Plant Mol Biol (2014) 86:471483
DOI 10.1007/s11103-014-0241-6
Characterization ofArabidopsis Tubbylike proteins
andredundant function ofAtTLP3 andAtTLP9 inplant response
toABA andosmotic stress
YanBao WeiMengSong YanLiJin
ChunMeiJiang YangYang BeiLi WeiJieHuang
HuaLiu HongXiaZhang
Received: 3 June 2014 / Accepted: 15 August 2014 / Published online: 29 August 2014
Springer Science+Business Media Dordrecht 2014
Abstract Tubby and Tubby-like proteins (TLPs) play
essential roles in the development and function of mam-
mal neuronal cells. In addition to the conserved carboxyl
(C)-terminal Tubby domain, which is required for their
plasma membrane (PM) tethering, plant TLPs also possess
an amino (N)-terminal F-box domain to interact with spe-
cific Arabidopsis Skp1-like (ASK) proteins as functional
SCF-type E3 ligases. Here, we report the molecular charac-
terization of Arabidopsis TLPs (AtTLPs). -Glucuronidase
staining showed overlapped but distinct expression pat-
terns of AtTLPs in Arabidopsis. Yeast two-hybrid assays
further revealed that AtTLP1, AtTLP3, AtTLP6, AtTLP7,
AtTLP9, AtTLP10 and AtTLP11 all interacted with spe-
cific ASKs, but AtTLP2, AtTLP5 and AtTLP8 did not.
Subcellular localization observations in both Arabidop-
sis protoplasts and tobacco pollen tubes indicated that all
GFP-AtTLP fusion proteins, except GFP-AtTLP8 which
lacks the conserved phosphatidylinositol 4,5-bisphosphate
binding sites, were targeted to the PM. Detailed studies on
AtTLP3 demonstrated that AtTLP3 is a PM-tethered PIP2
binding protein which functions redundantly with AtTLP9
in abscisic acid (ABA)- and osmotic stress-mediated seed
germination. Our results suggest that AtTLPs possibly work
in multiple physiological and developmental processes in
Arabidopsis, and AtTLP3 is also involved in ABA signaling
Electronic supplementary material The online version of this
article (doi:10.1007/s11103-014-0241-6) contains supplementary
material, which is available to authorized users.
Y.Bao W.-M.Song Y.-L.Jin C.-M.Jiang Y.Yang B.Li Although the C-terminal Tubby domain of TLPs is
W.-J.Huang H.Liu H.-X.Zhang(*)
National Key Laboratory ofPlant Molecular Genetics, Shanghai
Institute ofPlant Physiology andEcology, Chinese Academy
ofSciences, 300 Fenglin Road, Shanghai200032, China
e-mail: hxzhang@sippe.ac.cn
pathway like AtTLP9 during seed germination and early
seedling growth.
Keywords Tubby Arabidopsis AtTLP ABA Stress
Introduction
Tubby gene was initially identified in mouse through map-
based cloning. Mice with a mutated tubby gene develop
delayed-onset obesity, sensorineural hearing loss and reti-
nal degeneration (Kleyn etal. 1996; Noben-Trauth etal.
1996; Santagata etal. 2001). Tubby proteins perform
their functions in signal transduction from heterotrimeric
GTP-binding protein (G protein)-coupled receptor (San-
tagata etal. 2001). Tubby-like proteins (TLPs), which are
widely conserved across eukaryotic organisms including
the plant kingdom, are a class of proteins homologous to
Tubby proteins (Mukhopadhyay and Jackson 2011). Both
Tubby and Tubby-like proteins share a typical carboxyl
(C)-terminal Tubby domain for their proper tethering to the
plasma membrane by binding specific phosphatidylinositol
4,5-bisphosphates (Santagata etal. 2001). In rice (Oryza
sativa), fourteen OsTLP genes were predicted in the whole
rice genome (Yang etal. 2008). Subsequent studies demon-
strated that the expression of all OsTLPs was inducible by
Xanthomonas oryzae pv. oryzae, one of the most devastat-
ing diseases of rice caused by bacterial blight (Kou etal.
2009), and OsTLP2 could bind to the promoter region of a
disease-associated gene OsWRKY13 (Cai etal. 2008).
highly conserved among eukaryotic organisms, the amino
(N)-terminal domains of plant TLPs differ to impart spe-
cific functions to them (Mukhopadhyay and Jackson 2011).
Unlike their homologs in animals, all plant TLPs are
13

472
featured with a conserved F-box domain at their N-terminal
parts (Lai etal. 2004, 2012). F-box proteins are the largest
clade of E3 ligase in plants, and more than 700 members
have been predicted in the Arabidopsis genome (Hua and
Vierstra 2004). As the SCF-type (for SKIP1, Cullin1, and
F-box) E3 ligase, F-box proteins combine the complex con-
sisting of CUL1 (Cullin1), ASKs (Arabidopsis Suppressor
of Kinetochore Proteins) and RBX1 (Ring-Box 1)/ROC1
(Regulator of Cullins 1) to promote the degradation of its
target proteins by 26S proteasomes, which is crucial for
plant development and adaptation to environmental stresses
(Moon etal. 2004; Dreher and Callis 2007; Stone and
Callis 2007).
In Arabidopsis, a total of eleven TLPs (AtTLPs) have
been identified and AtTLP9 was found to be involved in
ABA-mediated seed germination (Lai etal. 2004). attlp9
mutant plants exhibited abscisic acid (ABA)-insensitive
phenotypes, whereas transgenic Arabidopsis plants over-
expressing AtTLP9 were hypersensitive to ABA. Yeast
two-hybrid assays revealed that AtTLP9 interacted with
ASK1 (Lai etal. 2004). Further investigations showed that
AtTLP9 also interacted with XERICO, an Arabidopsis
RING-H2 protein, in yeast, and possibly conferred drought
resistance on transgenic plants overexpressing XERICO
gene through increasing ABA biosynthesis (Ko etal. 2006).
However, unlike the animal Tubby proteins, AtTLP9 does
not have auto-activation activity as a transcriptional factor
in yeast, suggesting the functional diversities of this protein
family between animals and plants (Boggon etal. 1999;
Lai etal. 2004). Recently, AtTLP3 was also reported to
participate in stress signaling and root colonization by the
mutualist Piriformospora indica. Both H2O2 and osmotic
stress were able to trigger the release of AtTLP3 from the
plasma membrane (Reitz etal. 2012, 2013).
Although the functions of Tubby and TLPs in animals
have been well studied, details of the molecular mecha-
nism underlying their functions in plants are still largely
unknown. In this work, we performed molecular characteri-
zation of the Arabidopsis Tubby-like protein family genes.
Using TLP-promoter--glucuronidase (GUS) reporters
and GFP-AtTLP fusion protein vectors, we examined their
expression pattern in Arabidopsis and subcellular localiza-
tion in Arabidopsis protoplasts and in tobacco pollen tubes
and leaves. Interaction of AtTLPs with different ASKs was
also investigated to verify which AtTLP acts as a func-
tional E3 ligase. Our examinations revealed that AtTLPs
have versatile expression patterns and different interaction
activity with specific ASK proteins. We also examined the
germination of attlp3, attlp9 and attlp3attlp9 knock-out
mutants in response to ABA and osmotic stress. All these
mutants were insensitive to high concentrations of ABA
and mannitol. Our results suggest that AtTLPs may play
different roles, and AtTLP3 has a redundant function with
13
Plant Mol Biol (2014) 86:471483
AtTLP9 during seed germination and early seedling devel-
opment in Arabidopsis.
Materials andmethods
Plant growth condition andmutant isolation
Except for attlp3-7 which is in the WS ecotype back-
ground, all the accessions of Arabidopsis thaliana are
Columbia-0 (Col-0) ecotype. Five-day-old seedlings
grown on Murashige and Skoog (MS) medium (Sigma-
Aldrich) supplemented with 2% (w/v) sucrose and 0.8%
(w/v) agar were transplanted into soil and then grown
under 16h of light/8h of dark cycles in the green house at
22C (light) or 20C (dark). To identify the T-DNA inser-
tion in attlp1-1 (SALK_026655), attlp1-2 (GK-540D06),
attlp2-3 (SALK_122519), attlp3-3 (SALK_117348),
attlp3-7 (FLAG_462A07), attlp6-1 (SALK_019494),
attlp7-2 (GK-729B04), attlp8-3 (GK-918A08), attlp10-
3 (SALK_028746), attlp10-4 (GK-088B03), attlp11-
4 (SAIL_41_B07) and attlp11-7 (FLAG_441G06), the
T-DNA border of these SALK, SAIL, FLAG and GABI-
Kat lines were confirmed using the T-DNA left-border
primers LBa1, SAIL-LB1, FALG-LB4, pGABI-LB2,
pAC161-LB1 and the corresponding gene specific prim-
ers (Table S1). The T-DNA insertion in these mutants was
investigated by genomic PCR to confirm the disruption of
the endogenous gene. Homozygous mutants were identified
by RT-PCR to confirm the disruption of gene expression.
ACTIN2 was employed as an internal control.
Plasmid construction andplant transformation
To generate the ProAtTLP:GUS constructs, the 5-flank-
ing DNA of AtTLP coding regions was amplified with the
AtTLP promoter specific primers (Table S1). An average
length of~2.3kb genomic sequence was chosen for each
vector construction. The amplified PCR fragments were
digested with BamHI and SalI, and cloned into the same
sites in the p1381Z vector for sequence confirmation. The
constructs were then separately transformed into wild type
Arabidopsis (Col-0 ecotype) plants, as described previously
(Clough and Bent 1998).
Histochemical analysis
For histochemical analysis, five-day-old seedlings and dif-
ferent tissues from 6-week-old plants were collected and
stained with 5-bromo-4-chloro-3- indolyl-d-glucuronide
for 24h. They were then incubated in 75% ethanol to
remove chlorophyll as described previously (Jefferson etal.
1987).
Plant Mol Biol (2014) 86:471483 473
Seed germination
Seeds of wild-type Col-0 and each mutant line grown under
the same conditions were collected at the same time. For
each comparison, seeds were sown on the same plate con-
taining MS medium supplemented with or without differ-
ent concentrations of ABA or mannitol as indicated. Plates
were stratified at 4C for 3days and transferred to 22C
with 16h/light and 8h/dark cycles in a growth chamber
for 7days. The effect of ABA or mannitol on germina-
tion greening is defined as that cotyledons have obviously
expanded and turned green.
Southern blotting analysis
The number of T-DNA insertions was tested by South-
ern blotting analysis as described previously (Wang etal.
2013). Briefly, genomic DNA (10g) isolated from
45-day-old Col-0 and mutant plants were digested with
EcoRI, BamHI or PstI, electrophoresed on 0.8% agarose
gels, and transferred onto Hybond N+ nylon membranes
with a Whatman Biometra Vacuum-Blot System. The
hybridization probe was amplified with the SALK-line
specific primers (F: AATCATGGTCATAGCTGTTT CCT
and R: TCATCTATGTTACTAGATCGGGCC) (Cheng
etal. 2011). Probe labeling and Southern blotting analy-
ses were conducted with a DIG DNA Labeling and Detec-
tion Kit1 (Roche, Germany) following the manufacturers
instructions.
Subcellular localization andcolocalizaion analysis
To determine the subcellular localization of AtTLPs, all
AtTLP genes were inserted into the vector pRTL2-GFP
with GFP at the N-terminal of each AtTLP, driven by con-
stitutive 35S promoter. The resultant GFP-AtTLP fusion
proteins were transiently transformed, or co-transformed
with mRFP-PH (mRFFP-PLC1 PH) into Arabidopsis
protoplasts (Yoo etal. 2007). For detailed co-localizaion
analysis, the corresponding GFP-AtTLP was co-trans-
formed with mRFP-PH into tobacco pollen tubes. Equal
amount of GFP-AtTLP and mRFP-PH plasmid was used
for co-transformation. Fluorescence was analyzed for
GFP and RFP expression using a confocal microscope at
wavelength 488 and 559nm for excitation, and 509 and
608nm for emission (Olympus FluoView1000, confocal
microscope).
In vitro PIP2 binding assay
For GST-ATLP3 proein purification, cDNA of AtTLP3
gene was inserted into pEGX-4T1 via the EcoR I and Sal I
sites. After sequence confirmation, the construct was intro-
duced into E. coli strain BL21 (DE3), BL21 (Rosetta) or
BL21 (Coden plus), respectively. GST-AtTLP3 protein
was induced by 0.1mM IPTG at 18C for 3days (Fig.
S3). Purification of GST-AtTLP3 was performed with Glu-
tathione Sepharose 4B beads (GE Healthcare) following
the manufactures manuals.
For the in vitro PIP2 binding assay, PIP strips (P-6001;
Echelon Biosciences) were pre-blocked in TBS-T buffer
(10mM TrisHCl, pH 8.0, 150mM NaCl, and 0.1%
Tween 20) containing 1% fatty acid free milk for 1h at
25C, then GST or the recombinant GST-AtTLP3 pro-
tein was added to a final concentration of 10mg/ml. The
strips were incubated for another 2h, washed three times
with TBS-T buffer, incubated in TBS-T buffer with 1:1,000
mouse anti-GST antibody (Kangwei biotechnology, Shang-
hai, China) for 45min, and washed three times with fresh
TBS-T buffer. The signals were detected with the gel imag-
ing and documentation system (Tannon-4200, Shanghai,
China) according to the ECL Plus immunoblot method.
BiFC assay
BiFC experiments were performed as described previously
(Luo etal. 2012). Briefly, the coding regions of AtTP3 or
AtTLP9 were fused in frame with the N-terminal fragment
of YFP to generate p35S:AtTLP3-YN or p35S:AtTLP9-
YN. ASK1 was fused with the C-terminal fragment of YFP
to generate p35S:ASK1-YC. The resultant constructs were
introduced into Agrobacterium tumefaciens strain GV3101
and infiltrated into the leaves of N. benthamiana. After
2days, the epidermis of infiltrated leaves was examined for
YFP signals under a Zeiss 510META confocal laser scan-
ning microscope at a wavelength of 514nm.
Yeasttwohybrid
For yeast-two-hybrid assay, the coding regions of AtTLPs
were amplified with the corresponding gene specific prim-
ers (Table S1), and introduced into pGBKT7 bait plasmid
to produce a fusion protein with the GAL4 DNA binding
domain. Except for ASK1, all the other ASKs were ampli-
fied from the plasmids generously provided by Schumann
etal. (2011), and inserted into pGADT7 prey plasmid
containing the GAL4 activation domain. Different combi-
nations of these two kinds of plasmids were transformed
into yeast strain AH109 by the lithium chloride-polyethyl-
eneglycol method according to the manufacturers manual
(Clontech, Shanghai, China). Transformants were selected
on SD/-Leu/-Trp plates at 30C, and interactions were
tested on SD plates lacking Adenine and Histine (SD/-Leu/-
Trp/-His/-Ade), as described previously (Bao etal. 2014).
13

474
Fig.1Histochemical staining of AtTLP-promoter: GUS activity
in transgenic Arabidopsis plants. Different tissues from 6-week-old
transgenic plants were used for GUS staining, except for root tip
which were from 5-day-old seedlings. a Inflorescences (Bar 5mm).
Results
AtTLPs exhibit overlapped butdistinct expression patterns
In Arabidopsis, all AtTLPs contain a conserved C-terminal
Tubby domain, and except AtTLP8, an N-terminal F-box
domain. RT-PCR analyses have shown that AtTLP family
genes were widely expressed in different tissues such as
roots and flowers (Lai etal. 2004). Therefore, the function
of these genes may be highly redundant, unless their expres-
sion patterns are different. To dissect the possible functions
of these genes, we generated transgenic Arabidopsis plants
expressing AtTLP promoter-driven GUS reporter transgene.
The histochemical activity of -glucuronidase (GUS) in
transgenic plants was investigated. Such examinations
revealed rather distinct expression patterns of AtTLP genes.
Although no ProAtTLP4:GUS expression was observed in
any tested tissues of transgenic plants, GUS was expressed
in various tissues of transgenic plants expressing all other
13
Plant Mol Biol (2014) 86:471483
b Flowers (Bar 1mm). c Siliques (Bar 5mm). d Rosette leaves
(Bar 5mm). e Five-day-old seedlings (Bar 2mm). f Root tips (Bar
0.05mm)
ProAtTLP:GUS (Fig.1). This is consistent with the previ-
ous report that AtTLP4 might be a pseudogene (Lai etal.
2004). In the flowers of most transgenic plants, GUS was
predominantly expressed in the petals (Fig.1a, b). With
exception of AtTLP2 and AtTLP6, GUS expression was
also observed in stigmas (Fig.1b) and broadly expressed
in the siliques (Fig.1c). Interestingly, AtTLP3, AtTLP9
and AtTLP11 share very high amino acid similarities
(Fig. 2a, b), and strong GUS expression was observed in
the leaves of transgenic plants expressing ProAtTLP3:GUS,
ProAtTLP9:GUS or ProAtTLP11:GUS (Fig.1d). During
early seedling development (5-day-old seedlings), GUS
was preferentially expressed in cotyledons and hypoco-
tyl nodes (Fig.1e). In roots, strong GUS staining was
observed in the elongation zones and root tips of transgenic
plants harboring ProAtTLP1:GUS and ProAtTLP10:GUS,
and in the root stele of those harboring ProAtTLP3:GUS
and ProAtTLP11:GUS. Moreover, specific GUS stain-
ing was also observed in the root tips of transgenic plants
Plant Mol Biol (2014) 86:471483 475

Fig.2Phylogenetic and alignment analyses of Arabidopsis AtTLP ber of amino acid substitutions per site. b Amino acid alignment of
proteins. a Phylogenetic analysis of Arabidopsis AtTLPs and their Arabidopsis AtTLPs. Residues are highlighted in black and dark gray
homologs in Human and Mouse. Proteins are named according to according to the conservation level. The locations of F-box domain
their gene names, and black dots indicate the Tubby proteins from and Tubby domain are indicated with single solid lines in red and
human and mouse which are used as an outgroup. Phylogenetic tree black above the sequences, respectively. Red boxes and triangles
was constructed using MEGA and 1,000 replicates. The numbers indicate the two evolutionarily conserved PIP2 binding sites which
above the branches refer to the bootstrap value of the neighbor- are required for the plasma membrane tethering of Tubby proteins.
joining phylogenetic tree. The length of the branches is proportional Sequences of Arabidopsis TLPs are also listed in Data Set S1
to the amino acid variation rates. The scale bar indicates the num-

harboring ProAtTLP7:GUS and in the meristems of those AtTLPs interact withspecific ASK proteins
expressing ProAtTLP8:GUS, but not in plants expressing
ProAtTLP2:GUS, ProAtTLP5:GUS, ProAtTLP6:GUS or Although the deduced amino acid sequence and structural
AtTLP9 (Fig.1f). analyses have suggested that all plant TLP proteins contain

13

476 Plant Mol Biol (2014) 86:471483

Fig.3Yeast-two-hybrid and
subcellular localization analy-
ses. a Interactions of AtTLPs
and ASKs of Arabidoopsis. BD
(pGBK-T7) fusions of AtTLP
were tested with AD (pGADT7)
fusions of ASKs. Symbols of
grey and white blocks indicate
positive and negative inter-
actions, respectively. Three
independent clones were tested
for each combination. Images
for the interactions were also
shown in Fig. S1. b Subcel-
lular localization of AtTLPs.
GFP-AtTLP or GFP alone were
transiently expressed in Arabi-
dopsis protoplasts, incubated in
dark for 12h and observed with
a confocal microscope. Bar
10m

a conserved N-terminal F-box domain for ASK protein
binding, and AtTLP9 interacted with ASK1, the subunit of
SCF-type complex, as a putative functional SCF-type E3
ligase (Lai etal. 2004), experimental evidence for interac-
tion of AtTLPs and ASK family members is still limited.
To determine whether AtTLPs interact with specific ASKs,
we fused each of the ten AtTLPs with BD (pGBKT7) and
each of the seventeen ASKs with AD (pGADT7), and intro-
duced each combination from the two protein families into
yeast strain AH109. Interaction of AtTLPs and ASKs was
examined. AtTLP1, AtTLP3, AtTLP6, AtTLP7, AtTLP9,
AtTLP10 and AtTLP11 all interacted with specific ASK
proteins, suggesting that they may work as functional SCF-
type E3 ligase in Arabidopsis (Fig.3a, Fig. S1).
AtTLPs are localized tothe plasma membrane
Previously, it was reported that the mouse Tubby protein
was targeted to plasma membrane through binding to spe-
cific phosphoinositides like PtdIns(4,5)P2 (Santagata etal.

13
Plant Mol Biol (2014) 86:471483 477
Fig.4AtTLP3 is a plasma membrane localized PIP2 binding pro- PI(4,5)P2 marker mRFP-PLC1-PH are Co-localized to the plasma
tein. a Schematic diagram of the protein structure of AtTLP3. The
amino (N)-terminal F-box domain and carboxyl-terminal Tubby
domain are shown in red and yellow, respectively. AtTLP3NT (amino
acids from 1 to 110) and AtTLP3CT (amino acids from 111 to 406)
are depicted. AtTLP3m (K187A, R189A) indicates the point muta-
tion of the two conserved PIP2 binding sites. b GFP-AtTLP3 and
2001). A recent study also showed that Arabidopsis AtTLP3
was targeted to the plasma membrane by transient expres-
sion of GFP fusion in the leaf epidermal cells of Arabidopsis
(Reitz etal. 2012). Since subcellular localization is crucial
for the functional analyses of most proteins, we examined
the subcellular localization of AtTLPs in Arabidopsis pro-
toplasts. GFP-tagged AtTLPs were transiently expressed
in mesophyll protoplasts isolated from Arabidopsis rosette
leaves. Confocal imaging showed that with exception of
GFP-AtTLP8, which lacks the conserved PIP2 binding sites
(Fig.2b, indicated with two triangles), fluorescence signals
of all other GFP-AtTLP fusion proteins precisely coincided
with the plasma membrane, unlike the ubiquitous distribu-
tion of free GFP (Figs.3b, 4b). Slight localization of GFP-
AtTLP5 in the cytosol was also observed.
To further confirm the PM localization of these AtTLPs,
we co-expressed each GFP-AtTLPs with monomeric red
fluorescent protein (mRFP)-pleckstrin homology (mRFP-
PLC1-PH), a specific PI(4,5)P2 binding marker, in the
pollen tubes of tobacco (Nicotiana benthamiana), where
PtdIns(4,5)P2 is apically accumulated at the pollen tube
tips. Again, except GFP-AtTLP8, which was ubiquitously
spread, all GFP-AtTLP proteins coincided with the distri-
bution of mRFP-PLC1-PH on the plasma membrane (Fig.
S2). These observations suggest that AtTLP proteins are
anchored to the plasma membrane, probably by binding to
specific phosphoinositides.
membrane. Bar 10m. c Schematic diagram of the PIP strip indi-
cating where the phospholipids are located. d and e PIP binding of
GST and GST-AtTLP3 proteins. f GFP-AtTLP3NT, GFP-AtTLP3CT,
GFP-AtTLP3m, or GFP alone were transient expressed Arabidopsis
protoplasts. Bar 10m
AtTLP3 is targeted tothe plasma membrane viaPIP2
binding inthe Tubby domain
It has been well documented that mammalian TLPs were
tethered to the plasma membrane (PM) via Phosphati-
dylinositol 4,5-bisphosphate (PIP2) binding in the C-ter-
minal Tubby domain (Boggon etal. 1999; Santagata etal.
2001). A recent study also revealed that phospholipase C
triggered the release of AtTLP3 from the PM, indicating
a conserved mechanism for mammalian Tubby and TLP3
(Reitz etal. 2012). To understand whether the PIP2 binding
activity is indeed conserved in plant TLPs, we performed
detailed study with AtTLP3, a PM-localized ortholog of
mammalian Tubby protein (Fig.4a, b). As a first step, we
purified Arabidopsis AtTLP3 protein (Fig. S3) and tested
its PIP2 binding activity in vitro. AtTLP3 was able to bind
PtdIns(3,4)P2, PtdIns(3,5)P2 and PtdIns(4,5)P2 (Fig.4c,
e). Co-localization of GFP-AtTLP3 with mRFP-PLC1-PH
further confirmed the PIP2 binding activity of AtTLP3 in
vivo (Fig.4b).
Another representative property of plant TLPs is the
amino-terminal F-box domain (Fig.4a). To further elu-
cidate whether the F-box domain also contribute to its
PM-tethering, we constructed two fusion proteins, GFP-
AtTLP3NT (amino acids 1-110 containing the F-box
domain) and GFP-AtTLP3CT (amino acids 111-406 con-
taining the Tubby domain), and transiently expressed each
13

478
Fig.5Osmotic-stress triggers
the release of AtTLP3 from the
plasma membrane. Arabidopsis
protoplasts were transformed
with GFP-AtTLP3 plasmid
and incubated in dark at 23C
for 12h. Protoplasts were then
treated with 0.4M mannitol
or 0.3M NaCl for 1h, or with
20mM H2O2 for 0.5h. Bar
20m
of them in Arabidopsis mesophyll protoplasts. Deletion of
the C-terminal Tubby domain aborted the PM localization
of GFP-AtTLP3NT, on the other hand, removing of the
N-terminal F-box domain did not change the PM targeting
of GFP-AtTLP3CT, suggesting that the C-terminal Tubby
domain of AtTLP3 is required and sufficient to confer PM
localization (Fig.4f). To identify the exact PM targeting
determinants of AtTLP3, we replaced the conserved PIP2
binding sites K187 (Lysine187) and R189 (Arginine189)
with Alanine (A) (Figs.2b, 4a), and transiently expressed
the mutated fusion protein AtTLP3m-GFP in Arabidop-
sis mesophyll protoplasts. Mutation of the PIP2 binding
sites disturbed the PM tethering of AtTLP3m-GFP protein
(Fig.4f). Therefore, PIP2 binding of the C-terminal Tubby
domain is crucial for the PM tethering of AtTLP3.
Abiotic stress triggers the detachment ofAtTLP3 fromPM
A recent study has exhibited that abiotic stresses such
as NaCl and mannitol were able to translocate the GFP-
tagged AtTLP3 Tubby domain (GFP-CT-AtTLP31-115)
from PM into the cytosol and nucleoplasm (Reitz etal.
2012). To understand whether the whole AtTLP3 protein
is also removable from PM, we examined the movement
of GFP-AtTLP fusion protein in Arabidopsis mesophyll
protoplasts upon treatments with 0.4M mannitol, 0.3M
NaCl or 20mM H2O2. Similar results were observed in
our experiments. Under normal condition, GFP-AtTLP3
13
Plant Mol Biol (2014) 86:471483
was clearly targeted to the PM. However, upon treat-
ment with 0.4M mannitol, 0.3M NaCl or 20mM H2O2,
GFP-AtTLP3 was completely released into the cytosol
(Fig.5), while the control protein AtNSR3 (AT1G72220)
was not (Fig. S8). These observations imply that AtTLP3
may also play a role in the response to osmotic stress in
Arabidopsis.
AtTLP3 knockout mutants are insensitive toABA
duringseed germination
Phylogenic analyses have shown that AtTLP3 share very
highly homology with AtTLP9 (Fig.2a, b). To identify the
biological function of AtTLP3, three T-DNA insertion lines
attlp3-1, attlp3-3, attlp3-7 of AtTLP3 were characterized
(Fig.6a, Fig. S4). The attlp3 mutants contained a T-DNA
insertion in the first extron of AtTLP3 (Fig.6a). Homozy-
gous attlp3 mutants were isolated. The attlp3 mutant lacked
detectable level of transcripts for AtTLP3 (Fig. S4b). When
grown on normal MS medium, attlp3 plants did not show
any visible phenotypic changes. Seed germination and sub-
sequent seedling growth of attlp3 were similar to the wild
type (Fig.6b, c). However, attlp3 mutants were insensitive
to ABA treatment compared to wild type. Germination in
the wild type was significantly inhibited by high concen-
trations of ABA, but the inhibition in attlp3 seeds was less
severe (Fig.6b, c). At 0.5M ABA, more than 83% of
attlp3-1 and 70% of attlp3-7 seeds germinated, whereas
Plant Mol Biol (2014) 86:471483 479
Fig.6attlp3 mutants are insensitive to high concentration of ABA.
a Schematic diagram of the T-DNA insertion sites in AtLTP3. Exons
and introns are depicted to scale with boxes and lines, respectively.
The coding and un-coding regions of the gene are shown as black or
gray boxes. The positions of T-DNA are indicated with triangles. b
Seed germination of attlp3-1 (Colubia-0 ecotype, Col-0), attlp3-7
(Wassilewskija ecotype, WS) and their indicated wild-type Arabidop-
sis plants. Seeds were sown on MS plates or MS plates supplemented
less than 65% of Col-0 and 19% of WS wild type seeds
germinated, respectively. The germination difference was
also significant at 0.75M ABA: more than 45% of attlp3-
1 and 37% of attlp3-7 seeds germinated, whereas less than
24% of Col-0 and 18% of WS wild type seeds germinated,
respectively. The germination rate of attlp3-1 and attlp3-7
on 1M ABA were 35% and 27%, and their correspond-
ing wild type were 24% and 8% (Fig.6c). Therefore,
AtTLP3 appears to act as a positive regulator in ABA-medi-
ated inhibition of seed germination.
with different concentrations of ABA. After 3days at 4C, the plates
were transferred to a growth chamber and cultured for 7days before
the photographs were taken. c Statistical analysis of seed germi-
nation greening ratio of Col-0, attlp3-1, WS and attlp3-7 in (b). At
least 100 seeds of each genotype were counted at each time. Values
are meanSD. n=3 independent experiments. Asterisks indicate
significant differences from the corresponding control values at
*0.01<P<0.05 and **P<0.01 using the Students t test
attlp33atltp91 double mutant plants are more tolerant
toABA andosmotic stress duringseed germination
Previously, AtTLP9 knocked out mutants was found to be
ABA insensitive (Lai etal. 2004). Based on the facts that
AtTLP3 and AtTLP9 share very high homology and attlp3
mutants showed similar response to ABA treatment as
attlp9, we postulated that both AtTLP3 and AtTLP9 may
have redundant function in Arabidopsis (Figs.2a, b, 6b, c).
To verify this hypothesis, attlp3attlp9 double mutant was
13

480 Plant Mol Biol (2014) 86:471483

Fig.7attlp3-3attlp9-1 double mutant is more resistant to ABA and

mannitol than attlp3-3 and attlp9-1. a Schematic diagram indicating
the sowing positions of Col-0, attlp3-3, attlp9-1 and attlp3-3attlp9-1
seeds on the plates. Germination of Col-0, attlp3-3, attlp9-1 and
attlp3-3attlp9-1 seeds on MS-0 (b), MS supplemented with 0.75M
ABA (c) or 330mM mannitol (d). Seeds were stratified at 4C for
3days and transferred to a growth chamber. Photographs were taken
7days after the transfer

generated. Among the three attlp3 mutants and two attlp9

mutants we have identified, both attlp3-3 and attlp9-1 con-
tained a single copy of T-DNA insertion, as confirmed by
Southern blotting analysis (Fig. S4a). Therefore, attlp3at-
tlp9 double mutant was identified in the F2 populations
derived from a cross between attlp3-3 and attlp9-1 single
mutants. The attlp3-3attlp9-1 double mutant lacked detect-
able level of transcripts for both AtTLP3 and AtTLP9 (Fig.
S4b).
The germination rates of wild type (Col-0), attlp3-3,
attlp9-1 and attlp3-3attlp9-1 seeds on MS media sup-
plemented with different concentrations of ABA were
compared. Both single and double mutant seeds exhib-
ited insensitivity to ABA as compared with the wild
type seeds. In addition, mutant seeds and seedlings were
also resistant to osmotic stress. As shown in Figs.7 and
8, germination of wild type seeds was similar to that of
mutant seeds when sown on normal MS medium with-
out ABA or mannitol (Fig.7a, b, 8a, b). However, when
high concentration of ABA or mannitol was added to the
MS medium, germination of wild type seeds was signifi-
cantly inhibited compared to the mutant seeds (Figs.7c,
d, Fig.8a, b).
Fig.8Statistical analysis of seed germination of Col-0, attlp3-3,
attlp9-1 and attlp3-3attlp9-1. a, b Seeds of Col-0, attlp3-3, attlp9-
1 and attlp3-3attlp9-1 were tested on MS media supplemented with
different concentrations of ABA or mannitol. Seeds were stratified
at 4C for 3days and cultured in a growth chamber for 7days. At
least 100 seeds were counted at each time. Values are meanSD.
n=3 independent experiments. Asterisks indicate significant differ-
ences from the corresponding control values at *0.01<P<0.05 and
**P<0.01 using the Students t test
At 0.5M ABA, more than 46% of attlp3-3, 58% of
attlp9-1 and 65% of attlp3-3attlp9-1 seeds germinated,
but the germination frequency for wild type seeds was
less than 34%. The germination difference was even more
significant at 0.75M ABA: more than 25% of attlp3-3,
33% of attlp9-1 and 53% of attlp3-3attlp9-1 seeds ger-
minated, whereas less than 8% of wild type seeds ger-
minated (Fig.8a). Similarly, germination frequency of
wild type, attlp3-3, attlp9-1 and attlp3-3attlp9-1 was 47,
45, 73 and 82%, respectively, on the medium containing

13
Plant Mol Biol (2014) 86:471483 481
330mM mannitol, and 17, 16, 33 and 69% on the medium
containing 375mM mannitol (Fig.8b). The germination
frequency of attlp3-3, attlp9-1 and attlp3-3attlp9-1 in the
ABA or mannitol medium was different. The difference
of germination frequency between wild type and attlp3-
3attlp9-1 double mutant was larger than that between wild
type and attlp3-3 or attlp9-1 single mutant (Fig.8a, b). All
these results imply that AtTLP3 function redundantly with
AtTLP9 during seed germination and early seedling growth
in Arabidopsis.
Discussion
The function of AtTLP9 in ABA-mediated seed germina-
tion in Arabidopsis, and the interaction of AtTLP9 with
ASK1 and XERICO in yeast have been studied (Lai etal.
2004; Ko etal. 2006). Recently, the roles of AtTLP3 in
stress signaling and root colonization have also been
reported (Reitz etal. 2012, 2013). However, the possi-
ble functions of other AtTLP members are still unknown.
Microarray data have shown that the expression patterns
of AtTLPs are overlapped but distinct (Fig. S7). As a first
step to investigate the exact expression patterns of AtTLPs
in different tissues, we generated ProAtTLP:GUS trans-
genic Arabidopsis plants and examined the possible tran-
scriptional levels of AtTLP genes in different tissues and
organs. Consistent with the reported RT-PCR analyses,
GUS expression was undetectable in any tissues and organs
of transgenic plants harboring ProAtTLP4:GUS, suggest-
ing that AtTLP4 is indeed a putative pseudogene (Lai etal.
2004). And except AtTLP4, all the other members showed
overlapped but distinct expression patterns (Fig.1). For
examples, both ProAtTLP1:GUS and ProAtTLP10:GUS
transgenic plants showed same GUS expression in flow-
ers, siliques and roots (Fig.1ac, f), but different expres-
sion in rosette leaves (Fig.1d). Similarly, ProAtTLP3:GUS,
ProAtTLP9:GUS and ProAtTLP11:GUS transgenic plants
showed same GUS expression in flowers, siliques, rosette
leaves and cotyledons (Fig.1ae), but totally different
expression in roots (Fig.1f). Since differential expression
in various tissues and cell types of the same organs may
suggest tissue and cell-specific functions of genes, these
observations suggest that despite the high sequence homol-
ogy of them, AtTLPs could play different roles in multiple
pathways during plant growth and development.
In addition to the expression pattern, the subcellular
localization of certain protein may also reflect its spa-
tial function(s). Therefore, we determined the subcellular
localization of AtTLPs. For mammal TLPs, the conserved
C-terminal Tubby domain is required for PIP2 binding
to achieve their PM-localization (Santagata etal. 2001).
AtTLPs also contain a conserved Tubby domain at their
C-termini (Fig.2a, b), and most of them are specifically
associated with the PM in Arabidopsis cells (Fig.3). To
understand whether plant TLPs also have a conserved PIP2
binding activity for their PM targeting, we purified AtTLP3
protein and tested its PIP2 binding activity. AtTLP3 pref-
erentially bound PI(3,4)P2 and PI(4,5)P2 (Fig.4e), and
consistent with the earlier study using Arabidopsis leaf
cells (Reitz etal. 2012), the two conserved PIP2 binding
sites K187 and R189 in the Tubby domain of AtTLP3 were
critical for its accurate PM-tethering (Fig.4a, f). Notably,
AtTLP8 did not share the evolutionarily conserved PIP2
binding sites with other AtTLP proteins (Fig.2b, indicated
by two triangles), and consequently, it lost the PM tether-
ing ability and showed nucleic and cytosolic localization in
Arabidopsis protoplast (Fig.3).
It has been long suggested that in mammal, the N-termi-
nal transactivation domain endows TLPs the ability to act
as functional transcriptional factors (Boggon etal. 1999).
However, the N-terminal domains of plant TLPs are diver-
sified and evolved into an F-box domain, one of the rep-
resentative features of SCF-type E3 liagase. Actually, all
AtTLPs did not show any auto-activation activity in our
tests (Fig.3a, Fig. S1), implying the functional diversity of
TLPs between plants and animals. To further address the
question that whether AtTLPs function as ubiquitin ligase,
we constructed an interaction map between AtTLPs and
ASKs. Through yeast-two hybrid assays, we found that
AtTLP1, AtTLP3, AtTLP6, AtTLP7, AtTLP9, AtTLP10
and AtTLP11 all interacted with their corresponding ASK
partners, whereas AtTLP2, AtTLP5 and AtTLP8 did not
interact with any of the 17 tested ASK proteins (Fig.3a,
Fig. S1), with some slight difference from the previous
report (Lai and Shaw 2012). Notably, ASK11 specifically
interacted with AtTLP6 only, suggesting that AtTLP6 may
function differently from other AtTLPs. We also performed
BiFC assay to see the interaction of AtTLPs and ASK1 in
vivo. AtTLP3 and AtTLP9 were chosen as the representa-
tives of AtTLPs to be transiently expressed as a fusion
protein (AtTLP3-YN or AtTLP9-YN) in N. benthamiana.
Both of the fusion proteins interacted with ASK1-YC in
vivo (Fig. S5). Therefore, both AtTLP3 and AtTLP9 could
function as SCF-type E3 ligase to recruit their target pro-
teins to 26S proteasome for the subsequent degradation of
their target proteins. Future experiments such as yeast two-
hybridization and co-immunoprecipitation (Co-IP) will be
helpful to identify their possible target protein(s), and to
fully understand their precise functions in plants.
As mentioned previously, AtTLP9 is involved in ABA
signaling (Lai etal. 2004), and abiotic stresses such as
mannitol, NaCl and H2O2 could release the PM-tethered
AtTLP3 to the nuclei and cytosol (Reitz etal. 2012). Simi-
lar results were also observed in our experiments with
Arabidopsis protoplasts (Fig.5). Therefore, AtTLP3 could
13

482
be a new component in the abiotic stress signaling path-
way. Based on the high homology of AtTLP3 and AtTLP9
(Fig.2), we analyzed their physiological roles in atltp3-3,
atltp9-1 and atltp3-3atltp9-1 double mutants. The pheno-
typic response of atltp9-1 to ABA treatments was largely
shared by atltp3-3 and atltp3-3atltp9-1 mutants (Fig.6).
Although at lower concentration of ABA (0.5M), both
atltp9-1 and atltp3-3atltp9-1 were more tolerant to ABA
than atltp3-3. At higher concentrations of ABA (0.75M
and1M), atltp3-3atltp9-1 was more tolerant than both
atltp3-3 and atltp9-1 (Figs.7c, 8a). Further experiments
on MS plates supplemented with different concentrations
of manniol also gave similar results (Figs.7d, 8b). All
these results suggest that besides AtTLP9, AtTLP3 also
makes a contribution to the resistance to ABA and osmotic
stress, especially under higher concentrations. Generally,
osmotic stress could trigger the biosynthesis of ABA. In
return, ABA could stimulate the production of reactive
oxygen species, which functions as an important second
messenger to regulate seed germination (Kwak etal. 2003;
Pandey etal. 2004; He etal. 2012). Thus, we assume that
AtTLP3 and AtTLP9 primarily operate in a functionally
redundant manner during seed germination and early seed-
ling development. Actually, when we checked the pub-
lished literature, only several F-box proteins like DOR,
AtFBP7, EDL3 and MAX2 were involved in ABA or
abiotic stress signaling (Caldern-Villalobos etal. 2007;
Zhang etal. 2008; Koops etal. 2011; Bu etal. 2014). And
both AtFBP7 and DOR could interact with ASK14, imply-
ing the potential function of ASK14 in abictic stress sign-
aling (Caldern-Villalobos etal. 2007; Zhang etal. 2008).
We also isolated the homozygous knock-out mutants of
attlp1, attlp2, attlp3, attlp6, attlp7, attlp8, attlp10 and
attlp11 (Fig. S6). Further studies with these mutants will
provide more information about their precise functions
in plants. Taken together, our results demonstrate that
AtTLPs may play multiple roles in plant growth and adap-
tation to environmental stress, and AtTLP3 is a PM-tar-
geted protein which probably works together with AtTLP9
to modulate ABA- and osmotic stress-mediated seed ger-
mination in Arabidopsis.
Acknowledgments We thank the Arabidopsis Biological Resource
Center and the Nottingham Arabidopsis Stock Centre and GABI-
Kat (Kleinboelting etal. 2012) for providing us the T-DNA insertion
mutants; BiFC vectors were kindly provided by Dr. Guang Li (Shang-
hai Institute of Plant Physiology and Ecology, Chinese Academy of
Sciences, Shanghai, China). Vectors containing the ASK cDNAs were
kindly provided by Dr. Nadine Schumann and Dr. Marcel Quint (Inde-
pendent Junior Research Group and Department of Stress and Devel-
opmental Biology, Leibniz Institute of Plant Biochemistry, Halle,
Germany). This work has been supported by the following grants: the
National Natural Science Foundation of China 31000288, 31171169,
31100212, 31371228, 31370670; the National Basic Research Pro-
gram of China 2010CB126600; the National Mega Project of GMO
13
Plant Mol Biol (2014) 86:471483
Crops 2013ZX08001003-007, 2013ZX08004002-006; and the Strate-
gic Priority Research Program of the Chinese Academy of Sciences
XDA08030108.
Conflict of interest The authors declare that they have no conflict
of interest.
References
Bao Y, Wang CT, Jiang CM, Pan J, Zhang GB, Liu H, Zhang HX
(2014) The tumor necrosis factor receptor-associated factor
(TRAF)-like family protein SEVEN IN ABSENTIA 2 (SINA2)
promotes drought tolerance in an ABA-dependent manner in
Arabidopsis. New Phytol 202:174187
Boggon TJ, Shan WS, Santagata S, Myers SC, Shapiro L (1999)
Implication of tubby proteins as transcription factors by struc-
ture-based functional analysis. Science 286:21192125
Bu Q, Lv T, Shen H, Luong P, Wang J, Wang Z, Huang Z, Xiao L,
Engineer C, Kim TH, Schroeder JI, Huq E (2014) Regulation of
drought tolerance by the F-box protein MAX2 in Arabidopsis.
Plant Physiol 164:424439
Cai M, Qiu DY, Yuan T, Ding XH, Li HJ, Duan L, Xu CG, Li XH,
Wang SP (2008) Identification of novel pathogen-responsive
cis-elements and their binding proteins in the promoter of
OsWRKY13, a gene regulating rice disease resistance. Plant Cell
Environ 31:8696
Caldern-Villalobos L, Nill C, Marrocco K, Kretsch T, Schwech-
heimer C (2007) The evolutionarily conserved Arabidopsis thali-
ana F-box protein AtFBP7 is required for efficient translation
during temperature stress. Gene 392:106116
Cheng Y, Zhou W, El Sheery NI, Peters C, Li M, Wang X, Huang J
(2011) Characterization of the Arabidopsis glycerophosphodies-
ter phosphodiesterase (GDPD) family reveals a role of the plas-
tid-localized AtGDPD1 in maintaining cellular phosphate home-
ostasis under phosphate starvation. Plant J 66:781795
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agro-
bacterium-mediated transformation of Arabidopsis thaliana.
Plant J 16:735743
Dreher K, Callis J (2007) Ubiquitin, hormones and biotic stress in
plants. Ann Bot 99:787822
He J, Duan Y, Hua D, Fan G, Wang L, Liu Y, Chen Z, Han L, Qu LJ,
Gong ZZ (2012) DEXH box RNA helicase-mediated mitochon-
drial reactive oxygen species production in Arabidopsis mediates
crosstalk between abscisic acid and auxin signaling. Plant Cell
24:18151833
Hua Z, Vierstra RD (2004) The cullin-RING ubiquitin-protein ligases.
Annu Rev Plant Biol 62:299334
Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusion: betaglu-
curodinase as a sensitive and versatile gene fusion marker in
higher plants. EMBO J 6:39013907
Kleinboelting N, Huep G, Kloetgen A, Viehoever P, Weisshaar B
(2012) GABI-Kat SimpleSearch: new features of the Arabi-
dopsis thaliana T-DNA mutant database. Nucleic Acids Res
40:D1211D1215
Kleyn PW, Fan W, Kovats SG, Lee JJ, Pulido JC, Wu Y, Berkemeier
LR, Misumi DJ, Holmgren L, Charlat O etal (1996) Identifi-
cation and characterization of the mouse obesity gene tubby: a
member of a novel gene family. Cell 85:281290
Ko JH, Yang SH, Han KH (2006) Upregulation of an Arabidopsis
RING-H2 gene, XERICO, confers drought tolerance through
increased abscisic acid biosynthesis. Plant J 47:343355
Koops P, Pelser S, Ignatz M, Klose C, Marrocco-Selden K, Kretsch
T (2011) EDL3 is an F-box protein involved in the regulation
Plant Mol Biol (2014) 86:471483 483
of abscisic acid signalling in Arabidopsis thaliana. J Exp Bot
62:55475560
Kou YJ, Qiu DY, Wang L, Li XH, Wang SP (2009) Molecular analy-
ses of the rice tubby-like protein gene family and their response
to bacterial infection. Plant Cell Rep 28:113121
Kwak JM, Mori IC, Pei ZM, Leonhardt N, Torres MA, Dangl JL,
Bloom RE, Bodde S, Jones JD, Schroeder JI (2003) NADPH
oxidase AtrbohD and AtrbohF genes function in ROS-dependent
ABA signaling in Arabidopsis. EMBO J 22:26232633
Lai CP, Shaw JF (2012) Interaction analyses of Arabidopsis tubby-
like proteins with ASK proteins. Bot Stud 53:447458
Lai CP, Lee CL, Chen PH, Wu SH, Yang CC, Shaw JF (2004) Molec-
ular analyses of the Arabidopsis TUBBY-like protein gene fam-
ily. Plant Physiol 134:15861597
Lai CP, Chen PH, Huang JP, Tzeng YH, Chaw SM, Shaw JF (2012)
Functional diversification of theTubby-like protein gene families
(TULPs) during eukaryotic evolution. Biocatal Agric Biotechnol
1:28
Luo DX, Bernard DG, Balk J, Hai H, Cui XF (2012) The DUF59
family gene AE7 acts in the cytosolic iron-sulfur cluster assem-
bly pathway to maintain nuclear genome integrity in Arabidopsis.
Plant Cell 24:41354148
Moon J, Parry G, Estelle M (2004) The ubiquitinproteasome path-
way and plant development. Plant Cell 16:31813195
Mukhopadhyay S, Jackson PK (2011) The tubby family proteins.
Genome Biol 12:255
Noben-Trauth K, Naggert JK, North MA, Nishina PM (1996) A can-
didate gene for the mouse mutation tubby. Nature 380:534538
Pandey GK, Cheong YH, Kim KN, Grant JJ, Li LG, Hung W,
DAngelo C, Weinl S, Kudla J, Luan S (2004) The calcium sen-
sor calcineurin B-Like 9 modulates abscisic acid sensitivity and
biosynthesis in Arabidopsis. Plant Cell 16:19121924
Reitz MU, Bissue JK, Zocher K, Attard A, Huckelhoven R, Becker
K, Imani J, Eichmann R, Schafer P (2012) The subcellular locali-
zation of tubby-like proteins and participation in stress signaling
and root colonization by the mutualist Piriformospora indica.
Plant Physiol 160:349364
Reitz MU, Pai S, Imani J, Schafer P (2013) New insights into the sub-
cellular localization of tubby-like proteins and their participation
in the ArabidopsisPiriformospora indica interaction. Plant Sig-
nal Behav 8:e25198
Santagata S, Boggon TJ, Baird CL, Gomez CA, Zhao J, Shan WS,
Myszka DG, Shapiro L (2001) G-protein signaling through tubby
proteins. Science 292:20412050
Schumann N, Navarro-Quezada A, Ullrich K, Kuhl C, Quint M (2011)
Molecular evolution and selection patterns of plant F-box pro-
teins with C-terminal kelch repeats. Plant Physiol 155:835850
Stone SL, Callis J (2007) Ubiquitin ligases mediate growth and develop-
ment by promoting protein death. Curr Opin Plant Biol 10:624632
Wang C, Bao Y, Wang QQ, Zhang HX (2013) Introduction of the rice
CYP714D1 gene into Populus inhibits expression of its homolo-
gous genes and promotes growth, biomass production and xylem
fibre length in transgenic trees. J Exp Bot 64:28472857
Yang ZF, Zhou Y, Wang XF, Gu SL, Yu JM, Liang GH, Yan CJ, Xu
CW (2008) Genomewide comparative phylogenetic and molecu-
lar evolutionary analysis of tubby-like protein family in Arabi-
dopsis, rice, and poplar. Genomics 92:246253
Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts:
a versatile cell system for transient gene expression analysis.
Nature Protoco 2:15651572
Zhang Y, Xu W, Li Z, Deng XW, Wu W, Xue Y (2008) F-box pro-
tein DOR functions as a novel inhibitory factor for abscisic acid-
induced stomatal closure under drought stress in Arabidopsis.
Plant Physiol 148:21212133
13