Gatewayman PDF

GATEWAY™ Cloning Technology
Version 1
Note: This product is covered by a Limited Label License (see Section 1.3).The consideration paid for
this product grants a Limited License with a paid up royalty to use the product pursuant to the
terms set forth in the accompanying Limited Label License. By use of this product, you accept
the terms and conditions of the Limited Label License.
Table of Contents
1. Notices to Customer…………………………………………………………………….…….….….. 1
1.1 Important Information…………………………………………………………………...……. 1
1.2 Precautions…………………………………………………………………………….…..….. 1
1.3 Limited Label License………………………………………………………………….…..…. 1
2. Overview…………………………………………………………………………………….……..… 3
2.1 Two Reactions Constitute the GATEWAY™ Cloning System………………………...…..….. 4
2.2 Basis of GATEWAY Recombination Reactions……………………………………………….. 5
2.3 Details of the GATEWAY Cloning Reactions……………………………………………………6
2.4 Entry Vectors and Entry Clones……………………………………………………..……….. 8
2.5 Destination Vectors………………………………………………………………….………..10
2.6 Protein Expression in the GATEWAY Cloning System……………………………….……… 11
2.7 Considerations in Designing Entry Clones………………………………………………….. 12
2.7.1 Location of Translation Start Sequences…………………………………………… 12
2.7.2 Reading Frame………………………………………………………………………. 13
2.7.3 Examples of Sequences for Different Protein Constructs…………………………... 13
2.7.4 Transcription from Entry Clones…………………………………………………… 15
2.8 Choosing the Right Entry Vector…………………………………………………….……… 15
2.8.1 Features of the Entry Vectors………………………………………………………. 15
2.8.2 Entry Vector pENTR™11………………………………………………………….. 16
2.9 GATEWAY Nomenclature………………………………………………………………..….... 17
3. Methods………………………………………………………………………………………...…… 18
3.1 General Comments………………………………………………………………...………… 18
3.2 Creating an Entry Clone…………………………………………………………....………... 19
3.2.1 Cloning Genes into Entry Vectors using Restriction Endonucleases and Ligase……19
3.2.2 Cloning cDNA Libraries into Entry Vectors using Restriction
Endonucleases and Ligase……………………………………………………………21
3.2.3 Transferring Genes from Expression Clones into Entry Vectors via the BP Reaction... 22
3.2.4 Cloning of attB-PCR Products via the BP Reaction……………………………….. 23
3.3 Creating Expression Clones (Transferring Genes from Entry Clones into Destination
Vectors via the LR Reaction).……………………………………………………...……….... 27
4. Troubleshooting………………………………..…………………………………………………… 29
5. Additional Information…………….………………………………..……………………………… 34
5.1 Converting a Vector into a GATEWAY Destination Vector………………………...………... 34
5.2 Protocol for Making a Destination Vector……………………………………………....…... 35
5.3 Using the Destination Vector in the GATEWAY Cloning System…………………….….…... 38
5.4 "One-tube" Protocol: A Protocol for Cloning attB-PCR products directly into
Destination Vectors …………………………………………………..………….….….…… 39
5.5 Transferring Clones from cDNA Libraries Made in GATEWAY Vectors…………..….…….. 40
5.6 Detailed Descriptions of the Vectors of the GATEWAY Cloning System………….….….….. 41
6. Related Products …………………………………………………………..………….….…………. 57
Figures and Tables

Figure 1. Transferring a DNA Segment (Gene) between an Entry Clone and Multiple Destination
Vectors. ... .....................................................................................................................................3
Figure 2. GATEWAY Cloning Reactions: The LR Reaction. . ......................................................................4
Figure 3. GATEWAY Cloning Reactions: The BP Reaction. . .....................................................................5
www.lifetech.com/gateway
Figure 4. Bacteriophage Lambda Recombination in E. coli. . .....................................................................6
Figure 5. GATEWAY Cloning Technology as an Operating System for Cloning and Subcloning Genes. .. 6
Figure 6. Sequences of attB1 and attB2 Sites Flanking a Gene after Subcloning into a Destination
Vector to Create an Expression Clone..........................................................................................7
Figure 7. DNA Molecules Participating in the LR Reaction. . ....................................................................8
Figure 8. Four Ways to Make Entry Clones.. ..............................................................................................9
Figure 9. Schematic of Available Entry Vectors. ......................................................................................10
Figure 10. Cloning A PCR Product by the BP Reaction............................................................................11
Figure 11. Examples of Different Protein Expression Constructs. ...........................................................13
Figure 12. Two Types of GATEWAY Protein Expression...........................................................................16
Figure 13. attB Sequences to Add to Primers for PCR Cloning into an Entry Vector. ............................24
Figure 14. Schematic of the GATEWAY Cloning System Reading Frame Cassettes. ................................34
Figure 15. Sequences at Ends of GATEWAY Reading Frame Cassettes. ...................................................36
Figure 16. Examples of How to Choose the Correct GATEWAY Reading Frame Cassette for N-Terminal
Fusions. . ...................................................................................................................................36
Figure 17. One-Tube Protocol for Cloning PCR Products Directly into Destination Vectors. ................39
Figure 18. Vector Map of Typical Entry Vector.……………………………………………………….. 41
Figure 19. Cloning Sites of the Entry Vector pENTR™1A……………………………………………...42
Figure 20. Cloning Sites of the Entry Vector pENTR2B……………………………………………..….42
Figure 21. Cloning Sites of the Entry Vector pENTR3C……………………………………………..….43
Figure 22. Cloning Sites of the Entry Vector pENTR4……………………………………………….….43
Figure 23. Cloning Sites of the Entry Vector pENTR11……………………………………………...….43
Figure 24. pDEST™8…………………………………………………………………………………….44
Figure 25. pDEST10……………………………………………………………………………………...45
Figure 26. pDEST12.2……………………………………………………………………………………46
Figure 27. pDEST14…………………………………………………………………………………….. 47
Figure 28. pDEST15…………………………………………………………………………………….. 48
Figure 29. pDEST17…………………………………………………………………………………….. 49
Figure 30. pDEST20…………………………………………………………………………………….. 50
Figure 31. pDEST26…………………………………………………………………………………….. 51
Figure 32. pDEST27…………………………………………………………………………………….. 52
Figure 33. pDONR™201…………………………………………………………………………………56
Table 1. Available Entry Vectors.................................................................................................................9

Table 2. Available Destination Vectors .....................................................................................................12
Table 3. Location of Cleavage Sites for a Selection of Restriction Endonucleases. .................................35
Table 4. Restriction Endonucleases Restriction Endonucleases That Do Not Cleave the Destination
Vectors, or Cleave Twice…………………………………………………………………………….. 53
BAC-TO-BAC®, BENCHMARK™, CELLFECTIN®, CLONASE™, CLONECHECKER™, CONCERT™, DH5α™, DB3.1™,

DH10BAC™, GATEWAY™, GENETICIN®, FOCUS®‚ 1 Kb PLUS DNA LADDER™, LIPOFECTAMINE™, LIBRARY
EFFICIENCY®, MASS™, MAX EFFICIENCY®, pDEST™, pDONR™, pENTR™, pFASTBAC™, PLATINUM®,
PROQUEST™, REACT®, SUPERSCRIPT™, TAQUENCH™, TECH-LINESM, THERMOSCRIPT™, and the Life
Technologies logo are marks of Life Technologies, Inc.
Kodak Digital Science™ is a trademark of Eastman Kodak Co.
Falcon® is a registered trademark of Becton Dickinson & Company.
1
1. Notices to Customer
1.1 Important Information
This product is authorized for laboratory research use only. The product has not been qualified or found
safe and effective for any human or animal diagnostic or therapeutic application. Uses for other than the
labeled intended use may be a violation of applicable law.
1.2 Precautions
Warning: This product contains hazardous reagents. It is the end-user’s responsibility to consult the
applicable MSDS(s) before using this product. Disposal of waste organics, acids, bases, and radioactive
materials must comply with all appropriate federal, state, and local regulations. If you have any questions
concerning the hazards associated with this product, please call the Life Technologies, Inc.
Environmental Health and Safety Chemical Emergency hotline at (301) 431-8585.
1.3 Limited Label License

This product and its use is the subject of U.S. Patent 5,888,732 and other pending U.S. and foreign patent
applications owned by Life Technologies, Inc. (LTI). Use of this product requires a license from LTI.
Academic, Not-for-Profit and For-Profit institutions acquire certain limited nontransferable rights with the
purchase of this product (see below).
Academic and Not-For-Profit Institutions: The purchase price of this product includes limited,
nontransferable rights for non-profit and academic institutions to use only the purchased amount of the product
to practice recombinational cloning solely for internal research purposes, but does not provide rights to
perform amplification using primers containing recombination sites or portions thereof. Rights for performing
amplification using primers containing att recombination sites or portions thereof solely for internal research
purposes may be obtained by purchasing such primers from LTI or from a licensed supplier of such primers.
LTI reserves all other rights and in particular, the purchaser of this product can not transfer or otherwise sell
this product or its components to a third party and no rights are conveyed to the purchaser to use the product or
its components for commercial purposes as defined below. Academic and non-profit institutions must obtain a
license from LTI to acquire rights to use this product for any purpose other than those permitted above.
For-Profit Institutions: The purchase price of this product includes limited, nontransferable rights for for-
profit institutions to use only the purchased amount of the product up to but no more than 5000 µl of
CLONASE™ products per year per site to practice recombinational cloning solely for internal research
purposes, but does not provide rights to perform amplification using primers containing recombination sites or
portions thereof. Rights for performing amplification using primers containing att recombination sites or
portions thereof solely for internal research purposes may be obtained by purchasing such primers from LTI or
from a licensed supplier of such primers. LTI reserves all other rights and in particular, the purchaser of this
product can not transfer or otherwise sell this product or its components to a third party and no rights are
conveyed to the purchaser to use the product or its components for commercial purposes as defined below.
For-Profit institutions must obtain a license from LTI to use this product for any purpose other than those
permitted above.
Commercial purposes means any activity for which a party receives consideration and may include, but is not
limited to, (1) use of the product or its components in manufacturing, (2) use of the product or its components
to provide a service, information or data, (3) use of the product or its components for diagnostic purposes, (4)
transfer or sell vectors, clones, or libraries made with the product or components of the product, or (5) resell
the product or its components, whether or not such product or its components are resold for use in research.
2
If the purchaser is not willing to accept these use limitations, LTI is willing to accept return of the product for a
full refund. For information on obtaining a license, contact the Director of Licensing, 9800 Medical Center
Drive, Rockville, MD 20850, phone (301) 610-8000, fax (301) 610-8383.
Products 11827-011, 11804-010, 11806-015, 11807-013 are sold under patent license from Monsanto for
research purposes only and no license for commercial use is included. Requests for licenses for commercial
manufacture or use should be directed to Director, Monsanto Corporate Research, 800 N. Lindbergh, St.
Louis, MO 63167.
Products 11822-012, 11823-010, 11826-013, 11827-011, 11803-012, 11806-015, 11809-019 are provided with
a license for research use only. Information in respect of licenses to use the product for purposes other than
research may be obtained from F. Hoffmann-LaRoche Ltd, Corporate Licensing, 4002 Basel Switzerland.
Vectors containing the His6 affinity purification tag are manufactured for Life Technologies™ by QIAGEN,
Inc.
Ni-NTA resin may be purchased from QIAGEN, Inc., 9600 De Soto Ave., Chatsworth, CA 91311. (800-426-
8157).
The composition and/or use of the BL21-SI COMPETENT CELL is claimed in patents and patent applications
licensed to Life Technologies, Inc. ("LTI") (i) by Brookhaven Science Associates, LLC (U.S. Patent Nos.
4,952,496 and 5,693,489 and U.S. Submission 08/784,201) and (ii) by The Council of Scientific and Industrial
Research ("CSIR") (U.S. Patent No. 5,830,690.)
The "T7 expression system" and its improvements are based on technology developed at Brookhaven National
Laboratory under contract with the U.S. Department of Energy and separately by CSIR, and are the subject of
patents and patent applications assigned to Brookhaven Science Associates, LLC ("BSA", see above) and
CSIR respectively. By provisions of the Distribution License Agreements granted to Life Technologies, Inc.
covering said patents and patent applications, LTI grants you a non-exclusive sub-license for the use of this
technology, including the enclosed materials, based upon the following conditions:
(i) University/Academic and Not-for-Profit Institutions: The purchase of this product conveys to University,
Academic and Not-for-Profit Institutions the right to use the BL21-SI C OMPETENT CELLS only for internal
non-commercial research purposes.
(ii) For-Profit Organizations: For-profit organizations inside the United States must obtain a license from
Brookhaven Science Associates, LLC prior to purchasing and using the BL21-SI COMPETENT CELLS, for
research or commercial purposes. For information about obtaining the required license to purchase, use
and practice the "T7 expression system", please contact The Office of Technology Transfer, Brookhaven
National Laboratory, Bldg. 475D, P.O. Box 5000, Upton, New York, 11973-5000, Telephone (516) 344-
7134.
(iii) Commercial Use: Commercial use of this product may require an additional license to the improvements.
For information about obtaining a commercial license to purchase, use and practice the improvements to
the "T7 expression system", please contact The Centre for Cellular and Molecular Biology, Uppal Road,
Hybderabad, 500 007, India, Attention: Director, Telecopier 91-40-717-1195.
(iv) Usage Restrictions: No materials that contain the cloned copy of the T7 gene 1, the gene for T7 RNA
polymerase, may be distributed further to third parties outside of your laboratory, unless the recipient
receives a copy of this sub-license and agrees to be bound by its terms. This limitation applies to strains
BL21(DE3), BL21(DE3)pLysS and BL21(DE3)pLysE, CE6, BL21-SI Competent Cells and any
derivatives that are made of them.
3
2. Overview
GATEWAY Cloning Technology is a powerful new methodology that greatly facilitates protein
expression, cloning of PCR products, and analysis of gene function by replacing restriction
endonucleases and ligase with site-specific recombination. The GATEWAY Cloning Technology
provides:
• Transfer, in parallel, of one or more DNA Gene
Gene Gene
sequences into multiple types of vectors GST
(Figure 1). His 6 Trx
• Rapid, efficient cloning – and expression – of
PCR products, of a wide range of sizes. L2
L1 Gene
• Faithful maintenance of orientation and Gene
Gene
reading frame of the transferred DNA ptrc

Entry
Your
sequence. Vector
Clone
• Generation of a high percentage of correct
colonies (usually >99%), minimizing the need
Gene
for screening. Gene
•
Gene
Robust reactions that are simple to perform 2-Hybrid FastBac
(works well using miniprep DNA). CMV-neo

• A completely versatile system. Virtually any
standard cloning or expression vector can be
converted to a GATEWAY-compatible vector Figure 1. Transferring a DNA Segment (Gene)
(creating a Destination Vector). between an Entry Clone and Multiple
• An "operating system" for the exchange and Destination Vectors. DNA segments can be
immediate use of validated clones and transferred from an Entry Clone into any number of
expression vectors between different recipient vectors (Destination Vectors) to generate
laboratories. Once gene sequences are Expression Clones, or from Expression Clones back
converted to Entry Clones, they can be into Entry Clones.
subcloned into virtually any type of
Destination Vector, maintaining reading frame and orientation.
• Maximum flexibility to easily transfer DNA sequences from one expression vector into another. This
greatly speeds validation of clones, for example, in a two-hybrid screen.
• Reactions can be automated.
GATEWAY Cloning Technology provides a versatile system for transferring DNA segments between
vectors. Once in the system, DNA segments can be transferred from an Entry Clone into numerous vectors
(e.g., for protein expression) or from the Expression vector back into Entry Clones. Several options are
available for creating Entry Clones. These include:
• GATEWAY cloning (via the BP Reaction) of PCR products flanked by attB recombination sites to
generate Entry Clones.
• Cloning by standard recombinant DNA methods of restriction enzyme-generated fragments
directly into Entry Vectors.
• GATEWAY cloning (via the BP Reaction) into Entry Vectors of genes from genomic or cDNA
libraries prepared in attB-containing GATEWAY vectors. (See the following sections.)
4
2.1 Two Reactions Constitute the GATEWAY Cloning System
The first reaction, the LR Reaction, (Figure

2) is the main pathway of this system. The Entry Clone
L1 L2
LR Reaction is a recombination reaction Gene
between an Entry Clone and a Destination 100 bp 100 bp
Destination Vector
Vector (pDESTTM), mediated by the LR pENTR-gene R1 R2
ccdB
CLONASE mix of recombination proteins. + 125 bp
Knr
125 bp
This reaction transfers DNA segments (e.g., pDEST
cDNA, genomic DNA, or gene sequences) in
the Entry Clone to the Destination Vector, to Ap r
create an Expression Clone. LR CLONASE
Enzyme Mix Incubate ~60 min
(Int, IHF, Xis) at 25˚C
The sites labeled L, R, B, and P are
respectively the attL, attR, attB, and attP By-product
recombination sites for bacteriophage lambda P1
ccdB
P2
(λ) in E. coli (See Section 2.2). These sites are Expression Clone 200 bp 200 bp
B1 B2
specifically recognized by the recombination Gene +
proteins that constitute the CLONASE Enzyme 25 bp 25 bp
Knr
Mix cocktails. The GATEWAY cloning pEXP-gene
reactions are equivalent to concerted, highly

specific, cutting and ligation reactions. Ap r
Viewed in this way, the recombination Transform E. coli
proteins cut to the left and right of the gene in
the Entry Clone and ligate it into the
Destination Vector, creating a new Expression Ap r Colonies Next Day (>90% Correct Clones)
Clone. During this process, reading frame is
maintained. Figure 2. GATEWAY Cloning Reactions: The LR
Reaction. An Entry Clone, containing a gene flanked by
The gene in an Expression Clone is flanked by recombination sites, recombines with a Destination
attB1 and attB2 sites. The orientation of the Vector to yield an Expression Clone and a by-product
gene is maintained throughout the subcloning, plasmid. The result is that a gene sequence in the Entry
because attL1 reacts only with attR1, and Clone is transferred into an Expression Vector, donated
attL2 reacts only with attR2. by the Destination Vector. The by-product plasmid
contains the ccdB gene, and hence gives rise to no
When an aliquot from the recombination colonies when using standard strains of E. coli.
reaction is introduced into E. coli, the desired
transformants can be selected on plates containing ampicillin. The unreacted Destination Vector does not
give ampicillin-resistant colonies, even though it carries the ampicillin-resistance gene, because it
contains a gene lethal to E. coli, ccdB. Thus selection for ampicillin resistance selects for E. coli cells
that carry the desired product, which usually comprise >99% of the colonies on the ampicillin plate.
Expression Clones can express either native or fusion proteins. For native (non-fusion) proteins, the
coding sequence together with its translational start and stop signals is flanked by attB recombination
sites. As a consequence, the attB1 sequence resides in the 5′ untranslated region of the mRNA. In N-
terminal fusion proteins, in contrast, the 25 bp attB1 site becomes part of the coding sequence and inserts
an additional eight amino acids between the fusion domain and the protein encoded by a gene. For C-
terminal fusions, the attB2 sequence adds an additional eight codons between the gene and the C-
terminal fusion sequence.
5
Expression Clone The second major pathway of the

B1 B2
Gene
GATEWAY Cloning System is the BP
25 bp 25 bp Reaction, shown in Figure 3. Essentially
pEXP-gene the reverse of the LR Reaction, the BP
Donor Vector Reaction transfers the gene in the
P1 P2
Ap r + ccdB Expression Clone (between attB sites) into
200 bp 200 bp a Donor vector (containing attP sites), to
pDONR produce a new Entry Clone (attL sites).
This reaction is catalyzed by the BP
Kn r
CLONASE mix of recombination proteins.
BP CLONASE Once a gene is flanked by attL sites as an
Enzyme Mix Incubate ~60 min
(Int + IHF) at 25˚C Entry Clone, it can be transferred into new
expression vectors by recombination with
By-product
R1 R2 Destination Vectors (via the LR Reaction).
ccdB
125 bp 125 bp
A major use of the BP Reaction is for
Entry Clone
L1 L2 + cloning PCR products as Entry Clones.
Gene
100 bp 100 bp
Ap r PCR products made with primers
containing terminal attB sites (25
pENTR-gene
nucleotides + 4 Gs) are efficient substrates
for the BP reaction. The result is an Entry
Kn r
Clone containing the PCR fragment. Such
Transform E. coli Entry Clones can be readily recombined
with Destination Vectors (through the LR
Reaction) to yield Expression Clones of
Kn r Colonies Next Day (>90% Correct Clones) the PCR product.
Figure 3. GATEWAY Cloning Reactions: The BP 2.2 Basis of GATEWAY Recombination

Reaction. A gene in an Expression Clone can be Reactions
transferred into an Entry Vector by the BP Reaction.
Only plasmids without the ccdB gene that are also The recombination reactions of the
kanamycin resistant (Knr) will yield colonies. GATEWAY Cloning Technology are based
on the site-specific recombination
reactions of bacteriophage λ in E. coli.
Bacteriophage λ can grow as a lytic phage, in which case the host cell is lysed, with the release of
progeny virus. Alternatively, lambda can integrate site-specifically into the genome of E. coli by a
process called lysogenization. In this lysogenic state, the phage genome can be transmitted to daughter
cells for many generations, until conditions arise that trigger its excision from the genome. At this point,
the virus enters the lytic part of its life cycle. The control of the switch between the lytic and lysogenic
pathways is one of the best understood processes in molecular biology (Ptashne, M (1992) A Genetic
Switch, Cell Press, Cambridge). See Figure 4.
The integrative and excisive recombination reactions of phage λ are mediated by proteins encoded by
phage λ and E. coli. These recombination reactions, performed in vitro, are the basis of the GATEWAY
Cloning Technology. They can be represented as follows:
attB x attP ⇔ attL x attR (where “x” signifies recombination).
The four att sites contain binding sites for the proteins that mediate the reactions. The wild type attP,
attB, attL, and attR sites contain 243, 25, 100, and 168 base pairs, respectively. The attB x attP reaction
6
(integration) is mediated by the proteins Int and IHF.

The attL x attR reaction (excision) is mediated by the
proteins Int, IHF, and Xis. Int (integrase) and Xis Phage Lambda
(excisionase) are encoded by the λ genome, while attP

(243 bp)
IHF (integration host factor) is an E. coli protein.

[For a general review of lambda recombination, see
E. coli Genome
Landy, A. (1989) Annu. Rev. Biochem. 58, 913.]
attB (25 bp)
By using a combination of the LR and BP reactions, a Integration Excision

(Int, IHF) (Int,Xis,IHF)
gene or DNA segment can be easily moved between
Entry Clones and Expression Clones. This versatility attL attR
E. coli Genome (100 bp) (168 bp)
provides an operating system in which genes can be
Lambda Genome
transferred easily into different vector backbones.
(See Figure 5)
Figure 4. Bacteriophage Lambda
2.3 Details of the GATEWAY Cloning Reactions
Recombination in E. coli.
The LR CLONASE Enzyme Mix that mediates the
GATEWAY LR Reaction contains λ recombination
proteins Int, Xis, and the E. coli-encoded protein IHF.
In contrast, the BP CLONASE Enzyme Mix, which
mediates the BP Reaction (Figure 3) contains Int and
IHF, alone.
Restriction Enzyme
and Ligase Cloning
By-Product Entry Clone Destination Vector

ccdB GENE ccdB
attR1 attR2 attL1 attL2 attR1 attR2
BP Reaction LR Reaction
Donor Vector Expression Clone By-Product

ccdB GENE ccdB
attP1 attP2 attB1 attB2 attP1 attP2
PCR Product
GENE
attB1 attB2
Figure 5. GATEWAY Cloning Technology as an Operating System for

Cloning and Subcloning Genes. Once a DNA segment is cloned into the
GATEWAY system, it can be easily transferred from an Entry Clone into a
Destination Vector (via the LR reaction) to generate an Expression clone. A DNA
segment in an Expression Clone can be easily transferred into an attP pDONR
vector (via the BP reaction) to generate an Entry Clone and then into different
Destination Vectors, all without the need for restriction enzymes and ligase.
7
Note that the recombination reaction is conservative, i.e., there is no net synthesis or loss of base pairs.
The DNA segments that flank the recombination sites are merely switched. The wild type λ
recombination sites have been modified for purposes of the GATEWAY Cloning System, as follows:
• A part (43 bp) of attR has been removed, to make the excisive reaction irreversible and more
efficient [Bushman, W., Thompson, J.F., Vargas, L., and Landy, A. (1985), Science 230, 906). The
attR sites in GATEWAY Cloning System Destination Vectors are 125 bp in length.
• Mutations have been made to the core regions of the att sites to eliminate stop codons and to ensure
specificity of the recombination reactions (i.e., attR1 reacts only with attL1, attR2 reacts only with
attL2).
• Other mutations have been introduced into the short (5 bp) regions flanking the 15-bp core regions
of the attB sites to minimize secondary structure formation in single-stranded forms of attB plasmids,
e.g., in phagemid ssDNA or in mRNA.
The recombination (att) sites of each vector comprise a hybrid sequence, donated by the parental vectors.
The staggered lines dividing the two portions of each att site, in Figure 2, Figure 3, and Figure 6
represent the seven-base staggered cut produced by Int during the recombination reactions.
This structure is shown in greater detail in Figure 6, which displays the recombination sequences of an
attB Expression Clone, generated by recombination between the attL1 and attL2 sites of an Entry Clone
and the attR1 and attR2 sites of a Destination Vector.
The gene in the Expression

Clone is flanked by attB sites:
attB1 to the left (amino
terminus) and attB2 to the right
(carboxy terminus). As shown,
the bases within the 25-bp attB
site that are adjacent to the gene
are donated by the attL sites of
the Entry Vector; whereas the
attB sequences distal to the
gene derive from the
Destination Vector (attR).
Within the attB sites, these two
regions are demarcated by the
seven-base staggered cut
produced by Int during the
Figure 6. Sequences of attB1 and attB2 Sites Flanking a Gene recombination reaction. The
sequence of both attB sites is
after Subcloning into a Destination Vector to Create an
displayed (Figure 6) in triplets
Expression Clone.
corresponding to one of three
possible open reading frames.
If the reading frame of the gene cloned in the Entry Vector is in phase with the reading frame shown for
attB1 (note the –AAA-AAA-), amino-terminal protein fusions can be made between the gene and any
Destination Vector encoding an amino-terminal fusion domain. An analogous convention is followed for
8
making C-terminal fusions with

Gene ccdB Destination Vectors encoding C-terminal
attL1 attL2 fusion domains (See Sections 2.7.2 and
attR1 attR2
5.2).
Entry Clone Destination
attL2 X attR2 Vector
Figure 7 illustrates how an Entry Clone
and a Destination Vector recombine in
Knr Apr
the LR Reaction to form a co-integrate,
Gene which resolves through a second reaction
attL1
attB2 into two daughter molecules. A similar
process occurs during the BP Reaction.
Apr
Knr Co-integrate The two daughter molecules have the

same structure regardless of which pair of
attR1 sites, attL1 and attR1 or attL2 and attR2,
react first to form the co-integrate. The
attP2
ccdB segments change partners by these
Gene ccdB reactions, regardless of whether the
attL1 X attR1
attB2
parental molecules are both circular, one
attB1
is circular and one is linear, or both are
Expression linear. Selection for ampicillin resistance
attP1 By-product attP2
Clone
carried on the Destination Vector, which
Apr Knr
also carries the ccdB gene, ensures
survival of only the desired attB product
plasmid.
Figure 7. DNA Molecules Participating in the LR
Reaction. Two different co-integrates form during the LR 2.4 Entry Vectors and Entry Clones
Reaction (only one of which is shown here), depending on
whether attL1 and attR1 or attL2 and attR2 are first to The LR Reaction allows transfer of a
recombine. gene sequence into new expression
vectors by recombining an Entry Clone
with various Destination Vectors. To participate in the LR Reaction, the DNA segment of interest must
be flanked by attL1 and attL2 sites to create an Entry Clone. Entry Clones can be made in one of four
ways, as shown in Figure 8.
The first approach is to clone the gene into one or more of the Entry Vectors, using standard recombinant
DNA methods, with restriction endonucleases and ligase. The starting DNA fragment can be generated
by restriction endonuclease digestion or as a PCR product. The fragment is cloned between the attL1
and attL2 recombination sites in the Entry Vector. Note that the ccdB gene, provided to minimize
background colonies from incompletely digested Entry Vector, must be excised and replaced by your
DNA.
A schematic of the Entry Vectors and summary of their features is shown in Figure 9. Five Entry
Vectors currently are available, providing an array of cloning options. All carry the kanamycin
resistance gene. Table 1 provides information on the available Entry Vectors and details of their cloning
sites. Choosing the right Entry Vector is discussed in depth in Section 2.7.2.
9
Table 1. Available Entry Vectors
Name Cloning Features Expression Features

pENTR1A Alternative reading frame vectors for N-terminal or C-terminal fusions in E. coli or
pENTR2B N-terminal fusions. Multiple cloning site eukaryotic cells.
pENTR3C (MCS) immediately follows attL1. First
Native expression and carboxy fusions require
restriction endonuclease cut site yields
addition of ribosome recognition sequence
blunt ends.
and ATG translation initiation codon.
pENTR4 MCS immediately follows attL1. First C-terminal fusions require that no stop
restriction endonuclease site is Nco I. codons precede attL2.
pENTR11 Two good E. coli and eukaryotic Native, N-terminal or C-terminal fusions in
ribosome binding sites (SD and Kozak) E. coli or eukaryotic cells.
downstream of attL1. Blunt and Nco I
C-terminal fusions require that no stop
sites each preceded by SD and Kozak.
codons precede attL2.
A second way to obtain Entry Clones

cDNA
Library
is to prepare a cDNA library in an
Gene L1 L2 Entry (attL) Vector. Individual Entry
+ Restriction Enzymes
and Ligase Entry Clones, as well as populations of
+ Clone/Library Entry Clones, can be transferred
L1 L2 1 Kn r directly into the desired Destination
Entry Vector 2 Vectors.
L1 L2
Gene
Knr The third approach to making an
Entry Clone Entry Clone (Figure 8) is by PCR.
This method is diagrammed in Figure
Kn r 10. The DNA sequence is first
amplified with PCR, using primers
containing the 25-bp attB sequences
BP Reaction
4 (plus four terminal Gs). The PCR
B1 B2 3 B1 B2 product is then converted to an Entry
Gene Gene
Clone by performing a BP Reaction,
Expression
Clone/Library attB PCR Product in which the attB-PCR product
Apr P1 P2 recombines with a Donor Vector
+ ccdB
containing attP sites. Details of this
Donor
Vector approach and protocols for PCR
Knr fragment subcloning are provided in
Section 3.2.
Figure 8. Four Ways to Make Entry Clones: 1. Using
restriction endonucleases and ligase. 2. Starting with a cDNA The fourth approach to making Entry
library prepared in an attL Entry Vector. 3. Using an Clones (Figure 8) is to use
Expression Clone from a library prepared in an attB expression Expression Clones. These can be
vector via the BP Reaction. 4. Recombinational cloning of PCR obtained from cDNA libraries
fragments with terminal attB sites, via the BP Reaction. prepared in GATEWAY Expression
Approaches 3 and 4 rely on recombination with a Donor Vector Vectors or from the product of an LR
that provides the Entry Vector carrying Knr. Reaction. DNAs flanked by attB sites
can be introduced into an Entry
10
Vector by recombination with a

Xba I
Donor Vector, via the BP Reaction. Sal I
BamH I
EcoR V
Xho I
The BP Reaction protocols are given Variable
Region N
Kpn I
EcoR I
Not I
EcoR I
in Section 3.2. Expression Clone ccdB
cDNA libraries (attB) are available
from Life Technologies in
GATEWAY vectors pCMV•SPORT 6
or pSPORT-P. 1
attL att
L2
All Entry Vectors and Destination rrnB
Vectors are constructed so that the
N-terminal region of a cDNA insert Entry Vector
will be positioned next to the attL1
site. All Entry Vectors contain the
ori
rrnB transcriptional terminator, Knr
upstream of the attL1 site. This
sequence ensures that expression of Variable Region N Options:
cloned genes is reliably "off" in Blunt site close to attL1 site, in three possible reading
E. coli, to increase the likelihood frames (pENTR1A, 2B, 3C)
that even toxic genes can be Nco I site close to attL1 site (pENTR4)
successfully cloned. Thus in Blunt (Xmn I) and Nco I sites each preceded by E. coli
contrast to Expression Clones, Entry and eukaryotic ribosome recognition site (pENTR11)
Clones are designed to be
transcriptionally silent. Figure 9. Schematic of Available Entry Vectors. Shown at
the top are restriction sites flanking the ccdB gene that are
2.5 Destination Vectors common to all Entry Vectors. In addition, each Entry Vector has
its own selection of cloning sites and other options residing next
Once a gene has been cloned into an to the attL1 site (Variable Region N).
Entry Vector, it is ready to be
Variable Region N options are summarized in the lower half of
moved into any of the available
the figure.
Destination Vectors or into a
Destination Vector that you
construct (see Section 5.1). The upper-right portion of Figure 2 shows a schematic of the Destination
Vectors. The thick arrow represents some function (often transcription or translation) that will act on
cloned DNA. During the recombination reaction, the region between the attR1 and attR2 sites, including
the ccdB gene, is replaced by the DNA segment from the Entry Clone. Selection for recombinants that
have acquired ampicillin resistance (carried on the Destination Vector) and also lost the ccdB gene
ensures that a high percentage (usually >99%) of the resulting colonies will contain the correct insert.
The genes ccdA and ccdB are the antidote and toxin genes respectively of the E. coli F plasmid [Bernard,
P., Kezdy, K.E., Van Melderen, L., Steyaert, J., Wyns, L., Pato, M.L., Higgins, P.N., Couturier, M.
(1993) J. Mol. Biol. 234, 534]. Together they ensure that daughter cells that do not receive a copy of F
will not survive. The CcdB protein interferes with the rejoining step of DNA gyrase, causing the
chromosome to be cut to pieces. Plasmids that contain the ccdB gene without the antidote gene (Entry
Vectors and Destination Vectors) can be propagated in the gyrase mutant, gyrA462 [Miki, T., Park, J.A.,
Nagao, K., Murayama, N., and Horiuchi, T. (1992) J. Mol. Biol. 225, 39]. We have constructed a
gyrA462 strain, DB3.1™, for propagating Destination Vectors and Entry Vectors:
DB3.1: E. coli RR1 gyrA462 endA (recA-).
11
B1 B2
Gene Destination Vectors carry an inactive copy of the
25 bp 25 bp
attB-PCR Product ccdA gene (caused by a frame shift) as well as an
+ P1 P2
active ccdB gene. Entry Vectors carry only the
Death
ccdB
rrnB
200 bp 200 bp ccdB gene, with its own promoter (Figure 9).
Donor Vector
Knr
To move a gene into a Destination Vector,
Destination Vector DNA is mixed with Entry
Clone DNA and incubated with LR CLONASE
BP CLONASE
(Int + IHF) Enzyme Mix, followed by transformation into any
R1
standard E. coli strain. LIBRARY EFFICIENCY®
R2
ccdB DH5α™ Competent Cells are recommended.
125 bp 125 bp
Section 3 provides further details and protocols.
L1 L2 + By-product
Gene
rrnB
100 bp 100 bp Destination Vectors presently available from Life
Entry Clone Technologies are summarized in Table 2. Maps
and cloning site information for Destination
Kn r Vectors are provided in Section 5, as well as
methods for converting most standard vectors into
Figure 10. Cloning A PCR Product by the BP Destination Vectors.
Reaction. A PCR product with 25-bp terminal
attB sites (+ 4Gs) is shown as a substrate for the 2.6 Protein Expression in the GATEWAY
BP Reaction. Recombination between the attB- Cloning System
PCR product of a gene and a Donor Vector
(which donates an Entry Vector that carries Knr) Proteins are expressed in vivo as a result of two
results in an Entry Clone of the PCR product. processes, transcription (DNA into RNA), and
translation (RNA into protein).
Ribosomes convert the information present in mRNA into protein. Ribosomes scan RNA molecules
looking for methionine (AUG) codons, which begin nearly all nascent proteins. Ribosomes must,
however, be able to distinguish between AUG codons that code for methionine in the middle of proteins
from those at the start. Most often ribosomes choose AUGs that are 1) first in the RNA (toward the 5′
end) and 2) have the proper sequence context. In E. coli the favored context [first recognized by Shine
and Dalgarno, (1975) Eur. J. Biochem, 57, 221] is a run of purines (As and Gs) from five to 12 bases
upstream of the initiating AUG, especially AGGAGG or some variant.
In eukaryotes, a survey of translated mRNAs by Kozak [(1991) J. Biol. Chem. 266, 19867] has revealed a
preferred sequence context: --- GCC ACC ATG G-- around the initiating methionine, with the A at -3
being most important, and a purine at +4 (where the A of the ATG is +1), preferably a guanine (G), being
next most influential. Having an A at -3 is enough to make most ribosomes choose the first AUG of an
mRNA in plants, insects, yeast, and mammals. [For a review of initiation of protein synthesis in
eukaryotic cells, see Pain, V.M. (1996) Eur. J. Biochem. 236, 747.]
12
Table 2. Available Destination Vectors
Name Expression Features ori Antibiotic

in Resistance
pDEST14 E. coli Native protein expression with T7 promoter pBR Amp
pDEST15 E. coli N-terminal Glutathione-S-transferase fusion expression pBR Amp
with T7 promoter
pDEST17 E. coli N-terminal 6X histidine affinity tag fusion expression pBR Amp
with T7 promoter
pDEST8 insect cells Native protein expression with polyhedron promoter for pUC Amp
baculovirus expression
pDEST10 insect cells N-terminal 6X histidine affinity tag fusion expression pUC Amp
with polyhedron promoter for baculovirus expression
pDEST20 insect cells N-terminal Glutathione-S-transferase fusion expression pUC Amp
with polyhedron promoter for baculovirus expression
pDEST12.2 mammalian Native expression with SV40 promoter/ori and neo pUC Amp
cells resistance
pDEST26 mammalian N-terminal 6X histidine affinity tag fusion expression pUC Amp
cells with SV40 promoter/ori and neo resistance
pDEST27 mammalian N-terminal Glutathione-S-transferase fusion expression pUC Amp
cells with SV40 promoter/ori and neo resistance
2.7 Considerations in Designing Entry Clones
2.7.1 Location of Translation Start Sequences
Ribosome binding-site sequences (Shine-Dalgarno in E. coli and Kozak in eukaryotes) must lie close to
the initiating ATG. The attB site is 25 base pairs long. Therefore, if translation is to initiate at the native
ATG within a gene of interest, the ribosome binding site (RBS) sequence close to the ATG needs to be
positioned between the attL1 and attL2 sites in the Entry Clone of that gene.
If the Destination Vector provides a promoter but no N-terminal fusion sequence, protein synthesis will
initiate exclusively at the translation start signals of the native open reading frame (ORF). If the
Destination Vector encodes an N-terminal fusion peptide, however, protein synthesis may begin not only
at the N-terminal fusion sequence, but to some degree at the internal, native ATG as well. Even though
ribosomes most often initiate protein synthesis at the 5'-most ATG, internal ATGs can also serve to
initiate protein synthesis. The better the translation context around the internal ATG, the more internal
initiation of translation will be seen.
Whether to construct different Entry Clones to express native protein and N-terminal fusion protein is an
important consideration in designing Entry Clones. The presence of internal start sequences in
N-terminal fusion constructs will sometimes result in a significant amount of native protein being made,
contaminating and lowering the yield of the N-terminal fusion protein. This problem can be more
pronounced with short N-terminal fusion tags, such as the 6X histidine affinity tag.
13
2.7.2 Reading frame
When making fusions it is essential to maintain the correct reading frame in the Entry Vectors. For native
expression any reading frame is acceptable since translation starts and stops between the two att sites.
For fusions the reading frame of the DNA cloned into all GATEWAY vectors must be in phase with the
reading frame of the attB1 site shown in Figure 6, such that the six As of the site are split into two lysine
codons (AAA - AAA). All of the Destination Vectors that make amino-terminal fusions have been
constructed so that the attR1 site is in this reading frame. Figure 15 presents the attR1 and attR2
sequences present within the three GATEWAY Reading Frame Cassettes used to create new Destination
Vectors.
Therefore, if a gene is cloned into an Entry Vector so that the --- AAA - AAA --- reading frame within
the attL1 site is in phase with the reading frame of the gene, amino terminal fusions will automatically be
correctly phased, for all N-terminal fusion tags.
Likewise, for C-terminal fusion Destination Vectors, the C-terminal coding sequences should be aligned
in phase with the -TAC-AAA- sequence of the attR2 site, which translates into –Tyr-Lys- (See Figure 6
and Figure 15).
2.7.3 Examples of Sequences for Different Protein Constructs
The following examples of Expression Clone sequences and attB-PCR primer sequences (for preparing
Entry Clones) have been used successfully to express both native and fusion proteins in various cellular
contexts using the GATEWAY Cloning System. Other sequence options and motif combinations are
possible, and may be preferable in some situations. The examples below are offered only as a starting
point for recombinant protein expression in the GATEWAY Cloning System.
Figure 11. Examples of Different Protein Expression Constructs
1. Native expression in prokaryotic, insect, and mammalian cells:
A. Expression clone structure:
attB1 attB2
(promoter) RBS ATG Open Reading Frame Stop
B. Expression clone sequence:

Shine-Dalgarno Kozak Open reading frame (amino end)
5' - ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG NNN NNN NNN ---
3' - TGT TCA AAC ATG TTT TTT CGT CCG AAG GTT CCT CTA TCT TGG TAC NNN NNN NNN ---
attB1 Translation start*
Open reading frame (carboxy end)

--- NNN NNN NNN TAG GAC CCA GCT TTC TTG TAC AAA GTG GT - 3'
--- NNN NNN NNN ATC CTG GGT CGA AAG AAC ATG TTT CAC CA - 5'
Translation stop attB2
*Note: By placing the ATG in frame with the attB1sequence this construction can be used in both native
and N-terminal fusion expression vectors.
14
C. Suggested oligonucleotides for attB-PCR cloning of gene for native expression
attB1 forward oligo: (attB1 sequence bold; translation start codon underlined; sequence includes SD and Kozak)
5' - GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAGGAGATAGAACCATG(18-25 gene-specific nucleotides in frame

with start codon) - 3'
attB2 reverse oligo: (attB2 sequence bold; translation stop codon [complement strand] underlined)
5' - GGGGACCACTTTGTACAAGAAAGCTGGGTCCTA(18-25 gene-specific nucleotides [complement strand] in frame with

stop codon) - 3'
2. N-terminal and C-terminal fusion expression in prokaryotic, insect, and mammalian cells:
A. Expression clone structure:

GST
His6
Txn Myc
attB1 attB2 HA
RBS ATG Open Reading Frame Stop
(promoter)
B. Expression clone sequence:
Open reading frame (amino end)

5' – ATG NNN --- --- NNN ACA AGT TTG TAC AAA AAA GCA GGC TTC NNN NNN NNN ---
3' – TAC NNN --- --- NNN TGT TCA AAC ATG TTT TTT CGT CCG AAG NNN NNN NNN ---
N-fusion attB1
Open reading frame (carboxy end)
--- NNN NNN NNN GAC CCA GCT TTC TTG TAC AAA GTG GTN NNN --- --- NNN (Stop) - 3'
--- NNN NNN NNN CTG GGT CGA AAG AAC ATG TTT CAC CAN NNN --- --- NNN NNN - 5'
attB2 C-fusion
C. Suggested oligonucleotides for attB-PCR cloning of gene for N-terminal and C-terminal fusion expression
attB1 forward oligo: (attB1 sequence bold)
5' - GGGGACAAGTTTGTACAAAAAAGCAGGCTTA (18-25 gene specific nucleotides in frame with attB1) - 3'
attB2 reverse oligo: (attB2 sequence bold)
5' - GGGGACCACTTTGTACAAGAAAGCTGGGTC (18-25 gene specific nucleotides [complement strand] in frame with
attB2) - 3'
Note: Other nucleotides may be substituted for the underlined sequences as long as the reading frame is maintained and
the substituted sequences do not create a stop codon.
15
2.7.4 Transcription from Entry Clones
Many standard expression vectors use the lac promoter to control expression of cloned genes.
Transcription from the lac promoter is turned on by adding the inducer IPTG. Even in the absence of
inducer, however, a low level of mRNA is made, i.e., the lac promoter is never completely off. The
result of this "leakiness" is that genes whose expression is harmful to E. coli may prove difficult or
impossible to clone in vectors that contain the lac promoter, or they may be cloned only as inactive
mutants.
In contrast to other gene expression systems, genes cloned into an Entry Vector are designed not to be
expressed. The presence of the strong transcriptional terminator rrnB [Orosz, A., Boros, I., and
Venetianer, P. (1991) Eur. J. Biochem. 201, 653] just upstream of the attL1 site in Entry Vectors and
Entry Clones is designed to prevent transcription from vector promoters from reaching the cloned gene.
2.8 Choosing the Right Entry Vector
The choice of Entry Vector is dictated by

Considerations in Choosing an Entry Vector:
the particular DNA and what is to be
done with it (see sidebar). These factors
The DNA:
are critical when transferring a gene from
—Does it contain a gene?
an Entry Clone to a Destination Vector,
—Is the sequence known?
because all the base pairs between the
—Is the reading frame known?
gene and the Int cut sites in attL1 and
—Are there 5′ and 3′ untranslated regions?
attL2 (such as in Figure 6) move also.
—Do these regions contain stop codons?
—Does the gene fragment carry its own promoter and/or
For example, translation start signals
translation signals?
present in an Entry Clone will be
—Is the DNA a restriction fragment, or a PCR product?
translated into amino acids if an amino-
—Are there unique restriction endonuclease sites at the
terminal fusion to the gene is constructed.
amino and carboxy ends?
Deciding whether to express a gene as a
fusion protein, native protein, or both
How is the gene to be expressed?
(See Figure 12), dictates whether
—In eukaryotes or in E. coli?
translational start sequences must be
—As native protein, or as a fusion protein?
included between the attL sites of the
—With or without a protease cleavage site?
clone (native protein) or supplied by a
Destination Vector (fusion protein).
Entry Clones that include translational start sequences may prove less suitable for making fusion
proteins, as internal initiation of translation at these sites can decrease the yield of N-terminal fusion
protein, as discussed above.
2.8.1 Features of the Entry Vectors
All Entry vectors have restriction sites to the left and right of the ccdB gene to allow directional cloning
of the DNA. Each vector enables amino or carboxy fusions when transferred into the appropriate
Destination Vector if the cloned DNA maintains the reading frame registers shown in Figures 19-23.
The cloning sites of the Entry Vectors are organized in two groups that flank a copy of the ccdB gene.
The CcdB protein interferes with DNA gyrase and thereby inhibits growth of E. coli. The Entry Vectors
are positive selection vectors; therefore, undigested or partially digested molecules will not generate
16
transformants in standard E. coli strains

Native Protein Expression: (e.g., DH5α). For carboxy-terminal
ATG Term fusions, stop codons must be absent
attB2
from the cloned gene.
attB1 rbs
cDNA
Pro
Table 1 lists the available Entry Vectors,
and more detailed sequence information.
The location of cloning sites is presented
in Figures 19-23. pENTR1A,
Ap r pENTR2B, and pENTR3C are almost
identical, except that the restriction sites
at the 5'-end of the MCS (prior to the
ccdB gene) are in different reading
Fusion Protein Expression: frames.
ATG Term
attB1 attB2
pENTR4 is essentially identical to 1A,
cDNA
rbs except that the blunt Dra I site has been
Pro replaced with an Nco I site containing
His 6 Myc
GST the ATG methionine codon. Genes that
HA
Txn contain this site at the initiating ATG
can be conveniently cloned in this Entry
Ap r
Vector. The Nco I site in pENTR4 is
especially useful for expression of genes
Figure 12. Two Types of GATEWAY Protein Expression.
in eukaryotic cells, since it contains
Native Protein Expression (upper figure): All the
many of the bases that give efficient
translational start signals are included between the attB1
translation.
and attB2 sites. Therefore these signals must be present in
the starting Entry Clone.
pENTR11 is useful for expression of
Fusion Protein Expression (lower figure): This example both native and fusion proteins in E. coli
illustrates expression with both N-terminal and C-terminal and eukaryotic cells.
fusion tags, so that ribosomes read through attB1 as well as
attB2 to create the fusion protein. Unlike native protein 2.8.2 Entry Vector pENTR11
expression vectors, N-terminal fusion vectors have their
translational start signals upstream of the attB1 site. As an example, consider pENTR11
Likewise, C-terminal fusion vectors have the termination (Figure 23). Here is what can be done
signals downstream of the attB2 site. with it:
• Clone cDNAs from most commercially available libraries. The sites to the left and right of the ccdB
gene have been chosen so that directional cloning is possible.
• Clone genes directionally: Sal I, BamH I, Xmn I (blunt), or Kpn I on the left of ccdB; Not I, Xho I,
Xba I, or EcoR V (blunt), on the right.
• Clone genes or gene fragments with a blunt amino end at the Xmn I site. The Xmn I site has four of
the six most favored bases for eukaryotic expression (see Section 2.6), so that if the first three bases
of the DNA are ATG, the open reading frame will be expressed in mammalian, insect, yeast, etc.,
cells when it is transcribed in the appropriate Destination Vector. In addition, a Shine-Dalgarno
sequence is situated 8 bp upstream, for initiating protein synthesis in E. coli at an ATG.
• Clone cDNAs that have an Nco I site at the initiating ATG into the Nco I site. Similar to the Xmn I
site, this site has four of the six most favored bases for eukaryotic expression. Also, a Shine-
Dalgarno sequence is situated 8 bp upstream, for initiating protein synthesis in E. coli using an ORF
with a 5′ ATG .
17
• Select against uncut or singly cut Entry Vector molecules during cloning with restriction
endonucleases and ligase. If the ccdB gene is not removed with a double digest, it will kill any
recipient E. coli cell.
• Enable amino fusions with ORFs in all cloning sites. There are no stop codons (in the attL1 reading
frame) upstream of the ccdB gene.
• Enable carboxy fusions with ORFs positioned in phase with the reading frame convention for C-
terminal fusions, indicated in Figure 23.
2.9 GATEWAY Nomenclature
For subclones, the following naming convention has been adopted: the name of the vector is placed first,
followed by the name of the transferred gene.
Plasmid Type Descriptive Name Individual Vector or Clone Names
attL Vector Entry Vectors pENTR1,2,... (nos. 1-99)

attL subclone Entry Clones pENTR3-gus, .. ; pENTR201-gus
(where the number 3 refers to the Entry Vector and
201 refers to the Donor Vector used to make the Entry
subclone; gus is the subcloned gene)
attR Vector Destination Vectors pDEST1,2,3,...
attB Vector Expression Vectors pEXP501, 502,… (nos. 501-599). These vectors are
used to prepare Expression cDNA libraries.
attB subclone Expression Clones pEXP3-cat, ... [where 3 refers to the Destination
Vector (pDEST3) used to make the expression
subclone and cat is the subcloned gene]
attP Vector Donor Vectors pDONR™201
Other Names:
Name Reacting Sites Catalyzed by Desired Product Structure of
Desired Product
LR Reaction attL x attR LR CLONASE Expression Clone attB1-gene-attB2

Enzyme Mix
BP Reaction attB x attP BP CLONASE Entry Clone attL1-gene-attL2
Enzyme Mix
Examples:
• An LR Reaction:
pENTR201-tet x pDEST10 Æ pEXP10-tet
• Two BP Reactions:
attB-p53 PCR product x pDONR205 Æ pENTR205-p53
pEXP14-lacZ x pDONR201 Æ pENTR201-lacZ
18
3. Methods
3.1 General Comments
See www.lifetech.com/gateway for current information on additions/modifications to the protocols and

an increasing selection of GATEWAY-compatible vectors and libraries.
Purification of DNA: When preparing plasmid DNAs for use in the G ATEWAY System reactions, DNA
purified by CONCERT™ Rapid Plasmid Systems is recommended. Miniprep DNA prepared by standard
alkaline lysis protocols, with or without RNase treatment, can be used as well. During alkaline lysis
treatment, we recommend a final concentration of NaOH no higher than 0.125 M, to minimize
irreversible denaturation of the supercoiled plasmid DNA.
DNA Topology: For LR reactions, the most efficient substrates are supercoiled, relaxed, or linear Entry
Vectors (attL) and relaxed or linear Destination Vectors (attR). Reactions in which the Destination
Vector is supercoiled give five to ten-fold fewer colonies.
For BP Reactions, the attB vectors should be linear (PCR products or Expression Clones linearized by
restriction endonucleases), while the attP-containing pDONR Vector must be supercoiled. Expression
Clones (attB) can be used as supercoiled or relaxed (i.e., with Topoisomerase I) molecules, but will react
less efficiently than linearized Expression Clones.
Linearized Destination Vector can be obtained by cleaving at a restriction site within the region of the
GATEWAY Cassette, taking care to avoid the ccdB gene. All Destination Vectors from Life Technologies
are provided already linearized in this manner.
When suitable single-cut restriction sites are unavailable or unknown, as with complex mixtures of
plasmids or cDNA libraries, the DNA may be relaxed by brief treatment with Topoisomerase I.
Primers: Primers for attB PCR should have 18-25 bases of gene-specific sequence and 29 bases attB
sequence (includes four Gs). Generally, 50 nmol of standard purity oligos are adequate for most
applications. Oligos should be dissolved to a concentration of 20-50 µM and the concentration verified
by spectrophotometry. For cloning of large PCR products (>5 kb), colony output can be increased if
oligos (>65 bases) are further purified (i.e., HPLC or PAGE).
Incubation time: In the following protocols we recommend incubating the GATEWAY reactions for
60 min at 25°C. This will generally give sufficient colonies when transforming E. coli competent at 108
CFU/µg or higher, virtually all of which should contain the correct subclone. In some circumstances,
however, you may wish to convert a higher percentage of starting plasmid carrying your gene to product.
This can be achieved by incubating for longer periods, such as for 4-6 h, or overnight. An overnight
incubation often gives five-fold or more product than a one-hour incubation.
Longer incubation times are recommended for LR and BP Reactions involving large plasmids (≥10 kb),
for BP Cloning of large PCR products (≥5 kb), and for transfer of diverse populations of genes, such as
cDNA libraries.
19
3.2 Creating an Entry Clone
Entry clones can be created in one of four ways: 1) Cloning into Entry Vectors with restriction
endonucleases and ligase, 2) cloning cDNA libraries into Entry Vectors using restriction endonucleases
and ligase, 3) transferring genes from Expression Clones into Entry Vectors via the BP Reaction, or 4)
cloning attB-PCR products via the BP Reaction.
Restriction endonuclease fragments or PCR products can be cloned into an Entry vector. The PCR
fragment will be either cloned as a blunt-end fragment or require digestion with restriction endonucleases
(e.g., at sites incorporated into the primer).
All the Entry Vectors contain the ccdB gene as a stuffer between the “left” and “right” restriction sites.
The advantage of this arrangement is that there is virtually no background from vector that has not been
digested with both restriction endonucleases, because the presence of the ccdB gene will inhibit the
growth of all standard E. coli strains. Thus, it is necessary to cut each Entry Vector twice in order to
remove the ccdB gene fragment during cloning.
It is strongly recommended that after digestion of the Entry Vector with the second restriction
endonuclease, the reaction be treated with phosphatase (calf intestine alkaline phosphatase, CIAP or
thermosensitive alkaline phosphatase, TSAP). The phosphatase can be added directly to the reaction
mixture, incubated for an additional time, and inactivated. This step dephosphorylates both the vector
and ccdB fragments, so that during subsequent ligation there is less competition between the ccdB
fragment and the DNA of interest for the termini of the Entry Vector.
3.2.1 Cloning Genes into Entry Vectors using Restriction Endonucleases and Ligase
A. Cloning of a Restriction Endonuclease DNA Fragment:

1. Prepare Entry Vector and the DNA fragment to be cloned by digesting 0.5-1.0 µg DNA with the
selected restriction endonucleases under the appropriate conditions.
2. De-phosphorylate the Entry Vector DNA.
3. DNA fragments to be cloned can be purified by agarose gel electrophoresis and the fragments of
interest recovered from the gel using the CONCERT Matrix Gel Extraction System.
4. Ligate the prepared Entry Vector and insert fragments under appropriate conditions.
5. Transform into LIBRARY EFFICIENCY DH5α Competent Cells using standard conditions and plate
transformants on LB plates containing 50 µg/ml kanamycin.
B. Blunt Cloning of PCR products:

Prepare the Entry Vector so that the cloning ends are blunt. Digest Entry Vector with appropriate
restriction endonuclease as described in the previous section. If the restriction endonucleases are not
blunt-cutters, make ends flush with either T4 DNA Polymerase or Klenow Fragment. Dephosphorylate
the Entry Vector.
Generally PCR products do not have 5′ phosphates (because the primers are usually 5′-OH), and they are
not necessarily blunt. (On this latter point, see Brownstein, M.J., Carpten, J.D., and Smith, J.R. (1996)
Biotechniques 20, 1004 for a discussion of how the sequence of the primers affects the addition of single
3′ bases.) The following protocol repairs these two defects.
1. In a 0.5-ml tube, ethanol-precipitate about 40 ng of PCR product (as judged from an agarose gel).
20
2. Dissolve the precipitated DNA in 10 µl comprising 1 µl 10 mM rATP, 1 µl mixed 2 mM dNTPs (i.e.,

2 mM each dATP, dCTP, dTTP, and dGTP), 2 µl 5X T4 Forward Reaction Buffer (350 mM
Tris-HCl (pH 7.6), 50 mM MgCl2, 500 mM KCl, 5 mM 2-mercaptoethanol), 10 units T4
polynucleotide kinase, 1 µl T4 DNA polymerase, and water to 10 µl.
3. Incubate the tube at 37°C for 10 min, then at 65°C for 15 min, cool, centrifuge briefly to bring any
condensate to the tip of the tube.
4. Add 5 µl of 30% PEG 8000/30 mM MgCl2, mix and centrifuge at room temperature for 10 min.
Carefully remove and discard supernatant.
5. Dissolve the invisible precipitate in 10 µl containing 2 µl 5X T4 DNA ligase buffer, 0.5 units T4
DNA ligase, and about 50 ng of blunt, dephosphorylated Entry Vector.
6. Incubate at 25°C for 1 h, then at 65°C for 10 min.
7. Add 40 µl TE, transform 2 µl into 100 µl of of LIBRARY EFFICIENCY DH5α Competent Cells
following the suggested protocol. [TE is 10 mM Tris-HCl (pH 7.5), 1 mM EDTA.]
8. Plate on LB plates containing 50 µg/ml kanamycin.
9. Isolate miniprep DNA from single colonies (Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989)
Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, New York). Treat the miniprep with RNase A and store in TE. Cut with the
appropriate restriction endonuclease to determine the orientation of the PCR fragment. Choose
clones with the attL1 site next to the amino end of the open reading frame.
Note: In the above protocol, the ends of the PCR product are simultaneously polished (through the exo
and polymerase activities of T4 DNA polymerase) and the 5' ends phosphorylated (using T4
polynucleotide kinase). It is necessary to inactivate the kinase, so that the blunt, dephosphorylated vector
cannot self-ligate. The PEG precipitation removes all small molecules (primers, nucleotides), and can
improve the colony output of cloned PCR product by 50-fold.
C. Cloning PCR Products Digested with Restriction Endonucleases:
The Entry Vector is prepared as described in Section A or B above.
Efficient cloning of PCR products that have been digested with restriction endonucleases includes three
steps: inactivation of Taq DNA polymerase, efficient restriction endonuclease cutting, and removal of
small DNA fragments.
Inactivation of Taq DNA Polymerase: Carryover of Taq DNA polymerase and dNTPs into a restriction
endonuclease digestion significantly reduces the success in cloning a PCR product [Fox, D., Nathan, M.,
Natarajan, P., Bracete, A., and Mertz, L. (1998) FOCUS® 20, 15], because Taq DNA polymerase can fill
in sticky ends and add bases to blunt ends. Either TAQUENCH™ PCR Cloning Enhancer or extraction
with phenol can be used to inactivate the Taq DNA polymerase.
Option A: Inactivation with TAQUENCH PCR Cloning Enhancer
A1. Add 2 µl TAQUENCH PCR Cloning Enhancer.
A2. Perform restriction digest, using 10 to 50 units of restriction endonuclease and standard protocols,
and incubate for at least 1 h.
A3. Dilute reaction four-fold with TE.
21
A4. Add 1/2 volume of 30% PEG 8000/30 mM MgCl2. Mix well and immediately centrifuge at room
temperature for 10 min. Discard the supernatant (pellet is usually invisible), centrifuge again for a
few seconds, and discard any remaining supernatant.
A5. Dissolve the DNA in a suitable volume of TE (depending on the amount of PCR product in the
original amplification reaction) and apply an aliquot to an agarose gel to confirm recovery. Apply
to the same gel 20-100 ng of the appropriate Entry Vector that will be used for the cloning.
Option B: Extraction with Phenol
B1. Dilute the PCR reaction to 200 µl with TE. Add an equal volume of phenol:chloroform:isoamyl
alcohol, vortex vigorously for 20 s, and centrifuge for 1 min at room temperature. Discard the
lower phase.
B2. Extract the phenol from the DNA and concentrate as follows: Add an equal volume of 2-butanol
(colored red with “Oil Red O” from Aldrich, if desired), vortex briefly, centrifuge briefly at room
temperature. Discard the upper butanol phase. Repeat the extraction with 2-butanol. This time the
volume of the lower aqueous phase should decrease significantly. Discard the upper 2-butanol
phase.
B3. Ethanol-precipitate the DNA from the aqueous phase of the above extractions. Dissolve in 200 µl
of a suitable restriction endonuclease buffer. Then digest with the appropriate restriction
endonuclease, followed by inactivation of the restriction endonuclease, and ligation of the DNA to
the Entry Vector.
Efficient Restriction Endonuclease Cutting: Extra bases on the 5′-end of each PCR primer help the
restriction endonucleases cut near ends of PCR products. With the availability of inexpensive primers,
adding six to nine bases on the 5′ sides of the restriction sites is a good investment to ensure that most of
the ends are digested. Incubation of the DNA with a five-fold excess of restriction endonuclease for an
hour or more helps ensure success.
Removal of Small Molecules before Ligation: Primers, nucleotides, primer-dimers, and small fragments
produced by the restriction endonuclease digestion, can all inhibit or compete with the desired ligation of
the PCR product to the cloning vector. This protocol uses PEG precipitation to remove small molecules.
1. Add 150 µl of TE to 50 µl PCR reaction

2. Add 100 µl 30% PEG 8000/30 mM MgCl2. Mix well and centrifuge immediately at 10,000 × g for
10 min at room temperature. Remove the supernatant (pellet is clear and nearly invisible)
3. Dissolve the pellet in 50 µl TE and check recovery on a gel.
3.2.2 Cloning cDNA Libraries into Entry Vectors using Restriction Endonucleases and Ligase
The cDNA library can be constructed using standard methodology such as the SUPERSCRIPT™ Plasmid
System for cDNA Synthesis and Plasmid Cloning with an oligo(dT) primer adapter containing a Not I
site for first strand synthesis and ligation of Sal I adapters after second strand synthesis. The Entry
Vector is digested with Sal I and Not I which removes the ccdB gene and the cDNA library is ligated into
the vector. The Sal I-Not I sites in the Entry vectors are oriented so that the 5'-end of the cDNA (Sal I
end) is closest to the attL1 site.
22
3.2.3 Transferring DNA from an Expression Clone into an Entry Vector via the BP Reaction
The BP Reaction converts an Expression Clone to an Entry Clone. This reaction is useful when
transferring a gene present in an attB Expression Clone into other expression vectors. After converting
the gene into an attL Entry Clone, via the BP Reaction, the gene can be subcloned into new expression
vectors by performing an LR Reaction, thereby obtaining new attB Expression Clones.
An Expression Clone has the gene of interest flanked by attB sites. Expression Clones (attB) can be used
as supercoiled or relaxed (i.e., nicked or treated with Topoisomerase I) molecules, but will react most
efficiently when linearized. To linearize Expression Clones, the Expression Vector must cut outside the
attB region.
1. Digest 1-2 µg of the Expression Clone with a unique restriction endonuclease that does not cut within
the gene of interest.
2. Ethanol-precipitate the DNA after digestion and dissolve DNA in TE.
The most common cause of an unsuccessful BP Cloning Reaction is failure to plate the
reaction transformations on plates containing kanamycin.
Materials needed:
• BP Reaction Buffer
• attB Expression Clone DNA, ≥10 ng/µl, in TE
• pEXP7-tet Positive Control, linearized with Sca I, 50 ng/µl. The tetR insert is 1.4 kb, and includes
its own promoter.
• pDONR201 Vector, 150 ng/µl, supercoiled
• BP CLONASE Enzyme Mix (stored at -70°C)
• Proteinase K Solution
• pUC19 DNA, 10 pg/µl
• LIBRARY EFFICIENCY DH5α Competent Cells (≥1 × 108 CFU/µg)
• S.O.C Medium for culturing transformations
• LB plates containing 50 µg/ml kanamycin
23
Negative Positive Test

Control Control
Component Tube 1 Tube 2 Tube 3
pEXP7-tet Positive Control, 50 ng/µl - 2 µl -
attB Expression Clone DNA, linearized, ≥10 ng/µl - - 1 - 10 µl

pDONR201 Vector, 150 ng/µl 2 µl 2 µl 2 µl
BP Reaction Buffer 4 µl 4 µl 4 µl
TE 10 µl 8 µl To 16 µl
BP CLONASE Enzyme Mix (store at -70°C, add 4 µl 4 µl 4 µl
last)
Total Volume 20 µl 20 µl 20 µl
Procedure:
1. Compose the reactions on ice.
2. Add TE, BP Reaction Buffer, Donor Vector, and attB DNAs, and mix well.
3. Remove the BP CLONASE Enzyme Mix from the -70°C freezer and allow to thaw on ice (~2 min).
4. Vortex BP CLONASE Enzyme Mix briefly (2 s) twice.
5. Add 4 µl of BP CLONASE Enzyme Mix and mix well by vortexing briefly twice. Return vial to -70°C
freezer.
6. Incubate tubes at 25°C for 60 min.
7. Add 2 µl Proteinase K Solution. Incubate for 10 min at 37°C.
8. Transform 1 µl of BP Reaction into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells using
Falcon® 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42°C for 30 s. Place on ice
for 1-2 min. Add 450 µl S.O.C. Medium and incubate at 37°C for 1 h.
9. Spread 10 µl and 100 µl on LB plates containing 50 µg/ml kanamycin. (If the E. coli cells have a
transformation efficiency of 108 CFU/µg, the BP Reaction should give about 3,000 colonies if the
entire transformation is plated.)
10. Also transform 2 µl of pUC19 DNA into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells, as
above. Plate 10 µl and 100 µl on LB plates containing 100 µg/ml ampicillin. (Cells with a
tranformation efficiency of 108 CFU/µg should yield about 2,000 colonies if the entire transformation
is plated.)
3.2.4 Cloning of attB-PCR Products via the BP Reaction
Addition of 5′-terminal attB sequences to PCR primers allows synthesis of a PCR product that is an
efficient substrate for recombination with a Donor Vector in the presence of BP CLONASE Enzyme Mix.
This reaction produces an Entry Clone of the PCR product (See Figure 10).
24
A. Preparation of attB-PCR Products:
The attB1 and attB2 primer sequences are given in Figure 13. The four guanine (G) residues at the
5′ end of these primers are required to make the minimal 25-bp attB sequences an efficient GATEWAY
Cloning System substrate.
Figure 13. attB Sequences to Add to Primers for PCR Cloning into an Entry Vector
attB1: 5′-GGGG -ACA-AGT-TTG -TAC-AAA-AAA-GCA-GGC-TNN--(template-specific sequence)-3′
attB2: 5′-GGGG -AC -CAC- TTT- GTA- CAA-GAA-AGC-TGG- GTN--(template-specific sequence)-3′
Add the attB1 sequence to the amino (forward) primer and the attB2 sequence to the carboxy (reverse)
primer.
Note: These GATEWAY attB1 and attB2 modifications to primers are available from Life Technologies.
Note: The attB1 primer ends with a single thymidine (T), which requires the donation of two additional
nucleotides from the remainder of the primer sequence to maintain proper reading frame. These two
nucleotides cannot be AA, AG, or GA, because these additions would create a termination codon.
Similarly, for C-terminal fusions, the attB2 primer requires one nucleotide from the rest of the primer to
maintain the proper reading frame into the attB2 region.
For generating N-fusion proteins the attB1 site must maintain the reading frame register shown above. In
this reading frame, the six As of the attB1 sequence are read as -AAA - AAA- , and translated into -Lys-
Lys-. Because all of the N-terminal fusion Destination Vectors available from Life Technologies adhere
to this convention, all subclones into these Destination Vectors will automatically align the reading frame
of the N-terminal coding sequence in phase with the correct reading frame of your gene.
Likewise, to join the PCR product in the correct reading frame with a C-terminal fusion Destination
Vector, the C-terminal coding sequences of these vectors must be aligned in phase with the -TTT-GTA-
sequence of the attB2 primer sequence, shown above. This means that the complementary strand, which
is the sense strand, will be read as -TAC-AAA-, translating into Tyr-Lys- (See Figure 15). For this
purpose, any in-phase termination codons present between the coding region of the PCR sequence and
the attB2 region will also need to be eliminated.
Note that it is possible to install a protease cleavage sequence, such as that for the highly specific TEV
Protease, to permit the removal of N-terminal or C-terminal peptides from the fusion proteins. To do
this, you will need to include such a sequence between the gene-specific portion and the attB portion of
your PCR primers. As a result, the cleavage sequence will reside between the att sequence and the gene
sequence, and consequently will always transfer together with the cDNA into various Destination
Vectors. For examples of attB-PCR primer sequences used to construct native and fusion protein
expression clones for use in different cellular contexts, refer to Section 2.7.3.)
Standard PCR conditions and polymerases may be used to prepare the attB-PCR product. Likewise,
genomic DNA, mRNA, cDNA libraries, and cloned DNA sequences have all been used successfully as
substrates for amplification with attB-containing primers. The suggested polymerase for amplification of
PCR products <5-6 kb is PLATINUM® Pfx DNA Polymerase due to its high fidelity, robustness and
25
automatic "hot start" capabilities. For templates >5-6 kb, or those unsuccessfully amplified by the Pfx
polymerase, PLATINUM Taq DNA Polymerase High Fidelity is recommended. Appropriate buffers and
conditions for amplification that are provided with each polymerase should be utilized.
Following the PCR reaction, apply 1-2 µl to an agarose gel, together with size standards (1 Kb PLUS
DNA LADDER™) and appropriate quantitation standards (Low DNA MASS™ Ladder or Low DNA
MASS Ladder), to assess the yield and uniformity of the product.
If the starting PCR template is a plasmid that contains the gene for Kn r, it is advisable to treat the
completed PCR reaction with the restriction endonuclease Dpn I to degrade the plasmid. Such
plasmid is a potential source of false-positive colonies from the transformation of the GATEWAY
Cloning System reaction. Adding 5 µl of 10X REACT® 4 Buffer plus ~5 units of Dpn I to the
completed PCR reaction and incubating for 15 min at 37°C will eliminate this potential problem.
Heat-inactivate the Dpn I at 65°C for 15 min before doing the PEG/MgCl2 purification, described
below, or before using the PCR product in the GATEWAY Cloning System reaction.
Purification of the PCR product is recommended to remove attB primer-dimers which can clone
efficiently into the Entry Vector. The following protocol is fast and will remove DNA <300 bp in size:
1. Add 150 µl of TE to 50 µl PCR reaction.

2. Add 100 µl 30% PEG 8000/30 mM MgCl2. Mix well and centrifuge immediately at 10,000 × g for
15 min at room temperature. Remove the supernatant (pellet is clear and nearly invisible).
3. Dissolve the pellet in 50 µl TE and check recovery on a gel.
Longer centrifugation times and faster centrifugation speeds will increase the amount of PCR product
recovered from the PEG precipitation.
Note: Standard PCR product clean-up protocols don't efficiently remove large primer-dimer products
and are therefore not recommended for cleaning up attB-PCR products.
The conditions of the BP PCR Cloning reaction with an attB PCR substrate are similar to those of the BP
Reaction (Section 3.2.3), except that the attB-PCR product substitutes for the Expression Clone.
B. The BP Reaction with attB-PCR Products:
Materials needed:
• The PCR product with terminal attB1 and attB2 sequences(>10 ng/µl)
In general, increasing the amount of PCR product results in proportionately more colonies (do not
exceed ~500 ng/20 µl reaction). As a starting point, use 40-100 fmol of PCR product/20 µl reaction
(where a 1-kb PCR product is ~0.65 ng/fmol).
Note: For PCR products >4 kb, the number of colonies obtained per fmol of PCR DNA added
decreases with increasing size. Thus for larger PCR products we recommend increasing the amount
of DNA to at least 100 fmol of PCR product per 20-µl reaction, and using incubations longer than
one hour, such as 6 h or overnight.
• BP Reaction Buffer
• Donor Vector, pDONR201, 150 ng/µl, supercoiled.
• pEXP7-tet Positive Control (linearized with Sca I), 50 ng/µl. The tetR insert is 1.4 kb, and includes
its own promoter.
26
• BP CLONASE Enzyme Mix (stored at -70°C)

• pUC19 DNA, 10 pg/µl (for transformation control)
• LIBRARY EFFICIENCY DH5α Competent Cells (≥1 × 108 CFU/µg)
• S.O.C. Medium for culturing transformations
• LB plates containing 100 µg/ml ampicillin
• LB plates containing 50 µg/ml kanamycin
The most common cause of an unsuccessful BP Cloning Reaction is failure to plate the
reaction transformations on plates containing kanamycin.
Tube 1 Tube 2 Tube 3

Component Negative Positive Test
Control Control
BP Reaction Buffer 4 µl 4 µl 4 µl
attB-PCR product, ≥10 ng/µl - - 1-8 µl
pEXP7-tet, Positive Control, 50 ng/µl - 2 µl
pDONR201, Donor Vector, 150 ng/µl 2 µl 2 µl 2 µl
TE 10 µl 8 µl To 16 µl
BP CLONASE Enzyme Mix 4 µl 4 µl 4 µl
Procedure:
1. Compose reactions on ice.
2. Add TE, BP Reaction Buffer, Donor Vector, and appropriate attB-PCR DNA, and mix well.
3. Remove BP CLONASE Enzyme Mix and thaw on ice (~2 min).
4. Vortex BP CLONASE Enzyme Mix briefly (2 s) twice.
5. Add 4 µl of BP CLONASE Enzyme Mix and mix well by vortexing briefly twice. Return vial to
-70°C.
6. Incubate at 25°C for 60 min.
7. Add 2 µl Proteinase K Solution to all reactions. Incubate for 10 min at 37°C.
8. Transform 1 µl of BP Reaction into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells using
Falcon 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42°C for 30 s. Place on ice
for 1-2 min. Add 450 µl S.O.C. Medium and incubate at 37°C for 1 h.
9. Select on LB plates containing 50 µg/ml kanamycin. (If the E. coli cells have a transformation
efficiency of 108 CFU/µg, the BP Reaction should give about 3,000 colonies if the entire
transformation is plated.)
10. Also transform 2 µl of pUC19 DNA into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells, as
above. Spread 10 µl and 100 µl on LB plates containing 100 µg/ml ampicillin. (Cells with a
tranformation efficiency of 108 CFU/µg should yield about 2,000 colonies if the entire transformation
is plated.)
11. If desired, the percent correct clones in the positive control reaction can be confirmed by streaking
the kanamycin-resistant colonies onto LB plates containing 20 µg/ml tetracycline.
27
Alternatively, electroporation can be used to transform 1-2 µl of the BP Reaction, following

addition of the Proteinase K Solution, directly into 25-40 µl electocompetent E. coli.
3.3 Creating Expression Clones (Transferring Genes from Entry Clones into Destination
Vectors via the LR Reaction)
The reaction of an Entry Clone (attL) with a Destination Vector (attR) creates a new Expression Clone
(attB).
Materials needed:
• LR Reaction Buffer
• Destination Vector (linearized) ~150 ng/µl. Destination Vectors from Life Technologies are provided
linearized and at a concentration of 150 ng/µl. For preparation and use of Destination Vector DNA,
see Section 5. Use approximately 300 ng per 20-µl reaction.
• Entry Clone (≥30 ng/µl). Use 100-300 ng of Entry Clone per 20-µl reaction.
• pENTR-gus Positive Control at 50 ng/µl. The coding sequence of gus has been cloned with
translational start and stop signals permitting expression in E. coli, as well as in eukaryotic cells.
• LR CLONASE Enzyme Mix (stored at -70°C)
• pUC19 DNA, 10 pg/µl
• LIBRARY EFFICIENCY DH5α (≥1 × 108 CFU/µg) or BL21-SI Competent Cells (≥1 × 107 CFU/µg)
• S.O.C. Medium
• LB Plates containing 100 µg/ml ampicillin.
Tube 1 Tube 2 Tube 3

Component Neg. Control Pos. Control Your
Clone
LR Reaction Buffer 4 µl 4 µl 4 µl
pENTR-gus, 50 ng/µl - 2 µl -
Entry Clone (100-300 ng/20-µl - - 1-11 µl
reaction)
Destination Vector for your gene, 1-11 µl 1-11 µl 1-11 µl
(~300 ng/20-µl reaction)
TE To 16 µl To 16 µl To 16 µl
LR CLONASE Enzyme Mix 4 µl 4 µl 4 µl
Procedure:
1. Assemble reactions on ice.
2. Add TE, LR Reaction Buffer, and the appropriate Entry Clone and Destination Vector DNAs. Mix
well.
3. Remove LR CLONASE Enzyme Mix from the -70°C freezer, and thaw on ice (~2 min).
28
4. Vortex LR CLONASE Enzyme Mix briefly (2 s) twice.

5. Add 4 µl of LR CLONASE Enzyme Mix and mix well by vortexing briefly twice.
6. Return LR CLONASE Enzyme Mix to -70°C freezer.
7. Incubate tubes at 25°C for 60 min.
8. Add 2 µl of Proteinase K Solution to all reactions. Incubate for 10 min at 37°C.
9. Transform 1 µl into 50 µl LIBRARY EFFICIENCY DH5α or BL21-SI Competent Cells using Falcon
2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42°C for 30 s. Add 450 µl S.O.C.
Medium and incubate at 37°C for 1 h. (If the E. coli cells have a transformation efficiency of
108 CFU/µg, the LR Reaction should give about 8,500 colonies if the entire transformation is plated.)
10. Plate 20 µl and 100 µl on LB plates containing 100 µg/ml ampicillin.
11. Also transform 2 µl of pUC19 DNA into 50 µl of LIBRARY EFFICIENCY DH5α or BL21-SI
Competent Cells, as above. Spread 10 µl and 100 µl on LB plates containing 100 µg/ml ampicillin.
(Cells with a tranformation efficiency of 108 CFU/µg should yield about 2,000 colonies if the entire
transformation is plated.)
Alternatively, electroporation can be used to transform 1-2 µl of the LR Reaction, following

addition of the Proteinase K Solution, directly into 25-40 µl electrocompetent E. coli.
29
4. Troubleshooting
Problem Possible Cause Suggested Solution

LR Reaction:
Few or no colonies Transformation plated on LB Plate the reaction transformations on LB amp
obtained from reaction; plates with incorrect antibiotic plates (required for reactions using all but a few
expected numbers of types of Destination Vectors).
pUC19 control colonies
obtained
Reaction not treated with Repeat reaction using Proteinase K Solution.
Proteinase K
Used attB and/or attP DNA Repeat reactions using Entry Clone (attL) and
instead of attL and attR DNAs Destination Vector (attR).
Destination Vector not linearized Linearize within the attR Cassette, avoiding the
ccdB gene.
LR CLONASE Enzyme Mix is Test another aliquot or lot of LR CLONASE Enzyme
inactive Mix.
Check that LR CLONASE Enzyme Mix is being
stored at -70°C.
Prepare small aliquots of LR CLONASE Enzyme
Mix that will each be refrozen and opened no more
than ten times to minimize loss of activity.
Few or no colonies Used BP CLONASE Enzyme Mix Test transformation using pUC19 DNA and
obtained either from LR instead of LR CLONASE Enzyme competent cells known to be active. Verify that
Reaction or pUC19 Mix, transformation procedure competent cells are stored at -70°C.
control performed incorrectly, or
competent cells have lost
efficiency or are dead
Dilutions were performed Repeat transformation paying special attention to
incorrectly dilution steps.
Two distinct types of Unreacted Entry Clone plasmid Reduce the amount of Entry Clone from 300 ng to
colonies appear, large (co-transformed with Expression 100 ng per 20-µl reaction. Also reduce the volume
and small Clone) occasionally gives rise to of sample used for transformation from 2 µl to 1 µl.
colonies that grow slowly on LB
amp plates. When these small
colonies are restreaked onto LB Increase the concentration of ampicillin in the LB
kan (50-100 µg/ml) and LB amp amp plates to 300 µg/ml.
(100 µg/ml) plates, they often
will grow only on the LB kan
plates.
Plasmids carrying large genes Incubate plates at 30°C instead of at 37°C.
and/or genes toxic to E. coli may
be deleted during culture, leading Confirm whether deletion is occurring by analyzing
to two populations of colonies. the DNA present in cultures derived from the
Generally the larger colonies colonies.
contain the deleted plasmids.
30

Tiny colonies appear Unreacted Entry Clone plasmid See above.
after incubating the LB
Plasmids carrying large or lethal
amp plates for more than
genes
24 h
Tiny satellite colonies appearing
Increase the concentration of ampicillin in the LB
around larger ampR colonies that
amp plates to 300 µg/ml.
are releasing β-lactamase
High background in Contamination of one or more Test for plasmid contamination by transforming
absence of Entry Clone. solutions with another plasmid with aliquots of each of the separate solutions used
carrying the same antibiotic in the LR Reaction. Test for bacterial
resistance marker, or by bacteria contamination by plating an aliquot of each
carrying a resistance plasmid solution directly onto LB amp plates.
Some Destination Vectors have Prepare miniprep DNA from one or more
an inherently higher background background colonies. Unstable Destination
than others, possibly due to Vectors often reveal multiple bands on agarose
tendency to delete some or all of gels. If this is the case, try using a different vector
the ccdB gene backbone in your Destination Vector.
BP Reaction:
Few or no colonies Transformation of BP test Plate the BP Reaction transformations on LB kan
obtained using attB reaction plated on LB plates with plates.
Expression Clone; attB incorrect antibiotic
positive control and
pUC19 transformation
control gave expected
numbers of colonies
The attB Expression Clone is Linearize the attB Expression Clone outside the
supercoiled, and therefore attB sites with an appropriate restriction
reacting less efficiently endonuclease or relax with Topoisomerase I.
Linearized (attP) Donor Plasmid Repeat reactions using supercoiled Donor Plasmid.
Few or no colonies BP CLONASE Enzyme Mix is Test another aliquot or lot of BP CLONASE Enzyme
obtained with either new inactive Mix.
attB plasmid or attB
Check that BP CLONASE Enzyme Mix is being
positive control; pUC19
transformation control stored at -70°C.
yielded expected Prepare small aliquots of BP CLONASE Enzyme
numbers of colonies. Mix that will each be refrozen and opened no more
than 10 times, to minimize loss of activity.
Few or no colonies Transformation procedure Test transformation using pUC19 DNA and
obtained from either BP performed incorrectly, or competent cells known to be active. Verify that
Reaction or pUC19 competent cells have lost competent cells are stored at –80°C.
control efficiency or are dead
31

BP Reaction or attB-PCR Cloning:
Two distinct types of Plasmids carrying large genes Incubate plates at 30°C instead of at 37°C.
colonies appear, large and/or genes toxic to E. coli may
and small be deleted during culture, leading
to two populations of colonies.
Generally the larger colonies
contain the deleted plasmids.
Confirm whether deletion is
occurring by analyzing the DNA
present in cultures derived from
the colonies.
Deletions or point mutations of Obtain a new sample of attP Plasmid.
the ccdB gene within the attP
Plasmid can reduce the lethality
of ccdB, allowing E. coli to
grow, although at lower rates. In
this case, a negative control
reaction that omits the attB-
containing DNA will give a
similar number of colonies.
Tiny colonies appear Unreacted Entry Clone plasmid See above.
after incubating the LB or plasmids carrying large or
amp plates for more than lethal genes
24 h
Tiny satellite colonies appearing
around larger ampR colonies that Increase the concentration of ampicillin in the LB
are releasing β-lactamase amp plates to 300 µg/ml.
attB-PCR Cloning:
Few or no colonies Transformation of BP Reaction Plate BP Reaction transformations on LB kan
obtained from BP test plated on LB plates with plates.
reaction and attB incorrect antibiotic
positive control; pUC19
control gives expected
number of colonies.
BP CLONASE Enzyme Mix is Test another aliquot or lot of BP CLONASE Enzyme
inactive Mix.
Verify that BP CLONASE Enzyme Mix is being
stored at -70°C.
Few or no colonies attB-PCR primers have a mistake Replace with correct attB-PCR primers.
obtained from BP in the attB1 or attB2 sequences,
Long (>70 nucleotides) attB-PCR primers should
Reaction with new attB- or lack 5'-terminal four Gs
be purified by PAGE, due to higher likelihood of
PCR product; attB-
primers with incomplete sequence and primers with
positive control and
adducts resulting from repeated deprotection.
pUC19 control give
expected number of
colonies.
32

Few or no colonies Transformation procedure Test transformation using pUC19 DNA and
obtained from either BP performed incorrectly, or competent cells known to be active. Verify that
Reaction or pUC19 competent cells have lost competent cells are stored at -70°C.
control. efficiency
Entry Clones appear to BP recombination reaction may Confirm by either sequence analysis of Entry Clone
lack inserts, migrating as have cloned primer-dimers or by demonstrating that Entry Clone is active in
2.2 kb supercoiled LR Reaction in presence of LR Clonase and
plasmids Destination Vector.
For PCR products >500 bp, purify by precipitating
with one-half volume of 30% PEG 8000/30 mM
MgCl2 Solution, excise the correct size DNA
product band from an agarose gel, and use the
eluted, purified DNA in BP Reaction.
Use PLATINUM Taq DNA Polymerase High
Fidelity, or use "hot-start PCR".
Redesign primers to minimize potential mutual
priming sites leading to primer-dimers.
Low cloning efficiency AttB-PCR primers may contain a For problematic primers >60 nucleotides in length,
of attB- PCR products high percentage of incomplete or purify by PAGE.
incorrect attB sites (most likely
Alternatively, use nested primers, with the second
with primers > 60 nucleotides in
set of primers containing the 25-bp attB sites plus
length)
4 Gs at the 5'-terminus.
Very low cloning Too few PCR molecules added Adjust the amount (ng) of PCR product used to 40-
efficiency of large to BP Reaction 80 fmol of PCR DNA per 20-µl reaction. (For
(>5 kb) attB PCR example, for an 8 kb DNA, 1 fmol ~ 5 ng.)
products
Caution: >400 ng PCR DNA per 20-µl reaction
may inhibit the BP Reaction.
Incubation time needs to be Increase incubation time to 6-18 h.

increased for cloning large PCR
products.
Low yield of PCR PCR product not diluted with TE Dilute with 150 µl TE before adding 30% PEG
product from PEG before addition of 30% PEG 8000/30 mM MgCl2 Solution.
precipitation 8000/30 mM MgCl2 Solution
Centrifugation step too short or Increase time and speed of the centrifugation step.
centrifugation speed too low
Loss of PEG pellet Take care when removing the tube from the
microcentrifuge and keep track of the orientation of
the outer edge of the tube where the pellet is
located.
33

Preparing Entry Clones with Restriction Endonucleases and Ligase:
Few or no kanR colonies ccdB Cassette still present within Excise with appropriate restriction endonuclease(s).
obtained; pUC19 Entry Vector
positive control gave
expected number of
colonies.
Ligation did not work Include ligation positive control linearized plasmid,
with and without ligase.
Protein Synthesis using attB Expression Clones:

No native protein band Protein is being degraded by Use lon- strains of E. coli.
of expected MW visible endogenous proteases
Incubate plates at 30°C instead of at 37°C.
on SDS-PAGE
Compare expression using different N-terminal
and/or C-terminal fusion tags, and in other types of
host cells, such as yeast, insect, or mammalian
cells.
Protein contains secondary Compare expression in other types of host cells,
modifications that increase such as yeast, insect, or mammalian cells.
apparent MW
No fusion protein band Incorrect reading frame of Entry Verify that attB PCR primers were designed with
of expected MW visible Clone gene in correct reading frame.
on SDS-PAGE
Verify that Entry Clone was constructed with gene
in correct reading frame.
Verify that Destination Vector was constructed

with correct reading frame.
Proteins of MW>100 kDa may Perform transformation using BL21-SI Competent

express poorly or as partially Cells.
degraded protein in many
laboratory strains of E. coli.
34
5. Additional Information
5.1 Converting a Vector into a GATEWAY Destination Vector
Destination Vectors function in the GATEWAY Cloning System because they have two recombination
sites, attR1 and attR2, flanking a chloramphenicol resistance (CmR) gene and a ccdB gene. The
GATEWAY Cloning System recombination reactions exchange the entire Cassette (except for the few
bases that contribute to the attB sites) for the DNA segment of interest from the Entry Vector. Because
attR1, CmR, ccdB gene, and attR2 are contiguous, they can be moved on a single DNA segment. If this
cassette is cloned into a plasmid, the plasmid becomes a Destination Vector. Figure 14 shows a
schematic of the three GATEWAY Cloning System Reading Frame Cassettes. Three cassettes are available
to allow construction of Destination Vectors in any reading frame.
Mlu I (reading frame A, 897)

Bgl II (reading frame B, 898)
Xba I (reading frame C, 1040)
attR1 Cm r ccdB attR2
Pvu II Nco I BssH I Sma I

Sfc I Sal I
Not I EcoR I Sca I AlwN I
0 a = 1.7 kb
b = 1.7 kb
c = 1.8 kb
Figure 14. Schematic of the GATEWAY Cloning System Reading Frame Cassettes. Three
blunt-end cassettes are available to convert standard expression vectors into Destination Vectors.
Each cassette contains an attR1 site at the 5'-end followed by the chloramphenicol resistance gene
(Cmr) and ccdB gene. The attR2 site is at the 3'- end of the cassette. Each of the cassettes
provides N-terminal and C-terminal fusions in one of three possible reading frames. The unique
restriction sites listed above the line (Mlu I, Bgl II, and Xba I) distinguish the reading frame
cassettes. Restriction endonucleases common to all the cassettes are presented in Table 3.
35
Table 3. Location of Cleavage Sites for a Selection of Restriction Endonucleases.

Restriction Endonuclease Cleavage Site
DNA Not I Pvu II EcoR I Nco I Sca I BssH II AlwN I Sma I Sfc I Sal I
Rfa 129 348 450 751 865 944 1224 1319 1572 1578
Rfb 130 349 451 752 866 945 1225 1320 1573 1579
Rfc 131 491 593 894 100 1087 1367 1462 1715 1721
The protocol for constructing a Destination Vector is presented below. Keep in mind the following
points:
• Destination Vectors must be constructed and propagated in a gyrA462 strain of E. coli, such as
LIBRARY EFFICIENCY DB3.1 Competent Cells, available from Life Technologies, because the ccdB
gene will be lethal to any other strain.
• If the Destination Vector will be used to make a fusion protein, a GATEWAY Cloning System
Reading Frame Cassette with the correct translation reading frame must be used, as discussed in
Section 5.2. The nucleotide sequences at the ends of the cassettes are shown in Figure 15.
• Note that each reading frame cassette has a different unique restriction site between the
chloramphenicol resistance and ccdB genes (Mlu I for reading frame A, Bgl II for reading frame B,
and Xba I for reading frame C).
• Because the reading frame cassettes are blunt-ended, they will clone in both orientations.
Most standard vectors can be converted to Destination Vectors, by inserting the GATEWAY Reading
Frame Cassette into the multiple cloning site (MCS) of that vector. If you are converting a vector that
encodes kanamycin resistance, you will need to use the resulting Destination Vector with Entry Clones
that carry a selection marker other than kanR. For this purpose, you can make your Entry Clone in a BP
Reaction using a Donor Vector with a marker other than kanR, such as tetR or genR (available by
request).
5.2 Protocol for Making a Destination Vector
The following steps are required to construct a Destination Vector that will create N-terminal protein
fusions to genes in Entry Clones, via an LR Reaction.
1. If the vector will make an amino-terminal fusion protein, it is necessary to keep the -AAA-AAA-
triplets in attR1 (see Figure 15) in phase with the translation reading frame of the fusion protein,
since this is the reading frame convention employed in all of the N-terminal fusion Destination
Vectors available from Life Technologies and in the construction of attB Expression Clones and attB
PCR products.
Similar considerations are required to construct Destination Vectors that create C-terminal protein
fusions. The C-terminal coding sequences of these vectors should be aligned in phase with -TAC-
AAA- of the attR2 sequences as shown in Figure 15.
36
Figure 15. Sequences at Ends of GATEWAY Reading Frame Cassettes. The terminal
sequences of the attR1-Cmr-ccdB-attR2 cassettes are shown, including the terminal portions
of the flanking attR sites (boxed). The staggered cleavage sites for Int are indicated in the
boxed regions. Following recombination with an Entry Clone, only the outer (unshaded)
sequences in attR sites contribute to the resulting attB sites in the Expression Clone.
Figure 16. Examples of How to Choose the Correct GATEWAY Reading Frame Cassette
for N-Terminal Fusions.
N-Fusion protein
codon Reading Frame Cassette A
--- NNN NNN ATC ACA AGT TTG TAC AAA AAA GCT ---
--- NNN NNN TAG TGT TCA AAC ATG TTT TTT CGA ---
attR 1
* Reading Frame Cassette B
--- NNN NNN NNA TCA ACA AGT TTG TAC AAA AAA GCT ---
--- NNN NNN NNT AGT TGT TCA AAC ATG TTT TTT CGA ---
*cannot be TG or TA
Reading Frame Cassette C
--- NNN NNN NAT CAA ACA AGT TTG TAC AAA AAA GCT ---
--- NNN NNN NTA GTT TGT TCA AAC ATG TTT TTT CGA --- www.lifetech.com/gateway
37
2. Determine which GATEWAY Cloning System Reading Frame Cassette to use as follows:
—Write out the nucleotide sequence of the existing vector near the restriction site into which the
GATEWAY Cloning System Reading Frame Cassette will be cloned. These must be written in
triplets corresponding to the amino acid sequence of the fusion domain.
—Draw a vertical line through the sequence that corresponds to the restriction site end, after it has
been cut and made blunt, i.e., after filling in a protruding 5′-end or polishing a protruding 3′-end.
For N-terminal fusions:
—If the coding sequence of the blunt end terminates after a complete codon triplet, use the Reading
Frame Cassette A. (See Figure 16)
—If the coding sequence of the blunt end encodes two bases of a complete codon triplet, use the
Reading Frame Cassette B.
—If the coding sequence of the blunt end encodes one base of a complete codon triplet, use the
Reading Frame Cassette C.
For C-terminal fusions:
—If the coding sequence of the blunt end terminates after a complete codon triplet, use the Reading
Frame Cassette B. (See Figure 16)
—If the coding sequence of the blunt end encodes two bases of a complete codon triplet, use the
Reading Frame Cassette C.
—If the coding sequence of the blunt end encodes one base of a complete codon triplet, use the
Reading Frame Cassette A.
For preparing a vector that encodes both an N- and C-terminal fusion, care must be taken when
choosing appropriate restriction enzymes for cutting the vector. The resultant ends (after generating
blunt ends) need to be compatible with one of the three cassettes shown in Figure 16.
3. Cut one to five micrograms of the existing plasmid at the position where you wish your gene (flanked
by att sites) to be after the recombination reactions. Note: It is better to remove as many of the MCS
restriction sites as possible at this step. This makes it more likely that restriction endonuclease sites
within the GATEWAY Cloning System Reading Frame Cassette will be unique in the new plasmid,
which is important for linearizing the Destination Vector (Section 5.3).
4. If necessary, convert the ends of the vector to flush double-stranded DNA, so that the vector is
compatible with the blunt ends of the cassette, using either T4 DNA Polymerase or Klenow Fragment
(See protocol in Section 3.2.1B.)
5. Remove the 5′ phosphates with alkaline phosphatase. This increases the probability of success by
decreasing background associated with self-ligation of the vector.
6. Remove dNTPs and small DNA fragments by ethanol precipitation. Dissolve wet precipitate in
200 µl TE, add 100 µl of 30% PEG 8000/30 mM MgCl2, mix well, immediately centrifuge for
10 min at room temperature, discard supernatant, centrifuge again a few seconds, discard any
residual liquid.
7. Dissolve the DNA to a final concentration of 10 - 50 ng per microliter. Apply 20 - 100 ng to a gel
next to Low DNA MASS Ladder and linear size standards to confirm cutting and recovery.
8. In a 10-µl ligation reaction combine 10 - 50 ng vector, 10 - 20 ng of GATEWAY Cloning System

Reading Frame Cassette, and 1 unit T4 DNA ligase in ligase buffer. Incubate for 1 h at room
temperature (or overnight at 16°C, whichever is most convenient). Transform 1 µl into 100 µl DB3.1
38
Competent Cells. (The ccdB gene on the GATEWAY Cloning System Reading Frame Cassette will be
lethal to any other strain.)
9. After expression in S.O.C. Medium, plate 10 µl, 100 µl, and remaining cells on agar plates
containing 30 µg/ml chloramphenicol; incubate at 37°C for 16-20 h.
10. Isolate miniprep DNA from single colonies (Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989)
Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, New York). Treat the miniprep with RNase A and store in TE. Cut with the
appropriate restriction endonuclease to determine the orientation of the cassette. Choose clones
with the attR1 site next to the amino end of the protein expression function of the plasmid.
11. To demonstrate that the ccdB gene is functioning properly in a newly constructed Destination Vector
perform the following test.
—Transform equal amounts (10 - 50 pg) of Destination Vector into 100 µl of LIBRARY EFFICIENCY
DH5α and DB3.1 Competent Cells using the protocol provided with the cells. Plate dilutions
onto LB plates containing the appropriate antibiotic.
—As a control for transformation efficiency, transform pUC19 (50 pg) into both strains. Plate
dilutions onto LB plates containing 100 µg/ml ampicillin.
—Normalize the transformation efficiency of both strains to the pUC19 positive control using the
following calculation:
Transformation efficiency (CFU/µg) = colonies/pg of DNA × (1 × 106 pg/µg) × dilution factor(s)
For example, if 50 pg of pUC19 yields 100 colonies when 100 µl of a 1:10 dilution of the
transformation mix is plated, then:
CFU/µg = 100 CFU/50 pg × (1 × 106 pg/µg) × (1 ml/0.1 ml plated) × 10 = 2 × 108
—Calculate the number of colonies obtained in both strains from transformations using the
Destination Vector.
—An acceptable Destination Vector transformed into the permissive strain LIBRARY EFFICIENCY
DB3.1 Competent Cells should give greater than 10,000 times the number of colonies that it will
if transformed into LIBRARY EFFICIENCY DH5α Competent Cells. Any ratio less than 10,000
suggests contamination of the plasmid prep with another ampicillin-resistant plasmid, or an
inactive ccdB gene, or both. DNA with lower ratios can be used, but higher background will likely
be observed.
5.3 Using the Destination Vector in the GATEWAY Cloning System
About ten-fold more colonies result from a GATEWAY Cloning System reaction if the Destination Vector
is linear or relaxed. If the competent cells used are highly competent (>108 per microgram), linearizing
or relaxing the Destination Vector is less essential.
The site or sites used for linearization must be within the GATEWAY Cloning System Reading Frame
Cassette, but not within the ccdB gene. A sampling of the sites that cut within a cassette is shown in
Figure 14. The complete sequence is available on the website.
Mini-prep (alkaline lysis) DNA preparations are adequate for GATEWAY reactions; however, in general,
such DNA can not be quantitated by UV absorbance due to contaminating RNA and nucleotides.
39
Concentrations can be estimated by gel electrophoresis in comparison with standard DNA, i.e., DNA
MASS Ladder. Alternatively, DNA purified by CONCERT DNA purification systems is recommended.
5.4 "One-Tube" Protocol: A Protocol for Cloning attB-PCR Products Directly into Destination
Vectors.
1. Perform the BP Reaction in 20 µl at 25°C as described in Section 3.2.4, except incubate for 3-4 h.
2. Following incubation add:

1 µl of 0.75 M NaCl
3 µl of Destination Vector (150 ng/µl)
6 µl of LR CLONASE Enzyme Mix
The final volume should be 30 µl.
3. Mix reaction. Immediately

B1
Gene
B2 remove 5 µl of the mixture to a
separate tube and to this aliquot
+
P1 P2 add 0.5 µl of Proteinase K
pDONR BP Reaction Solution. Incubate for 10 min
Kn r at 37°C. Label as Tube A; place
L1 L2 on ice or store at -20°C. This
Gene aliquot will be used to recover
( ) Entry Clone
Entry Clones containing the
R1 R2 Kn r cloned PCR product. Transform
ccdB
1 µl of this reaction into 50 µl
Destination Vector
of LIBRARY EFFICIENCY DH5α
Apr LR Reaction Competent Cells using Falcon
2059 tubes. Incubate on ice for
30 min. Heat-shock the cells at
B1 B2 42°C for 30 s. Add 450 µl
Gene
Expression Clone
S.O.C. Medium and incubate at
37°C for 1 h. Plate 20 µl and
Stop reaction and
Transform
Apr 100 µl on LB plates containing
50 µg/ml kanamycin.
Figure 17. One-Tube Protocol for Cloning PCR Products 4. Incubate the remaining 25 µl
Directly into Destination Vectors. PCR product made with
mixture at 25°C for 1-2 h.
attB oligonucleotides can be directly moved into an
Expression Clone via a two-step reaction in one tube. Initially
5. Add 2.5 µl of Proteinase K
the BP Reaction transfers the attB-PCR product into an Entry
Solution. Incubate for 10 min
Clone. Subsequent addition of Destination Vector and LR
at 37°C. Label as Tube B.
CLONASE Enzyme Mix generates an Expression Clone via the
LR Reaction. No purification of the intermediate Entry Clone
is required. 6. Transform 1 µl of the
completed reaction into 50 µl
LIBRARY EFFICIENCY DH5α or
BL21-SI Competent Cells using Falcon 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells
at 42°C for 30 s. Add 450 µl S.O.C. Medium and incubate at 37°C for 1 h.
40
7. Plate 100 µl and 400 µl on LB plates containing 100 µg/ml ampicillin.
5.5 Transferring Clones from cDNA Libraries Made in GATEWAY Vectors
When working with a clone isolated from a cDNA library constructed in a GATEWAY vector, such as
SUPERSCRIPT cDNA libraries supplied in pCMV•SPORT6 (which contains attB sites), several
considerations must be made before the cDNA clone can be used for protein expression. These include
whether the clone is full-length and how it is to be expressed, either as a native protein, an amino-
terminal (N-terminal) fusion protein, or as a carboxy-terminal (C-terminal) fusion protein.
The following considerations must be kept in mind for expression of a native protein. Life Technologies
supplies many libraries containing full-length open reading frames. Some clones, however, may contain
only a partial reading frame, or may contain not only the entire ORF but 5' untranslated (5' UTR)
sequence as well. Contained within the 5' UTR of a cDNA is the ribosome recognition sequence for the
organism from which the cDNA was derived. Therefore, a full-length cDNA derived from mammalian
cells can be used for native expression in mammalian cells without prior characterization but cannot be
used for native expression in E. coli, as no Shine-Dalgarno sequence is present. When attempting to
express a mammalian cDNA in E. coli, a Shine-Dalgarno sequence must be supplied. This can be done
either by cloning the cDNA into an Entry Vector that contains a Shine-Dalgarno sequence, or by
introducing a Shine-Dalgarno sequence by PCR when amplifying the cDNA with primers also containing
attB sequences and cloning the PCR product by recombination. (See Section 3.2.4 for cloning of PCR
products).
The length and content of the clone is also important in expressing fusion proteins. If the cDNA is full-
length then the 5' UTR will also be translated as a part of the fusion protein. This may present problems
as the additional codons may interfere with the expression or function of the protein. Additionally, the
5' UTR may contain stop codons, which would prevent expression of the protein of interest. If the ORF
is not full-length then a truncated portion of the protein of interest will be expressed within the fusion. To
express any cDNA isolated from a library as an N-terminal fusion protein, the reading frame of the gene
must be in frame with the reading frame of the attB1 site (see Figure 13). In this case, there is one
chance in three that the cDNA will be in frame with the attB1 site and therefore allow for fusion protein
expression. A researcher can construct three Destination Vectors representing all three possible reading
frames through the attB1 sites so that any give cDNA clone can be expressed in one of the three vectors.
Alternatively, to assure that the ORF encoded by the cDNA will be in frame with an N-terminal fusion
protein sequence, PCR may be used to install attB sites, so that the AAA-AAA sequence within attB1 is
in phase with the ORF.
The major consideration in generating C-terminal fusion proteins from cDNAs is the fact that all cDNAs
will contain one or more stop codons, which must be removed before C-terminal fusion expression is
possible. This may be done by subcloning the gene into an Entry Vector so that no stop codon is present.
Alternatively, it may be done by amplifying the gene by PCR using attB primers where the stop codon
has been eliminated from the gene specific sequence.
41
5.6 Detailed Descriptions of the Vectors of the GATEWAY Cloning System
Figure 18. Vector Map of Typical Entry Vector
All Entry Vectors consist of the same vector backbone (outside of the attL sites) but differ in the
sequences and cloning sites provided between the attL sites.
The vector map of pENTR1A, shown here, displays the single-cut restriction enzyme sites in this
prototype vector.
42
NOTE: In the following figures the amino acids shown before the ccdB gene can be added to the N-
terminus of your protein only if a translation start site is provided in the Destination Vector (such as with
an N-terminal His6 or GST fusion).
NOTE: If a blunt-ended fragment containing a 5′-ATG is cloned into the Xmn I site of pENTR1A, 2B,
3C, or 4, the adenine at position –3 of the underlined ACC sites provides a Kozak eukaryotic ribosome
recognition sequence for initiation of translation.
Figure 19. Cloning Sites of the Entry Vector pENTR1A
Figure 20. Cloning Sites of the Entry Vector pENTR2B
43
Figure 21 Cloning Sites of the Entry Vector pENTR3C
Figure 22. Cloning Sites of the Entry Vector pENTR4
Figure 23. Cloning Sites of the Entry Vector pENTR11
The underlined AAGGAG/A and ACC sites correspond to the Shine-Dalgarno (prokaryotes) and Kozak
eukaryotic ribosome recognition sequences preceding the initiating ATG.
44
Figure 24. pDEST8

Polyhedron Promoter, Baculovirus Transfer Plasmid
Map of GATEWAY pDEST8 Vector. DNA from the Entry Clone replaces the region between
nucleotides 168 and 1990.
Recombination Region of the Expression Clone resulting from pDEST8 × Entry Clone:
Features of the Recombination Region:

• The sequence shown extends from nucleotides 60-167 and 1991-2069 on the pDEST8 map. The
nucleotides marked with * and ♦ correspond to bases 167 and 1991, respectively, of the pDEST8
sequence.
• The polyhedron promoter (pPolh), a portion of which is shown as a black box, extends from nt 24-64.
The start of transcription is indicated by the arrow at nt 67.
• Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST8
by recombination. Non-shaded regions are derived from pDEST8.
The designated reading frame for attB1 and attB2 are provided in Figure 5.
The sequence has not been confirmed by sequence analysis. It was assembled from the known sequence of fragments used to
construct the vector. The sequence and the location of sites for restriction endonucleases that cleave up to ten times can be found
in the TECH-ONLINESM section of Life Technologies' web page, http://www.lifetech.com.
45
Figure 25. pDEST10

Polyhedron Promoter with N-His6, Baculovirus Transfer Plasmid

• The sequence shown extends from nucleotides 155-344 and 2168-2226 on the pDEST10 map. The nucleotides
marked with * and ♦ correspond to bases 344 and 2168, respectively, of the pDEST10 sequence.
• The polyhedron promoter (pPolh), a portion of which is shown as a black box, extends from nt 116-156. The
start of transcription is indicated by the arrow at nt 159.
• Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST10 by
recombination. Non-shaded regions are derived from pDEST10.
46
Figure 26. pDEST12.2

CMV Promoter for Mammalian Expression, SV40 Promoter/ori
for Neo Resistance
Map of GATEWAY pDEST12.2 Vector. DNA from the Entry Clone replaces the region between
Recombination Region of the Expression Clone resulting from pDEST12.2 × Entry Clone:

• The sequence shown extends from nucleotides 630-737 and 2420-2498 on the pDEST12.2 map. The
nucleotides marked with * and ♦ correspond to bases 737 and 2420, respectively, of the pDEST12.2
sequence.
• The black box represents the sequence from nucleotides 15-629 and contains the CMV promoter (nt
15-535), the start of transcription at nt 537, and a portion of the 5'-untranslated region.
• Shaded regions correspond to those DNA sequences transferred from the Entry Clone into
pDEST12.2 by recombination. Non-shaded regions are derived from pDEST12.2.
47
Figure 27. pDEST14

Native Protein Expression in E. coli, T7 Promoter

• The position of the T7 promoter is shown. The start of transcription is indicated by the arrow.
• The nucleotides marked with * and ♦ correspond to bases 74 and 1898, respectively, of the
pDEST14 sequence.
48
Figure 28. pDEST15

Glutathione-S-transferase Amino-Fusion in E. coli, T7 Promoter

pDEST15 sequence.
49
Figure 29 pDEST17
6X Histidine Affinity Tag Amino-Fusion in E. coli, T7 Promoter

pDEST17 sequence.
50
Figure 30. pDEST20

Glutathione-S-transferase Amino-Fusion with Polyhedron Promoter for
Baculovirus Expression

• The sequence shown extends from nucleotides 6295-6403, 7060-13, and 1696-1754 on the pDEST20 map. The
nucleotides marked with * and ♦ correspond to bases 13 and 1696, respectively, of the pDEST20 sequence.
• The polyhedron promoter (pPolh), a portion of which is shown as a black box, extends from nt 6257-6297. The
start of transcription is indicated by the arrow at nt 6300.
51
Figure 31. pDEST26

CMV Promoter for Mammalian Expression, 6X Histidine Affinity
Tag Amino-Fusion SV40 Promoter/ori for Neo Resistance

• The sequence shown extends from nucleotides 615-678 and 2361-2499 on the pDEST26 map. The nucleotides
marked with * and ♦ correspond to bases 678 and 2361, respectively, of the pDEST26 sequence.
• The black box represents the sequence from nucleotides 15-614 and contains the CMV promoter (nt 15-535),
the start of transcription at nt 537, and a portion of the 5'-untranslated region.
52
Figure 32. pDEST27

CMV Promoter for Mammalian Expression, Glutathione-
S-Transferase Amino-Fusion SV40 Promoter/ori for Neo Resistance

• The sequence shown extends from nucleotides 630-643, 1301-1320, and 3003-3081 on the pDEST27 map. The
nucleotides marked with * and ♦ correspond to bases 1320 and 3003, respectively, of the pDEST27 sequence.
• The black box represents the sequence from nucleotides 15-619 and contains the CMV promoter (nt 15-535),
the start of transcription at nt 537, and a portion of the 5'-untranslated region.
53
Table 4. Restriction Endonucleases That Do Not Cleave the Destination Vectors, or Cleave Twice
Restriction endonucleases that do not cleave pDEST8 DNA:

Aat II Cla I Hind III Nsp V SexA I Sst I
Afl II Cvn I Kpn I Pac I Sfi I Stu I
Apa I Eco47 III Nar I PinA I Sgf I Sun I
Asc I Eco72 I Nde I Pme I SgrA I Swa I
Bpu1102 I EcoN I Nhe I PshA I Spe I Xba I
Bsg I EcoO109 I Nru I Psp5 II Sph I Xcm I
BstE II Fse I Nsi I Rsr II Sse8387 I Xho I
Restriction endonucleases that cleave pDEST8 DNA twice:

AlwN I 1521 4496 Bst1107 I 2 1280 Nsp I 4910 5892
Ban I 2837 4069 BstX I 1728 5356 PflM I 406 973
Bgl II 5193 5663 Dra III 2876 6224 Rca I 3182 4190
BspLU11 I 4910 5892 Eam1105 I 2522 4017 Tfi I 1097 4936
BssS I 3353 4737 Gsu I 848 3932 Xmn I 3418 6443

Aat II BstE II EcoO109 I Nsi I SexA I Swa I
Afl II Cla I Fse I Pac I Sfi I Xcm I
Apa I Cvn I Nar I PinA I Sgf I
Asc I Eco47 III Nde I Pme I SgrA I
Bpu1102 I Eco72 I Nhe I PshA I Sse8387 I
Bsg I EcoN I Nru I Psp5 II Sun I

AlwN I 1698 4770 BstX I 1905 5630 Not I 462 2233
BamH I 1377 2191 Dra III 3150 6498 PflM I 583 1150
Ban II 2220 3077 Eam1105 I 2795 4291 Pst I 2046 2256
Bgl II 5467 5937 EcoR I 924 2198 Rca I 3456 4464
BspLU11 I 5184 6166 EcoR V 298 5743 Sal I 2052 2214
BssS I 3627 5011 Gsu I 1025 4206 Xmn I 9 3692
Bst1107 I 94 1457 Nco I 1225 2187
Restriction endonucleases that do not cleave pDEST12.2 DNA:

Apa I BstE II EcoR V PshA I Sun I
Asc I Cvn I Fse I Psp5 II Swa I
Bgl II Eco47 III Pac I Sgf I Xba I
Bpu1102 I Eco72 I PinA I SgrA I Xcm I
Bsg I EcoN I Pme I Spe I Xho I
Restriction endonucleases that cleave pDEST12.2 DNA twice:

Acc I 1709 2304 Cla I 3048 5066 Sca I 1591 5779
Afl III 1623 7150 EcoO109 I 2781 5281 Sst I 518 7275
AlwN I 1950 6736 Kpn2 I 605 1172 Stu I 669 4089
Avr II 617 4092 Kpn I 719 3742 Vsp I 3059 6086
Bsa I 2179 6190 Nde I 187 2662 Xma III 856 4192
BssH II 1670 4683 NgoA IV 3301 4786
BstX I 2157 5000 Pvu I 3132 5890
54

Afl II BstE II Kpn I PinA I SnaB I Sun I
Apa I Cvn I Mun I Pme I Spe I Swa I
Asc I Dra III Nde I Rsr II Sse8387 I Xcm I
Avr II Eco72 I Nsi I SexA I Sst I Xho I
Bcl I Fse I Nsp V Sfi I Sst II
BseR I Hpa I Pac I Sgf I Stu I

Afl III 1101 4313 Bst1107 I 1187 4544 Pvu I 3053 6139
AlwN I 1428 3899 Drd I 4205 4620 Pvu II 552 4724
Apo I 654 2427 Ear I 2631 4435 Sca I 1069 2942
Ava I 1523 5363 Eco57 I 2738 3786 Ssp I 964 2618
Ban II 6307 6321 EcoR I 654 2427 Vsp I 19 3249
BsaA I 345 4563 EcoR V 2049 2240 Xma III 193 5849
BspM I 1778 5725 Psp5 II 5307 5349 Xmn I 2821 4755
BsrB I 2581 4382 Pst I 1776 3179

Afl II Cvn I Mlu I Rsr II Sse8387 I Xho I
Apa I Dra III Mun I SexA I Sst I
Asc I Eco72 I Nsi I Sfi I Sst II
Avr II Fse I Pac I Sgf I Stu I
BseR I Hpa I PinA I SnaB I Sun I
BstE II Kpn I Pme I Spe I Xcm I

Afl III 343 4908 Eco57 I 3333 4381 Pvu II 1136 5319
AlwN I 2012 4494 EcoN I 111 6760 Sap I 189 5030
Apo I 1238 3022 EcoR I 1238 3022 Sma I 2107 2506
Ban II 6902 6916 EcoR V 2644 2835 Ssp I 1548 3213
Bsg I 370 5733 Esp3 I 1456 5261 Vsp I 23 3844
BspLU11 I 343 4908 Nco I 777 1539 Xba I 63 1685
BspM I 2362 6320 Psp5 II 5902 5944 Xma III 918 6444
Bst1107 I 1771 5139 Pst I 2360 3774
Drd I 4800 5215 Pvu I 3648 6734

Afl II BstE II Kpn I PinA I SnaB I Sun I
Apa I Cvn I Mlu I Pme I Spe I Swa I
Asc I Dra III Mun I Rsr II Sse8387 I Xcm I
Avr II Eco72 I Nsi I SexA I Sst I Xho I
Bcl I Fse I Nsp V Sfi I Sst II
BseR I Hpa I Pac I Sgf I Stu I

AlwN I 1360 3831 Bst1107 I 1119 4476 Pst I 1708 3111
Apo I 586 2359 Drd I 4137 4552 Pvu I 2985 6071
Ava I 1455 5295 Ear I 2563 4367 Pvu II 484 4656
BamH I 336 1039 Eco57 I 2670 3718 Sca I 1001 2874
Ban II 6239 6253 EcoR I 586 2359 Ssp I 896 2550
Bgl II 1 1033 EcoR V 1981 2172 Vsp I 19 3181
BspM I 1710 5657 Esp3 I 804 4598 Xma III 266 5781
BsrB I 2513 4314 Psp5 II 5239 5281 Xmn I 2753 4687
55

Aat II Cvn I Nar I Pme I SgrA I Xcm I
Afl II Eco47 III Nde I PshA I Spe I Xho I
Apa I Eco72 I Nhe I Psp5 II Sph I
Asc I Fse I Nru I Rsr II Sse8387 I
Bpu1102 I Hind III Nsi I SexA I Sst I
BstE II Kpn I Pac I Sfi I Stu I
Cla I Mlu I PinA I Sgf I Sun I

AlwN I 1226 4203 Bst1107 I 985 6235 Gsu I 553 3639
Bcl I 1979 6825 BstX I 1433 5063 Nco I 753 6389
Bgl II 4900 5370 Dra III 2583 5931 Rca I 2889 3997
BsmF I 1228 6368 Eam1105 I 2229 3724 Sap I 4739 6475
BssS I 3060 4444 Esp3 I 670 5529 Tfi I 802 4643

Apa I Cvn I Fse I Pme I Spe I Xho I
Asc I Eco47 III Mlu I PshA I Sse8387 I
Bpu1102 I Eco72 I Nru I Psp5 II Sun I
Bsg I EcoN I Pac I Sgf I Swa I
BstE II EcoR V PinA I SgrA I Xcm I

Acc I 1650 2245 BstX I 2098 4942 Pst I 2239 4277
AlwN I 1891 6678 Cla I 2990 5008 Pvu I 3074 5832
Avr II 617 4034 Kpn2 I 605 1113 Sca I 1532 5721
Bsa I 2120 6132 Nde I 187 2604 Xma III 797 4134
BssH II 1611 4625 NgoA IV 3243 4728

Apa I Eco47 III Nru I Psp5 II Sun I
Asc I Eco72 I Pac I Sgf I Xcm I
Bpu1102 I EcoR V PinA I SgrA I Xho I
BstE II Fse I Pme I Spe I
Cvn I Mlu I PshA I Sse8387 I

Acc I 2292 2887 BspLU11 I 870 7734 NgoA IV 3885 5370
Afl III 870 7734 BssH II 2253 5267 Nsp V 1028 5551
AlwN I 2533 7320 BstX I 2740 5584 Pst I 2881 4919
Avr II 617 4676 Cla I 3632 5650 Pvu I 3716 6474
Bcl I 1066 3393 Kpn2 I 605 1755 Xma III 1439 4776
Bsa I 2762 6774 Nde I 187 3246 Xmn I 1021 6242
56
Figure 33. Donor Vector for BP Reactions: pDONR201
57
6. Related Products
Product Size Cat. No.
Systems
PCR Cloning System (with GATEWAY Technology) 20 reactions 11821-014
(Contains: GATEWAY BP CLONASE™ Enzyme Mix, reaction buffers, pDONR201 vector,
Proteinase K Solution, 30% PEG/Mg Solution, LIBRARY EFFICIENCY DH5α Competent
Cells, positive control and protocol)
E. coli Expression System (with GATEWAY Technology) (with LIBRARY 20 reactions 11822-012
EFFICIENCY DH5α Competent Cells)
(Contains: GATEWAY LR CLONASE™ Enzyme Mix, reaction buffers, pDEST14, pDEST15,
pDEST17 vectors, Proteinase K Solution, LIBRARY EFFICIENCY DH5α Competent Cells,
positive control and protocol)
E. coli Expression System (with GATEWAY Technology) (with BL21-SI 20 reactions 11823-010
Competent Cells)
(Contains: GATEWAY LR CLONASE Enzyme Mix, reaction buffers, pDEST14, pDEST15,
pDEST17 vectors, Proteinase K Solution, BL21-SI Competent Cells, positive control and
protocol)
Mammalian Expression System (with GATEWAY Technology) 20 reactions 11826-013

(Contains: GATEWAY LR CLONASE Enzyme Mix, reaction buffers, pDEST12.2, pDEST26,
Baculovirus Expression System (with GATEWAY Technology) 1 20 reactions 11827-011
(Contains: GATEWAY LR CLONASE Enzyme Mix, reaction buffers, pDEST8, pDEST10,
GATEWAY Vector Conversion System 20 reactions 11828-019
(Contains: GATEWAY rfA, rfB and rfC Cassettes, LIBRARY EFFICIENCY DB3.1 Competent
Cells, positive control and protocol)
PCR Cloning Vectors
GATEWAY pDONR201 Vector 40 µl 11798-014
[attP sites, knr] (150 ng/µl)
Enzymes
GATEWAY BP CLONASE Enzyme Mix 20 reactions 11789-013
(Contains: enzyme mix, reaction buffer, Proteinase K Solution, and 30% PEG/Mg Solution)
GATEWAY LR CLONASE Enzyme Mix 20 reactions 11791-019
(Contains: enzyme mix, reaction buffer, Proteinase K Solution)
1
The Baculovirus Expression System (with GATEWAY Technology) provides all the components necessary to
construct the GATEWAY version of the pFASTBAC™ clone. Once constructed, this clone can be used in conjunction
with the BAC-TO-BAC® Baculovirus Expression System to generate (by in vivo recombination with a bacmid) a
recombinant baculovirus vector for expression in insect cells. Components from the BAC-TO-BAC Baculovirus
Expression System that are also required include MAX EFFICIENCY® DH10BAC® cells, CELLFECTIN® Reagent, and
insect cells for expression. Refer to the BAC-TO-BAC® Baculovirus Expression System manual (which can be found
on our web site) for more information regarding this system.
58

Entry Vectors (for entry via restriction enzyme and ligase cloning)
GATEWAY pENTR1A Vector 20 µl 11813-011
[attL sites, rf 0, 1st site blunt, no Shine-Dalgarno; for N-terminal or C-terminal fusions in
E. coli or eukaryotic cells; native expression in E. coli or eukaryotic cells if gene contains (500 ng/µl)
endogenous ribosome binding sites]
GATEWAY pENTR2B Vector 20 µl 11816-014

[attL sites, rf +1, 1st site blunt, no Shine-Dalgarno; for N-terminal or C-terminal fusions in (500 ng/µl)
E. coli or eukaryotic cells; native expression in E. coli or eukaryotic cells if gene contains
GATEWAY pENTR3C Vector 20 µl 11817-012
[attL sites, rf +2, 1st site blunt, no Shine-Dalgarno; for N-terminal or C-terminal fusions in (500 ng/µl)
E. coli or eukaryotic cells; native expression in E. coli or eukaryotic cells if gene contains
GATEWAY pENTR4 Vector 20 µl 11818-010
[attL sites, 1st site Nco I, Kozak, no Shine-Dalgarno; for N-terminal or C-terminal fusions in (500 ng/µl)
E. coli or eukaryotic cells; native expression in eukaryotic cells; native expression in E. coli if
gene contains endogenous ribosome binding sites]
GATEWAY pENTR11 Vector 20 µl 11819-018
[attL sites, blunt and Nco I sites both preceded by Shine-Dalgarno and Kozak, for native, N- (500 ng/µl)
terminal or C-terminal fusions in E. coli or eukaryotic cells]
Competent Cells
LIBRARY EFFICIENCY DB3.1 Competent Cells 5 × 0.2 ml 11782-018
[For propagating plasmids containing the ccdB gene (e.g., Destination Vectors)]
Destination Vectors
GATEWAY pDEST14 Vector 40 µl 11801-016
[For native expression in E. coli: T7 promoter, attR sites]

[For prokaryotic expression: T7 promoter, N-terminal GST tag, attR sites]

[For prokaryotic expression: T7 promoter, N-terminal 6X histidine affinity tag, attR sites]

[For baculovirus expression: pFASTBAC vector with polyhedron promoter, attR sites]

[For baculovirus expression: pFASTBAC HT vector with polyhedron promoter, N-terminal 6X
histidine affinity tag, attR sites]

[For baculovirus expression: pFASTBAC vector with polyhedron promoter, N-terminal GST
tag, attR sites]
GATEWAY pDEST12.2 Vector 40 µl 11808-011

[For mammalian expression: pCMV•SPORT vector, neor, attR sites]

[For mammalian expression: pCMV•SPORT vector, neor, N-terminal 6X histidine affinity
tag, attR sites]

[For mammalian expression: pCMV•SPORT vector, neor, N-terminal GST tag, attR sites]
59

Competent Cells, Media, and Antibiotics:
LIBRARY EFFICIENCY DH5α Competent Cells 5 × 0.2 ml 18263-012
BL21-SI Competent Cells 5 × 0.2 ml 11665-015
MAX EFFICIENCY DH10BAC Competent Cells 5 × 0.1 ml 10361-012
Bluo-gal 100 mg 15519-010
X-gal 100 mg 15520-034
IPTG 1g 15529-019
S.O.C. Medium 10 × 10 ml 15544-034
Ampicillin Sodium salt, lyophilized 5 ml 13075-015
Kanamycin Sulfate 1g 11815-016
Products for Mammalian and Insect Expression:

BAC-TO-BAC Baculovirus Expression System 5 reactions 10359-016
LIPOFECTAMINE™ 2000 Reagent 1.5 ml 11668-019
CELLFECTIN Reagent 1 ml 10362-010
Sf-900 II SFM (1X), liquid 500 ml 10902-096
Sf9 Cells, SFM Adapted 3 ml 11496-015
Sf21 Cells, SFM Adapted 3 ml 11497-013
CD-CHO Medium 500 ml 10743-011
CHO-S Cells 3 ml 11619-012
293 SFM II 500 ml 11686-011
293-F Cells 3 ml 11625-019
VP SFM 1,000 ml 11681-020
COS-7L Cells 3 ml 11622-016
Liquid GENETICIN® 20 ml 10131-035
PCR/RT-PCR Products:
Custom Primers-Gateway attB modifications*
PLATINUM Pfx DNA Polymerase 50 units 11708-047
PLATINUM Taq DNA Polymerase High Fidelity 500 units 11304-029
TAQUENCH PCR Cloning Enhancer 100 units 11265-014
THERMOSCRIPT™ RT-PCR System plus PLATINUM Taq 100 reactions 11146-040
DNA Polymerase High Fidelity
DNA Purification Products:

CONCERT High Purity Plasmid Miniprep System 25 reactions 11449-014
CONCERT High Purity Plasmid Midiprep System 25 reactions 11451-010
CONCERT High Purity Plasmid Maxiprep System 10 reactions 11452-018
Nucleic Acid Purification Rack each 11494-010
CONCERT Rapid Plasmid Miniprep System 50 reactions 11453-016
CONCERT Rapid Plasmid Midiprep System 25 reactions 11454-014
CONCERT Rapid Plasmid Maxiprep System 10 reactions 11455-011
CONCERT Rapid Gel Extraction System 50 reactions 11456-019
CONCERT Matrix Gel Extraction System 150 reactions 11457-017
Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v) 100 ml 15593-031
60

Cloning Reagents:
SUPERSCRIPT II RNase H- Reverse Transcriptase 10,000 units 18064-014
SUPERSCRIPT Plasmid System for cDNA Synthesis and
Plasmid Cloning 3 reactions 18248-013
PROQUEST™ Two-Hybrid cDNA Libraries**
SUPERSCRIPT cDNA Libraries**
Calf Intestinal Alkaline Phosphatase (CIAP) 1,000 units 18009-019
Dpn I 100 units 15242-019
Nco I 200 units 15421-019
Thermosensitive Alkaline Phosphatase (TsAP) 1,000 units 10534-014
T4 DNA Ligase 100 units 15224-017
T4 DNA Polymerase 50 units 18005-017
T4 Polynucleotide Kinase 200 units 18004-010
Topoisomerase I 200 units 38042-016
Proteinase K 100 mg 25530-015
Plasmid pUC19 10 µg 15364-011
DNA Analysis Products:

CLONECHECKER™ System 100 reactions 11666-013
1 Kb PLUS DNA LADDER 250 µg 10787-018
Low DNA MASS Ladder 200 µl 10068-013
High DNA MASS Ladder 200 µl 10496-016
Low Melting Point Agarose 50 g 15517-014
Kodak Digital Science™ EDAS 120 System,
Windows version each 10947-042
Macintosh version each 10947-059
Protein Analysis Products:

BENCHMARK™ Protein Ladder 2 × 250 µl 10747-012
BENCHMARK Prestained Protein Ladder 2 × 250 µl 10748-010
*See our website (lifetech.com) for information about Custom Primers.

**See our website for an updated list of GATEWAY-compatible libraries.
Additional sizes of these products are also available.

Gatewayman PDF

Caricato da

Informazioni sul documento

Titolo originale

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

Gatewayman PDF

Caricato da

Copyright:

Formati disponibili

GATEWAY™ Cloning Technology

Figures and Tables

Table 1. Available Entry Vectors.................................................................................................................9

BAC-TO-BAC®, BENCHMARK™, CELLFECTIN®, CLONASE™, CLONECHECKER™, CONCERT™, DH5α™, DB3.1™,

Kodak Digital Science™ is a trademark of Eastman Kodak Co.

Falcon® is a registered trademark of Becton Dickinson & Company.

1.3 Limited Label License

• Transfer, in parallel, of one or more DNA Gene

reading frame of the transferred DNA ptrc

(works well using miniprep DNA). CMV-neo

2.1 Two Reactions Constitute the GATEWAY Cloning System

The first reaction, the LR Reaction, (Figure

reactions are equivalent to concerted, highly

Expression Clone The second major pathway of the

Figure 3. GATEWAY Cloning Reactions: The BP 2.2 Basis of GATEWAY Recombination

(integration) is mediated by the proteins Int and IHF.

(excisionase) are encoded by the λ genome, while attP

IHF (integration host factor) is an E. coli protein.

By using a combination of the LR and BP reactions, a Integration Excision

By-Product Entry Clone Destination Vector

Donor Vector Expression Clone By-Product

Figure 5. GATEWAY Cloning Technology as an Operating System for

The gene in the Expression

making C-terminal fusions with

Knr Co-integrate The two daughter molecules have the

Table 1. Available Entry Vectors

Name Cloning Features Expression Features

A second way to obtain Entry Clones

Vector by recombination with a

DB3.1: E. coli RR1 gyrA462 endA (recA-).

Table 2. Available Destination Vectors

Name Expression Features ori Antibiotic

2.7 Considerations in Designing Entry Clones

2.7.1 Location of Translation Start Sequences

2.7.2 Reading frame

2.7.3 Examples of Sequences for Different Protein Constructs

Figure 11. Examples of Different Protein Expression Constructs

1. Native expression in prokaryotic, insect, and mammalian cells:

A. Expression clone structure:

B. Expression clone sequence:

Open reading frame (carboxy end)

C. Suggested oligonucleotides for attB-PCR cloning of gene for native expression

5' - GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAGGAGATAGAACCATG(18-25 gene-specific nucleotides in frame

5' - GGGGACCACTTTGTACAAGAAAGCTGGGTCCTA(18-25 gene-specific nucleotides [complement strand] in frame with

A. Expression clone structure:

B. Expression clone sequence:

Open reading frame (amino end)

Open reading frame (carboxy end)

attB1 forward oligo: (attB1 sequence bold)

attB2 reverse oligo: (attB2 sequence bold)

2.7.4 Transcription from Entry Clones

2.8 Choosing the Right Entry Vector

The choice of Entry Vector is dictated by

2.8.1 Features of the Entry Vectors

transformants in standard E. coli strains

2.9 GATEWAY Nomenclature

Plasmid Type Descriptive Name Individual Vector or Clone Names

attL Vector Entry Vectors pENTR1,2,... (nos. 1-99)

LR Reaction attL x attR LR CLONASE Expression Clone attB1-gene-attB2

See www.lifetech.com/gateway for current information on additions/modifications to the protocols and

3.2 Creating an Entry Clone

A. Cloning of a Restriction Endonuclease DNA Fragment:

B. Blunt Cloning of PCR products: