ORIGINAL ARTICLES: FERTILITY PRESERVATION

The impact of culture conditions on

early follicle recruitment and growth
from human ovarian cortex
biopsies in vitro
ster, D.V.M.,a Christina Drengner,a Jochen Reinsberg, Ph.D.,a
Jana Liebenthron, M.Sc.,a Maria Ko
Hans van der Ven, M.D.,a and Markus Montag, Ph.D.b
a
Department of Gynecologic Endocrinology and Reproductive Medicine, University Womens Hospital, Bonn; and
b
Department of Gynecologic Endocrinology and Fertility Disorders, University Womens Hospital, Heidelberg, Germany

Objective: To investigate the effects of a dynamic uidic culture system on early in vitro folliculogenesis in standardized ovarian
cortex biopsies.
Design: Cortical small strips were cultured for 6 days in a conventional static or in a dynamic uidic culture system.
Setting: University-afliated laboratory with an associated cryobank facility.
Patient(s): Ovarian cortex from postpuberal female cancer patients (26.1
1.3 y) who opted for cryopreservation of their tissue for
fertility protection before gonadotoxic cancer therapy. With informed consent of the Institutional Ethics Committee, part of the tissue
was available for patient-related research studies.
Intervention(s): None.
Main Outcome Measure(s): The viability and proliferative capacity of the cortex biopsies were evaluated by chemiluminescent micro-
particle immunoassay for detection of in vitro produced E2 and P in the supernate, by viable follicle counting via calcein staining, by
histologic analyses, and by total RNA preparation and reverse transcription for real-time polymerase chain reaction of selected early
folliculogenesis genes.
Result(s): The data support the notion that early follicle development can be better achieved in vitro in a dynamic uidic culture
system. The ndings are based on the presence of more viable follicles, higher expression levels of early folliculogenesis genes
KIT-L, INHB, and GDF9, and the absence of premature luteinization of follicles.
Conclusion(s): This study provides evidence that dynamic uidic culture is a promising approach for investigating early follicular
recruitment and growth in cortical biopsies. It may serve as a rst step in a multistep culture system to design a complex in vitro system
for complete folliculogenesis. (Fertil Steril 2013;100:48391. 2013 by American Society for
Reproductive Medicine.) Use your smartphone
Key Words: Ovarian cortical tissue, in vitro uid culture, early folliculogenesis, oncofertility, to scan this QR code
fertility preservation and connect to the
discussion forum for
this article now.*
Discuss: You can discuss this article with its authors and with other ASRM members at http://
fertstertforum.com/liebenthronj-early-folliculogenesis-oncofertility-ovarian-cortical- * Download a free QR code scanner by searching for QR
tissue/ scanner in your smartphones app store or app marketplace.

very year 100 per 1 million

E
Increasing survival rates following gists and patients. Oncologic therapies
women under the age of 40 years cancer therapies for malignant diseases such as chemotherapy or radiation of
develop cancer in Western coun- and the growing interest in life quality the pelvis bear the risk of partial or
tries. This corresponds roughly to 2,000 after convalescence have put fertility complete arrest of gonadal function
women in Germany per year (1). preservation into the focus of oncolo- and thus may have a negative impact
on fertility in young women and lead
Received April 13, 2012; revised and accepted March 28, 2013; published online April 28, 2013. to premature ovarian failure POF (2,
J.L. has nothing to disclose. M.K. has nothing to disclose. C.D. has nothing to disclose. J.R. has nothing 3). This highlights the need for
to disclose. H.v.d.V. has nothing to disclose. M.M. has nothing to disclose.
Reprint requests: Jana Liebenthron, M.Sc., Department of Gynecologic Endocrinology and Reproduc- effective options for fertility
tive Medicine, University Womens Clinic, IVF Laboratory, Cryobank, Sigmund-Freud-Str. 25, preservation earlier initiation of
53127 Bonn, Germany (E-mail: jana.liebenthron@ukb.uni-bonn.de).
oncologic therapy. At present, options
Fertility and Sterility Vol. 100, No. 2, August 2013 0015-0282/$36.00 include cryopreservation of oocytes,
Copyright 2013 American Society for Reproductive Medicine, Published by Elsevier Inc. embryos, and ovarian tissue (49).
http://dx.doi.org/10.1016/j.fertnstert.2013.03.046

VOL. 100 NO. 2 / AUGUST 2013 483

ORIGINAL ARTICLE: FERTILITY PRESERVATION
Ovarian tissue banking is the focus of fertility protection for
prepubertal girls, when the patients are too young for
cryopreservation of oocytes or embryos, and for patients
where delaying of chemotherapy is not possible. Besides
fertility preservation, ovarian tissue may later allow
restoration of endocrine function (10). To date, 22 live
births have been reported after retransplantation of frozen-
thawed ovarian cortex (1113).
However, in the case of women with malignant tumors,
which might result in metastasis to the ovaries, retransplanta-
tion of ovarian tissue is absolutely contraindicated because of
the risk of reintroducing cancer cells after retransplantation
(1416). Therefore, several research activities have the
intention to establish effective culture systems for growing
meiotically competent oocytes from the pool of primordial
follicles in ovarian cortex fragments. Earlier studies of
individual culture systems have successfully demonstrated the
development of growing follicles in vitro (10, 17), but current
culture conditions do not consistently produce follicles from
the primordial stage up to the preovulatory stage resulting in
developmentally competent metaphase II oocytes equivalent
to those derived from in vivo microenvironments of the ovary.
Complete in vitro folliculogenesis has been achieved only in
a multistep culture system with follicles from the mouse (18).
Subsequently, multistep culture systems for the in vitro
development of follicles in large mammals were introduced,
but their potential is still under investigation (10, 19).
One culture method with benecial effects regarding tis-
sue viability and resulting in early folliculogenesis was pub-
lished in 2006. The principle was agitation of culture
medium during the culture period of cortical biopsies (20)
and might constitute a promising approach for the rst step
in a multistep culture system. The aim of the present study
was to design a modied variant of this culture system to an-
alyze possible positive effects on early folliculogenesis. We
constructed with the use of a microdiaphragm pump a dy-
namic uidic pulse which resulted in circulation of the
medium around the cultured tissue. We performed compara-
tive investigations of the initial recruitment and the early
follicular growth in cultured ovarian cortical biopsies. For
evaluation of all cell and molecular biologic parameters,
such as follicle viability, histologic analyses, E2/P production,
and gene expression proles of early folliculogenesis genes,
such as growth differentiation factor 9 (GDF9), bone morpho-
genetic protein 15 (BMP15), Kit ligand (KIT-L), and inhibin
B (INHB), we compared the results with those obtained by
an established static conventional culture system (21).
MATERIALS AND METHODS
Ovarian Cortical Tissue Collection
Ovarian cortex was obtained from ten postpuberal female
cancer patients, aged 26.1
1.3 years, who had cryopreserved
their tissue at the Cryobank Bonn for fertility protection
before the onset of any therapeutic treatment. With informed
consent and approval of the Institutional Ethics Committee,
part of the tissue was available for patient-related research
studies, which includes studies on the potential to recruit
primordial follicles. Tissue was obtained by laparoscopy,
484
immediately transferred into a cold transportation medium
(Custodiol; Dr. Franz K
ohler Chemie), and transported over-
night within 1822 hours at 4 C to the laboratory in special
cooled transport boxes (DeltaT).
Cortical Strip Preparation
On arrival in the laboratory, ovarian tissue was transferred to
fresh cold (4 C) medium (Custodiol), and the underlying ovar-
ian stroma as well as all detectable growing follicles were re-
moved under light microscopy with the use of ne forceps and
scalpels. For the experiments reported here, one thin cortical
slice of 15  5  1 mm per patient was used. Slices were
divided into three equally sized tissue pieces: One piece of
each slice served as untreated control, one as cortical tissue
sample for the uidic culture system, and the third as cortical
tissue sample for the conventional static culture system
(Fig. 1A).
Cortical Tissue Culture
For the static and uidic culture systems, cortical tissue sam-
ples were incubated in 4.5 mL serum-free ovarian tissue cul-
ture medium (OTCM) without oil overlay. The composition of
OTCM was McCoy 5a medium with bicarbonate supplemented
with HEPES (20 mmol/L), bovine serum albumin (0.1%), glu-
tamine (3 mmol/L), penicillin G (0.1 mg/mL), streptomycin
(0.1 mg/mL), transferrin (2.5 mg/mL), selenium (4 ng/mL), in-
sulin (10 ng/mL), and ascorbic acid (50 mg/mL), all obtained
from Sigma-Aldrich (21).
For the uidic culture system, a microdiaphragm pump
(MDP1304; ThinXXS Microtechnology) was connected
through 0.2-mL plastic straws (Cryo-Technik Erlangen), mi-
crouid connectors (ThinXXS Microtechnology), silicon
tubes (VWR International), female/male Luer adapters (Pieper
Filter), and Dial PP pump lters (DIA Nielsen) to a well in
a 6-well plate without a matrix (Becton Dickinson) to gener-
ate a periodic medium circulation of the culture medium.
Fluid pulses at a working frequence of 1 Hz (5 mL OTCM/1 s
for 15 min each half-hour) were controlled by an electronic
control unit (ThinXXS Microtechnology). The static culture
system worked collaterally in another well of the 6-well plate
(Fig. 1B). For both systems, identical culture conditions were
used (6 days culture period, 37 C in humidied air with 5%
CO2, no medium exchange, and no substitutions of gonado-
tropins or growth factors). Altogether, 20 cortical pieces
from ten patients were cultured, ten in each culture system.
Assessment of Follicular Viability
At days 0 and 6, one-half of each control and one-half of each
cultured biopsy were used for viability testing with the use of
calcein AM staining (Promega). In short, tissue samples were
incubated for 1 hour in OCTM supplemented with 0.2%
calcein AM/Dulbecco phosphate-buffered saline solution
(DPBS; PAA Laboratories) solution. Samples were then trans-
ferred in 0.2% calcein AM/DPBS solution supplemented with
68 mg/mL collagenase type 1A (Sigma-Aldrich) and incu-
bated for 1 hour at 37 C. Digestion of the tissue is important
for isolation of the viable follicles embedded in cortex, and
VOL. 100 NO. 2 / AUGUST 2013
 Fertility and Sterility

FIGURE 1

Tissue processing. (A) Following preparation, an ovarian cortical tissue strip was cut into three pieces of similar size, allocated to subgroups (control
[C], uidic culture [FC], and conventional culture [CC]), and incubated in the respective culture system with serum-free medium for 6 days. (B) The
complete trial setup with all investigations and an inset picture of the constructed FCe system. OTCM ovarian tissue culture medium; PCR
polymerase chain reaction.
Liebenthron. In vitro culture of ovarian tissue. Fertil Steril 2013.

this process was mechanically enhanced by pipetting every
15 minutes. The reaction was terminated by the addition of
an equal volume of cold DPBS supplemented with 10% serum
supplement substitute (Irvine Scientic) at room temperature.
Viable follicles were detected with the use of uorescence
microscopy.
Histologic Sections
At days 0 and 6, the other halves of each control and cultured
biopsy were used for preparation of histologic sections for fol-
licle quantication/staging and for RNA isolation for gene
expression investigations. Tissue samples were xed in 4%
neutral buffered formaldehyde solution (Merck) at 4 C, then
dehydrated and embedded in parafn wax. Four-micrometer
sections were cut from the formalin-xed parafn-embedded
(FFPE) ovarian tissue block for follicle quantication (with the
use of hematoxylin and eosin [HE] staining) followed by the
preparation of another three consecutive sections at 10 mm
thickness on special DNase- and RNase-free Super Frost Plus
slides (Menzel-Glaser) for RNA isolation.
Steroid Hormone Assay
At the beginning of the culture period (day 0 2 h, i.e., 2
hours after tissues were placed in culture, also called the
equilibration time of the biopsies) and at the end at day 6,
spent medium was collected and stored at 80 C for 34
months for subsequent E2 and P measurements with the use
of an established chemiluminescent microparticle immunoas-
say (Architekt i2000 system; Abbott Diagnostics).
A preliminary study showed that our OTCM medium was
linear for dilution with the use of the Architekt i2000 sytem after
manual dilution steps with unconditioned OTCM medium. The
calculation of all values of the steroid hormone assay was
enabled with the use of a calibration curve that we created
with OTCM. The resulting values of each cultured cortical biopsy
were then normalized to the corresponding viable follicle count

VOL. 100 NO. 2 / AUGUST 2013 485

ORIGINAL ARTICLE: FERTILITY PRESERVATION
after calcein AM staining. The limits of sensitivity for E2 and P
were 10 pg/mL and 0.1 ng/mL, respectively. The interassay
coefcients of variation were <7.4% for E2 and <6.2% for P.
Gene Expression Assay
For cellular RNA isolation, the FFPE samples prepared on spe-
cial slides were deparafnized, followed by treatment with
proteinase K at high temperature (5570 C). Double-stranded
DNA was then degraded with the use of an in-column DNase
I digestion method. All steps for the RNA isolation were imple-
mented with the use of the High Pure FFPE RNA Micro Kit
(Roche Applied Science). cDNA synthesis from the isolated
RNA was performed with the use of the Transcriptor First
Strand cDNA Synthesis Kit (Roche Applied Science). The total
RNA concentration and the purity were measured for every
sample with an ND-1000 Spectrophotometer (NanoDrop) and
then adjusted to a concentration of 40 mg/mL.
The gene expression assay itself was performed by real-
time polymerase chain reaction (PCR) with the use of a Light-
cycler system 1.2 (Roche Applied Science) and UPL probes
(Supplemental Table 1). Reagents for these investigations
were used from the Lightcycler Taqman Master Kit (Roche
Applied Science) as required. The oligonucleotide primers
for KIT-L, GDF9, BMP15, and INHB are presented in
Supplemental Table 1. The amplication steps were preincu-
bation step 95 C for 10 minutes in 1 cycle, amplication step
95 C for 10 seconds, 60 C for 30 seconds, and 72 C for 1 sec-
ond in 50 cycles, and cooling step 40 C for 30 seconds in 1
cycle. All PCR products were validated on a 2% agarose gel.
The mRNA levels were normalized on the basis of ribosomal
protein L19 mRNA content as housekeeping gene and the
number of follicles in a given section.
Data Analysis
All data are represented as mean
SEM. Values were com-
pared with the use of an unpaired t test and Graph Pad Prism
statistic software (version 5.01). P values of < .05 were con-
sidered to be signicant.
RESULTS
Follicle Viability in Cortical Tissue Pieces and Stage
of Development in Histologic Sections
A total of 30 cortical pieces from ten patients were investi-
gated with the use of calcein AM staining and histologic sec-
tions [ten untreated control (C-samples), ten cultured in the
conventional static culture system (CC-samples), and ten cul-
tured in the dynamic uidic culture (FC-samples)]. The mean
distribution of viable green uorescent follicles in the C-sam-
ples on day 0 was compared with corresponding cultured
tissue pieces. All cortical pieces showed stained healthy folli-
cles at different developmental stages (Supplemental Fig. 1,
available online at www.fertstert.org) ranging from primor-
dial to preantral stages. Compared with the control samples
(97.90
24.44 viable follicles), we found on average a slightly
lower follicle count after a 6-day culture period in the FC sys-
tem (88.60
36.39 viable follicles) and a further reduced fol-
licle count in samples from the CC system (83.10
37.44
486
viable follicles), although these differences were not signi-
cant (Fig. 2A). The same trends were found in the histologic
analyses (Fig. 2B). C-samples showed on average 38.80

21.17 follicles, FC-samples 29.80
16.35 follicles at day 6,
and CC-samples 16.70
4.29 follicles at day 6. Only morpho-
logically intact follicles with a visible oocyte and surrounding
cells possessing round nuclei were counted (Supplemental
Fig. 2, available online at www.fertstert.org). We found
more secondary and early preantral follicles in day 6 sections
compared with control biopsies (Supplemental Table 2, avail-
able online at www.fertstert.org). Most of late preantral folli-
cles showed signs of degeneration in both systems at the end
of the culture period, such as unphysiologic shrunken granu-
losa cells surrounding the oocyte, pycnotic cell nuclei, and
oocytes that were morphologically not intact.
Secretion of Estradiol and Progesterone
At the beginning of the culture period, the level of steroid hor-
mones was very low, but a distinct increase was noted at day 6.
The rise of E2 was signicant (P< .05) in the CC and FC groups
(Fig. 3A and B) whereas P signicantly increased in the CC but
not in the FC group (Fig. 3C and D). The hormone levels for E2
were 2.90
0.52 pg/mL at day 0 2 h and 20.76
3.72 pg/mL
at day 6 for FC-samples and 6.11
2.44 pg/mL at day 0 2 h
and 48.70
15.13 pg/mL at day 6 for CC-samples. The ratios
of E2 and P were signicantly different in both groups (Fig. 3E
and F). Samples of the FC group showed a signicantly higher
ratio (P< .05) as a result of the basal P level in early follicular
stages (from 0.02
0.01 ng/mL at day 0 2 h to 0.13
0.01
ng/mL at day 6), whereas the CC group showed a large decrease
FIGURE 2
Follicle counts. Histogram showing the mean
SEM values of healthy
uorescent follicles in (A) 5  2.5  1 mm cortical pieces and (B) 4-mm
histologic sections from 5  2.5  1 mm cortical pieces. The samples
in each trial were taken from 10 different ovarian cortical biopsies at
time of collection (day 0) and after 6 days of culture.
Liebenthron. In vitro culture of ovarian tissue. Fertil Steril 2013.
VOL. 100 NO. 2 / AUGUST 2013

FIGURE 3
Estradiol and progesterone production. The growth media supernatant from each cultured cortical piece was analyzed for (A and B) E2, (C and D) P,
and (E and F) the E2/P ratio at day 0 2 hours and at day 6. Each value was normalized to the respective follicle count. Data are presented as mean

SEM values representing evaluations from 10 different ovarian cortical biopsies. Asterisks indicate signicantly different results between treatments
according to unpaired t test (P<.05).
Liebenthron. In vitro culture of ovarian tissue. Fertil Steril 2013.
due to very high P levels (from 0.06
0.03 ng/mL at day 0 2
h to 0.51
0.11 ng/mL at day 6).
Early Folliculogenesis Gene Expression Proles
The normalized mRNA levels of KIT-L increased minimally
over the culture period in samples from the FC system and
decreased in samples from the CC system, though not signif-
icantly in both cases (Fig. 4A). For GDF9 levels we noticed
a signicant increase over the culture period in both culture
systems (P< .05) and minimally higher expression levels in
the FC-samples (Fig. 4B). In contrast, BMP15 decreased,
though not signicantly, over the culture period (Fig. 4C).
INHB was expressed similarly to GDF9 (Fig. 4D) except that
the expression level signicantly (P< .05) increased only in
samples from the FC system.
The expression products for all genes could consistently be
validated through agarose gel electrophoresis (Supplemental
Fig. 3, available online at www.fertstert.org).
DISCUSSION
In the past, numerous successful approaches were presented
for culture experiments focusing on in vitro folliculogenesis
VOL. 100 NO. 2 / AUGUST 2013
Fertility and Sterility
in ovarian cortical tissue (2123). All of those studies were
interested in fertility preservation of young women whose
cancer disease might result in metastasic spread to the
ovary and the risk of reintroducing aggressive cancer cells
after ovarian retransplantation. The primary and ultimate
aim is to obtain mature metaphase II oocytes that are
completely grown in vitro from early follicle stages rst
embedded in cortical ovarian tissue and later isolated or
embedded in alginate beads.
The objective of the present study was to investigate the
early steps of follicle recruitment in ovarian cortical frag-
ments, allowing the maintenance of normal follicular struc-
tures and epithelial-stromal interactions (24). These early
events in folliculogenesis were studied in two different culture
systems: a static and a dynamic uidic system using serum-
free culture conditions (21). For both culture systems the me-
dium was not exchanged during the entire culture period, and
supplements, such as growth factors or gonadotropins, were
not added. We had found in preliminary investigations that
the medium reservoir was sufcient for adequate nourish-
ment of ovarian tissue during the short 6-day culture period.
Furthermore, this approach favored the accumulation of
paracrine and autocrine endogenous factors, which were
487
ORIGINAL ARTICLE: FERTILITY PRESERVATION

FIGURE 4

Gene expression proles. Total RNA was extracted from 30 cortex fragments, three from each patient, before and after in vitro culture in a dynamic
uidic culture system or a static conventional culture system. Gene expression was assessed with the use of real-time polymerase chain reaction
(PCR) followed by agarose gel electrophoresis of the PCR products (Supplemental Fig. 3, available online at www.fertstert.org). The bars
represent mean
SEM values from the gene expression assays of early folliculogenesis genes: (A) Kit ligand, (B) growth differentiation factor 9,
(C) bone morphogenetic factor 15, and (D) inhibin B. Asterisks indicate signicantly different results from matched treatments according to
unpaired t test (P<.05).
Liebenthron. In vitro culture of ovarian tissue. Fertil Steril 2013.

produced by growing follicles inside the tissue and are
required for the regulation of follicular development (25).
Number of Viable Follicles
We observed a minimal decrease in the number of healthy fol-
licles over the culture period of 6 days. This nding is not sur-
prising, owing to the nonphysiological environment in which
the ovarian tissue was cultured. However, the number of
healthy follicles in samples of the FC system exceeded those
in the CC system. This benet of the FC system could be due
to the fact that toxic factors may not accumulate locally
around or even inside the cultured tissue (20) because the
medium was at all times circulating through periodic uid
pulses. Another possible explanation could be that essential
nutrients and paracrine secreted factors are optimally distrib-
uted throughout the entire tissue by the constant agitation
and media ow. The developmental stages found in the tissue
ranged from primordial follicles to preantral follicles, and at
day 6 we counted more secondary and early preantral follicles
compared with untreated control samples. It needs to be
added that all visible follicles were manually removed under
light microscopy earlier initiation of the culture period, and
therefore these results indicate that initial follicle recruitment
and development has occurred. Nevertheless, none of the
follicles developed antral cavities, and most of the late prean-
tral follicles showed in the histologic evaluation signs of
degeneration at the end of the culture period. This means
that at a certain time of culture or at a certain developmental
stage, further supplementation of hormones and/or growth
factors in suitable concentrations is required to assure a suc-
cessful continuation of follicle growth in vitro (2628).
Additionally, it may be of advantage to change the media
periodically to reduce locally produced inhibitory factors or
metabolic end-products (19).
Regarding the nonsignicant results of follicle viability
between the static and agitated culturing methods, we assume
the reason was the small number of the cases included in this
trial, because a trend was relatively clear. It also should be
considered that, although all three prepared biopsies de-
scended from one coherent cortex area and although the
mean age group of the included patients was relatively young
(in this age the follicle distribution should be more or less
even), we couldnt be sure if the distribution of follicles in
a given cortical strip was homogeneous and if the absolute
number of follicles in one piece was the same as that in either
of the other pieces.
Steroid Hormone Secretion
Depending on the development stage of the follicle, granulosa
cells surrounding the primary oocyte produce, with the aid of
theca cells, E2 and P. E2 is a marker for maturity of the follicle
and increases with the degree of differentiation and the num-
ber of granulosa cells (24). In contrast, P production starts with
the initial recruitment and increases minimally after the dif-
ferentiation of granulosa cells (29). A signicant increase of
the P level is observed in the late gonadotropin-dependent

488 VOL. 100 NO. 2 / AUGUST 2013


antral follicle stage. Therefore, an increased basal level of P in
early follicle stages could be a marker for premature stress-
induced luteinization (30). Our analysis of spent culture media
indicated that all cultured biopsies were steroidogenically ac-
tive throughout the entire culture period, indicating initiation
of early folliculogenesis. Particularly we found a signicant
rise of E2 in both culture systems (P< .05) and a signicant
rise of P (P< .05) in the CC system after each value was nor-
malized to the follicle count. Consequently, the ratios of E2
and P as an indicator of premature luteinization (30) was de-
creased in the static CC system owing to unphysiologically
high P levels, whereas samples of the dynamic FC system
showed a signicant surge as a result of the normal basal P
level. As already discussed, the reason for this pattern could
be due to the fact that toxic factors may not accumulate locally
around or even inside the cultured tissue through the constant
agitation of the medium, whereby a better supply to the tissue
of essential nutrients and paracrine secreted factors is ensured.
However, it can not be excluded that the variation of the
results is a consequence of the natural distribution of follicles
from adult women over the ovarian cortex owing to cyclic
cohort recruitment in distinct areas (3133).
Gene Expression Proles of Early Developmental
Genes
The processes of folliculogenesis are regulated by an inte-
grated interaction of endocrine, paracrine and autocrine
mechanisms. The incidence and efciency of these regulative
factors are intertwined with the developmental stage of indi-
vidual follicles. A major aspect of this study was to investigate
early and specic processes of follicular developmental with
their involved factors and dependent on the developmental
stage of the follicles present.
KIT-L. There is abundant evidence supporting the importance
of KIT-L in the initiation of folliculogenesis by inducing pri-
mordial follicle growth (34). KIT-L is expressed throughout
early folliculogenesisfrom primordial to antral folliclesin
pregranulosa and granulosa cells after initial recruitment of
primordial follicles (24, 35). KIT-L signaling interactions are
involved in the transition from primordial to primary follicle
(36). It has mutual stimulatory effects on oocytes and granu-
losa cells and promotes the recruitment of theca cells from the
surrounding stromal cell population (37); in addition, it regu-
lates the survival of both migratory and postmigratory pre-
granulosa cells through their antiapoptotic function (38).
In this study, KIT-L showed a nonsignicant minimal in-
crease over the culture period only in FC-samples, which
could indicate an initial recruitment of a few primordial fol-
licles and progress of resulting primary follicles. These results
are in accordance with other investigations of KIT-L (24).
Some studies reported a negative effect of GDF9 expression
on the expression of KIT-L mRNA (39, 40). However, in line
with results derived from bovine granulosa cells, where
GDF9 increased KIT-L mRNA expression (41), we did not
nd a negative effect of increased GDF9 expression on KIT-
L expression levels.
BMP15 and KIT-L are concomitantly expressed in the
early stages of follicular development and appear to be
VOL. 100 NO. 2 / AUGUST 2013
Fertility and Sterility
involved in granulosa cell mitosis. The oocyte-derived
BMP15 and granulosa cellderived KIT-L form a negative
feedback loop by oocytesomatic cell communication (42).
We noted a decrease in BMP15, though not signicant, which
does support the notion that KIT-L is able to negatively regu-
late BMP15 transcripts, probably in a paracrine manner (42).
Finally the higher viable follicle count in FC-samples may
be proof of a positive correlation to the antiapoptotic proper-
ties of KIT-L.
GDF9 and BMP15. The oocyte-derived factors GDF9 and
BMP15 are local members of the transforming growth factor
b family (43, 44). They are involved as positive regulators of
early follicle growth (4547), especially for initiating
primordial follicle growth (4851). BMP15, GDF9, and their
four relevant receptors have been identied in unilaminar
follicles from different mammalian species, including
humans (52, 53). It is also known that following exposure
to recombinant GDF9 in vitro, human ovarian tissue
showed a promotion of primordial follicle progression (46,
54). Furthermore, positive correlations were described
between higher levels of GDF9 and viable follicle counts
and higher E2 levels (54).
In this work, GDF9 showed a signicant (P< .05) increase
in gene expression over the culture period, slightly greater in
the FC system. Looking to GDF9 levels in relation to viable
follicle counts and histologic results conrmed that in both
culture systems early follicle development had taken place,
which is in good agreement with published observations by
others (45, 46, 54).
In contrast, BMP15 decreased nonsignicantly over the
culture period. The underlying reason was not clear, but as
described above it is likely that this can be mediated by a neg-
ative feedback loop through KIT-L.
According to our results GDF9 may play a more sub-
stantial role than BMP15 in early follicular development
(51, 54). Because BMP15 can be identied already in
primordial follicles (48), its presence may serve as a novel
marker for estimating ovarian reserve of not yet recruited
follicles (50).
INHB. INHB is derived from cohorts of initially recruited folli-
cles, which are prone to an FSH-dependent selection called cy-
clic recruitment (55, 56). Like GDF9, INHB showed a signicant
increase of expression (P< .05) over the culture period in
samples of the uidic culture system and thus conrming
that the FC system performed better than the CC system.
CONCLUSION
This initial research project has shown that both follicle sur-
vival and initiation of early follicle developmentfrom pri-
mordial or primary follicles stagescan be better achieved
with the use of a nonstatic culture system. Our observations
are very preliminary, and more work is required with more
included patient biopsies to prove or refute the signicance
of our observations between the static and agitated culturing
methods. In this study, consistent signicant evidence is
missing because of the small number of the cases and, in
the gene expression assays, restricted amount of RNA mate-
rial, which we isolated from small embedded tissue slices.
489
ORIGINAL ARTICLE: FERTILITY PRESERVATION
Nevertheless, a trend was obvious and therefore we prefer the
use of such an agitated tissue culturing method to optimize
the initialization of early in vitro folliculogenesis in cortical
biopsies and subsequent development in a multistep culture
system (19). Additional it would be interesting to test in
more detail the potential of this innovative system with
a set of experiments that compare the growth potential of iso-
lated preantral follicles that developed within each system.
Further improvements could be to evaluate the additional
use of culture matrices or clearly dened supplements for cul-
ture medium and optimal timing of the culture periods (10,
2123, 28, 57).
REFERENCES
1. von Wolff M, Strowitzki T. Fertilitatsprotektion bei onkologischen Erkran-
kungen der Frau. J Reproduktionsmed und Endokrinol 2009;6:527.
2. von Wolff M, Thaler CJ, Frambach T, Zeeb C, Lawrenz B, Popovici RM, et al.
Ovarian stimulation to cryopreserve fertilized oocytes in cancer patients can
be started in the luteal phase. Fertil Steril 2009;4:13605.
3. von Wolff M, Montag M, Dittrich R, Denschlag D, Nawroth F, Lawrenz B.
Fertility preservation in womena practical guide to preservation tech-
niques and therapeutic strategies in breast cancer, Hodgkins lymphoma
and borderline ovarian tumours by the fertility preservation network Ferti-
PROTEKT. Arch Gynecol Obstet 2011;284:42735.
4. Donnez J, Martinez-Madrid B, Jadoul P, van Langendonckt A, Demylle D,
Dolmans MM. Ovarian tissue cryopreservation and transplantation: a review.
Hum Reprod Update 2006;12:51935.
5. Donnez J, Squifet J, Pirard C, Demylle D, Delbaere A, Armenio L, et al. Live
birth after allografting of ovarian cortex between genetically nonidentical
sisters. Hum Reprod 2011;26:13848.
6. Gosden RG. Prospects for oocyte banking and in vitro maturation. J Natl
Cancer Inst Monogr 2005;34:603.
7. Hovatta O. Methods for cryopreservation of human ovarian tissue. Reprod
Biomed Online 2005;10:72934.
8. Meirow D, Levron J, Eldar-Geva T, Hardan I, Fridman E, Zalel Y, et al. Preg-
nancy after transplantation of cryopreserved ovarian tissue in a patient with
ovarian failure after chemotherapy. N Engl J Med 2005;353:31821.
9. Jeruss JS, Woodruff TK. Preservation of fertility in patients with cancer.
N Engl J Med 2009;360:90211.
10. Smitz J, Dolmans MM, Donnez J, Fortune JE, Hovatta O, Jewgenow K, et al.
Current achievements and future research directions in ovarian tissue
culture, in vitro follicle development and transplantation: implications for
fertility preservation. Hum Reprod Update 2010;16:395414.
11. Donnez J, Dolmans MM. Preservation of fertility in females with haemato-
logical malignancy. Br J Haematol 2011;154:17584.
12. Dittrich R, Lotz L, Keck G, Hoffmann I, Mueller A, Beckmann MW, et al. Live
birth after ovarian tissue autotransplantation following overnight transpor-
tation before cryopreservation. Fertil Steril 2012;97:38790.
13. Mu ller A, Keller K, Wacker J, Dittrich R, Keck G, Montag M, et al. Retrans-
plantation of cryopreserved ovarian tissue: the rst live birth in Germany.
Dtsch Arztebl Int 2012;109:813.
14. Abir R, Feinmesser M, Yaniv I, Fisch B, Cohen IJ, Ben-Haroush A, et al. Occa-
sional involvement of the ovary in Ewing sarcoma. Hum Reprod 2010;25:
170812.
15. Dolmans MM, Marinescu C, Saussoy P, van Langendonckt A, Amorim C,
Donnez J. Reimplantation of cryopreserved ovarian tissue from patients with
acute lymphoblastic leukemia is potentially unsafe. Blood 2010;116:290814.
16. Bittinger SE, Nazaretian SP, Gook DA, Parmar C, Harrup RA, Stern CJ. Detec-
tion of Hodgkin lymphoma within ovarian tissue. Fertil Steril 2011;95:
803.e36.
17. Fabbri R, Pasquinelli G, Keane D, Mozzanega B, Magnani V, Tamburini F,
et al. Culture of cryopreserved ovarian tissue: state of the art in 2008. Fertil
Steril 2009;91:161929.
490
18. OBrien MJ, Pendola JK, Eppig JJ. A revised protocol for in vitro development
of mouse oocytes from primordial follicles dramatically improves their devel-
opmental competence. Biol Reprod 2003;68:16826.
19. Telfer EE, McLaughlin M. In vitro development of ovarian follicles. Semin
Reprod Med 2011;29:1523.
20. Isachenko V, Montag M, Isachenko E, van der Ven K, Dorn C, Roesing B,
et al. Effective method for in-vitro culture of cryopreserved human ovarian
tissue. Reprod Biomed Online 2006;13:22834.
21. Telfer EE, McLaughlin M, Ding C, Thong KJ. A two-step serum-free culture
system supports development of human oozytens from primordial follicles in
the presence of activin. Hum Reprod 2008;23:11518.
22. Hovatta O, Wright C, Krausz T, Hardy K, Winston RM. Human primordial,
primary and secondary ovarian follicles in long-term culture: effect of partial
isolation. Hum Reprod 1999;14:251924.
23. Scott JE, Carlsson IB, Bavister BD, Hovatta O. Human ovarian tissue cultures:
extracellular matrix composition, coating density and tissue dimensions.
Reprod Biomed Online 2004;9:28793.
24. Carlsson IB, Laitinen MP, Scott JE, Louhio H, Velentzis L, Tuuri T, et al. Kit
ligand and c-Kit are expressed during early human ovarian follicular develop-
ment and their interaction is required for the survival of follicles in long-term
culture. Reproduction 2006;131:6419.
25. Albertini DF, Combelles CM, Benecchi E, Carabatsos MJ. Cellular basis for
paracrine regulation of ovarian follicle development. Reproduction 2001;
121:64753.
26. Adriaens I, Cortvrindt R, Smitz J. Differential FSH exposure in preantral folli-
cle culture has marked effects on folliculogenesis and oocyte developmental
competence. Hum Reprod 2004;19:398408.
27. Picton HM, Harris SE, Muruvi W, Chambers EL. The in vitro growth and mat-
uration of follicles. Reproduction 2008;136:70315.
28. Wright CS, Hovatta O, Margara R, Trew G, Winston RM, Franks S, et al.
Effects of follicle-stimulating hormone and serum substitution on the in-
vitro growth of human ovarian follicles. Hum Reprod 1999;14:155562.
29. Xu M, Barrett SL, West-Farrell E, Kondapalli LA, Kiesewetter SE, Shea LD,
et al. In vitro grown human ovarian follicles from cancer patients support
oocyte growth. Hum Reprod 2009;24:253140.
30. Xu M, Banc A, Woodruff TK, Shea LD. Secondary follicle growth and oocyte
maturation by culture in alginate hydrogel following cryopreservation of the
ovary or individual follicles. Biotechnol Bioeng 2009;103:37886.
31. Oktay K, Nugent D, Newton H, Salha O, Chatterjee P, Gosden RG. Isolation
and characterization of primordial follicles from fresh and cryopreserved hu-
man ovarian tissue. Fertil Steril 1997;67:4816.
32. Schmidt KL, Byskov AG, Nyboe Andersen A, M uller J, Yding Andersen C.
Density and distribution of primordial follicles in single pieces of cortex
from 21 patients and in individual pieces of cortex from three entire human
ovaries. Hum Reprod 2003;18:115864.
33. McGee EA, Hsueh AJ. Initial and cyclic recruitment of ovarian follicles.
Endocr Rev 2000;21:20014.
34. Driancourt MA, Reynaud K, Cortvrindt R, Smitz J. Roles of Kit and Kit ligand
in ovarian function. Rev Reprod 2000;5:14352.
35. Edson MA, Nagaraja AK, Matzuk MM. The mammalian ovary from genesis
to revelation. Endocr Rev 2010;30:624712.
36. Abir R, Fisch B, Jin S, Barnnet M, Kessler-Icekson G, Ao A. Expression of stem
cell factor and its receptor in human fetal and adult ovaries. Fertil Steril 2004;
82:123543.
37. Skinner MK. Regulation of primordial follicle assembly and development.
Hum Reprod Update 2005;11:46171.
38. de Felici M. Regulation of primordial germ cell development in the mouse.
Int J Dev Biol 2000;44:57580.
39. Elvin JA, Clark AT, Wang P, Wolfman NM, Matzuk MM. Paracrine actions of
growth differentiation factor-9 in the mammalian ovary. Mol Endocrinol
1999;13:103548.
40. Joyce IM, Clark AT, Pendola FL, Eppig JJ. Comparison of recombinant growth
differentiation factor-9 and oocyte regulation of Kit ligand messenger ribonu-
cleic acid expression in mouse ovarian follicles. Biol Reprod 2000;63:166975.
41. Nilsson EE, Skinner MK. Growth and differentiation factor-9 stimulates pro-
gression of early primary but not primordial rat ovarian follicle development.
Biol Reprod 2000;67:101824.
VOL. 100 NO. 2 / AUGUST 2013

42. Otsuka F, Shimasaki S. A negative feedback system between oozyten bone
morphogenetic protein 15 and granulosa cell Kit ligand: its role in regulating
granulosa cell mitosis. Proc Natl Acad Sci U S A 2002;99:80605.
43. Otsuka F, Yao Z, Lee T, Yamamoto S, Erickson GF, Shimasaki S. Bone mor-
phogenetic protein-15. Identication of target cells and biological functions.
J Biol Chem 2000;275:395238.
44. McNatty KP, Juengel JL, Reader KL, Lun S, Myllymaa S, Lawrence SB, et al.
Bone morphogenetic protein 15 and growth differentiation factor 9 co-
operate to regulate granulosa cell function. Reproduction 2005;129:47380.
45. Knight PG, Glister C. TGF-b superfamily members and ovarian follicle devel-
opment. Reproduction 2006;132:191206.
46. Hreinsson JG, Scott JE, Rasmussen C, Swahn ML, Hsueh AJ, Hovatta O.
Growth differentiation factor-9 promotes the growth, development, and
survival of human ovarian follicles in organ culture. J Clin Endocrinol Metab
2002;87:31621.
47. Sadeu JC, Smitz J. Growth differentiation factor-9 and anti-m ullerian
hormone expression in cultured human follicles from frozen-thawed ovarian
tissue. Reprod Biomed Online 2008;17:53748.
48. Margulis S, Abir R, Felz C, Nitke S, Krissi H, Fisch B. Bone morphogenetic pro-
tein 15 expression in human ovaries from fetuses, girls, and women. Fertil
Steril 2009;92:166673.
49. Oron G, Fisch B, Ao A, Zhang XY, Farhi J, Ben-Haroush A, et al. Expression of
growth-differentiating factor 9 and its type 1 receptor in human ovaries.
Reprod Biomed Online 2011;21:10917.
VOL. 100 NO. 2 / AUGUST 2013
Fertility and Sterility
50. Abir R, Fisch B. Invited commentary: a single nucleotide polymorphism in
BMP15 is associated with high response to controlled ovarian hyperstimula-
tion. Reprod Biomed Online 2011;23:7780.
51. Shimasaki S, Moore RK, Otsuka F, Erickson GF. The bone morphogenetic
protein system in mammalian reproduction. Endocr Rev 2004;25:72101.
52. Abir R, Ben-Haroush A, Melamed N, Felz C, Krissi H, Fisch B. Expression of
bone morphogenetic proteins 4 and 7 and their receptors IA, IB, and II in hu-
man ovaries from fetuses and adults. Fertil Steril 2008;89:143040.
53. Schilling B, Yeh J. Expression of transforming growth factor (TGF)-beta1,
TGF-beta2, and TGF-beta3 and of type I and II TGF-beta receptors during
the development of the human fetal ovary. Fertil Steril 1999;72:14753.
54. Kedem A, Fisch B, Garor R, Ben-Zaken A, Gizunterman T, Felz C, et al.
Growth differentiating factor 9 (GDF9) and bone morphogenetic protein
15 both activate development of human primordial follicles in vitro, with
seemingly more benecial effects of GDF9. J Clin Endocrinol Metab 2011;
96:E124654.
55. Welt CK, Schneyer AL. Differential regulation of inhibin B and inhibin a by
follicle-stimulating hormone and local growth factors in human granulosa
cells from small antral follicles. J Clin Endocrinol Metab 2001;86:3306.
56. Phillips DJ, Woodruff TK. Inhibin: actions and signaling. Growth Factors
2004;22:138.
57. Kedem A, Hourvitz A, Fisch B, Shachar M, Cohen S, Ben-Haroush A, et al.
Alginate scaffold for organ culture of cryopreserved-thawed human ovarian
cortical follicles. J Assist Reprod Genet 2011;28:7619.
491
ORIGINAL ARTICLE: FERTILITY PRESERVATION

SUPPLEMENTAL FIGURE 1

Evaluation of the viable follicle count and morphologic analysis before and after 6 days of culture. Viable follicles of digested ovarian cortex as
viewed under uorescence microscope (green) and with incident light (grey). (A, B) Example of primordial and primary healthy uorescent
follicles from uncultured cortex biopsies. (C, D) Example of healthy uorescent follicles in different developmental stages (from primary to
preantral stage) from biopsies cultured in the uidic culture system. (E, F) Example of healthy uorescent follicles in different developmental
stages (from primary to preantral stage) from biopsies cultured in the static conventional culture system. Scale bars 50 mm.
Liebenthron. In vitro culture of ovarian tissue. Fertil Steril 2013.

491.e1 VOL. 100 NO. 2 / AUGUST 2013

 Fertility and Sterility

SUPPLEMENTAL FIGURE 2

Histologic analysis after 6 days culture period. Histologic section,

stained with haematoxylin and eosin, from a sample that was
cultured in the dynamic uidic culture system. All counted follicles
show an intact healthy oocyte. Scale bar 50 mm.
Liebenthron. In vitro culture of ovarian tissue. Fertil Steril 2013.

VOL. 100 NO. 2 / AUGUST 2013 491.e2

ORIGINAL ARTICLE: FERTILITY PRESERVATION

SUPPLEMENTAL FIGURE 3

Agarose gel electrophoresis. DNA gel electrophoresis was performed

for analytic evaluation of the polymerase chain reaction (PCR)
products. Each lane represents a different gene: ribosomal protein
L19 (RPL19) as housekeeping gene, Kit ligand (KIT-L), growth
differentiation factor 9 (GDF9), bone morphogenetic protein 15
(BMP15), and inhibin B (INHB). The bottom panel represents the
negative control samples of each gene and excludes a contamination
of the PCR mixes.
Liebenthron. In vitro culture of ovarian tissue. Fertil Steril 2013.

491.e3 VOL. 100 NO. 2 / AUGUST 2013

 Fertility and Sterility

SUPPLEMENTAL TABLE 1

Oligonucleotide primers and UPL probes.

Gene Nucleotide sequence PCR product UPL probe no.
0
Ribosomal protein L19 RPL19 5 GCTCTTTCCTTTCGCTGCT 122 bp #46
30 CATTGGTCTCATTGGGGTCT
Inhibin B INHB 50 ATCAGCTTCGCCGAGACA 76 bp #52
30 GGTTGCCTTCGTTGGAGAT
Kit-ligand KIT-L 50 GCGCTGCCTTTCCTTATG 95 bp #68
30 CCTTCAGTTTTGACGAGAGGA
Bone morphogenetic protein 15 BMP15 50 AAGGAGGGCAGTCCTCTATTG 60 bp #30
30 CCTCAATCAGGGGCAAAGTA
Growth differentiation factor 9 GDF-9 50 CTCTTCACCCCCTGTACCC 75 bp #54
30 CAGTTCCACTGATGGAAGGAT
Note: UPL Universal Probe Library.
Liebenthron. In vitro culture of ovarian tissue. Fertil Steril 2013.

VOL. 100 NO. 2 / AUGUST 2013 491.e4

ORIGINAL ARTICLE: FERTILITY PRESERVATION

SUPPLEMENTAL TABLE 2

Evaluation of morphologically intact follicles in histologic sections.

Follicle Primordial Primary Secondary
Sample no. count (total) follicle stage follicle stage follicle stage
Control
1 7 1 3 3
2 12 1 10 1
3 13 5 8 0
4 18 4 13 1
5 221 75 130 16
6 3 2 1 0
7 9 2 7 0
8 12 8 4 0
9 72 30 39 3
10 21 3 16 2
Mean 39 13 23 3
Fluidic culture
1 16 4 10 2
2 2 1 1 0
3 5 2 2 1
4 2 0 2 0
5 169 92 63 14
6 2 0 2 0
7 10 1 6 3
8 1 0 1 0
9 51 14 31 6
10 37 10 23 4
Mean 30 13 14 3
Conventional culture
1 9 2 5 2
2 2 1 1 0
3 5 2 3 0
4 3 2 1 0
5 10 2 8 0
6 4 3 1 0
7 29 12 16 1
8 17 6 11 0
9 31 4 25 2
10 35 24 10 1
Mean 15 6 8 1
Liebenthron. In vitro culture of ovarian tissue. Fertil Steril 2013.

491.e5 VOL. 100 NO. 2 / AUGUST 2013