LTI to acquire rights to use this product for any purpose other than those permitted above.
For-Profit Institutions: The purchase price of this product includes limited, nontransferable rights for for-
profit institutions to use only the purchased amount of the product up to but no more than 5000 µl of
CLONASE™ products per year per site to practice recombinational cloning solely for internal research
purposes, but does not provide rights to perform amplification using primers containing recombination sites or
portions thereof. Rights for performing amplification using primers containing att recombination sites or
portions thereof solely for internal research purposes may be obtained by purchasing such primers from LTI or
from a licensed supplier of such primers. LTI reserves all other rights and in particular, the purchaser of this
product can not transfer or otherwise sell this product or its components to a third party and no rights are
conveyed to the purchaser to use the product or its components for commercial purposes as defined below.
For-Profit institutions must obtain a license from LTI to use this product for any purpose other than those
permitted above.
Commercial purposes means any activity for which a party receives consideration and may include, but is not
limited to, (1) use of the product or its components in manufacturing, (2) use of the product or its components
to provide a service, information or data, (3) use of the product or its components for diagnostic purposes, (4)
transfer or sell vectors, clones, or libraries made with the product or components of the product, or (5) resell
the product or its components, whether or not such product or its components are resold for use in research.
www.lifetech.com/gateway
2
If the purchaser is not willing to accept these use limitations, LTI is willing to accept return of the product for a
full refund. For information on obtaining a license, contact the Director of Licensing, 9800 Medical Center
Drive, Rockville, MD 20850, phone (301) 610-8000, fax (301) 610-8383.
Products 11827-011, 11804-010, 11806-015, 11807-013 are sold under patent license from Monsanto for
research purposes only and no license for commercial use is included. Requests for licenses for commercial
manufacture or use should be directed to Director, Monsanto Corporate Research, 800 N. Lindbergh, St.
Louis, MO 63167.
Products 11822-012, 11823-010, 11826-013, 11827-011, 11803-012, 11806-015, 11809-019 are provided with
a license for research use only. Information in respect of licenses to use the product for purposes other than
research may be obtained from F. Hoffmann-LaRoche Ltd, Corporate Licensing, 4002 Basel Switzerland.
Vectors containing the His6 affinity purification tag are manufactured for Life Technologies™ by QIAGEN,
Inc.
Ni-NTA resin may be purchased from QIAGEN, Inc., 9600 De Soto Ave., Chatsworth, CA 91311. (800-426-
8157).
The composition and/or use of the BL21-SI COMPETENT CELL is claimed in patents and patent applications
licensed to Life Technologies, Inc. ("LTI") (i) by Brookhaven Science Associates, LLC (U.S. Patent Nos.
4,952,496 and 5,693,489 and U.S. Submission 08/784,201) and (ii) by The Council of Scientific and Industrial
Research ("CSIR") (U.S. Patent No. 5,830,690.)
The "T7 expression system" and its improvements are based on technology developed at Brookhaven National
Laboratory under contract with the U.S. Department of Energy and separately by CSIR, and are the subject of
patents and patent applications assigned to Brookhaven Science Associates, LLC ("BSA", see above) and
CSIR respectively. By provisions of the Distribution License Agreements granted to Life Technologies, Inc.
covering said patents and patent applications, LTI grants you a non-exclusive sub-license for the use of this
technology, including the enclosed materials, based upon the following conditions:
(i) University/Academic and Not-for-Profit Institutions: The purchase of this product conveys to University,
Academic and Not-for-Profit Institutions the right to use the BL21-SI C OMPETENT CELLS only for internal
non-commercial research purposes.
(ii) For-Profit Organizations: For-profit organizations inside the United States must obtain a license from
Brookhaven Science Associates, LLC prior to purchasing and using the BL21-SI COMPETENT CELLS, for
research or commercial purposes. For information about obtaining the required license to purchase, use
and practice the "T7 expression system", please contact The Office of Technology Transfer, Brookhaven
National Laboratory, Bldg. 475D, P.O. Box 5000, Upton, New York, 11973-5000, Telephone (516) 344-
7134.
(iii) Commercial Use: Commercial use of this product may require an additional license to the improvements.
For information about obtaining a commercial license to purchase, use and practice the improvements to
the "T7 expression system", please contact The Centre for Cellular and Molecular Biology, Uppal Road,
Hybderabad, 500 007, India, Attention: Director, Telecopier 91-40-717-1195.
(iv) Usage Restrictions: No materials that contain the cloned copy of the T7 gene 1, the gene for T7 RNA
polymerase, may be distributed further to third parties outside of your laboratory, unless the recipient
receives a copy of this sub-license and agrees to be bound by its terms. This limitation applies to strains
BL21(DE3), BL21(DE3)pLysS and BL21(DE3)pLysE, CE6, BL21-SI Competent Cells and any
derivatives that are made of them.
www.lifetech.com/gateway
3
2. Overview
GATEWAY Cloning Technology is a powerful new methodology that greatly facilitates protein
expression, cloning of PCR products, and analysis of gene function by replacing restriction
endonucleases and ligase with site-specific recombination. The GATEWAY Cloning Technology
provides:
Gene Gene
sequences into multiple types of vectors GST
(Figure 1). His 6 Trx
• Rapid, efficient cloning – and expression – of
PCR products, of a wide range of sizes. L2
L1 Gene
• Faithful maintenance of orientation and Gene
Gene
•
Gene
Robust reactions that are simple to perform 2-Hybrid FastBac
GATEWAY Cloning Technology provides a versatile system for transferring DNA segments between
vectors. Once in the system, DNA segments can be transferred from an Entry Clone into numerous vectors
(e.g., for protein expression) or from the Expression vector back into Entry Clones. Several options are
available for creating Entry Clones. These include:
• GATEWAY cloning (via the BP Reaction) of PCR products flanked by attB recombination sites to
generate Entry Clones.
• Cloning by standard recombinant DNA methods of restriction enzyme-generated fragments
directly into Entry Vectors.
• GATEWAY cloning (via the BP Reaction) into Entry Vectors of genes from genomic or cDNA
libraries prepared in attB-containing GATEWAY vectors. (See the following sections.)
www.lifetech.com/gateway
4
(λ) in E. coli (See Section 2.2). These sites are Expression Clone 200 bp 200 bp
B1 B2
specifically recognized by the recombination Gene +
proteins that constitute the CLONASE Enzyme 25 bp 25 bp
Knr
Mix cocktails. The GATEWAY cloning pEXP-gene
Expression Clones can express either native or fusion proteins. For native (non-fusion) proteins, the
coding sequence together with its translational start and stop signals is flanked by attB recombination
sites. As a consequence, the attB1 sequence resides in the 5′ untranslated region of the mRNA. In N-
terminal fusion proteins, in contrast, the 25 bp attB1 site becomes part of the coding sequence and inserts
an additional eight amino acids between the fusion domain and the protein encoded by a gene. For C-
terminal fusions, the attB2 sequence adds an additional eight codons between the gene and the C-
terminal fusion sequence.
www.lifetech.com/gateway
5
The integrative and excisive recombination reactions of phage λ are mediated by proteins encoded by
phage λ and E. coli. These recombination reactions, performed in vitro, are the basis of the GATEWAY
Cloning Technology. They can be represented as follows:
attB x attP ⇔ attL x attR (where “x” signifies recombination).
The four att sites contain binding sites for the proteins that mediate the reactions. The wild type attP,
attB, attL, and attR sites contain 243, 25, 100, and 168 base pairs, respectively. The attB x attP reaction
www.lifetech.com/gateway
6
Restriction Enzyme
and Ligase Cloning
BP Reaction LR Reaction
PCR Product
GENE
attB1 attB2
www.lifetech.com/gateway
7
Note that the recombination reaction is conservative, i.e., there is no net synthesis or loss of base pairs.
The DNA segments that flank the recombination sites are merely switched. The wild type λ
recombination sites have been modified for purposes of the GATEWAY Cloning System, as follows:
• A part (43 bp) of attR has been removed, to make the excisive reaction irreversible and more
efficient [Bushman, W., Thompson, J.F., Vargas, L., and Landy, A. (1985), Science 230, 906). The
attR sites in GATEWAY Cloning System Destination Vectors are 125 bp in length.
• Mutations have been made to the core regions of the att sites to eliminate stop codons and to ensure
specificity of the recombination reactions (i.e., attR1 reacts only with attL1, attR2 reacts only with
attL2).
• Other mutations have been introduced into the short (5 bp) regions flanking the 15-bp core regions
of the attB sites to minimize secondary structure formation in single-stranded forms of attB plasmids,
e.g., in phagemid ssDNA or in mRNA.
The recombination (att) sites of each vector comprise a hybrid sequence, donated by the parental vectors.
The staggered lines dividing the two portions of each att site, in Figure 2, Figure 3, and Figure 6
represent the seven-base staggered cut produced by Int during the recombination reactions.
This structure is shown in greater detail in Figure 6, which displays the recombination sequences of an
attB Expression Clone, generated by recombination between the attL1 and attL2 sites of an Entry Clone
and the attR1 and attR2 sites of a Destination Vector.
If the reading frame of the gene cloned in the Entry Vector is in phase with the reading frame shown for
attB1 (note the –AAA-AAA-), amino-terminal protein fusions can be made between the gene and any
Destination Vector encoding an amino-terminal fusion domain. An analogous convention is followed for
www.lifetech.com/gateway
8
The first approach is to clone the gene into one or more of the Entry Vectors, using standard recombinant
DNA methods, with restriction endonucleases and ligase. The starting DNA fragment can be generated
by restriction endonuclease digestion or as a PCR product. The fragment is cloned between the attL1
and attL2 recombination sites in the Entry Vector. Note that the ccdB gene, provided to minimize
background colonies from incompletely digested Entry Vector, must be excised and replaced by your
DNA.
A schematic of the Entry Vectors and summary of their features is shown in Figure 9. Five Entry
Vectors currently are available, providing an array of cloning options. All carry the kanamycin
resistance gene. Table 1 provides information on the available Entry Vectors and details of their cloning
sites. Choosing the right Entry Vector is discussed in depth in Section 2.7.2.
www.lifetech.com/gateway
9
www.lifetech.com/gateway
10
The genes ccdA and ccdB are the antidote and toxin genes respectively of the E. coli F plasmid [Bernard,
P., Kezdy, K.E., Van Melderen, L., Steyaert, J., Wyns, L., Pato, M.L., Higgins, P.N., Couturier, M.
(1993) J. Mol. Biol. 234, 534]. Together they ensure that daughter cells that do not receive a copy of F
will not survive. The CcdB protein interferes with the rejoining step of DNA gyrase, causing the
chromosome to be cut to pieces. Plasmids that contain the ccdB gene without the antidote gene (Entry
Vectors and Destination Vectors) can be propagated in the gyrase mutant, gyrA462 [Miki, T., Park, J.A.,
Nagao, K., Murayama, N., and Horiuchi, T. (1992) J. Mol. Biol. 225, 39]. We have constructed a
gyrA462 strain, DB3.1™, for propagating Destination Vectors and Entry Vectors:
www.lifetech.com/gateway
11
B1 B2
Gene Destination Vectors carry an inactive copy of the
25 bp 25 bp
attB-PCR Product ccdA gene (caused by a frame shift) as well as an
+ P1 P2
active ccdB gene. Entry Vectors carry only the
Death
ccdB
rrnB
200 bp 200 bp ccdB gene, with its own promoter (Figure 9).
Donor Vector
Knr
To move a gene into a Destination Vector,
Destination Vector DNA is mixed with Entry
Clone DNA and incubated with LR CLONASE
BP CLONASE
(Int + IHF) Enzyme Mix, followed by transformation into any
R1
standard E. coli strain. LIBRARY EFFICIENCY®
R2
ccdB DH5α™ Competent Cells are recommended.
125 bp 125 bp
Section 3 provides further details and protocols.
L1 L2 + By-product
Gene
rrnB
100 bp 100 bp Destination Vectors presently available from Life
Entry Clone Technologies are summarized in Table 2. Maps
and cloning site information for Destination
Kn r Vectors are provided in Section 5, as well as
methods for converting most standard vectors into
Figure 10. Cloning A PCR Product by the BP Destination Vectors.
Reaction. A PCR product with 25-bp terminal
attB sites (+ 4Gs) is shown as a substrate for the 2.6 Protein Expression in the GATEWAY
BP Reaction. Recombination between the attB- Cloning System
PCR product of a gene and a Donor Vector
(which donates an Entry Vector that carries Knr) Proteins are expressed in vivo as a result of two
results in an Entry Clone of the PCR product. processes, transcription (DNA into RNA), and
translation (RNA into protein).
Ribosomes convert the information present in mRNA into protein. Ribosomes scan RNA molecules
looking for methionine (AUG) codons, which begin nearly all nascent proteins. Ribosomes must,
however, be able to distinguish between AUG codons that code for methionine in the middle of proteins
from those at the start. Most often ribosomes choose AUGs that are 1) first in the RNA (toward the 5′
end) and 2) have the proper sequence context. In E. coli the favored context [first recognized by Shine
and Dalgarno, (1975) Eur. J. Biochem, 57, 221] is a run of purines (As and Gs) from five to 12 bases
upstream of the initiating AUG, especially AGGAGG or some variant.
In eukaryotes, a survey of translated mRNAs by Kozak [(1991) J. Biol. Chem. 266, 19867] has revealed a
preferred sequence context: --- GCC ACC ATG G-- around the initiating methionine, with the A at -3
being most important, and a purine at +4 (where the A of the ATG is +1), preferably a guanine (G), being
next most influential. Having an A at -3 is enough to make most ribosomes choose the first AUG of an
mRNA in plants, insects, yeast, and mammals. [For a review of initiation of protein synthesis in
eukaryotic cells, see Pain, V.M. (1996) Eur. J. Biochem. 236, 747.]
www.lifetech.com/gateway
12
Ribosome binding-site sequences (Shine-Dalgarno in E. coli and Kozak in eukaryotes) must lie close to
the initiating ATG. The attB site is 25 base pairs long. Therefore, if translation is to initiate at the native
ATG within a gene of interest, the ribosome binding site (RBS) sequence close to the ATG needs to be
positioned between the attL1 and attL2 sites in the Entry Clone of that gene.
If the Destination Vector provides a promoter but no N-terminal fusion sequence, protein synthesis will
initiate exclusively at the translation start signals of the native open reading frame (ORF). If the
Destination Vector encodes an N-terminal fusion peptide, however, protein synthesis may begin not only
at the N-terminal fusion sequence, but to some degree at the internal, native ATG as well. Even though
ribosomes most often initiate protein synthesis at the 5'-most ATG, internal ATGs can also serve to
initiate protein synthesis. The better the translation context around the internal ATG, the more internal
initiation of translation will be seen.
Whether to construct different Entry Clones to express native protein and N-terminal fusion protein is an
important consideration in designing Entry Clones. The presence of internal start sequences in
N-terminal fusion constructs will sometimes result in a significant amount of native protein being made,
contaminating and lowering the yield of the N-terminal fusion protein. This problem can be more
pronounced with short N-terminal fusion tags, such as the 6X histidine affinity tag.
www.lifetech.com/gateway
13
When making fusions it is essential to maintain the correct reading frame in the Entry Vectors. For native
expression any reading frame is acceptable since translation starts and stops between the two att sites.
For fusions the reading frame of the DNA cloned into all GATEWAY vectors must be in phase with the
reading frame of the attB1 site shown in Figure 6, such that the six As of the site are split into two lysine
codons (AAA - AAA). All of the Destination Vectors that make amino-terminal fusions have been
constructed so that the attR1 site is in this reading frame. Figure 15 presents the attR1 and attR2
sequences present within the three GATEWAY Reading Frame Cassettes used to create new Destination
Vectors.
Therefore, if a gene is cloned into an Entry Vector so that the --- AAA - AAA --- reading frame within
the attL1 site is in phase with the reading frame of the gene, amino terminal fusions will automatically be
correctly phased, for all N-terminal fusion tags.
Likewise, for C-terminal fusion Destination Vectors, the C-terminal coding sequences should be aligned
in phase with the -TAC-AAA- sequence of the attR2 site, which translates into –Tyr-Lys- (See Figure 6
and Figure 15).
The following examples of Expression Clone sequences and attB-PCR primer sequences (for preparing
Entry Clones) have been used successfully to express both native and fusion proteins in various cellular
contexts using the GATEWAY Cloning System. Other sequence options and motif combinations are
possible, and may be preferable in some situations. The examples below are offered only as a starting
point for recombinant protein expression in the GATEWAY Cloning System.
attB1 attB2
(promoter) RBS ATG Open Reading Frame Stop
*Note: By placing the ATG in frame with the attB1sequence this construction can be used in both native
and N-terminal fusion expression vectors.
www.lifetech.com/gateway
14
attB1 forward oligo: (attB1 sequence bold; translation start codon underlined; sequence includes SD and Kozak)
attB2 reverse oligo: (attB2 sequence bold; translation stop codon [complement strand] underlined)
2. N-terminal and C-terminal fusion expression in prokaryotic, insect, and mammalian cells:
--- NNN NNN NNN GAC CCA GCT TTC TTG TAC AAA GTG GTN NNN --- --- NNN (Stop) - 3'
--- NNN NNN NNN CTG GGT CGA AAG AAC ATG TTT CAC CAN NNN --- --- NNN NNN - 5'
attB2 C-fusion
C. Suggested oligonucleotides for attB-PCR cloning of gene for N-terminal and C-terminal fusion expression
5' - GGGGACAAGTTTGTACAAAAAAGCAGGCTTA (18-25 gene specific nucleotides in frame with attB1) - 3'
5' - GGGGACCACTTTGTACAAGAAAGCTGGGTC (18-25 gene specific nucleotides [complement strand] in frame with
attB2) - 3'
Note: Other nucleotides may be substituted for the underlined sequences as long as the reading frame is maintained and
the substituted sequences do not create a stop codon.
www.lifetech.com/gateway
15
Many standard expression vectors use the lac promoter to control expression of cloned genes.
Transcription from the lac promoter is turned on by adding the inducer IPTG. Even in the absence of
inducer, however, a low level of mRNA is made, i.e., the lac promoter is never completely off. The
result of this "leakiness" is that genes whose expression is harmful to E. coli may prove difficult or
impossible to clone in vectors that contain the lac promoter, or they may be cloned only as inactive
mutants.
In contrast to other gene expression systems, genes cloned into an Entry Vector are designed not to be
expressed. The presence of the strong transcriptional terminator rrnB [Orosz, A., Boros, I., and
Venetianer, P. (1991) Eur. J. Biochem. 201, 653] just upstream of the attL1 site in Entry Vectors and
Entry Clones is designed to prevent transcription from vector promoters from reaching the cloned gene.
All Entry vectors have restriction sites to the left and right of the ccdB gene to allow directional cloning
of the DNA. Each vector enables amino or carboxy fusions when transferred into the appropriate
Destination Vector if the cloned DNA maintains the reading frame registers shown in Figures 19-23.
The cloning sites of the Entry Vectors are organized in two groups that flank a copy of the ccdB gene.
The CcdB protein interferes with DNA gyrase and thereby inhibits growth of E. coli. The Entry Vectors
are positive selection vectors; therefore, undigested or partially digested molecules will not generate
www.lifetech.com/gateway
16
• Clone cDNAs from most commercially available libraries. The sites to the left and right of the ccdB
gene have been chosen so that directional cloning is possible.
• Clone genes directionally: Sal I, BamH I, Xmn I (blunt), or Kpn I on the left of ccdB; Not I, Xho I,
Xba I, or EcoR V (blunt), on the right.
• Clone genes or gene fragments with a blunt amino end at the Xmn I site. The Xmn I site has four of
the six most favored bases for eukaryotic expression (see Section 2.6), so that if the first three bases
of the DNA are ATG, the open reading frame will be expressed in mammalian, insect, yeast, etc.,
cells when it is transcribed in the appropriate Destination Vector. In addition, a Shine-Dalgarno
sequence is situated 8 bp upstream, for initiating protein synthesis in E. coli at an ATG.
• Clone cDNAs that have an Nco I site at the initiating ATG into the Nco I site. Similar to the Xmn I
site, this site has four of the six most favored bases for eukaryotic expression. Also, a Shine-
Dalgarno sequence is situated 8 bp upstream, for initiating protein synthesis in E. coli using an ORF
with a 5′ ATG .
www.lifetech.com/gateway
17
• Select against uncut or singly cut Entry Vector molecules during cloning with restriction
endonucleases and ligase. If the ccdB gene is not removed with a double digest, it will kill any
recipient E. coli cell.
• Enable amino fusions with ORFs in all cloning sites. There are no stop codons (in the attL1 reading
frame) upstream of the ccdB gene.
• Enable carboxy fusions with ORFs positioned in phase with the reading frame convention for C-
terminal fusions, indicated in Figure 23.
For subclones, the following naming convention has been adopted: the name of the vector is placed first,
followed by the name of the transferred gene.
attB subclone Expression Clones pEXP3-cat, ... [where 3 refers to the Destination
Vector (pDEST3) used to make the expression
subclone and cat is the subcloned gene]
attP Vector Donor Vectors pDONR™201
Other Names:
Name Reacting Sites Catalyzed by Desired Product Structure of
Desired Product
Examples:
• An LR Reaction:
pENTR201-tet x pDEST10 Æ pEXP10-tet
• Two BP Reactions:
attB-p53 PCR product x pDONR205 Æ pENTR205-p53
pEXP14-lacZ x pDONR201 Æ pENTR201-lacZ
www.lifetech.com/gateway
18
3. Methods
3.1 General Comments
Purification of DNA: When preparing plasmid DNAs for use in the G ATEWAY System reactions, DNA
purified by CONCERT™ Rapid Plasmid Systems is recommended. Miniprep DNA prepared by standard
alkaline lysis protocols, with or without RNase treatment, can be used as well. During alkaline lysis
treatment, we recommend a final concentration of NaOH no higher than 0.125 M, to minimize
irreversible denaturation of the supercoiled plasmid DNA.
DNA Topology: For LR reactions, the most efficient substrates are supercoiled, relaxed, or linear Entry
Vectors (attL) and relaxed or linear Destination Vectors (attR). Reactions in which the Destination
Vector is supercoiled give five to ten-fold fewer colonies.
For BP Reactions, the attB vectors should be linear (PCR products or Expression Clones linearized by
restriction endonucleases), while the attP-containing pDONR Vector must be supercoiled. Expression
Clones (attB) can be used as supercoiled or relaxed (i.e., with Topoisomerase I) molecules, but will react
less efficiently than linearized Expression Clones.
Linearized Destination Vector can be obtained by cleaving at a restriction site within the region of the
GATEWAY Cassette, taking care to avoid the ccdB gene. All Destination Vectors from Life Technologies
are provided already linearized in this manner.
When suitable single-cut restriction sites are unavailable or unknown, as with complex mixtures of
plasmids or cDNA libraries, the DNA may be relaxed by brief treatment with Topoisomerase I.
Primers: Primers for attB PCR should have 18-25 bases of gene-specific sequence and 29 bases attB
sequence (includes four Gs). Generally, 50 nmol of standard purity oligos are adequate for most
applications. Oligos should be dissolved to a concentration of 20-50 µM and the concentration verified
by spectrophotometry. For cloning of large PCR products (>5 kb), colony output can be increased if
oligos (>65 bases) are further purified (i.e., HPLC or PAGE).
Incubation time: In the following protocols we recommend incubating the GATEWAY reactions for
60 min at 25°C. This will generally give sufficient colonies when transforming E. coli competent at 108
CFU/µg or higher, virtually all of which should contain the correct subclone. In some circumstances,
however, you may wish to convert a higher percentage of starting plasmid carrying your gene to product.
This can be achieved by incubating for longer periods, such as for 4-6 h, or overnight. An overnight
incubation often gives five-fold or more product than a one-hour incubation.
Longer incubation times are recommended for LR and BP Reactions involving large plasmids (≥10 kb),
for BP Cloning of large PCR products (≥5 kb), and for transfer of diverse populations of genes, such as
cDNA libraries.
www.lifetech.com/gateway
19
Entry clones can be created in one of four ways: 1) Cloning into Entry Vectors with restriction
endonucleases and ligase, 2) cloning cDNA libraries into Entry Vectors using restriction endonucleases
and ligase, 3) transferring genes from Expression Clones into Entry Vectors via the BP Reaction, or 4)
cloning attB-PCR products via the BP Reaction.
Restriction endonuclease fragments or PCR products can be cloned into an Entry vector. The PCR
fragment will be either cloned as a blunt-end fragment or require digestion with restriction endonucleases
(e.g., at sites incorporated into the primer).
All the Entry Vectors contain the ccdB gene as a stuffer between the “left” and “right” restriction sites.
The advantage of this arrangement is that there is virtually no background from vector that has not been
digested with both restriction endonucleases, because the presence of the ccdB gene will inhibit the
growth of all standard E. coli strains. Thus, it is necessary to cut each Entry Vector twice in order to
remove the ccdB gene fragment during cloning.
It is strongly recommended that after digestion of the Entry Vector with the second restriction
endonuclease, the reaction be treated with phosphatase (calf intestine alkaline phosphatase, CIAP or
thermosensitive alkaline phosphatase, TSAP). The phosphatase can be added directly to the reaction
mixture, incubated for an additional time, and inactivated. This step dephosphorylates both the vector
and ccdB fragments, so that during subsequent ligation there is less competition between the ccdB
fragment and the DNA of interest for the termini of the Entry Vector.
3.2.1 Cloning Genes into Entry Vectors using Restriction Endonucleases and Ligase
Generally PCR products do not have 5′ phosphates (because the primers are usually 5′-OH), and they are
not necessarily blunt. (On this latter point, see Brownstein, M.J., Carpten, J.D., and Smith, J.R. (1996)
Biotechniques 20, 1004 for a discussion of how the sequence of the primers affects the addition of single
3′ bases.) The following protocol repairs these two defects.
1. In a 0.5-ml tube, ethanol-precipitate about 40 ng of PCR product (as judged from an agarose gel).
www.lifetech.com/gateway
20
Note: In the above protocol, the ends of the PCR product are simultaneously polished (through the exo
and polymerase activities of T4 DNA polymerase) and the 5' ends phosphorylated (using T4
polynucleotide kinase). It is necessary to inactivate the kinase, so that the blunt, dephosphorylated vector
cannot self-ligate. The PEG precipitation removes all small molecules (primers, nucleotides), and can
improve the colony output of cloned PCR product by 50-fold.
Efficient cloning of PCR products that have been digested with restriction endonucleases includes three
steps: inactivation of Taq DNA polymerase, efficient restriction endonuclease cutting, and removal of
small DNA fragments.
Inactivation of Taq DNA Polymerase: Carryover of Taq DNA polymerase and dNTPs into a restriction
endonuclease digestion significantly reduces the success in cloning a PCR product [Fox, D., Nathan, M.,
Natarajan, P., Bracete, A., and Mertz, L. (1998) FOCUS® 20, 15], because Taq DNA polymerase can fill
in sticky ends and add bases to blunt ends. Either TAQUENCH™ PCR Cloning Enhancer or extraction
with phenol can be used to inactivate the Taq DNA polymerase.
A2. Perform restriction digest, using 10 to 50 units of restriction endonuclease and standard protocols,
and incubate for at least 1 h.
www.lifetech.com/gateway
21
A4. Add 1/2 volume of 30% PEG 8000/30 mM MgCl2. Mix well and immediately centrifuge at room
temperature for 10 min. Discard the supernatant (pellet is usually invisible), centrifuge again for a
few seconds, and discard any remaining supernatant.
A5. Dissolve the DNA in a suitable volume of TE (depending on the amount of PCR product in the
original amplification reaction) and apply an aliquot to an agarose gel to confirm recovery. Apply
to the same gel 20-100 ng of the appropriate Entry Vector that will be used for the cloning.
B1. Dilute the PCR reaction to 200 µl with TE. Add an equal volume of phenol:chloroform:isoamyl
alcohol, vortex vigorously for 20 s, and centrifuge for 1 min at room temperature. Discard the
lower phase.
B2. Extract the phenol from the DNA and concentrate as follows: Add an equal volume of 2-butanol
(colored red with “Oil Red O” from Aldrich, if desired), vortex briefly, centrifuge briefly at room
temperature. Discard the upper butanol phase. Repeat the extraction with 2-butanol. This time the
volume of the lower aqueous phase should decrease significantly. Discard the upper 2-butanol
phase.
B3. Ethanol-precipitate the DNA from the aqueous phase of the above extractions. Dissolve in 200 µl
of a suitable restriction endonuclease buffer. Then digest with the appropriate restriction
endonuclease, followed by inactivation of the restriction endonuclease, and ligation of the DNA to
the Entry Vector.
Efficient Restriction Endonuclease Cutting: Extra bases on the 5′-end of each PCR primer help the
restriction endonucleases cut near ends of PCR products. With the availability of inexpensive primers,
adding six to nine bases on the 5′ sides of the restriction sites is a good investment to ensure that most of
the ends are digested. Incubation of the DNA with a five-fold excess of restriction endonuclease for an
hour or more helps ensure success.
Removal of Small Molecules before Ligation: Primers, nucleotides, primer-dimers, and small fragments
produced by the restriction endonuclease digestion, can all inhibit or compete with the desired ligation of
the PCR product to the cloning vector. This protocol uses PEG precipitation to remove small molecules.
3.2.2 Cloning cDNA Libraries into Entry Vectors using Restriction Endonucleases and Ligase
The cDNA library can be constructed using standard methodology such as the SUPERSCRIPT™ Plasmid
System for cDNA Synthesis and Plasmid Cloning with an oligo(dT) primer adapter containing a Not I
site for first strand synthesis and ligation of Sal I adapters after second strand synthesis. The Entry
Vector is digested with Sal I and Not I which removes the ccdB gene and the cDNA library is ligated into
the vector. The Sal I-Not I sites in the Entry vectors are oriented so that the 5'-end of the cDNA (Sal I
end) is closest to the attL1 site.
www.lifetech.com/gateway
22
3.2.3 Transferring DNA from an Expression Clone into an Entry Vector via the BP Reaction
The BP Reaction converts an Expression Clone to an Entry Clone. This reaction is useful when
transferring a gene present in an attB Expression Clone into other expression vectors. After converting
the gene into an attL Entry Clone, via the BP Reaction, the gene can be subcloned into new expression
vectors by performing an LR Reaction, thereby obtaining new attB Expression Clones.
An Expression Clone has the gene of interest flanked by attB sites. Expression Clones (attB) can be used
as supercoiled or relaxed (i.e., nicked or treated with Topoisomerase I) molecules, but will react most
efficiently when linearized. To linearize Expression Clones, the Expression Vector must cut outside the
attB region.
1. Digest 1-2 µg of the Expression Clone with a unique restriction endonuclease that does not cut within
the gene of interest.
2. Ethanol-precipitate the DNA after digestion and dissolve DNA in TE.
The most common cause of an unsuccessful BP Cloning Reaction is failure to plate the
reaction transformations on plates containing kanamycin.
Materials needed:
• BP Reaction Buffer
• attB Expression Clone DNA, ≥10 ng/µl, in TE
• pEXP7-tet Positive Control, linearized with Sca I, 50 ng/µl. The tetR insert is 1.4 kb, and includes
its own promoter.
• pDONR201 Vector, 150 ng/µl, supercoiled
• BP CLONASE Enzyme Mix (stored at -70°C)
• Proteinase K Solution
• pUC19 DNA, 10 pg/µl
• LIBRARY EFFICIENCY DH5α Competent Cells (≥1 × 108 CFU/µg)
• S.O.C Medium for culturing transformations
• LB plates containing 50 µg/ml kanamycin
www.lifetech.com/gateway
23
Total Volume 20 µl 20 µl 20 µl
Procedure:
1. Compose the reactions on ice.
2. Add TE, BP Reaction Buffer, Donor Vector, and attB DNAs, and mix well.
3. Remove the BP CLONASE Enzyme Mix from the -70°C freezer and allow to thaw on ice (~2 min).
4. Vortex BP CLONASE Enzyme Mix briefly (2 s) twice.
5. Add 4 µl of BP CLONASE Enzyme Mix and mix well by vortexing briefly twice. Return vial to -70°C
freezer.
6. Incubate tubes at 25°C for 60 min.
7. Add 2 µl Proteinase K Solution. Incubate for 10 min at 37°C.
8. Transform 1 µl of BP Reaction into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells using
Falcon® 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42°C for 30 s. Place on ice
for 1-2 min. Add 450 µl S.O.C. Medium and incubate at 37°C for 1 h.
9. Spread 10 µl and 100 µl on LB plates containing 50 µg/ml kanamycin. (If the E. coli cells have a
transformation efficiency of 108 CFU/µg, the BP Reaction should give about 3,000 colonies if the
entire transformation is plated.)
10. Also transform 2 µl of pUC19 DNA into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells, as
above. Plate 10 µl and 100 µl on LB plates containing 100 µg/ml ampicillin. (Cells with a
tranformation efficiency of 108 CFU/µg should yield about 2,000 colonies if the entire transformation
is plated.)
Addition of 5′-terminal attB sequences to PCR primers allows synthesis of a PCR product that is an
efficient substrate for recombination with a Donor Vector in the presence of BP CLONASE Enzyme Mix.
This reaction produces an Entry Clone of the PCR product (See Figure 10).
www.lifetech.com/gateway
24
The attB1 and attB2 primer sequences are given in Figure 13. The four guanine (G) residues at the
5′ end of these primers are required to make the minimal 25-bp attB sequences an efficient GATEWAY
Cloning System substrate.
Figure 13. attB Sequences to Add to Primers for PCR Cloning into an Entry Vector
Add the attB1 sequence to the amino (forward) primer and the attB2 sequence to the carboxy (reverse)
primer.
Note: These GATEWAY attB1 and attB2 modifications to primers are available from Life Technologies.
Note: The attB1 primer ends with a single thymidine (T), which requires the donation of two additional
nucleotides from the remainder of the primer sequence to maintain proper reading frame. These two
nucleotides cannot be AA, AG, or GA, because these additions would create a termination codon.
Similarly, for C-terminal fusions, the attB2 primer requires one nucleotide from the rest of the primer to
maintain the proper reading frame into the attB2 region.
For generating N-fusion proteins the attB1 site must maintain the reading frame register shown above. In
this reading frame, the six As of the attB1 sequence are read as -AAA - AAA- , and translated into -Lys-
Lys-. Because all of the N-terminal fusion Destination Vectors available from Life Technologies adhere
to this convention, all subclones into these Destination Vectors will automatically align the reading frame
of the N-terminal coding sequence in phase with the correct reading frame of your gene.
Likewise, to join the PCR product in the correct reading frame with a C-terminal fusion Destination
Vector, the C-terminal coding sequences of these vectors must be aligned in phase with the -TTT-GTA-
sequence of the attB2 primer sequence, shown above. This means that the complementary strand, which
is the sense strand, will be read as -TAC-AAA-, translating into Tyr-Lys- (See Figure 15). For this
purpose, any in-phase termination codons present between the coding region of the PCR sequence and
the attB2 region will also need to be eliminated.
Note that it is possible to install a protease cleavage sequence, such as that for the highly specific TEV
Protease, to permit the removal of N-terminal or C-terminal peptides from the fusion proteins. To do
this, you will need to include such a sequence between the gene-specific portion and the attB portion of
your PCR primers. As a result, the cleavage sequence will reside between the att sequence and the gene
sequence, and consequently will always transfer together with the cDNA into various Destination
Vectors. For examples of attB-PCR primer sequences used to construct native and fusion protein
expression clones for use in different cellular contexts, refer to Section 2.7.3.)
Standard PCR conditions and polymerases may be used to prepare the attB-PCR product. Likewise,
genomic DNA, mRNA, cDNA libraries, and cloned DNA sequences have all been used successfully as
substrates for amplification with attB-containing primers. The suggested polymerase for amplification of
PCR products <5-6 kb is PLATINUM® Pfx DNA Polymerase due to its high fidelity, robustness and
www.lifetech.com/gateway
25
automatic "hot start" capabilities. For templates >5-6 kb, or those unsuccessfully amplified by the Pfx
polymerase, PLATINUM Taq DNA Polymerase High Fidelity is recommended. Appropriate buffers and
conditions for amplification that are provided with each polymerase should be utilized.
Following the PCR reaction, apply 1-2 µl to an agarose gel, together with size standards (1 Kb PLUS
DNA LADDER™) and appropriate quantitation standards (Low DNA MASS™ Ladder or Low DNA
MASS Ladder), to assess the yield and uniformity of the product.
If the starting PCR template is a plasmid that contains the gene for Kn r, it is advisable to treat the
completed PCR reaction with the restriction endonuclease Dpn I to degrade the plasmid. Such
plasmid is a potential source of false-positive colonies from the transformation of the GATEWAY
Cloning System reaction. Adding 5 µl of 10X REACT® 4 Buffer plus ~5 units of Dpn I to the
completed PCR reaction and incubating for 15 min at 37°C will eliminate this potential problem.
Heat-inactivate the Dpn I at 65°C for 15 min before doing the PEG/MgCl2 purification, described
below, or before using the PCR product in the GATEWAY Cloning System reaction.
Purification of the PCR product is recommended to remove attB primer-dimers which can clone
efficiently into the Entry Vector. The following protocol is fast and will remove DNA <300 bp in size:
Longer centrifugation times and faster centrifugation speeds will increase the amount of PCR product
recovered from the PEG precipitation.
Note: Standard PCR product clean-up protocols don't efficiently remove large primer-dimer products
and are therefore not recommended for cleaning up attB-PCR products.
The conditions of the BP PCR Cloning reaction with an attB PCR substrate are similar to those of the BP
Reaction (Section 3.2.3), except that the attB-PCR product substitutes for the Expression Clone.
Materials needed:
• The PCR product with terminal attB1 and attB2 sequences(>10 ng/µl)
In general, increasing the amount of PCR product results in proportionately more colonies (do not
exceed ~500 ng/20 µl reaction). As a starting point, use 40-100 fmol of PCR product/20 µl reaction
(where a 1-kb PCR product is ~0.65 ng/fmol).
Note: For PCR products >4 kb, the number of colonies obtained per fmol of PCR DNA added
decreases with increasing size. Thus for larger PCR products we recommend increasing the amount
of DNA to at least 100 fmol of PCR product per 20-µl reaction, and using incubations longer than
one hour, such as 6 h or overnight.
• BP Reaction Buffer
• Donor Vector, pDONR201, 150 ng/µl, supercoiled.
• pEXP7-tet Positive Control (linearized with Sca I), 50 ng/µl. The tetR insert is 1.4 kb, and includes
its own promoter.
www.lifetech.com/gateway
26
The most common cause of an unsuccessful BP Cloning Reaction is failure to plate the
reaction transformations on plates containing kanamycin.
Procedure:
1. Compose reactions on ice.
2. Add TE, BP Reaction Buffer, Donor Vector, and appropriate attB-PCR DNA, and mix well.
3. Remove BP CLONASE Enzyme Mix and thaw on ice (~2 min).
4. Vortex BP CLONASE Enzyme Mix briefly (2 s) twice.
5. Add 4 µl of BP CLONASE Enzyme Mix and mix well by vortexing briefly twice. Return vial to
-70°C.
6. Incubate at 25°C for 60 min.
7. Add 2 µl Proteinase K Solution to all reactions. Incubate for 10 min at 37°C.
8. Transform 1 µl of BP Reaction into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells using
Falcon 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42°C for 30 s. Place on ice
for 1-2 min. Add 450 µl S.O.C. Medium and incubate at 37°C for 1 h.
9. Select on LB plates containing 50 µg/ml kanamycin. (If the E. coli cells have a transformation
efficiency of 108 CFU/µg, the BP Reaction should give about 3,000 colonies if the entire
transformation is plated.)
10. Also transform 2 µl of pUC19 DNA into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells, as
above. Spread 10 µl and 100 µl on LB plates containing 100 µg/ml ampicillin. (Cells with a
tranformation efficiency of 108 CFU/µg should yield about 2,000 colonies if the entire transformation
is plated.)
11. If desired, the percent correct clones in the positive control reaction can be confirmed by streaking
the kanamycin-resistant colonies onto LB plates containing 20 µg/ml tetracycline.
www.lifetech.com/gateway
27
3.3 Creating Expression Clones (Transferring Genes from Entry Clones into Destination
Vectors via the LR Reaction)
The reaction of an Entry Clone (attL) with a Destination Vector (attR) creates a new Expression Clone
(attB).
Materials needed:
• LR Reaction Buffer
• Destination Vector (linearized) ~150 ng/µl. Destination Vectors from Life Technologies are provided
linearized and at a concentration of 150 ng/µl. For preparation and use of Destination Vector DNA,
see Section 5. Use approximately 300 ng per 20-µl reaction.
• Entry Clone (≥30 ng/µl). Use 100-300 ng of Entry Clone per 20-µl reaction.
• pENTR-gus Positive Control at 50 ng/µl. The coding sequence of gus has been cloned with
translational start and stop signals permitting expression in E. coli, as well as in eukaryotic cells.
• LR CLONASE Enzyme Mix (stored at -70°C)
• Proteinase K Solution
• pUC19 DNA, 10 pg/µl
• LIBRARY EFFICIENCY DH5α (≥1 × 108 CFU/µg) or BL21-SI Competent Cells (≥1 × 107 CFU/µg)
• S.O.C. Medium
• LB Plates containing 100 µg/ml ampicillin.
Procedure:
1. Assemble reactions on ice.
2. Add TE, LR Reaction Buffer, and the appropriate Entry Clone and Destination Vector DNAs. Mix
well.
3. Remove LR CLONASE Enzyme Mix from the -70°C freezer, and thaw on ice (~2 min).
www.lifetech.com/gateway
28
www.lifetech.com/gateway
29
4. Troubleshooting
www.lifetech.com/gateway
30
www.lifetech.com/gateway
31
www.lifetech.com/gateway
32
Entry Clones appear to BP recombination reaction may Confirm by either sequence analysis of Entry Clone
lack inserts, migrating as have cloned primer-dimers or by demonstrating that Entry Clone is active in
2.2 kb supercoiled LR Reaction in presence of LR Clonase and
plasmids Destination Vector.
For PCR products >500 bp, purify by precipitating
with one-half volume of 30% PEG 8000/30 mM
MgCl2 Solution, excise the correct size DNA
product band from an agarose gel, and use the
eluted, purified DNA in BP Reaction.
Use PLATINUM Taq DNA Polymerase High
Fidelity, or use "hot-start PCR".
Redesign primers to minimize potential mutual
priming sites leading to primer-dimers.
Low cloning efficiency AttB-PCR primers may contain a For problematic primers >60 nucleotides in length,
of attB- PCR products high percentage of incomplete or purify by PAGE.
incorrect attB sites (most likely
Alternatively, use nested primers, with the second
with primers > 60 nucleotides in
set of primers containing the 25-bp attB sites plus
length)
4 Gs at the 5'-terminus.
Very low cloning Too few PCR molecules added Adjust the amount (ng) of PCR product used to 40-
efficiency of large to BP Reaction 80 fmol of PCR DNA per 20-µl reaction. (For
(>5 kb) attB PCR example, for an 8 kb DNA, 1 fmol ~ 5 ng.)
products
Caution: >400 ng PCR DNA per 20-µl reaction
may inhibit the BP Reaction.
www.lifetech.com/gateway
33
No fusion protein band Incorrect reading frame of Entry Verify that attB PCR primers were designed with
of expected MW visible Clone gene in correct reading frame.
on SDS-PAGE
Verify that Entry Clone was constructed with gene
in correct reading frame.
www.lifetech.com/gateway
34
5. Additional Information
5.1 Converting a Vector into a GATEWAY Destination Vector
Destination Vectors function in the GATEWAY Cloning System because they have two recombination
sites, attR1 and attR2, flanking a chloramphenicol resistance (CmR) gene and a ccdB gene. The
GATEWAY Cloning System recombination reactions exchange the entire Cassette (except for the few
bases that contribute to the attB sites) for the DNA segment of interest from the Entry Vector. Because
attR1, CmR, ccdB gene, and attR2 are contiguous, they can be moved on a single DNA segment. If this
cassette is cloned into a plasmid, the plasmid becomes a Destination Vector. Figure 14 shows a
schematic of the three GATEWAY Cloning System Reading Frame Cassettes. Three cassettes are available
to allow construction of Destination Vectors in any reading frame.
0 a = 1.7 kb
b = 1.7 kb
c = 1.8 kb
Figure 14. Schematic of the GATEWAY Cloning System Reading Frame Cassettes. Three
blunt-end cassettes are available to convert standard expression vectors into Destination Vectors.
Each cassette contains an attR1 site at the 5'-end followed by the chloramphenicol resistance gene
(Cmr) and ccdB gene. The attR2 site is at the 3'- end of the cassette. Each of the cassettes
provides N-terminal and C-terminal fusions in one of three possible reading frames. The unique
restriction sites listed above the line (Mlu I, Bgl II, and Xba I) distinguish the reading frame
cassettes. Restriction endonucleases common to all the cassettes are presented in Table 3.
www.lifetech.com/gateway
35
The protocol for constructing a Destination Vector is presented below. Keep in mind the following
points:
• Destination Vectors must be constructed and propagated in a gyrA462 strain of E. coli, such as
LIBRARY EFFICIENCY DB3.1 Competent Cells, available from Life Technologies, because the ccdB
gene will be lethal to any other strain.
• If the Destination Vector will be used to make a fusion protein, a GATEWAY Cloning System
Reading Frame Cassette with the correct translation reading frame must be used, as discussed in
Section 5.2. The nucleotide sequences at the ends of the cassettes are shown in Figure 15.
• Note that each reading frame cassette has a different unique restriction site between the
chloramphenicol resistance and ccdB genes (Mlu I for reading frame A, Bgl II for reading frame B,
and Xba I for reading frame C).
• Because the reading frame cassettes are blunt-ended, they will clone in both orientations.
Most standard vectors can be converted to Destination Vectors, by inserting the GATEWAY Reading
Frame Cassette into the multiple cloning site (MCS) of that vector. If you are converting a vector that
encodes kanamycin resistance, you will need to use the resulting Destination Vector with Entry Clones
that carry a selection marker other than kanR. For this purpose, you can make your Entry Clone in a BP
Reaction using a Donor Vector with a marker other than kanR, such as tetR or genR (available by
request).
The following steps are required to construct a Destination Vector that will create N-terminal protein
fusions to genes in Entry Clones, via an LR Reaction.
1. If the vector will make an amino-terminal fusion protein, it is necessary to keep the -AAA-AAA-
triplets in attR1 (see Figure 15) in phase with the translation reading frame of the fusion protein,
since this is the reading frame convention employed in all of the N-terminal fusion Destination
Vectors available from Life Technologies and in the construction of attB Expression Clones and attB
PCR products.
Similar considerations are required to construct Destination Vectors that create C-terminal protein
fusions. The C-terminal coding sequences of these vectors should be aligned in phase with -TAC-
AAA- of the attR2 sequences as shown in Figure 15.
www.lifetech.com/gateway
36
Figure 15. Sequences at Ends of GATEWAY Reading Frame Cassettes. The terminal
sequences of the attR1-Cmr-ccdB-attR2 cassettes are shown, including the terminal portions
of the flanking attR sites (boxed). The staggered cleavage sites for Int are indicated in the
boxed regions. Following recombination with an Entry Clone, only the outer (unshaded)
sequences in attR sites contribute to the resulting attB sites in the Expression Clone.
Figure 16. Examples of How to Choose the Correct GATEWAY Reading Frame Cassette
for N-Terminal Fusions.
N-Fusion protein
codon Reading Frame Cassette A
--- NNN NNN ATC ACA AGT TTG TAC AAA AAA GCT ---
--- NNN NNN TAG TGT TCA AAC ATG TTT TTT CGA ---
attR 1
--- NNN NNN NNA TCA ACA AGT TTG TAC AAA AAA GCT ---
--- NNN NNN NNT AGT TGT TCA AAC ATG TTT TTT CGA ---
*cannot be TG or TA
--- NNN NNN NAT CAA ACA AGT TTG TAC AAA AAA GCT ---
--- NNN NNN NTA GTT TGT TCA AAC ATG TTT TTT CGA --- www.lifetech.com/gateway
37
2. Determine which GATEWAY Cloning System Reading Frame Cassette to use as follows:
—Write out the nucleotide sequence of the existing vector near the restriction site into which the
GATEWAY Cloning System Reading Frame Cassette will be cloned. These must be written in
triplets corresponding to the amino acid sequence of the fusion domain.
—Draw a vertical line through the sequence that corresponds to the restriction site end, after it has
been cut and made blunt, i.e., after filling in a protruding 5′-end or polishing a protruding 3′-end.
For N-terminal fusions:
—If the coding sequence of the blunt end terminates after a complete codon triplet, use the Reading
Frame Cassette A. (See Figure 16)
—If the coding sequence of the blunt end encodes two bases of a complete codon triplet, use the
Reading Frame Cassette B.
—If the coding sequence of the blunt end encodes one base of a complete codon triplet, use the
Reading Frame Cassette C.
For C-terminal fusions:
—If the coding sequence of the blunt end terminates after a complete codon triplet, use the Reading
Frame Cassette B. (See Figure 16)
—If the coding sequence of the blunt end encodes two bases of a complete codon triplet, use the
Reading Frame Cassette C.
—If the coding sequence of the blunt end encodes one base of a complete codon triplet, use the
Reading Frame Cassette A.
For preparing a vector that encodes both an N- and C-terminal fusion, care must be taken when
choosing appropriate restriction enzymes for cutting the vector. The resultant ends (after generating
blunt ends) need to be compatible with one of the three cassettes shown in Figure 16.
3. Cut one to five micrograms of the existing plasmid at the position where you wish your gene (flanked
by att sites) to be after the recombination reactions. Note: It is better to remove as many of the MCS
restriction sites as possible at this step. This makes it more likely that restriction endonuclease sites
within the GATEWAY Cloning System Reading Frame Cassette will be unique in the new plasmid,
which is important for linearizing the Destination Vector (Section 5.3).
4. If necessary, convert the ends of the vector to flush double-stranded DNA, so that the vector is
compatible with the blunt ends of the cassette, using either T4 DNA Polymerase or Klenow Fragment
(See protocol in Section 3.2.1B.)
5. Remove the 5′ phosphates with alkaline phosphatase. This increases the probability of success by
decreasing background associated with self-ligation of the vector.
6. Remove dNTPs and small DNA fragments by ethanol precipitation. Dissolve wet precipitate in
200 µl TE, add 100 µl of 30% PEG 8000/30 mM MgCl2, mix well, immediately centrifuge for
10 min at room temperature, discard supernatant, centrifuge again a few seconds, discard any
residual liquid.
7. Dissolve the DNA to a final concentration of 10 - 50 ng per microliter. Apply 20 - 100 ng to a gel
next to Low DNA MASS Ladder and linear size standards to confirm cutting and recovery.
www.lifetech.com/gateway
38
Competent Cells. (The ccdB gene on the GATEWAY Cloning System Reading Frame Cassette will be
lethal to any other strain.)
9. After expression in S.O.C. Medium, plate 10 µl, 100 µl, and remaining cells on agar plates
containing 30 µg/ml chloramphenicol; incubate at 37°C for 16-20 h.
10. Isolate miniprep DNA from single colonies (Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989)
Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, New York). Treat the miniprep with RNase A and store in TE. Cut with the
appropriate restriction endonuclease to determine the orientation of the cassette. Choose clones
with the attR1 site next to the amino end of the protein expression function of the plasmid.
11. To demonstrate that the ccdB gene is functioning properly in a newly constructed Destination Vector
perform the following test.
—Transform equal amounts (10 - 50 pg) of Destination Vector into 100 µl of LIBRARY EFFICIENCY
DH5α and DB3.1 Competent Cells using the protocol provided with the cells. Plate dilutions
onto LB plates containing the appropriate antibiotic.
—As a control for transformation efficiency, transform pUC19 (50 pg) into both strains. Plate
dilutions onto LB plates containing 100 µg/ml ampicillin.
—Normalize the transformation efficiency of both strains to the pUC19 positive control using the
following calculation:
Transformation efficiency (CFU/µg) = colonies/pg of DNA × (1 × 106 pg/µg) × dilution factor(s)
For example, if 50 pg of pUC19 yields 100 colonies when 100 µl of a 1:10 dilution of the
transformation mix is plated, then:
CFU/µg = 100 CFU/50 pg × (1 × 106 pg/µg) × (1 ml/0.1 ml plated) × 10 = 2 × 108
—Calculate the number of colonies obtained in both strains from transformations using the
Destination Vector.
—An acceptable Destination Vector transformed into the permissive strain LIBRARY EFFICIENCY
DB3.1 Competent Cells should give greater than 10,000 times the number of colonies that it will
if transformed into LIBRARY EFFICIENCY DH5α Competent Cells. Any ratio less than 10,000
suggests contamination of the plasmid prep with another ampicillin-resistant plasmid, or an
inactive ccdB gene, or both. DNA with lower ratios can be used, but higher background will likely
be observed.
About ten-fold more colonies result from a GATEWAY Cloning System reaction if the Destination Vector
is linear or relaxed. If the competent cells used are highly competent (>108 per microgram), linearizing
or relaxing the Destination Vector is less essential.
The site or sites used for linearization must be within the GATEWAY Cloning System Reading Frame
Cassette, but not within the ccdB gene. A sampling of the sites that cut within a cassette is shown in
Figure 14. The complete sequence is available on the website.
Mini-prep (alkaline lysis) DNA preparations are adequate for GATEWAY reactions; however, in general,
such DNA can not be quantitated by UV absorbance due to contaminating RNA and nucleotides.
www.lifetech.com/gateway
39
Concentrations can be estimated by gel electrophoresis in comparison with standard DNA, i.e., DNA
MASS Ladder. Alternatively, DNA purified by CONCERT DNA purification systems is recommended.
5.4 "One-Tube" Protocol: A Protocol for Cloning attB-PCR Products Directly into Destination
Vectors.
1. Perform the BP Reaction in 20 µl at 25°C as described in Section 3.2.4, except incubate for 3-4 h.
www.lifetech.com/gateway
40
When working with a clone isolated from a cDNA library constructed in a GATEWAY vector, such as
SUPERSCRIPT cDNA libraries supplied in pCMV•SPORT6 (which contains attB sites), several
considerations must be made before the cDNA clone can be used for protein expression. These include
whether the clone is full-length and how it is to be expressed, either as a native protein, an amino-
terminal (N-terminal) fusion protein, or as a carboxy-terminal (C-terminal) fusion protein.
The following considerations must be kept in mind for expression of a native protein. Life Technologies
supplies many libraries containing full-length open reading frames. Some clones, however, may contain
only a partial reading frame, or may contain not only the entire ORF but 5' untranslated (5' UTR)
sequence as well. Contained within the 5' UTR of a cDNA is the ribosome recognition sequence for the
organism from which the cDNA was derived. Therefore, a full-length cDNA derived from mammalian
cells can be used for native expression in mammalian cells without prior characterization but cannot be
used for native expression in E. coli, as no Shine-Dalgarno sequence is present. When attempting to
express a mammalian cDNA in E. coli, a Shine-Dalgarno sequence must be supplied. This can be done
either by cloning the cDNA into an Entry Vector that contains a Shine-Dalgarno sequence, or by
introducing a Shine-Dalgarno sequence by PCR when amplifying the cDNA with primers also containing
attB sequences and cloning the PCR product by recombination. (See Section 3.2.4 for cloning of PCR
products).
The length and content of the clone is also important in expressing fusion proteins. If the cDNA is full-
length then the 5' UTR will also be translated as a part of the fusion protein. This may present problems
as the additional codons may interfere with the expression or function of the protein. Additionally, the
5' UTR may contain stop codons, which would prevent expression of the protein of interest. If the ORF
is not full-length then a truncated portion of the protein of interest will be expressed within the fusion. To
express any cDNA isolated from a library as an N-terminal fusion protein, the reading frame of the gene
must be in frame with the reading frame of the attB1 site (see Figure 13). In this case, there is one
chance in three that the cDNA will be in frame with the attB1 site and therefore allow for fusion protein
expression. A researcher can construct three Destination Vectors representing all three possible reading
frames through the attB1 sites so that any give cDNA clone can be expressed in one of the three vectors.
Alternatively, to assure that the ORF encoded by the cDNA will be in frame with an N-terminal fusion
protein sequence, PCR may be used to install attB sites, so that the AAA-AAA sequence within attB1 is
in phase with the ORF.
The major consideration in generating C-terminal fusion proteins from cDNAs is the fact that all cDNAs
will contain one or more stop codons, which must be removed before C-terminal fusion expression is
possible. This may be done by subcloning the gene into an Entry Vector so that no stop codon is present.
Alternatively, it may be done by amplifying the gene by PCR using attB primers where the stop codon
has been eliminated from the gene specific sequence.
www.lifetech.com/gateway
41
All Entry Vectors consist of the same vector backbone (outside of the attL sites) but differ in the
sequences and cloning sites provided between the attL sites.
The vector map of pENTR1A, shown here, displays the single-cut restriction enzyme sites in this
prototype vector.
www.lifetech.com/gateway
42
NOTE: In the following figures the amino acids shown before the ccdB gene can be added to the N-
terminus of your protein only if a translation start site is provided in the Destination Vector (such as with
an N-terminal His6 or GST fusion).
NOTE: If a blunt-ended fragment containing a 5′-ATG is cloned into the Xmn I site of pENTR1A, 2B,
3C, or 4, the adenine at position –3 of the underlined ACC sites provides a Kozak eukaryotic ribosome
recognition sequence for initiation of translation.
www.lifetech.com/gateway
43
The underlined AAGGAG/A and ACC sites correspond to the Shine-Dalgarno (prokaryotes) and Kozak
eukaryotic ribosome recognition sequences preceding the initiating ATG.
www.lifetech.com/gateway
44
Recombination Region of the Expression Clone resulting from pDEST8 × Entry Clone:
www.lifetech.com/gateway
The designated reading frame for attB1 and attB2 are provided in Figure 5.
The sequence has not been confirmed by sequence analysis. It was assembled from the known sequence of fragments used to
construct the vector. The sequence and the location of sites for restriction endonucleases that cleave up to ten times can be found
in the TECH-ONLINESM section of Life Technologies' web page, http://www.lifetech.com.
45
Recombination Region of the Expression Clone resulting from pDEST10 × Entry Clone:
Recombination Region of the Expression Clone resulting from pDEST12.2 × Entry Clone:
www.lifetech.com/gateway
The designated reading frame for attB1 and attB2 are provided in Figure 5.
The sequence has not been confirmed by sequence analysis. It was assembled from the known sequence of fragments used to
construct the vector. The sequence and the location of sites for restriction endonucleases that cleave up to ten times can be found
in the TECH-ONLINESM section of Life Technologies' web page, http://www.lifetech.com.
47
Recombination Region of the Expression Clone resulting from pDEST14 × Entry Clone:
www.lifetech.com/gateway
The designated reading frame for attB1 and attB2 are provided in Figure 5.
The sequence has not been confirmed by sequence analysis. It was assembled from the known sequence of fragments used to
construct the vector. The sequence and the location of sites for restriction endonucleases that cleave up to ten times can be found
in the TECH-ONLINESM section of Life Technologies' web page, http://www.lifetech.com.
48
Recombination Region of the Expression Clone resulting from pDEST15 × Entry Clone:
www.lifetech.com/gateway
The designated reading frame for attB1 and attB2 are provided in Figure 5.
The sequence has not been confirmed by sequence analysis. It was assembled from the known sequence of fragments used to
construct the vector. The sequence and the location of sites for restriction endonucleases that cleave up to ten times can be found
in the TECH-ONLINESM section of Life Technologies' web page, http://www.lifetech.com.
49
Figure 29 pDEST17
6X Histidine Affinity Tag Amino-Fusion in E. coli, T7 Promoter
Map of GATEWAY pDEST17 Vector. DNA from the Entry Clone replaces the region between
nucleotides 148 and 1829.
Recombination Region of the Expression Clone resulting from pDEST17 × Entry Clone:
www.lifetech.com/gateway
The designated reading frame for attB1 and attB2 are provided in Figure 5.
The sequence has not been confirmed by sequence analysis. It was assembled from the known sequence of fragments used to
construct the vector. The sequence and the location of sites for restriction endonucleases that cleave up to ten times can be found
in the TECH-ONLINESM section of Life Technologies' web page, http://www.lifetech.com.
50
Recombination Region of the Expression Clone resulting from pDEST20 × Entry Clone:
www.lifetech.com/gateway
The designated reading frame for attB1 and attB2 are provided in Figure 5.
The sequence has not been confirmed by sequence analysis. It was assembled from the known sequence of fragments used to
construct the vector. The sequence and the location of sites for restriction endonucleases that cleave up to ten times can be found
in the TECH-ONLINESM section of Life Technologies' web page, http://www.lifetech.com.
51
Recombination Region of the Expression Clone resulting from pDEST26 × Entry Clone:
www.lifetech.com/gateway
The designated reading frame for attB1 and attB2 are provided in Figure 5.
The sequence has not been confirmed by sequence analysis. It was assembled from the known sequence of fragments used to
construct the vector. The sequence and the location of sites for restriction endonucleases that cleave up to ten times can be found
in the TECH-ONLINESM section of Life Technologies' web page, http://www.lifetech.com.
52
Recombination Region of the Expression Clone resulting from pDEST27 × Entry Clone:
www.lifetech.com/gateway
The designated reading frame for attB1 and attB2 are provided in Figure 5.
The sequence has not been confirmed by sequence analysis. It was assembled from the known sequence of fragments used to
construct the vector. The sequence and the location of sites for restriction endonucleases that cleave up to ten times can be found
in the TECH-ONLINESM section of Life Technologies' web page, http://www.lifetech.com.
53
Table 4. Restriction Endonucleases That Do Not Cleave the Destination Vectors, or Cleave Twice
www.lifetech.com/gateway
54
www.lifetech.com/gateway
55
www.lifetech.com/gateway
56
www.lifetech.com/gateway
57
6. Related Products
Product Size Cat. No.
Systems
PCR Cloning System (with GATEWAY Technology) 20 reactions 11821-014
(Contains: GATEWAY BP CLONASE™ Enzyme Mix, reaction buffers, pDONR201 vector,
Proteinase K Solution, 30% PEG/Mg Solution, LIBRARY EFFICIENCY DH5α Competent
Cells, positive control and protocol)
E. coli Expression System (with GATEWAY Technology) (with LIBRARY 20 reactions 11822-012
EFFICIENCY DH5α Competent Cells)
(Contains: GATEWAY LR CLONASE™ Enzyme Mix, reaction buffers, pDEST14, pDEST15,
pDEST17 vectors, Proteinase K Solution, LIBRARY EFFICIENCY DH5α Competent Cells,
positive control and protocol)
E. coli Expression System (with GATEWAY Technology) (with BL21-SI 20 reactions 11823-010
Competent Cells)
(Contains: GATEWAY LR CLONASE Enzyme Mix, reaction buffers, pDEST14, pDEST15,
pDEST17 vectors, Proteinase K Solution, BL21-SI Competent Cells, positive control and
protocol)
1
The Baculovirus Expression System (with GATEWAY Technology) provides all the components necessary to
construct the GATEWAY version of the pFASTBAC™ clone. Once constructed, this clone can be used in conjunction
with the BAC-TO-BAC® Baculovirus Expression System to generate (by in vivo recombination with a bacmid) a
recombinant baculovirus vector for expression in insect cells. Components from the BAC-TO-BAC Baculovirus
Expression System that are also required include MAX EFFICIENCY® DH10BAC® cells, CELLFECTIN® Reagent, and
insect cells for expression. Refer to the BAC-TO-BAC® Baculovirus Expression System manual (which can be found
on our web site) for more information regarding this system.
www.lifetech.com/gateway
58
www.lifetech.com/gateway
59
PCR/RT-PCR Products:
Custom Primers-Gateway attB modifications*
PLATINUM Pfx DNA Polymerase 50 units 11708-047
PLATINUM Taq DNA Polymerase High Fidelity 500 units 11304-029
TAQUENCH PCR Cloning Enhancer 100 units 11265-014
THERMOSCRIPT™ RT-PCR System plus PLATINUM Taq 100 reactions 11146-040
DNA Polymerase High Fidelity
www.lifetech.com/gateway
60
www.lifetech.com/gateway