The detection of Hymenolepis sp.

from house rats (Rattus rattus diardii Jentink, 1880)

in Mataram through ITS-1 gene PCR analysis
Galuh Tresnani, I. Wayan Suana, and Islamul Hadi

Citation: AIP Conference Proceedings 1744, 020023 (2016); doi: 10.1063/1.4953497

View online: http://dx.doi.org/10.1063/1.4953497
View Table of Contents: http://aip.scitation.org/toc/apc/1744/1
Published by the American Institute of Physics
 The Detection of Hymenolepis sp. from House Rats
(Rattus rattus diardii Jentink, 1880) in Mataram through
ITS-1 Gene PCR Analysis
Galuh Tresnani1, a), I Wayan Suana1 and Islamul Hadi1
1
Department of Biology, The Faculty of Mathematics and Natural Sciences, Universitas Mataram
Jl. Majapahit, No. 62 Mataram 83125, West Nusa Tenggara, Indonesia
a)
Corresponding author: gtresnani@unram.ac.id

Abstract. Hymenolepis are zoonotic cestodes and the house rats are their hosts. According to the previous study through
eggs morphology analysis, the house rats in Mataram infected with Hymenolepis nana and Hymenolepis diminuta. Since
both of the cestodes could also infect a human, therefore the accurate identification will be needed. The aim of the
research is to detect the species of Hymenolepis which infect the house rats in Mataram through ITS-1 gene PCR
analysis. The rats were trapped and dissected to collect the cestodes. The PCR analysis was done using the forward
primer 5 GCGGAAGGGATACTTACACGTTC 3 and reverse primer 5 GCTCGACTCTTCATCGATCCACG 3.
Based on the morphological analysis there are 35 worms samples which assumed as H. nana and H. diminuta. The ITS-1
PCR result showed that only three samples are positive, two samples are positive for H. nana (646 bp) and one sample
positive for H. diminuta (748 bp). The other 32 samples have a negative result which possibly due to an error in
morphological identification or there is another species of cestodes which have the similar morphological appearance but
different in ITS-1 gene such as Raillietina sp. In conclusion, there is an infection of both H. nana and H. diminuta in
house rats from Mataram based on the ITS-1 gene PCR analysis.

Keywords: House rat, Hymenolepis sp., PCR.

INTRODUCTION
The house rats (Rattus rattus diardii Jentink, 1880) have a close relationship with a human. Due to this close
relationship, some of the diseases from rats can transmit to human. Some of the rat diseases are caused by cestodes
such as Hymenolepis diminuta, Taenia taeniaeformis, and Railietina sp. [1]. The H. diminuta and H. nana are the
zoonotic parasitic worm [25].
The detection and identification of Hymenolepis worms in rats and human were made by morphological analysis
of adult worm and eggs. Molecular is an alternative method to detect the infection of Hymenolepis more accurately.
Polymerase chain reaction (PCR) on the ITS-1 COI gene has been used to differentiate Hymenolepis species that
infected murid rodents on the Canary Island, Spain. This research found that Hymenolepis mostly infect rats while
Rodentolepis only found in mice [6]. The amplification was done in ITS-1 and cox-1 genes. The research found that
H. nana which infected human is similar in morphology but different in genetic than H. nana that infected mouse.
Another research was done by [7] used the RAPD-PCR to detect the H. nana gene diversity which isolated from rats
and mice. This research use three primers (AB1-17; UBC-358; and UBC-387) and found that there are no significant
different in gene diversity between H. nana from rats and mice.
The development of PCR diagnostic for H. diminuta is emerging today. There was a research using the ITS-1
gene to differentiate between H. diminuta, H. nana and H. microstoma in mouse and rats. This research was done by
[8] using the ITS-1 primers and found that H. diminuta can be detected at 748 bp, H. nana at 646 bp and H.
microstoma at 635 bp.

Towards the sustainable use of biodiversity in a changing environment: From basic to applied research
AIP Conf. Proc. 1744, 020023-1020023-3; doi: 10.1063/1.4953497
Published by AIP Publishing. 978-0-7354-1401-3/$30.00

020023-1
 In the fact that some of the rats diseases can transmit to human including cestodes, there is an urgent need to
make the accurate diagnoses for H. nana and H. diminuta which already found in Mataram. The aim of this research
is to detect the species of Hymenolepis which infect the house rats in Mataram through ITS-1 gene PCR analysis.

MATERIALS AND METHODS

Rat samples were captured and dissected to collect the worms from their intestines. All the adult worms found
were identified through morphological analysis and were fixed in ethanol absolute for further analysis. The worm
eggs found from the fecal were examined to provide the species worm data.
The DNA templates were isolated from the adult worms. The DNA isolation was done according to the
procedures from Wizard Genomic DNA Purification Kit (Promega).
The PCR analysis for H. nana and H. diminuta were done using two primers which are forward primer
5 GCGGAAGGGATACTTACACGTTC 3 and reverse primer 5 GCTCGACTCTTCATCGATCCACG 3 [8].
Total DNA from each sample was used as a template for PCR amplification. The DNA was denatured at 94 C for
2 min. The PCR cycles were 50 at 94 C for 20 s, 63 C for 20 s and 72 C for 45 s. After this cycle, there is an
extended polymerization reaction at 72 C for 7 min [8]. The PCR products were visualized using 1.5 % agarose gel
through electrophoresis at 80 V for 1 h. The agarose gel was stained with Diamond Nucleic Acid Stain (Promega).

RESULTS AND DISCUSSION

There are 35 DNA samples were collected from 40 rats. The 35 cestodes were differentiated through
morphological examination for H. nana and H. diminuta. The PCR results for the ITS-1 gene detection can be seen
in three different agarose gels (Fig. 1).

(a) (b) (c)

FIGURE 1. ITS-1 gene analysis results (a) First 15 samples analysis, lane 10 positive with H. diminuta; (b) second analysis, nine
samples, lane nine positive for H. nana; (c) third analysis, 11 samples, lane two positive for H. nana. The H. diminuta lane was
read at 748 bp, and H. nana in 646 bp (base pairs).

The PCR results showed that from 35 DNA samples suspected for Hymenolepis worms, only three samples
which are positive. Two samples (gel b and c in Fig. 1) are positive for H. nana since the positive band spotted at
about 646 bp. The other one sample is positive for H. diminuta due to the PCR band stained at 748 bp. Thirty two
DNA samples were found negative both for H. nana and H. diminuta.
The primers that have been used in this research can detect three species of Hymenolepis: H. nana (646 bp),
H. diminuta (748 bp) and H. microstoma (635 bp) [9]. In this research, the ITS-1 primers detected only two species
of Hymenolepis which infect the house rats in Mataram. Those cestodes are H. nana and H. diminuta.
Both of H. nana and H. diminuta have a similar morphology, but they have genetic differences. The similar
characteristics are included in flat body shape, scolex with a skinny neck and they both have rostellum. They have
differences in body length. In addition, H. nana has a retractable rostellum and egg appearances. Although they have
similar morphological characteristics, they have genetic differences especially at the ITS-1 gene [9].
The worms of the 32 negative samples from this research have similar characters with H. nana and H. diminuta.
However, they have the different ITS-1 gene. Therefore, they can not be detected by the ITS-1 primers which

020023-2
designed for Hymenolepis that can distinguish between H. nana, H. diminuta, and H. miscrostoma. It can be
assumed that these 32 worms are cestodes but not from the genus or species of Hymenolepis (H. nana, H. diminuta
or H. microstoma). There is a possibility that the cestodes are from the species of Raillietina sp.

CONCLUSION
Based on ITS-1 gene analysis, three of 35 DNA samples are positive of Hymenolepis nana and Hymenolepis
diminuta is infecting house rats in Mataram.

ACKNOWLEDGEMENT
This research was funded by the higher education operational fund from Universitas Mataram and supported by
the Laboratory of Immunobiology, Universitas Mataram. Authors also thank Baiq Yulia Hasni Pratiwi and Nurul
Hafazah for their help in sample collection and sample analysis.

REFERENCES
1. T. Ogunniyi, H. Balogun and B. Shasanya, Iran J. Parasitol. 9, 134140 (2014).
2. H.S. Sadaf, S.S. Khan, N. Kanwal, B.M. Tasawer and S.M. Ajmal, Int. Res. J. Of Pharmacy 4, 3235 (2013)
3. D. Sharma, S. Joshi, S. Vatsya and C. L. Yadav, J. Parasit. Dis. 37, 181184 (2013).
4. M. Kataranovski, I. Mirkov, S. Belij, A. Popov, Z. Petrovic, Z. Gacic and D. Kataranovski, Parasite 18, 189
196 (2011).
5. P. M. Schantz, Gastroenterology Clinics of North America 25, 637653 (2006).
6. P. Foronda, M. Lopez-Gonzales, M. Hernandez, V. Haukisalmi and C. Feliu, Parasite & Vectors 4, 185 (2011)
7. T. Mohammadzadeh, S. M. Sadjjadi, M. H. Motazedian and G. R. Mowlavi, Iranian J. Of Vet. Res. 8, 1619
(2007).
8. R. Goswami, S. M. Singh, M. Kataria and R. Somvanshi, Braz. J. Vet. Pathol. 4, 103111 (2011).
9. D. Liu, Molecular Detection of Human Parasitoc Pathogens (CRC Press, United State of America, 2013), pp.
266267; 271273.

020023-3