Eur. J. Biochem. 270, 24862496 (2003)
FEBS 2003
Ycf1p-dependent Hg(II) detoxification in Saccharomyces cerevisiae
Olivier Gueldry, Myriam Lazard, Florence Delort, Marc Dauplais, Ioana Grigoras, Sylvain Blanquet
and Pierre Plateau
Laboratoire de Biochimie, Unite Mixte de Recherche CNRS-Ecole Polytechnique, Palaiseau, France
In Saccharomyces cerevisiae, disruption of the YCF1 gene
increases the sensitivity of cell growth to mercury.
Transformation of the resulting ycf1 null mutant with a
plasmid harbouring YCF1 under the control of the GAL
promoter largely restores the wild-type resistance to the
metal ion. The protective eect of Ycf1p against the
toxicity of mercury is especially pronounced when yeast
cells are grown in rich medium or in minimal medium
supplemented with glutathione. Secretory vesicles from
S. cerevisiae cells overproducing Ycf1p are shown to
exhibit ATP-dependent transport of bis(glutathionato)-
mercury. Moreover, using b-galactosidase as a reporter
protein, a relationship between mercury addition and the
Metal ions are essential to life. However, some metals, such
as mercury, are harmful, even when present in trace
amounts. Toxicity of mercury arises mainly from its
oxidizing properties. As a metal ion, it induces oxidative
stress or predisposes cells to oxidative stress, with much
subsequent damage to proteins, lipids and DNA [1].
Prokaryotic cells have acquired efcient defences against
mercury [2]. For instance, many bacteria reduce Hg2+ ions
into volatile Hg. Eukaryotes also are exposed to mercury.
An example of the defences of mammals is given by rat liver,
where elimination of Hg involves a glutathione S-conjugate
transporting ATPase (GS-X pump), the canalicular multi-
drug resistance protein (cMRP, also known as cMOAT or
MRP2p) [3].
In the case of lower eukaryotes, much less is known.
However, Saccharomyces cerevisiae possesses a protein, the
yeast cadmium factor (Ycf1p), which shares 24% identity
with rat cMRP [4]. Various glutathione S-conjugates,
including complexes with Cd2+ or As3+, are concentrated
in the vacuole by Ycf1p [57]. Ycf1p also transports into the
vacuole complexes between phosphoribosylaminoimidazole
Correspondence to P. Plateau, Laboratoire de Biochimie,
Ecole Polytechnique, 91128 Palaiseau Cedex, France.
Fax: + 33 1 69 33 30 13, Tel.: + 33 1 69 33 41 81,
E-mail: plateau@botrytis.polytechnique.fr
Abbreviations: GS-X pump, glutathione S-conjugate transporting
ATPase; cMRP, canalicular multidrug resistance protein; MRP1,
multidrug resistance associated protein 1; CDNB, 1-chloro-2,4-
dinitrobenzene; Hg(GS)2, bis(glutathionato)mercury.
(Received 11 March 2003, revised 9 April 2003,
accepted 15 April 2003)
doi:10.1046/j.1432-1033.2003.03620.
activity of the YCF1 promoter can be shown. Altogether,
these observations indicate a defence mechanism involving
an induction of the expression of Ycf1p and transport
by this protein of mercuryglutathione adducts into the
vacuole. Finally, possible coparticipation in mercury tol-
erance of other ABC proteins sharing close homology
with Ycf1p was investigated. Gene disruption experiments
enable us to conclude that neither Bpt1p, Yor1p, Ybt1p
nor YHL035p plays a major role in the detoxication of
mercury.
Keywords: ABC proteins; CDNB; glutathione; mercury;
YCF1.
and glutathione. Such complexes account for the red
pigmentation of ade2 mutants grown under adenine-limit-
ing conditions [8]. The expression of YCF1 is induced by the
presence of cadmium or by limiting levels of adenine [9]. The
response of YCF1 to cadmium is mediated by an up-regu-
lation of Yap1p [9,10], a transcriptional factor which
positively controls the expression of numerous genes
involved in the adaptation to oxidative stress [1113].
A Yap1p-regulatory element was identied in the YCF1
promoter region [10]. Yap1p overproduction leads to a

10-fold increase in YCF1 expression whereas deletion of
YAP1 results in a two- to threefold decrease [9,10].
The homology between the mammalian MRP family
and Ycf1p suggests that Ycf1p might be involved in
mercury detoxication. In favour of this assumption,
arsenate transport in yeast by Ycf1p is inhibited by Hg2+
ions [7].
To assess this idea, we deprived several S. cerevisiae
strains of Ycf1p and followed the growth of these strains in
the presence of HgBr2. The results indicate that a ycf1D
strain is much more sensitive to mercury than the parental
YCF1 strain. In addition, we show that Ycf1p can transport
bis(glutathionato)mercury [Hg(GS)2] in vitro and that YCF1
transcription positively responds to exposure of cells to
mercury.
Ycf1p belongs to subclass II.1 in the family of ABC
proteins in yeast [14]. As ABC proteins often display
overlapping specicities, we wondered whether other
members of subclass II.1: Bpt1p, Yor1p, Ybt1p and the
product of the YHL035c gene were also involved in
the defence against mercury. Systematic disruption of the
corresponding genes and measurement of the toxicity of
Hg2+ ions towards the resulting strains enabled us to
conclude that only Ycf1p plays an important role in
mercury detoxication.

FEBS 2003 Role of YCF1 in mercury detoxication (Eur. J. Biochem. 270) 2487

YHL035c were disrupted with the excisable XURA3KlX

Experimental procedures cassette [17]. YOR1 was disrupted using the excisable
HURA3KlH cassette [17]. YCF1 was disrupted using either
Materials
the TRP1, the HIS3, the XURA3KlX or the kanMX4
HgBr2, HgCl2, HgSO4, sodium arsenate, galactose, genet- cassette. In each case, the selectable marker was amplied
icin disulfate (G418), uracil, adenine, 1-chloro-2,4-dinitro- using oligonucleotide pairs including 4045 nucleotides of
benzene (CDNB), acivicin and o-nitrophenol-b-D- the target gene at their 5-end and 1215 nucleotides of the
galactopyranoside were from Sigma. CdCl2, glucose and marker gene at their 3-end (Table 2). The kanMX4, HIS3
amino acids were from Merck. Phosphocreatine and and TRP1 genes were amplied from plasmids pFA6a-
creatine kinase were from Roche. [35S]Glutathione KanMX4 [18], pRS313 and pRS314 [19], respectively. The
(883 Cimmol)1) was from Perkin Elmer Life Science. XURA3KlX and HURA3KlH cassettes were amplied from
Plasmids pYES2, pMC1871 and pBluescript were from plasmids pXUX and pHUH [17], respectively. The PCR
Invitrogen, Amersham Pharmacia Biotech and Stratagene, products were used to transform S. cerevisiae strain YPALS
respectively. [20]. Depending on the marker used, transformants were
selected either on minimal medium lacking trytophan, uracil
or histidine, or on rich medium supplemented with
Strains and media
200 mgL)1 G418. Disruptions of the target genes were
The S. cerevisiae strains used in this study are listed in conrmed by PCR analysis.
Table 1. Transformations of these strains were performed To disrupt YBT1, a DNA fragment (YBT1-Pro) con-
by the lithium acetate method [15]. Rich YT medium taining 379 base pairs (bp) from the 5-region of this gene
contained 1% yeast extract (Difco), 1% Bacto-tryptone (nucleotides )36 to +343, relative to the initiation codon
(Difco) and either 2% glucose or 2% galactose. Minimal of the gene) was amplied by PCR using chromosomal
MMY medium contained 0.67% yeast nitrogen base DNA from strain DBY2057 as template and YLL048-
(Difco) and 2% glucose. If required, 50 lgmL)1 adenine, CD5 and YLL048-CD3 oligomers as primers (Table 3).
uracil, lysine, tryptophan and/or histidine were added to A fragment (YBT1-End) containing 309 bp from the
the medium, in order to complement auxotrophies. 3-region of the gene (46874995) was amplied using
YLL048-CF5-and YLL048-CF3 oligomers as primers
(Table 3). After digestion by the appropriate restriction
Mercury or CDNB resistance assays
enzymes, the YBT1-Pro fragment was inserted between
To assay drug resistance, cells were grown overnight in YT/ the SacI and SmaI sites of a pBluescript(+)SK vector. The
glucose medium (or minimal MMY medium if the strains YBT1-End fragment was inserted in the correct orientation
harboured a plasmid) until an optical density of
2 at at the HindIII site of the resulting plasmid. Finally, a
650 nm was reached. The cells were then washed and GURA3KlG cassette derived from the pGUG plasmid [17]
diluted in water to obtain samples with optical densities of was inserted into the EcoRI site of the pBluescript plasmid
2, 0.2 or 0.02 at 650 nm. Five lL of each sample were carrying the two YBT1 fragments. The resulting recom-
spotted onto plates containing different concentrations of binant plasmid was eventually linearized by PvuII digestion
the compound under study. Plates were analysed after and used to transform strain YPALS. Transformants were
23 days incubation at 30 C. selected on minimal medium lacking uracil. Integration of
the GURA3KlG marker at the YBT1 locus was veried by
PCR assays.
Gene disruptions
To obtain strains YPDycf1, YPDbpt1, YPDyhl035,
Gene disruptions were carried out by a one-step replace- YPDybt1 and YPDyor1, excision of the XURA3KlX, the
ment method, as described by Baudin et al. [16]. BPT1 and GURA3KlG or the HURA3KlH marker was selected by
plating 106)107 cells onto 5-uoroorotic acid [21]. Loss of
the marker in the resistant cells was veried by PCR.
Table 1. S. cerevisiae strains used in this study.
Cloning of YCF1 on a multicopy plasmid
Strain Genotype Source (ref.)
A pYES2 derivative harboring YCF1 was generated by gap
YPALS MATa trp1-D1 his3D200 [20] repair [22]. For this purpose, a 258 bp fragment from the
ura3-52 ade2-101lys2-801 can
5 region of the gene (between positions )29 and +229) and
DBY2057 MATa ura3-52 [49]
a 261 bp fragment from the 3 region (43114571) were
NY17 MATa sec6-4 ura3-52 [50]
amplied by PCR using chromosomal DNA of strain
YPDycf1 YPALS ycf1D::X This work
DBY2057 as template and oligonucleotides pairs YCF1-Pro
YPDbpt1 YPALS bpt1D::X This work
plus YCF1-200-Pro, or YCF1-After plus YCF1-200-End,
YPDycf1-TRP YPALS ycf1D::TRP1 This work
as primers, respectively (Table 3). The two resulting DNA
YPDycf1-XUX YPALS ycf1D::XURA3KlX This work
fragments were digested by SacI plus SalI, or by SalI plus
YPDycf1-HIS YPALS ycf1D::HIS3 This work
YPDycf1-Kan YPALS ycf1D::kan This work
XhoI, respectively. The rst fragment was introduced
YPDyhl035 YPALS yhl035cD::X This work
between the SacI and SalI sites of a pBluescript(+)SK
YPDyor1 YPALS yor1D::H This work
vector. The second fragment was introduced in the resulting
YPDybt1 YPALS ybt1D::G This work plasmid between the SalI and XhoI sites. Proper construc-
tion was veried by DNA sequencing. The 486 bp
2488 O. Gueldry et al. (Eur. J. Biochem. 270)
FEBS 2003

Table 2. Oligonucleotides used for the disruption of YCF1, BPT1, YHL035c and YOR1. Underlined bases correspond to sequences belonging to the
marker genes. Pairs of oligonucleotides were used to amplify the indicated marker gene by PCR. Then, the target gene was disrupted in vivo by
transformation with the amplied DNA fragment.

Oligonucleotide Sequence Target gene Marker gene

YCF1-His-Pro ACAGTTTGAGAATAAATTAGGGGTATCGTACTACCGTAAAG YCF1 HIS3

CTCTTGGCCTCCTCTAG
YCF1-His-Ter TCATTGACCAAACCAGCCTCCATGCACAGTGAATAGAACAA
TCGTTCAGAATGACACG
YCF1-TRP-Pro ACAGTTTGAGAATAAATTAGGGGTATCGTACTACCGTAAAG YCF1 TRP1
CGGCATCAGAGCAGAT
YCF1-TRP-Ter TCATTGACCAAACCAGCCTCCATGCACAGTGAATAGAACAA
TCCGCAGGCAAGTGCA
YCF1-Kan-Pro ACAGTTTGAGAATAAATTAGGGGTATCGTACTACCGTAAAG YCF1 KanMX4
CGTACGCTGCAGGTCGAC
YCF1-Kan-Ter TCATTGACCAAACCAGCCTCCATGCACAGTGAATAGAACAA
TATCGATGAATTCGAGCTC
YCF1-X-Pro ACAGTTTGAGAATAAATTAGGGGTATCGTACTACCGTAAAG YCF1 XURA3KlX
AAAAATAGGCGTATCACGA
YCF1-X-Ter TCATTGACCAAACCAGCCTCCATGCACAGTGAATAGAACAA
TTCGATGATAAGCTGTCAA
LL15-Px-Pro GTACCACCCAGATTTAAGAACTTTCCTACATTACCAAGTAAA BPT1 XURA3KlX
AATAGGCGTATCACGAG
LL15-Px-Ter CTTCATTAGAATCATCACCTCTTGGTTTACTGTGCAGCATT
TTCGATGATAAGCTGTCAA
YHL35-U-Pro CGCTAGCTCTCACCTATATCTTATTCATGCTGCAACCTCAATGG YHL035c XURA3KlX
AAAAATAGGCGTATCACGA
YHL35-U-Ter GCTTCAAAAGCTCTAGGCCCCCACTGTCACGACACATACTATA
TCGATGATAAGCTGTCAAAC
YOR1-U-Pro CCAGTTAGTATAAATACGGAGGTAGAACAGCTCTCCGCGTGTA YOR1 HURA3KlH
AAAAATAGGCGTATCACGAG
YOR1-U-Ter GAGTATACAATGTGGGTATGCAATTATATCTATCTATGGCACA
TCGATGATAAGCTGTCAAAC

Table 3. Oligonucleotides used for the disruption of YBT1 and for the
construction of the pCF1 plasmid. Underlined bases show the mis-
matches used to create restriction sites.
Oligonucleotide Sequence
Blue [endA1 hsdR17 supE thi-1 recA1 gyrA96 lac (F proAB
lacI q lacZDM15 Tn10); Stratagene]. One plasmid displaying
the expected DNA restriction pattern was selected and
named pCF1. This was used in further studies.

YLL048-CD5 GAAGAGCTCATCAAGGGGGGAAAAGC Construction of a YCF1-lacZ fusion

YLL048-CD3 TTTCCCGGGAAAAGTGTCTATTTTTT
YLL048-CF5 ACGAAGCTTCAGCGTCCATCGACTACA For the construction of a YCF1-lacZ fusion, four DNA
YLL048-CF3 ATCCTCGAGACTAGTCCTTTTTAGA fragments were successively introduced into the centromeric
GTTCAATTTTT plasmid pRS316 [19]: (a) the lacZ gene from plasmid
YCF1-Pro GGTATCGAGCTCCCGTAAAGAACAAG pMC1871 was inserted between the SalI and SmaI restric-
AAAATG tion sites; (b) the kanamycin resistance cassette from
YCF1-After CAGGTCTCGAGTAGTTTCACAGTTT plasmid pMA6-kanMXA [18] was inserted between the
AATTTTC NaeI and NotI sites; (c) the CYCI terminator was amplied
YCF1-200-PRO GCCATCCTGTCGACAATAATCCAATT by PCR, using pYES2 plasmid as template and oligonucle-
CCGCCT otides 5-CCGGAATTCGCATGCGGGCCGCATCATG
YCF1-200-END GCCGCAGTCGACGTGGCCACAGATA TAATTAGTTATG-3 and 5-CGCGGATCCATGCA
AAGTC TGGCCGCAAATTAAAGCCTTCGAGCG-3 as pri-
mers. The amplied fragment was inserted between the SalI
and KpnI sites; (d) a DNA fragment containing 710 bp of
SacIXhoI fragment of the pBluescript derivative contain- the 5 upstream region of YCF1 (from )707 to +3 relative
ing the two YCF1 fragments was inserted between the SacI to the initiation codon of the gene) was amplied by PCR
and XhoI sites of the shuttle vector pYES2. After lineari- using chromosomal DNA from strain YPALS as template
zation by SalI and BalI, the plasmid was used to transform and oligonucleotides 5-GCCGCCGAATTCGCATGCG
strain YPALS. Transformants were selected on plates GCCTATGTGGCCATCTTCTTCTAAAGTATGAAA
without uracil. Plasmids from several transformants were AATA-3 and 5-GCCGCCTCTAGACATTTTCTTGTT
isolated and introduced into Escherichia coli strain XL1- CTTTACGGTAG-3 as primers. The amplied DNA was

FEBS 2003 Role of YCF1 in mercury detoxication (Eur. J. Biochem. 270) 2489
introduced between the SI and XbaI sites. The nal
plasmid was named pRS-promYCF1bgal.
Activity of b-galactosidase was assayed by using o-nitro-
phenol-b-D-galactopyranoside as the substrate. Measure-
ments were made on cells rendered permeable by
chloroform [23].
Secretory vesicles isolation
Secretory vesicles were isolated from strain NY17 trans-
formed with plasmid pYES2 or pCF1, essentially according
to Rebbeor et al. [24]. The only notable difference concerns
cell growth conditions. As strain NY17 grows poorly in
medium containing galactose, cells were rst cultured to
mid-logarithmic phase at 26 C in minimal MMY medium
containing 0.3% casamino acids (Fisher Scientic Labosi)
and 2% glucose. Then, cells were harvested by centrifuga-
tion and resuspended in the same volume of medium
containing 2% galactose. After an overnight incubation at
26 C in this medium, the temperature of the culture was
rapidly raised to 37 C by immersion in a water bath. Cells
were left at this nonpermissive temperature for 2 h and
vesicles were prepared. Protein concentrations in the
isolated vesicles were determined by the Bio-Rad protein
assay, in the presence of 0.1% (w/w) Triton-X100.
Synthesis and transport of Hg(GS)2
The specic radioactivity of c[35S]glutathione was adjusted
to 25 Cimmol)1 by the addition of unlabelled glutathione.
After extraction with acidic ethyl acetate to remove the
antioxidant dithiothreitol from the glutathione sample,
Hg(GS)2 was synthesized by mixing 125 nmol [35S]gluta-
thione with 62.5 nmol HgBr2 in 100 lL 20 mM ammonium
acetate pH 8.2. After a 20 min incubation at room
temperature, the reaction was complete and the glutathione
conjugate was puried by reverse-phase HPLC on an
Alltech C18 column (Alltima 5 lm, 150 3.2 mm) devel-
oped isocratically with a mobile phase consisting of 0.05%
(v/v) acetic acid, at a ow rate of 0.4 mLmin)1. Peaks were
detected according to the absorbance at 214 nm. Radio-
activity was found in a single peak with a retention time of
13.5 min. The retention times of glutathione, Hg2+ ions and
Hg(GS)2, as measured in separate experiments, were 4.5, 8.1
and 13.5 min, respectively. Hg(GS)2 in the peak collected
at 13.5 min was identied by mass analysis on a triple
quadripole mass spectrometer (VG Quattro II, Micromass,
UK). Positive electrospray spectrum indicated a pseudo
molecular ion at m/z 811818. The isotopic distribution
was characteristic of a species containing a single Hg atom.
Between 60 and 65% of the initial radioactivity brought by
the [35S]glutathione sample was recovered in the Hg(GS)2
complex.
[35S]Hg(GS)2 uptake in the secretory vesicles was
followed by a rapid ltration method [25]. Briey, secretory
vesicles were suspended in TB buffer (10 mM Tris/Hepes
pH 7.0, 250 mM sucrose, 20 mM KCl, 5 mM dithiothreitol)
to obtain a nal protein concentration of 810 mgmL)1. depend on the presence of a functional glutathione-S
Transport was initiated by mixing 20 lL of the vesicle
suspension with 80 lL TB buffer containing 12.5 mM
phosphocreatine, 100 lgmL)1 creatine kinase, 12.5 mM
MgCl2, 6.25 mM ATP, 0.65 mM acivicin, and 12 lM
[35S]Hg(GS)2. For uptake measurements without ATP,
the nucleotide was replaced by NaCl (10 mM) in the
reaction mixture. After incubation at 37 C for various
times, the uptake was stopped by the addition of 2 mL ice-
cold TB buffer, followed by rapid ltration through
nitrocellulose lters (0.45 lm pore size, Schleicher and
Schuell). The lters were washed twice with 5 mL TB
buffer, and the radioactivity retained on the lter was
measured by liquid scintillation counting. Rates of trans-
port are given in pmol Hg(GS)2 per min and per mg of
protein in the vesicles.
Results
Disruption of the YCF1 gene
To assess a possible relationship between YCF1 and the
resistance of S. cerevisiae to mercury, the YCF1 gene of
strain YPALS was disrupted by insertion of a TRP1
cassette. Preliminary experiments in rich medium showed
that the resulting ycf1D::TRP1 strain was more sensitive
to mercury than the parental type. However, the growth
of the ycf1D strain displayed improved resistance to
CDNB, a GS-X pump substrate [26]. The YCF1 and
ycf1D::TRP1 strains could grow in the presence of 30 lM
and 45 lM CDNB, respectively (Fig. 1). This resistance
was unexpected because Ycf1p had been reported to
mediate the vacuolar transport of S-(2,4-dinitrophe-
nyl)glutathione, a compound resulting from the conjuga-
tion of CDNB with glutathione [5,6]. Therefore, we
suspected that insertion of the TRP1 marker in the
chromosome of the trp1 strain YPALS, rather than
disruption of YCF1, was in fact responsible for the
improved resistance of the ycf1D::TRP1 strain to exposure
to CDNB. Indeed, because CDNB inhibits a tryptophan
transporter [27], it was possible that hypersensitivity to
CDNB of a trp1 cell, like YPALS, actually resulted from
tryptophan starvation. In agreement with this idea, we
established that transformation of YPALS with a plasmid
harbouring TRP1 (pRS314) allowed growth in the
presence of 45 lM CDNB (Fig. 1). Moreover, an increase
in the tryptophan concentration in the medium from 50 to
100 lgmL)1 gave YPALS the capacity to grow in the
presence of 40 lM CDNB.
To establish safely the role of Ycf1p in the detoxication
of mercury, further disruptions of YCF1 in YPALS were
achieved using either the HIS3, the kanMX4 or the URA3Kl
marker. A disruption without marker was also obtained by
popping out the URA3Kl gene after disruption of the YCF1
locus. All of the latter ycf1 mutants displayed the same
sensitivity to CDNB as the parental strain YPALS. This
result conrmed our assumption that insertion of TRP1 by
itself had caused higher resistance to CDNB of the strain
YPALS. The lack of involvement of YCF1 by itself in
CDNB detoxication deserves some discussion. Indeed, this
behaviour contrasts with that reported by Li et al. [5].
However, recent data establish that CDNB toxicity does not
transferase [28]. Such a result supports the idea that
detoxication of CDNB by yeast does not require forma-
tion of CDNBglutathione adducts and tends to exclude a
participation of Ycf1p.
2490 O. Gueldry et al. (Eur. J. Biochem. 270)
FEBS 2003

Fig. 1. Eect of CDNB on various yeast strains. Cells were grown overnight in liquid minimal MMY/glucose medium until an optical density of
2
at 650 nm was reached. Then, cells were washed and diluted in water to obtain samples with optical densities of 2, 0.2 or 0.02 at 650 nm. Five lL of
these dilutions were spotted on YT/glucose plates containing dierent CDNB concentrations. Plates were incubated at 30 C for 3 days.

Relationship between YCF1 and sensitivity to mercury

Table 4. Eect of mercury on the growth of strains YPALS (YCF1) and
The resistance of the ycf1 mutants to mercury was assayed
YPDycf1 (ycf1D) as a function of culture conditions. Cells were grown
on YT-glucose plates containing various concentrations
overnight in liquid YT/glucose medium until an optical density of
2
of HgBr2 (Table 4). Whatever the marker used for gene
at 650 nm was reached. Then, cells were washed and diluted in water to
disruption, the ycf1D strains stopped forming colonies when
obtain samples with optical densities of 2, 0.2 or 0.02 at 650 nm. Five
the HgBr2 concentration in the medium was > 40 lM. The
lL of each of these dilutions were spotted on plates corresponding to
parental strain YPALS still grew in the presence of 350 lM
various culture conditions and containing dierent HgBr2 concentra-
HgBr2. Examples of plates grown in the presence of 0, 20, 60 tions. Indicated in the table are the maximal mercury concentrations
and 350 lM HgBr2 are shown in Fig. 2A. Similar results for which some growth could still be detected after a 3 day incubation
were obtained using HgCl2 or HgSO4 instead of HgBr2 at 30 C.
(data not shown). We concluded that disruption of YCF1
was sufcient to cause an enhanced sensitivity to mercury. Mercury threshold (lM)
To conrm the involvement of Ycf1p in the resistance of
S. cerevisiae to HgBr2, the ycf1D::HIS3 strain was trans- Culture YPALS YPDycf1
formed either with plasmid pCF1, harbouring the YCF1 conditionsa (YCF1) (ycf1D)
gene under the control of the GAL promoter, or with
YT 400 40
control plasmid pYES2. Overexpression of the pCF1-borne
MMY 0.7 0.4
YCF1 gene was ensured by the presence of galactose. We MMY + all L-amino acids 0.7 0.4
found that the presence of pCF1 restored a great part of the except His and Cysb
wild-type level resistance to HgBr2. Growth could be MMY + L-histidine (2 mM) 6 4
detected in the presence of up to 350 lM HgBr2. The MMY + L-cysteine (2 mM) 800 400
control plasmid pYES2 had no effect (Fig. 2B). Using YT/ MMY + L-cystine (1 mM) 10 5
glucose plates on which expression of the cloned YCF1 gene MMY + reduced glutathione (30 lM) 20 2
is repressed, the ycf1D::HIS3 strain transformed with pCF1 MMY + reduced glutathione (0.8 mM) 300 5
became only slightly more resistant to mercury (growth was MMY + oxidized glutathione (15 lM) 1 0.7
measurable in the presence of up to 60 lM HgBr2) than the MMY + BSA (10 mgmL)1) 80 80
strain harbouring control plasmid pYES2 (growth up to
40 lM HgBr2). a
In these experiments, MMY medium was systematically supple-
The experiments shown above were performed in a his mented with 50 lgmL)1 of adenine, uracil, lysine, tryptophan and
context. Because some data in the literature indicate that histidine. b All L-amino acids were added at a concentration of
inhibition of yeast growth by metals such as copper, cobalt 2 mM except L-tyrosine (0.3 mM).

FEBS 2003
Fig. 2. Eect of HgBr2 on the growth of various ycf1D mutants. Cells were grown overnight in MMY/glucose medium until an optical density of
2
at 650 nm was reached. Then, cells were washed and diluted in water to obtain samples with optical densities of 2, 0.2 or 0.02 at 650 nm. Five lL of
these dilutions were spotted on YT/glucose (A) or YT/galactose (B) plates containing dierent HgBr2 concentrations. Plates were incubated at
30 C for 3 days.
or nickel can be markedly enhanced upon histidine
auxotrophy [29], we compared the resistance thresholds
to mercury of a couple of his+ and his strains
[YPALS(pRS313) and YPALS]. Toxicity of the metal did
not vary with histidine auxotrophy. Thus, we conclude
that there is no relationship between histidine metabolism
and mercury toxicity, as already reported in the cases
of cadmium and lead [29].
Unique role of Ycf1p in the defence against mercury
YCF1 belongs to an ABC protein family (subclass II.1)
composed of ve ORFs sharing signicant sequence and
topology homologies [14]. We wondered whether the
products of these ORFs could also be involved in mercury
detoxication. The YKR103w-YKR104w locus, composed
of two coding sequences corresponding to two parts of an
ABC protein, can be associated with this family. In
S. cerevisiae strains S288C [30] and DBY2057 (data not
shown), the two sequences are separated by a stop codon.
Because the functional signicance of such an abnormal
locus is not yet understood, we did not include YKR in our
studies. The other four genes (YOR1, BPT1, YBT1,
YHL035c) were disrupted with the help of an excisable
URA3Kl marker. Strains yor1D, bpt1D, ybt1D or yhl035cD
were nally obtained by removing the marker. Growths of
each of these strains were compared with that of the
Role of YCF1 in mercury detoxication (Eur. J. Biochem. 270) 2491
parental strain in the presence of 0800 lM HgBr2 on YT/
glucose plates. Fig. 3 shows the plates obtained in the
presence of up to 200 lM mercury. Whatever the deletion,
each strain kept a sensitivity to mercury identical to that of
the parental strain.
Growth medium and resistance to mercury
In minimal medium (MMY-glucose medium supplemented
with adenine, uracil, lysine, histidine and tryptophan), the
sensitivity of yeast growth to mercury appeared much more
acute than in rich medium. In addition, the difference
between the behaviours of YCF1 and ycf1D strains was less
pronounced in minimal medium. While wild-type and ycf1D
strains grew in rich medium in the presence of up to 400 and
40 lM HgBr2, respectively, these resistance thresholds
dropped to 0.7 and 0.4 lM in minimal medium.
To search for the origin of the variable resistance in rich
or minimal medium, toxicity tests were assayed in minimal
medium supplemented with several compounds present
in rich medium. A rst candidate was histidine. Addition of
2 mM of this amino acid (the concentration present
in rich medium, according to the data given by Difco,
http://www.bd.com/industrial/difco/manual.asp) slightly
increased the resistance thresholds of the two YCF1 and
ycf1D strains, up to 6 and 4 lM HgBr2, respectively. This
protective effect may be explained by a complexation of
2492 O. Gueldry et al. (Eur. J. Biochem. 270)
Fig. 3. Eect of HgBr2 on the growth of ycf1D, bpt1D, yor1D, yhl035cD and ybt1D yeast strains. Cells were grown overnight in YT/glucose medium
until an optical density of
2 at 650 nm was reached. Then, cells were washed and diluted in water to obtain samples with optical densities of 2, 0.2
or 0.02 at 650 nm. Five lL of these dilutions were spotted on YT/glucose plates containing dierent HgBr2 concentrations. Plates were incubated at
30 C for 3 days.
mercury outside the cells. Next, we assayed the effect of
cysteine. Addition of 2 mM of this amino acid markedly
increased the threshold values, up to 800 and 400 lM
HgBr2, respectively. Formation of dicysteinylmercury [31]
can account for the strong protection afforded by cysteine.
Finally, we examined the effect of the addition of 18 amino
acids (all L-amino acids except His and Cys). Such an
addition did not modify the sensitivity of either YCF1 or
ycf1D strains to mercury (Table 4).
Addition to minimal medium of several sulfur-containing
compounds other than cysteine also reduced the toxicity of
mercury towards S. cerevisiae. The protection was moder-
ate with L-cystine or oxidized glutathione. It was more
pronounced with compounds containing free SH groups,
such as BSA or reduced glutathione (Table 4). The case of
reduced glutathione deserves special attention. Indeed, the
protection afforded by this compound was more pro-
nounced in a YCF1 context than in a ycf1D one. In the
presence of 30 lM reduced glutathione, the YCF1 strain still
grew in minimal medium containing up to 20 lM mercury.
Under the same conditions, the studied ycf1D mutant
stopped growing in the presence of 2 lM mercury. With
0.8 mM glutathione, the threshold values with the YCF1
and ycf1D strains increased to 300 lM and 5 lM HgBr2,
respectively. In each experiment, the threshold values
measured with the YCF1 strain correspond to stoichio-
metries of mercury to glutathione close to 1 : 2. Up to this
stoichiometry value, added mercury is expected to become
fully trapped in an Hg(GS)2 complex. Therefore, we may
conclude that the protection conferred by glutathione in the
YCF1 context stays efcient as far as all mercury is
converted into Hg(GS)2. Moreover, the strong protection

FEBS 2003
associated with the presence of functional Ycf1p strongly
suggests that Hg(GS)2, once in the cell, is transported into
the vacuole. In contrast, the threshold values measured with
cysteine did not depend on the YCF1 context. It is likely that
the very stable dicysteinylmercury species [32] stays outside
the cell or, if imported in the cell, does not exchange with
glutahione to produce Hg(GS)2.
Ycf1p mediates Hg(GS)2 transport in secretory vesicles
To establish that Ycf1p transports mercuryglutathione
adducts, we measured in vitro transport into secretory
vesicles [25]. First, [35S]Hg(GS)2 complexes could be readily
synthesized by incubating HgBr2 in the presence of a
twofold excess of [35S]glutathione. The Hg(GS)2 product
was isolated by HPLC and characterized by MS (see
Experimental procedures). Next, secretory vesicles, isolated
from a S. cerevisiae sec64 mutant strain transformed with
pYES2 or pCF1, were puried and assayed for ATP-
dependent uptake of [35S]Hg(GS)2 (Fig. 4). Vesicles from
cells overproducing Ycf1p accumulated [35S]Hg(GS)2 at a
rate of 6.1 pmolmin)1mg)1, whereas those from cells
transformed with the control plasmid displayed little uptake
of the mercury-glutathione conjugate (< 0.4 pmol
min)1mg)1). In the absence of ATP in the assay, the
transport was abolished. Therefore, we may conclude that
Ycf1p actively transports mercuryglutathione conjugates.
Regulation of YCF1 expression in response to mercury
Exposure of yeast cells to cadmium induces a Yap1p-
dependent expression of the YCF1 gene [9]. Mercury, like

FEBS 2003
Fig. 4. Time course of [35S]Hg(GS)2 uptake in secretory vesicles pre-
pared from NY17 cells transformed with either pYES2 ( , s) or pCF1
(j, h) in the presence (closed symbols) or absence (open symbols) of
ATP. Data correspond to the mean SD of two independent
experiments.
cadmium, triggers an oxidative stress. Therefore, it is
predictable that an induction of YCF1 will also happen in
response to mercury. In order to verify this hypothesis, we
constructed a plasmid, pRS-promYCF1bgal, harbouring a
fusion between the 5 upstream region of YCF1 and the
coding sequence of lacZ. Strain YPALS transformed with
this plasmid was assayed for b-galactosidase activity.
Cells were grown in minimal medium containing 30 lM
glutathione. Under these conditions, resistance against
mercury toxicity depends markedly on the presence of a
functional YCF1 gene. The growth medium also contained
adenine (150 lgmL)1) to avoid YCF1 induction by adenine
starvation [9]. After addition of micromolar amounts of
mercury to the culture, the b-galactosidase activity increased
and reached a maximum value within 100 min (Fig. 5).
With 14 lM HgBr2, the peak activity obtained was 4.5-fold
higher than that measured in the absence of mercury. This
behaviour conrms that the cell has the capacity to adapt to
the toxicity of mercury through induction of the YCF1 gene.
Discussion
Role of Ycf1p in mercury resistance
Ycf1p participates in mercury detoxication in S. cerevisiae.
In rich YT/glucose medium, inactivation of YCF1 leads to a
10-fold increase in sensitivity to HgBr2. The parental strain
still grows in the presence of 400 lM HgBr2 whereas growth
of any of the studied ycf1D strains is inhibited at 40 lM
HgBr2. Now, upon trans expression of the YCF1 gene under
control of the inducible GAL promoter in the ycf1-defective
strain YPDycf1-HIS, a large part of the resistance to
mercury is restored.
Role of YCF1 in mercury detoxication (Eur. J. Biochem. 270) 2493
Fig. 5. Eect of HgBr2 on the b-galactosidase activity in strain
YPALS(pRS-promYCF1bgal). Cells were grown in minimal MMY
medium containing 2% glucose, 30 lM glutathione, 150 lgmL)1
adenine and 200 lgmL)1 geneticin. At time zero, HgBr2 was added to
the culture at nal concentrations of 0 lM (h), 5 lM (j), 10 lM (s) or
14 lM ( ). Data correspond to the mean values standard devia-
tions of two (5 and 14 lM HgBr2) or three (0 and 10 lM HgBr2)
independent experiments.
The detoxifying action of Ycf1p against mercury resem-
bles that against cadmium or arsenite ions [6,7]. Indeed, we
demonstrate an active transport of Hg(GS)2 across the
membrane of secretory vesicles puried from cells over-
producing Ycf1p.
Finally, by using a gene fusion with b-galactosidase, we
show that YCF1 expression responds to the presence of
mercury. In additional experiments (not shown), we veried
that arsenate also stimulates the YCF1 promoter. We
conclude therefore that cadmium [9,10], mercury or arsenate
additions have similar consequences on the activity of the
YCF1 gene. Actually, as already shown with cadmium
[33,34], mercury and arsenate are likely to act through an
increase in cellular reactive oxygen species caused, for
instance, by inhibition of glutathione reductase.
Mechanism of mercury toxicity
A dependence of the sensitivity of S. cerevisiae to mercury
on the composition of the growth medium has been noted
previously [35]. Here, in rich medium, the parental YCF1
strain resists HgBr2 concentrations as high as 400 lM. In
minimal medium, the same strain stops growing in the
presence of 0.7 lM HgBr2. This behaviour is likely to reect
sequestration of mercury by compounds in the rich medium,
as we shall discuss now.
In minimal medium, a large portion of mercury associates
with the cell wall fraction [35,36]. Hg2+ ions can also reach
the cell membrane. There, mercury can be highly toxic
because of the many vital functions carried by this
membrane. As an example, tyrosine uptake by yeast is
inhibited by mercury [37]. The question whether free Hg2+
ions succeed in penetrating inside the cytoplasm is still
2494 O. Gueldry et al. (Eur. J. Biochem. 270)
controversial. Several authors have reported an absence of
Hg2+ ions in the cytoplasm [3840]. On the other hand,
electron microscopic autoradiography of fractionated yeast
cells grown in the presence of 203HgCl2 indicates that
20%
of the mercury bound to the cells becomes internalized [36].
In minimal medium, because of the absence of reacting
compounds, the lifetime of Hg2+ ions may be relatively
long. This property and the capacity of Hg2+ ions to react
with the cell membrane would account for the marked
toxicity of mercury in minimal medium. On the other hand,
the concentration of mercury within the cell is likely to
remain low. As a consequence, contribution of Ycf1p to the
detoxication is expected to remain small. This may explain
why disruption of YCF1 has only a limited effect on the
sensitivity to mercury of yeast cells cultured in minimal
medium.
In rich medium, several compounds can react with free
Hg2+. The resulting mercury derivatives are likely to be
transported through the plasma membrane. For instance,
complexes containing two molecules of glutathione and
one mercuric ion might act as mimics of oxidized
glutathione molecules and be recognized by transporters
of glutathione [41]. Once in the cell, these derivatives
should undergo ligand exchange mechanisms and produce
new thiolmercury complexes including glutathione S-con-
jugates. Eventually, in rich medium, the toxicity of
internalized mercury should become dominant if compared
to that primarily caused by external free Hg2+ ions. By
concentrating intracellular Hg(GS)2 conjugates in the
vacuole, Ycf1p must then play a major role in the
counter-reaction against the toxicity of mercury. Indeed,
in rich medium, disruption of YCF1 renders the yeast cells
hypersensitive to the metal.
If added to minimal medium, reduced glutathione exerts
a strong protective effect on YCF1 cells. With ycf1D cells,
the protection is small. In other words, addition of
glutathione to minimal medium confers to the wild-type
cells a behaviour similar to that observed in rich medium. In
agreement with the discussion above, we may propose that,
in the presence of glutathione, Hg(GS)2 conjugates are
imported inside the cell and that, once in the cytoplasm,
these conjugates are concentrated by Ycf1p across the
vacuole membrane. In a ycf1D mutant, internalized
Hg(GS)2 would stay in the cytosol and harmful mercury
thiol complexes would be allowed to accumulate through
exchange mechanisms.
Possible additional defences against mercury
Within subclass II.1 ABC proteins, Ycf1p appears to play a
dominant role in the protection of yeast against mercury.
Similar conclusions regarding cadmium have been presen-
ted [9]. In the latter study, some transport properties of
Bpt1p could be detected upon deletion of YCF1 [9].
Additional mechanisms can help S. cerevisiae to ght
against the toxicity of metals. (a) Recent proteomic
analyses highlighted the importance of glutathione and of
the thioredoxin/thioredoxin reductase system in the defence
against cadmium [42,43]. Upon exposure to this metal,
most of the sulfur assimilated by the cells is converted into
glutathione [43]. Similar responses are likely to occur
in mercury and arsenite tolerance. In the same idea, a

FEBS 2003
Yap1p-dependent induction of GSH1 in the presence of
mercury has been recently demonstrated [44]. Since
the product of GSH1 (c-glutamylcysteine synthetase) is
involved in glutathione biosynthesis, induction of this gene
by mercury is likely to counterbalance the depletion of
cellular glutathione by the metal. Stimulation by heavy
metals of the expression of the human c-glutamylcysteine
synthetase has also been reported [45]. In addition, an
induction of the MRP1 gene by cadmium and arsenite was
observed [45]. It is likely that MRP1 transcription will also
positively respond to mercury, as shown here in the case of
YCF1. (b) The defence of yeast against As(III) also
involves Acr3p, a plasma membrane protein capable of
extruding the toxic compound out of the cell [7,46]. That
against diazaborine involves the major-facilitator-super-
family transporter Flr1p. Both ACR3 and FLR1 gene
expressions are under the control of Yap1p. In this context,
possible occurrence in the Yap1p regulon of a protein
product capable of extruding mercury from the cytosol
deserves consideration. (c) Finally, peptides capable of
chelating copper, zinc, cadmium or mercury are encoun-
tered in eukaryotic cells. Phytochelatins [47] and metallo-
thioneins are examples of such peptides. S. cerevisiae
contains two metallothionein genes, CUP1 and CRS5,
the products of which are involved in the resistance to
copper [48]. A role of Cup1p in mercury detoxication is
unlikely [35]. Much less is known on the specicity of
Crs5p.
Acknowledgements
We gratefully acknowledge Prof. Carlo V. Bruschi for the gift of
plasmids pGUG, pHUH and pXUX, Prof. Francois Kepes for
providing us with strains DBY2057 and NY17, and Dr Sophie
Bourcier for assistance in mass spectrometry measurements.
O.G. is a member of the Delegation Generale pour lArmement.
This work was partly supported by the association Vaincre la
Mucoviscidose.
References
1. Ercal, N., Gurer-Orhan, H. & Aykin-Burns, N. (2001) Toxic
metals and oxidative stress part I: mechanisms involved in metal-
induced oxidative damage. Curr. Top. Med. Chem. 1, 529539.
2. Hobman, J.L. & Brown, N.L. (1997) Bacterial mercury-resistance
genes. Metal Ions Biol. Syst. 34, 527568.
3. Sugawara, N., Lai, Y.R., Sugaware, C. & Arizono, K. (1998)
Decreased hepatobiliary secretion of inorganic mercury, its
deposition and toxicity in the Eisai hyperbilirubinemic rat with
no hepatic canalicular organic anion transporter. Toxicology 126,
2331.
4. Szczypka, M.S., Wemmie, J.A., Moye-Rowley, W.S. & Thiele,
D.J. (1994) A yeast metal resistance protein similar to human
cystic brosis transmembrane conductance regulator (CFTR) and
multidrug resistance-associated protein. J. Biol. Chem. 269,
2285322857.
5. Li, Z.S., Szczypka, M., Lu, Y.P., Thiele, D.J. & Rea, P.A. (1996)
The yeast cadmium factor protein (YCF1) is a vacuolar glu-
tathione S-conjugate pump. J. Biol. Chem. 271, 65096517.
6. Li, Z.S., Lu, Y.P., Zhen, R.G., Szczypka, M., Thiele, D.J. & Rea,
P.A. (1997) A new pathway for vacuolar cadmium sequestration
in Saccharomyces cerevisiae: YCF1-catalyzed transport of bis
(glutathionato) cadmium. Proc. Natl Acad. Sci. USA 94, 4247.

FEBS 2003 Role of YCF1 in mercury detoxication (Eur. J. Biochem. 270) 2495
7. Ghosh, M., Shen, J. & Rosen, B.P. (1999) Pathways of As (III)
detoxication in Saccharomyces cerevisiae. Proc. Natl Acad. Sci.
USA 96, 50015006.
8. Chaudhuri, B., Ingavale, S. & Bachhawat, A.K. (1997) apd1+, a
gene required for red pigment formation in ade6 mutants of
Schizosaccharomyces pombe, encodes an enzyme required for
glutathione biosynthesis: a role for glutathione and a glutathione-
conjugate pump. Genetics 145, 7583.
9. Sharma, K.G., Mason, D.L., Liu, G., Rea, P.A., Bachhawat, A.K.
& Michaelis, S. (2002) Localization, regulation, and substrate
transport properties of Bpt1p, a Saccharomyces cerevisiae MRP-
type ABC transporter. Eukaryot. Cell 1, 391400.
10. Wemmie, J.A., Szczypka, M.S., Thiele, D.J. & Moye-Rowley,
W.S. (1994) Cadmium tolerance mediated by the yeast AP-1
protein requires the presence of an ATP-binding cassette trans-
porter-encoding gene, YCF1. J. Biol. Chem. 269, 3259232597.
11. Wu, A., Wemmie, J.A., Edgington, N.P., Goebl, M., Guevara,
J.L. & Moye-Rowley, W.S. (1993) Yeast bZip proteins mediate
pleiotropic drug and metal resistance. J. Biol. Chem. 268, 18850
18858.
12. Hirata, D., Yano, K. & Miyakawa, T. (1994) Stress-induced
transcriptional activation mediated by YAP1 and YAP2 genes
that encode the Jun family of transcriptional activators in
Saccharomyces cerevisiae. Mol. Gen. Genet. 242, 250256.
13. Cohen, B.A., Pilpel, Y., Mitra, R.D. & Church, G.M. (2002)
Discrimination between paralogs using microarray analysis:
application to the Yap1p and Yap2p transcriptional networks.
Mol. Biol. Cell. 13, 16081614.
14. Decottignies, A. & Goeau, A. (1997) Complete inventory of the
yeast ABC proteins. Nature Genet. 15, 137145.
15. Gietz, D., St Jean, A., Woods, R.A. & Schiestl, R.H. (1992)
Improved method for high eciency transformation of intact
yeast cells. Nucleic Acids Res. 20, 1425.
16. Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F.
& Cullin, C. (1993) A simple and ecient method for direct
gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res. 21,
33293330.
17. Storici, F., Coglievina, M. & Bruschi, C.V. (1999) A 2-lm DNA-
based marker recycling system for multiple gene disruption in the
yeast Saccharomyces cerevisiae. Yeast 15, 271283.
18. Wach, A., Brachat, A., Pohlmann, R. & Philippsen, P. (1994) New
heterologous modules for classical or PCR-based gene disruptions
in Saccharomyces cerevisiae. Yeast 10, 17931808.
19. Sikorski, R.S. & Hieter, P. (1989) A system of shuttle vectors and
yeast host strains designed for ecient manipulation of DNA in
Saccharomyces cerevisiae. Genetics 122, 1927.
20. Plateau, P., Fromant, M., Schmitter, J.M. & Blanquet, S. (1990)
Catabolism of bis (5-nucleosidyl) tetraphosphates in Saccharo-
myces cerevisiae. J. Bacteriol. 172, 68926899.
21. Boeke, J.D., LaCroute, F. & Fink, G.R. (1984) A positive selec-
tion for mutants lacking orotidine-5-phosphate decarboxylase
activity in yeast: 5-uoro-orotic acid resistance. Mol. Gen. Genet.
197, 345346.
22. Orr-Weaver, T.L., Szostak, J.W. & Rothstein, R.J. (1981) Yeast
transformation: a model system for the study of recombination.
Proc. Natl Acad. Sci. USA 78, 63546358.
23. Adams, A., Gottschling, D.E., Kaiser, C.A. & Stearns, T. (1997)
Methods in Yeast Genetics. A Cold Spring Harbor Laboratory
Course Manual. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY.
24. Rebbeor, J.F., Connolly, G.C., Dumont, M.E. & Ballatori, N.
(1998) ATP-dependent transport of reduced glutathione in yeast
secretory vesicles. Biochem. J. 334, 723729.
25. Ruetz, S. (1998) Yeast secretory vesicle system for expression and
functional characterization of P-glycoproteins. Methods Enzymol.
292, 382396.
26. Muller, M., Meijer, C., Zaman, G.J.R., Borst, P., Scheper,
R.J., Mulder, N.H., de Vries, E.G.E. & Jansen, P.L.M. (1994)
Overexpression of the gene encoding the multidrug resistance-
associated protein results in increased ATP-dependent glutathione
S-conjugate transport. Proc. Natl Acad. Sci. USA 91, 13033
13037.
27. Kotyk, A. & Dvorakova, M. (1990) Transport of L-tryptophan in
Saccharomyces cerevisiae. Folia Microbiol. 35, 209217.
28. Choi, J.H., Lou, W. & Vancura, A. (1998) A novel membrane-
bound glutathione S-transferase functions in the stationary phase
of the yeast Saccharomyces cerevisiae. J. Biol. Chem. 273, 29915
29922.
29. Pearce, D.A. & Sherman, F. (1999) Toxicity of copper, cobalt, and
nickel salts is dependent on histidine metabolism in the yeast
Saccharomyces cerevisiae. J. Bacteriol. 181, 47744779.
30. Dujon, B., Alexandraki, D., Andre, B., Ansorge, W., Baladron, V.,
Ballesta, J.P.G., Banrevi, A., Bolle, P.A., Bolotin-Fukuhara, M.,
Bossier, P., Bou, G., Boyer, J., Buitrago, M.J., Cheret, G., Col-
leaux, L. et al. (1994) Complete DNA sequence of yeast chromo-
some XI. Nature 369, 371378.
31. Farrell, R.E., Germida, J.J. & Huang, P.M. (1990) Biotoxicity of
mercury as inuenced by mercury (II) speciation. Appl. Environ.
Microbiol. 56, 30063016.
32. Farrell, R.E., Germida, J.J. & Huang, P.M. (1993) Eects of
chemical speciation in growth media on the toxicity of mercury
(II). Appl. Environ. Microbiol. 59, 15071514.
33. Acan, N.L. & Tezcan, E.F. (1995) Inhibition kinetics of sheep
brain glutathione reductase by cadmium ion. Biochem. Mol. Med.
54, 3337.
34. Schutzendubel, A. & Polle, A. (2002) Plant responses to abiotic
stresses: heavy metal-induced oxidative stress and protection by
mycorrhization. J. Exp. Bot. 53, 13511365.
35. Ono, B., Ohue, H. & Ishimara, F. (1988) Role of cell wall in
Saccharomyces cerevisiae mutants resistant to Hg2+. J. Bacteriol.
170, 58775882.
36. Murray, A.D. & Kidby, D.K. (1975) Sub-cellular location of
mercury in yeast grown in the presence of mercuric chloride.
J. Gen. Microbiol. 86, 6674.
37. Ono, B., Sakamoto, E. & Yamaguchi, K. (1987) Saccharomyces
cerevisiae strains sensitive to inorganic mercury. III. Tyrosine
uptake. Curr. Genet. 11, 399406.
38. Rothstein, A. (1959) Cell membrane as a site of action of heavy
metals. Fed. Proc. 18, 10261038.
39. Kaplan, J.G. & Tacreiter, W. (1966) The b-glucosidase of the yeast
cell surface. J. Gen. Physiol. 50, 914.
40. Whittaker, S.G., Smith, D.G., Foster, J.R. & Rowland, I.R.
(1990) Cytochemical localization of mercury in Saccharomyces
cerevisiae treated with mercuric chloride. J. Histochem. Cytochem.
38, 823827.
41. Zalups, R.K. (2000) Molecular interactions with mercury in the
kidney. Pharmacol. Rev. 52, 113143.
42. Vido, K., Spector, D., Lagniel, G., Lopez, S., Toledano, M.B. &
Labarre, J. (2001) A proteome analysis of the cadmium response
in Saccharomyces cerevisiae. J. Biol. Chem. 276, 84698474.
43. Fauchon, M., Lagniel, G., Aude, J.C., Lombardia, L., Soularue,
P., Petat, C., Marguerie, G., Sentenac, A., Werner, M. & Labarre,
J. (2002) Sulfur sparing in the yeast proteome in response to sulfur
demand. Mol. Cell 9, 713723.
44. Westwater, J., McLaren, N.F., Dormer, U.H. & Jamieson, D.J.
(2002) The adaptive response of Saccharomyces cerevisiae to
mercury exposure. Yeast 19, 233239.
45. Ishikawa, T., Bao, J.J., Yamane, Y., Akimaru, K., Frindrich, K.,
Wright, C.D. & Kuo, M.T. (1996) Coordinated induction
of MRP/GS-X pump and c-glutamylcysteine synthetase by
heavy metals in human leukemia cells. J. Biol. Chem. 271, 14981
14988.
2496 O. Gueldry et al. (Eur. J. Biochem. 270)
46. Bouganim, N., David, J., Wysocki, R. & Ramotar, D. (2001)
Yap1 overproduction restores arsenite resistance to the ABC
transporter decient mutant ycf1 by activating ACR3 expression.
Biochem. Cell. Biol. 79, 441448.
47. Cobbett, C.S. (2000) Phytochelatin biosynthesis and function in
heavy-metal detoxication. Curr. Opin. Plant. Biol. 3, 211216.
48. Jensen, L.T., Howard, W.R., Strain, J.J., Winge, D.R. & Culotta,
V.C. (1996) Enhanced eectiveness of copper ion buering by

FEBS 2003
CUP1 metallothionein compared with CRS5 metallothionein in
Saccharomyces cerevisiae. J. Biol. Chem. 271, 1851418519.
49. Adams, A.E.M. & Botstein, D. (1989) Dominant suppressors of
yeast actin mutations that are reciprocally suppressed. Genetics
121, 675683.
50. Walworth, N.C. & Novick, P.J. (1987) Purication and char-
acterization of constitutive secretory vesicles from yeast. J. Cell.
Biol. 105, 163174.