BI

304 Winter 2015

Lab 4: Soil/ Activated Sludge Bacterial Community Analysis via DNA

Extraction, PCR and ARDRA
(Adapted from: Environmental Microbiology: A Laboratory Manual (Experiment 24), Second Edition, Ian L. Pepper and
Charles P. Gerba, Elsevier Science, 2005; Molecular Microbial Ecology, edited by A. Mark Osborn and Cindy J. Smith.
Taylor & Francis Group, 2005)

Objective: To introduce students to DNA extraction from soil and/or activated sludge bacteria and the
powerful technology known as polymerase chain reaction (PCR) which allows for DNA to be amplified
and analyzed. Analysis of amplified sequences via restriction digestion allows for analysis of the bacterial
community.

Extract DNA from soil or activated sludge bacteria using PowerSoil DNA Isolation Kit
Amplify 16S rRNA bacterial sequences via polymerase chain reaction (PCR)
Verify amplification by gel electrophoresis and SafeGreen staining
Digest amplified 16S rRNA gene with a single restriction enzyme (Hha I or Hae III)
Analyze mixed community restriction digestion patterns by Amplified ribosomal DNA restriction
analysis (ARDRA)

Theory and Significance

The characterization of microorganisms is of essential importance in many fields of microbiology.

Classification, identification and differentiation of microorganisms have traditionally relied on phenotypic
fingerprinting, such as substrate utilization or biochemical production.

With the identification of ribosomal RNA (rRNA) and the genes that code for rRNA (rDNA) as reliable
phylogenetic markers, significant progress in the knowledge and identification of non-cultivable
prokaryotes has been made. Ribosomal RNA is found in all cellular organisms and is highly conserved to
fulfill its role in protein synthesis. rRNA genes are widely used as molecular clocks for the study of
evolution and phylogeny.

The 16S rRNA genes contain many functionally diverse regions, where some sequences are highly
conserved and others are highly varied. The conserved regions are useful in primer design and the hyper-
variable regions are useful in identification as they differ significantly between species and have low
variability within species.

Comparison of Cultural Methods of Detection with PCR

Dilution and plating methodology is still widely used as a technique for the isolation and detection of
bacteria. However, there are distinct advantages of PCR as a detection technology, and also some
disadvantages. Table 1 illustrates these differences. The biggest single advantage of PCR is that the
molecular technique allows for the detection of viable but non-culturable bacteria. However, because PCR
only detects nucleic acid sequences, there is always the possibility that a PCR-positive result occurs when
the organism is not viable. PCR and subsequent sequence analysis does allow for specific identification of
the target organism.

Polymerase chain reaction (PCR) amplification of DNA and RNA (Saiki et al., 1985; Mullis and Faloona,
1987) has become a key protocol in many biological laboratories. This DNA polymerase catalyzed
reaction allows repeated synthesis of specific DNA sequences. A typical cycle involves denaturing the
double stranded DNA into single strands, annealing short oligonucleotide primers to the single strands and
extending the primer sequences using a DNA polymerase to complete the synthesis of strands
complimentary to the original single strands. This cycling is repeated to obtain an exponential increase in
the copies of the original DNA strand.


BI 304 Winter 2015

PCR allows amplification of specific DNA in vitro. During each cycle, the number of copies of template
DNA is theoretically doubled (Figure 1). In practice, 25 cycles of amplification results in approximately a
million-fold increase in the number of DNA copies. The primers are often unique 1825 base long
oligonucleotides, carefully chosen to flank and allow amplification of the target DNA of interest. There
are 3 steps in a PCR amplification cycle: i) template denaturation; ii) primer annealing; and iii) primer
extension. All 3 steps occur at different but defined temperatures and time intervals. These repeating
cycles are performed in an automated, self-contained temperature cycler or thermal cycler.

Table 1 Comparison of PCR and cultural methodology

Issue PCR Technology Cultural Methodology

Reduced time of detection Yes No
Increased sensitivity Yes No
Affected by PCR inhibitory Yes No
substances
Detects only viable organisms No Yes
Detects viable but non- Yes No
culturable organisms
Allows specific identification Yes No

Template denaturation occurs at a temperature greater than the melting temperature of the DNA (e.g.,
94C). Denaturation separates template DNA into single strands allowing subsequent primer annealing,
which occurs at a lower temperature which is typically 5070C. The higher the temperature of annealing,
the more specific the annealing is, and the extent of annealing of mismatched primer to template is
reduced.

The final step of PCR is primer extension. Extension, which involves the synthesis of the DNA strand
complementary to the template, extends from the 5 and proceeds to the 3 end of each primer and results
in a double stranded copy of target DNA from each original single strand. Primer extension typically
occurs at 72C and is catalyzed by the Taq DNA polymerase. Taq polymerase is a high temperature
tolerant enzyme that was originally isolated from Thermus aquaticus.

The reaction components (template, primers, Taq polymerase, dNTPs, and the reaction buffer) are placed
in a sterile microfuge tube, and cycles of PCR amplification is carried out in the thermal cycler.

n cycles = 2n amplification

Figure 1. General schematic illustrating the theoretical amplification of DNA through the polymerase
chain reaction (Photo Source: http://www.obgynacademy.com/)


BI 304 Winter 2015

Steps of the Polymerase Chain Reaction

There are three steps involved in amplification. These are denaturation, primer annealing, and extension.

Assume the double stranded segment to be amplified has the following sequence:

5AGC CGA TTA CGT ATG TTG AAT GTC GGC CCT3

3TCG GCT AAT GCA TAC AAC TTA CAG CCG GGA5

i) Denaturation

Denaturation involves separation of the two strands by heating (95100C), thereby breaking the
hydrogen bonds, which bind the two strands of DNA together. Consequently, the two strands will separate
and we will have:

5AGC CGA TTA CGT ATG TTG AAT GTC GGC CCT3

3TCG GCT AAT GCA TAC AAC TTA CAG CCG GGA5

ii) Primer Annealing

If we then lower the temperature to 55C, the strands will once again hybridize by forming hydrogen
bondsbut if in the same solution we have a high concentration of 2 primers corresponding to the 3 ends
of each strand we will have the following:

5AGC CGA TTA CGT ATG TTG AAT GTC GGC CCT3
3 A CAG CCG GGA5
Primer A

Primer B
5AGC CGA TTA C
3TCG GCT AAT GCA TAC AAC TTA CAG CCG GGA5
Note that the primers anneal on the 3 ends of the template.

iii) Extension

The Taq polymerase can now recognize the primed strands, and attach to the double stranded portion. The
optimum temperature for the Taq polymerase to work is 72C. Thus we have to increase the temperature
from the previous 55C to 72C, and at this temperature the Taq polymerase will start constructing the
complementary strands using the four deoxynucleotides (deoxyadenosine 5-triphosphate (dATP),
deoxycytosine 5-triphosphate (dCTP), deoxyguanosine 5-triphosphate (dGTP), and deoxythymidine 5-
triphosphate (dTTP)) which are also present in the solution We will then have:

5AGC CGA TTA CGT ATG TTG AAT GTC GGC CCT3
3TCG GCT AAT GCA TAC AAC TTA CAG CCG GGA5

5AGC CGA TTA CGT ATG TTG AAT GTC GGC CCT3
3TCG GCT AAT GCA TAC AAC TTA CAG CCG GGA5

The underlined sequences represent the extended or synthesized DNA, which occurs in the 3 direction of
the primers.

If we then repeat the whole process (the cycle) of heating to 95C to separate the strands then lower the
temperature to 55C for the primers to anneal to the complementary strand and then raise the temperature


BI 304 Winter 2015

again to 72C for the Taq polymerase to work, we will see that after every cycle, we will have twice as
many strands as we had in the previous cycle. The thermal cyclers can be programmed to automatically
change the temperatures for a certain number of heating and cooling cycles (usually 25-30 cycles).

The amplified DNA is detected via gel electrophoresis and subsequent SafeGreen staining. SafeGreen,
a non-toxic dye, binds to DNA and fluoresces green when viewed under UV light.

Ribosomal Fragment Length Polymorphism (RFLP) or Amplified Ribosomal

DNA Restriction Analysis (ARDRA)
Ribosomal fragment length polymorphism (RFLP) is a DNA fingerprinting technique based on PCR
amplification of microbial community DNA followed by restriction enzyme digestion and agarose gel
electrophoresis. This technique is also known as amplified ribosomal DNA restriction analysis (ARDRA).
In ARDRA, specific primers targeting conserved domains in rrs genes are used to amplify nearly the full
length of the 16S rDNA. The PCR products are generally a single band of well-defined size, in this case
~1500 bp. Subsequently, one or two tetrameric (4 bp cutters) restriction enzymes are used to digest the
amplified rDNA. When the digestion products are run on an agarose gel (higher percentage for better
resolution), a fingerprint is obtained. In general, PCR-ARDRA is straightforward and highly reproducible.
Important parameters in the analysis are the selection of appropriate primers and restriction enzyme(s).

Fig. 1. Agarose gel (A) and schematic representation (B) of restriction patterns of amplified 16S rDNA
genes from strains of major Streptococcal Species. ARDRA patterns are shown after digestion with Hha I
separated by agarose gel (2%) electrophoresis. The corresponding schematic pattern of Hha I fragments
separated by polyacrylamide gel electrophoresis are shown in (B). Lanes: 1, S. pyogenes HDP 89539T; 2,
S. infantarius HDP 90056T; 3, S. equinus HDP 89506T; 4, S. porcinus HDP 90049T; 5, molecular size
marker; 6, S. pneumoniae HDP 89540T; 7, S. pyogenes HDP 93110; 8, S. constellatus HDP 89579T

Source: Schlegel L et al. J. Clin. Microbiol. 2003;41:657-666


BI 304 Winter 2015

Procedure
Lab 4 Week 1 (February 23-26, 2015) DNA Extraction & PCR

Solutions from the MoBio Soil DNA Extraction Kit (1 set per side of the bench = 4 extractions)
Balance
E.coli bacterial culture for positive control (3 ml per section)
Micropipets (to measure 50 l and 1000 l)
Sterile tips (P100, P1000)
Vortex
MoBio Vortex Adapter
Microcentrifuge
Ice
Ice buckets (1 per bench)
Sterile mirotubes (for backup)

1. DNA Extraction using PowerSoil DNA Isolation Kit see instructions posted on eCentennial as
a separate file. Use ONLY about 0.3 g soil. If you put more soil, there wont be any space for
proper mixing and it may reduce your DNA yield. When measuring, avoid all the bark, foam and
white fertilizer additives found in soil. For activated sludge, the instructor will provide centrifuged
biomass sample for extraction. Use 500 l of the sample.

2. Each student will extract either a soil or a sludge sample.

3. Each side of the bench will have enough reagents for 4 extractions.

4. Clearly label your samples (your name or initials; sample name; section and date) and store
extracted DNA at -20C (freezer) in a labeled box.

Polymerase Chain Reaction (PCR) performed in Class (Feb. 23-26, 2015)

Procedure:

Sterile PCR tubes

PCR machine
Sterile PCR grade/ Millipore water
PCR Reagents Kit

Due to the class size, the instructor will prepare the master mix and distribute 48 l in each tube to each
student. Students are required to add 2 l of their extracted DNA (template) and gently vortex to mix
the contents. Below are the instructions for the preparation of Master Mix:

Universal 16S rRNA bacterial primers:

8F (also known as 16S rRNA For) AGAGTTTGATCCTGGCTCAG
1492R (also known as 16S rRNA Rev) TACGGYTTACCTTGTTACGACTT


BI 304 Winter 2015

Table 1. Master mix composition for the PCR procedure used in this experiment

Component Kit Concentration Volume per Tube (l) Final Concentration

PCR buffer 10X 5 1X

dNTP Mixture 10 mM 1 0.2 mM each

MgSO4 50 mM 1.5 1.5 mM

Primer F 100 M 0.5 1 M

Primer R 100 M 0.5 1 M

Platinum Taq
5U/l 0.5 2.5 unit/ rxn
DNA Polymerase

PCR Enhancer 10X 10 2X

Autoclaved
29
Millipore water

Template DNA 2

Include appropriate positive (E.coli DNA) and negative (sterile distilled water) controls 1 set per
class

Mix the contents by brief GENTLE vortexing.

The PCR conditions were set as follows: initially 94C for 5 minutes; 30 cycles of 94C for 1
minute, 55C for 1 minute, 72C for 3 minutes; followed by final extension of 72C for 8 minutes.
Once the PCR is done, your samples will be transferred to a labeled box and will be stored at -
20C freezer.

Analyze the PCR products next week on a 0.8% agarose gel stained with SafeGreen.


BI 304 Winter 2015

Lab 4 - Week 2 (March 2-5, 2015)

1. Agarose Gel Electrophoresis

Procedure

0.8% agarose gel (2 x 15 well gels per section)

1X TAE buffer 600 ml per section reuse running buffer
SafeGreen stain
100 bp DNA marker
10 l pipet
Sterile 10 l pipet tip
Agarose gel electrophoresis equipment 2 per section
Power Pac 2 per section
Gloves
Small squares of parafilm (for mixing DNA and dye before loading on the gel)

Agarose Gel Electrophoresis

a. Two 0.8% agarose gels will be provided to you (0.8g of Agarose in 100 ml of 1X TAE
buffer). Each section will make 2 gels for the next section.

b. On a small piece of Parafilm, mix 2 l of SafeGreen with 10 l of your PCR product;

mix well by pipeting up and down.

c. Carefully load 10 l of mixture into the well. Take precautions not to pierce the wells. It
is the students responsibility to keep a record of who loaded on which well.

d. Run the gels at 60V (5-8 V/cm) for 30 minutes.

e. View the gels under a UV transilluminator (bring your UV protective goggles).

Photograph the gel.

f. Dispose the used gels in biohazard.

2. Restriction Digestion

Restriction enzymes (or restriction endonucleases) are enzymes that cut double-stranded DNA by making
two breaks, one through each of the phosphate backbones of the double helix. The enzyme does this
without damaging the bases of the DNA.

The first restriction enzyme, HindII, was isolated in 1970 by Daniel Nathans, Werner Arber, and Hamilton
O. Smith. For this and the subsequent discovery and characterization of numerous restriction
endonucleases, the 1978 Nobel Prize for Physiology or Medicine was awarded to the above researchers.
Their discovery led to the development of recombinant DNA technology that allowed, for example, the
large-scale production of human insulin for diabetics using E. coli bacteria. Over 3000 restriction enzymes
have been studied in detail, and more than 600 of these are available commercially and are routinely used
for DNA modification and manipulation in laboratories.

By definition, 1 unit of restriction enzyme will completely digest 1 g of substrate DNA in a 50 l

reaction in 60 minutes.


BI 304 Winter 2015

Caution:
* Keep enzymes on ice when not in the freezer
* Enzyme should be the last component added to reaction
Procedure
Restriction Enzyme (Hha I or Hae III): 10 units/l (1l is used)
10X Buffer: 2.5 l (1X)
Bovine serum albumin (BSA; 50 mg/ml) if using Hha I: 1 l
Sterile filtered Water 10.5 l
DNA: 10 l of PCR product
Total Reaction Volume: 25 l
Incubation Time: 4 - 12 hours (overnight)
Incubation Temperature: 37C
Due to the class size, the instructor will prepare the Restriction Enzyme master mix and distribute 15 l in
each tube to each group. Students are required to add 10 l of their PCR product and mix the content by
flicking" the reaction tube. Do not vortex the reaction.

Incubate at 37C for 4 12 hours (minimum 4 hours; maximum overnight). Your samples will be
transferred to labeled box and kept in the freezer until analyzed by ARDRA (also known as RFLP) next
week.

Lab 4 - Week 3 (March 9 - 12, 2015) Restriction Fragment Length Polymorphism (RFLP)

Two 1.5% gels will be provided to your section. You will prepare two 1.5% agarose gels for the next
section.

On a piece of parafilm, mix 25 l of digested sample and 5 l of SafeGreen. Carefully load 25 l of this
mixture on to the well (It is the students responsibility to keep a record of who loaded on which well)
and run at 100V for 1 to 1.5 hours. Observe the banding pattern under UV light (bring your UV protective
goggles). Photograph the gel.


BI 304 Winter 2015

Lab 4: DNA Extraction, PCR and ARDRA Partial Report (/30)

Objectives
o clearly state the objectives of the experiment \2
o remember to mention type of sample used (soil or sludge)

Signed pre-lab flow charts (Week 1, 2 & 3) \6

Mention any deviations from the procedure

Results \20
o present the results in properly labeled Figures; all Figures should have a Figure #
and a descriptive title
o clearly identify your sample on the figures (label)
o identify which samples are soil and which ones are sludge (label wells)
o compare soil DNA fingerprint with sludge DNA fingerprint and comment on
the community diversity

Overall Formatting \2