General Biology 2 Ilovepdf Compressed

The Commission on Higher Education
in collaboration with the Philippine Normal University
Teaching Guide for Senior High School
GENERAL
BIOLOGY 2
CORE SUBJECT
This Teaching Guide was collaboratively developed and reviewed by

educators from public and private schools, colleges, and universities. We
encourage teachers and other education stakeholders to email their
feedback, comments, and recommendations to the Commission on Higher
Education, K to 12 Transition Program Management Unit - Senior High School
Support Team at k12@ched.gov.ph. We value your feedback and
recommendations.
Development Team
Team Leader: Ivan Marcelo A. Duka
Writers: Neil Andrew B. Bascos, Ph.D., Ma.
Genaleen Q. Diaz, Ph.D., Ian Kendrich C. Fontanilla, This Teaching Guide by the
Ph.D., Ma. Carmina C. Manuel, Ph.D., Sharon Rose Commission on Higher Education is
M. Tabugo, Ph.D., Eugenio P. Quijano Jr. licensed under a Creative
Commons Attribution-
Technical Editors: Annalee S. Hadsall, Ph.D. NonCommercial-ShareAlike 4.0
Copy Reader: Caroline H. Pajaron International License. This means
Published by the Commission on Higher Education, 2016 you are free to:
Illustrator: Ma. Daniella Louise F. Borrero
Chairperson: Patricia B. Licuanan, Ph.D. Share copy and redistribute the
Cover Artists: Paolo Kurtis N. Tan, Renan U. Ortiz material in any medium or format
Commission on Higher Education
Adapt remix, transform, and
K to 12 Transition Program Management Unit
build upon the material.
Office Address: 4th Floor, Commission on Higher Education, Senior High School Support Team The licensor, CHED, cannot revoke
C.P. Garcia Ave., Diliman, Quezon City CHED K to 12 Transition Program Management Unit these freedoms as long as you
Telefax: (02) 441-0927 / E-mail Address: k12@ched.gov.ph follow the license terms. However,
Program Director: Karol Mark R. Yee
under the following terms:
Lead for Senior High School Support: Attribution You must give
Gerson M. Abesamis appropriate credit, provide a link to
Consultants the license, and indicate if changes
Lead for Policy Advocacy and Communications:
THIS PROJECT WAS DEVELOPED WITH THE PHILIPPINE NORMAL UNIVERSITY. were made. You may do so in any
Averill M. Pizarro reasonable manner, but not in any
University President: Ester B. Ogena, Ph.D.
Course Development Officers: way that suggests the licensor
VP for Academics: Ma. Antoinette C. Montealegre, Ph.D.
endorses you or your use.
VP for University Relations & Advancement: Rosemarievic V. Diaz, Ph.D. John Carlo P. Fernando, Danie Son D. Gonzalvo
NonCommercial You may not use
Ma. Cynthia Rose B. Bautista, Ph.D., CHED Teacher Training Officers: the material for commercial
Bienvenido F. Nebres, S.J., Ph.D., Ateneo de Manila University Ma. Theresa C. Carlos, Mylene E. Dones purposes.
ShareAlike If you remix,
Carmela C. Oracion, Ph.D., Ateneo de Manila University Monitoring and Evaluation Officer: transform, or build upon the
Minella C. Alarcon, Ph.D., CHED Robert Adrian N. Daulat material, you must distribute your
Gareth Price, Sheffield Hallam University contributions under the same license
Administrative Officers:
Stuart Bevins, Ph.D., Sheffield Hallam University as the original.
Ma. Leana Paula B. Bato, Kevin Ross D. Nera,
Allison A. Danao, Ayhen Loisse B. Dalena
Printed in the Philippines by EC-TEC Commercial, No. 32 St.
Louis Compound 7, Baesa, Quezon City, ectec_com@yahoo.com
Table of Contents
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ii Chapter 3: Systematics Based on Evolutionary Relationships
DepEd General Biology 2 Curriculum Guide . . . . . . . . . . . . . vi Lesson 14: Systematics Based on Evolutionary Relationships:
Chapter 1: Genetics Tree of Life and Systematics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
Lesson 1: Pedigree Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Lesson 15: Systematics Based on Evolutionary Relationships:

Lesson 2: Sex Linkage and Recombination . . . . . . . . . . . . . . . .
8 Taxonomy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117
Lesson 3: Modifications to Mendels Classic Ratios . . . . . . . . . 13 Lesson 16: Systematics Based on Evolutionary Relationships:
Lesson 4: Molecular Structure of DNA, RNA, and Proteins . . .
19 Cladistics and Phylogeny . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129
Lesson 5: DNA Replication and Protein Synthesis . . . . . . . . . . 24 Chapter 4: Compare and Contrast Processes in Plants and Animals
Lesson 6: Genetic Engineering . . . . . . . . . . . . . . . . . . . . . . . . . 30 Lesson 17: Reproduction and Development . . . . . . . . . . . . . . . . . 136
Lesson 7: Discuss the Applications of Recombinant DNA . . . . 36 Lesson 18: Nutrition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 158
Chapter 2: Evolution and Origin of Biodiversity Lesson 19: Gas Exchange . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179
Lesson 8: History of Life on Earth . . . . . . . . . . . . . . . . . . . . . . . 49 Lesson 20: Transport and Circulation . . . . . . . . . . . . . . . . . . . . . . 190
Lesson 9: Mechanisms that Produce Change in Populations . . 70 Lesson 21: Regulation of Body Fluids . . . . . . . . . . . . . . . . . . . . . . 194
Lesson 10: Evolution and Origin of Biodiversity: Patterns of Lesson 22: Immune Systems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 204
Descent with Modification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Lesson 23: Chemical and Nervous Control . . . . . . . . . . . . . . . . . 214
Lesson 11: Development of Evolutionary Thought . . . . . . . . . 87 Lesson 24: Sensory and Motor Mechanisms . . . . . . . . . . . . . . . . . 226
Lesson 12: Evidences of Evolution . . . . . . . . . . . . . . . . . . . . . . 92 Lesson 25: Feedback Mechanisms . . . . . . . . . . . . . . . . . . . . . . . . 235
Lesson 13: Infer Evolutionary Relationships of Organisms . . . . 102 Colored Images . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249
Biographical Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257
i
Introduction
As the Commission supports DepEds implementation of Senior High School (SHS), it upholds the vision
and mission of the K to 12 program, stated in Section 2 of Republic Act 10533, or the Enhanced Basic
Education Act of 2013, that every graduate of basic education be an empowered individual, through a
program rooted on...the competence to engage in work and be productive, the ability to coexist in
fruitful harmony with local and global communities, the capability to engage in creative and critical
thinking, and the capacity and willingness to transform others and oneself.
To accomplish this, the Commission partnered with the Philippine Normal University (PNU), the National
Center for Teacher Education, to develop Teaching Guides for Courses of SHS. Together with PNU, this
Teaching Guide was studied and reviewed by education and pedagogy experts, and was enhanced with
appropriate methodologies and strategies.
Furthermore, the Commission believes that teachers are the most important partners in attaining this
goal. Incorporated in this Teaching Guide is a framework that will guide them in creating lessons and
assessment tools, support them in facilitating activities and questions, and assist them towards deeper
content areas and competencies. Thus, the introduction of the SHS for SHS Framework.
The SHS for SHS Framework, which stands for Saysay-Husay-Sarili for Senior High School, is at the
SHS for SHS core of this book. The lessons, which combine high-quality content with flexible elements to
Framework accommodate diversity of teachers and environments, promote these three fundamental concepts:
SAYSAY: MEANING HUSAY: MASTERY SARILI: OWNERSHIP

Why is this important? How will I deeply understand this? What can I do with this?
Through this Teaching Guide, Given that developing mastery When teachers empower
teachers will be able to facilitate goes beyond memorization, learners to take ownership of
an understanding of the value teachers should also aim for their learning, they develop
of the lessons, for each learner deep understanding of the independence and self-
to fully engage in the content subject matter where they lead direction, learning about both
on both the cognitive and learners to analyze and the subject matter and
affective levels. synthesize knowledge. themselves.
The Philippines is frequently cited as among the top countries most at risk to disasters. While disasters
can arise from man-made sources, the most inevitable ones come from natural phenomena. Even
without scientific scrutiny, every Filipino is familiar with the impacts of typhoons, earthquakes, volcanic
eruptions, and fires to everyday life and to national development. This makes learning about disaster
preparedness aligned with everyones interests.
This teaching guide for the Disaster Readiness and Risk Reduction (DRRR) subject of the Philippines
K-12 Curriculum provides a lesson-by-lesson framework for educators to help learners attain the target
competencies and outcomes. The challenge with teaching a subject like DRRR is its multi-disciplinary
nature, bringing together biological, geophysical, socio-cultural, political, and economic factors. This in
itself is an opportunity to make these various subject matters relevant to the lives of the people even if
studying disasters leans toward the sciences. With the use of these teaching guides, the teacher will be
able to handle a diverse set of materials that will enrich their existing knowledge on the natural and
social sciences. They will also be able to engage learners in a number of hands-on activities that make
use of mixed-media to maximize existing resources. And overall, lessons tackled in these guides
encourage a two-way interaction between the teachers and students that will ultimately result to
effective learning.
Lessons of these teaching guides address the content standards identified by the Department of
Education (DepEd). Some teaching guides may include multiple learning competencies as that may be
more efficiently achieved when tackled together. This guide approaches learning about DRRR by first
About this understanding the hazards that may then potentially lead to disasters, as a common confusion arises
Teaching Guide from distinguishing the concepts of hazard and disaster. Each hazard type has its own precautionary
measures and ideal responses to prevent disasters. Towards the end of the subject, learners will focus
on applications to the community and the Philippine society.
Users of these guides should note that sciences and policies related to DRRR are ever evolving along
with improvements and breakthroughs in data collection and technology; so it is expected that
reference materials also change through time. It would be important for teachers of the subject to
continually update any cited references in each guide to make sure that the lessons will also result to
cutting-edge teaching.
As a big part of understanding disasters involves projecting future possibilities, the success of teaching
the subject of Disaster Readiness and Risk Reduction may not be immediately measurable and definitely
not something anyone is looking forward to test. But while the country is exposed to hazards that can
alter the course of everyday life, bringing this subject to each classroom gives the people the power to
take control of their lives and of nation-building in whatever the situation they may encounter in the
future.
iii
This Teaching Guide is mapped and aligned to the DepEd SHS Curriculum, designed to be highly
Parts of the usable for teachers. It contains classroom activities and pedagogical notes, and is integrated with
Teaching Guide innovative pedagogies. All of these elements are presented in the following parts:
1. Introduction
Highlight key concepts and identify the essential questions
Show the big picture
Connect and/or review prerequisite knowledge
Clearly communicate learning competencies and objectives
Motivate through applications and connections to real-life
2. Motivation
Give local examples and applications
Engage in a game or movement activity
Provide a hands-on/laboratory activity
Connect to a real-life problem
3. Instruction/Delivery
Give a demonstration/lecture/simulation/hands-on activity
Show step-by-step solutions to sample problems
Give applications of the theory
Connect to a real-life problem if applicable
4. Practice
Discuss worked-out examples
Provide easy-medium-hard questions
Give time for hands-on unguided classroom work and discovery
Use formative assessment to give feedback
5. Enrichment
Provide additional examples and applications
Introduce extensions or generalisations of concepts
Engage in reflection questions
Encourage analysis through higher order thinking prompts
6. Evaluation
Supply a diverse question bank for written work and exercises
Provide alternative formats for student work: written homework, journal, portfolio, group/individual
projects, student-directed research project
On DepEd Functional Skills and CHED College Readiness Standards
As Higher Education Institutions (HEIs) welcome the graduates of On the other hand, the Commission declared the College
the Senior High School program, it is of paramount importance to Readiness Standards that consist of the combination of knowledge,
align Functional Skills set by DepEd with the College Readiness skills, and reflective thinking necessary to participate and succeed -
Standards stated by CHED. without remediation - in entry-level undergraduate courses in
The DepEd articulated a set of 21st century skills that should be college.
embedded in the SHS curriculum across various subjects and tracks. The alignment of both standards, shown below, is also presented in
These skills are desired outcomes that K to 12 graduates should this Teaching Guide - prepares Senior High School graduates to the
possess in order to proceed to either higher education, revised college curriculum which will initially be implemented by AY
employment, entrepreneurship, or middle-level skills development. 2018-2019.
College Readiness Standards Foundational Skills DepEd Functional Skills
Produce all forms of texts (written, oral, visual, digital) based on:
1. Solid grounding on Philippine experience and culture;
2. An understanding of the self, community, and nation; Visual and information literacies, media literacy, critical thinking
3. Application of critical and creative thinking and doing processes; and problem solving skills, creativity, initiative and self-direction
4. Competency in formulating ideas/arguments logically, scientifically, and creatively; and
5. Clear appreciation of ones responsibility as a citizen of a multicultural Philippines and a
diverse world;
Global awareness, scientific and economic literacy, curiosity,

Systematically apply knowledge, understanding, theory, and skills for the development of
critical thinking and problem solving skills, risk taking, flexibility
the self, local, and global communities using prior learning, inquiry, and experimentation and adaptability, initiative and self-direction
Global awareness, media literacy, technological literacy,

Work comfortably with relevant technologies and develop adaptations and innovations for
creativity, flexibility and adaptability, productivity and
significant use in local and global communities accountability
Global awareness, multicultural literacy, collaboration and

Communicate with local and global communities with proficiency, orally, in writing, and
interpersonal skills, social and cross-cultural skills, leadership
through new technologies of communication and responsibility
Media literacy, multicultural literacy, global awareness,

Interact meaningfully in a social setting and contribute to the fulfilment of individual and
collaboration and interpersonal skills, social and cross-cultural
shared goals, respecting the fundamental humanity of all persons and the diversity of skills, leadership and responsibility, ethical, moral, and spiritual
groups and communities values
v
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Grade: Grade 11/12 Quarters: 3rd to 4th Quarter
Subject Title: Biology 2 I No. of Hours: 40 hours/10 Weeks per Quarter
Subject Description: This subject is designed to enhance the understanding of the principles and concepts in the study of biology, particularly heredity and variation, and
the diversity of living organisms, their structure, function, and evolution.
CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE
The learners demonstrate The learners:
an understanding of:
1. compare and contrast the following processes in plants
1. Plant and Animal The learners shall be able to: and animals: reproduction, development, nutrition, gas STEM_BIO11/12-
exchange, transport/circulation, regulation of body IVa-h-1
Organ Systems and
develop a presentation (e.g. fluids, chemical and nervous control, immune systems,
their Functions
Organismal role-playing, dramatization and and sensory and motor mechanisms
other forms of multimedia) to
Biology 2. explain how some organisms maintain steady internal STEM_BIO11/12-
show how an organism
conditions that possess various structures and processes IVi-j-2
maintains homeostasis through
the interaction of the various 3. describe examples of homeostasis (e.g., temperature
2. Feedback Mechanisms organ systems in the body regulation, osmotic balance and glucose levels) and the STEM_BIO11/12-
major features of feedback loops that produce such IVi-j-3
homeostasis
1. predict genotypes and phenotypes of parents and STEM_BIO11/12-

1. make a pedigree analysis in offspring using the laws of inheritance IIIa-b-1
the learners family using a
simple genetic trait 2. explain sex linkage and recombination STEM_BIO11/12-
IIIa-b-2
2. make a research paper/case
3. describe modifications to Mendels classic ratios (gene STEM_BIO11/12-
study/poster on genetic
1. Mendels Laws of interaction) IIIa-b-3
diseases
Inheritance
2. Sex Linkage 4. illustrate the molecular structure of DNA, RNA, and STEM_BIO11/12-
Genetics 3. make a diagram (e.g., proteins
3. Central Dogma of IIIa-b-4
pictogram, poster) showing
Molecular Biology
the evolution of a 5. diagram the steps in DNA replication and protein STEM_BIO11/12-
4. Recombinant DNA
domesticated crop synthesis IIIa-b-5
4. differentiate the 3-Domain 6. outline the processes involved in genetic engineering STEM_BIO11/12-
Scheme from the 5-Kingdom IIIa-b-6
Scheme of classification of
living things STEM_BIO11/12-
7. discuss the applications of recombinant DNA
IIIa-b-7
K to 12 Senior High School STEM Specialized Subject General Biology 2 December 2013 Page 1 of 3
CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE
1. describe general features of the history of life on Earth,

including generally accepted dates and sequence of the STEM_BIO11/12-
geologic time scale and characteristics of major groups IIIc-g-8
of organisms present during these time periods
2. explain the mechanisms that produce change in
populations from generation to generation (e.g., STEM_BIO11/12-
artificial selection, natural selection, genetic drift, IIIc-g-9
mutation, recombination)
Evolution and Relevance, Mechanisms, 3. show patterns of descent with modification from
Origin of Evidence/Bases, and common ancestors to produce the organismal diversity STEM_BIO11/12-
Biodiversity Theories of Evolution observed today IIIc-g-10
4. trace the development of evolutionary thought STEM_BIO11/12-

IIIc-g-11
5. explain evidences of evolution (e.g., biogeography,
fossil record, DNA/protein sequences, homology, and STEM_BIO11/12-
embryology) IIIc-g-12
6. infer evolutionary relationships among organisms using STEM_BIO11/12-

the evidence of evolution IIIc-g-13
1. explain how the structural and developmental
characteristics and relatedness of DNA sequences are STEM_BIO11/12IIIh-
used in classifying living things j-14
Basic Taxonomic Concepts
Systematics
and Principles, Description, 2. identify the unique/distinctive characteristics of a
Based on STEM_BIO11/12IIIh-
Nomenclature, specific taxon relative to other taxa
Evolutionary j-15
Identification, and
Relationships 3. describe species diversity and cladistics, including the
Classification
types of evidence and procedures that can be used to STEM_BIO11/12IIIh-
establish evolutionary relationships j-16
Code Book Legend
Sample: STEM_BIO11/12IIIh-j-16
LEGEND SAMPLE
Learning Area and Strand/ Subject or Science, Technology, Engineering and

Specialization Mathematics
First Entry
STEM_BIO11/12
Grade Level Grade 11 or 12
Domain/Content/
Uppercase Letter/s General Biology
Component/ Topic
Roman Numeral
Quarter Third Quarter III
*Zero if no specific quarter
Lowercase Letter/s
*Put a hyphen (-) in between letters to indicate Week Weeks eight to ten h-j
more than a specific week
-
describe species diversity and cladistics,
including the types of evidence and
Arabic Number Competency 16
procedures that can be used to establish
evolutionary relationships
SUGGESTED ACADEMIC TRACK SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) STRAND SCHEDULING OF SUBJECTS*
Grade 11 Grade 12
STEM
1st Semester 2nd Semester 1st Semester 2nd Semester
st
21 Century Literature from the
Oral Communication in Context Reading and Writing Skills Physical Education and Health
Philippines and the World
Komunikasyon at Pananaliksik sa Pagbasa at Pagsusuri ng Ibat-Ibang Contemporary Philippine Arts from
Wika at Kulturang Pilipino Teksto Tungo sa Pananaliksik the Regions
CORE SUBJECTS
General Mathematics Statistics and Probability Media and Information Literacy

Disaster Readiness and Risk Understanding Culture, Society and
Earth Science
Reduction Politics
Introduction to the Philosophy of
Personal Development / Pansariling
the Human Person / Pambungad sa Physical Education and Health
Kaunlaran
Pilosopiya ng Tao
Physical Education and Health Physical Education and Health
Empowerment Technologies (E- English for Academic and
Research in Daily Life 1 Research in Daily Life 2
CONTEXTUALIZED
Tech): ICT for Professional Tracks Professional Purposes

SUBJECTS
Entrepreneurship
Pagsulat sa Filipino sa Piling

Research Project
Larangan (Akademik)
Pre-Calculus Basic Calculus General Physics 1 General Physics 2

SPECIALIZATION
SUBJECTS
General Chemistry 1 General Biology 1 General Biology 2
General Chemistry 2
Research/Capstone Project
HOURS
PER DAY 5.8 6.6 6.6 5.8
Please note that some subjects have prerequisites. These are indicated in the Curriculum Guides and are listed below for easy referral.
SUBJECT PREREQUISITE/S
Research in Daily Life 2 Statistics and Probability
Basic Calculus Pre-Calculus
General Biology 2 General Biology 1
General Chemistry 2 General Chemistry 1
General Physics 1 Pre-Calculus, Calculus
General Physics 2 General Physics 1
K to 12 Senior High School Science, Engineering, Technology and Mathematics Strand Scheduling * 80 hours per subject
General Biology 2 60 MINS
Lesson 1: Pedigree Analysis

Content Standard
The learners understand Mendels Laws of Inheritance. LESSON OUTLINE
Performance Standard Introduction Communicating Learning Objectives and 5
The learners shall be able to: Relevant Vocabulary
make a Pedigree Analysis in the learners family using a simple genetic trait. Motivation Narrative 5
Learning Competency
The learners shall be able to construct pedigrees and predict genotypes based Instruction Recall in Mendelian Ratios, Discussion 40
on pedigree analysis (STEM_BIO11/12-IIIa-b-1) on Co-Dominance and Multiple Alleles
Specific Learning Outcomes: Practice Group Work: Non-Mendelian Traits in 40

At the end of the lesson, the learners will be able to: Humans, Plants, and Animals
identify the mode of inheritance of a particular trait given the pedigree; Materials
predict the genotypes of parents; and Pen, paper, and ruler
compute the probability of occurrence of an affected offspring in a given Resources

cross. (1) Klug WS, Cummings MR, Spencer CA, Palladino MA.
2012. Essentials of genetics. 8th ed. Benjamin Cummings;
2012. 624 p.
(2) Reece JB, Urry LA, Cain ML, Wasserman SA, Minorsky PV,
Jackson RB. 2012. Campbell biology, 9th ed. The
Benjamin Cummings Publishing Co., Inc: 2012. 1464 p.
(3) Bennett RL, Steinhaus KA, Uhrich SB, OSullivan CK, Resta
RG, Lochner-Doyle D, Markel DS, Vincent V, Hamanishi J.
Recommendations for standardized human pedigree
nomenclature. Am J Human Genet. 1995; 56:745-752.
INTRODUCTION (5 MINS)
1. Cite the learning objectives, which are as follows:
I. identify the mode of inheritance of a particular trait given the pedigree
II. predict the genotypes of parents
III. predict the probability of having an affected offspring
2. Relevant vocabulary
I. Pedigree. Making use of diagrams showing the ancestral relationships and transmission of
genetic traits over several generations in a family
II. Proband. The individual in the pedigree that led to the construction of the pedigree. For
example, a couple consults a medical geneticist because they have an offspring who is
afflicted with a disease and they want to find out the mode of transmission of this disease.
When the medical geneticist constructs the pedigree, the offspring will be labeled as the
proband. Through the pedigree, the probability of having other affected children may be
determined.
III. Law of Segregation (1st Mendelian Law). For every trait governed by a pair of alleles,
these alleles segregate or separate during gamete formation in meiosis
IV. Law of Independent Assortment (2nd Mendelian Law). A pair of alleles for one trait will
segregate or separate independently of another pair of alleles for another trait during
meiosis
V. Autosomal trait. A trait whose alleles that control it are found in the autosomes (body
chromosomes/ non-sex chromosomes)
Teacher Tip:
VI. Genotype. The gene pair an individual carries for a particular trait symbolized with a pair Tell the learners that they have to use a letter in
of letters. By convention, uppercase letter (eg. A) for a dominant allele and lowercase which the uppercase and lowercase versions are
letter (eg. a) for the recessive allele. Any letter in the alphabet may be used easy to distinguish using cursive to avoid
confusion.
A. For a diploid organism with two alleles in a given gene pair, genotypes may be
written as:
i. Homozygous dominant, i.e. with two dominant alleles (DD)
Ask learners to recall their lessons in classical
ii. Heterozygous, i.e. with a dominant and recessive allele (Dd). The individual will genetics in their previous grade levels.
show the dominant phenotype.
iii. Homozygous recessive, i.e. with two recessive alleles (dd)
2
VII. Phenotype Teacher Tip:
A. The observable trait of an individual based on its genotype. Examples: red flower, curly Note that the phenotype is determined by the
genotype. In complete dominance, RR- red flower;
hair, blood types ( i.e. the blood type is the phenotype)
rr- white flower; but Rr will express the red flower
B. For a typical Mendelian trait, phenotypes may either be: condition because one dominant allele is enough
for the dominant trait to be expressed in the
i. Dominant. A trait that requires at least one dominant allele for the trait to be
organism.
expressed, e.g. Dd
ii. Recessive. A trait that requires two recessive alleles for the trait to be expressed
VIII.Phenocopy. A trait that is expressed due to specific environmental conditions (i.e. having
hair that is dyed of a different color) and is not due to the genotype.
IX. Identical twins. Also known as monozygotic twins, which are derived from a single
fertilization event. After the first cleavage or cell division of the zygote, the cells or
blastomeres separate and become independent blastocysts implanted in the mothers
uterus.
X. Fraternal twins. Twins that are derived from separate fertilization events (two eggs
fertilized by two sperms) within the fallopian tube, resulting in two separate zygotes; also
known as dizygotic twins
REVIEW (15 MINS) Teacher Tip:

The learners should be able to predict correctly
1. Ask the learners to recall Mendelian Laws of Inheritance
the Mendelian ratios without having to use a
I. Law of Segregation (1st Mendelian Law) Punnett square. They should be able to solve for
probabilities of occurrence of a trait by analyzing a
II. Law of Independent Assortment (2nd Mendelian Law)
pedigree.
2. Ask the learners to define genotypes and phenotypes, dominant and recessive traits,
homozygous and heterozygous dominants as well as homozygous recessive
3. Ask the learners to review the classic monohybrid Mendelian F2 genotypic and phenotypic
ratios by filling out a table (see table 1 at the end of this document)
4. In a monohybrid cross and assuming complete dominance, the ratio of the F2 progenies may
be predicted as 3:1, i.e. 3 with the dominant trait and 1 with the recessive trait.
5. In a dihybrid cross and assuming complete dominance, the ratio of the F2 progenies may be
predicted as 9:3:3:1.
INSTRUCTION (15 MINS)
1. Define pedigree analysis. 4. What to expect in a human pedigree
2. Enumerate uses of pedigree analysis: I. For autosomal dominant trait: Two affected individuals can
have a normal offspring
I. Describe the mode of inheritance of a trait
II. For autosomal recessive trait: Two affected individuals can
II. Calculate the probability of occurrence an affected offspring
NEVER have a normal offspring
in a given cross
5. Give an example of a pedigree and solve some questions
3. Establish symbols for creating pedigrees
I. Male (square) vs female (circle)
II. Affected (shaded) vs unaffected (unshaded) individual PRACTICE (25 MINUTES)
III. Marriage/mating line (line connecting mates) vs. sibship line 1. Divide learners into groups of four.
(line connecting siblings) 2. Provide copies of four sample pedigrees. (See samples in Figure
IV. Fraternal twins (one birthline branching out into the 2 at the end of this document.)
individual twin) vs. identical twins (same as fraternal twins but 3. For each pedigree, provide questions for the group to answer
with a horizontal bar connecting the branches) I. Identify the mode of inheritance
V. Generation (Roman numerals) vs. individuals in the same II. Write down the genotypes of specific individuals
generation, counting left to right (designated by Hindu- III. Compute for the probability of having an affected offspring
Arabic numerals)
VI. Proband (arrow)
Sample pedigree with symbol guides

4
A. Look at the family of IV-9 and IV-10. If the trait is dominant, is
it possible for them to have an affected offspring?
(Answer: NO. If the trait is dominant, then unaffected
individuals are homozygous recessive. Two recessive
individuals CANNOT produce a dominant offspring.) A. Is this trait dominant or recessive?
B. If the trait is recessive, is it also possible for IV-9 and IV-10 to (Answer: RECESSIVE. If the trait were dominant, then
have an unaffected offspring? individuals I-3 and I-4 are both homozygous recessive, which
(Answer: YES. This can happen if both parents are means they CANNOT have a dominant offspring.)
heterozygous for the trait, which means they can each B. What are the most probable genotypes of I-3 and I-4?
give a recessive allele to produce a homozygous (Answer: Dd and Dd in order for each parent to be able to
recessive offspring.)
contribute a recessive allele to give rise to a recessive
C. Based on your answers for a) and b), is the trait dominant or
offspring.)
recessive?
(Answer: RECESSIVE) C. What are the most probable genotypes of II-4 and II-5?
D. Give the genotypes of the following: (Answer: Dd and Dd. Same reason as b.)
i. IV-9 (Answer: Dd) D. What is the probability that II-4 and II-5 will have another normal
ii. IV-10 (Answer: Dd) offspring?
iii. V-1 (Answer: DD or Dd) (Answer: 75%. A hybrid cross will produce 75% dominant
iv. I-1 (Answer: dd) offspring and 25% recessive offspring.)
v. I-2 (Answer: Dd)
E. If IV-9 and IV-10 were to have another child, what is the
probability that they will have an affected offspring?
(Answer: 1/4 or 25% following the Mendelian ratio from a
hybrid cross)
A. Is the trait dominant or recessive? A. Is the trait dominant or recessive?
(Answer: DOMINANT. If the trait were recessive, then (Answer: DOMINANT. If the trait were recessive, then
individuals I-1 and I-2 are homozygous recessive, and individuals I-3 and I-4 must be homozygous recessive, and
they CANNOT produce a dominant affected offspring.) they CANNOT produce a dominant offspring.)
B. What are the genotypes of I-1 and I-2?
B. What are the most probable genotypes of I-2 and I-3?
(Answer: dd and dd. Since the trait is dominant, it follows that
(Answer: Dd and Dd. Each parent must be heterozygous unaffected individuals are homozygous recessive.)
in order to give a recessive allele to produce a recessive C. What is the probability that I-1 and I-2 will have an affected
unaffected offspring.) offspring?
C. What is the probability that II-2 is Dd? (Answer: 0. Homozygous recessive individuals CANNOT
(Answer: 1 or 100%. II-2, together with the homozygous produce an offspring with a dominant trait.)
recessive II-1, was able to produce homozygous D. What are the genotypes of I-3 and I-4?
recessive unaffected offspring. This can only happen if (Answer: Dd and Dd. Each parent must have a recessive allele
II-2 also possesses a recessive allele, which means s/he is in order to produce a homozygous recessive offspring.)
a heterozygote.) E. What is the probability that II-6 is Dd?
D. What is the probability that II-1 and II-2 will have another (Answer: 2/3. II-6s parents are both heterozygotes. Following
normal offspring? the Mendelian cross of Dd x Dd, the probabilities of
occurrence of phenotypes in this cross are 25% (1/4) DD, 50%
(Answer: 1/2 or 50%. Following the Mendelian cross of
(2/4) Dd, and 25% (1/4) dd, giving a ratio of 1:2:1. Since II-6 is
dd x Dd, there is a 50% probability of producing a
already affected, then his phenotype is dominant. Therefore,
homozygous recessive unaffected offspring.)
the probability of II-6 being affected is 0. So instead of a ratio
of 1:2:1, the ratio to be considered should now be just 1:2
(DD:Dd). The probability of II-6 being Dd should now be 2/3.)
6
ENRICHMENT
1. As a homework, assign each learner to construct a pedigree of an authentic family using any of the following traits:
I. With (dominant) or without finger hair (recessive)
II. Normal (dominant) or hitchhikers thumb (recessive)
III. Widows peak (dominant) or straight hairline (recessive)
IV. Free (dominant) or attached earlobe (recessive)
V. Curly (dominant), wavy (heterozygous) or straight (recessive) hair
2. B. Where possible, determine the genotypes of every individual in the family
CROSS EXPECTED GENOTYPE(S) EXPECTED PHENOTYPE(S)

1. DD x DD 100% DD 100% dominant
2. DD x Dd 50% DD: 50% Dd 100% dominant
3. DD x dd 100% Dd 100% dominant
4. Dd x Dd 25% DD: 50% Dd: 25% dd 75% dominant: 25% recessive
5. Dd x dd 50% Dd: 50% dd 50% dominant: 50% recessive

Lesson 2: Sex Linkage and

Recombination
Content Standard
LESSON OUTLINE
The learners understand inheritance of Sex Linked characters
Introduction Communicating Learning Objectives and 5
Performance Standard
The learners shall be able to Relevant Vocabulary
make a a research paper/case study/poster on transmission of a sex-linked Motivation Case Study 10

genetic disease
Instruction Discussion of Sex-Linked Traits 25
Learning Competency
The learners shall be able to explain sex related inheritance and Practice Group Work 20
recombination; illustrate the transmission of sex-linked characters; and
Enrichment Narrative
distinguish sex-linked traits from other sex-related traits (STEM_BIO11/12-IIIa-
b-2) Materials
Specific Learning Outcomes Pen, paper, and ruler
At the end of the lesson, the learners will be able to: Resources
illustrate the transmission of an X-linked and a Y-linked character; (1) Klug, W. S., M. R. Cummings, C. A. Spencer and M.A.
compute the probability of the occurrence of a sex-linked trait; and Palladino. 2012. Essentials of Genetics. 8th ed. Benjamin
Cummings.
give examples of other sex-related traits.
(2) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A.,
Minorsky, P.V., and Jackson, R.B. 2012. Campbell Biology,
(9th ed). The Benjamin Cummings Publishing Co., Inc.
(3) Sheridan, M. 1999. Instructors guide for Biology, 5th ed.
By Campbell, Reece, Mitchell. Addison Wesley Longman,
Inc.
8
INTRODUCTION (5 MINS) Teacher tip:
Ask the learners to review the topic on
Communicating Learning Objectives recombination in Meiosis that they took up in BIO 1.
1. Cite the learning objectives, which are as follows: Recombination or shuffling of genes/ alleles in
Meiosis results to variation in the genome of
I. illustrate the transmission of an X-linked and a Y-linked character gametes, the sperm cells and egg cells.
II. compute the probability of the occurrence of a sex-linked trait
In any cell of the body (somatic), there are
III. give examples of other sex-related traits chromosome pairs. In humans, pair numbers 1-22 are
the autosomes or body chromosomes while the last
Relevant Vocabulary
(23rd) pair is the sex chromosome.
2. State the relevant vocabulary:
I. Sex linked trait. The gene (pair) that determines a character (e.g. hemophilia) is located Normal human females have two X chromosomes
and normal human males have one X chromosome
on the sex chromosomes
and a Y chromosome; that is:
II. X-linked trait. A sex-linked trait is where the gene or allele for the trait is found on the X XX- female
chromosome XY- male
III. Color blindness. An X-linked recessive trait where a affected individual could not
distinguish red from green color (red green color blindness)
IV. Hemophilia. An X-linked recessive trait where an affected individual suffers from delayed
blood clotting during injuries because of the absence of certain blood clotting factors
V. Y-linked trait. A sex-linked trait where the gene or allele for the trait is found on the Y
chromosome
VI. Hypertrichosis pinnae auris. A Y-linked trait where affected males have hair growing from
their external ears
VII. Other sex-related traits.
A. Sex-influenced trait- Any trait in a diploid organism whose expression is affected by
an individuals biological sex; a trait that occurs at a higher frequency in one sex over
the other
B. Sex-limited trait- Any trait in a diploid organism whose expression is limited to just
one biological sex
C.
MOTIVATION (10 MINS)
Case Study
Present these three cases using pictures:
A picture of a color blindness test chart A picture of a family with male members A picture or description of a woman
Ask the learners if they could see a figure in who are bald breastfeeding a baby
the picture and ask the class to recite aloud Ask the learners if baldness occurs more in Ask the learners who among the men and
the figure/ number. men or women. women are able to lactate or breastfeed their
young.
Use a high resolution figure (photograph or image projected on a Be careful in conducting this test to discourage teasing of actual
computer or LCD) to ensure the accuracy of the color blindness test. colorblind learners. Emphasize that colorblind individuals are
Those that could see the figure are normal; those that cannot are normal except that they could not distinguish between red and
colorblind. In most cases, the colorblind males outnumber the green colors.
colorblind females, which are rare. If there are no colorblind
individuals in the class, the teacher will just have to mention as a
Misconception: Common misconception is that baldness occurs
matter of fact that colorblind females are rare.
only in males. Emphasize that baldness does happen in women,
although the frequency is much lower and is therefore rare.
10
Sex-linked traits
Give the definition of an X-linked trait Hypertrichosis pinnae auris as an example of a Y-linked trait
Explain why X-linked traits may occur more frequently in one If a male has the allele responsible for the trait, then his Y
sex over the other chromosome will possess that allele. Since he will pass on his
In humans, males and females are represented by different Y chromosome to his sons, then all his sons will inherit the
sex chromosomes trait, and they, in turn, can pass on the allele to their sons.
Females have two X chromosomes in the nucleus of their
cells. 3. Describe other sex-related traits
Males have one X chromosome and one Y chromosome in Sex-influenced trait
the nucleus of their cells. Give the definition
Depending on whether the trait is dominant or recessive, the Explain why traits may be expressed differently between
expression pattern of the trait differs in males and females sexes
Colorblindness in humans as an example of sex-linked trait Hormonal or physiological differences between the sexes
The alleles responsible for colorblindness is found on the X cause differences of expression of certain genes
chromosome only Baldness in humans as an example of a sex-influenced
The dominant allele is the normal allele; the recessive allele trait. See Table 1 how baldness is hypothesized to be
causes colorblindness expressed by a single pair of alleles, with B as the
Females need two copies of the recessive allele, one from dominant allele for baldness and b as the recessive
each of the two X chromosomes, for the trait to be normal allele.
manifested. If they only have one copy of the recessive Sex-limited traits
allele, they have normal color vision. However, they are Give the definition
carriers for the trait in that they may pass it on to their Explain why traits may be limited to one sex only
offspring. Hormonal or physiological differences between sexes
Males only need one recessive allele in their sole X may limit the expression of some genes to one biological
chromosome for the trait to be expressed. sex only
Explain what happens to the expression patterns if the trait Functional mammary glands as an example of a sex-
is X-linked and dominant. limited trait. Only females can express functional
Use Table 2 as guide. mammary glands that produce milk immediately after
Give the definition of a Y-linked trait giving birth.
Explain why there is difference in expression between males Note that baldness behaves like a dominant trait in
and females for Y-linked traits. (Since the allele is found only males in that only one dominant allele is needed for
in the Y chromosome, and since only males have Y- baldness to be expressed. On the other hand, the trait
chromosomes, then only males will express the trait. behaves like a recessive trait in women in that they need
Females CANNOT express Y-linked traits.) both dominant alleles to be present for baldness to be
expressed.
PRACTICE (20 MINS)
1. Divide learners into groups of four.
2. Ask each group to answer a set of questions related to sex-related traits in humans. See
sample questions.
ENRICHMENT
As a homework, provide this narrative to the class:
The last Emperor of Russia, Nicolas II, was married to Empress Alexandra, and they had five Teacher tip:
Hemophilia is an X-linked recessive trait. Empress
children, Olga, Tatiana, Maria, Anastasia, and Alexis. Alexis was the only one who was afflicted Alexandra was most likely a carrier of the trait (XCX).
with hemophilia or the royal bleeding disease; all other members were normal. She was a descendant of Queen Victoria of the
Research on this medical condition and determine the mode of inheritance. United Kingdom, who herself was a probable carrier.
The Emperor was completely unaffected and
If only Prince Alexis was afflicted with the disease, determine his genotype. therefore had an XY genotype. Based on the
What could be the genotypes of the Emperor and Empress? genotypes of the parents, Alexis had an XCY
genotype, with the defective X chromosome carrying
Is it possible that each daughter could have been a carrier? the allele for hemophilia coming from his mother.
Each daughter, in turn, had a 50% probability of
being a carrier, but they could NEVER have been
affected.
12
Lesson 3: Modification to Mendels Classic

Ratios
LESSON OUTLINE
Content Standard Introduction Communicating Learning Objectives and 5
The learners understand Non-Mendelian Modes of Inheritance Relevant Vocabulary
Performance Standard Motivation Narrative 5
The learners shall be able to
make a research paper/case study/poster on a non-Mendelian genetic trait Instruction Recall in Mendelian Ratios, Discussion 40
on Co-Dominance and Multiple Alleles
Learning Competency
The learners shall be able to describe some modifications to Mendels classic Practice Group Work: Non-Mendelian Traits in 40
ratios (gene interactions) (STEM_BIO11/12-IIIa-b-3) Humans, Plants, and Animals
Specific Learning Outcomes Materials

At the end of the lesson, the learners will be able to: Pen and Paper
distinguish Mendelian from non-Mendelian modes of inheritance; and Resources

(1) Klug, W.S., Cummings, M.R., Spencer, C.A. and Palladino, M.A.. 2012.
describe some cases of non-Mendelian genetic traits Essentials of Genetics. 8th ed. Benjamin Cummings.
(2) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V., and
Jackson, R.B. 2012. Campbell Biology, (9th ed). The Benjamin
Cummings Publishing Co., Inc.
(3) Sheridan, M. 1999. Instructors guide for Biology, 5th ed. By Campbell,
Reece, Mitchell. Addison Wesley Longman, Inc.
INTRODUCTION (5 MINS) MOTIVATION (5 MINS)
Communicating Learning Objectives Narrative
1. Cite the major learning objectives, which are as follows: 1. Provide this narrative to the class:
I. distinguish Mendelian from non-Mendelian modes of 2. A local hospital has sent word to a family of a possible mix up of
inheritance some of the children with other families when they were born.
II. describe some cases of non-Mendelian genetic traits To rule out any possible mix up, the hospital obtained the blood
types of every individual in the family, including the surviving
maternal grandfather and paternal grandmother. The results
Relevant Vocabulary were as follows:
2. Present the following relevant vocabulary:
Father: Type O
I. Co-dominance - When two contrasting alleles are present in Mother: Type A
the same locus or trait (heterozygote genotype), then the 1st child: Type O
phenotype expressed is a blend of the two extreme 2nd child: Type A
phenotypes. The two genes interact and the offspring shows 3rd child: Type B
the effects of both alleles. Maternal grandfather: Type AB
Paternal grandmother: Type B
II. Incomplete dominance - When two contrasting alleles are
present in the same locus or trait (heterozygote genotype), 3. Based on the results, is there a possibility that any one of the
then both alleles are expressed in the same phenotype children is not a biological offspring of the couple? To answer
this question, we must first understand how blood types, a non-
Mendelian trait is inherited.
III. Multiple alleles - When there are more than two types of
alleles for a given locus or trait, this will result in more than
two kinds of phenotypes that may be expressed for that
trait.
14
INSTRUCTION (40 MINS) Teacher Tip:
Review the Mendelian ratios and ensure that the
Recall in Mendelian Ratios, Discussion on Co-Dominance and Multiple Alleles learners are familiar with them before they could
1. Let the learners recall the Mendelian Ratios in STEM_BIO11/12-IIIa-b-1 proceed with the lesson.
2. Discuss incomplete dominance. Define the trait. The heterozygote genotype is expressed as a
distinct phenotype (a blend of the two extreme phenotypes). In this case, the phenotypic
ratio is the same as the genotypic ratio
I. Use snapdragon plants (Antirrhinum majus) as example (see figure 1).
A. RR red flowers
B. Rr pink flowers
C. rr white flowers
Emphasize that incomplete dominance and co-
3. Discuss co-dominance. Define the trait. The heterozygote genotype is expressed as a distinct
dominance are similar in that their phenotypic
phenotype (both extreme phenotypes are expressed at the same time). Similar to incomplete ratios follow their genotypic ratios. However, they
dominance, the phenotypic ratio is the same as the genotypic ratio. differ in the expression of the heterozygote
condition: in co-dominance, the heterozygote
I. Use human MN blood typing as an example
expresses both extreme phenotypes; in
A. MM type M incomplete dominance, the heterozygote is
expressed as a blend of the two extreme
B. MN type MN
phenotypes.
C. NN type N
4. Discuss multiple alleles. Define the trait. There are more than two types of alleles, and the
relationship of each allele with respect to others will determine the number of phenotypes
that may be expressed.
I. Use coat color in rabbits as example (see figure 2)
A. There are four different types of alleles in rabbits: C (Agouti), Cch (Chinchilla), Ch
(Himalayan), and c (Albino), with the following dominance hierarchy: C> Cch>Ch> c.
B. The following genotypes will have the corresponding phenotypes in coat color:
i. CC Agouti
ii. CCch Agouti
iii. CCh Agouti
iv. Cc Agouti
v. CchCch Chinchilla
vi. CchCh Chinchilla Teacher Tip:
vii. C c Chinchilla
ch Note that in the ABO system, the O allele is
recessive to both A and B alleles while the A and B
viii. ChCh Himalayan alleles are co-dominants of one another.
ix. Chc Himalayan
x. Cc Albino
C. Use ABO blood typing in humans as example

i. There are three different types of alleles A (or IA), B (or IB) and O (or i)
ii. The following genotypes will have the following blood types (phenotypes):
iii. AA (or IAIA) Type A
iv. AO (or IAi) Type A
v. BB (or IBIB) Type B
vi. BO (or IBi) Type B
vii. AB (IAIB) Type AB
viii. OO (ii) Type O
5. Go back to the Motivation narrative

Blood types O and AB can only have OO and AB
I. The class will now answer the question/narrative provided during the Motivation part. The genotypes, respectively.
teacher will ask first the most probable genotypes of all the members of the family as The mother must be AO in order to have an
follows: offspring that is either A or O.
The paternal grandmother must be BO in order to
i. Father: Type O - OO have an offspring (father) who is blood type O.
ii. Mother: Type A - AO The 3rd child could have been the result of a mix
up because the B allele is not present in either
iii. 1st child: Type O - OO parent.
iv. 2nd child: Type A - AO
v. 3rd child: Type B B? Misconception
Emphasize that blood typing could only be used to
vi. Maternal grandfather: Type AB - AB
exclude/disprove biological parentage, not to
vii. Paternal grandmother: Type B BO prove it.
viii. Possible mix-up? Yes, 3rd child.
16
PRACTICE (40 MINS)
1. Divide learners into groups of four. C. Two wavy plants will produce what possible kinds of
2. Ask each group to answer a set of questions related to non- offspring? Give their ratios? (ANSWER: 25% serrated:
Mendelian modes of inheritance. See sample questions. 50% wavy: 25% smooth; this is a hybrid cross, which will
give a 1:2:1 ratio)
1. In cattle, coat color is inherited in a co-dominant fashion.

3. In guinea pigs, coat color is governed by four alleles that
Homozygous B1B1 produces black coat, homozygous B2B2
constitute a multiple allelic series, C (black), cS (sepia), cC
produces white coat, and the heterozygous B1B2 produces
(cream), and c (albino) with the following dominance
roan coat. Give the phenotypic ratio of the offspring of the
hierarchy: C>cS>cC>c. Determine the phenotypic ratios of
following crosses:
the progeny from the following crosses:
A. B1B1 x B1B1 (ANSWER: all black)
A. Cc x CcS (ANSWER: 75% black: 25% sepia; the
B. B B x B B
1 1 2 2
(ANSWER: all roan) genotypes and their probabilities of occurrence are: 25%
C. B1B2 x B1B2 (ANSWER: 25% Black: 50% Roan: 25% CC, 25% CcS, 25% Cc, and 25% cSc, giving a phenotypic
White) ratio of 75% black and 25% sepia)
D. B1B1 x B1B2 (ANSWER: 50% Black: 50% Roan) B. CcS x cCc (ANSWER: 50% black: 50% sepia; the
E. B1B2 x B2B2 (ANSWER: 50% Roan: 50% White) genotypes and their probabilities of occurrence are 25%
CcC, 25% Cc, 25% cScC, 25% cSc, giving a phenotypic
ratio of 50% black and 50% sepia)
2. In a hypothetical plant, a serrated leaf margined plant, when
crossed with a smooth leaf margined plant, produces
offsprings with wavy leaf margin. 4. A man who is blood type B is married to a woman who is
blood type A. None of the mans parents is blood type O.
A. Identify the mode of inheritance. (ANSWER: Incomplete
This couple has 4 children with the following blood types: B,
dominance)
AB, AB and O. Give the genotypes of the parents.
B. Two serrated plants, when crossed, will give what type of (ANSWER: Man: BO; Woman: AO; Both parents must have
offspring? (ANSWER: Serrated plants; the trait is an O allele in order to produce and offspring with blood
homozygous, therefore producing offspring with the type O with genotype OO)
same phenotype as the parents)
Incomplete dominance in snapdragons, Antirrhinum majus. The
cross involving homozygote red flowers (RR) and homozygote white
flowers (rr) will yield a heterozygote (Rr) that expresses a different
phenotype, which is pink flowers. The cross between pink-flowered
Coat color in rabbits. The trait is controlled b multiple alleles with
individuals will produce offsprings where the genotypic ratio also
the following dominance hierarchy: C (Agouti) > Cch (Chinchilla) >
becomes the phenotypic ratio (25% red: 50% pink: 25% white).
Ch (Himalayan) > c (Albino).
(Wikipedia)
18
Lesson 4: Molecular Structure of DNA,

RNA, and Proteins
Content Standard LESSON OUTLINE
The learners understand Structures and Functions of DNA, RNA and proteins
Introduction Communicating Learning Objectives 5
The learners shall be able to Motivation Group Work 5
build models of DNA, RNA and proteins
Instruction Discussion on the Molecular Structures 30
Learning Competency of DNA, RNA, and Proteins
The learners shall explain how the structures of DNA, RNA and proteins are
related to their functions (STEM_BIO11/12- IIIa-b-4) Practice Building Models of DNA 5
Enrichment Conversion to mRNA Transcripts 5

Specific Learning Outcomes
Evaluation Identification of Biomolecule 10
At the end of the lesson, the learners will be able to:
Represented by Given Chain Structures
describe the building blocks of DNA, RNA and proteins;
identify the structural and functional differences between DNA and RNA Materials
Recyclable materials for model construction; freely
and
downloadable molecular modeling software.
explain the different levels of protein structure
Resources
Biochemistry textbooks; SwissPDB Viewer software (free
download); Protein Data Bank (www.pdb.org)
INTRODUCTION (5 MINS) Teacher Tip:
One dimensional and two dimensional models of
Communicating Learning Objectives
DNA should be presented to the class.
1. The learning outcomes will be presented as follows:
I. describe building blocks of DNA, RNA and Proteins.
II. identify the structural and functional differences between DNA and RNA.
III. discuss the different levels of protein structure (primary, secondary, tertiary and quaternary)
IV. 4.explain how protein structural features may influence their functions
2. Ask learners if they have heard of the term genes. Ask them what genes have they
inherited from their parents.
Sample answers: genes for dimples, straight hair, etc.
MOTIVATION (5 MINS) Teacher Tip:

Expected Answers:
1. Divide the class into groups of learners. Allow each group to enumerate the most important
DNA: repository of genetic information
functions of DNA and proteins that they can recall from their previous grade levels. RNA: transcripts; link between the gene and the
2. Consolidate these answers on the board. gene product (protein)
Protein: functional products; executors of cellular
functions

1. The building blocks of any nucleic acid are the nucleotides.
2. A nucleotide is composed of a phosphate group (with negative charges), a sugar portion and
an N-base.
3. The sugar in DNA is deoxyribose while the sugar in RNA is ribose. Explain the difference
through a visual aid.
4. DNA and RNA are polynucleotides. N-bases are either purines or pyrimidines. Purine bases
are Adenine (A) and Guanine (G). Pyrimidines are Cytosine (C), Thymine (T, in DNA only) and
Uracil (U, found only in RNA)
5. Specific base pairings occur in DNA. A pairs with T; G pairs with C
6. DNA is double stranded while RNA is single stranded with Uracil instead of Thymine.
20
7. Main Functions: Teacher Tip:
I. DNA: repository of genetic information; sequence of bases encodes the blueprint for life If computers and internet facilities are available,
processes structures for these biomolecules are available as
molecular structure files (*.pdb) from the Protein
II. RNA: information in the form of base sequence is transformed (transcribed) into mRNA, Data Bank (www.pdb.org).Focus on the important
tRNA and rRNA. DNA is the template copied into RNA by base pairing. G with C; A with parts of the structure that provide the necessary
U. physical properties of DNA, RNA and proteins.
III. Protein: functional products of genes; executes cellular functions
Discuss the importance of these physical features
8. The four structural levels of proteins are: 1.Primary- sequence of amino acids in the for the functions of DNA, RNA and proteins.
polypeptide chain; 2. Secondary- when the polypeptide chains form a helix or a pleated sheet
structure; 3. Tertiary- coiling of the polypeptide, combining helices and sheet forms; 4.
Quaternary- the association of two or more polypeptides in space
Summary of Important Physical Properties
BIOMOLECULE Physical Property Functional Relevance Emphasize that the DNA has negative charges on
the outside due to the phosphate groups. Other
DNA Complementary Base Pairs Allows each strand to serve as a template stabilizing factors in the DNA should be
for replication and transcription mentioned.
Phosphodiester bonds Essential for polynucleotide chain

elongation
RNA Single stranded but some bases For stability

can be complementary; hence,
some portions may be double
stranded
Uracil Nitrogenous base found only in RNA.

Note:
PROTEIN Amino (N)Terminus Start of the polypeptide chain
For each classification of amino acid,give the
names of each amino acid. Give the one letter
Amino (N)Terminus End of the polypeptide chain symbol for each amino acid. The three letter code
for each amino acid may also be provided.
Peptide Bond Links amino acids together
One letter symbol for each Classes:

amino acid a. non-polar- aliphatic or aromatic
b. polar, uncharged
c. polar, charged- acidic and basic
PRACTICE (5 MINS)
Given the following coding sequence for DNA, provide the sequence of the complementary
Teacher Tip:
(template) sequence. Be sure to note the antiparallel orientation of the
Coding sequence : 5 ATGCATAGATTAGGATATCCCAGATAG 3 coding and non-coding strands of DNA. Explain
the relative positions of the 5 and 3 ends.
(Answer)
Complementary sequence 3 TACGTATCTAATCCTATAGGGTCTATC 5
Ask the learners to build models of DNA by using recyclable materials such as popsicle sticks or
pieces of colored papers to represent the complementary bases: G with C; A with T. The DNA
backbone (phosphate, sugar) should be included.
ENRICHMENT (5 MINS)
1. Convert the given coding sequence into an mRNA transcript: Teacher Tip:
The mRNA transcript has almost the same
Complementary Non-coding/ Template sequence 3 TACGTATCTAATCCTATAGGGTCTATC 5 sequence as the coding sequence (DNA), but the
(Answer) thymines are replaced to Uracil.
Coding sequence ~ mRNA transcript 5 AUGCAUAGAUUAGGAUAUCCCAGAUAG 3 Show the learners how to read the codon Table
Teach the learners the single letter codes for the

2. Translate the given mRNA transcript into a polypeptide sequence: amino acids (e.g. ryptophan ! Trp ! W).
Ask the learners to spell their names using the

Coding sequence ~ mRNA transcript 5 AUGCAUAGAUUAGGAUAUCCCAGAUAG 3 amino acid codes (e.g. N-E-I-L ! Asn Glu Ile
(Answer) Lue).
Polypeptide sequence N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C
22
EVALUATION (10 MINS) Teacher Tip:
Ask learners to identify the type of biomolecule represented by a given chain structure: To help learners practice the generation of
complementary sequences, worksheets with
1. DNA- partially completed sequences may be used.
2. RNA-
3. Protein-
Example
Template sequence
3 TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5
5 _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3
Learners may be asked to identify the important structural features in these chain structures
(features are listed in the instruction/ delivery table). A similar exercise of generating non-coding
sequences (DNA), transcripts (RNA) and translated polypeptides may be done to test the learners
understanding of the topic.
Lesson 5: DNA Replication and Protein

Synthesis
LESSON OUTLINE
Content Standard Introduction Communicating Learning Objectives and 5
The learners understand Central Dogma of Molecular Biology.
Review
Motivation Inquiry 5
identify requirements, enzymes and products in DNA Replication, Instruction Discussion on DNA Replication or DNA 20
transcription, and protein synthesis. Synthesis
Learning Competency Practice Matching Type Game 10
The learners should be able to diagram the steps in DNA replication,
transcription, and protein synthesis (STEM_BIO11/12- IIIa-b-5) Evaluation Take-home Activity 5
Materials
Specific Learning Outcomes Paper, coloured pens
describe the requirements, proteins and enzymes in DNA replication; (1) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V., and
Jackson, R.B. 2012. Campbell Biology, (9th ed). The Benjamin
transcription and translation; and Cummings Publishing Co., Inc.
diagram the steps in replication, transcription and translation.
24
1. The learning objectives will be communicated as follows: To help learners practice the generation of
A. Describe the requirements, proteins and enzymes in DNA replication, transcription and partially completed sequences may be used.
translation
B. Diagram the steps in replication, transcription and translation.
C. Explain what happens to a gene sequence that undergoes transcription and eventual
translation into protein
2. Ask the learners to recall the significance of Mitosis.

Mitosis is an equational cell division that produces daughter cells which are identical or clones
of the original, mother cell. This ensures that every cell of the body has the same genetic
content, i.e. chromosome number. To make this possible, cells have to duplicate their genetic
material which is primarily DNA.
MOTIVATION (5 MINS)
1. Ask learners to imagine how many cells a typical mature human contains. Tell them that they
all came from just one fertilized egg cell. A zygote goes through millions of generations of cell
divisions to become just the one person that a learner is. Even until now, cells in an individual
are still dividing. Ask learners what examples of tissues in their body are undergoing cell
division. (sample answers: skin; blood cells)
2. Also, ask learners to recall that in the previous topics on genetics, the phenotype is the
outside, visible characteristic of an organism. Any phenotype (eg. red flower) is directly
determined by proteins or enzymes functioning in a metabolic pathway. Proteins are made by
turning on specific portions of DNA that are called genes. Particular sequences of DNA are
transcribed to become RNAs. These are then used to produce proteins in a process called
translation.
1. DNA replication or DNA synthesis. DNA strands separate and serve as templates for the To help learners practice the generation of
production of new DNA molecules.
partially completed sequences may be used.
A. The following are features of replication:
i. Semiconservative- the resulting DNA consists of one old and one new strand
ii. Base pairing is maintained; Adenine pairs with Thymine, Guanine pairs with Cytosine
iii. New DNA molecules are produced in the 5 to 3 direction
iv. Semidiscontinuous. The leading strand is synthesized in a continuous manner (5 to 3)
while the lagging strand is produced discontinuously in short stretches called Okazaki
fragments.
B. In lagging strand synthesis, there is a need for a primer terminus which is provided by an
RNA molecule. RNA is synthesized by a primase or RNA polymerase. The 3OH of the
RNA is where new DNA nucleotides are added thus new DNA is built in the 5 to 3
direction.
C. Enzymes in replication are as follows: 1. helicase; 2. gyrase; 3. SSB (single strand binding
proteins); 4. primase or RNA polymerase; 4. DNA polymerase and 5. DNA ligase.
26
2. Transcription or RNA synthesis. DNA is unwound and one strand is used as template for the Teacher Tip:
production of an RNA molecule. An RNA polymerase makes RNA in the 5 to 3 direction. To help learners practice the generation of
Specific regions in the DNA called promoters allow the binding of transcription factors which complementary sequences, worksheets with
partially completed sequences may be used.
make possible the binding of RNA polymerase. Three major types of RNA are: messenger
RNA (mRNA); transfer RNA (tRNA) and ribosomal RNA (rRNA).
3. Translation or protein synthesis. This occurs in the ribosome. Basic ingredients are the
various types of RNAs produced in transcription and some proteins or enzymes. The mRNA
contains triplets of bases called codons that specify an amino acid, eg. UUU-phe. Various
tRNAs carry amino acids from the cytoplasm to the actual site of translation in the ribosome. A
tRNA has an anticodon that pair with a codon in the mRNA. Different rRNAs combine with
ribosomal proteins to make up the subunits of a ribosome. A functional ribosome has a small
and a large subunit.
In bacteria, transcription and translation may be simultaneous. In eukaryotic cells, mRNA,

tRNA and rRNA travel from the nucleus to the cytoplasm through the nuclear pores. RNAs
may undergo processing. Some unnecessary parts like introns are removed. In eukaryotic
mRNA, a 5 cap and a 3 poly A tail are added. Coding regions of mRNA are called exons.
They specify functional protein products.
In the elongation
process of translation,
amino acids are linked
by peptide bond
formation due to the
action of peptidyl
transferase known to
be a part of the
ribosome subunit. The
process is summarized
in the diagram above.
To initiate translation, the small and the big subunits of the ribosome have
to be separated. Initiation factors (IF) make this possible. They also prevent
the premature reassociation of these subunits. The small subunit of the
ribosome binds the mRNA and allows the entrance of a tRNA to the P site
bearing the first amino acid. The big subunit then binds and together they
form an assembly ready for the next amino acid in the A site of the
ribosome.
A stop codon signals the

end of translation. No
amino acid corresponds
to a stop codon. Release
factors halt the process
and the polypeptide is
released.
The genetic code is the correspondence of the mRNA codons to

amino acids. An amino acid is specified by a codon with three
code letters. The genetic code is shown as above.
28
The genetic code is the correspondence of the mRNA codons to amino acids. An amino acid is Teacher Tip:
specified by a codon with three code letters. The genetic code is shown as follows: Use flash cards. Organize learners into groups and
ask them to compete.
Point out the effect of the loss of the

following:
PRACTICE (5 MINS)
1. Matching Type Game: For each protein or enzyme or structure mentioned above, identify ENZYME EFFECT OF LOSS
whether such is involved in replication, transcription or translation. DNA Polymerase No replication
2. Explain why both DNA replication and RNA transcription are disrupted by the loss of RNA
Helicases Decreased DNA replication
polymerase. efficiency
Peptidyl No peptide bond formation

EVALUATION (5 MINS) transferase
1. As an assignment, ask the learners to make their own diagram of the steps involved in DNA
RNA Polymerase No replication
replication, transcription and translation or protein synthesis. (Note: The learners may choose a
No transcription
variety of medium for presenting the steps of the processes.)
Ribosomes No translation
Lesson 6: Genetic Engineering

Content Standard
The learners outline the steps in Recombinant DNA. LESSON OUTLINE
Performance Standard Introduction Communicating Learning Objectives and 5
The learners shall be able to Review
explain how genes may be modified and/or inserted in host cells/
Motivation Desirable Traits 5
organisms.
Learning Competency Instruction Genetic Engineering 35

The learners should be able to outline the steps involved in genetic Practice Recitation 5
engineering (STEM_BIO11/12-III a-b-6)
Enrichment Poster Making 5
Specific Learning Outcomes Evaluation Assignment 5

compare classical breeding with modern genetic engineering techniques; Materials
Recyclable materials for paper models of plasmids; scissors; tape; pens of
enumerate the steps in molecular cloning; various colors
describe some methods to introduce DNA into cells; and Resources
explain the selection and screening of transformants / genetically modified Biochemistry textbooks; online videos on genetic engineering
organisms (GMOs) and GMOs
30
Communicating Learning Objectives and Review Teacher Tip:
1. The learning outcomes will be presented and the overall idea on how organisms may be Make a quick review of the previous lesson on
DNA replication and protein synthesis.
modified will be discussed.
2. In order to survive, man has successfully domesticated selected plants and animals. He has
taken an active part in choosing desired traits of plants and animals. Traits that were
considered valuable (i.e. high fruit yield; high milk production, etc.) were sought out and
propagated. The processes involved may include classical breeding practices such as
controlled pollination of plants, and the mating of animals with desired traits. In todays
modern science, molecular biology techniques are being employed in the insertion and
expression of proteins in different organisms for various purposes.
MOTIVATION (5 MINS)
Desirable Traits Teacher Tip:
Group the learners into 3s or 4s and allow each
1. Ask for volunteers to enumerate plants and animals that have desirable or enhanced traits.
group to discuss examples of enhanced animals/
2. Ask learners to explain how each of the traits was introduced or developed (i.e. classical plants.
breeding or recombinant DNA technology).
ENHANCED TRAIT MODIFYING TECHNIQUE
Kobe / Wagyu Beef (Beef with good fat Classical breeding

distribution)
Guapple (Large sized guava) Classical breeding
Human Insulin-producing bacteria Recombinant DNA Technology
Flavr-Savr (Delayed-ripening tomatoes) Recombinant DNA Technology
Macapuno trait in coconuts Classical breeding

Pictures of common domesticated plants and
Genetic Engineering
animals may be shown in class.
1. Classical breeding practices focus on the mating of organisms with desirable qualities.
2. Genetic engineering involves the use of molecular techniques to modify the traits of a target High cost of medicine and other agricultural
products may be mentioned.
organism. The modification of traits may involve:
I. introduction of new traits into an organism
II. enhancement of a present trait by increasing the expression of the desired gene
III. enhancement of a present trait by disrupting the inhibition of the desired genes
expression.
3. A general outline of recombinant DNA may be given as follows:
I. cutting or cleavage of DNA by restriction enzymes (REs)
II. selection of an appropriate vector or vehicle which would propagate the recombinant
DNA ( eg. circular plasmid in bacteria with a foreign gene of interest)
III. ligation (join together) of the gene of interest (eg. from animal) with the vector ( cut
bacterial plasmid)
IV. transfer of the recombinant plasmid into a host cell (that would carry out replication to
make huge copies of the recombined plasmid)
V. selection process to screen which cells actually contain the gene of interest
VI. sequencing of the gene to find out the primary structure of the protein
4. After outlining the key steps in recombinant DNA, the teacher can proceed to describe the
ways in which these plasmids may be introduced into host organisms.
Biolistics. In this technique, a gene gun is used to fire DNA-coated pellets on plant tissues.
Cells that survive the bombardment, and are able to take up the expression plasmid coated
pellets and acquire the ability to express the designed protein.

Plasmid insertion by Heat Shock Treatment. Heat Shock Treatment is a process used to
transfer plasmid DNA into bacteria. The target cells are pre-treated before the procedure to
increase the pore sizes of their plasma membranes. This pretreatment (usually with CaCl2) is
said to make the cells competent for accepting the plasmid DNA. After the cells are made
32
competent, they are incubated with the desired plasmid at about 4C for about 30min. The
plasmids concentrate near the cells during this time. Afterwards, a Heat Shock is done on
the plasmid-cell solution by incubating it at 42C for 1 minute then back to 4C for 2 minutes.
The rapid rise and drop of temperature is believed to increase and decrease the pore sizes in
the membrane. The plasmid DNA near the membrane surface are taken into the cells by this
process. The cells that took up the plasmids acquire new traits and are said to be
transformed.
Electroporation. This technique follows a similar methodology as Heat Shock Treatment, but,
the expansion of the membrane pores is done through an electric shock. This method is
commonly used for insertion of genes into mammalian cells.
5. Some methods to screen recombinant cells are as follows:

Selection of plasmid DNA containing cells
A selection marker within the inserted plasmid DNA sequence allows the selection of
transformants. Usually, an antibiotic resistance gene (e.g. AMP ampicillin resistance gene) is
included in the plasmid DNA. This allows only transformed cells to survive in the presence
of the antibiotic (e.g. ampicillin). Plating the plasmid-cell solution on antibiotic-containing
media will select for these transformants and only allow plasmid-containing cells to grow
and propagate into colonies.
Selection of transformed cells with the desired gene

Teacher Tip:
Certain inserted genes within the plasmids provide visible proof of their presence. These Agarose gel electrophoresis (AGE) allows the
include the antibiotic resistance genes that allow for the selection of the transformed cells identification of PCR products and estimation of
their sizes. This is done by running a molecular
within the solution. Some inserted genes also produce colored (e.g. chromogenic proteins) or
weight (MW) ladder alongside the samples. The
fluorescent products (e.g. GFP) that label the colonies/cells with the inserted gene. MW ladder is made up of DNA fragments of
known size (e.g. 100bp, 200bp, 300bp, 500bp,
etc). The size of the PCR product may be
In some cases, the location of the cloning site within the plasmid is in the middle of a gene approximated by the DNA fragment in the MW
(i.e. -galactosidase, lacZ) that generates a (blue) colored product in the presence of a ladder that runs a similar distance.
substrate (i.e. isopropyl -D-1 thiogalactopyranoside, or IPTG). Cells transformed with these
empty plasmids will turn blue in the presence of IPTG. Insertion of a gene in the cloning site
disrupts the sequence of the -galactosidase gene and prevents the generation of the colored
product in the presence of the substrate. Cells transformed with the disrupted -galactosidase
gene will remain white in the presence of IPTG. This blue-white screening protocol is thus
able to screen for cells that were transformed with the desired gene in the cloning site.
PCR detection of plasmid DNA

Alternatively, the presence of the desired gene in the inserted plasmids may be confirmed
using PCR amplification. PCR reactions specific for the desired gene may be done using DNA
from cells. Amplification of the expected product would confirm the presence of the gene
within the samples. PCR reactions specific for plasmid sequences will also confirm/identify the
type of plasmid used for the transformation.
Genetically Modified Organisms (GMOs)

Teacher Tip:
With the ability to insert gene sequences, comes the possibility of providing new traits for Note that antisense RNA strands bind to mRNAs.
these target organisms. This has allowed the development of GMOs. Some of these genetic This prevents their expression into proteins.
modifications promise higher product yield for their targets. These include the Flavr-Savr
Tomato and Bt-Corn.
The Flavr-Savr (Flavor Savor) tomato was the first genetically modified organism that was Note:
licensed for human consumption. The trait modified in this tomato is its ripening process. A Which of the techniques discussed can be used to
gene for an enzyme that causes the degradation of pectin in the cell walls (i.e. detect if GMOs were used in a certain food
product?
polygalacturonase) normally softens the fruit as it ripens. In Flavr Savr tomatoes, an inhibitor
(i.e. antisense RNA) disrupts the expression of this gene, thereby delaying the softening of the Answer: Assuming that the DNA is still intact in the
fruit and extending the time it may be kept in storage and transported to markets. sample, testing for specific marker genes in
expression plasmids can be used to detect the
presence of these engineered plasmids.
Bt-Corn was developed to incorporate the production of a toxin (i.e. Bt-endotoxin) from
Bacillus thuringensis in corn plants. This toxin results in the death of pests that feed on these
plants like the corn borer larvae. The toxin has been shown to be selective for Lepidoptera
larvae and is non-toxic to humans, mammals, fish and birds. The selective toxicity of the toxin
allows its use in foodcrops. The introduction of the toxin is believed to increase crop
production due to decreased losses from pest infestation. The same technology has been
applied in the Philippines for the development of Bt-Eggplant.
34
Despite the proposed benefits of GMOs, some people have raised their concerns regarding
the consumption of these modified foods. While most of the products are tested for safety,
concerns are raised for the possibility of not being able to detect hazards that are present, but
are currently undetectable by todays current technology.
Because of these issues, manufacturers are urged to provide labels that notify consumers of
GMO presence in their products. While GMOs are believed to be safe when licensed by the
food regulatory agencies, it is believed that the consumers must be provided with enough
information to make their own choices regarding their use.
PRACTICE (5 MINS)
Teacher Tip:
Recitation Biolistics may be more suitable for plants due to
1. Ask the learners to differentiate the various technologies for delivering genes into cells. their thick cell walls.
2. Determine which technologies are most appropriate for which cell types.
(Answers: Biolistics for plants; Electroporation for mammalian cells; Heat shock for
bacterial cells)
ENRICHMENT (5 MINS)
Teacher Tip:
Poster Making
This may also be given as an assignment.
1. Learners may be asked to make a poster on the steps and other methods involved in
recombinant DNA.
EVALUATION (5 MINS)
Assignment
1. Give an assignment and allow learners to research on the pros and cons of genetic
engineering.
2. Ask them for their opinion on the matter, and ask them to support these opinions with facts
learned in class. Be sure that issues of biosafety are included in the discussion.
Lesson 7: Discuss the Applications of

Recombinant DNA
Content Standard
The learners demonstrate an understanding of recombinant DNA and LESSON OUTLINE
examples of products from Recombinant DNA Technology.
Performance Standards
The learners shall be able to: Motivation Thought Experiment 5
describe some techniques for the expression of desired traits in target
organisms; and
Instruction Presentation of Recombinant DNA 35
search online databases for specific traits and source organisms. Practice Steps in PCR and Gene Cloning 5
Learning Competency Enrichment User of PCR and GMOs 5

The learners should be able to discuss the applications of Recombinant DNA
Technology (STEM_BIO11/12-III a-b-7) Evaluation Sample Exercise 5
Specific Learning Outcomes: Materials

At the end of the lesson, the learners will be able to: Writing materials, recyclable materials for models of plasmids,
give examples of products from recombinant DNA technology; tape, pens
illustrate the use of databases to search genes for desired traits; Resources
describe steps in PCR to amplify and detect a gene of interest; (1) Genbank, www.ncbi.nlm.nih.gov
identify the parts of an expression vector; (2) Protein Data Bank, www.pdb.org
explain how genes may be cloned and expressed
36
Be sure to stress that for a gene to add a trait to
Communicating Learning Objectives an organism, the gene for the trait must be
1. The learning objectives will be presented and the processes in the Central Dogma of Molecular inserted within the target organism, and the
Biology will be reviewed: organism should have the necessary
equipment (i.e. enzymes, materials ) to
DNA (gene) ! RNA (transcript) ! Protein (trait)
produce the protein that results in the trait or
2. Different organisms have different traits based on their genes (DNA sequences). desired phenotype.
For example, frogs have antimicrobial peptides on their skin. Some jellyfish have proteins that
allow them to glow in the dark. Mutations in hemoglobin genes lead to anemia.
3. Based on the central dogma, if transcription and translation of genes lead to some traits, then
the insertion of certain genes in a given organism may provide it with new traits. This is the basis
for the development of genetically modified organisms (GMOs).
MOTIVATION (5 MINS)
Teacher Tip:
Thought Experiment Discuss the merits of the different proposed
1. The learner may be given a group activity/ thought experiment for constructing a genetically designer genes based on the following
criteria:
modified organism/trait in a fruit. Designer Genes group work
I. Arrange the learners into groups of 3 or 4. 1. Originality of the study (i.e. Has anyone
done studies of this type before?)
II. Have them identify a special trait (e.g. large fruit size)
2. Feasibility of the study (How possible is the
III. Have them identify a source organism (e.g. jackfruit / langka) proposed modification? Can the target
organism support the proposed trait? )
IV. Have them identify a target organism (e.g. aratilis)
3. Potential Applications of the new organism
V. Have them identify the modified / added trait (e.g. langka-sized aratilis). (What benefits would the recombinant
organism provide to society?)
VI. Have the learners present their work to the rest of the class, and let the class decide on the
best proposal. Some examples: Flood-resistant rice Delayed-
ripening fruits
Teacher Tip:
Presentation of Recombinant DNA
Ask the learners on the significance of finding
1. After the exercise, the learners should now be aware that there are many different traits that can many versus few entries on a given topic in the
be introduced to organisms to change their properties. The following table shows examples of database.
modified traits using cloned genes and their applications:
GENE RECIPIENT APPLICATION FEW entries MANY

MODIFIED TRAIT in the entries in the
MODIFICATION ORGANISM (FIELD)
database database
Insulin Production Insertion of Human Bacteria (Medicine)
Insulin Gene Topic has not Topic is much
Production of Human
been studied
Insulin in Bacteria
extensively
studied
Much
Pest Resistance Insertion of Bt-toxin Corn / Maize (Agriculture) PROS information is
gene Production of corn High chance available on
plants with increased to discover the topic
resistance to corn novel traits /
boxer applications
CONS Low number Difficult to

of research to discover new
Delayed Ripening Disruption of a gene Tomato plant Agriculture)
verify the information
for a ripening enzyme Production of plants
observations on the topic
(e.g. with fruits that have
polygalacturonase) delayed ripening
fruits. These fruits will
survive longer
transport time,
allowing their delivery
to further locations
(i.e. export deliveries)
38

Chymosin Production Insertion of a gene for Bacteria (Industry)
chymosin Enhance large scale

production of
chymosin. This enzyme
serves as a substitute
for rennet in the
coagulation of milk.
Rennet has to be
harvested from calves.
The large scale
production of this
enzyme in bacteria
provides an abundant
supply of this
important component
for the cheese
production industry.
Web based research:

Search for these different traits and how they may be made useful. This involves the collection of gene sequences in accessible locations, such
as databases (e.g. Genbank (www.ncbi.nlm.nih.gov) ; Protein Data Bank (www.pdb.org)). These databases serve like libraries that may be
consulted when trying to find specific traits that belong to different organisms.
For example, one would want to find out if any work has been done on spider silks. The databases (e.g. Genbank:Nucleotide database) may be
searched for entries that contain information on Spiders, and Silk (Result: 93615 entries). The results may be screened for more specific
studies (e.g. Malaysia, Spiders, and Silk- Result two entries).
PCR Amplification
Once a desired trait is chosen, information must be acquired for either its detection or expression in a
given organism.
1. Detection Teacher Tip:

Some researchers may be interested in determining if a given gene/trait is available in a particular Mention that unlike DNA replication in
organism. If no previous research provides this information, researchers may test the DNA of vivo, PCR reactions do not use too many
helper enzymes such as helicases and
different organisms for the presence of these specific genes. A technique that allows the detection gyrases to help denature and stabilize the
of specific genes in target organisms is called PCR. template DNA strands.
The cyclic heating of the samples is meant
to provide the physical separation of the
PCR amplification is an in-vitro method that simulates DNA replication in vivo. It utilizes a template DNA strands through heat
thermostable (heat-resistant) DNA polymerase that builds single stranded DNA strands unto denaturation of the inter-strand H-bonds.
unwound DNA templates. PCR uses repeated cycles of incubation at different temperatures to
promote the unwinding of the DNA template (~95C); the annealing of a primer (a ~20bp
oligonucleotide sequence (recall RNA primers in DNA replication) onto the ssDNA template strand
(~54 - 60C); and the extension of the generated ssDNA strand through the binding of
complementary bases to the template strand (~72 C). The thermostability of the polymerase allows
it to survive the repeated cycles of denaturation, annealing and extension with little loss of enzyme
function. Each cycle of PCR doubles the amount of the target sequence. A typical PCR experiment
uses about 35 cycles of amplification. This increases the original amount of the target sequence by
235 (i.e. ~34 billion) times.
Gene detection by PCR involves the design of primers that would only bind to sequences that are
specific to a target. For example, researchers would want to find out if gene X (e.g. the gene for
insulin) is available in a target organism (e.g. a mouse, Mus musculus). Primers may be designed by
looking at the available sequences for gene X in the databases (e.g. all the genes for insulin in
different organisms; humans, pigs, cows, etc.). The different gene X sequences must be aligned/
compared to match areas of sequence similarity (conserved sequences) and areas of sequence
dissimilarity (non-conserved sequences). Primers designed to have the same sequence as the
conserved areas will be specific for binding gene X sequences in all the target organisms. Primers
designed to have the same sequence as the non-conserved areas will only be specific for the
organisms which match its sequence.
40
Primers may be classified as forward or reverse primers. Forward primers are complementary and Teacher Tip:
bind to the reverse complementary (non-coding) sequence of the gene. Reverse primers are Let the learners recall the antiparallel orientation
of the bound primers to the template DNA. If the
complementary and bind to the coding sequence of the gene.
template is represented from left to right in the
5 ! 3 orientation; then the primers should bind
near the 3 end and the primers would be
STEPS in PCR Amplification represented 3 ! 5 going left to right.
Step 0: Undenatured Template ; Temp ~ 54 "C;
Template: double stranded (ds) DNA strand. Complementary sequences are held together by H-bonds
5 A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3 (Coding strand)
3 T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5 (Non-coding strand)
Step 1: Template denaturation ; Temp ~ 95 "C;

Template: single stranded (ss) DNA strands; DNA strands are separated; H-bonds between
complementary sequences are broken
Step 2: Primer Annealing ; Temp ~ 54 "C (dependent on primer melting temperature);

Template: ssDNA strands. H-bonds are formed between complementary sequences on the primers
and the target sequences.
Direction of elongation CCATAGATC (Reverse Primer)
5 GCGATGAGG 3 Direction of elongation (Forward Primer)

Teacher Tip:
Step 3: New DNA strand elongation ; Temp ~ 72 "C; Illustrate how by the 2nd round of PCR the two
The two new dsDNA strands are formed by the elongation of the generated ssDNA and the H-bonds newly synthesized DNA strands can now be used
as templates. For the given example, new strand
between the complementary sequences on these new strands and their templates. Each of the new
synthesis will again generate a 37 base pair long
dsDNA strands is made up of one old strand from the original template, and one new strand that was product. Repeated cycles of PCR will make this
generated as a reverse complement of the template. This is called semiconservative replication of the product the predominant type of double stranded
sequence. DNA in the solution.
New Strand 1:
5 A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3 (Coding strand) (old)
3 CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC-5 (Reverse Primer) (new)
New Strand 2:
5 GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG-3 (Forward Primer) (new)
3 T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5 (Non-coding strand) (old)
Step 4: Repeat step 1 to 3 for N number of cycles (N is usually 35)
PCR Results
The expected product of PCR amplification will depend on the sequences / position at which the
primer sequences bind. If the forward primer starts binding at nucleotide 3 (coming from the 5 end) of
a 43bp long gene, and the reverse primer binds at a position complementary to nucleotide 39 of the
coding strand, then a 37bp product is expected per cycle of PCR.
New Strand 1:
Nucleotide # 3 Nucleotide # 39 Note: Other types of organisms (e.g. Yeast,
Mammalian Cells, etc.) may also be transformed
37 bp product to exhibit new traits. The type of DNA constructs
used for insertion of genes into these organisms
5 A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3 (Coding strand) (old) will vary (e.g. Bacmids, Cosmids, etc.)
3- CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC 5 (Reverse Primer) (new)

42
New Strand 2:
Nucleotide # 3 Nucleotide # 39
37 bp product
5 GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG -3 (Forward Primer) (new)
3 T A C GCTACTCCTATACTGGGCTATCTATCTCCATAGATC TCTA 5 (Non-coding strand) (old)
PCR Applications Teacher Tip:

PCR may be used to detect the presence of a desired gene in an organism. Depending on the primer The multiple cloning site (MCS) may contain
sequences that may be cut by different restriction
design, the expected product may represent only a specific region of the gene or the entire gene itself. enzymes. Stress how the use of two restriction
The first case is useful for detection of the gene, or the detection of organisms with that specific gene enzymes may control the orientation of the
within a sample. The second case is useful for the amplification of the entire gene for eventual inserted gene in the plasmid.
Note: Forward and Reverse primers should not be
expression in other organisms. The direct amplification/copying of a full gene is part of the process for complementary.
cloning that gene.
2. Cloning and Expression

Some genes provide economically, and industrially important products (e.g. insulin-coding genes;
genes for collagen degradation). In some cases, scientists would want to put these genes into
organisms for the expression of their products. One example would be the insertion of an insulin-
coding gene from the human genome into bacteria. This allows the transformed bacteria to now
produce human insulin as a product.
Certain types of bacteria are capable of this process since they are able to take genes within their cell
membranes for eventual expression. The genes are normally in the form of small, circular DNA
structures called plasmids.
The genes found in the inserted plasmid DNA sequence will be expressed as proteins that provide
specific traits to the transformed bacteria. The basic components of an expression plasmid are listed in
the following table. The purpose of each of these is also provided.
COMPONENT PURPOSE
Promoter Allows the controlled expression of the desired gene in the presence
of an inducing agent (e.g. beta- galactosidase; heat treatment (~65"C)
Multiple Cloning Site DNA sequence or portion for the insertion of the desired gene. This
section may contain sequences that will be cut by specific restriction
endonucleases ( cuts within the molecule) If both the amplified gene
and the plasmid are cut with the same restriction enzyme, then
complementary sequences will be generated for each, allowing them
to bind together or anneal. The desired gene is inserted into the
multiple cloning site through this process.
Restriction enzymes cut at specific sequences.
EcoR1 Target Sequence:

5 GAATTC 3
3 CTTAAG 5
Digestion Reaction
Undigested: Digested dsDNA:

5 GAATTC 3 5 G AATTC3
3 CTTAAG 5 3 CTTAA G5
If the desired cut sites are not found in the gene that needs to be
inserted; the sequences can be added by including the target
sequences in the primers used for PCR amplification.
44
COMPONENT PURPOSE
Multiple Cloning Site PCR Primers:

5 GCGATGAGG 3 (Forward Primer)
3 CCATAGATC 5 (Reverse Primer)
Forward Primer + EcoRI target sequence:

5 GAATTCGCGATGAGG 3
Reverse Primer + EcoRI target sequence:
3 CCATAGATCCTTAAG 5
Inserted Gene Sequence Successful insertion of a gene allows the expression of its protein
product. This usually provides a specific trait to the transformed
bacteria. For example, if the gene for Green Fluorescent Protein is
placed within the expression plasmid, bacteria transformed with this
plasmid will produce protein (GFP) that will allow the bacterial cells /
colonies to glow green in the dark.
Antibiotic Resistance Provides a way to screen a population of bacteria for those that took
Gene up the plasmid. For example, if an ampicillin resistance gene is
encoded in the plasmid, then only bacteria which took up the plasmid
will be able to grow on media with ampicillin.
However, if the ampicillin resistance gene is cut and the gene is
inserted here for cloning, then the cell will no longer be resistant to
ampicillin. This is a way to select which among the colony of cells
actually contain the inserted gene sequence. Bacterial cells whose
ampicillin resistance gene have been cut will die in the presence (agar
plate) of ampicillin.
PRACTICE (5 MINS) Teacher Tip:
At this point, learners imagination could be
Steps in PCR and Gene Cloning stretched, but caution the learners that certain
1. Let learners give other hypothetically modified or genetically engineered plants and animals which ethical principles should be followed and adhered
can be used for health, industry, agriculture and for the protection of the environment. to in the production of genetically modified
organisms. Animal welfare should be taken cared
2. Ask learner to draw the parts of an expression vector. of and human cloning must never be conducted.
3. Using pieces of paper, allow the learners to illustrate the steps in restriction digestion and PCR
ENRICHMENT (5 MINS)
Uses of PCR and GMOs
1. Discuss how PCR may be used for the detection of disease causing pathogens in a population. For
example, it may be used to check if a patient has a dengue virus infection. This is done by using
primers that are specific for complementary DNA (cDNA) sequences that correspond to the
dengue viruses. If PCR amplification occurs using cDNA from a patients blood sample then the
patient likely has dengue viruses in his/her blood.
2. Discuss how the cloning and expression of certain genes allows for massive production of the
desired product. For example, the cloning and expression of insulin in bacteria allows for the mass
production of this necessary protein for use by diabetic patients. Prior to insulin production in
bacteria, insulin was harvested from other animals such as pigs.
Teacher Tip:
Try using other classic restriction enzymes:
Ex. Xho1; HindIII
46
EVALUATION (5 MINS)
Sample Exercise
1. Give learners a set of known Restriction Enzyme (RE) cut sites:
EcoRI BamH1
5 GAATTC 3 5 GGATTC 3
3 CTTAGG 5 3 CTTAGG 5
DNA Sequence (69 bp long) 28 49
5 ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATCCTATGCCCGAATGTC 3
3 TACGTACCATGCATCTCAAGGTACTTAAGCGGGGATATCCCATCGGCTCCTAGGATACGGGCTTACAG 5
Expected Fragment sizes:

With EcoR1 digestion : 28 bp, 41 bp
With BamH1 digestion : 20 bp, 49 bp
With both EcoR1 and BamH1: 20bp, 28bp, and 21 bp
3. Ask the learners to scan a double stranded DNA sequence to determine the presence of these cut sites. Allow them to provide the
fragment sizes expected for using different combinations of the RE on the given sequence. You may choose to give the sequence as linear
or circular DNA. Discuss how the fragment sizes will vary if the target sequence is in circular or linear DNA.
4. A similar exercise may be done to locate areas where primer sequences can bind. The expected fragment sizes for PCR amplification using
different primers can be tested
Example:
Forward Primer:
5 CATGGTACGTAG 3
Reverse Primer:
3 GCTCTATACGGG 5
Target Sequence:
4 Product Size: 62 - 4 = 48bp 62
5 ATGCATGGTACGTAGAGTTCCATGATAGAGCCCCTATAGGGTAGCCGAGCGAGATATGCCCGAATGTC 3 3
TACGTACCATGCATCTCAAGGTACTATCTCGGGGATATCCCATCGGCTCGCTCTATACGGGCTTACAG 5
48
Lesson 8.1: History of Life on Earth

Content Standard
The learners demonstrate understanding of the major events in the history of LESSON OUTLINE - DAY ONE
life on Earth.
The learners shall be able to Motivation Discussion: How Old is the Earth? 15
create a personal timeline and compare it with the geologic time scale Instruction Picture Timeline and Short Film 20
design a poster tracing evolutionary changes in a crop plant (e.g., rice or
Enrichment GTS Introductory Worksheet 10
corn) that occurred through domestication
Learning Competency Evaluation My Life History: A Short Narrative 10

The learners describe general features of the history of life on Earth, including
Materials
generally accepted dates and sequence of the geologic time scale and Visual aids on the geologic time scale; 20 printed pictures of events/
characteristics (STEM_BIO11/12-IIIc-g-8) structures/ organisms; computers and internet connection
Specific Learning Outcomes All Resources listed at the End of this Lesson
identify the dates and sequence of the periods in the geologic time scale;
identify the major events in each major period;
describe the characteristics of the major groups of organisms present
during a time period;
identify types of fossils; and
describe causes of mass extinctions.
INTRODUCTION (5 MINS) Introduction
When we study the Earths age, we are also
Communicate Learning Objectives studying the fossil record and ultimately, the
Introduce the following objectives by asking volunteers to read them aloud: theory of evolution. The Earth is approximately 4.6
billion years old a very big number ordinary
1. I can identify the dates and sequence of the geologic time scale
humans cant easily relate with, especially, the
2. I can describe the characteristic features of major groups of organisms in each time period. specific time frame when we appeared. Comparing
the Earths age to one calendar year, events such
as the extinction of dinosaurs and the re-discovery
of the New World by Columbus would appear
MOTIVATION (10 MINS) relatively much easier. Understanding the
geologic time scale reminds us of our time and
Discussion: How Old is the Earth? place in the universe.
1. What is the age of the Earth?
The learners may give various answers from thousands to millions of years. Some will give Big Ideas: (May be written on the board or manila
answers near to 4.6 billion years. Write all the answers on the board and let them think of what paper and posted on the board.
the age of the Earth is.) The Earth is 4.6 billion years old.
Life on Earth arose around 3.5 billion years
ago.
2. What was the Earth like million of years ago? Over Earths vast history, both gradual and
catastrophic processes have produced
Ask learners: Have you seen the movies Ice Age and The Land Before Time? How was the enormous changes.
Earth presented in movies such as these? Based from what you may have read, describe the
Earth million of years ago. The following answers may be given by learners: (1) covered with
Misconceptions:
thick blanket of ice, (2) lots of volcanoes and high mountains, (3) large organisms roamed the Humans and dinosaurs existed on the Earth at
land, (4) the atmosphere did not have high oxygen content, (4) asteroids/ meteors frequently the same time.
hit the surface, (5) the lands moved a lot or the continents were a little closer to each other, (6) Plants and animals on Earth have always
volcanic eruptions, (7) a little bit warmer, (8) plants were bigger, (9) humans were not yet existed.
The Earth is too big to change.
around. Accept all answers and ask them what are the possible conditions on the early Earth.
The teacher may show a clip from any of the movies depicting ancient earth conditions.)
Teachers must correct the misconceptions learners
have about the history of life on Earth.
3. When did man first appear on Earth?
Learners may give answers such as millions to thousands years ago. Ask learners to choose
the more probable dates and provide evidence for its accuracy. They may enumerate the
different hominid species but ask them the approximate time when our species (modern
humans) first appeared. Tell them that humans did not co-exist with dinosaurs as what movies
50
usually depict. Man could have first appeared about 100 150 thousand years ago as shown Teacher Tip:
by artefactual evidences in various sites. The human timeline is rather flexible and debatable- Its hard for learners to understand geologic events
every time we know a specific date, a new discovery is announced and everything gets re- and the time frame where each event took place. It
will be easier if everything is connected in a 1- year
dated to fit the best estimates.) time frame (calendar year). It is more relevant to
see how everything unfolds in a short time span.
However, tell them that a lot of things can happen
4. Distribute the 15 20 pictures to some volunteers. Ask each volunteer to post them along the in the span of a year.
length of the board based on what each thinks occurred first.
The teacher will print 15 - 20 events (preferably
5. Let the other learners check what have been posted. They can suggest a possible re- with pictures, if necessary) to be used for this
lesson. Refer to the Sample Events List.
arrangement of the pictures.
6. When everybody is satisfied with the lineup, tell them that they are going to watch a short The pictures should be posted on the front board
that will serve as a 1-year timeline. Tell them that
video. they will view the Earths history in this time frame.
To make it more interesting, attach the 12 months
of the year. Ask interesting questions, such
as,Who would like to have a birthday party with
INSTRUCTION (20 MINS) dinosaurs?
1. Watch a short clip Unlocking of Terms:
I. Geologic Time Scale (https://www.youtube.com/watch?v=nofyRleo3Vc ) EON- largest division of the geologic time
scale; spans hundreds to thousands of million
II. Four Ways to Understand the Earths Age. (https://www.youtube.com/watch?v=tkxWmh- of years ago (mya)
ERA- division in an Era that span time periods
tFGs&spfreload=10
of tens to hundreds of millions of years
2. Tell everyone to listen and watch attentively. PERIOD- a division of geologic history that
spans no more than one hundred million years
3. Use the following questions to guide the learners as they watch the video. EPOCH- the smallest division of the geologic
time scale characterized by distinctive
I. What are the four ways mentioned in the film?
organisms
II. Why is it hard to create a timeline of events chronicling Earths history?
Tip:
III. What are the divisions of the geologic time scale? The teacher may also ask the learners to plot their
birthdates side-by-side with the geologic events.
4. Share in class what you have learned from the video.
5. Ask the learners to take a closer look at the timeline constructed on the board. Ask:
In which timeframe were you born? What specific
6. Let them re-arrange (if necessary) based on what they learned from the video. events happened the day you were born, using the
geologic time scale.
Alternate Video:
Geologic Time Scale: Major Eons, Eras, Periods
and Epochs- https://www.youtube.com/watch?
v=nofyRleo3Vc
ENRICHMENT (10 MINS) Teacher Tip:
1. Answer the following in your journal. Journaling is a good technique to help some
passive learners to jot down their thoughts first
I. The Earth has an incredibly long history. How does understanding of geologic time and then share whatever they have written with a
the significant geologic events of the past impact your understanding of humans unique partner.
responsibility and place on earth? Volunteers may be tapped in advance.
II. How does understanding the past help us understand the present? The best output will be posted in the room.
III. Calculate how many generations of humans it would take for us to exist now (assume an
average life span of 80 years) (What must we humans do to ensure we are able to exist this
long for many generations?
2. Form a dyad and discuss your answers.
Alternate Activity:
EVALUATION (5 MINS) Time Machine:
1. Answer the Worksheet on Geologic Time Scale. Submit next meeting. 1. Look around your community. Make a narrative
2. My Life History: Create a timeline of events that happened to you since you were born up to on how the place looked like several years ago
and how it will be several years (maybe after 50
the present time. Choose only 20 events that you think are the most important. Be ready to years) from now.
present your timeline next meeting.
ASSIGNMENT: (5 MINS) Going Further:

If time and space permits, the following activity
1. Make a table in your notebook of the geologic time scale (GTS) and include the following
can be done.
details; Understanding Geologic Time
I. Major divisions of the GTS (From: http://www.jsg.utexas.edu/glow/files/
II. Major events and characteristic organisms Understanding-Geologic-Time-6-8.pdf)
52

Content Standard
The learners demonstrate understanding of the major events in the history of LESSON OUTLINE - DAY TWO
life on Earth.
Motivation Discussion: How Old is the Earth? 5
create a personal timeline and compare it with the geologic time scale Instruction Lecture of the Geologic Time Scale 20
design a poster tracing evolutionary changes in a crop plant (e.g., rice or Enrichment The Anthropocene 20
Evaluation Quiz 10
Learning Competency
The learners describe general features of the history of life on Earth, including Materials
generally accepted dates and sequence of the geologic time scale and Visual aids on the geologic time scale; 20 printed pictures of events/
characteristics (STEM_BIO11/12-IIIc-g-8) structures/ organisms; computers and internet connection
Specific Learning Outcomes All Resources listed at the End of this Lesson
identify the dates and sequence of the periods in the geologic time scale;
describe causes of mass extinctions
This lesson will present formally the lesson on GTS.
Communicating Learning Objectives The learners will understand better the highlights
The lesson for today will cover the following topics: of each time frame in the GTS.
1. Major events in the Geologic Time Scale (GTS)
2. Cambrian Explosion
MOTIVATION (5 MINS)
Discussion: How Old is the Earth?
Discussion: How Old is the Earth?
Ask the following questions:
1. How old is the Earth?
2. What is the biggest time frame in the GTS?
3. What is the smallest time frame in the GTS?

Teacher Tip:
Lecture of the Geologic Time Scale The Geologic Time Record is a tabular
1. Present a lecture discussion on the Geologic Time Scale representation of the major divisions of the Earths
2. The following outline can guide the teacher in the discussion: history. The time intervals are divided and
described from the longest to the shortest as
I. The Geological Time Scale (GTS) EONS, ERAS, PERIODS and EPOCHS.
A. Four eras - Precambrian; Paleozoic; Mesozoic; Cenozoic
Each period has an approximated time frame and
B. Periods under the Paleozoic era - Cambrian, Ordovician, Silurian, Devonian, characterized by distinctive features (events and
Carboniferous, Permian organisms).
C. Periods under the Mesozoic era - Triassic, Jurassic, Cretaceous

D. Periods under the Cenozoic era - Tertiary and Quaternary
II. Age in millions of years of each time period
III. Major events in the history of life
54
The Geologic time is divided into four large segments called Eons:
Hadean, Archean, Proterozoic and Phanerozoic. The Phanerozoic is
divided into Eras: Paleozoic, Mesozoic, and Cenozoic. Extinction
events and appearance of new life forms characterized the
divisions among Eras. Smaller divisions, called Periods,
characterized by a single type of rock system, make up each Era.
Some Periods are further divided into smaller time frame called
Epochs. (From: http://goo.gl/ITmoty)
There is a mnemonics (memory device) to remember the Periods in

exact order (from the earliest to the recent); jumps between periods
and epochs.
Pregnant Plentiful
Camels Early
Often Oiling
Sit Might
Down Prevent
Carefully. Partial
Perhaps Rheumatism!
Their
Joints
Creak?
The teacher can also discuss CAMBRIAN EXPLOSION.

CAMBRIAN EXPLOSION is the belief that there was a sudden,
apparent explosion of diversity in life forms about 545 million years
ago. The explosion created the complexity of multi-celled organisms
in a relatively short time frame of 5 to 10 million years. This explosion
also created most of the major extant animal groups today.
SOURCE: http://d32ogoqmya1dw8.cloudfront.net/images/NAGTWorkshops/time/
visualizations_teachtips/variable_time_geologic_time.jpg
The start of the Cambrian was characterized by the breaking up of ** The following PowerPoint presentations might help in organizing your
supercontinent Gondwana into smaller land masses opening up new discussion on this lesson.
http://goo.gl/Xfu2dz
environmental niches where organisms can colonize and specialize. http://goo.gl/YMUvFL
http://goo.gl/yRa5c7
http://goo.gl/45c27A
http://goo.gl/CoumSB
Teacher Tip:
ENRICHMENT (20 MINS) Ask the learners to research if there are evidences to support that the explosion
is as sudden and spontaneous as it is used to describe the fossil record.
The Anthropocene
1. Present to the learners a new proposed Epoch, the Anthropocene. This is also a good time to discuss how new findings can affect an existing body of
I. What are the evidences that suggest that we are entering/ have knowledge.
entered a new epoch?
Let the learners read the following articles about a proposed new epoch, the
II. How do scientists decide if a new finding should be validated? Anthropocene.
Human impact has pushed Earth into the Anthropocene - http://goo.gl/
2. This can be discussed in a small group of 5 learners.
fxggQf (04/13/16)
What Is Anthropocene and Are We in It? - http://goo.gl/mq7I9V (04/13/16)
Welcome to the Anthropocene - http://www.anthropocene.info (04/13/16)
EVALUATION (10 MINS)

1. Geologically speaking with reference to the entire history of the 3. The Earth is ________ years old.
earth, the dinosaurs went extinct A. 6,000
A. Shortly after the formation of Earth B. 46,000,000
B. In the first billion years of Earths history C. 4,600,000,000
C. In the most recent 2% of the history of Earth D. There is no way to know
D. Before the first fish formed
2. Relative to the percent of time dominating the surface of Earth 4. 100,000 years in the geologic history of Earth would be
which organisms have the longest reign? considered
A. Dinosaurs A. Immensely long
B. Plants B. A drop in the bucket
C. Prokaryotes C. Half of Earth's history
D. Eukaryotes D. An extremely significant amount of time
E. Humans
56
5. Understanding geologic time is significant because it helps us 6. Which organism first dominated Earth?
A. Understand humans impact on our environment A. Dinosaurs
B. Understand the evolution of organisms over time B. Insects
C. Understand the possibility for life on other planets C. Plants
D. Understand the process of evolution D. Fish
E. All of the above E. Bacteria
ASSIGNMENT Answer Key:

Answer with discussion must be given by the teacher.
1. What are fossils? How are they formed?
1. C
2. List down the types of fossils and given examples. 2. C
3. C
3. How do we measure the age of fossils?
4. B
4. What are mass extinctions? How many mass extinctions events 5. B
happened in the GTS? 6. E
Teacher Tip:
See to it that everyone has a clear understanding of the geologic time scale.
There is no need to remember all the events in each period.

Content Standard
The learners demonstrate understanding of the major events in the history of LESSON OUTLINE - DAY THREE
life on Earth.
The learners shall be able to Motivation Questions on Dinosaurs 5
create a personal timeline and compare it with the geologic time scale; and
Instruction Types of Fossils 50
corn) that occurred through domestication Materials
Visual aids on the geologic time scale; 20 printed pictures of events/
Learning Competency structures/ organisms; computers and internet connection
The learners describe general features of the history of life on Earth, including Resources
generally accepted dates and sequence of the geologic time scale and (1) Freeman, S. Biological Science. 3rd ed. 2008. California: Pearson
characteristics (STEM_BIO11/12-IIIc-g-8) Benjamin Cummings. pp. 503-525.
(2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB Jackson.
Specific Learning Outcomes Campbell Biology. 9th ed. 2014. Illinois: Pearson Education Inc. pp.
At the end of the lesson, the learners will be able to: 480-499.
identify the dates and sequence of the periods in the geologic time scale; (3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology: the
Dynamic Science. 2008. California: Brooks/Cole CENGAGE Learning. pp.
identify the major events in each major period; 419-439.
Additional Resources listed at the End of this Lesson
58
The lesson for today will cover the following topic: An alternative could be to show a clip from the
movie Jurassic Park or Jurassic World.
1. The types of fossils
2. Ways fossils are formed and how fossils ages are determined
The following sites provide information about
3. Mass extinctions- causes and frequency in the GTS Fossils:
http://teacher.scholastic.com/scholasticnews/
magazines/scienceworld/assets/SW-
MOTIVATION (5 MINS) POWERPOINT-FOSSILS.ppt - (Downloaded
1. Where did scientists discover the first dinosaurs? 04/15/16)
2. Who coined the term dinosaurs? http://www.enchantedlearning.com/subjects/
dinosaurs/dinofossils/Fossiltypes.html -
3. How did the discovery of dinosaurs make scientists become more interested in the geologic (Downloaded 04/15/16)
record? http://www.livescience.com/37781-how-do-
4. How can fossils be used as evidence for the evolution of living forms? fossils-form-rocks.html - (Downloaded
04/15/16)
http://www.bbc.co.uk/nature/fossils -
INSTRUCTION (50 MINS) (Downloaded 04/15/16)
1. The teacher will post on the board examples of fossils and let the learners identify the type. http://www.whatisafossil.net - (Downloaded
04/15/16)
FOSSILS are evidences of organisms that lived in the past. They can be actual remains like
bones, teeth, shells, leaves, seeds, spores or traces of past activities such as animal
burrows, nests and dinosaur footprints or even the ripples created on a prehistoric shore.
In exceptional preservation, fine details such as original color and individual muscle fibers
are retained, features often visible in electron microscopes. This is referred to as the
Medusa effect. (From: http://www.bbc.co.uk/nature/fossils/Lagersttte)
TYPES OF FOSSILS DESCRIPTION EXAMPLES
Molds Impression made in a substrate = negative image of an Shells

organism
Casts When a mold is filled in Bones and teeth
Petrified Organic material is converted into stone Petrified trees;

Coal balls (fossilized plants and their tissues, in round
ball shape)
Original Remains Preserved wholly (frozen in ice, trapped in tar pits, dried/ Woolly mammoth;
dessicated inside caves in arid regions or encased in amber/ Amber from the Baltic Sea region
fossilized resin)
Carbon Film Carbon impression in sedimentary rocks Leaf impression on the rock
Trace / Ichnofossils Record the movements and behaviors of the organism Trackways, toothmarks, gizzard rocks, coprolites
(fossilized dungs), burrows and nests
THE SIX WAYS OF FOSSILIZATION Teacher Tips:

1. Unaltered preservation - Small organism or part trapped in amber, hardened plant sap The teacher may also mention that more than 90
percent of all organisms that have ever lived on
2. Permineralization/ Petrification - The organic contents of bone and wood are replaced with Earth are extinct (http://goo.gl/K83SA). This is due
silica, calcite or pyrite, forming a rock-like fossil to mass extinctions events that wiped out
organisms in the past. The following sites offer
3. Replacement - hard parts are dissolved and replaced by other minerals, like calcite, silica, explanations on these mass extinction events.
pyrite, or iron
4. Carbonization or Coalification - The other elements are removed and only the carbon Big 5 Mass Extinction Events - http://
www.bbc.co.uk/nature/extinction_events -
remained (Downloaded 04/16/16)
5. Recrystalization - Hard parts are converted to more stable minerals or small crystals turn into The Great Dying - http://science.nasa.gov/
larger crystals science-news/science-at-nasa/
2002/28jan_extinction/ - (Downloaded
6. Authigenic preservation - Molds and casts are formed after most of the organism have been 04/16/16)
destroyed or dissolved Mass Extinctions - http://
science.nationalgeographic.com/science/
prehistoric-world/mass-extinction -
(Downloaded 04/16/16)
60
DATING FOSSILS
Knowing the age of a fossil can help a scientist establish its position in the geologic time scale
and find its relationship with the other fossils. There are two ways to measure the age of a fossil:
relative dating and absolute dating.
1. RELATIVE DATING
I. Based upon the study of layer of rocks
II. Does not tell the exact age: only compare fossils as older or younger, depends on their
position in rock layer
III. Fossils in the uppermost rock layer/ strata are younger while those in the lowermost
deposition are oldest
How Relative Age is Determined

I. Law of Superposition: if a layer of rock is undisturbed, the fossils found on upper layers are
younger than those found in lower layers of rocks
II. However, because the Earth is active, rocks move and may disturb the layer making this
process not highly accurate
Rules of Relative Dating

(From: http://staff.harrisonburg.k12.va.us/~esutliff/forms/Relative_Dating_1334236393.ppt)
A. LAW OF SUPERPOSITION: Sedimentary layers are deposited in a specific time- youngest

rocks on top, oldest rocks at the bottom
B. LAW OF ORIGINAL HORIZONTALITY: Deposition of rocks happen horizontally- tilting,

folding or breaking happened recently
C. LAW OF CROSS-CUTTING RELATIONSHIPS: If an igneous intrusion or a fault cuts
through existing rocks, the intrusion/fault is YOUNGER than the rock it cuts through
Try this exercise on radioactive dating:

Carbon-14 Dating: http://www.starhop.com/library/pdf/studyguide/high/
brsp-15carbondating.pdf
INDEX FOSSILS (guide fossils/ indicator fossils/ zone fossils): fossils from short-lived
organisms that lived in many places; used to define and identify geologic periods
2. ABSOLUTE DATING
Determines the actual age of the fossil
Through radiometric dating, using radioactive isotopes carbon-14 and potassium-40
Considers the half-life or the time it takes for half of the atoms of the radioactive element
to decay
The decay products of radioactive isotopes are stable atoms.
Take a look at the table below. A living organism has carbon-14. For the amount of Carbon in the
organisms body to become half, it will take about 5,700 years; which is the half-life of carbon-14.
Fill up the remaining data in the table. What is the limit in using carbon-14 as a measure to
determine a fossils age?
62

Content Standard
The learners demonstrate understanding of the major events in the history of LESSON OUTLINE - DAY FOUR
life on Earth.
Practice Creation of Fossils 50
Wrap Up Clean Up 10
create a personal timeline and compare it with the geologic time scale Materials
Visual aids on the geologic time scale; 20 printed pictures of events/
design a poster tracing evolutionary changes in a crop plant (e.g., rice or structures/ organisms; computers and internet connection
Resources
Learning Competency (1) Freeman, S. Biological Science. 3rd ed. 2008. California: Pearson
The learners describe general features of the history of life on Earth, including Benjamin Cummings. pp. 503-525.
generally accepted dates and sequence of the geologic time scale and (2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB Jackson.
Campbell Biology. 9th ed. 2014. Illinois: Pearson Education Inc. pp.
characteristics (STEM_BIO11/12-IIIc-g-8) 480-499.
Specific Learning Outcomes (3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology: the
At the end of the lesson, the learners will be able to: Dynamic Science. 2008. California: Brooks/Cole CENGAGE Learning. pp.
419-439.
identify the dates and sequence of the periods in the geologic time scale
Additional Resources listed at the End of this Lesson
identify the major events in each major period
during a time period
identify types of fossils and
describe causes of mass extinctions
1. The learners are going to make fossils from a natural and man-made object. Making fossil is a fun way to get involved in
science. There are a lot of online sites to guide you
2. There are two methods used to create fossils. on how to create cheap replicas of fossils.
A. Imprint
The activity can be a little messy, so instruct the
I. Choose the object you want to make a fossil of. Any natural object (shells, leaves, learners to use newspapers or this can be done in
animal bone) will do as long as it fits in the container. If you choose leaves, be sure it is an open area.
not dry.
The following materials are needed for this activity.
II. Coat the object with petroleum jelly. This will keep the object from sticking to the 1. A small natural object (shell, bone, leaf)
plaster when you try to remove it. Coat it thoroughly. 2. Any small toy
3. Clay
III. Mix plaster and water in a bowl. Follow the directions on the plaster of Paris
4. Petroleum jelly
packaging. Mix them together thoroughly and let the concoction sit for a few minutes 5. Plaster of Paris
without stirring. You should need about 2x more water than plaster, but you can adjust 6. Disposable dish
the ratio as you see fit.
IV. Press the object into the plaster of Paris. Be careful not to push too hard! Now your Teacher Tip:
part is done; all it has to do is dry. Set it aside and check it the next day; drying will Given that this can be messy, tell learners to work
take at least one day. on top of old newspapers. Tell them not to throw
plastic of Paris in the sink or drainage in order for
V. Remove the object. After you've waited 24 hours, pop your natural item out of the them not to get clogged with the dried up
plaster of Paris. It's just like a shell that was enveloped in soil for thousands of years. It materials. Provide a container for them to put all
was disintegrated and this image was left behind. waste materials.
B. 3-D Object (Cast) It will take 1 - 2 days to completely dry and harden
I. Choose the object you want to make a fossil of. Any natural object (shells, leaves, the fossil model.
animal bone) will do as long as it fits in the container. If you choose leaves, be sure it is
Give incentives/ small tokens to those who made
not dry. the best fossils.
II. Combine the plaster of Paris with water. Use 1 part plaster of Paris to 2 parts water and
mix well in a paper cup with a plastic spoon. Let it sit while you work with the clay.
III. Choose an object as the template of your fossil. Generally, leaves, shells, branches, or
bones work best. Just make sure you have enough clay and plaster to cover it.
IV. Knead the modeling clay until it is soft and pliable. This will be what your object rests
and forms an impression in. It needs to be kneaded until it can cover the area of your
object.
V. Coat the object with petroleum jelly. Firmly yet slowly press it into the modeling clay to
64
make an impression. The petroleum jelly prevents it from sticking to the clay, so be
generous. Remove the object carefully to create a mold in the shape of the item you
used.
VI. Fill the impression left by your object with plaster of Paris. Smooth the plaster to the
level of the clay to form a flat surface. Place your clay and plaster mold on a
newspaper, paper towel, or other disposable surface and allow it to harden. You'll
need to wait at least overnight, but 2 or 3 days is preferable and safer.
VII. Peel the clay off the hardened plaster to free the fossil. The shape of your object
should be recreated in the plaster, details intact.
WRAP UP (10 MINS)

1. Tell the learners to clean up and put all the output in one corner of the room for them to dry
up.
2. Tell them to label their works with masking tape.

Content Standard
The learners demonstrate understanding of the major events in the history of
LESSON OUTLINE - DAY FIVE
life on Earth.
Performance Standards Evaluation Summative Assessment 60

The learners shall be able to Materials
create a personal timeline and compare it with the geologic time scale; and Visual aids on the geologic time scale; 20 printed pictures of events/
structures/ organisms; computers and internet connection
corn) that occurred through domestication Resources
(1) Freeman, S. Biological Science. 3rd ed. 2008. California: Pearson
Learning Competency Benjamin Cummings. pp. 503-525.
The learners describe general features of the history of life on Earth, including (2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB Jackson.
generally accepted dates and sequence of the geologic time scale and Campbell Biology. 9th ed. 2014. Illinois: Pearson Education Inc. pp.
480-499.
characteristics (STEM_BIO11/12-IIIc-g-8)
(3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology: the
Specific Learning Outcomes Dynamic Science. 2008. California: Brooks/Cole CENGAGE Learning. pp.
At the end of the lesson, the learners will be able to: 419-439.
identify the dates and sequence of the periods in the geologic time scale; Additional Resources listed at the End of this Lesson
describe the characteristics of the major groups of organisms
present during a time period;
66
SUMMATIVE ASSESSMENT 3. The layers in sedimentary rocks are also called
1. Geologic Time Scale Practice A. eras
Go to this site and try the quiz. (There is no need to memorize B. epochs
the smaller divisions of the geologic time scale.) http:// C. strata
www.geosci.ipfw.edu/gildner/TimeScalePractice.html D. gaps
(Downloaded 04/16/16)
4. The movie Jurassic Park got its title from which era?
2. Geologic Time Scale Events A. Paleozoic
B. Mesozoic
Go to this site and try the quiz. http://www.glencoe.com/qe/
scienceOLC.php?qi=6024 (Downloaded 04/16/16) C. Cenozoic
D. Holozoic
3. Practice Quiz for the Nature of Fossils 5. During which era were the first land plants formed?
Go to this site and try the quiz. http://anthro.palomar.edu/time/ A. Cambrian
quizzes/timquiz1.htm (Downloaded 04/16/16)
B. Pre-Cambrian
C. Paleozoic
MULTIPLE CHOICE. Choose the letter of the correct answer. D. Mesozoic
1. The largest division of the geologic time scale is the
6. The era of middle life, a time of many changes on Earth
A. Eon
A. Paleozoic
B. Era
B. Mesozoic
C. Period
C. Cenozoic
D. Epoch
D. Holozoic
2. The Mesozoic Era was the Age of Reptiles while the current 7. What is the longest part of Earths history where trace fossils
Cenozoic Era is the Age of appeared.
A. Mammals A. Pre-Cambrian
B. Birds B. Paloezoic
C. Humans C. Mesozoic
D. Technology D. Cenozoic
8. The geologic time scale is subdivided into 4 groups. List them TRUE OR FALSE. Write True if the statement is correct and False if
from the largest to the smallest. it is not.
A. Eons, periods, epochs, eras 1. Fossils give clues about the past.
B. Eras, eons, periods, epochs 2. Animals that are extinct are still alive today.
C. Epochs, periods, eras, eons 3. Scientists do not know for sure what happened to the dinosaurs.
D. Eons, eras, periods, epochs 4. A mold is a cast filled in with sediments.
5. Soft body parts cannot be fossilized.
9. The end of this era was believed to be caused by a comet or 6. Paleontology is the study of fossils.
asteroid colliding with Earth, causing a huge cloud of dust and 7. A wooly mammoths footprint is a trace fossil.
smoke to rise into the atmosphere, blocking out the sun.
8. Distinctive fossils used to determine the ages of rocks are called
A. Paleozoic scale fossils.
B. Holozoic 9. Saber - toothed tiger is more likely preserved in amber.
C. Mesozoic 10. Fossils are most likely found in sedimentary rocks.
D. Cenozoic
10. Which geologic event occurred during the Mesozoic era?

A. Pangaea formed
B. Asteroids killed the dinosaurs
C. The Rocky Mountains formed
D. The Pleistocene Ice Age began
68
RESOURCES:
NOTES:
1. The Geologic Time Scale: http://www.uky.edu/KGS/education/geologictimescale.pdf (Retrieved 07/08/15)
2. What Is a Fossil: http://www.discoveringfossils.co.uk/whatisafossil.htm (Retrieved 04/16/16)
3. BBC- Fossils: http://www.bbc.co.uk/nature/fossils (Retrieved 04/16/16)
4. How Fossils Form: http://www.enchantedlearning.com/subjects/dinosaurs/dinofossils/Fossilhow.html
(Retrieved 04/16/16)
VIDEOS:
1. Evolution (1971 animation)- https://www.youtube.com/watch?v=T1_vnsdgxII (viewed 07/08/15)
2. Geologic Time Scale
3. The Geologic Time Scale: https://www.youtube.com/watch?v=r10oh1NHKv4&spfreload=10 (viewed 07/08/15)
4. The Geologic Time Scale: https://www.youtube.com/watch?v=nofyRleo3Vc (viewed 07/24/15)
5. Four Ways to Understand the Earths Age: https://www.youtube.com/watch?v=tkxWmh-tFGs&spfreload=10 (viewed 07/08/15)
6. The History of Earth: https://www.youtube.com/watch?v=RQm6N60bneo (viewed 07/08/15)
FURTHER: Advance learners can explore these sites beyond class.

1. Deep Time: A History of the Earth Interactive Infographic: http://deeptime.info (viewed 07/09/15)
2. National Museum of Natural History Geologic Time: http://www.nmnh.si.edu/paleo/geotime/index.htm (viewed 07/09/15)
3. Abiogenesis: https://www.youtube.com/watch?v=W3ceg--uQKM (viewed 07/08/15)
4. http://mitep.mtu.edu/include/documents/2013/presentations/What_is_the_Geologic_Time_Scale_DWagner.pdf
5. http://ed.ted.com/lessons/the-earth-s-age-in-measurements-you-can-understand-joshua-m-sneideman#review
6. http://www.stratigraphy.org/index.php/ics-chart-timescale
7. http://deeptime.info
8. http://www.nmnh.si.edu/paleo/geotime/index.htm
9. http://www.enchantedlearning.com/subjects/dinosaurs/dinofossils/Fossiltypes.html
Other possible sources of quiz items on fossils: (Downloaded 04/16/16)

1. https://mrssmiths4thportfolio.wikispaces.com/file/view/fossil+quiz.pdf
2. http://www.marcom.com.au/SGuides/ZZVECS/6VCSQS06.pdf
3. https://www.nps.gov/blca/learn/education/upload/fossils-2.pdf
4. http://www.biorules.org/Biology/articles/hist_life/Chap12PracTest.pdf
5. http://scioly.org/wiki/images/4/44/2015CT_FOSS1_TESTKEY.pdf
Lesson 9.1: Mechanisms that Produce

Change in Populations (1 of 2)
LESSON OUTLINE
Content Standard
The learner will be able to understand the Hardy- Weinberg Principle and use Introduction Definition of Terms 10
its equation to test whether a gene (or a population in a larger scale) is in
equilibrium or it is changing. Motivation Observation 5
Learning Competency Instruction Lecture on Hardy-Weinberg Principle 60

The learners shall be able to explain the mechanisms that produce change in
Practice Word Problem 10
populations from generation to generation (STEM_BIO11/12-IIIc-g-9)
Specific Learning Outcomes Enrichment Group Work 15

Evaluation Assignment 20
explain that genetic variation is the prerequisite and should therefore be
present for any genetic process to cause change in populations from Attachment Teaching Hardy-Weinberg in the
generation to generation; Classroom
state the Hardy-Weinberg Principle;
Materials
enumerate the conditions that should be present for a gene or in a larger Pictures; chocolate and milk coated fish-shaped pretzels available in most
scale, a population, to attain Hardy-Weinberg equilibrium; and supermarkets; paper, pen, and calculator
calculate gene and genotype frequencies and derive the Hardy-Weinberg Resources
equation (1) Freeman, S. Biological Science. 3rd ed. 2008. California: Pearson
Benjamin Cummings. pp. 503-525.
480-499.
419-439.
Additional Resources at the End of this Lesson

70
Remind your learners about the process of meiosis
Definition of Terms discussed in the previous semester. Let them recall
1. Describe examples of genetic variation observed in a population. how genetic variation is generated through
meiosis.
2. Discuss the sources of variation.
independent assortment mixes paternal and
3. Define the following terms: gene pool, gene or allele frequency, and genotype frequency. maternal chromosomes in the gametes
crossing over leads to new combination of
alleles
You may also mention that fertilization mixes

alleles from two parents.
Discuss mutation as the ultimate source of

variation since it is the only genetic process that
can create new alleles.
MOTIVATION (5 MINS)
Teacher Tip:
Observation From the pictures, let the learners recognize the
1. Show your learners different photographs showing variation or differences among individuals. similarities and more importantly the differences
Examples: family picture showing differences in appearance of parents and siblings; group between individuals belonging to the same
species.
pictures of friends or colleagues or even a class picture; picture of different dog breeds;
picture of different varieties of pepper or any fruit or vegetable; etc.
2. You may also ask them to look at each other and tell them that all of us belong to the same
species yet we look differently.

Lecture on Hardy-Weinberg Principle You have to emphasize to the class that when gene
frequencies remain constant from generation to
1. Give a lecture on the following:
generation, the population exhibits Hardy-
I. Statement of the Hardy-Weinberg Principle Weinberg equilibrium and is therefore a non-
evolving population. When any of the conditions is
II. Conditions that should be satisfied for a gene in a population to be in Hardy-Weinberg
not fulfilled, there would be changes in gene
equilibrium frequencies and the population is said to be
III. Mathematical equation of the Hardy-Weinberg Principle evolving.
2. Demonstrate to the class the Hardy-Weinberg Principle. The demonstration can be adapted Teacher Tip:
from: Berkeley, C. Teaching Hardy-Weinberg in the classroom (http://www.carolina.com/ For the class demonstration, instead of the given
American brand of crackers, use locally available
teacher-resources/Interactive/teaching-hardy-weinberg-in-the-classroom/tr10630.tr). brands like the chocolate and milk coated fish-
Demonstrate only the given Activity 1 (Hardy Weinberg Equilibrium). The other activity will be shaped biscuits available in most supermarkets
done in the second part of the lesson. (e.g. Knick Knacks). Alternatively, this can be done
as a group activity especially if you have the right
amount of resources.
3. Show how to calculate the gene and genotype frequencies and how the Hardy-Weinberg
mathematical equation is derived. It is much easier to teach the Hardy-Weinberg
equation if the learners calculate gene and
genotype frequencies with you. Therefore, you
Consider flower color in a hypothetical population of 1000 plants with two alleles, R1 and R2. should pause frequently to give the learners
enough time to actively process the information
These alleles show incomplete dominance, thus plants homozygous for allele R1 will have red and practice the calculations.
flowers (R1R1), plants homozygous for allele R2 will have white flowers (R2R2) and heterozygote
plants (R1R2) will have pink flowers. Supposed this population include 490 plants with red
flowers, 420 with pink flowers and 90 with white flowers. Calculate the gene and genotype
frequencies in the given generation and in the next generation. Here is the solution to this
given problem.
Since the plants are diploid, there will be a total of 2,000 copies of the alleles for the locus
(1,000 x 2 = 2,000). R1 accounts for 980 of these copies (490 x 2 = 980) for R1R1 plants plus
420 x 1 = 420 for R1R2 plants. Thus, the frequency of the R1 allele is 1,400/2,000 = 0.7 (70%).
Let us use p to designate the frequency of this allele (R1) and q for the frequency of the other
allele (R2). Therefore, the frequency of R1 in the gene pool of this population is p = 0.8 and
since there are only two alleles for this gene, the frequency of R2, represented by q is q = 1-p
= 0.3 (30%). The sum of allele frequencies must always be equal to 1.
Let us now see how we can use the gene and genotype frequencies to illustrate a population
in Hardy-Weinberg equilibrium for this given locus. Let us assume that the members of the
population have equal chances of mating with each other meaning there is random union of
sperms and eggs. Using a diagram similar to a Punnett square and using the rule of
multiplication, the genotypes of the progenies of the next generation can be obtained.
72
The probability that two R1 alleles will come together is p x p = p2 = 0.7 x 0.7 = 0.49;
therefore the frequency of R1R1 individuals in the next generation is 49%. The frequency of
R1R2 plants is expected to be q x q = q2 = 0.3 x 0.3 = 0.09, or 9%. The heterozygotes (R1R2)
can arise in two different ways: 1) the egg provides the R1 allele and the sperm provides the R2
allele, thus the resulting heterozygote will be p x q = 0.7 x 0.3 = 0.21; 2) the egg provides the
R2 allele and the sperm provides the R1 allele, thus the resulting heterozygote will be q x p =
0.3 x 0.7 = 0.21. The frequency of the heterozygote is the sum of these two possibilities: pq +
qp = 2pq = 0.21 + 0.21 = 0.42, or 42%. The genotype frequencies must add up to 1 (100%).
The equation for Hardy-Weinberg equilibrium for a locus with two alleles can be stated as:
If you compute for the gene frequencies in the next generation: p (frequency of R1) is the
square root of p2, that is the square root of 0.49 = 0.7; and the frequency of R2 is q = 1- p, that
is 1- 0.7 = 0.3.
Take note that the gene and genotype frequencies of the original population and the next
generation are the same or are constant, implying that the population with regards to flower
color is in Hardy-Weinberg equilibrium.
Problems/questions can be obtained from the
Word Problem listed references. If you do not have copies of the
1. Aside from the example you used, give another problem for the learners to work on. books in the list, you may refer to any General
Biology books or Genetics books.
ENRICHMENT (15 MINS)

Group Work
2. Divide your learners into groups, with each group having five to six members. Let the learners Teacher Tip:
You have to go around the groups to check if they
in each group discuss among themselves how they answered the given problems. After ten
are doing things correctly.
minutes of group discussion, explain to the class the correct answers.

Assignment
1. Give two questions/problems (one on dominant trait and another on co-dominant trait) as
assignment to be submitted the next meeting. Instruct your learners to show the solution to
the problems.
2. The assignment will be given 10 points for perfect score. The solution will be 70% of the score
and the final answer is 30%.
Resources
PAPERS ONLINE:
(1) Brewer, MS and E Grant. Teaching evolution
through the Hardy-Weinberg Principle: A real-
TEACHING HARDY-WEINBERG IN THE CLASSROOM time, active-learning exercise using classroom
Adapted from: response devices. 2013. The American
Candace Berkeley, http://www.carolina.com/teacher-resources/Interactive/teaching-hardy- Biology Teacher, 75(7):476-479; DOI:
10.1525/abt.2013.75.7.6.
weinberg-in-the-classroom/tr10630.tr
(2) Berkeley, C. Teaching Hardy-Weinberg in the
classroom. http://www.carolina.com/teacher-
Materials resources/Interactive/teaching-hardy-
2 Large Bags of Milk-coated Fish-shaped Biscuits (e.g. Knick Knacks) (3) The teacher friendly guide to evolution:
2 Large Bags of Chocolate-coated Fish-shaped Biscuits (e.g. Knick Knacks) Hardy-Weinberg Equilibrium. http://
bivalves.teacherfriendlyguide.org/index.php?
Plates or Napkins option=com_content&view=article&id=30:har
Learner Data Sheet (optional) dy-weinberg-
equilibrium&catid=27&Itemid=126
74
Preparation and Procedure
1. Pour the contents of all 4 bags of Fish-shaped Biscuits into a large bowl which will represent
the lake.
2. Depending on class size and your resources, you may wish to divide your class into pairs or
groups.
3. Give each pair or group a copy of the Learner Data Sheet, if desired, and a plate or napkin;
have them wash their hands before beginning.
4. Explain that dark brown (chocolate-coated) biscuits are homozygous recessive individuals (gg)
and that white (milk-coated) biscuits display the dominant phenotype and therefore may be
either homozygous dominant (GG) or heterozygous (Gg).
Activity 1: Hardy-Weinberg Equilibrium

1. Have each learner pair or group remove 10 fish-shaped biscuits from the lake and place them
on the plate or napkin. In order to ensure random choice, have learners close their eyes.
2. Learners record the number of white and brown biscuits in Table 1 as Generation 1.
3. Instruct learners to close their eyes and to select and eat 3 of their 10 biscuits at random. (It is
important that this step be random; learners must not introduce bias.)
4. Have learners return to the lake, close their eyes, and randomly select 3 new biscuits to
replace those that were eaten.
5. Learners then record their new count of white and brown biscuits in Table 1 as Generation 2.
6. Have learners repeat steps 35 until they have data for 5 generations.
7. After data have been collected, have learners use the Hardy-Weinberg equation to
calculatep,q,p2,q2, and 2pqfor each generation.
8. Collect class data.
Activity 2: Hardy Weinberg and Natural Selection

1. Have each learner pair or group remove 10 fish-shaped biscuits from the lake and place them
on the plate or napkin. In order to ensure random choice, have learners close their eyes.
2. Learners record the number of white and brown biscuits in Table 2 as Generation 1.
3. Instruct learners to select and eat 3 of their brown biscuits. (If they do not have 3 brown ones
on their plate, have them substitute a white one. The point, though, is to select against the
brown phenotype over a few generations.)
4. Have learners return to the lake, close their eyes, and randomly select 3 new biscuits to
replace those that were eaten. It is important that this step be random; learners must not
introduce bias.
5. Learners then record their new count of white and brown biscuits in Table 2 as Generation 2,
and then, as before, select 3 brown ones to eat.
6. Have learners repeat steps 35 until they have data for 5 generations.
7. After data have been collected, have learners use the Hardy-Weinberg equation to
calculatep,q,p2,q2, and 2pq.
8. Collect class data.
After the Performance of Activities 1 and 2

Once class data are collected, have learners compare the genotype frequencies in both
simulations. The class data from the first activity should result in fairly constant frequencies over
the 5 generations. When selection is introduced in the second activity, the genotype frequencies
should vary over the 5 generations. Discuss what conditions must exist for frequencies to remain
stable over multiple generations. What do changing frequencies indicate in a population?
76
Lesson 9.2: Mechanisms that Produce

Change in Populations (2 of 2)
Content Standard
The learner will be able to understand how different genetic mechanisms LESSON OUTLINE
change the gene and genotype frequencies and ultimately cause change in
populations. Introduction Quick Review 5
Performance Standard Motivation Inquiry 5

calculate problems that involve changes in gene and genotype frequencies Instruction Lecture on Genetic Mechanisms 60
Learning Competency Practice Word Problem 15

The learners shall be able to explain the mechanisms that produce change in
Enrichment Group Work 15
populations from generation to generation (STEM_BIO11/12-IIIc-g-9)
Specific Learning Outcomes Evaluation Assignment 20

Materials
enumerate the genetic mechanisms that cause change in populations; Chocolate and milk coated fish-shaped biscuits available in most
explain how each genetic mechanism causes change in populations; and supermarkets; paper, pen, and calculator
calculate the change in gene and genotype frequencies cause by selection Resources
(1) Freeman, S. Biological Science. 3rd ed. 2008. California: Pearson
Benjamin Cummings. pp. 503-525.
480-499.
419-439.
Additional Resources at the Back

Let your learners recall the Hardy-Weinberg
Quick Review principle and the conditions that should be
1. Give a quick review of Hardy-Weinberg principle and the conditions that should be satisfied to satisfied for equilibrium to be attained.
attain equilibrium.

Inquiry You have to make your learners realize that if any
1. You may ask your learners: What would happen if any one of the conditions is not satisfied? one of the conditions is not met or satisfied,
equilibrium (constant gene and genotype
Ask them to recite their answers. frequencies) will not be attained. Therefore, the
gene and genotype frequencies will change and
eventually this will cause changes in the population
and will ultimately lead to species change and
evolution.
Lecture on Genetic Mechanisms
1. Give a lecture on the genetic mechanisms that change gene and genotype frequencies of Teacher Tip:
For the class demonstration, instead of the given
populations: American brand of crackers, use locally available
I. mutation brands like the chocolate and milk coated fish-
shaped biscuits (e.g. Knick Knacks) available in
II. selection most supermarkets. Alternatively, this can be done
III. gene flow or migration as a group activity especially if you have the right
amount of resources.
IV. genetic drift
2. Demonstrate to the class how gene and genotype frequencies change when selection is It is much easier to teach the use of Hardy-
present. The demonstration can be adapted from: Berkeley, C. Teaching Hardy-Weinberg in Weinberg equation in the presence of selection if
the learners calculate gene and genotype
the classroom (http://www.carolina.com/teacher-resources/Interactive/teaching-hardy- frequencies with you. Therefore, you should pause
weinberg-in-the-classroom/tr10630.tr). Use the given Activity 2 (Hardy Weinberg and Natural frequently to give the learners enough time to
Selection). actively process the information and practice the
calculations.
3. Based on the calculations done during the activity, discuss how selection changes the gene
and genotype frequencies in a population.
Let us assume that these are the calculated values from an activity described above done by a
class where there was selection against the white fish phenotype:
78
No. of black No. of white
Generation
fishes fishes
p q p2 2pq q2
1 100 80 0.34 0.66 0.12 0.44 0.44
2 128 72 0.37 0.63 0.14 0.46 0.40
3 126 54 0.45 0.55 0.20 0.50 0.30
4 138 42 0.52 0.48 0.27 0.50 0.23
5 150 30 0.59 0.41 0.35 0.48 0.17
4. Illustrate to your learners the change in gene and genotype frequencies by showing graphs
that reflect the changes. Make two graphs, one for genotype frequencies and another for
gene frequencies. Plot the values of the gene/genotype frequencies in the x axis and the
generations in the Y axis. Discuss to your learners what they can observe about the graphs.
They should clearly see the occurrence of change across five generations.
5. You may also compute the change in gene frequency from one generation to another
generation. Example: change in p and q from generation 1 to 2:
p = p2 p1 = 0.37 0.34 = 0.03; q = q2 q1 = 0.63 0.66 = -0.03
This means that there is increase in the frequency of p by 0.03 and a corresponding
decrease in q after one generation of selection against the white phenotype.
6. Take note that since there is selection against the white phenotype, there was continuous
decrease in the genotype and gene frequencies and a corresponding increase in the gene
and genotype frequencies for the black phenotype.
PRACTICE (15 MINS)

Teacher Tip:
Word Problem Problems/questions can be obtained from the
1. Aside from the examples that you used to illustrate the effect of selection, give another word listed references. If you do not have copies of the
books in the list, you may refer to any General
problem on selection for the learners to work on.
Biology books or Genetics books.
Group Work Teacher Tip:
1. Divide your learners into groups, with each group having five to six members. Let the learners You have to go around the groups to check if they
are doing things correctly.
in each group discuss among themselves how they answered the given problem. After ten
minutes of group discussion, explain to the class the correct answer.

Assignment
1. Give a questions/problem on selection as assignment to be submitted the next meeting.
Instruct your learners to show the solution to the problem. Resources
2. The assignment will be given 10 points for perfect score. The solution will be 70% of the score PAPERS ONLINE:
(1) Brewer, MS and E Grant. Teaching evolution
and the final answer is 30%.
through the Hardy-Weinberg Principle: A real-
time, active-learning exercise using classroom
response devices. 2013. The American
Biology Teacher, 75(7):476-479; DOI:
10.1525/abt.2013.75.7.6.
(2) Berkeley, C. Teaching Hardy-Weinberg in the
classroom. http://www.carolina.com/teacher-
resources/Interactive/teaching-hardy-
(3) Stanhope, J. Hardy Weinberg Equilibrium.
http://www.accessexcellence.org/AE/AEPC/
WWC/1994/hwintro.php
(4) The teacher friendly guide to evolution:
Hardy-Weinberg Equilibrium. http://
bivalves.teacherfriendlyguide.org/index.php?
option=com_content&view=article&id=30:har
dy-weinberg-
equilibrium&catid=27&Itemid=126
SUGGESTED VIDEO:
http://www.brightstorm.com/test-prep/ap-
biology/ap-biology-videos/hardy-weinberg-
equilibrium/
80
Lesson 10: Evolution and Origin of

Biodiversity: Patterns of Descent with
Modification LESSON OUTLINE
Content Standard
Introduction Quick Review 5
The learners demonstrate an understanding that organisms exhibit patterns of
descent with modification from common ancestors (also known as evolution) Motivation Classifying Animals 15
and that evolution can account for the organismal diversity observed today.
Performance Standard Instruction Species 115

The learners shall be able to Practice Activity 20
present a short skit or play to illustrate modes of speciation
Enrichment Film Viewing 20
Learning Competency
The learners shall be able to show patterns of descent with modification from Evaluation Quiz 5
common ancestors to produce the organismal diversity observed today.
STEM_BIO11/12-IIIc-g-10 Materials
Photographs of different species of plants and animals showing the various
Specific Learning Outcomes isolating mechanisms and the different modes of speciation
define species according to the biological species concept; (1) Freeman, S. Biological Science. 3rd ed. 2008. California:
Pearson Benjamin Cummings. pp. 503-525.
distinguish the various types of reproductive isolating mechanisms that can (2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB
lead to speciation; Jackson. Campbell Biology. 9th ed. 2014. Illinois: Pearson
Education Inc. pp. 480-499.
discuss the different modes of speciation; and
(3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology:
explain how evolution produce the tremendous amount of diversity among the Dynamic Science. 2008. California: Brooks/Cole
organisms. CENGAGE Learning. pp. 419-439.

Let your learners recall the mechanisms that cause
Quick Review changes in gene frequencies.
1. Give a quick review of the different mechanisms that bring about changes in the population
and ultimately lead to evolution.

Classifying Animals
1. Ask your learners to give an organism which can be an animal or a plant species.
2. Ask them further if they had seen different kinds or variants of this species and also other
species which look like them because they are related. An example is the cat family where
lion, tiger, cheetah, etc. belong.
3. Then tell them that the lesson is about how different kinds of organisms or species are
produced over time.

Species Teacher Tip:
1. Define species according to the biological species concept. Ernst Mayers definition: Species 1. Take note that there are different species
are groups of interbreeding natural populations that are reproductively isolated from other concepts but the best used and most popular
such groups. among biologists is the biological species concept.
2. Discuss the reproductive isolating mechanisms

2. All reference books in General Biology gives
A. Pre-zygotic isolation mechanisms prevent fertilization and zygote formation. examples of the occurrence of the isolating
I. geographic or ecological or habitat isolation potential mates occupy different mechanisms in different organisms and also
specific examples of the three models of
areas or habitats thus, they never come in contact
speciation. To make things more interesting it will
II. temporal or seasonal isolation different groups may not be reproductively mature help to show photographs of the species to your
at the same season, or month or year learners. You may download the photographs or
illustrations from the internet using google images.
III. behavioral isolation patterns of courtship are different
IV. mechanical isolation differences in reproductive organs prevent successful 3. Give examples of organisms or instances for
interbreeding each reproductive isolating mechanism. Think of
local examples.
V. gametic isolation incompatibilities between egg and sperm prevent fertilization
82
B. Post-zygotic isolation mechanisms allow fertilization but nonviable or weak or sterile hybrids
are formed.
I. hybrid inviability fertilized egg fails to develop past the early embryonic stages
II. hybrid sterility hybrids are sterile because gonads develop abnormally or there is
abnormal segregation of chromosomes during meiosis
III. hybrid breakdown - F1 hybrids are normal, vigorous and viable, but F2 contains many
weak or sterile individuals
3. Let your learners recall the different genetic mechanisms that can change gene frequencies.
Discuss with them that in the presence of a reproductive isolating mechanism, genetic drift,
natural selection, mutation and gene flow are free to operate on the population. These will lead
to genetic divergence and ultimately to species formation or speciation.
4. Discuss the modes of speciation:

A. Allopatric speciation or geographic speciation (allo other, patric place; other place) -
occurs when some members of a population become geographically separated from the
other members thereby preventing gene flow. Examples of geographic barriers are bodies
of water and mountain ranges.
B. Sympatric speciation (sym same, patric place; same place) - occurs when members of
a population that initially occupy the same habitat within the same range diverge into
two or more different species. It involves abrupt genetic changes that quickly lead to the
reproductive isolation of a group of individuals. Example is change in chromosome number
(polyploidization).
C. Parapatric speciation (para beside, patric place; beside each other) occurs when
the groups that evolved to be separate species are geographic neighbors. Gene flow
occurs but with great distances is reduced. There is also abrupt change in the environment
over a geographic border and strong disruptive selection must also happen.
5. You may show the following diagram to differentiate the three models of speciation.
6. You can wrap up your lecture by mentioning that present-day species evolved from earlier
species and that the relatedness of organisms is the result of common ancestry. This can be
supported by morphological and anatomical data, homology, biogeography, DNA and protein
sequences (molecular data), and embryology. All these evidences of evolution (descent with
modification) will be discussed in a separate topic.
PRACTICE (20 MINS)

Activity
Based on the descriptions let your learners identify the given isolating mechanisms:
1. Two species of garter snakes live in the same region but one lives in water and the other on
land
2. Two species of meadowlarks with different mating songs
3. Two species of trout that breed in different seasons
4. Mule is the sterile offspring of a horse and a donkey
5. Two species of plants flower at different months
84
Based on the descriptions let your learners identify the mode of speciation:
6. The hemp nettle, Galeopsis tetrahit is a tetraploid found to thrive in the same area as two
other diploids species, Galeopsis pubescens and Galeopsis speciosa.
7. The Panama porkfish, Anisotremus taeniatus, found in the Pacific Ocean is morphologically
similar to the porkfish, Anisotremus virginiacus, found in the Caribbean Sea are separated
by a land bridge between North and South America called the Isthmus of Panama.
8. The Siberian lesser black-backed gull, lesser black-backed gull and herring gull are all
found in the Arctic region. The lesser black-backed gull interbreeds with the Siberian lesser
black-backed gull but not with the herring gull.

Film Viewing
1. Show a short film (~15 minutes) about the The Beak of the Finch made by the Howard
Hughes Medical Institute. The film can be streamed from the HHMI Biointeractive website
(http://www.hhmi.org/biointeractive/origin-species-beak-finch) or through YouTube (https://www.youtube.com/
watch?v=mcM23M-CCog).
Answer Key:
EVALUATION (5 MINS) 1. C
You may give a quiz about this topic. Here are some sample questions.
2. B
1. Which of the following statements about biological species is(are) correct? 3. B
I. Biological species is a group of individuals whose members interbreed with one another. 4. A
II. Biological species are the model used for grouping extinct forms of life. 5. C
III. Members of biological species produce viable, fertile offsprings.

A. I only
B. II only
C. I and III
D. II and III
E. I, II, and III
Resources
2. The following isolating mechanisms prevent fertilization and formation of zygote except PAPERS THAT ARE AVAILABLE ONLINE:
(1) Filson, R.P. Island Biogeography and
A. Temporal isolation Evolution: Solving a Phylogenetic
B. Hybrid breakdown Puzzle with Molecular Genetics.
Available at http://
C. Gametic isolation www.ucmp.berkeley.edu/fosrec/
D. Ecological isolation Filson.html
(2) Flammer, L., J. Beard, C.E. Nelson, &
E. Behavioral isolation M. Nickels. 1998.ENSIWEB.
Evolution/Nature of Science Institutes.
Available at http://www.indiana.edu/
For numbers 3-5, use the following choices: ~ensiweb/home.html
A. Allopatric speciation (3) Flammer, L. Quick Speciation Activity.
B. Sympatric speciation ~ensiweb/lessons/
C. Parapatric speciation quick.speciation.html
(4) A Step in Speciation: The Analysis of
Field Observations of the California
3. Occurrence of abrupt genetic change cause reproductive isolation between groups of Salamander. Ensantina eschschsoltzii.
individuals.
~ensiweb/lessons/
4. Occurs when populations are separated by a geographic barrier. quick.speciation.html
(5) National Academy of Sciences.
5. Abrupt change in the environment over a geographic border and strong disruptive selection
Investigating Common Descent:
affects gene flow between neighboring populations. Formulating Explanations and Models
(Grades 9-12). Available at the
website of the Smithsonian National
Museum of Natural History http://
humanorigins.si.edu/education/
lesson-plans/investigating-common-
descent-formulating-explanations-
and-models-grades-9-12
SUGGESTED VIDEO:
The Origin of Species: The Beak of the
Finch. Video is available at the
Biointeractive website of the Howard
Hughes Medical Institute (HHMI) http://
www.hhmi.org/biointeractive/origin-
species-beak-finch
86
General Biology 2
Lesson 11: Development of Evolutionary

Thought
LESSON OUTLINE
Content Standard Introduction Own Definition of Evolution 5
The learners will be able to appreciate and understand the events, people and
their contributions in the development of evolutionary thought. Motivation Schema Building 15
Instruction Lecture: Evolutionary Thought 50
make a list of scientists/ people who contributed to early evolutionary ideas Practice Flash Cards 20
Learning Competency Enrichment Film Viewing 30

The learners shall be able to trace the development of evolutionary thought.
STEM_BIO11/12-IIIc-g-11 Evaluation Quiz 10

At the end of the lesson, the learners will be able to: Photographs of different species of plants and animals showing the various
isolating mechanisms and the different modes of speciation
enumerate the scientists and cite their respective contributions in the
development of evolutionary thought; Resources
(1) Freeman, S. Biological Science. 3rd ed. 2008. California:
describe Jean Baptiste Lamarcks hypothesis on evolutionary change; Pearson Benjamin Cummings. pp. 503-525.
discuss Charles Darwins theory of evolution by natural selection; and (2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB
Jackson. Campbell Biology. 9th ed. 2014. Illinois: Pearson
explain the Modern Synthesis as the unified theory of evolution Education Inc. pp. 462-470.
(3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology:
the Dynamic Science. 2008. California: Brooks/Cole
CENGAGE Learning. pp. 401-418.
To illustrate evolutionary relationships show
Own Definition of Evolution pictures of plants or animals that are members of
1. Ask learners to make their own definition of evolution the same genus or family (evolutionarily related).
Or you may show a phylogenetic tree with
illustrations of the species. The internet is a very
good source of illustrations like this. Point out how
similar they look like and relate it to the definition
of evolution.

Teacher Tip
Schema Building It is highly probable that you will get answers
1. Ask your learners what they know about evolution. This will give you an idea about the current about creationism vs evolution. Make sure that you
read well so that you may be able to provide
perception of your learners about evolution, which to some remains to be a controversial
answers to their questions.
topic.
INSTRUCTION (115 MINS) Teacher Tip

Use the internet to get images or pictures of the
Lecture: Evolutionary Thought following:
1. Give a lecture about early scientists who contributed in shaping and developing evolutionary A. People that will be mentioned in your lecture.
thought. Put emphasis on the following: This would personify the scientists and will
better familiarize the learners with them.
A. Carolus Linnaeus order in the diversity of life; hierarchy of taxonomic categories B. Images that exhibit Lamarcks theory (e.g.
B. Thomas Malthus Essay on the Principle of Population giraffe)
C. Map of the Galapagos Islands and organisms
C. Georges Cuvier fossils, paleontology and the theory of Catastrophism observed by Darwin
D. James Hutton theory of Gradualism
E. Charles Lyell principles of geology
2. Give a lecture on Jean Baptiste Lamarcks theory on evolutionary change

A. Principle of use and disuse
B. Inheritance of acquired characteristics
3. Describe Charles Darwins voyage and his observations that led him to write The Origin of
Species
88
A. Voyage of the Beagle and organisms in the Galapagos
islands
B. Darwins reflections after his voyage
C. Darwins use of common knowledge
D. Writing and publication of The Origin of Species
Take note that it is not only Charles Darwin who is credited

in the development of the theory of evolution through
natural selection. Another scientist, Alfred Russel Wallace
from his exploration of the Amazon Basin is considered as
the co-discoverer of the theory of evolution by natural
selection.
4. Explain to the class Darwins theory of evolution by natural 5. Give a lecture on the Neo-Darwinian theory or Modern
selection. Make sure that you will be able to include the Synthesis which is a unified theory of evolution. It should include
following in your discussion: the contributions of the following to substantiate Darwins idea
A. Descent with modification about evolution.
B. Existence of variation A. Contribution of Mendelian Genetics
C. Struggle for existence B. Birth of Population Genetics
D. Artificial selection, natural selection and adaptation C. Use of data from biogeography, comparative morphology,
comparative embryology,
A. Paleontology, taxonomy, etc.
The table on the upper right part is from Russell et al. (2008;
page 410) is a summary of Darwins observations and inferences.
Take note that the very last portion is somehow an
introduction to the next topic about the evidences of
evolution.
PRACTICE (20 MINS)
Flash Cards
1. With flash cards, allow learners to identify the name of the scientist and his contribution to early
evolutionary ideas.

Film Viewing Teacher Tip:
1. You may ask your learners to watch the following video: The Making of a Theory: Darwin, This can be done by the learners on their own
Wallace, and Natural Selection HHMI BioInteractive Video posted at YouTube (https:// time and at home.
www.youtube.com/watch? v=XOiUZ3ycZwU)
Answer Key:
1. B
2. B
EVALUATION (5 MINS) 3. C
You may give a quiz about this topic. Here are some sample questions. 4. E
5. C
1. Catastrophism, meaning the regular occurrence of geological or meteorological disturbances
6. A
(catastrophes), was Cuvier's attempt to explain the existence of 7. C
A. Evolution.
B. The fossil record.
C. Uniformitarianism.
D. The origin of new species.
E. Natural selection.
2. Which of the following represents an idea that Darwin learned from the writings of Thomas
Malthus?
A. Technological innovation in agricultural practices will permit exponential growth of the
human population into the foreseeable future.
B. Populations tend to increase at a faster rate than their food supply normally allows.
C. Earth changed over the years through a series of catastrophic upheavals.
D. The environment is responsible for natural selection.
E. Earth is more than 10,000 years old.
90
3. In the mid-1900s, the Soviet geneticist Lysenko believed that his 6. Which of the following must exist in a population before natural
winter wheat plants, exposed to ever-colder temperatures, selection can act upon that population?
would eventually give rise to ever more cold-tolerant winter A. Genetic variation among individuals
wheat. Lysenko's attempts in this regard were most in
B. Variation among individuals caused by environmental
agreement with the ideas of
factors
A. Cuvier.
C. Sexual reproduction
B. Hutton.
D. Three of the responses are correct.
C. Lamarck.
E. Two of the responses are correct.
D. Darwin.
E. Lyell. 7. Which of the following does not contribute to the study of
evolution?
4. Which of the following ideas is not included in Darwins theory? A. Population genetics
A. All organisms that have ever existed arose through B. Inheritance of acquired characteristics
evolutionary modifications of ancestral species.
C. Fossil records
B. The great variety of species live today resulted from the
D. Comparative embryology
diversification of ancestral species.
E. Comparative morphology
C. Natural selection drives some evolutionary change.
D. Natural selection preserves favorable traits.
E. Natural selection eliminates adaptive traits.
5. Which of the following statements is not compatible with

Darwins theory?
A. All organisms have arisen by descent with modification.
B. Evolution has altered and diversified ancestral species.
C. Evolution occurs in individuals rather than in groups.
D. Natural selection eliminates unsuccessful variations.

E. Evolution occurs in because some individuals function
better than others in a particular environment.
Lesson 12: Evidences of Evolution

Content Standard
The learners demonstrate understanding of evidences of evolution. LESSON OUTLINE
Performance Standard Introduction Review of Previous Lesson 5
illustrate the evidences of evolution Motivation Videos on Fossil Evidences 5
explain how the fossil record has aided in the development of the theory of
Instruction Report 30
evolution
Practice Giving Evidences for Evolution 10
Learning Competency
The learners explain evidences of evolution (e.g. fossil record, biogeography, Enrichment Evidences to Support Evolution in 10
DNA/ protein sequences, homology and embryology (STEM_BIO11/12-IIIc- Recent Times
g-12)
Materials
Specific Learning Outcomes Downloaded videos, internet sources, worksheets, laboratory sheets
Resources
describe the evidences to support evolution and (1) Evidence for Evolution: http://necsi.edu/projects/evolution/evidence/
evidence_intro.html (Retrieved 09/08/15)
explain some modern evidences of evolution
(2) Evidence of Evolution: https://www.boundless.com/biology/textbooks/
boundless-biology-textbook/evolution-and-the-origin-of-species-18/
understanding-evolution-124/evidence-of-evolution-498-11724/
(3) Evidence of Evolution: http://www.classzone.com/science_book/
mls_grade7_FL/508_514.pdf (Retrieved 09/08/15)
(4) Evolving Ideas: How Do We Know Evolution Happens http://
www.pbslearningmedia.org/resource/tdc02.sci.life.evo.howhappens/
evolving-ideas-how-do-we-know-evolution-happens/
(5) The Day the Mesozoic Died: The Asteroid That Killed the Dinosaurs
HHMI BioInteractive Video - https://www.youtube.com/watch?
v=tRPu5u_Pizk (Retrieved 04/16/16)
92
During Darwins time, people had been searching
Communicate Learning Objectives for evidences that will support evolution. Some
1. Introduce the following objectives by asking volunteers to read them aloud. evidences like fossil and structural similarities
were used by scientists to explain evolution.
I. I can explain each evidence of evolution.
Other evidences were obtained using inferences
II. I can use scientific evidence to infer relationships among organisms developed after Darwins time.
Guide Questions
1. What evidences did scientists use to support the theory of evolution?
2. What evidences are supported by modern technologies?
3. What recent evidences prove that evolution is taking place?
MOTIVATION (5 MINS)
Alternative
Videos on Fossil Evidences The following pictures can be shown and
The following videos will be shown to start the lesson, as well as, to review an evidence discussed the learners are asked to identify the
in the past topic. evidence presented.
1. Could a Fossilized Mosquito Resurrect Dinosaurs? (2:36 minutes) - https://www.youtube.com/ 1. Fossil of a dinosaur
watch?v=8kHyNOa7cuc (Retrieved 04/16/16)
2. Organisms found in different places
2. Theres a Dinosaur that Survived Mass Extinction (1:45 minutes) - https://www.youtube.com/ (but belong to the same group)
watch?v=8kHyNOa7cuc (Retrieved 04/16/16)
3. Vestigial structures in two related
3. How Dinosaurs Went Extinct? (2:20 minutes) - https://www.youtube.com/watch?v=Y8Ij9xboreA organisms
4. DNA sequence in two related
Guide Questions organisms
1. Is it possible to resurrect the organism (by cloning) whose DNA was sucked by the mosquito? 5. Domestication of dogs
2. What period did most dinosaurs become extinct? How could a dinosaur possibly escape the 6. The case of the peppered moth
fate suffered by other organisms?
7. Antibiotic resistance in bacteria
1. After showing the introductory videos, tell the learners that are other evidences that are used The topics for reporting should be given 1 2
days before to give the learners enough time to
to support the theory of evolution.
research. Four leaders will be chosen and they
2. The leaders will draw numbers to determine who will report first. will be the ones to choose their members.
3. The following topics are to be presented by the assigned group. 1. Evidence from molecular biology
I. Evidence from molecular biology 2. Structural evidences: homology, analogy,
vestigial structures
II. Structural evidences: homology, analogy, vestigial structures
3. Evidence from biogeography
III. Evidence from biogeography 4. Evidence from embryology
IV. Evidence from embryology
4. Each group will be given 7-10 minutes to present. The following criteria should be followed in the
report:
5. Other learners must remain quiet and take down notes during each report.
1. Content- should include the important
6. The scores by the teacher will be given next meeting. details about the topic
2. Creativity- must be engaging and interesting
3. Concise- brief and focused
EVIDENCES OF EVOLUTION
Evidence from Fossils 7-10 minutes are allotted for each topic
Fossils are remains of ancient organisms trapped in rocks, tar pits, frozen in ice or embedded in
amber. The activities and behavior of ancient life forms also left behind fossil traces (such as To engage everyone in reporting, the teacher
footprints, dungs, gastric stones, nests and burrows) which scientists can study. may grade the report and add the points to a
future assessment like long test or project. A
certain score in the report must be acquired to
The records found in the rocks show a gradual evolutionary descent from simpler to more complex
get the added point in the future assessment.
life forms. Paleontologists use the fossils found in rocks to track the evolutionary history of many
organisms. For example, the following may be used as
points for the various criteria:
Content = 10
Example:
Creativity = 10
The ancestors of modern horses were short browsers with diet of broad-leaved plants, shrubs Conciseness = 5
and trees. They had more toes (four in front, three at the back) which prevented them from
sinking in the soft, marshy ground. 20 25 pts = +3
15 20 pts = +2
10 15 pts = +1
As the climate changed to drier conditions, foliage plants were replaced by grass fields. Those below 10 = no additional points
with the characteristics suited for this (tooth structure fit for eating hard, dry grass) survived
better. The forced grazers also became runners (with longer leg bones and lesser toes) to be
able run more efficiently in the hard ground and to escape from predators.
94
Evidence from Structures Teacher Tip:
Structures in different organisms can be compared to infer common lineage. The principle of homologyillustrated by the
adaptive radiation of the forelimb of mammals.
All conform to the basic pentadactyl pattern but
HOMOLOGOUS STRUCTURES are structures with the same set of bones that presumably evolved are modified for different usages. The third
from a common ancestor. They appear different and may have varied functions. metacarpal is shaded throughout; the shoulder is
crossed-hatched.
(From: https://goo.gl/8yrjdd)
Teacher Tip:
ANALOGOUS STRUCTURES are structures that perform the same function but have very The wings of the bat are made of skin, hair and
different embryological development or set of structures like bones. bone; the wings of the bird are made of skin,
feather and bones; the wings of an insect are
made of chitin and bones are absent.
96
VESTIGIAL STRUCTURES are structures or attributes that have lost most of its ancestral function in Teacher Tip:
more recent species. Other vestigial structures in humans include the
following:
1. Tail bone/ coccyx
2. Sinuses
The human vermiform appendix has lost 3. Wisdom teeth
much of its ancestral functions (distant 4. Muscle in the external ear
5. Erector pili muscles
ancestors ate more vegetation).
6. Tonsils
7. Male nipples
8. Palmar grasp reflex of infants
9. Plica semilunaris in the eyelid
From: http://goo.gl/9qjcYK
EVIDENCE FROM EMBRYOLOGY Vertebrates have similarities in their embryo

Embryology is the study of the development of an organism from an embryo to its adult form. forms such as the pharyngeal gill slits and the
post-anal tail. In aquatic vertebrates, the gill slits
Common structures are shared in the embryo stage and disappear by the time the embryo reaches become part of the gills and tails are retained
the juvenile or adult form. while land vertebrates become covered with skin
and some lose the tail in adult forms.
EVIDENCE FROM MOLECULAR BIOLOGY

Many organisms have similar molecules of life (RNA, DNA, proteins) that suggest descent from a
common ancestor with modifications. The near universality of the genetic code reflects an
evidence of common ancestry and relatedness and can be inferred from the similarities in the DNA
sequences between and among organisms.
Many organisms have similar molecules of life (RNA, DNA, proteins) that suggest descent from a Human Beta Chain 0
common ancestor with modifications. The near universality of the genetic code reflects an
evidence of common ancestry and relatedness and can be inferred from the similarities in the DNA Gorilla 1
sequences between and among organisms.
Gibbon 2
Rhesus monkey 8
Many organisms have similar molecules of life (RNA, DNA, proteins) that suggest descent from a
common ancestor with modifications. The near universality of the genetic code reflects an Dog 15
evidence of common ancestry and relatedness and can be inferred from the similarities in the DNA
sequences between and among organisms. Horse, cow 25
Mouse 27
Evidence from Biogeography Gray Kangaroo 38
Biogeography is the study of geographical distribution of fossils and living organisms. Organisms
usually arise in areas where similar forms already exist. Similar organisms may also be found in Chicken 45
different locations which could mean that the two places were previously connected. Frog 67
Lamprey 125
PRACTICE (10 MINS) Sea slug 127
Identify the evidence shown by the picture and explain how it supports evolution.
Soybean 124
98
Given the evidence, the learner should be able to explain how it supports evolution.
Evidence from homologous structures- structures with different Evidence from fossils- shows the changes in the organism
functions but the same ancestral origin through time and how recent organisms compare with it
Evidence from embryology- show that related organisms have Evidence from biochemistry- show similarities in the molecules of
similar structures in their earlier forms; in some, the function is lost life such as proteins, DNA and RNA; similarities in the sequence
and the structure becomes vestigial reflects relationship
(taken from http://goo.gl/0W09FY)

FURTHER DISCUSSION Teacher Tip:
Evidences to support that Evolution is happening in recent times Sometimes the learners cant visualize something
that happened millions of years ago or
1. Antibiotic Resistance in Bacteria something that they cant see with their naked
2. Pesticide Resistance eyes. They might ask if evolution can happen
within their lifetime.
3. Variation in the Beaks of Finches
4. Industrial Melanism in Peppered Moth At this point, the teacher can discuss some
evidences that evolution can be proven to be
5. Domestication of Dogs going on in recent years.
6. Cultivation of Crops
Worksheets and other information can be
acquired from the following sites.
ASSIGNMENT
For antibiotic and pesticide resistance
1. How do we infer relationships among organisms given the various evidences of evolution? TCSS Biology: Unit 4- Evolution Information
2. Download and accomplish with a partner the Evidence of Evolution worksheet found in this http://goo.gl/0W09FY (last accessed 04/17/16,
10:36am)
site.
3. TCSS Biology: Unit 4- Evolution Information - http://www.msfta.org/cms/lib6/FL02001163/ For the variation in the beaks of finches
Centricity/Domain/54/Evidence%20of%20Evolution.pdf - (last accessed 04/17/16, 10:36am) Battle of the Beaks:
http://www.sepa.duq.edu/darwin/pdf/
4. The teacher can also download the pdf worksheet and provide the class a hard copy or post UniqueBeakPhysique.pdf (last accessed
the drawings on the board and ask questions as part of class recitation. 04/17/16, 11:09am)
Famous Beaks:
https://www.nsta.org/publications/press/extras/
files/virus/Virus-Activity5.pdf
(last accessed 04/17/16, 11:09am)
The Beaks of Finches

http://www.allhallows.org/ourpages/auto/
2015/5/26/53452671/biolab18.pdf
Peppered Moth Simulation

http://biologycorner.com/worksheets/
pepperedmoth.html
100
Additional Resources:
Fossils Evidence
http://www.nicholls.edu/biol-ds/biol155/Lectures/Evidence%20for%20Evolution.pdf
http://goo.gl/Hq7wAO
http://web.iitd.ac.in/~amittal/SEH_Evolution_Evidence.pdf
http://evolution.berkeley.edu/evolibrary/article/evograms_03
http://creation.com/the-evolution-of-the-horse
Structural Evidence
https://www.boundless.com/biology/textbooks/boundless-biology-textbook/evolution-and-the-origin-of-species-18/evidence-of-
evolution-129/homologous-structures-523-13101/
http://sdrdbiology.blogspot.com
Embryological Evidence
http://www.nicholls.edu/biol-ds/biol155/Lectures/Evidence%20for%20Evolution.pdf
Biogeographic Evidence
https://opencurriculum.org/5404/evidence-for-evolution/
Evidence for Evolution: http://necsi.edu/projects/evolution/evidence/evidence_intro.html (Retrieved 09/08/15)

Evidence of Evolution: https://www.boundless.com/biology/textbooks/boundless-biology-textbook/evolution-and-the-origin-of-species-18/
understanding-evolution-124/evidence-of-evolution-498-11724/ (Retrieved 09/08/15)
Evidence of Evolution: http://www.classzone.com/science_book/mls_grade7_FL/508_514.pdf (Retrieved 09/08/15)
Evolving Ideas: How Do We Know Evolution Happens http://www.pbslearningmedia.org/resource/tdc02.sci.life.evo.howhappens/evolving-

ideas-how-do-we-know-evolution-happens/
Lesson 13: Evolutionary Relationships of

Organisms LESSON OUTLINE
Content Standard Motivation Review 15
The learners demonstrate an understanding as to how organisms are
related to each other. Instruction Worksheets 70
and Practice
Evaluation Cladogram of Horses 20
The learners shall be able to:
describe the criteria used to establish relationships among groups of Enrichment Comparison of Wings 10
organisms Materials
Learning Competency Papers, pens, colored pens, worksheet, diagrams
The learners should be able to infer evolutionary relationships among Resources
organisms using the evidences of evolution (STEM_BIO11/12-IIIc-g-13) (1) Evidence for Evolution: http://necsi.edu/projects/evolution/evidence/
evidence_intro.html (Retrieved 09/08/15)
(2) Evidence of Evolution: https://www.boundless.com/biology/textbooks/
boundless-biology-textbook/evolution-and-the-origin-of-species-18/
recognize how comparisons of similarities and differences can understanding-evolution-124/evidence-of-evolution-498-11724/
suggest evolutionary relationships; (Retrieved 09/08/15)
explain the significance of using multiple lines of evidence to identify (3) Evidence of Evolution: http://www.classzone.com/science_book/
evolutionary relationships; mls_grade7_FL/508_514.pdf (Retrieved 09/08/15)!
(4) Molecular Evidence for Evolutionary Relationship http://
infer the degree of relationships among organisms based on the
www.pbslearningmedia.org/resource/tdc02.sci.life.gen.lp_cytoc/
amino acid sequence in the cytochrome c molecule; molecular-evidence-for-evolutionary-relationships/
compare four species of horses by measuring structures in their hind (5) Taxonomy: Classifying Life http://www.biology-pages.info/T/
legs; and Taxonomy.html (Last accessed 04/21/16, 3:10pm)
differentiate various hominids by describing their physical features. (6) Activity: Comparing Horse Hooves and Teeth Fossils http://
www.amnh.org/content/download/39770/581405/file/horsefossil.pdf
(Last accessed 04/23/16, 9pm)
102
Laboratory groups should have been assigned at
Communicating Learning Objectives the start of the school year. Each learner must take
1. Introduce the following learning objectives using any of the suggested protocols (Verbatim, a role in each group (leader, secretary, materials
Own words, Read-aloud) manager).
I. I can explain each evidence of evolution. The teacher must see to it that all members of the
II. I can use some evidences to infer relationships among organisms group contribute to the task.
Allocate the time properly.

Refer to the following sites that offer activities
Review which can be modified for this lesson:
1. Ask learners to recall evidences of evolution from the previous lessons.
The Molecular Connection: http://goo.gl/
Kfivwx (Last accessed 04/21/16, 8:15am)
INSTRUCTION AND PRACTICE (70 MINS) http://goo.gl/aeoEvu (answer key- Last
1. Distribute the worksheets to learners. Let them work with their groupmates. accessed 04/21/16, 8:15am)
I. Molecular Connection Worksheet
Cytochrome C Comparison Lab http://
II. How Do Fossils Show Change? www.indiana.edu/~ensiweb/lessons/
molb.ws.pdf (Last accessed 04/25/16,
2. Tell them to start at once in order for them to finish the activity on time.
2:30pm) http://www.indiana.edu/~ensiweb/
3. Move around to check on each group. cytows.r.pdf (answer key-Last accessed
04/25/16, 2:30pm)
4. You may ask learners on the spot some questions about the activity to check if they
understand what they are doing. How Do Fossils Show Change https://
5. The members may divide tasks in order to finish the activity. In case they are not able to finish, www.nps.gov/flfo/learn/education/upload/
unit3lesson10.pdf (Last accessed 04/25/16,
they can continue working after class and submit the paper next meeting.
3:35pm)
INFERRING RELATIONSHIPS FROM EVIDENCES OF EVOLUTION

Living things share some biomolecules which may be used to prove relationships. These
chemicals include DNA and proteins. The building blocks of these chemicals may be analyzed to
show similarities and differences among organisms. The more similarities, the closer the
relationships.
One of these is the protein cytochrome-c, an important enzyme found in virtually all organisms. It
is a highly conserved protein which functions in the electron transport chain system of the
mitochondria which is needed for the release of energy from food. It also performs a role in Teacher Tip:
apoptosis (programmed cell death) by being released into the cytosol activating the events of cell Laboratory groups should have been assigned at
death. The diagram below shows the structure of cytochrome c and its location in the the start of the school year. Each learner must take
a role in each group (leader, secretary, materials
mitochondrial inner membrane. manager).
The teacher must see to it that all members of the

group contribute to the task.
Allocate the time properly.
Refer to the following sites that offer activities

which can be modified for this lesson:
The Molecular Connection: http://goo.gl/

Kfivwx (Last accessed 04/21/16, 8:15am)
http://goo.gl/aeoEvu (answer key- Last
accessed 04/21/16, 8:15am)
Cytochrome C Comparison Lab http://

www.indiana.edu/~ensiweb/lessons/
molb.ws.pdf (Last accessed 04/25/16,
2:30pm) http://www.indiana.edu/~ensiweb/
cytows.r.pdf (answer key-Last accessed
04/25/16, 2:30pm)
The learners will compare the amino acid sequences of this protein for different animals. From this
information they will infer the evolutionary relationships between the animals. Then they will How Do Fossils Show Change https://
www.nps.gov/flfo/learn/education/upload/
compare this molecular data to a cladogram, a branching diagram of possible evolutionary
unit3lesson10.pdf (Last accessed 04/25/16,
relationships based on the anatomical structures of the animals. 3:35pm)
IMAGES FROM:
There are 104 amino acids in the human cytochrome c, 37 of which have been found at the same From: https://en.wikipedia.org/wiki/
position in every cytochrome c that has been sequenced. The molecules are assumed to have Cytochrome_c
descended from a primitive microbial cytochrome that existed over two billion years ago. From: http://goo.gl/3bcQva
The data can then be tabulated to show the number of differences. A cladogram, or branching
tree can then be made to show the relationship among the organisms.
104
http://www.indiana.edu/~ensiweb/cytows.r.pdf
http://www.indiana.edu/~ensiweb/cytows.r.pdf
Basic features (cells and anatomical structures) can also be used to infer relationship among organisms. The types of cells (prokaryotic or
eukaryotic), presence and number of limbs, presence of wings or hair can be compared to show relationships which can be plotted in a
cladogram.
WORKSHEET FOR PRACTICE

CELLS LEGS 6 LEGS WINGS
WORM
SPIDER
CARPENTER ANT
(BLACK)
FLY
Place the organisms above in the cladogram below and indicate the traits that made the organisms different from each other.
Vertebrates possess common structures (pharyngeal gill slits,

notochord, dorsal nerve cord, and post-anal tail) which are
present in embryo stage and are lost, modified or become
vestigial in adult forms. The presence of these structures implies
descent from a common ancestor. A complex cladogram can
then be created to show the positions of the organisms in the
evolutionary tree.
Teacher Tip:
The dry laboratory will serve as a guide for learners to understand better how
the evidences can be used to infer relationships among organisms.
106
The leg structures of modern-day horses can be compared with
those of fossilized remains.
Worksheet
Compare the leg structures and tooth structures of the horse
species shown below.
A. Color the toe bones red, marked with an x.
B. Color the foot bones blue, marked with a y.
C. Color the ankle bones green, marked with a w.
D. Color the heel bones yellow, marked with a z.
After accomplishing the worksheet, make a cladogram of the

horse.
https://www.nps.gov/flfo/learn/education/upload/unit3lesson10.pdf
EQUUS HYDRACOTHERIUM MYOHIPPUS METYCHIPPUS
NUMBER OF TOES
NUMBER OF TOE BONES
NUMBER OF FOOT BONES
NUMBER OF ANKLE BONES
NUMBER OF HEEL BONES
TOTAL NUMBER OF FOOT

BONES
LENGTH OF FOOT (MEASURE

IN SET DIAGRAM, IN MM)
GEITH OF TEEH, MM
Teacher Tip:
Additional Questions This activity was taken from
1. What environmental changes happened from the time of the earliest to the most recent http://goo.gl/5dALps (Last accessed: 04/24/16,
4pm)
horses?
2. How did the species adapt through time? Use this worksheet to evaluate the learners in
inferring relationships from evidences.

1. This may be given as a take home assignment
2. Compare and contrast the two structures.
3. What do scientists infer from the similarities between these two structures?
4. What do scientists call such similar structures?
5. Describe how DNA evidence might be used to confirm scientists conclusions about any
relationship between the bird and the seal.
Analyzing Cladograms:
http://www.isd622.org/cms/lib07/MN01001375/
Centricity/Domain/718/
Learning_Target_4.6_Cladograms.pdf (Last
accessed 04/24/16, 4:47pm)
108
Lesson 14: Systematics Based on

Evolutionary Relationships: Tree of Life and
Systematics LESSON OUTLINE
Content Standard
The learners demonstrate an understanding of Basic Taxonomic Concepts and Motivation Think Pair Share 30
Principles, Description, Nomenclature, Identification and Classification. Instruction Group Work 65
Performance Standard Practice Collaborative Learning through 3D Tree 50
The learners shall be able to: Building
demonstrate understanding of basic taxonomic principles.
Enrichment Inquiry and Research 15
Learning Competency
Materials
The learners should be able to Explain how the structural and developmental
Pieces of paper, wires, cartolina, colored papers, pen, markers, scissors,
characteristics and relatedness in DNA sequences are used to classify living glue. They may bring reading materials pertaining to the tree of life or
things (STEM_BIO11/12IIIh-j-14) some materials from the internet concerning Mammalian and Human
Evolution.
(1) Reece JB, Urry LA, Cain ML, Wasserman SA, Minorsky PV, Jackson RB.
describe the multiple lines of evidence used to infer evolutionary Campbell Biology.10th edition. San Francisco, California, USA: Pearson
relatedness; Education Inc.; 2014. p.465, p. 508, pp.510-514, pp. 536-
(2) Eric Lee. 2004. Making 3D Models of the Tree of Life. http://
discuss how anatomical, developmental and relatedness in DNA sequences toweb.org/online contributors/app?service-external/
are used as evidence to infer the relatedness of taxa; and ViewTreehouses&sp=2974. 24 August 2015.
explain that classification is based on evolutionary relatedness (3) The family tree. http://evolution.berkeley.edu/evolibrary/article/
evo_03.24 August 2015
Here are some definition of terms:
1. Introduce the following learning objectives using any of the suggested protocols (Verbatim, Own Phylogeny-the evolutionary history of a
words, Read-aloud) species or group of species
I. I can discuss multiple lines of evidence used to infer evolutionary relatedness. Systematics- the study of the kinds and
II. I can discuss how anatomical, developmental and relatedness in DNA sequences are used as diversity of organisms and of any and all
relationships among them.
evidence to infer the relatedness of taxa.
III. I can explain that classification is based on evolutionary relatedness. Homology-similarity due to shared ancestry
Review Molecular clock- a yardstick for measuring

the absolute time of evolutionary change
1. Say, Look around you and realize the enormous diversity of life you can observe. Life on earth is
based on the observation that some genes
amazing and over the last 3.7 billion years or so, living organisms on Earth have diversified and and other regions of genomes appear to
adapted to almost every environment. Though life is so diverse, all living organisms do share evolve at constant rates
certain similarities. Systematists use data ranging from fossils to molecules and genes to infer
evolutionary relationships. These information are used to construct the phylogenetic tree of life.
TRIVIA: A Window to Early Life? An instrument on the research submarine Alvin samples the water
around a hydrothermal vent in the Sea of Cortes. More than 1.5km below the surface, the vent
releases hydrogen sulfide and iron sulfide, which react and produce pyrite (fools gold) and
hydrogen gas. Prokaryotes that live near the vent use the hydrogen as an energy source. Such
environments are among the most extreme in which life exists today, and some researchers favor
the hypothesis that life may have begun in similar regions of early Earth.
2. Ask learners to define the following biological terms in their own words:
I. homology
II. molecular clock
III. phylogeny
IV. systematics
110
3. Stress the importance of understanding how trees are constructed and how multiple lines of Teacher Tip:
evidence are used to infer evolutionary relatedness. Ask learners to work in pairs and then
discuss the significance of the activity and
why such specific question was asked.
4. Outline of topics:
NOTE: Systematics encompasses the
I. multiple lines of evidence used to infer evolutionary relatedness
following fields:
II. anatomical, developmental and relatedness in DNA sequences as evidences to infer the a. biodiversity
relatedness of taxa b. evolutionary biology
c. phylogenetics
III. classification is linked to phylogeny d. taxonomy
IV. classification as basis of evolutionary relatedness

Think Pair Share
1. Instruct your learners to work with a partner. Ask What makes you unique and what makes you
similar? Discuss this with your partner. Ask them to write in a piece of paper the information they
shared with their partners and take note of the features (e.g. physical or genetic) that makes them
unique and similar to each other.
2. Ask for a volunteer to present in class what they have discussed in pairs.
3. Explain to learners, The foremost question that every systematist would ask himself is what makes
one unique and what makes one similar to one another. One of the major tasks of systematics is to
determine by means of comparison what the unique properties of each species and higher taxon
are. Another is to determine what properties certain taxa have in common and the biological causes
of the differences or shared characters. In this way, one begins to understand the relatedness and
relationships of organisms in the tree of life. Systematics has been used to construct the
evolutionary relationship of lifes diverse forms. In recent years, we have gained insight into the very
deepest branches of the tree of life through molecular systematics.
Systematics is the study of the kinds and diversity of organisms and of any and all relationships
among them. Tracing phylogeny is one of the goals of systematics; hence, it is considered as
the study of biological diversity in an evolutionary context. Systematists use data ranging from
fossils to molecules and genes to infer evolutionary relationships. These information enable
biologists to construct a comprehensive tree of life that will continue to be refined as additional
data are collected.
Beforehand, ask learners to bring materials
Group Work: Construction of 3D models of the Tree of Life when they come to class (wires, cartolina,
1. Say, It is difficult to grasp the tree of life. To understand this, we need to construct 3-D models colored papers, pen, markers, scissors,
One model would show the big picture, including the 3 Domains of Life: Bacteria, Archaea, and glue); They may bring reading materials
pertaining to the Tree of Life or some
Eukarya along with the major divisions of each domain. However, it is a tedious process of making
materials from the internet concerning
(such a big tree!). For the sake of this exercise and just to give us the feeling on how to go about in Human Evolution
constructing trees, we will construct a 3-D model of the phylogenetic tree of life (see figure below).
Ask the learner to make a personal review
2. Divide the class into two groups. The task is to create a 3-D model of the tree of life using the
on the multiple lines of evidence used to
listed materials. This 3-D model will help learners understand that all organisms evolved from 3 infer evolutionary relatedness.
lineages: Archaea, Bacteria and Eukarya.
Explain the rationale of the activity.
https://upload.wikimedia.org/wikipedia/commons/b/b7/PhylogeneticTree.png
112
Lines of evidence to infer evolutionary relationships: Teacher Tip:
1. Fossil evidence Discuss to learners different lines of
evidence used to construct trees.
2. Homologies - Similar characters due to relatedness are known as homologies. Homologies can be
revealed by comparing the anatomies of different living things, looking at cellular similarities and See Reece JB, Urry LA, Cain ML,
differences, studying embryological development, and studying vestigial structures within individual Wasserman SA, Minorsky PV, Jackson RB.
Campbell Biology.10th edition. San
organisms.
Francisco, California, USA: Pearson
Each leaf has a very different shape and function, yet all are homologous structures, derived Education Inc. Chapter 26: Phylogeny and
from a common ancestral form. The pitcher plant and Venus' flytrap use leaves to trap and the Tree of Life
digest insects. The bright red leaves of the poinsettia look like flower petals. The cactus leaves
are modified into small spines which reduce water loss and can protect the cactus from
herbivory.
Another example of homology is the forelimb of tetrapods (vertebrates with legs). - Frogs,
birds, rabbits and lizards all have different forelimbs, reflecting their different lifestyles. But those
different forelimbs all share the same set of bones - the humerus, the radius, and the ulna.
These are the same bones seen in fossils of the extinct transitional animal, Eusthenopteron,
which demonstrates their common ancestry.
Organisms that are closely related to one another share many anatomical similarities.
Sometimes the similarities are conspicuous, as between crocodiles and alligators, but in other
cases considerable study is needed for a full appreciation of relationships.
Developmental biology- Studying the embryological development of living things provides

clues to the evolution of present-day organisms. During some stages of development,
organisms exhibit ancestral features in whole or incomplete form.
3. Biogeography- the geographic distribution of species in time and space as influenced by many
factors, including Continental Drift and log distance dispersal.
4. Molecular clocks help track evolutionary time- The base sequences of some regions of DNA
change at a rate consistent enough to allow dating of episodes in past evolution. Other genes
change in a less predictable way.
Classification is linked to Phylogeny Sources:
5. Biologists use phylogenetic trees for many purposes, including: https://upload.wikimedia.org/
wikipedia/commons/3/34/
I. Testing hypotheses about evolution
Snow_Leopard_(PSF).png
II. Learning about the characteristics of extinct species and ancestral lineages http://s3.amazonaws.com/
thumbnails.illustrationsource.com/
III. Classifying organisms
huge.101.507103.JPG
http://quaker-animals.co.uk/wp-
content/uploads/2013/04/otter-
The connection between classification and phylogeny is that hierarchical classification is reflected in
drawing.jpg
the progressively finer branching of phylogenetic trees. The branching patterns in some cases http://s3.amazonaws.com/
match the hierarchical classification of groups nested within more inclusive groups. In other thumbnails.illustrationsource.com/
situations, however, certain similarities among organisms may lead taxonomists to place a species huge.102.510229.JPG
http://comps.canstockphoto.com/can-
within a group of organisms (for example genus or family) other than the group to which it is closely
stock-photo_csp6538507.jpg
related. If systematists conclude that such mistake has occurred, the organism may be reclassified
(that is placed in a different genus or family) to accurately reflect its evolutionary history.
The Connection between Classification

and Phylogeny.
Hierarchical classification can reflect the
branching patterns of phylogenetic trees.
This tree traces possible evolutionary
relationships between some of the taxa
within order Carnivora, itself a branch of
class Mammalia. The branch point (1)
represents the most recent common
ancestor of all members of the weasel
(Mustelidae) and dog (Canidae) families.
The branch point (2) represents the most
recent common ancestor of coyotes and
gray wolves.
114
Practice more on constructing a branch on
Collaborative Learning Groups through 3D Tree Building the tree of Life. This time work with Class
1. Learners will still work as a group Mammalia.
2. The task is to create a 3-D model of a branch of the Tree of Life and tell multiple lines of evidence
that converge to tell the story of Mammalia as a branch in the big Tree of Life.
Mammalia(Mammals) 22
Prototheria
Monotremata (Egg-laying mammals)
Ornithorhynchidae(Platypus)
Tachyglossidae(Echidnas)
Theria
Eutheria (Placentals)
Afrotheria(Golden mole, hyrax, shrew, elephant, manatee, aardvark)
Carnivora(Dog, cat, mongoose, hyena, skunk, otter, weasel, bear, pinniped)
Cetartiodactyla(Whale, dolphin, hippopotamus, ruminantes, pig)
Chiroptera(Bats)
Dermoptera(Flying lemur)
Edentata(Sloth, armadillo, anteater)
Insectivora(Hedgehog, shrew, moles)
Lagomorpha(Rabbits and hares)
Perissodactyla(Odd-toed ungulates: horses, zebra, rhinoceros, tapir)
Pholidota(Pangolins)
Primates(Old and New World monkeys, hominid, gibbon, lemur)
Rodentia(Rats, mice, guinea pig, chinchilla, capybara, porcupine, squirrel)
Scandentia(Tree shrews)
Metatheria (Marsupials)
Dasyuromorphia(Marsupial mice, Tasmanian devil, dunnart))
Didelphimorphia(Opossums)
Diprotodontia(Possums, tree kangaroo, wallaby, koala)
Microbiotheria(Monito del monte)
Notoryctemorphia(Marsupial moles)
Paucituberculata(Shrew opossums)
Peramelemorphia(Bandicoots)
ENRICHMENT (15 MINS) `

Inquiry and Research Project
Case Presentation: Applying Phylogenies
Possible Evaluation:
Why do biologists care about phylogenies? One reason is that species phylogeny provides enormous
a. What are the multiple lines of evidence
amount of information. and how are these used to infer
evolutionary relatedness?
Example: Corn or maize is the second most important source of food worldwide. From the phylogeny b. Prove that classification is based on
of maize based on DNA, data researchers identified two species of wild grasses that may be the closest evolutionary relatedness.
relatives of maize. These two closest relatives may prove useful as reservoirs of beneficial genes that
can be transferred to cultivated maize by plant breeding or genetic engineering. The phylogenetic
analysis of maize also led to the identification of the gene responsible for maizes unique fruiting body,
the cob.
Phylogenetic trees have played a key role in a wide range of other applications. Research on other
cases and present it to class.
I. Investigation whether food sold as whale meat in Japan was illegally harvested from whale
species protected under international law.
II. Application of DNA identification related to bioterrorism. In the fall of 2001, several politicians and
journalists were sent envelopes containing anthrax bacteria. Researchers used DNA to identify the
strain of bacterium sent inside the envelopes.
116

Evolutionary Relationships: Taxonomy
The learners demonstrate an understanding of Basic Taxonomic Concepts and Introduction Communicating Learning Objectives 20
Principles, Description, Nomenclature, Identification and Classification.
Motivation Classification Tasks 30
The learners shall be able to: Instruction Discussion on Linnaean Classification 60
construct a dichotomous key Practice Use of dichotomous keys for 45
identification
Learning Competency
The learners should be able to identify the unique/distinctive characteristics of Enrichment Assignment 15
a specific taxon relative to other taxa STEM_BIO11/12IIIh-j-15
Evaluation Group Work 10
Materials
Writing materials, sheets of paper, photos of plants (citrus fruits) and
describe the Linnaean system of classification; animals (turtles)
classify organisms into a hierarchy; and Resources

construct and use dichotomous keys for identification. (1) Pancho JV, William G SM. Vascular Flora of Mount Makiling and
Vicinity (Luzon: Philippines). Part 2. Laguna, Philippines: National
Academy of Science and Technology (NAST) Philippines, Department
of Science and Technology, Bicutan, Taguig City and Institute of
Biological Sciences, College of Arts and Sciences, University of the
Philippines Los Baos College; 2006. 223-241pp.
(2) Reece JB, Urry LA, Cain ML, Wasserman SA, Minorsky PV, Jackson RB.
Campbell Biology.10th edition. San Francisco, California, USA: Pearson
Education Inc.; 2014. 548-549 pp.
(3) Simpson MG. Plant Systematics. MA, USA: Elsevier Academic Press
Publications; 2006. 12-13pp.

Here are some definitions:
1. Introduce the following learning objectives using any of the suggested protocols (Verbatim, Own Classification method of grouping
words, Read-aloud) organisms; arranging entities into some
type of order to provide a system for
I. I can describe the Linnaean system of classification. cataloguing and expressing relationships
II. I can classify organisms into hierarchy of groups based on similarities and distinct characters. between these entities
III. I can use and construct dichotomous keys. Hierarchy- a system of organizing groups
into ranks according to status; putting
groups at various levels according to
Review importance or power
2. Say, The practice of classification is almost everywhere such that, humans tend to classify almost
everything. For instance, one can describe the clothes to wear, types of utensils used in the Nomenclature- the formal naming of taxa
according to some standardized system. For
kitchen and even the type of footwear . Classification becomes an essential part of everyday life
plants, fungi, and algae, rules for naming
and the habit can be quite useful. In the past humans have classified living organisms based on are provided by the International Code of
their general form and economic use. The type of classification may not be that systematic as Botanical Nomenclature. For animals, rules
compared to the ones we used today. However, it does not deny the fact that they were useful. on naming are based on the International
Code of Zoological Nomenclature.
Early taxonomists (e.g. Emperor Shen Nung of China around 3000BC) have classified plants based Identification- is the process of associating
an unknown taxon with a known one
on practical usesfor food, as herbal medicine, for shelter and others.
At this point, ask learners how they will classify objects or items commonly encountered or used in Description- is the assignment of features
everyday life such as those found in homes, schools and neighborhood/communities. or attributes (characters) to a taxon
Taxonomy- the theory and practice of

The following are sample responses: classifying organisms
I. Kitchen utensils (can be classified based on their use--- spoons, forks, ladles, pots, pans)
II. Clothing (skirts, blouses, socks, pants) Reminder:
Taxonomy is a major part of systematics
III. Learners in schools/universities (can be classified based on gender, age group, etc) that includes description, identification,
nomenclature and classification
IV. Books in the Library (can be classified based on Dewey decimal system)
118
3. Ask the learners to define the following biological terms in their own words.
I. classification
II. description
III. hierarchy
IV. identification
V. nomenclature
VI. taxonomy
4. Say, About three hundred years ago, a Swedish botanist and doctor named Carl Linnaeus realized:
All the real knowledge we have depends on the method by which we distinguish the similar from the
dissimilar. The greater the number of natural distinctions we make, the clearer becomes our idea of
thingsfrom here Linnaeus set himself the task of devising a method to : join the similar to the similar,
and to separate the dissimilar from the dissimilar in nature Note that the Linnaeus method was known
as Linnaeus system of classification or the Linnaean taxonomy.
5. Stress the importance of a classification system, nomenclature and identification

6. Topics to be covered:
I. Some Early Taxonomists
II. Linnaean System of Classification
III. Binomial Nomenclature
IV. Classifying organisms based on similar and distinct characters
V. The dichotomous key
Classification Tasks
1. Tell learners to form a group, with 4 members.
2. Ask them to look inside their bags and gather all possible types of writing and coloring materials
they can obtain within their group (e.g. ballpen, sign pen, whiteboard marker, pencil, highlighter,
color pens ). Ask learners to classify these materials.
3. Ask learners to write down key features to be used for groupings. Place these features in a table
(learners may focus on characters based on absence (-) or presence (+).
Sample Table:
whiteboard
Features ball pen ordinary pencil highlighter
marker
short (less than 6

inches) - - + -
long (more than 6

+ + - +
inches)
with black ink + - - +

without ink - + - -
4. Ask learners to create their own simple hierarchical system of classification by assigning ranks to
groups created. They may create a label for the ranks. A flow chart may be constructed.
120
Sample Flow Chart:
5. Ask for a volunteer to present the chart. (This activity will give them the actual feeling of how
classification is done.)

Setting the Atmosphere and Discussion Teacher Tip:
Discuss on some scientists contribution to
the classification system throughout history.
1. After getting a feel of how classification is done, learners begin to appreciate the job of early
For instance, Andrea Cesalpino, John Ray,
taxonomists. Discuss a little about the history of classification and the scientists who have Augustus Quirinus Rivinus, Joseph Pitton de
contributed to the field of taxonomy. Tournefort, Robert Whittaker, and Carl
Woese. ( Ask learners to make a personal
2. The taxonomic system was devised by Carolus Linnaeus (1707-1778). It is a hierarchical system
research on their respective contributions.)
since organisms are grouped into ever more inclusive categories from species up to kingdom. In
1981, a category higher than a kingdom, called domain, was proposed by Carl Woese. The table
below illustrates how four species are classified using the present classification system. (Note that it
is standard practice to italicize the genus and species names).
DOMAIN EUKARYA Teacher Tip:
The word species is both in singular and
KINGDOM Animalia Plantae plural form; there is no such word as
specie
PHYLUM Chordata Arthropoda Magnoliophyta
*Classification is based on key characters/
CLASS Mammalia Insecta Lilopsida features used in groupings. Take for
example the classification of humans. Refer
ORDER Primates Canivora Diptera Liliales
to the table below.
FAMILY Hominidae Canidae Drosophilidae Liliaceae
GENUS Homo Canis Drosophila Allium
specific epithet sapiens familiaris melanogaster cepa
SPECIES Homo sapiens Canis familiaris Drosophila Allium capa

melanogaster
COMMON NAME human dog fruit fly onion
DOMAIN EUKARYA FEATURES Note:

Most of us are accustomed to theLinnaean
KINGDOM Animalia Organisms that are able to move on their own system of classificationthat assigns every
organism a kingdom, phylum, class, order,
PHYLUM Chordata Animals with a backbone family, genus, and species
CLASS Mammalia Chordates with fur or hair and milk glands
The Linnean method is artificial since
ORDER Primates Mammals with grasping fingers organisms are classified based on
morphological similarities and not on
FAMILY Hominidae Primates with relatively flat faces and three-dimensional vision evolutionary relationships.
GENUS Homo Hominids with upright position and large brain

Phylogenetic classification is based on
specific epithet sapiens Members if the genus Homo with a high forehead and notably evolutionary history or pattern of descent.
thin skull bones
SPECIES Homo sapiens
COMMON NAME human
122
Teacher Tip:
Linnaeus introduced the binomial system of
nomenclature for plants, animals, fungi,
protozoans and protists. The binomial
system consists of the generic name and the
specific epithet. Thus, the species name is
binomial in nature.
Trivia:
What is the longest species name ?
Parastratiosphecomyia
stratiosphecomyioides
This is the scientific name of the soldier fly.
3. The Linnaean taxonomy which is hierarchical in nature is the most employed system nowadays. Sample mnemonics:
Kings Play Chess On Fine Glass Sets
Note: This system was created long before scientists understood that organisms evolved.
Kings Play Chess On Finely Green
4. Working as teams (4 learners per team) ask learners to come up with their own mnemonic. They Spaces
may share it with other groups (Which mnemonic works best for you?). Keep Pond Clean Or Froggy Gets Sick
Kings Play Chess On Fine Grained
5. Discuss binomial nomenclature. Sand
Nomenclature refers to the practice of assigning scientific names. Binomial comes from the words King Philip Came Over For Green Soup
Kindly Put Candy Out For Good
bi meaning two and nomen meaning name. A species name consists of two parts: the
Learners
genus or generic name and the specific epithet. The first letter of the genus is always capitalized
(e.g. Canis) while the specific epithet is not capitalized (e.g. familiaris). One can distinguish a
species name from the way it is written. Species name can be in bold letters or underlined or
italicized.
Examples:
SPECIES GENUS ENGLISH MEANING SPECIFIC EPITHET ENGLISH MEANING
Canis familiaris Canis a dog familiaris familiar
Felis catus Felis happy catus cat
Discuss dichotomous key as a tool in identification.

Teacher Tip:
Adichotomous keyis a tool that helps identify unknown organisms to some taxonomic level (e.g., Do your personal review on the
characteristics of the citrus family before
species, genus, family, etc.). The key is constructed in such a way that a series of choices is made that
giving this exercise. Be familiar with terms
leads the user to the correct identity of a sample organism. "Dichotomous" means, "divided into two associated with the family.
parts." Therefore, a dichotomous key always offer two choices for each step, each of which describes
key characteristics of a particular organism or group of organisms. Explain the rationale of the activity.
The importance of correct identification

Sample Key: Key to common snacks cannot be underestimated.
1a. Plastic bag packaging Go to 2 Present the plant pictures to learners and
give clear instructions on what they need to
1b. Hard tube packaging Go to 4 do.
2a. Chips have ridged surface Go to 3

Note:
2b. Chips have non-ridged surface Lays Cheese and Onion You may provide photos.
3a. Chips orange color Tortillos Cheese
3b. Chips tan color V-Cut
4a. Chips orange color Pringles Cheddar Cheese
4b. Chips have other color Go to 5
5a. Chips solid tan with no speckles Pringles Original
5b. Chips tan with greenish speckles Lays Stax Sour Cream and Onion
124
6. Now that you have an idea of how a dichotomous is constructed, let us try making one based on
real organisms. Lets try something quite challenging.
Practical example/ work with actual groupings

7. Say, Many plants in the Philippines are often confused because they share characteristics and look
similar.among these are plants belonging to the Citrus family (Family Rutaceae). We are quite
familiar with this group but often one identity is interchanged with the other or all examples are
treated as the same
8. Ask learners to work in groups. Show to class actual fruit samples with few leaves and flowers or if
not, colored pictures of these plants belonging to calamansi family (Rutaceae). Generally, family
Rutaceae is composed of trees or shrubs that are often spiny and rarely herbal. The leaves can be
simple or compound, alternately or oppositely arranged, with few to numerous pellucid glands,
and without stipules. In the Philippines, there are 20 genera and 83 species.
9. Using these fruits below from family Rutaceae, tell your learners to observe the features or
characteristics of each fruit. Place all these characters in a table. Suggest to them possible
characters that they can use like presence/absence of a feature or trait, shape, color etc. Use
common names at the end of each choice.
I. citron
II. key lime
III. pomelo
IV. makrut lime or Mauritius papeda
V. calamondin or calamansi
VI. bitter orange
VII. mandarin orange
VIII.Cochin China Atalantia
10. Ask for group volunteers to show their dichotomous key in class. Comment on how they
constructed their key. After the group has presented their key, show the correct dichotomous key
to your learners.
11. Below is the dichotomous key you will show the learners after they have constructed their own key.
Dichotomous key to the different fruits of family Rutaceae Teacher Tip
Glossary of terms
1. axillary relating to or located in an
1a. Foliage not constricted; berries less than 2 cm in diameter Cochin China Atalantia
axil: an axillary bud
1b. Foliage constricted; berries exceeding 2 cm in diameter Citrus 2. basal- located at or near the base of a
plant stem, or at the base of any other
2a. Leaves not constricted; petioles not or narrowly winged; fruits Citron plant part
3. berry fleshy fruit with many seeds
ellipsoid
derived from a single flower containing
one ovary
2b. Leaves constricted, petioles winged; fruits globose Go to 3
4. foliage- collectively, a cluster of leaves
5. fascicled- in bundles or clusters; can
3a. Flowers in axillary racemes Go to 4
be appied to stems, flowers or leaves
3b. Flowers solitary or fascicled in leaf axils Go to 5 6. globose-rounded
7. petiole-the stalk that attaches the leaf
4a. Basal leaf portion narrowly winged; fruits small key lime blade to the stem;
8. raceme- an inflorescence in which the
4b. Basal leaf portion broadly winged; fruits very large pomelo pedicellate flowers are borne along the
main stem, with the oldest flowers at
5a. Basal leaf portion broadly winged makrut lime the base
9. solitary-growing singly
5b. Basal leaf portion narrowly winged Go to 6
6a. Fruits 2-3 cm in diameter Calamansi
6b. Fruits much larger Go to 7
7a. Fruits tight-skinned bitter orange
7b. Fruits loose-skinned mandarin orange
12. Ask your learners to compare their key with the one you showed them. After comparing, let them
answer the questions below:
I. What trait(s) or character(s) did you use to separate the fruits into groups? Give an example to
illustrate this.
II. Notice differences among fruits. These differences set them distinct from the others. Can you
give an example to show this?
13. Stress that the presence of similarities among organisms will place them in a group. Differences
among organisms would set them distinct from each other.
126
PRACTICE (45 MINS) Teacher Tip
Learners will still work as a group. Glossary of terms
1. axillary relating to or located in an
1. Present to each group photos of 4 unknown turtles. Assign a letter or number for each photo. axil: an axillary bud
Provide a dichotomous key for each group. 2. basal- located at or near the base of a
plant stem, or at the base of any other
2. Say, The world has six species of marine turtles with the green sea turtle having two subspecies.
plant part
The loggerhead, flatback, hawksbill, leatherback and green sea turtle are considered endangered. 3. berry fleshy fruit with many seeds
The olive Ridley is plentiful in some seas. The Philippines is a rich haven for these marine creatures derived from a single flower containing
owing that we are part of the Coral Triangle. Now NAME that TURTLE to save it! one ovary
4. foliage- collectively, a cluster of leaves
3. Ask learners to use the provided dichotomous key to determine the identity of the unknown turtles. 5. fascicled- in bundles or clusters; can
Check if the group got each species correct. Rank each group based on who accomplished the task be appied to stems, flowers or leaves
first. Then, ask each group the difficulties they encountered and how they overcame these 6. globose-rounded
7. petiole-the stalk that attaches the leaf
difficulties.
blade to the stem;
KEY TO COMMON SPECIES OF TURTLES 8. raceme- an inflorescence in which the
pedicellate flowers are borne along the
main stem, with the oldest flowers at
1a.Has scutes arranged in a distinct patterns forming medial, lateral, Go to 2 the base
and marginal positions on the carapace 9. solitary-growing singly
1b.Has no scutes on the carapace but has longitudinal ridges on the Leatherback turtle
carapace
2a. Medial scutes 5 Go to 3
2b. Medial scutes more than 5 Olive Ridley turtle
3a. Lateral scutes 4 Go to 4
3b. Lateral scutes more than four Go to 5
4a. Medial scutes imbricated and the beak is hooked Hawksbill turtle
4b. Medial scutes are not imbricated and the beak is not noticeably Go to 6
hooked
5a. With terminal scute at the centerline along the posterior margin of Kemps Ridley turtle
the plastron
5b. Without terminal scute at the centerline along the posterior Loggerhead turtle Teacher Tip
Practice more on using dichotomous keys
margin of the plastron
Practice makes Perfect!
6a. Posterior margin of the carapace pointed Black Turtle
Note:
6b. Posterior margin of the carapace rounded Go to 7 Write down the following in the board.
Dermochelys coriacea (Leatherback turtle)
7a. Lateral scutes of the carapace are noticeably larger than the Flatback turtle Lepidochelys olivacea (Olive Ridley turtle)
Eretmochelys imbricata (Hawksbill turtle)
medial scutes
Lepidochelys kempii (Kemps Ridley turtle)
Caretta caretta (Loggerhead turtle)
7b. Lateral scutes of the carapace are nearly the same size as the Green turtle
Chelonia mydas agassizii (Black Turtle)-
medial scutes subspecies of the Eastern Pacific green
turtle
Chelonia mydas mydas (Green turtle)
Take note of the assigned letter for each picture. - subspecies of the Eastern Pacific green
turtle
A Black Turtle E Kemps Ridley Turtle Natator depressus (Flatback turtle)
B Flatback Turtle F Leatherback Turtle Glossary of terms

1. Carapace-a bony or chitinous covering
C Green Turtle G Loggerhead Turtle on the dorsal part of the turtle
2. Imbricated- overlapping or layered as
D Hawksbill Turtle H Olive Ridley Turtle scales and shingles
3. Lateral-relating to the side or sides
4. Medial- relating to or situated toward
the middle
ENRICHMENT (15 MINS) 5. Plastron-the ventral part of the shell of
1. Ask the learners to submit an assignment on other practical uses of biological classification. the turtle
6. Posterior-located behind a part or
toward the rear of a structure; on or
EVALUATION (10 MINS) near the hind end
Group Work 7. Scutes-a chitinous bony external plate,
2. Divide the class into groups. Learners will still work as a group composed of four (4) members. Ask as on the shell of a turtle
8. Terminal-situated at, pertaining to or
learners to make their own dichotomous key in order to identify their favorite plants/ vegetables forming the end; towards the end
found in a school garden or for instance, in the market. Give them time to think and write down the
plants or in their own spare time they can also visit an actual garden. Ask learners to submit their
work the following meeting. Ask for difficulties they encountered and strategies they used to make
the task easy.
128

Evolutionary Relationships: Cladistics and
Phylogeny LESSON OUTLINE
Content Standard Motivation Caf Conversation 20
The learners demonstrate an understanding of Basic Taxonomic Concepts and
Principles, Description, Nomenclature, Identification and Classification Instruction Works in Pairs 50
Performance Standard Practice Constructing Cladograms 40

The learners shall be able to: Enrichment Test your Skill 30
make simple cladograms
Evaluation After Class: Peer Evaluation 10
Learning Competency
Materials
The learners should be able to describe species diversity and cladistics,
Writing materials, sheets of paper, photos of animals ( may be provided as
including types of evidence and procedures that can be used to establish worksheet)
evolutionary relationships STEM_BIO11/12IIIh-j-16
Resources
Specific Learning Outcomes (1) Reece JB, Urry LA, Cain ML, Wasserman SA, Minorsky PV, Jackson RB.
At the end of the lesson, the learners will be able to: Campbell Biology.10th edition. San Francisco, California, USA: Pearson
Education Inc.; 2014. 551-558 pp.
demonstrate how shared derived characterscan be used to reveal degrees (2) Taxonomic Classification and Phylogenetics Trees.trees.http://
of relationship; and www.mhhe.com/biosci/pae/zoology/cladogram/index.mhtml. 17
August 2015
build cladograms to infer evolutionary relatedness (3) Cladogram and Phylogenetic Trees:Evoution Classifications.http://
study.com/academy/lesson/cladograms-and-phylogenic-trees-
evolution-classifications.html. 17 August 2015.
(4) Constructing a Phylogenetic tree. http://evolution.berkeley.edu/
evolibrary/article/0_0_0/phylogenetics_11. 17 August 2015.
Here are some definition of terms:
1. Introduce the following learning objectives using any of the suggested protocols (Verbatim, Own Phylogeny- the evolutionary relationships
words, Read-aloud) among organisms
I. I can demonstrate how shared derived characterscan be used to reveal degrees of relationship. Cladogram- a phylogenetic tree that shows
II. I can build cladograms to infer evolutionary relatedness. relationship of taxa based on shared
derived characters
Review
1. Say, Look around you, and see the enormous diversity the natural world has to offer. However, Character- any trait of an organism that
can be described or measured
amidst such diversity is also an amount of similarity which you can observe. This gives us the idea
that somehow, organisms are indeed related. Life is somehow interconnected to each other. Character state- describes the character.
Systematics is the study of the diversity of organisms in the evolutionary context. It intends to use A particular character can have several
character states.
phylogeny in classifying organisms. Phylogeny is the study of the evolutionary history and
relationships among organisms. Evidences from a wide variety of sources including paleontology, Example: Corolla is a character. Character
embryology, morphology, anatomy and molecular biology can be used to establish phylogeny. states can be: shape of the corolla, color of
corolla, number of petals comprising the
Over the last few centuries systematists have developed different approaches to show relationships
corolla.
among organisms. The most commonly used is cladistics.
2. Discuss briefly: Homologous characters - characters having
similar structures because these were
Cladistics studies relationships between taxa using shared derived characters. The basic derived from a common ancestor
assumption behind cladistics is that members of a group share a common recent ancestor and are
thus more "closely related" to one another than they are to other groups of organisms. Related Analogous characters-characters that have
separate evolutionary origins, but are
groups of organisms are recognized because they share a set of derived characters. These derived
superficially similar because they perform
characters were inherited from a recent ancestor. the same function. Analogous characters
3. Ask your learner to define the following terms in their own words: are the result of convergent evolution.
I. analogous character Example: Bird and bat wings areanalogous

II. character since both are used for flying.
III. character state Clade- a group of taxa consisting of an

IV. clade ancestor and all of its descendant taxa
V. cladogram
VI. homologous character
VII. phylogeny
130
4. Stress that similarities among existing organisms (including morphological, developmental, and
molecular similarities) reflect common ancestry and provide evidence for evolution.
I. Outline:
A. shared derived characterscan be used to reveal degrees of relationship
B. constructing and interpreting a phylogenetic tree

Caf Conversation
1. Ask learners: Do you remember the last time you had a family reunion? A summer vacation or a
family barbecue and the latest family picture taken together? Can you describe your family
members? What makes you similar to them and what makes you unique? Teacher Tip:
Suggestion: Include a website or video that
2. Ask learners to list characters or features that served as evidences (e.g. morphological, genetic, etc.)
learners can view to understand how to
that indeed they belong to the same family. Ask learners to note as many as they can think of. construct a cladogram. Explain the rationale
of the activity.
Sample responses:
Color of the eyes (e.g. brown, black)
Texture and color of the hair (e.g. curly black hair)
Color of the skin (e.g. fair complexion)
Blood type (e.g. A, AB, O, B)
Height
Shape of the nose
3. Explain, Basically, a family picture represents a family tree. Family trees show how people are
related to each other. Similarly, scientists use phylogenetic trees like cladograms to study the
relationships among organisms. Sometimes, family trees are used to show relationships between
individuals. Those who are closely related are located closer together than those who are only
distantly related. For instance, in a family tree, we can see that the siblings are close together,
indicating a close genetic relationship. But the siblings are far from their great aunt, indicating a
more distant genetic relationship. Family trees can also be used to see ancestral connections. That
is, we can see that all the people in the last generation have the same great-great-grandparents in
common.
This same idea of relationships can be used in science. Biologists use phylogenetic treesto Teacher Tip:
illustrate evolutionary relationships among organisms. Constructing a phylogenetic tree is one
way to visualize evolutionary relatedness. In
this activity, guide learners on how to
4. Stress that for the succeeding activities, focus will be on constructing and interpreting a simple construct their own tree from a set of
animals provided, using only observable
phylogenetic tree.
physical features.
This activity gives learners an opportunity to
INSTRUCTION (50 MINS) classify organisms on their own, and they
can visualize the types of evidence used to
Discussion: show evolutionary relationships.
A. shared derived characterscan be used to reveal degrees of relationship
Due to the open-ended nature of this
B. constructing and interpreting a phylogenetic tree activity, learners will come up with many
different combinations and layouts.
However, the end result should be an
Work in Pairs and Build that Tree evolutionary tree that shows the basic
1. Ask learners to choose a partner and work in pairs. relationship among animals. Arthropods
such as the spider and moth should be far
2. For this activity, present to learners a diverse group of vertebrates and ask them to make a apart from an aquatic mammal such as the
phylogenetic tree showing their evolutionary relationships. This tree should be primarily based on walrus.
physical characteristics, such as: This is also a good opportunity to gauge
how well learners understand the basis of
I. Presence or absence of a backbone different classifications, such as reptile,
II. Ability to breathe in air or water amphibian, and mammal.
III. Cold or warm blooded Phylogenetic systematics emphasize

IV. Carnivore, herbivore, or omnivore descent and common ancestry in order to
determine the evolutionary history of
V. Presence or absence of hair/fur groups of organisms as a determining factor
VI. Any other external structures such as horns in classification
132
Note: The following outline drawings of animals are provided for the activity. These can be printed and cut out for learners to work with.
3. Ask learners to work in pairs and individually cut out each animal, including the name.
4. Ask them to lay all the animals on their desks and separate them into two groups using the presence or absence of a backbone as the first
character.
5. On a separate sheet of paper, start constructing the phylogenetic tree like the one shown below.
6. Ask learners to continue separating the animals into smaller groups using the characters in number two.
7. When an animal reaches the tip of the branch, glue it. Repeat for all other animals in the
collection.
8. Ask volunteers to present their phylogenetic tree in class.
PRACTICE (40 MINS)
1. Learners will still work in pairs.
2. Ask each pair to construct a cladogram based on the data provided.
Homalozoa
Echinoid Asteroid Crinoid Holothuroid Opthiuriod
(Outgroup)
Water vascular system YES YES YES YES YES YES
Number of ambulacral grooves 3 5 5 5 5 5
Madreporita Aboral Aboral Aboral None Internal Oral
Suckers Non on podia On podia On podia Absent On podia On podia
Closed ambulacral grooves No Yes Yes No Yes Yes
Aboral surface reduced No Yes No No Yes Yes
Ambulacral grooves extended from oral No Yes No No Yes No

to aboral
Endoskeleton Highly flexible Not flexible Flexible Highly flexible Highly flexible Highly flexible
Constructing a Cladogram
1. Ask learners to use the data below to arrange the groups of organisms based on their shared
derived traits. This time you will be using distantly related organisms or a taxon termed an
outgroup.
2. For each group, the traits or characters are already listed. For each character, determine which
state is ancestral or primitive and which is derived. This is usually done by comparing with the
outgroup. Traits found in the outgroup are likely to be ancestral or primitive. Similarly, traits not
found in the outgroup are considered as derived. In cladistics, it is the derived trait shared among
taxa that should be placed in the cladogram.
3. Group taxa according to their sharedderived character(s).
4. Once you have evaluated all the characters, you may start constructing your cladogram. Where do
you place the outgroup?... (Correct, an outgroup is always placed at the base of the cladogram.)
5. Choose a learner to present the cladogram. After this, show them the correct cladogram below.
134
ENRICHMENT (30 MINUTES)
1. Now you're getting the hang of this! Once again, use the data below to arrange organisms based on their shared derived characters. This
time work again with your partner and test your skill in building a cladogram.
Of course, this was just an example of the tree-building process. Phylogenetic trees are generally based on many more characters and often
involve more lineages. For example, biologists reconstructing relationships between 499 lineages of seed plants began with more than 1,400
molecular characters.
EVALUATION (10 MINUTES)

1. Go online. Choose a group of organisms you are interested to work with (e.g. invertebrates);
2. Download pictures of different species.
3. Print the pictures. In tabular form, list all the characters. Evaluate the characters (whether primitive or derived).
4. Remember that in building your cladogram, use only shared derived characters.
5. Construct your own cladogram.
6. Share this with your seat mate and discuss your cladogram.
7. The outputs may be submitted as soon as it is discussed.
8. Learners can compare their work and provide each other with feedback (peer assessment). Remind learners to make specific suggestions
and recommendations and what could be improved. Ask for difficulties they encountered and strategies used to make the task easy.
17.1: Introduction to Reproduction

The learners demonstrate an understanding of Asexual and Sexual Modes of
Reproduction
Motivation Pictures of Different Types of 10
Reproduction
discuss the advantages and disadvantages of sexual and asexual Instruction Discussion on Two Forms of 45
reproduction Reproduction
Learning Competency Enrichment Reporting on Specific Examples of

The learners should be able to compare various modes of asexual and sexual Asexual and Sexual Reproduction
reproduction (STEM_BIO11/12-IVa-h-1) Materials
Specific Learning Outcomes Pictures of different examples of reproduction, materials for
At the end of the lesson, the learners will be able to: reporting (i.e. LCD projector and computer or illustrations on
Manila paper)
differentiate asexual from sexual reproduction; and
describe different modes of sexual and asexual reproduction Resources
(1) Hickman, C.P. Jr., Roberts, L.S., Larson, A. and lAnson, H.
2004. Integrated Principles of Zoology, (12th ed). McGraw-
Hill Education.
Minorsky, P.V., and Jackson, R.B. (2012). Campbell
Biology, (9th ed). The Benjamin Cummings Publishing Co.,
Inc.
136
Tell the learners that the list of defined
Communicate Learning Objectives terms need not be memorized. They are to
Introduce the following learning objectives: be mentioned during the course of the
discussions.
1. I can differentiate asexual and sexual modes of reproduction.
2. I can describe different modes of sexual and asexual reproduction.
Relevant vocabulary
1. Asexual reproduction - Mode of reproduction that does not involve the use of gametes or sex cells
2. Sexual reproduction - Mode of reproduction that involves the use of gametes or sex cells
3. Fission - Type of asexual reproduction involving the division of body into two or more equal parts
4. Fragmentation - Type of asexual reproduction where the body breaks into two or more parts, with
each fragment capable of becoming a complete individual; in animals, fragmentation is usually
followed by regeneration where the missing parts are produced. For example, a lost arm of the
starfish may be regenerated by mitotic cell divisions.
5. Budding - Type of asexual reproduction where a new individual arises as an outgrowth (bud) from
its parent, develops organs like those of the parent, and then detaches itself. Figure 1. Paramecium undergoing
6. Sporulation - Type of asexual reproduction where a new individual forms from an aggregation of asexual reproduction through fission
cells surrounded by a resistant capsule or spore, which later on germinates
7. Isogamy - Fusion of similar gametes which are usually motile
8. Heterogamy - Fusion of dissimilar gametes. In oogamy, a large immotile gamete, the egg is
fertilized by a small motile gamete, the sperm.
9. Bisexual reproduction - Type of sexual reproduction involving the union of gametes from two
genetically different parents
10. Hermaphrodite - An individual with both male and female reproductive tissues. In animals self
fertilization is not common. In worms, a hermaphrodite needs a male to donate sperms in order to
fertilize the oocytes in its body.

1. Show pictures of the following:
A. Paramecium undergoing fission (see figure 1) Figure 2. Asexual reproduction
B. Hydra undergoing budding (see figure 2) through budding in Hydra
C. A filamentous alga, i.e. Spirogyra, or a starfish arm undergoing fragmentation (see figure 3)
D. A fungus, i.e. Rhizopus, producing conidia/spores (see figure 4)
E. Two frogs in amplexus (see figure 5)
Provide this narrative to the class:

The following pictures depict reproduction across different organisms. As animals, we are only
Figure 3. Asexual reproduction
familiar with one form of reproduction, particularly the form depicted by the frogs in amplexus.
through fragmentation
However, there are other forms of reproduction that exist in nature. Can you spot differences
among the depicted forms of reproduction?

Discussion
1. Differentiate asexual and sexual reproduction.
2. Types of asexual reproduction and give examples
I. Fission- Paramecium as example
II. Budding- Hydra as example
III. Fragmentation- filamentous alga, i.e. Spirogyra or Oedogonium, and a detached starfish arm
growing lost parts as example
IV. Sporulation- fungus, i.e. Rhizopus, as example Figure 4. Fungi undergoing asexual
reproduction through sporulation
3. Describe types of union of gametes and give examples
I. Isogamy- Chlamydomonas producing gametes or Spirogyra undergoing conjugation as
example
II. Heterogamy- animal sperm and egg as examples
4. Special terms for sexual reproduction
I. Bisexual reproduction. Examples are in humans, and papaya among others.
II. Hermaphrodites- barnacles; worms
Figure 5. Frogs mating (in

amplexus)
138
5. Summarize differences between asexual and sexual reproduction Teacher Tips:
Emphasize that in asexual reproduction, an
ASEXUAL REPRODUCTION SEXUAL REPRODUCTION offspring is genetically identical to the
parent, which means the offspring is a
Number of parents involved one two CLONE of the parent. Sexual reproduction,
on the other hand, generally produces
Gametes No need for gamete union Present; sperm has to fertilize variation in the offspring because this
the egg results in the recombination of genomes
from the parents gametes.
Genetic composition of offspring Genetically identical to parent Generally are hybrids of parents
Note that sporulation is very rare in animals
(Clone)
and are only exhibited in some organism
like sponges.
ENRICHMENT Note that isogamy may involve either

1. Ask the learners to research on the advantages and disadvantages of asexual and sexual flagellated gametes (as in the case of
Chlamydomonas) or non-flagellated cells or
reproduction. They will then submit their assignment during the next meeting. structures (as in the case of Spirogyra)
2. If microscopes are available, slides of the organisms mentioned above may be observed. The
teacher may ask the learners to draw the specimens under low power and high power objectives of
the microscope.
Lesson 17.2: Compare and Contrast

Process in Plants and Animals: Reproduction
and Development
LESSON OUTLINE
Content Standard
The learners demonstrate an understanding of Animal Reproductive Organs Motivation Start of Drosophila Life Cycle of 30
and Their Functions; Processes in development Experiment
Performance Standard Instruction Discussion of Different Stages of Animal 145

The learners shall be able to: Development
illustrate the life cycle of the common fruit fly, Drosophila/ Debate on when Enrichment Illustration of the Life Cycle of 30
human life begins Drosophila
Learning Competency Materials
The learners should be able to describe processes in the life cycle of animals Wide-mouthed clean and empty bottles, potatoes or sweet potatoes or
and explain the process of human development STEM_BIO11/12-IVa-h-1 bananas, fruit flies, shallow basin, pen and paper, pictures of humans at
different stages of development
describe the different stages of animal development;
2004. Integrated Principles of Zoology, (12th ed). McGraw-
differentiate the developmental process in monozygotic and dizygotic Hill Education.
twins;
describe human reproductive organ systems; Minorsky, P.V., and Jackson, R.B. 2012. Campbell Biology,
illustrate the human female menstrual cycle; (9th ed). The Benjamin Cummings Publishing Co., Inc.
explain processes in human development; and (3) Sheridan, M. 1999. Instructors guide for Biology, 5th ed.
differentiate various forms of contraception in humans By Campbell, Reece, Mitchell. Addison Wesley Longman,
Inc.
140
Note that even unicellular forms like
Communicating Learning Objectives bacteria and fungi also undergo
1. Introduce the following learning objectives using any of the suggested protocols (Verbatim, Own development
words, Read-aloud)
I. I can describe the different stages in animal development.
II. I can differentiate the developmental process in monozygotic and dizygotic twins.
III. I can describe the human reproductive organ systems.
IV. I can illustrate the human female menstrual cycle.
V. I can explain processes in human development.
VI. I can differentiate various forms of human contraception.
Relevant Vocabulary
1. Development- involves formation of sex cells, zygote formation, subsequent stages in ones life
span. Development is terminated by death.
2. Haploid (n) condition- When a cell has only half the chromosome number or only one set of
chromosomes
3. Diploid (2n) condition- When a cell has the full chromosome number or two sets of chromosomes
4. Totipotent cell- A cell that is capable of differentiating to become any kind of cell
5. Gametogenesis- Stage of development that yields haploid gametes
6. Fertilization- Stage of development that results in a unicellular diploid zygote
7. Cleavage- Stage of development involving a series of mitotic divisions to produce a multicellular
blastula from a unicellular zygote
8. Gastrulation- Stage of development involving morphogenetic movements of the cells to produce
a gastrula with distinct germ cell layers; in vertebrates, this will result in three layers: the outermost
ectoderm; the inner endoderm, and the middle layer, the mesoderm
9. Organogenesis- Stage of development where the different germ layers differentiate into specific
organ systems
10. Growth- Stage of development characterized by an increase in size of an individual
11. Monozygotic twins- Also known as identical twins; result from the union of a sperm and egg to
form a single zygote that splits up during the first cleavage stage. Figure 1. Different stages of human
development
12. Dizygotic twins - Also known as fraternal twins; results from the development of two or more
separate fertilization events where the resulting zygotes develop almost simultaneously
13. Testis- Where sperms are produced
14. Epididymis- Where sperms are temporarily stored
15. Scrotal sac/scrotum - Supports the testis and epididymis
16. Vas deferens - Where the sperm passes through from the testis before it joins the urethra
17. Urethra - Connected to the urethra and the urinary bladder; serves as passageway of both sperm
and urine and terminates in the external urinary meatus of the penis
18. Seminal vesicle - Secretes fluid that forms part of the semen; secretion gives the semen its alkaline
characteristic to counteract the acidity of the vaginal tract and therefore protect the sperm; the
fluid also contains sugars like fructose
19. Prostate gland - Secretes fluid that also provides alkalinity to the semen; it also contains
proteolytic enzymes, citric acid, phosphatases, and lipids
20. Bulbourethral glands- Paired glands that produce clear, viscous secretion known as pre-ejaculate
that helps to lubricate the urethra for sperm to pass through, neutralizing traces of acidic urine in
the urethra, and helps flush out any residual urine or foreign matter Figure 2. Human male reproductive
21. Clitoris- The homologue (equivalent) of the penis in females system. (See vocabulary for
22. Vagina- Main entrance to the female reproductive tract; receives the penis during sexual definition of terms.) (Wikipedia-
Blausen.com staff. "Blausen gallery
intercourse
2014".Wikiversity)
23. Cervix- Where the vagina ends; projection of the uterus into the vagina; leads to the uterus
24. Uterus- Also known as the womb; where the embryo develops; with thick muscular walls, blood
vessels; and the endometrial lining
25. Endometrial lining/endometrium- Innermost lining of the uterus where the embryo implants and
develop
26. Fallopian tubes- Also known as oviducts; paired tubes that are connected to the uterus and
terminate near the ovaries; this is where fertilization takes place
27. Ovaries- Female gonads that release the oocytes during ovulation, which are then caught by the
fimbrae of the fallopian tubes in order for the oocytes to pass on to the fallopian tubes
28. Morula- A human blastula made up of a solid ball of cells
29. Blastocyst- A human blastula composed of the inner cell mass, which becomes the embryo, and
the trophoectoderm, which becomes the placenta
142
30. Implantation- Process where the blastocyst implants itself in the endometrium; this signals the start
of pregnancy
31. Gestation- Carrying of the embryo inside the female reproductive tract, specifically the uterus; can
last up to 9 months in humans
32. Human embryo- Corresponds to the first two months of gestation
33. Human fetus- Corresponds to the months 3-9 of human gestation
34. Follicular phase- Part of the menstrual cycle of the ovary in humans where the follicles begin to
mature; it is marked by secretions of the follicle-stimulating hormone (FSH) and the leutinizing
hormone (LH) by the anterior pituitary gland and the estrogen by the ovaries; both FSH and LH
stimulate the maturation of the oocytes while estrogen stimulates uterine lining growth in Figure 3. Human female
preparation for implantation of the embryo reproductive system. (See
35. Luteal phase- Part of the menstrual cycle of the ovary after the oocytes are released from the vocabulary for definition of terms.)
follicles; the remains of the follicle become the corpus luteum, which then secretes progesterone, (Wikipedia)
which stimulates the uterus to undergo final maturational changes that prepare it for gestation to
house and nourish an embryo
36. Menstrual phase- Part of the menstrual cycle of the uterus; also known as the period;
corresponds to the early part of the follicular phase of the ovaries (days 1-5) when endometrium
degenerates and sloughs off, producing the menstrual discharge
37. Proliferative phase- Part of the menstrual cycle of the uterus; corresponds to the latter part of the
follicular phase of the ovaries (days 8-14) when the endometrium heals and begins to thicken as a
consequence of estrogen secretion
38. Secretory phase- Part of the menstrual cycle of the uterus; corresponds to the luteal phase of the
ovaries; the endometrium undergoes final changes before it receives the embryo during
implantation
39. Contraception- Process that blocks any one of the following stages of reproduction in humans: (1)
release and transport of gametes; (2) fertilization; (3) implantation; (4) actual completion of
development of the embryo/fetus
40. Ovulation-suppressing methods- Type of contraception that prevents the oocyte to mature
41. Oral contraceptives- Type of contraception taken in by women to prevent them from ovulating
42. Barrier methods- Type of contraception that prevents fertilization
43. Condom- Type of barrier method that is inserted on the male penis to prevent release of sperm
into the female reproductive tract
44. Diaphragm- Type of barrier method that blocks the cervix, thereby preventing the passage of the
sperm into the uterus
45. Cervical cap- Type of barrier method that covers the cervix and blocks passage of the sperm into
the uterus
46. Spermicidal jelly or foam- Type of barrier method that kills the sperm on contact; they are placed
inside the vaginal canal
47. Surgical methods- A special type of contraception preventing fertilization that involves surgery
48. Vasectomy- Type of surgical method for men; entails cutting the vas deferens
49. Tubal ligation- Type of surgical method for women; entails cutting the fallopian tubes
50. Implantation-suppressing methods- Type of contraception that prevents the blastocyst from
being implanted in the endometrium
51. Intra-uterine devise (IUD)- Type of implantation-suppressing method that physically blocks the
blastocyst form implanting into the endometrium
52. Morning-after pill- Type of implantation-suppressing method that blocks the action of hormones
that prepare the uterus to receive the embryo
53. Abortion- Type of contraception that involves the deliberate removal of the embryo/fetus before it
completes gestation
54. Coitus interruptus- Type of contraception that requires the man to remove the penis before
ejaculation
Figure 4. Different types of
55. Abstinence- Type of contraception where the man and the woman do not engage in sexual contraceptives
intercourse
144
1. Show a picture of the fruit fly, Drosophila. (see Figure 5)
2. Then, provide this narrative to the class:
This is the fruit fly, Drosophila. Like all organisms, it goes through development as manifested by
its life cycle. Let us characterize its development by making observations of its life cycle.
3. Divide the class into groups of four, after which he/she explains how to conduct the Drosophila
life cycle experiment (see details of the experiment at the end of this document). The learners will
carry out the experiment for the next two weeks. Figure 5. Drosophila melanogaster
(Wikipedia)
INSTRUCTION (145 MINS) Teacher Tips:

1. Define development and life cycle Explain that development starts with
I. Stages of Animal Development formation of sex cells and ends only by
death. Until the old age of a person, for
A. Gametogenesis example, some cells still develop or divide.
i. Recall meiosis from Grade 11
The teacher should note that during
ii.Differentiate diploid and haploid cells within the context of meiosis gastrulation, the fates of the cells are
B. Fertilization beginning to be determined. The cells
started out as totipotent in cleavage, but as
C. Cleavage the cells are moved around through
i. Define totipotent cells within the context of cleavage in vertebrate animals morphogenetic movements, they become
more specialized in terms of their fates as
D. Gastrulation - formation of three germ layers: ectoderm, mesoderm and endoderm. Each they get assigned to specific germ layers.
will give rise to specific tissues and organs.
The teacher should note that identical twins
E. Organogenesis
result from an accident during cleavage
i. Show fates of each germ layer in a typical vertebrate animal (see table 1 at the end of this when totipotent cells, whose fates have not
document) yet been determined, are separated and
continue with their development
F. Differentiation and Growth independently of each group of cells.
2. Differentiate monozygotic and dizygotic twins. Identical twins should have identical gender,
whereas fraternal twins may have different
biological sex.
3. Differentiate human male and female reproductive organs
Teacher Tips:
Emphasize that pregnancy officially
I. Human male reproductive system commences only when the embryo
(blastocyst) has successfully implanted into
A. Show illustration of human male reproductive system and give the function of each part
the endometrium.
II. Human female reproductive system
Discuss the topic of contraception with as
A. Show illustration of human female reproductive system
much objectivity as possible. If the teacher
cannot teach the topic on the ground of his/
her religious convictions, then the teacher
4.Describe human development
should refer the task to another teacher
I. Fertilization - Occurs in the fallopian tube; results in a unicellular zygote who may be willing to teach this sensitive
topic.
II. Cleavage- Also takes place in the fallopian tube after fertilization
III. Describe Morula and Blastocyst Emphasize that abortion should never be
done.
IV. Implantation- Attachment of blastocyst to endometrium of uterus; start of pregnancy
V. Gestation- Differentiate embryonic development from fetal development in terms of period Emphasize that elective abortion (when the
covered during gestation life of the mother is not threatened by the
pregnancy) is illegal in the Philippines.
5. Describe the events in the Menstrual Cycle Emphasize that abstinence is the only form
of contraception that is guaranteed 100%
I.Ovarian cycle: Follicular phase; Ovulation; Luteal Phase effective
II.Uterine cycle: Menstrual phase; Proliferative phase; Secretory phase
It is the your discretion whether you will
show pictures of contraceptives or not.
6. Contraception and its Types
I. Ovulation-suppressing methods- Oral contraceptives
II. Barrier methods- Physical (Condom, Diaphragm, Cervical cap)
III. Chemical- Spermicidal jelly and foam
IV. Surgical methods- Vasectomy and Tubal ligation
V. Implantation-suppressing methods- IUD and Morning-after pill
VI. Others: Abstinence
146
1. The learners carry out the Drosophila life cycle experiment, then submit the life cycle illustration to
the teacher after two weeks.
2. Show the following pictures (see figure 8 as sample):
I. Sperm and egg
II. Blastula (morula or blastocyst)
III. An embryo (less than two month) implanted in the uterus
IV. A fetus inside the uterus (3-9 months)
V. A baby
VI. An adult human
3. Provide this narrative to the class:
The following pictures show humans at various stage of development. Question: when do you think
human life begins? How about an embryo? How about a baby? Would you consider a single cell
like a sperm or egg human? If so, should a single cell from our body, like a red blood cell or liver
cell, be likewise considered human?
4. Group the learners into four and encourages them to discuss among themselves how their answer is
correlated to which type of contraception they may use, if any.
Materials
Wide-mouthed glass bottles
Potatoes or sweet potatoes or bananas
Paper
Rubber bands
Shallow basin
Procedure
I. Collecting wild fruit flies
A. Prepare a clean glass bottle with a wide mouth (i.e. Gatorade).
B. Place banana peels inside the bottle.
C. Leave the bottle open and set aside for a day in a cool, dry place. Table 1. Fates of the cells of each
D. When there are enough flies, cover the bottle with a piece of paper secured by a rubber germ layer in vertebrate animals
band.
GERM LAYER FATES
II. Culturing fruit flies Ectoderm Nervous system
A.Boil sweet potatoes or potatoes. Remove the skin, and mash. (Alternatively, bananas may be (brain and spinal
used, but do not boil them.) This will serve as the medium/ food for the fruit flies. cord),
B. Add a small amount of the food medium into a bottle. (The bottle should only be epidermis,
approximately 1/10 full.) Use the same type of bottle as that used to catch fruit flies so that the sense organs
mouth openings will be the same. Be sure to flatten the medium at the bottom of the bottle so Mesoderm muscles, bones,
that the medium will not fall off if the bottle is placed upside down. cartilage,
C. Transfer the fruit flies from the catch bottle to the culture bottle. Do this by placing the circulatory,
culture bottle on top of the catch bottle with their mouths touching each other. Remove the excretory, and
paper cover of the catch bottle and let the flies move to the medium bottle. When there are at reproductive
least 10 flies in the culture bottle, immediately cover the bottle with paper secured with rubber organs
bands.
Endoderm digestive and
D. Store the culture bottles in a cool, dry place in the class room or laboratory. Place the bottles
respiratory
on a shallow basin with water to prevent ants from going into the medium.
organs,
endocrine
III. Observing the life cycle of the fruit flies glands, germ
A. Take note of the date when the flies were cultured. This is indicative of the approximate time cells and
the eggs will be laid. gametes
B. Record the date when the larvae first emerged. These will appear as small maggots crawling
on the medium or at the inner side of the bottle. Draw or take pictures of the larvae.
C. Record the date when the pupae first emerged. These will appear as small cocoons sticking
at the inner side of the bottle. Draw or take pictures of the pupae.
D. Record the date when the adult flies first emerged. Draw or take pictures of the adult flies.
E. Draw the life cycle of the fruit fly. Include the approximate number of days it takes for each
stage to emerge based on observations.
148

Process in Plants and Animals: Reproduction
and Development
Content Standard
The learners demonstrate an understanding of Plant Reproductive Organs and LESSON OUTLINE
their Functions. Introduction Communicating Learning Objectives 5
Performance Standard Instruction Discussion of General Life Cycle of 115
The learners shall be able to: Plants, and the Parts of the Flower
identify the parts of the flower, classify flowers, and explain plant
Enrichment Classification of Flowers
development
Materials
Learning Competency
Gumamela flower, other flowers, scalpel blade, pencil and
The learners should be able to compare and contrast different types of plant
paper
life cycles, and explain processes in flowering plant reproduction and
development (STEM_BIO11/12-IVa-h-1) Resources
Specific Learning Outcomes 2004. Integrated Principles of Zoology, (12th ed). McGraw-
Hill Education.
enumerate the different types of reproductive cycles;
illustrate the life cycles of moss, fern, and flowering plant; Minorsky, P.V., and Jackson, R.B. 2012. Campbell Biology,
describe double fertilization in flowering plants; and (9th ed). The Benjamin Cummings Publishing Co., Inc.
explain processes in plant development. (3) Sheridan, M. 1999. Instructors guide for Biology, 5th ed.
By Campbell, Reece, Mitchell. Addison Wesley Longman,
Inc.
The glossary of terms need not be memorized.
Communicating Learning Objectives They are to be mentioned as the teacher
1. Introduce the following learning objectives using any of the suggested protocols (Verbatim, Own explains the different aspects of reproduction
words, Read-aloud) which are interconnected with processes of
development. For instance, reproduction
I. I can enumerate the different types of reproductive cycles. requires that sex cells be developed.
II. I can illustrate the life cycles of algae, moss, fern, and flowering plant.
Ask the learner to recall the differences
III. I can describe double fertilization in flowering plants. between mitosis and meiosis from Biology 1.
IV. I can explain processes in plant development
Relevant Vocabulary
1. Gametophyte - Stage of the life cycle of a plant that is haploid; stage that produces gametes
via mitosis; these gametes fuse to form a zygote that develops into a sporophyte
2. Sporophyte - Stage of the life cycle of a plant that is diploid; it is the most recognizable
structure in most flowering plants; it produces haploid spores by meiosis in structures called
sporangia
3. Haplontic life cycle - Life cycle where the haploid stage (gametophyte) is multicellular and the
only diploid stage is the fertilized egg cell
4. Haplodiplontic life cycle - Life cycle that includes multicellular diploid (sporophyte) and haploid
(gametophyte) generations
5. Diplontic life cycle - Life cycle where the diploid stage (sporophyte)is multicellular and the
haploid stage (gametophyte) is represented by the single-celled gametes
6. Angiosperms - Also known as flowering plants; group of plants that produce reproductive
structures called flowers in their sporophyte stages
7. Flower - Reproductive structure in flowering plants; made up of four major whorls
8. Sepals - The outermost whorls of a flower; collectively called the calyx
9. Petals - Whorl inner to the sepals; may be brightly colored in some; collectively called the
corolla
PARTS OF A GENERALIZED FLOWER.
10. Stamen - Whorl inner to the petals; the male reproductive structure of the flower; bears the
male sporangia (also known as microsporangia)
11. Anther - Part of the stamen that contains the microsporangia that develops into pollen grains
150
12. Filament - Part of the stamen that serves as the stalk of the anther
13. Pistil or carpels - Innermost whorl of the flower; the female reproductive structure of the flower;
bears the female sporangia (also known as the megasporangia)
14. Stigma - Part of the pistil where the pollen grain derived from the microsporangium attaches
during pollination
15. Style - Part of the pistil that serves as the stalk of the stigma; leads to the ovary
16. Ovary - Found at the base of the pistil; contains one or more ovules; eventually becomes the
fruit
17. Ovule - Contains the female sporangia or megasporangia; eventually becomes the seed
18. Complete flower - A flower with sepals, petals, stamens and carpels
19. Incomplete flower - A flower that lacks one or more of the floral whorls
20. Perfect flower - A flower that has both stamens and carpels; a bisexual structure
21. Imperfect flower - A flower that has only either the stamens (staminate flower) or the carpels
(carpellate flower); also known as a unisexual flower
22. Monoecious plant - A plant having perfect flowers or both staminate and carpellate flowers on
PARTS OF A GUMAMELA
the same individual Hibiscus rosa-sinensis
23. Dioecious plant - A plant having only either the staminate or carpellate flower
24. Pollination - The placement of the pollen grain from the anther to the stigma of a carpel
25. Pollen grain - The immature male gametophyte that develops within the anthers of stamens;
derived from the microsporocytes inside the microsporangia of anthers. Inside the mature pollen
grain, there is a tube cell and a generative cell. The tube cell develops into the pollen tube as it
enters the style and eventually enters the micropyle of the ovule. The generative cell divides into
two sperm nuclei and traverses the pollen tube
26. Embryo sac - The female gametophyte found inside the ovule; derived from the megasporocyte
inside the megasporangia; a mature embryo sac contains 8 nuclei. Eventually, these nuclei
become enveloped by membranes to become real cells. These are the one egg cell; two
synergids that flank the egg; two polar cells that are often fused; and three antipodals opposite
the synergids and egg.
27. Micropyle - The opening through the integuments of the ovule that surrounds the embryo sac;
this is where the pollen tube enters in order to reach the embryo sac
28. Endosperm - Part of the mature seed that is derived from the fusion of the sperm nucleus and
the two polar nuclei of the embryo sac. This becomes a nutritive tissue with triploid cells that
serves to store food for the developing embryo
29. Zygote - Part of the mature seed that forms as a result of the fusion of the egg and one of the
sperm nuclei
30. Cotyledon - Embryonic leaf that forms inside the seed
31. Monocot - A plant with only one cotyledon inside its seed (monocotyledonous)
32. Dicot - A plant with two cotyledons inside its seed (dicotyledonous)
33. Seed germination - Process that transforms a seed into a seedling
34. Imbibition - The first step in seed germination; absorption of water
35. Radicle - Embryonic root that emerges from the seed
36. Plumule - Embryonic shoot that emerges from the seed and breaks through the soil surface
37. Epicotyl - Part of the plumule above the cotyledon
38. Hypocotyl - Part of the plumule below the cotyledon

1. Divide the class into groups of four and will assign each group to bring flowers and fruits to
class. The flowers (particularly gumamela) and fruits will be used during the delivery of the
lesson.
2. Describe the general life cycle of plants: The mature, multicellular organism is a diploid
sporophyte. Later, some cells undergo meiosis to produce haploid gametes which are then
released. Gametes fuse and form the zygote which develops by mitosis to become the
multicellular diploid sporophyte.
3. In some plants, the dominant part of the life cycle is a multicellular, haploid gametophyte ( all
cells have a haploid chromosome number). Mitosis releases individual cells that can act like
gametes (gamete are produced by mitosis). The following terms should be mentioned:
Gametophyte, Gametangia, Sporophyte, Sporangia
GENERALIZED LIFE CYCLE OF PLANTS
152
4. Describe the different types of life cycles:
I. Haplontic life cycle
A. Show life cycle of the green alga Chara
i. Chara is a multicellular green alga related to higher plants because it has both
chlorophyll a and b and produce plant starch. Its dominant stage is a multicellular
haploid stage which produces gametes that eventually fuse to form unicellular zygotes.
Each zygote then undergoes meiosis to become haploid, after which it undergoes
mitosis to become the multicellular organism.
II. Haplodiplontic life cycle
A. Show life cycle of a moss (use figure 3 at the end of the document as reference)
i. A moss has a multicellular haploid (gametophyte) stage that produces gametes. These LIFE CYCLE OF THE GREEN ALGA CHARA,
gametes fuse to produce a zygote that undergoes mitosis to produce a multicellular DEPICTING A HAPLONTIC LIFE CYCLE
WHERE THE DOMINANT STAGE IS A
sporophyte. Within a part of the sporophyte called the capsule, cells undergo meiosis to
MULTICELLULAR HAPLOID ORGANISM
produce meiospores. These spores are eventually released and germinate by dividing (GAMETOPHYTE) AND THE ONLY DIPLOID
mitotically to become a multicellular gametophyte. STAGE IS THE ZYGOTE WHICH UNDERGOES
MEIOSIS
III. Diplontic life cycle
A. Type of life cycle found in flowering plants (and in most animals). The organism is in the
diploid stage ( all cells are diploid in chromosome number) except for mature, haploid sex
cells which are called gametes.
5. The flower
I. The four major whorls
A. Sepals
B. Petals
C. Stamen with Anther and Filament
D. Carpels- with Stigma, Style, Ovary and Ovule LIFE CYCLE OF A MOSS, DEPICTING A
II. Types of flowers based on the presence of the whorls HAPLODIPLONTIC LIFE CYCLE WHERE BOTH
THE DIPLOID (SPOROPHYTE) AND HAPLOID
A. Complete (GAMETOPHYTE) STAGES ARE
B. Incomplete MULTICELLULAR. THE MOSS PLANT PROPER
IS A GAMETOPHYTE.
III. Types of flowers based on the presence of reproductive whorls
A. Perfect / Bisexual
B. Imperfect / Unisexual
i. Staminate flower
ii. Carpellate flower
Exercise: use the exercise given at the end of this section to identify different floral parts.
Plant types based on the presence of reproductive structures: Monoecious or Dioecious

Development in flowering plants
I. Gametophyte - Development through gametogenesis (use figure 6 to illustrate
gametogenesis in flowering plants)
A. Male gametophyte - The microsporangium in the anther contains numerous
microsporocytes. Each microsporocyte will undergo meiosis to produce four haploid
microspores each microspore develops into a pollen grain (containing two sperm nuclei
and one tube nucleus) GAMETOGENESIS IN FLOWERING
B. Female gametophyte - The megasporangium in the ovule contains megasporocytes. PLANTS
One megasporocyte will undergo meiosis to produce four haploid megaspores three
megaspores degenerate remaining megaspore divides mitotically three times, an
embryo sac with eight haploid nuclei membranes partition to make the embryo sac
multicellular
II. Pollination
A. Transfer of pollen grain from the anther to the stigma
B. May be animal-aided or wind-aided
III. Double fertilization
A. Inside a pollen grain there is a tube cell and generative cell generative cell divides to
produce two sperm cells while the tube cell becomes pollen tube pollen tube elongates
along the style and penetrates the ovule in the ovary via the micropyle (an opening)
pollen tube discharges the sperm cells into the embryo sac inside the ovule one sperm
unites with the egg to form the zygote while the other sperm fuses with the polar nuclei
to become the endosperm, which serves as food of the early embryo
DOUBLE FERTILIZATION IN
154 FLOWERING PLANTS
IV. Embryo development (embryogenesis)
A. Zygote divides mitotically to produce the proembryo and suspensor, which anchors the
proembryo and transfers nutrients from the parent plant to it cotyledons appear on the
proembryo (monocots have only one cotyledon whereas dicots have two) proembryo
elongates into an embryo.
V. Maturation of ovary and ovule
A. Ovary matures into fruit while the ovule becomes the seed. The seed may become
dormant for some time.
VI. Seed germination
A. Transformation of seed to seedling
B. Seed undergoes imbibition to break dormancy nutrients stored in the endosperm or
cotyledons are digested and transferred to the growing regions of the embryo to primary
meristems (protoderm, ground meristem, procambium) develop to radicle emerges to
plumule breaks through the soil surface
i. Epigeal germination occurs when the cotyledon emerges above ground, thereby LIFE CYCLE OF FLOWERING PLANTS
exposing the hypocotyl of the plumule.
ii. Hypogeal germination occurs when the cotyledon remains below ground, thereby
concealing the hypocotyl.
VII. Seedling growth to mature plant
A. Primary meristems differentiate to become the different plant tissues
TYPES OF GERMINATION
Teacher Tip:
ENRICHMENT Seeds can be dormant when conditions become
1. What could be the significance of the ability of flowering plants to produce seeds? What harsh or dry, then germinate when conditions
advantages does a seed provide? become favorable, i.e. presence of moisture.
Fruits allow better dispersal of the seeds in
2. What is the advantage of having seeds covered in fruits? order to minimize competition for resources
with their parents. Fruits encourage animals to
consume them, discarding the seeds in the
process. Other fruits physically disperse the
seeds, as seen in the wings of the fruits of
dipterocarps, also known as samara.
EXERCISE ON PLANT REPRODUCTION
Materials
1. Gumamela flower
2. Scalpel blade or sharp pencil
3. Optional: other available flowers
Procedure
1. Obtain a flower of gumamela (Hibiscus rosa-sinensis).

2. Locate the outermost floral whorl. You can find it at the base of the flower and resembles a green crown. These are the sepals, collectively
called the calyx. Inner to the sepals but extending beyond them are the prominent petals, collectively known as the corolla.
3. At the center of the flower is a prominent tube. This is called the staminal tube. Surrounding the tube are minute stalks with yellow bulbous
tips. These are the stamens. The bulbous tips are the anthers containing the microsporangia while the stalks are the filaments.
4. At the very tip of the staminal tube are five bulbous structures, each borne on a stalk that fuses with the other stalks as they go down the
staminal tube. The structures at the tips are the stigmas of the carpels while the stalks are the style.
5. Remove the petals carefully so as not to damage the base. Using a scalpel blade or the sharp end of a pencil, make an incision from the tip
of the staminal tube down to the base. Carefully open the staminal tube to reveal the rest of the fused styles. Follow the styles until they
terminate at the base. This base is the ovary.
6. Draw the flower and label the following parts: petals, sepals, stamens, anther, filament, carpels, stigma, style, and ovary.
156
7. Optional investigation: do the same for other flowers available. Draw and label the parts. Using all the flowers used in this exercise, classify
them as to whether they are complete or incomplete, perfect or imperfect.
Table 1. Fates of the primary meristems in flowering plant development
PRIMARY MERISTEM MATURE TISSUE
Protoderm Epidermis
Ground meristem Cortex, pith
Procambium Primary xylem, primary phloem, vascular cambium, cork cambium, secondary meristems

Process in Plants and Animals: Nutrient
Procurement and Processing (1 of 3)
Content Standard
LESSON OUTLINE
The learners demonstrate an understanding of plant and animal organ systems
for nutrient procurement and processing and their functions. Introduction Communicating Learning Objectives 5
Performance Standard Motivation Review Physiological Processes 5

Instruction Lecture on Plant Nutrition 25
enumerate the structures or organs involved in nutrient procurement and
processing in plants and animals; Practice Drawing Activity or Laboratory Work 15
describe the functions of structures or organs involved in nutrient Enrichment Quiz 5

procurement and processing; and
explain how food is processed in a mammalian digestive system
Materials
Learning Competency Microscopes and slides of monocot and dicot root cross sections. In the
The learners shall be able to compare and contrast nutrient procurement and absence of microscopes, visual aids on monocot and dicot root cross
sections.
processing in plants and animals. STEM_BIO11/12-IVa-h-1
Resources
Specific Learning Outcomes (1) Barrion AA, Tudor MFVA, Colle MCD, Reamillo MCS, and MAP Robles.
At the end of the lesson, the learners will be able to: 2000. BIOLOGY II Laboratory Manual: An Investigative Approach.
define nutrient and cite the nutritional requirements of plants and animals; Institute of Biological Sciences, College of Arts and Sciences, UP Los
Baos. ISBN 971-547-099-8. 140p.
enumerate nutritional adaptation by plants and feeding mechanisms in (2) Johnson GB and PH Raven.1996. BIOLOGY: Principles and
animals; Explorations.Austin, USA: Holt, Rinehart and Winston. 1072p.
(3) Reece JB, Urry LA, Cain ML, Wasseman SA, Minorsky PV, and RB
distinguish different kinds of digestive compartments in animals; and
Jackson. Campbell Biology. Tenth Edition. Boston, USA: Pearson
trace the pathway of food processing in a mammalian/human digestive Education, Inc. 1279p.
system. (4) Starr C and R Taggart. 2004. BIOLOGY: The Unity and Diversity of Life.
Tenth Edition. Australia: Thomson Brooks/Cole. 933p.
158
Communicating Learning Objectives Teacher Tip
The teacher may engage the attention of students
1. Give the overview of the lesson by enumerating the learning objectives.
by bringing food (e.g. fruits, nuts, biscuits, etc.) to
2. Present the topic outline for Nutrient Procurement and Processing. An example is given the class as an introduction for nutrition.
below:
I. Plant Nutrition Teacher Tip
The topic on Nutrient Procurement and Processing
A. Nutritional requirements of plants can be divided into three parts, with one-hour
B. Routes for absorption of water and minerals across the roots session being allotted for each part.
Part I. Plant Nutrition (1 hour)
C. Nutritional adaptations by plants Part II. Animal Nutrition (1 hour)
II. Animal Nutrition Part III. The Human Digestive System (1 hour)
A. Nutritional requirements of animals

B. Food uptake in cells
C. Variations in feeding mechanisms and digestive compartments in animals
III. The Human Digestive System
MOTIVATION (5 MINS)
Recall Physiological Processes Teacher tip
1. Ask the students what they think are the important activities for the maintenance of life. In relation to the questions asked, the following
Sample responses: eating, breathing, ability to respond to stimuli. concepts may be integrated to answers given by
the class:
2. Ask them to enumerate the kinds of nutrients that organisms obtain from food. Maintenance functions refer to the various
Sample responses: proteins, fats, carbohydrates, vitamins, minerals. physiological processes that occur in an
organism necessary for the maintenance of life.
3. Ask them to recite the different organs in the animal body that may be involved in digestion.
Some physiological processes for the
Sample responses: teeth, tongue, stomach, small intestine. maintenance of life include: nutrient
procurement and processing, gas exchange,
internal transport, and regulation of body fluids
among others.
Maintenance functions help the organism
attain homeostasis, that is, the state of stable
equilibrium in a biological system.
INSTRUCTION (25 MINS) Misconception:
Students may think that plants are self- sufficient in
Lecture on Plant Nutrition terms of nutrition. Emphasize that although plants
1. Define nutrient and enumerate the two types of organisms based on mode of nutrition. are capable of producing their own food
(autotrophic organisms) through photosynthesis,
I. Nutrient refers to any substance required for the growth and maintenance of an
they also require the raw materials from the
organism. The two types of organisms based on the mode of nutrition are: environment for the maintenance of life: water,
A. autotrophs organisms that obtain energy from sunlight and chemicals to produce carbon dioxide, and minerals.
their own food. Examples: plants; chemosynthetic bacteria

B. heterotrophs organisms that cannot make their own food and obtain their energy
Teacher Tips
from other organisms. Examples: animals, fungi The significant role of essential nutrients in plants
can be highlighted by showing pictures of plants
with mineral deficiencies or by enumerating
2. Identify the nutritional requirements of plants: symptoms or manifestations of mineral
A. water deficiencies.
B. carbon dioxide A visual aid on the cross section of a root showing

Further, note that water and carbon dioxide are the raw materials needed for the two routes will be helpful to the learners. The
photosynthesis, the process by which plants convert the energy from sunlight into different layers of cells should be illustrated and
labelled: epidermis, cortex, endodermis, Casparian
chemical energy. strip, vascular cylinder (xylem and phloem)
C. essential nutrients or elements which include macronutrients which are normally
required in amounts above 0.5% of the plants dry weight; and micronutrients which
are required in minute or trace amounts;
D. examples of macronutrients: C, H, O, N, K, Ca, Mg, P, S
E. examples of micronutrients: Cl, Fe, B, Mn, Zn, Co, Mo
3. Distinguish between the routes for the absorption of water and minerals across plant roots:
A. symplast route through plasmodesmata
B. apoplast route along cell walls
Note that the water and minerals from the soil need to reach the conducting tissues of
plants, specifically the xylem. The two routes mentioned show how this can happen.
160
4. Cite specialized absorptive structures:
A. root hairs slender extensions of specialized epidermal cells that greatly increase the
surface area available for absorption.
B. root nodules localized swellings in roots of certain plants where bacterial cells exist
symbiotically with the plant. The bacteria help the plant fix nitrogen and in turn, the
bacteria are able to utilize some organic compounds provided by the plant.
3. mycorrhizae (singular, mycorrhiza) a symbiotic interaction between a young root and
a fungus. The fungus obtains sugars and nitrogen-containing compounds from root cells
while the plant is able to get some scarce minerals that the fungus is better able to absorb
from the soil.
5. Enumerate nutritional adaptation by plants:

A. Symbiosis of plants and soil microbes
B. Symbiosis of plants and fungi
C. Parasitism
D. Predation
PRACTICE (15 MINS)

Drawing Activity or Laboratory Work Teacher Tips
Letting the students draw and trace the routes of
6. For those with microscopes, observe slides of monocot root and dicot root cross sections. For
movement of water and minerals reinforce the
those without microscopes, visual aids for monocot and dicot root cross sections may be concept of absorption through plant roots.
shown on the board. Ask the students to do the following:
A. Draw the monocot and dicot root cross sections.
B. For each, label the epidermis, cortex, endodermis, Casparian strip, xylem and phloem.
C. On the drawing, use a red ball pen to trace the symplast route, and a blue ball pen to
trace the apoplast route for the movement of water from the soil to the xylem.
ENRICHMENT (5 MINS)
Quiz
1. What is a nutrient?
2. Give the difference between:
A. autotrophs and heterotrophs
B. apoplast and symplast routes
C. macronutrients and micronutrients
3. What is the significance of having root hairs in plant roots?
4. How do plants benefit from symbiotic associations with bacteria? With fungi?
EVALUATION (5 MINS)
Quiz
1. Carbon, hydrogen, oxygen, nitrogen, and potassium are examples of ______ for plants.
A. macronutrients
B. micronutrients
C. trace elements
D. essential elements
E. both a and d Teacher Tips
Letting the students draw and trace the routes of
movement of water and minerals reinforce the
2. The nutrition of some plants depends on a root-fungus association known as a ______. concept of absorption through plant roots.
A. root nodule
B. mycorrhiza
C. root hair
D. root hypha
162
3. Th]]]e nutrition of some plants depends on a root-bacterium association known as a ______.
Answer Key:
A. root nodule
B. mycorrhiza 1. e
C. root hair 2. 2.
D. root hypha 3. b 3
4. 4 a
4. Plants are autotrophic organisms and therefore do not require raw materials from the 5. False. Plants need to acquire water
environment. True or False. from the soil through roots and
carbon dioxide from the air through
5. Certain plants may acquire nutrients from other organisms through parasitism or predation.
leaves. Both water and carbon dioxide
True or False.
are needed for photosynthesis.
5. True.
Assignment
6. Give three examples of nutrient deficiencies in plants and the corresponding symptoms.
7. What is the role of the Casparian strip present in endodermal cells?
8. Research on examples of parasitic plants and predator plants. Give an example for each. What
structural adaptations are present in these plants that allow them to acquire nutrition through
parasitism and predation? Tabulate answers by using three columns with the following criteria:
Type of Adaptation (parasitism or predation), Example Plant, and Structural Adaptation.
ASSESSMENT GUIDE (FOR THE ACTIVITY AND LABORATORY WORK)

A. 1. (POOR) disorganized drawing with many errors in the labeling of cell layers in the root
cross sections and in the tracing of the apoplast and symplast routes.
B. 2. (SATISFACTORY) acceptable drawing with some errors in the labeling of cell layers in the
root cross sections and in the tracing of the apoplast and symplast routes.
C. 3. (VERY GOOD) clear drawing with minimal error in the labeling of cell layers in the root
cross sections and in the tracing of the apoplast and symplast routes.
D. 4. (EXCELLENT) clear drawing with correct labels for the cell layers in the root cross
sections; and accurate tracing of the apoplast and symplast routes.

Process in Plants and Animals:
Nutrient Procurement and Processing (2 of 3)
Content Standard
The learners demonstrate an understanding of plant and animal organ systems LESSON OUTLINE
Performance Standard Motivation Observe Nutrition Facts 3
Instruction Lecture on Animal Nutrition 25
enumerate the structures or organs involved in nutrient procurement and
describe the functions of structures or organs involved in nutrient Enrichment Quiz 5
explain how food is processed in a mammalian digestive system
Materials
Learning Competency Microscopes and slides of Paramecium, Hydra, or Planaria. In the absence
The learners shall be able to compare and contrast nutrient procurement and of microscopes and slides, visual aids of the mentioned specimens may be
processing in plants and animals. STEM_BIO11/12-IVa-h-1 used. Also, visual aids of an insects digestive system and a toads digestive
system; if available, dissecting pan and dissecting kit.
(1) Barrion AA, Tudor MFVA, Colle MCD, Reamillo MCS, and MAP
define nutrient and cite the nutritional requirements of plants and animals; Robles. 2000. BIOLOGY II Laboratory Manual: An Investigative
Approach. Institute of Biological Sciences, College of Arts and
enumerate nutritional adaptation by plants and feeding mechanisms in
Sciences, UP Los Baos. ISBN 971-547-099-8. 140p.
animals; (2) Johnson GB and PH Raven.1996. BIOLOGY: Principles and
distinguish different kinds of digestive compartments in animals; and Explorations.Austin, USA: Holt, Rinehart and Winston. 1072p.
(3) Reece JB, Urry LA, Cain ML, Wasseman SA, Minorsky PV, and RB
trace the pathway of food processing in a mammalian/human digestive Jackson. Campbell Biology. Tenth Edition. Boston, USA: Pearson
system. Education, Inc. 1279p.
(4) Starr C and R Taggart. 2004. BIOLOGY: The Unity and Diversity of Life.
164
1. Present the topic outline for Nutrient Procurement and Processing. An example is given
can be divided into three parts, with one-hour
below: session being allotted for each part.
I. Plant Nutrition
A. Nutritional requirements of plants Part I. Plant Nutrition (1 hour)
Part II. Animal Nutrition (1 hour)
B. Routes for absorption of water and minerals across the roots
Part III. The Human Digestive System (1 hour)
C. Nutritional adaptations by plants
II. Animal Nutrition
III. The Human Digestive System
MOTIVATION (3 MINS) Teacher Tip

Observe Nutrition Facts You may assign the learners to bring food or snack
packed in foil or plastic that shows a table on
1. Ask the learners to locate the table on Nutrition Facts on the package of the food or snack
Nutrition Facts.
that they brought in class.
2. Call one or two learners to read aloud the kinds of nutrients listed in the Nutrition Facts table. The different kinds of nutrients listed in the
Nutrition Facts table are among the nutritional
Example: A 100 g foil pack of peanuts may show the following kinds of nutrients: Fat, requirements of animals.
Cholesterol, Carbohydrate, Protein, Sodium, Vitamins, Minerals e.g. Iron
3. Ask the class what we need to eat and why.
Example: what we need to eat rice, potato, meat, fish, fruits, vegetables, etc.
why we need to eat to obtain energy for our activities, to grow, to provide our bodies with
materials for making bone and muscles, etc.

You may ask the learners to check the amount of
Lecture on Animal Nutrition calories indicated in the Nutrition Facts table of
1. Introduce the concept of calories from food. the food they brought.
A Calorie is a unit of energy that indicates the amount of energy contained in food. It
specifically refers to the amount of heat energy required to raise the temperature of 1 kg (2.2
lb.) of water by 1oC (1.8oF). The greater the number of Calories in a quantity of food, the
greater energy it contains (Johnson and Raven, 1996).
2. Identify the nutritional requirements of animals:

Teacher Tips:
I. Carbohydrates serve as a major energy source for the cells in the body. These are Carbohydrates, proteins, and fats are energy-rich
usually obtained from grains, cereals, breads, fruits, and vegetables. On average, compounds present in food. The energy in food is
stored in in its chemical bonds. As body cells break
carbohydrates contain 4 Calories per gram.
the chemical bonds, energy is harvested to make
II. Proteins can also be used as an energy source but the body mainly uses these as ATP.
building materials for cell structures and as enzymes, hormones, parts of muscles, and
bones. Proteins come from dairy products, poultry, fish, meat, and grains. Like Essential amino acids, vitamins, and trace elements
are important substances for good health.
carbohydrates, proteins also contain 4 Calories per gram. Essential amino acids serve as building blocks for
III. Fats are used to build cell membranes, steroid hormones, and other cellular structures; proteins, while vitamins and trace elements are
also used to insulate nervous tissue, and also serve as an energy source. Fats also contain necessary for many cellular chemical reactions.
certain fat- soluble vitamins that are important for good health. Fats are obtained from
The significant role of essential nutrients in animals
oils, margarine, butter, fried foods, meat, and processed snack foods. They contain a can be highlighted by citing examples of the
higher amount of energy per gram than carbohydrates or proteins, about 9 Calories per effects of certain nutrient deficiencies or extreme
gram. excess. This may also be given as an assignment to
learners to enhance their appreciation of proper
IV. Essential Nutrients include substances that animals can only get from the foods they
nutrition. Examples include: rickets, scurvy, goiter,
eat because they could not be synthesized inside the body. These include: etc.
A. Essential amino acids needed for synthesis of proteins and enzymes; among the 20
amino acids, eight could not be synthesized by humans: lysine, tryptophan, threonine,
methionine, phenylalanine, leucine, isoleucine and valine.
B. Essential fatty acids used for making special membrane lipids; an example is
linoleic acid in humans.
C. Vitamins organic molecules required in small amounts for normal metabolism;
examples include fat-soluble Vitamins A, D, E, K, and water-soluble Vitamins B, B2, B3,
B12, C.
166
D. Trace Elements or Minerals inorganic nutrients needed by the body in minute Teacher Tip:
amounts; these form part of enzymes, body tissues, and body fluids; examples include: Pictures of phagocytosis and pinocytosis can be
iodine, cobalt, zinc, molybdenum, manganese, selenium. shown in class.
3. Describe food uptake in cells via the three types of endocytosis:

I. phagocytosis engulfment of organic fragments or big particles, eg. pseudopod
formation in
Amoeba.
II. pinocytosis uptake of extracellular fluid by a cell using small vesicles derived from
the plasma
membrane.
III. receptor-mediated endocytosis this relies on membrane receptor recognition of
specific solutes which are then taken up by the cell via receptor-coated pits.
Teacher Tips:
4. Cite the different types of animals based on feeding mechanisms: Consider a frogs complete digestive system. The
I. substrate-feeders animals that live in or on their food source. Examples: earthworms parts between the mouth and anus are: pharynx,
esophagus, stomach, small intestine, and large
that feed through the soil where they live in; caterpillars that eat through the leaves
intestine.
where they live on.
II. filter-feeders include many aquatic animals which draw in water and strain small
organisms and food particles present in the medium. Examples: whales and
coelenterates
III. fluid-feeders suck fluids containing nutrients from a living host. Examples:
mosquitoes, leeches, head lice, aphids
IV. IV. bulk-feeders eat relatively large chunks of food and have adaptations like jaws,
teeth, tentacles, claws, pincers, etc. that help in securing the food and tearing it to
pieces. Examples: snakes, cats, man
5. Enumerate the different kinds of digestive compartments in animals:

I. Food vacuoles in unicellular organisms these fuse with lysosomes that contain
hydrolytic
enzymes. Example: food vacuole in a protozoa like Paramecium
II. Gastrovascular cavity or incomplete digestive system composed of a single
opening through which food is taken in and where wastes are disposed of; it is a sac-
like body cavity. Examples: in the cnidarian Hydra and in flatworm Planaria
III. Complete digestive system essentially like a tube with an opening at one end for
taking in food (mouth) and an opening at the other end where unabsorbed waste
materials are eliminated (anus). In between the mouth and anus, are specialized organs
that carry out transport, processing, and absorption of digested nutrients.
6. Describe the accessory organs for digestion in a complete digestive system:

I. liver secretes bile for emulsifying fats
II. gallbladder stores bile produced by the liver
III. pancreas secretes enzymes that break down all major food molecules; secretes buffers
against HCl from the stomach; secretes the hormone insulin for control of glucose
metabolism
PRACTICE (20 MINS)

Teacher Tip:
Drawing Activity or Laboratory Work Letting the learners draw the structures for
1. Observe and draw a Paramecium as seen under the microscope or from a visual aid. Label the digestion allows them to compare different types
of digestive compartments in different animals.
food vacuole.
2. Observe and draw a Hydra or Planaria as seen under a microscope or from a visual aid. Label
the gastrovascular cavity.
3. Draw from a visual aid the complete digestive system of an invertebrate such as a cockroach
or grasshopper. Label the parts such as: salivary glands, esophagus, crop, gizzard, gastric
caeca, mesenteron, Malpighian tubules, small intestine (ileum), large intestine (colon), rectum,
and anus.
4. Pith and dissect a toad. Observe the following organs: mouth or buccal cavity, tongue,
pharynx, esophagus, stomach, small intestine, large intestine (colon), cloaca, anus. Also find
the accessory organs: liver, gallbladder, pancreas. Draw and label all the parts. If dissection will
not be done, let the learners copy and draw from a visual aid.
168
The answers to the review questions can be found
Quiz in the lecture given by the teacher.
1. State several reasons why carbohydrates are usually needed in more amounts than fats in the
diet.
2. Explain why protein should be included in the diet.
3. What will happen to the human body if we are deficient in particular vitamins and trace
elements? Give examples of effects of vitamin and mineral deficiencies.
4. There are 20 amino acids needed to make proteins in the animal body. Why arent they all
considered essential to animal diets?
5. Compare incomplete and complete digestive systems.
6. What are the functions of accessory organs in a complete digestive system?
EVALUATION (5 MINS) Answer Key:

1. State the average amount of energy obtained from the following nutrients in terms of
1. 4, 4, 9 Calories, respectively
Calories:
2. Eight
1 g of carbohydrate _______ Calories
3. Oil, water (or vice versa)
1 g of protein _______ Calories
1 g of fat _______ Calories 4. Trace elements or minerals 5.
endocytosis
2. Of the 20 amino acids used to make proteins in the human body, _______ must be obtained
through food. 5. Substrate-swallowers, food-seekers
3. The two main groups of vitamins include those soluble in _______ and in _______. 6. True
4. _______ refer to inorganic nutrients needed by the body in minute amounts. 7. True
5. Cells take up food via the process of _______.

6. In terms of feeding mechanisms, earthworms are considered _______, while humans are
considered _______.
7. A gastrovascular cavity is considered an incomplete digestive system. True or False.
8. A complete digestive system is characterized by the presence of a mouth at one end and anus
at the other end. True or False.
ASSIGNMENT Teacher Tip:

1. List four water-soluble vitamins and four oil-soluble vitamins. Present in a tabular form their Answers to the assignment may be written on
bond paper and submitted on the following
roles, food sources, and effects of deficiency. meeting.
2. Cite five trace elements or minerals. Tabulate their food sources and roles.
3. What are the roles of the following parts of an insects digestive system: crop, gizzard,
Malpighian tubules.
4. Enumerate the parts of the toads digestive system and give the function of each.
5. Define malnutrition. Are the conditions of undernutrition and obesity considered malnutrition?
Explain.
Teacher Tips:
Some questions in the assignment may be
ASSESSMENT GUIDE (FOR THE ACTIVITY AND LABORATORY WORK) included for assessment, in addition to the
1. (POOR) disorganized drawing with many errors in the labeling of cell layers in the root cross
drawings done during the laboratory work.
sections and in the tracing of the apoplast and symplast routes.
2. (SATISFACTORY) acceptable drawing with some errors in the labeling of cell layers in the
3. (VERY GOOD) clear drawing with minimal error in the labeling of cell layers in the root cross
4. (EXCELLENT) clear drawing with correct labels for the cell layers in the root cross sections;
and accurate tracing of the apoplast and symplast routes.
170

Process in Plants and Animals:
Nutrient Procurement and Processing (3 of 3)
Content Standard
Performance Standard Motivation The Digestive System 3
enumerate the structures or organs involved in nutrient procurement and Instruction Lecture on the Digestive System 30
describe the functions of structures or organs involved in nutrient
Enrichment Quiz 5
explain how food is processed in a mammalian digestive system Evaluation Assignment 5

Microscopes and slides of a vertebrate small intestine cross-section. In the
The learners shall be able to compare and contrast nutrient procurement and absence of microscopes and slides, visual aids of the mentioned specimen
processing in plants and animals. STEM_BIO11/12-IVa-h-1 may be used.
Specific Learning Outcomes Resources

At the end of the lesson, the learners will be able to: (1) Barrion AA, Tudor MFVA, Colle MCD, Reamillo MCS, and MAP Robles.
2000. BIOLOGY II Laboratory Manual: An Investigative Approach.
enumerate and describe the main stages of food processing; Institute of Biological Sciences, College of Arts and Sciences, UP Los
describe the organs involved in food processing in the human digestive Baos.
(2) Brooker RJ, Widmaier EP, Graham LE, Stiling PD. 2008.Biology. Boston:
system and their roles;
McGraw- Hill. 1300 pp.
summarize the mechanisms of digestion, absorption, and delivery of (3) Johnson GB and PH Raven.1996. BIOLOGY: Principles and
nutrients into cells; Explorations.Austin, USA: Holt, Rinehart and Winston. 1072p.
(4) Reece JB, Urry LA, ,Wasserman SA, Minorsky PV, Jackson RB. 2011.
explain the regulation of digestion; and Campbell Biology (10th Edition). US: Benjamin Cummings. 1488 pp.
cite some health problems associated with the digestive system. (5) Starr C and R Taggart. 2004. BIOLOGY: The Unity and Diversity of Life.
1. Present the topic outline for Nutrient Procurement and Processing. An example is given
can be divided into three parts, with one-hour
below: session being allotted for each part.
I. Plant Nutrition
Part I. Plant Nutrition (1 hour)
A. Nutritional requirements of plants Part II. Animal Nutrition (1 hour)
B. Routes for absorption of water and minerals across the roots Part III. The Human Digestive System (1 hour)
C. Nutritional adaptations by plants

II. Animal Nutrition
III. The Human Digestive System Teacher tip
You may assign the students to bring food or snack
2. Cite the Specific Learning Outcomes for this topic.
packed in foil or plastic that shows a table on
Nutrition Facts.
MOTIVATION (3 MINS) The different kinds of nutrients listed in the
The Digestive System Nutrition Facts table are among the nutritional
1. The usual way of presenting food processing in the human digestive system is to follow the requirements of animals.
fate of food as it passes from mouth to anus.

2. A figure or diagram of the human digestive system may be presented to class as an overview
of the components and processes of the digestive system.
3. Demonstrate peristalsis by placing a ball inside a stocking and squeezing to move it along.

Lecture on the Digestive System
1. Enumerate and describe the main stages of food processing:
A. Ingestion the act of eating or feeding; this is coupled with the mechanical breakdown of
food into smaller pieces allowing for a greater surface area for chemical digestion.
B. Digestion breakdown of food into particles, then into nutrient molecules small enough
172
to be Chemical digestion by enzymes involves breaking of chemical bonds through the Note to the Teacher
addition of water, i.e., enzymatic hydrolysis. The lecture for this part is quite long; some details
may be omitted in the delivery. A handout on the
C. Absorption passage of digested nutrients and fluid across the tube wall and into the
lecture may be given to the students so that time
body fluids; the cells take up (absorb) small molecules such as amino acids and simple may be devoted to listening to the teacher instead
sugars. of copying the lecture.
D. Elimination expulsion of the undigested and unabsorbed materials from the end of the
gut. Teacher Tips:
Regardless of the variations in the structures of a
complete digestive system (eg.digestive system of
2. Describe the organs involved in food processing in the human digestive system: a toad versus that of a bird), there are four distinct
stages of food processing that are carried out.
A. The Oral Cavity, Pharynx, and Esophagus
These are: ingestion, digestion, absorption, and
I. Oral Cavity it is where food is initially chewed into shreds by the teeth, and elimination.
mixed with saliva by the tongue. Saliva is secreted into the mouth by three
Saliva has several components. It contains an
pairs of salivary glands located above the upper jaw and below the lower jaw. enzyme (salivary amylase), a buffer (bicarbonate),
II. Pharynx the region in the back of the throat that serves as the entrance to the slippery glycoproteins (mucins), and antimicrobial
esophagus that connects to the stomach and trachea (windpipe) that serves as agents such as lysozyme.
airway to the lungs. To block breathing as food leaves the pharynx, a flap-like A sphincter is a ring of smooth muscles that close
valve (the epiglottis) and the vocal cords close off the trachea. off a passageway or an opening to the body
surface.
III. Esophagus connects the pharynx with the stomach. No digestion takes place
within the esophagus but the contractions within its muscular wall propel the The stomach secretes about 2 L of HCl every day,
food past a sphincter, into the stomach. The rhythmic waves of contraction of rendering a very low pH in the stomach (between
the smooth muscle wall of the esophagus are called peristaltic contractions or 1.5 and 2.5), about 3 million times more acidic
than the bloodstream.
peristalsis. The esophagus is about 25 cm (10 in.) long.
Ask the students to research on how the gastric
B. The Stomach juice can facilitate chemical digestion.
I. The stomach is a muscular, stretchable sac located just below the diaphragm. It has
three important functions. First, it mixes and stores ingested food. Second, it secretes
gastric juice that helps dissolve and degrade the food, particularly proteins. Third, it
regulates the passage of food into the small intestine.
II. The gastric juice is a combination of HCl and acid-stable proteases.
III. The churning action of the stomach together with the potent acidity of the gastric juice
convert food into a thick, liquid mixture called chyme.
C. Small Intestine
I. The small intestine is approximately 6 meters long and is composed of three regions: Teacher Tip:
The gut wall consists of four tissue layers
the duodenum, jejunum, and ileum. surrounding a central cavity the lumen. In contact
II. It is where most enzymatic hydrolysis of the macromolecules from food occurs. The with the lumen is the mucosa, followed by the
complete digestion of carbohydrates, fats, and proteins occurs in the duodenum, submucosa, circular muscle layer, longitudinal
about the first 25 cm. of the small intestine. muscle layer, and serosa.
III. The rest of the small intestine is devoted to absorbing water and the products of
digestion into the bloodstream.
IV. Absorption of the end products of digestion takes place in the ileum, the surface area
of which is increased by villi and microvilli.
D. The Accessory Digestive Organs

I. Pancreas, Liver, and Gallbladder review the functions discussed in previous
meeting.
E. The Large Intestine or Colon

I. The large intestine is much shorter than the small intestine, about 1 meter.
II. It concentrates and stores undigested matter by absorbing mineral ions and water. A
small amount of fluid, sodium, and vitamin K are absorbed through its walls.
III. Unlike the small intestine, it does not coil up and does not have villi and has only one-
thirtieth of the absorptive surface area of the small intestine.
IV. Many bacteria live and thrive within the large intestine where they help process
undigested material into the final excretory product, feces.
F. The Rectum and Anus

I. The rectum is a short extension of the large intestine and is the final segment of the
digestive tract. It is where the compacted undigested food from the colon are pushed
via peristaltic contractions.
II. The distention of the rectum triggers expulsion of feces.
III. The anus is the terminal opening of the digestive system through which feces are
expelled.
174
3. Summarize the mechanisms of digestion and absorption:
A. Carbohydrate digestion begins in the mouth but could not continue in the stomach due Teacher Tip:
Emphasize that digestion and absorption are
to the acidic pH that destroys the amylase. It resumes in the small intestine where the inseparable in the total function of providing
resulting monosaccharides are absorbed. nutrition to body cells.
B. Proteins are digested in the stomach and small intestine. Resulting amino acids are
absorbed in the small intestine where they leave the intestinal cell and enter the blood
through a facilitated diffusion carrier in the plasma membranes on the opposite side.
C. Fat digestion occurs entirely in the small intestine. Although fatty acids and
monoglycerides enter epithelial cells from the intestinal lumen, it is triglycerides that are
released on the other side of the cell and carried by blood capillaries to be transported
throughout the body.
D. Most water-soluble vitamins are absorbed by diffusion or active transport. Fat-soluble
vitamins follow the pathway for fat absorption.
4. Describe how nutrients are delivered into cells:

A. Substances pass through the brush border cells that line the free surface of each villus by
active transport, osmosis, and diffusion across the lipid bilayer of plasma membranes.
B. The nutrients then proceed into the internal environment and pass to the blood which is
collected into the hepatic portal vein leading to the liver.
C. After flowing through the liver, the blood carrying the nutrients passes into the hepatic
vein which carries the blood back to the heart to be distributed to the different body
tissues.
5. Explain the regulation of digestion:

A. The digestive system of animals is regulated in part by other organ systems, especially the
nervous and endocrine systems.
B. The nervous system exerts control on the digestive system in two ways:
I. regulation of muscular and glandular activity by the local nerves in the alimentary
canal; and
II. long-distance regulation by the brain.
C. Hormones regulate the rate of digestion.
6. Cite some health problems associated with nutrition and digestive system:
A. Frequent complaints associated with the gastro-intestinal tract include heart burn, ulcers,
and diarrhoea.
PRACTICE (20 MINS)

Drawing Activity or Laboratory Work
1. As an alternative to a pure lecture discussion, questions related to the anatomy or function of
each organ or component may be asked. As each digestive organ is discussed, reference to
an overhead transparency or visual can be done.
2. For example: In relation to the oral cavity, ask the students what other structures or secretions
may be found and cite the possible function of each in relation to digestion.
3. Sample answers: teeth, tongue, saliva cite the functions of each; proceed to the succeeding
parts of the digestive system
4. Ask the students to observe and draw a cross-section of the vertebrate small intestine (either
from a microscopic slide viewed under scanner objective or a visual aid) and label the
following components from the inner to outer layer:mucosa, submucosa, circular muscle layer,
longitudinal muscle layer, and serosa.
5. If using a microscope to view the small intestine cross-section, shift to the low power objective
(LPO) and focus on the infoldings of the mucosa which make up the villi. Draw and label.
6. Also present but could not be seen under an ordinary microscope are the numerous
cytoplasmic extensions of the cells lining a villus, which are called microvilli. Keeping in mind
the major functions of the small intestine, what is the significance of the presence of villi and
microvilli?
ENRICHMENT (5 MINS)
Conceptual Questions
1. Distinguish between digestion and absorption.
2. Give some reasons why dietary fiber which can come from fruits and vegetables, is so
important in our diet.
176
1. The pancreas connects to which part of the alimentary canal? 1. C
A. Esophagus 2. E
B. Stomach
3. D
C. Small intestine
4. E
D. Cecum
E. Large intestine 5. A
2. Which of the following statements regarding the vertebrate stomach is not correct? The teacher may add more items to the quiz to be
A. Its cells secrete the protease enzyme pepsin. taken from the lecture material or books with end
B. It is a saclike organ that evolved to store food. of chapter review questions.
C. Its cells secrete hydrochloric acid.

D. It is the initial site of protein digestion.
E. Absorption of many nutrients occurs there.
3. Absorption in the small intestine is increased by :

A. The many villi that are present on the inner surface of the small intestine.
B. The brush border formed by microvilli on the cells of the villi.
C. The presence of numerous transporter proteins on the epithelial cells.
D. All of the above.
E. None of the above.
4. Which of the following is a function of the large intestine?
A. It participates in cellulose digestion by microbes that exist in the cecum of herbivores.
B. It stores and concentrates fecal material.
C. Its cells absorb salts and water that remain in chyme after it leaves the small intestine.
D. Its cells absorb certain vitamins.
E. All of the above.
5. Which of the following is correct?
A. Carbohydrate digestion starts in the mouth and resumes in the small intestine.
B. Protein digestion occurs only in the small intestine.
C. Fat digestion occurs in the stomach and small intestine.
D. Both water-soluble and fat-soluble vitamins are absorbed by diffusion or active transport.
Assignment Note to the Teacher:
1. Enumerate the major digestive enzymes for carbohydrate, protein, fat, and nucleic acid Answers to the assignment may be written on
digestion. Tabulate as follows: bond paper and submitted on the following
ENZYME / SOURCE ORGAN / WHERE ACTIVE / SUBSTRATE / MAIN BREAKDOWN meeting.
PRODUCTS Answers to the assignment may be found in Reece

2. What contributes to the absorption capacity of the small intestine? et al., 2011; Starr and Taggart, 2004, and; any
General Biology book.
3. Why doesnt gastric juice destroy the stomach cells that make it?
4. What are the cells making up the gastric glands of the stomach?
5. Describe the following ailments associated with the digestive system and identify their causes:
A. Gastric ulcers
B. Acid reflux
C. Heartburn
ASSESSMENT GUIDE (FOR THE ACTIVITY AND LABORATORY WORK NUMBERS 2 AND 3
INVOLVING DRAWING LABELING)
ASSESSMENT GUIDE (FOR QUIZ AND ASSIGNMENT): THE TEACHER MAY ASSIGN
POINTS TO THE QUESTIONS
1. (POOR) 74% and below
2. (FAIR) 75 TO 79% correct
3. (SATISFACTORY) 80 to 84% correct
4. (VERY SATISFACTORY) 85 to 89% correct 5. (OUTSTANDING) 90 to 100% correct
178
Lesson 19: Compare and Contrast Process

in Plants and Animals: Gas Exchange
Content Standard
for gas exchange and their functions.
Motivation Questions on Gas Exchange 5
enumerate the structures or organs involved in gas exchange in plants and Instruction Lecture on Gas Exchange 100
animals; Practice Cross-section of Species 40
trace the pathway of air in a mammalian respiratory system; and
Enrichment Conceptual Questions 10
explain the coordination of the respiratory system with the circulatory
system in the transport of gases to the body tissues. Evaluation Assignment 10

Microscopes and slides of monocot and dicot lead cross-section, leaf upper
The learners shall be able to compare and contrast gas exchange in plants and
and lower epidermis, and insect tracheal system. In the absence of
animals. STEM_BIO11/12-IVa-h-1 microscopes and slides, visual aids of the mentioned specimens may be
used; visual aids on the human respiratory system; insect tracheal system;
Specific Learning Outcomes toad, dissecting pan, dissecting set, gloves.
Resources
state some basic principles IN gas exchange; (1) Barrion AA, Tudor MFVA, Colle MCD, Reamillo MCS, and MAP Robles.
describe the structures for gas exchange in plants and animals; 2000. BIOLOGY II Laboratory Manual: An Investigative Approach.
Institute of Biological Sciences, College of Arts and Sciences, UP Los
compare breathing mechanisms in vertebrates; Baos. ISBN 971-547-099-8. 140p.
describe the organs in the human respiratory system and their roles; (2) Brooker RJ, Widmaier EP, Graham LE, Stiling PD. 2008. Biology.
Boston: McGraw- Hill. 1300 pp.
discuss the coordination of gas exchange and circulation; (3) Johnson GB and PH Raven.1996. BIOLOGY: Principles and
explain the control of respiration in vertebrates; Explorations.Austin, USA: Holt, Rinehart and Winston. 1072p.
(4) Reece JB, Urry LA, Wasserman SA, Minorsky PV, Jackson RB. 2011.
describe some respiratory adaptations to extreme conditions such as low- Campbell Biology (10th Edition). US: Benjamin Cummings. 1488 pp.
oxygen environments; and (5) Starr C and R Taggart. 2004. BIOLOGY: The Unity and Diversity of Life.
cite some respiratory problems and impact on public health. Tenth Edition. Australia: Thomson Brooks/Cole. 933p.
1. Present the topic outline for Gas Exchange:
I. Basic principles influencing gas exchange
II. Structures for gas exchange in plants and animals
III. Breathing mechanisms in vertebrates
IV. The Human respiratory system
V. Coordination of gas exchange and circulation
VI. Control of respiration in vertebrates
VII. Respiratory adaptations to extreme conditions
VIII.Respiratory problems and on public health
2. Cite the specific learning objectives for this topic.

Questions on Gas Exchange
1. Ask the students what else do organisms need to acquire from the environment aside from
nutrition? Why?
Suggested response: oxygen needed for cellular respiration, in the process of extracting
chemical energy from food (with the exception of anaerobic organisms)
2. What gas is considered a metabolic waste product of cellular metabolism? How does it leave
the organisms body?
Suggested response: carbon dioxide it diffuses out of the respiratory surface of the
organism
3. Ask the students to cite the structures in plants and animals that allow for gas exchange.
Suggested responses: please refer to respiratory structures cited in the lecture
4. Let the students enumerate some respiratory problems encountered by humans.
Suggested responses: asthma, emphysema, lung cancer, pneumonia
180
Lecture on Gas Exchange
1. Define gas exchange:
I. Gas exchange is the uptake of molecular oxygen from the environment and the
discharge of carbon dioxide to the environment.
II. It is often called respiratory exchange or respiration but it should not be confused with
cellular respiration.
III. Oxygen is needed in tissues for aerobic cellular respiration to occur and extract ATP from
food.
IV. Carbon dioxide must be released to prevent physiological pH in tissues from being very
acidic. In plants however, the carbon dioxide that is released as a by-product of cellular
respiration may again be taken up for the process of photosynthesis.
2. State some basic principles influencing gas exchange:

I. The respiratory surface or organ is the part of an animals body where gases are
exchanged with the environment. To allow for gas exchange, it must be moist, large
enough, and protected from dessication.
II. Respiratory systems rely on the diffusion of gases down pressure gradients.
A. Partial pressures for each gas in the atmosphere can be computed; for example, the
partial pressure of oxygen is 160 mm Hg.
B. Ficks Law states that the amount of diffusion of a gas across a membrane is
proportional to the surface area and the difference in partial pressure between the two
sides and inversely proportional to the thickness of the membrane.
III. Surface-to-volume ratio
A. As an animal grows, the surface area increases at a lesser rate than its volume, making
diffusion of gases into the interior more difficult
B. Animals must have a body design that keeps internal cells close to the surface (e.g.
flatworms) or must have a system to move the gases inward.
IV. Ventilation
A. It refers to the movement of the respiratory medium (air or water) over the respiratory
surface.
B. Bony fish moves the gill covers (operculum) for water carrying oxygen to flow across
the gill.
C. Humans move the muscles of the thorax to expand and contract the chest cavity and
move air in and out of the lungs.
V. Respiratory Pigments or Proteins
A. Adaptations of animals for gas exchange include respiratory pigments that bind and
transport gases.
B. The respiratory pigment of vertebrates is hemoglobin while that of invertebrates (e.g.
arthropods and molluscs) is hemocyanin.
C. Blood cannot carry sufficient oxygen and carbon dioxide in dissolved form to meet the
bodys requirements; hemoglobin helps enhance its capacity.
3. Describe structures for gas exchange in plants:

I. Stomates in leaves
Figure of a leaf cross-section showing stomates.
182
II. Lenticels in stems
III. Root hairs in aerial roots
IV. Pneumatophores or the lateral roots of mangroves
4. Describe respiratory surfaces or organs in invertebrates:

I. Cell surface or cell membrane especially used in unicellular organisms
II. Integumentary exchange refers to the general body surface or skin used by animals with
high surface-to-volume ratio; e.g. flatworm and earthworm. Amphibians also use their skin
in addition to lungs as gas exchange surface
III. External Gills used by invertebrates that live in aquatic habitats; gills are highly folded,
thin- walled, vascularized epidermis that project outward from the body; e.g. crayfish,
lobster, sea star, nudibranch
IV. Tracheal system in arthropods utilizes fine air-conducting tubules to provide gaseous
exchange at the cellular level; it is not dependent on a circulatory system; e.g. insects,
spiders
5. Describe respiratory surfaces in vertebrates:

I. External Gills thin, vascularized epidermis that project from the body surface of a few
amphibians; e.g. larval salamander
II. Internal Gills rows of slits or pockets in adult fishes positioned at the back of the mouth
such that water that enters the mouth can flow over them as it exits just behind the head.
A. Water flows over the gills and blood circulates through them in OPPOSITE
DIRECTIONS.
B. This mechanism, called countercurrent flow, is highly efficient in extracting oxygen
from water, whose oxygen content is lower than air.
III. Lungs internal respiratory surfaces shaped as a cavity or sac; lungs provide a membrane
for gaseous exchange; since they are not in direct contact with all other parts of the body,
lungs require a circulatory system to transport gases to the rest of the body; found in birds,
reptiles, and mammals.
A. Air moves by bulk flow into and out of the lung.

B. Gases diffuse across the inner respiratory surfaces of the lungs.
C. Pulmonary circulation allows the diffusion of dissolved gases across lung capillaries
D. In body tissues, oxygen diffuses from blood interstitial fluid cells; the pathway of
carbon dioxide is in reverse
E. All lungs receive deoxygenated blood from the heart and return oxygenated blood to
the heart.
Different respiratory surfaces or organs in animals: (a) cell surface or cell membrane; (b)
integumentary exchange across body surface; (c) body surface with protruding papulae in
echinoderms; (d) tracheal system in arthropods; (e) gills in fishes; and (f) alveoli in
mammalian lungs. (Source: Raven and Johnson, 2001 PDF copy)
184
6. Compare breathing mechanisms in vertebrates: II. Carbon Dioxide Transport
I. Amphibians ventilate their lungs by positive pressure A. Carbon dioxide diffuses down its partial pressure
breathing which forces air down the trachea. gradient from the tissues into the blood
II. Birds use a system of air sacs as blower to keep air flowing plasma and red blood cells air in alveoli.
through the lungs in one direction only, preventing the B. Seven percent is dissolved in plasma, 23% binds with
mixing of incoming and outgoing air. hemoglobin to form
III. Mammals ventilate their lungs by negative pressure carbaminohemoglobin, and 70% is in bicarbonate form.
breathing which pulls air into the lungs when the volume of C. Bicarbonate and carbonic acid formation is enhanced by
the lungs expands as the rib muscles and diaphragm the enzyme carbonic anhydrase, which is located in the
contract. However, the incoming and outgoing air mix, red blood cells.
decreasing the efficiency of ventilation.
III. Coordination of air flow with blood flow:
7. Describe the human respiratory system:
A. Gas exchange in the alveoli is most efficient when air
I. Air enters or leaves the respiratory system through nasal flow equals the rate of blood flow.
cavities where air is filtered by hair and cilia, warmed by
B. Local controls within the lungs correct imbalances in air
blood vessels, and moistened with mucus.
and blood flow by constricting or dilating both
bronchioles and arterioles.
8. Discuss the coordination of gas exchange and circulation:
I. Oxygen Transport 9. Explain the control of respiration in vertebrates:
A. Oxygen diffuses down a pressure gradient from the lungs I. The nervous system controls oxygen and carbon dioxide
into the blood plasma red blood cells binds to levels for the entire body by regulating the rate and depth of
hemoglobin (4 molecules per hemoglobin to form breathing.
oxyhemoglobin).
II. The brain monitors the pH of the cerebrospinal fluid
B. Hemoglobin gives up its oxygen in tissues where partial through sensors (reflecting carbon dioxide concentration in
pressure of oxygen is low, blood is warmer, partial the blood).
pressure of carbon dioxide is higher, and pH is lower;
III. Secondary control is exerted by sensors in the aorta and
these four conditions occur in tissues with high
carotid arteries that monitor blood levels of oxygen as well
metabolism.
as carbon dioxide (via blood pH).
10. Describe some respiratory adaptations to extreme conditions PRACTICE (40 MINS)
such as low-oxygen environments:
Cross Section of Species
I. Animals that inhabit high altitudes have larger hearts and 1. As an alternative to a pure lecture discussion, questions related
lungs, and hemoglobin with a high affinity for binding to the different structures for gas exchange in plants and animals
oxygen. may be asked. As each respiratory structure is discussed,
II. Many diving animals have unusually high hematocrits (ratio reference to an overhead transparency or visual is suggested.
of the volume of packed red blood cells to the volume of
2. Ask the students to observe and draw the following either from
whole blood) and also muscles with high amounts of a microscopic examination or through the use of visual aids: (a)
myoglobin (an oxygen-binding protein found in muscle cells) monocot leaf cross section e.g. Zea mays; (b) dicot leaf cross
section e.g. Ixora sp. Label the upper and lower epidermis,
11. Cite some respiratory problems and impact on public health: mesophyll, and vascular bundles.
I. In a respiratory disorder like asthma, the muscles around 3. Describe how air can enter the leaf. If the following are available
bronchioles contract more than usual, increasing resistance (microscopes, slides, coverslips, scalpel or blade), prepare thin
to airflow. sections of the upper and lower epidermal surfaces of Rhoeo
II. Emphysema is an abnormal condition of the lungs marked spathacea. Examine the stomata under the microscope for both
by decreased respiratory function; associated with smoking the upper and lower epidermis. Which side contains more
or chronic bronchitis or old age. stomates? Draw the leaf epidermis showing the stoma. Label
the stomatal pore, guard cells, and subsidiary or accessory cells.
III. Smoking tobacco products is one of the leading global
causes of death and is strongly linked to cancer, 4. Draw an insect tracheal system from a visual aid. The large
cardiovascular disease, stroke, and emphysema. tracheae are reinforced by thickened spiral rings of cuticle called
IV. Pneumonia is an infectious disease involving inflammation taenidia while the smaller tracheae have annular rings. Label the
and fluid buildup in the lungs. large tracheae, taenidia, smaller tracheae, and annular rings. As
an alternative, dissect a cockroach and locate the tracheal
system. Under the dissecting microscope, these appear as
silvery white tubes throughout the insects body.
5. Pith and dissect a toad. Examine the external nares and the oral
cavity. Locate the epiglottis which leads to the glottis. Observe
the lungs in the chest cavity. What do you call the numerous
branches and the air sacs found in the lungs? Draw a
diagrammatic representation of the respiratory system of the
toad. Label the external nares, pharynx, epiglottis, glottis,
larynx, trachea, bronchi, and lungs.
186
Answer to Question 3:
An increase in blood carbon dioxide concentration
1. Why is the position of lung tissues within the body an advantage for terrestrial animals? causes an increase in the rate of carbon dioxide
2. After a heavy rain, earthworms come to the surface. How would you explain this behavior in diffusion into the cerebrospinal fluid, where the
terms of an earthworms requirements for gas exchange? carbon dioxide combines with water to form
carbonic acid. Dissociation of carbonic acid
3. How does an increase in the carbon dioxide concentration in the blood affect the pH of the releases hydrogen ions, decreasing the pH of the
cerebrospinal fluid? cerebrospinal fluid (Reece et al., 2011).

Quiz
1. Which of the following is not a structure for gas exchange in
plants?
A. Stomates
B. Lenticels 4. The driving force for diffusion of oxygen across the cells of a
C. Aerial root hairs respiratory organ is:
D. Flowers A. The difference in partial pressure of oxygen in the
E. Pneumatophores environment and in the blood.
B. The humidity.
2. Which of the following respiratory systems is not closely
C. The partial pressure of carbon dioxide in the blood.
associated with a blood supply?
D. The temperature.
A. The lungs of a vertebrate
B. The tracheal system of an insect
C. The gills of a fish
5. The process of bringing oxygenated water or air into contact
D. The skin of an earthworm
with a gas-exchange surface is:
C. When you hold your breath, which of the following gas changes A. Respiration
in the blood first leads to the urge to breathe? B. Ventilation
A. Rising oxygen C. Inspiration
B. Falling oxygen D. Resuscitation
C. Rising carbon dioxide E. Exhalation
D. Falling carbon dioxide
E. Rising carbon dioxide and falling oxygen
6. The group of vertebrates that relies on gas exchange across the 8. Which of the following factors does not alter the rate of
skin as well as at the lungs to maintain sufficient blood oxygen breathing by influencing the respiratory centers of the brain?
levels is: A. Carbon dioxide partial pressures in the blood
A. The fishes B. Oxygen partial pressures in the blood
B. The reptiles C. Blood pH
C. The amphibians D. Blood glucose levels
D. The birds E. Hydrogen ion concentration in the blood
E. The mammals
9. With rare exceptions, the majority of oxygen is transported in
7. In negative pressure filling, air moves into the lungs when the blood of vertebrates
A. The volume of the thoracic cavity increases A. By binding to plasma proteins
B. The pressure in the thoracic cavity decreases B. By binding to hemoglobin in erythrocytes
C. Air is forced down the trachea by muscular contractions of C. As a component of large organic molecules that are broken
the mouth and pharynx down by the cells
D. All of the above D. As dissolved gas in the cytoplasm of erythrocytes
E. A and B only E. By binding to myoglobin
ANSWER KEY 10. Which of the following is brought about by infection and
1. D. involves inflammation and fluid buildup in the lungs?
6. C.
A. Emphysema
2. B. 7. E. B. Pneumonia
3. C. 8. D. C. Asthma
4. A. 9. B. D. Coughing
5. B. 10. B. E. Sneezing
ASSIGNMENT
1. Explain the underlying mechanism in the opening and closing of a Teacher Tip:
stomate. Answers to the assignment may be written on bond paper and submitted on the
following meeting.
2. How does oxygen get to the different parts of the plant?
Answers to the assignment may be found in Reece et al., 2011; Starr and
3. Explain countercurrent flow. How does it help make the fish gill the
Taggart, 2004, and; any General Biology book.
most efficient respiratory organ?
188
4. Compare the avian and mammalian lungs in terms of structure and respiratory function.
5. Discuss the special adaptations for life at high altitudes.
6. In what form does most of the carbon dioxide travel in the blood? How and where is this
molecule produced?
7. How does the brain control inspiration and expiration? How do peripheral and central
chemoreceptors influence the brains control of breathing?
8. What respiratory problems can arise from habitual smoking? Explain how these problems may
develop due to smoking.
ASSESSMENT GUIDE (FOR THE ACTIVITY AND LABORATORY WORK NUMBERS 2 AND 3
INVOLVING DRAWING LABELING)
ASSESSMENT GUIDE (FOR QUIZ AND ASSIGNMENT): THE TEACHER MAY ASSIGN
POINTS TO THE QUESTIONS
1. (POOR) 74% and below
4. (VERY SATISFACTORY) 85 to 89% correct
5. (OUTSTANDING) 90 to 100% correct
Lesson 20: Compare and Contrast

Process in Plants and Animals: Transport and
Circulation LESSON OUTLINE
Content Standard
The learners demonstrate an understanding of plant transport and animal Motivation Demonstration 10
circulation Instruction Discussion of Plant Transport and Animal 90
Performance Standard Circulation
The learners shall be able to: Practice Experiment 20
state the functions of various structures involved in plant transport and
Evaluation Quiz 30
animal circulation.
Enrichment Video and Take-Home Research 10
Learning Competency
The learners compare and contrast transport and circulation in plants and Materials
animals (STEM_BIO11/12-IVa-h-1) Podcast, Pigs Heart, Models of the Heart

(1) Human Anatomy and Physiology: http://www.internet4classrooms.com/
high_school/human_anatomy_physiology_transport.htm (Retrieved
describe the transport of substances in xylem and phloem; 09/08/15)
(2) The Transport System: http://www.ib.bioninja.com.au/standard-level/
explain the functions of structures in animal circulation; and
topic-6-human-health-and/62-the-transport-system.html (Retrieved
trace the path of blood in the systemic and the pulmonary circulation 09/08/15)
(3) Circulatory System: Facts, Function and Diseases- http://
www.livescience.com/22486-circulatory-system.html
(4) The Circulatory System: https://www.youtube.com/watch?
v=NJzJKvkWWDc
(5) Crash Course- Circulatory and Respiratory Systems: https://
www.youtube.com/watch?v=9fxm85Fy4sQ
!!!!!!!
(6) Inner Body: The Heart- http://www.innerbody.com/image/card01.html
!!
190
1. The learning objectives will be communicated to the class. Transport and Circulation are interchangeable
terms although the term transport usually
2. Tell the class that transport in animals is basically due to the circulatory system. A applies to structures that deliver water and
cardiovascular system consists of the heart, blood and blood vessels. The heart pumps the substances throughout the plant body.
blood which circulates to other body parts through blood vessels. Along the way, nutrients Circulation as a term is more applicable to
animals.
and other substances are delivered to body tissues and wastes are removed to be excreted
out from the body.

1. Show the class a cut celery stick. The big holes they see are huge xylem cells. Describe the The heart is the pump that pushes blood to the
importance of transport in organisms. lungs for oxygenation and delivers it to different
body parts. It consists of several chambers,
2. Show a model of the human heart. Ask learners the function of the heart in transport. Ask muscles and are connected with blood vessels.
learners if they remember/ know any parts of an animals heart.

Plant Transport
1. Ask the learners to recall the functions of xylem and phloem from BIO 1. The current topic is
mentioned in the chapter on Nutrient procurement but it may also be reviewed here. Plant
transport involves: (A) absorption of water through the roots and (B) up and down movement
of substances in phloem.
A. Absorption of water plus macronutrients and micronutrients through the root system is
possible by diffusion. Root hairs increase the surface area for transport. Water
molecules pass through the epidermis, cortex, endodermis and pericycle; then they
move upwards by means of xylem vessels.
B. Phloem cells transport substances such as products of photosynthesis, water and other
compounds up and down the plant body. Phloem tissues are adjacent to companion
cells that give them support and nourishment. There are two major hypotheses on how
substances can move up and down the plant body. These are (i) Ascent of xylem sap
and (ii) Pressure flow or bulk flow.
i. Ascent of xylem sap is explained as a push from below by the water
molecules gushing upwards through xylem vessels. It can also be described as
pull from above by a combination of transpiration (evaporation of water from
the plant body) and cohesion of water molecules through hydrogen bonds. Teacher Tip:
ii. Pressure flow or bulk flow maintains that in the plant there is a source cell and a Be guided by an atlas of heart anatomy.
sink cell. A source cell is where photosynthesis occurs and a sink cell is
where the nutrients are needed. Leaf cells are definitely source cells. Sucrose
and other substances accumulate in the source and due to high concentration
they flow down (or up) where they are needed. Sink cells are growing parts of
the plants- buds, flowers, fruits, root tips. In this way, phloem tissues carry
materials down and up. Xylem lies adjacent to phloem tissues and water may
easily diffuse from xylem to phloem. Materials are transported up and down the
plant body by a combination of the actions of phloem and xylem cells.
Animal Circulation
1. With visual aids make a lecture on animal circulatory systems. Discuss the evolution of the
heart in vertebrates. Fish have one atrium and one ventricle. Amphibians have two atria and
one common ventricle where oxygenated and deoxygenated blood mix. In mammals and
birds there is a complete separation of the four chambers of the heart by a tissue, called the
septum.
2. Trace the path of blood in Systemic and Pulmonary Circulation. Mention the major arteries,
veins and heart chambers where blood flows through. Show the class the major valves
between the heart chambers.
PRACTICE (20 MINS)

1. If available, dissect a pigs heart. Show the major chambers and valves of the heart.

1. A short quiz may be given to compare and contrast plant and animal transport mechanisms.
2. The path of blood in systemic versus pulmonary circulation may be followed through a
diagram.
192
ASSIGNMENT Teacher Tip:
1. Research on the following technologies related to the circulatory system. Topics can be assigned to volunteer pairs/ groups.
One pair/ group will discuss the technologies and
A. Pacemaker another group will discuss the diseases. If many
B. Electrocardiograph (ECG) pairs/ groups volunteer to report, they will draw
C. Stethoscope lots to determine who will report. Other groups
D. Defibrillator will be given a chance to report in future topics.
The rest of the class will evaluate the group report
E. Sphygmomanometer based on the following:
F. Computerized axial tomography (CAT) A. Content
G. Magnetic resonance imaging (MRI) B. Creativity
C. Delivery
2. Research on the following diseases of the circulatory system.

A. Hypertension
B. Aneurysm
C. Rheumatic heart disease
D. Stroke
E. Leukemia
F. Sickle-cell anemia
G. Atherosclerosis
H. Thrombosis
I. Hemophilia

1. Watch a video on animal circulation. Use the following guide questions:
I. How do animals transport materials inside their bodies?
II. What structures are necessary in animal transport?
III. State the function of the following components of animal transport: heart, blood and
blood vessels.
2. You may put on the board cut-outs/ drawings of the parts of the circulatory system. Call on
learners to go the board, get a part then describe the main features and functions of the part.
Lesson 21: Compare and Contrast Process

in Plants and Animals: Regulation of Body
Fluids LESSON OUTLINE
Content Standard
The learners demonstrate an understanding of animal organ systems for
regulation of body fluids and their functions. Motivation Questions related to Body Fluids 3
Performance Standards Instruction Lecture on Body Fluids 100
Practice Analogy 40
enumerate the structures or organs involved in regulation of body fluids in
animals; Enrichment Conceptual Questions 20
describe the different parts of the mammalian urinary system and their Evaluation Assignment 10
functions;
Materials
discuss the role of nephrons as the functional units of the kidney; and Visual aids or models or models of excretory systems in invertebrates;
explain the regulation of mammalian kidney function. visual aids on the human urinary system, kidney, and nephron; toad,
dissecting pan, dissecting set, gloves.
Learning Competency
Resources
The learners shall be able to describe excretory systems in animals especially (1) Barrion AA, Tudor MFVA, Colle MCD, Reamillo MCS, and MAP Robles.
the human urinary system and their functions in homeostasis. 2000. BIOLOGY II Laboratory Manual: An Investigative Approach.
(STEM_BIO11/12-IVa-h-1) Institute of Biological Sciences, College of Arts and Sciences, UP Los
Baos. ISBN 971-547-099-8. 140p.
Specific Learning Outcomes (2) Brooker RJ, Widmaier EP, Graham LE, Stiling PD. 2008. Biology.
At the end of the lesson, the learners will be able to: Boston: McGraw- Hill. 1300p.
(3) Hoefnagels M. 2013. Biology: The Essentials. New York: McGraw-Hill.
define some key terms related to osmoregulation; 631p.
describe different types of animals based on the osmolarity of their body (4) Johnson GB and PH Raven.1996. BIOLOGY: Principles and
Explorations.Austin, USA: Holt, Rinehart and Winston. 1072p.
fluids in relation to the environment;
(5) Reece JB, Urry LA, Wasserman SA, Minorsky PV, Jackson RB. 2011.
enumerate the three types of nitrogenous wastes in animals; Campbell Biology (10th Edition). US: Benjamin Cummings. 1488p.
enumerate and describe excretory systems in invertebrates; (6) Starr C and R Taggart. 2004. BIOLOGY: The Unity and Diversity of Life.
194
characterize the mammalian urinary system and the role of nephrons; and
analyze the role of the kidneys in the bodys acid-base balance. Teacher Tip
The presentation of the topic on Regulation of
Body Fluids can be divided into a two- hour lecture
INTRODUCTION (5 MINS) and one-hour laboratory/ activity work.
1. Present the topic outline for Gas Exchange:
I. Some key terms related to osmoregulation
II. Different types of animals based on the osmolarity of their body fluids in relation to the
environment
III. Three types of nitrogenous wastes in animals
IV. Excretory systems in invertebrates
V. The mammalian urinary system and the role of nephrons
VI. The mechanism of urine formation
VII. The regulation of mammalian kidney function
VIII.The role of the kidneys in the bodys acid-base balance
2. Cite the Specific Learning Outcomes for this topic.
MOTIVATION (3 MINS)
Questions related to Body Fluids
1. Ask the learners the possible consequences should there be a failure in the ability of the body
to dispose or eliminate toxic metabolic wastes.

Lecture on Body Fluids
1. Define some key terms related to the regulation of body fluids:
I. Internal environment the fluid environment that bathes the cells (extracellular fluid)
composed of the interstitial fluid and blood.
II. Osmolarity solute concentration expressed in milliosmoles per liter of solution
(mOsm/L).
III. Osmosis the movement of water from a region of higher osmolarity to a region of lower Teacher Tips:
osmolarity across a selectively permeable membrane. The lecture presentation may be divided into two
one-hour sessions and a one-hour session can be
IV. Osmoregulation the regulation of water and ion balance.
allotted for activity:
V. Excretion the elimination of metabolic wastes including nitrogenous wastes produced
from the breakdown of proteins; this process also helps in the regulation of water and ion 1ST HOUR:
A. Some key terms related to omoregulation
balance. B. Different types of animals based on the
osmolarity of their body fluids in relation to the
2. Describe the two types of animals based on the osmolarity of their body fluids in relation to environment
the environment: C. Three types of nitrogenous wastes in animals
I. Osmoconformers allow the osmolarity of their body fluids to match that of the D. Excretory systems in invertebrates
environment; 2ND HOUR:

A. These include most marine invertebrates with body fluids that are generally E. The mammalian urinary system and the role of
hyperosmotic to their surroundings nephrons
F. The mechanism of urine formation
B. Because their bodies are isosmotic to seawater, they consume little or no energy in
G. The regulation of mammalian kidney function
maintaining water balance H. The role of the kidneys in the bodys acid-base
II. Osmoregulators keep the osmolarity of body fluids different from that of the balance
environment;
3RD HOUR: Laboratory Activities
A. These include most marine vertebrates, birds, mammals
B. Either they discharge water in hypotonic environment or they take in water in a
hypertonic environment
3. Identify the three types of nitrogenous wastes excreted by animals:

I. Ammonia the primary nitrogenous waste for aquatic invertebrates, teleosts, and larval
amphibians
A. It is readily soluble in water but is also highly toxic
B. It can be excreted from the body only in dilute solutions.
II. Urea produced by mammals, most amphibians, some reptiles, some marine fishes, and
some terrestrial invertebrates
A. It is formed by combining ammonia with bicarbonate ion (HCO3 ) and converting the
product into urea
B. Although its formation requires more energy compared to ammonia, it is about
100,000x less toxic than ammonia
C. Its excretion requires only about 10% as much water compared to ammonia
196
III. Uric acid excreted by birds, insects, and terrestrial reptiles Teacher Tips:
A. It is relatively nontoxic but more energetically expensive to produce than urea This part of the lecture can be supplemented with
B. It is largely insoluble in water and it is excreted as a semisolid paste or precipitate with visual aids of the different excretory system to be
discussed.
very little water loss
4. Enumerate and describe excretory systems in invertebrates:
I. Cell surface or cell membrane allows passage of wastes in unicellular organisms
II. Contractile vacuole a specialized cytoplasmic organelle in many freshwater protists (e.g.
Paramecium) that expels excess water out of the cell to prevent lysis
III. Protonephridia or Flame Bulb System network of tubules that lack internal openings
but have external openings at the body surface called nephridiopores such as in the
flatworm, Dugesia.
A. The smallest branches of the tubule network end with a large cell called a flame bulb
or cell
B. Water and solutes in body fluids enter the flame cell and get filtered
C. Specific molecules and ions are removed by reabsorption while other ions and
nitrogenous wastes are released into the tubule network and excreted via the
nephridiopore.
IV. Metanephridia the excretory tubule of most annelids and adult mollusks;
A. The tubular network has a funnel-like internal opening called a nephrostome that
collects
body fluids
B. As the body fluids move through the network, some molecules and ions are
reabsorbed while other ions and nitrogenous wastes are secreted into the tubule
C. The bladder stores the nitrogenous wastes as urine and later on excreted from the
body surface via the nephridiopore
V. Malpighian Tubules the excretory tubules of insects and other terrestrial arthropods
attached to their digestive tract (midgut);
A. The tubules have ends that are immersed in the hemolymph (circulatory fluid) while the
distal ends empty into the gut
B. Malpighian tubules do not filter body fluids; instead they employ secretion to generate
the fluid for release from the body
C. In particular, they help actively secrete uric acid and ions like Na+ and K+ into the
tubules, allowing the water to move osmotically from the hemolymph into the tubule
D. The fluid then passes into the hindgut (intestine and rectum) of the insect as dilute urine
E. Reabsorption of ions and water occurs in the hindgut wall, causing the formation of uric acid crystals that are released with the feces.
5. Characterize the mammalian urinary or excretory system:

I. The mammalian urinary system consists of two kidneys,
each with a ureter, a tube leading to a urinary bladder (for 6. Describe the components of nephrons functional units of
storage), with an open channel called urethra leading to the kidneys:
body surface.
I. Nephrons generally have the following components:
II. The kidneys serve as specialized organs for osmoregulation
A. Bowmans capsule an infolded region that encloses a
and excretion; they are composed
ball of blood capillaries called glomerulus where initial
of the following:
filtration of the blood plasma occurs.
A. Renal capsule the outer coat of connective tissue;
B. Renal tubules receive and modify the glomerular
B. Cortex the zone near the capsule consisting of blood filtrate; consist of a proximal convoluted tubule, followed
vessels and nephrons; by a U-shaped loop of Henle, and a distal convoluted
C. Medulla inner zone also consisting of blood vessels tubule.
and nephrons; C. Peritubular capillaries bring substances to and take
D. Nephrons the functional units of the kidney where substances away from the renal tubules.
urine is formed; and D. Collecting duct receives the urine from the renal
E. Renal pelvis central cavity in the kidney where urine tubule leading to the renal pelvis.
coming from the nephrons is channeled before going to II. Nephrons filter and retain water and solutes, leaving
the ureter. concentrated urine to be collected in the central renal pelvis.
III. Each kidney contains about 1.3 M nephrons, approximately III. The glomerulus serve as initial site for filtration and the
80 km long if connected end to end. glomerular filtrate produced is directed into the Bowmans
IV. About 1,600 liters of blood pass through the kidneys each capsule.
day (300x the blood volume); approximately 180 liters IV. The Bowmans capsule collects the filtrate and directs it
become filtrate but only about 1.5 liters of urine get though the continuous renal tubules: proximal tubule
excreted. loop of Henle distal tubule collecting duct renal
V. More than 99% of the water and almost all sugar, vitamins pelvis.
and other organic nutrients are reabsorbed across the tubule V. The peritubular capillaries exit the glomerulus, converge,
epithelium. then branch again around the nephron tubules where they
198
participate in reclaiming water and essential solutes. ii. Filtrate is collected by the Bowmans capsule and
funneled into the proximal tubule.
B. During tubular reabsorption, useful materials such as
salts, water, glucose, and amino acids move out from the
renal tubules and into adjacent peritubular capillaries.
C. Tubular secretion results in movement of surplus
hydrogen and potassium ions, uric acid, toxins and other
drugs from the blood into the renal tubules.
II. There are several factors influencing filtration:

A. Blood enters the glomerulus under high pressure in
order to facilitate filtration; arterioles present in the
glomerulus tend to have wider diameters than most.
B. Glomerular capillaries are highly leaky to water and
small solutes.
C. The volume of blood flow affects the rate of filtration.
8. Discuss the regulation of mammalian kidney function:

I. Receptors in the juxtaglomerular apparatus function in the
kidneys autoregulation system.
Figure 1. The organization of the mammalian nephron the
A. The receptors trigger constriction or dilation of the
functional unit of the kidney. (Picture taken from Reece et al., 2011.)
afferent arteriole to keep blood flow and filtration
constant during small variations in blood pressure.
7. Discuss the mechanism of urine formation in mammalian
nephrons: II. Antidiuretic hormone (ADH) promotes water conservation.
I. Urine formation involves three processes: A. It is secreted from the hypothalamus via the pituitary
when osmoreceptors detect an increase in the osmolarity
A. In filtration, blood pressure forces filtrate (water and
of body fluids.
small solutes) out of the glomerular capillaries.
B. It makes the walls of distal tubules and collecting ducts
i. Blood cells, proteins, and other large solutes cannot
more permeable to water, and thus the urine becomes
pass the capillary wall and they remain in the blood.
more concentrated.

III. Aldosterone enhances sodium reabsorption.
A. When too much sodium is lost, extracellular fluid volume is reduced, and pressure
receptors detect corresponding drop in blood pressure.
B. In response, the kidney secretes an enzyme, renin, which indirectly stimulates the adrenal
cortex to secrete aldosterone, which in turn stimulates reabsorption in the distal tubule
and collecting ducts.
IV. Cells in the hypothalamus thirst center inhibit saliva production and stimulate the urge to
drink when there is an increase in the solute concentration in extracellular fluid.
9. Explain the role of the kidneys in the bodys acid-base balance:
I. Over-all acid-base balance is maintained by controlling hydrogen ions through buffer
systems, respiration, and excretion by the kidneys.
II. Only the urinary system can eliminate excess hydrogen ions, permanently, and restore the
bicarbonate buffering ions to the blood.
PRACTICE (40 MINS)

Analogy
1. As a supplement to the lecture discussion, the teacher may ask 5. Provide visual aids of the following excretory organs and allow
the learners to make an analogy to the functions of the different the learners to draw them in their worksheets with proper
parts of: labeling of parts:
I. urinary system I. Cell membrane
II. kidney II. Contractile vacuole
III. nephron III. Protonephridia
2. Use a mannequin or a visual aid to show the locations of urinary IV. Metanephridia
organs. V. Malpighian tubules
3. Exhibit a model of a kidney to illustrate its parts and the blood
vessels associated with it.
6. Actual dissection of toad can also be done in order to observe
4. Display a model of a nephron and review the process of urine the following parts: I. Kidney
formation. II. Ureter III. Bladder
200
1. Of the three processes filtration, reabsorption, secretion which is (are) accomplished by a kidney dialysis machine? Explain any limitations
of the device.
2. Why do high-protein diet supplements for increasing muscle mass or losing weight include warnings stating that water intake must be
increased when consuming the product?
3. Why does eating salty foods make you thirsty? Why does eating salty foods make you temporarily gain weight?
Quiz
1. Which process is primarily involved in the control and 3. The following are true about uric acid as a form of nitrogenous
maintenance of water and ion balance in the body? waste except:
A. Respiration A. Excreted by birds and insects
B. Osmoregulation B. Relatively non-toxic
C. Excretion C. Highly soluble in water
D. Nutrition D. Energetically expensive to produce from ammonia
E. Circulation E. Excreted as a semi-solid paste
2. Which type of animals consume little or no energy in 4. For numbers 4-6, match the type of excretory system with the
maintaining water balance? corresponding animal where each is found:
A. Birds
B. Mammals
4. Protonephridia A. Cockroach
C. Marine vertebrates
5. Metanephridia B. Flatworm
D. Marine invertebrates
E. All of the above 6. Malpighian tubules C. Earthworm
7. The part of the urinary system that serves to temporarily store 9. The following components in the filtrate are reabsorbed back
urine: into the blood except:
A. Urinary bladder A. Water
B. Kidneys B. Glucose
C. Ureter C. Amino acids
D. Urethra D. Urea
E. Nephron E. Salts
8. In each nephron of the kidney, the glomerulus and Bowmans 10. The following are involved in the regulation of mammalian
capsule: kidney function except:
A. Filter the blood and capture the filtrate. A. ADH
B. Reabsorb water into the blood. B. Aldosterone
C. Reabsorb salts and nutrients. C. Renin
D. Break down harmful toxins and poisons. D. Thirst center in hypothalamus
E. Refine and concentrate the urine for excretion. E. Oxygen
ASSIGNMENT
1. List the organs that make up the human urinary system. What is the ANSWER KEY:
function of each? 1. B. 6. A.
2. Discuss in detail how the reabsorption and secretion of substances 2. D. 7. A.
occur across the different parts of the renal tubules. 3. C. 8. A.
3. Kidney stones are calcium-rich crystals that form inside the kidney. 4. B. 9. D.
What symptoms would you expect if the stones lodge in a ureter? 5. C. 10.E.
4. Shortly after you drink a large glass of water, you will feel the urge to
urinate. Explain this observation. Begin by tracing the path of water,
Teacher Tip:
starting at the stomach and ending with the arrival of urine in the Answers to the assignment may be written on bond paper and submitted on
bladder. the following meeting.
5. Why is protein in the urine a sign of kidney damage? What structures

in the kidney are probably affected?
202
ASSESSMENT GUIDE (FOR THE ACTIVITY AND LABORATORY ASSESSMENT GUIDE (FOR QUIZ AND ASSIGNMENT): THE
WORK NUMBERS 2 AND 3 INVOLVING DRAWING LABELLING) TEACHER MAY ASSIGN POINTS TO THE QUESTIONS
1. (POOR) disorganized drawing with many errors in the labeling 1. (POOR) 74% and below
of cell layers in the root cross sections and in the tracing of the
apoplast and symplast routes.
2. (SATISFACTORY) acceptable drawing with some errors in the

labeling of cell layers in the root cross sections and in the tracing
of the apoplast and symplast routes.
4. (VERY SATISFACTORY) 85 to 89% correct
3. (VERY GOOD) clear drawing with minimal error in the labeling

of cell layers in the root cross sections and in the tracing of the 5. (OUTSTANDING) 90 to 100% correct
4. (EXCELLENT) clear drawing with correct labels for the cell

layers in the root cross sections; and accurate tracing of the

Process in Plants and Animals: Immune
Systems (1 of 3)
Content Standard
The learners demonstrate an understanding of animal immune systems. LESSON OUTLINE
Performance Standard Introduction Communicating Learning Objectives 5
develop a presentation (e.g. play, song) to show how an organism
maintains homeostasis through the immune system. Instruction Discussion of Innate and Adaptive 40
Immune Systems
Learning Competency
The learners shall be able to explain how immune systems work Enrichment Description of Inflammation 5
(STEM_BIO11/12-IVa-h-1) Evaluation Quiz 5
At the end of the lesson, the learners will be able to: Freely downloadable images of disease symptoms and short videos of the
compare innate and adaptive immune responses; innate and adaptive immune responses
describe how the innate immune response helps protect a person from Resources
illness; and (1) Immunology textbooks (e.g., Coico, Richard and
Geoffrey Sunshine. Immunology: A Short Course
explain why the innate immune response (inflammation in particular) is (Coico, Immunology) 7th Edition. 2015. Wiley-
Blackwell)
essential for a protective immune response.
204
INTRODUCTION (5 MINS) Teacher Tips:
1. Ask the learners about the most common
Communicate the learning objectives as follows: diseases that they have had. (Examples:
I. compare innate and adaptive immune responses common colds, diarrhea, influenza, dengue
fever, etc.).
II. describe how the innate immune response helps protect a person from illness
2. Ask the learners if they know or have heard of
2. Tell the learners that the lesson today will be on how the body protects itself from disease- the following diseases: chikungunya;
causing organisms. smallpox; leukemia
3. The teacher will ask volunteers to describe what is Immunity.
MOTIVATION (5 MINS) Teacher Tips:

1. Explain that persons usually get fevers or body
1. Ask learners to think about what happens to them when they get sick. Ask them if they know
pain no matter what kind of pathogen infects
the cause of these diseases: common colds (rhinoviruses); diarrhea (various bacterial toxins); them.
influenza (influenza virus). 2. Point out that it usually takes 3-4 days for them
to get well.
3. The two things mentioned above are directly
due to the immune system and how it
responds to pathogens.
1. Discuss the two types of immune system: innate and adaptive
Teacher Tips:
2. Use a table to define and show the main differences between the innate and adaptive Important points are
response (innate: fast-acting, non-specific; adaptive: slower response, pathogen-specific; etc.) 1. The innate immune response is always the first
response to an infection.
3. Explain that the innate immune response involves :
2. The innate immune response acts fast, but
I. Barrier defenses like the skin, mucous membranes and secretions. In humans and in most never changes from exposure to exposure.
vertebrates, the skin with other ectodermal derivatives is the first line of defense against 3. Inflammation is characterized by fever,
redness, swelling, pain, and loss of function in
infection. Ask the class to recall their previous lessons on healthcare in their lower year
the infected area.
levels; that is why it is important to wash hands with soap and water frequently. If there is 4. Inflammation can help kill the pathogen (fever
an invading pathogen like a virus (or bacteria or any foreign substance) the body reacts produces heat that may kill the bacteria/
through mucous secretions. Even the saliva contains agents which are antimicrobial. viruses or make them stop replicating for
example).
II. Internal defenses of the innate immune response consist of phagocytic cells, natural killer
cells, antimicrobial proteins (interferons; the complement system) and the inflammatory
response (that involves histamines, mast cells and cytokines).
4. Explain that the adaptive immune response ( for vertebrates only ) involves the recognition of Teacher Tips:
traits specific to particular pathogens using a vast array of receptors. The adaptive immune 4. Without the innate immune response, the
response is made possible because of: adaptive immune response cannot be
activated, because the innate immune
I. The Humoral response- production and secretion of antibodies or immunoglobulins response gives the rest of the immune system
against specific antigens (any foreign body/structure- pollen, bacteria, virus, dust). signals that say there is a real threat to the
Antibodies are produced by cells that secrete them in the bloodstream or display them in body that must be eliminated.
5. Therefore, stopping inflammation is not always
the surface of some cells, ready to face and combat any antigen. a good thing. For example, you need to have
II. Cell mediated response- occurs when cytotoxic cells defend the body against infection. a fever to really mount a full-blown response
The development of B and T cells, memory cells and plasma cells are important aspects of against a pathogen so taking paracetamol
when you have a mild fever (below 38.3OC) for
cell mediated immune mechanism. example, may not always be a good thing
5. As a practical lesson, describe inflammation and point out that is important in activating the since you may lose the sterilizing effects of the
adaptive immune response (acts as danger signals for the body) fever and dampen the danger signals that
activate the adaptive immune response.
However, it is still best to get medical advice
on how to treat disease
ENRICHMENT (5 MINS)
1. Ask learners to describe when inflammation is good and when it is bad. Teacher Tip:
Acute inflammation can be good since it activates
the immune response, but chronic inflammation
(e.g., arthritis, psoriasis, irritable bowel disease) is
EVALUATION (5 MINS) bad because it ultimately leads to tissue damage.
1. Which of the following is NOT a pattern found on pathogens that the immune system
Correct answers:
recognizes as foreign? 1. D. Double stranded DNA is normally found in
A. Double stranded RNA human cells.
2. Fever, redness, swelling, pain, and loss of
B. Presence of N-formyl methionine function.
C. Presence of lipopolysaccharide (LPS) 3. Inflammation is a signal produced by the body
in response to a real infection. It also sends
D. Double stranded DNA signals to the adaptive immune response that
E. None of the above there is a real danger present and that it has
to be eliminated.
2. What are the five hallmarks of inflammation?
3. What is the importance of inflammation in the immune response
206

Process in Plants and Animals: Immune
Systems (2 of 3)
The learners demonstrate an understanding of the humoral immune response
Motivation Antibodies and Antigens 3
make a comic strip on the humoral immune response Instruction Humeral and Cellular Response 40
Learning Competency Practice Questions 5

The learners will be able to describe how immune systems contribute to Enrichment Inquiry on Vaccinations 5
homeostasis.(STEM_BIO11/12-IVa-h-1)
Evaluation Comic Strip 5
At the end of the lesson, the learners will be able to: Materials
Freely downloadable images of antibodies and antigens. Freely
define the term antibody; downloadable molecular viewers (e.g. Swiss PDB Viewer; spdbv.org).
name the different kinds of antibodies produced by humans; and Downloadable molecular models of antibodies from the Protein Data Bank
(www.pdb.org; PDBID: 1H0D). Art supplies for creating comic strips, paper
explain the function of each type of antibody. / clay models of antigen and antibody interactions.
Resources
(1) Immunology textbooks (e.g., Coico, Richard and Geoffrey Sunshine.
Immunology: A Short Course (Coico, Immunology) 7th Edition. 2015.
Wiley-Blackwell)
Teacher Tips:
INTRODUCTION (2 MINS) Pre-class discussion:
In the previous lecture, we learned that it takes
Communicating Learning Objectives about 4 days to fully activate our adaptive immune
1. State the learning objectives as follows: response.
I. define the term antibody;
Can you explain what happens during those 4
II. name the different kinds of antibodies produced by humans and days?
III. explain the function of each type of antibody
What important events need to take place?
(Answers are listed in the Instruction section of this
2. Mention that in the past lesson the innate immune response was described. It is necessary to guide)
activate the adaptive immune response. It should take about 3-4 days for a person to get
better from an illness, meaning fever and other symptoms of inflammation should disappear Get input from students regarding these
questions. Comment on the correctness/
after 3-4 days. incorrectness of these answers. State how some of
3. Point out that at day 3-4 of infection, the adaptive immune response is fully activated and is these topics will be discussed in todays lecture.
able to effectively control, combat, and eliminate the pathogen. Specifically, the lecture will focus on how
antibodies are developed to target antigens from
pathogenic organisms / substances.
MOTIVATION (3 MINS)
1. Ask the students what they know of antibodies and antigens. Teacher Tip:
Definition: Discuss how the specific interaction between
antigens and antibodies can be used to make
Antibody is a protein produced by our immune system to specifically bind a target. targeted drugs.
Usually, these targets are parts of pathogens. Antigen is a substance / part of pathogen
that generate an immune response. Usually this response leads to the production of a Answer: Drugs and other therapeautic agents can
be attached to antibodies that are specific for
specific antibody for the given target.
antigens on cancer cells. This allows for specific
targeting of these drugs to the diseased cells,
INSTRUCTION (40 MINS) thereby avoiding damage to healthy tissue .
1. The adaptive immune response has two aspects: the humeral and cellular response.
2. The humeral response is due to the production of antibodies by B-cells. Teacher Tip:
Emphasize that the adaptive immune response is
I. B cells are white blood cells that develop and mature in the bone marrow. activated by the presence of foreign substances
II. B cells are activated when they encounter antigen in the lymph nodes. (proteins, nucleic acids, sugars, etc. found on
pathogens).
III. Activated B cells produce antibodies, proteins that recognize and bind to specific parts of
the pathogen, called antigens. Each B cell produces only one antibody which recognizes
only one kind of antigen (specificity)
208
IV. Antibodies are of five major types; IgM, IgD, IgG, IgA, and IgE. Teacher Tip:
A. IgM is the first antibody produced. It coats the pathogen and promotes endocytosis Also point out that although it is important to turn
on the immune response during an infection, it is
by macrophages.
just as important that it is turned off after the
B. IgG is a major antibody produced. It activates the other parts of the immune response infection is gone.
and leads to neutralization and destruction of pathogen.
C. IgA is the important antibody for the mucosal immune response. It prevents
Answers for Practice Part:
pathogens from crossing the epithelium and entering the blood stream. 1. B cells
D. IgE activates mast cells and leads to the production of histamine, which is why it is also 2. In the bone marrow
associated with allergic reactions. 3. IgE
4. This person becomes very susceptible to
E. IgD. (The role of this antibody is still unclear at this point.) diseases. They cannot effectively combat
3. The antibody response is best suited to combat pathogens that survive outside of the cell, pathogens and can eventually die from even
the mildest infections.
such as bacteria, fungi, and some worms.
Teacher Tip:
Most vaccines today contain an adjuvant
PRACTICE (5 MINS) (substance that activates the innate immune
response) along with a protein antigen from the
Quiz pathogen, or an inactivated version of the
1. What type of cell produces antibodies? pathogen which stimulates B cells to produce
2. Where are B cells produced? antibodies against the pathogen. After getting
the vaccine, you now have cells that remember the
3. The antibody involved in allergy is ______. pathogen and can act quickly when you actually
4. What will happen if a person cannot produce antibodies? get infected with the disease-causing organism.
This memory of the B cells and quick response
prevents the person from feeling any symptoms of
the disease.
ENRICHMENT (5 MINS)
Ask the students to think about what happens when they get vaccinated. How does a person get
antibodies upon vaccination?
Teacher Tip:
Check for the following features in the comic strip:
1. The five types of antibodies
EVALUATION (5 MINS) 2. The known functions of these antibodies
Assignment: Make a comic strip showing the different types of antibodies and the roles they play 3. Highlight special features of each antibody
based on sequence of production, amount
in the immune response. produced, special shapes, etc.)
Lesson 22.3: Compare and Contrast in

Plants and Animals: Immune Systems (3 of 3)
Content Standard
The learners demonstrate an understanding of the structures and processes LESSON OUTLINE
involved in immune systems.
illustrate the functions of T cells Instruction Discussion of the Types of T Cells 40
Learning Competency Practice Quiz 5

The learners will be able to describe the importance of immune systems Enrichment Listing of Common Autoimmune 5
(STEM_BIO11/12-IVa-h-1) Disorders
Specific Learning Outcomes Evaluation Exam 10
explain where T cells come from; Materials
Art supplies for creating comic strips, paper / clay modelling materials
identify the different types of T cells and
Resources
describe the functions of T cells (1) Immunology textbooks (e.g., Coico, Richard and Geoffrey Sunshine.
Immunology: A Short Course (Coico, Immunology) 7th Edition. 2015.
Wiley-Blackwell)
210
Point out that although antibodies are good at
Communicating Learning Objectives combating extracellular pathogens, they cannot
1. State the learning objectives as follows: eliminate pathogens found inside cells like viruses.
I. explain where T cells come from;
II. identify the different types of T cells and
III. describe the functions of T cells
2. The teacher will ask the students what they can recall in the past lessons.
Discussion Question: Our previous lectures discussed how the body deals with several
kinds of pathogens (e.g. bacteria, viruses, etc.). What is common among these
examples?
Answer: These are extracellular pathogens

Teacher Tip:
Discussion Question:
3. Emphasize that the humoral immune response (B-cells) targets extracellular pathogens.
If you were controlling the immune system and you
had to protect the body from a pathogen hiding
within a diseased cell, what would you do?
Possible answer:
MOTIVATION (5 MINS) If you cant eliminate the pathogen directly,
perhaps its better for the system to quarantine/
Question: If antibodies cannot eliminate intracellular pathogens, how does the immune system
eliminate the diseased cell to prevent the spread
deal with these situations? of the infection.
1. This lecture focuses on the system that handles pathogens that are not easily accessible for
Is this practice also done in the organismal level?
the antibodies produced by B-cells. This system involves the function of another type of
Can you think of institutions that practice the same
immune cell; the T-cells. system?
Quarantine:
(Cellular) Antibodies (Organismal) Quarantine
Office (at airports) for Food safety and Biosafety.
(Cellular) Antibodies (Organismal) Leper colonies

INSTRUCTION (40 MINS) Teacher Tips:
1. The adaptive immune system is due to the production of T cells. 1. Explain that T cells have to recognize the
foreign antigen in the context of a self-
A. T cells are white blood cells that are produced in the bone marrow and mature in the molecule, the MHC molecule. This ensures
thymus. that the immune system will only be activated
when there is a real infection in the body.
B. T cells are activated when they encounter antigens in the lymph nodes.
2. It is important to only activate the T cell
C. However, unlike B cells, T cells need to recognize an antigen in the context of self- response (particularly the cytotoxic and helper
molecules called major histocompatibility complex (MHC) molecules. T response) only if there is a real infection
because these responses are very potent and
2. There are 3 major types of T cells: cytotoxic T cells, helper T cells and regulatory T cells could potentially harm the body if they are not
A. Cytotoxic T cells recognize virus-infected cells and kill them. regulated properly.
3. Regulatory T cells are very important because
B. Helper T cells secrete proteins that help other immune cells (B cells, macrophages, etc.) loss in their function can lead to autoimmune
survive and perform their function. disease. This occurs when the immune system
starts to attack itself.
C. Regulatory T cells control the immune response by turning it off. This prevents the immune
system from harming the body.
Answer Key:
PRACTICE (5 MINS) 1. Cytotoxic, Helper and Regulatory T-cells
2. T stands for Thymus, where these cells
Quiz mature.
1. Enumerate the types of T-cells. 3. Bone marrow
2. What does the T in T-cells mean? 4. Thymus
5. There is danger of developing an autoimmune
3. Where are T cells produced? disorder.
4. Where do T cells mature?
5. What will happen if you lose all of your regulatory T cells?
212
ENRICHMENT (5 MINS) Answers:
The loss of regulatory T-cell function leads to autoimmune disorders. Ask the students for Rheumatoid Arthritis an autoimmune disorder
where T-cells attack the lining of the joints. This
examples of these diseases. Common autoimmune disorders include rheumatic arthritis
leads to inflammation, joint deformation and bone
(rayuma) and lupus. What are the symptoms of these diseases, and how does T-cell dysfunction erosion. (www.mayoclinic.org/diseases-conditions/
lead to their occurrence? rheumatoid-arthritis)
Lupus: There are several types of lupus. The most

common is named systemic lupus erythematosus.
T-cells attack the joints, skin, kidneys, heat, lungs,
blood vessels and the brain in this autoimmune
disease. Dysfunctional T-cell attacks lead to
inflammation in these targets. (www.lupus.org.uk)
Answers to the Quiz:

EVALUATION (10 MINUTES) 1. Lymph nodes
2. Major Histocompatibility Complex.
Quiz
3. The MHC serves as a signal for self/non-
1. Where are T-cells activated? foreign cells. This allows the body to
2. What does the acronym MHC mean? recognize tissues to reject.
4. They cannot make mature T cells, but can still
3. What is the function of the MHC? make mature B cells.
4. What happens to an individual who has had their thymus removed?
Assignments could be in the form of:

Examinations can be given to test the students retention of the information provided in the 1. Comic strips about the different kinds of T
cells, and what they do in the immune
lecture. Questions may be similar to the PRACTICE quiz. Alternatively, the students may be
response.
asked to do an assignment to show how they understood the concepts presented. 2. A dueling card game where the right type of
T-cell should match the pathogen that it
should combat (e.g. Magic card games;
Modified Rock-Paper-Scissors).
3. Clay models of antigens bound in the MHC
complex and their interactions with the T-cell
receptors.

Process in Plants and Animals: Chemical and
Nervous Control
LESSON OUTLINE - DAY ONE
Content Standard
The learners demonstrate an understanding of plant and animal organ systems Introduction Communicating Learning Objectives 10
and their functions.
Motivation Video clip 10
Instruction Television Show Proper 60
develop a presentation (e.g. role-playing, dramatization and other forms of Enrichment Short Quiz 10
multimedia) to show how an organism maintains homeostasis through the Materials
interaction of various organ systems in the body. Podcast, Short Videos
Learning Competency Resources

(1) Responding to Environmental Changes- http://www.bbc.co.uk/
The learners compare and contrast chemical and nervous control in plants and
schools/gcsebitesize/science/add_ocr_21c/brain_mind/
animals (STEM_BIO11/12-IVa-h-1) environmentrev1.shtml (Retrieved 10/15)
(2) Chemical Signals in Animals: http://web.calstatela.edu/faculty/mchen/
433/Chem%20Sig%20Hormones.ppt (Retrieved 10/15)
At the end of the lesson, the learners will be able to: (3) The Endocrine System: http://www.shmoop.com/animal-systems/
explain how animals respond to environmental stimuli; endocrine-system.html (Retrieved 10/15)
(4) The Nervous System: http://www.shmoop.com/animal-systems/
describe the mechanisms of chemical and nervous control in animals; nervous-system.html (Retrieved 10/15)
explain how plants respond to environmental stimuli; and (5) Nerves and Hormones: http://www.rsc.org/Education/Teachers/
Resources/cfb/nerves.htm (Retrieved 10/15)
describe the mechanisms of chemical control in plants. (6) Comparing the Nervous and Endocrine Systems: https://
www.boundless.com/physiology/textbooks/boundless-anatomy-and-
physiology-textbook/the-endocrine-system-16/overview-of-the-
endocrine-system-149/comparing-the-nervous-and-endocrine-
systems-773-4975/ (Retrieved 10/15)
!!
214
Choose volunteers beforehand and tell them their
Communicating Learning Objectives specific tasks: host (1-2 students), resource
1. Communicate learning objectives as follows: speakers (3-5 students) and production crew (5
I. Explain how animals respond to environmental stimuli students). Tell them to prepare a script to be
submitted to you a day before the show. Include
II. Describe the mechanisms of chemical and nervous control in animals
an interesting and catchy title for the show.
III. Explain how plants respond to environmental stimuli
IV. Describe the mechanisms of chemical control in plants You may act like the producer of the show and
2. Tell students that they will act as resource persons to talk about chemical and nervous discuss thoroughly with the volunteer students
how a TV show is created.
control in animals. Explain to them that they are going to watch a class simulated television
show and they will become participants.

Video Clip This can be part of the television show.
1. Show the students a short podcast: Fight or Flight Response: https://www.youtube.com/
watch?v=m2GywoS77qc
Television Show Proper

1. The host will introduce the show and the guests (resource speakers).
2. The guests will discuss in an educational and entertaining manner how animals respond to To make the show more entertaining, tell the
students not to make it too technical and engage
environmental stimulus. the audience in the discussion.
3. The host should make the show as interactive as possible by letting the audience (students)
interact with the resource speakers. The TV show may be done in two meetings to
cover the discussions on Chemical and Nervous
4. The host/s will close the show. Control.
Prizes may be given as incentives for those who

INSTRUCTION (60 MINS) will interact during the show.
Lesson Proper:
Compared to plants, animals have chemical and nervous control that enable them to respond to Tell them to make a handout that will be
environmental stimuli. Chemical control is under the regulation of the endocrine system and distributed to the audience after the show.
includes the various hormones. Chemical control is slow-acting but the effect is long-term. On the
Assign some students to take a video of the show
other hand, nervous control is under the regulation of the nervous system with its system of which will be shown a day after to the class.
neuronal mechanisms. Nervous control is fast-acting and the effect is short-term, although
frequent stimulation can be stored to produce a longer-lasting behavioral response.
Nervous System. The nervous system is the one responsible for coordinating the functions of the Teacher Tip:
other body systems. The discussion of the system may focus on the following outline: Choose volunteers beforehand and tell them their
specific tasks: host (1-2 students), resource
1. Divisions of the nervous system
speakers (3-5 students) and production crew (5
2. The neuron as the basic unit students). Tell them to prepare a script to be
submitted to you a day before the show. Include
3. Transmission across synapse
an interesting and catchy title for the show.
You may act like the producer of the show and

The nervous system gathers information, processes the information and elicits a corresponding
discuss thoroughly with the volunteer students
response or reaction to the stimulus. The nervous system has two main divisions: the central how a TV show is created.
nervous system (CNS) and the peripheral nervous system (PNS). The CNS is composed of the
brain and the spinal cord. The brain is the main control center while the spinal cord connects the
brain to other nerves of the body. The PNS is composed of nerves that branch out from the brain
and the spinal cord to specific body parts and divided further into somatic and autonomic
nervous system. The somatic nervous system controls voluntary body movements while the This can be part of the television show.
autonomic control involuntary actions. The diagram below shows the brief description of each
division.
To make the show more entertaining, tell the

students not to make it too technical and engage
the audience in the discussion.
The TV show may be done in two meetings to

cover the discussions on Chemical and Nervous
Control.
Prizes may be given as incentives for those who

will interact during the show.
Tell them to make a handout that will be

distributed to the audience after the show.
Assign some students to take a video of the show

which will be shown a day after to the class.
From: http://pharmacologyview.blogspot.com (Last accessed 04/28/16, 3:00pm)
216
The basic structural and functional unit of the nervous system is the neuron. Once stimulated, a
neuron transmits electrical signals called an action potential or an impulse across the system and
lets a body part respond accordingly. Although neurons differ in some respects, they contain four
basic parts: dendrite, soma, axon and axon terminals. The cell body or soma contains the nucleus
and most organelles. The axon is a single projection from the soma which carries the impulse to
the axon terminal. An impulse is a sudden change in the electric potential of the cell membrane.
The axon may be enveloped by a myelin sheath for faster conduction of impulse. The dendrites
are several projections which extend outward from the cell body and receive chemical signals
from the axon terminals of another neuron. Electrical disturbances in the dendrites or axon will
cause a new wave of impulse down the axon. The diagram below shows a typical neuron with its
parts and the direction of impulse transmission.
From: http://img.docstoccdn.com/thumb/orig/99214785.png (Last accessed 04/28/16, 3:00pm)

Neurons connect with one another through a junction called synapse. The moment an action
potential reaches the axons terminal, a series of events will be created leading to the stimulation
of the next neuron. Chemicals called neurotransmitters are released which facilitate the
transmission of an impulse across a synapse. The figure below shows a synapse and synaptic
transmission.
From: http://faculty.pasadena.edu/dkwon/chap%208_files/images/image60.png
218
Endocrine Gland System. Chemical coordination of body functions is mediated by the endocrine
system, composed of ductless glands that release hormones. Hormones are chemical messengers
secreted by a gland and affect a specific target tissue or organ. The endocrine and the nervous
system coordinate with each other through a series of feedback mechanisms. A disorder results
when a hormone is under- or over-secreted. The table below shows the major endocrine glands,
the hormones that they release and their specific functions.
From: http://usdbiology.com/cliff/Courses/General%20Biology/153figs/47_02_endocrine_system-
L.jpg (Last accessed 04/28/16, 3:00pm)
The diagram below shows a simple coordination between the nervous and the endocrine system.
From: http://csls-text3.c.u-tokyo.ac.jp/images/fig/fig05_07.jpg
EVALUATION (5 MINS) Teacher Tip:

1. What are the divisions of the nervous system? You may select some items from this sites:
http://footprints-science.co.uk/quizzes.php?
2. Draw the structure of a neuron. difficulty=2&module=50&section=1&type=Th
3. What is a synapse? e_nervous_system&quiz=yes&animation=&su
bjectarea=Biology%201
4. Define a hormone. http://highered.mheducation.com/sites/
5. Differentiate the functions of the endocrine and the nervous system. 0072437316/student_view0/chapter47/
chapter_quiz.html
220
90 MINS
General Biology 2

Process in Plants and Animals: Chemical and
Nervous Control LESSON OUTLINE - DAY TWO
Introduction Preview 5
Content Standard Motivation Observation 10

The learners demonstrate an understanding of plant and animal organ systems Instruction Discussion on Plant Response 60
and their functions.
Evaluation Take-home Activity 10
The learners shall be able to: Enrichment Short Quiz 5
develop a presentation (e.g. role-playing, dramatization and other forms of Materials
multimedia) to show how an organism maintains homeostasis through the Podcast, Short Videos
interaction of various organ systems in the body. Resources
(1) Responding to Environmental Changes- http://www.bbc.co.uk/
Learning Competency schools/gcsebitesize/science/add_ocr_21c/brain_mind/
The learners compare and contrast chemical and nervous control in plants and environmentrev1.shtml (Retrieved 10/15)
animals (STEM_BIO11/12-IVa-h-1) (2) Chemical Signals in Animals: http://web.calstatela.edu/faculty/mchen/
433/Chem%20Sig%20Hormones.ppt (Retrieved 10/15)
Specific Learning Outcomes (3) The Endocrine System: http://www.shmoop.com/animal-systems/
At the end of the lesson, the learners will be able to: endocrine-system.html (Retrieved 10/15)
(4) The Nervous System: http://www.shmoop.com/animal-systems/
explain how animals respond to environmental stimuli;
nervous-system.html (Retrieved 10/15)
describe the mechanisms of chemical and nervous control in animals; (5) Nerves and Hormones: http://www.rsc.org/Education/Teachers/
Resources/cfb/nerves.htm (Retrieved 10/15)
explain how plants respond to environmental stimuli; and
(6) Comparing the Nervous and Endocrine Systems: https://
describe the mechanisms of chemical control in plants www.boundless.com/physiology/textbooks/boundless-anatomy-and-
physiology-textbook/the-endocrine-system-16/overview-of-the-
endocrine-system-149/comparing-the-nervous-and-endocrine-
systems-773-4975/ (Retrieved 10/15)

!!
1. Tell the students that although plants cant move like animals, they also have mechanisms to
perceive what is happening around them.
2. Plants can respond to environmental cues such as light and chemical signals and thus change
their morphological and physiological features.
Teacher Tip:
MOTIVATION ( 10 MINS) This set-up should be prepared a week in advance
Show the students several setups of seedlings in a box with holes. Ask the following questions: in order for the seeds to germinate just in time for
1. What do you observe in these set-ups? the demonstration.
2. Are the seedlings exhibiting any form of reaction to environmental stimuli? (1) Prepare a shoe box with a hole on top, as
3. What are these stimuli the plants are reacting to? shown below.
(2) Half-fill two small plastic cups with soil and
plant one kidney bean in each cup.
INSTRUCTION (60 MINS) (3) Put the cups inside, one under the side with
1. Post in front pictures of plants with some responses. Pictures that can be shown are as follows: hole.
(4) Set aside for a week. Dont forget to put some
A. Leaflets of makahiya plant closing (nastic movement)
amount of water every other day.
B. Sunflower growing in the suns direction (phototropism)
C. Tendrils of a vine around a pole (thigmotropism)
Teacher Tip:
D. Venus flytrap trapping an insect (thigmotropism)
The students must realize that all living things
E. Roots of a plant growing underground (geo- and hydrotropism) respond to environmental stimuli as one of their
characteristics. They must be able to differentiate
2. Call some students to identify these specific responses.
how plants compare with animals in terms of the
3. Discuss the importance of these responses in the survival of plants. specific response and why such response is
important. Let them define the words STIMULUS
4. Explain the role of hormones in coordinating plant physiological mechanisms. (Six volunteers
and RESPONSE.
may be asked to present a brief report on plant hormones.)
5. Show a short video at the end of the discussion.
PLANT RESPONSE
All living things respond to environmental stimuli primarily to survive. Plants, which are sessile
(stationary) exhibit responses to stimuli such as light, water, touch and wind. Responses are
important to get a needed nutrient, survive a certain condition (such as extreme weather changes)
or defend itself from predators and to reproduce. The sensitive plant, Mimosa pudica, locally
222
called makahiya, closes its leaflets once touched. The sunflower moves toward the direction of Teacher Tip:
the sun. The stomata close in response to rapid loss of water. The seeds of some plants need to STIMULUS- anything in the environment (light,
be burned to trigger seed germination. Recent studies also show that some plants can release water, heat, pressure, wind, touch, etc) that
triggers a physiological change in an organism
chemicals that act as defense mechanisms against pathogen and predators and warn nearby
plants to prepare for an impending attack. RESPONSE- the corresponding reaction to an
environmental stimulus. In the long run, a series of
responses will enable an organism to adapt and
Tropism is a biological mechanism that enables plant to move toward (positive tropism) or against survive.
(negative tropism) the source of a stimulus. The roots grow underground because they usually
move toward the source of water and the center of gravity while leaves usually grow above Ask volunteers to report on the following plant
hormones:
ground where they absorb sunlight. The table below shows a list of responses in plants.
1. Auxin
2. Gibberellin
3. Abscissic acid
4. Ethylene
5. Cytokinin
The following sites have materials which you can

modify for your discussion.
1. http://www2.nsysu.edu.tw/Bio/images/
commen/plant-horm10303.pdf
2. http://bio.fsu.edu/~outlaw/shared/BOT
%203015L%20(Laboratory)/05-Plant-Growth-
Hormones.ppt
3. http://ljhs.sandi.net/faculty/RTenenbaum/ap-
biology-folder/7thedition/ch3908_files/
ch3908.ppt
4. http://www.unionps.org/filesSiteEmployee/
17/2291/Plant%20Tropisms%202011.pptx
5. http://peer.tamu.edu/NSF_Files/Plant
%20Tropisms.ppt
6. peer.tamu.edu/NSF_Files/Plant Tropisms.ppt
From: http://catholicscienceteacher5.blogspot.com/2013/12/plants-tropisms-hormones.html
Hormones are chemical messengers in plants. They regulate various biochemical and
physiological responses that include seed germination, flowering, photosynthesis, fruit ripening
and shoot and root development. The table below shows a list of plant hormones and their
specific actions.
From: http://plantbiotechinfo.blogspot.com/2011/10/plant-hormones-and-growth-
regulators.html
1. What is a stimulus and what is a response?
2. Give one stimulus and the corresponding response of a plant.
224
ENRICHMENT (5 MINS) Teacher Tip
1. Read the article How Plants Secretly Talk to Each Other. Summarize in your notebook what You may select some items from this sites:
http://highered.mheducation.com/sites/
you learned from the article.
0072919345/student_view0/chapter27/
2. Watch short videos on plant responses and hormones. multiple_choice_quiz.html
http://highered.mheducation.com/sites/
0072347201/student_view0/chapter18/
EVALUATION (5 MINS) multiple_choice_quiz.html
1. Give a short quiz on plant response and functions of hormones http://www.cliffsnotes.com/study-guides/
biology/biology/vascular-plants-structure-and-
function/quiz-plant-hormones
ADDITIONAL RESOURCES:
1. Tropism- https://en.wikipedia.org/wiki/Tropism (Last accessed 05/01/16)
2. Hormonal Sentience: https://en.wikipedia.org/wiki/Hormonal_sentience (Last accessed, 05/01/16)
3. Endocrine System: Control and Coordination - https://www.youtube.com/watch?v=HNk5JdMUmno
4. Central Nervous System- https://www.youtube.com/watch?v=oHgg4S9xIiA
5. Fight or Flight Response: https://www.youtube.com/watch?v=m2GywoS77qc
6. Mimosa pudica: the Sensitive Plant - https://www.youtube.com/watch?v=BLTcVNyOhUc (Last accessed, 05/05/16)
7. Flesh-eaters: Carnivorous Plants Lure Insects Into their Deadly Clutches - https://www.youtube.com/watch?v=MnY_cCRELvs (Last accessed,
05/05/16)
8. Plants Tropisms and Hormones - https://www.youtube.com/watch?v=pCFstSMvAMI (Last accessed, 05/05/16)
9. Plant Control - http://catholicscienceteacher5.blogspot.com/2013/12/plants-tropisms-hormones.html (Last accessed, 05/05/16)
10. Control and Coordination http://old.nios.ac.in/secscicour/CHAPTER28.pdf (Last accessed 04/28/16, 2:29pm)
11. How Plants Secretly Talk to Each Other - http://www.wired.com/2013/12/secret-language-of-plants/ (Last accessed 05/01/16)

Processes in Plants and Animals: Sensory and
Motor Mechanisms (1 of 2)
LESSON OUTLINE
Content Standard
The learners demonstrate an understanding of sensory mechanisms in animals. Introduction Communicating Learning Objectives 5
Performance Standards Motivation Importance of Senses 10

The learners shall be able to: Instruction Lecture 45
draw and label the parts of the human eye and human ear.
Practice Drawing Activity 15
Learning Competency
Enrichment Small Group Discussions 10
The learners should be able to describe the structures involved in major animal
senses (STEM_BIO11/12-IVa-h-1) Evaluation Quiz 5
Materials
Writing and drawing materials (bond paper, ball pen, pencil, coloured pens,
Manila paper
Resources
describe the five types of sensory receptors;
(1) Audesirk, T, Audesirk G and Byers DE. 2002. Biology. Life
illustrate the three types of eyes in animals;
on Earth. (6th edition). Prentice-Hall, Inc. 892 p.
explain how vision occurs in humans;
(2) Campbell, N, Mitchell L and Reece J. Biology. Concepts
differentiate the parts of the human ear and describe the functions of each; and Connections. (3rd edition). Addison Wesley Longman.
and 809 p.
discuss how the senses of smell and taste detect chemicals. (3) Reece, JB, Urry LA, Wasserman SA, Minorsky PV and
Jackson RB. 2011. Campbells Biology. (10 edition).
Benjamin Cummings. 1488 pp.
226
INTRODUCTION (5 MINS) Teacher Tip
You may begin the class with a thought
Review of Prerequisite Knowledge experiment and ask the class what will
1. The previous topics on the central and peripheral nervous system should be mentioned. happen if any of their sense organs stop to
Transmission of a nerve impulse should be recalled. function. The learners may answer orally or
in a piece of paper.
1. The learning objectives will be given and the following topic outline will be written on the board:
Misconception
A. Sensory receptors- mechanoreceptors, thermoreceptors, chemoreceptors, photoreceptors and Extrasensory perception may be mentioned
pain receptors and discussed how it might be difficult for
scientists to prove the existence of such
B. Three types of eyes in animals traits.
C. Parts of the human eye and how seeing occurs
D. Parts of the human ear and how hearing is achieved
E. The senses of smell and taste

Sample Class Activities
1. Ask learners how different animals sense their environment
(Examples: dogs sniffing chemicals; salmon returning from the sea swimming upstream at times to
spawn in freshwater; echolocation in bats; vision perception in birds and bees)
2. Learners may be asked to touch the smooth and rough surfaces of a chair or table
3. Looking at an object very near to the observer and gradually increase the distance of the object
away from the observer
4. With eyes closed, determine the source of a sound, whether on the left or right.

Lecture
1. The five sensory receptors are:
I. Photoreceptors- respond to light
II. Mechanoreceptors- respond to physical stimuli such as sound or touch
III. Chemoreceptors- detect chemicals
IV. Thermoreceptors- respond to temperature
V. Pain receptors- detect possible tissue damage
2. The three types of eyes that have evolved in the animal kingdom are:
I. Eye cups in flatworms and other invertebrates
II. Compound eyes in insects and arthropods
III. Single lens eyes in squid
Teacher Tip:
3. Describe the parts of the human eye
Use colored diagrams or illustrations.
The sclera is the outermost layer of the eyeball. It forms the white of the eye and in front, there is a
transparent cornea. The conjunctiva lines the eyelids and the front of the eyeball. It helps keep the
eyes moist. The sclera surrounds the choroid. The iris giving the eye its color, is formed from the
choroid. Vision starts when light passes through the pupil and into a transparent lens that focuses
images on the retina. The retina contains photoreceptor cells which transduce light energy into
action potentials. These nerve impulses travel along the optic nerve to the corresponding visual
areas of the brain. An image is then formed.
4. The photoreceptor cells are rods and cones

I. Rod cells use the pigment called rhodopsin. They are used for night vision and can detect only
shades of gray and not color.
II. Cone cells distinguish various colors and they are sensitive to bright light.
5. Explain how hearing is possible in the human ear

The outer ear lobes catch sound waves and channel them to the eardrums. From the eardrum, the
middle ear amplifies the sound wave vibrations to three small bones the hammer, anvil and
stirrup. The sound waves travel to the oval window. The Eustachian tube equalizes air pressure in
the middle ear and outer ear. The hearing organ is in the inner ear, composed of several channels of
fluid wrapped in a spiral cochlea. This is encased in the bones of the skull. Vibrations in the oval
window produce pressure waves. These waves travel through the upper canal to the tip of the
cochlea, enter the lower canal and fade away. Pressure waves of the upper canal push down to the
middle canal and the membrane below this canal vibrates. These vibrations stimulate hair cells
228
attached to the membrane by moving them against the overlying tissue. The hair cells are able to
develop receptor potentials causing release of neurotransmitters that induce action potentials in
the auditory neurons.
6. Illustrate how odor and taste senses are achieved

The senses of odor and taste are interrelated. Chemoreceptors in the nose detect molecules,
differentiated into numerous types of odor. In the upper portion of the nasal cavity, there are
olfactory chemoreceptors. Odor molecules enter the nose and bind to specific receptor molecules
on the chemoreceptor cilia. This event triggers receptor potentials.
Teacher Tip:
Use colored diagrams or illustrations.
In the tongue, chemoreceptors in taste buds detect salty, bitter, sweet and sour tastes. Taste
perception is due to similar signal mechanisms as mentioned above for smell. What one tastes is
actually smell or odor. The common cold (due to a virus) can disrupt our sense of smell, thus, we
lose taste for the food.
PRACTICE (15 MINS)

Drawing Activity Teacher Tip:
1. With a colored diagram, point out the parts of the human eye, ear, and the taste buds in the For discussion: Challenge the learners to
tongue. redesign the human eye and ear for better
adaptation.
2. In the diagram for the eye, trace the path of light which is converted to an image that one sees.
Similarly, in the diagram for the ear, trace the events that lead to hearing sensation.
3. Ask learners to make their own diagram for the human eye and ear by simple recall.

Small Group Discussions
Teacher Tip:
1. What is normal human vision? How are visions for nearsighted, farsighted and astigmatic persons Consult the internet and for more
corrected by lenses? enrichment activities/ authentic assessment.
2. If you are in a dark room, why is it that you dont see any colors? What cells are active in the dark?
1. Anvil
Quiz 2. Transduction
1. Which of the following does not belong to the group? 3. Mechanoreceptors
4. In the dark, rod cells are active but
A. Cornea
when there is light, colors can be seen
B. Anvil due to cone cells.
C. Pupil
D. Rods
E. Sclera
2. A receptor absorbs the energy of a stimulus by means of

A. Reception
B. Transmission
C. Amplification
D. Transduction
E. Integration
3. Sensory receptors that respond to touch and pressure are called _____________.
4. Differentiate the function of rod cells from cone cells.
ASSIGNMENT
1. Explain echolocation in bats.
2. Discuss the evolution of the vertebrate eye.
3. What causes motion sickness?
230
Lesson 24.2: Compare and Contrast in

Plants and Animals: Sensory and Motor
Mechanisms (2 of 2)
The learners demonstrate an understanding of animal organ systems for
locomotion and movement and their functions.
Motivation Diagram of the Skeletal System 10
The learners shall be able to: Instruction Lecture 45
describe the importance of animal movement/locomotion; Practice Recitation 15
explain the functions of a skeletal system;
Enrichment Conceptual Questions 10
illustrate the interaction of skeleton and muscles in movement; and
Evaluation Quiz 5
discuss how much motor neurons stimulate muscle contraction.
Materials
Learning Competency Microscopes, prepared slides of bone and muscle tissues, diagrams and
The learners should be able to describe structures and functions of organs models of frog and human skeletal and muscular systems, writing and
involved in sensory and motor systems. (STEM_BIO11/12-IVa-h-1) drawing materials

At the end of the lesson, the learners will be able to: (1) Audesirk, T, Audesirk G and Byers DE. 2002. Biology. Life
describe diverse means of animal locomotion; on Earth. (6th edition). Prentice-Hall, Inc. 892 p.
differentiate the three types of skeletal systems: hydrostatic, exoskeleton (2) Campbell, N, Mitchell L and Reece J. Biology. Concepts
and endoskeleton; and Connections. (3rd edition). Addison Wesley Longman.
809 p.
enumerate the parts of the frog skeleton; and
(3) Reece, JB, Urry LA, Wasserman SA, Minorsky PV and
explain how a muscle contracts.
Jackson RB. 2011. Campbells Biology. (10 edition).
Benjamin Cummings. 1488 pp.
(Explain that) ..movement is obvious in
Communicating Learning Objectives animals but plants can exhibit movement in
1. Present the topic outline for Sensory and Motor Mechanisms. Emphasis that todays topic will center several ways: plant parts grow towards the
on Motor System. light; xylem and phloem cells move
materials on the plant body.
2. The topic outline for Motor Systems can be presented as:
I. Animal Locomotion Plants can move or show their own version
of locomotion.
II. Skeletal Systems
III. Human Skeletal System
IV. Muscle cells
V. Muscular contraction
3. Cite the specific learning objectives for this topic.

Diagram of Skeletal System Teacher Tip:
1. Show a diagram of the human skeletal and muscular system. Point out the major bones and muscles Plastic models of the human skeleton are
available in toy stores.
on the arms, legs and torso.
2. Explain the occurrences of some disorders like polio and muscular dystrophy.

Lecture
1. Describe the importance of locomotion in various animal activities:
Animals have to move to find food and sexual partners. To avoid predators and adjust to varying
environmental conditions, animals exhibit different ways of moving. Ask learners other examples
and uses of animal movement, e.g. in ants, lizards, earthworm.
2. Show, using visuals, several means of animal locomotion: walking, running, swimming, flying,
crawling, hopping, gliding.
3. Explain the three types of skeleton.
232
I. Hydrostatic skeleton occurs in a body compartment in 6. Explain the sliding filament theory of muscular contraction.
which a volume of fluid is held under pressure. This is 7. The thin myofilaments, actin, stay at the center and the thick
common in aquatic and burrowing animals. An example is myofilaments, myosin, slide past one another. Every muscle that
the Hydra and other invertebrates with a semi-enclosed contracts is therefore a pull not a push. You can demonstrate
body cavity made of a few layers of cells. There is no solid this by interlocking your fingers and sliding them past one
bone but the animal under aquatic pressure can stay another.
upright and move. Earthworms have smooth muscles and
fluid-filled body compartments.
II. Rigid, armor-like coverings characterize an exoskeleton.
PRACTICE (20 MINS)
Muscles are attached inside. Joints are thin and flexible. The
best examples are found in arthropods (insects, crustaceans). Recitation
When insects grow, they shed off their old armor and grow 1. Find a method for the learners to submit a clean, complete
a new one. Cite other examples such as those in clams and properly labeled skeletal system of a frog/toad.
snails. 2. With a compound microscope, allow the learners to examine a
III. An endoskeleton consists of rigid but flexible support made cross-section of a mammalian compact bone. Use the low power
of bones, cartilage surrounded by masses of muscles. In objective (LPO) to locate the Haversian systems.
sponges, cells are supported on spicules. The endoskeleton 3. Ask the learners to switch between LPO and high power
of echinoderms is made from calcium plates underneath the objective (HPO). Point out and draw the following structures:
skin. Haversian canal, lamellae, lacunae, canaliculi. Bone cells or
4. Distinguish the axial skeleton from the appendicular skeleton: osteocytes are deposited in lacunae.
I. Axial skeleton skull and backbone (spiral cord); rib cage 4. With a clean, big toad skeleton point out the major bones of the
skull, vertebral column, pectoral girdle, pelvic girdle, anterior
II. Appendicular skeleton bones of the appendages (arms,
and posterior limbs.
legs, fins) and bones linking the appendages to the axial
skeleton the pectoral and pelvic girdles 5. Using a compound microscope, examine and draw the three
types of muscles: smooth, striated and cardiac. Ask the learners
5. Draw on the board the differences among striated or skeletal
to describe their differences. Use the HPO to get more details.
muscle, smooth muscle and cardiac muscle. Illustrate the parts
of a striated muscle as seen in an electron photomicrograph. 6. With a diagram, point out to the learners the major muscles in
Locate the following parts: dark band; light band; A-band; I- the frog/toad abdomen and the ventral side of the posterior
band; Z line; sarcomere; myosin; actin filaments; troponin; limb.
tropomyosin
Toads are better to use since they are more
Conceptual Questions abundant and the bones are bigger. Advise
1. What happens during a sprain? the learners to be careful in making the
toad skeletal system (which could be a
2. Give examples of skeletal disorders (arthritis, osteoporosis) and their causes.
group project). A book atlas on frog and
human anatomy may be used as reference.
EVALUATION (5 MINS)
Quiz
Answer Key:
1. A muscle cell is also referred to as a 3. Diverse adaptations for animal Muscle fiber
1.
A. Sarcoplasm movement are mainly due to: 2. Smooth
A. Nervous systems 3. B and C
B. Myofibril 4. Scapula
C. Muscle fiber B. Skeletal system
D. Muscle bundle C. Muscular system
E. Myofilament D. Both A and B

E. Both B and C
2. Peristalsis is due to what type of muscle? 4. Which of the following does not
A. Smooth belong to the group?
B. Striated A. Femur
C. Cardiac B. Tibio-fibula
D. Skeletal C. Scapula
E. Voluntary D. Phalanges
E. Tarsals
ASSIGNMENT
1. Describe each of the following muscle actions: levator, 4. Differentiate:
depressor, flexor, rotator, dilator, constrictor, adductor A. Bone vs. Cartilage
2. Explain how a motor neuron stimulates muscle contraction B. Compact bone vs. Spongy bone
3. On the cellular level, describe the steps that lead to the sliding C. Tendon vs. Ligament
filament theory of muscular contraction. D. Osteocyte vs. Chondrocyte
234
Lesson 25.1: Feedback LESSON OUTLINE
Mechanisms Introduction
Motivation
Survey Says
5
5
Instruction Human Body Systems Campaign 100
Content Standard and Practice
The learners demonstrate an understanding of feedback mechanisms.
Assignment Essay Writing 10
Materials
The learners shall be able to: Reference materials with information about the human body systems, computer with
develop a presentation (e.g. role-playing, dramatization and other internet access, pencils, colored pencils or crayons, markers, manila paper, scissors,
paste/ glue
forms of multimedia) to show how an organism maintains
homeostasis through the interaction of the various organ systems Resources
in the body. (1) InnerBody- http://www.innerbody.com (Retrieved 10/15)
(2) The Human Body: Anatomy, Facts and Functions: http://www.livescience.com/
Learning Competency 37009-human-body.html (Retrieved 10/15)
(3) Body Systems: http://www.mananatomy.com/body-systems (Retrieved 10/15)
The learners should be able to explain how some organisms can (4) Brain Pop: https://www.brainpop.com/health/bodysystems/humanbody/
maintain steady internal conditions (STEM_BIO11/12-IVi-j-2) preview.weml (Retrieved 10/15)
(5) Get Body Smart: http://www.getbodysmart.com/ap/systems/tutorial.html
Specific Learning Outcomes (Retrieved 10/15)
At the end of the lesson, the learners will be able to: (6) Human Body: http://science.nationalgeographic.com/science/health-and-human-
body/human-body/ (Retrieved 10/15)
explain the need for homeostasis; and (7) Body Maps: http://www.healthline.com/human-body-maps (Retrieved 10/15)
(8) Body Systems: http://www.infoplease.com/dk/science/encyclopedia/body-
describe how various organs systems enable homeostasis systems.html (Retrieved 10/15)
(9) Science: Human Body and Mind. http://www.bbc.co.uk/science/humanbody/
body/index_interactivebody.shtml (Retrieved 10/15)
(10) Human Organ Systems: http://www.quia.com/rr/269891.html (Retrieved 10/15)
(11) All Systems Go: http://sciencenetlinks.com/interactives/systems.html (Retrieved
10/15)
(12) Human Body Games: http://www.gamequarium.com/humanbody.html (Retrieved
10/15)
(13) Oakland Schools Biology Resource Unit http://www.oakland.k12.mi.us/
LinkClick.aspx?link=Learning/Biology+Resource+Unit5+final.doc
1. Divide the class into 11 groups to cover
Communicating Learning Objectives all the systems:
1. Introduce the following learning objectives using any of the suggested protocols (Verbatim, Own A. Integumentary
words, Read-aloud) B. Skeletal
C. Muscular
I. I can explain why homeostasis is important to organisms. D. Digestive
II. I can describe how structures and processes maintain homeostasis. E. Excretory
F. Respiratory
G. Circulatory
MOTIVATION (5 MINS) H. Immune
I. Endocrine
Survey Says J. Nervous
1. Engage the learners in a class activity by making a simple (online) survey. Use the Survey Monkey K. Reproductive
(or any similar online survey applications) on which organ system learners think as the most
2. Assign one body system to each group.
important in maintaining homeostasis.
If there are not much learners to cover
2. Give learners time to create an internet account. 11 groups, 2 systems may be handled
by one group.
3. Once everyone has registered, they can start voting by clicking on the organ system they believe is
the most important. 3. Distribute the Worksheets on Body
4. The teacher should devise a mechanism so that the learners can see the results of the voting on the System Campaign (A) and the Rubrics
for Grading (B) to each group.
spot.
5. If computers are not available, learners can just vote in class by raising their hands. The teacher can (Results tend to vary between classes, but
just tally the results on the board. The learners can vote up to 3x.) there usually is not a clear winner.) The
class discussion should center on why there
is no clear winner.
Note:
INSTRUCTION/DELIVERY (100 MINUTES) Numbers 4-7 may be done if there is
DAY 1: HUMAN BODY SYSTEMS CAMPAIGN
enough time.
1. The learners will research on their assigned body system using reference materials and computers
with internet access. The attached handouts may be modified by
the teacher to suit the needs of the class.
2. Once research is done, learners should obtain a sheet of manila paper to write their data.
3. Spread out the paper and choose a member who is as tall as the paper.
4. Placing the paper flat on the floor, have that member of the group lay on his/her back on the paper
while the other members of the group trace his/her outline in pencil.
5. Label the manila paper with the name of their body system and using their research results draw in
and label all parts/organs of the system on the outline in their respective positions. (They may also
236
draw the part on colored papers and attach these on the manila paper using paste or glue.) Teacher Tip:
6. Once drawn, they should color their life-size representation. 1. Pose this question to learners Why is
7. When the representation is complete, the group should organize the presentation of their campaign there not one system that is most
essential to the survival of the human
by completing the function of the system, parts/organs, and their concluding description of the species?
importance of their system. The group must be able to discuss or present mechanisms and
processes in the system that contribute to homeostasis. 2. Distribute handout D, go over the
8. The learners may bring home their presentation to finalize the details for a successful campaign. rubric with learners, and ask them to
answer the question in writing. Collect
9. The learners should be ready with possible negations that the other groups might raise against their the essay and with the rubrics attached
organ-system. on it within a reasonable amount of
time given to the learners.
Wrap Up
1. Tell the learners to continue improving their output and be ready with their presentation next
meeting.
DAYS 2 and 3: HUMAN BODY SYSTEMS CAMPAIGN

1. Let all the groups post their output in front of the class.
2. Call on each group to present their output. This can be done in order based from the list or drawn
at random.
3. Call 2 representatives from each group to present within 4 minutes why their system is the most
important for human survival. The other learners should take down notes about each system and
write possible points to refute.
4. Once all the groups have presented, allow each group to finalize their rebuttal.
5. Rebuttal should be from 2-3 minutes and everyone should be quiet. Remind learners that this is not
the time to argue with each other.
6. Slips of paper containing all the systems (handout C) will be distributed. The learners will again vote
for the system they now feel is the most essential for the survival of the human species.
7. Tally the votes and let the learners see the results.
EVALUATION Note:
1. Check the content of the output using handout B. This will also serve as an ENRICHMENT
activity. Give the learners one day to
Assignment compose their essay. Use handout D to
1. Essay Writing- Why is there not one system that is most essential to survival of the human species? evaluate their essay.
Lesson 25.2: Feedback Mechanisms

Content Standard
LESSON OUTLINE
The learners demonstrate an understanding of feedback mechanisms.
The learners shall be able to: Motivation Homeostasis: A Balancing Act 10
develop a presentation (e.g. role-playing, dramatization and other forms of Instruction Lecture on Homeostasis 40
multimedia) to show a simple feedback mechanism that leads to
Evaluation Inquiry 10
homeostasis
Enrichment Research on Disorders 10
Learning Competency
The learners should be able to describe examples of homeostasis (e.g., Materials
temperature regulation, osmotic balance and glucose level regulation) and the Stopwatch, videos, podcasts
major features of feedback loops that produce homeostasis (STEM_BIO11/12-
Resources
IVi-j-3) (1) Notes for Homeostasis and Excretion- http://tfssbio.pbworks.com/f/
Homeostasis+Notes09.pdf (Retrieved 11/15)
Specific Learning Outcomes (2) Human Physiology/ Homeostasis- http://www.saylor.org/site/wp-
At the end of the lesson, the learners will be able to: content/uploads/2010/11/Homeostasis-Overview.pdf (Retrieved 11/15)
explain the need for homeostasis; (3) Homeostasis: http://bio5090.wikispaces.com/file/view/Homeostasis
+note.pdf (Retrieved 11/15)
differentiate positive and negative feedback mechanisms; (4) Homeostasis: http://igbiologyy.blogspot.com/2014/03/133-
outline the homeostatic control of temperature regulation, osmotic balance homeostasis.htmlweml (Retrieved 11/15)
(5) Homeostasis: http://www.passbiology.co.nz/biology-level-3/
and glucose level regulation; and
homeostasis (Retrieved 11/15)
describe some disorders that result from the disruption of homeostasis. (6) Homeostasis Game: http://www.purposegames.com/game/
homeostasis-game-game (Retrieved 11/15)
(7) Homeostasis: A Balancing Act . http://www.msichicago.org/fileadmin/
Education/learninglabs/lab_downloads/Homeostasis.pdf (Retrieved
11/15)
(8) Homeostasis: https://www.youtube.com/watch?
v=_0afKWu4yVg&spfreload=10 (Retrieved: 11/15 )
238
The human body is composed of various
Communicating Learning Objectives organs with specific functions. Organs
1. Introduce the following learning objectives using any of the suggested protocols (Verbatim, Own assemble to form organ-systems that
words, Read-aloud) contribute to homeostasis inside the
organism. Homeostasis is the condition
I. I can explain why there is a need for homeostasis wherein steady state is regulated inside the
II. I can explain how feedback mechanisms maintain homeostasis organism in order for it to adapt to internal
and external changes. This is important for
III. I can differentiate a positive from a negative feedback survival. Once homeostasis is disrupted, the
IV. I can outline some ways by which our body maintains homeostasis organism may experience a disorder that
might affect its normal functions.

Homeostasis: A Balancing Act! Teacher Tip:
1. Ask all learners to stand up and balance themselves on one foot.!After one minute, tell them to put After the activities, ask 3 volunteers to share
their other foot down. Let them share with each other what they experienced.!Tell them to take their their experiences.
resting pulse for 15 seconds. Multiply this by 4 to have their pulse rate in 1 minute.!
Tell the learners that they just experienced
2. Tell them to jog in place for 1 minute then take their pulse again for 15 seconds. Multiply this by 4 homeostasis.
to have their pulse rate in 1 minute. Let them share with each other what they experienced.
In the second activity, respiration rate will
increase during exercise due to the increase
in carbon dioxide. The heart rate will
increase in order to remove the extra
INSTRUCTION (40 MINS) carbon dioxide and increase the amount of
1. Ask the following questions: What is homeostasis? In the previous activities, how did the body oxygen. When things are normalized, the
maintain homeostasis? What factors can disrupt homeostasis in the body? heart rate will go back to the resting state.
How long does it take for this to happen?
2. Introduce the concept of feedback mechanism. What does the word feedback mean? With what do
you associate this term? Can you give an example of a feedback? Why is a feedback important in the
body?
3. Show the following video about homeostasis.
I. Positive and Negative Feedback Loops: Post this video (https://www.youtube.com/watch?
v=CLv3SkF_Eag&spfreload=10) (Retrieved 11/15) or show diagrams and pictures and explain
what homeostatic mechanisms took place. Then ask, How was the system maintained?
! Teacher Tip:
Discuss briefly what a feedback is. You may
give as an example the report card that they
get every Quarter or grading period.
What are shown in a report card? What is

the purpose of a report card?
To pass the subject, what grade must you

get? If you are running for honors, what is
the acceptable range for your grades? How
will you reach your target grades?
Likewise, tell them that the body works at a

certain range of conditions (such as blood
glucose level, body temperature and blood
pH). Diseases normally disrupt these
conditions and the body must try to return
the conditions back to normal.
The learners should understand the

following about homeostasis.
The main parts and functions of the
homeostatic control system.(What it
does and what structures are used and
why)
The mechanism of this control system,
i.e.How and why it responds to the
normal range of environmental
! fluctuations, the interaction and
feedback mechanisms between parts of
the system?
How balance is re-established following
the potential effect of one specific
Homeostasis is the physiological consistency of the body despite external fluctuations. All complex disruption- (What occurs in the system
multicellular organisms maintain a stable internal environment using their organ systems. to return the fluctuation back to the
normal internal physiological state)
Homeostasis in a general sense refers to stability, balance or equilibrium. It is the body's attempt to Explain an example of a negative
feedback being broken.
maintain a constant internal environment. Maintaining a stable internal environment requires constant
monitoring and adjustments as conditions change. The adjustment of physiological systems within the
body is called homeostatic regulation.
240
The homeostatic control has three components:
II. A receptor (sense organ) to detect a change
III. A center of control (the brain or the spinal cord) that will process and integrate what is happening
IV. An effector (muscle cells or organs/ glands) to produce a response appropriate to the change.
There are ways of communication among these components (basically through the nervous and endocrine control).
When a change of variable occurs, there are two main types of feedback to which the system
reacts:
1. Negative feedback: a reaction in which the system responds in such a way as to reverse
the direction of change.
I. Thermoregulation
II. Carbon dioxide concentration
III. Blood sugar level
2. Positive feedback: a response is occurs to amplify the change in the variable. (This has a
destabilizing effect, so does not result in homeostasis. Positive feedback is less common
in naturally occurring systems than negative feedback, but it has its applications.)
I. For example, in nerves, a threshold electric potential triggers the generation of a
much larger action potential.
II. Blood clotting
III. Events in childbirth

1. Give examples of feedback mechanisms in the body.
1. Describe the homeostatic control of the following:
I. blood glucose level
II. temperature regulation
III. water and salt balance
IV. carbon dioxide concentration
Assignment:
1. Research on the following disorders. Discuss how
homeostasis is disrupted. Form a group with 5 members
I. Diabetes mellitus
II. Hemophilia
III. Hemorhagic fever
IV. Hypothermia
V. Diarrhea
2. Prepare a 5 10 slide presentation about your topic. You will be evaluated by your classmates using the rubrics.
3. Each will be given a maximum of 10 minutes to present.
242
Lesson 25.3: Feedback Mechanisms
60 MINS
Content Standard
The learners demonstrate an understanding of feedback mechanisms LESSON OUTLINE
The learners shall be able to: Motivation Review on Past Topic 5
develop a presentation (e.g. role-playing, dramatization and other forms of Instruction Reporting 40
multimedia) to show a simple feedback mechanism that leads to
homeostasis Evaluation Quiz 10

The learners should be able to describe examples of homeostasis (e.g., Stopwatch, videos, podcasts
temperature regulation, osmotic balance and glucose level regulation) and the Resources
major features of feedback loops that produce homeostasis (STEM_BIO11/12- (1) Notes for Homeostasis and Excretion- http://tfssbio.pbworks.com/f/
IVi-j-3) Homeostasis+Notes09.pdf (Retrieved 11/15)
(2) Human Physiology/ Homeostasis- http://www.saylor.org/site/wp-
Specific Learning Outcomes content/uploads/2010/11/Homeostasis-Overview.pdf (Retrieved 11/15)
At the end of the lesson, the learners will be able to: (3) Homeostasis: http://bio5090.wikispaces.com/file/view/Homeostasis
+note.pdf (Retrieved 11/15)
explain how homeostasis is disrupted during a disease or disorder; and (4) Homeostasis: http://igbiologyy.blogspot.com/2014/03/133-
explain how the body restore homeostasis after a disease or disorder homeostasis.htmlweml (Retrieved 11/15)
(5) Homeostasis: http://www.passbiology.co.nz/biology-level-3/
homeostasis (Retrieved 11/15)
(6) Homeostasis Game: http://www.purposegames.com/game/
homeostasis-game-game (Retrieved 11/15)
(7) Homeostasis: A Balancing Act . http://www.msichicago.org/fileadmin/
Education/learninglabs/lab_downloads/Homeostasis.pdf (Retrieved
11/15)
(8) Homeostasis: https://www.youtube.com/watch?
v=_0afKWu4yVg&spfreload=10 (Retrieved: 11/15 )
Introduce the following objectives by asking volunteers to read them aloud.
I. I can explain how homeostasis is disrupted during a disease or disorder.
II. I can explain how the body restore homeostasis after a disease or disorder.
MOTIVATION (5 MINS)
1. A learner will give a short review of the past topic.
INSTRUCTION/DELIVERY (40 MINS) Teacher Tip:

Tell the learners that each member must
1. Draw lots on the order of reporting.
share something to the report. Everyone
2. Each group will be given 7 minutes to present. must be able to talk during the reporting. If
a group exceeds the allotted time, they are
3. Other learners will listen and evaluate the group.
disqualified for the prize

Wrap Up: Answer briefly.
I. What happens when there is little sugar in the body?
II. What happens when carbon dioxide in the blood increases?
1. What could happen due to a failure in homeostasis?

A. The accumulation of waste products
B. The loss of excess water from the body
C. Maintaining excess levels of sugar in the body
D. All of the above are potential outcomes of failure of homeostasis.
2. Which anatomical system of an organism introduces respiratory gases to the interior of the body
and enables gas exchange?
A. Excretory
B. Endocrine
C. Respiratory
D. None of the above
244
Answer Key:
3. Which organ system alters kidney functions? 1. D
A. Excretory 2. C
B. Nervous
3. A
C. Immune
D. Respiratory 4. B
5. C
4. The ___________ systems regulate other organ systems to maintain homeostasis, the maintenance
of a stable internal environment.
A. digestive and urinary
B. nervous and endocrine
C. muscular and endocrine
D. digestive and respiratory
5. The ______ system regulates the volume of water in the blood and also has an important role in
eliminating wastes.
A. respiratory
B. nervous
C. excretory
D. endocrine
For Enrichment Part:

ENRICHMENT This can also be given as an Assignment.
Case Study Analysis: Joshs Story The Case Study is taken from:
Let the learners read the case then accomplish the time line. https://msturin.wordpress.com/2010/11/23/
reading-about-homeostasis-in-the-body/
(Last accessed, 04/26/17, 2:57pm)
Assignment: Teacher Tip:

Research on the range of physiological (sugar level, blood pH, body temperature, pulse rate, breathing Tell the learners that during medical check-
up or physical examination, the hospital or
rate) conditions for a normal adult (males and females).
clinic provides the person a print out of the
results. This contains qualitative and
quantitative data that may indicate whether
a person has an alarming condition.
General Biology 2
SUPPLEMENTARY HANDOUTS
HANDOUT A
BODY SYSTEM DEBATE
In this project you and your group mates will research on a human Your campaign must include the following:
body system. Organize a campaign for your body system, present 1. The name of your body system written clearly.
your campaign to the rest of the class, and debate whether or not
2. A colored, life-size representation of your body system.
your body system is most essential to the survival of the human
3. A brief description of the overall function(s) of your body
species. In doing this, you will become an expert on your body
system.
system as well as learn about the other body systems from our
classroom experts. Once all campaigning and debating is 4. All organs/parts of your body system drawn on your
complete, each student will vote for the system that they feel is representation where they are found in nature and clearly
most essential to humans. labeled.
5. A complete description of the function of each organ/part.
The body system you will be campaigning for is the (check one): 6. A complete description of the importance of your body system
to an individual and to the survival of humans referencing
Digestive
information given in points 1-5.
Respiratory
Reproductive
Circulatory Your Debate must include the following:
Excretory 1. A review of the importance of your system to the individual and
Lymphatic the species.
Integumentary
2. Rebuttals to points made by each of the other systems.
Nervous
3. Closing arguments.
Skeletal
Endocrine
Muscular
246
CAMPAIGN and DEBATE RUBRIC
CAMPAIGN CAMPAIGN DEBATE
NAME OF BODY SYSTEM POINTS DESCRIPTION OF ORGAN OR PART REVIEW POINTS

FUNCTION
Written clearly, spelled correctly, easy Clearly stated, easy to understand 2
3 Accurate, clearly stated, easy to
to see
6 Missing one criterion 1
understand
Missing one criterion 2
Missing one criterion 4 Absent 0
Missing two criteria 1
Missing two criteria 2 REBUTTAL
Absent 0
Not all organs and parts accounted for 1 Effectively refutes points made in all 15
LIFE SIZE REPRESENTATION other campaigns
Absent 0
Correct size, colored, neatly drawn 12 All other campaigns are refuted, but 10
CONCLUSION not all points
Clearly stated, easy to understand, All other campaigns are not refuted 5
Missing two criteria 4 9
evidence to back it up
Absent 0
Absent 0 Missing one criterion 6
CLOSING ARGUMENT
DESCRIPTION OF BODY SYSTEM FUNCTION Missing two criteria 3
Clearly stated, easy to understand, 3
Accurate, clearly stated, easy to Absent 0 evidence to back it up
6
understand
Absent 0
Absent 0
PLACEMENT AND LABELLING OF ORGANS

AND PARTS
All organs and parts are accurately

4
placed and labeled
Either not labeled or placed correctly 3
Not all organs and parts accounted for 2
Absent 0
BALLOT ESSAY RUBRIC
QUESTION: WHY IS THERE NOT ONE SYSTEM

WHICH BODY SYSTEM IS MOST ESSENTIAL TO THAT IS MOST ESSENTIAL TO SURVIVAL OF THE
THE SURVIVAL OF THE HUMAN SPECIES? HUMAN SPECIES?
Nervous System Substandard

Student shows only a surface level understanding of why there is no
Integumentary System one system that is most essential to the survival of the species, and
cannot cite examples of this in practice or effectively refute
Skeletal System arguments to the contrary.
Muscular System
Adequate
Circulatory System Student shows clear but not deep understanding of why there is no
one system that is most essential to the survival of the species, cites
Respiratory System examples of this in practice, but cannot effectively refute arguments
to the contrary.
Digestive System
Proficient
Excretory System
Student shows clear and deep understanding of why there is no one
Endocrine System system that is most essential to the survival of the species, cites
examples of this in practice, but cannot effectively refute arguments
Reproductive System to the contrary.
Lymphatic System Exemplary

Student shows clear and deep understanding of why there is no one
system that is most essential to the survival of the species, cites
examples of this in practice, and effectively refutes arguments to the
contrary.
248
General Biology 2 - Colored Images
Lesson 2: Sex Linkage Lesson 3: Modification to

Lesson 5: DNA Replication and Protein Synthesis
and Recombination Mendels Classic Ratios
Page 26, 27, and 28
Page 10 Page 18
Lesson 5: DNA Replication and Protein
Synthesis, Page 28
250
Lesson 17.1: Compare and Contrast Process in Plants and Animals: Reproduction and Development
Pages 141, 142, and 143
Lesson 17.1: Reproduction and
Lesson 17.2: Reproduction and Development / Pages 150, 151, 152, and 153
Development / Pages 143 and 145
252
Lesson 17.2: Reproduction and Development
Pages 153, 154, and 155
Lesson 19: Gas Exchange / Page 184 Lesson 23: Chemical and Nervous Control / Page 217
Lesson 23: Chemical and Nervous Control /

Page 218
254
Lesson 23: Chemical and Nervous Control / Page 216
Lesson 17: Introduction to Reproduction / Page 138
Lesson 25: Feedback Mechanisms / Pages 240 and 241
!
256
Biographical Notes
IVAN MARCELO A. DUKA NEIL ANDREW B. BASCOS, PH.D.
Team Leader Writer
Prof. Ivan Marcelo A. Duka is an Associate Professor 5 and the Dr. Bascos is an Associate Professor 7 at the National Institute of
College Secretary of the College of Arts and Sciences at the Molecular Biology and Biotechnology at the University of the
University of the Philippines Los Banos. He has been teaching at Philippines Diliman. He earned his doctorate degree in Molecular
the university various courses, such as Biology 1 and 2, Molecular and Cellular Biology from Tulane University, New Orleans; and his
Biology, Evolutionary Biology, Cell Biology and Genetics for 40 bachelors degree in Molecular Biology and Biotechnology from
years. the University of the Philippines Diliman. He is also a Principal
Investigator at the Protein Structure and Immunology Laboratory
at the National Institute of Molecular Biology and Biotechnology,
He finished his Master of Science in Genetics from the University
UP Diliman. He is a member of the Technical Panel on Biology
of the Philippines Los Banos, and his Bachelors Degree in
and Molecular Biology at the Commission on Higher Education,
Biology, major in Zoology, in the same university. He also earned
and also became the Deputy Director for Facilities and Services
a Cell Biology Apprentice Degree from the University of Wales
at the National Institute of Molecular Biology and Biotechnology,
College of Cardiff, United Kingdom. He received numerous
University of the Philippines Diliman.
grants and fellowships, such as the AIDAB Fellowship Award in
Sydney, Australia; and the British Council Fellowship to the
University of Wales. He also wrote various papers, articles, books, MA. GENALEEN Q. DIAZ, PH.D.
laboratory manuals, and other teaching materials focusing on Writer
Biotechnology, Molecular Biology, Immunology, Recombinant Dr. Genaleen Diaz is Professor IV at the University of the
DNA Techniques, Physiology, and Genetic Engineering. Philippines Los Banos where she has been teaching
undergraduate and graduate subjects for 27 years. She is
currently the Head of Genetics and Molecular Biology Division of
Prof. Duka is also a Board Member of the Philippine Society for
the Institute of Biological Sciences. Dr. Diaz earned her doctorate
Biochemistry and Molecular Biology, a Subject Matter Specialist
degree in Genetics at the UPLB. She also completed her masters
of the Learning Resource Centre for Biology Tutorials and
degree in Genetics and her bachelors degree in Biology at the
Biology Summer Bridge Course, and a member of the UPLB
same university. Dr. Diaz is a member of the National Research
University Council. He is also primarily responsible for assisting
Council of the Philippines and the Outstanding Young Scientists,
incoming university instructors by providing them necessary
Inc. Her scholarly works were included in publications such as the
mentorship in classroom management and curriculum
Philippine Journal of Philippine Science and Technology, Journal
development.
of Genetics, and UPLBs Genetics Laboratory Manual.
MA. CARMINA C MANUEL, PH.D. IAN KENDRICH C. FONTANILLA, PH.D.
Writer Writer
Dr. Carmina Manuel is Assistant Professor V at the University of Dr. Ian Fontanilla has been teaching at the University of the
the Philippines Los Banos where she teaches subjects spanning Philippines Diliman for 20 years, where he is currently Assistant
molecular genetics, human genetics, and evolutionary biology. Professor. His researches are found in scholarly publications,
Dr Manuel is recipient of the IBS Outstanding Teacher Award for including the Philippine Journal of Science, Asia Life Sciences,
3 consecutive years since 2013. She has also presented her and the Zoological Journal of the Linnean Society. Dr. Fontanilla
authored research papers in Science conferences around the has presented academic papers in international conferences in
country. Dr. Manuel finished her doctorate degree in Genetics at the Philippines, Portugal, Brazil, Belgium, London, and Australia.
the UPLB. She earned her masters degree in Genetics and her He is a member of professional societies such as Unitas
bachelors degree (cum laude) also in UPLB. Malacologia and the Philippine Environmental Mutagen Society
among others. Dr. Fontanilla completed his doctorate in Genetics
at the University of Nottingham, while he earned his masters and
bachelors degrees in Biology at UP Diliman.
SHARON ROSE M. TABUGO, PH.D.
Writer
Dr. Sharon Rose is Assistant Professor IV at the Mindanao State
University - Iligan Institute of Technology where she has been EUGENIO P. QUIJANO, JR.
teaching for 6 years. Her academic papers and researches were Writer
published in a number of ISI-indexed and international journals Mr. Eugenio Quijano, Jr. has been teaching science for 25 years
such as the International Research Journal of Biological Sciences, now. He is currently a Biology and General Science teacher at the
the European Journal of Zoological Research, the Australian Xavier School and also a student Trainer in science competitions.
Journal of Biological Sciences, and the Global Journal of Prior to teaching, he has worked as a Researcher for the DOST
Medicinal Plant Research. Dr. Tabugo earned her doctorate and DepEd. Mr Quijano is a member of the Biology Teachers
degree in Biology at the MSU-IIT. She received her masters Association of the Philippines and the Greenpeace Organization.
degree in Biology as a DOST scholar also in MSU-IIT and she He is currently finishing his masters degree in Biological Sciences
graduated cum laude with a bachelors degree in Biology at the at the University of Santo Tomas. He finished his Certification
same university. Program in Education at the University of the Philippines Diliman,
and earned his bachelors degree in Biology at the UST.
258
ANNALEE S. HADSALL CAROLINE PAJARON
Technical Editor Writer
Prof. Annalee S. Hadsall is an Assistant Professor 7 at the Institute Caroline Hernandez Pajaron is a communication specialist and
of Biological Sciences, College of Arts and Sciences, University of journalist. She has 13 years of experience in content
the Philippines Los Banos. She earned her bachelors degree in development, production, and management with different
Biology, Cum Laude, from the Philippine Normal College. She agencies such as Globe Telecommunications, and Asian
finished her Master of Science degree in Botany, Major in Plant Development Bank . She is currently Information and Advocacy
Systematics, and a Minor degree in Horticulture at the University Officer of the Civil Society Coalition on the Convention on the
of the Philippines Los Banos, under the UP-NSDB Graduate Rights of the Child. Ms. Pajaron received her masters degree in
Manpower Scholarship Program. Journalism from the Ateneo de Manila University through a
Konrad Adenauer Center for Journalism grant. She graduated
She is also the curator for orchids and epiphytes at the UPLB from the Ateneo as a Father Nicholas Kulny scholar with degrees
Museum of Natural History. Her research interests include in English Literature and Communication. She is finishing her
morpho-anatomical diversity of indigenous Philippine orchids, doctorate degree in Public Administration at the University of the
biodiversity studies of Mt. Isarog, and phytogeographical Philippines.
patterns of epiphytes. With her work in botany studies, she was
able to describe three new plant species, and has written
laboratory exercises in biodiversity and general botany. She also MA. DANIELA LOUISE F. BORRERO
a writer in Distance Education Modules for the Diploma in Illustrator
Science Teaching of UP Open University. Ms. Daniela Borrero is a visual artist, photographer, writer, and
teacher. She is the Founder and Chief Operating Officer of the
Besides being prolific in her academic publications, she was also D11B Graphic Design Studio. She has also worked as Human
tapped by the Department of Education to evaluate teaching Resource Officer in a Law Office. Ms. Borreros works were part in
materials and general references in elementary Science. She exhibits such as The Heist Conference and Analog Signals in
became a trainer for Grades 8, 9, and 10 Science. She is actively Nova Gallery, and Maximum Purity in Prose Gallery. She
involved in training teachers, especially in biodiversity and plant graduated her bachelors degree in Home Economics and
systematics. Elementary Education at the University of the Philippines Diliman.

General Biology 2 Ilovepdf Compressed

Caricato da

Informazioni sul documento

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

General Biology 2 Ilovepdf Compressed

Caricato da

Copyright:

Formati disponibili

The Commission on Higher Education

in collaboration with the Philippine Normal University

Teaching Guide for Senior High School

This Teaching Guide was collaboratively developed and reviewed by

Chapter 1: Genetics Tree of Life and Systematics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109

Lesson 1: Pedigree Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Lesson 15: Systematics Based on Evolutionary Relationships:

Lesson 6: Genetic Engineering . . . . . . . . . . . . . . . . . . . . . . . . . 30 Lesson 17: Reproduction and Development . . . . . . . . . . . . . . . . . 136

Lesson 12: Evidences of Evolution . . . . . . . . . . . . . . . . . . . . . . 92 Lesson 25: Feedback Mechanisms . . . . . . . . . . . . . . . . . . . . . . . . 235

Biographical Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257

SAYSAY: MEANING HUSAY: MASTERY SARILI: OWNERSHIP

College Readiness Standards Foundational Skills DepEd Functional Skills

Global awareness, scientific and economic literacy, curiosity,

Global awareness, media literacy, technological literacy,

Global awareness, multicultural literacy, collaboration and

Media literacy, multicultural literacy, global awareness,

1. predict genotypes and phenotypes of parents and STEM_BIO11/12-

CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE

1. describe general features of the history of life on Earth,

4. trace the development of evolutionary thought STEM_BIO11/12-

6. infer evolutionary relationships among organisms using STEM_BIO11/12-

Code Book Legend

Learning Area and Strand/ Subject or Science, Technology, Engineering and

General Mathematics Statistics and Probability Media and Information Literacy

Tech): ICT for Professional Tracks Professional Purposes

Pagsulat sa Filipino sa Piling

Pre-Calculus Basic Calculus General Physics 1 General Physics 2

General Chemistry 1 General Biology 1 General Biology 2

Lesson 1: Pedigree Analysis

Specific Learning Outcomes: Practice Group Work: Non-Mendelian Traits in 40

compute the probability of occurrence of an affected offspring in a given Resources

REVIEW (15 MINS) Teacher Tip:

Sample pedigree with symbol guides

CROSS EXPECTED GENOTYPE(S) EXPECTED PHENOTYPE(S)

2. DD x Dd 50% DD: 50% Dd 100% dominant

3. DD x dd 100% Dd 100% dominant

4. Dd x Dd 25% DD: 50% Dd: 25% dd 75% dominant: 25% recessive

5. Dd x dd 50% Dd: 50% dd 50% dominant: 50% recessive

Lesson 2: Sex Linkage and

make a a research paper/case study/poster on transmission of a sex-linked Motivation Case Study 10

Lesson 3: Modification to Mendels Classic

Specific Learning Outcomes Materials

distinguish Mendelian from non-Mendelian modes of inheritance; and Resources

C. Use ABO blood typing in humans as example

5. Go back to the Motivation narrative

1. In cattle, coat color is inherited in a co-dominant fashion.

Lesson 4: Molecular Structure of DNA,

Enrichment Conversion to mRNA Transcripts 5

MOTIVATION (5 MINS) Teacher Tip:

INSTRUCTION (30 MINS)

Summary of Important Physical Properties

Phosphodiester bonds Essential for polynucleotide chain

RNA Single stranded but some bases For stability

Uracil Nitrogenous base found only in RNA.

One letter symbol for each Classes:

Teach the learners the single letter codes for the

Ask the learners to spell their names using the

Polypeptide sequence N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C

5 _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3

General Biology 2 60 MINS

Lesson 5: DNA Replication and Protein

2. Ask the learners to recall the significance of Mitosis.

In bacteria, transcription and translation may be simultaneous. In eukaryotic cells, mRNA,

A stop codon signals the

The genetic code is the correspondence of the mRNA codons to