BLUE PRINT

SAMPLE PAPER-III
CLASS-XII
BIOLOGY(044)

SL. TYPE OF QUESTION VSA SA I SA II VBQ LA WEIGHTAGE

NO (1 mark) (2 marks) (3 marks) (4 marks) (5 marks)
. UNIT

1 REPRODUCTION 2(1) 3(4) 14

2 GENETICS AND 1(2) 2(1) 3(3) 5(1) 18
EVOLUTION
3 BIOLOGY AND HUMAN 1(1) 2(1) 3(2) 5(1) 14
WELFARE
4 BIOTECHNOLOGY AND ITS 2(1) 3(1) 5(1) 10
APPLICATIONS
5 ECOLOGY AND 1(2) 2(1) 3(2) 4(1) 14
ENVIRONMENT
Total 5(5) 10(5) 36(12) 4(1) 15(3) 70(26)
 The number in the bracket indicates the number of question.
 SAMPLE PAPER-III
CLASS-XII
BIOLOGY(044)

Time allowed: 3hrs Max. Marks: 70

General Instructions:
(i) There are 26 questions and five sections in the questions paper. All questions are compulsory.
(ii) Section A contains question number 1 to 5, Very Short Answer type questions of one mark each.
(iii) Section B contains question number 6 to 10, Short Answer type I questions of two mark each.
(iv) Section C contains question number 11 to 22, Short Answer type II questions of three marks each.
(v) Section D contains question number 23, Value Based question of four marks.
(vi) Section E contains question number 24 to 26, Long Answer type questions of five marks each.
(vii) There is no overall choice in the question paper, however, an internal choice is provided in one
question of two marks, one question of three marks, all three questions of five marks. An
examinee is to attempt any one of the questions out of the two given in the question paper with
the same question number.

SECTION-A

1. If the sequence of one strand of DNA is: 5’ATGCATGCATGCATGCATGCATGC3’ then what is the
sequence of mRNA synthesised from this DNA?

2. Which is the largest known human gene? How many bases are there in it?

3. Name the source from where morphine is extracted.

4. Write two regions why CNG is considered a better fuel than diesel for automobiles

5. Name the relationship established between clown fish and sea anemone.

SECTION-B

6. In corn cob which part of the flower is/are modified into tassels? Write the significance of tassels for
the flower.
7. Write two essential roles of ribosome in translation.

Or,

Write two characters of DNA which makes it more stable than RNA.

8. Explain with the help of a suitable example the naming of a restriction endonuclease.

9. What is BOD? What does it mean if a water sample has more BOD?

10. What is ‘Sixth Extinction’? How it is different from previous episode?

SECTION-C

11. Write 4 complications resulted due to STD’s. Which age group is most vulnerable to STD. Expand VD.
12. Write 3 most important devices in angiosperm which prevents self pollination and encourages cross
pollination.

13. Draw a neat 8 nucleate 7 celled structure of an angiosperm and label at least 3 major cells with their
ploidy.

14. How placenta is connected to embryo. Placenta is an endocrine tissue. Justify.

15. Usually adaptive radiation represents the divergent evolution. Give the situation where the adaptive
radiation can be called as convergent evolution. Explain with example.

16. Answer the following:

a) With the help of a diagram, show the type of bond present between two nucleotides in
a DNA strand and name the bond.
b) Mention the type of bond which holds the two strands of DNA in a double helical
structure.
c) Mention the type of bond which links the nitrogen base with pentose sugar in a
nucleotide.

17. What is the packaging unit of DNA in eukaryotes called? With the help of a diagram, show packaging
unit of DNA. Name the region in the prokaryotic cell where DNA is packaged.

18. Write three key roles played by predators in the environment.

19. How do the Monarch butterfly and Calotropis defend themselves from the predators? How do seal
adapt to their natural habitat

20. Describe how DNA is isolated in pure from the cell of bacteria, plant, animal and fungus?

21. a) Following are the steps in a particular process. Name the process and fill in the steps that are
given as blank
Collection of germplasm

Cross breeding/hybridisation

Testing, release and commercialisation of new cultivar

b) What is a germplasm?

22. What is the difference between primary and secondary lymphoid organs? Cite two examples from
each. What is MALT?
 Or,

What is the difference between Innate and Acquired immunity? Explain any two barrier as innate
immunity

SECTION-D

23. Susil and Mithil are two brothers staying in Delhi.One day their father called them and asked them
for suggestion to purchase a new car. Susil insisted on buying a CNG car with a bettermileage but Mithil
insisted on buying a diesel version of a high end car with better music system and A.C but relatively low
mileage.

a) Being a responsible citizen whose suggestion would have been taken by their father?
b) What qualities of personality are being exhibited by Susil by suggesting so?
c) Suggest two more measures which can help in reducing vehicular pollution.

SECTION-E

24. Explain Mendel’s law of Independent assortment with the help of a dihybrid cross taking the coat
colour of the seed and position of the flower in pea plants.

Or,

Draw a schematic diagram of a transcription unit.What is the difference between polycistronic and
monocistronic transcription unit. What the precursor of mRNA called?

25. a) What is biofortification.

b) What are the objectives of breeding for improved nutritional quality?

c) What are SCP. Give one example how SCP is meets the food demands of increasing population.

Or,

a) What is tissue culture?

b) What are the plant parts taken for tissue culture called?
c) Name the property because of which a plant tissue/cell can develop into a whole plant.
d) Write the application of tissue culture in the recovery of the healthy plants from diseased
plants.
e) What is somatic hybridisation?

26. a) Sequentially write the steps in a recombinant DNA technology.

b) how can the products of rDNA can be obtained in large scale

Or,

Diagrammatically explain PCR. Write two applications of PCR.

 SAMPLE PAPER – III
Marking scheme
Sl. Topic Marks
No
SECTION - A
1. Same sequence only T will be replaced by U 1
2. Dystrophin, 2.4 milllion base ½+½
3. Latex of Papaver sominiferum / Poppy plant 1
4. Any two reason ½+½
5. Commensalism 1
SECTION – B
6. Stigma & style 1
Wave in wind to trap pollen grain 1
7. - Act as catalyst for formation of peptide bond 1
- Cellular site for protein synthesis 1

OR
Any two of the following:
- Absence of –OH at 2’carbon
- Double strand
- Presence of Thyamine in place of Uracil
8. Any example with stepwise nomenclature 2
9. - Amount of oxygen consumed to oxidise all the organic matter present in 1 1
litre of water 1
- More polluted
10. - The episode of extinction of species taking place presently. 1
- In sixth extinction the species extinction rates are estimated to be 100 to 1000
times faster than previous episode 1
SECTION - C
11. Complications are, 2
Pelvic inflammatory disease, abortion, still births, ectopic pregnancies, infertility,
cancer. (any 4)
Age group – 15 – 24 years 1
12. Any 3 devices 3
13. Neat diagram + 3 labelling 3
14. Through umbilical cord 1
- It secretes many hormones like hCG, hPL, estrogen, progesterone etc.,
during pregnancy 1
- hCG, hPL, relaxin 1
15. When more than one adaptive radiation appeared to have occurred in an isolated
geographical area representing different habitats 2
Example: Adaptive radiation in marsupials in Australia (In one sentence only) 1
16. a. Diagram 1
Phosphodiester 1
b. Hydrogen bond ½
c. Glycosidic bond ½
17. Nucleosome ½
Labelled diagram of nucleosome 2
Nucleoid ½
18. 1. Maintains species diversity in community. 1
2. Act as conduits for energy transfer across trophic level 1
3. Keep prey population under control 1
19. - Monarch butterfly is highly distasteful to its predator due to presence of a 1
chemical in its body
- Calotropis produces highly poisonous cardiac glycosides 1
- Seals have a thick layer as fat below their skin acts as an insulator and
reduces loss of body heat 1
20. At first digestion of cell wall
Bacteria – lysozyme
Fungi – Chitinase
Plant cell – Cellulose
Then all of the cell will be subjected to digestion of protein, carbohydrale & lipid
by proteinase, amylase, lipase & RNase. Then treated with chilled ethanol 3
21. a. A – Evaluation and selection of parents 1
B – Selection and testing of superior recombinants 1
b. Any part of the plant having all the diverse alleles for all genes for a given
crop is called germ plasm. 1
22. Primary lymphoid organ – where differentiation of immature lymphocyte takes
place. Ex. – Bone marrow & Tfhymus.
Secondary lymphoid organ – The site for interaction of lymphocytes with
antigen. Eg. – Spleen, tonsil etc.
MALT – Mucosa – associated lymphoid tissue
OR
Innate immunity – Non-specific immunity present since birth 1
Acquired immunity – Specific immunity acquired in life time due to exposure of
body to pathogen. 1
Any two barriers. 1
SECTION - D
23. a. Susil’s 1
b. Any two qualities 1
c. Any two measures 2
SECTION - E
24. - Law 1
- Dihybrid cross with punnet square. Explanation of the law 4
OR
Labelled diagram of Transcription unit 2
Polycistronic – Transcription unit with more than one structural gene (in pro
karyote) 1
Monocistronic – Transcription unit with one structural gene (in eukaryote) 1
Heterogenous nuclear RNA (hnRNA) 1
25. a) Breeding crops with higher levels of vitamins and minerals/higher protein 1
and healthier fats.
b) i-protein content and quality improvement ii-oil content and quality
improvement iii-improvement in vitamin content iv- improved
micronutrients and mineral content 2
c) Single cell protein.Any one example 2

Or,
a) Growing the whole plant from a plant tissue in culture medium. 1
 b)
Explants ½
c)
Totipotency ½
d)
Meristem culture as it is free from viral infection 1
e)
In vitro fusion of protoplast from two different plants each with desirable 2
character to get hybrid protoplast and then growing it to new plant
26. a) i -isolation of DNA ii-cutting by restriction endonuclease iii-separation 3
of DNA fragments by gel electrophoresis iv-amplification of gene of
interest using PCR v-ligation of desirable DNA and vector DNA
i.e.formation of rDNA vi-insersion of rDNA into host cell.
b) In bioreactors by providing optical conditions of
temperature,pH,substrate,salt,vitamins and oxygen. 2

Or, 3
a) Labelled diagram
b) Describe application in rDNA technology and molecular diagnosis 2