Journal of Biotechnology 129 (2007) 421432

Embryonic stem cells remain highly pluripotent following long term

expansion as aggregates in suspension bioreactors
Nicole I. zur Nieden a,1,2 , Jaymi T. Cormier b,1,3 , Derrick E. Rancourt a,4 , Michael S. Kallos c,
a
Institute of Maternal & Child Health, University of Calgary, Calgary, Alberta, Canada T2N 4N1
b
Department of Medical Science, Faculty of Medicine, University of Calgary, Calgary, Alberta, Canada T2N 4N1
c Pharmaceutical Production Research Facility (PPRF), Schulich School of Engineering, University of Calgary, Calgary, Alberta, Canada T2N 1N4

Received 25 August 2006; received in revised form 8 December 2006; accepted 3 January 2007

Abstract
Increasing attention has been drawn towards pluripotent embryonic stem cells (ESCs) and their potential use as the primary material in various
tissue engineering applications. Successful clinical implementation of this technology would require a quality controlled reproducible culture system
for the expansion of the cells to be used in the generation of functional tissues. Recently, we showed that suspension bioreactors could be used in
the regulated large-scale expansion of highly pluripotent murine ESCs. The current study illustrates that these bioreactor protocols can be adapted
for long term culture and that murine ESC cultures remain highly undifferentiated, when serially passaged in suspension bioreactors for extended
periods. Flow cytometry analysis and gene expression profiles of several pluripotency markers, in addition to colony and embryoid body (EB)
formation tests were conducted at the start and end of the experiment and all showed that the ESC cultures remained highly undifferentiated over
extended culture time in suspension. In vivo teratoma formation and in vitro differentiation into neural, cardiomyocyte, osteoblast and chondrocyte
lineages, performed at the end of the long term culture, further supported the presence of functional and undifferentiated ESCs in the expanded
population. Overall, this system enables the controlled expansion of highly pluripotent murine ESC populations.
2007 Elsevier B.V. All rights reserved.

Keywords: Embryonic stem cells; Suspension bioreactor; Long term culture; Pluripotency; Embryoid body formation

1. Introduction As a result, our research efforts have focused on the development

With their multi-lineage differentiation capability and capac-
ity for long term self renewal, embryonic stem cells (ESCs) are
an effective option as the basic material for a variety of tissue
regeneration applications, and therefore may offer a potential
treatment alternative for many non-curable degenerative dis-
eases and injuries (Smith, 2001). Successful clinical implemen-
tation of tissue engineering products generated from ESCs will
rely on the development of a quality controlled, reproducible cell
culture system for the expansion and differentiation of the cells.
Corresponding author. Tel.: +1 403 220 7447; fax: +1 403 284 4852.
E-mail addresses: nicole.zur.nieden@gmx.net (N.I. zur Nieden),
cormierj@ucalgary.ca (J.T. Cormier), rancourt@ucalgary.ca (D.E. Rancourt),
mskallos@ucalgary.ca (M.S. Kallos).
1 These authors contributed equally.
2 Tel.: +1 403 220 8684; fax: +1 403 283 8727.
3 Tel.: +1 403 220 4549.
4 Tel.: +1 403 220 2888; fax: +1 403 283 8727.
of ESC culture methods in suspension bioreactor systems.
Recent studies by Oh et al. (2005) and Fong et al. (2005)
presented static culture perfusion systems for murine and
human ESC expansion, respectively. In both studies, the
perfusion systems yielded a substantially higher cell expansion
than the regular static culture flasks. Although this expansion
method was efficient, the use of a static culture perfusion
system for generating clinically relevant cell numbers would
only be applicable for a per-patient treatment basis. For a
bioprocess in which cells are generated for numerous patients,
static culture flasks are disadvantageous because many flasks
would be required; the process would be labour intensive
and time consuming and would introduce culture-to-culture
variability. Alternatively, suspension culture bioreactors offer
several advantages over the conventional use of static culture
flasks. First, these systems facilitate the large-scale expansion
of the cells in a homogeneous culture environment, decreasing
the risk of culture variability. They are also less labour-intensive
to operate and offer the possibility for computer control and

0168-1656/$ see front matter 2007 Elsevier B.V. All rights reserved.
doi:10.1016/j.jbiotec.2007.01.006
422 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432
monitoring of the culture conditions, including temperature,
pH and oxygen levels. With respect to ESCs, we envision a
scenario in which a complete bioprocess would exist for the
bioreactor expansion and subsequent differentiation of the
ESCs to generate the specialized cell type of interest. The
specialized cell populations could then be used for cell therapies
or combined with scaffolds to produce tissue constructs. For
the latter application, the bioreactors would also facilitate cell
seeding of the scaffolds, due to the stirred culture environment,
a further advantage over the use of static culture flasks.
Although bioreactors have been used in a variety of biotech-
nology applications, including cell culture, protein and virus
production, and waste water treatment (Martin et al., 2004),
little progress has been made towards the development of proto-
cols for the expansion of ESCs in these systems, as it has been
found that excessive agglomeration and spontaneous differen-
tiation led to a diminished proliferative capacity (Dang et al.,
2002, 2004).
Previous work in our laboratory however, has shown that
suspension bioreactors can be used to expand undifferentiated
mammalian stem cell populations, specifically neural stem cells
(NSCs) (Kallos et al., 2003). These results formed the basis
for our current ESC studies. Recently, we reported a success-
ful protocol for the large-scale expansion of undifferentiated
ESCs in suspension bioreactors (Cormier et al., 2006), in which
agglomeration of the cells was effectively controlled through
the agitation rate and inoculation density. Another recent study
presented a similar suspension culture system for the expansion
of ESCs (Fok and Zandstra, 2005). The current study extends
that work to demonstrate that large-scale expansion of highly
undifferentiated ESC cultures is possible in suspension culture
bioreactors over extended time periods.
To assess the pluripotency of the ESCs following serial pas-
saging in suspension, biological and functional attributes of the
cells were examined at the end of a 28-day culture period and
compared to static controls from the start of the experiment.
Flow cytometry analysis and gene expression profiles, including
pluripotency markers Oct-4, Nanog, SSEA-1, rex-1 and alkaline
phosphatase were used to determine the fraction of undifferen-
tiated cells present over the course of the expansion. Additional
characterization of the cells involved embryoid body formation
and colony forming assays, in vivo teratoma formation and in
vitro multi-lineage differentiation, all of which confirmed that
the functional attributes of undifferentiated ESCs were not lost
as a result of expansion in a suspension culture system. Over-
all, this study offers a comprehensive analysis of the efficacy of
suspension culture bioreactors for the expansion of ESCs over
several passages.
2. Materials and methods
2.1. Cell culture
Murine R1 ESCs were routinely cultured as a monolayer
in static cultures, designated as Stat.Prolif, in the presence
of Leukemia Inhibitory Factor (LIF, 1000 U/mL, Gibco) to
maintain their undifferentiated status and passaged every
second day. ESC medium consisted of high glucose DMEM
(4.5 g glucose/L, Gibco) supplemented with 15% FBS (Gibco,
chosen batches), 50 U/mL penicillin and 50 g/mL strepto-
mycin, 1% non-essential amino acids (Gibco) and 0.1 mM
-mercaptoethanol (Sigma). Bioreactors from NTS Technolo-
gies (264501-125) for stirred suspension cultures contained
100 mL of ESC medium and 1000 U/mL of LIF. The suspension
cultures were run in duplicate, designated as Susp.Prolif A and
Susp.Prolif B, and were seeded with a single cell suspension
at 3.75 104 cells/mL and agitated at 100 rpm. Daily samples
were taken for cell counts, using the trypan blue exclusion
method. The suspension cultures were passaged every 4 days by
dissociating the ESC aggregates, using 0.25% Trypsin/EDTA
and DNase I, and inoculating new suspension systems with
single cells. Samples for growth rate determination, metabolite
and amino acid concentrations in the medium were collected
as described (Cormier et al., 2006). All static and suspension
cultures were maintained in a humidified incubator at 37 C
and 5% CO2 .
2.2. Oxygen uptake rate
The oxygen uptake rate of the murine ESCs was determined
using batch experiments in a modified suspension culture flask.
The vessel, which consisted of a regular spinner flask that
was modified at the University of Calgary, had a volume of
approximately 250 mL and was operated with no head space, so
that no atmospheric oxygen was supplied to the culture (other
than that originally dissolved in the media). For each run, the
modified flask was filled with 250 mL of pre-warmed ESC cul-
ture medium, ESCs were added at 5.0 105 cells/mL and the
dissolved oxygen concentration was monitored using a probe.
Oxygen consumption rates were determined, as described pre-
viously (Kallos and Behie, 1999), for intact ESC aggregates and
for a single cell suspension of ESCs, both derived from day 4
suspension cultures (Susp.Prolif).
2.3. Immunouorescence
ESCs were fixed with ice-cold methanol:acetone (7:3) for
10 min at 20 C. Cells were permeabilized with PBS/0.1%
Triton-X 100 and unspecific binding was blocked by incubation
with PBS/1% BSA for 30 min at room temperature. Undifferen-
tiated ESCs were identified through an anti-Oct4 (Chemicon,
MAB 4305), an anti-Nanog (Chemicon, AB 9920), an anti-
SSEA-1 (Chemicon, MAB 4301) and an anti-ALP antibody
(R&D Systems, MAB 1448). Differentiated EBs were probed
with an anti-GFAP (Chemicon, MAB 360) and an anti-NF
200 kDa (Sigma, N-4142) antibody. The cells were overlaid with
the primary antibody and incubated at 4 C overnight. The appro-
priate Alexa Fluor 488 or Alexa Fluor 546 conjugated secondary
antibody (Molecular Probes) was diluted in PBS and 5% goat
serum (Sigma) and applied to the cells for 2 h at 4 C.
2.4. FACS analysis
Static cultures and suspension culture aggregates were disso-
ciated into single cells and subjected to fluorescence-activated
 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432 423

cell sorting on day 0 (static), day 4 (suspension) and day 28
(static and suspension). Ten thousand events were registered
per sample with a FACS Calibur instrument and CellQuest soft-
ware from Becton Dickinson as described (Cormier et al., 2006).
Only events that showed >99% fluorescence intensity compared
to cells that were incubated with the secondary antibody alone
were registered as positive.
PCR master mix (Biorad, Hercules, CA), with the following
cycle conditions: an initial denaturation step at 95 C followed
by 40 rounds of cycling between 30 s at 95 C and 45 s at the
respective annealing temperatures (see Table 1). Expression of
genes of interest was normalized to the house-keeping gene
GAPDH, which does not alter its expression levels during ESC
differentiation (Murphy and Polak, 2002).

2.5. RNA isolation 2.7. Embryoid body and colony forming cell assays

Cells were harvested for RNA isolation from biological trip-
licates at various stages of static and suspension culture and
from embryoid bodies as indicated. Total RNA was isolated
using the RNeasy Midi Kit (Qiagen) according to the manufac-
turers instructions with on-column DNase digest. Yield of RNA
was determined with the Ribogreen RNA quantitation reagent
(Molecular Probes) as before (zur Nieden et al., 2001). Com-
plementary DNA was synthesized from 500 ng of RNA with
Superscript II (Invitrogen) as described (zur Nieden et al., 2005).
2.6. RT-PCR and quantitative PCR
Primer sequences that were not found in the literature were
designed with Primer3 available at http://frodo.wi.mit.edu/cgi-
bin/primer3/primer3 www.cgi and subjected to a BLAST search
(http://www.ncbi.nlm.nih.gov/BLAST/). PCR reactions were
composed of 0.8 M of each of the primers (see Table 1), 2 mM
MgCl2 , 0.1 mM of each of the dNTPs and 2.5 U of Taq Poly-
merase in 1 PCR buffer (Invitrogen) in a total reaction volume
of 25 L using 75 ng of cDNA. Following a 5 min denaturation,
reactions were cycled through 35 rounds of 30 s at 94 C, 30 s
at the corresponding annealing temperature (see Table 1) and
30 s at 72 C. Obtained DNA product was fractionated on 23%
agarose gels at 70 V for 45 min.
Quantitative PCR was carried out with 50 ng cDNA essen-
tially as described (zur Nieden et al., 2004). A two-step PCR
run was performed in an iCycler iQ system using a SYBR green
As a means to assess pluripotency, ESCs were tested for their
capability to form embryoid bodies in methylcellulose and to
reform colonies as modified from Palmqvist et al. (2005). In
brief, varying numbers of ESCs were diluted in methylcellulose-
based medium plus 15% FBS, 2.2 mM l-glutamine, and 127 nM
monothioglycerol in IMDM (Gibco) and seeded into low adher-
ent dishes. Cell were incubated at 37 C, 5% CO2 and >95%
humidity and emerging EBs from n = 6 dishes were counted
after 5 days. For the CFC (Colony Forming Cell) assay, three dif-
ferent concentrations of ESCs were seeded onto gelatin-coated
gridded dishes and grown in regular ESC maintenance medium
containing 1000 U/mL of LIF. Emerging colonies were counted
after 5 days. Differentiated colonies were distinguished from
the undifferentiated colonies through the appearance of colony
outgrowths and counted as well.
2.8. ESC differentiation
Differentiation was carried out in hanging drops as described
(zur Nieden et al., 2004). In brief, 20 L drops of the stem
cell suspension, containing approximately 750 cells per drop,
were placed onto the top lid of a Petri dish filled with PBS
and then incubated at 37 C with 5% CO2 . The resulting EBs
were transferred into non-adherent suspension cultures at day
3. At day 5, intact EBs, which consisted of approximately
50,000 cells/EB were plated into primaria treated flasks. Car-
diogenic differentiation was examined through spontaneous

Table 1
Primer sequences used for the amplification of stem cell specific genes and early differentiation markers
Gene Forward primer Reverse primer Tm ( C) References

Oct-4 GCCTTGCAGCTCAGCCTTAA CTCATTGTTGTCGGCTTCCTC 61

nanog ATGCCTGCAGTTTTTCATCC GAGGCAGGTCTTCAGAGGAA 60 Palmqvist et al. (2005)
ALP GTGCCCTGACTGAGGCTGTC GGATCATCGTGTCCTGCTCAC 60 zur Nieden et al. (2003)
rex-1 TGGCTTCCCTGACAGATACC CCTTCGAACGTGCACTGATA 60 Palmqvist et al. (2005)
NF 68 AGTGGCTTTCTGGCTTGCTG TCTGTGTGATTCACATTGCCATAG 59
NF 160 GCTTTCCTGCGGCGTAATC TTGCGCTCTACCGTGATGTG 62 zur Nieden et al. (2004)
FGF-5 GGCAGAAGTAGCGCGACGTT TCCGGTTGCTCGGACTGCTT 50 Johansson and Wiles (1995)
CK 18 AGAGAGCCTGAGGGAGGTGG GCACACATCAACACCTATCGAA 50 Wang et al. (2004)
AFP CCCACTTCCAGCACTGCCTGCGG GGCTGCAGCAGCCTGAGAGTC 58 Wilkinson et al. (2005)
5T4 AACTGCCGAGTCTCAGATACC ATGATACCCTTCCATGTGATCC 55 Ward et al. (2003)
Eomesodermin CCACTGGATGAGGCAGGAGATTTCC AGTCTTGGAAGGTTCATTCAAGTCC 56 Kimura et al. (1999)
Brachyury GCTGTGACTGCCTACCAGCAGAATG GAGAGAGAGCGAGCCTCCAAAC 58 Ginis et al. (2004)
osteocalcin CCGGGAGCAGTGTGAGCTTA TAGATGCGTTTGTAGGCGGTC 60 zur Nieden et al. (2003)
aggrecan GATCTGGCATGAGAGAGGCG GCCACGGTGCCCTTTTTAC 61 zur Nieden et al. (2005)
/-MHC ACCTGTCCAAGTTCCGCAAG CTTGTTGACCTGGGACTCGG 62 zur Nieden et al. (2001)
GAPDH GCACAGTCAAGGCCGAGAAT GCCTTCTCCATGGTGGTGAA 60 zur Nieden et al. (2004)

Sequences are depicted in 5 3 direction.

424 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432
differentiation of the cells in ESC maintenance medium with-
out LIF. Osteogenic differentiation was induced with 10 mM
-glycerophosphate, 50 g/mL ascorbic acid and 5 108 M
1,25-OH2 vitamin D3 (zur Nieden et al., 2003). For differentia-
tion along the chondrocyte lineage, EBs were supplemented with
TGF1 (10 ng/mL), BMP-2 (10 ng/mL), insulin (1 g/mL) and
ascorbic acid (50 g/mL) as described previously (zur Nieden et
al., 2004). ESCs were forced to differentiate into neuronal cell
types using lineage selection (Okabe et al., 1996) with minor
modifications as described in zur Nieden et al. (2004).
2.9. Histochemical stains for bone and cartilage
Mineralized nodules were identified by the von Kossa method
(McGee, 1958) after 30 days of osteoblast culture as described
(zur Nieden et al., 2003). Proteoglycans secreted by ESC derived
chondrocytes were stained with Alcian Blue. Cultures were fixed
in 2.5% glutaraldehyde, 25 mM sodium acetate, 0.4 M MgCl2
containing 0.05% Alcian Blue (Sigma) for 48 h.
2.10. Ca2+ determination
Matrix incorporated calcium was quantified using the purple
substrate Arsenazo III (DCL). Calcium reacts with Arsenazo III
at neutral pH to yield a blue colored complex, whose intensity is
proportional to the calcium concentration. Cells were intensively
washed with PBS to remove any traces of medium. Values are
calculated from a standard, which was measured along with the
samples at 650 nm in a Benchmark Plus microplate spectropho-
tometer (Biorad). Values obtained for osteogenic cultures were
normalized to spontaneously differentiated control cultures of
the same type of cell to filter out unspecific incorporation into
the EB matrix.
2.11. Lowry protein assay
Calcium content of EBs was normalized to the total pro-
tein content of the samples. After Ca2+ determination, EBs
were rinsed twice in PBS and lysed in RIPA buffer (150 mM
NaCl, 10 mM Tris, pH 7.2, 0.1% SDS, 1% Triton X-100, 1%
deoxycholate, 5 mM EDTA) containing 1 mM phenylmethylsul-
fonyl fluoride, 10 mM benzamidine, 2 g/mL leupeptin, 100 M
sodium orthovanadate and 10 mM p-nitrophenylphosphate.
After gentle rocking for 30 min, lysates were collected, cen-
trifuged and an aliquot of the supernatant mixed with DC
protein assay reagents from Biorad. After 15 min incubation at
room temperature, absorbance was read in a Benchmark Plus
microplate spectrophotometer (Biorad) at 750 nm. Protein quan-
tities in samples were taken from a BSA standard curve.
2.12. ALP assay
Alkaline phosphatase activity was determined from the
protein lysates using p-nitrophenyl phosphate (Sigma) as a sub-
strate. The production of yellow p-nitrophenol was stopped with
3N NaOH after a 20 min incubation at 37 C. Absorbance was
read at t = 0 and t = 20 min at 405 nm. Enzyme activity was cal-
culated as described before (zur Nieden et al., 2003).
2.13. Teratoma formation
CB17SC-M SCID mice (genotype C.B-Igh-1b /IcrTac-
Prkdcscid) were obtained from Taconic and housed in the
single-barrier animal facility of the Faculty of Medicine, Uni-
versity of Calgary. Mice were fed ad libitum with a standard
diet and water. A quarter million cells were injected as a sin-
gle cell suspension into the skin fold of the inner thigh, using a
27 gauge syringe, of four mice per group. After 23 weeks, ani-
mals were sacrificed and emerging tissue material was dissected.
Animal protocols were carried out as approved by the Univer-
sity of Calgary animal protocol # 157-GM. Tissue was fixed
in formalin and embedded in paraffin. Sections were stained in
hematoxylin/eosin according to standard procedures (Loken et
al., 2004).
2.14. Statistical analysis
Significance of quantitative PCR results, Ca2+ determina-
tion and Image analysis was determined with a Students
t-test using a web-based program from the Physics Depart-
ment of the College of Saint Benedict/Saint Johns University
(http://www.physics.csbsju.edu/stats/t-test.html).
3. Results
3.1. Long term passaging of ESCs as aggregates in
suspension
In the current study, we developed a serial passaging proto-
col, which allowed for the propagation of ESCs in suspension
culture. For passaging, ESC aggregates were harvested from the
suspension cultures (Susp.Prolif) at day 4 (96 h), as this would
ensure that the cells were still in the exponential growth phase
(Cormier et al., 2006). The aggregates were dissociated into sin-
gle cells, and then inoculated into subsequent suspension culture
systems at a cell density of 3.75 104 cells/mL (Cormier et al.,
2006). Following this same procedure every 4 days, ESCs were
carried through seven passages (P1P7) for a total of 28 days of
culture. Static cultures (Stat.Prolif), which were run simultane-
ously, went through 13 passages over the same 28 days.
Through daily cell counts of the suspension cultures, viable
cell density and cell viability were assessed. ESC growth kinet-
ics over the first two passages were found to be consistent with
those typically seen for ESCs cultured under suspension con-
ditions (Cormier et al., 2006). However, the peak density by
the third passage was diminished (Fig. 1A). During the first
three passages, cell loss was observed when dissociating the
aggregates and the passaging protocol was therefore modified
slightly from the fourth passage on. Instead of dissociating the
ESC aggregates enzymatically as a pellet, the pellet of aggre-
gates was transferred to a sterile culture dish and then dissociated
using Trypsin/EDTA. Following this modification, the cultures
again reached normal peak densities (Fig. 1A). Over the course
 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432 425

Fig. 1. Serial passaging of embryonic stem cells in suspension culture. (A) Cell densities and viability over the course of seven passages of ESCs in suspension.
Cultures were inoculated at 3.75 104 cells/mL and agitated at 100 rpm. (B) Morphology of the suspension cultures remained consistent over the course of the
28-day culture period. Scale bars: 200 m.

of the long term passaging, the morphology of the ESC aggre-
gates remained consistent (Fig. 1B). Further, the viability of
the cultures remained greater than 85% for the duration of the
experiment (Fig. 1A).
The cumulative expansion of the ESCs achieved through
serial passaging of the suspension bioreactors (Susp.Prolif) was
2.5 billion-fold over the 28-day culture period, with a mean
doubling time of 14.5 0.2 h for passages 1, 3 and 7. The mean
doubling time for the static cultures was 15.0 1.7 h over the
13 passages. Although the cumulative expansion in suspension
was lower than that observed for the static cultures (Stat.Prolif),
of approximately 76.4 trillion-fold over the same period of time,
it should be noted that the static cultures were passaged twice as
many times over the 28-day period. On a per passage basis, the
suspension culture bioreactors yielded a greater ESC expansion,
of approximately 31-fold over 4 days, compared to the static
cultures, which yielded an expansion of approximately 10-fold
over 2 days. Although the static culture flasks offer a greater
efficiency for ESC expansion, it should be highlighted that 37
static culture flasks would be required to obtain the same total
cell number obtained over one passage in one bioreactor. For
clinical applications, ESC expansion in bioreactors is therefore
advantageous as labour and time requirements are drastically
decreased and culture-to-culture variability is avoided. In addi-
tion, as the risk of contamination and errors increases with the
number of passages, the reduced number of passages required
in suspension cultures is also advantageous.
3.2. Oxygen uptake rates of ESCs in suspension bioreactors
To determine the oxygen consumption rate of the sus-
pension culture ESCs, a probe was inserted into a modified
426 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432
250 mL suspension system with no head space and the con-
centration of dissolved oxygen was measured over a period of
45 min. The oxygen consumption rate of the suspension cul-
ture murine ESCs (Susp.Prolif) was found to be approximately
4.0 1017 mol O2 /cell s, with no statistical difference between
a single cell suspension of ESCs and intact ESC aggregates.
This value is comparable to the average range of consumption
rates reported in literature for mammalian cell types (Kallos
and Behie, 1999). At this consumption rate, the maximum cell
density that could be supported in the bioreactor system was
calculated to be 3.75 106 cells/mL, using equations described
previously (Kallos and Behie, 1999). Therefore, at the peak cell
density of approximately 1.0 106 cells/mL observed on day
4 of each passage in the current study, the oxygen supply was
deemed adequate. Interestingly, the similarity in consumption
rates between the single cell suspension of ESCs and intact ESC
aggregates may suggest that the ESC aggregates are packed
loosely, facilitating oxygen and nutrient mass transfer (i.e. no
mass transfer limitations).
3.3. ESC aggregates form colonies and embryoid bodies
As a means of assessing pluripotency of d28 suspension
culture ESCs, cells were examined for their capacity to
form new colonies. Cells from the d28 suspension cultures
(Susp.Prolif d28) as well as d28 static cultures (Stat.Prolif
d28) formed new colonies at rates that were not statistically
different from the d0 static culture ESCs used to initiate the
experiments (Stat.Prolif d0) (Fig. 2A). However, d28 suspen-
sion culture ESCs (Susp.Prolif d28) colonized more efficiently
than d28 static cultures (Stat.Prolif d28) with p-values of
0.03 and 0.1 for the biological duplicates respectively. Dishes
contained similar percentages of colonies with undifferentiated
morphology (static d0 2.41%, static d28 1.59%, suspension
d28 1.68%). Long-term static (Stat.Prolif) and suspension
(Susp.Prolif) cultures also retained the ability to form EBs
in hanging drops (Fig. 2B) and in methylcellulose (Fig. 2C),
at rates that were not statistically different from the static d0
cultures.
3.4. ESC aggregates express markers of the
undifferentiated state
Expression levels of four characteristic ESC proteins were
examined through FACS analysis (Fig. 2D). Cells from day
0 static cultures (Stat.Prolif d0) were used as a control and
compared to day 4 suspension (Susp.Prolif d4) and day 28 static
(Stat.Prolif d28) and suspension culture (Susp.Prolif d28) cells.
Cells from suspension cultures (Susp.Prolif) were assessed
on the fourth day of a given passage as this would assure that
they were in the exponential growth phase. Overall, Oct-4 and
Nanog levels remained high, greater than 90%, for all cultures.
SSEA-1 levels decreased in static cultures (Stat.Prolif) from
99.9% at d0 to 87.3% at d28. However, the levels of SSEA-1
remained high in the cells from the suspension culture ESCs
(Susp.Prolif) at 96.7% by d28. ALP levels declined from 68.7%
to 7.8% in the static cultures (Stat.Prolif) over the course of
13 passages, but decreased to a lesser extent in the suspension
cultures (Susp.Prolif d28, 27.8%).
Although 99% of the cells in the static cultures (Stat.Prolif)
at day 28 still expressed Oct-4 as quantified by FACS anal-
ysis, gene expression levels were down-regulated to 20 7%
compared to static controls from d0, as measured by quanti-
tative PCR (Fig. 2E). However, Oct-4 gene expression levels
remained high in suspension cultures (Susp.Prolif) through-
out the duration of the experiment. Nanog expression levels
increased slightly in the long-term passaged suspension cultures
(Susp.Prolif) as compared to the initial ESC population (p < 0.1).
Rex-1 expression levels remained unchanged, whereas ALP lev-
els decreased after 28 days in the static culture (Stat.Prolif)
as well as in suspension (Susp.Prolif). Further, cells from the
suspension cultures (Susp.Prolif) did not express detectable lev-
els of mesodermal markers, such as Eomes and BMP-4, and
Brachyury was expressed at lower levels in the suspension cul-
tures (Susp.Prolif) than in static cultures (Stat.Prolif) (Fig. 2F).
Markers for early ectodermal (NF68, FGF-5) and endodermal
(CK18, AFP) differentiation were expressed only in long-term
static cultures (Stat.Prolif). The general marker for early differ-
entiation, 5T4, was expressed at low levels in our ESC line as
we have shown previously (Cormier et al., 2006). This expres-
sion, however, was not seen after long term culture in suspension
(Susp.Prolif). The absence of all early differentiation markers in
the suspension culture aggregates strongly suggests that suspen-
sion culture supports the expansion of highly undifferentiated
ESC cultures.
3.5. ESC aggregates retain the capability to differentiate
into distinct lineages in vitro
A true characteristic of stem cells is their ability to differ-
entiate into functional progeny of a particular lineage. ESCs
specifically differ from other stem cells in their capacity to dif-
ferentiate into all three germ layers. Thus, we performed an in
vitro differentiation study comparing long-term expanded ESCs
from static and suspension cultures.
On day 28 of the expansion study, ESCs were induced to dif-
ferentiate into the cardiac, osteoblast, neural and chondrocyte
lineages by applying the hanging drop method (zur Nieden et
al., 2004). Spontaneous differentiation to cardiomyocytes was
carried out in regular ESC medium without LIF. After 9 days,
clusters of spontaneously beating cardiomyocytes appeared in
the EBs (Fig. 3A). The number of EBs containing beating car-
diomyocytes was counted and calculated as percentage of the
total number of EBs plated. It has been found that R1 ESCs have a
considerably lower potential to differentiate spontaneously into
contracting cardiomyocytes than other ESC lines, such as D3,
CCE or CM7/1 (Zandstra et al., 2003). In the current study, only
8.3 1.76% of EBs generated from static controls (Stat.Prolif)
developed contracting clusters. However, this percentage was
significantly higher in spontaneously differentiated cells from
the duplicate suspension cultures (Susp.Prolif): A (14.7 2.41,
p < 0.1) and B (17.7 2.79, p < 0.01). Hence, cells from the sus-
pension cultures seemed to have retained a higher capacity to
differentiate into cardiomyocytes, a finding that was supported
 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432 427

Fig. 2. Pluripotency markers are preserved in suspension culture aggregates. (A) CFC assay. ESCs from suspension culture aggregates (Susp.Prolif) form new
colonies with a slightly higher efficiency than static controls (Stat.Prolif) of the same age. (B and C) Suspension ESCs maintain the capacity to form EBs through
hanging drops. (D) Pluripotency markers Oct-4 and Nanog persist to be expressed in the suspension culture ESCs (Susp.Prolif) as revealed by FACS analysis. ALP
levels drop over time in culture, however not as fast in suspension as in static controls. (E) Quantitative real-time PCR analysis for pluripotency marker genes. Values
represent expression levels normalized to GAPDH of n = 3 independent experiments S.D. standardized to static control values at d0. (F) RT-PCR for pluripotency
and early differentiation genes. * p < 0.1; ** p < 0.01; *** p < 0.001.

by expression levels of the /-cardiac myosin heavy chain
gene (Fig. 3B). Gene expression levels were 1.4 0.12-fold and
1.66 0.29-fold up-regulated in EBs from the duplicate suspen-
sion cultures (Susp.Prolif A and B) respectively compared to
EBs from static controls (Stat.Prolif) (p < 0.01 and p < 0.001).
We further examined the ability of the bioreactor-
expanded ESCs to undergo induced directed differentiation into
osteoblasts. Osteogenic differentiation was carried out accord-
ing to zur Nieden et al. (2003) using vitamin D3 as an inducer.
After 25 days of culture, von Kossa staining, which is indicative
of mineralized cells, showed that embryoid bodies differentiated
from suspension culture ESCs (Susp.Prolif) contained a similar
number of osteoblasts as static controls (Stat.Prolif) (Fig. 3C).
This was further supported through subsequent image analy-
428 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432

Fig. 3. In vitro differentiation into mesodermal lineages. (A) Embryoid bodies containing clusters of spontaneously beating cardiomyocytes were counted in all
three experimental groups on day 10 of differentiation. (B) Embryoid bodies generated from suspension aggregates (Susp.Prolif) contained a higher percentage
of cardiomyocytes, which was confirmed by quantitative expression analysis for the cardiomyocyte marker gene alpha/beta-cardiac myosin heavy chain. (CG)
Differentiation into the osteoblast lineage was induced with 1,25-OH2 vitamin D3 . (C) von Kossa staining confirmed the presence of mineralized calcium after 4
weeks of differentiation. Scale bar: 100 m. (D) Image analysis for mineralized cells was performed on pictures taken in (C). (E) Calcium content of the cultures. (F)
ALP activity of the cultures. (G) Quantitative expression analysis for the bone marker genes osteocalcin (OCN) and bone sialoprotein (BSP). None of these assays
showed a significant difference in the potential of suspension culture vs. static control ESCs to differentiate into the osteogenic lineage. (H and I) Chondrogenic
differentiation was carried out with BMP-2. Alcian Blue staining showed increased presence of matrix proteoglycans in static controls (Stat.Prolif) and suspension
culture aggregates (Susp.Prolif) as compared to cells cultured in medium without chondrogenic supplements (Control). Scale bar: 0.5 cm. (I) Quantitative PCR
results point to increased chondrogenesis in suspension aggregates (Susp.Prolif). All quantitative expression values represent means S.D. of three independent
experiments and were normalized to GAPDH expression. Static control values were set as 1. * p < 0.1; ** p < 0.01; *** p < 0.001.

sis for black mineralized areas on the photomicrographs of the
von Kossa stains (Fig. 3D). Calcium content and ALP enzyme
activity were also used to measure the degree of mineraliza-
tion. Again, neither of these tests showed a significant difference
in osteoblast generation from the suspension (Susp.Prolif) and
static control cultures (Stat.Prolif) (Fig. 3E and F). Moreover,
expression levels of the bone marker genes osteocalcin and bone
sialoprotein in the differentiated cultures generated from suspen-
sion cultures (Susp.Prolif) were comparable to those from static
controls (Stat.Prolif) (Fig. 3G).
In contrast, suspension culture ESCs (Susp.Prolif) showed
a greater potential to differentiate into the chondrocyte lineage
when induced with BMP-2, TGF1 , ascorbic acid and insulin.
EBs generated from d28 suspension ESCs (Susp.Prolif) were
stained with Alcian Blue on day 32 of differentiation, a time
where they contain fully mature chondrocytes (zur Nieden et al.,
2005). A spontaneously differentiated control was included and
a representative Alcian Blue stain is shown in Fig. 3H. Staining
was significantly darker in cells treated with chondrogenic sup-
plements. Moreover, EBs made from suspension culture cells
(Susp.Prolif) contained reproducibly higher amounts of chon-
drocytes, as judged from the darker Alcian Blue stain and further
determined through expression levels of collagen type II, a
gene exclusively expressed by mature chondrocytes (Fig. 3I).
Compared to the static control (Stat.Prolif), aggrecan expres-
sion levels were 1.51 0.27 and 1.91 0.04-fold up-regulated
in EBs from the duplicate suspension cultures (Susp.Prolif) A
and B respectively (p < 0.001).
As neural differentiation is known to be a default dif-
ferentiation of ESCs, it was not surprising that suspension
(Susp.Prolif) and static control (Stat.Prolif) ESCs retained the
capability to differentiate into neurons and astrocytes after 28
 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432 429

Fig. 4. In vitro differentiation into neural lineages. Differentiation was induced according to the lineage selection protocol by Okabe et al. (1996). (A) Mature neurons
and glia, which stain positive for neurofilament 200 kDa and GFAP, respectively, can be detected after 28 days in culture. Scale bar: 10 m. (B) ESCs from suspension
aggregates (Susp.Prolif) differentiated into the neuronal lineage with a similar rate as static culture ESCs (Stat.Prolif) as revealed by quantitative PCR, n = 3 S.D.
Static control values were set as 1.

days of expansion. Positive immunostaining for neurofilament
200 kDa and GFAP allowed for the conclusion of successful
differentiation with comparable outcomes between cells from
the two culture systems (Fig. 4A). When normalized to the
static control (Stat.Prolif), expression levels of the neuronal
marker NF68 kDa in both suspension ESC cultures (Susp.Prolif
A 1.05 0.1 and Susp.Prolif B 1.17 0.2 n-fold expression),
remained statistically the same as static controls. The same was
true for the astrocyte marker GFAP (Susp.Prolif A 0.98 0.06
and Susp.Prolif B 1.02 0.03 n-fold expression), which was
also normalized to the static control levels (Fig. 4B).
3.6. ESCs from suspension culture aggregates form all
three germ layers in vivo
After 28 days of expansion, ESCs from suspension (Susp.
Prolif) and static control (Stat.Prolif) cultures were trypsinized
into separate single cell suspensions and 2.5 105 cells
from each were injected into the inner thigh skin fold of six
2-month-old SCID beige mice. Further, static control cells
(Stat.Prolif) were induced to differentiate into embryoid bodies,
using hanging drops, and the day 4 EBs were also injected, as
a negative control (Stat.Diff d4). After 14 days, teratomas were
excised and weighed (Fig. 5A and B). Teratomas formed from
suspension culture ESCs (Susp.Prolif) were slightly but sig-
nificantly smaller than tumors from static control (Stat.Prolif)
cultures. Differentiated cells from embryoid bodies (Stat.Diff
d4) did not form teratomas in 50% of the cases and when they
did, the teratomas were significantly reduced in size (Fig. 5A
and B). Teratomas from static control ESCs (Stat.Prolif) as
well as from suspension culture ESCs (Susp.Prolif) contained
tissues representative of all three germ layers (Fig. 5CH). On
the contrary, cells from day 4 embryoid bodies (Stat.Diff d4)
formed unorganized tissue structures within major portions
of the teratomas (Fig. 5I and J). The structures most easily
identifiable in the teratomas formed from EBs were ectoderm
derivatives (Fig. 5K) and enormous keratin sheets (data not
shown).
430 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432

Fig. 5. ESCs cultured in suspension form teratomas in vivo comprising all three germ layers. (A) Teratomas photographed in situ 15 days after injection of
2.5 105 cells taken from day 28 static control cultures (Stat.Prolif), day 28 suspension aggregates (Susp.Prolif) and 4-day old EBs formed in hanging drops
from static controls (Stat.Diff). (B) Average weight distribution of teratomas formed in four SCID mice. Differentiated ESCs (Stat.Diff) form significantly smaller
teratomas. (CK) H&E stain of tissue sections. (CE) Teratomas from static control d28 ESCs (Stat.Prolif) contain derivatives from all germ layers. (FH) Teratomas
formed from ESCs cultured in suspension (Susp.Prolif A) also contain representative tissues from all three germ layers. (IK) Differentiated ESCs from day 4 old
embryoid bodies do not form organized teratomas. Although ectoderm derivatives could be found (K), the majority of the teratoma contains unstructured tissue (I
and J). Additionally, these teratomas contain huge portions of keratin sheets. () Endoderm; ( ) mesoderm; () ectoderm.

4. Discussion
Large-scale expansion protocols will be a prerequisite for the
therapeutic application of stem cells. Such procedures have been
developed for hematopoetic stem cells and CD34+ hematopoetic
precursors (Zandstra et al., 1994; Kogler et al., 1998; Eridani et
al., 1998), neural stem and precursor cells (Kallos and Behie,
1999; Gilbertson et al., 2006) and human mesenchymal progen-
itor cells (Baksh et al., 2003). However, embryonic stem cells
(ESCs) have long been thought to agglomerate and initiate dif-
ferentiation when cultured in stirred suspension. Only recently,
our research group along with one other group have reported the
development of effective culture protocols for the expansion of
pluripotent ESCs in stirred bioreactors (Fok and Zandstra, 2005;
Cormier et al., 2006).
Stem cells are defined by two fundamental functional prop-
erties: the ability to (i) generate cells of identical properties
(self-renewal) and (ii) give rise to different cell types (Smith,
2001; Lagasse et al., 2001). In the current study, both of these
attributes were sustained through long term culture of ESCs in
suspension bioreactors. Pluripotency of the ESCs was assessed
in this study through a number of tests, with both the bio-
logical and functional attributes of the cells being considered.
Interestingly, the day 28 suspension ESC cultures (Susp.Prolif
d28) seemed to possess more pluripotent cells compared to
the static controls (Stat.Prolif) that had been cultured for the
same duration. ESCs from suspension cultures (Susp.Prolif), for
example, had higher colony forming efficiencies than the d28
static culture cells (Stat.Prolif). Further, at the end of the experi-
ment, ESCs cultured in suspension (Susp.Prolif) also possessed
higher SSEA-1 and ALP protein expression levels compared
to d28 static controls and had maintained high levels of Oct-4
gene expression, which showed a significant drop in the d28
static controls. Loss of pluripotency in the static culture cells
 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432
(Stat.Prolif) was further confirmed by the presence of early ecto-
dermal and endodermal differentiation markers, which were not
seen in the ESCs cultured in suspension (Susp.Prolif). It is also
interesting to note that the 5T4 marker, found previously to
be an effective general marker for early differentiation (Ward
et al., 2003), was detected in low levels in the d0 static cells
(Stat.Prolif), which were used to inoculate the suspension culture
systems, but not in the d28 suspension culture cells (Susp.Prolif).
These results suggest that the loss in pluripotency over 28 days
observed in the static culture systems did not occur in the suspen-
sion culture systems. We hypothesize that the increased number
of pluripotent cells in the suspension culture system may be
the result of a cell type selection process, whereby the prolif-
eration of undifferentiated ESCs is enhanced, or conversely the
expansion of differentiated cells is impeded, and hence the cell
population is maintained highly pluripotent.
As there are distinct differences between the culture envi-
ronments in the suspension culture systems as opposed to the
static vessels, including the formation of aggregates, exposure
to shear forces from agitation, and homogeneity in the culture
from mixing, we postulate that the culture conditions in the
suspension systems enhance the expansion of undifferentiated
ESCs as compared to the static culture systems. The maximum
shear stress in the Susp.Prolif cultures reached 0.78 Pa, which
is at the top of the range 0.300.75 Pa previously described for
neural precursor cells (Gilbertson et al., 2006). One possible
mechanism for the cell type selection process observed in the
bioreactors (Susp.Prolif) could be shear induced mechanotrans-
duction in the cells. The G protein Ras has been associated with
the regulation of many cellular activities, including progression
through the cell cycle, differentiation and gene transcription, and
in endothelial cells Ras has been found to attenuate STAT3 (Ni et
al., 2003). In ESCs, Ras activation has been observed to increase
during EB formation and has been linked to Nanog downregula-
tion and endoderm differentiation (Yoishida-Koide et al., 2004;
Hamazaki et al., 2004). Further, shear stress and Ras activation
have been found to alter cell response to cytokine signaling (Li et
al., 1996). From these studies, it appears that shear-activated Ras
signaling may be contributing to the differences in proliferation
and differentiation between static (Stat.Prolif) and suspension
(Susp.Prolif) ESC cultures in the current study. Further studies
should be undertaken to better characterize these mechanisms
in the bioreactor ESC cultures.
The functionality of the cells cultured in suspension
(Susp.Prolif) was compared to that of the cells from static
culture (Stat.Prolif) by assessing their capacity for multi-
lineage differentiation. Overall, there were greater efficiencies
for chondrogenesis and generation of spontaneously beating
cardiomyocytes from the cells that were expanded in the suspen-
sion culture system (Susp.Prolif). Outcomes for osteogenesis
and neurogenesis were similar between static and suspension
culture cells. The greater potential for cardiomyocyte and chon-
drocyte generation from the ESCs cultured in suspension could
be explained by the presence of shear within the system. A pre-
vious study by Shimada et al. (2005) found that exposure to low
levels of shear and microgravity, within a suspension bioreac-
tor, influenced gene expression during the early development of
431
zebrafish. They concluded that the cells in the developing heart
were especially sensitive to this type of culture environment
and attributed this characteristic to their susceptibility to mor-
phological changes resulting from the shear forces associated
with blood flow. Similarly, several studies have examined the
mechanobiology of cells comprising skeletal tissues in order to
determine the effect of mechanical/physical conditions on osteo-
and chondrogenesis (Carter et al., 2004; Mullender et al., 2004;
Carter et al., 1998). Overall, it has been found that the cell type
generated during differentiation of skeletal progenitor or stem
cells is affected by the magnitude, type and orientation of extra-
cellular mechanical forces. In particular, Carter et al. (1998)
found that bone formation occurs in regions of low to moderate
tensile strain and chondrogenesis is promoted in areas of hydro-
static compressive stress. From the results in these studies, we
postulate that although the presence of hydrodynamic shear in a
suspension bioreactor permits the expansion of a highly undif-
ferentiated ESC population, the shear may also predispose the
cells to favor the generation of cell lineages that are sensitive to
mechanical loading, such as cardiomyocytes and chondrocytes.
As in previous work, including the original isolation of ESCs
(Martin, 1981; Evans and Kaufman, 1981; Thomson et al.,
1998), murine ESCs have commonly been used as a model sys-
tem for human ESCs. Compared to human ESCs, murine ESCs
are readily available and are of low cost, making them highly
beneficial to protocol development studies. Although the direct
application of this process to human ESC expansion may not be
possible, the current study provides an important starting point
for future studies in human ESC expansion.
Acknowledgements
We thank Dr. A. Nagy for providing us with the R1 ESC line.
NZN and DER are funded by the Alberta Heritage Foundation
of Medical Research and the Canadian Stem Cell Network. JC is
supported by scholarships from the Natural Sciences and Engi-
neering Research Council of Canada (NSERC) and the Graduate
Studies department at the University of Calgary. MSK is funded
by a grant from NSERC. The authors would like to thank Shi-
Ying Liu and Lesley Davis for maintenance of the SCID mice
and assistance in sectioning the teratomas.
References
Baksh, D., Davies, J.E., Zandstra, P.W., 2003. Adult human bone marrow-derived
mesenchymal progenitor cells are capable of adhesion-independent survival
and expansion. Exp. Hematol. 31 (8), 723732.
Carter, D.R., Beaupre, G.S., Giori, N.J., Helms, J.A., 1998. Mechanobiology of
skeletal regeneration. Clin. Orthop. 355S, S41S55.
Carter, D.R., Beaupre, G.S., Wong, M., Smith, R.L., Andriacchi, T.P., Schurman,
D.L., 2004. The mechanobiology of articular cartilage development and
degeneration. Clin. Orthop. Relat. Res. 427S, S69S77.
Cormier, J., zur Nieden, N.I., Rancourt, D.E., Kallos, M.S., 2006. Expansion of
undifferentiated murine embryonic stem cells as aggregates in suspension
culture bioreactors. Tissue Eng. 12 (11) (Epub ahead of print).
Dang, S.M., Kyba, M., Perlingeiro, R., Daley, G.Q., Zandstra, P.W., 2002. Effi-
ciency of embryoid body formation and hematopoietic development from
embryonic stem cells in different culture systems. Biotechnol. Bioeng. 78
(4), 442453.
432 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432
Dang, S.M., Gerecht-Nir, S., Chen, J., Itskovitz-Eldor, J., Zandstra, P.W., 2004.
Controlled, scalable embryonic stem cell differentiation culture. Stem Cells
22, 275282.
Eridani, S., Mazza, U., Massaro, P., La Targia, M.L., Maiolo, A.T., Mosca, A.,
1998. Cytokine effect on ex vivo expansion of hematopoetic stem cells from
different human sources. Biotherapy 11 (4), 291296.
Evans, M.J., Kaufman, M.H., 1981. Establishment in culture of pluripotential
cells from mouse embryos. Nature 292, 154156.
Fok, E.Y., Zandstra, P.W., 2005. Shear-controlled single-step mouse embryonic
stem cell expansion and embryoid body-based differentiation. Stem Cells
23 (9), 13331342.
Fong, W.J., Tan, H.L., Choo, A., Oh, S.K.W., 2005. Perfusion cultures of human
embryonic stem cells. Bioprocess Biosyst. 27, 381387.
Gilbertson, J.A., Sen, A., Behie, L.A., Kallos, M.S., 2006. Scaled-up produc-
tion of mammalian neural precursor cell aggregates in computer-controlled
suspension bioreactors. Biotechnol. Bioeng. 94 (4), 783792.
Ginis, I., Luo, Y., Miura, T., Thies, S., Brandeberger, R., Geretch-Nir, S., Amit,
M., Hoke, A., Carpenter, M.K., Itskovitz-Eldor, J., Rao, M.S., 2004. Dif-
ferences between human and mouse embryonic stem cells. Dev. Biol. 269,
360380.
Hamazaki, T., Oka, M., Yamanaka, S., Terada, N., 2004. Aggregation of
embryonic stem cells induces nanog repression and primitive endoderm
differentiation. J. Cell Sci. 117 (23), 56815686.
Johansson, B.M., Wiles, M.V., 1995. Evidence for involvement of activin A and
bone morphogenetic protein 4 in mammalian mesoderm and hematopoietic
development. Mol. Cell. Biol. 15 (1), 141151.
Kallos, M.S., Behie, L.A., 1999. Inoculation and growth conditions for high-cell
density expansion of mammalian neural stem cells in suspension bioreactors.
Biotechnol. Bioeng. 63 (4), 473483.
Kallos, M.S., Sen, A., Behie, L.A., 2003. Large-scale expansion of mam-
malian neural stem cells: a review. Med. Biol. Eng. Comput. 41 (3), 271
282.
Kimura, N., Nakashima, K., Ueno, M., Kiyama, H., Taga, T., 1999. A novel
mammalian T-box-containing gene, Tbr2, expressed in mouse developing
brain. Dev. Brain Res. 115, 183193.
Kogler, G., Callejas, J., Sorg, R.V., Wernet, P., 1998. An eight-fold ex vivo expan-
sion of long-term culture-initiating cells from umbilical cord blood in stirred
suspension cultures. Bone Marrow Transplant. 21 (Suppl. 3), S48S53.
Lagasse, E., Shizuru, J.A., Uchida, N., Tsukamoto, A., Weissman, I.L., 2001.
Toward regenerative medicine. Immunity 14, 425436.
Li, Y.S., Shyy, J.Y.J., Li, S., Lee, J., Su, B., Karin, M., Chien, S., 1996. The
Ras-JNK pathway is involved in shear-induced gene expression. Mol. Cell.
Biol. 16 (11), 59475954.
Loken, S.D., Norman, K., Hirasawa, K., Nodwell, M., Lester, W.M., Demetrick,
D.J., 2004. Morbidity in immunosuppressed (SCID/NOD) mice treated with
reovirus (dearing 3) as an anti-cancer biotherapeutic. Cancer Biol. Ther. 3
(8), 734738.
Martin, G.R., 1981. Isolation of a pluripotent cell line from early mouse embryos
cultures in medium conditioned by teratocarcinoma stem cells. Proc. Natl.
Acad. Sci. 78 (12), 76347638.
Martin, I., Wendt, D., Heberer, M., 2004. The role of bioreactors in tissue
engineering. Trends Biotechnol. 22 (2), 8086.
McGee, S.M., 1958. Histochemical methods for calcium. J. Histochem. 6,
2241.
Mullender, M., El Haj, A.J., Yang, Y., van Duin, M.A., Burger, E.H.,
Klein-Nulend, J., 2004. Mechanotransduction of bone cells in vitro:
mechanobiology of bone tissue. Med. Biol. Eng. Comput. 42 (1), 1421.
The author has requested enhancement of the downloaded file. All in-text references underlined in blue are linked to publications on ResearchGate.
Murphy, C.L., Polak, J.M., 2002. Differentiating embryonic stem cells: GAPDH,
but neither HPRT nor beta-tubulin is suitable as an internal standard for
measuring RNA levels. Tissue Eng. 8, 551559.
Ni, C.W., Hsieh, H.J., Chao, Y.J., Wang, D.L., 2003. Shear flow attenuates
serum-induced STAT3 activation in endothelial cells. J. Biol. Chem. 278
(22), 1970219708.
Oh, S.K.W., Fong, W.J., Teo, Y., Tan, H.L., Padmanabhan, J., Chin, A.C.P., Choo,
A.B.H., 2005. High density cultures of embryonic stem cells. Biotechnol.
Bioeng. 91 (5), 524533.
Okabe, S., Forsberg-Nilsson, K., Spiro, A.C., Segal, M., McKay, R.D., 1996.
Development of neuronal precursor cells and functional post-mitotic neurons
from embryonic stem cells in vitro. Mech. Dev. 59, 89102.
Palmqvist, L., Glover, C.H., Hsu, L., Lu, M., Bossen, B., Piret, J.M., Humphries,
R.K., Helgason, C.D., 2005. Correlation of murine embryonic stem cell gene
expression profiles with functional measures of pluripotency. Stem Cells 23,
663680.
Shimada, N., Sokunbi, G., Moorman, S.J., 2005. Changes in gravitational force
affect gene expression in developing organ systems at different developmen-
tal times. BMC Dev. Biol. 5 (1), 10 (ahead of print).
Smith, A.G., 2001. Embryo-derived stem cells: of mice and men. Annu. Rev.
Cell Dev. Biol. 17, 435462.
Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J.,
Marshall, V.S., Jones, J.M., 1998. Embryonic stem cell lines derived from
human blastocysts. Science 282, 11451147.
Wang, Z., Dooley, T.P., Curto, E.V., Davis, R.L., VandeBerg, J.L., 2004. Cross-
species application of cDNA microarrays to profile gene expression using
UV-induced melanoma in monodelphis domestica as the model system.
Genomics 83, 588599.
Ward, C.M., Barrow, K., Woods, A.M., Stem, P.L., 2003. The 5T4 oncofoetal
antigen is an early differentiation marker of mouse ES cells and its absence
is a useful means to assess pluripotency. J. Cell Sci. 116 (22), 45334542.
Wilkinson, D.S., Ogden, S.K., Stratton, S.A., Piechan, J.L., Nguyen, T.T., Smu-
lian, G.A., Barton, M.C., 2005. A direct intersection between p53 and
transforming growth factor beta pathways targets chromatin modification
and transcription repression of the alpha-fetoprotein gene. Mol. Cell. Biol.
25, 12001212.
Yoishida-Koide, U., Matsuda, T., Saikawa, K., Nakanuma, Y., Yokota, T.,
Asashima, M., Koide, H., 2004. Involvement of Ras in extraembryonic
endoderm differentiation of embryonic stem cells. Biochem. Biophys. Res.
Commun. 313 (3), 475481.
Zandstra, P.W., Eaves, C.J., Piret, J.M., 1994. Expansion of hematopoetic pro-
genitor cell populations in stirred suspension bioreactors of normal human
bone marrow cells. Biotechnology (NY) 12 (9), 909914.
Zandstra, P.W., Bauwens, C., Yin, T., Liu, Q., Schiller, H., Zweigerdt, R.,
Pasumarthi, K.B., Field, L.J., 2003. Scalable production of embryonic stem
cell-derived cardiomyocytes. Tissue Eng. 9, 767778.
zur Nieden, N.I., Ruf, L.J., Kempka, G., Hildebrand, H., Ahr, H.J., 2001. Molec-
ular markers in embryonic stem cells. Toxicol. In Vitro 15, 455461.
zur Nieden, N.I., Kempka, G., Ahr, H.J., 2003. In vitro differentiation of embry-
onic stem cells into mineralized osteoblasts. Differentiation 71, 1827.
zur Nieden, N.I., Kempka, G., Ahr, H.J., 2004. Molecular multiple endpoint
embryonic stem cell testa possible approach to test for the teratogenic
potential of compounds. Toxicol. Appl. Pharmacol. 194, 257269.
zur Nieden, N.I., Kempka, G., Rancourt, D.E., Ahr, H.J., 2005. Induction of
chondro-, osteo- and adipogenesis in embryonic stem cells by bone mor-
phogenetic protein-2: effect of cofactors on differentiating lineages. BMC
Dev. Biol. 5, 115.