Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
2013
H2 BIOLOGY
1 ANGLO - CHINESE 2013
2 ANDERSON 2013
3 CATHOLIC JC 2013
4 DUNMAN 2013
5 ST. ANDREW'S 2013
6 HWA CHONG INSTITUTION 2013
7 INNOVA JC 2013
8 JURONG JC 2013
9 MILLENNIA INSTITUTE 2013
10 MERIDIAN 2013
11 NATIONAL JC 2013
12 NANYANG 2013
13 PIONEER 2013
14 RAFFLES INSTITUTION 2013
15 RIVER VALLEY 2013
16 SERANGOON 2013
17 TAMPINES 2013
18 YISHUN 2013
2
3
BIOLOGY 9648/01
There are forty questions in this paper. Answer all questions. For each question there are four
possible answers, A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate
answer sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
1 If the cell shown below has been cultured in an environment where the source of nitrogen
provided is labelled radioactively, in which of the following labelled regions would we
expect to find high radioactivity?
S
A S and T only
B T and U only
C S, T and U only
D S, T, U and V
2 Which row of molecules found in the cell surface membrane have their corresponding roles
listed?
3 During the production of fruit juice, enzymes are used to break down the components of
cell walls. Which carbohydrate will be produced by this hydrolysis?
A Sucrose
B Maltose
C - glucose
D - glucose
4 Two enzyme experiments were carried out. The first, experiment X, was carried out at a
constant temperature of 37oC. During the second experiment, Y, the temperature was
increased from 37oC to 80oC.
5 A cell in the G1 phase has two homologous pairs of chromosomes. It then undergoes a
mitotic division, followed by meiosis. At the end of meiosis II, what is the total number of
chromosomes and gene loci found in all the daughter cells formed?
A 8 chromosomes and 4 times as many gene loci as the original parent cell
B 8 chromosomes and 8 times as many gene loci as the original parent cell
C 16 chromosomes and 4 times as many gene loci as the original parent cell
D 16 chromosomes and 8 times as many gene loci as the original parent cell
6 The graph represents the changes in the DNA content within a cell at different stages in the
cell cycle.
DNA
content in
a cell/
arbitrary
unit
Name the events occurring at P, Q and R, and identify the stage where meiosis is
occurring.
P Q R Meiosis occurring
at
A S phase Fertilisation Cytokinesis Y
7 The RNA triplet UAG acts as a stop codon terminating the synthesis of a polypeptide. The
diagram shows a template strand of DNA which codes for four amino acids.
3 T C C A C A C G A T G C 5
A B C D
8 Part of the amino acid sequences in normal and sickle cell haemoglobin are shown.
Which tRNA molecule is not involved in the formation of this part of the sickle cell
haemoglobin?
9 Haemoglobin is a globular protein consisting of four polypeptide chains two alpha chains
and two beta chains. In normal individuals, the gene for beta chain codes for glutamic acid
at the sixth triplet.
In individuals with sickle cell anaemia, this base triplet is changed and codes for valine.
Which aspect of the haemoglobin molecule does this mutation directly affect?
II They disrupt and inactivate the tumor suppressor genes of the host cell causing
uncontrolled cell division.
III They disrupt and inactivate the oncogenes of the host cell causing uncontrolled cell
division.
IV Their viral proteins and glycoproteins on the surface membrane of host cells cause
them to be recognized and destroyed by the bodys immune system.
V They deplete the host cell of cellular materials essential for metabolic functions.
A I, II and V
B I, II, III and V
C I, II, IV and V
D All of the above
A contains an F factor.
B has been infected by a bacteriophage.
C is virulent.
D integrates into host chromosome.
13 When the lac operon for lactose metabolism is switched off, which of the following genes
would still be expressed?
I -galactosidase gene
IV Repressor gene
A I and II
B I and III
C II, III and IV
D All of the above
14 Which of the following statements correctly describes the control of transcription for genes
in a lac operon?
A The genes are transcribed as a single transcription unit, with each gene having its own
promoter.
B Methylation of DNA causes the DNA to be tightly packed, hence RNA polymerase will
not have access to the promoter region.
C The genes have control elements such as enhancers that enable activators to bind,
hence affecting the rate of transcription.
D The genes are found next to one another on the same chromosome, and repressor
proteins act as a form of transcriptional control.
15 Housekeeping genes are expressed all the time in all cells, whereas other non-essential
genes are expressed only when needed. Under certain conditions, gene expression of
selected genes can be increased.
A A chemical is added which will increase the activity of enzyme poly-A polymerase.
B Alternative splicing links different combinations of exons together in mRNA.
C Histone methylation results in the formation of heterochromatin.
D Activator proteins will bind to silencers to speed up the rate of transcription.
Condition Effect
Lack of translation initiation factor Inhibition of translation of selected
A
proteins mRNA
Presence of repressor proteins binding Prevents small ribosomal subunit
B
to 5-UTR of selected mRNA from binding
Presence of repressor proteins to distal
C mRNA is translationally-repressed
control elements
mRNA is degraded slowly by
D mRNA with a long poly-A tail
restriction endonuclease
17 A human papillomavirus (HPV) infection may cause cervical cancer in women. Which of the
following is not a reasonable explanation for cancer development caused by HPV infection?
18 After explaining about cell structure, DNA, chromosomes, telomeres and centromeres in
great detail during lectures and tutorials, a teacher decided to conduct a simple test to
determine the level of understanding in students. The following statements were observed in
the students scripts.
III Centromeres are the protein molecules found at right angles to each other
in centrosomes, and they are absent in plant cells.
A I and II only
B III and IV only
C I, II and IV only
D All of the above
19 A genetic disorder causes degeneration of muscle tissue in humans. The diagram shows
the inheritance of such a genetic disorder in one family.
affected male
affected female
Which of the following statements can be concluded based on the diagram above?
A Individual 5 was affected with the genetic disorder as a result of genetic mutation
during his lifetime.
B Individual 10 should be an affected male too, since his brother (individual 11) was
affected with the genetic disorder.
C This genetic disorder is a sex-linked recessive trait.
D This genetic disorder is due to an autosomal dominant allele.
Probability, P
Degree of
freedom
0.10 0.05 0.02 0.01 0.001
1 2.71 3.84 5.41 6.64 10.83
2 4.61 5.99 7.82 9.21 13.82
3 6.25 7.82 9.84 11.35 16.27
4 7.78 9.49 11.67 13.28 18.47
21 A PhD student performed a cross between a pure-breeding plant that bore white flowers,
and another pure-breeding plant that also bore white flowers. All the F1 plants obtained
bore purple flowers. Upon selfing the F1 plants, a F2 phenotypic ratio of 9 purple flowers: 7
white flowers was obtained. Gene A codes for the production of enzyme A, and gene B
codes for enzyme B. The diagram below shows the metabolic pathway involved.
Enzyme A Enzyme B
White pigment White pigment Purple pigment
Which of the following statements cannot be deduced from the above information?
A The parental pure-breeding plants must have the genotype AAbb and aaBB.
B Gene A is epistatic to gene B.
C Genes A and B are found on the same chromosome.
D All the F1 plants have the genotype AaBb.
22 A genetic cross was performed between two heterozygous Drosophila fruit flies with normal
wings and red eyes. The allele for normal wings is dominant to the allele for vestigial wings,
and the allele for red eyes is dominant to the allele for white eyes.
A 1 out of 16
B 3 out of 16
C 4 out of 16
D 9 out of 16
A I only
B I and II only
C I and III only
D All of the above
24 Which of the following statements correctly compares oxidative phosphorylation and non-
cyclic photophosphorylation?
25 14
C-labelled carbon dioxide was supplied to photosynthesising algae. The relative amounts
of three organic compounds were measured. The diagram shows the results.
Relative amount
of substance /
arbitrary units
Which of the following are correct explanations for the graph above?
I GP level falls as shown in graph 2 due to the absence of reduced NADP when light is
switched off.
II GP level rises as shown in graph 1 due to the absence of ATP when light is switched
off.
III Levels of RuBP and GP are constant during periods of light as they serve as
intermediates in the Calvin cycle.
IV RuBP level falls as carboxylation of RuBP is independent of light as shown in graph 3.
V Sucrose level falls as shown in graph 3 due to the absence of ATP and reduced
NADP.
A I, II and V only
B I, II and III only
C II, III and IV only
D III, IV and V only
A 1, 2 and 4 only
B 1, 2 and 3 only
C 2 and 3 only
D 3 and 4 only
27 The diagram below shows the cell signalling pathway involving a growth factor receptor.
From the given diagram, which step is involved in the role of signal amplification?
I. Events 1 to 5 occur in the synaptic knob during the transmission of an action potential
across the synapse.
II. Event 3, 4 and 5 are critical to ensure that the action potential travels unidirectionally
across a synapse.
III. Event 5 prevents a weak signal from initiating an action potential.
IV. Event 1 is necessary for an impulse to be transmited along an axon.
A I and II only
B I and III only
C II and IV only
D III and IV only
29 Which of the following statements does not correctly compare the neutral theory of
molecular evolution and natural selection?
A Neutral theory of molecular evolution accounts for most of the differences that we
observe at the phenotypic level as compared to natural selection.
B Neutral theory of molecular evolution accounts for most of the differences that we
observe at the genotypic level as compared to natural selection.
C The rate of change in the nucleotide sequence brought about by neutral theory of
molecular evolution occurs at a constant rate due to random chance events while the
rate of change brought about by natural selection can be fast or slow depending on the
strength of the selection pressure.
D Neutral theory of molecular evolution is largely responsible for the RFLP that we
observe between species as compared to natural selection.
30 The figure below shows the alignment of amino acid residues of the alpha haemoglobin
chain of the cow and the sheep. There are a total of 142 amino acid residues in both the
alpha chain of the cow and sheep. Regions of polypeptide that form an alpha helix are
underlined while positions where amino acid residues differ between the cow and the
sheep alpha haemoglobin chain are marked with an arrow.
Amino Amino
acid acid
position position
Cow
Sheep
Cow
Sheep
Cow
Sheep
Which of the following statements can be concluded from the diagram shown above?
I. Differences between the amino acid residues between the 2 polypeptides are due to
neutral mutation brought about by the degeneracy of the genetic code.
II. Differences between the amino acid residues between the 2 polypeptides are due to
neutral mutation brought about by mutations in the introns.
III. Natural selection is one of the main driving forces that bring about the differences
between the 2 polypeptides.
IV. Differences between the amino acid sequences did not change the secondary
structure of protein.
A I and II only
B I and III only
C II and IV only
D III and IV only
31 The diagram below shows the blood glucose concentration of two persons after eating a
meal.
How can the levels of blood glucose concentrations in Jack and Jill be best explained?
I. Jack and Jill both had insulin released into their bloodstream by their pancreas after
the meal.
II. The number of glucose transporter in the cell surface membrane of the muscle cells
increased in Jill but not in Jack.
III. Lowering of blood glucose level in Jack is brought about by utilisation of glucose in
respiration and excretion through urine.
IV. Jack must have type II diabetes while Jill is a healthy individual.
A I and II only
B II and III only
C I and IV only
D II, III and IV only
32 The figure below shows the phylogeny of selected primates and their lice which live on
them. The dotted lines indicate the host of the respective lice.
A I only
B I and II only
C II and III only
D I, III and IV only
33 The figure below shows how a metalmark moth mimics a jumping spider. It does so by
having hairs on both its hind wings and forewings.
Which of the following statements best explains the evolution of spider mimicry in
metalmark moth?
A Moths mutate their genes to grow hairs on their wings in order to escape predation.
B Moths develop hairs on their wings to mimic spiders.
C Moths with hairs on their wings leave behind a higher proportion of offspring than
moths without hairy wings.
D Moths with hairy wings experience a higher selection pressure than moth without hairy
wings.
34 During the process of polymerase chain reaction (PCR), the amount of DNA synthesised
can be traced using fluorescent probes and the measurements are shown in the following
plot. The process initially goes through an exponential phase, followed by a plateau phase
eventually.
Amount
of DNA/
arbitrary
units
Number of cycles
Which of the following statements is true?
A During the exponential phase, the number of DNA molecules synthesized after 15
cycles is 152.
B During the exponential phase, the temperature is always maintained at the optimum
temperature of 72oC hence there is rapid amplification.
C During the plateau phase, the reaction mixture is being depleted of ribonucleotides.
D During the plateau phase, Taq polymerase may be denatured.
35 The insulin hormone is made up of two different polypeptide chains, A-chain and B-chain,
joined together by disulphide bonds. The human insulin gene codes for both polypeptide
chains. To produce the insulin hormone using E. coli, cDNA coding for each polypeptide
chain are inserted into separate plasmids and used to transform separate batches of
bacteria. The synthesised polypeptide chains are then mixed together to form the hormone.
Disulphide bond
Which one of the following reasons explains why the two chains have to be produced
separately?
36 A family with a history of a genetic disease is studied using restriction fragment length
polymorphism (RFLP) analysis. The mutation responsible for the disease allele produces a
RFLP which can be detected by Southern blotting using an appropriate probe. The
pedigree chart of the family is aligned with the autoradiogram obtained from Southern
blotting. (Shaded symbols in the pedigree chart indicate individuals affected by disease.)
Pedigree
chart
Autoradiogram
37 The Human Genome Project (HGP) has brought about great advancements in health and
medicine. Which of the following applications is not a result of the knowledge gained from
the HGP?
38 The following diagram shows how a stem cell can differentiate into different specialized cell
types.
Which of these statements is false with regards to the stem cells shown?
A The mass production of edible vaccines by rice plants lowers production costs
compared to traditional pharmaceutical vaccines.
B The genes coding for the cholera toxin may spread to wild plant species through cross-
pollination, causing the development of superweeds.
C Antibiotic resistance marker genes used in the process of cloning the cholera toxin
gene may lead to the development of antibiotic resistance in gut bacteria.
D The insertion of a foreign gene into the rice plant genome may lead to the production
of unknown toxic components.
40 The following diagram shows one method where gene therapy can be used to treat cystic
fibrosis. Inactivated adeno-associated virus (AAV) is used to introduce the normal gene into
lung epithelial cells.
End of Paper
1 B 21 C
2 B 22 C
3 D 23 C
4 A 24 C
5 C 25 C
6 B 26 C
7 B 27 C
8 D 28 D
9 B 29 A
10 D 30 D
11 C 31 B
12 A 32 D
13 C 33 C
14 D 34 D
15 A 35 B
16 B 36 A
17 C 37 D
18 A 38 C
19 C 39 B
20 C 40 B
27
Subject
Name Class Class Index Number
2BI
BIOLOGY 9648/03
Write your name, subject class, form class and index number on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagrams, graphs or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
TOTAL
72
1. Embryonic stem (ES) cells are highly regarded in research because their pluripotency offers the
potential for a wide range of therapeutic and research applications. However, ethical concerns
have been raised with regards to the source of ES cells.
Scientists have come up with an alternative method of generating pluripotent cells, which is to
genetically reprogramme adult cells to an embryonic stem cell-like state. Genetic reprogramming
is carried out by using deactivated retroviruses to introduce the genes of four transcription factors
into adult cells from a patient (Fig. 1.1).The reprogrammed cells, called induced pluripotent stem
(iPS) cells, are specific to the patient from which the adult cells were taken.
Fig. 1.1
It describes the potential of a cell to become/differentiate into any cell type in the
(ii) Suggest one reason why the use of iPS cells evades the ethical concerns regarding the
source of ES cells.
Ref. to iPS uses adult cells, whereas obtaining ES cells involves the destruction
of embryos; @ 1m [1]
(iii) Give three reasons why deactivated retroviruses are used for genetic reprogramming of
the adult cells rather than active retroviruses or liposomes.
*1. deactivated because they will not cause disease/will not become virulent;
2. retoviruses allow for integration of genes into host genome while liposomes
do not;
3. retroviruses are more efficient at delivering genes into the host cell than
liposomes because they target specific cells;
(iv) Suggest how the expression of such a small number of transcription factors in adult cells
could genetically reprogramme these adult cells to an embryonic stem cell-like state.
Patient-specific iPS cells can be induced to differentiate into the affected diseased tissue as this
will allow the patient's disease to be modelled in vitro. Using this diseased tissue, potential drugs
to treat the disease can be screened for, aiding in the discovery of new drugs.
Scientists have managed to obtain iPS cells from cystic fibrosis (CF) patients with a mutation at
amino acid position 508 (F508). They have caused these iPS cells to differentiate into diseased
human lung tissue, which is now being used to screen for potential drugs to treat cystic fibrosis
caused by the F508 mutation (Fig. 1.2).
Fig. 1.2
Previously, a cell line comprising rat cells expressing recombinant human mutant CFTR protein
was used for screening purposes. This cell line was successfully used to identify a drug to treat
cystic fibrosis.
(b) (i) Explain the effect of the F508 mutation on the function of the CFTR protein.
[3]
(ii) Suggest and explain one advantage of using a drug to treat CF rather than to use
liposomes to deliver a functional copy of a CFTR gene.
1. easier to regulate dosage of drug/avoid using high concentrations of
liposomes which could be toxic;
2. using the drug avoids the problem that the CFTR gene may not be properly
expressed (to form the CFTR protein); [1]
(iii) Suggest and explain one advantage of using diseased lung tissue derived from human
iPS cells to screen for CF drugs rather than the use of rat cells expressing recombinant
human CFTR.
1. ref. to iPS cells are (human cells and are) more representative of the actual
diseased cell than rat cells e.g. rat cells may have different biochemical
2. ref. to iPS cells are patient-specific and could be used to screen for drugs
specific to that patient; [1]
[Total: 13]
2. Cysteine proteinase (CP) is an enzyme that is coded by the mir-1 gene, which is found in plants
that are naturally resistant to attacks by Lepidopteran larvae. Lepidopteran larvae feeding on the
Black Mexican Sweet (BMS) maize leaf tissue cause crop losses. In an attempt to increase the
yield of BMS maize, plant biologists have used genetic technology to transform the wild-type BMS
maize callus with mir-1 gene. The growth of larvae feeding on transformed and non-transformed
BMS maize calli was studied for seven days, and the experiment was repeated. The results are
shown in Fig. 2.1.
Fig. 2.1
(a) (i) Suggest one delivery method that could be used to introduce the mir-1 gene into BMS
maize callus.
[1]
(ii) With reference to Fig. 2.1, describe and explain the effectiveness of genetically engineered
BMS maize with mir-1 gene on larvae growth.
[3]
(b) An in vitro experimental study was performed to investigate the effects of transformed BMS
plant cells expressing both cysteine proteinase (CP) and Bacillus thuringiensis (Bt) toxin on
Lepidopteran larvae. Table 2.1 shows the relative growth rate and percentage mortality of
Lepidopteran larvae fed with maize cell lines containing CP, Bt-toxin and a combination of CP
and Bt-toxin.
Table 2.1
With reference to Table 2.1, describe the effects of maize plant cells expressing CP together
with Bt-toxin on the percentage mortality of Lepidopteran larvae.
[2]
(c) Both CP and Bt-toxin target the mid-gut lumen. Fig. 2.2 shows a cross section of mid-gut. CP is
known to damage the peritrophic protein matrix of mid-gut lumen in the larvae, a structure that
protects the mid-gut from microbial infection.
Fig. 2.2
(i) With reference to Table 2.1, Fig. 2.2 and the information given, suggest how CP may
enhance the effect of Bt-toxin on Lepidopteran larvae.
[3]
(ii) Over many generations, laboratory populations of Lepidopteran larvae have evolved
resistance against Bt-toxins. Suggest and explain how this resistance is developed.
[2]
[Total: 11]
3. Fig. 3.1 below shows a schematic diagram of targeted gene replacement in a mammalian cell
involving the gene Ig M. Targeted Ig M gene replacement is a method of replacing Ig M mutated
allele (Fig. 3.1a) in the genome in a cell with wildtype allele (Fig. 3.1b) via crossing over, giving
rise to the recombinant DNA (Fig. 3.1c). The wildtype allele is carried by a linearised plasmid (Fig.
3.1b) and introduced into the cell.
As shown in Fig. 3.1b, the linearised plasmid contains an antibiotic resistance gene (Neo gene),
wildtype alllele with the exons represented by the black boxes, as well as several restrictions sites
in between the exons. In this technique, the enhancer of the Neo gene on the linearised plasmid
was removed prior to the therapy.
Ig M mutated alleleNhe1
Ava1
Sca1
Afl1
Aat1
Dra1
Kpn1
Neo gene
Linearized Fig. 3.1 b
Ig M wildtype allele plasmid
R primer
Hpa1
Aat1
Ava1
Dra1
Sca1
Fig. 3.1
Legend
Exon
Restriction sites on mutated allele Ava1, Sca1, Afl1, Nhe1
Restriction sites on wildtype allele Kpn1, Ecor1, Dra1, Aat1
Naturally occurring restriction site on Hpa1
linearised plasmid
[1]
(ii) Although the mutated and wildtype alleles are homologous regions, different restriction
sites are present in them. Explain the presence of these different restriction sites.
[2]
ACJC 9648/03 Prelim 2013 [Turn over
36
10 For
Examiners
Use
(iii) With reference to Fig. 3.1, explain how the Neo gene allows the transformed cells with
recombinant DNA to be distinguished from the transformed cells which did not undergo
recombination in their DNA.
[4]
(iv) With reference to Fig. 3.1a and Fig. 3.1b, briefly describe another method how Hpa1 can
be used to verify the identity of cells with recombinant DNA.
[4]
(v) The wildtype IgM allele was isolated from a genomic DNA library and not a cDNA library
before being introduced into the linearised plasmid. With reference to Fig. 3.1, state one
evidence which suggests this.
[1]
(b) In the gene replacement therapy shown in Fig. 3.1, the site of DNA breakage occurred
between restriction sites Sca1 and Afl1 as shown in Fig. 3.1a. In another case of therapy, the
site of DNA breakage along the mutated allele was unknown. To determine the exact site of
crossing over between the genomic DNA and the linearised plasmid, RFLP analysis was
carried out on the recombinant DNA. The recombinant DNA was isolated from the
transformed cell and amplified using PCR via the forward and reverse primers as shown in Fig.
3.1a and Fig. 3.1b. The amplified DNA products were separated into eight tubes and digested
using eight restriction enzymes respectively: Ava1, Sca1, Afl1, Nhe1, Kpn1, Ecor1, Dra1, Aat1.
The products of digestions were separated using gel electrophoresis and the results are
shown in Fig. 3.2.
Fig. 3.2
(i) With reference to Fig. 3.1 and 3.2, describe and explain the band pattern of the restriction
digest for the recombinant cell.
[3]
(ii) Hence identify the site of DNA breakage where crossing over took place in the mutated
allele.
[1]
[Total: 16]
Planning Question
4. Electroporation is a method which is routinely used to introduce foreign DNA into E. coli cells. This
involves subjecting a mixture of bacteria and plasmid to a brief electric pulse. You are required to
plan, but not carry out, an investigation into the effect of voltage on the efficiency of transformation
by electroporation.
In this investigation, the recombinant plasmid used to transform the E. coli cells is made up of two
components: the plasmid vector and the gene of interest. pGFP is a plasmid with two marker
genes, GFP and AmpR, and a number of restriction sites throughout the plasmid as shown in Fig.
4.1 below. GFP is a marker gene coding for the green fluorescent protein. Expression of GFP in
bacteria will cause bacteria to fluoresce under UV light. The gene of interest is the ras proto-
oncogene, which has been inserted into the plasmid using the restriction enzyme BmtI.
Fig. 4.1
An electroporator is a machine used to carry out electroporation. It is possible to vary the voltage
and length of the electrical pulse with this machine. The range of voltage used is typically 1400
2000 V and the length of electrical impulse between 4-6 ms. A voltage which is too high will cause
irreversible changes in membrane permeability. The mixture of bacteria and recombinant plasmid,
which must be kept on ice prior to electroporation, is put into a cuvette (Fig. 4.2) which is then
placed into a chamber in the electroporator (Fig. 4.3).
After electroporation, the mixture of bacteria must be quickly resuspended in SOC broth (a type of
growth medium) and incubated at 37C for 1 hour for the surviving cells to recover. This is then
followed by plating the bacteria on agar and incubation at 37C for 16-24 hours. The plates can
then be examined to calculate transformation efficiency.
Fig. 4.2
ACJC 9648/03 Prelim 2013 [Turn over
39
13 For
Examiners
Use
Fig. 4.3
Your planning must be based on the assumption that you have been provided with the following
equipment and materials which you must use:
Microcentrifuge tubes of 100 l E. coli cells in electroporation buffer
Microcentrifuge tubes of 1 l recombinant DNA (concentration of 0.1 g / l)
Microcentrifuge tubes of 1 l sterile water
Ice bucket with ice
Electroporator
Sterile cuvettes for electroporation (max. volume of 150l)
Agar plates with ampicillin
Sterile spreader for spreading bacterial culture on agar plate
SOC broth
Incubator
UV transilluminator (a device which emits UV light)
UV shields which provide protection from UV light
A variety of micropipettes, sterile micropipette tips and sterile 2 ml microcentrifuge tubes
[Total: 12]
Free-response question
Your answer:
5. (a) Describe and explain how bacteria can be used to mass produce human insulin without the
use of any DNA libraries. [7]
(b) Discuss the advantages and the limitations of the Polymerase Chain Reaction. [5]
(c) Discuss the implications of the Human Genome Project, including the benefits and difficult
ethical concerns for humans. [8]
[Total: 20]
1 (a) Fig 1.1 shows the protein structure of the enzyme cellulase, which is found in animals
feeding on grass such that they can digest the cellulose found in grass.
Fig. 1.1
(ii) State two differences between the structures of cellulase and its substrate.
1. Made up of amino acids vs -glucose;
E
4. With ref. to change in 3D conformation of enzyme for a better fit/ tighter
binding between substrate and enzyme;
(b) Collagen is a protein found extensively in connective tissue, bones, cartilage, dermis (skin),
blood vessels and teeth. It is a fibrous protein, and has a very distinct structure and function
from cellulase.
Describe two differences between the primary structures of collagen and cellulase.
1. Amino acid sequence in collagen is highly regular with repeating tripeptide
sequence while amino acid sequence in cellulase rarely shows regularity;
2. Amino acid sequence in collagen may vary between two samples of collagen;
while amino acid sequence in cellulase is highly specific;
3. Length of polypeptide chain varies in collagen while length of polypeptide chain For
seldom varies in cellulase; Examiner's
Use
4. More amino acids make up collagen while less amino acids make up cellulase; For
5. Modified amino acids such as hydroxylysine and hydroxyproline are found in Examiner's
Use
collagen but not cellulase;
[Total: 11]
Fig. 2.1
E
purine and a pyrimidine/2 nm wide;
5. One complete turn has 10 base pairs with length of 3.4 nm;
6. Phosphodiester bonds between adjacent deoxyribonucleotides; [3]
Any 3 @ 1m each
(b) Describe the role of the AP-1 protein in increasing the expression of the MMP-13 gene.
1. AP1 act as the activator (R! repressor) and binds to the conserved DNA region,
the enhancer (R! silencer);
2. DNA bends to bring the AP1 protein and conserved DNA region to close
proximity to the promoter/transcription initiation complex/MMP-13 gene;
3. Ref. to mediator proteins and transcription factors binding at promoter/AP-1
protein;
4. Increases the affinity of RNA polymerase to the promoter of the MMP13
gene/ enhances formation of the transcription initiation complex; @1m [3]
(c) Describe one type of histone modification that can occur in the presence of the activated
AP1 protein.
For
Examiner's
1. *Acetylation of histones; Use
2. neutralises the positively-charged R groups on histones / decreases the affinity For
Examiner's
of the histone tails for DNA; Use
OR
4. *De-methylation of histones;
5. proteins that bind to methylated histones removed;
@1m [2]
(d) MMP-13 is secreted as an inactive form. It is activated once the pro-domain is cleaved,
leaving an active enzyme that participates in collagen degradation. State this level at
which the expression of MMP-13 gene is controlled.
1. post-translational; [1]
(e) MMP-13 is involved in the degradation of the basement membrane where cells are
anchored. Tumour cells have elevated MMP-13 production and secretion. Suggest how
the elevated secretion of MMP-13 contributes to the malignant properties of the tumour
cells.
1. Metastasis/metastasizing;
E
Fig 3.1
(a) Name the structures labelled A and B.
A: Centrioles; R: Asters
For
B: Nucleolus; @1/2 m [1] Examiner's
Use
For
Examiner's
(b) State one visible feature in Fig 3.1 that enables you to identify that the cell is at Use
1. * Non-disjunction;
E
4. One daughter cell with (n+1/4) and the other (n-1/2) chromosomes/OWTTE;
5. Fusion of (n+1/4) gamete with normal gamete (3) to form 2n = 7 zygote; [3]
@ 1 m, * point essential to get full mark
[Total: 9]
4 Fig. 4.1 shows the components of the lac operon and its regulatory gene which is some
distance away.
lacO lacZ lacY IacA
lacI
Promoter (Operator)
mRNA mRNA
For
Examiner's
repressor -galactosidase lactose transacetylase Use
protein For
permease Examiner's
Use
Fig. 4.1
(a) (i) Describe what will happen to the repressor protein if lactose is present.
(c) Human DNA has been analysed and details of certain genes are shown in Table 4.1.
Gene
Insulin
Albumin
Phenyalanine
Gene size / kb
1.7
25.0
90.0
Table 4.1
mRNA size / kb
0.4
2.1
2.4
Number of introns
2
14
12
E
hydroxylase
Dystrophin 2000.0 17.0 50
(i) Calculate the average size of the introns for the albumin gene (show your workings.)
25.0 2.1
= 1.6 kb;
14 For
Examiner's
Use
[1] For
Examiner's
Use
(ii) With reference to Table 4.1, describe the relationship(s) between the gene size and the
number of introns.
[Total: 13]
(a) A phenotypically normal woman married a CLS sufferer. Using a genetic diagram,
illustrate this cross and determine the probability of the couple having a male child
E
suffering from CLS. [3]
Gametes Xr XR Y
2. 1m for both F1
genotype and F1
phenotypic ratio correct
F1 genotype: XRXr XrY
F1 phenotypic ratio: 1 CLS female : 1 normal male
0 3. 1m for correct answer
Probability of a male child suffering from CLS: ___________________
For
The Canine Genome Sequencing Project was successfully completed in year 2005. Examiner's
During the project, researchers needed to investigate two particular genes in dogs. The Use
For
genes were the amino-methyl-transferase (AMT) gene (which codes for AMT enzyme to Examiner's
degrade excess glycine), and the T-cell leukemia translocation-associated (TCTA) gene Use
(which codes for TCTA protein involved in osteoclastogenesis, the formation of osteoclasts
for the breakdown of bone tissue).
(b) To increase sample size for statistical reliability, scientists selected several
heterozygous female poodles for normal AMT phenotype and normal TCTA phenotype,
and conducted test crosses on them. The following results were observed in the
offspring.
Parental phenotype: normal AMT, normal TCTA x mutant AMT, mutant TCTA
E
1. 1m for P genotype, with
Parental genotype: (AT) (at) x (at) (at)
brackets indicating linked
genes;
F1 genotype:
R: fraction
@1 mark
(iii) The recombinant frequency between the AMT gene and the canine DAG1 gene
was found to be 8.4%, and the recombinant frequency between the TCTA gene
and DAG1 gene was found to be 8.3%. On the diagram of a chromosome below,
indicate the relative positions of the AMT, TCTA and DAG1 genes. [1]
[Total: 9 marks]
E
Fig. 6.1
(a) Describe how G protein is activated upon binding of the signal molecule to GPCR.
(b) With reference to Fig. 6.1, describe how the activated phospholipase C- results in the
activation of protein kinase C.
@ 1m
[3]
E
(e) Besides storing Ca2+, describe two other functions of the smooth endoplasmic reticulum.
1. synthesis of lipids/steroids/triglycerides/phospholipids;
Some types of protein kinase C do not require presence of Ca2+ for activation. Protein kinase C
is known to be involved in cell signalling pathways which promote cell division.
(f) Phorbol esters are plant compounds which mimic the action of DAG. Phorbol esters are
known to promote the formation of tumours. With reference to Fig. 6.1, suggest and explain
how phorbol esters can promote tumour formation.
7 The mechanisms of speciation in ferns have been studied in temperate and tropical habitats.
One group of three species from the genus Polypodium lives in rocky areas in temperate
forests in North America. Members of this group have similar morphology (form and
structure). Another group of four species from the genus Pleopeltis live at different altitudes
in tropical mountains in Mexico and Central America. Members of this group are
morphologically distinct.
Data from the different species within each group was compared in order to study the
mechanisms of speciation.
Genetic identity was determined by comparing the similarities of certain proteins and genes
in each species. Values between 0 and 1 were assigned to pairs of species to indicate the
degree of similarity in genetic identity. A value of 1 would mean that all the genetic factors
studied were identical between the species being compared.
Fig. 7.1 shows the approximate distribution in North America of the first group comprising
three species of Polypodium (Po.) and a summary of genetic identity.
IRS1
p110
E
Fig. 7.1
Fig. 7.2 shows the approximate distribution in Central America and Mexico of the second group
comprising four species of Pleopeltis (Pl.) and a summary of genetic identity.
For
Examiner's
Use
For
Examiner's
Use
Fig. 7.2
(a) State, with reasons which group, Polypodium or Pleopeltis, has most probably been
genetically isolated for a longer period of time.
1. Polypodium;
2. it has lower genetic identity values of 0.338 0.608/the highest genetic value of
0.608 in Polypodium is still lower than those of Pleopeltis/ the lowest genetic
@ 1m [4]
E
(b) Describe the distributions of the two groups of ferns within their respective geographical
locations.
1. The Polypodium species are (completely) found in different parts of the
continent/geographically separated;
2. The Pleopeltis species are much closer together / physically overlapping / share
same habitats; @ 1m
[2]
(c) Suggest how the process of speciation could have occurred in Polypodium.
1. Allopatric speciation;
2. The three species of Polypodium are geographically isolated (on different parts of
the continent);
For
3. Inherited variation is present in the (original) population of Polypodium; Examiner's
Use
4. Different habitats exert different selection pressures; For
Examiner's
Use
5. Only those with favourable traits are selected for and survive to pass on their
alleles to their offspring;
(d) According to neutralists, when one compares the genomes of existing species, the vast
majority of molecular differences, which arises from gene mutations, are selectively neutral.
Describe the effect of changing the selection pressure on populations of species which have
these neutral mutations.
1. These mutations do not affect fitness/reproductive success;
[Total: 13]
E
ribosomes at the 5-end of mRNA;
5. Ref to complementary base pairing between anti-codon of tRNA with codons of
mRNA;
6. Ref to (elongation via) peptidyl transferase catalyzing the formation of peptide bond
between amino acids;
7. As ribosome moves along mRNA in 5 to 3 direction till stop codon;
8. polyribosomes may form to increase the rate of protein synthesis;
9. Completed polypeptide released into and embedded into membrane of RER;
10. Transport vesicles with polypeptide (embedded) moved towards and fused with (cis
face of) Golgi apparatus;
11. Proteins undergo post-translational modifications in RER/GA;
12. Membrane (with embedded proteins) pinches off as secretory vesicles;
13. Vesicles travel along microtubules;
14. And fuse with plasma membrane/ cell surface membrane;
@ 1m , max 8
(b) Compare the process in which ATP molecules are synthesised during respiration with that in
photosynthesis. [6]
Similarities: For
1. Both processes involved chemiosmotic synthesis/proton gradient across Examiner's
membrane surfaces; Use
For
2. Both processes involved hydrogen carriers, ETC and ATP synthase (any 2 of 3); Examiner's
Use
Differences:
Respiration Photosynthesis
3. ATP synthesized via both substrate- ATP synthesized via
level and oxidative phosphorylation; photophosphorylation only;
5. Energy/(H+ and) electrons used for Energy/H+ and electrons used for ATP
ATP synthesis from chemical synthesis from light absorbed by
reactions/oxidation involving organic photosynthetic pigments/photolysis of
compounds; water;
E
@ 1 m max 5
Receptor
3 / cells of Islets of Langerhans are the receptors (which detect the
increase/decrease/deviation in blood glucose concentration);
4 Resulting in the (increased) secretion of insulin/glucagon;
Effector
5 The effectors are liver, fat and muscle (any 2 of 3 for insulin) / liver (for glucagon);
6 Any e.g. of corrective mechanism by effector i.e. insulin causes increase in
glycogenesis in liver/muscle cells / increase in glucose carriers in the plasma
membrane / increase in glucose uptake in fat/muscle cells / increase in rate of
respiration/ATP synthesis/ DNA/RNA synthesis OR glucagon causes increase in
glycogenolysis/gluceoneogenesis / decrease in glycogenolysis in liver cells ;
7 Insulin/glucagon brings about a decrease/increase in blood glucose levels (back to
norm);
Negative feedback
8 Ref. to negative feedback e.g. a disturbance in the system sets in motion a sequence
of events which counteracts the disturbance and brings the system to its original
state/ Negative feedback brings about change in the opposite direction restoring
stability / Negative feedback is seen when the initial increase in blood glucose
concentration brings about the subsequent decrease in blood glucose concentration
/ OWTTE;
E
Note: students need to have at 1 point from 3-5 (receptor section) AND 5-6 (effector
section) AND 8-9 (negative feedback section) to score full marks.
@1m, max 8
(b) Describe how the uni-directional transmission of nerve impulses is ensured along a
neuron and across a synapse. [6]
@ 1m
(c) With reference to sickle-cell anemia, explain how gene mutation may affect the
phenotype of a person. [6]
1. The mutation in sickle-cell anemia involves the substitution of one base, from
thymine to adenine in haemoglobin;
2. (Alteration in nucleotide sequence) changes the codon of mRNA(from GAA to GUA
and thus the amino acid sequence in a polypeptide);
3. Mutated beta-globin/haemoglobin has hydrophilic amino acid glutamic acid
replaced by hydrophobic valine;
4. Affects the conformation/tertiary structure of protein (may result in loss of protein
activity/change in function/ non-functional protein, leading to a change in
phenotype of a person);
5. At low oxygen concentrations, (the hydrophobic portion of HbS molecules stick
together, causing) the haemoglobin (HbS) molecules (to) polymerize into fibres.
E
spleen.
Points 5 to 8 (phenotype) max 3 m
@1m, max 6
For
Examiner's
Use
For
Examiner's
Use
Subject
Name Class Class Index Number
2BI
BIOLOGY 9648/03
Write your name, subject class, form class and index number on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagrams, graphs or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
TOTAL
72
1. Embryonic stem (ES) cells are highly regarded in research because their pluripotency offers the
potential for a wide range of therapeutic and research applications. However, ethical concerns
have been raised with regards to the source of ES cells.
Scientists have come up with an alternative method of generating pluripotent cells, which is to
genetically reprogramme adult cells to an embryonic stem cell-like state. Genetic reprogramming
is carried out by using deactivated retroviruses to introduce the genes of four transcription factors
into adult cells from a patient (Fig. 1.1).The reprogrammed cells, called induced pluripotent stem
(iPS) cells, are specific to the patient from which the adult cells were taken.
Fig. 1.1
It describes the potential of a cell to become/differentiate into any cell type in the
(ii) Suggest one reason why the use of iPS cells evades the ethical concerns regarding the
source of ES cells.
Ref. to iPS uses adult cells, whereas obtaining ES cells involves the destruction
of embryos; @ 1m [1]
(iii) Give three reasons why deactivated retroviruses are used for genetic reprogramming of
the adult cells rather than active retroviruses or liposomes.
*1. deactivated because they will not cause disease/will not become virulent;
2. retoviruses allow for integration of genes into host genome while liposomes
do not;
3. retroviruses are more efficient at delivering genes into the host cell than
liposomes because they target specific cells;
(iv) Suggest how the expression of such a small number of transcription factors in adult cells
could genetically reprogramme these adult cells to an embryonic stem cell-like state.
Patient-specific iPS cells can be induced to differentiate into the affected diseased tissue as this
will allow the patient's disease to be modelled in vitro. Using this diseased tissue, potential drugs
to treat the disease can be screened for, aiding in the discovery of new drugs.
Scientists have managed to obtain iPS cells from cystic fibrosis (CF) patients with a mutation at
amino acid position 508 (F508). They have caused these iPS cells to differentiate into diseased
human lung tissue, which is now being used to screen for potential drugs to treat cystic fibrosis
caused by the F508 mutation (Fig. 1.2).
Fig. 1.2
Previously, a cell line comprising rat cells expressing recombinant human mutant CFTR protein
was used for screening purposes. This cell line was successfully used to identify a drug to treat
cystic fibrosis.
(b) (i) Explain the effect of the F508 mutation on the function of the CFTR protein.
[3]
(ii) Suggest and explain one advantage of using a drug to treat CF rather than to use
liposomes to deliver a functional copy of a CFTR gene.
1. easier to regulate dosage of drug/avoid using high concentrations of
liposomes which could be toxic;
2. using the drug avoids the problem that the CFTR gene may not be properly
expressed (to form the CFTR protein); [1]
(iii) Suggest and explain one advantage of using diseased lung tissue derived from human
iPS cells to screen for CF drugs rather than the use of rat cells expressing recombinant
human CFTR.
1. ref. to iPS cells are (human cells and are) more representative of the actual
diseased cell than rat cells e.g. rat cells may have different biochemical
2. ref. to iPS cells are patient-specific and could be used to screen for drugs
specific to that patient; [1]
[Total: 13]
2. Cysteine proteinase (CP) is an enzyme that is coded by the mir-1 gene, which is found in plants
that are naturally resistant to attacks by Lepidopteran larvae. Lepidopteran larvae feeding on the
Black Mexican Sweet (BMS) maize leaf tissue cause crop losses. In an attempt to increase the
yield of BMS maize, plant biologists have used genetic technology to transform the wild-type BMS
maize callus with mir-1 gene. The growth of larvae feeding on transformed and non-transformed
BMS maize calli was studied for seven days, and the experiment was repeated. The results are
shown in Fig. 2.1.
Fig. 2.1
(a) (i) Suggest one delivery method that could be used to introduce the mir-1 gene into BMS
maize callus.
[1]
(ii) With reference to Fig. 2.1, describe and explain the effectiveness of genetically engineered
BMS maize with mir-1 gene on larvae growth.
[3]
(b) An in vitro experimental study was performed to investigate the effects of transformed BMS
plant cells expressing both cysteine proteinase (CP) and Bacillus thuringiensis (Bt) toxin on
Lepidopteran larvae. Table 2.1 shows the relative growth rate and percentage mortality of
Lepidopteran larvae fed with maize cell lines containing CP, Bt-toxin and a combination of CP
and Bt-toxin.
Table 2.1
With reference to Table 2.1, describe the effects of maize plant cells expressing CP together
with Bt-toxin on the percentage mortality of Lepidopteran larvae.
[2]
(c) Both CP and Bt-toxin target the mid-gut lumen. Fig. 2.2 shows a cross section of mid-gut. CP is
known to damage the peritrophic protein matrix of mid-gut lumen in the larvae, a structure that
protects the mid-gut from microbial infection.
Fig. 2.2
(i) With reference to Table 2.1, Fig. 2.2 and the information given, suggest how CP may
enhance the effect of Bt-toxin on Lepidopteran larvae.
[3]
(ii) Over many generations, laboratory populations of Lepidopteran larvae have evolved
resistance against Bt-toxins. Suggest and explain how this resistance is developed.
[2]
[Total: 11]
3. Fig. 3.1 below shows a schematic diagram of targeted gene replacement in a mammalian cell
involving the gene Ig M. Targeted Ig M gene replacement is a method of replacing Ig M mutated
allele (Fig. 3.1a) in the genome in a cell with wildtype allele (Fig. 3.1b) via crossing over, giving
rise to the recombinant DNA (Fig. 3.1c). The wildtype allele is carried by a linearised plasmid (Fig.
3.1b) and introduced into the cell.
As shown in Fig. 3.1b, the linearised plasmid contains an antibiotic resistance gene (Neo gene),
wildtype alllele with the exons represented by the black boxes, as well as several restrictions sites
in between the exons. In this technique, the enhancer of the Neo gene on the linearised plasmid
was removed prior to the therapy.
Ig M mutated alleleNhe1
Ava1
Sca1
Afl1
Aat1
Dra1
Kpn1
Neo gene
Linearized Fig. 3.1 b
Ig M wildtype allele plasmid
R primer
Hpa1
Aat1
Ava1
Dra1
Sca1
Fig. 3.1
Legend
Exon
Restriction sites on mutated allele Ava1, Sca1, Afl1, Nhe1
Restriction sites on wildtype allele Kpn1, Ecor1, Dra1, Aat1
Naturally occurring restriction site on Hpa1
linearised plasmid
[1]
(ii) Although the mutated and wildtype alleles are homologous regions, different restriction
sites are present in them. Explain the presence of these different restriction sites.
[2]
ACJC 9648/03 Prelim 2013 [Turn over
68
10 For
Examiners
Use
(iii) With reference to Fig. 3.1, explain how the Neo gene allows the transformed cells with
recombinant DNA to be distinguished from the transformed cells which did not undergo
recombination in their DNA.
[4]
(iv) With reference to Fig. 3.1a and Fig. 3.1b, briefly describe another method how Hpa1 can
be used to verify the identity of cells with recombinant DNA.
[4]
(v) The wildtype IgM allele was isolated from a genomic DNA library and not a cDNA library
before being introduced into the linearised plasmid. With reference to Fig. 3.1, state one
evidence which suggests this.
[1]
(b) In the gene replacement therapy shown in Fig. 3.1, the site of DNA breakage occurred
between restriction sites Sca1 and Afl1 as shown in Fig. 3.1a. In another case of therapy, the
site of DNA breakage along the mutated allele was unknown. To determine the exact site of
crossing over between the genomic DNA and the linearised plasmid, RFLP analysis was
carried out on the recombinant DNA. The recombinant DNA was isolated from the
transformed cell and amplified using PCR via the forward and reverse primers as shown in Fig.
3.1a and Fig. 3.1b. The amplified DNA products were separated into eight tubes and digested
using eight restriction enzymes respectively: Ava1, Sca1, Afl1, Nhe1, Kpn1, Ecor1, Dra1, Aat1.
The products of digestions were separated using gel electrophoresis and the results are
shown in Fig. 3.2.
Fig. 3.2
(i) With reference to Fig. 3.1 and 3.2, describe and explain the band pattern of the restriction
digest for the recombinant cell.
[3]
(ii) Hence identify the site of DNA breakage where crossing over took place in the mutated
allele.
[1]
[Total: 16]
Planning Question
4. Electroporation is a method which is routinely used to introduce foreign DNA into E. coli cells. This
involves subjecting a mixture of bacteria and plasmid to a brief electric pulse. You are required to
plan, but not carry out, an investigation into the effect of voltage on the efficiency of transformation
by electroporation.
In this investigation, the recombinant plasmid used to transform the E. coli cells is made up of two
components: the plasmid vector and the gene of interest. pGFP is a plasmid with two marker
genes, GFP and AmpR, and a number of restriction sites throughout the plasmid as shown in Fig.
4.1 below. GFP is a marker gene coding for the green fluorescent protein. Expression of GFP in
bacteria will cause bacteria to fluoresce under UV light. The gene of interest is the ras proto-
oncogene, which has been inserted into the plasmid using the restriction enzyme BmtI.
Fig. 4.1
An electroporator is a machine used to carry out electroporation. It is possible to vary the voltage
and length of the electrical pulse with this machine. The range of voltage used is typically 1400
2000 V and the length of electrical impulse between 4-6 ms. A voltage which is too high will cause
irreversible changes in membrane permeability. The mixture of bacteria and recombinant plasmid,
which must be kept on ice prior to electroporation, is put into a cuvette (Fig. 4.2) which is then
placed into a chamber in the electroporator (Fig. 4.3).
After electroporation, the mixture of bacteria must be quickly resuspended in SOC broth (a type of
growth medium) and incubated at 37C for 1 hour for the surviving cells to recover. This is then
followed by plating the bacteria on agar and incubation at 37C for 16-24 hours. The plates can
then be examined to calculate transformation efficiency.
Fig. 4.2
ACJC 9648/03 Prelim 2013 [Turn over
71
13 For
Examiners
Use
Fig. 4.3
Your planning must be based on the assumption that you have been provided with the following
equipment and materials which you must use:
Microcentrifuge tubes of 100 l E. coli cells in electroporation buffer
Microcentrifuge tubes of 1 l recombinant DNA (concentration of 0.1 g / l)
Microcentrifuge tubes of 1 l sterile water
Ice bucket with ice
Electroporator
Sterile cuvettes for electroporation (max. volume of 150l)
Agar plates with ampicillin
Sterile spreader for spreading bacterial culture on agar plate
SOC broth
Incubator
UV transilluminator (a device which emits UV light)
UV shields which provide protection from UV light
A variety of micropipettes, sterile micropipette tips and sterile 2 ml microcentrifuge tubes
[Total: 12]
Free-response question
Your answer:
5. (a) Describe and explain how bacteria can be used to mass produce human insulin without the
use of any DNA libraries. [7]
(b) Discuss the advantages and the limitations of the Polymerase Chain Reaction. [5]
(c) Discuss the implications of the Human Genome Project, including the benefits and difficult
ethical concerns for humans. [8]
[Total: 20]
1 Embryonic stem (ES) cells are highly regarded in research because their pluripotency offers the
potential for a wide range of therapeutic and research applications. However, ethical concerns
have been raised with regards to the source of ES cells.
Scientists have come up with an alternative method of generating pluripotent cells, which is to
genetically reprogramme adult cells to an embryonic stem cell-like state. Genetic reprogramming
is carried out by using deactivated retroviruses to introduce the genes of four transcription factors
into adult cells from a patient (Fig. 1.1).The reprogrammed cells, called induced pluripotent stem
(iPS) cells, are specific to the patient from which the adult cells were taken.
Fig. 1.1
It describes the potential of a cell to become/differentiate into any cell type in the
(ii) Suggest one reason why the use of iPS cells evades the ethical concerns regarding the
source of ES cells.
Ref. to iPS uses adult cells, whereas obtaining ES cells involves the destruction /
endangering / risk of embryos;
A! pts
@ 1m
[1]
(iii) Give three reasons why deactivated retroviruses are used for genetic reprogramming of
the adult cells rather than active retroviruses or liposomes.
*1. deactivated because they will not cause disease/infect other cells /will not
become virulent;
2. retoviruses allow for integration of genes into host genome while liposomes
do not;
3. retroviruses are more efficient at delivering genes into the host cell than
liposomes because they target specific cells while liposome does not fuse with
target cell;
(iv) Suggest how the expression of such a small number of transcription factors in adult cells
could genetically reprogramme these adult cells to an embryonic stem cell-like state.
Patient-specific iPS cells can be induced to differentiate into the affected diseased tissue as
this will allow the patient's disease to be modelled in vitro. Using this diseased tissue, potential
drugs to treat the disease can be screened, aiding in the discovery of new drugs.
Scientists have managed to obtain iPS cells from cystic fibrosis (CF) patients with a mutation
at amino acid position 508 (F508). They have caused these iPS cells to differentiate into
diseased human lung tissue, which is now being used to screen for potential drugs to treat
cystic fibrosis caused by the F508 mutation (Fig. 1.2)
Fig. 1.2
Previously, a cell line comprising of rat cells expressing recombinant human mutant CFTR
was used for screening purposes. This cell line was successfully used to identify a drug to
treat cystic fibrosis.
(v) Explain the effect of the F508 mutation on the function of the CFTR protein.
[3]
(vi) Suggest and explain one advantage of using a drug to treat CF rather than to use
liposomes to deliver a functional copy of a CFTR gene.
1. easier to regulate dosage of drug/avoid using high concentrations of
liposomes which could be toxic;
2. using the drug avoids the problem that the CFTR gene may not be properly
expressed (to form the CFTR protein); [1]
3. Drug is able to travel to many/most parts of body and treat all affected parts
whereas liposomes are able to treat only localised areas; (note: liposomes can
be injected into the blood stream but the e.g. in the notes relates to the
treatment of a localised area)
4. Drug with (specific 3D config) can bind to specific cells while liposome are
not specific in targeting cell
(vii) Suggest and explain one advantage of using diseased lung tissue derived from human
iPS cells to screen for CF drugs rather than the use of rat cells expressing recombinant
human CFTR.
1. ref. to iPS cells are (human cells and are) more representative of the actual
diseased cell than rat cells e.g. rat cells may have different biochemical
pathways (which affect CFTR protein or drug)/ OWTTE;
2. ref. to iPS cells are patient-specific and could be used to screen for drugs
specific to that patient (i.e. personalised treatment); [1]
[Total: 13]
2 (a) Cysteine proteinase (CP) is an enzyme that is coded by mir-1 gene, which is found in plants
that are naturally resistant to attacks by Lepidopteran larvae. Lepidopteran larvae feeding on
the Black Mexican Sweet (BMS) maize leaf tissue causes crop losses. In an attempt to
increase the yield of BMS maize, plant biologists have used genetic technology to transform
the wild-type BMS maize callus with mir-1 gene. The growth of larvae feeding on transformed
and non-transformed BMS maize calli was studied for seven days, and the experiments were
repeated twice. The results are shown in Fig. 2.1.
Fig. 2.1
(i) Suggest one delivery method that could be used to introduce the mir-1 gene into BMS maize
callus.
1. Ref. to the use of gene gun/soil bacterium/ Agrobacterium/Electroporation; @ 1m
(ii) With reference to Fig. 2.1, describe and explain the effectiveness of genetically engineered
BMS maize with mir-1 gene on larvae growth.
1. Larvae feeding on transformed BMS maize have a decreased larvae growth /
lower weight (as compared to that of the untransformed BMS maize);
2. Ref. to 140 mg as shown in exp. 1 as compared to 25 mg for larvae feeding on
transformed maize callus
OR
(85 - 86) mg as shown in exp. 2 for larvae feeding on untransformed maize callus
compared to (28-30) mg as shown for larvae feeding on transformed maize
callus; @ 1m
3. CP/mir-1 protein was expressed in transformed BMS maize callus and
ingested/eaten/consumed by larvae (which slows down/reduces/stunts their
growth);
[3]
(b) An in vitro experimental study was performed to investigate the effects of transformed BMS
plant cells expressing both cysteine proteinase (CP) and Bacillus thuringiensis (Bt) toxin on
Lepidopteran larvae. Table 2.1 shows the relative growth rate and percentage mortality of
Lepidopteran larvae fed with maize cell lines containing CP, Bt-toxin and a combination of CP
and Bt-toxin.
Table 2.1
With reference to Table 2.1, describe the effects of maize plant cells expressing CP together
with Bt-toxin on the percentage mortality of Lepidopteran larvae.
[2]
(c) Both CP and Bt-toxin target the mid-gut lumen. Fig 2.2 shows a section of mid-gut. CP is
known to damage the peritrophic protein matrix of mid-gut lumen in the larvae, a structure that
protects the mid-gut from microbial infection.
Fig. 2.2
(i) With reference to Table 2.1 and information given above, suggest how CP may enhance
the effect of Bt-toxin on Lepidopteran larvae.
1. ref. to 4% mortality (relative growth rate 0.568 A.U.) due to Bt toxin alone;
(ii) Over many generations, laboratory populations of Lepidopteran larvae have evolved
resistance against Bt-toxins. Suggest and explain how the resistance is developed.
[Total: 11]
3. Fig. 3.1 below shows a schematic diagram of targeted gene replacement in a mammalian cell
involving the gene Ig M. Targeted Ig M gene replacement is a method of replacing Ig M mutated
allele (Fig. 3.1a) in the genome in a cell with wildtype allele (Fig. 3.1b) via crossing over, giving
rise to the recombinant DNA (Fig. 3.1c). The wildtype allele is carried by a linearised plasmid (Fig.
3.1b) and introduced into the cell.
As shown in Fig. 3.1b, the linearised plasmid contains an antibiotic resistance gene (Neo gene),
wildtype alllele with the exons represented by the black boxes, as well as several restrictions sites
in between the exons. In this technique, the enhancer of the Neo gene on the linearised plasmid
was removed prior to the therapy.
Ig M mutated alleleNhe1
Ava1
Sca1
Afl1
Aat1
Dra1
Kpn1
Neo gene
Linearized Fig. 3.1 b
Ig M wildtype allele plasmid
R primer
Hpa1
Aat1
Ava1
Dra1
Sca1
Fig. 3.1
Legend
Exon
Restriction sites on mutated allele Ava1, Sca1, Afl1, Nhe1
Restriction sites on wildtype allele Kpn1, Ecor1, Dra1, Aat1
Naturally occurring restriction site on Hpa1
linearised plasmid
ii. Although the mutated and wildtype alleles are homologous regions, different restriction
sites are present on them. Explain the presence of these different restriction sites.
1. (Single) DNA polymorphism / changes in DNA sequences between individual /
mutation;
R! RFLP [2]
ACJC 9648/03 Prelim 2013 [Turn over
83
9 For
Examiners
Use
iii. With reference to Fig 3.1, explain how the Neo gene allows the transformed cells with
recombinant DNA to be distinguished from transformed cells which did not undergo
recombination in their DNA.
1. Cells that were transformed with subsequent recombination in the
chromosome/DNA would survive in the presence of neomycin;
A! Neo antibiotic or just a/the antibiotic. R! antibiotics.
2. Transformed cell without recombination event would not survive
3. Neo gene from vector would come under the control of an active enhancer
4. High expression of neo gene confers resistance against neomycin. A!
comparison.
5. No /low expression of neo gene due to absence of enhancer in linearized
plasmid / absence of Neo gene on genomic fragment;
[4]
iv. With reference to Fig 3.1a and Fig.3.1 b, briefly describe another method how Hpa1 can be
used to verify the identity of cells with recombinant DNA.
v. The wildtype IgM allele was isolated from a genomic DNA library and not a cDNA library
before being introduced into the linearized plasmid. With reference to Fig. 3.1 state one
evidence which suggest so.
b) In the gene replacement therapy shown in Fig. 3.1, the site of DNA breakage occurred
between restriction sites Sca1 and Afl1 as shown in Fig. 3.1a. In another case of therapy, the
site of DNA breakage along the mutated allele was unknown. To determine the exact site of
crossing over between the genomic DNA and the linearised plasmid, RFLP analysis was
carried out on the recombinant DNA. The recombinant DNA was isolated from the
transformed cell and amplified using PCR via the forward and reverse primers as shown in Fig.
3.1a and Fig. 3.1b. The amplified DNA products were separated into eight tubes and digested
using eight restriction enzymes respectively: Ava1, Sca1, Afl1, Nhe1, Kpn1, Ecor1, Dra1, Aat1.
The products of digestions were separated using gel electrophoresis and the results are
shown in Fig. 3.2.
Fig .3.2
(i) With reference to Fig.3.1 and 3.2, describe and explain the band pattern of the restriction
digest for the recombinant cell.
1. presence of 2 restriction fragments each using Ava1, Ecor1, Dra1 and Aat1
digest;
2. Indicates presence of restriction sites on recombinant DNA.
3. digest with Sca1, Afl1, Nhe1 and Kpn1 yields no bands,
4. indicating absence of restriction sites;
5. Ref. to explanation linking action of named restriction enzyme/position of a
named restriction site (Ava1, Ecor1, Dra1 and Aat1) on the size of the fragments
produced;
[3]
(ii) Hence identify the site of DNA breakage where crossing over took place in the mutated
allele.
[1]
[Total: 16]
Planning Question
4 Electroporation is a method which is routinely used to introduce foreign DNA into E. coli cells. This
involves subjecting a mixture of bacteria and plasmid to a brief electric pulse. You are required to
plan, but not carry out, an investigation into the effect of voltage on the efficiency of transformation
by electroporation.
In this investigation, the recombinant plasmid used to transform the E. coli cells is made up of two
components: the plasmid vector and the gene of interest. pGFP is a plasmid with two marker
genes, GFP and AmpR, and a number of restriction sites throughout the plasmid as shown in Fig.
4.1 below. GFP is a marker gene coding for the green fluorescent protein. Expression of GFP in
bacteria will cause bacteria to fluoresce under UV light. The gene of interest is the ras proto-
oncogene, which has been inserted into the plasmid using the restriction enzyme BmtI.
Fig. 4.1
An electroporator is a machine used to carry out electroporation. It is possible to vary the voltage
and length of the electrical pulse with this machine. The range of voltage used is typically 1400
2000 V and the length of electrical impulse between 4-6 ms. A voltage which is too high will cause
irreversible changes in membrane permeability. The mixture of bacteria and recombinant plasmid,
which must be kept on ice prior to electroporation, is put into a cuvette (Fig. 4.2) which is then
placed into a chamber in the electroporator (Fig. 4.3).
After electroporation, the mixture of bacteria must be quickly resuspended in SOC broth (a type of
growth medium) and incubated at 37C for 1 hour for the surviving cells to recover. This is then
followed by plating the bacteria on agar and incubation at 37C for 16-24 hours. The plates can
then be examined to calculate transformation efficiency.
Fig. 4.2
Fig. 4.3
Transformation efficiency can be calculated using the following equation: -
Your planning must be based on the assumption that you have been provided with the following
equipment and materials which you must use:
Microcentrifuge tubes of 100 l E. coli cells in electroporation buffer
Microcentrifuge tubes of 1 l recombinant DNA (concentration of 0.1 g / l)
Microcentrifuge tubes of 1 l sterile water
Ice bucket with ice
Electroporator
Sterile cuvettes for electroporation (max. volume of 150l)
Agar plates with ampicillin
Sterile spreader for spreading bacterial culture on agar plate
SOC broth
Incubator
UV transilluminator (a device which emits UV light)
UV shields which provide protection from UV light
A variety of micropipettes, sterile micropipette tips and sterile 2 ml microcentrifuge tubes
2 At least 5 different voltages (between 1400 to 2000 V), regular spacing between intervals
3 (a) Constant volume of E. coli cells (eg. 100l) and
(b) constant volume of recombinant DNA (eg. 1l)
4 Specify time for incubation of bacteria and recombinant plasmid in ice (1 - 20 minutes). A!
incubate together or separately.
5 Specify fixed time for electroporation (4 6 ms)
6 Specify fixed vol of SOC (>2ml ) and incubate at 37C for 1 hr
7 (a) Incubate the plates at 37C
(b) for fixed no. of hours between 16-24hr R! overnight
8 Control experiment (a) E. coli cells + sterile water subjected to electroporation (no
colonies observed)
(b) subjected to same conditions as mixtures with plasmid / repeat exp/ OWTTE
9 Count number of colonies which fluoresce under UV light
10 (a) Replicates
(b) At least two repeats
11 Tabulation:
(a) Ref to colony count
(c) Average transformation efficiency/cfu g1 under different voltages/V tabulated with correct
headings and units
12 Plot graph (with trend line) of ave. transformation efficiency/ cfu g1 against voltage/ V A!
ECF for colonies and units.
13 Drawing of Petri dish with fluorescent colonies labelled
14 Two safety precautions / risk hazards identified
(a) Wear gloves when handling E. coli to avoid contact with microorganisms
(b) Wipe table with antiseptic solution (such as ethanol/chlorox) to prevent growth of harmful
microorganisms
(c) Use the UV shields to cut down on exposure to UV light
(d) Proper disposal/treatment of contaminated materials or equipment using sterilizer/
autoclave to prevent growth of harmful microorganisms
(e) Handle (plug of) electroporator with dry hands to prevent electrocution.
Max 10 for 2 14
Free-response question
5 (a) Describe and explain how a bacteria can be used to mass produce human insulin without the
use of any DNA libraries. [7]
1. using isolated mRNA for insulin ( from human pancreatic cells as template) forming
cDNA using reverse transcriptase/reverse transcribe / OWTTE
2. DNA linkers (containing the restriction site) added to cDNA using (DNA ligase)
3. digest plasmids (containing lacZ and ampR or any antibiotic marker genes) and the
cDNA with the a/same RE to produce sticky ends. (A! reference to plasmids cut within
lacZ by RE)
4. mix the cDNA and the plasmids together and let the sticky ends anneal by H bonds by
complementary base pairing
5. Add DNA ligase to covalently join the fragments with phosphodiester bonds (covalent
bond to form recombinant plasmids)
6. transform bacteria / electroporation / heat shock
7. plate the transformed bacterial cells onto nutrient agar plate with ampicillin and X-gal
added into the medium
8. select colonies which are white in colour as these are the ones with recombinant
plasmid (R! bacteria appears white)
9. due to inactivation of Lac z gene
*10. selected bacteria grown (in large quantities) in a suitable medium and bacteria
secrete insulin which is extracted, (purified and packaged for use)
(b) Discuss the advantages and the limitations of the Polymerase Chain Reaction. [5]
Limitations: (@1m)
6. Need to first know the nucleotide sequence of at least one short DNA sequence
on each side of the region of interest in order to synthesise the PCR primers;
7. Some errors can be introduced into the amplified DNA copies at low but
significant frequencies / Due to lack of a built-in proofreading activity in Taq
polymerase, PCR produces a higher than normal frequency of replication errors;
(c) Discuss the implications of the Human Genome Project, including the benefits and difficult
ethical concerns for humans. [ 8]
Benefits max 4
Pharmacogenetics (max 1)
5 The HGP allows scientists/doctors to know which genes/alleles/polymorphisms affect a
persons response to a drug / genetic differences affect the way we react to a drug;
6 It is (theoretically) possible to tailor drugs/treatments to fit patients genome for greater
efficacy / avoiding dangerous side effects / personalized medicine based on personal
genotype;
Gene therapy
7 (Since gene sequences are now readily available and we better understand which
genes/alleles/polymorphisms are associated with which diseases,) it is possible to use
gene therapy to treat certain diseases;
Concerns max 4
Ethical and social concerns
i) Privacy and confidentiality of genetic information.
20 The issue of who owns (and controls) genetic information individual or
company/researcher/government;
ii) Fairness in the use of genetic information by insurers, employers, courts, schools,
adoption agencies, and the military, among others.
21 The issue of how insurers/employers/courts/schools/adoption agencies/military may
request for/use DNA testing/have access to personal genetic information to
discriminate people based on their genomes;
vi) Conceptual and philosophical implications regarding human responsibility, free will vs
genetic determinism, and concepts of health and disease. (Max 1)
30 The issue of to what extent is a persons behaviour influenced by his genome (instead
of the environment/choices)
31 The issue of defining what is considered a disorder and what is within the limits of
normality.
CANDIDATE
NAME
PDG
PDG INDEX NUMBER
BIOLOGY 9648/01
Paper 1 Multiple Choice 4 September 2013
1 hour 15 mins
There are forty questions on this paper. Answer all questions. For each question there are four
possible answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer
Sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
1 Which row is correct for each of the components found on the cell surface membrane?
Structure Function
I W Manufactures carbohydrates
II X Manufactures rRNA
III Y Regulates the movement of substances
IV Z Separates the cell from the external environment
A II only
B III only
C I and IV only
D II, III and IV only
94
4
A dehydrogenation
B condensation
C enzymatic hydrolysis
D oxidation
95
5
Fig. 6.1.
X-ray diffraction analysis was used to determine the structure of caspase 1 when bound to one of the
inhibitors and to compare it with the active and inactive structures. The enzymes shape when one
such inhibitor was bound resembled the inactive caspase 1 more than the active form as shown in
Fig. 6.1.
Which of the following explains how the allosteric inhibitory site on caspase 1 controls enzymatic
activity?
A C
Stages
8 What is the basis for the difference in the synthesis of the leading and lagging strands of DNA
molecules?
A 2 and 4
B 1 and 3
C 1 and 4
D 2 and 3
98
8
9 Three experiments were carried out to investigate the mode of DNA replication in bacteria.
Experiment 1: Bacteria were grown for many generations with only the light isotope of nitrogen,
14
N, and then allowed to replicate once with the light isotope, 15N.
Experiment 2: Bacteria were grown for many generations with only the heavy isotope of nitrogen,
15
N, and then allowed to replicate once with the light isotope, 14N.
Experiment 3: Bacteria were grown for many generations with only the heavy isotope of nitrogen,
15
N, and then allowed to replicate twice with the light isotope, 14N.
The figure shows possible DNA molecules U to Z and indicates the varying proportion of nitrogen
isotopes present in each DNA molecule.
Which of the following products shows the semi-conservative mode of DNA replication?
10 An antibiotic, edeine, was isolated. It inhibits protein synthesis but has no effect on either DNA
synthesis or RNA synthesis. When added to a translation mixture containing fully intact organelles,
edeine stops haemoglobin translation after 10 seconds.
Analysis of the edeine-inhibited mixture by centrifugation showed that no polyribosomes remained by
the time protein synthesis had stopped. Instead, all the mRNA accumulated, together with small
ribosomal subunit and initiator tRNA.
A 1 and 4
B 1 and 2
C 2 and 3
D 2 and 4
100
10
12 The diagram below shows an electron micrograph of viruses entering into a T helper cell.
1 Most of the components found on the plasma membrane of X can be found on the envelope of
Y.
2 X and Y have the same type of nucleic acid.
3 Y enters by endocytosis.
4 Transduction occurs after Y successfully integrates its nucleic acid inside X.
A 1 only
B 1 and 3 only
C 2 and 4 only
D 3 and 4 only
13 Patients infected with the human immunodeficiency virus (HIV) tend to develop a cancer called
Kaposi Sarcoma. Which is the correct order of steps to explain how HIV causes this cancer?
A 1423
B 2314
C 1234
D 1243
101
11
14 The photomicrographs below show two different processes occurring in two different species of
bacteria.
Process 1 Process 2
Which of the following statements is/are true of both processes?
1 For both processes, only bacteria with genes that code for cytoplasmic bridge are involved.
2 Process 1 requires direct contact between 2 different bacteria whereas process 2 can occur
with 1 bacterium.
3 Process 1 will result in an increase in the number of identical bacteria whereas process 2 will
result in an increase in the number of different bacteria.
4 Both processes involve DNA replication.
A 1 and 3 only
B 2 and 4 only
C 1, 2 and 4 only
D All of the above
15 If glucose and lactose are both absent from the growth medium, and the lac structural genes are
expressed efficiently, what would you suspect about the condition of the E.coli cell?
A 1 and 2 only
B 2 and 3 only
C 3 and 4 only
D 1, 2 and 4 only
102
12
16 The figure below shows the relative distributions of four types of mRNA molecules along the head-to-
tail axis in the cytoplasm of a Drosophila fertilized egg.
bicoid protein binds to the 3 untranslated region of caudal mRNA to interfere with the
interaction between 3 poly-A tail and 5 cap
bicoid protein is also a specific transcription factor that binds to the enhancer of the
hunchback gene
nanos protein inhibits translation of hunchback mRNA
Using the information given above, determine which one of the following graphs shows the relative
protein distribution along the head-to-tail axis of this fertilized egg.
B
103
13
17 In a laboratory, the 5 7-methylguanosine cap and the length of the polyA tail of an mRNA
transcript are altered in order to examine their effects on the number of functional proteins
translated.
mRNA Alteration
1 5 cap removed with 1000-adenine tail
2 5 cap removed with 500-adenine tail
3 5cap present with 500-adenine tail
4 5cap present with 300-adenine tail
Using the information given in the table above, predict the relative amount of protein
produced in the descending order (greatest least).
A 1,3,2,4
B 1,2,3,4
C 3,1,4,2
D 3,4,1,2
104
14
18 The diagram below illustrates the development of colorectal cancers.
Which of these statements can be inferred from this multistep model of carcinogenesis?
I Cells whose APC and -catenin genes are inactivated have lost density dependent inhibition.
II APC and -catenin genes are tumour suppressor genes.
III High levels of Ras protein are produced only when both copies of Ras gene are mutated.
IV Two copies of normal p53 alleles must be present to inhibit cell division.
V Gain-of-function mutation in COX-2 gene is a pre-requisite for the formation of carcinoma.
A I, II and III
B II, III and IV
C I, II and V
D II, III and V
105
15
19 Questions 19 and 20 refer to the following pedigree chart.
Blue eyes
Green eyes
Yellow eyes
A II only
B I and III only
C II and III only
D All of the above
21 In Shorthorn cattle, the allele for hornless is dominant to the allele for the presence of horns. Coat
colour can be red (genotype CRCR), roan (genotype CRCW) or white (genotype CWCW). A roan bull,
106
16
heterozygous for the hornless trait, is crossed with a cow of the same genotype.
What is the probability that a calf from this cross would have the same genotype as its parents?
A 1/4
B 3/8
C 1/2
D 3/4
22 A yellow flower, green-stemmed plant with the genotype YYrr was crossed with a white flower, red-
stemmed plant with the genotype yyRR. The F1 plants were allowed to self fertilise, A 2 test was
carried out on the results obtained for the F2 generation. Part of the table of values for 2 is shown.
What is the probability of this value of 2 and do the results fit the expected ratio?
results fit
probability
expected ratio
A between 0.01 and 0.05 No
B between 0.01 and 0.05 Yes
C between 0.05 and 0.1 Yes
D between 0.1 and 0.5 No
107
17
23 Fig. 23A and Fig. 23B show the results of two separate experiments on carbon dioxide fixation in
photosynthesis using a unicellular green alga and the radioactive isotope 14C to label carbon
dioxide. The algae were actively photosynthesizing before the start of both experiments.
Light Dark
R
Relative
quantity of
each
radioactive
labelled
substance
(Fig. 23A)
S
addition of time / s
14
CO2 14
CO2
Concentration
reduced
1% 14CO2 0.003% 14CO2
Relative
quantity of T
each
radioactive
labelled
substance
U
(Fig. 23B)
time / s
With reference to Fig. 23A and 23B, identify the graphs R, S, T, and U.
R S T U
25 When cyanide is bound to cytochrome oxidase, the cell can no longer produce ATP aerobically.
Which statement below best explains this?
A It prevents reduced NADP from being oxidised to NADP, hence preventing electron flow
down the electron transport chain.
B It prevents oxygen from accepting electrons and protons to form water, hence preventing
electron flow down the electron transport chain.
C It prevents photolysis from occurring to produce oxygen.
D It prevents pyruvate from being synthesised in glycolysis, hence stopping the Krebs cycle.
26 Which of the following shows correctly the differences in the products of glycolysis and Krebs cycle
per glucose molecule?
27 Certain drugs act at synapses and affect the action of neurotransmitter substances. The table
shows the effects of four different drugs.
Drug Effect
1 Inhibits the enzyme cholinesterase
2 Prevents the release of acetylcholine
3 Opening of Ca2+ gates on the pre-synaptic membrane.
4 Binds to the post-synaptic membrane receptors.
Which of the two drugs would most likely to encourage the response from a skeletal response to an
electrical impulse arriving at the neuro-muscular junction?
A 1 and 3
B 1 and 4
C 2 and 3
D 2 and 4
109
19
28 What is the role of active transport in the transmission of nerve impulses by neurones?
A Propagates an action potential by pumping sodium ions across the membrane out of the
neurone.
B Propagates an action potential by pumping sodium ions across the membrane into the
neurone.
C Initiates the action potential needed for the transmission of an impulse by pumping calcium
ions out of the endoplasmic reticulum.
D Establishes the resting potential needed for the transmission of an impulse by pumping
sodium and potassium ions across the membrane.
29 Three proteins isolated from a human cell were investigated for their involvement in cell signalling
pathways.
Which of the following correctly shows the identity of these three proteins?
Which of the following correctly explains the type of structures for each pair?
1 Frogs with more similar call patterns are more closely related.
2 A frog species can be identified by looking at the duration, intensity, and frequency of the
call.
3 The call of each species of frog acts as a selection pressure.
4 These calls are a form of isolation mechanism.
A 1 and 2 only
B 1, 2 and 4 only
C 1 and 3 only
D All of the above
35 Which primers should be paired to amplify, by PCR, the DNA flanked by the two indicated
sequences?
5 GGAATTCGT -- // -- AATGCTACC 3
The electrophoresis result from the DNA of a normal allele of the gene is shown below.
Which diagram represents the DNA sequence for the mutant allele of this gene?
115
25
37 Genetic profiling can be used to determine the paternity of a child. DNA from the mother and the child
is cut into fragments, separated by electrophoresis and made visual using a stain. The diagram
shows the genetic profiles of a mother and child, and four possible fathers.
38 Which of the following statements are TRUE about all stem cells?
A 1 and 4
B 2 and 3
C 1, 3 and 4
D 1, 2, 3 and 4
39 Somaclonal variation may arise during in vitro culturing of plant tissues because
A crossing over occurs between homologous chromosomes during meiosis in the cultured
plant cells, leading to genetic recombination.
B some cells are committed to differentiation into specialized plant tissues, therefore may
silence the expression of certain genes.
C of increased rate of mutation due to high growth rate of cells which is induced by the large
amount of growth regulators used.
D pollinating insects inserts DNA sequences containing genes from other plant cells into the
cultured cells genome, leading to genetic variation.
116
26
40 Corn is a major crop grown in Europe. In the past, it was either ruined by attack from the corn borer
larvae or intensively sprayed with pesticides each year. The biotech company Novartis gained
approval to insert a Bt gene into corn. This gene codes for a protein that kills the larvae feeding on
the corn. The genetically engineered Bt corn initially thrived without the addition of any pesticides, but
later suffered damage from pests again.
Which of the following are possible reasons why the Bt corn is again under attack from pests?
I A strain of resistant larvae has emerged as a chance mutation. The frequency of the gene
conferring resistance as well as the number of larvae with resistance has increased. The Bt
gene is now ineffective.
II Corn is being attacked by other pests which are not killed by the Bt gene protein.
III The Bt allele has undergone insertional mutagenesis. This mutagenesis has had a selective
advantage in seed fertility.
A I and II only
B I and III only
C II and III only
D All of the above
117
1
CANDIDATE
NAME
PDG
PDG INDEX NUMBER
BIOLOGY 9648/01
Paper 1 Multiple Choice 4 September 2013
1 hour 15 mins
There are forty questions on this paper. Answer all questions. For each question there are four
possible answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer
Sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
1 Which row is correct for each of the components found on the cell surface membrane?
2 The electron micrograph shows two adjacent plant mesophyll cells with structures W to Z labeled.
A II only
B III only
C I and IV only
D II, III and IV only
120
4
Fig. 6.1.
X-ray diffraction analysis was used to determine the structure of caspase 1 when bound to one of the
inhibitors and to compare it with the active and inactive structures. The enzymes shape when one
such inhibitor was bound resembled the inactive caspase 1 more than the active form as shown in
Fig. 6.1.
Which of the following explains how the allosteric inhibitory site on caspase 1 controls enzymatic
activity?
A C
Stages
8 What is the basis for the difference in the synthesis of the leading and lagging strands of DNA
molecules?
A 2 and 4
B 1 and 3
C 1 and 4
D 2 and 3
124
8
9 Three experiments were carried out to investigate the mode of DNA replication in bacteria.
Experiment 1: Bacteria were grown for many generations with only the light isotope of nitrogen,
14
N, and then allowed to replicate once with the heavy isotope, 15N.
Experiment 2: Bacteria were grown for many generations with only the heavy isotope of nitrogen,
15
N, and then allowed to replicate once with the light isotope, 14N.
Experiment 3: Bacteria were grown for many generations with only the heavy isotope of nitrogen,
15
N, and then allowed to replicate twice with the light isotope, 14N.
The figure shows possible DNA molecules U to Z and indicates the varying proportion of nitrogen
isotopes present in each DNA molecule.
Which of the following products shows the semi-conservative mode of DNA replication?
10 An antibiotic, edeine, was isolated. It inhibits protein synthesis but has no effect on either DNA
synthesis or RNA synthesis. When added to a translation mixture containing fully intact organelles,
edeine stops haemoglobin translation after 10 seconds.
Analysis of the edeine-inhibited mixture by centrifugation showed that no polyribosomes remained by
the time protein synthesis had stopped. Instead, all the mRNA accumulated, together with small
ribosomal subunit and initiator tRNA.
A 1 and 4
B 1 and 2
C 2 and 3
D 2 and 4
126
10
12 The diagram below shows an electron micrograph of viruses entering into a T helper cell.
1 Most of the components found on the plasma membrane of X can be found on the envelope of
Y.
2 X and Y have the same type of nucleic acid.
3 Y enters by endocytosis.
4 Transduction occurs after Y successfully integrates its nucleic acid inside X.
A 1 only
B 1 and 3 only
C 2 and 4 only
D 3 and 4 only
13 Patients infected with the human immunodeficiency virus (HIV) tend to develop a cancer called
Kaposi Sarcoma. Which is the correct order of steps to explain how HIV causes this cancer?
A 1423
B 2314
C 1234
D 1243
127
11
14 The photomicrographs below show two different processes occurring in two different species of
bacteria.
Process 1 Process 2
Which of the following statements is/are true of both processes?
1 For both processes, only bacteria with genes that code for cytoplasmic bridge are involved.
2 Process 1 requires direct contact between 2 different bacteria whereas process 2 can occur
with 1 bacterium.
3 Process 1 will result in an increase in the number of identical bacteria whereas process 2 will
result in an increase in the number of different bacteria.
4 Both processes involve DNA replication.
A 1 and 3 only
B 2 and 4 only
C 1, 2 and 4 only
D All of the above
15 If glucose and lactose are both absent from the growth medium, and the lac structural genes are
expressed efficiently, what would you suspect about the condition of the E.coli cell?
A 1 and 2 only
B 2 and 3 only
C 3 and 4 only
D 1, 2 and 4
128
12
16 The figure below shows the relative distributions of four types of mRNA molecules along the head-to-
tail axis in the cytoplasm of a Drosophila fertilized egg.
bicoid protein binds to the 3 untranslated region of caudal mRNA to interfere with the
interaction between 3 poly-A tail and 5 cap
bicoid protein is also a specific transcription factor that binds to the enhancer of the
hunchback gene
nanos protein inhibits translation of hunchback mRNA
Using the information given above, determine which one of the following graphs shows the relative
protein distribution along the head-to-tail axis of this fertilized egg.
B
129
13
17 In a laboratory, the 5 7-methylguanosine cap and the length of the polyA tail of an mRNA
transcript are altered in order to examine their effects on the number of functional proteins
translated.
mRNA Alteration
1 5 cap removed with 1000-adenine tail
2 5 cap removed with 500-adenine tail
3 5cap present with 500-adenine tail
4 5cap present with 300-adenine tail
Using the information given in the table above, predict the relative amount of protein
produced in the descending order (greatest least).
A 1,3,2,4
B 1,2,3,4
C 3,1,4,2
D 3,4,1,2
130
14
18 The diagram below illustrates the development of colorectal cancers.
Which of these statements can be inferred from this multistep model of carcinogenesis?
I Cells whose APC and -catenin genes are inactivated have lost density dependent inhibition.
II APC and -catenin genes are tumour suppressor genes.
III High levels of Ras protein are produced only when both copies of Ras gene are mutated.
IV Two copies of normal p53 alleles must be present to inhibit cell division.
V Gain-of-function mutation in COX-2 gene is a pre-requisite for the formation of carcinoma.
A I, II and III
B II, III and IV
C I, II and V
D II, III and V
131
15
19 Questions 19 and 20 refer to the following pedigree chart.
Blue eyes
Green eyes
Yellow eyes
II If individual 10 married someone with green eyes, the first child would have green eyes.
III If individual 6 married a woman with green eyes, half of the offspring would have blue eyes.
A II only
B I and III only
C II and III only
D All of the above
132
16
21 In Shorthorn cattle, the allele for hornless is dominant to the allele for the presence of horns. Coat
colour can be red (genotype CRCR), roan (genotype CRCW) or white (genotype CWCW). A roan bull,
heterozygous for the hornless trait, is crossed with a cow of the same genotype.
What is the probability that a calf from this cross would have the same genotype as its parents?
A 1/4
B 3/8
C 1/2
D 3/4
22 A yellow flower, green-stemmed plant with the genotype YYrr was crossed with a white flower,
red-stemmed plant with the genotype yyRR. The F1 plants were allowed to self fertilise, A 2
test was carried out on the results obtained for the F2 generation. Part of the table of values for
2 is shown.
results fit
probability
expected ratio
A between 0.01 and 0.05 No
B between 0.01 and 0.05 Yes
C between 0.05 and 0.1 Yes
D between 0.1 and 0.5 No
133
17
23 Fig. 23A and Fig. 23B show the results of two separate experiments on carbon dioxide fixation in
photosynthesis using a unicellular green alga and the radioactive isotope 14C to label carbon
dioxide. The algae were actively photosynthesizing before the start of both experiments.
Light Dark
R
Relative
quantity of
each
radioactive
labelled
substance
(Fig. 23A)
S
addition of time / s
14
CO2 14
CO2
Concentration
reduced
1% 14CO2 0.003% 14CO2
Relative
quantity of T
each
radioactive
labelled
substance
U
(Fig. 23B)
time / s
R S T U
25 When cyanide is bound to cytochrome oxidase, the cell can no longer produce ATP aerobically.
Which statement below best explains this?
A It prevents reduced NADP from being oxidised to NADP, hence preventing electron flow
down the electron transport chain.
B It prevents oxygen from accepting electrons and protons to form water, hence preventing
electron flow down the electron transport chain.
C It prevents photolysis from occurring to produce oxygen.
D It prevents pyruvate from being synthesised in glycolysis, hence stopping the Krebs cycle.
26 Which of the following shows correctly the differences in the products of glycolysis and Krebs cycle
per glucose molecule?
27 Certain drugs act at synapses and affect the action of neurotransmitter substances. The table
shows the effects of four different drugs.
Drug Effect
1 Inhibits the enzyme cholinesterase
2 Prevents the release of acetylcholine
3 Opening of Ca2+ gates on the pre-synaptic membrane.
4 Binds to the post-synaptic membrane receptors.
Which of the two drugs would most likely to encourage the response from a skeletal response to an
electrical impulse arriving at the neuro-muscular junction?
A 1 and 3
B 1 and 4
C 2 and 3
D 2 and 4
135
19
28 What is the role of active transport in the transmission of nerve impulses by neurones?
A Propagates an action potential by pumping sodium ions across the membrane out of the
neurone.
B Propagates an action potential by pumping sodium ions across the membrane into the
neurone.
C Initiates the action potential needed for the transmission of an impulse by pumping calcium
ions out of the endoplasmic reticulum.
D Establishes the resting potential needed for the transmission of an impulse by pumping
sodium and potassium ions across the membrane.
29 Three proteins isolated from a human cell were investigated for their involvement in cell signalling
pathways.
Which of the following correctly shows the identity of these three proteins?
Which of the following correctly explains the type of structures for each pair?
1 Frogs with more similar call patterns are more closely related.
2 A frog species can be identified by looking at the duration, intensity, and frequency of the
call.
3 The call of each species of frog acts as a selection pressure.
4 These calls are a form of isolation mechanism.
A 1 and 2 only
B 1, 2 and 4 only
C 1 and 3 only
D All of the above
35 Which primers should be paired to amplify, by PCR, the DNA flanked by the two indicated
sequences?
5 GGAATTCGT -- // -- AATGCTACC 3
The electrophoresis result from the DNA of a normal allele of the gene is shown below.
Which diagram represents the DNA sequence for the mutant allele of this gene?
141
25
37 Genetic profiling can be used to determine the paternity of a child.
DNA from the mother and the child is cut into fragments, separated by electrophoresis and made
visual using a stain.
The diagram shows the genetic profiles of a mother and child, and four possible fathers.
38 Which of the following statements are TRUE about all stem cells?
A 1 and 4
B 2 and 3
C 1, 3 and 4
D 1, 2, 3 and 4
39 Somaclonal variation may arise during in vitro culturing of plant tissues because
A crossing over occurs between homologous chromosomes during meiosis in the cultured
plant cells, leading to genetic recombination.
B some cells are committed to differentiation into specialized plant tissues, therefore may
silence the expression of certain genes.
C of increased rate of mutation due to high growth rate of cells which is induced by the large
amount of growth regulators used.
D pollinating insects inserts DNA sequences containing genes from other plant cells into the
cultured cells genome, leading to genetic variation.
142
26
40 Corn is a major crop grown in Europe. In the past, it was either ruined by attack from the corn borer
larvae or intensively sprayed with pesticides each year. The biotech company Novartis gained
approval to insert a Bt gene into corn. This gene codes for a protein that kills the larvae feeding on
the corn. The genetically engineered Bt corn initially thrived without the addition of any pesticides, but
later suffered damage from pests again.
Which of the following are possible reasons why the Bt corn is again under attack from pests?
I A strain of resistant larvae has emerged as a chance mutation. The frequency of the gene
conferring resistance as well as the number of larvae with resistance has increased. The Bt
gene is now ineffective.
II Corn is being attacked by other pests which are not killed by the Bt gene protein.
III The Bt allele has undergone insertional mutagenesis. This mutagenesis has had a selective
advantage in seed fertility.
A I and II only
B I and III only
C II and III only
D All of the above
143
27
Paper 1 Answer scheme
CANDIDATE
NAME
PDG
PDG INDEX NUMBER
BIOLOGY
9648/02
Paper 2 Core Paper 17 September 2013
2 hours
1
Section A
Answer all questions. 2
Section B 3
Answer any one question.
4
All working for numerical answers must be shown. 5
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or 6
part question.
7
Calculators may be used
Section B 20
8/9
Total 100
Section A
Answer all the questions in this section.
(b) The nitrogenous bases of the double helix are paired in specific combinations:
It was mainly by trial and error that Watson and Crick arrived at this key feature of DNA. At first,
Watson imagined that the bases paired like with likefor example, A with A. But this model was
inconsistent with the uniform width of the double helix.
Explain why the earlier DNA model would have inconsistent width. [3]
(c) DNA replicates semi-conservatively by the two strands separating and forming templates for the
synthesis of two new strands.
In addition to the template provided by the DNA, describe the role of two other types of factors that
are required for DNA replication. [2]
.
146
3
(d) Just as a DNA strand provides a template for making a new complementary strand during DNA
replication, it also can serve as a template for transcription.
Fig. 1.1
(i) Describe how the structure of molecule E is adapted to its role in transcription. [3]
.
147
(ii) Describe one way by which the structure of molecule(s) F, which is / are adapted for [1]
transcription, differs from that of amino acids, which are adapted for translation.
[Total : 12]
148
2 Influenza A viruses are divided into subtypes based on two proteins on the surface of the
virus: haemagglutinin (HA) and neuraminidase (NA). The influenza A (H7N9) virus designation of
H7N9 identifies it as having HA of the H7 subtype and NA of the N9 subtype.
(a) Describe the roles of haemagglutinin (HA) and neuraminidase (NA) in the reproductive cycle of the
influenza (H7N9) virus. [2]
(b) (i) The influenza genome comprises genes for RNA polymerase. How is the virus RNA
polymerase different from the host RNA polymerase? [1]
(ii) Explain the role of the viral RNA polymerase in the reproductive cycle. [3]
(c) H7N9 is an avian influenza virus but it is also able to infect mammals.
Suggest changes that may have occurred to give H7N9 greater ability to infect mammals. [2]
.
149
6
(d) While the influenza genome comprises 8 distinct linear segments of negative sense ssRNA,
bacterial genome consists of chromosome and plasmid. Operons are needed for the regulation of
gene expression.
[Total : 11]
150
3 In normal person, the fragile X mental retardation protein (FMRP), regulates the synthesis of neurone
proteins by stopping ribosomal translocation on target mRNAs. Fig 3.1 shows how patients with fragile
X syndrome (FXS) have non-functional FMRP, resulting in accelerated synaptic protein synthesis that
leads to abnormal synaptic function and intellectual disability.
NonfunctionalFMRP(FXS)
Fig. 3.1
..
..
..
(b) (i) State the level of control by FMRP on synaptic protein expression. [1]
151
(ii) Describe one other control mechanism of a similar level as (b)(i). [2]
(iii) Explain how FMRP stops the ribosome from translocation. [2]
(c) Initial gene therapy trial uses a short stretch of anti-sense RNA. Explain how this will help to
reduce the symptom of FXS. [2]
..
..
..
..
(d) Synaptic proteins that are folded wrongly are usually degraded.
Suggest the advantages of degrading proteins that are wrongly folded. [2]
..
..
..
[Total : 11]
152
Fig. 4.1 shows the events in the JAK-STAT cell signaling pathway when cytokine binds and this in
turn leads to an activated receptor. Fig. 4.2 shows two causes that could lead to a non-functional
receptor.
(a) Explain why transmembrane proteins such as the cytokine receptor are especially suited for a role
in cell signalling. [2]
(b) With reference to Fig. 4.1, suggest when happens after cytokine binds to the receptor. [2]
.
153
10
(c) With reference to Fig. 4.2, explain how a change in the sequence of the DNA nucleotide may
affect the signaling downstream of cytokine receptors. [5]
(d) Proteins synthesized by ribosomes attached to the endoplasmic reticulum may be embedded in
the cell surface membrane. Outline the route taken by such a protein. [3]
[Total: 12]
154
11
5 Chickens have a structure called a comb on their heads. The drawings show two types of comb.
Fig. 5.1
The shape of the comb is controlled by two alleles of one gene. The allele for pea comb, A, is
dominant to the allele for single comb, a. The colour of chicken eggs is controlled by two alleles of
a different gene. The allele for blue eggs, B, is dominant to the allele for white eggs, b.
The genes for comb shape and egg colour are situated on the same chromosome.
A farmer crossed a chicken that had pea comb and produced blue eggs with a chicken that had a
single comb and produced white eggs. The chicken that had a pea comb and produced blue eggs
are the offspring of the cross between pure bred pea comb, blue eggs and pure bred single comb,
white eggs.
12
(b) The farmer could identify which of the female offspring from this cross would eventually produce
blue eggs. Explain how. [2]
(c) However, in certain crosses, the farmer was not able to identify the female offspring which will
produce blue eggs. Explain why. [2]
.
156
13
(e) In chickens the males are the homogametic sex while the females are the heterogametic sex.
A gene on the X chromosome controls the rate of feather production. The allele for slow feather
production, F, is dominant to the allele for rapid feather production, f.
A farmer made a cross between two chickens with known genotypes. He chose these chickens so
that he could tell the sex of the offspring soon after they hatched by looking at their feathers.
Which of the crosses shown in the table did he make? Explain your answer.
(f) Female chickens are more likely than male chickens to show recessive sex-linked characteristics.
Explain why. [2]
[Total: 11]
157
14
Table 6.1
(a) Describe one way in which the distribution of protein in the inner and outer membranes of these
two organelles is similar.
..
..
..
..
..
(b) (i) Atrazine is a widely used herbicide (weedkiller). It binds to a chloroplast protein involved in
electron transfer between photosystems.
158
15
The cytoplasm of maize plant cells contains a tripeptide which binds to atrazine. The product
is then transported to the vacuole.
(c) At the end of photosynthesis, glyceraldehyde 3-phosphate (3-carbon sugar) is produced by the [3]
Calvin cycle, which is subsequently converted into starch for storage.
..
..
..
..
..
..
[Total : 11]
159
16
7 The marine threespine sticklebacks, Gasterosteus aculeatus is a freshwater fish living in the
lakes of British Columbia, Canada as shown in Fig. 7.1.
Fig. 7.1
In order to investigate the process of speciation in these populations, three small lakes were
studied. Each lake contained two varieties of stickleback: a large, bottom-dwelling variety that
fed on invertebrates near the shore and a small, plankton-eating variety that lived in the open
water. The probability of breeding between pairs of individuals was measured under laboratory
conditions in the following breeding combinations:
Fig. 7.1
160
17
(a) (i) Identify the highest and lowest probabilities of breeding for individuals of the same variety
from different lakes. [1]
..
...
(ii) With reference to Fig. 7.1, describe the differences in probability of breeding between
individuals from the same lake. [2]
..
..
..
..
(b) Scientists concluded that speciation is taking place in these populations. Explain the type of
speciation as shown in Fig. 7.1. [4]
..
..
..
..
..
..
(c) With reference to Fig. 7.1, explain why all the individuals are still considered the same species. [2]
..
..
..
161
18
(d) The freshwater lakes also contain many different types of parasites that infect the marine
threespine sticklebacks. Suggest why these parasites help to speed up speciation of the marine
threespine sticklebacks. [3]
..
..
..
..
[Total : 12]
162
19
Section B
Answer one question.
Write your answers on the separate answer paper provided.
Your answer should be illustrated by large, clearly labeled diagrams, where appropriate.
Your answers must be in continuous prose, where appropriate.
Your answers must be set out in section (a), (b) etc., as indicated in the question.
8 (a) Explain how the positive and negative control of the lac operon affect bacteria growth. [10]
(b) Describe how regulation of blood glucose level in humans involves cAMP. [5]
9 (a) Describe the differences between cellulose synthase and cellulose. [5]
(b) With reference to photosynthesis and cellular respiration, explain the importance of
compartmentalization within a plant cell. [10]
CANDIDATE ANSWERS
NAME
PDG
PDG INDEX NUMBER
BIOLOGY
9648/02
Paper 2 Core Paper 17 September 2013
2 hours
1
Section A
Answer all questions. 2
Section B 3
Answer any one question.
4
All working for numerical answers must be shown. 5
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or 6
part question.
7
Calculators may be used
Section B 20
8/9
Total 100
Section A
Answer all the questions in this section.
It was mainly by trial and error that Watson and Crick arrived at this key feature of DNA. At first,
Watson imagined that the bases paired like with likefor example, A with A. But this model was
inconsistent with the uniform width of the double helix.
Explain why the earlier DNA model would have inconsistent width.
purines (A and G) are twice as wide as pyrimidines (C and T)
purines (A and G) are nitrogenous bases with two organic rings
pyrimidines (C and T) are single ring nitrogenous bases.
A purine-purine pair is too wide and a pyrimidine-pyrimidine pair too narrow to account for a
uniform (2-nm) diameter of the double helix.
Always pairing a purine with a pyrimidine results in a uniform width.
[Any 3]
(c) DNA replicates semi-conservatively by the two strands separating and forming templates for the
synthesis of two new strands.
[2]
In addition to the template provided by the DNA, describe the role of two other types of factors that
are required for DNA replication.
Presence of enzymes to catalyse the processes: (Any one enzyme)
1. Helicase
Unzipping of DNA double helix so that DNA molecule can be separated in order to create
replicating bubble/fork.
2. Topoisomerase
breaking, swiveling and rejoining DNA strands to relieve DNA strains during unwinding
3. DNA Polymerase
Addition of free deoxyribonucleotides for elongation of the new DNA strand.
4. DNA ligase
form phosphodiester bonds between adjacent deoxyribonucleotides to join the Okazaki
fragments.
5. Primase (Reject RNA primase N2010 comments)
to synthesise the RNA primers to provide free 3OH for DNA Polymerase to elongate the
new DNA strand
165
3
Free deoxyribonucleotides / deoxyribonucleoside triphosphate
6. to provide building blocks for the synthesis of new DNA strand
7. to provide free 5 Phosphate group for formation of phosphodiester bond with existing DNA
strand.
RNA primers
provide free 3OH for DNA Polymerase to elongate the new DNA strand
ATP
When a nucleoside triphosphate links to the sugar phosphate molecule backbone of a growing
DNA strand, it losses two of its phosphates as a pyrophosphate molecules. Hydrolysis of the bond
between the phosphate groups provides energy for the reaction.
NOTE: Enzymes are consider as ONE group of factors thus only a maximum of 1 mark will be
awarded if students mention more than 1 type of enzymes with explanation.
(d) Just as a DNA strand provides a template for making a new complementary strand during DNA
replication, it also can serve as a template for transcription.
Fig. 1.1
(i) Describe how the structure of molecule E is adapted to its role in transcription. [3]
1. molecule E has a specific active site which is complementary to substrate such as DNA
template, ribonucleotides;
2. R groups of (contact) amino acid residues forms weak (ionic) bonds with substrate;
3. R groups of (catalytic) amino acid residues; that catalyses phosphoester bond formation
between growing RNA strand and incoming free nucleotide;
4. funnel allows entry of nucleoside triphosphates;
5. rudder separates the RNADNA hybrid;
(ii) Describe one way by which the structure of molecule(s) F, which is / are adapted for [1]
transcription, differs from that of amino acids, which are adapted for translation.
1. a molecule of F (NTP) is made of a ribose sugar, phosphate group and nitrogenous base (also
accept ribulose triphosphate nucleoside (ribose sugar, 3 phosphates, nitrogeneous base); but
an amino acid is made of a central carbon attached to H group, R group, amine group,
carboxyl group;
2. identity of molecule F is determined by identity of nitrogenous base; but identity of amino acid
is determined by identity of Rgroup;
3. Molecule F has 4 different types (A, U, G, C) while amino acid has 20 different types (distinct R
group).
[Any 1 pt]
[Total : 12]
167
5
2 Influenza A viruses are divided into subtypes based on two proteins on the surface of the
virus: haemagglutinin (HA) and neuraminidase (NA). The influenza A (H7N9) virus designation of
H7N9 identifies it as having HA of the H7 subtype and NA of the N9 subtype.
(a) Describe the roles of haemagglutinin (HA) and neuraminidase (NA) in the reproductive cycle of the
influenza (H7N9) virus. [2]
Haemagglutinin facilitates attachment of virus to host cell membrane by binding to specific
sialic acid receptors on epithelial cells.
Neuraminidase facilitates the release of newly formed virus from the infected host cell by
cleaving the sialic acid receptors.
(b) (i) The influenza genome comprises genes for RNA polymerase. How is the virus RNA
polymerase different from the host RNA polymerase? [1]
host RNA polymerase is a DNA-dependent RNA polymerase, while the virus RNA
polymerase is a RNA-dependent RNA polymerase
(ii) Explain the role of the viral RNA polymerase in the reproductive cycle.
[3]
The viral RNA polymerase synthesizes (accept transcribes) complementary ssRNA (+)
using ssRNA (-) as a template.
These complementary ssRNA(+) strands serve as:
mRNAs for eventual translation into viral proteins in the cytoplasm using the host cell
ribosomes; and
templates for making new copies of the ssRNA (-) genome in the nucleus.
(c) H7N9 is an avian influenza virus but it is also able to infect mammals.
Suggest changes that may have occurred to give H7N9 greater ability to infect mammals.
[2]
Caused by mutations to haemagglutinin gene during the replication of viral RNA
Antigenic drift occurs when accumulation of mutations result in a gradual change to
haemagglutinin (HA)
change shape / conformation/ configuration of the haemagglutinin glycoprotein in H7N9
Shape of haemagglutinin have better fit / more complementary to shape of specific receptors
on human host cells
Haemagglutinin of H7N9 was previously only able to bind to sialic acid on epithelial cells of birds.
However, H7N9 has now acquired the ability to bind to sialic acid on epithelial cells of mammals.
Given that both avian and human influenza strains can infect pigs at the same time, suggest how
H7N9 acquired the ability to infect mammals.
Single cell infected with different types of viruses at the same time;
During viral assembly there could be random assembly of RNA segments from different influenza
viruses;
Leading to novel gene combinations/genetic shift;
168
6
(d) While the influenza genome comprises 8 distinct linear segments of negative sense ssRNA,
bacterial genome consists of chromosome and plasmid. Operons are needed for the regulation of
gene expression.
R description of selective advantage eg. increase in frequency, pass on alleles to next generation.
[Total : 11]
169
7
3 In normal person, the fragile X mental retardation protein (FMRP), regulates the synthesis of neurone
proteins by stopping ribosomal translocation on target mRNAs. Fig 3.1 shows how patients with fragile
X syndrome (FXS) have non-functional FMRP, resulting in accelerated synaptic protein synthesis that
leads to abnormal synaptic function and intellectual disability.
Fig. 3.1
Comments:
The question asked how are polysomes formed and not what are polysomes or why
do polysomes form. Hence, answers related to beads on the string structure,
polysomes are multiple ribosomes on an mRNA, and they undergo translation
simultaneously to speed up translation are not accepted. [2]
(b) (i) State the level of control by FMRP on synaptic protein expression.
Translational control;
Comments:
This was generally well answered by the majority. Those who got it wrong either identified
the wrong stage of control or answered positive and negative control. [1]
170
8
(ii) Describe one other control mechanism of a similar level as (b)(i).
OR
Binding of translational repressors/ regulatory proteins to 5UTR/ covers AUG;
Prevents the initiation of translation/ assembly of ribosome;
OR
Polyadenylation/ Addition of poly(A) tail;
A longer polyA tail increases the half life of mRNA so more translation;
[2]
(iii) Explain how FMRP stops the ribosome from translocation.
FMRP has a specific binding site complementary in shape to a specific mRNA base
sequence/ codon;
Physically blocks / steric hindrance to ribosome;
Accept: FMRP has amino acid R groups that attach to mRNA by weak hydrogen/ ionic
bonds;
(c) Initial gene therapy trial uses a short stretch of anti-sense RNA. Explain how this will help to
reduce the symptom of FXS.
[2]
Anti-sense RNA binds by complementary base pairing;
Ref to binding to same stretch of mRNA bases that FMRP binds (to cause the same effect of
stopping ribosomal translocation);
(d) Synaptic proteins that are folded wrongly are usually degraded.
Comments:
Some candidates suggested preventing the wrongly folded protein from causing a phenotypic
effect. This is not accepted because usually wrongly folded protein is non-functional and would
not cause any phenotypic effect. [2]
[Total : 11]
171
9
Fig. 4.1 shows the events in the JAK-STAT cell signaling pathway when cytokine binds and this in
turn leads to an activated receptor. Fig. 4.2 shows two causes that could lead to a non-functional
receptor.
(a) Explain why transmembrane proteins such as the cytokine receptor are especially suited for a role [2]
in cell signalling.
Spans the entire membrane;
with one part interacting with extracellular ligand/ signal molecule;
and another interacting with intracellular proteins;
ligand binds via complementary shape;
Leading to conformational change of the transmembrane protein/ dimerisation of receptor;
Cause activation of intracellular enzymes / intracellular proteins inside the cell;
Allows cellular responses without the external signal having to move into the cell/ able to
transduce external signal into internal signal;
(1/2 mark each)
(b) With reference to Fig. 4.1, suggest when happens after cytokine binds to the receptor. [2]
Dimerization of and chains;
Activates JAKs;
(Activated JAK) phosphorylates the intracellular tails of the receptors;
Which activate/ phosphorylate STATs
(1/2 mark each)
(c) With reference to Fig. 4.2, explain how a change in the sequence of the DNA nucleotide may
affect the signaling downstream of cytokine receptors. [5]
Compulsory points:
Leads to change in mRNA codon leading to a change in amino acid sequence;
2 examples (2m):
change in amino acid R-group properties, lead to polypeptide chain folded wrongly, resulting in
172
10
a defective JAK
change in amino acid R-group properties, lead to polypeptide chain cannot embed in the
membrane, resulting in a absent c or absent IL-7R chain
ref to stop codon in mRNA resulting in shorter polypeptide or no polypeptide chain made,
resulting in absent c or absent IL-7R chain and;
relevant consequences (2m):
absent chain in receptor, cytokine cannot bind;
defective JAK, cannot be activated, subsequent events cannot occur;
(d) Proteins synthesized by ribosomes attached to the endoplasmic reticulum may be embedded in
the cell surface membrane. Outline the route taken by such a protein. [3]
Protein is inserted into the membrane of the rough endoplasmic reticulum;
Vesicles with protein embedded in membrane bud off from membrane of RER;
move to and fuse with cis face;
of Golgi apparatus;
modified and sorted;
Vesicles bud off from the trans face of Golgi apparatus;
fuse with the plasma/cell membrane and receptor is presented to the exterior of the cell;
movement across cell is aided by microtubules of cytoskeleton;
(1/2 mark each)
[Total: 12]
173
11
5 Chickens have a structure called a comb on their heads. The drawings show two types of comb.
Fig. 5.1
The shape of the comb is controlled by two alleles of one gene. The allele for pea comb, A, is
dominant to the allele for single comb, a. The colour of chicken eggs is controlled by two alleles of
a different gene. The allele for blue eggs, B, is dominant to the allele for white eggs, b.
The genes for comb shape and egg colour are situated on the same chromosome.
A farmer crossed a chicken that had pea comb and produced blue eggs with a chicken that had a
single comb and produced white eggs. The chicken that had a pea comb and produced blue eggs
are the offspring of the cross between pure bred pea comb, blue eggs and pure bred single comb,
white eggs.
Parental phenotype Pea comb, blue eggs X Single comb, white eggs
A B a b
Parental genotype
a b a b
A B A b
a b
Gametes
a B a b
A B A b a B a b
A B A b a B a b
a b
a b a b a b a b
F2 genotype A B A b a B a b
ratio
174
12
a b a b a b a b
1 single 1 single
F2 phenotype 1 Pea comb 1 Pea comb,
comb, Blue comb, white
ratio blue eggs white eggs
eggs eggs
(b) The farmer could identify which of the female offspring from this cross would eventually produce
blue eggs. Explain how. [2]
Pea comb offspring will produce blue eggs;
Alleles A and B are inherited together / are on the same chromosome;
(c) However, in certain crosses, the farmer was not able to identify the female offspring which will
produce blue eggs. Explain why. [2]
Crossing over will separate alleles;
If crossing over occurred some gametes will contain alleles A and b;
In chickens the males are the homogametic sex while the females are the heterogametic sex.
(e) A gene on the X chromosome controls the rate of feather production. The allele for slow feather
production, F, is dominant to the allele for rapid feather production, f.
A farmer made a cross between two chickens with known genotypes. He chose these chickens so
that he could tell the sex of the offspring soon after they hatched by looking at their feathers.
Which of the crosses shown in the table did he make? Explain your answer.
(f) Female chickens are more likely than male chickens to show recessive sex-linked characteristics.
Explain why. [2]
Two alleles for each gene present in male / chromosomes are homologous in male;
OR female has one allele for each gene (for the non-homologous section of chromosome);
Recessive alleles always expressed in female;
Males need two recessive alleles for allele to be expressed / in males recessive alleles can
be masked by dominant allele
[Total: 11]
175
13
Table 6.1
(a) Describe one way in which the distribution of protein in the inner and outer membranes of these
two organelles is similar.
Reason:
Inner membrane of mitochondrion and chloroplast has various enzymes and proteins such as
ATP synthase, proton pumps, electron transport proteins/ electron carriers in ETC required
to carry out chemiosmosis in respiration or photosynthesis;
Note: Chloroplast has a double outer membrane and the inner membrane refers to the thylakoid
membrane.
(b) (i) Atrazine is a widely used herbicide (weedkiller). It binds to a chloroplast protein involved in
electron transfer between photosystems.
The cytoplasm of maize plant cells contains a tripeptide which binds to atrazine. The product
is then transported to the vacuole.
(c) At the end of photosynthesis, glyceraldehyde 3-phosphate (3-carbon sugar) is produced by the [3]
Calvin cycle, which is subsequently converted into starch for storage.
176
14
[Total : 11]
177
15
6 Fig 6.1 shows T.W. Engelmanns experiment to measure the action spectrum of the filamentous
green alga. He placed the filamentous green alga into a test-tube along with a suspension of
oxygen-seeking bacteria. He allowed the bacteria to use up the available oxygen and then
illuminated the alga with light that had been passed through a prism to form a spectrum. After a
short time he observed the results shown in Fig. 6.1.
(Fig on pg 333)
(a) (i) Sketch the action spectrum for this alga. [1]
2 peaks at correct range: one between 400 to 500 range the other between 600 to 700
(b) (i) At the end of photosynthesis, glyceraldehyde 3-phosphate (3-carbon sugar) is produced by
the Calvin cycle. Outline how this glyceraldehyde 3-phosphate is made in the Calvin cycle
and converted into starch. [5]
(Carbon fixation phase) Carbon dioxide (1C) is accepted by RuBP (5C compound), [
catalyzed by ribulose bisphosphate carboxylase (Rubisco); 5
6C compound then cleaves to form 2 molecules of 3C glycerate-3-phosphate (GP); ]
(reduction phase) in the presence of ATP and NADPH, GP forms 3C triose phsophate
(G3P);
For every 6 G3P formed, 1 G3P exits the cycle
G3P can form glucose via condensation
Many -glucose monomers are linked to form long chain via glycosidic bonds
Long chain then coils to form compact helix
[Total : 11]
178
16
7 The marine threespine sticklebacks, Gasterosteus aculeatus is a freshwater fish living in the
lakes of British Columbia, Canada as shown in Fig. 7.1.
Fig. 7.1
In order to investigate the process of speciation in these populations, three small lakes were
studied. Each lake contained two varieties of stickleback: a large, bottom-dwelling variety that
fed on invertebrates near the shore and a small, plankton-eating variety that lived in the open
water. The probability of breeding between pairs of individuals was measured under laboratory
conditions in the following breeding combinations:
Fig. 7.1
(a) (i) Identify the highest and lowest probabilities of breeding for individuals of the same variety
from different lakes.
(ii) With reference to Fig. 7.1, describe the differences in probability of breeding between
individuals from the same lake.
[2]
IV combination (of the same variety): Individuals have higher breeding probability if they
are the same variety and
quote values 0.58;
OR
Accept: Individuals of different varieties have a lower probability of breeding and
quote values;
The probability of breeding between individuals of the same variety shows a larger
range of values / narrower range if of different variety;
[Any 2]
(b) Scientists concluded that speciation is taking place in these populations. Explain the type of
speciation as shown in Fig. 7.1.
Sympatric speciation
is taking place because different varieties from the same lake have a low probability of
breeding
OR
No evidence of allopatric speciation
as same varieties from different lakes do not show strong reproductive isolation/ Comparing
exp III and IV, they show similar range of breeding probability.
Different feeding habits or habitat (shore versus open water) contribute to low breeding
probability/ reproductive isolation;
Reducing interbreeding and gene flow between the varieties in each lake;
[4]
(c) With reference to Fig. 7.1, explain why all the individuals are still considered the same species.
(d) The freshwater lakes also contain many different types of parasites that infect the marine
threespine sticklebacks. Suggest why these parasites help to speed up speciation of the marine
threespine sticklebacks.
Parasites are host specific/ infect either bottom-dwelling variety or plankton-eating variety;
Parasites constitute a selection pressure;
Cite an example of a characteristic that confer a selective advantage, e.g. resistance against
parasitic infection
Those selected for survive, reproduce and pass on their alleles coding for the beneficial
characteristic to their offsprings. [3]
[Total : 12]
180
18
Section B
Answer one question.
Write your answers on the separate answer paper provided.
Your answer should be illustrated by large, clearly labeled diagrams, where appropriate.
Your answers must be in continuous prose, where appropriate.
Your answers must be set out in section (a), (b) etc., as indicated in the question.
8 (a) Explain how the positive and negative control of the lac operon affect bacteria growth. [10]
[Compulsory 1 point]
Metabolism is biased toward the utilization of glucose - glucose is the simplest form of
sugar /enzymes required for the breakdown of glucose via glycolysis are continuously
present.
[Max 3m]
When [glucose] high and [lactose] is absent, glucose is preferred over lactose/used as
a main respiratory substrate/ main energy source.
Repressor binds to operator;
[cAMP] decreases, CAP is not activated/cAMP does not bind to CAP and CAP unable
to bind to CAP binding site;
RNA polymerase does not bind to promoter/ lac operon is switched off;
bacteria growth increases exponentially because energy from glucose breakdown is
utilized for bacterial growth.
[Compulsory 2 points]
When glucose is fully utilized, bacterial growth will remain constant
[lactose] also remains constant initially as time is needed for lac operon to turn on
genes to produce -galactosidase to hydrolyse lactose;
[Max 3m]
Absence of [glucose] and high [lactose];
Allolactose acts an inducer, binds to repressor to inactivate it;
high levels of cAMP binds and activates CAP and
increases affinity of RNA polymerase to bind to promoter and to turn on expression of
lac genes;
high [lactose] - Bacteria growth increases exponentially due to production of -
galactosidase that hydrolyses lactose to form glucose (main respiratory substrate) and
galactose;
as [lactose] concentration decreases; less allolactose binds to the repressor; and as a
result, the activated repressor can bind to the operator;
this blocks binding of RNA Polymerase to the promoter and inhibits transcription of lac
operon;
bacteria growth plateaus/drops as lactose is used up
9 (a) Describe the differences between cellulose synthase and cellulose. [5]
(Any 3)
Crossing over at prophase I (exchanges alleles);
Independent assortment of homologous chromosomes at metaphase I;
Introduces genetic variation in a population;
Random fusion of gametes after meiosis (further increases genetic variation in
individuals);
(Compulsory 2 marks)
Selection pressure results in some organisms having selective advantage;
Those selected for survive and reproduce and pass on their alleles to their offspring,
increasing frequency of alleles over time;
183
CANDIDATE
NAME
PDG PDG I
INDEX NUMBER
BIOLOGY 9648/03
Applications Paper and Planning Question 20 September 2013
Paper 3
2 hours
Additional Materials: Answer Paper
1 In a maternity ward at a local hospital, a mix-up involving three couples and three babies caused
a lot of confusion. Based on phenotypic characteristics, the nurses were unable to correctly
identify the parents of the babies. In order to solve the case, a scientist was called in to carry out a
DNA test to identify the parents of the babies. The test was based on the principle that different
individuals have a different number of repeating units at a particular locus in a chromosome.
(a) State the name of the test that was carried out. [1]
......
Chromosome 13 was isolated from the DNA samples that were obtained from the three couples
and three babies and used for further analysis. The sequence below shows a segment of
chromosome 13, which was used in the analysis where (TTAGGAT) is the repeating unit and n
is the number of repeats.
The gel diagram in Fig. 1.1 shows the results of the DNA test obtained from each individual, Dad
and Mom #1, #2 and #3, and baby A, B, and C.
Fig. 1.1
(b) (i) Explain the purpose of the DNA ladder in Fig. 1.1. [1]
.....
......
.....
.....
185
3
(c) With reference to Fig. 1.1, explain why
.....
.....
.....
(ii) the lane for Dad#3 has only one band; [2]
.....
.....
.....
.....
.....
.....
(d) (i) With reference to Fig. 1.1, state and explain which couple is the parents of Baby A. [2]
.....
.....
.....
(ii) Explain why results of paternity testing are not absolutely certain. [2]
.....
.....
.....
[Total: 13]
186
4
22 One approach of gene therapy to treat cystic fibrosis uses viruses to deliver normal alleles of the
CFTR gene into epithelial cells of the airways.
The normal AAV strain and the AAV2.5T strain were added to cultures of epithelial cells from the
airways. After adding luciferin, the number of cells that had taken up the viral genes was
estimated using the intensity of the green fluorescence which developed. The results are shown
in Fig. 2.1.
Intensity of
green
fluorescence
/ arbitrary
units
AAV
Time / days
Fig. 2.1
(a) Explain why the researchers inserted a gene for luciferase into the viral DNA. [1]
.....
.....
.....
(b) With reference to Fig. 2.1, compare the ability of the two viral strains, AAV and AAV2.5T, to
infect epithelial cells of the airways. [2]
.....
.....
.....
187
5
(c) Suggest why a decrease in intensity of green fluorescence was detected in cells infected
with AAV2.5T during the last 10 days. [2]
.....
.....
.....
(d) Describe how delivering normal alleles of the CFTR gene into epithelial cells in the airways
could relieve the symptoms of cystic fibrosis. [4]
.....
.....
.....
.....
.....
.....
(e) Researchers have started to use cDNA of the CFTR gene for more effective therapeutic
results. Explain why cDNA of the normal CFTR gene is used instead of the normal CFTR
gene. [2]
.....
.....
.....
188
6
(f) AAV does not cause human disease, but because we are routinely exposed to this virus,
30 to 60 percent of people develop antibodies that neutralize AAV if it enters the
circulation.
To extend the potential benefits of gene therapy to a broader population, researchers have
produced a bioengineered decoy, which are empty AAV capsids disabled of their ability to
enter target cells.
Suggest how using both the decoy and vector at the same time would improve the success
rate of the gene therapy. [3]
.....
.....
.....
.....
.....
[Total: 14]
189
7
3 Plants have developed defense mechanisms against pathogens such as bacteria, fungi, and
viruses. Chemicals released by these pathogens can trigger a defense response in infected plant
cells. For example, the production of hydrogen peroxide (H2O2) which reacts with pathogen
membranes and cellular chemicals, eventually kills both the cell and the pathogen.
The OSRac1 gene was isolated and introduced into a number of rice plant (Oryza spp.) lines to
study its role in disease resistance of plants to Blast fungus. Experiments were carried out to see
if the OSRac1 gene was part of the signalling pathway for hydrogen peroxide production.
A control and four other genetically modified rice plant lines were exposed to chemicals known to
initiate a defense response and the production of hydrogen peroxide. The results are shown in
Fig. 3.1 below.
Fig. 3.1
(a) With reference to Fig. 3.1, compare the changes in H2O2 production in the control and [4]
genetically modified plants after the chemical was applied and conclude if OSRac1 gene is
involved in disease resistance.
.....
.....
.....
.....
.....
.....
190
8
(b) Suggest two possible concerns about the use of transgenic plants with the disease
resistance gene. [2]
.....
.....
.....
(c) Edible vaccine against cholera using rice was developed by a team of Japanese scientists
by cloning a gene from cholera bacteria, Vibrio cholerae into the genome of the Kitaake rice
plant. The gene expressed a subunit of the disease-causing cholera toxin B. The steps are
shown in Fig. 3.2.
Coded by
Fig. 3.2
(i) Describe how the antigen gene inserted into rice DNA genome would result in successful
vaccination once the rice is eaten. [2]
.....
.....
.....
191
9
(ii) Explain why it is necessary to form a callus in order to grow genetically modified rice. [3]
.....
.....
.....
(d) Edible vaccines have been made using other plants like tomato and banana. Suggest the
advantages of using rice over other plants. [2]
.....
.....
.....
[Total: 13]
192
10
4 Planning question
DNA is the genetic material in all living organisms. DNA from an external source can be taken up
by bacteria by a process known as transformation.
Plan an experiment to investigate the effect of varying plasmid concentration on the efficiency of
E. coli transformation.
You may, or otherwise, also use the following equipment and materials:
Solution of plasmid containing ampicillin resistance gene of concentration 100
Unit/ml
Suspension of competent E. coli cells
Distilled water
LB broth (nutrient solution)
Petri dishes containing LB agar medium and ampicillin (LB/amp plates)
Sterilised microfuge tubes
Micropipettes
Bleach solution
alcohol
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.
194
12
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.
195
13
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
.....
196
14
Free-response question
Write your answers to this question on the separate answer paper provided.
Your answer:
Outline how it might be possible to produce genetically modified plants with increased
rubisco concentrations, or rubisco with enhanced efficiency.
(b) Explain the basis of genetic engineering and how genetic engineering can improve the yield [8]
of one named crop plant and one named animal in solving the demand for food in the
world.
(c) Discuss how the human genome project can help parents customise their babies and the [6]
possible implications of doing so.
[Total: 20]
197
CANDIDATE
NAME
PDG PDG I
INDEX NUMBER
BIOLOGY 9648/03
Applications Paper and Planning Question 20 September 2013
Paper 3
2 hours
Additional Materials: Answer Paper
1 In a maternity ward at a local hospital, a mix-up involving three couples and three babies caused
a lot of confusion. Based on phenotypic characteristics, the nurses were unable to correctly
identify the parents of the babies. In order to solve the case, a scientist was called in to carry out a
DNA test to identify the parents of the babies. The test was based on the principle that different
individuals have a different number of repeating units at a particular locus in a chromosome.
(a) State the name of the test that was carried out. [1]
Paternity Test/ DNA Fingerprinting/Genetic Fingerprinting
Chromosome 13 was isolated from the DNA samples that were obtained from the three couples
and three babies and used for further analysis. The sequence below shows a segment of
chromosome 13, which was used in the analysis where (TTAGGAT) is the repeating unit and n
is the number of repeats.
The gel diagram in Fig. 1.1 shows the results of the DNA test obtained from each individual, Dad
and Mom #1, #2 and #3, and baby A, B, and C.
Fig. 1.1
(b) (i) Explain the purpose of the DNA ladder in Fig. 1.1. [1]
Each band serves as a comparison / reference for the size / no. of repeats present / found in
the individuals tested.
(ii) the lane for Dad#3 has only one band; [2]
They are homozygous at this locus.
they have the same number of repeats on both homologous chromosome13
For example: Dad #3 has 25 repeats on both versions of his chromosome 13.
(d) (i) With reference to Fig. 1.1, state and explain which couple is the parents of Baby A. [2]
couple #3
Baby A has a band in n=25 and Dad #3 is the only parent with n=25 @ chromosome.
(ii) Explain why results of paternity testing are not absolutely certain. [2]
Only a limited number of loci were considered.
It is possible that a male may be a match at all the loci considered, but not be a match at
another loci that was not considered in the test.
[Total: 13]
200
4
22 One approach of gene therapy to treat cystic fibrosis uses viruses to deliver normal alleles of the
CFTR gene into epithelial cells of the airways.
The normal AAV strain and the AAV2.5T strain were added to cultures of epithelial cells from the
airways. After adding luciferin, the number of cells that had taken up the viral genes was
estimated using the intensity of the green fluorescence which developed. The results are shown
in Fig. 2.1.
Intensity of
green
fluorescence
/ arbitrary
units
AAV
Time / days
Fig. 2.1
(a) Explain why the researchers inserted a gene for luciferase into the viral DNA. [1]
infected cells are able to produce luciferase;
able to identify infected cells/cells that have taken up viral DNA (which will
fluoresce when luciferin is added)/ ref to gene for luciferase functions as a
reporter gene;
(b) With reference to Fig. 2.1, compare the ability of the two viral strains, AAV and AAV2.5T, to
infect epithelial cells of the airways. [2]
1. Both AAV and AAV2.5T can infect epithelial cells;
[Both pt 2 & 3 - 1m]
2. AAV2.5T infects more cells than AAV / infects cells more readily;
3. Quote relevant values (both intensity and day indicated) from graph;
[Both pt 4 & 5 - 1m]
4. Intensity of green fluorescence increases more in AAV2.5T compared to AAV
from 0-20 days;
5. from 0 to 15 au in AAV2.5T compared to only 2 au in AAV; A! any values correctly
comparing rate of increase anytime during the first 20 days period
[Both pt 6& 7 - 1m]
6. From the 20th to 30th day, ability of AAV2.5T to infect cells fall but AAVs ability
remains constant;
7. Intensity of green fluorescence decreases to 12.5 au in AAV2.5T compared to
remaining at 2 au in AAV; @ m
201
5
(c) Suggest why a decrease in intensity of green fluorescence was detected in cells infected
with AAV2.5T during the last 10 days. [2]
Green fluorescent protein was broken down;
Luciferin was used up;
(Infected) cells die (as virus regain virulence);
R! cells constantly being shed/killed by immune system as gene therapy was done in
cultures of epithelial cells.
(d) Describe how delivering normal alleles of the CFTR gene into epithelial cells in the airways
could relieve the symptoms of cystic fibrosis. [4]
1m, max 3
normal allele of CFTR gene is transcribed and translated / expressed to produce
functional CFTR protein;
CFTR protein embedded in cell membrane allows chloride ions to leave cell /
serves as functional chloride channel;
water also leaves cell down the water potential gradient;
normal / less viscous mucus formed ;
(essential point)
no blockage of airways / less chance of bacterial lung infections/any other
related possible symptoms;
(e) Researchers have started to use cDNA of the CFTR gene for more effective therapeutic
results. Explain why cDNA of the normal CFTR gene is used instead of the normal CFTR
gene. [2]
cDNA does not contain non-coding regions such as introns;
cDNA can be transcribed and translated directly without the need for post-
transcriptional modifications such as splicing;
Hence the CFTR proteins can be synthesized efficiently;
(f) AAV does not cause human disease, but because we are routinely exposed to this virus,
30 to 60 percent of people develop antibodies that neutralize AAV if it enters the
circulation.
To extend the potential benefits of gene therapy to a broader population, researchers have
produced a bioengineered decoy, which are empty AAV capsids disabled of their ability to
enter target cells.
Suggest how using both the decoy and vector at the same time would improve the success
rate of the gene therapy. [3]
Higher ratio of decoy to vector;
Decoy cannot enter target cells, thus they stay in circulation for longer period of
time;
Ref to antibodies bound to the capsid decoys;
Allowing the DNA-carrying vectors to evade the antibodies and enter the targeted
cells in the liver;
[Total: 14]
202
6
3 Plants have developed defense mechanisms against pathogens such as bacteria, fungi,
and viruses. Chemicals released by these pathogens can trigger a defense response in
infected plant cells. For example, the production of hydrogen peroxide (H2O2) which reacts
with pathogen membranes and cellular chemicals, eventually kills both the cell and the
pathogen.
The OSRac1 gene was isolated and introduced into a number of rice plant (Oryza spp.)
lines to study its role in disease resistance of plants to Blast fungus. Experiments were
carried out to see if the OSRac1 gene was part of the signalling pathway for hydrogen
peroxide production.
A control and four other genetically modified rice plant lines were exposed to chemicals
known to initiate a defense response and the production of hydrogen peroxide. The results
are shown in Fig. 3.1 below.
Fig. 3.1
(a) With reference to Fig. 3.1, compare the changes in H2O2 production in the control and [4]
genetically modified plants after the chemical was applied and conclude if OSRac1 gene is
involved in disease resistance.
Production of H2O2 increased less in C (control) plants than A1/A5 plants supported
with relevant data;
Production of H2O2 in D41/D42 plants increased less than in C (control) plants
supported with relevant data;
Production of H2O2 increased the most in A1/least in D41 plants supported with
relevant data;
[Compulsory conclusion point]
Transgenic plants with functioning gene showed more H2O2 production so
hypothesis; OR
Transgenic plants with gene suppressed showed less H2O2 production so
hypothesis;
203
7
(b) Suggest two possible concerns about the use of transgenic plants with the disease
resistance gene.
(c) Edible vaccine against cholera using rice was developed by a team of Japanese scientists
by cloning a gene from cholera bacteria, Vibrio cholerae into the genome of the Kitaake rice
plant. The gene expressed a subunit of the disease-causing cholera toxin B. The steps are
shown in Fig. 3.2.
Coded by
Fig. 3.2
(i) Describe how the antigen gene inserted into rice DNA genome would result in successful [2]
vaccination once the rice is eaten.
[Essential compulsory point] Antigen protein would be expressed in rice cells;
Any 1 below:
Antigen would trigger immune system to produce the antibody;
Antibody have a specific configuration that is complementary to the glycoprotein
(antigen);
Antibody will be synthesized to mount an immune response against a subsequent
vaccination against cholera bacteria;
204
8
Extend Q N06/P2/Q8c - Outline the roles of glycoproteins in the cell surface membrane.
[8]
(ii) Explain why it is necessary to form a callus in order to grow genetically modified rice.
Callus divide by mitosis to ensure all the genetically identical daughter cells would
have the gene;
Callus can be genetically modified by A. tumefaciens;
Callus can be sub-cultured to increase the number of callus;
Callus can be manipulated by auxin and cytokinin to induce root and shoot
formation to form a plantlet; [3]
(Any three)
(d) Edible vaccines have been made using other plants like tomato and banana. Suggest the [2]
advantages of using rice over other plants.
Rice can be stored for a long time;
Rice forms a staple diet among many Asians
Rice is versatile enough to be eaten with other dishes;
[Total: 13]
205
9
4 Planning question
DNA is the genetic material in all living organisms. DNA from an external source can be taken up
by bacteria by a process known as transformation.
Plan an experiment to investigate the effect of varying plasmid concentration on the efficiency of
E. coli transformation.
You may, or otherwise, also use the following equipment and materials:
Solution of plasmid containing ampicillin resistance gene of concentration 100
Unit/ml
Suspension of competent E. coli cells
Distilled water
LB broth (nutrient solution)
Petri dishes containing LB agar medium and ampicillin (LB/amp plates)
Sterilised microfuge tubes
Micropipettes
Bleach solution
alcohol
Mark Scheme
1. Theoretical consideration / rationale of plan to justify the practical procedure [1]
2. Correct use of technical and scientific terms any 2 of the following [1]
Relate theory to prac
Examples:
DNA is the genetic material in all living organisms. Transformation is the process by
which DNA from an external source is taken up by bacteria.
The plasmid contains an ampicillin-resistance gene that confers resistance to the
antibiotic.
Bacteria that have taken up this plasmid are able to grow on LB/amp medium.
Amp resistance gene serves as genetic marker to identify transformed cell
When made competent by heat-shock, pores appear transiently in the membrane of
bacteria. External DNA/plasmids may then enter the cell via these pores
Consequently, as plasmid concentration increases, the efficiency of E.coli transformation
will also increase proportionally.
[A description of method used including the scientific reasoning behind the method]
4. Description of how the plasmid solution is prepared [1]
206
10
i. Using plasmid solution of concentration 100 Unit/ml, make dilutions to obtain 5 different
concentrations.
Concentration of Volume of plasmid solution of Volume of water
plasmid (unit/ml)* conc 100 Units/ml (ml)* (ml)*
100 1.0 0.0
80 0.8 0.2
60 0.6 0.4
40 0.4 0.6
20 0.2 0.8
0 0 1.0
* or any other reasonable range / volume
OR
serial dilutions:
Concentration of plasmid Volume of stock (ml) Volume of water (ml)
(unit/ml)
Undiluted 1.0 0.0
1 to 10 or 10-1 0.1 of non dilute 0.9
-2 -1
1 to 100 or 10 0.1 of 10 0.9
1 to 1000 or 10-3 0.1 of 10-2 0.9
1 to 10000 or 10-4 0.1 of 10-3 0.9
5. Controlling factors that affect experiment (eg. Duration, temp, volumes,etc) [1]
[How you will record your results and ensure they are as accurate and reliable as
possible]
7. Control [1]
vii. For the control tube, replace plasmid solution with same volume of 10l of distilled
water/buffer solution.
Rationale:
To show that the presence of bacterial colonies on agar plates containing
ampicillin is due to transformed bacteria which have taken up plasmid with amp
resistance gene OR
in the absence of plasmid which carries the ampicillin resistant genes, there are no
ampicillin resistant bacterial cells.
[Propose layout of results table and graph with clear headings and labels]
Average number
of colonies
colonies
-1
Concentration of plasmid /Unit ml
12. Suitable diagram illustrating plates with bacteria / process of heat shock [1]
208
12
Free-response question
Write your answers to this question on the separate answer paper provided.
Your answer:
Outline how it might be possible to produce genetically modified plants with increased
rubisco concentrations, or rubisco with enhanced efficiency.
(b) Explain the basis of genetic engineering and how genetic engineering can improve the yield [8]
of one named crop plant and one named animal in solving the demand for food in the
world.
OR
OR
Reject
A named crop: Golden rice
The problem: Childhood blindness in developing countries due to vitamin A deficiency in
the diet, which comprised of rice primarily. Outer coat of the dehusked grains (aleurone
layer) does not contain beta-carotene.
Source of the gene: Two beta-carotene biosynthesis genes/ phytoene synthase (psy)
gene and phytoene desaturase (crt 1) gene from the daffodil plant and soil bacterium,
Erwinia uredovora.
Gene product in the crop: beta-carotene produced 23 times more.
The solution: Prevent vitamin A deficiency as beta-carotene is a precursor of Vitamin A.
AND
(c) Discuss how the human genome project can help parents customise their babies and the [6]
possible implications of doing so.
Info from HGP [1] must have both to gain 2 marks.
One can use the information from Human Genome Project to identify a wide
range /genome-wide range (or state number of genes);
of disease causing alleles, alleles that give desirable traits such as height,
intelligence, strength endurance etc;
(Important to state that it is a genome-wide range, since prior to HGP, other genetic
traits would have been known).
How info use to create Designer Babies [1] either one is a necessary point.
Based on info from HGP, Designer babies could 1) be selected for using Pre-
210
14
implantation Genetic Diagnosis (PGD)/(OWTTE) that are disease-free or have
desirable traits;
Or based on the HGP, designer babies could 2) go through genetic modification
for enhancements in desirable traits/removal of undesirable traits discovered
through info from HGP;
Possible Benefits (at least 2 points to gain full marks)
Babies that are born would not have to suffer from genetic defects as those that
have disease-causing alleles are not implanted or have their genes modified to
correct the disease;
Designer siblings of children who have genetic diseases may be created to
provide matching and healthy stem cells for therapy;
Determine the sex of the child as this might prevent babies who have diseases
like haemophilia and Duchenne Muscular Dystrophy, Fragile X syndrome, only
show themselves in male babies;
Ethical concerns (at least 2 points to gain full marks)
For the selection of embryos to implant in PGD, those that are not selected are
discarded or unused which will raise ethical concerns since these embryos have
been fertilized.
Designer siblings may be feel that their existence was for a cure rather than
parents wanting a child/feel inferior to the child who is sick
Choosing the sex of babies can raise ethical concerns especially in societies
where boys are valued more highly than girls, tipping the sex-ratio.
Designer babies with genetical enhancements (cf gene therapy) to add genes for
HIV resistance or longevity or a high IQ?
May lead to a social divide between between those who can afford designer
babies/designer genome and those that cannot.
[Total: 20]
211
NAME: ___________________________________________ CLASS: _________ INDEX: __________
BIOLOGY 9648/01
Paper 1 Multiple Choice WEDNESDAY 4 SEPT 2013
1 hour 15 minutes
Additional Materials: Multiple Choice Answer Sheet
There are forty questions on this paper. Answer all questions. For each question, there are
four possible answers, A, B, C and D.
Choose the one you consider correct and record your choice in 2B pencil on the separate
Answer Sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
I The cell dies because it is unable to make glycoproteins to detect stimuli from its
environment.
II The cell dies from a lack of enzymes to digest food taken in by endocytosis.
III The cell dies from the accumulation of worn out organelles within itself.
IV The cell is unable to reproduce itself.
V The cell is unable to export its enzymes or peptide hormones.
A II and III
B II and V
C III, IV and V
2
213
2 The diagram below shows a biological molecule found in the living cells.
The following are some statements concerning the molecule shown above.
1 It is soluble in water.
2 Double bonds between the carbon and oxygen atoms increase membrane fluidity.
3 It can act as a buffer against extreme pH change.
4 It can undergo condensation to form a polymer.
A 1 and 3
B 1 and 4
C 2 and 3
D 2 and 4
3 An experiment was carried out to investigate the digestion of starch using amylase at two different
temperatures. A sample was removed from each mixture at 15 second intervals and place onto a
spotting tile well containing two drops of iodine in KI solution. The results are shown in the diagram.
Which shows the correct temperatures and times for the complete digestion of starch?
temperature / C time / s
A 30 3.15
10 0.45
B 30 45
10 195
C 10 45
30 195
D 10 3.15
30 0.45
3
214
4 The graph shows changes in the amount of DNA in a cell during one cell cycle. The letters U Z
marks out the different phases in the cell cycle.
Many drugs that are used to treat cancer work at different time periods during the cell cycle.
(i) Cisplatin binds to DNA and stops free DNA nucleotides from joining together.
With reference to the cell cycle above, determine where these 2 drugs work.
Cisplatin Drug B
A W X
B W Y
C U X
D U Z
4
215
5 The diagram shows how genetically identical frogs can be developed from unfertilised frog eggs.
The diploid number for frogs is 26.
Which combination of numbers correctly identifies the number of chromosomes in each type of cell?
V W X
A 13 13 26
B 13 26 13
C 13 26 26
D 26 26 13
6 The table below shows a list of characteristics displayed by mutant strains of E.coli during DNA
replication and the possible reasons.
Which of the reasons correctly explain the characteristics displayed by the mutant E. coli strains?
A 2 and 3
B 1 and 3
C 1, 3, and 4
D All the above
5
216
7 Part of the amino acid sequence of protein X in normal and disease patients are shown below.
Lys-His-Pro-Asp-Thr Lys-His-Pro-Gly-Thr
mRNA codons for the amino acids shown in the sequence are as follows:
Thr: ACU, ACC, ACA, ACG Gly: GGU, GGC, GGA, GGG Pro: CCU, CCC, CCA, CCG
A B C D
8 Listed below are some antibacterial drugs that can affect the synthesis of bacterial proteins.
Which row shows the correct effects of these drugs on bacterial protein synthesis?
6
217
9 The diagram represents a length of DNA which includes an operon. E, F, G and H have different
functions.
E F G H
A I, II and IV
B II and IV
C III, IV and V
D III and V
7
218
11 Which of the following correctly identifies the reproductive cycles X and Y and structures A and B?
X Y A B
A lytic lysogenic virus DNA provirus
B lysogenic lytic virus DNA prophage
C lytic lysogenic bacterial DNA prophage
D lysogenic lytic bacterial DNA provirus
8
219
13 The diagram below shows the reproductive cycle of the herpes virus which causes cold sores on the
mouth. With reference to the diagram below, which of the following statements best describes the
herpes virus?
9
220
15 Human telomeres consist of repeating TTAGGG sequences which extend from the ends of the
chromosomal DNA.
When cells undergo mitotic division, some of these repeating sequences are lost. This results in a
shortening of the telomeric DNA.
What is a consequence of the loss of repeating DNA sequences from the telomeres?
16 The acetylation of histones promotes loose chromatin structure. Recent evidence has shown that
chemical modification of histones play a direct role in regulation of gene expression.
Which of the following best explains how acetylation regulates gene expression?
17 The translation mixture contains a polynucleotide that directs the synthesis of Met-Gly-Gly-Phe-Leu-
Ala. In the presence of Azithromycin, this polymer directs the synthesis of Met-Gly only.
From the information given, which of the following deductions could you make about Azithromycin?
B Post translational It inhibits binding of aminoacyl- tRNAs to the A site in the ribosome.
D Post translational It interferes with chain termination and release of the peptide.
10
221
18 Which of the following genetic changes might lead to lower risk of cancer?
A 1 and 3 only
B 2 and 3 only
C 1, 2 and 4 only
D 1, 2, 3 and 4
19 What do chromosomal aberrations and gene mutations have in common and how are they different?
Similarity Difference
A Both may involve addition of Gene mutations always produce dominant
nucleotides. alleles but not chromosomal aberrations.
B Both may not result in disorders. Gene mutations do not involve inversions but
inversions of segments of chromosomes do
occur.
C Both affect nucleotide sequence in Gene mutations occur within a chromosome
DNA molecule. but chromosomal aberrations may occur
across chromosomes.
D Both may not result in a difference in Chromosomal aberrations are more harmful
protein expression. than gene mutations.
20 In poultry, males have two X chromosomes and females have one X chromosome and one Y
chromosome. The gene for feather-barring is sex-linked. The allele for barred feathers is dominant
to the allele for non-barred feathers. A non-barred male is crossed with a barred female.
11
222
21 Purple buds of the morning glory flower, Ipomoea, open into blue flowers. As the flower opens, the
pH on the vacuoles of the flower epidermal cells increases and this results in a change of colour
from purple to blue.
A mutant purple-flowered morning glory plant carries recessive alleles of a gene B/b, coding for a
membrane-bound ion pump, and is unable to increase the pH of the vacuole. Both normal blue
flowers and mutant purple flowers have the same anthocyanin pigment, coded by the dominant
allele of the gene A/a. Plants with aa cannot produce anthocyanin and they have white flowers.
A blue-flowered morning glory plant was crossed with a purple-flowered plant. Their offspring
consisted of plants which are blue-flowered, purple-flowered as well as white-flowered.
A AABB AaBb
B AaBb Aabb
C aaBB AaBB
D aaBb aaBb
22 The table below shows the blood group phenotypes resulting from crosses between different
genotypes.
What is the probability that the second child of these parents will be a girl with blood group A who
does not have phenylketonuria?
A 1 in 16
B 1 in 8
C 3 in 16
D 3 in 8
12
223
23 When a pure-breeding maize plant with yellow seeds and full endosperm is crossed with another
pure-breeding plant having white seeds and shrunken endosperm, the F1 maize plants are found
with yellow seeds and full endosperm. When the F1 plants are selfed, four classes of descendants
are obtained as shown in the table below:
where = sum of
O = observed value
E = expected value
Degrees of Probability
freedom 0.10 0.05 0.01 0.001
1 2.71 3.84 6.64 10.83
2 4.69 5.99 9.21 13.82
3 6.25 7.82 11.35 16.27
4 7.78 9.49 13.28 18.47
Which of the following conclusions made about the inheritance of colour of seed and shape of
endosperm is correct?
A Since p < 0.05, the difference between the observed and expected results is not significant.
Thus the inheritance of colour of seed and shape of endosperm is following Mendels law of
independent assortment.
B Since p > 0.05, the difference between the observed and expected results is not significant.
Thus the inheritance of colour of seed and shape of endosperm is not following Mendels law
of independent assortment.
C Since p < 0.01, the difference between the observed and expected results is not significant.
Thus the inheritance of colour of seed and shape of endosperm is following Mendels law of
independent assortment.
D Since p < 0.01, the difference between the observed and expected results is significant.
Thus the inheritance of colour of seed and shape of endosperm is not following Mendels law
of independent assortment.
13
224
24 Solute Q moves across the plasma membrane via protein channels. Solute R moves across the
plasma membrane by simple diffusion. The rate of movement of each solute into a cell is recorded
and graphed.
14
225
26 The following graphs shows two separate experiments on carbon dioxide fixation in photosynthesis
using a unicellular green alga and radioactive isotope 14C to label the carbon dioxide. The algae
were actively photosynthesizing before the start of both experiments.
E F G H
A RuBP GP GP RuBP
B GP RuBP GP RuBP
C GP RuBP RuBP GP
D RuBP GP RuBP GP
15
226
27 Rotene and oligomycin are two metabolic poisons which affect cellular respiration. The effects of
rotene and oligomycin on aerobic respiration are summarised in the table.
Which of the following correctly identifies the specific functions of these two metabolic poisons?
Rotene Oligomycin
A Electron transport inhibitor Inhibits ATP synthase
B Inhibits ATP synthase Electron transport inhibitor
C Dissipate proton gradient Inhibits ATP synthase
D Inhibits ATP synthase Dissipate proton gradient
D Reaction Z is a catabolic pathway which occurs twice for every glucose molecule to be
completely oxidised.
16
227
29 Which sequence of events correctly describes evolution?
A 2 4 1 3
B 2 4 3 1
C 4 1 3 2
D 4 3 1 2
30 The graph below shows data on a population of a species of moth which shows considerable
variation in colour intensity
17
228
31 Darwins view of the process of evolution to form new species (speciation) has been reinforced by
more recent discoveries in genetics and cell biology. This is termed the neo-Darwinian view of
evolution.
In this view, which sequence of events is considered most likely to lead to speciation?
competition and
adaptation of behavioural sympatric
A predation leading
population isolation speciation
to natural selection
competition and
adaptation of behavioural allopatric
B predation leading
population isolation speciation
to natural selection
competition and
adaptation of
predation leading geographical sympatric
C isolated
to natural isolation speciation
populations
selection
competition and
adaptation of
predation leading geographical allopatric
D isolated
to natural isolation speciation
populations
selection
32 The table shows amino acid sequences from a segment of a viral protein that is found in a number
of different viruses. These viruses were isolated from patients suffering from either the common cold
caused by rhinovirus or flu caused by influenza. Each letter represents a single amino acid.
Rhinovirus 1 P E F P Y N A T T E P T K A V P F Q
Rhinovirus 2 P E F S Y S A V D D P I G E E P F K
Rhinovirus 3 P E F S Y S A G D D P A G E E P F N
Influenza A P E Y H T P V M E P L D P F T M D K
Influenza B P E Y H T P K M E P L D A F A M D N
Influenza C P E Y H T P V M E P L D V F D M D K
A The rhinoviruses are more closely related to each other than the influenza viruses are to
each other.
B Influenza virus A is more closely related to influenza virus B than influenza virus B is to
influenza virus C.
C The influenza viruses are less closely related to each other than they are to the rhinoviruses.
pBR322
Vector
(4361 bp)
Following transformation, bacterial cells were grown in four different media, as shown below:
Which of the following media would bacterial cells containing the recombinant plasmids grow in?
A 4
B 1 and 2
C 2 and 3
D 1 and 4
19
230
34 Digestion of a 4 kb DNA molecule with EcoRI yields two fragments of 1 kb and 3 kb each. Digestion
of the same molecule with HindIII yields fragments of 1.5 kb and 2.5 kb. Finally, digestion with
EcoRI and HindIII in combination yields fragments of 0.5 kb, 1 kb and 2.5 kb. How would a
restriction map indicating the positions of the EcoRI and HindIII cleavage sites look like?
35 The dashed lines in the template sequence represent a long sequence of bases to be amplified.
Template
5 ATTCGGACTTG - - - - - - - - - - - - - - - - - - - - GTCCAGCTAGAGG 3
3 TAAGCCTGAAC - - - - - - - - - - - - - - - - - - - - CAGGTCGATCTCC 5
Which of the following sets of primers can be used in the PCR for the amplification of the following
DNA sequence?
20
231
36 Which of the following statements about the human genome project (HGP) is false?
A HGP aims to identify all the genes in human and to determine the DNA sequences of these
genes.
B HGP aims to allow genetic testing to take place for earlier detection of genetic diseases
C HGP allows defective genes to be replaced through gene therapy
D HGP allows comparative studies to be made between humans and other organisms to
identify similar genes associated with diseases.
37 What is the role of stem cells with regard to the function of adult tissues and organs?
A Stem cells are undifferentiated cells that divide asymmetrically, giving rise to one daughter
cell that remains a stem cell and one daughter that will differentiate to replace damaged and
worn out cells in the adult tissue or organ.
B Stem cells are embryonic cells that persist in the adult, and can give rise to all of the cell
types in the body.
C Stem cells are differentiated cells that have yet to express the genes and produce proteins
characteristic of their differentiated state, and do so when needed for repair of tissues and
organs.
D Stem cells are fully differentiated cells that reside under the surface of epithelial tissue, in
position to take over the function of the tissue when the overlying cells become damaged or
worn out.
38 Which of the following regarding embryonic stem cells and hematopoietic stem cells is true?
A As embryonic stem cells develop, they turned into hematopoietic stem cells as they lose their
ability to differentiate into all types of cells.
B Embryonic stem cells have more genes than hematopoietic stem cells and thus are able to
form more types of cells.
C Under normal conditions, embryonic stem cells express more of their genes compared to the
hematopoietic stem cells.
D Both stem cells are derived from the zygotic stem cells with the hematopoietic stem cells
having a lowered telomerase activity compared to the embryonic stem cells.
39 Some scientists are concerned about the release of genetically modified microorganisms into their
natural habitat.
21
232
40 An attempt was made to produce Golden rice. To determine whether or not DNA from the daffodils
and the bacterium had been successfully incorporated in the DNA of the rice, scientists used PCR
and gel electrophoresis to produce DNA profiles.
The following DNA profiles belong to the original strain of rice, three strains I to III of genetically
modified Golden rice, and the species of daffodil and bacterium used to incorporate beta-carotene
genes in the rice.
Which one of the strain(s) of Golden rice has successfully incorporated DNA from both the daffodil
and the bacterium?
A Strain I only
B Strain II only
END OF PAPER
22
233
2013 CJC H2 Biology Prelim Paper 1 Answers
1 D 21 B
2 B 22 C
3 B 23 D
4 A 24 B
5 C 25 A
6 C 26 C
7 D 27 A
8 B 28 D
9 C 29 A
10 D 30 C
11 C 31 D
12 D 32 D
13 A 33 D
14 C 34 A
15 C 35 B
16 D 36 B
17 C 37 A
18 D 38 D
19 C 39 D
20 C 40 B
23
234
1
H2 BIOLOGY
9648/01
Paper 1 Multiple Choice Questions 23 September 2013
1 hour 15 mins
Additional Materials: OTAS sheet
INSTRUCTIONS TO CANDIDATES:
DO NOT TURN THIS PAGE OVER UNTIL YOU ARE TOLD TO DO SO.
READ THESE NOTES CAREFULLY.
There are forty questions in this paper. Answer all questions. For each question there are four
possible answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer
Sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer. Any
rough working should be done in this booklet.
[Turn over
DHS 2013
235
2
Which bar chart shows the results of investigating hydrolytic enzyme activity?
J K
J K L
Enzyme C catalyses the splitting of C into D and J. Assuming that product E is an allosteric
inhibitor of C, which of the following would likely happen if E were not consumed in a
subsequent reaction?
5 The figure shows the life cycle of the water flea, Daphnia. The cells of individual R contain
10 chromosomes.
R
P
T
A I and II only
B I and III only
C II and IV only
D All of the above
237
4
6 Bacteria grown in 15N for many generations were transferred to 14N for further replication.
DNA from the bacteria was extracted and separated by density gradient centrifugation.
What are the percentages of DNA containing 15N and 14N in tube 4?
7 What is the basis for the difference in the synthesis of the leading and lagging strands of
DNA molecules?
A I and III
B II and IV
C I and IV
D II and III
238
5
A III only
B IV only
C I and II
D III and IV
9 Which of the following shows the possible effects of a single nucleotide substitution in each
of the following locations in a gene on the production of the protein it codes for?
10 Two new viruses E and Z, which infect eukaryotic cells, have been identified.
In one experiment, the nucleic acid from each virus is isolated and analyzed over a range of
temperatures. The light absorbance of nucleic acids changes when denaturation or
annealing occurs. The behaviour of the nucleic acid from each virus is shown in the graph.
Light Virus E
absorbance
(arbitrary units)
Virus Z
Temperature (C)
In a second experiment, it is found that treatment with reverse transcriptase inhibitors or with
inhibitors of DNA synthesis blocks the ability of virus Z to infect cells. In contrast, reverse
transcriptase inhibitors have no effect on the ability of virus E to infect cells but DNA
synthesis inhibitors block infection by virus E.
Which of the following conclusions can be drawn from both the experiments?
11 Which of the following correctly identifies the reproductive cycles X and Y and structures A
and B?
X Y A B
A lytic lysogenic virus DNA provirus
12 Bacterial strain A has been infected with viruses. Upon lysis, the virions produced are
introduced to Bacterial strain B. After a short period of time, a new strain of bacteria is
detected that is very similar to strain A but has a few characteristics of Strain B. Which is the
process that leads to the production of the new strain?
A Conjugation
B Transduction
C Transformation
D Transposition
241
8
13 A student has two cultures of cells. Cell culture A consists of a culture of normal cells
whereas cell culture B consists of a culture of cells dividing uncontrollably (isolated from a
tumour). He wanted to determine if the uncontrolled growth (in culture B) was the result of
an oncogene or a mutated tumour suppressor gene. He decided to fuse the cells from the
two cultures (i.e. culture A with culture B) to form a hybrid cell line. As he was not certain of
the expected results, he wrote down all the possible combinations in terms of the expected
results and the gene that is involved as shown below.
Of the four possibilities, only two of them are set correctly. Based on your understanding of
the genetic changes that has occurred in oncogenes and the mutated tumour suppressor
genes, choose one of the options below which shows the two correct possibilities.
A 1 and 3
B 1 and 4
C 2 and 3
D 2 and 4
Which row of the table correctly identifies which genes are prokaryotic and which are
eukaryotic?
prokaryotic eukaryotic
A 1 and 2 3 and 4
B 1 and 3 2 and 4
C 2 and 3 1 and 4
D 2 and 4 1 and 3
242
9
I. Telomere
II. Centromere
III. Intron
IV. Control element
A I and II
B II and III
C III and IV
D I, II and III
16 A cross between a round-leafed, tall plant and round-leafed dwarf plant produced the
following offspring:
Key
121 round-leafed, tall plant R round leaf
124 round-leafed, dwarf plant r oval leaf
42 oval-leafed, tall plant T tall
37 oval-leafed, dwarf plant t dwarf
A RrTt x Rrtt
B RrTt x RRtt
C RrTT x Rrtt
D RrTT x RRtt
243
10
I Autosomal dominant
II Autosomal recessive
IV Sex-linked recessive
A I only
B II only
C I and III
D II and IV
18 Agoutic mice have banded hairs, giving a grey colour. Black mice have unbanded hairs.
White mice have no pigment. A cross between a homozygous black mouse and a white
mouse produced offspring with agouti hair. Another cross between the black mouse and
another white mouse produced some offspring with agoutic hair and some with black hair.
A There is a single gene with two codominant allele, black and white.
B There is a single gene with three alleles in a dominance series, black grey white.
C There are two epistatic genes, one controlling pigment production and one controlling
banding.
D There are two linked genes, one controlling pigment production and one controlling
banding.
244
11
Which of the following statement is/are CORRECT outline of the main events in
photosynthesis?
A 1 only
B 2 only
C 1 and 2
D 3 and 4
20 Dinitrophenol is a metabolic poison that can lodge within the thylakoid membranes of
chloroplasts. It then provides an alternative route for H+ ions to diffuse across the thylakoid
membranes. In what way will the Calvin cycle be affected in chloroplasts poisoned by
dinitrophenol?
A No change in rate as Calvin cycle occurs in the stroma and not at thylakoid membranes.
B The rate of Calvin cycle will increase as pH in the stroma will decrease towards the
optimum for enzymes involved in the cycle.
C The rate of Calvin cycle will decrease with the accumulation of glycerate-3-phosphate.
D The rate of Calvin cycle will decrease with the accumulation of glyceraldehyde-3-
phosphate.
245
12
21 Isotopes of oxygen can be used to distinguish between oxygen absorbed by plants and
oxygen evolved.
A mixture of oxygen isotopes 16O2 and 18O2 was supplied to a suspension of the
unicellular alga Chlorella which had previously been exposed to 16O2 only. During the
following hour, changes in concentration of these gases in the suspension were measured
in light and dark conditions.
16
O2
18
oxygen O2
concentration/
arbitrary units
time
16
What caused the concentration of O2 to rise in light?
22 Both glucose and appropriate enzymes are necessary for the process of glycolysis to
begin.
A Acetylcoenzyme A
B ATP
C Pyruvate
D Reduced NAD
246
13
I II III
A Mitochondria + glucose Cell lysate + pyruvate Chloroplast + RuBP
carboxylase
B Mitochondria + starch + Cell lysate + RuBP Cell lysate + pyruvate
amylase carboxylase
C Cell lysate + glucose Cell lysate + pyruvate Mitochondria + pyruvate
D Cell lysate + pyruvate Chloroplast + RuBP Lysosome + starch
carboxylase
25 The diagram represents a transverse section through a neurone as seen under an electron
microscope. Which of the following most appropriately describes the function of X?
27 These statements describe an action potential. Which one of the following is FALSE?
28 The diagram represents a G-protein coupled receptor on the cell surface membrane. A
peptide hormone ligand is bound to the receptor and initiates the production of a second
messenger.
A a peptide hormone
B ATP
C cyclic AMP
D kinase
248
15
29 Which of the following is a correct statement regarding the hormonal control of blood glucose
level?
30 The diagram below shows an example of cell signaling. Identify the stages P, Q and R.
P Q R
A amplification ligand-receptor interaction phosphorylation
B ligand-receptor interaction dephosphorylation amplification
C transduction phosphorylation amplification
D ligand-receptor interaction amplification dephosphorylation
249
16
A Amino acid
B DNA
C Edited mRNA transcript
D Primary mRNA transcript
What could account for the difference in the rates of the development of resistance?
33 Fish in the Artic and Antarctica have antifreeze proteins. But these two population of fish
diverged long before the antifreeze genes evolved. It was found that the genes that code for
the antifreeze proteins in fish, at the Artic and Antarctica, are quite different. This is evidence
that separate and independent episodes of molecular evolution occurred, and obtained the
same functional result.
Which of the following processes is responsible for the antifreeze property in the two
populations of the fish?
A Reproductive isolation
B Divergent evolution
C Convergent evolution
D Geographical isolation
250
17
35 The diagram below shows the changes in temperature in a thermocycler over time during
polymerase chain reaction.
X X
Z Z
Y Y
36 The diagram below shows the position of four restriction sites J, K, L and M for four different
restriction enzymes in a single plasmid. The distances between these sites are measured in
kilobases of DNA.
The plasmid was cut using only two restriction enzymes. The resulting fragments were
separated by gel electrophoresis. The positions of the fragments are shown in the chart
below.
A J and K
B L and M
C J and M
D L and K
252
19
37 A synthetic plasmid having an origin of replication (ori), a restriction site (R), two genetic
markers, -galactosidase gene (-gal) and tetracycline-resistance gene (tetr), was used as a
vector to transfer the human growth hormone gene into bacteria. The -gal gene codes for an
enzyme -galactosidase, which breaks down a colourless compound called X-gal to a blue
compound.
At which position should the restriction site (R) be located on the plasmid in order to identify
the desired transformed bacteria on an agar medium containing both X-gal and tetracycline?
38 How is the polymerase chain reaction (PCR) similar to the replication of DNA?
A I only
B II and IV only
C I, II and III only
D II, III and IV only
253
20
39 The autoradiograms obtained below (after electrophoresis and Southern Blotting) show
human DNA digested with a specific restriction enzyme and probed with labeled rRNA.
On the left, the probe used was 28S rRNA. On the right, the probe used was 18S rRNA.
If the arrows in the following map show the location of the restriction sites of this restriction
enzyme, which map best explains the results shown above?
40 Which of the following explains why insulin expressed in a prokaryotic host cell is not
functional?
A I only
B II only
C II and III
D I, II, III and IV
END OF PAPER
254
21
255
1
H2 BIOLOGY 9648/02
Paper 2 Structured and Free-Response Questions 16 September 2013
2 hours
Additional Materials: Writing paper
INSTRUCTIONS TO CANDIDATES:
DO NOT TURN THIS PAGE OVER UNTIL YOU ARE TOLD TO DO SO.
READ THESE NOTES CAREFULLY.
8 / 9
INFORMATION FOR CANDIDATES
9 / 9
Essential working must be shown.
Section C [20]
The intended marks for questions or parts of
questions are given in brackets [ ]. 1/2
Total [140]
Questio
on 1
Fig 1.1
257
3
Fig 1.2
2
258
4
(ii) Describ
be region X. [2]
Activ
ve site
Fig 1.3
(ii) With re
eference to Fig 1.3, exxplain how the removal of a hexxapeptide frrom the
amino terminus
t of trypsinoge n can resultt in the activ
vation of thee enzyme. [2]
Total: [10]
259
5
on 2
Questio For
Examiners
E
use
Fig. 2.1 shows a fe A F) of m eiosis in the
ew stages (A e lily, Lilium
m longiflorum
m.
A B C
D E F
Fig. 2.1
(a) W
With referencce to Fig. 2.1,
2
(ii) arrange
e these stag
ges in the ccorrect sequence. [1]
(ii) describ
be the main events thatt will occur to
t complete
e meiosis affter stage A.
A [2]
260
6
Total: [5]
261
7
Questio
on 3 For
Examiners
use
A studyy of a bacte
erias chrommosome sh howed that it possesse es a lac opperon to allow the
bacteriu
um to metabbolise lactos
se. The stru
ucture of the n is shown in Fig 3.1 below:
e lac operon b
Fig 3.1
Fig 3.2
(b) Explain the changes in graph C in Part II and Part III. [4]
Total: [5]
263
9
Question 4 For
Examiners
use
(a) Alpha tropomyosin (-TM) is a protein found in muscles as well as several other
tissues in different isoforms.
Fig 4.1 shows the organisation of the -TM gene with exons shown as boxes.
Fig 4.1
Fig 4.2 shows the -TM mRNA transcripts found in various tissues.
Fig 4.2
(i) Explain how the -TM gene can produce different -TM isoforms in different
cell types. [3]
264
10
(b) Telomeres are found at the ends of eukaryotic chromosomes. They contain a series of
tandem repeat sequences and end with a single-stranded section called the 3
overhang. This 3 overhang results from the limitation of DNA polymerase to replicate
all the way to the end of the chromosome. This is known as the end-replication
problem.
Fig 4.3
(ii) Explain the role of the T loop structure shown in Fig 4.3. [1]
265
11
Total: [10]
266
12
Question 5 For
Examiners
use
In Drosophila flies, the wing shape and eye colour are controlled by two different genes
found on separate chromosomes. The gene controlling wing shape is found on chromosome
2 and has 2 alleles. Curly wings were found to be dominant over normal wings. Fig 5.1 and
Fig 5.2 shows the normal wing and curly wing phenotype respectively.
The gene controlling eye colour is found on the X chromosome and has two alleles. It was
observed that red eye trait is dominant over white eye trait.
(b) Construct a genetic diagram showing the phenotypes of the offspring and the
expected ratio of phenotypes when a white eyed female is crossed with a red eyed
male, both are heterozygous for curly wings. [4]
267
13
83
3 red-eyed females
f witth curly wing
gs
41
1 red-eyed females
f witth normal wwings
78
8 white-eyed males witth curly wing
gs
38
8 white-eyed males witth normal wwings
A Chi-square
e test was performed o n the resultts on the cro
oss.
Fig 5.3
3
Tottal: [10]
268
14
Question 6 For
Examiners
use
C3 plants undergo photorespiration, a process by which RuBP has oxygen added to it by
the enzyme RuBisCO, instead of carbon dioxide during normal photosynthesis.
Photorespiration can occur when carbon dioxide levels are low and when temperatures are
high, but unlike respiration, photorespiration produces no ATP.
Fig. 6.1 shows the rate of photosynthesis (measured by rate of CO2 fixation, graph drawn in
solid line) and the rate of photorespiration (measured by rate of O2 fixation, graph drawn in
dotted line) in wheat over a typical summer day.
Fig. 6.1
(a) With reference to Fig. 6.1, explain how stomata size affects the overall rate of
photosynthesis in wheat. [3]
(b) State the type of inhibitor that oxygen is to the enzyme RuBisCO. [1]
269
15
(c) Some plants have mechanisms to reduce photorespiration, such as the C4 plants.
These plants undergo additional steps of capturing carbon dioxide using another
enzyme (PEP carboxylase) to form oxaloacetate, before undergoing the Calvin cycle.
PEP carboxylase has been found to have a lower Km than RuBisCO for carbon
dioxide. Examples of C4 plants include sugar cane and maize.
Describe the type of environment that C4 plants are usually found in and explain how
PEP carboxylase enables C4 plants to be better adapted to their environments. [3]
Total: [9]
270
16
on 7
Questio For
Examiners
E
use
Fig. 7.1
1 shows thee observed changes inn permeability of the ax
xonal plasmma membra
ane of a
neuronee to sodium
m ions and to
o potassium
m ions durin
ng a single action
a potenntial.
Fig. 7.1
(a) De
escribe and
d explain the f sodium ions betweeen 0.5 ms and
e shape of the curve for a 0.7
mss. [4]
271
17
(b) During an action potential, the membrane potential rises to +40 mV and then falls. Use
information from Fig. 7.1 to explain the fall in membrane potential. [3]
(i) Predict and explain the effect of TEA on the axonal plasma membrane of the
neurone. [2]
(ii) Predict and explain the effect of TEA if it could be applied selectively to a
presynaptic neurone that releases an excitatory neurotransmitter. [2]
(d) After exercise, some ATP is used to re-establish the resting potential in axons. Explain
how the resting potential is re-established. [2]
Total: [13]
272
18
Question 8 For
Examiners
use
(a) Fig. 8.1 shows the sequence of events in the inositol phosphate signaling pathway.
Fig. 8.1
(i) describe the main sequence of events that leads to the activation of protein
kinase C. [4]
(ii) explain why the signal molecule cannot act directly on the DNA in the nucleus.
[1]
273
19
Fig. 8.2
2
Coomment if the data in Fig. 8.2 su pports the hypothesis that high cconcentratio on of up
to 14.3mM off EGTA can effectively inhibit the binding
b of IP
P3 to its recceptor. [2]
To
otal: [9]
274
20
on 9
Questio For
Examiners
E
use
(a) IIn Lake Tan
nganyika in Africa, therre are six sp
pecies of fis
sh of the geenus Tropheeus and
a much larg ger numberr of distincttly coloured
d subspecie es of each oof the six species.
s
TTropheus species
s are small fish that are co onfined to issolated rockky habitats around
tthe shores of
o Lake Tannganyika.
SSecondary radiations into the m any subspe ecies occurrred during the last 2002 000
yyears. Sommetime durin ng this peri od, the water level in the lake feell, resulting
g in the
fformation of three sepaarate lake b basins. The
ese basins persisted
p foor many tho ousands
oof years beffore the watter level rosse again.
F
Fig. 9.1 shows an outtline map o of the lake and the loc
cation of thhe three tem
mporary
b
basins caussed by lowe
ering of lake
e levels.
Fig. 9.1
(b) Recent research has compared DNA sequence of cytochrome b gene of the six
different species of Tropheus. Fig. 9.2 shows part of the cytochrome b DNA
sequence.
T. brichardi CTTTTAACTATGATAACAGCTTTTGTGGGCTACG
T. kasabae CTTTTAACTATGATAATAGCTTTTGTGGGCTACG
T. annectens CTTTTAACTATGATAACAGCTTTTGTGGGCTACG
T. moorii CTTTTAACTATGATAACAGCTTTTGTGGGTTACG
T. polli CTTTTAACTATAATAACAGCTTTTGTGGGCTACG
T. duboisi CTTTTAACCATGATAACGGCTTTTGTAGGCTATG
Fig. 9.2
A family tree based on differences between the DNA sequences is shown in Fig. 9.3.
Fig. 9.3
With reference to Fig. 9.2, explain why different species of Tropheus can have similar
DNA sequence in their cytochrome b gene. [2]
276
22
(c) With reference to Fig. 9.2 and Fig 9.3, describe how the time of divergence of the
species could be estimated. [3]
Total: [9]
277
23
Question 1
(b) (i) Describe how molecular methods can be used to classify organisms. [6]
(ii) Suggest how bacteria evolve. [4]
OR
Question 2
(a) Outline the differences between prokaryotic and eukaryotic control of gene expression. [10]
Total: [20]
END OF PAPER
278
24
BLANK PAGE
279
25
Answer Scheme
Structured Answers
Question 1
(a)
A Rough Endoplasmic Reticulum;
Ribosomes on RER responsible for synthesis of proteins (enzymes) to be secreted;
OR
Packaging of proteins (enzymes) for transport to Golgi Apparatus in transport vesicles;
B Mitochondrion;
Aerobic cellular respiration for the synthesis of ATP necessary for protein synthesis;
C Nucleus;
Contains the genes that code for the various pancreatic enzymes which are transcribed into
mRNA for protein synthesis;
(b)(i)
Alpha helix,
held by H bonds located between CO and NH groups (of the main polypeptide chain);
Between n and n+4 residues in the chain;
(ii)
Cleavage of hexapeptide from amino terminus shortens primary structure which changes the
secondary structure such that pleated sheets can form;
this creates a pocket / groove for the substrate to fit into on the surface of the tertiary
structure that functions as the active site of the enzyme;
Question 2
(a) (i) D, F, C, B, A, E ;
(ii)
The chromosomes uncoil / decondense and become very indistinct to form chromatin;
Spindle fibres disassemble / disintegrate / dissassociate;
Nuclear envelopes reform around each nucleus;
2 max
(b)
Crossing over between non-sister chromatids / homologous chromosomes during prophase
I;
Independent assortment and random segregation of homologous pairs of chromosomes
during metaphase I and anaphase I respectively;
Independent assortment and random segregation of non-identical sister chromatids due to
crossing over during metaphase II and anaphase II respectively;
2 max
280
26
Question 3
(a) glucose as the level of glucose is decreasing;
(b)
In Part II, there is no increase in the cell count of the bacteria as glucose has been used up
and time is needed for the expression/activation of the lac operon to produce -
galactosidase before lactose can be used/metabolized;
The presence of lactose means that the small amount of -galactosidase present in the
bacterial cells will catalyse conversion of some lactose molecules to allolactose;
Allolactose binds to the lac repressor, causing a change in conformation, inactivating it such
that it no longer binds to the lac operator. Allowing RNA polymerase access to the promoter;
The absence of glucose means that cAMP levels in the cells are high;
cAMP binds to CAP, causing a change in conformation of CAP such that it binds to the CAP
binding site, increasing RNA polymerases affinity for the promoter, increasing the rate of
transcription of -galactosidase;
many copies of -galactosidase, allowing bacteria to efficiently use lactose as a respiratory
substrate to support growth, thus the increase in the bacterial cell count seen in part III. This
continues until lactose is used up and cell count levels off;
4 max
Question 4
(a)(i)
alternative RNA splicing of the pre-mRNA;
different spliceosomes are present in different cell types which recognize different base
sequences are introns and exons;
from 1 gene 1 pre-mRNA different mRNAs produced different proteins;
(ii)
1 gene can code for different versions of a protein, this increases the coding capacity of the
genome without needing to increase the amount of DNA within the cell;
(b)(i)
DNA polymerase can only add nucleotides to the 3 hydroxyl end of a pre-existing daughter
strand / cannot add nucleotides to the bare template;
In lagging strand synthesis, once that primer is removed, it cannot be replaced with DNA as
there is no 3 end onto which DNA polymerase can add deoxyribonucleotides;
Therefore the 5 ends of daughter DNA strands of the lagging strand cannot be completed /
repeated rounds of replication thus produce shorter and shorter DNA molecules at the 5
end;
(ii)
to prevent exonucleases from degrading the ends of the linear DNA molecules;
to prevent fusions of the ends of chromosome with other DNA molecules;
1 max
(iii)
Telomere length plays a role in regulating replicative cell senescence as the length of the
telomeres limits the number of times each cell can divide / ref to apoptosis;
Telomerase allows the generation of telomeres lost at each cell division. This allows cancer
cells to divide continuously and indefinitely;
281
27
Question 5
(a)
In a heterozygous individual, the phenotype of the dominant allele is always expressed and
masks the effect of the recessive allele;
(b)
Let A represent the dominant allele for curly wings
a represent the recessive allele for normal wings
XR represent the dominant allele for red eyes
Xr represent the recessive allele for white eyes
Punnets square:
XRA XRa YA Ya
[1]
XrA XRXrAA XRXrAa XrYAA XrYAa
Offspring 3: 1: 3: 1 [1]
phenotypic ratio:
(c)(i)
Classes Observed Expected Expected (O E)2 (0 E)2
number (O) ratio number (E) E
Red eyed female 83 3 90 49 0.544
with curly wing
Red eyed female 41 1 30 121 4.033
with normal wing
White eyed male 78 3 90 144 1.6
with curly wing
White eyed male 38 1 30 64 2.133
with normal wing
Total 240 8 240 0 0
8.31
(Calculations / Workings [1] Correct Answer to 2d.p. [1])
282
28
(ii)
0.02 <p < 0.05;
(iii)
Critical 2 value (7.82) < calculated 2 value (8.31), therefore there is a significant difference
between observed and expected values;
cross does not follow Mendalian ratios and other factors may be at work;
Question 6
(a)
As average stomata size increases from 0 to 10 units, rate of photosynthesis increases
drastically by 550% / from 20 to 130 a.u.;
An increase in stomata size enables more atmospheric CO2 to enter, which is fixed by
RuBisCO;
(b)
Competitive;
(c)
Dry and hot;
Stomata closes and thus result in lower CO2 concentration entering leaves;
Since PEP carboylase has a higher affinity for carbon dioxide than RuBisCO/ PEP
carboylase not inhibited by oxygen;
Thus C4 plants are able to fix the carbon dioxide more efficiently;
(d)
Calvin cycle is the light-independent stage of photosynthesis;
Only through Calvin cycle can carbon dioxide be fixed to form glucose/ carbohydrate;
283
29
Question 7
(a)
permeability to sodium ions increases drastically from 0 to 28 a.u;
initial rise in permeability to sodium ions occurs when a stimulus opens some voltage-gated
sodium channels;
Influx of sodium ions through those channels depolarises the membrane, making the inside
of the neurone positive with respect to the outside / threshold;
As the influx of sodium ions continues, the membrane becomes further depolarised in a
positive-feedback loop, opening more voltage-gated sodium channels;
This allows even more sodium ions to diffuse into the neurone, explaining the sharp rise in
permeability to sodium ions;
4 max
(b)
The fall in membrane potential indicates repolarisation of the membrane as efflux of
potassium ions occurs without further influx of sodium ions;
(c)(i)
Depolarised membrane would not be able to repolarise / return to the resting potential;
This is because efflux of potassium ions cannot occur when voltage-gated potassium
channels are blocked by TEA;
OR
Takes a long time for resting potential to return back to resting potential;
hence the next action potential will take a longer time to be generated / no action potential
can be generated;
(ii)
The presynaptic neurone would continue to release excitatory neurotransmitters until the
neurotransmitters in the presynaptic neurone are depleted;
This is because calcium ions would continue to enter the presynaptic neurone via the
voltage-gated calcium channels and trigger the release of excitatory neurotransmitters so
long as the presynaptic membrane remains depolarized;
OR
TEA prevents next action potential from being generated since neurone is perpetually in its
depolarised state / repolarisation cannot occur when efflux of potassium ions across the
voltage gated channels cannot take place.
hence the neurone is not able to release neurotransmitter across the synapse upon
stimulation. / action potential cannot be generated / decrease the occurrence of action
potential;
(d)
Sodium-potassium ion pump by active transport with the hydrolysis of ATP;
2 potassium ions in and 3 sodium ions out of the neurone;
284
30
Question 8
(a) (i)
Signal molecule binds to GPCR via ligand-receptor interaction which in turn activates G-
protein. G-protein is activated when it is attached to GTP nucleotide;
Upon activation, activated G-protein dissociates from the receptor, diffuses along the
membrane and then binds to and activates phospholipase C-;
IP3 serves as the second messenger and binds to ligand-gated Ca2+ channels in the ER
membrane, causing them to open;
Ca2+ ions flow down concentration gradient from ER lumen to cytosol and binds to protein
kinase C, thus activating the enzyme;
4 max
(ii)
Signal molecule is water soluble / lipid-insoluble, thus it cannot pass through the
hydrophobic lipid bilayer/ fatty acid tails of the plasma membrane;
(iii)
Dephosphorylation of IP3 by phosphatase which removes phosphate groups from proteins;
IP3 will no longer be able to bind to ligand-gated Ca2+ channels, hence leading to the inability
of Ca2+ ions to diffuse into the cytosol;
Presence of calcium ions that enter the cytosol is rapidly pumped out, mainly to the exterior
of the cell disruption to the ionic gradient of Ca2+ / answers pertaining to the disruption in
the Ca2+ concentration;
Breakdown of signal molecule such that it is unable to bind to GPCR, forming ligand-
receptor interaction. Hence, there will be no activation of G-protein and phospholipase C;
2 max
(b)
Data in Fig. 8.2 do not support the hypothesis that high concentration of EGTA can inhibit
the binding of IP3 to its receptor;
When total EGTA concentration was increased from 4.5 mM to 10.0 mM to 14.3 mM, the
calcium release rate remained relatively constant at approximately 0.020 sec-1;
285
31
Question 9
(a) (i)
variations in the Tropheus fish population due to mutation resulting in different alleles;
at least 6 different niches in the lake with different selection pressure;
fish with at selective advantage survive and reproduce viable offspring;
passing on advantageous genes/alleles to the next generation;
accumulation of many genetic changes over a long period of time to evolve into 6 species;
reproductive/ behavioural/ sympatric/ allopatric/ geographical isolation/ accept hundreds of
km apart thus no gene flow between different populations;
4 max
(b)
evolved from a common ancestor;
cytochrome b gene code for important protein involved in respiration thus any mutation will
result in non-functional protein which will be fatal to the organism;
this gene would have gone through the least mutation not counting silent mutation;
3 max
(c)
compare and note the number of differences in the DNA sequences between species;
determine the age of fossil record of each species by dating;
calculate the rate of mutation using calibrated molecular clock;
no. of mutation/ no. of difference in DNA sequence is used to calculate the length of time
since divergence;
3 max
286
32
Essay answers
1(a)
Similarities:
1. Function: Both processes are required for gene expression / protein synthesis;
2. Process: Both involve synthesis of polymers from monomers by condensation
reaction with the removal of 1 water molecule;
3. Process: both involve synthesis of polymer based on a reference molecule /
template;
4. Process: initiation of both processes requires the aid of factors in formation of
initiation complex;
5. Both require post-processing of products post-transcriptional modification for
pre-mRNA to become mature mRNA and post-translational modification of
polypeptide chain before formation of mature protein;
Differences:
1 (b) (i)
1. Molecular methods used in classification of organisms involve using molecular homology
such as similarities in DNA or amino acid sequences;
2. molecular methods are objective and quantifiable ways to classify organisms base on
their phylogenetic relationships;
4. the higher the percentage of similarities in DNA or amino acid sequence, the more
closely related the organisms are; Accept: vice versa
5. If the species have evolved from the same common ancestors, their DNA or amino acid
sequence should show a high degree of homology with each others and also with that of
the original species;
6. based on the idea of molecular clock, different species can be arranged in chronological
order of time of evolution, thus creating a phylogeny and extrapolation in phylogenetic
studies;
7. Molecular methods can pick up in silent mutation thus the mutation will be reflected in
the DNA sequence;
8. New species are evolved when changes in DNA sequence are accumulated over time;
6 max
(b) (ii)
2(a)
Genetic code
Prokaryotes Eukaryotes
Transcriptional control
Prokaryotes Eukaryotes
Post-transcriptional
Prokaryotes Eukaryotes
Translational
Prokaryotes Eukaryotes
Post-translational
Prokaryotes Eukaryotes
2 (b)(i)
1. Acetyl CoA and oxaloacetate undergo a condensation reaction. Acetyl CoA adds its two-
carbon acetyl group to oxaloacetate to form citrate. Enzyme = citrate synthetase;
2(b) (ii)
Similarities
Both processes synthesizes ATP by chemiosmosis, where energy released by the transport
of electrons down electron transport chain is used to pump H+ against a concentration
gradient. And as the H+ diffuses back down a concentration gradient, the energy released is
used to phosphorylate ADP to ATP;
Both processes involves the transport of electron down ETC.
2 max
Differences
Features Oxidative phosphorylation Photophosphorylation
Definition ;
Synthesis of ATP occurs as Synthesis of ATP occurs as
electrons are transferred from electrons are transferred from
NADH or FADH2 to oxygen by an water and chlorophyll
electron transport chain. The molecules to NADP by an
energy coupling occurs through a electron transport chain. The
proton gradient. energy coupling occurs
through a proton gradient.
H2 BIOLOGY 9648/03
Paper 3 Applications Paper and SPA Planning Task 23 September 2013
2 hours
Additional Materials: Writing paper
INSTRUCTIONS TO CANDIDATES:
DO NOT TURN THIS PAGE OVER UNTIL YOU ARE TOLD TO DO SO.
READ THESE NOTES CAREFULLY.
Section A:
Consists of 4 Structured Questions
Answer all questions.
Write your answers in the space provided on the
question paper.
Section B:
Consists of 1 SPA Planning Task
Write your answers on the separate writing papers
provided. At the end of the examination, fasten all
your work securely together.
For Examiners Use
Section C: Section A [40]
Consists of 1 Free-Response Question.
Write your answers on the separate writing papers 1 / 12
provided. At the end of the examination, fasten all
your work securely together. 2 / 8
Question 1
Fig 1.1 shows two plasmids pAMP and pKAN. Ampr and Kanr confer resistance to the
antibiotics ampicillin and kanamycin respectively.
Bam HI Bam HI
Kanr
Nco I
784 bp
pAMP pKAN 1875 bp
3755 bp
4539 bp 4207 bp
2332 bp
Hind III
ori
Ampr
Hind III
Sca I
ori
Fig 1.1
In an experiment to make a cloning vector, solution containing the plasmids pAMP and
pKAN were treated with a solution containing restriction enzymes BamHI and HindIII. DNA
ligase was then added and the mixture was incubated at 37oC.
This experiment produced the plasmid pAK which can be used as a cloning vector. The
restriction map of pAK is shown in Fig 1.2 and the specific recognition sequence of its
restriction sites are shown in Table 1.3.
Bam HI
Restriction Recognition Sequence
Enzyme
Kanr Bam HI 5'-G^G A T C C-3'
3'-C C T A G^G-5'
Nco I
Hind III 5'-A^A G C T T-3'
3'-T T C G A^A -5'
1875 bp
pAK
Sca I 5'-A G T^A C T-3'
5630 bp 3'-T C A^T G A-5'
3755 bp
Nco I 5'-C^C A T G G-3'
3'-G G T A C^C-5'
Ampr
Hind III
^ indicates where the restriction enzyme cuts
Sca I ori
Fig 1.2 Table 1.3
293
3
(a) Restriction sites are palindromic. Explain the meaning of the term palindromic. [1]
(b) With reference to Fig 1.2 and Table 1.3, explain why Nco I is a more suitable choice of
restriction enzyme for use in genetic engineering with the pAK plasmid than Sca I. [2]
To clone a human gene with a molecular size of 600 bp in bacterial cells, the following
proceedure was carried out as shown in Fig 1.4.
Isolate mRNA
Transformation of recombinant
plasmids into E.coli
Fig 1.4
294
4
(d) Draw three possible gene products formed in the ligation mixture. [3]
295
5
(e) Explain how the plasmid pAK can aid in the successful selection of recombinant
colonies with the gene of interest. [3]
Total: [12]
296
6
on 2
Questio Foor
Exxaminers
usse
A lengthh of DNA frrom one of a pair of ho
omologous chromosom mes is show
wn in Fig 2.1. The
target sites of EcoR
RI are show
wn by arrowws and the le NA betweenn the target sites is
ength of DN
given in kilobases (kb).
(
Fig 2.1
(a) On
n Fig. 2.2 below,
b
(i)) Draw all
a the fraggments of this length h of DNA produced from the pair of
homolo ogous chrom
mosomes in n each of the individualls tested annd label the size of
the frag
gments prod
duced. [2]
Fig 2.2
297
7
(c) State the role of the DNA ladder seen in Fig 2.2. [1]
Total: [8]
298
8
Question 3 For
Examiners
use
(a) Cystic fibrosis (CF) is a genetic disease which affects many parts of the body. This
disease is caused by mutations of a gene coding for a transmembrane protein
(CFTR) which acts as an ion pore.
A study on ion transport was carried out on pancreatic cells by comparing ion
transport in cells expressing the normal allele for CFTR with that in cells expressing
mutant alleles. The pancreas secretes pancreatic juice which is alkaline to neutralize
the acidic gastric acid from the stomach.
The abilities of the cells to transport HCO3 and Cl were measured and expressed as
a HCO3 : Cl transport ratio. The results are shown in Table 3.1.
Table 3.1
(i) With reference to Table 3.1, explain the cause of inadequate functioning of the
pancreas in CF. [2]
(b) Gene therapy involves transferring normal CFTR genes into lung epithelial cells with
defective genes. Describe how a liposome can be used to insert the normal CFTR
gene into a CF patient. [2]
299
9
(c) The mucus produced in the lungs of someone with cystic fibrosis contains a lot of
DNA from dead cells. DNase, an enzyme which cuts DNA into short pieces has
recently been approved for the treatment of cystic fibrosis. In an investigation, different
concentrations of DNase were added to mucus collected from people with cystic
fibrosis. Fig. 3.1 shows the results.
Fig. 3.1
Using the information given in Fig. 3.1, explain why inhaling DNase helps a cystic
fibrosis patient to breathe more easily. [3]
(d) Describe how the isolated CFTR gene can be obtained from the genome using the
polymerase chain reaction. [3]
(e) About twenty percent of the DNA molecules produced by the PCR are copied
inaccurately. Explain why it is not safe to use the PCR to clone the normal CFTR gene
for use in treating cystic fibrosis. [2]
Total: [13]
300
10
Question 4 For
Examiners
use
EH1 is a hybrid derived from a cross between Eucalyptus grandis (2n = 22) and Eucalyptus
urophylla (2n = 22). Embryo culture is used to develop EH1 embryos into plantlets. At three
different stages of the embryonic development as shown in Fig. 4.1, the nutrients and plant
growth hormones concentrations in the medium are changed to allow development into
plantlets.
Fig. 4.1
(a) (i) Explain why the EH1 plantlets grown from different hybrid embryos are not
genetically identical. [2]
(ii) With reference to Fig. 4.1, explain why the concentrations of the plant growth
hormones have to be applied and changed to ensure development of plantlets.
[3]
301
11
The average growth of wood was recorded for EH1 grown in different parts of the
United States. Non-GM EH1 was grown in plot A, while GM EH1 was grown in plots B,
C, and D. The results are shown in Fig. 4.2.
Fig. 4.2
(b) Explain how the data shows that lignin gene expression level is difficult to control in
GM crops despite being placed under the control of an antifreeze promoter. [2]
Total: [7]
302
12
Question 5
Digestion of lipids usually occurs in the small intestines by the action of pancreatic lipase.
Unfortunately, dietary fats do not dissolve in water, and bile salts secreted by the liver are
required to emulsify fats. This provides a larger surface area for lipase to act on.
Using this information and your own knowledge, design an experiment to investigate the
effect of bile salt concentration on the rate of digestion of lipids.
Your planning must be based on the assumption that you have been provided with the
following equipment and materials.
Phenolphthalein
5% lipase solution
5% Bile salts solution
Sodium carbonate solution
Distilled water
Full cream milk
Stopwatch
A variety of different sized beakers, measuring cylinders and syringes for measuring
volumes
Access to standard laboratory equipment
Total: [12]
303
13
Question 6
(b) Discuss the social and ethical considerations for gene therapy. [10]
Total: [20]
END OF PAPER
304
14
BLANK PAGE
305
15
Structu
ured Answe ers
1(a)
nucleotide sequences that are e the same on both strands of the DNA moleccule when read r in
the sam
me direction (5 to 3) / read
r the sa me in the 5
5 to 3 direction on eacch strand of DNA.
(b)
Nco I prroduces sta
aggered / stticky ends w
whereas Sca I produce
es blunt endds;
This faccilitates the
e annealing of the gene
e of interes
st to plasmid
d when thee plasmid an
nd gene
are cut with Nco I byb complemmentary basse pairing;
Using S
Sca I would require the e additional procedure of
o adding lin
nker DNA too generate sticky
o facilitate annealing of gene of intterest.
ends to
(c)
Oligo-dT primers anneal
a to 3 poly-A tail o
of mRNA
Reversee transcripttase extends primers u
using mRNA
A as templatte to syntheesize single
strande
ed cDNA, prroduct is RNNA-DNA du plex.
Partial d
digestion off mRNA using alkaline solution / RNase
R H
ref to syynthesis of 2nd comple
ementary sttrand to form
m double stranded cDN
NA using DNA
polymerase
3 max.
(d)
1 mark each
(e)
AmpR g gene codess for ampic cillin resista
ance thus allows
a for first
f selectioon for succ
cessfully
transforrmed coloniies which ha
ave taken in n the plasm
mid;
Coloniees with rean
nnealed pla ct Kanr gene
asmids will have intac e which coodes for kan
namycin
nce and will survive on kanamycin
resistan n plate;
Coloniees with reco ombinant pla asmids will gene of inte erest inserted into Kannr gene wich
h results
in inserrtional inactiivation, and
d will not surrvive on kan
namycin plaate;
306
16
2(a)
Figure2.2
(i)
Normal individual 3 correct bands, labeeled and of the correct thickness;
Heterozzygous indivvidual 4 correct
c band
ds, labeled and
a of the correct
c thickkness;
(ii)
circling of 10kb and
d 5kb bands for norma
al individual & circling of
o 20kb, 10kkb and 5 kb bands
for heteerozygous in
ndividual;
(b)
A loadinng dye is addded to the DNA samp ples to help DNA to sink into the w wells / allowss the
processs of electropphoresis to be tracked;;
DNA lad dder and saamples are loaded intoo wells;
Gel is ssubmerged in a buffer solution
s tha
at will condu
uct electricity
y;
electric current is applied
a thou
ugh electroddes at oppoosite ends of the gel;
negatively-charged d DNA fragmments migra ate to the positively charged electtrode / anod de;
Gel elecctrophoresis separates s DNA fragm ments by sizze / molecu ular weightss, with the smallest
fragmen nts moving the fastest and furthesst;
4 max.
(c)
3 (a) (i)
Transport ratio is all < 0.1 : 1.0;
Inability to transport HCO3 out of pancreatic cell;
increase in acidity / decrease in pH outside the cells in the intestine;
2 max
(ii)
Poor digestion of proteins/ lipid/starch in the intestines thus poor absorption of nutrients;
Decreases secretion of insulin/glucagon thus affect blood glucose level;
ref. damage to wall of intestine/ pain in the intestine;
1 max
(b)
Normal CFTR gene is inserted into liposomes which are inhaled/sprayed into nose and
mouth;
Liposomes fuse with the cell membrane and release normal CFTR gene into (cytoplasm of
lung epithelial ) cells;
(c)
A higher conc. of DNase will result in a greater number of shorter DNA pieces;
With shorter DNA pieces in the lungs, viscosity of the mucus is reduced;
more air can pass through the airways/airways are no longer blocked/mucus more easily
removed from airways;
(d)
Heat dsDNA to 95C for 1-2min to break the hydrogen bonds (between complementary
bases) / separate DNA strands;
Lower temperature to 55 C for 1-2min to allow annealing of forward and reverse primers to
ssDNA / to regions flanking the CFTR gene;
Increase temperature to 70C for 1-2min to allow Taq polymerase catalyses formation of
new DNA strand (using the template);
(e)
percentage risk is too high for human application/ ref to a wrong/mutant gene introduced into
CF patient;
incorrect mRNA formed changes sequence of amino acids in protein;
produce a toxic/harmful/non-functional/ mutated protein;
chloride ions not transported / thick mucus results;
2 max
4 (a) (i)
Crossing over and independent assortment and random segregation of chromosomes during
meioisis;
Formed gametes which showed variation / allelic recombination;
(ii)
Need to apply auxin and cytokinin to stimulate mitosis of undifferentiated embryonic cells;
Need to change to low auxin to cytokinin ratio to stimulate formation of shoot meristem;
Need to change to high auxin to cytokine ratio to stimulate formation of root meristem;
(b)
B, C and D experienced average winter temperature of 3 C, -1 C and 2 C respectively,
yet average growth are 5, 8 and 15 kg/ tree respectively;
There is no correlation between temperature and average growth;
308
18
Planning Answer
Essay Answers
1. remove T-lymphocytes from patient with SCID and insert healthy genes in them using a
retrovirus, then transplanting them back into the patient;
2. gene therapy can be used to treat both ADA-SCID and sex-link-SCID;
3. An ex vivo gene therapy approach was used;
4. where lymphocytes obtained from the blood of the patient/bone marrow stem cell;
5. was stimulated to proliferate in culture;
6. A functional adenosine deaminase (ADA) cDNA/ IL2-RG cDNA in a retroviral vector was
then introduced into these cells;
7. The retrovirus had been inactivated to become non-pathogenic;
8. The transgenic lymphocytes were allowed to proliferate further;
9. retroviruses naturally integrate their genome into the genome of host cells;
10. thus the retrovirus was integrating the normal ADA gene / IL2-RG gene into the
chromosomes of the patients cells during this culturing;
11. After a short period of culturing, these ADA-containing lymphocytes were re-introduced
into the patient;
309
19
6 (b) Discuss the social and ethical considerations for gene therapy.
H2 BIOLOGY 9648/1
Write your name, civics group and index number on the multiple choice answer sheet in
the spaces provided.
There are 40 questions in this paper. Answer all questions. For each question, there are
four possible answers, A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate
multiple choice answer sheet.
INFORMATION TO CANDIDATES
Each correct answer will score one mark. A mark will not be deducted for wrong answer.
Any rough working should be done in this booklet.
At the end of the examination, submit the multiple choice answer sheet only.
1 Th
he nuclei off both plan
nt and anim
mal cells co
ontain one or more deense bodie es known
as nucleoli. Which
W one of the follo
owing corrrectly describes the fuunction of nucleoli?
2 Whhat could be
b a possib
ble explana
ation for th
he ability off lysosomees to withsttand self-
dig
gestion?
3 Th
he diagram
m below sho ows the ulttrastructure aryotic cell . Which orrganelle
e of a euka
do
oes not con
ntain nucleic acid?
4 ome organ
So nisms cha ange the compositiion of the
eir membbranes to maintain
me
embrane fluidity when tempera ture chang
ges.
Whhich chang
ges occur in the com
mposition of
o the mem
mbranes folllowing a change
c to
low
w temperatture?
2H2O2 2H2O + O2
A 1 and 4
B 2 and 3
C 2 and 4
D 1, 3 and 4
7 Thhe graph sh
hows the effect
e of two
o different compound
ds on the rrate of reac
ction of
the
e enzyme at
a differentt substrate
e concentraations.
hich statem
Wh ment is true
e?
10 To function as the heritable genetic code, DNA molecules must have all of the
following structural features except
11 A particular eukaryotic protein is 300 amino acids long. Which of the following
could be the minimum number of nucleotides in the DNA molecule containing the
gene that codes for the amino acids in this protein?
A 100
B 300
C 900
D 1800
A Binary fission.
B Conjugation.
C Transduction.
D Transformation.
A 3 only
B 1 and 2
C 2 and 4
D 3 and 4
A 4 only
B 1 and 3
C 2 and 4
D 2, 3 and 4
A 1 and 3
B 2 and 3
C 1, 2 and 4
D 1, 2, 3 and 4
1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16
What is the probability that the first child of individuals 15 and 16 will be a
normal boy?
A 0.125
B 0.25
C 0.50
D 0.75
17 Agouti mice have banded hairs, giving a grey colour. Black mice have unbanded
hairs. White mice have no pigment. A cross between a homozygous black mouse
and a white mouse produced offspring with agouti hair. Another cross between the
black mouse and another white mouse produced some offspring with agouti hair
and some with black hair.
A There is a single gene with two codominant alleles, black and white.
B There is a single gene with three alleles in a dominance series, black
grey white.
C There are two epistatic genes, one controlling pigment production and one
controlling banding.
D There are two linked genes, one controlling pigment production and one
controlling banding.
Which role of the table correctly identifies which genes are prokaryotic and which
are eukaryotic?
prokaryotic eukaryotic
A 1 and 2 3 and 4
B 1 and 3 2 and 4
C 2 and 3 1 and 4
D 2 and 4 1 and 3
20 Which of the following statements about the eukaryotic control elements are
correct?
A 1 and 4
B 2 and 3
C 2, 3 and 4
D 1, 2, 3 and 4
21 Cells taken from a human bone cancer multiplied readily in culture. Analysis
showed that the cells were homozygous for the deletion of an allele on
chromosome 13 coding for a protein, RB.
22 Which of the following processes could still occur in a chloroplast in the presence
of an inhibitor that prevents H+ from passing through ATP synthase complexes?
1 Sugar synthesis
2 Photolysis of water
3 Transfer of electrons down the electron transport chain
4 Oxidation of NADPH
A 1 and 2
B 1and 4
C 2 and 3
D 3 and 4
Which of the following correctly matched the products of glycolysis and Krebs
cycle for every oxidation of one glucose molecule in this mitochondria suspension?
27 Which one of the following statements about the transmission across a typical
chemical synapse is true?
29 Some receptors for hormones like growth factors activate a protein kinase
cascade, with the participation of multiple enzymes catalysing multiple steps to
effect a change in gene expression. Which of the following statement about a
protein kinase cascade are true?
30 Which of the following statements were not part of Darwins theory of evolution by
natural selection?
A 1 and 2
B 1 and 5
C 2 and 3
D 3 and 5
31 A comparison was made between human, rabbit, mouse and chimpanzee of the
A 1 and 4
B 2 and 4
C 1, 3, and 4
D 2, 3, and 4
33 Which of the following is the most powerful way of increasing the specificity of a
DNA profile analysis?
34 The data below shows the results of electrophoresis of PCR fragments amplified
using primers for the site that has been shown to be altered in Huntington's
disease.
The inherited mutation in the Huntington's disease gene abnormally repeats the
nucleotide sequence CAG from 36 up to more than 120 times of that. The male
parent, shown as individual 2, had the onset of Huntington's disease when he was
40 years old.
Six of his children (individuals 3, 5, 7, 8, 10, 11) suffer from Huntington's disease,
and the age at which the symptoms first began is shown by the number below the
band from the PCR fragment.
A Individuals 4 and 9 do not have the trait, and will not get Huntington's
disease, but individual 6 is likely to start the disease when he reaches his
father's age of 40.
B Individuals 4, 6, and 9 have not inherited the defect causing Huntington's
disease.
C Individuals 4, 6, and 9 will still develop Huntington's disease at some point
in their lives, since the disease is inherited as a dominant trait.
D Two of the three will develop the disease, since it is inherited as a
dominant trait, but the data does not allow you to predict which two.
36 Which of the following statements are true about adult stem cells?
A 1 and 2
B 1 and 4
C 2 and 3
D 3 and 4
39 Which uses of the information from the human genome project are generally
considered to be unethical?
A 1 and 3
B 1 and 6
C 2 and 5
D 3 and 4
H2 BIOLOGY 9648/1
Write your name, civics group and index number on the multiple choice answer sheet in
the spaces provided.
There are 40 questions in this paper. Answer all questions. For each question, there are
four possible answers, A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate
multiple choice answer sheet.
INFORMATION TO CANDIDATES
Each correct answer will score one mark. A mark will not be deducted for wrong answer.
Any rough working should be done in this booklet.
At the end of the examination, submit the multiple choice answer sheet only.
1 Th
he nuclei off both plan
nt and anim
mal cells co
ontain one or more deense bodie es known
as nucleoli. Which
W one of the follo
owing corrrectly describes the fuunction of nucleoli?
2 Whhat could be
b a possib
ble explana
ation for th
he ability off lysosomees to withsttand self-
dig
gestion?
3 Th
he diagram
m below sho ows the ulttrastructure aryotic cell . Which orrganelle
e of a euka
do
oes not con
ntain nucleic acid?
4 ome organ
So nisms cha ange the compositiion of the
eir membbranes to maintain
me
embrane fluidity when tempera ture chang
ges.
Whhich chang
ges occur in the com
mposition of
o the mem
mbranes folllowing a change
c to
low
w temperatture?
2H2O2 2H2O + O2
A 1 and 4
B 2 and 3
C 2 and 4
D 1, 3 and 4
7 Thhe graph sh
hows the effect
e of two
o different compound
ds on the rrate of reac
ction of
the
e enzyme at
a differentt substrate
e concentraations.
hich statem
Wh ment is true
e?
10 To function as the heritable genetic code, DNA molecules must have all of the
following structural features except
11 A particular eukaryotic protein is 300 amino acids long. Which of the following
could be the minimum number of nucleotides in the DNA molecule containing the
gene that codes for the amino acids in this protein?
A 100
B 300
C 900
D 1800
A Binary fission.
B Conjugation.
C Transduction.
D Transformation.
A 3 only
B 1 and 2
C 2 and 4
D 3 and 4
A 4 only
B 1 and 3
C 2 and 4
D 2, 3 and 4
A 1 and 3
B 2 and 3
C 1, 2 and 4
D 1, 2, 3 and 4
1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16
What is the probability that the first child of individuals 15 and 16 will be a
normal boy?
A 0.125
B 0.25
C 0.50
D 0.75
17 Agouti mice have banded hairs, giving a grey colour. Black mice have unbanded
hairs. White mice have no pigment. A cross between a homozygous black mouse
and a white mouse produced offspring with agouti hair. Another cross between the
black mouse and another white mouse produced some offspring with agouti hair
and some with black hair.
A There is a single gene with two codominant alleles, black and white.
B There is a single gene with three alleles in a dominance series, black
grey white.
C There are two epistatic genes, one controlling pigment production and one
controlling banding.
D There are two linked genes, one controlling pigment production and one
controlling banding.
Which role of the table correctly identifies which genes are prokaryotic and which
are eukaryotic?
prokaryotic eukaryotic
A 1 and 2 3 and 4
B 1 and 3 2 and 4
C 2 and 3 1 and 4
D 2 and 4 1 and 3
20 Which of the following statements about the eukaryotic control elements are
correct?
repress transcription
A 1 and 4
B 2 and 3
C 2, 3 and 4
D 1, 2, 3 and 4
21 Cells taken from a human bone cancer multiplied readily in culture. Analysis
showed that the cells were homozygous for the deletion of an allele on
chromosome 13 coding for a protein, RB.
22 Which of the following processes could still occur in a chloroplast in the presence
of an inhibitor that prevents H+ from passing through ATP synthase complexes?
1 Sugar synthesis
2 Photolysis of water
3 Transfer of electrons down the electron transport chain
4 Oxidation of NADPH
A 1 and 2
B 1and 4
C 2 and 3
D 3 and 4
Which of the following correctly matched the products of glycolysis and Krebs
cycle for every oxidation of one glucose molecule in this mitochondria suspension?
29 Some receptors for hormones like growth factors activate a protein kinase
cascade, with the participation of multiple enzymes catalysing multiple steps to
effect a change in gene expression. Which of the following statement about a
protein kinase cascade are true?
30 Which of the following statements were not part of Darwins theory of evolution by
natural selection?
A 1 and 2
B 1 and 5
C 2 and 3
D 3 and 5
31 A comparison was made between human, rabbit, mouse and chimpanzee of the
A 1 and 4
B 2 and 4
C 1, 3, and 4
D 2, 3, and 4
33 Which of the following is the most powerful way of increasing the specificity of a
DNA profile analysis?
34 The data below shows the results of electrophoresis of PCR fragments amplified
using primers for the site that has been shown to be altered in Huntington's
disease.
The inherited mutation in the Huntington's disease gene abnormally repeats the
nucleotide sequence CAG from 36 up to more than 120 times of that. The male
parent, shown as individual 2, had the onset of Huntington's disease when he was
40 years old.
Six of his children (individuals 3, 5, 7, 8, 10, 11) suffer from Huntington's disease,
and the age at which the symptoms first began is shown by the number below the
band from the PCR fragment.
A Individuals 4 and 9 do not have the trait, and will not get Huntington's
disease, but individual 6 is likely to start the disease when he reaches his
father's age of 40.
B Individuals 4, 6, and 9 have not inherited the defect causing Huntington's
disease.
C Individuals 4, 6, and 9 will still develop Huntington's disease at some point
in their lives, since the disease is inherited as a dominant trait.
D Two of the three will develop the disease, since it is inherited as a
dominant trait, but the data does not allow you to predict which two.
36 Which of the following statements are true about adult stem cells?
A 1 and 2
B 1 and 4
C 2 and 3
D 3 and 4
39 Which uses f the information from the human genome project are generally
considered to be unethical?
A 1 and 3
B 1 and 6
C 2 and 5
D 3 and 4
H2 BIOLOGY 9648/2
Paper 2: Core
Thursday 29 August 2013 2 hours
Write your name, civics group and index number on all the work you
hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagram, graph or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
2
/13
INFORMATION TO CANDIDATES 3
/11
6
/11
The number of marks is given in brackets [ ] at the end of each
question or part question. 7
/10
Total
/80
Answ
wer all ques
stions.
1. Fig. 1.1 show ws the intracellular annd extracellular eventts in the forrmation of a
collageen fibril. Co
ollagen fibrils are shoown assemmbling in thee extracell ular spacee
containned within a large info olding in th
he plasma membrane e. Collagenn fibrils cann form
ordered d arrays in the extraccellular spaace by further assemmbling into llarge collagen
fibre.
Fig 1.1
...
....[1]
...
........
...
........
...
........
...
....[2]
SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
342
3
(c) Suggest why assembly of collagen fibril is done outside the cell.
...........
.......[1]
Collagen is an important matrix for the deposition of hard mineral crystals in the
formation of bones. Certain forms of osteogenesis imperfecta, or brittle-bone
disease, are caused by a single change of amino acid in the middle of the chain, from
glycine to arginine.
(i) State 3 structural differences in the formation of the leading and lagging strands.
...........
...........
...........
......[1]
(ii) Explain why the two new strands of DNA are synthesized in opposite directions.
...........
......[1]
(b) State three differences between the structures of DNA and RNA. [3]
DNA RNA
(c) In eukaryotic cells, the end-replication problem explains why normal somatic
cells are limited in the number of mitotic divisions before they die out.
In bacteria cells, binary fission differs significantly from the process of mitosis seen in
eukaryotic cells.
Virus A Virus B
Fig. 3.1
(i) Relate the structure of virus A to its mechanism of release from the host.
...........
...........
...........
...[2]
(ii) Contrast the reproductive cycles of the Virus A and Virus B. [3]
Virus A Virus B
However, virus B often develop resistance against these inhibitors due to a single
base substitution in the DNA sequence resulting in a change of an amino acid in a
subunit of reverse transcriptase. The mutant protein is full-length and retains reverse
transcriptase activity, but does not allow the binding of the inhibitors.
(ii) Explain why the mutated protein remains full-length and retains reverse
transcriptase activity, but does not allow the binding of the inhibitors.
...........
...........
...........
...........
..[2]
(c) In recent years, vaccines have been developed for virus B. Vaccines can either
be live but weakened forms of the virus, or its structural parts that are recognised by
the immune system. This provides immunity to the disease.
However, vaccine development for virus B has become more challenging due to the
viruss ability to undergo a high rate of antigenic drift.
(i) Suggest a reason for this high rate of antigenic drift and how it affects vaccine
development.
...........
...........
...........
...........
..[2]
(ii) A student tries to produce a vaccine by heating a human virus to 100C for five
minutes to inactivate its infectivity. Suggest why effective vaccines cannot be
produced using the virus that has been heated to 100C.
...........
...[1]
A world-wide, long term genetic study on the possible associations between FD and
hearing loss is implemented in 2003. Table 4.1 above shows the genotypes and
phenotypes of some subjects in this study.
Subject
Gene name Genotype Phenotype
number
FD Heterozygous No FD
1031
TMC1 Heterozygous Normal hearing
FD Homozygous recessive FD
1050
TMC1 Homozygous dominant Normal hearing
FD Homozygous dominant No FD
1088
TMC1 Homozygous recessive Hearing loss
FD Homozygous recessive FD
1092
TMC1 Homozygous recessive Hearing loss
Table 4.1
(i) genotype
...........
...[1]
(ii) phenotype
...........
...[1]
(b) Subject 1031 and another subject listed in Table 4.1 are married and they have
their first child in 2005. This cross between them theoretically resembles a test
cross.
(i) Deduce the subject number of subject 1031s wife from Table 4.1.
......[]
A total of 200 couples with the same genotypes as subjects 1031 and his wife were
monitored in this study. Information on their children (total number of 186) was
collated 10 years after the implementation of this study and presented in Table 4.2.
Table 4.2
(ii) Using the information give in Table 4.2, calculate the 2 and state the
conclusions derived from this test.
2 =
Conclusion .............
...........
...........
...[2]
(O E) 2
=
2
v=c1
E
where = sum of O = observed value
v = degrees of freedom E = expected value
c = number of classes
A chi-squared table.
degrees of probability, p
freedom 0.10 0.05 0.02 0.01 0.001
1 2.71 3.84 5.41 6.64 10.83
2 4.61 5.99 7.82 9.21 13.82
3 6.25 7.82 9.84 11.35 16.27
4 7.78 9.49 11.67 13.28 18.47
Symbols:
F dominant allele for no FD
f recessive allele for FD
T dominant allele for Normal hearing
t recessive allele for hearing loss
During gamete formation in Subject 1031s wife from a diploid germ cell, an error
occurred once. As a result, her children will have 50% chance of having 3 copies of
chromosome 9; and 50% of having only 1 copy of chromosome 9 in his/her cells.
Fig. 5.1
(i) Sta
ate the sou
urce of the insulin mo
olecule in Fig
F 5.1.
...
....[1]
...
........
...
........
...
........
...
........
...
........
...
....[3]
(iii) W
With referen
nce to Fig. 5.1, descrribe the eve
ents occurrring in stagges A to D.
D
...
........
...
........
...
........
...
........
...
........
...
........
...
........
...
....[3]
SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
351
12
(iv) Based on your knowledge, describe the events that lead to an increase in the
number of glucose transporters in the cell surface membrane.
...........
...........
.......[1]
(v) A tissue may, over time, lose its responsiveness to insulin, even though insulin
concentration remains unchanged. Suggest possible reasons for this decrease in
responsiveness.
...........
.......[1]
Fig. 5.2 shows the various experimental systems that are prepared in an attempt to
synthesize ATP.
Fig. 5.2
(b) Which experimental system (A to D) shown in Fig. 5.2 would result in the
successful synthesis of ATP by thylakoid-derived vesicles? Explain your answer.
...........
...........
...........
...........
...........
......[3]
Fig. 6.1
(i) Explain the shape of the curve for sodium ions between 0.5 ms and 0.7 ms.
...........
...........
...........
...[2]
(ii) During an action potential, the membrane potential rises to +40mV and then falls.
Using information from the graph, explain the fall in membrane potential.
...........
...........
...........
...[2]
(iii) After exercise, some ATP is used to re-establish the resting potential in axons.
Explain how the resting potential is re-established.
...........
...[1]
(i) The
e length off the sectio
on of DNA that codes
s for the co
omplete toxxin is longe
er than
the mR
RNA used for
f translattion. Explaain.
...
...[]
...
........
...
........
....[2]
(c) Do opamine iss a neurotraansmitter rreleased by dopamin nergic neurrons for the
e
transmission of nerve signa als importa nt for moto
or control. Dopaminee binds to and
a
activate
es its recep
ptors locatted on the post-synapptic membrane.
Fig 6.2
...
...[]
SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
354
15
Excesssive neurottransmissio
on of dopaamine is asssociated with
w schizoophrenia, a clinical
mental disorder. To
T relieve this disord
der, antipsy ugs are devveloped to bind to
ychotic dru
and ina
activate the
e post-syna
aptic dopa mine receptors.
Fig 6.3
... ........
...
........
...
........
...
........
...
........
...
........
...[3]
otal: 11]
[Q6 To
SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
355
16
7. Fishes in the genus Anisotremus comprise of ten described species which occur
predominantly on coral reefs and subtropical rocky reefs in the Neotropics.
(a) Bernardi et.al. did a molecular phylogenetic study on such fishes in that area.
Results are shown in Fig. 7.1.
Fig. 7.1
(i) Explain how molecular methods can be used to elucidate the evolutionary
relationships of the different species of Anisotremus fishes.
...........
...........
...........
...........
..............[2]
(iii) With reference to Fig. 7.1 and molecular homology, comment on the
evolutionary relationship between A. taeniatus and A. virginicus.
...........
..............[1]
...
........
...
........
...
........
...
........
...
........
...
........
...
........
...
........
..
.[4]
... ........
...
........
...
........
..
.[2]
[Q7 To
otal: 10]
SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
358
19
Section B
Your answers must be set out in sections (a), (b) etc., as indicated in the question.
[Total: 20]
OR
9 (a) Describe the molecular structure of starch (amylose) and cellulose and
relate these structures to their functions in living organisms. [7]
(b) Explain, with two named examples, how the environment may affect the
phenotype. [6]
(c) Explain how biogeography and the fossil record support the
evolutionary deductions based on homologies. [7]
[Total: 20]
H2 BIOLOGY 9648/2
Write your name, civics group and index number on all the work you
hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagram, graph or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
2
/13
INFORMATION TO CANDIDATES 3
/11
6
/11
The number of marks is given in brackets [ ] at the end of each
question or part question. 7
/10
Total
/80
Answ
wer all ques
stions.
1. Fig. 1.1 show ws the intracellular annd extracellular eventts in the forrmation of a
collageen fibril. Co
ollagen fibrils are shoown assemmbling in thee extracell ular spacee
containned within a large info olding in th
he plasma membrane e. Collagenn fibrils cann form
ordered d arrays in the extraccellular spaace by further assemmbling into llarge collagen
fibre.
Fig 1.1
Collagen is an important matrix for the deposition of hard mineral crystals in the
formation of bones. Certain forms of osteogenesis imperfecta, or brittle-bone
disease, are caused by a single change of amino acid in the middle of the chain, from
glycine to arginine.
Examiners comments:
Candidates should answer the question more directly, instead of phrasing the answers in a indirect,
reversed manner.
Order of packing: Tropocollagen (triple-helix) collagen fibrils collagen fibre
The terms microfibrils and macrofibrils are used to describe cellulose, NOT collagen!
Tutor: reject general statements about change in 3D structure due to amino acid change
(i) State 3 structural differences in the formation of the leading and lagging strands.
......[1]
1 Presence of DNA ligase in lagging strand to ligate Okazaki fragments;
2 Presence of Okazaki fragments in lagging strand;
3 Presence of more than 1 primer/primase in lagging strand;
(REJECT: no primer needed in leading strand. This is incorrect!)
4 Strands are synthesized in opposite directions;
(ii) Explain why the two new strands of DNA are synthesized in opposite directions.
......[1]
1 DNA polymerase can only add nucleotides to the free 3 OH end of elongating
DNA strand
2 Template strands are antiparallel
(b) State three differences between the structures of DNA and RNA. [3]
DNA RNA
1 Exists as a double-stranded helix Single-stranded
2 Pentose sugar is deoxyribose Pentose sugar is ribose
3 Bases are A, T, C and G Bases are A, U, C and G
4 Ratio of A to T and G to C is always 1. Ratio varies.
(c) In eukaryotic cells, the end-replication problem explains why normal somatic
cells are limited in the number of mitotic divisions before they die out.
Examiners comments:
Candidates must answer the questions specifically for the role of telomeres in relation to the end-
replication problem. REJECT other roles of telomeres (i.e. protects the end of the chromosome from
degradation by nucleases; prevents end-joining of chromosome ends which may lead to chromosomal
mutations; prevents unintentional cell death).
Telomeres does not prevent DNA from shortening! It acts as a disposable buffer to protect the genes
from erosion as DNA shortens with each round of replication.
Telomeres Telomerase!
In bacteria cells, binary fission differs significantly from the process of mitosis seen in
eukaryotic cells.
Virus A Virus B
Fig. 3.1
(i) Relate the structure of virus A to its mechanism of release from the host.
...[2]
1 Haemagglutinin binds to sialic acid (receptor) on host cells
2 Neuraminidase removes/cleaves sialic acid on viral envelope
3 to prevent agglutination/clumping of virus
4 to allow release of virus from host cell
/ to prevent virus from attaching to host cell during release
(ii) Contrast the reproductive cycles of the Virus A and Virus B. [3]
Virus A Virus B
Enters host cell via endocytosis Enters host cell via membrane fusion
with plasma membrane of host cell
Examiners comments:
REJECT structural differences e.g. reverse transcriptase vs no reverse transcriptase, enveloped virus
vs not enveloped virus;
REJECT metabolic machineries
Budding (which happens for both influenza virus and HIV) Exocytosis !!
However, virus B often develop resistance against these inhibitors due to a single
base substitution in the DNA sequence resulting in a change of an amino acid in a
subunit of reverse transcriptase. The mutant protein is full-length and retains reverse
transcriptase activity, but does not allow the binding of the inhibitors.
(ii) Explain why the mutated protein remains full-length and retains reverse
transcriptase activity, but does not allow the binding of the inhibitors.
..[2]
Remain full-length
1 No frame-shift mutation
2 number of amino acids coded for remains the same
(c) In recent years, vaccines have been developed for virus B. Vaccines can either
be live but weakened forms of the virus, or its structural parts that are recognised by
the immune system. This provides immunity to the disease.
However, vaccine development for virus B has become more challenging due to the
viruss ability to undergo a high rate of antigenic drift.
(i) Suggest a reason for this high rate of antigenic drift and how it affects vaccine
development.
..[2]
1 Reverse transcriptase lacks proof-reading ability
2 Unable to remove mismatched deoxyribonucleotides and insert the correct one
(during DNA polymerisation)
3 Mutation in genes coding for protein/glycoprotein (gp120)
4 Produces altered (gp120) protein/glycoprotein
5 Antibodies induced by earlier strains of HIV / previously synthesised antibodies
can no longer bind to protein/glycoprotein
6 Hence, new vaccines must be developed
Examiners comments
Vaccines Antibodies Antibiotics!
Vaccines = A vaccine typically contains an agent that resembles a disease-causing
microorganism, and is often made from weakened or killed forms of the microbe, its toxins or
one of its surface proteins. The agent stimulates the body's immune system to recognize the
agent as foreign, destroy it, and "remember" it, so that the immune system can more easily
recognize and destroy any of these microorganisms that it later encounters.
Antibodies = Immunoglobulin proteins produced by the immune cells in response to foreign
antigen (eg. virus or vaccines). Antibodies will bind to the antigen.
Antibiotics = chemicals that are used to kill bacteria. They have no effect on viruses.
Examiners comments
Function of vaccines is to stimulate the production of new antibodies by the immune system. Some
candidates mistakenly thought that vaccines will be targeted by existing antibodies.
A world-wide, long term genetic study on the possible associations between FD and
hearing loss is implemented in 2003. Table 4.1 above shows the genotypes and
phenotypes of some subjects in this study.
Subject
Gene name Genotype Phenotype
number
FD Heterozygous No FD
1031
TMC1 Heterozygous Normal hearing
FD Homozygous recessive FD
1050
TMC1 Homozygous dominant Normal hearing
FD Homozygous dominant No FD
1088
TMC1 Homozygous recessive Hearing loss
FD Homozygous recessive FD
1092
TMC1 Homozygous recessive Hearing loss
Table 4.1
(i) genotype
...[1]
1 the genetic makeup of an organism;
2 the paired alleles that produces a phenotype;
3 can be either homozygous or heterozygous;
(ii) phenotype
...[1]
1 physical and chemical characteristic of an organism;
2 depend on genotype of the organism and the environment;
(b) Subject 1031 and another subject listed in Table 4.1 are married and they have
their first child in 2005. This cross between them theoretically resembles a test
cross.
(i) Deduce the subject number of subject 1031s wife from Table 4.1.
......[]
Subject 1092;
A total of 200 couples with the same genotypes as subjects 1031 and his wife were
monitored in this study. Information on their children (total number of 186) was
collated 10 years after the implementation of this study and presented in Table 4.2.
Table 4.2
(ii) Using the information give in Table 4.2, calculate the 2 and state the
conclusions derived from this test.
...[2]
1 23.42 (follow d.p. or sig.fig, whichever is applicable, of the 2-square table)
2 Since the calculated 2 value 23.42 > critical 2 value 7.82 at p = 0.05;
3 reject null hypothesis
4 The results of the 2 test suggest that there is a significant difference between the
observed and the expected values at the 5% level
5 Any difference is not due to chance
6 The predicted phenotype ratio of 1:1:1:1 is incorrect;
(O E) 2
=
2
v=c1
E
where = sum of O = observed value
v = degrees of freedom E = expected value
c = number of classes
A chi-squared table.
degrees of probability, p
freedom 0.10 0.05 0.02 0.01 0.001
1 2.71 3.84 5.41 6.64 10.83
2 4.61 5.99 7.82 9.21 13.82
3 6.25 7.82 9.84 11.35 16.27
4 7.78 9.49 11.67 13.28 18.47
(O E) 2
2 =
E
(59 46.5) 2 (35 46.5) 2 (26 46.5) 2 (66 46.5) 2
= + + +
46.5 46.5 46.5 46.5
Symbols:
F dominant allele for no FD
f recessive allele for FD
T dominant allele for Normal hearing
t recessive allele for hearing loss
Parental gametes: FT ft Ft fT ft
Punnett square
showing F1 genotypes:
FT ft Ft fT
ft FT ft Ft fT
ft ft ft ft
Legend:
F1 No FD, normal hearing ; FD, hearing loss; No FD, hearing loss ; FD, Normal hearing
phenotypes:
Parental Recombinant
1 Parental genotypes ;
2 Parental gametes;
3 F1 genotypes;
4 F1 genotypes correspond to phenotypes / legend for Punnett square;
5 Correct presentation of genetic diagram (circled gametes, Indication of
recombinants and non-recombinant gametes, Indication of recombinants and
non-recombinant phenotypes);
Examiners comments:
Reject non-disjunction at anaphase II/separation of sister chromatids as an error that occurred once at
meiosis II will result in 50% chance of normal (2 copies of chromosome 9); 25% chance of getting 3
copies of chromosome 9; 25% chance of getting only 1 copy of chromosome 9 after fusion with sperm
Fig. 5.1
(i) Sta
ate the sou
urce of the insulin mo
olecule in Fig
F 5.1.
...
....[1]
1 -ceells of the islets of La
angerhans
2 of th
he pancrea as
SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
373
15
(iii) With reference to Fig. 5.1, describe the events occurring in stages A to D.
.......[3]
1 insulin receptor exists as a dimer prior to the binding of insulin
2 insulin bind to insulin receptor
3 ref. complementary in shape to the ligand binding site of the insulin receptor
4 results in the activation of the tyrosine kinase domains in the cytoplasmic tail.
5 each receptor phosphorylates the tyrosine residues (at the cytoplasmic tails) of
the other receptor, hence activating it
6 auto-crossphosphorylation
7 receptor phosphorylates and activates IRS-1
8 which in turn phosphorylates and activates PI 3-kinase
Examiners comment
The question asks for a description of stages A, B C. Candidates must use the information given in the
diagram i.e. specifically referring to IRS-1, PI 3-kinase and phosphorylation rather than just proteins,
tyrosine kinases, relay proteins, activation.
(iv) Based on your knowledge, describe the events that lead to an increase in the
number of glucose transporters in the cell surface membrane.
.......[1]
1 movement of vesicles containing glucose transporters (GLUT4 transporters)
towards the cell surface membrane.
2 fusion of vesicle membrane with cell surface membrane results in incorporation
of glucose transporters on the cell membrane.
(v) A tissue may, over time, lose its responsiveness to insulin, even though insulin
concentration remains unchanged. Suggest possible reasons for this decrease in
responsiveness.
.......[1]
1 Mutation in the gene coding for insulin receptor / change in the shape of insulin
receptor as cell/tissue ages
2 Mutation in the gene coding for insulin receptor / change in the shape of Glut4
transporters as cell/tissue ages
3 Fewer insulin receptors are synthesised / ref. lower transcription rate of gene that
codes for insulin receptor
4 Fewer Glut4 transporters are synthesised/incorporated / ref. lower transcription
rate of gene that codes for Glut4 transporters
Fig. 5.2 shows the various experimental systems that are prepared in an attempt to
synthesize ATP.
Fig. 5.2
Which experimental system (A to D) shown in Fig. 5.2 would result in the successful
synthesis of ATP by thylakoid-derived vesicles? Explain your answer.
......[3]
1 Experimental system A
2 pH within the membrane is lower (pH 4 as compared to pH 8 outside the
membrane)
3 Concentration of H+ ions is higher within the membrane (than outside the
membrane)
4 ref. proton gradient
5 tendency for the H+ ions to diffuse out of the vesicle
6 via ATP synthase;
7 ATP is formed using ADP and Pi found outside the membrane
Examiners comments
pH 4 represents a higher concentration of H+. Some candidates made careless mistakes when relating
pH and H+ concentrations.
Some candidates merely describe the chloroplast without reference to the diagram. This will earn
them minimum marks.
Only ATP synthase can be seen in the diagram; no ETC or stalked particles are drawn.
Fig. 6.1
(i) Explain the shape of the curve for sodium ions between 0.5 ms and 0.7 ms.
...[2]
1 Between 0.5 ms and 0.7 ms, permeability to Na+ ions increases from 0 a.u. to 28
a.u. (acceptable range 23 29 a.u.)
2 Some voltage-gated Na+ ion channels open
3 Na+ ions diffuse into the neurone
4 Changes membrane potential/makes inside of axon less
negative/positive/depolarisation/ reaches threshold
5 All voltage-gated Na+ ion channels open
6 More Na+ ions diffuse into the neurone
Examiners comments
The type of ion channels (eg. ungated, voltage-gated, ligand-gated) must be clearly stated.
In this question about action potential occurring in the axon, the ligand-gated ion channels are NOT
applicable.
(ii) During an action potential, the membrane potential rises to +40mV and then falls.
Using information from the graph, explain the fall in membrane potential.
...[2]
1 Repolarisation occurs;
(i) The length of the section of DNA that codes for the complete toxin is longer than
the mRNA used for translation. Explain.
......[]
1 DNA contains introns/non- coding bases
/ mRNA only contains exons/coding bases
(ii) The black mambas toxin kills prey by inhibiting the enzyme acetylcholinesterase
at neuromuscular junctions that controls muscles involved in breathing. Explain how
this inhibition affects breathing.
...[2]
1 Acetylcholine not broken down
/ stays bound to receptor
2 Na+ ions continue to enter
/ continued depolarisation
/ Na+ channels continuously open
3 action potentials generated/impulses fired continuously;
4 Muscles involved in breathing remain contracted/cannot relax;
Examiners comments:
Muscles contract alone is not sufficient; muscles remain contracted.
Inability to breath is not due to lack of action potential generation. Students should read the question
carefully to note that acetylcholinesterase is inhibited.
Fig 6.2
SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
378
20
Excesssive neurottransmissio
on of dopaamine is asssociated with
w schizoophrenia, a clinical
mental disorder. To
T relieve this disord
der, antipsy ugs are devveloped to bind to
ychotic dru
and ina
activate the
e post-syna
aptic dopa mine receptors.
Fig 6.3
otal: 11]
[Q6 To
SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
379
21
7. Fishes in the genus Anisotremus comprise of ten described species which occur
predominantly on coral reefs and subtropical rocky reefs in the Neotropics.
(a) Bernardi et.al. did a molecular phylogenetic study on such fishes in that area.
Results are shown in Fig. 7.1.
Fig. 7.1
(i) Explain how molecular methods can be used to elucidate the evolutionary
relationships of the different species of Anisotremus fishes.
..............[2]
1 Neutral mutations do not confer any selective advantage or disadvantage;
2 Neutral mutations are accumulated at a relatively constant rate for any particular
gene and use as a molecular clock;
3 compare DNA sequence of a particular common gene (between different species
of fish);
/ comparison/alignment of homologous genetic sequences
(ii) Explain why it may be more reliable to construct a phylogenetic tree of the ten
species of Anisotremus using molecular data instead of morphological comparisons.
...[1]
1 Quantifiable ;
protein, nucleic acid sequence data are precise and accurate and easy to
quantify / convertible to numerical form for mathematical and statistical analysis;
OR
2 Objective;
based strictly on heritable material
/ can be easily described in an unambiguous manner
/ some morphological characteristics may be analogous / ref. convergent
evolution;
(iii) With reference to Fig. 7.1 and molecular homology, comment on the
evolutionary relationship between A. taeniatus and A. virginicus.
..............[1]
1 A. taeniatus and A. virginicus are closely related;
2 share a (recent) common ancestor;
3 high percentage homology in DNA sequence alignment;
2 The ere must bee variation (in a popuulation) beffore selection can takke place;
3 Individuals aree selected for or aga inst by nattural selecttion;
4 Individuals can only pas ss alleles too the next generationn;
5 It is the popula
ations thatt actually e
evolve
[Q7 To
otal: 10]
SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
382
24
Section B
Your answers must be set out in sections (a), (b) etc., as indicated in the question.
[Total: 20]
OR
9 (a) Describe the molecular structure of starch (amylose) and cellulose and
relate these structures to their functions in living organisms. [7]
(b) Explain, with two named examples, how the environment may affect the
phenotype. [6]
(c) Explain how biogeography and the fossil record support the
evolutionary deductions based on homologies. [7]
[Total: 20]
11. mRNAs have multiple ribosome mRNAs have only one start site
binding sites / direct synthesis of only one kind of
/ direct the synthesis of several polypeptide
different polypeptides
Faulty cytokinesis
5 faulty cytokinesis / non-disjunction
6 result in one or more extra sets of chromosomes ending up in a single cell
/ ref. polyploidy
/ ref. duplication of chromosomes sets
Significance in development
13 In developing ovum/egg cell, additional copies of the rRNA genes
14 for making enormous number of ribosomes
15 for active protein synthesis (once the egg is fertilized)
Starch
Structure
1 amylose is unbranched;
2 polymer of -glucose molecules linked by (1, 4) glycosidic bonds
Cellulose
Structure
11 unbranched;
12 polymer of -glucose molecules linked by (1, 4) glycosidic bonds;
Example 1 [max 3]
1 Himalayan rabbit homozygous for the ch allele;
2 tyrosinase gene codes for heat-sensitive enzyme/tyrosinase that makes
melanin;
7 if a small section of fur is shaved from a Himalayan rabbit, fur will grow back
either white or black depending on temp. of environment / Eg. experiment
involving ice-pack on shaved rabbit ;
8 just-born rabbits are all white as they had developed at temp. of mothers womb;
9 to produce rabbits with black extremities, the young are kept in the cold;
Example 2 [max 3]
1 In Drosophila homozygous for allele coding for vestigial wing;
2 allele for vestigial wing is recessive to that for long wing;
3 expression of vestigial wing is affected by the temperature at which the insect
develops;
4 The allele for vestigial wing is expressed only at low temperatures;
5 develop vestigial wings at 21C;
6 intermediate wings at 26C;
7 long wings at 31C;
Example 3 [max 3]
1 honeybee drones, queen and workers;
2 drones are males arise from unfertilised eggs;
3 queen and workers are females arise from fertilised eggs;
4 queen and workers have same amount of genetic material but phenotypically
different;
5 depends on diet of larva;
6 in the first 3 days of hatching, all female larvae feed on royal jelly;
7 after 3 days, those fed with diet consisting of honey/nectar and pollen would
develop into workers;
8 workers are sterile, smaller in size and have larger mouthparts and modified legs
as compared to the queen;
9 those fed with royal jelly develops into queens as high protein content of royal
jelly stimulates formation and maturation of female reproductive system;
Biogeography [max 3]
1 the study of the geographic distribution of species;
2 species that are closely related are found closer together;
3 and not found in similar environments far away due to geographical
barriers/convergent evolution;
4 e.g. Marsupials are not found anywhere else in the world except in Australia;
18 provide evidence that accumulated changes over long period of time led to
diverse forms of life present today/diversity of life arose from evolution;
H2 BIOLOGY 9648/3
Write your civics group, index number and name on all the work you
hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagram, graph or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
4
(Planning) /12
This document consists of 15 printed pages.
[Turn over
Sample 1 Sample 2
- well
+
Fig. 1.1
(a)(i) Describe how the DNA fragments were separated into visible bands.
.......
.......
.......
......[2]
Subsequent cloning procedures involving Escherichia coli host cells yield functional
HGH protein when Sample 2 was used, but not for Sample 1.
(ii) Based on the difference in the bands observed in Fig. 1.1, account for the failure
to produce functional HGH protein for Sample 1.
.......
.......
.......
......[2]
(iii) State the type of DNA library where Sample 2 was obtained from.
......[]
Kanamycin resistant
(kanr) gene
Tetracycline
resistant (tetr) gene
Fig. 1.2
(b) With reference to the properties of bacterial plasmids, provide 2 reasons why this
plasmid in Fig 1.2 will not work well as a cloning vector.
.......
.......
.......
..........[2]
(c) The student researcher has since made improvements to the plasmid in Fig. 1.2
such that it is now a functional cloning vector.
Steps were then taken to create a recombinant plasmid using BamHI and the
improved plasmid.
(iv) With reference to Fig. 1.2, explain how you would identify transformed bacterial
cells that have taken up the recombinant plasmid with the HGH gene using antibiotic
selection.
.......
.......
.......
.......
.......
.......
.......[3]
Fig. 2.1 shows the inheritance of SCID in a family in which both parents are carriers.
Only one of the sons suffer from SCID.
Fig. 2.1
(a) State the form of SCID that is being inherited in the family and the mode of
inheritance.
.......
...[1]
(b) Two RFLP morphs have been found tightly linked to the adenosine deaminase
(ADA) gene which can be used for genetic screening. A radioactive probe has been
designed to reveal the two RFLP morphs.
Both RFLP morphs and radioactive probe are shown in Fig. 2.1 with the arrows
representing the PvuII restriction sites. The asterisk (*) indicates the position of a
mutation at the restriction site that results in the loss of the restriction site. Morph 2
was found to be linked to the mutant ADA gene.
Fig. 2.2
DNA
ladder Father Daughter 1 Son 2
200 bp
100 bp
20 bp
5 bp
(c) Apart from disease detection, other applications of RFLP include genetic
fingerprinting and in genomic mapping.
(i) Explain why genes especially protein-encoding genes are seldom used as
markers for genetic fingerprinting.
.......
.......
.......
......[2]
(ii) Explain the use of genetic markers in genomic mapping in terms of linkage
mapping.
.......
.......
.......
.......
.......
.......
......[3]
Fig 2.3
(ii) Suggest two reasons for the leveling off of the graph from cycles 17 to 20.
.......
...[1]
An allele, Sub1A-1, was found only in submergence-tolerant rice. Varieties that are
submergence-intolerant either have a second allele, Sub1A-2, or lack the gene
altogether.
(i) Sub1A-1 codes for a protein that controls the transcription of the gene for alcohol
dehydrogenase. This gene is activated when the plant is in anaerobic conditions.
The mean heights of three types of rice plants were compared before and after 10
days of submergence in water. The types of rice plants were:
I : submergence-intolerant plants
I+ : submergence-intolerant plants genetically engineered to express Sub1A-1
T : submergence-tolerant plants
Fig. 3.1
(iii) Suggest two advantages of using genetic engineering, rather than selective
breeding, to introduce the allele.
.......
..........[1]
(i) To obtain a callus culture, suitable explants must first be chosen. Suggest a
suitable explant and explain your choice.
.......
.......[1]
(ii) Explain three advantages of growing soyabean plants from tissue culture rather
than from seeds.
.......
.......
.......
.......
.......
.......
.......[3]
The environment
.......
.........[]
Human safety
.......
.........[]
The Royal Society for the Protection of Birds (RSPB) has found a man in possession
of four young goshawks and an adult female. He claimed to have bred the young
birds using his adult female and a male bird borrowed from another keeper of these
birds of prey. The RSPB suspects that the young goshawks were poached from the
wild and not bred in captivity as claimed by the man.
Plan an investigation using DNA fingerprinting to verify if the young goshawks were
bred in captivity or poached from the wild.
[Total: 12]
You planning must be based on the assumption that you have been provided with the
following equipment and materials
tissue samples (feather tips) from the four young gohawks, the adult female
and the adult male under investigation
pestle and mortar
DNA extraction buffer solution
ice-cold ethanol
glass rods
microcentrifuge tubes
centrifuge
restriction enzyme
PCR reagents and equipment
agarose gel electrophoresis reagents and equipment
suitable source of electrical current
radioactive probe
nitrocellulose membrane
autoradiography equipment
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
SAJC / H2 Biology 9648/3 JC2 Prelim 2013
404
14
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
SAJC / H2 Biology 9648/3 JC2 Prelim 2013
405
15
Free-response question
Write your answer to this question on the separate answer paper provided.
Your answer:
(b) Using one named example of an adult stem cell, describe its normal
role and how it could be used in gene therapy against SCID using a
retrovirus. [8]
(c) Discuss the social and ethical considerations for the use of gene
therapy. [7]
[Total: 20]
H2 BIOLOGY 9648/3
Write your civics group, index number and name on all the work you
hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagram, graph or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
4
(Planning) /12
This document consists of 15 printed pages.
[Turn over
Sample 1 Sample 2
- well
+
Fig. 1.1
(a)(i) Describe how the DNA fragments were separated into visible bands.
......[2]
1 negatively-charged DNA fragments migrate to the positively-charged electrode;
2 through an agarose gel/matrix;
3 DNA fragments separated by size / molecular weights
/ shorter fragments move faster than longer ones;
4 invisible DNA bands revealed under UV light by staining the gel with a dye such
as ethidium bromide;
Examiners comments:
Many candidates failed to read the question properly and missed out the EtBr staining followed by
visualization under UV light in order to obtain visible bands
Subsequent cloning procedures involving Escherichia coli host cells yield functional
HGH protein when Sample 2 was used, but not for Sample 1.
(ii) Based on the difference in the bands observed in Fig. 1.1, account for the failure
to produce functional HGH protein for Sample 1.
......[2]
1 sample 1 has a higher molecular weight/larger size compared to sample 2;
2 due to presence of introns in sample 1;
3 bacterial host cells do not have RNA splicing machinery;
4 ref. HGH gene not expressed correctly;
(iii) State the type of DNA library where Sample 2 was obtained from.
......[]
1 cDNA library;
Kanamycin resistant
(kanr) gene
Tetracycline
resistant (tetr) gene
Fig. 1.2
(b) With reference to the properties of bacterial plasmids, provide 2 reasons why this
plasmid in Fig 1.2 will not work well as a cloning vector.
..........[2]
1 no origin of DNA replication ;
2 no independent replication of the plasmid (and target gene)
/ cannot result in multiple copies of the plasmid (and target gene) within one
bacterium;
3 no prokaryotic promoter;
4 which allows recognition by host cells RNA polymerase (which is also prokaryotic)
/ no transcription/ expression of genes;
(c) The student researcher has since made improvements to the plasmid in Fig. 1.2
such that it is now a functional cloning vector.
Steps were then taken to create a recombinant plasmid using BamHI and the
improved plasmid.
(iv) With reference to Fig. 1.2, explain how you would identify transformed bacterial
cells that have taken up the recombinant plasmid with the HGH gene using antibiotic
selection.
.......[3]
1 grow bacteria on LB/tet plate ;
2 transformed cells can survive;
3 as they contain plasmid with intact with tetracycline resistance gene;
Examiners comments
REJECT recombinant plasmid cannot survive. The correct phrasing should be bacterial colonies
containing the recombinant plasmid cannot survive.
Fig. 2.1 shows the inheritance of SCID in a family in which both parents are carriers.
Only one of the sons suffer from SCID.
Fig. 2.1
(a) State the form of SCID that is being inherited in the family and the mode of
inheritance.
...[1]
1 ADA-SCID
2 autosomal recessive
(b) Two RFLP morphs have been found tightly linked to the adenosine deaminase
(ADA) gene which can be used for genetic screening. A radioactive probe has been
designed to reveal the two RFLP morphs.
Both RFLP morphs and radioactive probe are shown in Fig. 2.1 with the arrows
representing the PvuII restriction sites. The asterisk (*) indicates the position of a
mutation at the restriction site that results in the loss of the restriction site. Morph 2
was found to be linked to the mutant ADA gene.
Fig. 2.2
DNA
ladder Father Daughter 1 Son 2
200 bp
100 bp
20 bp
5 bp
(c) Apart from disease detection, other applications of RFLP include genetic
fingerprinting and in genomic mapping.
(i) Explain why genes especially protein-encoding genes are seldom used as
markers for genetic fingerprinting.
......[2]
1 sequence of protein-encoding genes are conserved
2 due to its important biological function;
3 mutation rate lower than non-coding region
4 not able to differentiate between individuals;
(ii) Explain the use of genetic markers in genomic mapping in terms of linkage
mapping.
......[3]
1 Genetic markers are scattered throughout each of the chromosomes
2 used to determine the order/position of genes
3 Frequency with which two genetic markers are inherited together
4 is a measure of the closeness of the two loci on a chromosome
Fig 2.3
3 Easy to set up a PCR reaction and the use of a thermocycler / PCR machine
4 availability of computer software for primer design / commercial synthesis of
primers
5 Sensitivity of PCR
6 capable of amplifying sequences from minute amounts of target DNA
9 A broad range of nucleic acid sources are suitable templates for PCR
amplification / Robustness
10 permit amplification of specific sequences from material in which the DNA is badly
degraded or embedded in a medium
(ii) Suggest two reasons for the leveling off of the graph from cycles 17 to 20.
...[1]
1 Nucleotides are used up (hence is unable to make complementary chains)
2 Primers are used up
3 the template DNA strands anneal with each other instead of with the primer
4 Taq DNA polymerase gradually becomes denatured ref. no elongation
An allele, Sub1A-1, was found only in submergence-tolerant rice. Varieties that are
submergence-intolerant either have a second allele, Sub1A-2, or lack the gene
altogether.
(i) Sub1A-1 codes for a protein that controls the transcription of the gene for alcohol
dehydrogenase. This gene is activated when the plant is in anaerobic conditions.
Examiners comments
In plants (i.e. alcoholic fermentation), alcohol dehydrogenase enzyme catalyses the reduction of
ethanol/acetaldehyde to produce ethanol, with NAD+ being regenerated in the process. In animals,
alcohol dehydrogenase is used in the liver in an opposite reaction to breakdown ethanol..
The mean heights of three types of rice plants were compared before and after 10
days of submergence in water. The types of rice plants were:
I : submergence-intolerant plants
I+ : submergence-intolerant plants genetically engineered to express Sub1A-1
T : submergence-tolerant plants
Fig. 3.1
(iii) Suggest two advantages of using genetic engineering, rather than selective
breeding, to introduce the allele.
..........[1]
1 More specific in transfer of allele conferring high yield
2 Does not dilute desirable traits of high yield variety
3 Genes from different species can be combined (to produce a transgenic
organism)
4 Shorter time required to see results compared to traditional selective breeding
which may take several generations
(i) To obtain a callus culture, suitable explants must first be chosen. Suggest a
suitable explant and explain your choice.
.......[1]
1 eg. apical or axillary buds / shoot tips / root tips
2 contain meristematic tissues which are (actively dividing, undifferentiated and)
disease-free
15 possible to standardise the conditions for growth and obtain many batches of
identical plants
16 ensures product uniformity
(iii) Soyabean plants can reproduce sexually by means of seeds. Soyabean plants
grown from seeds are very variable in their yield. Explain why.
.......[2]
1 there is genetic variation due to
The environment
.........[]
1 Seeds from GM crops might be carried to other places and establish themselves
as weeds
2 Cross-pollination between the GM crops and their wild relatives may spread the
resistance to weeds
/ Emergence of vigorous weeds with herbicide-resistant genes
Examiners comments
Some candidates were confused between herbicide-resistant plants and pesticide-resistant plants.
Human safety
.........[]
1 Introduction of foreign gene(s) may result in production of secondary metabolites
which may be toxic to animals themselves and/or livestock/humans that consume
them.
2 New proteins in GM plants may be potentially allergenic to humans that consume
them.
3 Vectors used in introducing the herbicide resistant gene can contain genes for
antibiotic resistance which may pass from the plant to the E. coli in the gut when
the soybean is eaten, making the bacteria resistant to antibiotics
The Royal Society for the Protection of Birds (RSPB) has found a man in possession
of four young goshawks and an adult female. He claimed to have bred the young
birds using his adult female and a male bird borrowed from another keeper of these
birds of prey. The RSPB suspects that the young goshawks were poached from the
wild and not bred in captivity as claimed by the man.
Plan an investigation using DNA fingerprinting to verify if the young goshawks were
bred in captivity or poached from the wild.
[Total: 12]
You planning must be based on the assumption that you have been provided with the
following equipment and materials
tissue samples (feather tips) from the four young gohawks, the adult female
and the adult male under investigation
pestle and mortar
DNA extraction buffer solution
ice-cold ethanol
glass rods
microcentrifuge tubes
centrifuge
restriction enzyme
PCR reagents and equipment
agarose gel electrophoresis reagents and equipment
suitable source of electrical current
radioactive probe
nitrocellulose membrane
autoradiography equipment
Control (1 mark)
1 Extract DNA from random gohawks and conduct the same DNA fingerprinting
experiment. Unrelated gohawks should have unassigned bands compared to the
male and female parents.
2 Otherwise, new probes for other regions of the genome should be designed to
differentiate between individuals.
Reliability ( mark)
1 ref. At least 3 replicates and at least 3 repeats
Write your answer to this question on the separate answer paper provided.
Your answer:
(b) Using one named example of an adult stem cell, describe its normal
role and how it could be used in gene therapy against SCID using a
retrovirus. [8]
(c) Discuss the social and ethical considerations for the use of gene
therapy. [7]
[Total: 20]
Similarities (max 1)
1 Self-renewal ability / divide continuously by mitosis to produce new stem cells
2 Unspecialized / do not have cell-specific structures to carry out specific functions
3 Undifferentiated
Differences
Zygotic stem cells Embryonic stem cells
Isolated from morula / zygote; Isolated from inner cell mass of
blastocyst;
able to differentiate into any cell type to able to differentiate into almost any cell
form any organ or type of cells, type to form any organ or type of cells,
including extra-embryonic membranes; except those of the extra-embryonic
membranes;
ability to differentiate into any cell type to give rise to various organs in organism /
form whole organisms; multiple specialized cell types that make
up the heart, lung, skin and other tissues
in the developing foetus
8 Attenuate retroviral vector by removing viral genes that cause harm (eg. lysis);
9 mRNA of target gene inserted in vector;
10 ref. ADA gene / IL2RG gene;
18 ref. normal functional protein product, thereby restoring the correct function of the
target cells and altering the phenotype
19 functional T and B lymphocytes in the patient;
20 to fight off infections / development of functional immune system;
(c) Discuss the social and ethical considerations for the use of gene therapy.[7]
Cost
7 gene therapy is currently very expensive, require expertise and equipment found
only in major medical centres, concerns about gene therapy become a luxury
available only to the rich and powerful.
8 possible genetic enhancements creating an advantage for those who can
afford the treatment
Privacy
11 concerns about the protection of privacy and confidentiality of medical
information of patients involved in clinical trials
12 which may have implications on (medical) insurance coverage / employability
CANDIDA
ATE
CT
C GROUP
P 12S7___
__
NAME
CENTRE INDEX
R
NUMBER NUMBER
N
BIOLOG
GY 9648/01
Paper 1 M
Multiple Cho
oice 27 Septe
ember 2013
3
Additional Materials: Optical Marrk Sheet 1 hour 15
1 minutes
s
CTIONS TO CANDIDAT
INSTRUC TES
ATION FOR
INFORMA R CANDIDA
ATES
Each corre
ect answer will score one n be deducted for a w
o mark. A mark will not wrong answ
wer.
Any rough
h working sh
hould be do
one in this b
booklet.
Calculatorrs may be used.
u
1 Which organellle(s) is / arre required for the forrmation of the hydrolyytic enzyme
es found in
n
lysosomes?
2 Lipid
d membranes can be formed in tthe laborato
ory by paintting phosphholipids ove
er a supportt
(PTF w a hole in it.
FE sheet) with
Which stateme
ent is cons
sistent with this inform
mation and
d your know
wledge of membrane
e
struccture?
A a carbohyydrate mole
ecule found only on the
e outside of the membrrane.
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
427
3
3 The table shows the results of food tests carried out to identify two types of biomolecules.
test-tube
sodium hydroxide +
Benedict's solution iodine in potassium iodide
copper sulphate
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 1
428
4
B After 60 min,
m the con
ncentration of enzymes
s becomes the limiting factor.
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
429
5
telophase
e of mitosis telophase II of meiosis
A 1
12 6 6 3
B 2
24 1
12 12 6
C 1
12 1
12 6 3
D 2
24 6 12 6
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
430
6
6 Nocodazole is a chemical used in the study of mitosis. It causes all mitotic cells to be
arrested at metaphase.
8 An alien organism was found and investigated. Like eukaryotes, it has a linear double-
stranded DNA genome. When DNA replication was examined, it revealed that although the
process is semi-conservative, no Okazaki fragments were observed in all the multiple
replication forks. In addition, the end-replication problem was not observed.
B Alien DNA replication only starts at the 3 end of each template strand.
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 1
431
7
9 You have three different double-stranded DNA molecules, each of which you incubate
(separately) in solution that is heated from 25 C to 100 C to denature the double-stranded
molecules.
Which statement is likely to be the correct prediction of the denaturation of these molecules?
10 Which statements correctly describe the structure and function of prokaryote ribosomes?
A 1, 3 and 5 only
B 2, 4 and 5 only
C 1, 2, 3 and 4 only
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 1
432
8
1 e genetic co
The ode has red undancy an
nd is degenerate.
2 The
ere is only one or the amino acid meth
o codon fo hionine.
3 Cod
dons act as stop and start signa
als during tra
anscription and transla
ation.
4 Prokaryotes ge
enerally use
e the same genetic cod
de as eukarryotes.
5 RNA codons have the ssame nucleo
mR otide sequence as DNA
A triplet cod
des.
A 1, 2 and 3 only
o B 1, 2 and 4 only C 1, 3 and
d 5 only D 2, 4 an
nd 5 only
12 During the proccess of transcription, errrors somettimes occurr such that ccertain nucleotides are
e
eated. Thesse errors are
repe a often re eferred to as duplicattions. Dupl ications of nucleotide e
basees within ge enes vary in severity. Some result in non-functional prooteins and others mayy
havee little or no
o effect on function. Th
he diagramm shows a strand
s of m RNA produ uced from a
particular gene.
A One base
e pair is dup
plicated at Z
Z.
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
433
9
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 1
434
10
sta
age 1 sta
age 2 sta
age 4 sta
age 7
A drugs th
hat bind to inhibitio
on of viral mutation
n in the HIV inhib
bition of
gpp120 repllicase gennome exoc
cytosis
B restriction inhibitio
on of viral inhib
bition of inhib
bition of
endonuccleases to repllicase inte
egrase buddding
cut th
he viral
gennome
C drugs th
hat bind to inhibition
n of reverse inhib
bition of inhib
bition of
gpp120 transccriptase inte
egrase buddding
D restriction inhibition
n of reverse mutation
n in the HIV inhib
bition of
endonuccleases to transccriptase gennome exoc
cytosis
cut th
he viral
gennome
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
435
11
16 Drug
g R is a DN
NA methyltrransferase inhibitor annd drug Q iss a histonee deacetylas
se inhibitor..
An e
experiment was carried
d out to inve
estigate the
e effects of drug R andd Q on exprression of a
gene
e. The grap
ph shows the experime ental results.
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
436
12
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 1
437
13
telomerase RN
NA lagging stra
and templatte teelomerase protein
A acts as
a a ribozym
me acts as a template acts as a DNA polymerase
p
B actss as a prime
er acts as a template aacts as a re
everse
transcripttase
C acts as a templa
ate acts as
s a primer aacts as a re
everse
transcripttase
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
438
14
19 The diagram sh
hows cance
erous cells d
dividing in between
b norrmal cells.
20 A po opulation of
o cats conntains indiviiduals with shortened tails know wn as Manx x cats andd
indivviduals with
h normal tails known a s non-Manx x cats. Mating of two nnon-Manx cats
c alwayss
prodduced non-M Manx cats. Mating of twwo Manx cats always produced a mixture off Manx catss
and non-Manx cats, where e the numbeer of Manx cats
c is usua
ally twice th at of non-M
Manx cats.
A The gene
es for shorte
ened tails an
nd normal tails
t are link
ked on the ssame chrom
mosome.
B The gene
es for shorte
ened tails an
nd normal tails
t are sex
x-linked.
C The allele
e for shorttened tails is dominan e allele for normal tails, but the
nt over the e
homozygous domina ant genotyp pe is lethal.
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
439
15
key
normal male
normal female
d male
affected
affected
d female
m
marriage 1: III - 1 x III - 3 marriage 2:: III - 2 x III - 4
A 0% 50 % ooffspring
B 50 % offspring
o 0%
C 0% 50 % femaale offspring
22 In th
he fruit fly, re
ecessive mutations in either of tw wo independently assorrting genes, brown andd
purpple, preventts the synth hesis of red d pigments in the eyes
s. Thus, hommozygotes of either off
thesse mutation ns have brownish-purrple eyes. However, heterozygot
h tes for botth of these
e
muta ations have e dark red, that is, wild--type eyes.
7 1 2 3
A B C D
16 2 3 4
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
440
16
23 In a breed of ra
abbits, multiple alleles with the following dom
minance relaationships control
c coatt
ch h
colouration: C (agouti) > c (chinchillla) > c (Him malayan) > c (albino)
An e
experimenta
al cross be
etween ago
outi and Himalayan prroduced 500 % agouti and 50 %
Hima
alayan prog
geny.
Whicch cross wo
ould have th
he lowest prrobability off producing this result??
24 The phenotype
es of three experimenttal populations of plan
nts X, Y annd Z are sh
hown in the
e
grap
phs.
A F1, F2 and
d F3 generations.
B P, F1 and F2 generations.
D F3, F1 and
d F2 generations.
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
441
17
Glucos
se
Whicch statemen
nts are corrrect?
1 Ace
etyl coenzym
me A is requ
uired for ste
ep Q.
2 Sub
bstrate level phosphoryylation occu
urs in both steps
s P andd Q.
3 The
ere is a net increase in ATP during
g steps P, Q and R.
4 Oxid
dised form of NAD is u
used in step
ps P and R.
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
442
18
27 Mammalian liver cells were homogenised and the resulting homogenate centrifuged.
Portions containing only mitochondria and cytosol (residual cytoplasm) were each isolated.
Samples of each portion, and of the complete homogenate, were incubated in four ways:
1 with glucose;
2 with pyruvate;
3 with glucose plus cyanide; and
4 with pyruvate plus cyanide.
Cyanide inhibits carriers in the electron transport chain. After incubation, the presence or
absence of carbon dioxide and lactate in each sample was determined. The results are
summarised in the table below.
samples of homogenate
1 glucose
2 pyruvate
3 glucose +
cyanide
4 pyruvate +
cyanide
= absent, = present
A Carbon dioxide was not formed when mitochondria was incubated with glucose as
there was no oxygen present.
D The mode of action of cyanide would be similar to that of a cell experiencing anaerobic
respiration.
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 1
443
19
28 A te
est was admministered too evaluate b
blood glucose levels. Subjects
S weere asked to
o fast for 12
2
hourrs before th
he start of the
t test. Th hey were ad dministeredd glucose att time 0 an
nd then had d
bloo
od samples drawn everry 30 min fo or a total of 4 h 30 min.
A grraph of bloo
od glucose levels for n
normal, hyp
perglycaemic and hypooglycaemic individualss
is sh
hown. The values reprresent averaaged data from
f ten sub
bjects for eaach conditio
on.
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
444
20
29 The diagram sh
hows a neuromuscularr junction.
Q R S
A axo
on allows foor p
post-synapttic membrane musscle cell will undergo
transmisssion of electrical allows for exocytosis
e of
o contrraction upon receiving
impulse neurotraansmitters chemical signals
B axon allo
ows for movvement pre-synaptic membran ne siggnal transduuction will
of neurootransmitters from allows for exocytosis
e of
o occcur in cytop
plasm of
cell bo
ody to the post-
p neurotraansmitters musccle cell upon
n activation
synapptic membra ane oof chemicallyy-gated
receptoors
C axo
on allows foor pre-synaptic membran ne siggnal transduuction will
transmisssion of electrical allows for exocytosis
e of
o occcur in cytop
plasm of
impulse neurotraansmitters musccle cell upon
n activation
oof chemicallyy-gated
receptoors
D axon allo
ows for mov vement p
post-synapttic membrane musscle cell will undergo
of neurootransmitters from allows for exocytosis
e of
o contrraction upon receiving
cell body to the pre-
p neurotraansmitters chemical signals
synap ptic membraane
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
445
21
In a treatment for
f seizuress, Valium, a drug, acts s as alloste
eric regulatoor by bindinng at a site
e
that is away from
m the GABAA-binding ssite. Fig. 2 shows
s the movement
m oof chloride io
ons throughh
the cchannel as GABA is inc
creased witth and witho out the drugg being pressent.
Whicch statemen
nts are correct?
1 The
e GABA rece
eptor is a m
multimeric prrotein.
2 Bind
ding of Valiu
um enhance
es the open
ning of the channel.
c
3 A de
epolarizatio
on occurs in the target cell.
c
4 Bind
ding of Valiu
um helps to
o open the channel
c en if GABA is not prese
eve ent.
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
446
22
31 Before the settlement of California in the 1800s, the elk population was very large. By about
1900 there were only a few dozen elk left. Owing to protection, there are now about 3000 elk
living in a small number of isolated herds. Unfortunately, some of the elk in all the herds
have difficulty grazing due to a shortened lower jaw.
Which statements, when taken together, suggest the existence of a molecular clock that
enables scientists to estimate the time at which one species might have diverged from
another?
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 1
447
23
33 Twoo organismss, P and Q are from the same order but from
f differeent families. Therefore
e
orga
anisms P an
nd Q belong
g to
A different kingdoms.
k
B different phyla.
p
C the same
e genus.
D the same
e class.
sY
species speciees Z
Sp
pecies X 8 2
Sp
pecies Y 0 9
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
448
24
35 Hind
d III is a resstriction end
donuclease
e commonly
y used to cu
ut human D
DNA into pie
eces before
e
inse
erting it into a plasmid.
A AAGGAA
A
B AAGAAG
G
C AAGTTC
C
D AAGCTT
T
36 The diagram sh
hows a vecttor, pUC18,, used in ge
enetic engin
neering.
1 ne of interest is inserte
Gen ed into the la
ac promoter.
2 Gen
ne of interest is inserte
ed into the polylinker.
p
3 Baccteria colon
ny with succcessfully inserted gene of interesst will appe
ear white in
n
colo
our.
4 Baccteria colony with this vvector will grow
g in agarr plate with ampicillin.
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
449
25
B Restriction endonucleases cut DNA at specific sites that are always located between
genes.
38 DNA fingerprinting is often used to confirm the identity of an individual. The diagram shows
a small section of the gel electrophoresis results from a DNA fingerprinting analysis of a
family.
A child 1
B child 2
C child 3
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 1
450
26
39 The diagram sh
hows a gene therapy a
approach for SCID.
1 e patient ma
The ay develop leukaemia.
2 The
e virus may lyse the tarrget T lymphocyte.
3 The
e normal AD
DA allele ma
ay be passe
ed to the ne
ext generati on.
4 Thiss approach may not be nt, thus conttinual gene therapy is necessary.
e permanen
A 1 and 4 only
o
B 2 and 3 only
o
C 1, 2 and 4 only
D 1, 3 and 4 only
40 Wha
at are the arguments against
a the u etically modified organissms (GMOs
use of gene s)?
1 ufficient tes
Insu sting of gene
etically mod
dified crop for their sidee effects
2 Unfforeseen lon
ng-term effe
ects of gene
etic manipulation
3 Acccidental genetic recom
mbination in humans as a resuult of consu
uming food
d
derrived from GMOs
G
4 ntrol of food supply b
Con by a small number of companiess that have
e access to
o
gen
netic engine
eering techn
nology
--- END
D OF PA
APER ---
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2 Preliminaary Examination / Paper 1
451
452
HW
WA CHONG G INSTITU
UTION
JC2
2 Prelimin
nary Exam
mination
Hig
gher 2
CAN
NDIDATE CT
12S7__
___
NAM
ME GROUP
NTRE
CEN INDEX
NUM
MBER NUMBERR
BIO
OLOGY 9648 / 02
Pap
per 2 Core Paper 3 Sep
ptember 20
013
Add
ditional Mate
erials: Writting Paper 2 hou
urs
INSTRUCTION
NS TO CAN
NDIDATES
The
ere are fourr question booklets
b (I to IV) to thiss paper. Write
W your na
ame, CT grroup, Centrre number and
inde
ex numberr in the spaces provide
ed at the to p of this co
over page, and
a your naame and CT
T group on
n the
lines
s provided a
at the top of
o the cover page of Bo
ooklets II, III and IV.
SEC
CTION A
This
s section co
ontains seve
en structure
ed question
ns. Answerr all questio
ons.
Writte your answ
wers on the
e lines / in th
he spaces p
provided.
CTION B
SEC
This ontains two questions. Answer a ny one que
s section co estion. For Exa
aminers' Us
se
You
ur answers m
must be in continuous
c prose, whe
ere appropriiate.
Question
n Mark
ks
Writte your answ
wers on the
e writing pap
per provide d.
BEG
GIN EACH PART ON A FRESH SHEET
S OF WRITING PAPER.
P 1 / 12
A NIL RETURN
N is required. 2 / 12
3 / 10
INFORMATION
N FOR CAN
NDIDATES
4 / 12
The
e number off marks is given
g in bra
ackets [ ] a
at the end of
o each que
estion or
partt question. 5 / 11
You
u may use a calculator.. 6 / 10
You
u are remind
ded of the need
n for go
ood English and clear presentation
p n in your 7 / 13
answers.
8/9 / 20
Total / 100
This document
d consists
c off 22 printed
d pages an
nd 4 blank pages.
HWA CHONG INSTITUTION 453
2013 JC2 H2 BIOLOGY
PRELIMINARY EXAMINATION MARK SCHEME
PAPER 2
QUESTION 1
(a)(i) Identify the class of carbohydrate molecule of which agarose is an example. [1]
polysaccharide
(ii) Plants contain a carbohydrate called amylose. Amylose does not contain galactose. Describe one similarity and
another difference in structure between agarose and amylose. [2]
similarity:
1. monosaccharides of both agarose and amylose are held together by glycosidic bonds
2. both agarose and amylose are unbranched
difference:
1a. coiled/helical structures in amylose
1b. but linear/straight structures in agarose
(b) (i) Describe how the structure of domain A of the cholera toxin is maintained. [3]
(ii) Explain how a globular protein like cholera toxin differs from a fibrous protein, such as collagen. [2]
1a. cholera toxin being a globular protein is soluble due to the presence of hydrophilic amino acids on the
surface of the protein
1b. collagen being a fibrous protein is insoluble due to the presence of mainly hydrophobic amino acids in the
protein
2a. cholera toxin being a globular protein is more compact/ spherical in shape
2b. collagen being a fibrous protein is elongated in shape/forms multimolecular parallel filament to strands/
collagen fibrils and collagen fibres
3a. cholera toxin being a globular protein is made up of fixed, non-repetitive specific sequence of amino acids
3b. collagen being a fibrous protein is made up of repetitive sequence of amino acids
4a. cholera toxin being a globular protein has a relatively unstable structure ref. to weak non-covalent bonds
4b. collagen being a fibrous protein has a stable structure ref. to extensive intra- and inter-molecular
hydrogen bonds/ covalent crosslinks
5a. cholera toxin being a globular protein performs metabolic functions since they are soluble
5b. collagen being a fibrous protein performs structural functions since they have high tensile strength
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 1
(c) Suggest h
how the chole
era toxin enters epithelia l cells. 454 [2]
[Total: 12 marks]
ESTION 2
QUE
X: Heterocchromatin
Y: Euchro
omatin
5 ; 3 ;
3 5
Fig. 2b
2
1. Hyd
drogen bonds allow for th
he formation of double sttranded DNA
A / a double hhelix
HW
WA CHONG INS
STITUTION / 2013 JC2 H2 BIOLOGY / PRELIM
MINARY EXAM
MINATION / MAR
RK SCHEME 2
2. Hydrogen bonds hold the two polynucleotide strands together 455
3. Hydrogen bonds hold the complementary nucleotides / bases together
4. Many hydrogen bonds give stability to DNA molecule
5. Hydrogen bonds can be broken for transcription / DNA replication to occur
(c) Explain how the data in Table 2.1 helps to confirm the arrangement of bases in DNA. [3]
1. In all the organisms, percentage of adenine to thymine and percentage of guanine to cytosine are
approximately 1:1 ratio / equal / similar
2. For example, in yeast, percentage of adenine is 31.3% which is very similar to thymine with percentage at
32.9% and percentage of guanine is 18.7% which is very similar to cytosine with percentage at 17.1%.
Accept any one example
3 . This shows that adenine and guanine base pair with thymine and cytosine respectively
(d) (i) State how the result for the virus differs from those for all the organisms given in table 2.1. [1]
1. The percentage of adenine to thymine and guanine to cytosine are not similar / not 1:1
[Total: 12 marks]
QUESTION 3
(a) Describe the role of lactose in the regulation of lac operon. [3]
(b) Identify the location of the point mutation in the operon of strain A. Give a reason for your answer. [2]
(d) Describe how the formation of separate mature proteins from these polycistronic mRNAs in HIV maturation and
in bacteria differs. [3]
[Total: 10]
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 3
456
QUESTION 4
(a) Describe how an individual can inherit a recessive disorder like albinism or LDHA deficiency from his parents.
[2]
1. Ref to both parents having at least 1 recessive allele each
2. Ref to individual receiving 2 recessive alleles
(b) (i) Using the symbols provided, draw a genetic diagram in the space provided below to show the cross between
the couple. For each of their children, state their genotypes. [5]
AN an
an an
Gametes AN an An aN an
Random fertilization
Female gametes
AN an An aN
Male AN an An aN
an
gametes an an an an
AN AN
Child I Child II
an an
aN an
Child III Child IV
an an
(ii) Suggest how the genotype of Child III has arisen. [2]
(ii) With reference to Fig. 4.1, identify the parent who have the abnormal karyotype and suggest how the
abnormality arises. [2]
1. Mother
2. Ref to chromosomal translocation
[Total: 12 marks]
QUESTION 5
(a) (i) Describe the effect of flashing light on ATP synthesis in the absence of venturicidin. [2]
1. As the number of light flashes increases from 1 3 flashes, the concentration of ATP increases from
25nM 190 nM
2. which eventually plateaus
1. Increasing the number of flashes of light result in an increase in the number of excited electrons
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 4
2. and results in more excited electrons travelling down the electron transport chain 457
3. The energy released is coupled to pump/ actively transport H+
4. from the stroma into the thylakoid space/ thylakoid lumen
5. resulting in the formation of a proton motive force/ electrochemical gradient (OWTTE)
6. H+ then diffuses down the concentration gradient from the thylakoid space to the stroma
7. via the ATP synthase complex
8. releasing more free energy which is coupled for synthesise more ATP
(b) Describe and explain the effect of venturicidin on the plant and its ability to produce sugars. [4]
1. In the presence of ventruricidin, ATP concentration remains at close to 0nM even when 3 flashes of light
are used
2. Since ATP synthase is inhibited, H+ cannot diffuse down the electrochemical gradient
3. from thylakoid space to stroma
4. thus there is no supply of energy to drive ATP synthesis/ no energy released for formation of ATP
5. This prevents the progression of the Calvins cycle / no G3P/ no hexose sugar being produced (OWTTE)
6. since ATP is not available for conversion of GP to 1,3-bisphosphoglycerate / regeneration of RuBP
(c) Distinguish the role of ATP synthesis in mitochondria and chloroplasts [1]
1. In mitochondria, ATP synthesised is transported into the cytosol and used for various cellular functions/
active transport/ protein synthesis/ @ref to specific process
2. While ATP synthesised in chloroplasts is transported into the stroma for use in the light-independent
reaction / Calvin cycle for synthesis of glucose
R: Photosynthesis/ light dependent reaction
[Total: 11 marks]
QUESTION 6
1. Receptor proteins that are located in the cytoplasm / cytosol / nucleus / cell
2. Ligands, e.g. estrogens, that binds such receptors are hydrophobic / lipid soluble and small enough to
diffuse across the hydrophobic core of the cell membrane
Stage A:
Stage B:
Stage C:
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 5
8. to initiate transcription/rate of transcription increases 458
(i) explain how SERMs can be used in the treatment of breast cancer. [2]
2a. SERMs recruit M1 but not M2 / prevent complete recruitment / assembly of mediators
2b. Formation of stable transcription initiation complex is reduced / prevented
Accept: positioning / stability of TIC
3.* This reduces rate of oncogene/cancer critical gene expression OR reduce rate of transcription of gene
that result in excessive cell division/rate of cell division exceeding rate of cell death
* Point 3 is essential to achieve full credit because it specifically address treatment of cancer.
(ii) suggest why ERDRs might be more effective than SERMs. [2]
[Total: 10 marks]
QUESTION 7
1. The existence of two phenotypes / phenotypically distinct forms (melanic and non-melanic) of moths in a
particular species
1. Biston betularia is the unique two-part name of a particular moth species, recognised internationally
2. Biston indicates the genus and betularia is the specific epithet
(d) Explain for the trends observed for the three moths species from 1987 to 2002. [3]
1. From 1987 to 2002, the % melanic B. betularia declined from 95% to 5% as compared to the % melanic
A. crenata which ranged between 63% to 60% and % melanic O. bidentata declined from 60% to 32%
2. There was a change from polluted (industrial) to clean (post-industrial) environment leading to growth of
pale coloured lichens on the bark of trees
3. B. betularia are most vulnerable to in the day as they lay on the branches
4. O. bidentata are hidden under the leaves or within cracks less likely to be vulnerable
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 6
5. Gra uickly / colour not influencced by polluttion so least change in / less selectio
ass grows qu on pressure
459 o A.
on
cren
nata
6. AVPP
QUE ESTION 8
(a) Describe tthe structure
e of a chromo
osome prior tto the start of
o mitosis. [5]
1. Prio
or to the sta art of mitosis, each chrromosome contains
c DNA molecules joined at the
two identical D
cen
ntromeres
2. Thiss is due to DNA
D replicatio
on during S p phase of inte
erphase
3. Thee chromosom me exists in n the form o of unconden nsed chroma atin and dis crete chrom
mosomes are e not
obsserved in the cell
4. Eacch DNA mole ecule is tightlly coiled arou
und the posittively charge
ed histone occtamer
5. Thiss forms the 10-nm
1 chrommatin fibre/ nuucleosome fiibre/ beads--on-a-string
6. DNA A is further coiled
c to give
e a 30-nm ch hromatin fibre
e / solenoid
7. Thee chromatin within a nuc cleus prior too mitosis caan be organiized into difffused euchro
omatin, or highly
h
con
ndensed hete erochromatin n.
1.
PL1 Propha
ase I
PL2. Homologo
ous chromossomes
PL3
3. Crossing over occurss between
er chromatidds at the
non-siste
chiasmatta
PL4
4. Different alleles
a
ML1. Metaph
hase I
HW
WA CHONG INS
STITUTION / 2013 JC2 H2 BIOLOGY / PRELIM
MINARY EXAM
MINATION / MAR
RK SCHEME 7
460
ML2.
M Kinetochore spinndle fibre
ML3.
M Metaphase plate
ML6. Rec
combinant chhromatid
HW
WA CHONG INS
STITUTION / 2013 JC2 H2 BIOLOGY / PRELIM
MINARY EXAM
MINATION / MAR
RK SCHEME 8
QUESTION 9 461
(b) Explain the roles of insulin and glucagon in the regulation of blood glucose. [10]
1. The control of blood glucose concentration operates by a negative feedback system via insulin and
glucagon, which are antagonistic hormones
2. When blood glucose concentration is higher than the set point of 90 mg/100ml of blood, the change is
detected by the -cells of the islets of Langerhans of pancreas and insulin is released to decrease blood
glucose concentration towards the set point
3. Insulin binds to insulin receptors on target cells and accelerates rate of glucose uptake
4. In muscle, liver and adipose cells, the number of glucose transporters increases in cell membrane
5. In liver and skeletal muscle cells, glucose utilisation and storage increases such that there is an
increased rate of glycolysis for production of ATP, glycogenesis stimulated by activating glycogen
synthase and glycogenolysis inhibited
6. In skeletal muscle cells, amino acid absorption and protein synthesis stimulated and gluconeogenesis
inhibited
7. In adipose tissues, lipogenesis is stimulated
8. When blood glucose concentration is lower than the set point of 90 mg/100ml of blood, change is
detected by the -cells of the islets of Langerhans of pancreas, glucagon is released to increase blood
glucose concentration towards the set point
9. Glucagon binds to glucagon receptors on target cells and stimulates glycogenolysis in liver and muscle
cells
10. Gluconeogenesis stimulated in liver cells and lipolysis in adipose tissues
(c) Describe how two named membrane proteins are involved in impulse transmission along the axon of a motor
neuron. [5]
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 9
462
HW
WA CHONG G INSTITU
UTION
JC2
2 Prelimin
nary Exam
mination
Hig
gher 2
CAN
NDIDATE CT
12S7__
___
NAM
ME GROUP
NTRE
CEN INDEX
NUM
MBER NUMBERR
BIO
OLOGY 9648 / 03
Pap
per 3 Applications Pap
per and Pla
anning Quesstion 23 Sep
ptember 20
013
Add
ditional Mate
erials: Writting Paper 2 hou
urs
INSTRUCTION
NS TO CAN
NDIDATES
The
ere are fourr question booklets
b (I to IV) to thiss paper. Write
W your na
ame, CT grroup, Centre numberr and
inde
ex numberr in the spaces provide
ed at the to p of this co
over page, and
a your naame and CT
T group on
n the
lines
s provided a
at the top of
o the cover page of Bo
ooklets II, III and IV.
STR
RUCTURED
D QUESTIO
ONS
Ans
swer all thre ur answers on the lines
ee questionss. Write you s provided.
ANNING QU
PLA UESTION
Ans
swer the que
estion in bo
ooklet IV. Write
W your an
nswers on th
he lines / in the spacess provided.
FRE
EE RESPONSE QUES
STION
Ans estion. Your answers must
swer the que m be in ccontinuous prose, where appropriaate.
Writte your answ
wers on the
e writing pap
per provide d.
BEG
GIN EACH PART ON A FRESH SHEET
S OF WRITING PAPER.
P
A NIL RETURN
N is required. For Examiners' Us
se
Question Mark
ks
INFORMATION
N FOR CAN
NDIDATES
1 / 14
e number off marks is given in brac
The ckets [ ] at tthe end of each
e question
or part
p question
n. 2 / 12
Calc
culators ma
ay be used. 3 / 14
You
u are remind
ded of the need
n for goo
od English a
and clear presentation
p n in
4 / 12
your answers.
5 / 20
Total / 72
This document
d consists
c off 15 printed
d pages an
nd 2 blank pages.
463
2
B
BOOKLET
TI
STRUCT
TURED QU
UESTIONS
QUESTIO
ON 1
Tobacco p plants are vulnerable to tobacco o mosaic virus (TMV). It is a RN NA virus, which
w upon
eads to dea
infection le ath. Scientists have uused genetic engineerring to overrcome this problem
p byy
creating ttransgenic plants tha at are resisstant to TMV.
T This technique involves the t use off
Agrobacte erium tumeffaciens (thaat naturally infects plan
nt cells) and
d the Ti plassmid as shown in Fig.
1.1. These e transgeniic plants ca
an express the viral ge ene coding for TMV cooat protein. The coatt
protein willl provoke a response from
f ants, resulting in resista
the pla ance to TM
MV.
step 3: Transformation
n of A. tumeffaciens R
Recombinantt Ti plasmid
w
with recombinant Ti plasmid
step 5: R
Recombinant plant cells grrown in
Infected plant
p cell Ti plasmiid DNA
tissue culture into plantletts and
hen whole tra
th ansgenic plannts carrying viral
v gene
for TMV coat
protein within
w plant
Tra
ansgenic plan t Control
Fig. 1.1
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2
J Preliminaary Examinattion / Paper 3
464
3
(a) Outline how the isolated viral RNA can be converted into a double-stranded cDNA in step 1.
[2]
(b) (i) Explain how the recombinant Ti plasmid in step 2 can be formed. [3]
(ii) Explain the purpose of having a leaf-specific promoter in the recombinant Ti plasmid
formed in step 2. [2]
One important role of A. tumefaciens is to infect plant cells to facilitate the integration of Ti plasmid
DNA into plant chromosomes in step 4.
(c) Suggest another important role of A. tumefaciens in the process of creating transgenic
plants which are resistant to TMV.
[1]
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
465
4
Recombinant plant cells are grown using tissue culture into plantlets and then whole transgenic
plants in step 5. The initial stages involve growing the plant cells in growth media supplemented
with different ingredients, such as inorganic nutrients, before a change of environment is required
for the newly formed plantlets in the final stage.
(d) (i) Describe the functions of two other named ingredients in the growth media in the
development of plant tissues. [4]
(ii) Explain the significance of the change of environment for the newly formed plantlets in
the final stage of tissue culture. [2]
[Total: 14]
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
466
5
BOOKLET II
BLANK PAGE
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
467
6
QUESTIO
ON 2
The CFTRR alleles of each family y member a are amplified by polymerase chainn reaction (PCR). Fig.
2.1 showss the resultss of gel elec
ctrophoresiss performedd on each DNA samplee.
Fig. 2.1
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2
J Preliminaary Examinattion / Paper 3
468
7
Fig. 2.2
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2
J Preliminaary Examinattion / Paper 3
469
8
limitation:
imprrovement:
Linkage a
analysis usin
ng RFLP markers
m provvided evideence for the existence of the CFT TR locus on
human ch hromosome e 7. Fig. 2.3
2 shows the positio on of the CFTR
C locuss in relation to RFLPP
markers. The asterrix (*) indicates the poosition of a Taq I resstriction sitee that can be lost byy
mutation.
Fig. 2.3
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2
J Preliminaary Examinattion / Paper 3
470
9
[Total: 12]
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
471
10
BOOKLET III
BLANK PAGE
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
472
11
QUESTIO
ON 3
transcriptio
on transcrription
Drosh
ha enzyme
DGCR8
nuclear nucleus
memmbrane
cytoplasm
m Dicer enz
zyme
ddouble-stran
nded
mmiRNA
RISC
R
one strand of miRNA
ribosome destroyed
RISC
R RISSC protein with
w miRNA
m
mRNA bin ds to mRNAA
Transla
ation ON Tra
anslation OFF
Fig. 3.1
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2
J Preliminaary Examinattion / Paper 3
473
12
(a) Describe how the expression of the miRNA gene controls the expression of the structural
gene. [3]
(b) Researchers believe that cancer cells may have mutations in some of the miRNA genes.
With reference to proto-oncogenes, suggest how these mutations may have contributed to
the progression of cancer.
[2]
Recent research has investigated the importance of miRNA in controlling the fate of stem cells in
adult organisms. To determine the role of miRNAs in these processes, stem cells were modified to
knock out miRNA production. These miRNA knockout cells lack the protein DGCR8, an activator
of Drosha.
(d) Describe how the knockout of DGCR8 affects RNA interference. [2]
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
474
13
Fig. 3.2
Hwa C
Chong Institu
ution 2013 9648 H2
H Biology / JC2
J Preliminaary Examinattion / Paper 3
475
14
[Total: 14]
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
476
15
BOOKLET IV
PLANNING QUESTION
QUESTION 4
The yield of many cultivated varieties of crop plants such as the onion, Allium cepa, is reduced by
the presence of relatively high concentrations of salts, particularly sodium chloride, in the soil.
There are, however, salt-tolerant varieties of onion, which can be grown successfully in such
places. One possible explanation for this is that the fluid in the cell vacuoles of plants of the
tolerant varieties differs in solute potential from that of non-tolerant varieties. To measure the
solute potential of the cell vacuole, one can make use of the concept of incipient plasmolysis.
Incipient plasmolysis is the point where 50 % of plant cells are plasmolysed. At incipient
plasmolysis, the water potential of plant cells is equal to the solute potential as the pressure
potential is zero.
Plan an investigation to find out whether or not the solute potentials of the cell vacuoles of
epidermal cells of the bulbs of salt-tolerant onions differ from those of their non-tolerant counter
parts.
You are provided with the following equipment. Choose your equipment from this list. You may
not use any additional equipment.
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
477
16
have a clear and helpful structure such that the method you use is able to be repeated by
anyone reading it,
identify the independent and dependent variables,
describe the method with the scientific reasoning used to decide the method so that results
are as accurate and reliable as possible,
include layout of results tables and graphs with clear headings and labels,
use the correct technical and scientific terms,
include reference to safety measures to minimise any risks associated with the proposed
experiment.
[Total: 12]
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
478
17
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
479
18
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
480
19
QUESTION 5
(a) Describe the polymerase chain reaction and explain one limitation of this procedure. [8]
(b) Explain the problems associated with the expression of eukaryotic genes in prokaryotes and
how these problems are overcome. [6]
(c) Discuss the benefits and difficult ethical concerns of the human genome project for humans.
[6]
Hwa Chong Institution 2013 9648 H2 Biology / JC2 Preliminary Examination / Paper 3
481
PAPER 3
QUESTION 1
(a) Outline how the isolated viral RNA can be converted into a double-stranded cDNA in step 1. [2]
1. Reverse transcriptase catalyses synthesis of the single-stranded cDNA using the isolated viral RNA
template
2. DNA polymerase converts the single-stranded cDNA into a double-stranded cDNA
(b) (i) Explain how the recombinant Ti plasmid in step 2 can be formed. [3]
1. The same restriction enzyme is used to cleave both the viral gene coding for TMV coat protein from the
cDNA formed in Step 1 and the Ti plasmid
2. to produce complementary sticky ends which facilitate annealing of / formation of hydrogen bonds
between the viral gene and linearized Ti plasmid
3. DNA ligase is added to covalently link / form phosphodiester bonds between the viral gene and linearized
Ti plasmid to produce a recombinant Ti plasmid
(ii) Explain the purpose of having a leaf-specific promoter in the recombinant Ti plasmid formed in step 2. [2]
1. The leaf-specific promoter will ensure that the viral gene coding for TMV coat protein is only expressed in
the leaves of transgenic plants
2. to ensure production of TMV coat protein
(c) Suggest another important role of Agrobacterium tumefaciens in the process of creating transgenic plants which
are resistant to TMV. [1]
1. Agrobacterium tumefaciens allows for in vivo amplification / production of numerous / multiple copies of
the recombinant Ti plasmid
(d) (i) Describe the functions of two other named ingredients in the growth media in the development of plant tissues.
[4]
Ingredient Use in developing tissue
1a. Carbon source, 1b. As respiratory substrate due to lack in autotrophic ability for proliferation of
e.g. glucose / sucrose cells and regeneration of shoots
2a. Plant growth 2b. Stimulates root growth by promoting cell growth & differentiation
regulators, auxins
3a. Plant growth 3b. Stimulates shoot growth by promoting cell growth & differentiation
regulators, cytokinins
4a. Amino acids 4b. Precursors for protein synthesis to stimulate cell growth
5a. Vitamins 5b. As catalysts / coenzymes / enzyme activators in various metabolic processes
6a. Antibiotics 6b. Prevent growth of systemic microbes / effectively control systemic infection
(ii) Explain the significance of the change of environment for the newly formed plantlets in the final stage of tissue
culture. [2]
1. The change of environment represents the shift from heterotrophic / sugar-requiring to autotrophic / free-
living condition
2. and the acclimatization of the plantlets to the outdoor environment before they develop into whole
transgenic plants
[Total: 14 marks]
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 1
482
QUESTION 2
(ii) the position of allele 2 on the agarose gel indicates that it contains a deletion in comparison with allele 1. [2]
(c) Suggest why the child cannot pass on the normal CFTR allele to his offspring. [1]
1. tracheal epithelial cells are somatic cells / are not germ cells
(d) State one limitation of liposome-mediated gene therapy and suggest one improvement to this limitation. [2]
limitation:
1. transient expression of CFTR allele
2. CFTR allele delivered is not integrated into chromosome
3. short-lived/ transient nature/ repeated treatment needed
4. not specific in delivering CFTR allele into target cells
improvement:
1. Use retrovirus-mediated gene therapy
2. design liposomes carrying glycoproteins/glycolipids in their membranes that are recognised by cell
receptors
(e) Describe how RFLP analysis facilitated linkage mapping of the CFTR gene on chromosome 7. [4]
1. restriction sites occur more than once outside the CFTR locus, i.e. Taq I
2. point mutations that create / destroy the restriction sites
3. restriction digestion / cutting with Taq I produce unique patterns of restriction fragments respectively
4. each pattern / set of restriction fragment is an RFLP marker
5. determine the COV between each RFLP marker and the CF condition
6. the longer the distance between an RFLP marker and a particular CFTR allele, the higher the frequency
of crossing over
7. Application: to determine order of CFTR gene in relation to RFLP markers and relative distances
between the loci
[Total: 12 marks]
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 2
483
QUESTION 3
(a) Describe how the expression of the miRNA gene controls the expression of the structural gene. [3]
1. Transcription of the miRNA gene gives a double-stranded miRNA precursor/ RNA folding onto itself/
forming a hairpin loop
2. Drosha cleaves/cut the free ends of the double stranded miRNA precursor and this is exported out of the
nucleus
OR
Dicer then cleaves/ cut the loop and gives a double stranded miRNA
Reject: Non-specific terms (e.g processed/ modify miRNA)
(b) Researchers believe that cancer cells may have mutations in some of the miRNA genes. With reference to
proto-oncogenes, suggest how these mutations may have contributed to the progression of cancer. [2]
1. (i) Mutation of miRNA gene results in miRNA that are no longer complementary to target mRNA and thus
cannot bind to mRNA to down-regulate expression
OR
(ii) Mutation of miRNA gene results in miRNA that cannot form double stranded miRNA thus
Drosha/Dicer/RISC cannot bind to it
OR
(iii) Mutation of miRNA gene results in miRNA promoter of the miRNA is mutated resulting in no miRNA
being produced
Reject: Vague description (inactive/ non-functional miRNA etc) or reference to nonsense mutation resulting in
truncated miRNA.
(d) Describe how the knockout of DGCR8 affects RNA interference [2]
1. Drosha is inactivated
2. miRNA/precursor is not processed / not cleaved
3. RISC cant bind miRNA
4. RNA interference is reduced / translation is left on
(e)(i) Describe how self-renewal in stem cells allows for their proliferation and subsequent differentiation. [2]
5. Differentiation occurs when precursor cells are exposed to different (internal and external) signals /
chemicals
6. and undergo differential gene expression
Note: point 1 and 2 are required to obtain full marks
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 3
484
Trend 1
T1a. In normal cells, self-renewal marker decreases from 1 unit (day 0) to 0.8 unit (day 8) to 0.5 unit (day 16)
T1b. Differentiation marker increases from 0.8 units (day 0) to 8 unit (day 8) to 16 units (day 16)
Explanation 1
E1a. This shows that self-renewal is switched off as differentiation proceeds
E1b. The inverse relationship is due to presence of miRNA which regulated the translation of mRNA of self-
renewal and differentiation markers
E1c. AVP
Trend 2
T2a. In KO cells, self-renewal marker increases from 1.5 unit (day 0) to 1.8 units (day 8) before decreasing to
1 unit (day 16)
T2b. Differentiation marker increases from 1.2 unit (day 0) to 4 units (day 8) before decreasing to 2 units (day
16)
OR
T2c. AVP
Explanation 2
E2a. The interaction of self-renewal and differentiation is abnormal in knockout cells
E2b. No relationship is observed due to the absence of miRNA, thus the loss of regulation in translation of
mRNA of self-renewal and differentiation markers
E2c. AVP
[Total=14 marks]
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 4
485
QUESTION 4
1. Cell vacuoles of salt-tolerant onions are of more negative solute potential than that of non-tolerant onions.
2. Use the scalpel to cut 1 section of 2 cm by 1 cm epidermal tissue from salt-tolerant onion.
3. Using the forceps, put the tissue into 5 cm3 of 0.1 mol dm-3 NaCl solution in a glass specimen tube.
4. Incubate the tube for 15 minutes as timed using a stopwatch.
5. Remove the onion epidermal tissue and place it on a microscopic slide.
6. Add a drop of iodine in potassium iodide solution using a dropper.
7. Cover the sample with a coverslip using mounting needle and place the slide onto the microscope.
8. Count the number of cells undergoing plasmolysis in the first 30 cells seen in this field of view.
9. Repeat for the remaining salt-tolerant onion samples in other concentrations of NaCl solution and for non-
tolerant onion samples.
10. Calculate percentage of plasmolysed cells at each NaCl concentration.
11. The NaCl concentration at which there is incipient plasmolysis can be used to further determine the
respective solute potential.
12. Care must be taken when using the scalpel to avoid cutting oneself.
13. AVP
[Total: 12 marks]
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 5
486
QUESTION 5
(a) Describe the polymerase chain reaction and explain one limitation of this procedure. [8]
Stage 1
1. DNA denatures / H bonds broken, resulting in separation of DNA strands
2. by heating to 95 C
Stage 2
3. Primers / oligonucleotides anneal / hybridize to single-stranded DNA template
4. by cooling to 54 C
Stage 3
5. new strands (of DNA) are synthesized from the position of the primers / amplification of target region
flanked by primers
6. by TAQ DNA polymerase
7. by heating to 72 C
General
8. entire 3 step cycle repeat 20 30 times in a thermocycler
9. PCR products serve as templates for further amplification
L5. It can only be applied to amplify nucleic acids but not proteins
(b) Explain the problems associated with the expression of eukaryotic genes in prokaryotes and how these
problems are overcome. [6]
A. Presence of introns
PA1. Eukaryotic genes contain introns OR prokaryotic genes do not contain introns
PA2. There is no RNA splicing machinery OR introns are not removed in prokaryotes
PA3. pre-mRNA not converted into mature mRNA OR additional amino acid incorporated
SA1. cDNA for the gene of interest is synthesised using mRNA as a template via reverse transcriptase
B. Transcriptional initiation
PB1. Bacterial transcriptional machinery does not recognise eukaryotic promoter OR lack enhancers and
activators
PB2. hence eukaryotic gene is not expressed OR expressed at very low rates when it is placed in a prokaryote
host
SB1. Eukaryotic gene is placed under the control of a strong bacterial promoter to allow for expression of the
eukaryotic gene
C. Translational initiation
PC1. Eukaryotic mRNA lack a Shine-Dalgarno sequence
PC2. hence prokaryotic ribosomes / translation machinery cannot recognise the start site
SC1. Insert the DNA form of the Shine-Dalgarno sequence OR leader sequence
OR
different 5 UTR sequence in the 5UTR of the eukaryotic gene / upstream of gene of interest
D. Post-translational modifications
PD1. Prokaryotes do not have membrane-bound organelles
OR
have no / different post-translational modifications
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 6
487
PD2. hence proteins are not folded into their native / specific 3D conformations/ glycosylation
SD1. Recombinant proteins have to be further purified and modified manually
(c) Discuss the benefits and difficult ethical concerns of the human genome project for humans. [6]
B1a. allows for early detection of mutant genes that causes disease / risk assessment for disease
B1b. screening allows for diagnosis of inherited mutations that predisposes them to specific diseases
B4a. associated techniques eg. genetic testing / RFLP / DNA fingerprinting / DNA sequencing techniques
can be used
B4bi. in forensic science eg. analysis of DNA at crime scenes
OR
B4bii. to establish family relationships e.g. paternity testing
OR
B4biii. to assess risk of mutagenesis / health damage posed by exposure to radiation or carcinogens
B5a. Comparative genomics where the genes in the human genome project of unknown functions can be used
as comparison against known sequences of other organisms
B5b. for identification of gene functions in HGP
B7. AVP
E3a. Use of genetic information in reproductive decision making and reproductive rights
E3b. Concerns that prenatal genetic testing could lead to genetic manipulation or a decision to abort based
on undesirable traits disclosed by the tests
E5a. Clinical issues including the professional education of doctors and other health service providers and
patients; as well as public education
E5b. in genetic capabilities, scientific limitations, and social risks and implementation of standards and quality-
control measures in testing procedures
E7. AVP
[Total: 20 marks]
HWA CHONG INSTITUTION / 2013 JC2 H2 BIOLOGY / PRELIMINARY EXAMINATION / MARK SCHEME 7
488
INNO
OVA JUNIOR COLLLEGE
JC 2 PRELIMINARY E
EXAMINA
ATION II
in prep
paration for General Ce
ertificate of Education Advanced
A LLevel
Higher 2
CANDIDA
ATE
NAME
BIOLO
OGY 96
648/01
Paper 1 Multiple Choiice 225 Septem
mber 2013
1 hour 15 minutes
Additional Materials: Multiiple Choice Answer Sh
heet
READ THE
ESE INSTR
RUCTIONS FIRST
Write yourr name and class on all the work yyou hand in.
Write in so
oft pencil.
Do not usee staples, paper clips, highlighters
h s, glue or co
orrection fluid.
Each corre
ect answer will
w score one mark. A mark will not
n be deduc
cted for a w
wrong answe
er.
Any rough working sh
hould be done in this bo
ooklet.
Innova Junio
or College [Turn
[ over
2 489
A B
C D
4 The
e graph beelow show ws the rate of an enzzyme catalyzed reacction with increasing
sub
bstrate con
ncentration arried out at 37oC annd a pH of
n. The reacction is ca o 7 for all
sub
bstrate concentrations.
1 Decrea
ase in enzy
yme conce
entration
2 Decrea
ase in temp o 27oC
perature to
3 Increasse in pH to
o9
4 Additio
on of competitive inhi bitor
A 1 and 4 on
nly
B 2 and 3 on
nly
C 2 , 3 and 4 only
D 1, 2, 3 and
d4
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
5 492
5 The
e diagram shows
s a se
ection of a cell surfac
ce membra
ane.
A 2 only
B 1, 2 and 4 only
C 2, 3 and 4 only
D All of the above
a
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
6 493
7 The
e figure bellow shows 6 stages o
of meiosis occurring in a plant ccell, where
e 2n = 18.
Wha
at is the co er of these 6 stages?
orrect orde
8 A ccell contain
ning 92 chrromatids a
at metapha
ase of mito
osis wouldd produce two
t nuclei
eacch containinng ____ ch
hromosom es?
A 92
B 46
C 23
D 16
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
7 494
A 1432
B 1234
C 3124
D 3214
10 Cells taken from a human bone cancer multiplied readily in culture. Analysis showed
that the cells were unable to produce the protein, RB. Addition of RB to these cells
reduced their rate of division.
Which of the following statement accounts for the observation?
A Both chromosomes in the cancer cell carry alleles for tumour suppressor gene.
B Both chromosomes in the cancer cell have the allele for tumour suppressor gene
deleted.
C Both chromosomes in the cancer cell carry alleles for proto-oncogene.
D Both chromosomes in the cancer cell have the allele for proto-oncogene deleted.
11 A cculture of bacteria
b ha NA labelled with the heavy isottope of nitrrogen, 15N.
ad all its DN
14
The w then allowed to rreproduce using nucleotides coontaining normal
e culture was n N.
Thee DNA wass examined using a centrifuge after one generationn and again after two o
gennerations.
Thee diagram shows the e position of the DNA band at Z in the ccentrifuge tube when
n
the
e DNA was first labelled.
In w
which patttern would
d the DNA
A be found after the first and aafter the second
s celll
gennerations?
After first
f genera
ation Afte
er second generation
g
A B
C D
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
9 496
13 Wh
hich of the
e following
g statemen
nt is true of the end
d-replicatioon problem
m of linear
DN
NA?
A 1 and 2
B 1 and 4
C 2 and 3
D 3 and 4
14 If th
here were
e 35 aminoo acids an
nd DNA on
nly contain
ned three ttypes of nitrogenous
n s
basses, what would
w be the
t minimu um numbeer of bases
s per codonn that could code for
prooteins?
A 3
B 4
C 6
D 8
15 The
e RNA trip plet UAG acts as a stop codon which terminatess the syntthesis of a
polyypeptide. The
T diagraam shows a strand off DNA whic
ch codes foor four amino acids.
In w
which position will an
n insertion of a thymine nucleo
otide resultt in the term
mination of
tran
nslation?
A B C D
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
10 497
16 Rib
bonucleasee is an ennzyme tha at digests RNA. The
e first five amino ac
cids of the
e
functioning molecule
m of ribonuclea
ase are
lys glu thr ala ala
The e mRNA of
o the gene
e coding fo
or ribonucle
ease, for th
he first 15 nucleotide
es, has the
e
follo
owing sequence.
AU G A A GG AA ACUG C U
Ag
genetic cod
de, showing mRNA ccodons, is shown
s belo
ow.
Wh
hich event occurs
o to explain
e the
e informatio
on given above?
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
11 498
A 1 only
B 1 and 4
C 1, 3 and 4
D 2, 3 and 4
18 The diagram below shows the reproductive cycle of the herpes virus which causes
cold sores on the mouth.
With reference to the diagram above, which of the following statements best
describes the herpes virus?
D Death of the host cell is necessary for the release of the viral progeny.
19 The diagram represents the structure of the human immunodeficiency virus (HIV).
V W X Y Z
amino acids
A amino acids and lipids nucleotides amino acids
carbohydrates
amino acids
B amino acids lipids amino acids amino acids and
carbohydrates
amino acids
C and lipids amino acids nucleotides amino acids
carbohydrates
amino acids amino acids
D and amino acids lipids nucleotides and
carbohydrates carbohydrates
Wh
hich one off the follow
wing statem ely to be true?
ments is like
A Bacterium
m D is resistant to pe ue the transfer of thee complete F plasmid
enicillin du d
and peniccillin resista
ant gene th
hrough transduction involving B Bacterium A.
B Bacterium
m D is resiistant to pe
enicillin du
ue to horizontal genee transfer involving a
bacteriop
phage and Bacterium A.
C Bacteriumm E acquireed resistan
nce to pen
nicillin as a result of rrandom mu
utation and
d
genetic trransformation.
D Bacteria E and F are resisttant to pe
enicillin as a result of conjug
gation from
m
m D.
Bacterium
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
15 502
21 The
e diagram shows som
me of the ffactors affe
ecting the lac operon .
Whhich statem
ment descrribes the ro
ole of the regulator
r protein
p in tthe expres
ssion of the
e
lac operon?
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
16 503
22 The
e diagram shows a gene in a h uman cell.
In o
one form of
o the bloo
od conditio
on thalassa
aemia, there is a muutation in an
a intron of
o
the
e haemogloobin gene.
Wh
hich stage of
o gene ex
xpression w
would this mutation directly
d affeect?
A Activation
n of the gene by a ste
eroid horm
mone
B Attachme
ent of mRN
NA to a ribo
osome
C Binding of
o RNA poly
ymerase to
o DNA
D Splicing of
o pre-mRN
NA
23 Thee following
g diagram shows th he express sion of a particular gene to its proteinn
pro
oduct in a eukaryotic
e cell. Whi ch of the following
f combination
c n correctly
y describess
steps 1 4?
1 2 3 4
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
17 504
24 The
e pedigree
e chart belo
ow shows tthe inherita
ance of a genetic
g dissease in a family.
f
Wh
hat is the nature of the allele tha
at causes this
t diseas
se?
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
18 505
A 1 4 2 3
B 1 4 3 2
C 2 1 4 3
D 3 1 4 2
26 Which one of the following is a correct outline of the main events in photosynthesis?
27 The
e diagram shows the e reversible
e dehydrog
genase co
onversion oof pyruvate
e to lactate
e
by tthe enzym
me lactate dehydrogen
d nase.
Whhat would be
b the effe
ect of inhibiition of lac
ctate dehyd
drogenase in a mammalian cell
und
der anaero
obic conditiions?
A Decrease
e in cell pH
H, due to th
he accumulation of lactic acid.
B Decrease
e in glycoly
ysis, due to
o the lack of
o NAD.
C Increase in ATP pro
oduction, d
due to incre
eased amo
ounts of redduced NAD
D.
D Increase in activity of
o the Kreb
bs cycle, due to incre
eased amoounts of py
yruvate.
29 Whhich of the
e following
g statemennts best describes
d the outcoome of the
e negative
e
fee
edback loop
p in a homeostatic m
mechanism??
A Blood glu
ucose level increasess to the no
ormal level in responnse to the release of
o
glucagon.
B Glucagonn is released by the pancreas in respon
nse to a drrop in bloo
od glucose
e
concentra
ation below
w the norm
mal level.
C Release of glucago on is stop pped in re
esponse to
o blood gllucose con
ncentration
n
returning to the norm
mal level.
D The liver cells break
k down glyycogen to glucose
g in response tto glucago
on.
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
20 507
(-)
hypothalamus
TRF
(-)
anterior pituitary
gland
TSH
thyroid gland
Thyroxine
Increases
metabolic rate
Based on the results shown, which of the following cannot be a long-term effect of
BPA?
32 The
e diagram shows some bioche emical path
hways in a liver cell . Some off the pointss
whe
ere hormones affect the pathw belled 1 to 5.
ways are lab
At w
which poin
nts would the
t hormon
ne insulin accelerate
a the pathw
ways in the
e directionss
indicated?
A 1 and 2
B 2 and 5
C 1, 2 and 5
D 2, 3 and 4
@INNOVA
A 9648
8/01/PRELIM II/2013 [Turn ov
ver
23 510
34 Tetrodotoxin, a puffer fish toxin, blocks voltage-gated sodium channels. Black widow
spiders venom causes the voltage-gated calcium channels to be constantly open.
Crotoxin binds irreversibly to acetylcholine receptors.
What will happen to the nerve transmission if each toxin is applied?
When one such healthy iguana was mated with another from its source of origin in
the Virgin Islands, the offspring were infertile. Which of the following best explains
this?
A Allopatric speciation
B Artificial selection
C Diversifying selection
D Founder effect
36 The graph below shows the distribution of huntsman spiders at a forest boundary:
One species of huntsman spider (Isopeda isopedella) varies in body colour from
dark brown to light grey. In one community at the forest boundary, two populations of
this species were found. Some were found living in the leaf litter inside the forest and
others were found living in the grass just outside the forest. The relative numbers of
dark brown adult spiders and light grey adult spiders found at certain distances from
the forest boundary are shown in the graph above.
37 In separate reactions, PCR was performed using a pair of primers with sequences
complementary to parts of separate exons of a gene suspected to be involved in a
genetic disease.
Using genomic DNA and RNA isolated from healthy (wild-type) and diseased cells,
separate PCR reactions were done. The PCR products were analysed on
polyacrylamide gels. The sizes of the bands in the molecular weight marker (M) are
indicated in base-pairs.
GENOMIC RNA
A Deletion of an exon
B Deletion of several introns
C Deletion of several codons
D Deletion of a splice site
38 As part of the procedure to produce recombinant proteins in E. coli, you are asked to
insert the gene encoding for the Bt toxin protein into the pSEK-T vector. The
restriction sites and selectable markers on the vector are shown below.
Nah I
Ptz II
Wyn II
AdrL II
Oli II
Ampr lacZ Eva II
Multiple Chk II
pSEK-T cloning site AriC II
Vector
AcmI III
If the gene for Bt toxin were to be inserted into the multiple cloning site, what should
be added to the agar plate in order to screen for recombinant clones and how would
the recombinant clones appear?
A Using a retrovirus to introduce the normal -globin gene into bone marrow cells.
B Using a retrovirus to introduce the normal -globin gene into an egg cell.
C Using an adenoviral vector to introduce the normal -globin gene into bone
marrow cells.
D Using an adenoviral vector to introduce the normal -globin gene into an egg
cell.
40 Which genetic modification could increase the yield of crop measured as mass of
crop produced per unit area per year?
BLANK PAGE
Qn Answer Qn Answer
1 C 21 A
2 D 22 D
3 C 23 A
4 C 24 B
5 A 25 B
6 A 26 A
7 D 27 B
8 B 28 B
9 C 29 C
10 B 30 D
11 D 31 C
12 C 32 C
13 D 33 D
14 B 34 B
15 B 35 A
16 D 36 B
17 B 37 D
18 A 38 B
19 C 39 B
20 B 40 B
INN
NOVA JU
UNIOR COLLEGEE
C 2 PRELIMINARY
JC Y EXAMIN
NATION II
in preparation
p for Genera l Certificate
e of Educatio
on Advanceed Level
Hig
gher 2
CANDID
DATE
NAME
BIOL
LOGY 9648/02
Paper 2 Core Pape
er 177 Septemb
ber 2013
2 hours
Addition
nal Materialls: Answerr Paper
Cover Page
P
READ T
THESE INS
STRUCTION
NS FIRST
F
For Examin
ners Use
Write yoour name and
a class on n all the worrk you handd in.
Write in o black pen on both s ides of the paper.
n dark blue or Seection A
You ma ay use a soft
s pencil for any dia agrams, grraphs or roough
1
workingg. 10
0
Do not use staple es, paper clips,
c highlig
ghters, glue
e or correc
ction
2
fluid. 14
4
3
nA
Section 16
6
Answerr all questio
ons.
4
14
4
nB
Section
5
Answerr any one question.
q 15
5
6
At the end of the examinatio on, fasten aall your wo
ork securelyy 11
1
togethe
er. Seection B
The nummber of maarks is given
n in the bra
ackets [ ] at the end of
each qu
uestion or part
p question n. 7/8
20
0
T
Total
100
0
Perrcentage
G
Grade
This document
d cconsists of 18
1 printed pages.
p
Innova Ju
unior College
e [Tu
urn over
518
2 For
Examiners
Use
Section A
Answ
wer all ques
stions.
Fig. 1
[2]
b) Describe how in
(b nsulin, afte
er being synthesized
s d by ribossomes on Y, is
ed out of th
exporte he cell.
[4]
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
519
3 For
Examiners
Use
[2]
[2]
[Tota
al: 10]
Fig 2.1
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
520
4 For
Examiners
Use
(a
a) (i) With referrence to FFig. 2.1, sta
ate the ev
vidences thhat the enz
zyme
has both a tertiary a nd quatern
nary protein structuree.
[2]
[2]
b) The ra
(b ate of reac
ction of H
HIV proteas
se may be
e decreassed by diffferent
inhibito
ors.
Fig 2.2
2
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
521
5 For
Examiners
Use
(ii) Describe and explain the difference in the shape of the curve you
have drawn and that of the non-competitive inhibitor.
[3]
Fig. 2.3
[2]
(ii) Explain wh
hy there iss no activity
y of toxin when
w pH faalls below 8.5.
8
[2]
[2]
[Tota
al: 14]
Fig. 3.1
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
523
7 For
Examiners
Use
(a) Suggest how this bacteriophage attaches to the correct host cell.
[2]
(b) Outline the main events which occur following the entry of the phage
DNA into the host cell until new phage particles are released.
[4]
M-protein neeuraminidas
se
envvelope enzyme Q
ribonu
ucleoprotein
n hemaggluttinin
Fig. 3.2
[3]
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
525
9 For
Examiners
Use
(d) A person is infected with the H1N1 influenza virus but does not develop
the symptoms. Examination shows that the persons immune system
has produced an antibody that binds to the haemagglutinin molecules.
[2]
(ii) After a few days and many viral generations, the person begins to
develop influenza symptoms. Tests for the antibody referred to
above show that it is still present in the blood.
[2]
(e) Contrast the reproductive cycles of the H1N1 influenza virus and Human
Immunodeficieny Virus (HIV).
[3]
[Total: 16]
4 O
Oxytocin (OOT) is a neuropeptidee secreted from the posterior
p ppituitary gla
and in
th
he brain an
nd is best known
k for iits role in mammalian
m n birth and lactation.
In
n response e to a varriety of stim
muli such as sucklin
ng, parturiition, or ce
ertain
kiinds of strress, the processed d OT pepttide is rele
eased fromm the pos sterior
pituitary into
o the syste
emic circulaation.
Fig. 4.1
a) The blo
(a ood brain barrier
b is sset by the endothelial
e cells liningg the vessels in
the bra
ain.
[2]
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
527
11 For
Examiners
Use
(b) With reference to Fig. 4.1, describe and explain how a molecule of
oxytocin can lead to signal amplification leading to cellular responses.
[5]
Fig. 4.2
[4]
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
529
13 For
Examiners
Use
(d) With reference to Fig. 4.2, explain how GABA could have differing
effects on the post-synaptic membrane in different neurons.
[3]
[Total: 14]
An unaffected man with blood group O marries an affected female with blood
group B. Fig. 5 shows the resultant pedigree.
Fig. 5
(i) State and explain the mode of inheritance of NPS with respect to
the ABO locus.
[3]
[4]
(b) (i) State the genotype of the individuals 5 and 8 in Generation II with
respect to both the NPS and ABO loci.
[2]
[3]
(c) Apart from the factors due to the inheritance of genes, environment
plays a very important role in determining phenotype of certain
organisms.
Explain, with one example, how the environment may affect the
phenotype.
[3]
[Total: 15]
6 Cranes are large birds and one of the endangered species, Grus americana
commonly known as the Whooping crane is the tallest North American bird
which faced near extinction due to unregulated hunting and loss of habitat.
Cranes can be categorised based on their behaviours and one of the earliest
methods of classifying cranes was based on the calls they make during the
breeding season.
[3]
Table 6
(b) Describe the structure of the hybrid DNA between the same species.
[4]
(c) With reference to Table 6, which of the two species seemed to be the
most closely related? Explain your answer.
[2]
[2]
[Total: 11]
Section B
Answer one question
(b) Define control elements and explain how they influence transcription in the
eukaryotic genome. [6]
(c) State the various ways in which gene expression of an enzyme may be
controlled at translational and post-translational level. [6]
[Total: 20]
(c) With one named example, describe the role of proto-oncogenes and tumour
suppressor genes in the control of normal cellular division. [8]
[Total: 20]
BLANK PAGE
INN
NOVA JU
UNIOR COLLEGEE
C 2 PRELIMINARY
JC Y EXAMIN
NATION II
in preparation
p for Genera l Certificate
e of Educatio
on Advanceed Level
Hig
gher 2
CANDID
DATE
NAME
BIOL
LOGY 9648/02
Paper 2 Core Pape
er 177 Septemb
ber 2013
2 hours
Addition
nal Materialls: Answerr Paper
Cover Page
P
READ T
THESE INS
STRUCTION
NS FIRST
F
For Examin
ners Use
Write yoour name and
a class on n all the worrk you handd in.
Write in o black pen on both s ides of the paper.
n dark blue or Seection A
You ma ay use a soft
s pencil for any dia agrams, grraphs or roough
1
workingg. 10
0
Do not use staple es, paper clips,
c highlig
ghters, glue
e or correc
ction
2
fluid. 14
4
3
nA
Section 16
6
Answerr all questio
ons.
4
14
4
nB
Section
5
Answerr any one question.
q 15
5
6
At the end of the examinatio on, fasten aall your wo
ork securelyy 11
1
togethe
er. Seection B
The nummber of maarks is given
n in the bra
ackets [ ] at the end of
each qu
uestion or part
p question n. 7/8
20
0
T
Total
100
0
Perrcentage
G
Grade
This document
d cconsists of 18
1 printed pages.
p
Innova Ju
unior College
e [Tu
urn over
537
2 For
Examiners
Use
Section A
Answ
wer all ques
stions.
Fig. 1
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
538
3 For
Examiners
Use
(c) When insulin is released into the bloodstream, it exerts many effects on
carbohydrate, lipid and protein metabolism.
4. -OH groups not protruding 4. Does not interact with water, insoluble,
outwards; osmotically inactive, can be stored
without causing influx of water;
Any 2, 1 mark each
[2]
Gly
ycogen Cellulose
C
1. Madde up of glucose monomers; 1. Mad de up of glucose
g moonomers;
2. -1,,4 and -1,6 glycosid
dic bonds 2. - 1,4
4 glycosidic
c bonds linnk glucose
link
k glucose monomers
m together; monomers together;
3. highhly branchhed structu
ure; 3. long, unbranche ed linear ch
hains;
4. OHH groups not
n protrud ding 4. OH groups
g pro
ojecting ou
ut of cellulo
ose
outtwards of macromolec
m cule/ face chains tot allow cro
oss-linkage
ges to be foormed
inte
erior of maccromolecuule; b/w OH groups of parallel ceellulose cha ains;
5. gllucose monomers no ot flipped 5. gluucose mon pped 180o with
nomers flip w
1800o with resp
pect to prev
vious resppect to prev
vious mono omer;
mon nomer;
Any 2, 1 mark eac ch
[2]
[Tota
al: 10]
Fig 2.1
a) (i)
(a With referrence to FFig. 2.1, sta
ate the ev
vidences thhat the enz
zyme
has both a tertiary a nd quatern
nary protein structuree.
1. Folding
g of polyppeptide cha g -helicess and -plleated
ain to bring
sheets into speciific 3-D strructure (via ds)
a intramoleecular bond
shows tertiary strructure;;
2. Enzymme made up p of 2 poly ypeptide subunits
s heeld together by
intermo
olecular boonds shows quaterrnary struccture;;
3o/4o but circle
Accept 3
[2]
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
540
5 For
Examiners
Use
b) The ra
(b ate of reac
ction of H
HIV proteas
se may be
e decreassed by diffferent
inhibito
ors.
Fig 2.2
2
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
541
6 For
Examiners
Use
3. At high [S],
Competitive inhibition: higher chances of S binding to the
active site outcompeting inhibitor hence effect of inhibitor
becomes negligible / WTE
VS
non-competitive inhibition: effective enz concentration
reduced;; [3]
Fig. 2.3
(ii) Explain wh
hy there iss no activity
y of toxin when
w pH faalls below 8.5.
8
1. increasse H+ conc centration disrupts
d in
ntramolecu ular ionic bo
onds
and hyydrogen bo onds that help maintain the speccific 3D
conforrmation of tthe proteasse;; toxin
n
2. Disruption of seccondary an nd tertiary structures/
s /
denatu protease loss of sp
uration of p pecific 3D
conforrmation of eenz active site toxiin (substraate) cannott
bind to
o active site ase no ac
e of protea ctivation o
of toxin;; [2]
[Tota
al: 14]
Fig. 3.1
b) Outline
(b e the main n events w which occu ur followingg the entry
ry of the phage
p
DNA innto the hosst cell until new phage particles s are releassed.
1. Mu phage
p genoome integrrates into host
h hromosomee propha
cell ch age
repllicated toge
ether with h host cell ch
hromosom me;;
2. Prop
phage increease in nummber of co
opies until exposure
e tto certain
chemiccals/ UV, prrophage in
nduced to exit
e bacteriial chromo osome;;
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
543
8 For
Examiners
Use
3. Prop
phage trans scribed intto structuraal proteins (capsid prroteins, head
and taiil/ tail fibre structuress) using hoost cell RNAA pol and rribosomes
these together
t wiith viral ge
enome asse emble to foorm compleete Mu vira al
particle
e;;
4. phaage directs s the prod duction of an enzym me that bre reaks down n the
bacteriial cell walll from with hin fluid en
nters the baacteria, cauusing it to swell
and unndergo celll lysis re elease neww Mu phage particles;;;
everrything if T4 is relea
ased
[4]
M-protein neeuraminidas
se
envvelope enzyme Q
ribonu
ucleoprotein
n hemaggluttinin
Fig. 3.2
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
544
9 For
Examiners
Use
(d) A person is infected with the H1N1 influenza virus but does not develop
the symptoms. Examination shows that the persons immune system
has produced an antibody that binds to the haemagglutinin molecules.
(ii) After a few days and many viral generations, the person begins to
develop influenza symptoms. Tests for the antibody referred to
above show that it is still present in the blood.
(e) Contrast the reproductive cycles of the H1N1 influenza virus and Human
Immunodeficieny Virus (HIV).
[3]
[Tota
al: 16]
4 O
Oxytocin (OOT) is a neuropeptidee secreted from the posterior
p ppituitary gla
and in
th
he brain an
nd is best known
k for iits role in mammalian
m n birth and lactation.
In
n response e to a varriety of stim
muli such as sucklin
ng, parturiition, or ce
ertain
kiinds of strress, the processed d OT pepttide is rele
eased fromm the pos sterior
pituitary into
o the syste
emic circulaation.
Fig. 4.1
a) The blo
(a ood brain barrier
b is sset by the endothelial
e cells liningg the vessels in
the bra
ain.
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
546
11 For
Examiners
Use
b) With reference
(b r to
t Fig. 4.1 1, describe and exp plain how a molecu ule of
oxytoccin can lead
d to signal amplification leadingg to cellula
ar response
es.
1. Oxy
xytocin bin nds to GP PCR (at extracellul
e lar face), which ha as an
asssociated inactive G G-protein change in co onformatioon of
GPPCR;;
2. stimmulates GDP
G excha ange for GTP
G at - subunit o of G-proteein
trannslocatedd along cy ytoplasmiic face off CSM tow wards effeector/
pho ospholipaase;;
3. pho ospholipaase cleav ves many y PIP2 molecules
m into second
me essengers DAG and d IP3 / sign
nal amplification at tthis stagee;;
4. DAAG activate es protein n kinase C which ca arries out target cellular
ressponses;;
5. IP3 stimulate es the rellease of CaC 2+ ions from (s)E ER, Ca2+ forms
fo
com mplex wiith calmo odulin wh hich carriies out ttarget cellular
ressponses;;
Refereence to siggnal casca ade
*mech h of action
n: literaturre seems tot imply 1 DAG 1 PKC [5]
Fig. 4.2
OVA
@INNO 9648/02
2/PRELIM II/20
013 n over
[Turn
547
12 For
Examiners
Use
(c) Describe and explain how GABA is released from the pre-synaptic
neurone to the post-synaptic neurone to result in an inhibitory post-
synaptic potential.
1. Depolarization of/ arrival of A.P. at pre-synaptic knob causes
opening of voltage-gated Ca2+ channels Ca2+ influx;;
2. Induces migration of synaptic vesicles containing GABA to
CSM and fuse release GABA into synaptic cleft via
exocytosis;;
3. GABA diffuses across synaptic cleft (down conc grad) and
binds to ligand-gated Cl- channels, causing them to open;;
4. influx of Cl- occurs hyperpolarized of post-synaptic
memb IPSP;; [4]
(d) With reference to Fig. 4.2, explain how GABA could have differing
effects on the post-synaptic membrane in different neurons.
1. 25mM in immature neurone higher than that in ECF vs 7mM in
mature neurone lower than that in ECF;;
2. Binding of GABA to ligand-gated Cl- channels result in Cl-
efflux in immature neurone leads to memb depolarization =
EPSP;;
3. but Cl- influx in mature neurone leads to memb
hyperpolarization = IPSP;;
Accept IPSP / EPSP
[3]
[Total: 14]
An unaffected man with blood group O marries an affected female with blood
group B. Fig. 5 shows the resultant pedigree.
Fig. 5
(i) State and explain the mode of inheritance of NPS with respect to
the ABO locus.
1. autosomal linkage between NPS and ABO loci, mutated
NPS allele is dominant;;
2. all individuals with blood group B except individuals II-5
and III-3 are affected;;
3. mutant NPS allele is linked to IB tends to be
inherited together;; [3]
(b) (i) State the genotype of the individuals 5 and 8 in Generation II with
respect to both the NPS and ABO loci.
1. Individual 5 nnIBIO with both copies of the normal allele for
NPS;;
2. Individual 8 NnIOIO with one copy of the normal allele
and one mutated copy;; [2]
(c) Apart from the factors due to the inheritance of genes, environment
plays a very important role in determining phenotype of certain
organisms.
Explain, with one example, how the environment may affect the
phenotype.
1. Stating of a specific e.g. and the environmental conditions;;
[Total: 15]
6 Cranes are large birds and one of the endangered species, Grus americana
commonly known as the Whooping crane is the tallest North American bird
which faced near extinction due to unregulated hunting and loss of habitat.
Cranes can be categorised based on their behaviours and one of the earliest
methods of classifying cranes was based on the calls they make during the
breeding season.
Table 6
(b) Describe the structure of the hybrid DNA between the same species.
1. 2 polynucleotides held in a double helix;;
5. anti//, 3 5, 5 3;;
[4]
(c) With reference to Table 6, which of the two species seemed to be the
most closely related? Explain your answer.
1. Grus americana and Grus monachus;;
[Total: 11]
Section B
Answer one question
(b) Define control elements and explain how they influence transcription in the
eukaryotic genome. [6]
1. Control elements consist of cis-acting elements which are on the
same chromosome and trans-acting elements which are on
different chromosomes as the gene to be regulated;;
2. Cis-acting elements includes promoters core and proximal,
enhancers and silencers;;
3. Trans-acting elements includes genes coding for basal and
specific TFs activators and repressors;;
4. Core promoters are adjacent DNA sequences where the basal TF
and RNA pol will bind to initiate transcription;;
5. Proximal promoters, which are DNA sequences that are close to
the core promoter allow the binding of specific TFs to increase
transcription;;
6. Enhancers allow the binding of activators to recruit DNA
bending protein so that the enhancer is brought nearer to the
core promoter to stabilise the TIC, effectively increasing the rate
of transcription/ amount of mRNA produced/time;;
7. Silencers allow the binding of repressors to result in a decrease
Post-translational level
4. Concentration/ stability of the translated product could be
regulated via the degradation of the protein;;
5. Proteins designated for destruction are conjugated with a small
protein called ubiquitin;;
6. Ubiquitinylated proteins are subsequently recognized and
degraded by proteasome;;
7. GA modification of the translated polypeptide by cleaving the
polypeptide or modifying the sugar monomers on the oligosacc
chains/ phosphorylation;;
[Total: 20]
(c) With one named example, describe the role of proto-oncogenes and tumour
suppressor genes in the control of normal cellular division. [8]
1. proto-oncogene = genes that code for proteins that stimulate
normal cell growth and division.
2. RAS, codes for a G prot, role in G1 check point where the
presence of growth factor is being checked for;;
3. Binding of growth factor result in phosphorylation cascade to
result in the increase in levels of cyclins in cell;;
4. Cyclins bind to CDKs, forming complexes to remove the
inhibition of other proteins that prevents progress to S phase;;
5. In the absence of growth factor, the RAS is not activated, hence
cells do not progress to S phase/ presence of growth factor, Ras
activated cells progress from G1 S phase;;
6. p53, tumour suppressor genes = code for proteins that normally
inhibit cell division (when conditions for cell division not met);;
7. by activating DNA repair proteins to repair damaged DNA /
controlling proper cell anchorage;;
8. activating transcription of p21 gene p21 binds to Cdks
prevent entry into S phase;;
9. triggering apoptosis (when DNA damage is beyond repair);;
[Total: 20]
BLANK PAGE
INN
NOVA JU
UNIOR COLLEGEE
C2 PRELIMINARY
JC Y EXAMIN
NATION II
in preparation
p for Genera l Certificate
e of Educatio
on Advanceed Level
Hig
gher 2
CANDID
DATE
NAME
BIOL
LOGY 9648/03
2 5 Septemb
ber 2013
Paper 3 Applications Paper
2 hours
Addition
nal Materialls: Answerr Paper
Cover Page
P
READ T
THESE INS
STRUCTION
NS FIRST
F
For Examin
ners Use
Write yoour name and
a class on n all the worrk you handd in.
Write in o black pen on both s ides of the paper.
n dark blue or 1 15
5
You ma ay use a soft
s pencil for any dia agrams, grraphs or roough
workingg. 2
15
5
Do not use staple es, paper clips,
c highlig
ghters, glue
e or correc
ction
fluid. 3
10
0
G
Grade
This document
d cconsists of 16
1 printed pages.
p
Innova Ju
unior College
e [Tu
urn over
556
2 For
Examiners
Use
Section A
Answ
wer all ques
stions.
1 In fla
ax plants, the
t flowers s are white
e, lilac or blue. Fig.1 shows
s the pathway by
b
whicch the flow
wer cells pro
oduce colooured pigm ments.
Fig. 1
(a) A single ba
ase deletio
on occurs in
n gene 1.
DDescribe and
a explain the effecct of this mutation
m o the coloour of flax plant
on
fflowers.
[4]
OVA
@INNO 9648/0 3/PRELIM II/20
013 n over
[Turn
557
3 For
Examiners
Use
(b) G
Gel electroophoresis was used d to separate the enzymes
e i nvolved in
n this
p
pathway. When ex xtracts of the diffeerently colloured flax
ax petals were
a
analyzed, four differeent pattern
ns of band
ds were prroduced. Inn Table 1, only
b
bands thatt contain fu
unctional e nzymes arre shown.
Table 1
R
Results of electrophore
esis Colo
our of petalss
White
((i) With
h reference
e to Fig. 1
1, complete Table 1 to give thhe colour of
o the
al from which each exxtract was taken.
peta [3]
[5]
OVA
@INNO 9648/0 3/PRELIM II/20
013 n over
[Turn
558
4 For
Examiners
Use
(c) Genomic libraries and cDNA libraries can be created for the flax plant
genome.
[3]
[Total: 15]
Each artificial gene is cloned into a separate bacterial plasmid pUC21, using the
restriction enzyme HindIII, and placed under the control of a strong lac
promoter. Fig. 2.2 shows the plasmid map of pUC21. It includes the positions of
the restriction sites for the three restriction enzymes, PstI, EcoRI and HindIII,
and distances (in base pairs) between the sites. The shaded regions represent
two marker genes, AmpR and lac Z.
6 28 35 8 40 48
Fig. 2.1
PstI
Amp
800 1600
pUC21
EcoRI ORI
Lac Z
lac operator
Fig. 2.2
Both recombinant plasmids containing the two artificial genes are transformed
separately into E. coli cells. The bacterial cells from the transformation process are
grown on an agar plate containing ampicillin and X-Gal.
(a) State the substance that must be added to induce the expression of the
artificial genes in E. coli.
[1]
[1]
(c) Heat shock treatment is applied to E.coli cells to render them competent to
take up recombinant plasmids.
[3]
(d) Describe and explain the procedure to select for bacterial cells containing
the recombinant plasmid.
[4]
Once the transformed bacterial colonies have been identified, nucleic acid
hybridization is carried out to further identify the colonies which contained
the artificial genes.
The plasmid DNA from these colonies is then isolated and subjected to
digestion by a particular restriction enzyme to determine which colonies
have the artificial genes inserted in the correct orientation.
Table 2
Restriction
enzyme
used
(e) With reference to Fig. 2.1 and Fig. 2.2, complete Table 2 by identifying the
particular restriction enzyme used for digestion of the respective plasmid
DNA. [2]
(f) With reference to Fig. 2.1, Fig. 2.2 and Table 2, state the appropriate
restriction enzyme that has to be used for the digestion of the respective
plasmid DNA in order to determine which has the artificial genes inserted in
the correct orientation.
[2]
[2]
[Total: 15]
[2]
The dystrophin gene was inserted into an adenovirus and injected into a
strain of mice with the symptoms of muscular dystrophy.
Eight mice with DMD were injected once in a muscle in one hind limb with
different doses of the modified virus 7 days after birth. The mice were then
killed at the age of 2 to 25 weeks and sections of the injected muscle and
uninjected muscle from the other hind limb were obtained.
Table 3
Increase in muscles
Virus dose/ Death/weeks
Mouse fibres with
particles*109 cm-3 after birth
dystrophin/%
1 1.0 2 6
2 2.0 3 8
3 2.5 5 10
4 3.0 8 22
5 4.0 10 30
6 5.0 14 50
7 5.0 18 35
8 5.0 25 15
(b) Describe and explain how the adenovirus delivers the dystrophin gene.
[3]
(i) suggest why uninjected muscle from each mouse was also treated
with fluorescent antibody specific to dystrophin.
[1]
(ii) describe the effect of the injected dosage of virus on the percentage
of muscle fibres producing dystrophin.
[2]
[2]
[Total: 10]
4 Planning question
Malt is germinated cereal grains which have been dried in a process known as
malting. Malted barley contain amylases which digest starch into maltose units by
cleaving the -1,4-glycosidic bonds.
The digestion of starch is an exothermic process and releases energy. This energy
released can be detected by the largest increase in temperature of the reaction
mixture over a period of time.
Using this information and your own knowledge, design an experiment to determine
the concentration of active amylase in malted barley samples that have undergone
different heat treatments.
Free-response question
Write your answers to this question on the separate answer paper provided.
Your answer:
should be illustrated by large, clearly labelled diagrams, where appropriate;
must be in continuous prose, where appropriate;
must be set out in sections (a), (b), etc., as indicated in the question.
5 (a) Explain the normal functions of stem cells in a living organism. [6]
[Total: 20]
BLANK PAGE
INN
NOVA JU
UNIOR COLLEGEE
C2 PRELIMINARY
JC Y EXAMIN
NATION II
in preparation
p for Genera l Certificate
e of Educatio
on Advanceed Level
Hig
gher 2
CANDID
DATE
NAME
BIOL
LOGY 9648/03
2 5 Septemb
ber 2013
Paper 3 Applications Paper
2 hours
Addition
nal Materialls: Answerr Paper
Cover Page
P
READ T
THESE INS
STRUCTION
NS FIRST
F
For Examin
ners Use
Write yoour name and
a class on n all the worrk you handd in.
Write in o black pen on both s ides of the paper.
n dark blue or 1 15
5
You ma ay use a soft
s pencil for any dia agrams, grraphs or roough
workingg. 2
15
5
Do not use staple es, paper clips,
c highlig
ghters, glue
e or correc
ction
fluid. 3
10
0
G
Grade
This document
d cconsists of 16
1 printed pages.
p
Innova Ju
unior College
e [Tu
urn over
573
2 For
Examiners
Use
Section A
Answ
wer all ques
stions.
1 In fla
ax plants, the
t flowers s are white
e, lilac or blue. Fig.1 shows
s the pathway by
b
whicch the flow
wer cells pro
oduce colooured pigm ments.
Fig. 1
(a) A single ba
ase deletio
on occurs in
n gene 1.
DDescribe and
a explain the effecct of this mutation
m o the coloour of flax plant
on
fflowers.
11. framesh hift mutatioon/ changee in reading
g frame of gene/ chan nge in codo
ons
downsttream of mutation;;
22. change e in aa seq. of enz 1 change in n R groupss changee in R grou up
interacttions in po
olypeptide;;;
33. leading g to differen
nt folding tthus 3D con n of enz 1 likely to be
nfiguration
non-funnctional / does
d not ca
atalyze syn
nthesis of liilac pigmen
nt;;
44. lack of substrate
s fo
or enz 2 to act on to synthesize
s ment flax
blue pigm
fflowers app pear white;; [4]
OVA
@INNO 9648/0 3/PRELIM II/20
013 n over
[Turn
574
3 For
Examiners
Use
(b) G
Gel electroophoresis was used d to separate the enzymes
e i nvolved in
n this
p
pathway. When ex xtracts of the diffeerently colloured flax
ax petals were
a
analyzed, four differeent pattern
ns of band
ds were prroduced. Inn Table 1, only
b
bands thatt contain fu
unctional e nzymes arre shown.
Table 1
R
Results of electrophore
esis Colo
our of petalss
White
blue
lilac
white
w
((i) With
h reference
e to Fig. 1
1, complete Table 1 to give thhe colour of
o the
al from which each exxtract was taken.
peta [3]
OVA
@INNO 9648/0 3/PRELIM II/20
013 n over
[Turn
575
4 For
Examiners
Use
(c) Genomic libraries and cDNA libraries can be created for the flax plant
genome.
[3]
[Total: 15]
Each artificial gene is cloned into a separate bacterial plasmid pUC21, using the
restriction enzyme HindIII, and placed under the control of a strong lac
promoter. Fig. 2.2 shows the plasmid map of pUC21. It includes the positions of
the restriction sites for the three restriction enzymes, PstI, EcoRI and HindIII,
and distances (in base pairs) between the sites. The shaded regions represent
two marker genes, AmpR and lac Z.
6 28 35 8 40 48
Fig. 2.1
PstI
Amp
800 1600
pUC21
EcoRI ORI
Lac Z
lac operator
Fig. 2.2
Both recombinant plasmids containing the two artificial genes are transformed
separately into E. coli cells. The bacterial cells from the transformation process are
grown on an agar plate containing ampicillin and X-Gal.
(a) State the substance that must be added to induce the expression of the
artificial genes in E. coli.
Lactose/ allolactose/ IPTG;;
[1]
(c) Heat shock treatment is applied to E.coli cells to render them competent to
take up recombinant plasmids.
[3]
(d) Describe and explain the procedure to select for bacterial cells containing
the recombinant plasmid.
1. Bacterial cells successfully transformed with plasmids will be resistant to
ampicillin hence can survive/ grow/ form colonies;;
2. bacterial cells containing non-recombinant plasmids appear blue since
lacZ gene is intact/ not disrupted by insertion of insulin genes
functional -galactosidase produced
3. bacterial cells containing recombinant plasmids appear white since lacZ
gene has been disrupted/ insertional inactivation of lacZ gene has
occurred no functional -galactosidase produced
4. X-gal hydrolyzed/ cleaved/ X-gal not hydrolyzed/ cleaved;; (only
awarded if pt2/3 is correct) [4]
Once the transformed bacterial colonies have been identified, nucleic acid
hybridization is carried out to further identify the colonies which contained
the artificial genes.
The plasmid DNA from these colonies is then isolated and subjected to
digestion by a particular restriction enzyme to determine which colonies
have the artificial genes inserted in the correct orientation.
Table 2
Restriction
EcoRI; PstI; PstI; EcoRI;
enzyme
used
(e) With reference to Fig. 2.1 and Fig. 2.2, complete Table 2 by identifying the
particular restriction enzyme used for digestion of the respective plasmid
DNA. [2]
(f) With reference to Fig. 2.1, Fig. 2.2 and Table 2, state the appropriate
restriction enzyme that has to be used for the digestion of the respective
plasmid DNA in order to determine which has the artificial genes inserted in
the correct orientation.
[2]
[Total: 15]
The dystrophin gene was inserted into an adenovirus and injected into a
strain of mice with the symptoms of muscular dystrophy.
Eight mice with DMD were injected once in a muscle in one hind limb with
different doses of the modified virus 7 days after birth. The mice were then
killed at the age of 2 to 25 weeks and sections of the injected muscle and
uninjected muscle from the other hind limb were obtained.
Table 3
Increase in muscles
Virus dose/ Death/weeks
Mouse fibres with
particles*109 cm-3 after birth
dystrophin/%
1 1.0 2 6
2 2.0 3 8
3 2.5 5 10
4 3.0 8 22
5 4.0 10 30
6 5.0 14 50
7 5.0 18 35
8 5.0 25 15
(b) Describe and explain how the adenovirus delivers the dystrophin gene.
1. adenovirus binds to specific receptors found on CSM of muscle
cells, enters by receptor-mediated endocytosis;;
2. viral capsid enters cytoplasm, enzymes remove capsid to release
viral genome along with normal dystrophin gene;;
3. normal dystrophin gene travels into nucleus of muscle cell,
undergoes homologous recombination with host chromosome
to replace defective allele / exist and expressed extra-
chromosomally to express dystrophin prot;; [3]
(i) suggest why uninjected muscle from each mouse was also treated
with fluorescent antibody specific to dystrophin.
act control
to calculate % increase in muscle fibres w dystrophin by
subtracting away baseline production from uninjected
muscle;; [1]
(ii) describe the effect of the injected dosage of virus on the percentage
of muscle fibres producing dystrophin.
1. higher dosage of virus, higher the increase in % of muscle
fibre producing dystrophin
1.0 x 109 cm-3 with 6% increase at 2 weeks to 5.0 x 109 cm-3
with 50% increase at 14 weeks;;
2. virus dose of 5.0 x 109 cm-3 for mice killed in 14 25 weeks
caused decreased in % increase of muscle fibre producing
dystrophin
from 50% to 15%;;
[2]
4 Planning question
Malt is germinated cereal grains which have been dried in a process known as
malting. Malted barley contain amylases which digest starch into maltose units by
cleaving the -1,4-glycosidic bonds.
The digestion of starch is an exothermic process and releases energy. This energy
released can be detected by the largest increase in temperature of the reaction
mixture over a period of time.
Using this information and your own knowledge, design an experiment to determine
the concentration of active amylase in malted barley samples that have undergone
different heat treatments.
Theoretical consideration
Precaution:
4. [Precaution & safety = 1 mark any 2]
Mercury is toxic. Exercise caution in handling thermometer so as to prevent
breakage.
Glassware is fragile, handle with care to prevent breakage.
Buffer is a skin irritant, wear gloves and googles when handling.
Procedure
Dilution Table
6. [acclimatisation timing]
Step 2:
Set up a water bath maintained at 37oC and immerse boiling tube A containing 3 cm3
of 10% amylase solution into it.
Immerse a test tube containing 3 cm3 of 1.0 moldm-3 starch solution into the same
water bath.
Allow both amylase and starch solutions to acclimatize to the temperature for 2-10
minutes before adding the starch solution into boiling tube A.
same setup as the experiment except that the 3cm3 amylase solution has been
replaced by distilled water.
10.0
8.0
6.0
4.0
2.0
0.0
M1
M2
Formulas must be shown in table heading.
Table 1
Write your answers to this question on the separate answer paper provided.
Your answer:
should be illustrated by large, clearly labelled diagrams, where appropriate;
must be in continuous prose, where appropriate;
must be set out in sections (a), (b), etc., as indicated in the question.
5
(a) Explain the normal functions of stem cells in a living organism. [6]
1. undifferentiated, unspecialised cells with no specific tissue structures;;
2. unlimited self-renewal capacity;
due to high level of telomerase acty ;
capable of undergoing cont division / mitosis;
to replace damaged or worn out tissues;
3. totipotent;
zygotic SC;
4. able to dy/dx into all cell types including extra-embryonic tiss / placenta;
extracellular mem
5. pluripotent;
ESCs found in inner cell mass of embryo / blastocyst;
6. able to dy/dx into any cell type except extra-embryonic tiss / placenta;;
7. into the 3 dermal layers: ectoderm, mesoderm, endoderm;;
8. multipotent;
ASC e.g. HSCs, found in the bone marrow;
9. able to dy/dx into grp of cells with related f(x) / limited cell lineages / myeloid,
lymphoid progenitor;
e.g. give rise to RBCs, WBCs, lymphocytes;
10. SCs dy/dx in response to internal & external signals;
that influences gene expression;
Advantages (max. 4)
1. rapid pdtn of many plants in short period of time;
which are genetically identical;
plants grow faster
2. able to generate whole plant from a small portion of explant;
facilitate growing of GM plants;
3. prod hybrid offspring from sexually incompatible plants with desirable traits fr
Limitations (max 4)
7. high risk of contamination / genetic uniformity increases susceptibility
resulting in high losses;
8. exposure to high conc. of PGRs;
plants tend to undergo mutation;
9. plant cells may possess physiological memory;
plants generated from non-juvenile cells may mature before they are fully
grown;
10. high cost due to need for sophisticated facilities & high labour input;
e.g. sterile lab conditions / tiss culture room / special nutrient media /
trained personnel / transplanting plantlets;
(c) Comment on the statement GM crops can make a relevant contribution to
solving health problems in developing countries. [6]
CANDIDATE
NAME
CLASS
BIOLOGY 9648/01
Paper 1 Multiple Choice 20 September 2013
1 hour 15 minutes
Additional Materials: Multiple Choice Answer Sheet
There are forty questions on this paper. Answer all questions. For each question there are four
possible answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer
Sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
Calculators may be used.
9648 / 01
592
2
1 Which row correctly identifies all the locations of ribosomes in a eukaryotic cell?
attached to attached to
free in in
endoplasmic nuclear in nucleus
cytoplasm mitochondria
reticulum envelope
A
B
C
D
3 Liver tissue produces an enzyme called catalase which breaks down hydrogen peroxide
into water and oxygen.
2H2O2 2H2O + O2
The rate of this reaction can be determined by measuring the volume of oxygen
produced in a given length of time.
Students added small cubes of fresh liver tissue to a range of hydrogen peroxide
solutions and measured the volumes of oxygen produced. Their data were used to
produce the graph showing how changing the concentration of hydrogen peroxide
affected the rate of oxygen production.
8 Ribonuclease is an enzyme that digests RNA. The first five amino acids of the functional
molecule of ribonuclease are:
The mRNA of the gene coding for ribonuclease, for the first 15 nucleotides, has the
following sequence.
AUGAAGGAAACUGCU
9 Base substitution mutations can have the following molecular consequence except
A changes one codon for an amino acid into another codon for that same amino acid.
B codon for one amino acid is changed into a codon of another amino acid.
C reading frame changes downstream of the mutant site.
D codon for one amino acid is changed into a translation termination codon.
10 What happens when a bacterial cell that is infected by lambda phage divides?
11 The following describes events in the life cycle of an influenza virus. Which statement is
correct?
A Acidification results in the viral envelope fusing with the exocytic vesicle membrane,
releasing the capsid in the process.
B Viral genome acts as a template for the making of new copies of viral RNA genome.
C Complementary RNA strand is translated into viral proteins.
D Glycoproteins synthesised by ribosomes are transported to the plasma membrane
via endocytic vesicles whereby the glycoproteins are incorporated into the host cells
plasma membrane.
She has a F plasmid containing a functional copy of lacZ gene. She then adds a high
concentration of the plasmid to a tube of the bacteria in a medium for bacterial growth
that contains glucose or lactose as the only energy source. This tube (+) and a control
tube (-) with similar bacteria but no plasmid are both incubated under the appropriate
conditions for growth and plasmid uptake. The scientist then spreads a sample of each
bacterial culture (+ and -) on each of the three types of plates indicated below.
Which row correctly identifies the plates with growth () or no growth ()?
Bacterial strain with added plasmid (+) Bacterial strain with no plasmid (-)
Plate A Plate B Plate C Plate A Plate B Plate C
A
B
C
D
13 The diagram represents a length of DNA which forms a structure called an operon. Parts
of the operon are labelled E, F, G and H. They have different functions.
E F G H
A operator structural gene(s) regulator promoter
B promoter regulator structural gene(s) operator
C regulator promoter operator structural gene(s)
D structural gene(s) operator promoter regulator
A All eukaryotic genes are transcribed continuously because they are not packaged by
histones.
B A DNA must be selectively released from its histone packaging before transcription
can occur in bacteria.
C Histones package prokaryote chromatin into the nucleosomes that form the bulk of the
chromosome.
D The organisation of DNA by histones in eukaryotes allows some gene control
sequences to be thousands of base pairs away from the gene concerned.
17 A student has 2 cultures of cells. Culture A consists of normal cells, while culture B
consists of cells which were isolated from a tumour and divide uncontrollably. He wants
to determine if the uncontrolled growth of cells in culture B was the result of activation of
an oncogene or the mutation of a tumour suppressor gene. He decides to fuse the cells
from the two cultures to form a hybrid line containing DNA from both cells.
The list of possible results and the conclusions drawn from the experiment are
summarised by the student in the table below:
Only two of the conclusions are correctly matched with the possible results. The two
correct possibilities are
18 A parent organism of unknown genotype is mated in a test cross. Half of the offspring
have the same phenotype as the parent.
19 The table shows the results of a series of crosses in a species of small mammal.
What explains the inheritance of the range of phenotypes shown by these crosses?
20 Two
o genes A and
a B are lin
nked togeth
her as show
wn below.
If th
he genes area far enou ugh apart ssuch that crossing ove
er between the alleles
s occurs
occa asionally, which
w ment is true of the gam
statem metes?
The
e table shows some distances
d b
between the
e gene loci, as determ
mined by breeding
b
experiments.
Jurong J
JC/JC2 H2 Biology/Prelims/2013
600
10
22 The following pedigree depicts the inheritance of a rare hereditary disease affecting
muscles.
A autosomal dominant
B autosomal recessive
C X-linked dominant
D X-linked recessive
23 The phenotypes of 200 offspring of a dihybrid test cross were recorded. The cross
involved petal colour and fertility of the anthers of sweet pea flowers. The table shows
the observed and expected numbers of each phenotype.
A chi-squared (2) test was performed and the probability of the difference between the
observed and expected results being due to chance was found to be <0.001.
1 2 3 4 5 6
Which row correctly identifies the structure or function of the labelled regions?
A 1 and 2 1 and 2 4 6 5
B 1 and 2 1 4 6 5
C 1, 2 and 3 1 3 and 4 5 6
A chemical bond energy released during the light independent stage of photosynthesis
B chemical bond energy released during glycolysis and the Krebs cycle
C potential energy of protons diffusing through the inner mitochondrial membranes in
mitochondria
D potential energy of protons diffusing through thylakoid membranes in chloroplasts
28 Lipid membranes can be formed in the laboratory by painting phospholipids over a PTFE
sheet with a hole in it.
In one experiment with Na+ ions, no current flowed across the membrane until a
substance called gramicidin was added, at which time current flowed.
Which statement is consistent with this information and your knowledge of membrane
structure?
29 The graph shows how the rate of entry of glucose into a cell changes as the
concentration of glucose outside the cell changes.
31 During which stage of a nerve impulse does the opening of the voltage-gated sodium
channels play an important role?
A resting potential
B depolarisation
C repolarisation
D hyperpolarisation
32 The heart, like most internal organs, is supplied with nerves from both the sympathetic
and parasympathetic nervous systems. The neurones in these nerves form synapses
with muscle tissue in the sino-atrial node (SAN) of the heart.
The diagram shows how the rate of heartbeat of a mammal changed when the
sympathetic and parasympathetic nerves were stimulated at different frequencies. The
frequency of stimulation was measured in hertz (Hz), i.e. the number of stimulations per
second.
34 Before the settlement of California in the 1800s, the elk population was very large. By
about 1900 there were only a few dozen elk left.
Owing to protection, there are now about 3000 elk living in a small number of isolated
herds.
Unfortunately, some of the elk in all the herds have difficulty grazing due to a shortened
lower jaw.
A 2 and 5 only
B 3 and 4 only
C 1, 2 and 4 only
D 2, 3 and 5 only
35 Darwins view of the process of evolution to form new species (speciation) has been
reinforced by more recent discoveries in genetics and cell biology.
In this view, which sequence of events is considered most likely to lead to speciation?
competition and
adaptation of behavioural sympatric
A predation leading to
population isolation speciation
natural selection
competition and
B
adaptation of predation leading to behavioural allopatric
population isolation speciation
natural selection
competition and adaptation
geographical sympatric
C predation leading to of isolated
isolation speciation
natural selection populations
competition and adaptation
D predation leading to
geographical of isolated allopatric
isolation speciation
natural selection populations
36 Restriction enzymes can be used to cut DNA at specific sites. Genes such as the gene
for insulin can be cut from the chromosome of one species and as a result of ligation
joined to the chromosome of another species forming recombinant (hybrid) DNA.
The figure shows two chromosomes from different species. The specific restriction
enzyme sites (R1, R2, and R3) are shown.
Both chromosomes were cut at restriction site R1 with EcoRI which recognises the
sequence GAATTC and produces restriction fragments with sticky ends. The fragments
were mixed and allowed to join to form recombinant (hybrid) DNA.
What is the maximum number of ways in which the fragments can join?
A 2 B 4 C 6 D 8
37 In which way(s) is/are the polymerase chain reaction (PCR) similar to the replication of
DNA?
A 243165
B 423165
C 421365
D 243156
39 A key feature of most multicellular organisms is the ability to differentiate and produce
specialised cells.
40 Which row correctly states the effects and possible consequences of producing the
various genetically-modified organisms?
might
improve toxic to closely improve improve
D cause allergies become
yield related species yield quality
weeds
CANDIDATE
NAME
CLASS
BIOLOGY 9648/01
Paper 1 Multiple Choice 20 September 2013
1 hour 15 minutes
Additional Materials: Multiple Choice Answer Sheet
There are forty questions on this paper. Answer all questions. For each question there are four
possible answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer
Sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
Calculators may be used.
9648 / 01
611
2
1 Which row correctly identifies all the locations of ribosomes in a eukaryotic cell?
attached to attached to
free in in
endoplasmic nuclear in nucleus
cytoplasm mitochondria
reticulum envelope
A
B
C
D
3 Liver tissue produces an enzyme called catalase which breaks down hydrogen peroxide
into water and oxygen.
2H2O2 2H2O + O2
The rate of this reaction can be determined by measuring the volume of oxygen
produced in a given length of time.
Students added small cubes of fresh liver tissue to a range of hydrogen peroxide
solutions and measured the volumes of oxygen produced. Their data were used to
produce the graph showing how changing the concentration of hydrogen peroxide
affected the rate of oxygen production.
8 Ribonuclease is an enzyme that digests RNA. The first five amino acids of the functional
molecule of ribonuclease are:
The mRNA of the gene coding for ribonuclease, for the first 15 nucleotides, has the
following sequence.
AUGAAGGAAACUGCU
9 Base substitution mutations can have the following molecular consequence except
A changes one codon for an amino acid into another codon for that same amino acid.
B codon for one amino acid is changed into a codon of another amino acid.
C reading frame changes downstream of the mutant site.
D codon for one amino acid is changed into a translation termination codon.
10 What happens when a bacterial cell that is infected by lambda phage divides?
11 The following describes events in the life cycle of an influenza virus. Which statement is
correct?
A Acidification results in the viral envelope fusing with the exocytic vesicle membrane,
releasing the capsid in the process.
B Viral genome acts as a template for the making of new copies of viral RNA genome.
C Complementary RNA strand is translated into viral proteins.
D Glycoproteins synthesised by ribosomes are transported to the plasma membrane
via endocytic vesicles whereby the glycoproteins are incorporated into the host cells
plasma membrane.
She has a F plasmid containing a functional copy of lacZ gene. She then adds a high
concentration of the plasmid to a tube of the bacteria in a medium for bacterial growth
that contains glucose or lactose as the only energy source. This tube (+) and a control
tube (-) with similar bacteria but no plasmid are both incubated under the appropriate
conditions for growth and plasmid uptake. The scientist then spreads a sample of each
bacterial culture (+ and -) on each of the three types of plates indicated below.
Which row correctly identifies the plates with growth () or no growth ()?
Bacterial strain with added plasmid (+) Bacterial strain with no plasmid (-)
Plate A Plate B Plate C Plate A Plate B Plate C
A
B
C
D
13 The diagram represents a length of DNA which forms a structure called an operon. Parts
of the operon are labelled E, F, G and H. They have different functions.
E F G H
A operator structural gene(s) regulator promoter
B promoter regulator structural gene(s) operator
C regulator promoter operator structural gene(s)
D structural gene(s) operator promoter regulator
A All eukaryotic genes are transcribed continuously because they are not packaged by
histones.
B A DNA must be selectively released from its histone packaging before transcription
can occur in bacteria.
C Histones package prokaryote chromatin into the nucleosomes that form the bulk of the
chromosome.
D The organisation of DNA by histones in eukaryotes allows some gene control
sequences to be thousands of base pairs away from the gene concerned.
17 A student has 2 cultures of cells. Culture A consists of normal cells, while culture B
consists of cells which were isolated from a tumour and divide uncontrollably. He wants
to determine if the uncontrolled growth of cells in culture B was the result of activation of
an oncogene or the mutation of a tumour suppressor gene. He decides to fuse the cells
from the two cultures to form a hybrid line containing DNA from both cells.
The list of possible results and the conclusions drawn from the experiment are
summarised by the student in the table below:
Only two of the conclusions are correctly matched with the possible results. The two
correct possibilities are
18 A parent organism of unknown genotype is mated in a test cross. Half of the offspring
have the same phenotype as the parent.
19 The table shows the results of a series of crosses in a species of small mammal.
What explains the inheritance of the range of phenotypes shown by these crosses?
20 Two
o genes A and
a B are lin
nked togeth
her as show
wn below.
If th
he genes area far enou ugh apart ssuch that crossing ove
er between the alleles
s occurs
occa asionally, which
w ment is true of the gam
statem metes?
The
e table shows some distances
d b
between the
e gene loci, as determ
mined by breeding
b
experiments.
Jurong J
JC/JC2 H2 Biology/Prelims/2013
619
10
22 The following pedigree depicts the inheritance of a rare hereditary disease affecting
muscles.
A autosomal dominant
B autosomal recessive
C X-linked dominant
D X-linked recessive
23 The phenotypes of 200 offspring of a dihybrid test cross were recorded. The cross
involved petal colour and fertility of the anthers of sweet pea flowers. The table shows
the observed and expected numbers of each phenotype.
A chi-squared (2) test was performed and the probability of the difference between the
observed and expected results being due to chance was found to be <0.001.
1 2 3 4 5 6
Which row correctly identifies the structure or function of the labelled regions?
A 1 and 2 1 and 2 4 6 5
B 1 and 2 1 4 6 5
C 1, 2 and 3 1 3 and 4 5 6
A chemical bond energy released during the light independent stage of photosynthesis
B chemical bond energy released during glycolysis and the Krebs cycle
C potential energy of protons diffusing through the inner mitochondrial membranes in
mitochondria
D potential energy of protons diffusing through thylakoid membranes in chloroplasts
28 Lipid membranes can be formed in the laboratory by painting phospholipids over a PTFE
sheet with a hole in it.
In one experiment with Na+ ions, no current flowed across the membrane until a
substance called gramicidin was added, at which time current flowed.
Which statement is consistent with this information and your knowledge of membrane
structure?
29 The graph shows how the rate of entry of glucose into a cell changes as the
concentration of glucose outside the cell changes.
31 During which stage of a nerve impulse does the opening of the voltage-gated sodium
channels play an important role?
A resting potential
B depolarisation
C repolarisation
D hyperpolarisation
32 The heart, like most internal organs, is supplied with nerves from both the sympathetic
and parasympathetic nervous systems. The neurones in these nerves form synapses
with muscle tissue in the sino-atrial node (SAN) of the heart.
The diagram shows how the rate of heartbeat of a mammal changed when the
sympathetic and parasympathetic nerves were stimulated at different frequencies. The
frequency of stimulation was measured in hertz (Hz), i.e. the number of stimulations per
second.
34 Before the settlement of California in the 1800s, the elk population was very large. By
about 1900 there were only a few dozen elk left.
Owing to protection, there are now about 3000 elk living in a small number of isolated
herds.
Unfortunately, some of the elk in all the herds have difficulty grazing due to a shortened
lower jaw.
A 2 and 5 only
B 3 and 4 only
C 1, 2 and 4 only
D 2, 3 and 5 only
35 Darwins view of the process of evolution to form new species (speciation) has been
reinforced by more recent discoveries in genetics and cell biology.
In this view, which sequence of events is considered most likely to lead to speciation?
competition and
adaptation of behavioural sympatric
A predation leading to
population isolation speciation
natural selection
competition and
B
adaptation of predation leading to behavioural allopatric
population isolation speciation
natural selection
competition and adaptation
geographical sympatric
C predation leading to of isolated
isolation speciation
natural selection populations
competition and adaptation
D predation leading to
geographical of isolated allopatric
isolation speciation
natural selection populations
36 Restriction enzymes can be used to cut DNA at specific sites. Genes such as the gene
for insulin can be cut from the chromosome of one species and as a result of ligation
joined to the chromosome of another species forming recombinant (hybrid) DNA.
The figure shows two chromosomes from different species. The specific restriction
enzyme sites (R1, R2, and R3) are shown.
Both chromosomes were cut at restriction site R1 with EcoRI which recognises the
sequence GAATTC and produces restriction fragments with sticky ends. The fragments
were mixed and allowed to join to form recombinant (hybrid) DNA.
What is the maximum number of ways in which the fragments can join?
A 2 B 4 C 6 D 8
37 In which way(s) is/are the polymerase chain reaction (PCR) similar to the replication of
DNA?
A 243165
B 423165
C 421365
D 243156
39 A key feature of most multicellular organisms is the ability to differentiate and produce
specialised cells.
40 Which row correctly states the effects and possible consequences of producing the
various genetically-modified organisms?
might
improve toxic to closely improve improve
D cause allergies become
yield related species yield quality
weeds
CANDIDATE
NAME
CLASS
BIOLOGY 9648/02
Paper 2 Core Paper 2 September 2013
Write your name and class on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use soft pencil for any diagrams, graphs or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
Section A
Answer all questions.
For Examiners Use
Section B
Answer any one question. Section A
Circle the question number of the question attempted.
1
3
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or part 4
question.
5
Section B
8 / 9
Total
9648 / 02
630
Section A
1 In translation, mRNA that is produced in transcription is used as the template for the
synthesis of a polypeptide chain which will be further coiled and folded to form a
functional protein. Fig. 1.1 shows a stage during translation.
Fig. 1.1
___________________________________________________________________
(b) State the number of amino acids found on the peptide chain. [1]
___________________________________________________________________
(c) During translation, Enzyme X was used to catalyse the reaction shown in Fig. 1.2.
Fig. 1.2
________________________________________________________________
(ii) Using the information provided in Fig. 1.1 and Fig. 1.2, describe the process
catalysed by Enzyme X. [3]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
(iii) Enzyme X is able to act on all the aminoacyl-tRNA found in the body. Describe
the model by which the aminoacyl-tRNA binds to the enzyme. [2]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
The rate of reaction of Enzyme X is affected by pH within the cytosol where translation is
taking place. Fig. 1.3 was the result of an experiment to investigate how pH affected the
rate of translation in normal cells.
Fig. 1.3
(d) With reference to Fig. 1.3, describe how pH affects the rate of enzyme reaction. [2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(e) A toxin introduced into normal cells changes the pH of the cells, leading to a reduced
rate of translation and hence bringing about cell death.
Suggest what the pH of the cells was after the introduction of the toxin and explain
why protein synthesis was affected. [2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
[Total: 12]
Fig. 2.1
______
__________
__________
__________
_________
____________________
______
______
__________
__________
__________
_________
____________________
______
______
__________
__________
__________
_________
____________________
______
______
__________
__________
__________
_________
____________________
______
______
__________
__________
__________
_________
____________________
______
______
__________
__________
__________
_________
____________________
______
______
__________
__________
__________
_________
____________________
______
(iii) Describ
be the roles of enzymess used in th
he process. [3]
______
__________
__________
__________
_________
____________________
______
______
__________
__________
__________
_________
____________________
______
______
__________
__________
__________
_________
____________________
______
______
__________
__________
__________
_________
____________________
______
______
__________
__________
__________
_________
____________________
______
______
__________
__________
__________
_________
____________________
______
Jurong J
JC/JC2 H2 Biology/Prelim/2013 - 5 -
634
(b) Describe the events that occur during the stage shown in Fig. 2.1. [3]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
An enzyme called telomerase is produced by some cells in the human body. Telomerase
adds nucleotides to the ends of chromosomes.
Table 2.1 shows the telomerase activity and telomere length of some types of cell after
cell division.
Table 2.1
________________________________________________________________
________________________________________________________________
(ii) Explain the relationship between high levels of telomerase expression and
cancer. [2]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
[Total: 12]
p53
3 gene loca ated on ch
hromosome e 17 codess for p53 and is knnown as a tumour
suppressor geene. Mutatio
ons of one of the two e cause a hhereditary disorder
o p53 gene
known as Li-Frraumeni syn
ndrome.
1
Fig. 3.1
(a) What is a tu
umour supp
pressor gen
ne? [1]
_________
__________
__________
__________
_________
____________________
______
_________
__________
__________
__________
_________
____________________
______
Jurong J
JC/JC2 H2 Biology/Prelim/2013 - 8 -
637
In the inactive form, p53 forms a p53-protein complex. In the active form, p53 is no
longer attached to the protein.
(b) Suggest why only the active form of p53 can enter the nucleus. [1]
___________________________________________________________________
___________________________________________________________________
(c) Using the information in Fig. 3.1, explain how mutation of p53 gene could lead to
cells continuing to divide even after a change in the structure of DNA is detected. [3]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
Fig. 3.2
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(ii) compare the effectiveness of the two drugs when used to treat patients suffering
from metastatic colorectal cancer. [2]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
[Total: 10]
Fig. 4.1
A __________________________________________________________________
B __________________________________________________________________
(b) Describe how the viral genome is released into host cell after a conformational
change has occurred in gp41. [2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(c) Fig. 4.2 shows a generalized graph of the relationship between HIV RNA copies and
T lymphocytes counts over the average course of untreated HIV infection.
Fig. 4.2
(i) With reference to Fig. 4.2, describe and explain what happens during the period
of clinical latency. [3]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
(ii) Explain how HIV infection causes death in the 11th year from primary infection. [2]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
(d) The management of AIDS normally includes the use of multiple anti-retroviral drugs
that act on different stages of the HIV life cycle in an attempt to control HIV infection.
One such drug is alpha interferon which inhibits an enzyme necessary in the
maturation and release stage of the HIV life cycle.
Identify the enzyme and explain how HIV infection is controlled. [2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
[Total: 10]
BLANK PAGE
cross 1 - pure breeding tomato plants with uniformly pigmented red-coloured fruit
were crossed with pure breeding tomato plants with dark patches at the base of the
orange-coloured fruit
cross 2 - the offspring of cross 1 (offspring 1) were crossed with each other
cross 3 - offspring 1 were crossed with pure breeding tomato plants with dark
patches at the base of the orange-coloured fruit
Table 5.1
(a) Using the symbols R for red fruit and r for orange fruit, D for uniform pigment and d
for dark patches, draw a genetic diagram to explain the results shown in Cross 3. [4]
(b) Explain the deviation of the observed results from the expected dihybrid ratio. [3]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
Observations showed that in tomato plants, there are 3 different types of pigmentation at
the base of the fruit. Pigmentation in these fruits is controlled by 2 proteins involved in
the same metabolic pathway for production of pigments, Inhibitor E and Enzyme B.
Uniform pigmentation is produced in the presence of two copies of e alleles and one
copy of B alleles. Dark patches are produced in the presence of two copies of e alleles.
No pigmentation is produced in the presence of at least one copy of E allele.
(c) Suggest a possible mode of inheritance for pigmentation at the base of the fruit. [1]
___________________________________________________________________
(d) Explain how the interaction between the two genes E and B gives rise to
pigmentation. [3]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(e) Explain the biochemical basis for this form of epistasis. [2]
[Total: 13]
Fig. 6.1
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(b) From your biological knowledge, explain the adaptation of the mitochondrions double
membrane for its role in the production of energy. [2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
Fig. 6.2 shows a stage in respiration that takes place during the oxidation of glucose.
Fig. 6.2
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(d) List two ways in which photophosphorylation differs from oxidative phosphorylation.
[2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
[Total: 12]
7 The takah, Porphyrio hochstetteri, is a flightless bird that is restricted to a small area of
the South Island of New Zealand. It is one of only two remaining species of large,
flightless, herbivorous birds from New Zealand. The other remaining species is found on
the North Island of New Zealand. Their flighted ancestor came over from Australia
millions of years ago.
The takah was thought to be extinct, but a small population with low genetic variation
was discovered in 1948 among the remote mountains of the South Island. The takah is
a grassland specialist and lives in alpine grassland dominated by tussock grasses as
shown in Fig. 7.1.
Fig. 7.1
(a) Explain why it has been possible for flightless birds, such as the takah, to evolve in
New Zealand. [3]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(b) Differences in the DNA sequences that encode cytochrome b in the two species of
flightless birds from New Zealand have been measured.
(i) When differences in cytochrome b gene are plotted against time since
colonisation, the plot of the line is straight. Describe how this supports the neutral
theory of molecular evolution. [2]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
(ii) Suggest why the cytochrome b gene is used to measure changes in DNA
sequences between the two species of flightless birds. [2]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
(c) The takah is similar in appearance to another flightless bird found on the
Desventuradas Islands off the coast of Chile even though molecular studies have
shown that they do not share a common ancestor. Explain how biogeography
support the evolutionary deductions based on molecular homology. [2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
Fig. 7.2 shows the relationship between some animals which was determined by
comparing the arrangement of the bones in their forelimbs, which had a basic
pentadactyl structure.
Fig. 7.2
(d) Explain how the anatomical homology in Fig. 7.2 provides evidence to support the
theory of evolution. [2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
[Total: 11]
Section B
Your answers should be illustrated by large, clearly labelled diagrams, where appropriate.
Your answers must be set out in sections (a), (b) etc., as indicated in the question.
8 (a) Describe the main structural features and function(s) of collagen and glycogen. [8]
(b) Explain how a change in the nucleotide sequence of DNA leads to cystic fibrosis. [8]
(c) Explain how the recessive allele that results in cystic fibrosis may be preserved in a
natural population. [4]
[Total: 20]
9 (a) Describe the main structural features of the lac operon and explain how the presence
of lactose in the growth medium affects the lac operon. [6]
(b) Describe the role of insulin and glucagon in regulating blood glucose concentration.
[8]
(c) Explain how a nerve impulse is passed across a cholinergic synapse. [6]
[Total: 20]
CANDIDATE
NAME
CLASS
BIOLOGY 9648/02
Paper 2 Core Paper 2 September 2013
Write your name and class on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use soft pencil for any diagrams, graphs or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
Section A
Answer all questions.
For Examiners Use
Section B
Answer any one question. Section A
Circle the question number of the question attempted
1
3
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or part 4
question.
5
Section B
8 / 9
Total
9648 / 02
654
Section A
1 In translation, mRNA that is produced in transcription is used as the template for the
synthesis of a polypeptide chain which will be further coiled and folded to form a
functional protein. Fig. 1.1 shows a stage during translation.
Fig. 1.1
Elongation;;
(b) State the number of amino acids found on the peptide chain. [1]
5;;
(c) During translation, Enzyme X was used to catalyse the reaction shown in Fig. 1.2.
Fig. 1.2
1. Peptidyl transferase;;
Jurong JC/Prelim/2013 - 2 -
655
(ii) Using the information provided in Fig. 1.1 and Fig. 1.2, describe the process
catalysed by Enzyme X. [3]
(iii) Enzyme X is able to act on all the aminoacyl-tRNA found in the body. Describe
the model by which the aminoacyl-tRNA binds to the enzyme. [2]
Jurong JC/Prelim/2013 - 3 -
656
The rate of reaction of Enzyme X is affected by pH within the cytosol where translation is
taking place. Fig. 1.3 was the result of an experiment to investigate how pH affected the
rate of translation in normal cells.
Fig. 1.3
(d) With reference to Fig. 1.3, describe how pH affects the rate of enzyme reaction. [2]
(e) A toxin introduced into normal cells changes the pH of the cells, leading to a reduced
rate of translation and hence bringing about cell death.
Suggest what the pH of the cells were after the introduction of the toxin and explain
why protein synthesis was affected. [2]
[Total: 12]
Jurong JC/Prelim/2013 - 4 -
657
Fig. 2.1
(iii) Describ
be the roles of enzymess used in th
he process. [3]
1. Helicase;
2. unwinding g of DNA double he elix (at orrigins of replication)
r ) by breaking of
hydrogen bonds bettween com mplementarry base pa airs, (allow
wing separaation of
the two strrands);
OR
3. Primase;
4. synthesize es RNA primmer to initiiate replica
ation proce
ess;
OR
5. DNA polym merase;
6. catalyses the form mation off phosphodiester bonds beetween adjacent a
nucleotide owing stra nd, synthe
es (of gro esising daaughter sttrand in 55 to 3
direction);
OR
7. another DN NA polymeerase;
8. removed RNAR primerrs and repllaced with DNA nucle eotides;
OR
9. DNA ligase e;
10. anneal sug gar phosphate backb bone / seals nicks be etween (Okkazaki) fra
agments
via formation of phos
sphodieste er bonds to o form conttinuous strrands;
Jurong J
JC/Prelim/201
13 - 5 -
658
(b) Describe the events that occur during the stage shown in Fig. 2.1. [3]
An enzyme called telomerase is produced by some cells in the human body. Telomerase
adds nucleotides to the ends of chromosomes.
Table 2.1 shows the telomerase activity and telomere length of some types of cell after
cell division.
Table 2.1
(ii) Explain the relationship between high levels of telomerase expression and
cancer. [2]
Jurong JC/Prelim/2013 - 6 -
659
p53
3 gene loca ated on ch
hromosome e 17 codess for p53 and is knnown as a tumour
suppressor geene. Mutatio
ons of one of the two e cause a hhereditary disorder
o p53 gene
known as Li-Frraumeni syn
ndrome.
1
Fig. 3.1
(a) What is a tu
umour supp
pressor gen
ne? [1]
1. encodes protein
p thatt prevent u ncontrolled cell divis
sion;;
In the inactive
e form, p53 3 forms a p
p53-protein complex. In the activve form, p5
53 is no
long
ger attachedd to the protein.
Jurong J
JC/Prelim/201
13 - 7 -
660
(c) Using the information in Fig. 3.1, explain how mutation of p53 gene could lead to
cells continuing to divide even after a change in the structure of DNA is detected. [3]
Fig. 3.2
Jurong JC/Prelim/2013 - 8 -
661
(ii) compare the effectiveness of the two drugs when used to treat patients suffering
from metastatic colorectal cancer. [2]
2. At 25th day, volume of tumour treated with T138067 is 120mm3 while volume of
tumour treated with vinblastine is 370mm3;
3. Tumour treated with T138067 is 3.1X smaller;
4. Tumour treated with T138067 grew at a slower rate of 4.8mm3 while that treated
with vinblastine grew at a faster rate of 14.8mm3;
OR
5. Compared to tumour that is untreated, T138067 slowed down growth by
510(10)mm3/41.3% while vinblastine slowed down growth by
260(10)mm3/81.0%;
6. T138067 is more effective than vinblastine by 1.96X;
Jurong JC/Prelim/2013 - 9 -
662
Fig. 4.1
1. A glycoprotein / gp120;
2. B reverse transcriptase;
(b) Describe how the viral genome is released into host cell after a conformational
change has occurred in gp41. [2]
Jurong JC/Prelim/2013 - 10 -
663
(c) Fig. 4.2 shows a generalized graph of the relationship between HIV RNA copies and
T lymphocytes counts over the average course of untreated HIV infection.
Fig. 4.2
(i) With reference to Fig. 4.2, describe and explain what happens during the period
of clinical latency. [3]
1. From the 12th week to 6th year (since primary infection), the HIV RNA copies
remain constant at 3/ less than 10/~ 0 copies per ml plasma;
2. Replication occurs;
3. Reverse transcriptase catalyses the synthesis of a complementary DNA
strand (cDNA) from viral RNA;
4. synthesis of a second DNA strand which is complementary to cDNA;
5. double stranded DNA is integrated/incorporated into the T lymphocytes
DNA/genome (as a provirus) by integrase;
6. number of free infectious virus is low;
7. number of HIV RNA copies is low;
(ii) Explain how HIV infection causes death in the 11th year from primary infection. [2]
Jurong JC/Prelim/2013 - 11 -
664
(d) The management of AIDS normally includes the use of multiple anti-retroviral drugs
that act on different stages of the HIV life cycle in an attempt to control HIV infection.
One such drug is alpha interferon which inhibits an enzyme necessary in the
maturation and release stage of the HIV life cycle.
Identify the enzyme and explain how HIV infection is controlled. [2]
1. HIV protease;
2. HIV polyprotein cannot be cleaved (into individual functional proteins);
3. like capsid proteins, reverse transcriptase and integrase (any 2);
4. virus remained immatured / non-infectious / non-functional;
5. unable to infect other cells/ unable to carry out further infection;
[Total: 10]
Jurong JC/Prelim/2013 - 12 -
665
cross 1 - pure breeding tomato plants with uniformly pigmented red-coloured fruit
were crossed with pure breeding tomato plants with dark patches at the base of the
orange-coloured fruit
cross 2 - the offspring of cross 1 (offspring 1) were crossed with each other
cross 3 - offspring 1 were crossed with pure breeding tomato plants with dark
patches at the base of the orange-coloured fruit
Table 5.1
(a) Using the symbols R for red fruit and r for orange fruit, D for uniform pigment and d
for dark patches, draw a genetic diagram to explain the results in Cross 3. [4]
parental
red uniformly pigmented fruit X orange fruit with dark patches
phenotypes:
parental genotypes: RD rd ;;
X
rd rd
Gametes RD Rd rd ;;
rD rd
Punnett Square
RD Rd rD rd
rd RD Rd rD rd
rd rd rd rd
offspring RD Rd rD rd
: : : ;;
genotype : rd rd rd rd
offspring red uniformly red fruit with orange uniformly orange fruit with ;
: : :
phenotype : pigmented fruit dark patches pigmented fruit dark patches
offspring
83 : 23 : 19 : 85 ;
phenotypic ratio :
Jurong JC/Prelim/2013 - 13 -
666
(b) Explain the deviation of the observed results from the expected dihybrid ratio. [3]
1. Expected dihybrid ratio is 1:1:1:1 while observed test cross results is approx.
4:1:1:4 which deviates from the expected ratio;
2. The 2 genes for colour of fruit and pigmentation are linked;
3. which means they form a linkage group and are usually pass into the same
gamete and are inherited together /do not undergo independent assortment
and segregation during meiosis;
4. crossing over between the 2 linked genes on non-sister chromatids of
homologous chromosomes during prophase 1 of meiosis 1 occur ;
5. to form recombinant gametes Rd and rD;
6. since crossing over is a chance event, there are lower chances of getting
recombinant gametes;
7. thus the observed offspring of test cross are majority of parental combinations
and minority of recombinants combinations;
Observations showed that in tomato plants, there are 3 different types of pigmentation at
the base of the fruit. Pigmentation in these fruits is controlled by 2 proteins involved in
the same metabolic pathway for production of pigments, Inhibitor E and Enzyme B.
Uniform pigmentation is produced in the presence of two copies of e alleles and one
copy of B alleles. Dark patches are produced in the presence of two copies of e alleles.
No pigmentation is produced in the presence of at least one copy of E allele.
(c) Suggest a possible mode of inheritance for pigmentation at the base of the fruit. [1]
Dominant epistasis;;
(d) Explain how the interaction between the two genes E and B gives rise to
pigmentation. [3]
1. The pigmentation is controlled by a pair of genes (gene E/e and gene B/b)
occupying different loci;
2. the epistatic gene determines the production of pigments;
3. the dominant allele (E_) results in no pigmentation;
4. homozygous for the recessive allele (ee) results in uniform pigmentation or
dark patches, depending on the genotype of the gene B/b;
5. the hypostatic gene determines the type/intensity of pigmentation;
6. the dominant allele (B_) determines uniform pigmentation;
7. homozygous for the recessive allele (bb) determines dark patches;
8. In the interaction between these two genes, the presence of allele E hides the
effects of either B_ or bb, producing no pigmentation;
9. E_ is epistatic to (any genotype of the) B/b gene;
Jurong JC/Prelim/2013 - 14 -
667
(e) Explain the biochemical basis for this form of epistasis. [2]
gene e gene B
inhibitor e enzyme B
Jurong JC/Prelim/2013 - 15 -
668
Fig. 6.1
Jurong JC/Prelim/2013 - 16 -
669
(b) From your biological knowledge, explain the adaptation of the mitochondrions double
membrane for its role in the production of energy. [2]
Fig. 6.2 shows a stage in respiration that takes place during the oxidation of glucose.
Fig. 6.2
Jurong JC/Prelim/2013 - 17 -
670
(d) List two ways in which photophosphorylation differs from oxidative phosphorylation.
[3]
Source of 4a Energy for synthesis of ATP comes 4b Energy for synthesis of ATP comes
energy for ATP from light from the oxidation of glucose
synthesis
Electron donors 5a Water is the electron donor in non- 5c NADH and FADH2 are electron
cyclic reaction donors
Electron 6a NADP+ is the final electron acceptor 6c Oxygen is the final electron
acceptors in the non-cyclic reaction acceptor
[Total: 12]
Jurong JC/Prelim/2013 - 18 -
671
7 The takah, Porphyrio hochstetteri, is a flightless bird that is restricted to a small area of
the South Island of New Zealand. It is one of only two remaining species of large,
flightless, herbivorous birds from New Zealand. The other remaining species is found on
the North Island of New Zealand. Their flighted ancestor came over from Australia
millions of years ago.
The takah was thought to be extinct, but a small population with low genetic variation
was discovered in 1948 among the remote mountains of the South Island. The takah is
a grassland specialist and lives in alpine grassland dominated by tussock grasses as
shown in Fig. 7.1.
Fig. 7.1
(a) Explain why it has been possible for flightless birds, such as the takah, to evolve in
New Zealand. [3]
Jurong JC/Prelim/2013 - 19 -
672
(b) Differences in the DNA sequences that encode cytochrome b in the two species of
flightless birds from New Zealand have been measured.
(i) When differences in cytochrome b gene is plotted against time since colonisation,
the plot of the line is straight. Describe how this supports the neutral theory of
molecular evolution. [2]
1. Plot of line being straight indicates that the rate of mutation is constant /
steady;
2. Mutations are silent and there are small number of changes;
3. There is no effect on the phenotype i.e. cytochrome b of the organisms;
4. No selective advantage or disadvantage is involved;
(ii) Suggest why the cytochrome b gene is used to measure changes in DNA
sequences between the two species of flightless birds. [2]
(c) The takah is similar in appearance to another flightless bird found on the
Desventuradas Islands off the coast of Chile even though molecular studies have
shown that they do not share a common ancestor. Explain how biogeography
support the evolutionary deductions based on molecular homology. [2]
Jurong JC/Prelim/2013 - 20 -
673
Fig. 7.2 shows the relationship between some animals which was determined by
comparing the arrangement of the bones in their forelimbs, which had a basic
pentadactyl structure.
Fig. 7.2
(d) Explain how the anatomical homology in Fig. 7.2 provides evidence to support the
theory of evolution. [2]
Jurong JC/Prelim/2013 - 21 -
674
Section B
8 (a) Describe the main structural features and function(s) of collagen and glycogen. [8]
(b) Explain how a change in the nucleotide sequence of DNA leads to cystic fibrosis. [8]
(c) Explain how the recessive allele that results in cystic fibrosis may be preserved in a
natural population. [4]
[Total: 20]
9 (a) Describe the main structural features of the lac operon and explain how the presence
of lactose in the growth medium affects the lac operon. [6]
(b) Describe the role of insulin and glucagon in regulating blood glucose concentration.
[8]
(c) Explain how a nerve impulse is passed across a cholinergic synapse. [6]
[Total: 20]
Jurong JC/Prelim/2013 - 22 -
675
Section B
8 (a) Describe the main structural features and function(s) of collagen and glycogen. [8]
functions of glycogen
6. food and energy stores in animals / compact nature of glycogen allows packing of
many monomers per unit volume;
7. provides a useful energy reserve for liver and muscles;
8. Hydrolysis of glycogen in liver and muscle cells releases glucose when the
demand for glucose increases. E.g. During exercise;
9. can be hydrolysed by enzymes more efficiently / easily broken down into its
glucose monomers (to be used as respiratory substrates);
10. Large and insoluble nature of glycogen does not allow its diffusion out of the cell
and do not change the osmotic potential within the cell;
function of collagen
11. structural protein found in connective tissue / in the basement membrane (in skin,
tendons, cartilage, bones, teeth and the walls of blood vessels of humans and
almost all animals);
[Total: 8]
Jurong JC/Prelim/2013 - 23 -
676
(b) Explain how a change in the nucleotide sequence of DNA leads to cystic fibrosis. [8]
1. Cystic fibrosis (CF) is an inherited disease where the mucus glands are
affected.
2. caused by a mutation of the cystic fibrosis transmembrane conductance
regulator (CFTR) gene found on chromosome 7;
3. a mutation results in deletion of 3 nucleotides CTT;
4. malformed CFTR protein loses an amino acid, phenylalanine;
5. at position 508
6. CFTR protein is a transmembrane chloride channel that allows efflux of
chloride ions out of the epithelial cells;
7. mutation of the CFTR gene results in a change in the 3D conformation/
configuration of the chloride channel;
8. channel is no longer able to transport chloride ions;
9. prevent normal efflux of chloride ions out of epithelial cells;
10. chloride ions accumulate in the epithelial cells;
11. attracting water into the epithelial cells causing thick and sticky mucus;
12. cells that line the passageways of the lungs/pancreas/other organs produce
thick and sticky mucus.
13. mucus obstruct the airways
14. leading to severe problems with breathing/ resulting in bacterial infections in
the lungs/ permanent lung damage/ formation of scar tissue (fibrosis) and
cysts in the lungs;
15. mucus blocks the duct / interferes with the function of the pancreas;
16. preventing enzymes and hormones from reaching the intestines to aid
digestion and assimilation, leading to digestive problems;
17. reduces life expectancy;
(c) Explain how the recessive allele that results in cystic fibrosis may be preserved in a
natural population. [4]
1. Diploidy ;
2. individuals have 2 sets of chromosomes;
3. The diploid nature of (most) eukaryotes hides a considerable amount of
genetic variation from selection;
4. Recessive allele that results in cystic fibrosis is less favourable / harmful in the
present environment than its dominant counterparts/the dominant allele hence
the recessive allele can persist/exist in the heterozygotes individuals in a
population;;
5. Only alleles present in the homozygous recessive organism will be expressed
in the phenotype;
6. and be exposed to (environmental) selection / elimination;
7. Very few of the recessive alleles can be eliminated from the population in each
generation;
8. Known as heterozygote protection;
[Total: 20]
Jurong JC/Prelim/2013 - 24 -
677
9 (a) Describe the main structural features of the lac operon and explain how the presence
of lactose in the growth medium affects the lac operon. [6]
12. allolactose is formed when lactose enters the cell and is cleaved by -
galactosidase;
13. allolactose recognises and binds to the allosteric site of the lac repressor;
14. lac repressor changes its conformation from active to inactive;
15. lac repressor unable to bind to the operator;
16. RNA polymerase recognises and binds to promoter;
17. transcribe the genes of the lac operon/ transcription occurs;
Jurong JC/Prelim/2013 - 25 -
678
(b) Describe the role of insulin and glucagon in regulating blood glucose concentration.
[8]
1. Blood glucose concentration increases above normal level of 90 mg per 100 cm3
of blood;
2. Islets of Langerhans of the pancreas detect the deviation;
3. cells of islets of Langerhans secrete insulin;
4. Insulin recognises and binds to receptor sites of receptors on the surface
membrane of target cells;
5. to stimulate glycogenesis, an increase in the rate of conversion of glucose to
glycogen;
6. for storage in liver cells and muscle cells;
7. to stimulate an increase in the rate of respiration using glucose;
8. as respiratory substrate which will be broken down and oxidised to form carbon
dioxide and water;
9. to stimulate an increase in the permeability of plasma membrane to glucose;
10. to increase the rate of uptake of glucose from the blood by almost all body cells
especially muscle cells;
11. to stimulate an increase in the rate of conversion of excess glucose to fats;
12. for storage in adipose tissues;
13. Blood glucose concentration decreases and return back to normal level;
[Max 6m]
14. Blood glucose concentration decreases below normal level of 90 mg per 100 cm3
of blood;
15. Islets of Langerhans of the pancreas detect the deviation;
16. cells of islets of Langerhans secrete glucagon;
17. Glucagon recognises and binds to receptor sites of receptors on the surface
membrane of liver/target cells;
18. To stimulate glycogenolysis, an increase in the rate of breakdown of glycogen to
glucose;
19. to stimulate gluconeogenesis, an increase in the rate of conversion of amino
acids and glycerol to glucose;
20. Blood glucose concentration increases and return back to normal level;
Jurong JC/Prelim/2013 - 26 -
679
(c) Explain how a nerve impulse is passed across a cholinergic synapse. [6]
1. Before the presynaptic membrane is depolarised, there are few Ca2+ ions inside
the synaptic knob;
2. The arrival of an impulse/action potential at the synaptic knob causes voltage-
gated Na+ channels and voltage-gated Ca2+ channels to open;
3. resulting in influx of Na+ ions and Ca2+ ions into the synaptic knob from the
synaptic cleft;
4. The influx of Ca2+ ions causes vesicles containing neurotransmitters/
acetylcholine to move to the presynaptic membrane and fuse with it;
5. emptying the neurotransmitters into the synaptic cleft by exocytosis;
6. The Ca2+ ions are pumped out of the synaptic knob by active transport using ATP;
7. Acetylcholine diffuse across the 20nm synaptic cleft;
8. usually in less than 0.5 ms;
9. Acetylcholine is complementary in shape to specific binding sites of receptors;
10. and recognises and binds to the binding sites of receptors on the postsynaptic
membrane;
11. This changes the shape of the receptor protein, opening chemically-gated Na+
channels on the postsynaptic membrane;
12. Influx of Na+ ions into the cytoplasm along concentration gradient depolarise the
postsynaptic membrane;
13. The membrane potential becomes more positive than resting potential;
14. The local potential that develops is known as an excitatory postsynaptic potential
(EPSP);
15. If the membrane potential of the postsynaptic membrane reaches threshold
potential (-50mV), an action potential is generated in the postsynaptic neurone
and travels down the axon to the next synapse;
16. The synaptic cleft contains an enzyme, acetylcholinesterase, which hydrolyses
each acetylcholine molecule into acetate and choline. The choline is taken back
into the presynaptic neurone to combine with acetyl coA to form acetylcholine;
[Total: 20]
Jurong JC/Prelim/2013 - 27 -
680
CANDIDATE
NAME
CLASS
BIOLOGY 9648/03
Applications Paper and Planning Question 16 September 2013
Paper 3 2 hours
Additional Materials: Answer Booklet/Paper
Write your name and class on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use soft pencil for any diagrams, graphs or rough working.
Do no use staples, paper clips, highlighters, glue or correction fluid.
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or part question.
Total
Fig. 1.1
(a) State two properties of the plasmid which allows it to be used as a cloning vector. [2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(b) The plasmid pMOD2-Neo and the human DNA containing the gene of interest are cut
with restriction enzymes and cloned using bacteria in genetic engineering.
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
(ii) Suggest why the restriction enzyme will cut the human DNA in many places but
will only cut the plasmid DNA once. [1]
________________________________________________________________
________________________________________________________________
________________________________________________________________
(iii) Suggest why the plasmid should only be cut once. [1]
________________________________________________________________
________________________________________________________________
(c) Disease X is an autosomal disease resulting from a single base substitution which
removes a recognition site of the restriction enzyme, HaeIII, as shown in Fig. 1.2.
The enzymes recognition sites on allele 1 and allele 2 are indicated by arrows.
Fig. 1.2
Fig. 1.3
(i) On allele 1, draw the probe at the position it will hybridise to. [1]
(ii) On allele 2, draw the position of the polymorphic restriction site by marking it with
an asterisk (*). [1]
________________________________________________________________
(iv) Explain how gel electrophoresis can be used to distinguish between the two
alleles. [4]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
(d) Information from the Human Genome Project (HGP) has allowed for better
understanding of the genetic basis of diseases such as Disease X.
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
[Total: 15]
The dominant allele coding for FIX was packaged in a modified adeno-associated virus,
AAV8, that has been designed to infect liver cells specifically. The modified AAV8 was
injected into six patients with severe haemophilia B who were producing FIX at less than
1% of normal levels.
Fig. 2.1
Prior to undergoing gene therapy, all six patients were receiving the standard treatment
for severe haemophilia Binjection of purified FIX produced by recombinant DNA
technologyseveral times a month. After receiving the FIX gene therapy, each patient
produced FIX at between 2% to 12% of normal levels. For at least six months, four of the
six patients no longer required purified FIX injections for routine bleeding. The other two
patients required purified FIX injections less frequently than before the therapy.
(a) Suggest and explain why two out of the six patients still require purified FIX injection.
[2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(b) Explain why it is sufficient to insert a single dominant allele coding for FIX into each
liver cell. [2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(c) Explain why individuals who have been treated by this method of gene therapy do
not pass on the dominant allele coding for FIX to their children. [1]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(e) Suggest and explain the advantages of using a viral delivery system for the dominant
allele coding for FIX. [2]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
[Total: 9]
3 Investigators often report success in culturing plant tissue using root tips. This technique
has many commercial applications which include the production of large numbers of
genetically identical plants and the culturing of plant cells in a fermenter with culture
medium for the production of secondary products.
(a) (i) Suggest one reason why plant tissue culture was successful using organs such
as root tips. [1]
________________________________________________________________
________________________________________________________________
(ii) Suggest why it is advantageous that plants produced by plant tissue culture are
genetically identical. [1]
________________________________________________________________
________________________________________________________________
In many stages of plant tissue culture, strict aseptic techniques need to be used. One of
the difficulties of culturing plant tissue is in carrying out surface sterilisation of the
explant.
To investigate a suitable method of culturing explants, plant tissue samples were taken
at three different times of the year and placed on a medium containing no fungicide or
antibiotic. Two different sampling methods were used:
Fig. 3.1
(b) compare the effect of the different methods of taking tissue samples and the time of
the year on fungal or bacterial contamination of the cultured explants. [3]
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
(c) Early attempts to culture plant tissue on a culture medium were not always
successful. Studies have shown that the culture medium must contain a range of
substances - mineral ions, a sugar suitable for plant cells to use as well as plant
growth regulators, to bring about successful plant cell growth and division.
To investigate the role of plant growth regulators, equal masses of plant callus were
cultured for four weeks on media containing different concentrations of two plant
growth regulators: auxin and cytokinin. The results are shown in Table 3.1.
Table 3.1
(i) Suggest why a sugar was included in the culture medium. [1]
________________________________________________________________
________________________________________________________________
(ii) describe the effects of auxin and cytokinin on callus growth. [3]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
(iii) Suggest and explain what treatment should be given to the shoots developed
from callus in treatment D to turn them into plantlets. [2]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
Plantlets often do not have fully functional cuticle and this causes them to be
inefficient in their use of water. Hence, plantlets might not be able to survive the ex-
vivo acclimatisation process if directly transferred from the culture medium to the
greenhouse.
(iv) Suggest what steps need to be taken to increase the viability of the plantlets. [2]
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
(d) In many regions of temperate rice production, severe weed infestations have
removed land from economic rice production. LLRICE62 is adapted for planting in the
temperate rice production regions.
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
________________________________________________________________
[Total: 16]
BLANK PAGE
4 Planning question
You are required to plan, but not carry out, an investigation into the effect of alcohol
concentration on the membrane permeability of beetroot tissue. Beetroot is a starchy
edible root from the Beta vulgaris plant whose cells contain a water-soluble red pigment,
betacyanin, in their vacuoles. This pigment cannot pass through membranes unless the
membrane is damaged.
Fig. 4.1 shows a spectrophotometer which can be used to measure colour intensity by
measuring absorbance of different wavelengths of light as they pass through the sample.
A cuvette filled with sample to be placed into the sample holder is also shown. Generally,
a sample of higher colour intensity will absorb more light energy at a specific wavelength.
Fig. 4.1
have a clear and helpful structure such that the method you use is able to be repeated
by anyone reading it,
be illustrated by relevant diagram(s), if necessary,
identify the independent and dependent variable,
describe the method with the scientific reasoning used to decide the method so that
the results are as accurate and reliable as possible,
include layout of results tables and graphs with clear headings and labels,
use the correct technical and scientific terms,
include reference to safety measures to minimise any risks associated with the
proposed experiment.
Your planning must be based on the assumption that you have been provided with the
following equipment and material, which you must use:
[Total: 12]
Free-response question
Write your answer to this question on the separate answer paper provided.
Your answer:
5 (a) Describe the polymerase chain reaction (PCR) and explain the advantages of this
procedure. [8]
(b) Describe, with examples, how a eukaryotic gene can be incorporated into E.coli. [6]
(c) Explain how RFLP analysis facilitates the process of DNA fingerprinting and genomic
mapping. [6]
[Total: 20]
CANDIDATE
NAME
CLASS
BIOLOGY 9648/03
Applications Paper and Planning Question 16 September 2013
Paper 3 2 hours
Additional Materials: Answer Booklet/Paper
Write your name and class on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use soft pencil for any diagrams, graphs or rough working.
Do no use staples, paper clips, highlighters, glue or correction fluid.
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or part question.
Total
9648 / 3
699
BLANK PAGE
Fig. 1.1
(a) State two properties of the plasmid which allows it to be used as a cloning vector. [2]
(b) The plasmid pMOD2-Neo and the human DNA containing the gene of interest are cut
with restriction enzymes and cloned using bacteria in genetic engineering.
(ii) Suggest why the restriction enzyme will cut the human DNA in many places but
will only cut the plasmid DNA once. [1]
(iii) Suggest why the plasmid should only be cut once. [1]
(c) Disease X is an autosomal disease resulting from a single base substitution which
removes a recognition site of the restriction enzyme, HaeIII as shown in Fig. 1.2. The
enzymes recognition sites on allele 1 and allele 2 are indicated by arrows.
Fig 1.2
Fig. 1.3
(i) On allele 1, draw the probe at the position it will hybridise to. [1]
(ii) On allele 2, draw the position of the polymorphic restriction site by marking it with
an asterisk (*). [1]
Autosomal recessive;;
(iv) Explain how gel electrophoresis can be used to distinguish between the two
alleles. [4]
1. The two alleles Allele 1 (A1) and Allele 2 (A2), differ in their base sequences
such that A1 has 3 HaeIII restriction sites while A2 has 2 HaeIII restriction
sites;;
2. Restriction digestion of the DNA with A1 by HaeIII will produce 3 restriction
fragments of 3.2kb, 2.8kb and 1.7kb;
3. Restriction digestion of the DNA with A2 by HaeIII will produce 2 restriction
fragments of 3.2kb and 4.5kb;
4. These fragments are separated out by gel electrophoresis, the 4.5kb
fragment from A2 is a longer fragment, faces more resistance from gel
matrix, will move slower and be found closest to the well (or vice versa);;
5. Different band patterns for A1 and A2 will result after gel electrophoresis;
6. and when the DNA fragments are stained with ethidium bromide, they can
be visualised under UV light;
(d) Information from the Human Genome Project (HGP) has allowed for better
understanding of the genetic basis of diseases such as Disease X.
[Total: 15]
The dominant allele coding for FIX was packaged in a modified adeno-associated virus,
AAV8, that has been designed to infect liver cells specifically. The modified AAV8 was
injected into six patients with severe haemophilia B who were producing FIX at less than
1% of normal levels.
Fig 2.1
Prior to undergoing gene therapy, all six patients were receiving the standard treatment
for severe haemophilia Binjection of purified FIX produced by recombinant DNA
technologyseveral times a month. After receiving the FIX gene therapy, each patient
produced FIX at between 2% to 12% of normal levels. For at least six months, four of the
six patients no longer required purified FIX injections for routine bleeding. The other two
patients required purified FIX injections less frequently than before the therapy.
(a) Suggest and explain why two out of the six patients still require purified FIX injection.
[2]
2. most liver cells had not taken up the dominant allele coding for FIX/functional
FIX allele during viral gene delivery / Only some of liver cells contains
dominant allele coding for FIX/functional FIX allele;
3. leading to low expression of the dominant allele coding for FIX/functional FIX
allele;;
4. Lower concentration of FIX produced;
OR
5. Gene delivered is not long lasting;
6. because the dominant allele coding for FIX/functional FIX allele delivered
remained in the cytoplasm is degraded after some time/earlier;;
7. AAV8 have low integration efficiency;
(b) Explain why it is sufficient to insert a single dominant allele coding for FIX into each
liver cell. [2]
(c) Explain why individuals who have been treated by this method of gene therapy do
not pass on the dominant allele coding for FIX to their children. [1]
1. allele may be inserted into tissue other than target with unknown
consequences;;
2. Gene therapy is commonly conducted on somatic cells. The natural death of
treated cells as well as the rapidly dividing nature of somatic cells makes the
gene therapy short-lived hence patients need to be treated on a frequent
basis;;
3. Viral vector introduced into the tissue may be recognized as foreign particle
and trigger immune system to mount an attack which reduces the
effectiveness of gene therapy;;
4. Viral vector may regain virulence and cause an immune response in the
patient;;
5. low integration efficiency;;
(Credit: any other valid data analysis / reverse answers)
(e) Suggest and explain the advantages of using a viral delivery system for the dominant
allele coding for FIX. [2]
1. Specific targeting, the virus is able to deliver genes to specific target tissues;;
2. Greater efficiency, the virus is able to transfer the gene into the cell more
effectively;;
3. The virus is able to introduce the normal DNA / allele into the nucleus;;
[Total: 9]
3 Investigators often report success in culturing plant tissue using root tips. This technique
has many commercial applications which include the production of large numbers of
genetically identical plants and the culturing of plant cells in a fermenter with culture
medium for the production of secondary products.
(a) (i) Suggest one reason why plant tissue culture was successful using organs such
as root tips. [1]
(ii) Suggest why it is advantageous that plants produced by plant tissue culture are
genetically identical. [1]
1. all possess the desirable features of the stock plants/transgenic plants with
improved / new desired traits;;
OR
2. ensures product uniformity, this reliability is an important sales
advantage;;
In many stages of plant tissue culture, strict aseptic techniques need to be used. One of
the difficulties of culturing plant tissue is in carrying out surface sterilisation of the
explant.
To investigate a suitable method of culturing explants, plant tissue samples were taken
at three different times of the year and placed on a medium containing no fungicide or
antibiotic. Two different sampling methods were used:
Fig. 3.1
(b) compare the effect of the different methods of taking tissue samples and the time of
the year on fungal or bacterial contamination of the cultured explants. [3]
different methods
1. stem tissue has less contamination than leaf discs;
2. average 66.0% vs average 7.33% lesser contaminations / 52% - 65% lesser
contaminations;
3. stem tissue has average 9X lesser contamination than leaf discs / 7.5X to 12.8X
lesser contamination than leaf discs;
(Credit: any other valid data analysis / reverse answers)
4. extraction with a sterile hypodermic syringe is a better method of taking
samples;
time of year
5. both treatments has highest % non-contamination in January;
6. 74% for stem tissue and 9% for leaf disc;
7. lowest % non-contamination for stem tissue is in April while the lowest % non-
contamination for leaf discs is in August;
8. 60% for stem tissue and 5% for leaf disc;
(Credit: any other valid data analysis / reverse answers)
9. culturing of explants should be done in January;
(c) Early attempts to culture plant tissue on a culture medium were not always
successful. Studies have shown that the culture medium must contain a range of
substances - mineral ions, a sugar suitable for plant cells to use as well as plant
growth regulators, to bring about successful plant cell growth and division.
To investigate the role of plant growth regulators, equal masses of plant callus were
cultured for four weeks on media containing different concentrations of two plant
growth regulators: auxin and cytokinin. The results are shown in Table 3.1.
Table 3.1
(i) Suggest why a sugar was included in the culture medium. [1]
(ii) describe the effects of auxin and cytokinin on callus growth. [3]
1. both cytokinin and auxin needed for cell division/growth / little or no growth
if only one present;;
2. highest conc. of auxin cf. cytokinin, ratio of 100:1/100X more auxin, only
triggers formation of roots growth;;
3. lowest conc. of auxin cf. cytokinin, ratio of 4:1/4X more auxin, only triggers
formation of shoots;;
4. intermediate auxin cf. cytokinin concentration, ratio of 10:1/10X more auxin,
triggers formation of more callus/stimulates cell division/growth/mitosis;;
(iii) Suggest and explain what treatment should be given to the shoots developed
from callus in treatment D to turn them into plantlets. [2]
Plantlets often do not have fully functional cuticle and this causes them to be
inefficient in their use of water. Hence, plantlets might not be able to survive the ex-
vivo acclimatisation process if directly transferred from the culture medium to the
greenhouse.
(iv) Suggest what steps need to be taken to increase the viability of the plantlets. [2]
(d) In many regions of temperate rice production, severe weed infestations have
removed land from economic rice production. LLRICE62 is adapted for planting in the
temperate rice production regions.
1. Due to less competition from weeds, there is increase in crop yield for the
farmers;;
2. Allows for removal of weeds that are difficult to control, to make lands
available for farming/ allow rice cultivation to return;;
[Total: 16]
4 Planning question
You are required to plan, but not carry out, an investigation into the effect of alcohol
concentration on the membrane permeability of beetroot tissue. Beetroot is a starchy
edible root from the Beta vulgaris plant whose cells contain a water-soluble red pigment,
betacyanin, in their vacuoles. This pigment cannot pass through membranes unless the
membrane is damaged.
Fig. 4.1 shows a spectrophotometer which can be used to measure colour intensity by
measuring absorbance of different wavelengths of light as they pass through the sample,
as well as the cuvette with sample to be placed into the sample holder. Generally, a
sample of higher colour intensity will absorb more light energy at a specific wavelength.
Fig. 4.1
have a clear and helpful structure such that the method you use is able to be repeated
by anyone reading it,
be illustrated by relevant diagram(s), if necessary,
identify the independent and dependent variable,
describe the method with the scientific reasoning used to decide the method so that
the results are as accurate and reliable as possible,
include layout of results tables and graphs with clear headings and labels,
use the correct technical and scientific terms,
include reference to safety measures to minimise any risks associated with the
proposed experiment.
Your planning must be based on the assumption that you have been provided with the
following equipment and material, which you must use:
[Total: 12]
5. Identification of other variables to be kept constant e.g. washing and rinsing cut
beetroot cylinders before start of experiment
8. Description of how beetroot tissues are to be used in experiment e.g. cutting into
cylinders of diameter 5 mm using corkborer, trimming to length of 1.0 cm
cylinders OR cut to specific dimensions
9. Description of control.
13. Graph with average absorbance/ A.U. (y-axis) against alcohol concentration/ % (x-
axis).
[12 marks]
(3) Variables
The independent variable in this experiment is alcohol concentration while the
dependent variable is absorbance.
2. (Pt 8: preparation of beetroot) Cut the beetroot tissue into cylinders of a diameter
of 5 mm (less than 11mm) using a cork borer and trim the length to 1.0 cm (less
than 100mm) on a white tile using a scalpel OR cut to specific dimensions.
3. (Pt 5: variables kept constant) Wash and rinse beetroot cylinders in distilled water
to remove any pigments which may leak out during cutting. There should be no
further leakage of colour from the beetroot tissue.
4. (Pt 4: Method) Calibrate the spectrophotometer with cuvette containing distilled
water.
5. Place 2 beetroot cylinders (appropriate dimension) into test tube A.
6. (Pt 5: variables kept constant) Immediately start timing for 5 minutes using a
stopwatch.
7. (Pt 4: Method) After 5 minutes, remove 1 cm3 of solution from test tube A and
transfer to a cuvette to measure absorbance value using a spectrophotometer.
(Pt 10)
8. Repeat step 5-7 to obtain another 2 readings.
9. Repeat step 5-8 for 2%, 4%, 6%, 8%, 10% alcohol solutions.
10. Repeat entire experiment twice.
11. Plot a graph of average absorbance / A.U. against alcohol concentration /%.
Absorbance / A.U.
Alcohol concentration/% Average
Reading 1 Reading 2 Reading 3
(Pt 11)
0.0
2.0
4.0
6.0
8.0
10.0
State: Handle liquid chemicals such as the 10% alcohol with care or wear protective
goggles
Explain: to prevent eyes from being in contact with alcohol.
State: Handle fragile objects like test tubes with care. Arrange test tubes neatly in the
test tube rack, ensuring that they are placed where they cannot be knocked over or
roll off the bench.
Explain: To prevent breakage
Free-response question
Write your answer to this question on the separate answer paper provided.
Your answer:
5 (a) Describe the polymerase chain reaction (PCR) and explain the advantages of this
procedure. [8]
Stage 1 [2]
1. Denaturation;
2. Hydrogen bonds holding the double-stranded DNA fragment break;
3. The double-stranded DNA separate and dissociates into single-stranded DNA;
4. By heating to 95oC; (A) 90-100oC
Stage 2 [2]
5. Annealing of DNA primers/oligonucleotides;
6. DNA primers base pair with complementary sequences;
7. At the 3 end of the single stranded DNA;
8. By cooling to about 65oC; (A) 30-65oC
Stage 3 [2]
9. Primer extension;
10. Using the DNA primer, the heat stable polymerase-Taq polymerase
synthesizes the rest of the fragment (new strand of DNA);
11. Nucleotides are added to the 3' ends on both primers;
12. By heating to 72oC; (A) 60-75oC
Advantages [2]
13. High sensitivity: PCR can amplify minute amount of DNA, this is especially
useful in forensic work where DNA may not be present in high quality;;
14. Speed and ease of use: PCR can amplify many copies/very large amounts of
DNA in a few hours;;
15. Robustness: PCR can permit amplification of specific sequences from
material in which the DNA is badly degraded or embedded in a medium from
which conventional DNA isolation is problematic;;
16. Automation of PCR: use of thermostable Taq polymerase, can withstand high
temperatures without being denatured allows for the automation of PCR;;
(b) Describe, with examples, how a eukaryotic gene can be incorporated into E.coli. [6]
1. Isolate plasmids;
2. Named example of plasmid-e.g. pBR322/pVector;
3. Named example of human gene-e.g. insulin gene
Either
4. Isolate insulin gene from human DNA;
Or
5. Isolate insulin gene using PCR/reverse transcription using mRNA to form cDNA
and add linker DNA;
6. Cut both the human DNA and plasmid with the same restriction enzyme;
7. to get complementary sticky ends;
8. Named example of RE e.g. EcoRI/BamHI/PstI/HindIII;
9. Mix the desired gene and plasmid vector in vitro, allowing the sticky ends to
reanneal (in a specific, complementary manner);
10. via complementary base pairing;
11. formation of hydrogen bonds between the complementary bases;
12. DNA ligase is added to the mixture;
13. to seal the nicks between the fragments/join sugar-phosphate backbone
together/join adjacent nucleotides together;
14. via the formation of phosphodiester bonds between adjacent nucleotides;
15. so that a recombinant plasmid is formed;
16. Add CaCl2 to the mixture and subject the mixture to heat
shock/electroporation;
17. so that transient pores formed on the bacteria cell membrane;
18. Allowing the recombinant plasmid to enter host E.coli cells via transformation;
(c) Explain how RFLP analysis facilitates the process of DNA fingerprinting and genomic
mapping. [6]
DNA fingerprinting:
1. DNA fingerprinting is a technology that identifies particular individuals using
properties of their DNA;
2. Certain loci within human chromosomes contain tandemly repeated
sequences (e.g. minisatellites);
3. The number of tandem repeats (at each minisatellite) varies substantially
among individuals;
4. and is highly polymorphic;
5. (minisatellites are also referred to as loci with a variable number of tandem
repeats (VNTRs));
6. Different number of tandem repeats leads to generation of (different)
restriction fragments;
7. that are of different molecular weight and length;
8. giving rise to unique DNA fingerprint;
9. Each individuals combination is unique, having inherited one allele for each
locus from each parent;
Genomic Mapping:
12. Genomic mapping is a reconstruction of the entire set of chromosomes for a
given organism;
13. showing the relative position of every gene / genetic markers on a
chromosome;
14. RFLPs greatly increased the number of genetic markers available for mapping
the human genome;
Reject: Gene markers / genome markers / marker genes;
15. An RFLP serves as a genetic marker for a particular locus in the genome,
(analogous to an allele of a particular gene);
16. RFLPs are used as genetic markers to construct linkage map;
17. The frequency with which two RFLP markers or an RFLP marker and a certain
allele for a gene is inherited together is a measure of the closeness of the 2
gene loci on a chromosome and the relative distance between 2 gene loci;;
18. Based on the recombination frequencies / frequency of crossing over between
2 RFLP markers / cross-over values of 2 RFLP markers, the linkage map is
constructed;
19. The order of the genetic markers / the relative distances between genetic
markers along a chromosome can be determined;
Candid
date Name
e:
2013 Prelimin
P nary Examinaation 2
Pre-U
University 3
Biolog
gy Highe
er 2 Sylllabus 96
648/01
255 September 2013
1 hrr 15 min
Addition
nal materiall: Multiple
e Choice An
nswer Shee
et
READ T
THESE INS
STRUCTION
NS FIRST
Write in
n soft pencil.
Do not use stapless, paper clip
ps, highlightters, glue orr correction fluid.
Write yyour name, Centre number and index numb ber on the Answer Shheet in the spaces
provideed unless this has beenn done for yyou.
Choose
e the one yo
ou considerr correct an
nd record yo
our choice in
i soft pen
ncil on the separate
s
Answerr Sheet.
he instructtions on the
Read th e Answer S
Sheet very carefully.
Each co
orrect answ
wer will score educted for a wrong answer.
e one markk. A mark wiill not be de
Any rou
ugh working
g should be done in thiss booklet.
Calcula
ators may be
e used.
This ques
stion pape r consists of 22 printed pages.
[Tu
urn over
720
2
-helix and
amino acid association of
-pleated sheet folding of each
A. sequence of one three
regions of each polypeptide
polypeptide polypeptides
polypeptide
-helix and
amino acid association of
-pleated sheet folding of each
B. sequence of one three
regions of each polypeptide
polypeptide polypeptides
polypeptide
-helix and
association of amino acid
-pleated sheet folding of each
C. three sequence of one
regions of each polypeptide
polypeptides polypeptide
polypeptide
-helix and
association of amino acid
folding of each -pleated sheet
D. three sequence of one
polypeptide regions of each
polypeptides polypeptide
polypeptide
The approximate length of the amino acid shown below was estimated using the
figures in the table.
What would be the approximate length of a dipeptide formed using this amino acid?
A. 0.8 nm
B. 1.2 nm
C. 1.5 nm
D. 1.9 nm
3. The diagrams show the results of an investigation into the composition of different
mixtures of amino acids. Each mixture of amino acids was separated using
chromatography. Each chromatogram was then turned through 90 and the amino
acids separated again by electrophoresis.
Which diagram shows an amino acid mixture in which the solubility of some of the
amino acids is the same but the charge on those particular amino acids is different?
4. Fractionation
n is used to
o separate plant cell componentts accordingg to their size
s and
de
ensity.
D
DCPIP and buffer soluttion were a added to eaach sedimen nt and the mixtures le
eft in the
lig
ght for fiftee he oxidised DCPIP to bbe reduced.
en minutes. Sediment 2 caused th
W
Which organ
nelles are prresent in se
ediment 2?
A
A. nuclei
B
B. mitochon
ndria
C
C. chloropla
asts
D
D. ribosome
es
9648/0
01/PU3 Prelim 2/2013
[Tu
urn over
724
6
5. Nocodazole is a chemical used in the study of mitosis. It causes all mitotic cells to stop
dividing at metaphase.
A. 3 only
B. 1, 2 and 3
C. 1 and 2 only
D. 1 and 3 only
6. What is the maximum number of hydrogen bonds in a length of DNA containing 600
base pairs?
A. 300
B. 600
C. 1200
D. 1800
7. Which correctly describes the structure and role of a type of nucleic acid?
When cells undergo mitotic division, some of these repeating sequences are lost. This
results in a shortening of the telomeric DNA.
What is a consequence of the loss of repeating DNA sequences from the telomeres?
C. The number of mitotic divisions the cell can make will be limited.
What was the sequence of bases on the strand of the DNA which was complementary
to the mRNA from which this polypeptide was formed?
A. CTTTTATGGGGA
B. CUUUUAUGGGGA
C. GAAAATACCCCT
D. GAAAAUACCCCU
A. 1, 2 and 3
B. 1, 2 and 4
C. 1, 4 and 5
D. 2 and 4 only
11. The diagram shows the major components of the lac operon.
12. Which type of control of gene expression is commonly found in both prokaryotes and
eukaryotes?
A. transcriptional
B. post translational
C. post transcriptional
D. translational
B. addition of chemical groups, such as phosphate groups, to free amino acids in the
cytoplasm
15. Which type of enzyme enables a retrovirus to prepare its genetic information for
insertion into a host cell's DNA?
A. DNA polymerase
B. integrase
C. restriction enzyme
D. reverse transcriptase
Which statement best provides evidence that mitochondria and chloroplasts are
endosymbionts?
B. Their inner membrane has different structure from other intracellular membranes.
17. Gene mutations in either the BRCA1 or the BRCA2 genes are responsible for the
majority of hereditary breast cancer in humans.
The proteins produced by the two genes migrate to the nucleus where they interact
with other proteins, such as those produced by the tumour suppressor gene, p53 and
the DNA repair gene, RAD51.
gene
BRCA1 or
p53 RAD51
BRCA2
A.
B. X
C. X
D. X X X
18. Human immunodeficiency virus (HIV) is a retrovirus. After infecting a host cell, viral
DNA is produced which is incorporated into the DNA of the host cell. The modified host
genome now codes for the production of new HIV particles.
Which could be used as a potential treatment to slow down the spread of HIV?
A. 1 and 4 only
B. 2 and 3 only
C. 1 only
D. 2 only
19. One hypothesis about the origin of viruses is that they existed before cellular life forms,
later evolving into parasites of cellular organisms. Groups with an ancient, common
origin tend to share conserved sequences of DNA or RNA.
Which observation about virus genomes supports the view that viruses existed before
cellular life forms and only much later evolved into parasites?
D. Viral genomes have conserved genes not found in any other genomes
Grow together in the presence of methionine,
biotin, threonine and leucine
Grow together without methionine,
biotin, threonine and leucine
Growth of some bacteria that
are met+, bio+, thr+, leu+
1 transformation
2 transduction
3 conjugation
A. 1 only
B. 3 only
C. 1 and 2
D. 1 and 3
21. What is necessary for an organism to respond to changes in its internal environment?
22. A snake venom causes death by leading to paralysis of muscles. It exerts its effect at
synapses.
The statements below were put forward by scientists as possible explanations for the
effects of this venom.
A. 1, 2, 3 and 5 only
B. 2, 4 and 5 only
C. 1 and 4 only
D. 1, 2, 3, 4 and 5
23. Vibrio cholerae produces a toxin that binds to a cell surface membrane receptor on
intestinal cells of the host. The toxin permanently activates the G protein in target cells,
causing them to lose water rapidly. When a person is infected with cholera they suffer
severe dehydration.
C. It is a lipid-soluble molecule.
D. It acts as a neurotransmitter.
24. The graphs show the response of sensory neurones to increasing pressure on the
Pacinian corpuscles (receptors found in deep layers of the skin that senses vibratory
pressure and touch.) in mammalian skin.
C. If the corpuscle is stimulated for long enough the depolarisation of the sensory
neurone increases.
D. If the corpuscle is stimulated for long enough the axon terminal depolarisation
reaches a value that depolarises the sensory neurone.
25. The following graph shows the relationship between light intensity and net oxygen
uptake or output by a particular green plant.
26. What causes phenotypic variation among organisms of the same genotype?
D. mutation
27. One of the many recessive mutations of the CFTR gene changes one amino acid in
the region of the CFTR protein that binds ATP. The graph shows the effect of different
concentrations of ATP on normal and mutant CFTR proteins.
Which correctly describes individuals who are homozygous for this mutation?
1 Their CFTR protein cannot bind ATP and cannot act as an ion channel.
2 Their CFTR protein binds ATP less readily than normal CFTR protein.
3 They produce CFTR protein that must bind ATP to function as an ion
channel.
4 They produce a mixture of normal and mutant CFTR protein, both of which
can act as an ion channel.
A. 1 only
B. 2 only
C. 2 and 3 only
D. 2 and 4 only
28. Many plants are not fertilised by pollen from their own flowers. This is known as self-
incompatibility. In any individual species, a single gene, the S gene, is responsible and
it may have many different alleles.
If a pollen grain has an S allele which matches an allele in the genotype of the stigma
then the pollen grain fails to germinate or the pollen tube fails to grow through the style.
A. 4 only
B. 2 and 4 only
C. 1 only
D. 3 and 4 only
29. Two areas of molecular biology that have received considerable attention in
evolutionary studies are the genetic code and cytochrome C. Cytochrome C is an
essential component of all respiratory electron transport chains.
A. 2 and 3 only
B. 1 and 2 only
C. 3 and 4 only
D. 1, 3 and 4 only
2 Organisms with similar base sequences in their DNA are closely related to
each other.
Which statements, when taken together, suggest the existence of a molecular clock
that enables scientists to estimate the time at which one species might have diverged
from another?
A. 1 and 2
B. 1 and 4
C. 2 and 3
D. 3 and 4
31. Based on binomial nomenclature, which two species are most closely related?
A. 1 and 4
B. 1 and 3
C. 2 and 4
D. 3 and 4
32. The graphs represent the frequency of alleles in species X, Y and Z during and after
selection.
A. X only
B. Y only
C. Y and Z
D. none of X, Y nor Z
33. Why can restriction fragment length polymorphism (RFLP) be used to detect inherited
diseases?
B. The DNA fragments are the same length within each gene.
34. Ripening of fruit, for example figs, is caused by ethylene gas, a lipid-soluble compound
that diffuses easily from cell to cell as well as to neighbouring plants. Plant tissues
produce ethylene at certain developmental stages and in response to stressful
conditions, such as heat or injury.
D. Ethylene receptors are located on the external surfaces of the cell surface
membrane.
Which property of stem cells makes them particularly useful in this research?
C. They can divide and be made to differentiate into various types of cell.
A. P and Q
B. Q and R
C. R and S
D. S and P
37. Which genetic modification could increase the yield of a crop measured as mass of
crop produced per unit area per year?
38. The following figures show two different methods used to sequence DNA.
D. Method 2 requires the DNA to be loaded at the positive end on the sequencing
gel.
9648/01/PU3 Prelim 2/2013
[Turn over
740
22
39. Gene therapy is a way of treating genetic disease by introducing a piece of DNA into
the cells of an affected individual. Liposomes can be used for gene therapy as they
target the cells affected by a genetic disease.
What feature of a cell surface membrane allows the liposome to target cells affected by
a genetic disease?
A. carrier molecules
B. phosphate groups
C. receptor molecules
D. protein channels
40. Small samples from crime scenes can be genetically profiled (DNA finger printed).
Key: present
X absent
crime scene ethidium bromide
PCR
sample and X-rays
Candid
date Name
e:
2013 Prelimin
P nary Examinaation 2
Pre-U
University 3
Biolog
gy Highe
er 2 Sylllabus 96
648/01
255 September 2013
1 hrr 15 min
Addition
nal materiall: Multiple
e Choice An
nswer Shee
et
READ T
THESE INS
STRUCTION
NS FIRST
Write in
n soft pencil.
Do not use stapless, paper clip
ps, highlightters, glue orr correction fluid.
Write yyour name, Centre number and index numb ber on the Answer Shheet in the spaces
provideed unless this has beenn done for yyou.
Choose
e the one yo
ou considerr correct an
nd record yo
our choice in
i soft pen
ncil on the separate
s
Answerr Sheet.
he instructtions on the
Read th e Answer S
Sheet very carefully.
Each co
orrect answ
wer will score educted for a wrong answer.
e one markk. A mark wiill not be de
Any rou
ugh working
g should be done in thiss booklet.
Calcula
ators may be
e used.
This ques
stion pape r consists of 22 printed pages.
[Tu
urn over
742
2
Ans: B
Which row correctly describes the structure of vicilin?
-helix and
amino acid association of
-pleated sheet folding of each
A. sequence of one three
regions of each polypeptide
polypeptide polypeptides
polypeptide
-helix and
amino acid association of
-pleated sheet folding of each
B. sequence of one three
regions of each polypeptide
polypeptide polypeptides
polypeptide
-helix and
association of amino acid
-pleated sheet folding of each
C. three sequence of one
regions of each polypeptide
polypeptides polypeptide
polypeptide
-helix and
association of amino acid
folding of each -pleated sheet
D. three sequence of one
polypeptide regions of each
polypeptides polypeptide
polypeptide
The approximate length of the amino acid shown below was estimated using the
figures in the table.
What would be the approximate length of a dipeptide formed using this amino acid?
A. 0.8 nm
Ans: B
B. 1.2 nm
C. 1.5 nm
D. 1.9 nm
3. The diagrams show the results of an investigation into the composition of different
mixtures of amino acids. Each mixture of amino acids was separated using
chromatography. Each chromatogram was then turned through 90 and the amino
acids separated again by electrophoresis.
Which diagram shows an amino acid mixture in which the solubility of some of the
amino acids is the same but the charge on those particular amino acids is different?
Ans: B
4. Fractionation
n is used to
o separate plant cell componentts accordingg to their size
s and
de
ensity.
Ans: C
m shows the main stepss in fractiona
The diagram ation of a plant cell.
D
DCPIP and buffer soluttion were a added to eaach sedimen nt and the mixtures le
eft in the
lig
ght for fiftee he oxidised DCPIP to bbe reduced.
en minutes. Sediment 2 caused th
W
Which organ
nelles are prresent in se
ediment 2?
A
A. nuclei
B
B. mitochon
ndria
C
C. chloropla
asts
D
D. ribosome
es
9648/0
01/PU3 Prelim 2/2013
[Tu
urn over
746
6
5. Nocodazole is a chemical used in the study of mitosis. It causes all mitotic cells to stop
dividing at metaphase.
A. 3 only
B. 1, 2 and 3
Ans: A
C. 1 and 2 only
D. 1 and 3 only
6. What is the maximum number of hydrogen bonds in a length of DNA containing 600
base pairs?
A. 300
Ans: D
B. 600
C. 1200
D. 1800
7. Which correctly describes the structure and role of a type of nucleic acid?
A. double stranded, partly base paired, unpaired bases to bind to a ribosome Ans B
When cells undergo mitotic division, some of these repeating sequences are lost. This
results in a shortening of the telomeric DNA.
What is a consequence of the loss of repeating DNA sequences from the telomeres?
C. The number of mitotic divisions the cell can make will be limited.
What was the sequence of bases on the strand of the DNA which was complementary
to the mRNA from which this polypeptide was formed?
A. CTTTTATGGGGA
Ans: A
B. CUUUUAUGGGGA
C. GAAAATACCCCT
D. GAAAAUACCCCU
A. 1, 2 and 3
Ans: A
B. 1, 2 and 4
C. 1, 4 and 5
D. 2 and 4 only
11. The diagram shows the major components of the lac operon.
Ans: D
12. Which type of control of gene expression is commonly found in both prokaryotes and
eukaryotes?
A. transcriptional Ans A
B. post translational
C. post transcriptional
D. translational
B. addition of chemical groups, such as phosphate groups, to free amino acids in the
cytoplasm
15. Which type of enzyme enables a retrovirus to prepare its genetic information for
insertion into a host cell's DNA?
Ans D
A. DNA polymerase
B. integrase
C. restriction enzyme
D. reverse transcriptase
Which statement best provides evidence that mitochondria and chloroplasts are
endosymbionts?
Ans: A
A. Proteins encoded by the nucleus are exported to these organelles.
B. Their inner membrane has different structure from other intracellular membranes.
17. Gene mutations in either the BRCA1 or the BRCA2 genes are responsible for the
majority of hereditary breast cancer in humans.
The proteins produced by the two genes migrate to the nucleus where they interact
with other proteins, such as those produced by the tumour suppressor gene, p53 and
the DNA repair gene, RAD51.
gene
BRCA1 or
p53 RAD51
BRCA2
A.
B. X
C. X
D. X X X
18. Human immunodeficiency virus (HIV) is a retrovirus. After infecting a host cell, viral
DNA is produced which is incorporated into the DNA of the host cell. The modified host
genome now codes for the production of new HIV particles.
Which could be used as a potential treatment to slow down the spread of HIV?
A. 1 and 4 only
B. 2 and 3 only
C. 1 only
D. 2 only
19. One hypothesis about the origin of viruses is that they existed before cellular life forms,
later evolving into parasites of cellular organisms. Groups with an ancient, common
origin tend to share conserved sequences of DNA or RNA.
Which observation about virus genomes supports the view that viruses existed before
cellular life forms and only much later evolved into parasites?
Ans: D
A. All viruses have genes that code for capsid components.
D. Viral genomes have conserved genes not found in any other genomes
Grow together in the presence of methionine,
Ans: D
Grow together without methionine,
biotin, threonine and leucine
Growth of some bacteria that
are met+, bio+, thr+, leu+
1 transformation
2 transduction
3 conjugation
A. 1 only
B. 3 only
C. 1 and 2
D. 1 and 3
21. What is necessary for an organism to respond to changes in its internal environment?
22. A snake venom causes death by leading to paralysis of muscles. It exerts its effect at
synapses.
The statements below were put forward by scientists as possible explanations for the
effects of this venom.
A. 1, 2, 3 and 5 only
B. 2, 4 and 5 only
C. 1 and 4 only
D. 1, 2, 3, 4 and 5
23. Vibrio cholerae produces a toxin that binds to a cell surface membrane receptor on
intestinal cells of the host. The toxin permanently activates the G protein in target cells,
causing them to lose water rapidly. When a person is infected with cholera they suffer
severe dehydration. Ans: B
C. It is a lipid-soluble molecule.
D. It acts as a neurotransmitter.
24. The graphs show the response of sensory neurones to increasing pressure on the
Pacinian corpuscles (receptors found in deep layers of the skin that senses vibratory
pressure and touch.) in mammalian skin.
Ans: B
C. If the corpuscle is stimulated for long enough the depolarisation of the sensory
neurone increases.
D. If the corpuscle is stimulated for long enough the axon terminal depolarisation
reaches a value that depolarises the sensory neurone.
25. The following graph shows the relationship between light intensity and net oxygen
uptake or output by a particular green plant.
Ans: C
26. What causes phenotypic variation among organisms of the same genotype?
D. mutation
27. One of the many recessive mutations of the CFTR gene changes one amino acid in
the region of the CFTR protein that binds ATP. The graph shows the effect of different
concentrations of ATP on normal and mutant CFTR proteins.
Which correctly describes individuals who are homozygous for this mutation?
1 Their CFTR protein cannot bind ATP and cannot act as an ion channel.
2 Their CFTR protein binds ATP less readily than normal CFTR protein.
3 They produce CFTR protein that must bind ATP to function as an ion
channel.
4 They produce a mixture of normal and mutant CFTR protein, both of which
can act as an ion channel.
A. 1 only
Ans: C
B. 2 only
C. 2 and 3 only
D. 2 and 4 only
28. Many plants are not fertilised by pollen from their own flowers. This is known as self-
incompatibility. In any individual species, a single gene, the S gene, is responsible and
it may have many different alleles.
If a pollen grain has an S allele which matches an allele in the genotype of the stigma
then the pollen grain fails to germinate or the pollen tube fails to grow through the style.
A. 4 only
Ans: C
B. 2 and 4 only
C. 1 only
D. 3 and 4 only
29. Two areas of molecular biology that have received considerable attention in
evolutionary studies are the genetic code and cytochrome C. Cytochrome C is an
essential component of all respiratory electron transport chains.
B. 1 and 2 only
C. 3 and 4 only
D. 1, 3 and 4 only
2 Organisms with similar base sequences in their DNA are closely related to
each other.
Which statements, when taken together, suggest the existence of a molecular clock
that enables scientists to estimate the time at which one species might have diverged
from another?
A. 1 and 2
Ans: B
B. 1 and 4
C. 2 and 3
D. 3 and 4
31. Based on binomial nomenclature, which two species are most closely related?
A. 1 and 4
B. 1 and 3
C. 2 and 4
D. 3 and 4
32. The graphs represent the frequency of alleles in species X, Y and Z during and after
selection.
Ans: B
A. X only
B. Y only
C. Y and Z
D. none of X, Y nor Z
33. Why can restriction fragment length polymorphism (RFLP) be used to detect inherited
diseases?
B. The DNA fragments are the same length within each gene.
34. Ripening of fruit, for example figs, is caused by ethylene gas, a lipid-soluble compound
that diffuses easily from cell to cell as well as to neighbouring plants. Plant tissues
produce ethylene at certain developmental stages and in response to stressful
conditions, such as heat or injury.
D. Ethylene receptors are located on the external surfaces of the cell surface
membrane.
Which property of stem cells makes them particularly useful in this research?
C. They can divide and be made to differentiate into various types of cell.
A. P and Q
B. Q and R
C. R and S
D. S and P
37. Which genetic modification could increase the yield of a crop measured as mass of
crop produced per unit area per year?
Ans: A
A. winter resistant plants
38. The following figures show two different methods used to sequence DNA.
Ans: C
What of the following statements is correct?
D. Method 2 requires the DNA to be loaded at the positive end on the sequencing
gel.
9648/01/PU3 Prelim 2/2013
[Turn over
762
22
39. Gene therapy is a way of treating genetic disease by introducing a piece of DNA into
the cells of an affected individual. Liposomes can be used for gene therapy as they
target the cells affected by a genetic disease.
What feature of a cell surface membrane allows the liposome to target cells affected by
a genetic disease?
Ans C
A. carrier molecules
B. phosphate groups
C. receptor molecules
D. protein channels
40. Small samples from crime scenes can be genetically profiled (DNA finger printed).
Key: present
X absent
crime scene ethidium bromide
PCR
sample and X-rays
Candid
date Name
e:
2013 Prelimin
P nary Examinaation 2
Pre-U
University 3
H2 Biology 9648/02
2
17 Septe
ember 2013
3
2 hours
s
Additionall Materials: Writing paper
READ TH
HESE INSTR
RUCTIONS
S FIRST
Section A
Answer alll questionss.
Fo
or Examiner's Use
Section B
ny one question.
Answer an Secction A
At the end
d of the examination, faasten all you
ur work seccurely together. 1
The numb ber of marks is given n in brackeets [ ] at th
he end of each
e
question oor part queestion. At th
he end of t he examina ation, fasten all 2
your workk securely to
ogether.
3
Secction B
T
Total
This ques
stion pape r consists of 24 printed pages.
[Tu
urn over
764
2 For
Examiners
Use
Section A
Table 1.1 shows how the foxes were put into categories according to their tameness.
Table 1.1
The tamest 5% of the male foxes and the tamest 20% of the female foxes in each
generation were used for breeding to produce the next generation. This was
repeated for over forty generations.
(a)
(i) State the name given to the process in which only a certain percentage of
adult foxes were chosen by humans to breed in each generation.
...... [1]
(ii) Suggest why 20% of the female foxes were used for breeding but only 5%
of the male foxes.
......
......
......
......
......
...... [2]
(b) Table 1.2 shows the number of foxes in the elite tameness class during the
long-term experiment.
Table. 1.2
Discuss what the results shown in Table 1.2 suggest about the causes of
variation in tameness behaviour in silver foxes.
.........
.........
.........
.........
.........
........ [3]
Table 1.3 compares the frequency of these traits in a control group of silver
foxes that had not been used in this long-term breeding experiment and in the
tame population of foxes.
Table. 1.3
Select one hypothesis from the list and explain how it could account for the
data in Table 1.3.
.........
.........
.........
.........
.........
........ [2]
(d) Similar changes in tameness, colour and body shape are believed to have
occurred in the 11 000 year period during which the grey wolf species, Canis
lupus, evolved into the domesticated dog species, Canis familiaris.
.........
.........
.........
.........
.........
.........
........ [3]
(e) Interbreeding between members of the wolf species and some dogs has been
reported.
However, there are some large breeds of dogs that cannot breed successfully
with small dog breeds.
Use this information and your own knowledge to explain the problems of
classifying wolves and different dog breeds according to:
and
.........
.........
.........
.........
.........
.........
.........
.........
........ [4]
[Total: 15]
When a person suffers a stroke, blood flow to part of the brain is stopped, so
some neurones receive no oxygen. ATP production by oxidative
phosphorylation stops. Fig. 2.1 shows some of the ways in which the lack of
ATP affects a neurone in the brain.
No ATP
Na+ / K+ pump stops working
membrane depolarises
voltage-gated Ca2+ channels open
Ca2+ ions flood into the neurone
2+
Ca ions activate enzymes that eventually
destroy the neurone
Fig. 2.1
(i) Explain why the membrane of the neurone depolarises when the Na+ / K+
pump stops working.
......
......
......
......
......
......
......
...... [4]
(ii) Suggest why calcium ions flood into the neurone when the Na+ / K+ pump
stops working.
......
......
......
...... [2]
(b) The freshwater turtle, Trachemys scripta, is able to survive for long periods in
conditions of very low oxygen concentration. As in humans, the rate of activity
of the Na+ / K+ pump in the neurones in its brain falls sharply. However, in
turtles this does not result in damage to these cells.
after about four hours, the quantity of mRNA involved in the synthesis
of proteins used to build ion channels, falls to less than one fifth of
normal concentrations.
(i) Suggest how the closure of ion channels in the neurones of the turtle in
very low oxygen concentrations could allow the cells to survive.
......
......
......
...... [2]
(ii) Suggest what causes the quantity of mRNA for protein channels to fall.
......
......
......
...... [2]
Suggest and explain what occurs at the synapse when phenothiazine is used
in the treatment of schizophrenia.
.........
.........
.........
........ [2]
(d) DRD4 is a dopamine receptor in humans. The gene coding for the DRD4
receptor has a large number of alleles, of which an individual can have only
two.
Three alleles of the DRD4 receptor gene have the following mutations:
The 13 base-pair deletion has the most serious consequences for the
structure of the DRD4 receptor protein. Suggest why this is so.
.........
.........
.........
.........
.........
........ [3]
(e) One allele of the DRD4 gene has been found more frequently amongst
individuals whose personality is described as impulsive and exploratory.
Describe the mechanism whereby an allele such as this could have become
common in the human population.
.........
.........
.........
.........
.........
........ [3]
[Total: 18]
Fig. 3.1 shows changes in the mass of DNA in a human stem cell from the bone
marrow during three cell cycles.
Fig. 3.1
(i) what happens to bring about the changes in the mass of DNA per cell at K
and at L.
K ......
......
L ...
...... [2]
(ii) how many blood cells are formed from the stem cell in the time shown.
...... [1]
...... [1]
.........
.........
.........
.........
.........
........ [3]
(c) Describe the changes that occur during prophase in an animal cell.
.........
.........
.........
.........
.........
.........
.........
........ [4]
.........
.........
.........
.........
.........
........ [3]
[Total: 14]
BLANK PAGE
Sometimes when a green male is crossed with a green female all the offspring, male
and female, are green. However, sometimes a green male crossed with a green
female results in offspring in which the majority of the offspring are green, but in
which some of the females are purple, as shown in Table 4.1.
Table. 4.1
Phenotype Number of
offspring
green male 7
green female 3
purple female 4
(a)
(i) Using the results shown in Table 4.1, a geneticist proposed a hypothesis
which predicted a 3:1 ratio of green:purple phenotypes. She used the 2
test to test her hypothesis
Table. 4.2
Observed (O) 7 + 3 = 10 4
OE
(O E)2
(O E)2
E
(O E)2
= 2
E
[2]
(ii) Draw a conclusion from your calculation in Table 4.2, given that the critical
value for 2 at p = 0.05 with one degree of freedom is 3.84. Explain why
this conclusion should be treated with caution.
......
......
......
......
......
...... [3]
In birds, the sex chromosomes are referred to as W and Z, rather than Y and
X as in mammals. The W chromosome has no genes that affect plumage
colour. The heterogametic sex is the female, not the male. Thus the male has
two Z chromosomes (ZZ) and the female has one W and one Z chromosome
(WZ).
[3]
......
...... [2]
[Total: 10]
BLANK PAGE
Several lizards were fitted with small, airtight masks that covered their heads.
Air was supplied inside the mask through one tube, and collected through
another. The differences between oxygen concentrations in the air supplied
for inhalation and the exhaled air enabled the researchers to measure the
rate of oxygen consumption of the lizards.
The rate of oxygen consumption of each lizard was measured when it was at
rest and when it was running. Measurements were made at different
temperatures ranging from 15 C to 40 C.
Fig. 5.1
(i) Running requires rapid use of ATP by muscle cells in the legs and heart of
a lizard.
......
......
......
......
......
......
......
...... [4]
......
......
......
......
......
...... [3]
.........
.........
.........
.........
.........
.........
.........
........ [3]
(c) It is expected that the carbon dioxide concentration in the atmosphere will
increase in the future, which would be expected to increase rates of
photosynthesis in many crop plants.
Investigations were carried out into the effect of increased carbon dioxide
concentration on the rate of photosynthesis in maize.
Maize plants were grown in open-air trials, in the same field and were
exposed to the same changes in the weather.
50% of the plants were exposed to a normal carbon dioxide
concentration.
50% of the plants were exposed to an increased carbon dioxide
concentration.
The rate of photosynthesis was measured as the net assimilation rate
of carbon dioxide.
Measurements were made at three-hourly intervals between 0700
hours and 1900 hours on three different days.
Fig. 5.2
......
......
......
...... [2]
(ii) Suggest one explanation for the changes in the rate of photosynthesis
between 0700 hours and 1900 hours on day 1.
......
......
......
...... [2]
[Total: 14]
The finding adds to a growing body of knowledge about epigenetics that show though
we cannot change our DNA we can change the way our genes are expressed to fight
disease.
(a) Describe and explain the effect of DNA methylation in eukaryotic genome.
.........
.........
.........
.........
.........
........ [3]
.........
........ [1]
In the 1950s, Erwin Chargaff determined the relative quantities of the four bases in
DNA in different organisms. His results provided important evidence for the model of
DNA proposed by James Watson and Francis Crick in 1953. Some of Chargaffs data
is shown in Table 6.1.
Table. 6.1
(c) Explain how the data in Table 6.1 helps to confirm the arrangement of bases
in DNA.
.........
.........
.........
.........
.........
........ [3]
Table. 6.2
(i) State how the result for the virus differs from the results for all the
organisms given in Table 6.1.
......
......
......
...... [1]
(ii) Suggest why the results for the virus are different from all the other
organisms.
......
......
......
...... [1]
[Total: 9]
7.
(a) Outline the molecular structure of phospholipids in relation to their function in cell
membranes. [7]
(b) Explain the role of the Golgi body and its link to the rough endoplasmic reticulum.
[7]
[Total: 20]
8.
(a) Explain the effects of competitive and non-competitive inhibitors on the rate of
enzymatic activity. [6]
(b) Explain the mode of action of enzymes in terms of specificity and activation
energy. [10]
[Total: 20]
Candid
date Name
e:
2013 Prelimin
P nary Examinaation 2
Pre-U
University 3
H2 Biology 9648/02
2
17 Septe
ember 2013
3
2 hours
s
Additionall Materials: Writing paper
READ TH
HESE INSTR
RUCTIONS
S FIRST
Section A
Answer alll questionss.
Fo
or Examiner's Use
Section B
ny one question.
Answer an Secction A
At the end
d of the examination, faasten all you
ur work seccurely together. 1
The numb ber of marks is given n in brackeets [ ] at th
he end of each
e
question oor part queestion. At th
he end of t he examina ation, fasten all 2
your workk securely to
ogether.
3
Secction B
T
Total
This ques
stion pape r consists of 24 printed pages.
[Tu
urn over
788
2 For
Examiners
Use
Section A
Table 1.1 shows how the foxes were put into categories according to their tameness.
Table 1.1
The tamest 5% of the male foxes and the tamest 20% of the female foxes in each
generation were used for breeding to produce the next generation. This was
repeated for over forty generations.
(a)
(i) State the name given to the process in which only a certain percentage of
adult foxes were chosen by humans to breed in each generation.
artificial selection / selective breeding ;
...... [1]
(ii) Suggest why 20% of the female foxes were used for breeding but only 5%
of the male foxes.
......
......
...... [2]
(b) Table 1.2 shows the number of foxes in the elite tameness class during the
long-term experiment.
Table. 1.2
Discuss what the results shown in Table 1.2 suggest about the causes of
variation in tameness behaviour in silver foxes.
.........
1 (mostly) genetic ;
2 as can be selected for / selective breeding increases frequency ;
3 allele(s) for tameness ;
.........
4 (from) mutation ;
5 query role of environment / learning ;
.........
6 ref. DRD4 / dopamine receptor ;
.........
R environment also given as cause
R genetic drift
.........
........ [3]
Table 1.3 compares the frequency of these traits in a control group of silver
foxes that had not been used in this long-term breeding experiment and in the
tame population of foxes.
Table. 1.3
Select one hypothesis from the list and explain how it could account for the
data in Table 1.3.
.........
linkage
tameness.........
genes and genes for these traits on same chromosome ;
(so) inherited together ;
.........
epistasis
(product.........
of) one gene affects expression of another ;
via enzyme pathway ;
.........
inbreeding
(hidden ........
/ masked) recessive alleles ; [2]
selected for, as well / unintentionally ;
more chance homozygous as, small gene pool / parents related ;
ACCEPT idea of (recessive )allele inherited from both parents because, they are closely-
related / small gene pool / reduced genetic diversity
genetic drift
random / chance (which alleles, present / passed on) ;
(effect stronger because) small breeding population ;
(d) Similar changes in tameness, colour and body shape are believed to have
occurred in the 11 000 year period during which the grey wolf species, Canis
lupus, evolved into the domesticated dog species, Canis familiaris.
3 behavioural ;
.........
4 detail / description ; eg differences in, pheromones / courtship
.........
5 mechanical ;
6 idea of different size of wolves and some small dogs ; ACCEPT different
.........
genitalia
.........
7 gamete incompatibility ;
8 possibility of different chromosome numbers ;
.........
9 seasonal / temporal ;
10 different breeding, seasons / times ; idea that dogs breed all year round /
........ [3]
wolves breed once a year
(e) Interbreeding between members of the wolf species and some dogs has been
reported.
However, there are some large breeds of dogs that cannot breed successfully
with small dog breeds.
Use this information and your own knowledge to explain the problems of
classifying wolves and different dog breeds according to:
and
.........
biological species concept
.........
.........
........ [4]
[Total: 15]
When a person suffers a stroke, blood flow to part of the brain is stopped, so
some neurones receive no oxygen. ATP production by oxidative
phosphorylation stops. Fig. 2.1 shows some of the ways in which the lack of
ATP affects a neurone in the brain.
No ATP
Na+ / K+ pump stops working
membrane depolarises
voltage-gated Ca2+ channels open
Ca2+ ions flood into the neurone
2+
Ca ions activate enzymes that eventually
destroy the neurone
Fig. 2.1
(i) Explain why the membrane of the neurone depolarises when the Na+ / K+
pump stops working.
......
1. (when pump stops working), resting potential not maintained
or
......
pump usually maintains the resting potential;
......
2. (during resting potential) membrane polarised
or
positive charge outside (neurone) / negative charge inside (neurone) / -70mV
......
inside neurone relative to outside / potential difference across membrane;
......
3. (when pump stops working), ions (only) move by diffusion;
4. Na+ into the neurone;
......
5. outward diffusion of K+ is limited / K+ stay in neurone;
6. ref. non voltage-gated channels;
......
7. (eventually) inside of the neurone, becomes less negative / contains
......
(relatively) more positive ions [4]
or
there is a reduced potential difference across the membrane;
(ii) Suggest why calcium ions flood into the neurone when the Na+ / K+ pump
stops working.
......
1. voltage gated (calcium) channels open;
......
2. (calcium ions move in) by diffusion / move down their concentration
gradient;
......
...... [2]
(b) The freshwater turtle, Trachemys scripta, is able to survive for long periods in
conditions of very low oxygen concentration. As in humans, the rate of activity
of the Na+ / K+ pump in the neurones in its brain falls sharply. However, in
turtles this does not result in damage to these cells.
after about four hours, the quantity of mRNA involved in the synthesis
of proteins used to build ion channels, falls to less than one fifth of
normal concentrations.
(i) Suggest how the closure of ion channels in the neurones of the turtle in
very low oxygen concentrations could allow the cells to survive.
......
1. Na+ / K+, cannot move through membrane;
2. so potential across membrane maintained even when pump stops / so membrane depolarisation does not
happen; ......
3. calcium ions cannot enter cell;
......
4. so, (destructive) enzymes not activated;
...... [2]
(ii) Suggest what causes the quantity of mRNA for protein channels to fall.
......
1. gene (for protein channels), expressed less / switched off;
2. transcription, reduced / stopped;
......
3. AVP; e.g. reduced aerobic respiration / less ATP, for transcription
......
...... [2]
Suggest and explain what occurs at the synapse when phenothiazine is used
in the treatment of schizophrenia.
........ [2]
(d) DRD4 is a dopamine receptor in humans. The gene coding for the DRD4
receptor has a large number of alleles, of which an individual can have only
two.
Three alleles of the DRD4 receptor gene have the following mutations:
The 13 base-pair deletion has the most serious consequences for the
structure of the DRD4 receptor protein. Suggest why this is so.
.........
ref 13 base deletion
frame shift/alters reading frame (after mutation);
(so) all amino acids different after mutation;
.........
3-D shape/tertiary structure, of protein changed;
(whereas) 21 base-pair deletion, loses 7 amino acids/no frame shift;
.........
(whereas) substitution, may change only one amino acid/may be silent;
.........
.........
........ [3]
(e) One allele of the DRD4 gene has been found more frequently amongst
individuals whose personality is described as impulsive and exploratory.
Describe the mechanism whereby an allele such as this could have become
common in the human population.
.........
increased chances of, survival/breeding/mating;
.........
provides a selective advantage;
allele passed on (to next generation);
.........
allele increases in frequency over time;
natural selection;
.........
.........
........ [3]
[Total: 18]
Fig. 3.1 shows changes in the mass of DNA in a human stem cell from the bone
marrow during three cell cycles.
Fig. 3.1
(i) what happens to bring about the changes in the mass of DNA per cell at K
and at L.
K ......
K (DNA) replication / synthesis / described ;
L ...
...... [2]
(ii) how many blood cells are formed from the stem cell in the time shown.
3;
...... [1]
.........
transcription (of specific genes) ; A reference to gene switching
protein / polypeptide, synthesis ; A translation
.........
lymphocytes / B -cells / T-cells / divide (by mitosis) ;
producing, clone / many cells ;
.........
.........
.........
........ [3]
(c) Describe the changes that occur during prophase in an animal cell.
.........
.........
appearance of chromosomes / condensation of chromatin / AW ;
chromosomes visible as two, sister chromatids / chromatids joined by a centromere ;
.........
spindle formation / spindle fibres form / microtubules assemble / AW ;
centrioles, move to / reach, opposite poles ;
.........
R sides / ends
disappearance of nucleolus ;
.........
disassembly / breakdown of, nuclear envelope ;
A nuclear membrane
.........
.........
........ [4]
.........
.........
........ [3]
[Total: 14]
BLANK PAGE
Table. 4.1
Pheno
otype Numberr of
offsprin
ng
green male 7
green ffemale 3
purple ffemale 4
(a)
(i) Using the results
r showwn in Tablee 4.1, a gen
neticist propposed a hyp
pothesis
which pred dicted a 3:1 ratio of green:purple phenotypess. She used the 2
test to test her hypothe
esis
Complete Table
T o calculate 2 .
4.2 to
Table. 4.2
Gre
een Plumage
e P
Purple Plum
mage
Obserrved (O) 7 + 3 = 10 4
Expec
cted (E) 10.5 3.5
OE
(O E)2
(O E)2
E
(O E)2
= 2
E
[2]
9648/0
02/PU3 Prelim 2/2013
801 For
15 Examiners
Use
...
..
.
1 not significant
s ;
2 no difference
d... betw
ween observed
.. d and expecte
d which canno
ot be explaineed
by chance
;
.
3 (obsserved ratio) iss a valid approoximation to a 3:1 ratio ;
4 (shoould be treated
d with cautionn since it is) baased on a smalll sample ;
...
..
.
...
..
.
.....
.
.....
. [3]
(b) Plum
mage colou
ur in pheasa
ants is sex-linked.
In birds,
b the se
ex chromos omes are referred to as
a W and Z Z, rather tha
an Y and
X as
a in mamm mals. The W chromos some has non genes thhat affect plumage
p
colo
our. The hetterogameticc sex is the female, no
ot the male. Thus the male
m has
two Z chromos somes (ZZ) and the fem male has one W and oone Z chrom mosome
(WZZ).
[3]
9648/0
02/PU3 Prelim 2/2013
[Tu
urn over
802
16 For
Examiners
Use
(ii) Using the same sym mbols as in (b)(i), indicate thhe genotyp pes and
phenotypes rents which could give rise to purpple male offs
s of the pare spring.
.....
.
.....
. [2]
[T
Total: 10]
9648/0
02/PU3 Prelim 2/2013
803 For
17 Examiners
Use
BLANK PAGE
Several lizards were fitted with small, airtight masks that covered their heads.
Air was supplied inside the mask through one tube, and collected through
another. The differences between oxygen concentrations in the air supplied
for inhalation and the exhaled air enabled the researchers to measure the
rate of oxygen consumption of the lizards.
The rate of oxygen consumption of each lizard was measured when it was at
rest and when it was running. Measurements were made at different
temperatures ranging from 15 C to 40 C.
Fig. 5.1
(i) Running requires rapid use of ATP by muscle cells in the legs and heart of
a lizard.
......
1. ATP is made, in the electron transport chain/by oxidative
phosphorylation;
......
2. oxygen is the final electron acceptor;
3. in the, inner membrane of the mitochondrion/cristae;
......
4. transfer of electron (between electron carriers) provides energy;
5. energy used to pump hydrogen ions (into intermembrane space);
6. creates proton gradient;
......
7. diffusion of hydrogen ions down their electrochemical gradient
causes ATP to be synthesised;
......
8. ref. chemiosmosis/ATP synthase/stalked particles;
9. idea that if less oxygen (consumed/available) then fewer
......
electrons transferred along the chain;
......
...... [4]
...... [3]
1. stomata closed ;
.........
2. to reduce transpiration / to avoid too much loss of water ;
3. so carbon dioxide cannot enter the leaf ;
.........
4. so carbon dioxide concentration (in leaf / in chloroplast) becomes very low ;
.........
.........
.........
.........
.........
........ [3]
(c) It is expected that the carbon dioxide concentration in the atmosphere will
increase in the future, which would be expected to increase rates of
photosynthesis in many crop plants.
Investigations were carried out into the effect of increased carbon dioxide
concentration on the rate of photosynthesis in maize.
Maize plants were grown in open-air trials, in the same field and were
exposed to the same changes in the weather.
50% of the plants were exposed to a normal carbon dioxide
concentration.
50% of the plants were exposed to an increased carbon dioxide
concentration.
The rate of photosynthesis was measured as the net assimilation rate
of carbon dioxide.
Measurements were made at three-hourly intervals between 0700
hours and 1900 hours on three different days.
Fig. 5.2
......
1. CO2 concentration is always high ;
2. CO2 not limiting ;
......
3. another factor / light intensity / temperature, limiting ;
4. no photorespiration ;
......
...... [2]
(ii) Suggest one explanation for the changes in the rate of photosynthesis
between 0700 hours and 1900 hours on day 1.
......
1. idea of change in temperature ;
2. affects, light independent / light dependent, stage (of photosynthesis) ;
......
or
3. idea of change in light intensity ;
......
4. affects light dependent stage (of photosynthesis) ;
...... [2]
[Total: 14]
The finding adds to a growing body of knowledge about epigenetics that show though
we cannot change our DNA we can change the way our genes are expressed to fight
disease.
(a) Describe and explain the effect of DNA methylation in eukaryotic genome.
.........
DNA methylation leads to a more compact chromatin structure / chromatin
with a closed conformation / heterochromatin;
.........
Addition of methyl group to certain bases (usually cytosine) of DNA;
.........
DNA methytransferase catalyze the transfer of a methyl group to DNA;
.........
Transcription factors and RNA polymerase unable to bind to DNA;
.........
Methylated DNA attracts other proteins which and in turn recruits histone
deacetylation enzymes;
........ [3]
.........
Unrequired genes are silenced/not expressed/switched off when methylated;
........ [1]
In the 1950s, Erwin Chargaff determined the relative quantities of the four bases in
DNA in different organisms. His results provided important evidence for the model of
DNA proposed by James Watson and Francis Crick in 1953. Some of Chargaffs data
is shown in Table 6.1.
Table. 6.1
(c) Explain how the data in Table 6.1 helps to confirm the arrangement of bases
in DNA.
.........
1 (named) base / nucleotide, pairing ;
.........
2 purine pyrimidine ;
3 percentage of A = percentage of T ; A very similar
4 percentage of C = percentage of G ; A very similar
.........
5 data quote in support ;
.........
.........
........ [3]
Table. 6.2
(i) State how the result for the virus differs from the results for all the
organisms given in Table 6.1.
......
idea that
percentages of, A and T / C and G, are not the same / three percentages are
......
similar;
......
...... [1]
(ii) Suggest why the results for the virus are different from all the other
organisms.
......
single-stranded DNA / not double-stranded / not a double helix ;
A may be other bases ;
......
......
...... [1]
[Total: 9]
7.
(a) Outline the molecular structure of phospholipids in relation to their function in cell
membranes. [7]
(b) Explain the role of the Golgi body and its link to the rough endoplasmic reticulum.
[7]
[Total: 20]
8.
(a) Explain the effects of competitive and non-competitive inhibitors on the rate of
enzymatic activity. [6]
(b) Explain the mode of action of enzymes in terms of specificity and activation
energy. [10]
[Total: 20]
BLANK PAGE
Candid
date Name
e:
2013 Prelimin
P nary Examinaation 2
Pre-U
University 3
H2 Biology 9648/03
3
20 Septe
ember 2013
3
2 hours
s
Additionall Materials: Writing paper
READ TH
HESE INSTR
RUCTIONS
S FIRST
At the end
d of the examination, faasten all you
ur work sec curely together.
The numb ber of markss is given in
n brackets [ ] at the end
d of each qu
uestion or ppart question
n.
At the end
d of the examination, faasten all you
ur work sec curely together.
Fo
or Examiner's Use
1
T
Total
This ques
stion pape r consists of 16 printed pages.
[Tu
urn over
814
2 For
Examiners
Use
1. The pink bollworm moth, Pectinophora gossypiella, is a pest of cotton crops. The size
of its population can be reduced by releasing large numbers of sterile male moths
into cotton fields. The sterile male moths mate with wild females from the cotton
fields, but no offspring are produced.
Over a period of three years, 20 million genetically modified (GM) sterile male moths
were released in the USA. Each insect contained a gene coding for a red fluorescent
protein (DsRed) taken from a species of reef coral. The added DNA also included a
promoter.
(i) genes for fluorescent proteins such as DsRed are now more commonly
used as markers than are genes for antibiotic resistance
......
......
......
...... [2]
......
......
......
......
......
...... [3]
(b) DsRed is visible at all stages of the life cycle of the moth, but the presence of
the gene in a particular individual can be confirmed by genetic fingerprinting,
using gel electrophoresis.
......
......
......
......
......
......
......
...... [4]
(ii) Explain how the presence of the gene for DsRed in a moth can be
confirmed once electrophoresis is complete.
......
......
......
......
...... [2]
(c) DsRed allows sterile male moths to be distinguished from wild moths when
caught in an insect trap in a field of cotton plants.
.........
.........
.........
........ [2]
.........
.........
.........
........ [2]
[Total: 15]
BLANK PAGE
.........
.........
.........
........ [2]
(b) The following investigation was carried out into the effects of plant growth
substances on germination
a large number of lettuce seeds was divided into eight equal batches
each batch of seeds was placed on moist filter paper in a Petri dish
and given a different treatment
The different treatments are shown in Table 2.1. Each tick represents one of
the eight batches of seeds.
Table. 2.1
Fig. 2.1
(i) Describe, with reference to Fig. 2.1, the effects of the plant growth
substances on the germination of lettuce seeds.
......
......
......
......
......
......
......
...... [4]
(ii) Explain why all the lettuce seeds were kept at 25 oC.
......
......
......
...... [2]
(iii) State three variables, other than temperature, that needed to be controlled
in the investigation.
1 ...
2 ...
3 ...[3]
.........
.........
.........
........ [2]
[Total: 13]
.........
.........
.........
.........
.........
.........
.........
........ [4]
Scientists investigating the performance of athletes found that one gene contributing
to the performance of sprinters is the ACTN3 gene. There are two alleles of the gene,
the 577R allele and the 577X allele. The 577X allele codes for a very short protein
fragment in muscle fibres due to a stop codon mutation.
Table 3.1 summarises the athletic potential for the three possible genotypes for the
ACTN3 gene.
Table. 3.1
A scientist tested sprinters to see if they possessed the 577R allele. Samples were
obtained from athletes muscle fibres. A standard containing proteins of the same
lengths as the proteins coded for by both alleles 577X and 577R was used as a
comparison. The standard and the samples were exposed to gel electrophoresis. In
gel electrophoresis, protein molecules separate in the same way as DNA molecules.
Fig. 3.1
(b) On Fig. 3.1, draw the bands expected for an outstanding sprinter and for a
good sprinter.
.........
.........
.........
.........
.........
.........
.........
........ [4]
Fig. 3.2
(c) The DNA of such a cybrid is 99.6% human. The remaining 0.4% of the DNA
is in the cytoplasm. Explain why there is DNA in the cytoplasm of the cybrid.
.........
.........
.........
........ [1]
(d) When the Human Fertilisation and Embryology Bill was considered by the UK
Parliament in 2008, some people argued that it is unethical to allow the
production of cybrids.
State whether you agree or disagree that this is unethical and explain why
you reached this decision.
.........
.........
.........
.........
.........
.........
.........
........ [3]
[Total: 12]
You are required to plan an investigation to compare the activity of urease free in
solution and urease immobilised in alginate beads.
You are provided with the following equipment which you may use or not in your plan,
as you wish. You may not use any additional equipment in your plan.
an unlimited supply of calcium alginate beads all of uniform size prepared with
a 50 g dm-3 urease solution (you may call this immobilised urease)
an unlimited volume of 50 g dm-3 urease solution (you may call this free
urease)
an unlimited volume of 1.0 mol dm-3 urea solution
an unlimited volume of distilled water
beakers and flasks of different sizes
stop watch or electronic timer
broad and narrow range pH papers and liquids with appropriate colour charts,
pH probes and meters
colorimeter and tubes/cuvettes
thermometer
thermostatically-controlled water baths
graduated pipettes and pipette fillers
filter funnels
syringes
glass rods for stirring
test-tubes and boiling tubes
test-tube racks
Your plan should include a clear statement of the hypothesis or prediction and should
identify key variables.
Your plan should be written in clear scientific language and should be illustrated with
a diagram.
Your plan should give full details and explanations of the procedures that you would
adopt to ensure that the results are as precise and reliable as possible. A brief risk
assessment should be included.
[Total: 12]
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
Write your answer to this question on the separate answer paper provided.
Your answer:
should be illustrated by large, clearly labelled diagrams, where appropriate;
must be in continuous prose, where appropriate;
must be set out in sections (a), (b) etc., as indicated in the question.
5.
(a) Describe the genetic diseases SCID (severe combined immunodeficiency) and
cystic fibrosis. [12]
(b) Discuss the factors which prevent gene therapy from becoming an effective
treatment. [8]
[Total: 20]
Candid
date Name
e:
2013 Prelimin
P nary Examinaation 2
Pre-U
University 3
H2 Biology 9648/03
3
20 Septe
ember 2013
3
2 hours
s
Additionall Materials: Writing paper
READ TH
HESE INSTR
RUCTIONS
S FIRST
At the end
d of the examination, faasten all you
ur work sec curely together.
The numb ber of markss is given in
n brackets [ ] at the end
d of each qu
uestion or ppart question
n.
At the end
d of the examination, faasten all you
ur work sec curely together.
Fo
or Examiner's Use
1
T
Total
This ques
stion pape r consists of 16 printed pages.
[Tu
urn over
830
2 For
Examiners
Use
1. The pink bollworm moth, Pectinophora gossypiella, is a pest of cotton crops. The size
of its population can be reduced by releasing large numbers of sterile male moths
into cotton fields. The sterile male moths mate with wild females from the cotton
fields, but no offspring are produced.
Over a period of three years, 20 million genetically modified (GM) sterile male moths
were released in the USA. Each insect contained a gene coding for a red fluorescent
protein (DsRed) taken from a species of reef coral. The added DNA also included a
promoter.
(i) genes for fluorescent proteins such as DsRed are now more commonly
used as markers than are genes for antibiotic resistance
......
1. easier to, identify / screen;
2. more economical / time saving / labour saving / harmless;
3. resistance gene(s) can be passed to other bacteria;
......
4. idea of antibiotics no longer effective
or
......
requiring development of new antibiotics;
...... [2]
......
......
...... [3]
(b) DsRed is visible at all stages of the life cycle of the moth, but the presence of
the gene in a particular individual can be confirmed by genetic fingerprinting,
using gel electrophoresis.
......
1. DNA fragmented by, restriction enzyme(s) / endonuclease(s);
2. loaded (into wells) at, negative end / cathode end, (of gel);
3. ref. buffer / electrolyte;
......
4. phosphate groups of DNA give negative charge;
5. (negatively charged) DNA attracted to, anode / positive electrode;
6. separation due to, electric field / PD / potential difference;
......
7. short pieces / smaller mass, move further (in unit time) / move faster; ora
8. ref. impedance of gel / AW;
......
......
......
......
...... [4]
(ii) Explain how the presence of the gene for DsRed in a moth can be
confirmed once electrophoresis is complete.
1. idea of comparison of position with reference DNA;
......
2. ref. staining / fluorescence in UV;
3. by use of DNA probe;
4. ref. single-stranded / complementary base pairing;
......
......
......
...... [2]
(c) DsRed allows sterile male moths to be distinguished from wild moths when
caught in an insect trap in a field of cotton plants.
........ [2]
.........
........ [2]
[Total: 15]
BLANK PAGE
The different treatments are shown in Table 2.1. Each tick represents one of
the eight batches of seeds.
Table. 2.1
Fig. 2.1
(i) Describe, with reference to Fig. 2.1, the effects of the plant growth
substances on the germination of lettuce seeds.
......
in water / in A / with no abscisic acid,
germination increases as conc. GA increases ;
......
when abscisic acid present / in B, no germination ;
......
2 comparative figures (x and y refs. plus units) ;
GA concentration increases,
......
logarithmically / by a factor of 10, on x axis ;
...... [4]
(ii) Explain why all the lettuce seeds were kept at 25 oC.
.........
seedless, fruits / grapes ;
weedkillers ;
.........
rooting powder / to grow cuttings / used in tissue culture ;
control fruit ripening ;
controls fruit drop ;
.........
restrict hedge growth ;
preserve, cut flowers / green vegetables ;
specific example of improved fruit quality ;
........
producing malt / in brewing ; [2]
[Total: 13]
.........
heat DNA to approximately 90 C or to separate strands;
cool to approximately 50 C or to anneal/attach primers;
.........
heat to approx 72 C or Taq/DNA polymerase copies strands;
repeat cycle;
.........
.........
.........
.........
.........
........ [4]
Scientists investigating the performance of athletes found that one gene contributing
to the performance of sprinters is the ACTN3 gene. There are two alleles of the gene,
the 577R allele and the 577X allele. The 577X allele codes for a very short protein
fragment in muscle fibres due to a stop codon mutation.
Table 3.1 summarises the athletic potential for the three possible genotypes for the
ACTN3 gene.
Table. 3.1
A scientist tested sprinters to see if they possessed the 577R allele. Samples were
obtained from athletes muscle fibres. A standard containing proteins of the same
lengths as the proteins coded for by both alleles 577X and 577R was used as a
comparison. The standard and the samples were exposed to gel electrophoresis. In
gel electrophoresis, protein molecules separate in the same way as DNA molecules.
Fig. 3.1
(b) On Fig. 3.1, draw the bands expected for an outstanding sprinter and for a
good sprinter.
.........
On Fig 3.1,
.........
Outstanding Spinter 1 band near well
Good Sprinter 2 bands, same as standard
.........
An outstanding sprinter would have only one band as only one allele is
present/homozygous.
.........
.........
A good sprinter has two different alleles/heterozygous.
.........
.........
........ [4]
Fig. 3.2
(c) The DNA of such a cybrid is 99.6% human. The remaining 0.4% of the DNA
is in the cytoplasm. Explain why there is DNA in the cytoplasm of the cybrid.
.........
1 (mitochondrial DNA) from the cow / not of human origin ;
.........
.........
........ [1]
(d) When the Human Fertilisation and Embryology Bill was considered by the UK
Parliament in 2008, some people argued that it is unethical to allow the
production of cybrids.
State whether you agree or disagree that this is unethical and explain why
you reached this decision.
unethical: .........
1 presence of human and animal DNA means it is partly human and partly cow / a
humananimal .........
hybrid which would not happen in nature ;
2 claims of the benefits of embryonic stem cell research are over-rated / few (if any)
.........
examples of success in medical applications ;
3 dangerous precedent / thin end of the wedge argument / current applications (may be
.........
benign) but will lead to abuse in future ;
4 possibility of unforeseen (irreversible) consequences ;
5 unnecessary.........
because, there already are / will soon be, alternative techniques (to the use
of embryonic stem cells) ;
6 e.g. use of adult stem cells/umbilical cord cells ;
.........
ethical: .........
1 the amount of non-human DNA is very small/negligible ;
2 protocol limits keeping embryo to 14 days (to guard against abuse) so cannot develop
........ [3]
into a whole organism ;
3 provides a more ethical alternative to the use of embryonic stem cells from humans ;
4 can provide many more stem cells than is possible from embryonic stem cells ; [Total: 12]
5 it would be unethical not to use cybrids to relieve, human suffering / e.g. diseases such
as Parkinsons disease ;
6 techniques which offer alternatives to embryonic stem cells builds on work done initially
on embryonic stem cells ;
7 idea that ovum has bovine proteins which would be rejected at implantation ;
Allow other reasonable arguments on either side. If a candidate does not express an opinion,
limit score to one mark unless an attempt has been made to argue that it is a finely balanced
matter. Ignore references to playing God and against religion.
You are required to plan an investigation to compare the activity of urease free in
solution and urease immobilised in alginate beads.
You are provided with the following equipment which you may use or not in your plan,
as you wish. You may not use any additional equipment in your plan.
an unlimited supply of calcium alginate beads all of uniform size prepared with
a 50 g dm-3 urease solution (you may call this immobilised urease)
an unlimited volume of 50 g dm-3 urease solution (you may call this free
urease)
an unlimited volume of 1.0 mol dm-3 urea solution
an unlimited volume of distilled water
beakers and flasks of different sizes
stop watch or electronic timer
broad and narrow range pH papers and liquids with appropriate colour charts,
pH probes and meters
colorimeter and tubes/cuvettes
thermometer
thermostatically-controlled water baths
graduated pipettes and pipette fillers
filter funnels
syringes
glass rods for stirring
test-tubes and boiling tubes
test-tube racks
Your plan should include a clear statement of the hypothesis or prediction and should
identify key variables.
Your plan should be written in clear scientific language and should be illustrated with
a diagram.
Your plan should give full details and explanations of the procedures that you would
adopt to ensure that the results are as precise and reliable as possible. A brief risk
assessment should be included.
[Total: 12]
Hypothesis or prediction ;
e.g. rate of hydrolysis is faster using free enzyme/quantity of urea hydrolysed over time is
greater with free enzyme/immobilised urease catalyses reaction over much longer period of time
Outline of strategy ;
e.g. method of following the reaction taking samples at intervals and calculating the initial rate
Justification/evaluation, of strategy ;
e.g. can only alter concentration of immobilised enzyme by changing number of
beads/limitations of colour comparison these could be awarded at the end of the plan
Risk assessment ;
ref to hazard and precaution
..........
urea solution mixed with pH indicator ;
..........
uncertainty/precision, of results ;
..........
repeats/replicates (calculate means) ;
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
Write your answer to this question on the separate answer paper provided.
Your answer:
should be illustrated by large, clearly labelled diagrams, where appropriate;
must be in continuous prose, where appropriate;
must be set out in sections (a), (b) etc., as indicated in the question.
5.
(a) Describe the genetic diseases SCID (severe combined immunodeficiency) and
cystic fibrosis. [12]
(b) Discuss the factors which prevent gene therapy from becoming an effective
treatment. [8]
(a) describe SCID (severe combined immunodeficiency) and cystic fibrosis. [12]
[Total: 20]
SCID
S1 more males affected (than females);
S2 recessive;
S3 (most common form is) sex-linked (X chromosome);
S4 mutation of IL2RG (interleukin-2 receptor gamma) gene (for gamma chain on
lymphocyte receptor);
S5 ADA (adenosine deaminase) (deficiency);
S6 mutation of gene on chromosome 20;
S7 prevents formation of, lymphocytes / T cells / B cells;
S8 toxic metabolites not broken down so lymphocytes killed;
S9 so susceptible to opportunistic infections;
S10 children usually die (if not treated);
S11 pneumonia / PCP / meningitis / chickenpox / measles / other valid;
CF
C1 autosomal/chromosome 7;
C2 recessive;
C3 mutation of CFTR/CFTCR gene;
C4 deletion of 3 base pair/codons;
C5 CFTR/CFTCR, (protein) has lost phenylalanine;
C6 (channels) no longer able to transport chloride ions
C7 causing thick mucus
C8 resulted in stated problems in lungs/pancreas/reproductive system
C9 reduces life expectancy
(b) discuss the factors which prevent gene therapy from becoming an effective
treatment. [8]
______________________________________________________________________
H2 BIOLOGY 9648/01
Paper 1 Multiple Choice 27 September 2013
1 hour 15 minutes
Additional Materials: OMR
______________________________________________________________________
There are 40 questions in this section. Answer all questions. For each question, there are four
possible answers labelled A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate OMR
answer sheet.
_________________________________________________________________________
This paper consist of 25 printed pages
[Turn over]
846
3 The glycosidic bond that is formed in Y is similar to the glycosidic bond that is
found in cellulose.
A 1 and 3 only
B 2 and 4 only
C 1, 3 and 4 only
D 1, 2, 3 and 4
847
A 2 only
B 1 and 2 only
C 2 and 3 only
D 2, 3 and 4 only
848
3 Which one of the following statements about the cell surface membrane is true?
4 The table below summarises the results from experiments on the rate of absorption of certain
monosaccharides by pieces of mammalian intestine.
A 1 and 3 only
B 1, 2 and 3 only
C 1 and 4 only
D 2 and 4 only
849
A 1>4>3>2
B 1>3>4>2
C 4>1>3>2
D 4>2>3>1
850
6 A biologist counted 2,500 cells from an embryo on a microscope slide and recorded the
following data.
Prophase 125
Metaphase 50
Anaphase 50
Telophase 25
Interphase 2,250
C Protein synthesis mainly occurs during the G1 and G2 phases of the cell cycle.
851
D A lower temperature
852
9 The fig
gure below shows a DN
NA moleculle.
Which
h statementss correctly describe
d the
e polynucleotide?
1T
The structurre labelled A correspo
onds to a pu
urine, while
e the structuure labelled
dB
ccorresponds to a pyrim
midine.
2 T
The antiparrallel nature
e of DNA double helix aligns th
he DNA strrands so th hat
p
phosphodieester bonds s can form properly be
etween the nitrogenouus bases fro
om
o
opposite strrands.
3 D
Distance between
b ad
djacent de oxyribonucleotides is 3.4 and with 10
d
deoxyribonu
ucleotides per ote: 10
p turn. (No = 1 nm)
4 T
The wound DNA doub ble helix coonsists of alternating
a major
m grovees and min
nor
g
groves alon
ng its axis, that is essen
ntial for the binding witth proteins.
A 1 only
B 1 and 2 onlyy
C 3 and 4 only
D 1, 3 and 4 only
853
10 The figure below shows structures that are formed along a DNA molecule of a
eukaryotic cell during S phase of the cell cycle.
Which statement(s) correctly describe the labelled structure and the process that is
taking place?
A 1 and 2 only
B 1 and 3 only
C 3 only
D 3 and 4 only
854
A 1 and 2 only
B 1 and 4 only
C 2 and 3 only
D 1, 2 and 4 only
10
855
12 Which of the following statements correctly describes the type of mutation that gives rise to
sickle cell anaemia?
A Deletion of a codon resulting in the deletion of amino acid phenylalanine at position 508
of the polypeptide chain.
B Deletion of a base pair resulting in the deletion of amino acid phenylalanine at position
508 of the polypeptide chain.
D Base pair substitution of thymine by adenine on the template strand of DNA causes a
change in amino acid from glutamic acid to valine.
13 Which of the following statement correctly describes introns and/or exons in a eukaryotic cell?
B Different combinations of exons and introns allow more than one type of proteins to be
coded for by a gene.
D Single base-pair deletion on the first exon of a gene is likely to be more harmful than one
which occurs on the last exon of a gene.
1 The genes coding for the ribosomal proteins are found in the nucleolus whereas the
genes coding for the spliceosomal proteins are found in other parts of the nucleus.
5 Both are found in the cells which constitute the inner cell mass of a blastocyst.
A 1, 2 and 3
B 1, 4 and 5
C 2, 3 and 6
D 4, 5 and 6
11
856
W X Y Z
16 To date, more than 10 different strains of influenza virus (e.g. H1N1, H2N3, H5N1, H7N9 and
so on) have been documented.
Which of the following structural characteristic of influenza virus makes this possible?
12
857
17 During heat-shock transformation, competent E. coli cells take up plasmid DNA which contains
ampicillin-resistant gene. Successfully transformed cells are allowed to divide for several
generations in a medium without ampicillin. It is observed that some of the E. coli cells are no
longer resistant to ampicillin.
B Incorporation of the plasmid DNA into the heterochromatin region of the bacterial
genome renders the ampicillin-resistant gene inactive.
D Unequal distribution of plasmid during binary fission results in some daughter cells
without plasmids.
B Structure A is made up of protein subunits that are coded for by the genes carried on the
chromosomal DNA in Bacterium X.
13
858
19 In a certain species of bacteria, the gene coding for enzyme X is not transcribed when the
repressor protein binds to the operator gene.
A Enzyme X
B TATA-binding protein
C RNA polymerase
D Repressor protein
20 A fisherman was surprised to catch a fish which had no scales (nude). To investigate the origin
of this phenotype the nude fish was mated several times to fish with scales and the result of
each cross was recorded. In the crosses of nude with scaled, a third phenotype appeared,
which was later called linear. The linear phenotype has only a single line of scales down one
side of the body.
14
859
Crosses involving two loci at a time were set up and their outcomes are shown in the table below.
Cross 1 Cross 2
B Locus 1 and locus 3 undergo independent The albino coat and straight-tailed offspring
assortment. of the test cross are pure breeding.
C Locus 1 and locus 3 are located on the The F1 mice were test crossed with agouti
same chromosome. coat and straight-tailed mice.
D The interaction between locus 1 and locus 3 Locus 1 and locus 2 undergo independent
is an example of epistasis. assortment.
15
860
h of the follo
Which owing can be concluded
d from the result
r of the
e experimennt?
A T
The flies fro
om generation 25 onwa
ards are phenotypically
y identical.
B B
Body size iss inherited in a polygen
nic manner..
D B
Body size iss a sex-linke
ed trait.
A yello
ow-floweredd plant is kn
nown to be homozygou ve at the A/aa locus. The genotype
us recessiv e
at the B/b locus iss unknown.
A abb
aa B AABB C AAbb D aaBB
16
861
M N
24 One of the human blood groups is the MN group. There are two alleles, L and L , at this
gene locus which determine the presence of an antigen, M or N, on the surface of the red
M N
blood cells. The heterozygote L L has a different phenotype from each of the homozygotes.
The frequencies of the phenotypes of the MN blood group were measured in a European
population. Of the 100 individuals sampled, 40 were blood type M, 20 were blood type MN and
40 were blood type N.
N
A The frequency of the L allele in the European population is 0.3.
M
B The frequency of the L allele in the European population is 0.5.
M
C There are 60 L alleles in the European population.
D There is a total pool of 200 alleles at this locus in the European population.
25 In the graph below, the rate of CO2 uptake by plant cells is shown to vary with increasing light
intensity.
17
862
26 Removal of the source of carbon dioxide from photosynthesising chloroplasts results in rapid
changes in the concentration of certain chemicals. Which one of the following represents the
correct combination of concentration changes?
27 Both glucose and appropriate enzymes are necessary for the process of glycolysis to begin.
Which additional compound must also be present?
A acetylcoenzyme A
B ATP
C pyruvate
D reduced NAD
29 A populations gene pool was found to have remained unaltered for many generations. Which
of the following conditions must have existed in the population?
18
863
30 Competition, isolation and selection are thought to be events that take place during the
formation of new species. In which order did these events take place in the process of
speciation to form 13 species of Darwins finches?
31 The dendrite end of the axon is stimulated at the site 1 (see figure below). The excitation is
transferred from site 1 to 2 and then to 3 and 4. The excitation is measured at these sites.
Which statement of impulse frequencies (I) measured at these sites is correct?
A I(1) > I(2) > I(3), I(3) = I(4), I(3) + I(4) = I(2).
19
864
32 Drosophila flies homozygous for the shake mutation are extremely sensitive to diethyl ether
that causes convulsions in homozygous individuals. Convulsions are caused by abnormalities
in nerve impulse conduction as shown in the graph below. Which of the following structures is
impaired in the shake mutations?
A Na+ channels
B K+ channels
C Ca2+ channels
D Na+/ K+ pump
20
865
Which of the following options will allow the selection of the colonies containing the
recombinant form of plasmid X?
C Containing ampicillin,
White colonies
lactose and luciferin
D Containing ampicillin,
Colonies that emit light
lactose and luciferin
21
866
34 A scientist planned to insert a gene of approximately 2719 base pairs into a plasmid vector
using restriction enzyme EcoRI. The diagram below shows the recombinant plasmid with the
gene in the desired orientation.
Restriction mapping can be used to check the orientation of the gene inserted into a plasmid.
The recombinant plasmid is cleaved with restriction enzymes(s) and the fragments are run on
an electrophoresis gel to ascertain their size.
Which of the following results will confirm that the gene was not inserted in the desired
orientation?
Primer 1 Primer 2
A 5 ATTCTCGATCGG 3 5 TCGATATGATCG 3
B 5 CTTCCGATCGAG 3 5 ATTCTCGATCGG 3
C 5 GAAGGCTAGCTC 3 5 GCTAGTATAGCT 3
D 5 CCGATCGAGAAT 3 5 TCGATATGATCG 3
22
867
36 Restriction Fragment Length Polymorphism (RFLP) was used to analyse the inheritance of a
rare mutation that causes the pre-mature degeneration of the nervous system. A genetic
marker on Chromosome 5 was discovered to be associated with the disease and used in the
analysis. Genomic DNA was digested with a restriction enzyme BamHI and the results of the
gel electrophoresis and nucleic acid hybridisation are shown in the diagram below.
Which of the following observations cannot be made from the information provided?
23
868
38 A proposed method of stem cell gene therapy is illustrated in the diagram below.
B only one copy of the normal allele is inserted to treat a recessively inherited disorder.
39 Recent advances in the field of stem cell research have shown that induced pluripotent stem
cells (iPS cells) can be artificially derived from adult somatic cells. iPS cells are mostly similar
to natural pluripotent cells. This implies that
24
869
40 Which of the following theoretical application(s) of information obtained from the Human
Genome Project is/are unethical?
II. Potential parents undergoing genetic testing and genetic counselling prior to
conceiving.
III. Potential parents choosing embryos for implantation only after ante-natal tests for
selected genes.
IV. Increasing insurance premiums for people who are genetically predisposed to cancer.
A I and V
B I and III
C II and III
D III and IV
THE END
25
870
______________________________________________________________________
H2 BIOLOGY 9648/01
Paper 1 Multiple Choice 27 September 2013
1 hour 15 minutes
Additional Materials: OMR
______________________________________________________________________
There are 40 questions in this section. Answer all questions. For each question, there are four
possible answers labelled A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate OMR
answer sheet.
_________________________________________________________________________
This paper consist of 25 printed pages
[Turn over]
871
872
3 The glycosidic bond that is formed in Y is similar to the glycosidic bond that is
found in cellulose.
A 1 and 3 only
B 2 and 4 only
C 1, 3 and 4 only
D 1, 2, 3 and 4
873
A 2 only
B 1 and 2 only
C 2 and 3 only
D 2, 3 and 4 only
874
3 Which one of the following statements about the cell surface membrane is true?
4 The table below summarises the results from experiments on the rate of absorption of certain
monosaccharides by pieces of mammalian intestine.
A 1 and 3 only
B 1, 2 and 3 only
C 1 and 4 only
D 2 and 4 only
875
A 1>4>3>2
B 1>3>4>2
C 4>1>3>2
D 4>2>3>1
876
6 A biologist counted 2,500 cells from an embryo on a microscope slide and recorded the
following data.
Prophase 125
Metaphase 50
Anaphase 50
Telophase 25
Interphase 2,250
877
C Protein synthesis mainly occurs during the G1 and G2 phases of the cell cycle.
D A lower temperature
878
9 The fig
gure below shows a DN
NA moleculle.
Which
h statementss correctly describe
d the
e polynucleotide?
1T
The structurre labelled A correspo
onds to a pu
urine, while
e the structuure labelled
dB
ccorresponds to a pyrim
midine.
2 T
The antiparrallel nature
e of DNA double helix aligns th
he DNA strrands so th hat
p
phosphodieester bonds s can form properly be
etween the nitrogenouus bases fro
om
o
opposite strrands.
3 D
Distance between
b ad
djacent de oxyribonucleotides is 3.4 and with 10
d
deoxyribonu
ucleotides per ote: 10
p turn. (No = 1 nm)
4 T
The wound DNA doub ble helix coonsists of alternating
a major
m grovees and min
nor
g
groves alon
ng its axis, that is essen
ntial for the binding witth proteins.
A 1 only
B 1 and 2 onlyy
C 3 and 4 only
D 1, 3 and 4 only
879
10 The figure below shows structures that are formed along a DNA molecule of a
eukaryotic cell during S phase of the cell cycle.
Which statement(s) correctly describe the labelled structure and the process that is
taking place?
A 1 and 2 only
B 1 and 3 only
C 3 only
D 3 and 4 only
10
880
A 1 and 2 only
B 1 and 4 only
C 2 and 3 only
D 1, 2 and 4 only
12 Which of the following statements correctly describes the type of mutation that gives rise to
sickle cell anaemia?
A Deletion of a codon resulting in the deletion of amino acid phenylalanine at position 508
of the polypeptide chain.
B Deletion of a base pair resulting in the deletion of amino acid phenylalanine at position
508 of the polypeptide chain.
D Base pair substitution of thymine by adenine on the template strand of DNA causes a
change in amino acid from glutamic acid to valine.
11
881
13 Which of the following statement correctly describes introns and/or exons in a eukaryotic cell?
B Different combinations of exons and introns allow more than one type of proteins to be
coded for by a gene.
D Single base-pair deletion on the first exon of a gene is likely to be more harmful than one
which occurs on the last exon of a gene.
1 The genes coding for the ribosomal proteins are found in the nucleolus whereas the
genes coding for the spliceosomal proteins are found in other parts of the nucleus.
5 Both are found in the cells which constitute the inner cell mass of a blastocyst.
A 1, 2 and 3
B 1, 4 and 5
C 2, 3 and 6
D 4, 5 and 6
12
882
W X Y Z
16 To date, more than 10 different strains of influenza virus (e.g. H1N1, H2N3, H5N1, H7N9 and
so on) have been documented.
Which of the following structural characteristic of influenza virus makes this possible?
13
883
17 During heat-shock transformation, competent E. coli cells take up plasmid DNA which contains
ampicillin-resistant gene. Successfully transformed cells are allowed to divide for several
generations in a medium without ampicillin. It is observed that some of the E. coli cells are no
longer resistant to ampicillin.
B Incorporation of the plasmid DNA into the heterochromatin region of the bacterial
genome renders the ampicillin-resistant gene inactive.
D Unequal distribution of plasmid during binary fission results in some daughter cells
without plasmids.
B Structure A is made up of protein subunits that are coded for by the genes carried on the
chromosomal DNA in Bacterium X.
14
884
19 In a certain species of bacteria, the gene coding for enzyme X is not transcribed when the
repressor protein binds to the operator gene.
A Enzyme X
B TATA-binding protein
C RNA polymerase
D Repressor protein
20 A fisherman was surprised to catch a fish which had no scales (nude). To investigate the origin
of this phenotype the nude fish was mated several times to fish with scales and the result of
each cross was recorded. In the crosses of nude with scaled, a third phenotype appeared,
which was later called linear. The linear phenotype has only a single line of scales down one
side of the body.
15
885
Crosses involving two loci at a time were set up and their outcomes are shown in the table below.
Cross 1 Cross 2
B Locus 1 and locus 3 undergo independent The albino coat and straight-tailed offspring
assortment. of the test cross are pure breeding.
C Locus 1 and locus 3 are located on the The F1 mice were test crossed with agouti
same chromosome. coat and straight-tailed mice.
D The interaction between locus 1 and locus 3 Locus 1 and locus 2 undergo independent
is an example of epistasis. assortment.
16
886
h of the follo
Which owing can be concluded
d from the result
r of the
e experimennt?
A T
The flies fro
om generation 25 onwa
ards are phenotypically
y identical.
B B
Body size iss inherited in a polygen
nic manner..
D B
Body size iss a sex-linke
ed trait.
A yello
ow-floweredd plant is kn
nown to be homozygou ve at the A/aa locus. The genotype
us recessiv e
at the B/b locus iss unknown.
A abb
aa B AABB C AAbb D aaBB
17
887
M N
24 One of the human blood groups is the MN group. There are two alleles, L and L , at this
gene locus which determine the presence of an antigen, M or N, on the surface of the red
M N
blood cells. The heterozygote L L has a different phenotype from each of the homozygotes.
The frequencies of the phenotypes of the MN blood group were measured in a European
population. Of the 100 individuals sampled, 40 were blood type M, 20 were blood type MN and
40 were blood type N.
N
A The frequency of the L allele in the European population is 0.3.
M
B The frequency of the L allele in the European population is 0.5.
M
C There are 60 L alleles in the European population.
D There is a total pool of 200 alleles at this locus in the European population.
25 In the graph below, the rate of CO2 uptake by plant cells is shown to vary with increasing light
intensity.
18
888
26 Removal of the source of carbon dioxide from photosynthesising chloroplasts results in rapid
changes in the concentration of certain chemicals. Which one of the following represents the
correct combination of concentration changes?
27 Both glucose and appropriate enzymes are necessary for the process of glycolysis to begin.
Which additional compound must also be present?
A acetylcoenzyme A
B ATP
C pyruvate
D reduced NAD
28 What happens to most of the reduced NADP molecules in cell metabolism?
29 A populations gene pool was found to have remained unaltered for many generations. Which
of the following conditions must have existed in the population?
19
889
30 Competition, isolation and selection are thought to be events that take place during the
formation of new species. In which order did these events take place in the process of
speciation to form 13 species of Darwins finches?
31 The dendrite end of the axon is stimulated at the site 1 (see figure below). The excitation is
transferred from site 1 to 2 and then to 3 and 4. The excitation is measured at these sites.
Which statement of impulse frequencies (I) measured at these sites is correct?
A I(1) > I(2) > I(3), I(3) = I(4), I(3) + I(4) = I(2).
20
890
32 rosophila flies homozygous for the shake mutation are extremely sensitive to diethyl ether that
causes convulsions in homozygous individuals. Convulsions are caused by abnormalities in
nerve impulse conduction as shown in the graph below. Which of the following structures is
impaired in the shake mutations?
A Na+ channels
B K+ channels
C Ca2+ channels
D Na+/ K+ pump
21
891
Which of the following options will allow the selection of the colonies containing the
recombinant form of plasmid X?
C Containing ampicillin,
White colonies
lactose and luciferin
D Containing ampicillin,
Colonies that emit light
lactose and luciferin
22
892
34 A scientist planned to insert a gene of approximately 2719 base pairs into a plasmid vector
using restriction enzyme EcoRI. The diagram below shows the recombinant plasmid with the
gene in the desired orientation.
Restriction mapping can be used to check the orientation of the gene inserted into a plasmid.
The recombinant plasmid is cleaved with restriction enzymes(s) and the fragments are run on
an electrophoresis gel to ascertain their size.
Which of the following results will confirm that the gene was not inserted in the desired
orientation?
Primer 1 Primer 2
A 5 ATTCTCGATCGG 3 5 TCGATATGATCG 3
B 5 CTTCCGATCGAG 3 5 ATTCTCGATCGG 3
C 5 GAAGGCTAGCTC 3 5 GCTAGTATAGCT 3
D 5 CCGATCGAGAAT 3 5 TCGATATGATCG 3
23
893
36 Restriction Fragment Length Polymorphism (RFLP) was used to analyse the inheritance of a
rare mutation that causes the pre-mature degeneration of the nervous system. A genetic
marker on Chromosome 5 was discovered to be associated with the disease and used in the
analysis. Genomic DNA was digested with a restriction enzyme BamHI and the results of the
gel electrophoresis and nucleic acid hybridisation are shown in the diagram below.
Which of the following observations cannot be made from the information provided?
24
894
38 A proposed method of stem cell gene therapy is illustrated in the diagram below.
B only one copy of the normal allele is inserted to treat a recessively inherited disorder.
39 Recent advances in the field of stem cell research have shown that induced pluripotent stem
cells (iPS cells) can be artificially derived from adult somatic cells. iPS cells are mostly similar
to natural pluripotent cells. This implies that
25
895
40 Which of the following theoretical application(s) of information obtained from the Human
Genome Project is/are unethical?
II. Potential parents undergoing genetic testing and genetic counselling prior to
conceiving.
III. Potential parents choosing embryos for implantation only after ante-natal tests for
selected genes.
IV. Increasing insurance premiums for people who are genetically predisposed to cancer.
A I and V
B I and III
C II and III
D III and IV
THE END
26
896
CANDIDATE
NAME
CIVICS INDEX
GROUP 1 2 S NUMBER
_______________________________________________________________________________
H2 BIOLOGY 9648/02
Paper 2 Core Paper 18 September 2013
2 hours
Additional Materials: Answer papers
_______________________________________________________________________________
Section A
Answer all questions.
For examiners Use
Section B Section A
Answer any one question.
1 / 10
7 / 10
Section B
8/9 / 20
Total /100
________________________________________________________________________________
This paper consists of 21 printed pages.
[Turn over]
JC2Prelim2013Biology9648/02 1
897
QUESTION 1
Heavy metal ions are waste products of many industrial processes and at times may leak into the
ocean and cause environmental pollution. The toxic effects of heavy metals on organisms stems
from their effect on metabolically-important enzymes, such as lactate dehydrogenase. Lactate
dehydrogenase catalyses the conversion of pyruvate into lactate.
Fig. 1.1 shows the effect of varying concentrations of mercury ions on the rate of reaction
catalysed by lactate dehydrogenase isolated from Oreochromis mossambicus, a species of fish.
Fig. 1.1
JC2Prelim2013Biology9648/02 2
898
(a) Describe and explain the effect of mercury ions on the rate of reaction catalysed by lactate For
dehydrogenase. [4] Examiners
Use
.........
.........
.........
.........
.........
.........
.........
.........
(b) Explain how mercury ions may affect the survival of the fish when oxygen concentrations are
low. [3]
.........
.........
.........
.........
.........
.........
JC2Prelim2013Biology9648/02 3
899
Human lysozyme is an important enzyme which is part of the human body's defence against For
some bacteria. It is found in abundance in tears, saliva and mucous. The main action of Examiners
Use
lysozyme is to catalyse the hydrolysis of -(1,4) glycosidic bonds between N-acetylmuramate
(NAM) and N-acetylglucosamine (NAG) sugar residues in the peptidoglycan cell walls of bacteria.
With the weakened cell wall, the bacterial cells are more likely to undergo lysis.
Fig. 1.2
(c) With reference to Fig. 1.2 and with your knowledge of haemoglobin, state two structural
differences between lysozyme and haemoglobin. [2]
1. ...
...
2. ...
...
(d) Suggest why some bacteria are more resistant to digestion by lysozymes. [1]
.........
.........
[Total: 10]
JC2Prelim2013Biology9648/02 4
900
QUESTION 2 For
Fig. 2.1 illustrates the Central Dogma, which describes the flow of genetic information from DNA Examiners
Use
to RNA to proteins.
Fig. 2.1
(a) Explain, with an example, how the Central Dogma may not always hold true. [2]
.........
.........
.........
.........
(b) Describe how the information carried on mRNA allows the synthesis of a complete
polypeptide chain. [3]
.........
.........
.........
.........
.........
.........
JC2Prelim2013Biology9648/02 5
901
A ribonucleoprotein is a protein that is associated with RNA. The ribosome is an example of a For
ribonucleoprotein. Prokaryotes have 70S ribosomes while eukaryotes have 80S ribosomes, each Examiners
Use
consisting of a small and large subunit. In prokaryotes, the small subunit is made up of a 16S
rRNA associated with 21 proteins. Fig. 2.2 shows the structure of a 16S rRNA.
Fig. 2.2
JC2Prelim2013Biology9648/02 6
902
(c) 16S rRNA and tRNA are both made up of four types of ribonucleotides linked by For
phosphodiester bonds. Examiners
Use
State two other similarities between the structures of the 16S rRNA and tRNA. [2]
1. ...
...
2. ...
...
.........
.........
.........
.........
.........
.........
.........
.........
(e) Suggest how prokaryotes are still able to secrete proteins. [1]
.........
.........
[Total: 12]
JC2Prelim2013Biology9648/02 7
903
QUESTION 3 For
The Human Immunodeficiency Virus (HIV) weakens the immune system, causing the patient to Examiners
Use
succumb to secondary infections, leading to the development of AIDS. The first recognized case
of AIDS was reported in 1981 in Los Angeles, U.S.A.
Fig. 3.1 shows the binding of a HIV particle to a T cell. The viral receptor gp120 trimer binds to
both CD4 and a co-receptor called CCR5 on the T cell surface.
Fig. 3.1
(a) Explain why the composition of the viral envelope is similar to the composition of the T cell
membrane. [1]
.........
.........
(b) Individuals who carry a mutation known as CCR532 in both copies of the CCR5 gene are
resistant to certain strains of HIV. The CCR532 allele is a result of a deletion of a particular
sequence of 32 base-pairs within the exon of CCR5 gene.
Explain how an individual who is homozygous for the CCR532 allele is resistant to HIV. [4]
.........
.........
.........
.........
.........
.........
.........
JC2Prelim2013Biology9648/02 8
904
(c) It was observed that this strain of HIV that uses CCR5 as the co-receptor quickly evolves into For
another strain which bind to another co-receptor known as CXCR4. Examiners
Use
Suggest and explain how HIV can evolve to use CXCR4 as the co-receptor. [2]
.........
.........
.........
.........
(d) The allele frequency of CCR5-32 is unusually high in the western European countries, with
up to 20% of ethnic western Europeans carrying this allele, which is rare or absent in all other
ethnic groups throughout the world.
.........
.........
(e) A technique called RNA interference has been shown to slow down the replication of HIV in
vitro. Double-stranded RNA molecules, 21 to 23 nucleotides long, were added to a culture of
T cells infected with HIV. The sequence of this small interfering RNA (siRNA) matches part of
the HIV protease gene. Once inside the T cell, the two strands of the siRNA separate into
single strands. One of the strands is identical in sequence to the mRNA of the HIV protease.
Explain how this siRNA is able to interfere with HIV replication. [4]
.........
.........
.........
.........
.........
.........
.........
[Total: 12]
JC2Prelim2013Biology9648/02 9
905
QUESTION 4 For
Gene expression in eukaryotic cells can be controlled in many ways, one of which is the Examiners
Use
regulation of mRNA production. Fig. 4.1 shows how transcription can be controlled.
Fig. 4.1
(a) Using the information in Fig. 4.1 and with your knowledge on the control of eukaryotic gene
expression, explain how transcription is initiated. [4]
.........
.........
.........
.........
.........
.........
.........
JC2Prelim2013Biology9648/02 10
906
Ubiquitin-dependent protein degradation in the proteasome is one way in which the amount of For
cytosolic proteins in a cell can be controlled at the post-translational level. An amino acid Examiners
Use
sequence of proline, glutamic acid, serine and threonine (PEST) in a protein are often recognized
by enzymes and tagged with ubiquitin proteins. Globular proteins in their correct conformation
are not tagged for degradation.
(b) Using the above information, suggest why denatured cytosolic proteins can be tagged with
ubiquitin. [1]
.........
.........
Suggest how transmembrane proteins on the cell surface are degraded. [2]
.........
.........
.........
JC2Prelim2013Biology9648/02 11
907
Ovalbumin
O g
gene from chicken wa as isolated and made single-stra anded, whicch was then mixed For
to
ogether witth its maturre mRNA. The
T results were obse erved underr an electroon microsco
ope. Fig. Examiners
E
Use
4.2
4 shows the electron n micrograph and its co orrespondin
ng diagrammatic repreesentation, showing
s
th
he binding oof the mRNA to certain
n regions off the DNA.
F
Fig. 4.2
(d) Explain w
why loops (A
( G) were observed . [3]
.........
.........
.........
.........
.........
.........
(e
e) Explain w
why the reg
gion of the mRNA, ind
dicated by th
he arrow in Fig. 4.2, reemains unb
bound to
DNA. [2]
.........
.........
.........
.........
JC 02
C2Prelim2013Biology9648/0 12
908
Repeating nucleotide sequences are common in the genome of eukaryotes. These repeating For
sequences have been commonly referred to as junk DNA. Examiners
Use
.........
.........
.........
[Total: 14]
JC2Prelim2013Biology9648/02 13
909
QUESTION 5 For
Hereditary hypophosphatemic rickets is a genetic disorder that results on low level of phosphate Examiners
Use
in the blood (hypophosphatemia).
Fig. 5.1 shows the inheritance of this disease over four generations in an extended family.
Fig. 5.1
.........
.........
.........
.........
(b) Using the symbols D/d to represent the alleles, construct a genetic diagram to show how
individual III-7 and III-8 can pass on the disease to their children. [4]
JC2Prelim2013Biology9648/02 14
910
Fur colour of Labrador dogs is controlled by two genes, B/b and E/e. The genes are on different For
pairs of chromosomes. Examiners
Use
Allele B produces black fur while allele b produces brown fur. However, the colour is expressed
only in the presence of allele E. In the absence of allele E, the dogs are beige in colour, hence
the name Golden Labrador.
(c) Explain how the phenotypic ratio will differ if genes B/b and E/e are located on the same
homologous pair of chromosomes, as shown in Fig. 5.2. [3]
Fig. 5.2
.........
.........
.........
.........
.........
[Total: 9]
JC2Prelim2013Biology9648/02 15
911
QUESTION 6
(a) Describe the role of the following ions in impulse transmission along a nerve cell.
+
(i) Na [2]
...
...
...
+
(ii) K [2]
...
...
...
2+
(b) Describe the role of Ca in the passage of impulses across a synapse. [3]
.........
.........
.........
.........
.........
.........
2+
(c) Explain why the concentration of Ca in the cytosol of the synaptic knob remains low despite
frequent opening of channels. [2]
.........
.........
.........
JC2Prelim2013Biology9648/02 16
912
A water-soluble toxin, muscarine, derived from a mushroom, causes deceleration of the heart For
rate, resulting in death of individuals. Fig. 6.1 shows the signalling pathway of muscarine on a Examiners
Use
postsynaptic membrane.
Fig. 6.1
(d) Describe how muscarine results in inhibition of nerve transmission in heart muscle cells. [4]
.........
.........
.........
.........
.........
.........
.........
.........
[Total: 13]
JC2Prelim2013Biology9648/02 17
913
QUESTION 7 For
Fig. 7.1 shows the distribution of malaria and the allele frequency of the sickle cell allele. Examiners
Use
Fig. 7.1
(a) Describe and explain the correlation between the occurrence of malaria and the frequency of
the sickle cell allele. [4]
.........
.........
.........
.........
.........
.........
.........
.........
JC2Prelim2013Biology9648/02 18
914
The evolution of haemoglobin molecules has been studied extensively by comparing the amino For
acid sequences in both myoglobin and haemoglobin. Myoglobin is used for oxygen storage while Examiners
Use
haemoglobin is used for oxygen transport. Ancient prehistoric animals had a single chain of
simple globin for oxygen storage and transport.
About 500 million years ago, a gene duplication event occurred and one copy became the
present day myoglobin and the other evolved into an oxygen-transport protein that gave rise to
the present day haemoglobin (Fig. 7.2).
Fig. 7.2
(b) State how many years ago the haemoglobin molecule diverged into chains and chains. [1]
.........
(c) Suggest why changes observed in the sequence of amino acids may lead to an under-
estimation of the actual number of mutations. [2]
.........
.........
.........
.........
JC2Prelim2013Biology9648/02 19
915
(d) Explain how variations in the haemoglobin gene can be used as a molecular clock. [3] For
Examiners
Use
.........
.........
.........
.........
.........
.........
[Total: 10]
JC2Prelim2013Biology9648/02 20
916
Section B For
Answer ONE question Examiners
Use
QUESTION 8
(c) Discuss, with a named example, how mutation to centromeres can result in genetic disorders.
[7]
[Total: 20]
QUESTION 9
(a) Describe and explain how the structures of chloroplasts and mitochondria are similarly
adapted for their functions. [8]
(c) Explain the concept of negative feedback in controlling insulin levels in the body. [5]
[Total: 20]
End of Section B
JC2Prelim2013Biology9648/02 21
917
CANDIDATE
NAME
CIVICS INDEX
GROUP 1 2 S NUMBER
_______________________________________________________________________________
H2 BIOLOGY 9648/02
Paper 2 Core Paper 18 September 2013
2 hours
Additional Materials: Answer papers
_______________________________________________________________________________
Section A
Answer all questions.
6 / 13
ANSWERSCHEME 7
Section B
/ 10
8/9 / 20
Total /100
________________________________________________________________________________
This paper consists of ___ printed pages.
[Turn over]
JC2Prelim2013Biology9648/02 1
918
Section A (Part I)
Answer all the questions in this section.
QUESTION 1
Heavy metal ions are waste products of many industrial processes and at times may leak into the
ocean and cause environmental pollution. The toxicity of heavy metals on organisms stems from
their effect on metabolically-important enzymes, such as lactate dehydrogenase. Lactate
dehydrogenase catalyses the conversion of pyruvate into lactate.
Fig. 1.1 shows the effect of varying concentrations of mercury ions on the rate of reaction
catalysed by lactate dehydrogenase isolated from Oreochromis mossambicus, a species of fish.
Fig. 1.1
JC2Prelim2013Biology9648/02 2
919
(a) Describe and explain the effect of mercury ions on the rate of reaction catalysed by lactate
dehydrogenase. [4]
In the presence of 10g/ml of mercury, the maximum rate (Vmax) of reaction decreased
from 0.048 arbitrary units to 0.033 arbitrary units.
Has a different structure from the substrate pyruvate and binds permanently / irreversibly
to another site away from the active site on the enzyme
Forms a strong covalent bond to an amino acid R group (e.g. -SH group) on the enzyme.
This causes a conformational change on the enzyme which alters the shape of the active
site.
Increasing substrate/pyruvate concentration will not allow the maximum rate of reaction to be
achieved.
(b) Explain how mercury ions may affect the survival of the fish when oxygen concentrations are
low. [3]
When oxygen concentrations are low, aerobic respiration cannot produce sufficient ATP.
In addition, the fish cannot carry out anaerobic respiration in the presence of mercury
ions
Hence, glycolysis cannot continue to produce ATP via substrate level phosphorylation.
Thus ATP-requiring cellular activities are inhibited, causing the death of the fish.
JC2Prelim2013Biology9648/02 3
920
Human lysozyme is an important enzyme which is part of the human body's defence against
some bacteria. It is found in abundance in tears, saliva and mucous. The main action of
lysozyme is to catalyse the hydrolysis of -(1,4) glycosidic bonds between N-acetylmuramate
(NAM) and N-acetylglucosamine (NAG) sugar residues in the peptidoglycan cell walls of bacteria.
With the weakened cell wall, the bacterial cells are more likely to undergo lysis.
Fig. 1.2
(c) With reference to Fig. 1.2 and with your knowledge of haemoglobin, state two structural
differences between lysozyme and haemoglobin. [2]
The secondary structure of lysozyme consists of -helices and -pleated sheets, whereas
the secondary structure of haemoglobin consists of only -helices.
Lysozyme is a protein with a tertiary structure as it consists of only one polypeptide chain,
whereas haemoglobin is a protein with a quaternary structure as it consists of four
polypeptide chains.
Lysozyme does not carry a prosthetic group, whereas each polypeptide chain in
haemoglobin carries a prosthetic (non-proteinaceous) haem group containing Fe2+ which
binds a molecule of oxygen each.
(d) Suggest why some bacteria are more resistant to digestion by lysozymes. [1]
These bacteria cells have a slime layer that makes the -(1,4) glycosidic bonds less
accessible to the lysozymes.
These bacteria cells (gram negative bacteria) have a lower proportion of peptidoglycan in
their cell walls.
These bacteria (gram negative bacteria) have an additional outer membrane that makes the
-(1,4) glycosidic bonds less accessible to the lysozymes.
[Total: 10]
JC2Prelim2013Biology9648/02 4
921
QUESTION 2
Fig. 2.1 illustrates the Central Dogma, which describes the flow of genetic information from DNA
to RNA to proteins.
Fig. 2.1
(a) Explain, with an example, how the Central Dogma may not always hold true. [2]
JC2Prelim2013Biology9648/02 5
922
(b) Describe how the information carried on mRNA allows the synthesis of a complete
polypeptide chain. [3]
The stop codon (UAG, UAA, UGA) terminates translation by allowing the binding of a
release factor that adds a water molecule to the polypeptide chain
JC2Prelim2013Biology9648/02 6
923
Fig. 2.2
JC2Prelim2013Biology9648/02 7
924
(c) 16S rRNA and tRNA are both made up of four types of ribonucleotides linked by
phosphodiester bonds.
State two other similarities between the structures of the 16S rRNA and tRNA. [2]
Both have intra-molecular hydrogen bonds between complementary bases / between A&U
and C&G.
Ribosomal protein is transported from the cytoplasm into nucleus via nuclear pore
Partial assembly of rRNA and ribosomal proteins into large and small subunits occurs in
nucleolus
(e) Suggest how prokaryotes are still able to secrete proteins. [1]
Prokaryotes have protein channels in the cell surface membrane that allows secretion of
proteins
[Total: 12]
JC2Prelim2013Biology9648/02 8
925
QUESTION 3
The Human Immunodeficiency Virus (HIV) weakens the immune system, causing the patient to
succumb to secondary infections, leading to the development of AIDS. The first recognized case
of AIDS was reported in 1981 in Los Angeles, U.S.A.
Fig. 3.1 shows the binding of a HIV particle to a T cell. The viral receptor gp120 trimer binds to
both CD4 and a co-receptor called CCR5 on the T cell surface.
Fig. 3.1
(a) Explain why the composition of the viral envelope is similar to the composition of the T cell
membrane. [1]
Viral membrane is derived from the host cell when the virus exits the host cell via
budding
JC2Prelim2013Biology9648/02 9
926
(b) Individuals who carry a mutation known as CCR532 in both copies of the CCR5 gene are
resistant to certain strains of HIV. The CCR532 allele is a result of a deletion of a particular
sequence of 32 base-pairs within the exon of CCR5 gene.
Explain how an individual who is homozygous for the CCR532 allele is resistant to HIV. [4]
Loss-of-function mutation
The shape of the mutant CCR5 co-receptor no longer complementary to the shape of
gp120 hence cannot bind
Loss-of-function mutation
The deletion causes mis-folding of the CCR5 co-receptor, leading to its degradation.
(c) It was observed that this strain of HIV that uses CCR5 as the co-receptor quickly evolves into
another strain which bind to another co-receptor known as CXCR4.
Suggest and explain how HIV can evolve to use CXCR4 as the co-receptor. [2]
The conformation of the mutated gp120 protein is complementary to and binds CCXR4
(d) The allele frequency of CCR5-32 is unusually high in the western European countries, with
up to 20% of ethnic western Europeans carrying this allele, which is rare or absent in all other
ethnic groups throughout the world.
Founders effect a small group of individuals from a larger population, some of whom carry
the CCR5-32 allele, colonized/established a new population in the western European
countries.
JC2Prelim2013Biology9648/02 10
927
(e) A technique called RNA interference has been shown to slow down the replication of HIV in
vitro. Double-stranded RNA molecules, 21 to 23 nucleotides long, were added to a culture of
T cells infected with HIV. The sequence of this small interfering RNA (siRNA) matches part of
the HIV protease gene. Once inside the T cell, the two strands of the siRNA separate into
single strands. One of the strands is identical in sequence to the mRNA of the HIV protease.
Explain how this siRNA is able to interfere with HIV replication. [4]
The other strand of the siRNA is complementary to and binds to the mRNA of HIV protease
Interferes with translation of the HIV protease mRNA into the enzyme protease, hence new
HIV protease is not produced.
During subsequent infection, HIV polyprotein is not cleaved into the functional HIV
polypeptides
One strand of the siRNA is complementary to and binds to the (+) RNA of HIV protease.
No double-stranded DNA is formed and hence no integration of dsDNA of HIV into host
genome
No new (+)RNA genome / HIV mRNA will be formed, hence interfering with assembly.
[Total: 12]
JC2Prelim2013Biology9648/02 11
928
QUESTION 4
Gene expression in eukaryotic cells can be controlled in many ways, one of which is the
regulation of mRNA production. Fig. 4.1 shows how transcription can be controlled.
Fig. 4.1
(a) Using the information in Fig. 4.1 and your knowledge of the control of eukaryotic gene
expression, explain how transcription is initiated. [4]
Loosen the attraction between the negatively-charged DNA and octameric histone
JC2Prelim2013Biology9648/02 12
929
Ubiquitin-dependent protein degradation in the proteasome is one way by which the amount of
cytosolic proteins in a cell can be controlled at the post-translational level. An amino acid
sequence of proline, glutamic acid, serine and threonine (PEST) in a protein are often recognized
by enzymes and tagged with ubiquitin proteins. Globular proteins in their correct conformation
are not tagged for degradation.
(b) Using the above information, suggest why denatured cytosolic proteins can be tagged with
ubiquitin. [1]
Denaturation exposes the hidden PEST sequence within the hydrophobic core of the protein
to be tagged with ubiquitin by enzymes.
Suggest how transmembrane proteins on the cell surface are degraded. [2]
JC2Prelim2013Biology9648/02 13
930
Ovalbumin
O g
gene from chicken wa as isolated and made single-stra anded, whicch was then mixed
to
ogether witth its maturre mRNA. The
T results were obse erved underr an electroon microsco
ope. Fig.
4.2
4 shows the electron n micrograph and its co orrespondin
ng diagrammatic repreesentation, showing
s
th
he binding oof the mRNA to certain
n regions off the DNA.
F
Fig. 4.2
(d) Explain w
why loops (A
( G) were observed . [3]
e) Explain w
(e why the reg
gion of the mRNA, ind
dicated by th
he arrow in Fig. 4.2, reemains unb
bound to
DNA. [2]
There is no corresp
ponding stre
etch of thymmine on the template DNA
D where the poly(A)) tail can
form com
mplementarry base pairr with / not ccomplementary to the DNA
D templaate
JC 02
C2Prelim2013Biology9648/0 14
931
Repeating nucleotide sequences are common in the genome of eukaryotes. These repeating
sequences have been commonly referred to as junk DNA.
[Total: 14]
JC2Prelim2013Biology9648/02 15
932
QUESTION 5
Hereditary hypophosphatemic rickets is a genetic disorder that results in low level of phosphate
in the blood (hypophosphatemia).
Fig. 5.1 shows the inheritance of this disease over four generations in an extended family.
Fig. 5.1
An affected male pasess the disease allele on the X chromosome to all his daughters but
not his son + citing any one example
o I-2 passed the dominant allele to daughters II-1, II-4, II-8 but not to the sons
o III-7 passed the dominant allele to daughters IV-5 and IV-6 but not to the sons
o III-3 passed the dominant allele to daughters IV-3 but not to the sons
o III-11 passed the dominant allele to daughters IV-9 and IV-10 but not to the sons
(b) Using the symbols D/d to represent the alleles, construct a genetic diagram to show how
individual III-7 and III-8 can pass on the disease to their children. [4]
D d D d d d
F1 genotype X X X X X Y X Y
JC2Prelim2013Biology9648/02 16
933
Fur colour of Labrador dogs is controlled by two genes, B/b and E/e. The genes are on different
pairs of chromosomes.
Allele B produces black fur while allele b produces brown fur. However, the colour is expressed
only in the presence of allele E. In the absence of allele E, the dogs are beige in colour, hence
the name Golden Labrador.
(c) Explain how the phenotypic ratio will differ if genes B/b and E/e are located on the same
homologous pair of chromosomes, as shown in Fig. 5.2. [3]
Fig. 5.2
3 black : 1 golden
Tightly linked, hence no crossing over / chiasma not formed between gene B/b and E/e.
Inherited as one unit
No recombinant gametes
No fixed ratio
Large number of black and golden, small number of brown dogs
Closely linked, hence crossing over between gene B/b and E/e occurs at low frequency.
Small number of recombinant gametes
[Total: 9]
JC2Prelim2013Biology9648/02 17
934
QUESTION 6
(a) Describe the role of the following ions in impulse transmission along a nerve cell.
+
(i) Na [2]
Influx of/ movement of Na+ ions into the axoplasm via facilitated diffusion through
voltage-gated Na+ channels and causes depolarization
+
(ii) K [2]
2+
(b) Describe the role of Ca in the passage of impulses across a synapse. [3]
Ca2+ influx into presynaptic neuron via facilitated diffusion through voltage-gated Ca2+
channels
The increase in Ca2+ causes vesicles that contain neurotransmitters to move to and fuse
with presynaptic membrane
2+
(c) Explain why the concentration of Ca in the cytosol of the synaptic knob remains low despite
frequent opening of channels. [2]
that actively transport / pump Ca2+ out of the cytosol of synaptic knob at the expense of
ATP.
JC2Prelim2013Biology9648/02 18
935
A water-soluble toxin, muscarine, derived from the mushroom, causes deceleration of the heart
rate, resulting in death of individuals. Fig. 6.1 shows the signalling pathway of muscarine on
postsynaptic membrane.
Fig. 6.1
(d) Describe how muscarine results in inhibition of nerve transmission in heart muscle cells. [4]
3. IP3 binds to the IP3/ligand-gated Ca2+ channel and cause the opening of Ca2+ channels
on the ER, resulting in the release of Ca2+ ions into the cytosol.
4. This increase the membrane potential causing the opening of voltage-gated K+ channel,
and hence the efflux of K+ ions into the synaptic cleft
[Total: 13]
JC2Prelim2013Biology9648/02 19
936
QUESTION 7
Fig. 7.1 shows the distribution of malaria and the allele frequency of the sickle cell allele.
Fig. 7.1
(a) Describe and explain the correlation between the occurrence of malaria and the frequency of
the sickle cell allele. [4]
Heterozygous / sickle cell traits individuals are at selective advantage in malaria affected
areas / more resistant to malaria
Heterozygous individuals survive to reproduce and pass on the sickle cell allele to viable
and fertile offspring
hence increasing the HbS allele frequencies in the population within these malaria
areas over time.
JC2Prelim2013Biology9648/02 20
937
The evolution of haemoglobin molecules has been studied extensively by comparing the amino
acid sequences in both myoglobin and haemoglobin. Myoglobin is used for oxygen storage while
haemoglobin is used for oxygen transport. Ancient prehistoric animals had a single chain of
simple globin for oxygen storage and transport.
About 500 million years ago, a gene duplication event occurred and one copy became the
present day myoglobin and the other evolved into an oxygen-transport protein that gave rise to
the present day haemoglobin (Fig. 7.2).
Fig. 7.2
(b) State how many years ago the haemoglobin molecule diverged into chains and chains. [1]
(c) Suggest why changes observed in the sequence of amino acids may lead to an under-
estimation of the actual number of mutations. [2]
A mutation may result in the same amino acid being produced due to genetic code being
degenerate
Some mutations may have occurred in the non-coding DNA region / introns
(d) Explain how variations in the haemoglobin gene can be used as a molecular clock. [3]
The mutation in the gene coding for haemoglobin occurred at a constant rate through time
The number of nucleotide differences can be used as a gauge to estimate when two species
diverged from a common ancestor / OWTTE
The lesser the number of nucleotide difference, the more closely related the two species
are [A: reverse argument]
[Total: 10]
JC2Prelim2013Biology9648/02 21
938
Section B
Answer ONE question
QUESTION 8
3. Movement of transport vesicles from the rER to Golgi apparatus / from the Golgi apparatus
to the cell surface membrane
4. Proton pumps on the lysosomal membrane, which pumps H+ from the cytosol into the
lysosome, to maintain its acidic pH
5. Sodium and potassium ion pump on the cell surface membrane of axons maintains the
resting potential of neurons. Energy of one ATP molecule is used to actively pump three
sodium ions out to the tissue fluid and two potassium ions in to the axoplasm.
6. Calcium pumps for the active transport of calcium ions out of synaptic knob. This maintains
a low concentration of calcium ions in the synaptic knob, thus regulating synaptic
transmission.
7. Active reabsorption of choline back to the synaptic knob for the reformation of
acetylcholine neurotransmitter. This allows the cell to save cellular resources.
11. In the initial stages of glycolysis in respiration, ATP is required to donate phosphate groups
during the phosphorylation of glucose to glucose-6-phosphate
14. In cell signalling, ATP donates a phosphate group to a target protein, catalysed by protein
kinases.
15. This causes the target protein to undergo a conformational change and convert from the
inactive to active form, which leads to signal transduction.
JC2Prelim2013Biology9648/02 22
939
16. ATP is also used as a substrate for the formation of cAMP by adenylyl cyclase. cAMP
acts as second messenger that leads to signal transduction.
JC2Prelim2013Biology9648/02 23
940
Angiogenesis
Occurs only when new tissue
(growth of blood Occurs even when growth is
5 is needed to repair damaged
vessels towards not necessary.
tissue.
itself)
JC2Prelim2013Biology9648/02 24
941
(c) Discuss, with a named example, how mutation to centromeres can result in genetic disorders.
[7]
1. Mutation to the centromere changes the shape/3D conformation of the centromeres due to
changes in nucleotide sequence.
6. Nondisjunction occurs as the separation of sister chromatids during anaphase II does not
occur.
8. This results in the formation of abnormal gametes / (n+1) or (n-1) gametes during meiosis.
9. When fusion of a normal haploid gamete (n) from one parent and an abnormal gamete
with (n+1) or (n-1) chromosomes from another parent occurs, this results in a genetic
disorder.
10. For example, Downs Syndrome is a condition where there is presence of an extra
chromosome 21 / any valid examples
JC2Prelim2013Biology9648/02 25
942
QUESTION 9
(a) Describe and explain how the structures of chloroplasts and mitochondria are similarly
adapted for their functions. [8]
The presence of electron carriers Passage of electrons via the electron carriers
1 on the thylakoid membrane and release energy to create proton gradient for
mitochondrial inner membrane the synthesis of ATP
JC2Prelim2013Biology9648/02 26
943
1. Speciation is the formation of new species / divergence of existing species into new
species
9. Genetic drift / Founders effect / Bottleneck effect changes the allele frequencies within
the population by chance.
11. Over many successive generations, each subpopulation became 2 genetically distinct
species which were unable to interbreed and produce fertile viable offspring.
JC2Prelim2013Biology9648/02 27
944
(c) Explain the concept of negative feedback in controlling insulin levels in the body. [5]
2. and cells of the islet of Langerhans in the pancreas detect an increase in blood
glucose level above set point of 90mg/100ml.
3. cells of the islet of Langerhans secrete insulin and cells of the islet of Langerhans stop
secretion of glucagon.
4. This decreases the blood glucose level back to the set point.
6. and circulating insulin will be removed from the blood / destroyed in the liver.
[Total: 20]
JC2Prelim2013Biology9648/02 28
945
CANDIDATE
NAME
CIVICS INDEX
GROUP 1 2 S NUMBER
_______________________________________________________________________________
H2 BIOLOGY 9648/03
Applications Paper and Planning Question 23 September 2013
Paper 3 2 hours
Additional Materials: Answer papers
_______________________________________________________________________________
1 / 15
2 / 16
3 /9
4 / 12
Planning
5 / 20
Essay
Total / 72
________________________________________________________________________________
This paper consists of 11 printed pages.
[Turn over]
JC2Prelim2013Biology9648/03 1
946
Fig. 1.1
..
..
JC2Prelim2013Biology9648/03 2
947
An artificially-synthesised human growth hormone (hGH) gene with flanking HindIII restriction site For
sequences was created. The restriction sites for the restriction enzymes HindIII and SacI are Examiners
Use
shown in Fig. 1.2.
Fig. 1.2
(b) Using information in Fig. 1.1 and 1.2, explain how the hGH gene can be inserted into
pCMV6-XL5. [3]
..
..
..
..
..
..
(c) State the conditions required for artificial transformation of E. coli cells with the plasmid vector.
[2]
..
..
..
JC2Prelim2013Biology9648/03 3
948
(d) Describe the steps required to select bacterial colonies containing the human growth For
hormone gene after artificial transformation has taken place. [5] Examiners
Use
..
..
..
..
..
..
..
..
..
..
(e) Suggest an explanation for the inclusion of the polyA signal sequence in pCMV6-XL5. [2]
..
..
..
..
(f) Plasmid replication is usually initiated by RNAII, which is a sequence of ribonucleotides that
binds to plasmid DNA prior to replication.
..
..
..
..
[Total: 15]
JC2Prelim2013Biology9648/03 4
949
QUESTION 2 For
The location of the gene locus responsible for cystic fibrosis was not discovered until 1985. Examiners
Use
Scientists used restriction fragment length polymorphism to discover the genetic markers
associated with the disease. One such marker was a 950bp-long region known as KM19 that had
been sequenced prior to 1985.
Samples of DNA were obtained from a family known to have the condition. The KM19 locus was
amplified by PCR and mixed with PstI and EcoRI in two separate restriction digests. The results
of gel electrophoresis of both restriction digests are shown in Fig. 2.1.
Fig. 2.1
(i) state and explain which restriction enzyme digest should be used to detect the KM19
genetic marker associated with cystic fibrosis. [3]
...
...
...
...
...
...
(ii) draw a restriction map of the KM19 genetic marker that is associated with cystic fibrosis in
the space below. [1]
JC2Prelim2013Biology9648/03 5
950
(b) Explain why genetic markers like KM19 can be used to detect the presence of disease- For
causing alleles. [2] Examiners
Use
..
..
..
..
(c) Further research in the 1980s identified sequences of genetic markers located both upstream
and downstream of the gene suspected to cause cystic fibrosis.
Using this information, suggest how the gene could be isolated using these two genetic
markers. [2]
..
..
..
..
Clinical trials for the treatment of inherited conditions via gene therapy have been conducted in
the past two decades, but an unsuccessful and lethal trial in 1999 revealed the risks involved in
using adenoviruses in gene therapy. Adeno-associated viruses were then used as alternative
viral vectors for gene therapy trials as they exhibit little or no disease-causing side effects. More
recently, non-viral gene therapies have been explored as safer alternatives to viral vectors.
1. ...
...
2. ...
...
(e) State two criteria that make cystic fibrosis a condition that can be potentially treated with gene
therapy. [2]
1. ...
2. ...
JC2Prelim2013Biology9648/03 6
951
Immune responses to non-viral gene therapy have been documented. The main cause of the For
immune response was found to be the plasmids carrying the normal allele. Examiners
Use
(f) Suggest a reason why plasmids may elicit an immune response during non-viral gene
therapy. [1]
..
..
(g) State three other differences between non-viral gene therapy and viral gene therapy. [3]
1. ...
...
2. ...
...
3. ...
...
[Total: 16]
JC2Prelim2013Biology9648/03 7
952
QUESTION 3 For
Examiners
Embryonic stem (ES) and induced pluripotent stem (iPS) cells hold great promise for the Use
treatment of a wide variety of acquired or hereditary diseases. One of the major obstacles to
clinical applications is directing them to differentiate into functional cells.
The effect of various growth factors on stem cell differentiation in ectodermic, mesodermic and
endodermic embryonic stem cells was carried out and the process was documented in Fig. 3.1.
Embryonic stem cells were cultured and embryoid bodies allowed to differentiate into ectodermic,
mesodermic and endodermic embryonic stem cells. Growth factors were added to the stem cells
and the expression of cell-specific genes was measured after ten days.
Fig. 3.1
One of the growth factors tested was the epidermal growth factor. 100ng/mL of epidermal growth
factor was given to the three different embryonic stem cells. The results are summarised in
Table 3.1.
Table 3.1
(a) Using the information given and the data from Table 3.1, describe and explain the effect of
epidermal growth factor on the expression of keratin in stem cells. [3]
..
..
..
..
..
..
JC2Prelim2013Biology9648/03 8
953
(b) Suggest why the insulin gene was not expressed in the three different kinds of embryonic For
stem cells even after treatment with a variety of other growth factors. [1] Examiners
Use
..
..
Researchers have recently used induced pluripotent stem (iPS) cells generated from human skin
cells to create precursor heart cells.
(c) State two advantages of using iPS cells instead of embryonic stem cells for research and
clinical trials. [2]
1. ...
...
2. ...
...
Cord blood stem cell therapy has been used in clinical trials for the treatment of autoimmune
diseases like leukaemia and inherited conditions like Severe Combined Immuno-deficiency
(SCID).
o Allogeneic The patient receives stem cells from a matching donor, either a sibling or
an unrelated donor
..
..
..
..
(e) Suggest a potential limitation of autologous cord blood stem cell therapy. [1]
..
..
[Total: 9]
JC2Prelim2013Biology9648/03 9
954
Question
Q 4 Planning Question
Q For
You
Y are req quired to pla
an, but not carry out, an investig
gation into the
t effect oof temperatu ure from Examiners
E
Use
10C to 70C C on the peermeability of potato ce
ell membranes. Potato oes are richh in potassiu
um ions.
When
W small disc-shapeed potatoes cut from a core borer (Fig. 4.1) are
a placed iin water, po otassium
io
ons are rele
eased from the cell into
o the water.
T concentration of potassium io
The ons in the w
water can be
e measured
d using an eelectrode (F
Fig. 4.2)
th
hat is selecctive for pota
assium ions
s.
F 4.1
Fig. Fig. 4.2
2
Your
Y plan sh
hould:
Your
Y plannin
ng must be based on the
t assump ption that yo
ou have been providedd with the following
f
equipment
e a
and apparattus which yo
ou must use
e:
Potatoess
Potassiuum ion-selecctive electro
ode which m
measures in
n mg/L
A core bborer of 10m
mm in diame eter
Scalpel
Ruler
ubes
Boiling tu
Measurin ng cylinderss
Stopwatch
Thermosstatically-co
ontrolled waater bath
Thermom meter
Isotonic buffer soluttion
De-ionizzed water
Other coommon labo oratory appaaratus
[To
otal: 12]
JC 03
C2Prelim2013Biology9648/0 10
955
Your answer:
QUESTION 5
(a) Explain how genetically modified organisms may provide a solution to global food shortage
issues. [8]
(b) Discuss the social and ethical implications of germ-line gene therapy. [5]
End of Paper
JC2Prelim2013Biology9648/03 11
956
CANDIDATE
NAME
CIVICS INDEX
GROUP 1 2 S NUMBER
_______________________________________________________________________________
H2 BIOLOGY 9648/03
Applications Paper and Planning Question 23 September 2013
Paper 3 2 hours
Additional Materials: Answer papers
_______________________________________________________________________________
1 / 15
2 / 16
ANSWERSCHEME 3 /9
4 / 12
Planning
5 / 20
Essay
Total / 72
________________________________________________________________________________
This paper consists of __ printed pages.
[Turn over]
JC2Prelim2013Biology9648/03 1
957
QUESTION 1
pCMV6-XL5 is a plasmid with a multiple cloning site (MCS) that lies downstream of the CMV
promoter (Fig. 1.1). This plasmid can be inserted into both eukaryotic and prokaryotic host cells.
The arrows denote the direction in which the genes are transcribed.
Fig. 1.1
It is where RNA polymerase binds to initiate transcription of the human growth hormone
gene inserted into the multiple cloning site (downstream of the promoter).
JC2Prelim2013Biology9648/03 2
958
An artificially-synthesised human growth hormone (hGH) gene with flanking HindIII restriction site
sequences was created. The restriction sites for the restriction enzymes HindIII and SacI are
shown in Fig. 1.2.
Fig. 1.2
(b) Using information in Fig. 1.1 and 1.2, explain how the hGH gene can be inserted into
pCMV6-XL5. [3]
Cleave plasmid with SacI to generate complementary sticky ends to the HindIII sticky
ends flanking the hGH gene.
Mix the cleaved gene and plasmid together and add DNA ligase to seal the nicks / form
phosphodiester bond between gene and plasmid.
(c) State the conditions required for artificial transformation of E. coli cells with the plasmid vector.
[2]
Addition of calcium chloride solution to the mixture of E. coli and plasmid.
Subject mixture to heat shock in a 42C water bath for 2 minutes (or less).
JC2Prelim2013Biology9648/03 3
959
(d) Describe the steps required to select bacterial colonies containing the human growth
hormone gene after artificial transformation has taken place. [5]
2. Bacterial colonies on the ampicillin plate are transferred onto a nitrocellulose membrane.
3. Add sodium hydroxide to the filter to lyse bacterial cells and denature dsDNA into
ssDNA.
4. A solution of radioactively-labelled gene probe is added so that it will hybridize with the
complementary DNA sequence of the human growth hormone gene.
6. The position of the cell containing the DNA-gene probe hybrid/labelled gene can be located
by autoradiography performed on the filter.
7. The position of dark spots on the x-ray film corresponds to the position of the bacterial
colonies containing the human growth hormone gene.
(e) Suggest an explanation for the inclusion of the polyA signal sequence in pCMV6-XL5. [2]
If the plasmid is inserted into a eukaryotic host cell, the polyA signal sequence will direct
the addition of a poly A tail to mRNA.
Facilitate the export of mRNA out of the nucleus into the cytoplasm.
(f) Plasmid replication is usually initiated by RNAII, which is a sequence of ribonucleotides that
binds to plasmid DNA prior to replication.
[Total: 15]
JC2Prelim2013Biology9648/03 4
960
QUESTION 2
The location of the gene locus responsible for cystic fibrosis was not discovered until 1985.
Scientists used restriction fragment length polymorphism to discover the genetic markers
associated with the disease. One such marker was a 950bp-long region known as KM19 that had
been sequenced prior to 1985.
Samples of DNA were obtained from a family known to have the condition. The KM19 locus was
amplified by PCR and mixed with PstI and EcoRI in two separate restriction digests. The results
of gel electrophoresis of both restriction digests are shown in Fig. 2.1.
Fig. 2.1
(i) state and explain which restriction enzyme digest should be used to detect the KM19
genetic marker associated with cystic fibrosis. [3]
PstI
Digestion with PstI produced two bands of 300bp and 650bp in affected individuals but
unaffected individuals showed either a single band of 950bp or three bands of 950bp,
650bp and 300bp.
But after digestion with EcoRI, all individuals had single 950bp fragments and the
affected and unaffected individuals are not differentiated.
(ii) draw a restriction map of the KM19 genetic marker that is associated with cystic fibrosis.
[1]
JC2Prelim2013Biology9648/03 5
961
(b) Explain why genetic markers like KM19 can be used to detect the presence of disease-
causing alleles. [2]
They are tightly linked to the disease-causing alleles on the same chromosome and are
likely to be inherited together as one unit with the disease-causing allele.
(c) Further research in the 1980s identified sequences of genetic markers located both upstream
and downstream of the gene suspected to cause cystic fibrosis.
Using this information, suggest how the gene could be isolated using these two genetic
markers. [2]
Design primers that are complementary to the genetic markers upstream and downstream
of the suspected gene.
Use the polymerase chain reaction (PCR) to synthesise multiple copies of suspected
gene.
Clinical trials for the treatment of inherited conditions via gene therapy have been conducted in
the past two decades, but an unsuccessful and lethal trial in 1999 revealed the risks involved in
using adenoviruses in gene therapy. Adeno-associated viruses were then used as alternative
viral vectors for gene therapy trials as they exhibit little or no disease-causing side effects. More
recently, non-viral gene therapies have been explored as safer alternatives to viral vectors.
Adeno-associated viruses are capable of infecting both non-dividing and dividing cells.
Adeno-associated viruses are capable of integrating the normal allele into the patients
genome at a specific site, hence there is a lesser chance of oncogene formation.
Treatment is permanent if stem cells are used as the normal allele is integrated into the
cells genome and the stem cells are capable of self-renewal.
(e) State two criteria that make cystic fibrosis a condition that can be potentially treated with gene
therapy. [2]
CF is a single-gene disorder hence it can be treated by the introduction of the normal allele
by gene therapy.
JC2Prelim2013Biology9648/03 6
962
Immune responses to non-viral gene therapy have been documented. The main cause of the
immune response was found to be the plasmids carrying the normal allele.
(f) Suggest a reason why plasmids may elicit an immune response during non-viral gene
therapy. [1]
Plasmids used for gene therapy may have sequences that are bacterial/prokaryotic in
origin and are recognised by the human immune system.
(g) State three other differences between non-viral gene therapy and viral gene therapy. [3]
[Total: 16]
JC2Prelim2013Biology9648/03 7
963
QUESTION 3
Embryonic stem (ES) and induced pluripotent stem (iPS) cells hold great promise for the
treatment of a wide variety of acquired or hereditary diseases. One of the major obstacles to
clinical applications is directing them to differentiate into functional cells.
The effect of various growth factors on stem cell differentiation in ectodermic, mesodermic and
endodermic embryonic stem cells was carried out and the process was documented in Fig. 3.1.
Embryonic stem cells were cultured and embryoid bodies allowed to differentiate into ectodermic,
mesodermic and endodermic embryonic stem cells. Growth factors were added to the stem cells
and the expression of cell-specific genes was measured after ten days.
Fig. 3.1
One of the growth factors tested was the epidermal growth factor. 100ng/mL of epidermal growth
factor was given to the three different embryonic stem cells. The results are summarised in
Table 3.1.
Table 3.1
(a) Using the information given and the data from Table 3.1, describe and explain the effect of
epidermal growth factor on the expression of keratin in stem cells. [3]
Epidermal growth factor receptor was present only on ectodermal stem cells.
JC2Prelim2013Biology9648/03 8
964
(b) Suggest why the insulin gene was not expressed in the three different kinds of embryonic
stem cells even after treatment with a variety of other growth factors. [1]
The insulin gene will only be transcriptionally active in -cells / will not be synthesised until
the pancreas is fully developed.
Researchers have recently used induced pluripotent stem (iPS) cells generated from human skin
cells to create precursor heart cells.
(c) State two advantages of using iPS cells instead of embryonic stem cells for research and
clinical trials. [2]
iPS cells can be generated from skin cells/adult cells, so there are fewer ethical issues
involved as compared to using embryonic stem cells obtained from an embryo.
iPS cells can be generated from skin cells/adult cells of the patient/sufferer, so there might be
less risk of tissue rejection after gene therapy and transplantation.
Cord blood stem cell therapy has been used in clinical trials for the treatment of autoimmune
diseases like leukaemia and inherited conditions like Severe Combined Immuno-deficiency
(SCID).
o Allogeneic The patient receives stem cells from a matching donor, either a sibling or
an unrelated donor
Multi-potent and able to undergo differentiation to produce different types of blood cells.
Unspecialised and undifferentiated.
Has telomerase activity.
Has ability to undergo long-term self-renewal.
(e) Suggest a potential limitation of autologous cord blood stem cell therapy. [1]
Cord blood stem cell therapy cannot cure inherited genetic diseases if the donor has the
same inherited condition or the treatment is autologous (as the patient receives his own stem
cells).
The amount of cord blood stem cells that can be collected from a single donor is small and
reduces chances of repeated therapy.
[Total: 9]
JC2Prelim2013Biology9648/03 9
965
Question
Q 4 Planning Question
Q
You
Y are req quired to pla
an, but not carry out, an investig
gation into the
t effect oof temperatu ure from
10C to 70C C on the peermeability of potato ce
ell membranes. Potato oes are richh in potassiu
um ions.
When
W small disc-shapeed potatoes cut from a core borer (Fig. 4.1) are
a placed iin water, po otassium
io
ons are rele
eased from the cell into
o the water.
T concentration of potassium io
The ons in the w
water can be
e measured
d using an eelectrode (F
Fig. 4.2)
th
hat is selecctive for pota
assium ions
s.
F 4.1
Fig. Fig. 4.2
2
Your
Y plan sh
hould:
Your
Y plannin
ng must be based on the
t assump ption that yo
ou have been providedd with the following
f
equipment
e a
and apparattus which yo
ou must use
e:
Potatoess
Potassiuum ion-selecctive electro
ode which m
measures in
n mg/L
A core bborer of 10m
mm in diame eter
Scalpel
Ruler
ubes
Boiling tu
Measurin ng cylinderss
Stopwatch
Thermosstatically-co
ontrolled waater bath
Thermom meter
Isotonic buffer soluttion
De-ionizzed water
Other coommon labo oratory appaaratus
[To
otal: 12]
JC 03
C2Prelim2013Biology9648/0 10
966
Objective
To investigate the effect of temperature on the permeability of cell membranes using potatoes
Control
For every temperature examined, no potato disc added to ensure the K+ detected is from
the potato cells.
Methods
1. Cut a potato into cylindrical shapes of diameter 10mm using the core borer.
2. Cut the cylindrical potato into disc shape of height 3mm using scalpels.
3. Place the disc-shaped potatoes into an isotonic buffer. This is to prevent the potato from
drying up and also to maintain its osmotic pressure.
4. Add 10ml of fresh de-ionized water into a boiling tube and equilibrate in a 10C water bath
until the de-ionized water is at 10C. Monitor temperature using thermometer.
5. Add 10 discs of potatoes and start the stopwatch.
6. After 15min (accept range), measure the concentration of K+ with the electrode.
7. Repeat step 4 6 twice to obtain a total of 3 readings to minimize error by calculating
average.
8. Repeat step 4 7 for 20, 30, 40, 50, 60 and 70C.
9. Repeat the whole experiment twice to ensure reproducibility.
JC2Prelim2013Biology9648/03 11
967
Results
+ -1
Concentration of K / mgL
Temperature / C
1 2 3 Average
10
20
30
40
50
60
70
JC2Prelim2013Biology9648/03 12
968
QUESTION 5
(a) Explain how genetically modified organisms may provide a solution to global food shortage
issues. [8]
1. Increase yield by genetically modifying food crops that will result in decreased losses caused
by pesticides, fungal infestation, viruses, bacterial infection and pests.
Introduction of genes that code for proteins that confer insecticidal resistance
2. Example: Genetically engineered crop plants that express the Bt-toxin gene from the
bacteria Bacillus thuringiensis produce Bt-toxin protein which kills insect larvae feeding
on the plant.
Introduction of genes that code for proteins that confer herbicidal resistance
3. Example: Genetically engineered crop plants that are resistant to herbicides by introducing
the herbicide/glyphosate resistance gene
4. When herbicide is applied to the field, the weeds are eliminated but not the herbicide
resistance crop plants.
Introduction of genes that code for proteins that confer viral resistance
5. E.g., tobacco plant can be made resistant to the tobacco mosaic virus by expressing the
coat protein gene of a virus.
Introduction of genes that code for proteins that confer fungal resistance
Or
Inclusion of a gene expressing anti-fungal compounds (e.g. phytoalexin) into transgenic crop
plant (e.g. Alfafa, potato) confer fungal resistance.
7. Example: The Atlantic salmon has been genetically modified by the addition of a growth
hormone gene from a Pacific Chinook salmon and an active promoter from an ocean pout
placed upstream of the growth hormone gene.
8. The insertion of the growth hormone gene results in faster growth rate and yield of the
salmon, thereby increasing the supply of salmon.
9. Flavr Savr tomatoes are engineered to include a gene for antisense mRNA to
polygalacturonase gene to reduce expression of polygalacturonase.
10. This will result in delayed ripening allowing crops to be stored for longer period of time
JC2Prelim2013Biology9648/03 13
969
(b) Discuss the social and ethical implications of germ-line gene therapy. [7]
Limitation in technology
1. The technology for germ-line gene therapy is not perfect and there is a risk of inducing
mutations, which can be passed down to the offspring, when the insertion of gene
happens to introduce further defects.
Research on embryos
2. Those involved in the research related to germ-line gene therapy regularly create and
destroy embryos as a part of their research.
3. There are objections to killing embryos used for research in gene therapy as human life
may be considered to have begun at conception.
Abuse of technology
4. It may be abused by parents who want to eliminate undesirable alleles from their offspring.
8. The definition of normal and disability may change. The decision of what is normal and
what is a disability should not rest on just a small group of individuals or medical
professionals. The question of whether disabilities are considered disease and whether these
need to be cured or prevented requires thorough consideration.
9. Demeaning the life of the disabled. There is a concern that the presence of a cure might
demean the lives of individuals presently affected by disabilities. There could be a new
definition of what contributes to a normal being. E.g. the exclusion of individuals who are
merely average in intelligence.
10. Creation of social class distinctions. There can be a formation of class distinctions,
because expensive gene therapy is easily available to individuals with financial means, but
not to those financially less well off. There should also be an establishment of procedural
fairness in selection of patients for research.
11. Religious and cultural belief. Changing the genetic makeup of individuals goes against
many religious and cultural beliefs.
12. Other issues. There may be incidental elimination of genes that are important but with
unknown functions and this may lead to decreased species fitness
2. Determine the DNA sequence of the entire human genome (about 3 billion base pairs).
3. Store this information in databases to be shared publicly by researchers throughout the world
JC2Prelim2013Biology9648/03 14
970
5. Transfer related technologies to the private sector and award grants for innovative research,
so as to catalyse the biotechnology industry and the development of new medical
applications.
6. Address the ethical, legal and social issues that may arise from the project.
End of Paper
JC2Prelim2013Biology9648/03 15
971
CANDIDATE
NAME
BIOLOGY REGISTRATION
CLASS 2BI2___ / 2IPBi2___ NUMBER
BIOLOGY 9648/01
Paper 1 Multiple Choice 19 Sep 2013
1 hour 15 minutes
Additional Materials: Multiple Choice Answer Sheet
There are forty questions on this paper. Answer all questions. For each question there are
four possible answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate
Answer Sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
Calculators may be used.
[Turn over
972
2 Most wild plants contain toxins that deter animals from eating them. A scientist
discovered that a toxin produced by a certain plant was also toxic to the same
plant if it as applied to the roots of the plant. As the first step on finding out why
the plant was not normally killed by its own toxin, he fractionated some plant
cells and found that the toxin was in the fraction that contained the largest cell
organelle. He also found that the toxin was no longer toxic after it was heated.
A I, II and V
B I, IV and V
C II, III and IV
D III, IV and V
973
3 The graph shows the effect of pH on the structure of a protein which consists of
entirely of repeating residues of one amino acid.
-helix
Increasing
symmetry
random coil
0 2 4 6 8 10 12 14
pH
4 The following graphs show the activities of different enzymes (1-5) under different
conditions:
Rate of reaction
0 20 40 60 80 100
(a)
Temperature
Rate of reaction
(b) pH
5
5 The figure below shows some biomolecules numbered 1 to 10.
1 2 3 4 5
6 7
10
A III only
B I and II only
C I, II and IV only
D All of the above
976
6
6 The following events occur during the mitotic cell cycle.
I division of centromeres
II proofreading mechanism in replication
III duplication of chromosomes
IV overlapping of non-kinetochore spindle fibres
Which event(s) in mitosis directly ensure that the daughter cells are genetically identical to
each other and to the parent cell?
A I only
B I and III
C II and III
D II and IV
7 The diagram above shows a bivalent. Which of the following correctly represents the final
products at the end of Meiosis II?
977
8 The mechanism of action of four drugs that inhibit DNA replication is stated below.
Which anticodons present on tRNA are needed for the synthesis of this
polypeptide?
CGATTACCATGCATA
original base sequence
CGATTAACCTGCATA CGATTACCAGGCATA
mutant sequence 1 mutant sequence 2
A deletion insertion
B insertion deletion
C inversion substitution
D substitution insertion
11 Which of the following mutations will bring about active transcription of the lac operon in E. coli?
12 E.coli bacteria are grown in a culture of nutrients, which includes glucose and lactose as the
main source of carbon-based nutrient.
R
Q
Which of the following statements account for the growth curve showing the reproduction of
E.coli bacteria?
P Q R
A I and II
B I and IV
C II and III
D III and IV
Which combination correctly identifies the gene regulatory steps involving prokaryotes and
eukaryotes?
prokaryotic eukaryotic
A 1 and 2 3 and 4
B 1 and 3 2 and 4
C 2 and 3 1 and 4
D 2 and 4 1 and 3
15 Which choice presents items in the proper order (earliest to latest) in which they would be
used in the process of gene expression resulting in the formation of a protein?
10
16 The hepatitis C virus is a single-stranded, enveloped, positive sense RNA virus, which
attack the liver cells of human beings.
Which of the following correctly describe the reproductive cycle of hepatitis C virus?
A Fusion of the viral envelope with the host cell membrane, uncoating to release
viral genome, followed by synthesis of complementary RNA for translation.
B Fusion of the viral envelope with the host cell membrane, uncoating to release
viral genome, followed by protein synthesis.
C Receptor mediated endocytosis, uncoating to release viral genome, followed
by reverse transcription.
D Receptor mediated endocytosis, uncoating to release viral genome, followed
by transcription.
17 In a hypothetical situation, DNA from T4 phage is mixed with proteins from a lambda
phage, resulting in a hybrid virus. If this hybrid virus were to infect a bacterium and
reproduce, what would the resulting "offspring" viruses be like?
A T4 phage
B Lambda phage
C A hybrid virus with T4 DNA and lambda protein
D A hybrid virus with lambda DNA and T4 protein
18 BRCA1 is expressed in the cells of breast and other tissue, where it helps repair
damaged DNA, or destroy cells if DNA cannot be repaired. BRCA1 gene is on
chromosome 17 of the human genome.
11
1 2 3
Assuming that all techniques and conditions (apart from time) were standardised,
which of the following conclusions is justified from these data?
12
21 In tomato plants, purple pigment and hairy stem are genetically determined and
the genes are tightly linked. Pure breeding, purple, hairy plants crossed with pure
breeding green, hairless plants produced only purple, hairy plants in the F1
generation.
These F1 plants were then crossed to produce the F2 generation and a total of 500
F2 generation plants were produced. Which of the following best describes the
number of offsprings obtained from this cross?
A 187 48 52 213
B 204 205 45 46
C 282 218 0 0
D 467 0 0 33
22 In a series of mapping experiments, the recombination frequencies for four different linked
genes of Drosophila were determined as shown below.
13
23 The feather colors in budgies (a kind of bird) are determined by two pairs of unlinked
genes Y/y and allele B/b. The genotype of green color feather is Y_B_, blue yyB_,
and white _ _bb (where _ indicates the presence of either the dominant or recessive
allele).
What is the most likely genetic basis for the occurrence of this defect?
A autosomal dominant
B autosomal recessive
C sex-linked dominant
D sex-linked recessive
984
14
15
I Gene mutation
II Increased gene flow
III Natural selection
IV Geographical isolation
V Habitat differentiation within the same geographical location
A IV, I, III
B IV, II, III
C V, I, III
D V, II, III
27 Members of two different species possess a similar-looking structure that they use in a
similar fashion to perform the same function. Which information would best help distinguish
between an explanation based on homology versus one based on convergent evolution?
28 Which of the following would provide the best information for distinguishing
phylogenetic relationships between several species that are almost identical in
anatomy?
A Comparative embryology.
B Homologous structures.
C Molecular comparisons of DNA and amino acid sequence.
D The fossil records.
986
16
29 The diagram shows the sequence of events occurring as an action potential arrives at a
synapse.
The numbered arrows represent the movement of substances across the membranes.
Presynaptic Postsynaptic
neurone neurone
A an action potential.
B membrane depolarization.
C the production of an excitatory post-synaptic potential.
D the production of an inhibitory post-synaptic potential.
organ 1 product 1
organ 2 product 2
17
32 Which of the following is a similarity between G protein coupled receptors and receptors
tyrosine kinase?
33 Which feature of stem cells obtained from blood in the umbilical cord enables their
use in the treatment of a variety of blood disorders?
Which of the following would ensure that the normal allele is passed on to the next
generation?
A Using a liposome to introduce the normal -globin allele into bone marrow
cells.
B Using a retrovirus to introduce the normal -globin allele into a germ cell.
C Using an adeno-associated virus to introduce the normal -globin allele into
bone marrow cells.
D Using an adenovirus to introduce the normal -globin allele into a germ cell.
35 Each of the statements is concerned with the success or failure of gene therapy as a
permanent cure for genetic disorders.
Which statements explain the limitation of gene therapy as a permanent cure for
genetic disorders in human population?
A I and II
B I and III
C II and III
D All of the above
988
18
36 36 The diagram below shows the results of DNA profiling using gel electrophoresis.
What conclusion can be drawn about the DNA in bands I and II?
A The DNA in the two bands has the same base sequence.
B The DNA in the two bands consists of fragments of the same length.
C The DNA in the two bands has the same ratio of bases.
D The DNA in the two bands came from the same source.
37 Which of the following components show the correct combinations that are required
for synthesizing a collection of cDNAs containing copies of EPO-R cDNA?
19
38 The cDNAs synthesized in this mixture were converted into double-stranded DNA molecules
supplied with Xho restriction endonuclease specific cohesive ends and ligated into the Xho
site of a mammalian expression plasmid.
Which of the following sequence should be present in this plasmid if it is to express inserted
cDNAs in human cells?
40 Plants are more readily manipulated by genetic engineering than are animal cells because
1 B 11 C 21 A 31 C
2 A 12 D 22 A 32 A
3 D 13 A 23 B 33 B
4 D 14 D 24 B 34 B
5 D 15 C 25 B 35 D
6 A 16 B 26 C 36 B
7 D 17 A 27 D 37 D
8 D 18 A 28 C 38 D
9 B 19 C 29 C 39 D
10 C 20 D 30 D 40 A
1 993
CANDIDATE
NAME
BIOLOGY REGISTRATION
CLASS NUMBER
BIOLOGY 9648/02
Paper 2 30 August 2013
2 hours
Additional Materials: Answer Paper
Write your Biology class, registration number and name on all the work you hand in.
You may use a soft pencil for any diagrams, graphs or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
Paper 2
The number of marks is given in brackets [ ] at the end of each
question or part question. Section A
1 / 11
Section A 2 / 15
3 / 10
Write your answers in this booklet using dark blue or black pen.
4 / 12
5 / 10
Section B
6 / 12
Write your answers on the separate Answer Paper using dark
blue or black pen. 7 / 10
Section B
8/9 / 20
TOTAL / 100
Section A
Fig. 1.1
Table 1.1
structure name of structure function of structure within mammalian cell
[3]
Table 1.2 below represents the ionic concentrations inside and outside a typical mammalian
cell.
Table 1.2
normal conditions
concentration (mM)
ions intracellular extracellular
+
Na 5-15 145
+ -5
H 7 X 10 4 X 10-5
Cl- 5-15 110
[1]
(c) By comparing normal and diarrhoeal situations, explain how this disruption of cellular
ion concentrations would result in extreme dehydration.
[4]
(d) One of the antibiotics used in the treatment of cholera is tetracycline. Tetracycline
causes the death of the pathogen by binding to ribosomes and inhibiting protein
synthesis.
(i) Suggest two ways in which tetracycline acts at ribosomes to inhibit protein
synthesis.
[2]
(ii) Tetracycline does not harm mammalian cells. Suggest an explanation for this.
[1]
[Total: 11]
2 Meselson and Stahl performed the following experiment with the bacterium Escherichia
coli (E. coli). They grew cells for several generations in the presence of the heavy
isotope of nitrogen, 15N. All the DNA of the progeny that were produced from the initial
small inoculum was labelled with 15N. The 15N-labeled cells were then placed in 14N-
containing medium. The DNA produced in subsequent generations was extracted. The
DNA from the different generations was compared using the technique of differential
centrifugation using a caesium chloride density gradient to separate the DNA
containing 15N from DNA containing 14N, as 15N labelled DNA is more dense than
ordinary 14N DNA. The position of the 15N and 14N DNA absorbance was determined in
ultraviolet light at 260 nm. The results obtained are shown in Fig. 2.1.
Fig. 2.1
(a) (i) With reference to Fig. 2.1, do you consider the replication of DNA in E. coli as
conservative or semi-conservative? Give reasons for your answer.
[3]
[2]
(iv) The enzyme that catalyses the replication of DNA checks for errors in the
process and corrects them. Suggest why checking for errors and correcting them
is necessary.
[1]
A group of scientists has discovered that a change in the chromatin structure of mammalian
cell brought about by Protein A is associated with increased gene expression of several
genes involved in the suppression of tumour growth. Fig. 2.2 shows the overall survival (OS)
percentage of patients in the absence and presence of Protein A.
OS
(%)
Months
Fig. 2.2
(b) (i) With reference to Fig. 2.2, comment on the overall survival percentage of patients
in the presence of Protein A with that in the absence of Protein A, and explain its
differences.
[4]
(ii) Explain how the presence of transcription factors causes an increase in the
expression of gene involved in suppression of tumour growth.
[3]
(iii) Suggest why the change in chromatin structure, in the presence of Protein A,
does not occur over large area of the chromatin.
[1]
[Total: 15]
Fig.3.1
Structure A:
Structure B: [2]
(b) Describe the events occurring in stage C leading to formation of structure A on the host
cells plasma membrane.
[3]
(c) After contraction of HIV, the initial symptoms are followed by a stage called clinical
latency when no symptoms are observed for a few years. With reference to the
reproductive features of HIV, explain the cause of clinical latency.
[1]
(i) Distinguish the genome replication between HIV and influenza virus.
[2]
(ii) Every year, new flu vaccines are developed to ensure their efficacy. Explain the
frequent need for new flu vaccines.
[2]
[Total: 10]
4 The arrow in Fig. 4.1 shows the direction of an impulse in part of a nervous system.
Fig. 4.1
(a) With reference to Fig. 4.1, describe how transmission of impulse is believed to have
taken place.
[4]
(b) When summation of EPSP and IPSP exceeds threshold, depolarisation occurs. Explain
why the magnitude of the signal initiated at the exon hillock is always at constant
voltage.
[2]
(c) Suggest the purpose of the refractory period during an action potential.
[2]
In a nerve muscle preparation, a novel drug called AWZ with a molecular structure
resembling acetylcholine was applied to the cells. The investigation showed that the drug
significantly increases muscular contractions. However, it was found that the drug, when
applied to either one kind of cells directly, did not affect the axon nor muscle cells.
(d) Suggest, in detail, one possible way in which the drug, AWZ, could cause the
increased muscle contractions.
[4]
[Total: 12]
Stack 2
Name: ___________________________ Class: __________
Fig. 5.1
[1]
(ii) With reference to Fig 5.1, explain the mode of inheritance using two pieces of
evidences.
[4]
A series of breeding experiments were carried out with a certain species of mice. A cross
between pure breeding males with red eyes and bent tails, and females with black eyes and
straight tails produced offspring all with red eyes and bent tails. The same results were
obtained when the cross was carried out again but with the sexes reversed.
(b) Suggest a reason for carrying out the cross with the sexes reversed.
[2]
In another crossing, female offspring from the first experiment were then crossed with black
eyes and straight tails males to obtain the following:
(c) Using the given formula and part of the table of chi-square values as shown in Table
5.1, determine if the null hypothesis for the eye color allele and tail shape allele can be
accepted in the space below.
[3]
[Total: 10]
Fig.6.1
(a)
[3]
(ii) Compare the initial electron donor and final electron acceptor between oxidative
phosphorylation and non-cyclic photophosphorylation.
[2]
(b) A point mutation results in dysfunctional NADP+ reductase. State and explain how the
concentration of Ribulose 1,5 Bisphosphate in the chloroplasts would be affected.
[3]
(c) Glyceraldehyde 3-phosphate exits the Calvin cycle for production of glucose, which will
be used for cell wall formation. Explain how the structure of cellulose allows it to serve
its function.
[4]
[Total: 12]
(a) Describe the principles which scientists use to classify organisms into taxonomic
groups.
[2]
Fig. 7.1
Thousands of years ago, populations of the greenish warbler spread around the western and
eastern edges of the Himalayan mountain range to establish themselves in north-eastern
Europe and Siberia.
One example of gradual change is in the song of the male warbler, which is very
distinctive and is used in mating behavior.
When greenish warblers from north-eastern Europe meet those from Siberia, no mating
takes place.
The greenish warblers from north-eastern Europe and Siberia are now considered to be
two separate species.
Fig. 7.2
(b) State the likely isolating mechanism taking place in populations of the greenish
warbler.
[1]
(c) Explain how the process of speciation occurred in the greenish warbler populations.
[4]
An investigation was carried out to study the relationships between the different species of
warbler using DNA analysis. The base sequences of a region of mitochondrial DNA from the
four species were compared and results are shown in Table 7.1.
Table 7.1
P. laetus
P. laetus P. laurae
(d) Researchers have put forward the hypothesis that the three species, P. laetus, P.
laurae and P. ruficapilla, have originated from three separate events in which a few
individuals of P. affinis spread directly from Cuba to three different places.
The smaller the number, the smaller the differences between the base sequences of
the two species.
Explain how the results in Table 7.1 support the researchers hypothesis.
[2]
(e) It was observed that the warblers have remained at approximately the same
frequency for many generations. Suggest an explanation for this phenomenon.
[1]
[Total: 10]
Section B
Your answers should be illustrated by large, clearly labelled diagrams, where appropriate.
Your answers must be set out in sections (a), (b) etc., as indicated in the question.
(b) With reference to specific genes, discuss how point mutations and chromosomal
mutations can lead to cancer. [10]
9 (a) Describe how the effects of glucagon are achieved in the liver cell. [10]
(b) Discuss why the eukaryotic genome is considered to be more complex than the
prokaryotic genome. [10]
Section A
Table 1.1
structure name of structure function of structure within mammalian cell
A: translation
[3]
Table 1.2 below represents the ionic concentrations inside and outside a typical mammalian
cell.
Sodium-potassium pumps pump out excess Na+ thus requires ATP for the active
transport of this ion.
(c) By comparing normal and diarrhoeal situations, explain how this disruption of cellular
ion concentrations would result in extreme dehydration. [4]
Under normal conditions, the chloride ions remain in the cells lining the lumen of the
small intestine creating an overall negative charge within the cells that drives
positively charged sodium ions into the cells
This creates a hyperosmotic condition in the cells/ lower water potential in cells (or
content of the cell would contain more solutes than extracellular fluid) Thus resulting
in water moving into the cells by osmosis.
When suffering from diarrhoea, there is increased concentration of Cl- and Na+ in the
lumen of the small intestine.
Elevated concentrations of these two ions results in the lumen of the small intestines
becoming hyperosmotic/ having a lower water potential compared to the cells lining the
intestines.
This in turn causes large amounts of water through osmosis into the lumen of the
intestine from the cells and blood stream Water passes out of the body as diarrhoea,
leaving the body dehydrated.
(d) One of the antibiotics used in the treatment of cholera is tetracycline. Tetracycline
causes the death of the pathogen by binding to ribosomes and inhibiting protein
synthesis.
(i) Suggest two ways in which tetracycline acts at ribosomes to inhibit protein
synthesis. [2]
(ii) Tetracycline does not harm mammalian cells. Suggest an explanation for this.
[1]
[Total: 11]
2 Meselson and Stahl performed the following experiment with the bacterium Escherichia
coli (E. coli). They grew cells for several generations in the presence of the heavy
isotope of nitrogen, 15N. All the DNA of the progeny that were produced from the initial
small inoculum was labelled with 15N. The 15N-labeled cells were then placed in 14N-
containing medium. The DNA produced in subsequent generations was extracted. The
DNA from the different generations was compared using the technique of differential
centrifugation using a caesium chloride density gradient to separate the DNA
containing 15N from DNA containing 14N, as 15N labelled DNA is more dense than
ordinary 14N DNA. The position of the 15N and 14N DNA absorbance was determined in
ultraviolet light at 260 nm. The results obtained are shown in Fig. 2.1.
(a) (i) With reference to Fig. 2.1, do you consider the replication of DNA in E. coli as
conservative or semi-conservative? Give reasons for your answer. [3]
14
It is semi-conservative, because after one generation in N, the DNA had a density
intermediate between that containing 15N and that with 14N.
14
After 2 generations in N, the DNA was of two types: one with an intermediate density
and another with a density corresponding to 14N DNA.
This shows that the DNA molecule unzips and each original strand acts as a template for
the synthesis of new strand. Daughter DNA contains one old and one new strand. If it is
conservative, in each generation there would always present DNA that has density
similar to the parent DNA.
Two peaks: A higher peak at 14N and a smaller peak at 14N-15N sedimentation
Hydrogen bonds hold the two polynucleotides / strands / chains together via
complementary base pairing
Many hydrogen bonds give stability as DNA is a stable molecule
Hydrogen bonds can be broken for the process of DNA replication/ transcription to take
place
Reference made to structure of DNA as double helix
(iv) The enzyme that catalyzes the replication of DNA checks for errors in the
process and corrects them. Suggest why checking for errors and correcting them
is necessary. [1]
Errors are mutations and the presence of mutations may lead to production of altered
proteins / impaired / loss of function
Altered proteins may lead to different antigens on the surface of cells, so cells will be
rejected by immune system
Impaired coordination of cells i.e. cancerous cells whereby there is uncontrolled cell
division / cell replication / cell growth OR lack of contact inhibition / no apoptosis / proto-
oncogenes
A group of scientists has discovered that a change in the chromatin structure of mammalian
cell brought about by Protein A is associated with increased gene expression of several
genes involved in the suppression of tumour growth. Fig. 2.2 shows the overall survival (OS)
percentage of patients in the absence and presence of Protein A.
(b) (i) With reference to Fig. 2.2, comment on the overall survival percentage of patients
in the presence of Protein A with that in the absence of Protein A, and explain for
its differences. [4]
(ii) Explain how the presence of transcription factors causes an increase in the
expression of the gene involved in suppression of tumour growth. [3]
Compulsory marking point: Activator proteins (specific transcription factors) bind to distal
control elements grouped as an enhancer in the DNA.
DNA-bending protein binds to the DNA and brings the bound activators closer to the
promoter.
Enables the enhancer to influence a promoter hundreds or even thousands of
nucleotides away. Other transcription factors, mediator proteins and RNA polymerase
are nearby in the cells nucleus.
The activators bind to certain general transcription factors and mediator proteins. These
multiple protein-protein interactions help position and increase the rate of assembly of
the transcription initiation complex on the promoter for RNA synthesis to begin.
(iii) Suggest why the change in chromatin structure, in the presence of Protein A,
does not occur over large area of the chromatin [1]
Reason 1:
Only a small proportion of genes are to be expressed for tumor suppression
Thus genes that code for proteins that are not required in that particular cell type
will have their transcription repressed instead
Reason 2:
Size of eukaryotic genome is very large with largely non-coding regions
thus histone acetylation (changes to the chromatin structure) do not occur at
these regions as no gene expression is required
[Total: 15]
A: gp120
B: CD4 receptor
(b) Describe the events occurring in stage C leading to formation of structure A on the host
cells plasma membrane. [3]
(c) After contraction of HIV, the initial symptoms are followed by a stage called clinical
latency when no symptoms are observed for a few years. With reference to the
reproductive features of HIV, explain the cause of clinical latency. [1]
The reverse transcribed HIV DNA is integrated into the host chromosome as provirus.
Provirus remains silent/ transcriptionally inactive for years, causing no symptoms.
i. Distinguish the genome replication between HIV and influenza virus. [3]
Examiners comments: Not sufficient information is given in this question for marks
to be awarded. Enzymes should also be stated when mentioning processes.
ii. Every year, new flu vaccines are developed to ensure their efficacy. Explain the
frequent need for new flu vaccines. [2]
Influenza viruses undergo antigenic drift frequently due to high mutation rate during its
genome replication leading to change in conformation of haemagglutinin and
neuraminidase on its viral envelope
The lack of proof reading ability of RNA-dependent RNA polymerase as well as the fast
replication involving two rounds of complementary RNA strand formation account for
the high mutation rate.
[Total: 10]
4 The arrow in Fig. 4.1 shows the direction of an impulse in part of a nervous system.
(a) With reference to Fig. 4.1, describe how transmission of impulse is believed to take
place. [4]
(b) When summation of EPSP and IPSP exceeds threshold, depolarisation occurs. Explain
why the magnitude of the signal initiated at the exon hillock is always at constant
voltage. [2]
When threshold potential is reached, all the voltage sensitive sodium ion channels will
open, resulting in the influx of Na+.
When +50mv is reached, all the sodium ion channels will closed
It is an all-or-none event/Axon hillock naming
(c) Suggest the purpose of the refractory period during an action potential. [2]
In a nerve muscle preparation, a novel drug called AWZ with a molecular structure
resembling acetylcholine was applied to the cells. The investigation showed that the drug
significantly increases muscular contractions. However, it was found that the drug, when
applied to either one kind of cells directly, did not affect the axon nor muscle cells.
(d) Suggest, in detail, one possible way in which the drug, AWZ, could cause the
increased muscle contractions. [4]
Fig. 5.1
(ii) With reference to Fig 5.1, explain the mode of inheritance using two pieces of
evidences. [4]
A series of breeding experiments were carried out with a certain species of mice. A cross
between pure breeding males with red eyes and bent tails, and females with black eyes and
straight tails produced offspring all with red eyes and bent tails. The same results were
obtained when the cross was carried out again but with the sexes reversed.
(b) Suggest a reason for carrying out the cross with the sexes reversed. [2]
To check whether the genes are sex-linked. [Answers stating linked genes were
rejected]
If sex-linkage involved as the mode of inheritance, then offspring phenotypic ratio will
be different.
In another crossing, female offspring from the first experiment were then crossed with black
eyes and straight tails males to obtain the following:
Since 5.42<7.81, there is no significant difference between observed and expected and is
due to chance. Therefore accept null hypothesis.
(a)
(i) Describe how electron transport chain leads to ATP production. [3]
(ii) Compare the initial electron donor and final electron acceptor between oxidative
phosphorylation and photophosphorylation. [2]
Oxidative Photophosphorylation
phosphorylation
(b) A point mutation results in dysfunctional NADP+ reductase. State and explain how the
concentration of Ribulose 1,5 Bisphosphate in the chloroplasts would be affected.
[3]
NADP+ cannot be reduced to NADPH which is required as a reducing power for the
conversion of 1,3-bisphosphoglycerate to glyceraldehydes 3-phosphate.
The subsequent regeneration of Ribulose 1,5 Bisphosphate is prevented while carbon
fixation continues to occur,
depleting the supply of Ribulose 1,5 Bisphosphate, causing its concentration to drop.
(c) Glyceraldehyde 3-phosphate exits the Calvin cycle for production of glucose, which will
be used for cell wall formation. Explain how the structure of cellulose allows it to serve
its function. [4]
About 10,000 -glucose units with alternating units rotated 180o in space are linked by
(1,4) glycosidic bonds to form long and linear chains.
Large number of H-bonds / extensive cross-links is formed between the linear cellulose
chains due to the large number of -glucose units with protruding OH groups in each
chain.
These cross-linked chains are associated to form microfibrils, which are then meshed
into a macrofibril matrix .
The resultant great tensile strength & insolubility in water allows cellulose to be the main
component of plant cell wall, providing structural support to plant cells. The porous matrix
allows free passage of water molecules.
[Total: 12]
(a) Describe the principles which scientists use to classify organisms into taxonomic
groups. [2]
Thousands of years ago, populations of the greenish warbler spread around the western and
eastern edges of the Himalayan mountain range to establish themselves in north-eastern
Europe and Siberia.
One example of gradual change is in the song of the male warbler, which is very
distinctive and is used in mating behavior.
When greenish warblers from north-eastern Europe meet those from Siberia, no mating
takes place.
The greenish warblers from north-eastern Europe and Siberia are now considered to be
two separate species.
(b) State the likely isolating mechanism taking place in populations of the greenish warbler.
[1]
(c) Explain how the process of speciation occurred in the greenish warbler populations.
[4]
An investigation was carried out to study the relationships between the different species of
warbler using DNA analysis. The base sequences of a region of mitochondrial DNA from the
four species were compared and results are shown in Table 7.1.
Table 7.1
P. laetus
P. laetus P. laurae
(d) Researchers have put forward the hypothesis that the three species, P. laetus, P.
laurae and P. ruficapilla, have originated from three separate events in which a few
individuals of P. affinis spread directly from Cuba to three different places. The smaller
the number, the smaller the differences between the base sequences of the two
species.
Explain how the results in Table 7.1 support the researchers hypothesis. [2]
P. laetus, P. laurae and P. ruficapilla have smaller differences with P. affinis Thus,
are more closely related to D. affinis than to each other
[Quote figures]: For example the number of base differences between P. laurae and
P. affinis is 8.9, as compared to P. ruficapilla and P. laurae which is 15.0.
Comment about figures for P. laurae with P. laetus with reference to different times of
separation
(e) It was observed that the warblers have remained at approximately the same
frequency for many generations. Suggest an explanation for this phenomenon. [1]
[Total: 10]
Section B
Your answers should be illustrated by large, clearly labelled diagrams, where appropriate.
Your answers must be set out in sections (a), (b) etc., as indicated in the question.
Similarities:
Same number of genes;
Carry the same genes / carry code for the same characteristics;
Same relative position / loci along the chromosome;
Same length/ size/ shape;
Position of the centromere is the same;
Differences:
Different alleles/ carry genes of an alternative kind;
Each originates from different parents;
Different sequence of bases / nucleotides
(b) With reference to specific genes, discuss how point mutations and chromosomal
mutations can lead to cancer. [10]
Proto-oncogenes such as Ras gene codes for Ras protein which is involved in promoting
mitosis in the presence of signaling molecules such as epidermal growth factor.
Gain-of-function mutations change the proto-oncogene to oncogene, causing production
of hyperactive Ras protein or over-production of Ras protein.
Base pair substitutions in the coding sequence can results in missense mutations,
coding different amino acids and resulting in altered three dimensional conformation of
the protein. For instance, the GTPase active site could be altered and is no longer able
to catalyse hydrolysis of GTP bound to Ras protein, making it perpetually active /
hyperactive.
Base pair substitutions in the regulatory sequences such as promoter and enhancer of
the Ras gene can transform the promoter into a more powerful regulator of gene
transcription, resulting in large quantity of Ras protein synthesized.
Chromosomal translocation can cause Ras gene next to a stronger promoter, resulting in
over-production of Ras protein.
Aneuploidy as a result of non-disjunction during mitosis can lead to more than 2 copies
of the Ras gene present in a cell, resulting in over-production of Ras protein also.
Tumor suppressor genes such as p53 gene codes for p53 protein which is a transcription
factor switching on genes whose products are involved in repairing DNA damage or
triggering apoptosis should the damage is beyond repair.
Point mutations and chromosomal mutations can lead to loss-of-function mutation in p53
gene, leading to nonfunctional p53 protein or inadequate amount of p53 protein.
Base pair substitutions in the coding sequence of p53 gene can lead to missense
mutations, coding for a different amino acid. The tertiary structure of p53 protein is
altered, rendering it dysfunctional.
Base pair substitution in the regulatory sequence such as promoter or enhancer of p53
gene can lead to a non-functional promoter or enhancer not recognizable by transcription
factors and RNA polymerase, hence leading to transcriptional inactivation. No or
insufficient p53 protein is produced.
A chromosomal translocation of p53 gene next to a non-promoter region such as
centromere or other repeated sequence cause the gene to be silent / no expressed.
Aneuploidy as a result of non-disjunction during mitosis can lead to only 1 copy of p53
gene present, increasing the likelihood of losing functional p53 proteins as a mutant
allele will not be masked by the other normal allele.
Chomosomal deletion may also result in loss of heterozyosity. One less copy of p53
gene is present in the genome. Mutation in the only allele will directly cause loss of
functional p53 proteins in the cell.
When both p53 alleles undergo loss-of-function mutation, no functional p53 proteins are
produced to arrest cell cycle when there is severe DNA damage, causing genetic
instability.
When mutations accumulate in the genome, especially mutations in other tumor
suppressor genes and proto-oncogenes occur, cells will undergo mitosis uncontrollably,
leading to cancer.
7 (a) Describe how the effects of glucagon are achieved in the liver cell. [10]
1. Ligand-receptor interactions:
Hormone glucagon binds to a G protein-coupled receptor (GPCR) present on the cell
surface membrane of liver cells
Ligand-receptor interaction results in the formation of a hormone-receptor complex
The hormone glucagon is the first messenger that triggers the subsequent
intracellular signaling events in the target cell
2. Signal Transduction:
Binding of glucagon triggers a conformation change in the GPCR
providing a signal that activates the G protein (found on the cytoplasmic side of the
membrane) by replacing the GDP to a GTP
The activated G protein diffuses along the plasma membrane to bind to and activate
adenylyl cyclase which in turn catalyses the conversion of many cyclic AMP (cAMP)
molecules from ATP
cAMP acts as a second messenger (within the liver cell) to activate enzymes such as
protein kinase A
Protein kinase A activate other enzymes by phosphorylating them triggering a
phosphorylation cascade that serves to amplify the initial signal
where the binding of a single glucagon molecule results in a strong response inside
the cell/ number of enzyme molecules activated each step exceeds the preceding
step
3. Cellular response:
(Phosphorylation cascade) finally leads to activation of glycogen phosphorylase
which is needed for the breakdown of glycogen stored in liver cells to glucose
molecules
thereby increasing the availability of glucose for cellular respiration / bring blood
glucose levels back to the norm
(b) Discuss why the eukaryotic genome is considered to be more complex than the
prokaryotic genome. [10]
Usually haploid (i.e. only 1 set of Usually in diploid or higher ploidy levels
chromosomes)
Pairing of homologous chromosomes,
No pairing of homologous chromosomes allows for genetic recombination during
possible, hence no genetic meiosis, giving rise to genetic diversity
recombination as a means of giving rise
to genetic diversity
Allows only single-step control of gene Fine tuned control of gene expression,
expression, i.e. dependent on promoter allows for different levels of expression
strength and operator state of a particular gene depending on the
activators and repressors present in the
cell at a specific time
Hence only one possible protein product Presence of introns allows for choice of
per gene splice sites, giving rise to varying mature
mRNA molecules and hence multiple
possible protein variants from the same
gene
Hence fewer levels of control of gene Allowing for more levels of control of
expression gene expression
CANDIDATE
NAME
BIOLOGY REGISTRATION
CLASS NUMBER
BIOLOGY 9648/03
Paper 3 17 September 2013
2 hours
Additional Materials: Answer Paper
Write your Biology class, registration number and name on all the work you hand in.
You may use a soft pencil for any diagrams, graphs or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
The number of marks is given in brackets [ ] at the end of each question or part question.
Section A
Write your answers in this booklet using dark blue or black pen.
5 / 20
TOTAL / 72
Section A
Fig. 1.1 shows a recombinant plasmid construct named pMCS-Red Firefly Luc used
to study the regulation of lac operon in bacteria.
Fig. 1.1
Fig 1.2 shows the detailed structure of Red Firefly Luc insert.
(a) State the factors which you will need to consider when choosing the right restriction
enzyme to construct the pMCS-Red Firefly Luc.
[2]
(b) Both genomic and cDNA libraries of firefly are available. State where you will take the
luciferase gene from for this experiment. Justify your decision.
[2]
Outline how you can select bacterial cells transformed with recombinant plasmid
containing the Red Firefly Luc insert.
[2]
A few experiments are conducted to study the regulation of lac operon via expression of
luciferase gene in the bacterial colonies.
Complete the table below by putting in + (low light intensity), ++ (high light intensity) and
- (no light emitted) in the last column.
1
2
3
4
[2]
[4]
(e) Instead of Red Firefly Luc, human insulin gene can also be cloned into pMCS plasmid
shown in Fig.1.1. Suggest a suitable method to select bacterial cells transformed with
recombinant plasmid containing the insulin gene insert.
[2]
[Total: 14]
The molecular basis of XP-V was determined using DNA samples from a family in North
America. Insertion of a single guanine nucleotide at position 1078 of exon 10 of the
POLH gene creates a new Bsl1 site as shown in Fig. 2.1 and is linked to an RFLP.
Fig. 2.1
(a) State and explain the possible consequence of such gene mutation.
[2]
(b) Describe two factors that are required for an RFLP marker to be used in disease
detection.
[2]
(c) PCR amplification of the entire coding region of POLH gene was first performed.
Step B
Step A
Fig. 2.2
(i) Step A
[1]
(ii) Step B
[1]
Digestion of POLH gene from individuals within the family was then carried out using Bsl1.
Fig. 2.3 shows the incomplete pedigree chart and the results obtained from gel
electrophoresis.
1 2
I
I II
3 4 5
III
6 7
Fig. 2.3
Legend:
(-) indicates no Bsl1 treatment; (+) indicates Bsl1 treatment; (*) indicates normal size band;
() indicates bands of digested DNA.
(d) Using the information provided in the question and with reference to Fig. 2.3, state and
explain the genotype of individual III-6.
[2]
(d) Outline the experimental procedure of obtaining a DNA fingerprint after the action of Bsl1.
[4]
[3]
[Total: 15]
Set 2
3. (a) Immature anther of a hibiscus flower bud was removed and the procedure shown in
Fig. 3.1 was carried out to make complete plantlets.
formation of callus
addition of colchicine
Fig. 3.1
[1]
(ii) Describe briefly the importance of adding sucrose to the sterile medium.
[1]
(iii) Explain the purpose of adding colchicine in the final stages of the procedure.
[2]
(b) Explain the advantages of tissue culture over more traditional methods of cloning plants,
such as taking cuttings or graftings.
[2]
(c) With a relevant example, explain how genetic engineering has improved the quality of crops.
[3]
(d) Researchers are experimenting with the injection of human brain cells into the brain
tissues of mice. Discuss the ethical concerns that may arise.
[2]
[Total: 11]
4. Planning question
Write your answers to this question on the separate answer paper provided.
A type of genetically modified sugar cane contains higher amount of sucrose per unit mass. You
are required to measure the sucrose concentration of freshly squeezed sugar cane juice from
this new variant.
Your planning must be based on the assumption that you have also been provided with the
following materials which you must use:
In addition, you may include in your plan the usage of any equipment that can be found in a
standard school laboratory.
[Total: 12]
Write your answers to this question on the separate answer paper provided.
Your answer:
5 (a) Explain, with examples, the treatment of genetic diseases with reference to viral
and non-viral gene delivery systems. [8]
(b) Discuss the social and ethical concerns that have arisen from gene therapy in the
treatment of genetic diseases. [6]
Section A
Fig. 1.1 shows a recombinant plasmid construct named pMCS-Red Firefly Luc used
to study the regulation of lac operon in bacteria.
(a) State the factors which you will need to consider when choosing the right restriction
enzyme to construct the pMCS-Red Firefly Luc. [2]
The restriction site of the enzyme must be present in both the MCS of the plasmid and
the sequence flanking the Red Firefly Luc insert, so that complementary sticky ends will
be produced for ligation.
The restriction site must only be found once in the whole plasmid / must be a unique
cloning site.
(b) Both genomic and cDNA libraries of firefly are available. State where you will take the
Luciferase gene from for this experiment. Justify your decision. [2]
cDNA libraries
Firefly is a eukaryote whose genes contain introns which need to be removed through
splicing during post-transcriptional modifications of pre-mRNA. Bacteria are prokaryotes
which do not perform post-transcriptional modifications. Hence, cDNA of luciferase gene
which only contain exons is needed for bacteria to produce functional luciferase.
(i) Outline how you are to select bacterial cells transformed with recombinant plasmid
containing the Red Firefly Luc insert.
Add IPTG/ lactose (served as inducer to switch on the operon) and luciferin
(substrate of luciferase) to the medium. Those colonies which give out
luminescence are cells transformed with recombinant plasmids containing the
luciferase gene.
A few experiments are conducted to study the regulation of lac operon via expression of
luciferase gene in the bacterial colonies.
Complete the table below by putting in + (low light intensity), ++ (high light intensity) and -
(no light emitted) in the last column.
When lactose is present, allolactose acts as an inducer which binds and changes
the conformation of repressor protein. Thus the repressor protein can no longer
bind the operator, allowing RNA polymerase to transcribe the luciferase gene.
(d) Instead of Red Firefly Luc, human insulin gene can also be cloned into pMCS plasmid
shown in Fig.1.1. Suggest a suitable method to select bacterial cells transformed with
recombinant plasmid containing the insulin gene insert. [2]
[Total: 14]
The molecular basis of XP-V worldwide was analyzed from a family in North America.
Insertion of a single guanine at position 1078 of exon 10 creates a new Bsl1 site as
shown in Fig. 2.1 and is linked to an RFLP.
(a) State and explain the possible consequence of such gene mutation. [2]
Leads to frame-shift mutation as the bases downstream are re-grouped into different
codons
Extensive missense or nonsense mutations can be resulted Causing different
sequence of amino acid coded or shorter amino acid sequence
Altered three dimensional structure of DNA polymerase / truncated protein leading to a
loss of biological function
(b) Suggest two factors that are required for a RFLP marker to be used in disease
detection. [2]
The marker must be polymorphic, meaning that alternative forms must exist among
individuals for detection among different members in the family.
The marker must be closely linked to the disease locus such that crossing over between
the marker and the gene is unlikely to occur during gamete formation. The greater the
distance between the RFLP and gene locus, the lower the probability of an accurate
diagnosis.
(c) PCR amplification of the entire coding region of POLH was first performed.
DNA strand elongate from the 3 end of the DNA primer using Taq DNA
polymerase where extension of DNA strand occurs from 5 to 3 direction
Digestion of POLH gene from individuals within the family was then carried out using Bsl1.
Fig. 2.3 shows the incomplete pedigree chart and the results obtained from gel
electrophoresis.
(d) Using the information provided in the question and with reference to Fig. 2.3, state and
explain the genotype of individual III-6. [2]
Have the presence of one band that corresponds to the wild-type allele which is 353bp,
while the other two bands correspond to the mutant allele which corresponds to 105bp
and 248bp
(e) Outline the experimental procedure, after the action of Bsl1, of obtaining a DNA fingerprint. [4]
Bands obtained are transferred / blotted from the gel onto a nitrocellulose membrane
(f) Apart from disease detection, explain how RFLP analysis facilitates genomic mapping.
[3]
[RFLP as genetic marker]: RFLP markers spaced throughout the chromosomes are used
as genetic markers (such as STRs, and other polymorphic sites)
[RFLP in the construction of linkage map]: Frequency with which two RFLP markers or
an RFLP marker and a certain allele for a gene are inherited together is a measure of the
closeness of the 2 gene loci on a chromosome.
The higher the frequency of 2 RFLP being inherited together, the closer the 2 loci are on
the chromosome / Based on cross-over values / recombination frequency / frequency of
crossing-over between the RFLP marker and the gene loci (or between 2 RFLP markers)
[RFLP in determining the order of markers]: The presence of RFLP on a chromosome
can serve as marker to order the sequence of genes and their relative distances on a
chromosome.
[Total: 15]
3. (a) Immature anther of a hibiscus flower bud was removed and the following main
procedures were introduced in the making of a complete plantlet.
(ii) Describe briefly the importance of adding sucrose in the sterile medium. [1]
as plant cells in the culture medium lack autotrophic ability/ are unable to
photosynthesize. or
(iii) Explain the purpose of adding the chemical colchicine in the final stages of the procedure. [2]
To double the chromosome number, to restore the haploid cells back to the diploid
condition.
By preventing mitotic spindle formation
Hence sister chromatids cannot be separated during anaphase of mitosis
(b) Explain the advantages of tissue culture over more traditional methods of cloning plants,
such as taking cuttings or graftings. [2]
The rapid and mass multiplication of plants is made possible because a single plant can
be cloned into thousands or millions of genetically identical copies by subdividing
calluses as they grow.
Plant tissue cultures take up relatively little space compared to growing plants in
greenhouses or on farms.
Micropropagated plants can be airfreighted easily and cheaply, because cultures are not
bulky.
Many genetically engineered plants can be multiplied and mass produced relatively
easily.
(c) With relevant example, explain how genetic engineering has improved the quality of crops. [3]
(d) Researchers are experimenting with the injection of human brain cells into the brain
tissues of mice. Suggest the ethical considerations that may arise. [2]
[Total: 11]
4. Planning question
Write your answers to this question on the separate answer paper provided.
A type of genetically modified sugar cane contains higher amount of sucrose per unit mass. You
are required to measure the sucrose concentration of freshly squeezed sugar cane juice from
this new variant.
Your planning must be based on the assumption that you have also been provided with the
following materials which you must use:
In addition, you may include in your plan the usage of any equipment that can be found in a
standard school laboratory.
[Total: 12]
When Benedicts solution containing Cu2+ is added, reducing sugar causes Cu2+ to be
reduced to Cu2O, which is a red precipitate.
Dilute hydrochloric acid is used to hydrolyse sucrose into reducing sugars glucose and
fructose
Benedicts solution is then added to test for the amount of reducing sugars / glucose and
fructose present.
The higher the concentration of sucrose, the greater the amount of brick-red precipitate
produced from the Benedicts test, and the less Cu2+ remaining in the Benedicts solution
After filtering the ppt out, use colorimeter to measure the colour intensity of the filtrate, and
lower absorbance value is expected.
Compare the absorbance value of the S with absorbance values of sucrose solutions of
known concentrations by reading off the graph plotted
Variables: (1 mark)
Dependent variables: amount of ppt produced in Benedicts test measured as absorbance value
in colorimeter (A.U.)
Using simple dilution (include dilution table) to obtain at least five sucrose solutions of
known concentrations, with equal intervals (concentration range: 1% - 10%)
Use syringe to add 2 cm3 of each sucrose solution (including solution S) into a separate test
tube
Use syringe to add 2cm3 dilute hydrochloric acid to test tube and mix well
Place the test tubes into a thermostatically controlled water bath set at 100 oC / boiling
water bath for three minutes (accept reasonable time)
Remove the test tubes from water bath. Use syringe to add 5cm 3 (accept reasonable range)
of sodium hydrogen carbonate solution until no effervescence is observed. This is to quench
the acid hydrolysis reaction by neutralising the acid
Place test tubes into a thermostatic water bath set at 100oC / boiling water bath; for 2
minutes (accept reasonable time);
Place a small sample of each filtrate into the colorimeter to read the absorbance value
Tabulation of data with correct column headings and units; include average value for
absorbance value;
Reagents such as Benedicts solution, dilute hydrochloric acid, etc are corrosive to skin and
eyes. Wear gloves and goggles. Rinse under running water when in contact occurs.
Boiling water bath can scald. Handle hot glassware such as test tubes with test-tube holders
or oven gloves/rags.
Write your answers to this question on the separate answer paper provided.
Your answer:
5 (a) Explain, with examples, the treatment of genetic diseases with reference to viral
and non-viral gene delivery system. [8]
(b) Discuss the social and ethical concerns that have arisen from gene therapy in the
treatment of genetic diseases. [6]
(a) Explain, with examples, the treatment of genetic diseases with reference to viral and
non-viral gene delivery system. [8]
1. Gene therapy is a technique for introducing normal allele for the purpose of generating
functional (correct) protein product to restore the target cell to normal state (correct
function of cell / correct phenotype)
2. Example of viral gene delivery method involves SCID treatment, using ex vivo method
3. Functional ADA allele is cloned into retroviral vector. The viral vector has to be
genetically engineered so that they neither produce disease nor replicate in the host cell.
4. Patients lymphocytes will then be extracted from the blood and be transfected with ADA
recombinants
5. Following infection, the recombinants cells can be cultured in a suitable medium and
suitable cells can then be expanded in culture in vitro before they were re-injected into
the patients blood stream.
(Max: 4)
6. Example of viral gene delivery method involves CF treatment, using in vivo method
7. Functional CFTR allele is cloned into adenoviral vector. The viral vector has to be
genetically engineered so that they neither produce disease nor replicate in the host cell.
9. Directly either through a bronchoscope or through the nasal cavity. the gene is
inserted into cells within body
10. Example of using non-viral gene delivery method involves cystic fibrosis treatment, using
the in vivo method
11. In vivo cationic liposomes are used and consists of lipid : DNA complexes that were
developed for the transfection of epithelial cells lining the airway
12. DNA (functional CFTR allele) interacts with the cationic lipids on the inner layer via
electrostatic interactions. The cationic lipids on the outer layer serve to play a role in
enhancing liposome interaction with the target cells
13. The functional CFTR allele enters the target cells (i.e. lung epithelial cells) through the
lipids fusing with the plasma membrane, and the DNA eventually entering the cell
nucleus. direct introduction of DNA into target cells
14. Liposomes containing the functional CFTR allele are administered by the inhalation of
aerosols by the patient.
(Max: 4)
(b) Discuss the social and ethical concerns that have arisen from gene therapy in the
treatment of genetic diseases. [6]
Social considerations
1. Gene therapy is currently very expensive and there is concern about gene therapy
becoming accessible only to the wealthy
2. Possible enhancements in creating an advantage for those who can afford the treatment
3. Large numbers of gene therapy trials are currently directed to diseases with an
enormous social impact, such as cancer, SCID, CF etc.
4. Gene therapy might provide new forms of treatments directed to currently unmet clinical
needs with the potential impact to improve patients quality of life
5. Concern over widespread use of gene therapy making society less accepting of people
who have mild disorders
7. Gene therapy might provide new forms of treatments directed to currently unmet clinical
needs / alternative treatments for patients where conventional treatments have failed.
Ethical considerations
8. Difficulty in following-up with patients in long-term clinical research. Gene therapy
patients have to be under surveillance to monitor for long term effects of the therapy on
future generations.
9. Concerns over whether patients and their family members fully understand the risks
associated with gene therapy trials
10. And whether they make informed decisions before participating in a trial
11. Ref. to Jesse Gelsinger (1st death) gene therapy trial he had a relatively mild form of a
disease that was being successfully treated with medication and perhaps should not
have been a gene therapy trial participant
12. Issues pertaining to safety and efficacy of gene therapy as such therapy have not yet
had the success anticipated by many scientists as a few unexpected complications and
side effects have been identified. Therefore, the novelty of risks related to gene transfer
means there will be lots of uncertainties as compared to conventional therapeutics.
13. Raises questions over who should participate in a human trial the terminally ill with no
treatment options or anyone who understands the potential risk but is a willing participant
14. Sponsors of human clinical trials must exercise responsibility in balancing experimental
aims and ensuring that participants are not exposed to known risks / experimental
products are as safe as possible.
15. Issues of justice and allocation where the high cost of gene therapy for the actual
treatment and technical expertise may leads to inequality between individuals with
genetic enhancements and those without.
16. In the event of disastrous outcomes brought about by gene therapy, the challenge lies in
identifying who should be held accountable
17. Germ-line gene therapy will violate the rights of subsequent generations to inherit a
genetic endowment that has not been intentionally modified and permission must be
sought from the individuals in these generations as to whether are they willing to
undergo gene therapy.
18. Concerns about the protection of privacy and confidentiality of medical information of
patients involved in clinical trials
19. Which may have implications on (medical) insurance coverage and/or employability
20. There can be the potential harmful abuse of the technology where individuals are using
the technique for enhancement rather than for therapeutic purpose. Tampering with
human genes / nature and bias handling of trial results
These are the cells in morula, which are formed during the first few divisions after
fertilisation/fusion of an egg and sperm.
Zygotic stem cells, which include the zygote and early embryo cells are totipotent.
They have the ability to differentiate into any cell type to form whole organisms and
hence are also pluripotent and multipotent.
Functions
2. Zygotic stem cell has the potential to differentiate into all the cells that form the complete
organism plus the extra-embryonic tissues which include the placenta and amnion.
3. These cells give rise to form all cells in the body of the organism therefore they have
limited ability to self-renew.
Embryonic stem cells are pluripotent. They have the ability to differentiate into almost
any cell type to form any organ or type of cell and so are not totipotent but are multi-
potent.
They are obtained from the Inner Cell Mass on the fourth day of development where the
embryo forms into two layers, an outer layer (extra-embryonic membranes) and an inner
cell mass (ICM).
Functions
5. Inner cell mass (ICM) forms the three primary germ layers: ectoderm, endoderm and
mesoderm, which later form all the tissues of the human body.
6. Give rise to various organs in organism / multiple specialized cell types that make up the
heart, lung, skin and other tissues in the developing foetus.
7. Adult stem cells [E.g. Blood stem cells, Stromal Stem cells, Gut Epithelium stem cells]
Blood stem cells are multipotent. / found in each tissues or organs which have the ability
to differentiate into a limited range of cell type and so are not pluripotent or totipotent.
Functions
8. Help to replenish worn-out or damaged cells / responsible for constant renewal of blood
CANDIDATE
NAME
CLASS
BIOLOGY 9648/01
Paper 1 Multiple Choice September 2013
1 hour 15 minutes
Additional Materials: Multiple Choice Answer Sheet
There are forty questions on this paper. Answer all questions. For each question there are four possible
answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer Sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
Calculators may be used.
[Turn over
1064
2
1 The diagram shows the ultrastructure of a eukaryotic cell.
3 Which statement is true for cellulose, but not true for protein?
H2 Biology/9648/01
1065
3
4 Diagrams 1, 2 and 3 show the structural formulae of three polysaccharides.
1 2 3
A amylose cellulose Glycogen
B amylose glycogen Amylose
C cellulose glycogen Cellulose
D glycogen amylose Amylose
5 The graph shows the activation energy of an enzyme-catalysed reaction and the same
reaction without a catalyst.
H2 Biology/9648/01
1066
4
6 Which of the following statement about chromosome structure is true?
A 1 and 2
B 1 and 4
C 2 and 3
D 3 and 4
7 If there were 30 amino acids and DNA only contained three types of nitrogenous bases,
what would be the minimum number of bases per codon that could code for proteins?
A 3
B 4
C 6
D 8
A Both strands of the DNA have the same sequence of purines and pyrimidines.
B In each strand, the number of purine bases equals the number of pyrimidine bases.
C Purine bases in one strand become hydrogen-bonded to purine bases in the other
strand.
D The number of purine bases in one strand equals the number of pyrimidine bases in
the other strand.
H2 Biology/9648/01
1067
5
9 Part of the amino acid sequences in normal and sickle cell haemoglobin are shown.
Which tRNA molecule is not involved in the formation of this part of the sickle cell
haemoglobin?
A B C D
H2 Biology/9648/01
1068
6
12 Which statement about the genomes of prokaryotes is correct?
A via conjugation
B via transduction
C via transformation
D both A and C above
H2 Biology/9648/01
1069
7
16 The diagram below depicts a lac operon of the wild type bacterial chromosome in E. coli.
The lacZ gene is regulated via the normal operator sequence (O+). However, the lacZ allele
is a recessive form (lacZ-) that does not code for beta-galactosidase.
Structural gene
for beta-galactosidase
This particular E. coli strain is conjugated with a mutant strain of E. coli carrying the P lac Oc
lacZ+ DNA sequence as shown below. In this sequence, the lacZ allele is normal (lacZ+)
but the operator (O) is mutated. The Oc mutant is unable to bind the lac repressor coded for
by lacI.
sequence W
Structural gene
for beta-galactosidase
How would the expression of the lacZ gene be regulated in the recipient cells after
homologous recombination between the wild type (recipient) and the mutant strain (donor)
involving sequence W?
H2 Biology/9648/01
1070
8
18 Which of the following event(s) is/are necessary for the production of a malignant tumour?
A 1 and 2
B 1 only
C 3 only
D 3 and 4
19 In Drosophila long wing and broad abdomen are dominant to vestigial wing and narrow
abdomen. A pure-breeding long-winged, broad-abdomened Drosophila is crossed with
pure-breeding vestigial-winged and narrow-abdomened Drosophila. Two of the F1
generation were crossed and the following results were produced in the F2 generation.
A autosomal linkage
B incomplete dominance
C Mendelian dihybrid inheritance
D Mendelian monohybrid inheritance
20 In cats, the genes controlling coat-colour are co-dominant and carried on the X
chromosomes. When a black female was mated with a ginger male the resulting litter
consisted of black male and tortoise-shell female kittens.
H2 Biology/9648/01
1071
9
21 The diagram shows the pedigree of a family carrying sex-linked allele for colour-blindness.
normal male
normal female
colour-blind male
colour-blind female
From which labelled member of his family did F inherit this disorder?
22 In guinea pigs, the allele R for rough coat is dominant over allele r for smooth coat and the
allele B for black fur is dominant over the allele b for white fur. The genes for fur colour and
texture are not linked.
Two guinea pigs with genotype RrBb were mated together and one of the offspring had a
rough and black coat.
What is the probability that this offspring was homozygous for both rough coat and black
fur?
A 1 in 16
B 1 in 9
C 2 in 16
D 2 in 9
H2 Biology/9648/01
1072
10
24 The flow diagram shows some of the stages in respiration.
A 1 and 3
B 2 and 3
C 3 and 4
D 4 and 5
H2 Biology/9648/01
1073
11
25 Six tubes containing preparations from animal tissue were set up as shown in the table.
tube Contents
1 glucose + homogenised cells
2 glucose + mitochondria
3 glucose + cytoplasm lacking organelles
4 pyruvate + homogenised cells
5 pyruvate + mitochondria
6 pyruvate + cytoplasm lacking organelles
A 1, 2 and 4
B 1, 4 and 5
C 2, 4 and 5
D 2, 4 and 6
26 Variegated leaves of a plant were supplied with radioactive carbon dioxide ( 14CO2) during
an experiment. Leaf X was kept in the dark and leaf Y was kept in the light.
At the end of the experiment, the radioactivity in the leaves was measured. The results (in
arbitrary units) are shown in the boxes in the diagram
What is the most likely explanation for the level of radioactivity found in the yellow zone of
leaf Y?
H2 Biology/9648/01
1074
12
27 The diagram shows an action potential.
time
resting
potential
At which point on the graph is the membrane most permeable to sodium ions?
28 What effect do sexual processes (meiosis and fertilization) have on the allelic frequencies in
a population?
A They tend to reduce the frequencies of deleterious alleles and increase the
frequencies of advantageous ones.
B They tend to increase the frequencies of deleterious alleles and reduce the
frequencies of advantageous ones.
C They tend to selectively combine favourable alleles into the same zygote but do not
change allelic frequencies.
D They have no effect on allelic frequencies.
29 As adults, certain species of whales possess baleen instead of teeth. Baleen is used to filter
the whales diet of planktonic animals from seawater. As embryos, baleen whales possess
teeth, which are later replaced by baleen. The teeth of embryonic baleen whales are
evidence that
H2 Biology/9648/01
1075
13
30 The population of the Malayan Colugo in Singapore shown below are descendants from a
small population of Colugos that were over-hunted and had their habitats destroyed post-
1819 when 90% of primary forests in Singapore were cleared.
31 In using the average mutation rate of a gene as a molecular clock, which of the following
would act to make the clock underestimate the true amount of time that had elapsed since
two related species diverged from their common ancestor?
A mutation
H2 Biology/9648/01
1076
14
33 The diagram below shows the general procedure in the cloning of an animal gene to study
gene expression.
34 The diagram below shows a plasmid carrying two selectable markers which code for
resistance to kanamycin and neomycin. The restriction site is also shown.
DraI
kanamycin neomycin
resistance gene resistance gene
A eukaryotic gene is produced by the restriction endonuclease DraI. This gene was inserted
and ligated into a cut plasmid containing compatible ends. The E. coli transformation
mixture was grown in four different media: nutrient medium plus kanamycin, nutrient
medium plus neomycin, nutrient medium plus kanamycin and neomycin, and nutrient
medium containing no antibiotics.
The bacteria which has taken up the religated plasmid would grow in
H2 Biology/9648/01
1077
15
35 A sample of DNA is cut at the positions indicated (marked with ) below.
When the fragments are loaded and run on an electrophoresis gel, which lane (1 to 5) has
the pattern that you would expect?
A 1
B 2
C 3
D 4
H2 Biology/9648/01
1078
16
38 What are the normal functions of stem cells in a living human?
Functions
A differentiating into producing insulin in cells that can
many kinds of cells in pancreas damaged differentiate into bone
a 3 -5 by type 1 diabetes cells in the skeleton
day old human
embryo
B differentiating into producing red blood cells that can
many kinds of cells in cells worn out by differentiate into
a 3 -5 normal wear and tear cardiac muscles in
day old human the heart
embryo
C differentiating into producing dopamine cells that can
only one kind of cells in brains of people differentiate into
in a 3 -5 with Parkinsons cartilage cells in the
day old human disease joint
embryo
D differentiating into producing cells that can
only one kind of cells differentiated cells differentiate into
in a 3 -5 that can be used to nerve cells in the
day old human screen new drugs brain
embryo
A Cystic fibrosis
B Haemophilia
C Hungtingtons disease
D Sickle cell anaemia
40 What are some similarities between all cancer cells and all stem cells?
A They replicate indefinitely, are non-differentiated and can be found in various parts of
the body.
B They replicate indefinitely, lack cell-cell adhesion and are able to move from one
location in the body to another.
C They lack contact inhibition, are non-differentiated and are regulated by molecular
signals.
D They are able to move from one location in the body to another, are regulated by
molecular signals and can be found in various parts of the body.
H2 Biology/9648/01
1079
CANDIDATE
NAME MARK SCHEME
CLASS
BIOLOGY 9648/01
Paper 1 Multiple Choice September 2013
1 hour 15 minutes
Additional Materials: Multiple Choice Answer Sheet
There are forty questions on this paper. Answer all questions. For each question there are four possible
answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer Sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
Calculators may be used.
[Turn over
1080
2
1 The diagram shows the ultrastructure of a eukaryotic cell.
3 Which statement is true for cellulose, but not true for protein?
H2 Biology/9648/01
1081
3
4 Diagrams 1, 2 and 3 show the structural formulae of three polysaccharides.
1 2 3
A amylose cellulose Glycogen
B amylose glycogen Amylose
C cellulose glycogen Cellulose
D glycogen amylose Amylose
5 The graph shows the activation energy of an enzyme-catalysed reaction and the same
reaction without a catalyst.
H2 Biology/9648/01
1082
4
6 Which of the following statement about chromosome structure is true?
A 1 and 2
B 1 and 4
C 2 and 3
D 3 and 4
7 If there were 30 amino acids and DNA only contained three types of nitrogenous bases,
what would be the minimum number of bases per codon that could code for proteins?
A 3
B 4
C 6
D 8
A Both strands of the DNA have the same sequence of purines and pyrimidines.
B In each strand, the number of purine bases equals the number of pyrimidine bases.
C Purine bases in one strand become hydrogen-bonded to purine bases in the other
strand.
D The number of purine bases in one strand equals the number of pyrimidine bases in
the other strand.
H2 Biology/9648/01
1083
5
9 Part of the amino acid sequences in normal and sickle cell haemoglobin are shown.
Which tRNA molecule is not involved in the formation of this part of the sickle cell
haemoglobin?
A B C D
H2 Biology/9648/01
1084
6
12 Which statement about the genomes of prokaryotes is correct?
A via conjugation
B via transduction
C via transformation
D both A and C above
H2 Biology/9648/01
1085
7
16 The diagram below depicts a lac operon of the wild type bacterial chromosome in E. coli.
The lacZ gene is regulated via the normal operator sequence (O+). However, the lacZ allele
is a recessive form (lacZ-) that does not code for beta-galactosidase.
Structural gene
for beta-galactosidase
This particular E. coli strain is conjugated with a mutant strain of E. coli carrying the P lac Oc
lacZ+ DNA sequence as shown below. In this sequence, the lacZ allele is normal (lacZ+)
but the operator (O) is mutated. The Oc mutant is unable to bind the lac repressor coded for
by lacI.
sequence W
Structural gene
for beta-galactosidase
How would the expression of the lacZ gene be regulated in the recipient cells after
homologous recombination between the wild type (recipient) and the mutant strain (donor)
involving sequence W?
H2 Biology/9648/01
1086
8
18 Which of the following event(s) is/are necessary for the production of a malignant tumour?
A 1 and 2
B 1 only
C 3 only
D 3 and 4
19 In Drosophila long wing and broad abdomen are dominant to vestigial wing and narrow
abdomen. A pure-breeding long-winged, broad-abdomened Drosophila is crossed with
pure-breeding vestigial-winged and narrow-abdomened Drosophila. Two of the F1
generation were crossed and the following results were produced in the F2 generation.
A autosomal linkage
B incomplete dominance
C Mendelian dihybrid inheritance
D Mendelian monohybrid inheritance
20 In cats, the genes controlling coat-colour are co-dominant and carried on the X
chromosomes. When a black female was mated with a ginger male the resulting litter
consisted of black male and tortoise-shell female kittens.
H2 Biology/9648/01
1087
9
21 The diagram shows the pedigree of a family carrying sex-linked allele for colour-blindness.
normal male
normal female
colour-blind male
colour-blind female
From which labelled member of his family did F inherit this disorder? B
22 In guinea pigs, the allele R for rough coat is dominant over allele r for smooth coat and the
allele B for black fur is dominant over the allele b for white fur. The genes for fur colour and
texture are not linked.
Two guinea pigs with genotype RrBb were mated together and one of the offspring had a
rough and black coat.
What is the probability that this offspring was homozygous for both rough coat and black
fur?
A 1 in 16
B 1 in 9
C 2 in 16
D 2 in 9
H2 Biology/9648/01
1088
10
24 The flow diagram shows some of the stages in respiration.
A 1 and 3
B 2 and 3
C 3 and 4
D 4 and 5
H2 Biology/9648/01
1089
11
25 Six tubes containing preparations from animal tissue were set up as shown in the table.
tube Contents
1 glucose + homogenised cells
2 glucose + mitochondria
3 glucose + cytoplasm lacking organelles
4 pyruvate + homogenised cells
5 pyruvate + mitochondria
6 pyruvate + cytoplasm lacking organelles
A 1, 2 and 4
B 1, 4 and 5
C 2, 4 and 5
D 2, 4 and 6
26 Variegated leaves of a plant were supplied with radioactive carbon dioxide ( 14CO2) during
an experiment. Leaf X was kept in the dark and leaf Y was kept in the light.
At the end of the experiment, the radioactivity in the leaves was measured. The results (in
arbitrary units) are shown in the boxes in the diagram
What is the most likely explanation for the level of radioactivity found in the yellow zone of
leaf Y?
H2 Biology/9648/01
1090
12
27 The diagram shows an action potential.
time
resting
potential
At which point on the graph is the membrane most permeable to sodium ions? A
28 What effect do sexual processes (meiosis and fertilization) have on the allelic frequencies in
a population?
A They tend to reduce the frequencies of deleterious alleles and increase the
frequencies of advantageous ones.
B They tend to increase the frequencies of deleterious alleles and reduce the
frequencies of advantageous ones.
C They tend to selectively combine favourable alleles into the same zygote but do not
change allelic frequencies.
D They have no effect on allelic frequencies.
29 As adults, certain species of whales possess baleen instead of teeth. Baleen is used to filter
the whales diet of planktonic animals from seawater. As embryos, baleen whales possess
teeth, which are later replaced by baleen. The teeth of embryonic baleen whales are
evidence that
H2 Biology/9648/01
1091
13
30 The population of the Malayan Colugo in Singapore shown below are descendants from a
small population of Colugos that were over-hunted and had their habitats destroyed post-
1819 when 90% of primary forests in Singapore were cleared.
31 In using the average mutation rate of a gene as a molecular clock, which of the following
would act to make the clock underestimate the true amount of time that had elapsed since
two related species diverged from their common ancestor?
A mutation
H2 Biology/9648/01
1092
14
33 The diagram below shows the general procedure in the cloning of an animal gene to study
gene expression.
34 The diagram below shows a plasmid carrying two selectable markers which code for
resistance to kanamycin and neomycin. The restriction site is also shown.
DraI
kanamycin neomycin
resistance gene resistance gene
A eukaryotic gene is produced by the restriction endonuclease DraI. This gene was inserted
and ligated into a cut plasmid containing compatible ends. The E. coli transformation
mixture was grown in four different media: nutrient medium plus kanamycin, nutrient
medium plus neomycin, nutrient medium plus kanamycin and neomycin, and nutrient
medium containing no antibiotics.
The bacteria which has taken up the religated plasmid would grow in
H2 Biology/9648/01
1093
15
35 A sample of DNA is cut at the positions indicated (marked with ) below.
When the fragments are loaded and run on an electrophoresis gel, which lane (1 to 5) has
the pattern that you would expect?
A 1
B 2
C 3
D 4
H2 Biology/9648/01
1094
16
38 What are the normal functions of stem cells in a living human?
Functions
A differentiating into producing insulin in cells that can
many kinds of cells in pancreas damaged differentiate into bone
a 3 -5 by type 1 diabetes cells in the skeleton
day old human
embryo
B differentiating into producing red blood cells that can
many kinds of cells in cells worn out by differentiate into
a 3 -5 normal wear and tear cardiac muscles in
day old human the heart
embryo
C differentiating into producing dopamine cells that can
only one kind of cells in brains of people differentiate into
in a 3 -5 with Parkinsons cartilage cells in the
day old human disease joint
embryo
D differentiating into producing cells that can
only one kind of cells differentiated cells differentiate into
in a 3 -5 that can be used to nerve cells in the
day old human screen new drugs brain
embryo
A Cystic fibrosis
B Haemophilia
C Hungtingtons disease
D Sickle cell anaemia
40 What are some similarities between all cancer cells and all stem cells?
A They replicate indefinitely, are non-differentiated and can be found in various parts of
the body.
B They replicate indefinitely, lack cell-cell adhesion and are able to move from one
location in the body to another.
C They lack contact inhibition, are non-differentiated and are regulated by molecular
signals.
D They are able to move from one location in the body to another, are regulated by
molecular signals and can be found in various parts of the body.
H2 Biology/9648/01
1095
CANDIDATE
NAME
CLASS
BIOLOGY 9648/02
Paper 2 Core Paper September 2013
2 hours
Additional Materials: Answer Paper
Write your name and CT on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use soft pencil for any diagrams, graphs or rough working.
Do no use staples, paper clips, highlighters, glue or correction fluid.
Section A
2
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or part 3
question.
4
Section B
Total
H2 Biology / 9648 / 02
1096
2
Section A
Answer all the questions in this section.
1 The electron micrograph in Fig. 1.1 shows an acinar cell found in the pancreas.
Fig. 1.1
(a) With reference to the Fig. 1.1, suggest the principal function of the pancreatic acinar
cell. Give two reasons to explain your answer.
[3]
H2 Biology / 9648 / 02
1097
3
Fig. 1.2 shows two different structures, A and B, found in an animal cell.
Fig. 1.2
(b) With reference to the Fig. 1.2, describe three ways in which A is similar to B.
[3]
H2 Biology / 9648 / 02
1098
4
Scientists isolated mitochondria from the liver cells. They broke the cells open in an ice-cold,
isotonic solution. They then used a centrifuge to separate the cell organelles. Fig. 1.3
illustrates the steps that take place in the process of centrifugation.
Fig. 1.3
(c) State and explain which pellet contains mitochondria.
[2]
(d) Suggest why the solution used was ice-cold and isotonic.
[2]
People with mitochondrial disease have mitochondria that do not function properly. These
disorders may be caused by mutations in the mitochondrial DNA or in the nuclear genes
that code for mitochondrial components.
(e) Explain why a person with mitochondrial disease can only exercise for a short time.
[2]
[Total: 12]
H2 Biology / 9648 / 02
1099
5
2 Prokaryotes were first discovered in the late 1600s by Antony van Leeuwenhoek, using the
microscope he invented. With the advancements in science, scientists have been able to
unravel the mysteries between prokaryotes and eukaryotes.
Fig. 2.1 (a) and (b) shows protein synthesis carried out by the two types of cells.
Fig. 2.1
(a) Describe the structure of a RNA molecule that is not shown in Fig. 2.1 in relation to its
function.
[3]
(b) Describe the differences between prokaryotes and eukaryotes with respect to gene
expression at the following levels:
(i) Chromatin level
[2]
(ii) Transcriptional level
[3]
H2 Biology / 9648 / 02
1100
6
During research into the mechanism of DNA replication, bacteria were grown for many
generations in a medium containing only the heavy isotope of nitrogen, 15N. This resulted
in all the DNA molecules containing only 15N. This is illustrated in Fig. 2.2 below.
100
% DNA molecules
75
50
25
0
14 14
DNA containing N only DNA containing N/15N DNA containing 15
N only
Fig. 2.2
Step 1: These bacteria were then grown in a medium containing only light nitrogen, 14
N.
After the time taken for the DNA to replicate once, the DNA was analysed.
Step 2: The bacteria continued to grow in the light nitrogen, 14N, medium until the DNA
had replicated once more. The DNA molecules were then analysed.
(c) Complete the bar chart below to indicate the expected results of the composition of
these DNA molecules after step 3.
[1]
100
% DNA molecules
75
50
25
0
14 14
DNA containing N only DNA containing N/15N DNA containing 15
N only
H2 Biology / 9648 / 02
1101
7
DNA replication is a process which involves DNA polymerase and the deoxyribonucleotides
A, T, C and G, while transcription involves RNA polymerase and the ribonucleotides A, U, C
and G.
(d) Describe two other differences and two similarities between DNA replication and
transcription.
[4]
[Total: 13]
H2 Biology / 9648 / 02
1102
8
3 Fig. 3.1 is an electron micrograph showing T4 bacteriophages invading a bacterium.
Fig. 3.1
(a) Clearly label the base plate of one T4 phage in Fig. 3.1. [1]
(b) Explain how T4 may mediate the transfer of a random piece of this bacterias genetic
material to another bacteria.
[4]
(c) Briefly describe the structure of bacterial chromosomes.
[2]
H2 Biology / 9648 / 02
1103
9
Some genes in bacteria are organized into operons, such as the lac operon. Transcription
of the lac operon in E. coli is dependent on the presence or absence of food molecules such
as glucose and lactose.
(d) Under normal conditions, predict the transcription of the operon in the presence or
absence of these two substrate molecules by writing High or Low in the table below.
(e) Mutation XX-6 deletes the DNA binding site from the CAP protein, but leaves the rest
of the operon unaffected. Predict the effect on transcription under these four conditions
by writing High or Low in the table below.
Suggest the mutation that could have occurred and explain how it would have given rise
to the above results.
[2]
[Total: 11]
H2 Biology / 9648 / 02
1104
10
4 A woman's risk of developing breast cancer is greatly increased if she inherits BRCA1 gene
mutation. The role of BRCA1 protein is shown in Fig. 4.1.
Fig. 4.1
[1]
H2 Biology / 9648 / 02
1105
11
(ii) Explain how mutations in BRCA1 gene can contribute to cancer.
[3]
(iii) The expression of BRCA1 gene can be furthered controlled at post-translational
level. Explain how this can occur.
[2]
(b) The HER2 gene codes for a growth factor receptor. When the growth factor binds to
HER2 protein (the growth factor receptor), the signal is given for the cell to start dividing.
Gene amplification of HER2 gene could also result in breast cancer.
(i) Describe a process which results in gene amplification.
[2]
(ii) Suggest how amplification of HER2 could result in breast cancer.
[2]
[Total: 10]
H2 Biology / 9648 / 02
1106
12
5 Rickets is a childhood disorder involving the softening and weakening of bones in humans.
It is usually caused by a lack of vitamin D, calcium ions or phosphate ions. A rare form of
rickets that cannot be successfully treated with vitamin D therapy is caused by an allele on
the X chromosome that arose as a result of a gene mutation.
[2]
(b) Fig. 5.1 below illustrates how this rare form of rickets is inherited in an afflicted family.
Fig. 5.1
(i) With reference to Fig. 5.1, state and explain the pattern of inheritance of this form
of rickets.
[3]
(ii) Using appropriate symbols, state the genotypes of the following individuals.
1
10
[2]
H2 Biology / 9648 / 02
1107
13
(iii) Couple 6 and 7 decided to have another son. Draw a genetic diagram to determine
the probability that their second son will suffer from rickets.
[3]
H2 Biology / 9648 / 02
1108
14
Colour blindness and haemophilia are inherited sex-linked recessive conditions in humans. Fig.
5.2 shows two generations of a family in which these conditions are inherited.
Fig. 5.2
[2]
[Total: 12]
H2 Biology / 9648 / 02
1109
15
6 Fig. 6.1 below shows the cell signalling pathway in smooth muscle cells in response to the
hormone Epinephrine, resulting in smooth muscle relaxation of blood vessels (vasodilation).
activated
Epinephrine
adenylate cyclase
-adrenergic
receptor
cyclic AMP
Fig. 6.1
(a) State the class of receptors that the -adrenergic receptor belongs to.
[1]
(b) With reference to Fig. 6.1,
(i) describe how adenylate cyclase is activated.
[3]
(ii) identify the stage where signal amplification is observed and explain how the signal
is amplified in that stage.
[2]
H2 Biology / 9648 / 02
1110
16
(c) Explain how the structure of the -adrenergic receptor allows it to carry out its function
as a receptor.
[3]
(d) A drug was designed to ensure that permanent vasodilation occurs. Suggest how this
drug might work within the cell signalling pathway in Fig. 6.1.
[2]
[Total: 11]
H2 Biology / 9648 / 02
1111
17
7 Scientists studying the evolutionary history of the Human Immunodeficiency Virus (HIV)
found that it is closely related to the Simian Immunodeficiency Virus (SIV) found in certain
species of monkeys. The phylogenetic tree in Fig. 7.1 shows part of the evolutionary
relationships between these viruses. A common ancestral virus is believed to have evolved
into strains that infected chimpanzees (SIV). Over time, new strains emerged which infect
humans.
Fig. 7.1
(a) Explain the significance of the branch points in the phylogenetic tree shown in Fig. 7.1.
[2]
(b) Explain how molecular homology could be used to support the claim that HIV and SIV
share an evolutionary relationship.
[2]
H2 Biology / 9648 / 02
1112
18
(c) State two advantages of using molecular techniques in classification.
[2]
SIV infections in their natural hosts appear in many cases to be non-pathogenic (non-
disease causing). Certain individuals within the human population have also shown similar
characteristics when exposed to HIV. These individuals continue to test negative for HIV
despite being repeatedly exposed to HIV.
Investigations have found a mutation present in the CCR5 gene in these individuals. CCR5
is a co-receptor that facilitates the entry of HIV into the T-cell after gp120 (present on the
viral envelope) binds with the CD4 receptor.
(d) Suggest and explain how these individuals continue to resist HIV infection.
[2]
(e) Assuming that humans do not take active steps to prevent HIV infection, explain how
the human population could possibly evolve to not be affected by HIV.
[3]
[Total: 11]
H2 Biology / 9648 / 02
1113
19
Section B
Answer one question.
8 (a) Outline how the endomembrane system is involved in synaptic transmission. [8]
(b) Describe the main stages of the Calvin cycle [8]
(c) Contrast the structure of cellulose with that of collagen and suggest why plant
cells have cellulose but not collagen. [4]
9 (a) Compare and contrast the structures of influenza and HIV. [8]
(b) Describe how HIV infects host cells and reproduces. [8]
(c) Briefly explain how a person infected only once by one strain of HIV may
eventually have many strains of HIV. [4]
H2 Biology / 9648 / 02
1114
CANDIDATE
NAME
Mark Scheme
CLASS
BIOLOGY 9648/02
Paper 2 Core Paper September 2013
2 hours
Additional Materials: Answer Paper
Write your name and CT on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use soft pencil for any diagrams, graphs or rough working.
Do no use staples, paper clips, highlighters, glue or correction fluid.
Section A
2
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or part 3
question.
4
Section B
Total
H2 Biology / 9648 / 02
1115
2
Section A
Answer all the questions in this section.
1 The electron micrograph in Fig. 1.1 shows an acinar cell found in the pancreas.
Fig. 1.1
(a) With reference to the Fig. 1.1, suggest the principal function of the pancreatic acinar
cell. Give two reasons to explain your answer.
secretion of pancreatic / digestive enzymes;
ANY TWO
presence of large amount of rER, which is the site where pancreatic enzymes are
synthesized;
[3]
H2 Biology / 9648 / 02
1116
3
Fig. 1.2 shows two different structures, A and B, found in an animal cell.
Fig. 1.2
(b) With reference to the Fig. 1.2, describe three ways in which A is similar to B.
Both are bound by a single membrane / single membrane-bound structures.
Both give rise to membrane-bound vesicles which are involved in transport of newly
synthesized proteins within the cell.
[3]
H2 Biology / 9648 / 02
1117
4
Scientists isolated mitochondria from the liver cells. They broke the cells open in an ice-cold,
isotonic solution. They then used a centrifuge to separate the cell organelles. Fig. 1.3
illustrates the steps that take place in the process of centrifugation.
Fig. 1.3
(c) State and explain which pellet contains mitochondria.
Pellet B ;
Isotonic to prevent net movement of water so organelle will not burst or shrivel /
maintain organelles integrity;
[2]
People with mitochondrial disease have mitochondria that do not function properly. These
disorders may be caused by mutations in the mitochondrial DNA or in the nuclear genes
that code for mitochondrial components.
(e) Explain why a person with mitochondrial disease can only exercise for a short time.
Mitochondria use aerobic respiration to synthesize ATP ;
[2]
[Total: 12]
H2 Biology / 9648 / 02
1118
5
2 Prokaryotes were first discovered in the late 1600s by Antony van Leeuwenhoek, using the
microscope he invented. With the advancements in science, scientists have been able to
unravel the mysteries between prokaryotes and eukaryotes.
Fig. 2.1 (a) and (b) shows protein synthesis carried out by the two types of cells.
Fig. 2.1
(a) Describe the structure of a RNA molecule that is not shown in Fig. 2.1 in relation to its
function.
Transfer RNA is a single-stranded RNA /, which is folded into a clover leaf structure
then into its three-dimensional structure + to bind to ribosome/ to fit into EPA site of
ribosome;
tRNA possess an anticodon which base pairs complementarily with codon on mRNA;
tRNA has an acceptor stem / 3 end for amino acid attachment, thus allowing tRNA to
transfer the amino acid to the ribosome during translation;
[2]
H2 Biology / 9648 / 02
1119
6
(ii) Transcriptional level
In eukaryotic, TATA binding proteins/Transcription factors binds to TATA
box/promoter recruiting RNA polymerase and basal TF for the assembly of
transcription initiation complex
In prokaryotes: Prokaryotic RNA polymerase can bind directly to core promoter
without aid of TF, resulting in basal rate of transcription of operon
In eukaryotes, binding of activators to enhancers loop the DNA and increases rate of
transcription
In prokaryotes, usually lack distal control elements but contains CAP site for binding of
CAP and increases rate of transcription
H2 Biology / 9648 / 02
1120
7
During research into the mechanism of DNA replication, bacteria were grown for many
generations in a medium containing only the heavy isotope of nitrogen, 15N. This resulted
in all the DNA molecules containing only 15N. This is illustrated in Fig. 2.2 below.
100
% DNA molecules
75
50
25
0
14 14
DNA containing N only DNA containing N/15N DNA containing 15
N only
Fig. 2.2
Step 1: These bacteria were then grown in a medium containing only light nitrogen, 14
N.
After the time taken for the DNA to replicate once, the DNA was analysed.
Step 2: The bacteria continued to grow in the light nitrogen, 14N, medium until the DNA
had replicated once more. The DNA molecules were then analysed.
(c) Complete the bar chart below to indicate the expected results of the composition of
these DNA molecules after step 3.
[1]
100
% DNA molecules
75
50
25
0
14 14
DNA containing N only DNA containing N/15N DNA containing 15
N only
H2 Biology / 9648 / 02
1121
8
DNA replication is a process which involves DNA polymerase and the deoxyribonucleotides
A, T, C and G, while transcription involves RNA polymerase and the ribonucleotides A, U, C
and G.
(d) Describe two other differences and two similarities between DNA replication and
transcription.
[4]
[Total: 13]
Differences
Features DNA replication Transcription
Template Both strands of the double helix Only one strand of the double
are used as templates. helix is used as template.
Parts of template Entire DNA molecule / Entire Only short segments of DNA /
copied chromosome / Entire or All of 2 gene is transcribed to form RNA
strands is/are replicated
Product Double stranded DNA Single stranded RNA which can
be mRNA, tRNA or rRNA
Similarities
1 Both involve unwinding and unzipping double helix DNA/ separation of 2 DNA strands by
breaking of the weak hydrogen bonds between complementary bases
2 Both involve formation of phosphodiester bonds between neighbouring nucleotides
3 Both involve aligning free nucleoside triphosphates / nucleotides through complementary
base pairing
4 Both products elongate in 5 to 3 direction
5 Both require energy from ATP hydrolysis
H2 Biology / 9648 / 02
1122
9
3 Fig. 3.1 is an electron micrograph showing T4 bacteriophages invading a bacterium.
Fig. 3.1
(a) Clearly label the base plate of one T4 phage in Fig. 3.1. [1]
Answer must show clear line pointing to base plate with appropriate label (base plate
or (a)).
(b) Explain how T4 may mediate the transfer of a random piece of this bacterias genetic
material to another bacteria.
In generalized transduction;
After T4 DNA entered the donor bacterium, phage enzymes hydrolyze bacteria DNA;
During assembly of new phage virus, random piece of hydrolysed bacterial DNA
packaged within phage capsid;
After lysis of bacterial cell, phage infects recipient bacterium, injecting donor DNA
along with its own;
[2]
H2 Biology / 9648 / 02
1123
10
Some genes in bacteria are organized into operons, such as the lac operon. Transcription
of the lac operon in E. coli is dependent on the presence or absence of food molecules such
as glucose and lactose.
(d) Under normal conditions, predict the transcription of the operon in the presence or
absence of these two substrate molecules by writing High or Low in the table below.
(e) Mutation XX-6 deletes the DNA binding site from the CAP protein, but leaves the rest
of the operon unaffected. Predict the effect on transcription under these four conditions
by writing High or Low in the table below.
Suggest the mutation that could have occurred and explain how it would have given rise
to the above results.
Mutation of lacI gene, resulting in non-functional repressor / repressor that no longer
binds to operator;
OR
Mutation of operator such that repressor can no longer bind (without affecting binding
of RNA polymerase to promoter);
H2 Biology / 9648 / 02
1124
11
4 A woman's risk of developing breast cancer is greatly increased if she inherits BRCA1 gene
mutation. The role of BRCA1 protein is shown in Fig. 4.1.
Fig. 4.1
H2 Biology / 9648 / 02
1125
12
(ii) Explain how mutations in BRCA1 gene can contribute to cancer.
Loss of function mutation in BRCA1 gene which codes for proteins involved in DNA
repair / repair damaged DNA;
[3]
(iii) The expression of BRCA1 gene can be furthered controlled at post-translational
level. Explain how this can occur.
Biochemical modification by phosphorylation / addition of phosphate groups to BRCA1
protein by ATM kinase;
(b) The HER2 gene codes for a growth factor receptor. When the growth factor binds to
HER2 protein (the growth factor receptor), the signal is given for the cell to start dividing.
Gene amplification of HER2 gene could also result in breast cancer.
(i) Describe a process which results in gene amplification.
Any 1 pair
During DNA replication, DNA polymerase may slip from the DNA template strand;
OR
A copy of the repeat sequence in one chromosome can misalign with a different copy
of the repeat in the homologous chromosome;
Unequal crossing over occurs, resulting in one chromosome being longer than the
other;
[2]
(ii) Suggest how amplification of HER2 could result in breast cancer.
Increases the number of copies of HER2 gene / causes over-expression of HER2
growth receptors;
Therefore more sensitive to growth factors and thus stimulate uncontrolled cell
division;
[2]
[Total: 10]
H2 Biology / 9648 / 02
1126
13
5 Rickets is a childhood disorder involving the softening and weakening of bones in humans.
It is usually caused by a lack of vitamin D, calcium ions or phosphate ions. A rare form of
rickets that cannot be successfully treated with vitamin D therapy is caused by an allele on
the X chromosome that arose as a result of a gene mutation.
Fig. 5.1
(i) With reference to Fig. 5.1, state and explain the pattern of inheritance of this form
of rickets.
(Sex-linked) dominant condition;
Individual 2 has one X chromosome with dominant mutant allele and will pass to all
the daughters 4, 5 and 6;
OR Individual 6 can pass the dominant mutant allele to their daughter 9;
The dominant mutant allele will mask the effect expression of the recessive normal
allele / only one copy of the mutant allele required to manifest rickets;
[3]
(ii) Using appropriate symbols, state the genotypes of the following individuals.
1 Xr Xr
3 XrY
9 X RX r
H2 Biology / 9648 / 02
1127
14
10 X RY
[2]
(iii) Couple 6 and 7 decided to have another son. Draw a genetic diagram to determine
the probability that their second son will suffer from rickets.
After meiosis, Xr Y XR Xr
gametes produced
By random fertilisation,
Xr Y
XR X RX r X RY
;
X r XrXr XrY
H2 Biology / 9648 / 02
1128
15
(c) Colour blindness and haemophilia are inherited sex-linked recessive conditions in
humans. Fig. 5.2 shows two generations of a family in which these conditions are
inherited.
Fig. 5.2
H2 Biology / 9648 / 02
1129
16
6 Fig. 6.1 below shows the cell signalling pathway in smooth muscle cells in response to the
hormone Epinephrine, resulting in smooth muscle relaxation of blood vessels (vasodilation).
activated
Epinephrine
adenylate cyclase
-adrenergic
receptor
cyclic AMP
Fig. 6.1
(a) State the class of receptors that the -adrenergic receptor belongs to.
G protein coupled receptors / G protein linked receptors;
[1]
(b) With reference to Fig. 6.1,
(i) describe how adenylate cyclase is activated.
When the epinephrine binds to the -adrenergic receptor, a ligand-receptor complex is
formed causing the receptor undergoes a conformation change;
Bound G-protein (at the cytoplasmic) end of the receptor to exchange its GDP with a
GTP / substitute GTP for GDP;
the G-protein is now activated and translocates / moves along the membrane to bind
to and activate adenylate cyclase
[3]
(ii) identify the stage where signal amplification is observed and explain how the signal
is amplified in that stage.
Stage B / Conversion of ATP to cAMP by adenylate cyclase;
H2 Biology / 9648 / 02
1130
17
(c) Explain how the structure of the -adrenergic receptor allows it to carry out its function
as a receptor.
Transmembrane protein embedded on cell surface membrane;
[3]
(d) A drug was designed to ensure that permanent vasodilation occurs. Suggest how this
drug might work within the cell signalling pathway in Fig. 6.1.
[2]
[Total: 11]
H2 Biology / 9648 / 02
1131
18
7 Scientists studying the evolutionary history of the Human Immunodeficiency Virus (HIV)
found that it is closely related to the Simian Immunodeficiency Virus (SIV) found in certain
species of monkeys. The phylogenetic tree in Fig. 7.1 shows part of the evolutionary
relationships between these viruses. A common ancestral virus is believed to have evolved
into strains that infected chimpanzees (SIV). Over time, new strains emerged which infect
humans.
Fig. 7.1
(a) Explain the significance of the branch points in the phylogenetic tree shown in Fig. 7.1.
Each branch point represents the common ancestor shared by descendents /
divergence of two species from common ancestor;
Position of branch point corresponds to the relative time when two species had
diverged;
[2]
(b) Explain how molecular homology could be used to support the claim that HIV and SIV
share an evolutionary relationship.
Direct comparison of DNA / RNA of a homologous sequence
/ amino acid sequence of a common gene;
Two viral species that show high similarity in their sequences probably share a
common ancestor;
The more similar the sequences of two species are, the more closely related they are
in their evolutionary relationship.
[2]
H2 Biology / 9648 / 02
1132
19
(c) State two advantages of using molecular techniques in classification.
Degree of divergence between different species can be quantitatively measured by
comparison of nucleotide / amino acid sequences;
Evolutionary changes between species can be compared even though they may differ
vastly in terms of morphology / Molecular comparisons transcend barriers among
organisms whose relationships cannot be evaluated by traditional experimental
techniques;
[2]
SIV infections in their natural hosts appear in many cases to be non-pathogenic (non-
disease causing). Certain individuals within the human population have also shown similar
characteristics when exposed to HIV. These individuals continue to test negative for HIV
despite being repeatedly exposed to HIV.
Investigations have found a mutation present in the CCR5 gene in these individuals. CCR5
is a co-receptor that facilitates the entry of HIV into the T-cell after gp120 (present on the
viral envelope) binds with the CD4 receptor.
(d) Suggest and explain how these individuals continue to resist HIV infection.
A CCR5 gene mutation may result in lowered expression of CCR5 protein / change in
structure of CCR5 / non-functional CCR5 receptor on cell surface membrane of helper
T-cells;
Virus envelope unable to fuse with cell surface membrane of helper T-cells and thus
unable to replicate in T-cells;
[2]
H2 Biology / 9648 / 02
1133
20
(e) Assuming that humans do not take active steps to prevent HIV infection, explain how
the human population could possibly evolve to not be affected by HIV.
Variation in genotype of humans some with CCR5 mutation, some without;
@ HIV resistant individuals and non HIV resistant individuals
individuals with HIV and individual without HIV
When exposed to HIV, humans with CCR5 mutation that prevent entry of HIV are able
to survive and thus possess a selective advantage over other humans without CCR5
mutation;
Allele frequency for CCR5 mutation increases in human population, over long period
of time, most humans will be unaffected by HIV;
[3]
[Total: 11]
H2 Biology / 9648 / 02
1134
21
Section B
Answer one question.
8 (a) Outline how the endomembrane system is involved in synaptic transmission. [8]
(b) Describe the main stages of the Calvin cycle [8]
(c) Contrast the structure of cellulose with that of collagen and suggest why plant
cells have cellulose but not collagen. [4]
9 (a) Compare and contrast the structures of influenza and HIV. [8]
(b) Describe how HIV infects host cells and reproduces. [8]
(c) Briefly explain how a person infected only once by one strain of HIV may
eventually have many strains of HIV. [4]
(a) Outline how the endomembrane system is involved in synaptic transmission. [8]
H2 Biology / 9648 / 02
1135
22
H2 Biology / 9648 / 02
1136
23
(c) Contrast the structure of cellulose with that of collagen and suggest why plant cells have
cellulose but not collagen. [4]
5 Genes encoding for polypeptides of collagen is absent / not expressed in plant genome;
6 Lack enzymes necessary for the post-translational processing / hydroxylation of proline /
glycosylation of amino acids in collagen;
7 Plant cells can undergo photosynthesis, so glucose is readily available for the synthesis of
cellulose whereas amino acids are not as readily abundant for formation of collagen;
H2 Biology / 9648 / 02
1137
24
(a) Compare and contrast the structures of influenza and HIV. [8]
H2 Biology / 9648 / 02
1138
25
(b) Describe how HIV infects host cells and reproduces. [8]
Adsorption / Attachment
1 gp120 on viral envelope recognize and bind to specific receptor molecules (CD4 +) on
cell surface membrane of T helper cells of immune system;
Entry / Penetration
2 Viral envelope fuses with cell surface membrane;
3 Capsid is digested by cellular enzymes ( exonucleases), releasing the viral RNA
molecules, viral proteins and enzymes into the cytoplasm.
Integration
4 Reverse transcriptase catalyses the synthesis of a single DNA strand complementary to
the viral RNA;
5 The viral RNA is degraded and reverse transcriptase catalyses the synthesis of a
second DNA strand complementary to the first;
(OR
4 & 5 may be combined for a single mark as:
Reverse transcriptase catalyses the synthesis of double stranded DNA from RNA
template)
6 The double-stranded viral DNA then enters the cells nucleus and integrates, as a
provirus, into the host cell DNA via the action of integrase;
(The provirus never leaves the hosts genome, remaining permanently in the host cell.)
Synthesis of viral components
7 When host cell is activated, proviral genes are transcribed into RNA;
8 RNA is used as the HIV genome;
9 Or serves as mRNA which is translated into viral proteins (capsid protein and viral
glycoproteins at ribosomes in cytoplasm and surface of endoplasmic reticulum
respectively);
10 Golgi vesicles embedded with viral glycoproteins migrate towards and fuse with the cell
surface membrane such that viral glycoproteins become embedded on the cell surface
membrane;
11 Polyproteins are similarly cleaved by proteases to produce structural proteins.
Viral assembly / maturation
12 Capsid proteins enclose viral genome and viral proteins;
Release
13 Virus buds off from the cell (exocytosis), surrounded by host cell surface membrane
embedded with viral glycoproteins;
H2 Biology / 9648 / 02
1139
26
(c) Although a person may be infected only once by one strain of HIV he may eventually
have many strains of HIV. Briefly explain why. [4]
1 Different strains of HIV are genetic variation that arise via mutations;
2 HIV mutates very rapidly;
3 Reverse transcriptase is inaccurate in its replication / Unlike DNA polymerase, reverse
transcriptase does not proof read the nucleotides added;
4 Reproductive rate of rate of HIV is high increases chances of mutant strains arising;
5 Mutation rate is greater because the genetic material is single stranded (RNA);
6 RNA single stranded less stable because no complementary strand no template
for DNA repair;
H2 Biology / 9648 / 02
1140
CANDIDATE
NAME
CLASS
BIOLOGY 9648/03
Paper 3 Applications and Planning September 2013
2 hours
Additional Materials: Answer Paper
Write your name and CT on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use soft pencil for any diagrams, graphs or rough working.
Do no use staples, paper clips, highlighters, glue or correction fluid.
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or part question.
Total
60
For Examiners Use
4
12
H2 Biology / 9648 / 03
1141
2
Section A
Answer all the questions in this section.
1 Bacteria can be genetically modified to produce insulin for human use. To achieve this,
human insulin genes are transferred into bacteria. Plasmids containing two antibiotic
resistance genes, one coding for resistance to tetracycline and one for resistance to
ampicillin, are used to carry out this transfer.
A restriction enzyme was used to cut up the human DNA and plasmids. Fig. 1.1 shows the
different fragments of human DNA and the type of cut plasmid that was produced.
Fig. 1.1
[2]
(b) Suggest why the restriction enzyme has cut the human DNA in many places but has
cut the plasmid DNA only once.
[2]
H2 Biology / 9648 / 03
1142
3
The fragments of human DNA and the cut plasmids were mixed together with DNA ligase.
Several types of plasmid were formed. Some contained human DNA in the centre of the
gene coding for resistance to tetracycline. The different types of plasmid are shown in
Fig 1.2.
Fig 1.2
[2]
(d) Outline the reaction that DNA ligase catalyses.
[1]
H2 Biology / 9648 / 03
1143
4
The plasmids are mixed with the bacteria. Some bacteria take up the plasmids.
Some of the plasmids did not take up the extra human DNA. Replica plating was used to
identify the bacteria with the human DNA. Fig. 1.3 shows the bacterial colonies that grew on
two replica plates.
Fig. 1.3
(e) With reference to Fig. 1.3, explain the results of the replica plate containing:
(i) ampicillin.
[2]
(ii) tetracycline.
[3]
H2 Biology / 9648 / 03
1144
5
(f) Describe how the bacteria containing the insulin gene are used to obtain sufficient
insulin for commercial use.
[3]
[Total: 15]
H2 Biology / 9648 / 03
1145
6
2 Cord blood is the blood that circulates through the umbilical cord from the foetus to the
placenta. The umbilical cord that remains attached to the placenta has been found to be
rich in cord blood stem cells. Cord blood stem cells are the young or immature cells that can
transform into other forms of essential blood cell types, such as red blood cells, white blood
cells and platelets.
[3]
(b) Suggest an advantage of using cord blood stem cells in place of blood stem cells from
the bone marrow.
[1]
(c) State the potency of cord blood stem cells.
[1]
[2]
H2 Biology / 9648 / 03
1146
7
Besides using stem cell transplant to treat genetic disorders such as SCID, gene therapy
could be another treatment option. Severe Combined Immunodeficiency (SCID) is a
disease of young children in which patients have neither cell-mediated immune responses
nor the ability to make antibodies.
There are two types of SCID: Adenosine Deaminase (ADA) deficient SCID and X-linked
SCID. The delivery system used in SCID gene therapy is usually viral gene delivery
system.
(e) Suggest a type of virus that can be used in SCID gene therapy.
[1]
(f) Explain the factors that keep gene therapy from becoming an effective treatment for
SCID.
[3]
[Total: 11]
H2 Biology / 9648 / 03
1147
8
3 Golden rice is a transgenic variety of rice that has been genetically engineered to be rich in
beta-carotene (a pre-cursor to vitamin A). Fig. 3.1 below shows an artificial DNA sequence
used in the production of golden rice.
Key:
pro promoter sequence
ter terminator sequence
Hyg resist antibiotic resistance from a bacterium
Fig. 3.1
[1]
(b) State the organism from which the promoter sequence for Hyg resist were taken from
and explain your choice.
[2]
(c) Briefly outline one way in which this gene construct may be inserted into rice cells.
[2]
(d) State why it is not possible to produce golden rice by breeding.
[1]
H2 Biology / 9648 / 03
1148
9
Hyg resist confers resistance to hygromycin, an antibiotic which kills both bacterial cells and
plant cells.
(e) Explain the role of the Hyg resistance gene in this procedure.
[2]
(f) A concern of having Hyg resistance in the golden rice is the possible horizontal transfer
of Hyg resist to other organisms.
(i) Suggest how Hyg resistance can be acquired by other plants and state a technical
safeguard that can minimize this risk.
[2]
(ii) Hyg resistance may result in a resistant strain of bacteria for which this antibiotic
will no longer be effective. Explain if this claim is biologically valid.
[2]
(g) Suggest 2 possible benefits of golden rice.
[2]
[Total: 14]
H2 Biology / 9648 / 03
1149
10
Planning Question
4 You are required to plan, but not carry out, an investigation into the effect of temperature on
rate of photosynthesis.
Fig. 4.1 shows an oxygen probe and meter that can be used to measure the concentration
of dissolved oxygen in a solution in mg/L.
Your planning can include, but is not limited to the following equipment & materials.
H2 Biology / 9648 / 03
1150
11
5 (a) Using your knowledge of the genetic basis of cystic fibrosis, compare liposomal and
viral delivery systems in the treatment of cystic fibrosis using gene therapy. [6]
(b) Describe how RFLP analysis can be used in genome mapping. [8]
(c) Discuss the ethical concerns that have arisen regarding the Human Genome Project.
[6]
[Total: 20]
H2 Biology / 9648 / 03
1151
CANDIDATE
NAME
Mark Scheme
CLASS
BIOLOGY 9648/03
Paper 3 Applications and Planning September 2013
2 hours
Additional Materials: Answer Paper
Write your name and CT on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use soft pencil for any diagrams, graphs or rough working.
Do no use staples, paper clips, highlighters, glue or correction fluid.
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or part question.
Total
60
For Examiners Use
4
12
H2 Biology / 9648 / 03
1152
2
Section A
Answer all the questions in this section.
1 Bacteria can be genetically modified to produce insulin for human use. To achieve this,
human insulin genes are transferred into bacteria. Plasmids containing two antibiotic
resistance genes, one coding for resistance to tetracycline and one for resistance to
ampicillin, are used to carry out this transfer.
A restriction enzyme was used to cut up the human DNA and plasmids. Fig. 1.1 shows the
different fragments of human DNA and the type of cut plasmid that was produced.
Fig. 1.1
sequence of bases / recognition site / specific restriction site (on which enzyme acts)
occurs once in plasmid and many times in human DNA;
[2]
H2 Biology / 9648 / 03
1153
3
The fragments of human DNA and the cut plasmids were mixed together with DNA ligase.
Several types of plasmid were formed. Some contained human DNA in the centre of the
gene coding for resistance to tetracycline. The different types of plasmid are shown in
Fig 1.2.
Fig 1.2
It is a random process by which sticky ends join and subsequently ligated by DNA
ligase;
[2]
(d) Outline the reaction that DNA ligase catalyses.
Formation of phosphodiester bonds between nucleotides (by condensation reaction
with the removal of water);
[1]
H2 Biology / 9648 / 03
1154
4
The plasmids are mixed with the bacteria. Some bacteria take up the plasmids.
Some of the plasmids did not take up the extra human DNA. Replica plating was used to
identify the bacteria with the human DNA. Fig. 1.3 shows the bacterial colonies that grew on
two replica plates.
Fig. 1.3
(e) With reference to Fig. 1.3, explain the results of the replica plate containing:
(i) ampicillin.
Colonies 1,2 3 & 6 have taken up the plasmid;
OR
Colonies 4 & 5 did not take up the plasmid;
Because they are not resistant to ampicillin / lack of ampicillin resistance gene;
[2]
(ii) tetracycline.
Colonies 1 & 3 do not have the recombinant plasmid;
Because they are still resistant to tetracycline / has tetracycline resistance gene;
Colonies 2 and 6 dies because taken up the plasmid with human DNA / recombinant
plasmid;
[3]
H2 Biology / 9648 / 03
1155
5
(f) Describe how the bacteria containing the insulin gene are used to obtain sufficient
insulin for commercial use.
use of fermenters;
provides nutrients plus suitable conditions for optimum growth / named environmental
factor;
reproduction of bacteria via binary fission increasing the expression of insulin gene /
more insulin proteins are produced;
H2 Biology / 9648 / 03
1156
6
2 Cord blood is the blood that circulates through the umbilical cord from the foetus to the
placenta. The umbilical cord that remains attached to the placenta has been found to be
rich in cord blood stem cells. Cord blood stem cells are the young or immature cells that can
transform into other forms of essential blood cell types, such as red blood cells, white blood
cells and platelets.
Stem cells are capable of dividing by mitosis and continually renewing themselves for
long periods;
Stem cells are capable of differentiating into specialised cell types under appropriate
conditions;
[3]
(b) Suggest an advantage of using cord blood stem cells in place of blood stem cells from
the bone marrow.
It is not painful as blood is drawn from umbilical vein after umbilical cord is separated
from the newborn baby / no surgical procedure involved;
Cord blood stem cells are easier to collect as blood is drawn from umbilical vein after
umbilical cord is separated from the newborn baby / no surgical procedure involved;
There is no risk to the baby or mother as blood is drawn from umbilical vein after
umbilical cord is separated from the newborn baby / no surgical procedure involved;
[1]
(c) State the potency of cord blood stem cells.
Multipotent;
[1]
There exist other groups of stem cells of greater developmental potential.
(d) Describe, with a named example, a group of stem cells with higher developmental
potential than cord blood stem cells.
Zygotic stem cells are totipotent;
These cells can differentiate into any cell types to form whole organisms;
H2 Biology / 9648 / 03
1157
7
Besides using stem cell transplant to treat genetic disorders such as SCID, gene therapy
could be another treatment option. Severe Combined Immunodeficiency (SCID) is a
disease of young children in which patients have neither cell-mediated immune responses
nor the ability to make antibodies.
There are two types of SCID: Adenosine Deaminase (ADA) deficient SCID and X-linked
SCID. The delivery system used in SCID gene therapy is usually viral gene delivery
system.
(e) Suggest a type of virus that can be used in SCID gene therapy.
Retrovirus;
[1]
(f) Explain the factors that keep gene therapy from becoming an effective treatment for
SCID.
Gene therapy is short-lived and requires frequent / repeated treatments;
Incorrect insertion of normal gene into tumour-suppressor gene may cause cancer /
insertional mutagenesis;
H2 Biology / 9648 / 03
1158
8
3 Golden rice is a transgenic variety of rice that has been genetically engineered to be rich in
beta-carotene (a pre-cursor to vitamin A). Fig. 3.1 below shows an artificial DNA sequence
used in the production of golden rice.
Key:
pro promoter sequence
ter terminator sequence
Hyg resist antibiotic resistance from a bacterium
Fig. 3.1
Agrobacterium infects rice cell to incorporate gene construct into rice cell;
OR
DNA containing gene coated on to gold particles;
Even if interbreeding occurred, it involves random fusion of gametes which will not
necessarily contain only favourable traits.
[1]
H2 Biology / 9648 / 03
1159
9
Hyg resist confers resistance to hygromycin, an antibiotic which kills both bacterial cells and
plant cells.
(e) Explain the role of the Hyg resistance gene in this procedure.
It is a selectable marker to enable the selection of the transformed / transgenic cells;
only the cells with the new DNA can grow in the presence of the antibiotic;
[2]
(f) A concern of having Hyg resistance in the golden rice is the possible horizontal transfer
of Hyg resist to other organisms.
(i) Suggest how Hyg resistance can be acquired by other plants and state a technical
safeguard that can minimize this risk.
Transgenic plants may pass their new genes (for hyg-resistance) to close relatives in
nearby wild areas through pollen transfer;
Greater isolation distances between the transgenic crop and nearby areas (fields,
forests etc);
OR
Planting a border of unrelated plants with which transgenic plants would not hybridize
through spread of transgenic pollen;
[2]
(ii) Hyg resistance may result in a resistant strain of bacteria for which this antibiotic
will no longer be effective. Explain if this claim is biologically valid.
Yes; When humans ingest golden rice, the resistance gene may be transferred to gut
bacteria;
No; The resistance gene will probably be broken down by the time it reaches the gut.
No; Direct transfer between plants and bacteria is unlikely since they are highly
unrelated species.
[2]
(g) Suggest 2 possible benefits of golden rice.
May help to prevent night blindness;
[2]
[Total: 14]
H2 Biology / 9648 / 03
1160
10
Planning Question
4 You are required to plan, but not carry out, an investigation into the effect of temperature on
rate of photosynthesis.
Fig. 4.1 shows an oxygen probe and meter that can be used to measure the concentration
of dissolved oxygen in a solution in mg/L.
Your planning can include, but is not limited to the following equipment & materials.
H2 Biology / 9648 / 03
1161
11
Variables
Independent variable: Temperature
Dependent variable: Concentration of dissolved oxygen
Variable kept constant:
Volume of algae suspension, wavelength of light, light intensity, pH
6.51 mg/L
7 cm3 of algal
suspension +
3 cm3 of buffer +
(total volume = 10cm3)
Varying
Temperature
Procedures
1. Using a beaker of hot water and thermometer, prepare a water bath fixed at 300C.
2. Label 5 boiling tubes A E.
3. Using a syringe, add 7.0 cm3 of algae suspension and 3.0 cm3 of pH buffer.
4. Place the boiling tube into the water bath and allow for 5 minutes of equilibration.
5. Using a ruler, place the bench lamp 10 cm away from the water bath.
6. Switch on the bench lamp.
7. After 5 min, insert the oxygen probe into the boiling tube and ensure solution covers probe.
Record the concentration of dissolved oxygen detected.
8. Wash/ rinse the probe with distilled water and put it aside, ready for the next reading.
9. Repeat steps 3 to 8 for the 4 other temperatures of 400C, 500C, 600C and 700C.
10. Repeat steps 3 to 9 twice and calculate the mean concentration of dissolved oxygen.
11. Set up the control by repeat the experiment steps 3 to 8 but carrying out in the dark.
12. Record the data in the table below and calculate rate of reaction as 1/time taken. Calculate
the mean rate of oxygen produced per minute by dividing by 5 minutes.
H2 Biology / 9648 / 03
1162
12
30
40
50
60
70
13. Plot the graph of mean rate of oxygen production / mgL-1 min-1 against temperature / 0C.
Mean rate of
oxygen
production/
mg L-1 min-1
Temperature / 0C
Conclusion
The rate of photosynthesis is maximum at optimum temperature and decreases away from
optimum temperature.
Risk Assessment
1. Scalding by hot water. Use cloth to wrap the mouth of beaker.
2. Electrocution due to thermostat water bath. Avoid touching electrical appliance with water.
H2 Biology / 9648 / 03
1163
13
Mark scheme
Theoretical background [2m max]
T1: Temperature is a limiting factor of photosynthesis;
T2: Temperature affects rate of enzymatic reactions during light dependent reaction (e,g,
NADP reducatase) and light independent reaction (e.g, Rubisco)
T3: Oxygen is released during photolysis of water and can be used to determine rate of
photosynthesis.
H2 Biology / 9648 / 03
1164
14
5 (a) Using your knowledge of the genetic basis of cystic fibrosis, compare liposomal and
viral delivery systems in the treatment of cystic fibrosis using gene therapy. [6]
(b) Describe how RFLP analysis can be used in genome mapping. [8]
(c) Discuss the ethical concerns that have arisen regarding the Human Genome Project.
[6]
[Total: 20]
(a) Scientist use either viral (e.g. adenovirus) or non-viral delivery (liposomes) methods to
introduce a normal functional CFTR allele into the human.
D2 Effectiveness Less likely to be effective after Remains effective as body does not
on evoking the body has developed develop immunity to the vector
immune immunity to the viral vector
response
D3 Disease Adenoviral vector (which does Do not cause disease at all / safer
causing / risk not integrate into the genome (Liposomes have a small degree of
assessment / can cause throat infections but toxicity so many rounds of
Toxicity not human malignancies treatment can be harmful to the cells
(cancer) or tissues being treated)
(Idea that viral delivery methods cause more harm or health implications
than the liposomal method)
D4 Specificity More specific targeting of cells Less specific targeting of cells
H2 Biology / 9648 / 03
1165
15
(Idea that viral delivery methods allow higher success of functional gene
integrating with host cell genome as compared to the liposomal method)
D7 Entry into cell Virus enters cell via endocytosis, Fusion of lipid bilayer of liposome
delivering normal functional with cell membrane leads to delivery
CFTR allele into target cell. of normal functional CFTR allele into
cell.
Similarities
S1 Integration Liposomes and adenoviruses not able to integrate normal functional
CFTR allele into genome (extrachromosomal) / do not cause insertional
mutagenesis;
And hence the treatment is short-lived (due to the transient nature of the
gene that has been inserted into the cell cytoplasm);
(b)
1 RFLP is a phenomenon whereby various lengths of restriction fragments are
generated from DNA sequences using restriction enzymes
+ arises due to different nucleotide sequences or / variable number of tandem
repeats (VNTR);
2 RFLP analysis: involves amplification by PCR cutting by restriction enzymes
separation by gel electrophoresis transfer by Southern blotting + nucleic acid
hybridization with radioactive probe;
3 Definition of RFLP marker: a segment of DNA found at a specific site along a
chromosome and can be uniquely recognized by probes;
+ RFLP markers are inherited in a Mendelian fashion;
4 RFLP analysis can be performed on RFLP markers located on two different loci of
the genome
+ 2 individuals, each being homozygous for each RFLP marker, but have different
band patterns for each particular RFLP marker, can be crossed to produce
heterozygous offsprings;
5 Heterozygotes are then crossed with one of the homozygous parent
+ offspring can inherit pairs of RFLP markers like the parents or inherit
recombinant pairs of RFLP markers;
H2 Biology / 9648 / 03
1166
16
6 If the 2 gene loci are not linked, number of offspring showing the four phenotypes will
be of ratio 1:1:1:1;
7 If the 2 gene loci are linked without crossing over, there will only be 2 phenotypes
observed
+ as the two gene loci will assort and segregate together;
8 If the two gene loci are closely linked, the proportion of offspring with recombinant
phenotypes will be less than parental phenotypes;
9 If the two gene loci are linked, frequency at which genetic markers are inherited together
with gene loci, can be used to calculate distance between both gene loci based on
frequency of crossing-over;
10 By performing analysis on many other pairs of RFLP markers and with other
cytogenetic studies, the researcher is able to come up with a detailed map of the
genome;
(c)
1 Fairness in the use of genetic information by insurers, employers, courts, schools,
adoption agencies, and the military, among others / Discrimination by institutions ;
2 Privacy and confidentiality of genetic information;
3 Psychological impact and stigmatization due to an individual's genetic differences /
Discrimination by individuals;
4 Reproductive issues including adequate informed consent for complex and potentially
controversial procedures / use of genetic information in reproductive decision making /
reproductive rights;
5 Clinical issues including the education of doctors and other health service providers,
patients, and the general public in genetic capabilities, scientific limitations, and social
risks / implementation of standards and quality-control measures in testing procedures;
6 Uncertainties associated with gene tests for susceptibilities and complex conditions
(e.g., heart disease) linked to multiple genes and gene-environment interactions;
7 Conceptual and philosophical implications regarding human responsibility, free-will
versus genetic determinism / concepts of health and disease / Religious concerns,
doctrinal issues ;
8 Health and environmental issues concerning genetically modified foods (GM) and
microbes;
9 Commercialization of products including property rights (patents, copyrights, and trade
secrets) and accessibility of data and materials;
H2 Biology / 9648 / 03
1167
Candidate
Name
Civics INDEX
Group NUMBER
H2 BIOLOGY 9648 / 01
There are forty questions on this paper. Answer all questions. For each question
there are four possible answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the
OTAS answer sheet provided.
Each correct answer will score one mark. A mark will not be deducted for a wrong
answer. Any rough working should be done in this booklet.
[Turn Over]
1
1168
Structure Function
an extensive network of tubes and sacs; each Lipid synthesis
A
tube and sac bounded by a single membrane
a spherical sac bounded by a single Protein synthesis
B
membrane
a sac bounded by two membranes, the inner Packaging of proteins
C
highly folded
a stack of elongated, curved sacs; each sac Photosynthesis
D
bounded by a single membrane
3. Which carbohydrate has glycosidic bonds between carbon atom 1 and carbon
atom 6 of its component glucose molecules?
A amylose
B glycogen
C maltose
D sucrose
2
1169
A I and II only
B I and IV only
C II and III only
D I, III and IV only
A B
10 20 30 40 50 60 10 20 30 40 50 60
Temperature / C Temperature / C
C D
10 20 30 40 50 60 10 20 30 40 50 60
Temperature / C Temperature / C
3
1170
6. The amount of DNA per nucleus in a cell during a meiotic cell cycle as shown
below was measured.
4
1171
7. The packing of DNA in the nucleus is a very precise process. The following
statements describe this process.
A I, III, IV, II
B I, IV, III, II
C III, I, IV, II
D III, IV, I II
Which tube shows the position of the DNA after two more generations of semi-
conservative replication in light nitrogen (14N)?
5
1172
9. Which of the following is not involved in regulating the synthesis of RNA in the
eukaryotic nucleus?
From the figure above, which conclusion cannot be deduced from these results?
A The gene that codes for PHGDH cannot be found in all types of cells.
B Activators are bound to enhancers of the gene coding for -actin in skeletal
muscle cells.
C The gene coding for -actin is located in euchromatin.
D Inhibitors are bound to silencers of the gene codng for PHGDH in lung cells.
6
1173
12. Which of the following correctly describes the function of components involved in
translation?
Aminoacyl-tRNA
Peptidyl transferase Ribosomes
synthetase
Contains an aminoacyl
Transfers an amino acid
site that is occupied by Attaches an amino acid
A to a growing polypeptide
the initiator tRNA to the 5 end of a tRNA
chain
attached to methionine
Contains a peptidyl site
Forms a peptide bond
that is occupied by the Attaches an amino acid
B between two amino
initiator tRNA attached to the 5 end of a tRNA
acids
to methionine
Contains a peptidyl site
Forms a peptide bond
that is occupied by the Attaches an amino acid
C between two amino
initiator tRNA attached to the 3 end of a tRNA
acids
to methionine
Contains an aminoacyl
Transfers an amino acid
site that is occupied by Attaches an amino acid
D to a growing polypeptide
the initiator tRNA to the 3 end of a tRNA
chain
attached to methionine
13. A point mutation can occur anywhere on a chromosome. Which statements are
true?
A I and II
B I and III
C II and III
D I, II and III
7
1174
W X Y Z
8
1175
13
18 15.
TheThe diagram
diagram below below
shows shows the structure
the structure of M13
of an M13 bacteriophage.
bacteriophage. It hasIt ahas single-
single-stranded
stranded circular DNA genome. g3p, g6p, g7p, g8p and g9p are capsid proteins.
circular DNA genome. g3p, g6p, g7p, g8p and g9p are capsid proteins. Its life cycle does
not Its life cycle
cause does
the lysis of not cause
its host the lysis of the host cell.
cell.
Based
Based on on your
your understanding
understanding of
of bacteriophages,
bacteriophages, which
which of
of the
the following
following statements
statements are
are true of the M13 bacteriophage?
true of the M13 bacteriophage?
9
ACJC 9648/01/Prelim 2012 [Turn Over
1176
16. The photomicrographs below show two different processes of genetic transfer in
bacteria.
Which row shows the correct statements for the corresponding process?
Process R Process S
10
1177
P Q
Red-green colour blind Completely colour blind
R S
Normal vision Red-green colour blind
female
male
19. In Drosophila melanogaster, there are two known independently assorting genes
B and P that affect wing shape. Flies homozygous for the recessive b mutant
allele at one gene have bent wings. Flies homozygous for the recessive p mutant
allele have no wings at all, regardless of their genotype at other loci. All other
genotypes give normal wings. If a true breeding bent winged fly is crossed with a
fly with no wings that is homozygous for the normal B allele and the p allele, what
proportion of the F2 would have no wings?
A 1/16
B 1/4
C 3/16
D 9/16
A AaBb x AaBb
B aaBb x Aabb
C aaBB x AAbb
D aabb x AABB
21. A maize plant with green seedlings and opaque leaves was crossed with a maize
plant with yellow seedlings and bright leaves. The table below shows the
phenotypes of the offspring.
A The genes for seedling colour and leaf brightness are linked and crossing over
has taken place in 11.5% of the offspring.
B The genes for seedling colour and leaf brightness are on different chromosomes
and crossing over has taken place in 11.5% of the offspring.
C The genes for seedling colour and leaf brightness are linked and 53.8% of the
offspring contain at least 1 dominant allele.
D The genes for seedling colour and leaf brightness are on different chromosomes
and 6.9% of the offspring express only two recessive alleles.
12
1179
22. The table below shows the results of an early investigation into the genetic
control of phenotypic variation. The dry masses of 5493 bean seeds collected
from many plants were classified into nine categories.
Mass of 51- 151- 251- 351- 451- 551- 651- 751- 851-
bean/mg 150 250 350 450 550 650 750 850 950
Number
5 38 370 1676 2255 928 187 32 2
of beans
Which statement correctly describes these data and could account for the variation
shown?
A The phenotypic variation is continuous and could be the result of two non-linked
genes acting on their own.
B The phenotypic variation is continuous and could be the result of several non-
linked genes acting on their own.
C The phenotypic variation is discontinuous and could be the result of two linked
genes acting on their own.
D The phenotypic variation is discontinuous and could be the result of several
linked genes acting on their own.
23. In the presence of a signal protein, the Ras protein, which is a G-protein,
becomes activated and switches on other proteins. These in turn switch on genes
that lead to cell growth and division. When the Ras gene is mutated, the Ras
protein will prevent GTP hydrolysis, resulting in unintended and overactive
signaling inside the cell. This happens even in the absence of incoming signals,
leading to increased cell growth and division.
Which of the following describes the type of mutation in the Ras gene?
A Gain of function, point mutation
B Loss of function, chromosomal translocation
C Gain of function, chromosomal translocation
D Loss of function, point mutation
13
1180
24. The graph below shows how various factors affect the rate of photosynthesis.
It can be deduced from the data shown in the graph above that the rate of
photosynthesis
A varies directly with carbon dioxide concentrations.
B varies directly with light intensity.
C is dependent on light intensity at high carbon dioxide concentrations.
D is unaffected by carbon dioxide concentration at low light intensity.
A I only
B II only
C I and III
D II and IV
14
1181
26. The diagram below shows what happens to pyruvate in the root cells of plants in
waterlogged soil.
W Y
X Z
W X Y Z
A pyruvate lactate alcohol ethanol
dehydrogenase decarboxylase
B pyruvate ethanal alcohol ethanol
decarboxylase dehydrogenase
C pyruvate ethanol alcohol ethanal
decarboxylase dehydrogenase
D pyruvate ethanal alcohol ethanol
dehydrogenase decarboxylase
2.5 molecules of ATP can be made from each reduced NAD and 1.5 molecules
of ATP from each reduced FAD.
What is the maximum number of ATP molecules that can be made during the Krebs
cycle from two molecules of glucose?
A 18
B 26
C 36
D 56
15
1182
28. The diagram below shows a tyrosine kinase receptor on a liver cell.
Extracellular Matrix
Cytosol
29. The figure below shows the relative irritability of a stimulated nerve fibre.
16
1183
30. What is the correct sequence of events in the signal transduction pathway when
insulin interacts with receptor tyrosine kinases?
A I, II, III, IV
B II, III, I ,IV
C II, I, III, IV
D I, III, II IV
31. The chart below shows the hierarchical classification of two species of crocodiles.
A Chordata
B Crocodylidae
C Loricata
D Reptilia
17
1184
32. The diagram illustrates variation in the pericarp (fruit wall) for a variety of
methods of seed dispersal.
33. The average mutation rate of a gene can be used as a molecular clock. Which
type of mutation would cause an underestimate of the time that has elapsed
since two related species diverged from their common ancestor?
18
1185
34. Which pattern of mutation rate would be most helpful if one desires to use a gene
as a molecular clock to determine evolutionary relatedness of species that are
closely related to each other?
19
1186
35. A gene coding for the production of a human gene product was inserted into a
plasmid with genes coding for resistance to antibiotics ampicillin, streptomycin
and tetracycline. The plasmids were used to transform E.coli and the bacteria
grown on a nutrient medium. The resulting master plate is shown in the diagram.
Transformed cells were selected by replica plating the bacteria colonies onto media
containing various antibiotics.
Which plate contains the colony of bacteria into which the human gene has been
successfully inserted?
36. The construction of a cDNA library involves a number of stages. What is the
correct sequence of stages?
20
1187
38. A patient suffers from Marfan Syndrome, an autosomal dominant genetic disorder
in the gene coding for fibrillin-1 (FBN1). Almost all cells express FBN1 as its
product is involved in the maintenance of connective tissues, which are abundant
throughout the body. Which of the following treatment would permanently cure
this patient?
21
1188
39. Callus tissue is produced using leaves by the technique shown in the diagram
below. Using this, a student investigated the effect of two different concentrations
of auxin on the volume of callus material produced. The table shows the results
obtained over five days.
I. The leaves are disinfected and sterilized by washing with detergent and
alcohol.
II. The sterilization process can alternatively be done using an autoclave
machine.
III. The only nutrient required to stimulate callus formation is auxin.
IV. Continued subculturing at three- to four-week intervals of small cell
clusters taken from calli can maintain the callus cultures for long periods
of time.
A II only
B I and IV only
C III only
D II and III only
22
1189
40. Salmon has been genetically modified to increase its yield within a shorter period
of time. Which of the following is incorrect?
1 A 21 A
2 A 22 B
3 B 23 A
4 B 24 C
5 C 25 D
6 B 26 B
7 B 27 C
8 D 28 C
9 C 29 D
10 A 30 C
11 C 31 D
12 C 32 D
13 D 33 C
14 D 34 A
15 B 35 A
16 B 36 D
17 B 37 B
18 C 38 D
19 B 39 D
20 C 40 B
23
1190
Figure 1.1
..
..
..
..
..
1191
The
e following structure
s in Figure 1.2 iis also foun on of a neurrone.
nd in the axo
Figure 1.2
..
..
..
3
1192
Figure 1.3
..
(ii) With your understanding of the cell membrane, explain how process B occurs.
[1]
..
..
(iii) Suggest the significance of this process with regard to synaptic transmission. [1]
..
..
(iv) On the pre-synaptic membrane, there are also Ca2+ voltage-gated channels
found. Describe how a change in potential difference will result in the diffusion of
Ca2+. [2]
..
..
..
..
4
1193
Que
estion 2 [13
3 marks]
Figure 2.1
..
..
..
..
..
..
5
1194
Figure 2.2
..
..
..
..
(c) Different genetic muttations on a gene an nd its mRN NA may ressult in diffe
erent
diseases. For
F example ation of -globin mRNA
e, RNA splicce site muta A is responssible
of some cases
c of -thalassem ia and a point mutation on -gglobin gene is
responsible
e for sickle cell
c anaemiia.
..
..
..
..
..
..
6
1195
(ii) Explain why a point mutation on a -globin gene does not always produce
mutated globin whereas an RNA splice site mutation will always produce
mutated globin. [3]
..
..
..
..
..
..
7
1196
Que
estion 3 [13
3 marks]
Figu
ure 3.1 show
ws an electtron microgrraph of H1N
N1.
Figure 3.1
(b) RNA-depen ndent RNA A polymera se can be e found in this virion while reverse
transcriptasse can be found
f in rettrovirus. Be ype of viruss, describe one
esides the ty
similarity and
a two diffferences bbetween RN NA-depende ent RNA p olymerase and
reverse transcriptase. [3]
..
..
..
..
..
..
8
1197
Ose
eltamivir, be
etter knownn under its ttrademark name
n as Taamiflu, is a recommen nded
med
dication for H1N1. Its mechanism
m s illustrated in Figure 3..2 and 3.3.
of action is
Figure 3.2
2
Figure 3.3
3
..
..
..
..
9
1198
The effects of oseltamivir were studied on patients infected with influenza virus.
These patients were randomly separated into two groups one group administered
with a placebo (a pseudo-drug with no effect) while the other group was administered
oseltamivir. Symptoms were measured and recorded in Table 3.4.
Study Groups
Symptoms
Placebo (n=129) Oseltamivir, 75mg (n=124)
Cough
Duration, hr 55 (36-73) 31 (24-42)
Severity, arbitrary units 110 67
Nasal Obstruction
Duration, hr 43 (31-64) 33 (25-43)
Severity, arbitrary units 80 60
Sore Throat
Duration, hr 21 (8-29) 10 (4-19)
Severity, arbitrary units 29 20
Fatigue
Duration, hr 41 (26-50) 24 (19-34)
Severity, arbitrary units 89 54
Feverishness
Duration, hr 23 (16-29) 10 (8-14)
Severity, arbitrary units 49 21
Table 3.4
(d) With reference Table 3.4, determine the effectiveness of oseltamivir. [2]
..
..
..
..
(e) In a separate case, a patient was treated for H1N1. During this treatment, he was
infected with H3N3. Upon testing, it was found that his blood now contains H3N3
and a new strain of virus, H1N3. Explain how this new strain could have arisen.
[3]
..
..
..
..
..
..
10
1199
(a) In maize plants, a recessive mutant allele leads to green leaves as opposed to
bronze leaves. Another recessive mutant allele at a separate locus leads to
yellow cobs as opposed to brown cobs. F1 maize plants from a standard dihybrid
cross was test crossed with a plant with green leaves and yellow cobs. The table
shows the phenotypes of 200 of the offspring.
(i) In the space below, draw a genetic diagram to explain the observed results of
the cross. [4]
11
1200
..
..
..
..
..
..
(b) A chi-squared test was also carried out for the above cross and the chi-square
value was 109.6. Using the probability table given, does this value for the chi-
squared test support the expected phenotypic ratio? Explain. [3]
..
..
..
..
..
..
12
1201
Que
estion 5 [13
3 marks]
Figure 5.1
1
(i) Identify wh
hich individu
ual has a no eostatic systtem in contrrolling blood
ormal home d
glucose levvel. Explain
n your answ
wer. [2]
..
..
..
..
..
..
..
..
..
..
..
..
13
1202
(b) Ras is a GTTP-binding protein thatt helps to broadcast signals from the cell surrface
arts of the cell to stimu late cell pro
to other pa oliferation. If Ras functtion is inhib
bited,
the cell pro
oliferation responses
r nnormally induced by the activateed receptors s do
not occur. Conversely y, if a hypeeractive mu utant, Ras protein, is introduced into
some cell lines, the efffect on celll proliferatio
on is the same as that induced by y the
binding of ligands to cell surface e receptors. This hype eractive prooduct of mu utant
ras gene prromotes the e developm ent of canc cer.
Figure 5.2
..
..
..
..
..
..
..
..
..
..
..
..
14
1203
(c) Suggest on
ne function of
o signal tra
ansduction. [1]
..
..
Que
estion 6 [10
0 marks]
Figu
ure 6.1 show
ws an electtromicrograp oroplast
ph of a chlo
B
Figure 6.1
A
. B
.
C
. D
.
15
1204
(b) The blue dye DCPIP can be converted to colourless reduced DCPIP by gaining
electrons.
A suspension of chloroplasts was made by grinding fresh leaves in buffer solution
and centrifuging the mixture. Tubes were then prepared and treated in the
following way:
..
..
..
..
..
..
..
..
(ii) Explain, using tubes A and C, the effects of illumination on Calvin cycle (dark
reaction). [2]
..
..
..
..
16
1205
(iii) The chloroplast suspension may be contaminated with mitochondria. Explain the
evidence from the investigation that presence of mitochondria was not
responsible for the reduction of DCPIP. [2]
..
..
..
..
The Galpagos tortoise or Galpagos giant tortoise (Chelonoidis nigra) is the largest
living species of tortoise and 13th-heaviest living reptile, reaching weights of over
400 kg and lengths of over 1.8 metres. With life spans in the wild of over 100 years, it
is one of the longest-lived vertebrates.
Shell size and shape vary between populations. On islands with humid highlands, the
tortoises are larger, with domed shells and short necks. Due to the climate, there is
abundant vegetation and vegetation is closer to the ground. On islands with dry
lowlands, the tortoises are smaller, with "saddleback" shells, which are flatter than
domed shells, and long necks. There is less vegetation. Charles Darwin's
observations of these differences on the second voyage of the Beagle in 1835,
contributed to the development of his theory of evolution.
Tortoise numbers declined from over 250,000 in the 16th century to a low of around
3,000 in the 1970s. This decline was caused by exploitation of the species for meat
and oil, habitat clearance for agriculture, and introduction of non-native animals to
the islands, such as rats, goats, and pigs.
(a) (i) Explain how the distinct phenotypic differences between the populations may
have arisen. [4]
..
..
..
..
..
..
..
..
(ii) State the phenomenon that describes the decline in tortoise numbers from the
16th century to the 1970s. [1]
..
17
1206
..
..
Figu
ure 7.1 beelow shows the rela ationship beetween number of ssubstitutions
s in
cyto
ochrome c between
b related pairs of species and how lo
ong ago thee two compa
ared
species had divverged from
m a common n ancestor.
Figure 7.1
..
..
..
..
..
..
..
..
..
..
18
1207
Write your answers on the separate writing paper provided. Your answers should be
illustrated by large, clear labeled diagrams, where appropriate. Your answers must
be in continuous prose, where appropriate.
Your answers must be set out in sections (a), (b) etc., as indicated in the question.
Question 8
(a) Explain how the structure of triglyceride is related to its function. [7]
(c) Some enzymes function optimally in acidic conditions, while other enzymes
function optimally in alkaline conditions. Explain why different enzymes have
different optimal pH. [6]
Question 9
(a) Explain the role of the F plasmids in bacterial conjugation and suggest the
advantages of conjugation over transduction. [8]
(b) Explain how the lac operon is regulated by both negative and positive control. [8]
19
1208
Figure 1.1
Golgi Apparatus
The
e following structure
s in Figure 1.2 iis also foun
nd in the axo
on of a neurrone.
Figure 1.2
crotubules
Mic
(iv) In what wa
ay is this strructure relatted to the fu
unction of organelle A iin the
neurone? [1]
Figure 1.3
Exocytosis
(ii) With your understanding of the cell membrane, explain how process B occurs.
[1]
(iii) Suggest the significance of this process with regard to synaptic transmission. [1]
(iv) On the pre-synaptic membrane, there are also Ca2+ voltage-gated channels
found. Describe how a change in potential difference will cause them to open. [2]
a. When the potential difference across the membrane is varied from the
resting potential,
b. conformational change in the protein causes the gate to open
c. This allows charged ions to flow down their electrochemical gradient
d. through the hydrophilic channel provided by this transmembrane protein
1211
B
Figure 2.1
A: Enhancer
B: Promoter
(ii) With reference to Figure 2.1, describe how transcription is initiated and
regulated. [3]
Figure 2.2
C: D
DNA
D: P
Polyribosomes
a. It increase
es the rate of
o translatiion as man
ny ribosom
mes are tran
nslating the
e
mRNA at the same time;
b. Increase thhe rate of protein
p pro
oduction;
(c) Different genetic muttations on a gene an nd its mRN NA may ressult in diffe
erent
diseases. For
F example ation of -globin mRNA
e, RNA splicce site muta A is responssible
of some cases
c of -thalassem ia and a point mutation on -gglobin gene is
responsible
e for sickle cell
c anaemiia.
(ii) Explain why a point mutation on a -globin gene does not always produce
mutated globin whereas an RNA splice site mutation will always produce
mutated globin. [3]
Figure 3.1
A
a. Neuraminidase;;
b. Haemagglutinin;;
B
Negative/antisense RNA segments;;
(b) RNA-dependent RNA polymerase can be found in this virion while reverse
transcriptase can be found in retrovirus. Besides the type of virus, describe one
similarity and two differences between RNA-dependent RNA polymerase and
reverse transcriptase. [3]
1214
Similarity:
a. Both are viral proteins, i.e. they are only coded for by viral genes and not
the host genes.
b. Both are dependent on RNA as a template
Differences
Ose
eltamivir, be
etter known under its trrademark na ame as Tam miflu, is a reecommende ed
dication for H1N1. Its mechanism
med m of action is
s illustrated in Figure 3..2 and 3.3.
Figure 3.2
Figure 3.3
The effects of oseltamivir were studied on patients infected with influenza virus.
These patients were randomly separated into two groups one group administered
with a placebo (a pseudo-drug with no effect) while the other group was administered
oseltamivir. Symptoms were measured and recorded in Table 3.4.
Study Groups
Symptoms
Placebo (n=129) Oseltamivir, 75mg (n=124)
Cough
Duration, hr 55 (36-73) 31 (24-42)
Severity, arbitrary units 110 67
Nasal Obstruction
Duration, hr 43 (31-64) 33 (25-43)
Severity, arbitrary units 80 60
Sore Throat
Duration, hr 21 (8-29) 10 (4-19)
Severity, arbitrary units 29 20
Fatigue
Duration, hr 41 (26-50) 24 (19-34)
Severity, arbitrary units 89 54
Feverishness
Duration, hr 23 (16-29) 10 (8-14)
Severity, arbitrary units 49 21
Table 3.4
(d) With reference Table 3.4, determine the effectiveness of oseltamivir. [2]
(e) In a separate case, a patient was treated for both H1N1 and H3N3. During this
treatment, he was infected with H3N3. Upon testing, it was found that his blood
now contains H3N3 and a new strain of virus, H1N3. Explain how this new strain
could have arisen. [3]
a. The new strain of virus could have arisen due to antigenic shift.
b. As H1N1 and H3N3 infect the same cell simultaneously, their protein
capsids and lipid envelopes are removed, exposing their RNA.
c. Influenza virus can undergo antigenic shift because it contains a
segmented genome composed of 8 different segments.
d. The new strain, H1N3, could have arisen via genetic recombination of the
genome segments.
1217
(a) In maize plants, a recessive mutant allele leads to green leaves as opposed to
bronze leaves. Another recessive mutant allele at a separate locus leads to
yellow cobs as opposed to brown cobs. F1 maize plants from a standard dihybrid
cross was test crossed with a plant with green leaves and yellow cobs. The table
shows the phenotypes of 200 of the offspring.
(i) In the space below, draw a genetic diagram to explain the observed results of
the cross. [4]
Let B be the dominant allele coding for bronze leaves and let b be the
recessive allele for green leaves.
Let N be the dominant allele for brown cobs and let n be the recessive allele for
yellow cobs. a. legend [1/2]
Genotype Bn x bn
bN bn c. correct genotype [1/2]
Types of Gametes Bn bN bn
BN bn
bn Bn bN BN bn
bn bn bn bn
(a) Bronze Green leaves, Bronze Green leaves,
leaves, yellow brown cobs leaves, brown yellow cobs
cobs cobs
Expected ratio: 1: 1: 1: 1
Experimental ratio 44% 43% 6% 7%
1218
(b) A chi-squared test was also carried out for the above cross and the chi-square
value was 109.6. Using the probability table given, does this value for the chi-
squared test support the expected phenotypic ratio? Explain. [3]
a. No;
b. Calculated 2 value of 109.6 is greater than 7.82
c. At 3 degrees of freedom
d. The probability of getting chi-square value is between p<0.001
e. P<0.5 (or less than 5% probability) which is the cut off probability
f. Hence difference between observed and expected results is significant
g. and not due to chance
1219
Que
estion 5 [12
2 marks]
Fig 5.1
(i) Identify wh
hich individu
ual has a no
ormal home
eostatic systtem in contrrolling blood
d
glucose levvel. Explain
n your answ
wer. [2]
a. Individual D;
b. Increase in
n blood gluucose levell from 90 mg
m to 150 mgm 100 cm-3 -3
of blood
from 0 1..0 hour as glucose is absorbed into the bloodstream m;
c. Beta cells of the pancreas deteects prod duces/trigg
gers insulin
n productio on;
d. increases glucose pe ermeability
y in liver an
nd muscle cells;
e. return gluc
cose level back to sett point 1000 mg per 1000 ml bloodd after 2.5
hours
a. Hypoglyca aemia;
b. blood gluccose level drop
d from 100 to 35mmg 100 cm-33 of blood; (below sett
point of 90
0 mg / 100 ml
m of bloodd)
c. Person C is
i unable to o absorb th
he glucosee from the intestine
i in
nto his bloo
od
stream/due e to intensive exercis
se/fasting; (AVP)
d. Glucagon not secrete ed/synthessised
(iii) State th
he type of re eceptor thatt glucagon binds to and
d explain hoow this
recepto y activated. [2]
or is the fully
(b) Ras is a GTTP-binding protein thatt helps to broadcast signals from the cell surrface
to other pa oliferation. If Ras functtion is inhib
arts of the cell to stimu late cell pro bited,
1220
Figure 5.2
B
a. relay protein(s), Grb b-2 adaptorr protein reecognizes and
a binds tto specific
phosphorrylated tyro osine(s) whhich acts as s docking protein
b. for Ras GEF which becomes
b a
activated
c. which acttivates G protein,
p Ras s protein by
b removing GDP and d
d. replacing it with GTP P
e. in order to
o activate Ras
R protein n
f. to relay siignal by acctivating otther proteinns or enzym
mes to brin
ng about
various ce ellular resp
ponses (= c cell proliferration).
a. may transform the signal into a different form, which is suitable for passing
or stimulating a cell response
OR
b. It may amplify the signal it receives either by producing large amounts of a
small signal intracellular mediators or by activating many copies of a
downstream signaling protein.
1222
Que
estion 6 [11
1 marks]
Figu
ure 6.1 sho
ows an electtromicrogra
aph of a chlo
oroplast
B
Figure 6.1
A grana/thylak
koid memb
branes B stroma
ubes
Tu Contentt Treatment Colo
our
Start
S After 20 min
m
A 1 cm3 chloroplast Illuminated d Blue
e-green Green
suspensio
on strongly
5cm3 DCP PIP
B c 3 buffer so
1 cm olution Illuminated d Blue
B blue
5cm3 DCP PIP strongly
C 1 cm3 chloroplast L
Left in the da
ark Blue
e-green Blue-green
suspensio
on
5cm3 DCP PIP
1223
a. DCPIP acts like final hydrogen ion and electron acceptor, NADP+ in non-
cyclic photophosphorylation of the light-dependent reaction;
(iii) Explain, using tubes A and C, the effects of illumination on Calvin cycle (dark
reaction). [2]
a. Light dependent reaction taking place in tube A but not in C means that
ATP & NADPH can be produced in A
b. With ATP and NADPH, Calvin cycle can take place giving rise to sugars
c. No Calvin cycle in tube C
d. ATP and NADPH are required for reduction and regeneration phase in
Calvin cycle.
(iv) The chloroplast suspension may be contaminated with mitochondria. Explain the
evidence from the investigation that presence of mitochondria was not
responsible for the reduction of DCPIP. [2]
b. When left in the dark/ absence of light/ tube C, DCPIP remained blue-green
like at the start of the experiment, indicating that there is no reduction of
DCPIP
1224
The Galpagos tortoise or Galpagos giant tortoise (Chelonoidis nigra) is the largest
living species of tortoise and 13th-heaviest living reptile, reaching weights of over
400 kg and lengths of over 1.8 metres. With life spans in the wild of over 100 years, it
is one of the longest-lived vertebrates.
Shell size and shape vary between populations. On islands with humid highlands, the
tortoises are larger, with domed shells and short necks. Due to the climate, there is
abundant vegetation and vegetation is closer to the ground. On islands with dry
lowlands, the tortoises are smaller, with "saddleback" shells, which are flatter than
domed shells, and long necks. There is less vegetation. Charles Darwin's
observations of these differences on the second voyage of the Beagle in 1835,
contributed to the development of his theory of evolution.
Tortoise numbers declined from over 250,000 in the 16th century to a low of around
3,000 in the 1970s. This decline was caused by exploitation of the species for meat
and oil, habitat clearance for agriculture, and introduction of non-native animals to
the islands, such as rats, goats, and pigs.
(a) (i) Explain how the distinct phenotypic differences between the populations may
have arisen. [4]
(ii) State the phenomenon that describes the decline in tortoise numbers from the
16th century to the 1970s. [1]
Bottleneck effect
Increase in
n the occurrrence of re
ecessive diseases
d as
s each pareent will most
probably have
h a copyy of the rec
cessive allele.
Figu
ure 7.1 beelow shows the rela ationship beetween number of ssubstitutions
s in
cyto
ochrome c between
b related pairs of species and how lo
ong ago thee two compa
ared
species had divverged from
m a common n ancestor.
Figure 7.1
a. The graphh suggests a linear re elationshipp between thet numbeer of seque ence
changes and
a the timee of diverg
gence.
b. Such a relationship indicates that the observed
o ra
ate of neu tral mutatiions
remains co onstant over millions s of years.
c. The number of nucle eotide diffe
erences is higher when two speecies share ed a
common ancestor
a in
n the very ddistant pas s in anotheer two species
st than it is
that sharedd a more re ecent comm mon ances stor.
d. Human and cow have a differen nce of 90 nucleotides
n s and they diverged from
f
the commo on ancesto or about 1220 millions of years ag go.
e. Compared d to horse and donke ey which have
h a diffe
erence of 110 nucleotides
and they diverged fromf the c
common an ncestor 8 million yeears ago. (Any
(
other valid
d comparison)
f. The gene sequences s of speciees which had
h diverge ed from eaach other for
f a
longer pe eriod of time wou uld have accumulated more independ dent
mutations,, which ma ake their se
equences more
m different.
a. No gene marks
m time with compplete precis
sion. In factt, some poortions of th
he
genome ap ppear to ha
ave evolved
d in irregular fits and
d starts that
at are not att all
clocklike.
1226
b. Even genes that seem to have reliable molecular clocks are accurate only
in the statistical sense of showing a fairly smooth average rate of change.
Over time, there may still be chance deviations above and below that
average rate.
c. The same gene may also evolve at different rates in different groups of
organisms, making it necessary to calibrate and use molecular clock with
care.
d. Even among genes that are clocklike, the rate of the clock may vary greatly
from one gene to another; some genes evolve a million times faster than
others.
Section B: Essay
Question 8
(a) Explain how the structure of triglyceride is related to its function. [7]
Collagen Cellulose
Monomers Amino acids Only B-glucose molecules
Bonds between Peptide bonds formed B 1,4, glycosidic bonds
monomers between amino acid formed between B-glucose
monomers monomers
Structure Loose helical structure of Linear chain due to rotation
adopted by polypeptide chain due to the of alternate glucose residue,
each chain lack of intra-chain H bonds resulting in bulky side
(because of lack of N-H chains on each side of the
group in proline) chain
Subunit making Tropocollagen 3 Linear unbranched chain
up polypeptide chains wound
macromolecule tightly together
Arrangement of Tropocollagen arranged in Long chains run parallel to
subunit in staggered out of step each other, but not in a
macromolecule manner to increase tensile staggered manner
and mechanical strength
Bonds involved Covalent cross-linkages Cumulative strength of H-
in stabilizing formed between the C- bonds formed between the
macromolecule terminus of one hydroxyl groups projected
tropocollagen and the N- outwards in all directions of
terminus of another each chain
tropocollagen
Organism Produced in animals Produced in plants
Similarities
Both serve as structural support with high tensile and mechanical strength
Both are insoluble in water due to the lack of hydroxyl groups to form H-bonds
with water.
(c) Some enzymes function optimally in acidic conditions, while other enzymes
function optimally in alkaline conditions. Explain why different enzymes have
different optimal pH. [6]
k. and thus the conformation of the active site can no longer be maintained.
l. Substrate no longer fits into active site as enzyme is denatured.
Question 9
(a) Explain the role of the F plasmids in bacterial conjugation and suggest the
advantages of conjugation over transduction. [8]
(b) Explain how the lac operon is regulated by both negative and positive control. [8]
a. Only when lactose is in high supply AND glucose is in low supply does E
coli use lactose as an energy source.
b. When lactose is present, some of the lactose gets transported into the cells
c. Lactose is converted into the inducer, allolactose.
d. Allolactose is the isomer form of lactose.
e. The inducer binds to the repressor protein and alters its conformation
f. so it cannot bind to the operator site (repressor becomes inactive)
g. In the absence of an operator-bound repressor protein, RNA polymerase
can now transcribe the structural genes into mRNA,
h. which are then translated into enzymes, permease, transacetylase and -
galactosidase, which transport and hydrolyse the disaccharide, lactose.
i. The lac operon has a very inefficient promoter element that is, it has a low
1229
affinity for RNA polymerase, even when the repressor protein is inactivated.
j. cyclic AMP (cAMP), accumulates when glucose is in low concentration in
the cell.
k. Another regulatory protein, catabolite activator protein (CAP) (which is
produced in inactive form) can bind to CAP-binding site.
l. To activate CAP, cAMP must bind to CAP;
m. The resulting cAMP-CAP complex then binds to the CAP-binding site.
n. This binding of active CAP bends DNAs double helix strengthens the
affinity of the promoter region for RNA polymerase
o. the rate of transcriptional initiation increases in the presence of lactose.
p. Lac operon is thus regulated by both negative (due to repressor) and
positive (due to activator) control.
Candidate
Name
Civics INDEX
Group NUMBER
H2 BIOLOGY 9648 / 03
Write your name, class and index number on all the work you hand in.
Write in dark blue or black pen.
You may use a soft pencil for any diagrams, graphs or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
Section A 1 / 12
Answer ALL questions.
2 / 14
Answers are to be written in the spaces provided.
3 / 14
Section B
Answer Question 5. Section B
Write your answer on the lines provided.
5 / 20
Do not open this booklet until you are told to do so.
TOTAL / 60
4 (SPA) /12
[Turn Over
1231
SectionA:Answerallquestions[40marks]
1. The ability to identify salmon species following food processing such as canning and smoking
is problematic but of great commercial importance. The most commonly used methods of
identifying raw fish are not applicable to thermally treated products. Polymerase chain
reaction-restriction fragment length polymorphism (PCR-RFLP) is thus an alternative method
to authenticate canned or smoked fish products.
..
..
Following extraction of DNA from the processed fish product, PCR was carried out to amplify a
500bp segment from the DNA sample. Figure 1.1 illustrates the thermal cycling characteristic
of PCR.
Figure 1.1
....
2
1232
Figure 1.2 shows the number of molecules of DNA produced over a number of PCR cycles.
Figure 1.2
3
1233
DNA
D sample
es were takken from 10 0 different ssmoked salmon produc cts to autheenticate the
e salmon
used.
u The a
amplified sa
amples were then subjjected to re estriction digests usingg various reestriction
enzymes.
e Fo
or each reaaction, the DNA
D restricttion fragme
ents were suubjected to gel electrophoresis
and
a visualize ed using a staining kit.
Figure
F 1.3 sshows the RFLP
R profile
es of salmon
n products 1 to 10 follo
owing digesstion with re
estriction
enzymes
e Bssp 1286I, Ecco RII and Sau
S 3AI. 10 00bp DNA laadder lanes s were incluuded as refeerence.
F
Figure 1.3
With
W referen nce to Figurre 1.3,
(d) expla
ain what is meant
m by RF
FLP. [2]
..
..
..
..
[Total: 12
2 marks]
4
1234
2.
2 The first g
gene therap
py trial for an
a inherited
d disorder was
w initiated d on 14 Se ptember 19 990. The
patient, A
Ashanthi De
eSilva, suffeered from a very rare recessively
y inherited ddisorder, ad
denosine
deaminasse (ADA) deeficiency.
An inherited deficien
ncy of ADA has, howevver, particularly severe
e consequeences in the
e case of
T lymph hocytes. As A a resu ult, ADA-deeficient paatients sufffer from severe co ombined
immunoddeficiency (SSCID).
.
..
..
.
(b) Sugggest why a recessivelyy inherited ddisorder succh as ADA--SCID can be treated by gene
thera
apy. [2]
.
..
..
.
(c) The novel ADA gene therapy approacch involved essentially the followinng steps:
Fi gure 2.1
(i) Suggest wh
hy the ex vivo method was used in
n this case. [1]
5
1235
(ii) Suggest an improvement to the procedure in Figure 2.1 so as to increase the success
rate of the treatment. [3]
...
...
...
...
(d) Name another method, other than gene therapy, which can be used for the treatment of
ADA-deficiency. [1]
...
(e) Gene therapy using the same form of treatment as the above case study has succeeded
for 15 French baby boys suffering from X-linked SCID. However 3 of the little boys later
developed cancer and died. Suggest how this is possible. [3]
....
....
....
....
....
....
6
1236
(f) State and explain 2 other factors that hinder the effectiveness of current gene therapy
approaches. [2]
....
....
....
....
[Total: 14 marks]
7
1237
3. AquAdvantage salmon is a transgenic salmon where a promoter for the anti-freeze gene of an
ocean pout and a gene for the Chinook growth hormone was inserted into a plasmid pUC18
(Figure 3.1). The recombinant DNA (Figure 3.2) is then introduced into fertilized egg cells of
the Atlantic salmon by microinjection and stimulated to become triploid.
Figure 3.1
Figure 3.2
...
...
8
1238
...
...
......
...
(b) The egg cells were induced to be triploid. Explain the significance of this. [2]
...
......
...
(c) Figure 3.3 below shows the differences between weight of AquAdvantage salmon and
standard salmon.
Figure 3.3
9
1239
(i) With reference to Figure 3.3, compare the growth curves of standard salmon and
AquAdvantage salmon. [3]
.....
...
.....
...
(ii) Explain the difference in the weight increase of AquAdvantage salmon and the
standard salmon. [2]
........
....
.....
(d) Describe one ethical and one social concern that might arise from the production of
AquAdvantage salmon. [2]
........
....
........
[Total: 14 marks]
10
1240
Plan an investigation to investigate if these creatures found in Western New Guinea are
descendents of the Thylacine that was thought to be extinct.
Your planning must be based on the assumption that you have been provided with the
following equipment and materials.
Tissue sample from the museum specimen and from the Western New Guinea
creatures under investigation
Pestle and mortar
DNA extraction buffer solution
Microcentrifuge tubes
Centrifuge
Restriction enzymes
Agarose or polyacrylamide gel plate
Suitable source of electric current
Radioactive probe
Nitrocellullose membrane
Autoradiography equipment
11
1241
12
1242
13
1243
14
1244
15
1245
16
1246
Your answer:
(a) Describe how the micropropagation technique is used in production and cloning of
herbicide resistant plants. [9]
(b) Discuss the social and ethical implications of GMO plants using 3 named examples. [6]
(c) Discuss the limitations for the use of gene therapy to treat diseases in humans. [5]
17
1247
18
1248
19
1249
20
1250
21
1251
22
1252
Candidate
Name
Civics INDEX
Group NUMBER
H2 BIOLOGY 9648 / 03
Write your name, class and index number on all the work you hand in.
Write in dark blue or black pen.
You may use a soft pencil for any diagrams, graphs or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.
Section A 1 / 12
Answer ALL questions.
2 / 15
Answers are to be written in the spaces provided.
3 / 14
Section B
Answer Question 5. Section B
Write your answer on the lines provided.
5 / 20
Do not open this booklet until you are told to do so.
TOTAL / 60
4 (SPA) /12
[Turn Over
1253
1. The ability to identify salmon species following food processing such as canning and
smoking is problematic but of great commercial importance. The most commonly used
methods of identifying raw fish are not applicable to thermally treated products. Polymerase
chain reaction-restriction fragment length polymorphism (PCR-RFLP) is thus an alternative
method to authenticate canned or smoked fish products.
Following extraction of DNA from the processed fish product, PCR was carried out to amplify
a 500bp segment from the DNA sample. Figure 1.1 illustrates the thermal cycling
characteristic of PCR.
Figure 1.1
As specific DNA primers are used to anneal to 3 end of target sequence via
complementary base-pairing,
temperature is specific at 55C;
1254
Figure 1.2 shows the number of molecules of DNA produced over a number of PCR cycles.
Figure 1.2
DNA samples were taken from 10 different smoked salmon products to authenticate the
salmon used. The amplified samples were then subjected to restriction digests using various
restriction enzymes. For each reaction, the DNA restriction fragments were subjected to gel
electrophoresis and visualized using a staining kit.
Figure 1.3 shows the RFLP profiles of salmon products 1 to 10 following digestion with
restriction enzymes Bsp 1286I, Eco RII and Sau 3AI. 100bp DNA ladder lanes were included
as reference.
1255
Fig
gure 1.3
d) expla
ain what is meant
m by RFLP. [2]
Diffe
ferent lengtth of fragmments
wheen genome e of 2 indiviiduals dige
ested by the same RE
E
Duee to genetic c mutation
resuulting in loss or gain of restrictiion sites
Questio
on 2
(c) (i) Suggest why the ex vivo method was used in this case. [1]
Either one:
(ii) Suggest an improvement to the procedure in Figure 2.1 so as to increase the success
rate of the treatment. [3]
also accept:
(d) Name another method, other than gene therapy, which can be used for the treatment of
ADA-deficiency. [1]
(e) Gene therapy using the same form of treatment as the above case study has
succeeded for 15 French baby boys suffering from X-linked SCID. However 3 of the little
boys later developed cancer and died. Suggest how this is possible. [3]
inability to control the specific site of insertion / random integration of transgene ->
insertional mutagenesis
disrupt gene control regions -> activation of oncogenes
Inactivation of 2 copies of the tumor suppressor gene
Ref function of the TSG
Inactivation of a gene involved in apoptosis
-> uncontrolled cell division/proliferation
(f) State and explain 2 other factors that hinder the effectiveness of current gene therapy
approaches. [2]
3. AquAdvantage salmon is a transgenic salmon where a promoter for the anti-freeze gene
of an ocean pout and a gene for the Chinook growth hormone was inserted into a plasmid
pUC18 (Figure 3.1). The recombinant DNA (Figure 3.2) is then introduced into fertilized
egg cells of the Atlantic salmon by microinjection and stimulated to become triploid.
Figure 3.1
Figure 3.2
mRNA from the growth hormone is converted to a single stranded cDNA using
reverse transcriptase;
the RNA from the RNA-cDNA hybrid is hydrolysed by RNAseH;
DNA polymerase is used to form a complementary strand to form double stranded
cDNA;
Promoter and terminator region from ocean pout antifreeze gene is joined to the
growth hormone cDNA using DNA ligase;
Linker DNA is added to ends of the promoter and the terminator region;
1259
Linker DNA and pUC18 plasmid is cut using the same RE (state any RE shown in
the diagram) to produce complementary sticky ends;
Hydrogen bonds are formed/Annealing between the sticky ends;
DNA ligase is used to form phosphodiester bonds between the transgene/gene
construct to form a recombinant DNA.
(b) The egg cells were induced to be triploid. Explain the significance of this. [2]
AquAdvantage salmon are infertile as unable to produce haploid eggs via meiosis;
Any AquAdvantage salmon which might escape into the wild cannot mate with wild
salmon
hence preventing transfer of the transgene to wild species
(c) Figure 3.3 below shows the differences between weight of AquAdvantage salmon and
standard salmon.
Figure 3.3
(i) With reference to Figure 3.3, compare the growth curves of standard salmon and
AquAdvantage salmon. [3]
Both graphs show gradual increase and then exponential increase (necessary)
AquAdvantage salmon is always heavier than standard salmon from the first
feeding.
Standard salmon reached maximum weight of 4000g in 850 days while
AquAdvantage salmon reached more quickly 4000g in 620 days.
The weight gain for AquAdvantage salmon was gradual from 0 to 600g from 0 to
230 days while standard salmon weight increased gradually from 0 to 600g from 0
to 440 days.
AquAdvantage salmon showed an exponential increase in weight from 600g at 230
days to a maximum of 6000 g at 720 days. But standard salmon showed an
1260
(ii) Explain the difference in the weight increase of AquAdvantage salmon and the
standard salmon. [2]
AquAdvantage salmon contains the growth hormone gene of the larger Chinook
salmon -> produce the GH to grow larger;
Promoter of the ocean pout antifreeze gene -> produce the hormone all year round;
Enabling the AquAdvantage salmon to grow larger in a shorter period of time.
Total weight gain from AquAdvantage salmon was 6000g over 720 days and
standard salmon was 4000g in 850 days.
(c) Describe one ethical and one social concern that might arise from the production of
AquAdvantage salmon. [2]
Health concern (R: Environmental concern as the fish are triploid, cannot mate with
wild type)
The effects of extra salmon growth hormones and the safety of these salmon for
human consumption
Ethical concern
Increased production of growth hormone has harmful effects on the health of
salmon -> additional stress in salmon -> exploitation of animals for food
Your planning must be based on the assumption that you have been provided with
the following equipment and materials.
Tissue sample from the museum specimen and from the Western New Guinea
creatures under investigation
Pestle and mortar
DNA extraction buffer solution
Microcentrifuge tubes
Centrifuge
Restriction enzymes
Agarose or polyacrylamide gel plate
Suitable source of electric current
Radioactive probe
Nitrocellullose membrane
Autoradiography equipment
Suggested answer
Introduction: 4 marks
Use of molecular homology: the similarities in DNA nucleotides sequence of
organisms
Especially certain VNTR / DNA sequences that are conserved within a species but
different between species.
Extract the DNA from the specimen from the nucleus
Brief description of RFLP and reference to DNA fingerprinting
Use of a suitable RE to cut the genomic DNA recognise specific RE sites within the
DNA (to ensure that RE used does not cut up the target DNA sequence
Separate fragments using gel electrophoresis via molecular sizes
Perform southern blotting (brief outline of blotting process and denaturation of double
stranded DNA);;
Nucleic Acid hybridisation using a single stranded radioactive DNA probe (DNA if
VNTR is used) that is complementary to the target sequences
Description of autoradiography use of xray film
1262
Hypothesis:
If the RFLP banding patterns obtained are identical or similar, it suggests that the
creatures found in Western New Guinea are closely related to the Thylacine, thus this
suggests that they may share a recent common ancestor.
Procedures: (7 marks)
Proposed method of experiments to achieve results:
(i) Method of DNA extraction from tissue samples including use of buffers;;
Mechanical breakage of tissues with pestle and mortar
Use of DNA extraction buffer solution
Centrifuge & DNA in the supernatant
(ii) Digestion with a suitable restriction enzyme for 1 hour at optimum temperature of 370C.
(Restriction enzyme must be able to cleave the DNA sequence at specific sites generating
different sized fragments between species.);;
2l DNA
0.5l - 1 l restriction enzyme
(iv) Load DNA samples in gel as shown: - represents 3 lanes of same sample
DNA Ladder
Sample 2
Sample 1
Control
Agarose gel
(v) Separation of fragments by gel. Run at 110V for 30min. Stop current when loading dye
reach 2/3 gel;
Control;
Tube with all reagents but no DNA added. This negative control will show that only DNA
fragments with regions complementary to the probe will show up as a dark band after
autoradiography.
More tests can be done on other VNTR / gene sequences to obtain more evidence of
homology.
Sample 2
Control Sample 1
autoradiograph
1264
Safety precautions;
- be careful when working with radioactive DNA probes wear goggles, gloves and lab coat
to prevent touching bare skin
Your answer:
(a) Describe, using a named example, how the micropropagation technique is used in [9]
production and cloning of herbicide resistant plants.
b) Discuss the social and ethical implications of GMO plants using 3 named examples. [6]
1) Definition of GMO 1m
Genetically Modified Organism: Organism that has acquired one or more genes by
artificial means. The genes may or may not be from the same species.
2) Social implications
(a) Threat to Human Safety
(i) Genetic markers
- Vectors used for transforming plant/crop cells contain antibiotic markers/
kanamycin resistance;
- Concerns that the antibiotic resistant gene if it is not properly broken down by the
digestive system may be passed to potentially harmful bacteria in the human gut
making them resistant to the antibiotics;
(ii) Spread of resistance from genetically modified crops to weeds (Any herbicide
resistant plant)
- Pollen grains from genetically modified plants can be carried in the wind and fertilise
wild relatives and weeds;
- -> superweeds. These may become more invasive (overrun agricultural areas
rapidly) or compete with the natural species;
3) Ethical implications
(a) Genetic manipulation of plants may be deemed unacceptable as there are no
rights to tampering with nature and affecting the intrinsic value of the plant ;
Other points:
(d) Non-mandatory labeling of products containing GMO plants -> consumer rights;
(e) Patent rights to GMO plants -> patenting plants is itself unethical as it reduces
them to the level of objects;
(c) Discuss the limitations for the use of gene therapy in treating diseases in humans. [5]
RAFFLES INSTITUTION
2013 Year 6 Preliminary Examination
Higher 2
BIOLOGY 9648/01
Paper 1 Multiple Choice 30th September 2013
1 hour 15 min
There are forty questions in this paper. Answer all questions. For each question there are four possible
answers A, B, C, and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer Sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
Calculators may be used.
(Erase all mistakes completely. Do not bend or fold the OMR Answer Sheet).
Raffles Institution
Internal Examination
1. The diagram below shows a lactating mammary secretory cell. In this cell, milk proteins, such as
casein, are transcribed and translated, and eventually secreted into the lumen of the mammary
gland.
Which of the following shows the most likely sequence of locations involved in this process?
start finish
A 6 3 4 7 2 5 1
B 6 4 3 7 5 2 1
C 4 6 7 3 5 2 1
D 4 3 7 6 2 5 1
2. Liver tissue produces an enzyme called catalase which breaks down hydrogen peroxide into
water and oxygen.
2H2O2 2H2O + O2
The rate of this reaction can be determined by measuring the volume of oxygen produced in a
given length of time.
Students added small cubes of fresh liver tissue to a range of hydrogen peroxide solutions and
measured the volumes of oxygen produced. Their data were used to produce the graph
showing how changing the concentration of hydrogen peroxide affected the rate of oxygen
production.
A 1, 3, 4 and 5 only
B 1, 4 and 5 only
C 2 and 3 only
D 2 and 5 only
A 1 and 3
B 1 and 4
C 2 and 3
D 2 and 4
RI 2013 Preliminary Examination 9648/01 [Turn over
1270
4. The diagrams below show the results of an investigation into the composition of different
mixtures of amino acids. Each mixture of amino acids was separated using chromatography
which separates the amino acids based on their differential solubility in a propanol and aqueous
ammonia mixture. Each chromatogram was then turned through 90 and the amino acids
separated again by electrophoresis. Electrophoresis separates amino acids based on their
charge using an electrical field.
Which diagram shows an amino acid mixture in which the solubility of some of the amino acids
is the same but the charge on those particular amino acids is different?
5. Sex determination in some insects such as bees and wasps is not controlled by sex
chromosomes.
male female
P Q
R S
Q P
female male
Using the diagram, which row in the table shows how sex is determined in these insects?
P Q R S
A n n mitosis mitosis
B n 2n mitosis meiosis
C 2n n meiosis meiosis
D 2n 2n meiosis mitosis
6. Compared to a diploid cell, how much genetic material would the nucleus of a haploid cell of the
same organism contain?
A one quarter
B double
C half
D same amount
VI
IV
II V
III
Which of the following options best describes I, II, III, IV, V and VI?
I II III IV V VI
lagging DNA Okazaki
A 3 end 5 end DNA primer
strand polymerase fragments
leading lagging DNA Okazaki
B 5 end RNA primer
strand strand polymerase fragments
lagging Okazaki
C 5 end 3 end DNA ligase RNA primer
strand fragments
template Okazaki
D 5 end 3 end DNA ligase DNA primer
strand fragments
8. Scientists were able to splice out the promoter of eukaryotic gene and attach it to the end of a
gene as shown below. The gene was reintroduced back to the genome of the organism.
gene gene
10. Below shows a partial segment of two variant alleles of the gene coding for EcoRI in bacteria.
5 TTATACCTAATAAATGAACCTGAATTCATGCCGG 3
wild type Promoter
3 AATATGGATTATTTACTTGGACTTAAGTACGGCC 5
5 TTATACCTAATAAATGAACCTGAATTCATGACGG 3
mutant Promoter AATATGGATTATTTACTTGGACTTAAGTACTGCC 5
3
11. A complete reproductive cycle of the T4 bacteriophage requires all of the following processes to
occur except
A incorporation of viral DNA into host cell DNA.
B translation of viral mRNA.
C replication of viral genome.
D addition of methyl groups to viral genome.
12. Wh
hich of the ffollowing sta
atements be
est distinguiishes the type of virus shown
s below
w?
13. In the presencce of hydrog gen sulphidde and nitratte ions, the bacterium Thiomargarrita namibiensis
neeeds to turn on the ope erons conta aining the geenes for hyydrogen sulpphide oxidaation and ge
enes
forr nitrate ionss reduction.. Both operoons are turn
ned on in thhe presencee of hydrogeen sulphide and
nittrate ions. N
Neither operon is turned d on unless hydrogen ssulphide andd nitrate ions are prese
ent.
Hyydrogen sulp phide and n nitrate ions a
are acting a
as
A inducerss.
B activatorrs.
C co-repre
essors.
D Represssors.
RI 2013 Prelim
minary Examinatiion 9648/01
1275
15. Which of the following options is true with regards to gene expression in yeast and E.coli?
yeast E.coli
transcription & transcription &
polycistronic translation polycistronic translation
polyribosome polyribosome
mRNA occur mRNA occur
simultaneously simultaneously
A
B
C
D
16. Which of the following statements about transcription in eukaryotes is/are incorrect?
1 Acetylation of histones leads to decondensation of heterochromatin to euchromatin for
transcription to take place.
2 RNA polymerase, general transcription factors and specific transcription factors make
up the transcription initiation complex.
3 Specific transcription factors such as repressors bind to silencers to prevent assembly
of the transcription initiation complex.
4 The binding of enhancer proteins to activators result in enhanced rate of transcription.
A 1 and 2 only
B 1 and 3 only
C 2 and 4 only
D None of the above
10
18. Eye colour of Drosophila is determined by the synthesis of two pigments, red and brown. Wild-
type flies have brick-red eyes. There are also flies with scarlet (bright-red), brown and white
eyes. Flies homozygous for allele s have scarlet eyes whereas flies homozygous for allele b
have brown eyes. The double homozygous recessive genotype results in white eyes.
To investigate the inheritance of eye colour in flies, a geneticist carried out 2 crosses as
described below.
CROSS 1
Two strains of wild-type flies that are heterozygous for each of 2 genes, s and b, affecting eye
colour were mated.
Among 240 progeny,
progeny phenotype number of progeny
wild-type eyes 150
scarlet eyes 36
brown eyes 46
white eyes 8
The results are analysed by chi-squared test to determine if the difference between the
observed and expected numbers are significant. The P-value obtained is greater than 0.05.
CROSS 2
A test-cross was performed on wild-type flies that are heterozygous for recessive allele of each
of 2 genes, s and b.
progeny phenotype percentage / %
wild-type eyes 25.1
scarlet eyes 24.9
brown eyes 25.2
white eyes 24.8
Which statement correctly describes the conclusion that can be drawn from the above
crosses?
A Cross 1 results give evidence that we should reject the null hypothesis, indicating that the
inheritance of the two genes follows Mendelian ratio of 9:3:3:1.
B Cross 1 results give evidence that we should not reject the null hypothesis as there is
interaction between the two gene loci.
C Cross 2 results is used to prove that the inheritance of the two genes follows Mendels law
of segregation.
D Cross 2 results are sufficient to prove that the S/s and B/b gene loci are not linked.
11
19. Achondroplastic dwarfism is an autosomal dominant disorder and red-green colour blindness is
an X-linked recessive disorder.
An achondroplastic male dwarf with normal vision marries a colour blind woman of normal
height. The mans father is 1.7 meters tall while both the womans parents are of average
height.
What is the probability that their son will be colour blind and of normal height?
A 0.25
B 0.5
C 0.75
D 1.0
20. Feathers in poultry can be white or coloured and this is controlled by two genes, P/p and Q/q.
The phenotypes of offspring that are expected from mating two birds, each of which is
heterozygous at both loci, are shown in the Punnett square.
Which of the following best explains the proportion of white to coloured feathers in the Punnett
square?
A Dominant epistasis in which a suppressor prevents the expression of epistatic gene.
B Dominant epistasis in which the epistatic allele is P.
C Recessive epistasis in which colour is recessive to no colour at one allelic pair.
D Recessive epistasis in which the epistatic allele is p.
12
21. Achillea millefolium, commonly known as yarrow is a flowering plant that was traditionally used
as a herbal medicine to treat wounds and minor bleedings. It is native to temperate regions of
the Northern hemisphere.
Phenotypic variation in the species has been extensively studied along an altitudinal gradient
from sea level to more than 3000m elevation. It is observed that there is variation in height and
biomass. Adaptation to different local environments also results in variation in physiology such
as dormancy period and resistance to cold.
Which is the best method to determine if the observed phenotypic variation in the species is due
to genotypic variation?
A Searching for chromosomal differences between populations at the extremes of altitude.
B Determine if viable offspring can be produced when plants from phenotypically different
populations are crossed.
C Determine if hybrids between phenotypically different populations can grow at altitudes
intermediate between the parent populations.
D Determine if phenotypic differences are maintained when plants from different altitudes are
grown under one environmental condition.
22. A child with Down syndrome has the genotype P1 P2 P3 for a polymorphism on chromosome 21
that has four different alleles allele P1, allele P2, allele P3, allele P4. The childs mother has
the genotype P1 P2 and the father has the genotype P3 P4.
In which parent did non-disjunction occur, and did this event occur in the first or second meiotic
division?
A father; Meiosis I
B father; Meiosis II
C mother; Meiosis I
D mother; Meiosis II
23. Rotene and oligomycin are two metabolic poisons which affect cellular respiration. The effects
of rotene and oligomycin on aerobic respiration are summarised in the table.
Which of the following correctly identifies the specific functions of these two metabolic poisons?
rotene oligomycin
A dissipate proton gradient inhibits ATP synthase
B inhibits ATP synthase electron transport inhibitor
C electron transport inhibitor inhibits ATP synthase
D inhibits ATP synthase dissipate proton gradient
13
24. The blue dye DCPIP can be converted to colourless DCPIP as shown below:
DCPIP (blue) reduced DCPIP (colourless)
In an experiment, green chloroplast extract was first mixed with DCPIP and the extract turned
blue-green. After exposure to 2 hours of light in the presence of ample carbon dioxide and
water, the extract became green again.
Which of the following correctly shows the products that were formed after the experiment?
Hydropathy plots are used to estimate the relative hydrophobicity of amino acid residues. Which
of the following hydropathy plot most likely represents the transmembrane nature of
glycophorin?
A B
C D
14
26. The d
diagram bellow shows a neuron. Tw
wo stimuli a
are applied, one at X an
nd the otherr at Y.
X Y Z
RI 2013 Prelim
minary Examinatiion 9648/01
1281
15
protein affected e
effect
A Na+-K+ A
ATPase ation of Na+ and K+ gra
no restora adient acrosss
mem
mbrane
B acetylcholinesterase acetylch
holine canno
ot be broken
n down and
hence remains in synaptic cleft
D vo d Ca2+ chann
oltage-gated nel ux of Ca2+ a
no influ and fusion o
of synaptic
vesicles w
with membra ane
RI 2013 Prelim
minary Examinatiion 9648/01 [Turn ove
er
1282
16
28. The figure below shows the time course of glucose uptake by the working rat heart in the
absence (I) of insulin and in the presence (II) of insulin. The lower the amount of total blood
glucose, the greater is the uptake of glucose by the rat heart.
600
400
300
II
200
10 30 50 70 90 110 130
Time (min)
From the given data, which of the following statements can be concluded to be correct?
A 1 and 2 only
B 1 and 3 only
C 2 and 3 only
D 3 and 4 only
17
29. The diagram below shows the cell signalling pathway involved in cell proliferation and
differentiation in the shoot meristem.
Legend:
inhibition
Which one of the following sequences regarding the activation of the above signalling pathway
is correct?
A binding of CLV3 to subunits CLV2 and CLV1 dimerisation of CLV2 and CLV1
autophosphorylation of serine/threonine residues activation of Rho-like protein
inhibition of gene transcription
B dimerisation of CLV2 and CLV1 binding of CLV3 to dimer autophosphorylation of
serine/threonine residues activation of Rho-like protein activation of gene
transcription
C binding of CLV3 to subunits CLV2 and CLV1 dimerisation of CLV2 and CLV1
dephosphorylation of serine/threonine residues by protein phosphatase activation of
Rho-like protein inhibition of gene transcription.
D dimerisation of CLV2 and CLV1 binding of CLV3 to dimer dephosphorylation of
serine/threonine residues by protein phosphatase activation of Rho-like protein
inhibition of gene transcription
18
30. The Galapagos Islands aree a group of volcanic islands in the eastern Pacific O Ocean, abou ut
10000km from So
outh Americca. The dia
agram below w illustratess the finche
es found on the islandss;
they resemble e
each other closely butt differ in th
heir feeding g habits and in the sh
hape of theeir
beakks.
RI 2013 Prelim
minary Examinatiion 9648/01
1285
19
31. Five species, 1, 2, 3, 4 and 5 possess the enzyme cytochrome c oxidise. The primary structure
of the enzyme was determined for each species and the number of amino acid differences
between species is given below.
1 2 3 4 5
1 0 7 8 20 23
2 7 0 3 19 22
3 8 3 0 18 21
4 20 19 18 0 20
5 23 22 21 20 0
From the above evidence, which one of the following represents the probable evolutionary
relationships between the species?
A B C D
32. An experiment is conducted using a small population of 25 stoneflies with the frequency of allele
A at 50% (i.e. 1 in 2 alleles present in the population is allele A).
The graph below shows the changes in the frequency of allele A with subsequent generations.
The experiment is repeated several times with the same condition and each trial is represented
by a line on the graph.
All AA
frequency of allele A
Allele A lost
generation (25 stoneflies at the start of each)
Which of the following statement(s) is/are correct?
1 The populations were undergoing genetic drift.
2 The populations were undergoing selection.
3 Allele A will be lost in approximately 50% of such trials.
4 Over time, 2 separate species will emerge.
A 1 only
B 2 only
C 1 and 3 only
D 2, 3 and 4 only
RI 2013 Preliminary Examination 9648/01 [Turn over
1286
20
34. If the first three nucleotides in a six-nucleotide restriction site are CTG, what would the next
three nucleotides most likely be?
A AGG
B GTC
C CTG
D CAG
35. The human X-linked disease haemophilia A is a result of a mutation to a gene that codes for
Factor VIII, a component of the blood coagulation pathway. The haemophilia allele is recessive
to the normal allele.
For the gene locus of haemophilia A, the two alleles exist:
A man who suffers from the disease married a woman who is a carrier of the disease. The
couple has 2 children. Child R is normal while Child S is affected. Which autoradiogram below
correctly identifies the children?
21
36. Which of the following best describes the complete sequence of steps occurring during every
cycle of PCR?
1 The primers hybridise to the target DNA.
2 The mixture is heated to a high temperature to denature the double stranded DNA.
3 Fresh Taq polymerase is added.
4 Taq polymerase extends the primers to make a copy of the target DNA.
A 2, 1, 4
B 3, 2, 4
C 2, 3, 1, 4
D 2, 1, 3, 4
37. Stem cells are found in many tissues that require frequent cell replacement such as the skin, the
intestine or the blood.
However, within their own environments, a bone marrow cell cannot be induced to produce a
skin cell and a skin cell cannot be induced to produce a bone marrow cell. Which statement
explains this?
A Genes not required for a particular cell line are methylated.
B mRNA that is not required for a particular cell line is destroyed.
C Genes not required for a particular cell line are removed using restriction enzymes.
D Different stem cells have only the genes required for their particular cell line.
38. Retrovirus is a more suitable vector than liposome for gene therapy as it
A is non-pathogenic and does not trigger an immune response.
B is more specific and causes mutation to the defective allele.
C has a phospholipid bilayer that can fuse with the target cell.
D results in more stable gene integration.
22
39. Which of the following correctly match the plant tissue culture techniques to their main
purposes?
40. Bt gene from Bacillus thuringiensis may be inserted into cotton plant cells to produce Bt cotton
plants. Insecticide use and yield in India were compared for Bt cotton hybrid (XBt), the same
hybrid X but without the Bt gene (X_), and another hybrid widely grown in that particular locality
(Y). This process was repeated at more than 150 locations. The table below shows the results:
The following are the conclusions that are drawn from the data:
1 All insect pests are killed when they consume the Bt crop.
2 Bt cotton reduces the amount of pesticide used.
3 Both yield and quality of cotton from XBt crop improved.
4 Bt cotton increases cost effectiveness.
5 Both X_ and Y hybrids contain susceptible genes to the pest.
6 Bt toxin is not found in the plant sap.
Which of the conclusions stated are correct?
A 1, 2 and 3
B 2, 3 and 5
C 4, 5 and 6
D 2, 4 and 6
- End of Paper -
RI 2013 Preliminary Examination 9648/01
1289
23
Answers:
RAFFLES INSTITUTION
2013 Year 6 Preliminary Examination
Higher 2
CANDIDATE
NAME
CIVICS
GROUP
1 3 S 0 3 INDEX
NUMBER
BIOLOGY 9648/02
th
Paper 2 Core paper 16 SEPTEMBER 2013
2 hours
Additional materials: Answer Sheet
Write your index number, CT group & name on all the work you hand in. Section A
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagrams, graphs or rough working. 1 /12
Do not use staples, paper clips, highlighters, glue or correction fluid.
Section A 2 /13
Section B
8 or 9 /20
Total /100
S
Section A
Answ
wer all the q n this sectio
questions in on.
A A A C T G T T T C T GC T G G AA C A T
Fig. 1.1
(a
a) (i) M
Methionine is coded by
b the initiattion codon. On Fig. 1.1, label thee 3' and 5' end of the
e
D
DNA templaate strand. [1]
(ii) L
List the corrresponding codons in tthe mRNA transcribed
t from the te mplate in Fig.
F 1.1.
.. [1]
T
The polypep ptide was hydrolysed
h tto release the
t first sev
ven amino aacids. It con
ntained fourr
d
different am
mino acids. The
T numbe r of each ty ype obtainedd is shown iin the Table
e 1.1.
Table
e 1.1
(iii) U
Using inform
mation in Ta
able 1.1, wo
ork out the order of am
mino acids inn the polype
eptide.
.. [1]
(b
b) (i) EExplain whyy a single base
b deletio
on in the DN
NA sequenc
ce is more likely to pro
oduce non--
ffunctional proteins
p than
n a single b
base substitution.
.. [3]
(ii) Describe the effect of replacing guanine (underlined in Fig.1.1) with adenine.
....
....
....
... [2]
(c) Explain how the structure of the nuclear envelope facilitates translation.
...
...
...
.. [2]
(d) A variety of related proteins can be produced from a single gene. State the process and
explain how the same gene can produce different protein products.
.......
...
...
.. [2]
[Total : 12]
Fig. 2.1 is a diagrammatic representation of chromosome 21, showing the location of two
different RFLP loci.
RFLP 53
RFLP 99
Fig. 2.1
Fig. 2.2 is a pedigree of a family and the results following restriction digestion, gel
electrophoresis and Southern blotting with specific probes of the genetic material of some
family members.
died
Individual 1 Individual 2
Individual 3 Individual 4
Allele B
Allele C RFLP 53
Allele H
Allele I
Allele J RFLP 99
Allele K
Fig. 2.2
(i) Identify which individual (3 or 4) has three copies of chromosome 21. Give a reason for
your answer.
.. [2]
(ii) Non-disjunction of chromosomes during the formation of gametes would have resulted in
gametes with two copies of chromosome 21.
In which parent (individual 1 or 2) did the non-disjunction of chromosomes occur?
.. [1]
(iii) State when the non-disjunction event occurred. Explain your answer.
.. [2]
(iv) Draw chromosome(s) 21 in the gamete that resulted in the individual having Down
syndrome. Clearly label the alleles at the RFLP loci on each homologue of chromosome
21.
gamete
[1]
(b) Fig. 2.3 shows the formation of a Philadelphia chromosome which is a chromosomal
abnormality that results from a reciprocal translocation between chromosome 9 and 22. This
chromosomal abnormality is associated with chronic myelogenous leukemia which is
considered a form of cancer.
Philadelphia
Chromosome 22 chromosome
Fused
Bcr gene
Bcr-Abl gene
translocation
Abl gene
Chromosome 9
Changed
Chromosome 9
On chromosome 9
Abl gene On Philadelphia
chromosome
On chromosome 22 translocation
Bcr gene Fused Bcr-Abl gene
Fig. 2.3
The Abl gene normally codes for a receptor involved in signal transduction that results in the
cell proliferation.
Using the information in Fig. 2.3, suggest how the fused gene product can result in cancer.
...
...
...
...
...
.. [3]
(c) Cancer cells require tetrahydrofolate to make purines and pyrimidines for cell proliferation.
Conversion of precursors to tetrahydrofolate is carried out by the enzyme dihydrofolate
reductase (DHFR). Competitive inhibition of DHFR by administering the drug Methotrexate
(MTX) is a key treatment for certain cancers such as acute lymphoblastic leukemia.
.. [1]
(ii) However, researchers have since found that one of the main causes of failure in the
treatment of acute lymphoblastic leukemia is MTX resistance due to the amplification of
the DHFR gene.
During the early stages of the research, scientists suggested a mechanism for the
amplification of the DHFR gene as shown in Fig. 2.4.
Direction of rolling
3- OH 5- P
5- P
5- P
Fig. 2.4
.. [3]
[Total : 13]
3(a) A study was conducted on the lac operon of E. coli. Fig. 3.1 below shows the activity of -
galactosidase as a function of time for a culture of E. coli. The bacterial cells were initially
grown in glycerol as the only carbon source. At time A, lactose was added to the culture. When
the lactose supply is exhausted at time B, glucose was added.
Activity of Time B
-galactosidase
(a. u.)
Time A
Time (sec)
Fig. 3.1
.. [2]
.. [4]
(iii) Draw in Fig. 3.1 what a continuation of the graph would look like from time B.
[1]
(b) Fig. 3.2 shows the arrangement of the lac operon and its regulatory gene.
Fig. 3.2
(i) The operator is deleted. Assuming lactose is present, what is the effect of this on the
transcription of lac Z, lac Y and lac A genes?
.. [2]
(ii) A point mutation was introduced into lac Z, resulting in the production of a truncated non-
functional protein. Assuming lactose is present, explain if the proteins encoded by lac Y
and lac A genes are produced?
.. [2]
(c) An E. coli strain was isolated from the intestines of a mammal. The bacterium was found
to have two different copies of the lac operon. Describe a genetic transfer process that
resulted in this observation.
.. [1]
[Total : 12]
4 An absorption spectrum
s is a graph o f the absorrption of diffferent wavvelengths off light by a
photossynthetic pig
gment.
An acttion spectrum is a graaph of the rrate of phottosynthesis at differentt wavelengtths of light.
Fig. 4..1 shows thhe absorptio
on spectra of chlorophhyll a and chlorophyll
c b as well as
s an action
spectruum.
percentage
light
absorption
Fig. 4.1
1
(a
a) With re
eference to Fig. 4.1,
(i) ccompare the
e absorptioon spectra of chloroph
hyll a and ch
hlorophyll b..
.. [2]
(ii) e
explain the shape of th
he action sp
pectrum.
.. [2]
(b) The light-dependent stage of photosynthesis takes place on the thylakoids of the chloroplast.
Fig. 4.2 represents a section through a thylakoid to show some of the components involved in
the light-dependent stage.
Fig. 4.2
R : S : [2]
(ii) Atrazine is a widely used herbicide (weed killer). It binds to a chloroplast protein involved
in electron transfer between photosystems.
Explain how atrazine works as an effective herbicide.
.. [3]
(c) In an investigation, mammalian liver cells were homogenised (broken up) and the resulting
homogenate centrifuged. Samples of the complete homogenate and samples with only
mitochondria were incubated with:
1 glucose
2 pyruvate
3 glucose and cyanide
4 pyruvate and cyanide
After incubation, the presence or absence of carbon dioxide and lactate in each sample was
determined. The results are summarised in Table 4.1.
Sample of homogenate
X = absent = present
Table 4.1
(i) Explain why carbon dioxide is produced when mitochondria are incubated with pyruvate
but not when they are incubated with glucose.
.. [2]
(ii) With reference to Table 4.1, explain the difference in the results when the complete cell
homogenate is incubated with 2 and 4.
.. [2]
[Total : 13]]
Banded
d snail Unb
banded snail
ban
nded pink sh
hell 121
unb
banded pinkk shell 14
ban
nded yellow
w shell 11
unb
banded yello
ow shell 104
4
(a
a) State tthe expecte
ed offspring phenotypicc ratio of the
e test cross..
.. [1]
(b
b) (i) S our working clearly, calcculate the 2 value in the space beelow.
Showing yo
[2]
(ii) Using the table, explain the conclusion drawn from the calculated value in b(i).
2 2
.. [2]
(c) With the use of a genetic diagram, explain the observed results of the test cross.
[5]
(d
d) State tthe observe
ed phenotyp
pic ratio of th
he offspring
g from this test cross.
.. [1]
[Total : 11]]
Fig. 6.1
1
(a
a) Use evvidence from
m Fig. 6.1 to explain th
he change in plasma glucose conccentration.
...
..
..
..
..
..
...
.. [4]
Adrenaline is a signal molecule that stimulates similar cellular responses from liver cells and
adipose cells in a way similar to that of glucagon.
Step 1
Step 2
Fig. 6.2
(b) With reference to Fig. 6.2,
(i) describe the events occurring in step 1 after the binding of adrenaline molecule to the
adrenergic receptor.
.. [2]
(ii) explain the significance of step 2 that results in effective signal transduction.
.. [2]
(iii) describe the series of events that occur after the activation of protein kinase A that
results in a cellular response.
.. [2]
[Total : 10]
7 For a long time, the prevailing idea among evolutionary biologists is that geographical barriers
are a prerequisite for speciation. However, recently, more and more examples of an alternative
speciation process which does not require a geographical barrier were discovered but this
remains the exception rather than a norm.
.. [1]
One case study involved studying the palm genus Howea from Lord Howe Island, a tiny
volcanic island in the Tasman Sea. The two related palm species found on the island have a
different soil preference. The different types of soil are interspersed throughout the island and
pollen from the palms is wind-dispersed.
Fig. 7.1
(ii) Explain how speciation could have taken place to give rise to the two sister species from
a common ancestor.
.. [5]
(iii) Give an evidence why scientists can rule out geographical isolation mechanisms?
.. [1]
(b) Howea belmoreana goes by the names, curly palm, kentia palm and Belmore sentry palm
while Howea forsteriana goes by the names thatch palm and kentia palm.
Explain why the scientific name is better than the common names.
...
...
...
.. [2]
[Total: 9]
Section B
Answer EITHER 8 OR 9.
8 (a) Explain how meiosis can contribute to genetic variation in offspring. [6]
(b) Discuss how bacteria evolve through natural selection and the implication in [8]
antibiotic resistance.
(c) Describe the link between the frequency of sickle cell anaemia allele and the [6]
number of cases of malaria.
[Total: 20]
9 (a) Explain how gene expression can be controlled at the translational level and [8]
describe the mechanisms present in prokaryotes and eukaryotes.
(b) Explain how the structure of specific transcription factors is linked to their roles [7]
in control of eukaryotic gene expression.
(c) With reference to changes in protein structure, explain how the level of protein [5]
activity can be regulated post-translationally.
[Total: 20]
S
Section A
Answ
wer all the q n this sectio
questions in on.
5 A A A C T G T T T C T G C T G G AA C A T 3
Fig. 1.1
a)
(a (i) M
Methionine is coded by
b the initiattion codon. On Fig. 1.1, label thee 3' and 5' end of the
e
D
DNA templaate strand. [1]
(ii) L
List the corrresponding codons in tthe mRNA transcribed
t from the te mplate in Fig.
F 1.1.
AUG
A UUC C
CAG CAG AAA
A CAG UUU
U
A: 3 UUU GAC
C AAA GAC
C GAC CUU
U GUA 5
[
[1]
T
The polypep ptide was hydrolysed
h tto release the
t first sev
ven amino aacids. It con
ntained fourr
d
different am
mino acids. The
T numbe r of each ty ype obtainedd is shown iin the Table
e 1.1.
Table
e 1.1
(iii) U
Using inform
mation in Ta
able 1.1, wo
ork out the order of am
mino acids inn the polype
eptide.
mett phe
e gln
n glln ly
ys g
gln phe
p
R
R: reverse sequence [1]
(b
b) (i) EExplain whyy a single base
b deletio
on in the DN
NA sequenc
ce is more likely to pro
oduce non--
ffunctional proteins
p than
n a single b
base substitution.
1
1. deletionn results in
n frameshiift
2
2. Change e in sequen nce of codo
ons thus /ccausing all amino acidids downsttream of
mutatioon to chang ge
3
3. substituution usually cause cchange in 1 aa/1 codo on;
4. or may result in silent mutattion that re
4 esults in no
o change inn aa (if it oc
ccurs at
3rd base
e as a resuult of degen
neracy of genetic
g codde) Or aa haas similar property
p
5
5. Substittution may not lead too conforma ational change of pro tein but de eletion
mutatioon will. WTTE
[Turn
n over
1311
2 For
Examiners
Use
[3]
(ii) Describe the effect of replacing guanine (underlined in Fig.1.1) with adenine.
(c) Explain how the structure of the nuclear envelope facilitates translation.
Pt 1 must be in
Mark for 2 to 4 is awarded for direction of movement and molecule [2]
(d) A variety of related proteins can be produced from a single gene. State the process and
explain how the same gene can produce different protein products.
1. Alternative splicing*;
(Spliceosome binds to intron-exon boundaries in the pre-mRNA)
2. Resulting in different exons being spliced together in different ways leading to
formation of many different mature mRNA resulting in different proteins translated
[2]
[Total : 12]
2 Chrom
mosome abe
errations can have devvastating efffects on hum
man health..
(a
a) Down syndrome is a disorder caused by an aberrration in chromosomaal number. Individualss
with D
Down syndro ome have three copie es of chrom
mosome 21, which typpically resullts in some e
delay iin cognitive ability and physical grrowth, as we
ell as a characteristic sset of facial features.
RFLP 53
3
RFLP 99
9
Fig. 2.1
died
Individu
ual 1 Ind
dividual 2
Individual 3 Individu
ual 4
Allele B
Allele C RFLP 53
Allele H
Allele I
Allele J RFLP 99
Allele K
Fig. 2.2
(i) Identify which individual (3 or 4) has three copies of chromosome 21. Give a reason for
your answer.
1. Individual 3
Reasons (any one):
2. 3 bands/alleles of RFLP 99
Or
3. Has 1 copy of allele H, 1 copy of allele I and 1 copy of allele J of RFLP 99
[2]
(ii) Non-disjunction of chromosomes during the formation of gametes would have resulted in
gametes with two copies of chromosome 21.
In which parent (individual 1 or 2) did the non-disjunction of chromosomes occur?
1. Individual 1 [1]
(iii) State when the non-disjunction event occurred. Explain your answer.
1. Anaphase I or Meiosis I
2. Homologous chromosomes with different combinations of RFLP alleles (BH on one
and BJ on another) move to the same daughter cell [2]
(However if crossing over occurred in Prophase I between RFLP 53 and RFLP 99.)
3. Anaphase II or Meiosis II
4. Crossing over occurred between RFLP 53 and RFLP 99 (in prophase I) and the non-
identical sister chromatids moved to the same daughter cell in Meiosis II
(iv) Draw chromosome(s) 21 in the gamete that resulted in the individual having Down
syndrome. Clearly label the alleles at the RFLP loci on each homologue of chromosome
21.
B B
J H
gamete
[1]
(b) Fig. 2.3 shows the formation of a Philadelphia chromosome which is a chromosomal
abnormality that results from a reciprocal translocation between chromosome 9 and 22. This
chromosomal abnormality is associated with chronic myelogenous leukemia which is
considered a form of cancer.
Philadelphia
Chromosome 22 chromosome
Fused
Bcr gene
Bcr-Abl gene
translocation
Abl gene
Chromosome 9
Changed
Chromosome 9
On chromosome 9
Abl gene On Philadelphia
chromosome
On chromosome 22 translocation
Bcr gene Fused Bcr-Abl gene
Fig. 2.3
The Abl gene normally codes for a receptor involved in signal transduction that results
in the cell proliferation.
Using the information in Fig. 2.3, suggest how the fused gene product can result in cancer.
(c) Cancer cells require tetrahydrofolate to make purines and pyrimidines for cell proliferation.
Conversion of precursors to tetrahydrofolate is carried out by the enzyme dihydrofolate
reductase (DHFR). Competitive inhibition of DHFR by administering the drug Methotrexate
(MTX) is a key treatment for certain cancers such as acute lymphoblastic leukemia.
(ii) However, researchers have since found that one of the main causes of failure in the
treatment of acute lymphoblastic leukemia is MTX resistance due to the amplification of
the DHFR gene.
During the early stages of the research, scientists suggested a mechanism for the
amplification of the DHFR gene as shown in Fig. 2.4.
Direction of rolling
3- OH 5- P
5- P
5- P
Fig. 2.4
[Total : 13]
3(a) A study was conducted on the lac operon of E. coli. Fig. 3.1 below shows the activity of -
galactosidase as a function of time for a culture of E. coli. The bacterial cells were initially
grown in glycerol as the only carbon source. At time A, lactose was added to the culture. When
the lactose supply is exhausted at time B, glucose was added.
Activity of Time B
-galactosidase
(a. u.)
Time A
Time (sec)
Fig. 3.1
(i) Why is the lac operon considered inducible?
1. Expression of the 3 genes (lac Z, lac Y and lac A*) is usually off/not transcribe ;
2. but can be turned on/trascribed in the presence of inducer allolactose/lactose ;
[2]
High lactose,
1. Time is needed for the expression /activation of lac operon to produce enzyme before
lactose can be metabolised
2. Lactose converted to allolactose
3. Lactose/ allolactose binds to and inactivates/alters tertiary structure of repressor such
that it fails to bind to operator
4. RNA polymerase is free to bind to promoter and actively transcribe structural genes of
the operon.
Low glucose
5. High cAMP* will result in active catabolite activator protein (CAP) that strengthen
affinity of promoter for RNA polymerase. Thus, rate of transcription increases [4]
(iii) Draw in Fig. 3.1 what a continuation of the graph would look like from time B. [1]
Time B
Activity of
-galactosidase
(a. u.)
Time A
Time (sec)
Figure 2.1
(b) Fig. 3.2 shows the arrangement of the lac operon and its regulatory gene.
Fig. 3.2
(i) The operator is deleted. Assuming lactose is present, what is the effect of this on the
transcription of lac Z, lac Y and lac A genes?
(ii) A point mutation was introduced into lac Z, resulting in the production of a truncated non-
functional protein. Assuming lactose is present, explain if the proteins encoded by lac Y
and lac A genes are produced?
(c) An E. coli strain was isolated from the intestines of a mammal. The bacterium was found
to have two different copies of the lac operon. Describe a genetic transfer process that
resulted in this observation.
[Total : 12]]
4 An absorption spectrum
s is a graph o f the absorrption of diffferent wavvelengths off light by a
photossynthetic pig
gment.
An acttion spectrum is a graaph of the rrate of phottosynthesis at differentt wavelengtths of light.
Fig. 4..1 shows thhe absorptio
on spectra of chlorophhyll a and chlorophyll
c b as well as
s an action
spectruum.
percentage
light
absorption
Fig. 4.1
1
(a
a) With re
eference to Fig. 4.1,
(i) ccompare the
e absorptioon spectra of chloroph
hyll a and ch
hlorophyll b..
D
Differences
s
1. For percentage of light a yll a peaks at 430nm with
absorption,, chlorophy w 80%
of light absorp
ption while chlorophy
yll b peaks at 450nm wwith a high
her 90%
light absorptio
on;
2. Chloorophyll a peaks at 6660nm with much high her light ab
bsorption of
o 70%
whille chloroph
hyll b peak
ks at 63564 40nm with 45% light absorptionn/ peak of
light absorptio
on for chlorrophyll a at
a 660nm.
S
Similarities
s
3. Botth shows higher light absorption
n of blue light (4005500nm) and
d red light
(600
0700nm) than
t other wavelengtths;
4. Botth peaks in blue light are higherr than red light;
5. Botth have littlle/least abs
sorption, between
b 500
0600nm / in green light;
Or
Little light absorption for chlorophyll a between 450600nm and for
chlorophyll b between 500600nm ;
(b) The light-dependent stage of photosynthesis takes place on the thylakoids of the chloroplast.
Fig. 4.2 represents a section through a thylakoid to show some of the components involved in
the light-dependent stage.
Fig. 4.2
(ii) Atrazine is a widely used herbicide (weed killer). It binds to a chloroplast protein involved
in electron transfer between photosystems.
Explain how atrazine works as an effective herbicide.
(c) In an investigation, mammalian liver cells were homogenised (broken up) and the resulting
homogenate centrifuged. Samples of the complete homogenate and samples with only
mitochondria were incubated with:
1 glucose
2 pyruvate
3 glucose and cyanide
4 pyruvate and cyanide
After incubation, the presence or absence of carbon dioxide and lactate in each sample was
determined. The results are summarised in Table 4.1.
Sample of homogenate
X = absent = present
Table 4.1
(i) Explain why carbon dioxide is produced when mitochondria are incubated with pyruvate
but not when they are incubated with glucose.
(ii) With reference to Table 4.1, explain the difference in the results when the complete cell
homogenate is incubated with 2 and 4.
[Total : 13]
5 Grove snails are known to have brightly coloured shells, with the alleles CP and CY coding for
pink and yellow coloured shells respectively. Shells of the grove snails have different banding
patterns as well, with allele BB conferring a shell with bands and allele BO conferring an
unbanded shell.
A grove snail with a banded pink shell is crossed with another grove snail with an unbanded
yellow shell, and the resultant F1 generation all had unbanded pink shells. The F1 were test-
crossed and gave rise to 250 offspring with the following phenotypes:
(a) State the expected offspring phenotypic ratio of the test cross.
1 banded pink shell : 1 unbanded pink shell : 1 banded yellow shell : 1 unbanded yellow shell
.. [1]
(b
b) (i) S our working clearly, calcculate the 2 value in the space beelow.
Showing yo
6 + 27.556 + 37.636 + 4
= 54.756 42.436
= 162.38
84
[2]
(ii) Using the 2 table, explain the con
U nclusion dra e calculatedd 2 value in
awn from the n b(i).
1
1. df = 3 an
nd p < 0.001
2
2. At 5% significant
s level (if p< 0.001 men ntioned)/Since p < 0.055, differenc
ce between n
expecteed and obseerved resultts is signific
cant and is due to som
me other fac ctor and nott
by chance alone.
3
3. May be due to autoosomal linkaage [2]
c)
(c With th
he use of a genetic diagram, expla
ain the obse
erved resultts of the tesst cross.
P Y Y Y
C C C C [1]
Parental X
genotype
B O
B B B
B
B
B
P Y P Y Y
C C C C C
gametes [1]
B O O B B
B B B B B
Y Y P Y Y
Offspring C
P Y C C C C C
Y
C
C
genotype
[1]
O B O B B
B
B B
B B B B B B
B B
[1]
parental recombinant
[5]
The same test cross was carried out another time and the resulting number of banded pink
snails and unbanded yellow snails were equal. The resulting number of unbanded pink snails
was also equal to that of the banded yellow snails. Through this test cross, the 2 gene loci are
determined to be 28 map units apart.
(d) State the observed phenotypic ratio of the offspring from this test cross.
18 banded pink shell : 18 unbanded yellow shell : 7 unbanded pink shell : 7 banded yellow
shell [1]
[Total : 11]
Fig. 6.1
1
(a
a) Use evvidence from he change in plasma glucose conccentration.
m Fig. 6.1 to explain th
Adrenaline is a signal molecule that stimulates similar cellular responses from liver cells and
adipose cells in a way similar to that of glucagon.
Step 1
Step 2
Fig. 6.2
(b) With reference to Fig. 6.2,
(i) describe the events occurring in step 1 after the binding of adrenaline molecule to the
adrenergic receptor.
(ii) explain the significance of step 2 that results in effective signal transduction.
1. An activated adenylyl cyclase catalyses the formation of many cAMP from many
ATP
2. Thus amplifying the signal as
3. Idea of a single ligand/ligand can produce a large cellular response (Any 2 of 1-3)
Or
4. cAMP is a second messenger* that is small and diffusible and
5. can diffuse easily in the cell to activate the next relay protein (2M for 4&5)
[2]
(iii) describe the series of events that occur after the activation of protein kinase A that
results in a cellular response.
1. Activated protein kinase A passes through the nuclear pore into the nucleus ;
2. Phosphorylate transcription factor resulting in a conformation change/activation thus
allowing it to
3. bind to a specific regulatory DNA sequence e.g. enhancer
4. recruiting RNA polymerase or promote assembly of transcription initiation complex/
result in the transcription of the target gene ;
[2]
[Total : 10]
7 For a long time, the prevailing idea among evolutionary biologists is that geographical barriers
are a prerequisite for speciation. However, recently, more and more examples of an alternative
speciation process which does not require a geographical barrier were discovered but this
remains the exception rather than a norm.
One case study involved studying the palm genus Howea from Lord Howe Island, a tiny
volcanic island in the Tasman Sea. The two related palm species found on the island have a
different soil preference. The different types of soil are interspersed throughout the island and
pollen from the palms is wind-dispersed.
Fig. 7.1
(ii) Explain how speciation could have taken place to give rise to the two sister species from
a common ancestor.
(iii) Give an evidence why scientists can rule out geographical isolation mechanisms?
It is a tiny island;
R: no major barrier only
Pollen grains can be easily dispersed by wind;
Different soil where the 2 species grow on are interspersed throughout the island;
[1]
(b) Howea belmoreana goes by the names, curly palm, kentia palm and Belmore sentry palm
while Howea forsteriana goes by the names thatch palm and kentia palm.
Explain why the scientific name is better than the common names.
1. It is unambiguous and precise with one unique name for one species;
2. unlike the common name Kentia palm which is used to refer to both species or
multiple names referring to one species (evidence);
Or
3. The binomial nomenclature is a systematic naming system that allows one to
categorise/group similar organisms together involving both the species name and
genus name (evidence);
4. while the common names do not reveal their position in the plant kingdom nor attempts
to categorise them; ORA
1 and 2 (link) or 3 and 4 (link). If 1 and 3 or 4 allow only 1 mark (unlink) [2]
[Total: 9]
Section B
Answer EITHER 8 OR 9.
8 (a) Explain how meiosis can contribute to genetic variation in offspring. [6]
(b) Discuss how bacteria evolve through natural selection and the implication in [8]
antibiotic resistance.
(c) Describe the link between the frequency of sickle cell anaemia allele and the [6]
number of cases of malaria.
[Total: 20]
9 (a) Explain how gene expression can be controlled at the translational level and [8]
describe the mechanisms present in prokaryotes and eukaryotes.
Prokaryotes Eukaryotes
mRNA half-life 1. Both involve regulation of mRNA half-life longer half-life
allows for translation of more proteins from mRNA;
2. mRNA rapidly degraded / 4. Half-life of mRNA
has short half life to allow for influenced by length of 3 poly-
fast changes in gene A tail;
expression; Or
3. Binding of anti-sense when the polyA tail shorten to
mRNA can target mRNA for a critical length, 5 cap is
degradation, further removed and mRNA is
decreasing its half-life; degraded
5. longer 3 poly-A tail = more
stable / longer half life;
6. siRNA bind to target mRNA
for degradation
Binding to small ribosomal 7. Translation can be blocked by preventing the binding of the
subunit small ribosomal subunit to the mRNA for assembly of the
translation initiation complex;
(b) Explain how the structure of specific transcription factors is linked to their roles [7]
in control of eukaryotic gene expression.
(c) With reference to changes in protein structure, explain how the level of protein [5]
activity can be regulated post-translationally.
[Total: 20]
RAFFLES INSTITUTION
2013 Year 6 Preliminary Examination
Higher 2
CANDIDATE
NAME
CIVICS INDEX
GROUP 1 3 S0 3 NUMBER 1 3
BIOLOGY 9648/03
Paper 3 23 September 2013
2 hours
Additional materials: Answer Booklet/Paper
2 /12
3 /15
4 /12
5 /20
Total /72
This document consists of 16 printed pages.
Raffles Institution
Internal Examination
1333
For
2 Examiners
Use
1 (a) Restriction mapping is a technique used to identify restriction enzyme cleavage sites. In an
experiment, restriction mapping was used to investigate an unknown piece of DNA. This
piece of DNA was 3 000 base pairs (bp) long.
The scientists first took plasmids that had one restriction site for the enzyme KpnI and one
restriction site for the enzyme BamHI. The unknown piece of DNA was ligated into the
multiple cloning site of the plasmid.
Fig. 1.1
When the scientists digested one of the recombinant plasmids with KpnI, they obtained two
fragments. One fragment was measured as 1000 bp. The other fragment was described as
"very large".
... [2]
ii. One of the fragments that the scientists obtained was described as "very large". What is
represented by this very large fragment?
... [1]
For
3 Examiners
Use
iii. When the scientists digested another of the recombinant plasmids with BamHI, they
obtained three fragments. How many BamHI restriction sites are there in the unknown
piece of DNA?
... [1]
iv. When carrying out restriction mapping of the unknown DNA, scientists need to make sure
that the restriction enzyme they have used has completely digested the DNA.
Suggest how they could use results from agarose gel electrophoresis to show that this
DNA has not been completely digested.
... [1]
RI 2013 Preliminary Examination 9648/03 [Turn over
1335
For
4 Examiners
Use
(b) The urate transporter is a crucial protein found primarily in the kidney. Fig. 1.2 below
shows how genetic engineering can be used to clone the human urate transporter gene in
bacteria.
Fig. 1.2
i. The human genomic DNA sample was digested with restriction enzyme. What is an
important assumption made in this procedure to clone the urate transporter gene?
... [1]
RI 2013 Preliminary Examination 9648/03 [Turn over
1336
For
5 Examiners
Use
ii. Comment on the choice of using the kidney for the extraction of the urate transporter gene
in the procedure shown in Fig. 1.2.
... [2]
iii. The human DNA fragments are inserted into the gene coding for resistance to tetracycline.
What effect will this have?
... [2]
... [1]
v. Use an arrow () to point to the bacterial colony containing the human DNA fragment. [1]
vi. State one disadvantage of using the bacterium as a host cell for expressing the urate
transporter gene.
... [1]
[Total: 13]
For
6 Examiners
Use
2 Primordial dwarfism (PD) is a rare autosomal recessive disorder in which the lack of normal
growth is not due to a deficiency of growth hormone. In linkage analysis using RFLPs, scientists
can examine segments of DNA for a haplotype that is associated with PD. A haplotype refers to
a group of gene loci or genetic markers that is inherited together on one chromosome. An
individual inherits one haplotype from each parent.
Fig. 2.1 shows a pedigree of a family affected by PD followed by haplotype analysis with
polymorphic microsatellite markers on a segment of chromosome 3. Each microsatellite marker
has 7 different known alleles.
Fig. 2.1
i. identify all the microsatellite marker alleles that are associated with primordial dwarfism.
... [2]
... [1]
For
7 Examiners
Use
(b)i. One of the conditions for a microsatellite marker to be useful for disease detection is that it
must be polymorphic.
Condition 1: locus of the microsatellite marker allele must be tightly linked to the gene
locus of the disease allele;
...
..... [1]
...
..... [1]
ii. Suggest why the disease allele causing PD can only be mapped using linkage analysis.
...
..... [1]
RI 2013 Preliminary Examination 9648/03 [Turn over
1339
For
8 Examiners
Use
After more research, scientists discovered another RFLP marker that is also linked to PD.
Fig. 2.2 shows the two alleles of the RFLP marker with their restriction sites.
They carried out PCR to amplify the target DNA segment containing the RFLP allele. The
amplified DNA can then be subjected to PCR-RFLP analysis where restriction digestion
using BtgI is done, followed by gel electrophoresis. The products of restriction digestion
using BtgI can also be subjected to Southern blot analysis.
Fig. 2.3 shows the results of the PCR-RFLP analysis and the Southern blot analysis.
I I I I I
Fig. 2.2
Fig. 2.3
... [3]
i. indicate on the RFLP allele 1 in Fig. 2.2 the position where the probe should hybridise; [1]
ii. explain the banding pattern of individual II4 as seen in the PCR-RFLP analysis in Fig. 2.3.
... [2]
[Total: 12]
RI 2013 Preliminary Examination 9648/03 [Turn over
1340
For
9 Examiners
Use
3 The Syngonanthus mucugensis species has significant economic value for the Brazilian
ornamental dry flower business. However, extreme exploitation has rendered this species
endangered.
Attempts at conventional propagation of this species by seeding have generated little success
and studies are ongoing to develop alternative techniques that can assure propagation on a
commercial scale. In a particular experiment, the potential of three different explants (stem, leaf
and root) to form callus was studied using two plant growth regulators (BAP and NAA). The data
from the experiment is shown in Table 3.1.
Table 3.1
...... [1]
...
...
... [4]
For
10 Examiners
Use
(b) In a separate experiment, the ability of the explant to undergo organogenesis was studied
using the same plant growth regulators. Data obtained is shown in Table 3.2.
Table 3.2
With reference to Table 3.2, explain which plant growth regulator has an inhibitory effect
on shoot regeneration.
... [3]
To create transgenic maize which can produce the Bacillus thuringiensis toxin, the recombinant
plasmid shown in Fig. 3.1 was constructed. The recombinant plasmid also contains the gene for
phosphomannose isomerase (PMI), an enzyme which allows plants cells to utilise mannose as a
carbon source.
Fig. 3.1
RI 2013 Preliminary Examination 9648/03 [Turn over
1342
For
11 Examiners
Use
To produce transgenic maize using the plasmid shown in Fig. 3.1, the procedure shown in
Fig. 3.2 was carried out.
Fig. 3.2
i. explain why the sterilised explant was treated with cellulase and pectinase before
electroporation.
... [2]
For
12 Examiners
Use
ii. In the preparation of protoplasts, mannitol must be present. In the absence of mannitol,
no protoplast is formed even if the sterilised explant was treated with cellulase and
pectinase.
..... [1]
(d) Antibiotic or herbicide resistance genes are commonly included in the plasmid used for
creating transgenic plants.
..
..
..
.[2]
..
..
..
.[2]
[Total: 15]
For
13 Examiners
Use
Planning question
4 The purple colour of beet root (Beta vulgaris) is due to the water soluble betacyanin pigment
molecules that are found in the vacuole of intact cells. Beet root pigment is used
commercially as a food dye and heat is typically used as a method to extract the pigment
from intact beet root cells.
Cuvette holding
betacyanin solution
Cover
Filter that allows light of
Light sensor 550nm to pass through
Bulb
Colorimeter
% absorbance
shown by meter
Fig. 4.1
Using the information and your own knowledge, design an experiment to investigate the
effect of temperature on membrane permeability in beetroot.
Your plan must be based on the assumption that you have been provided with the following
which you must use.
Beet root
Cork borer
Scalpel
Thermometer
Source of boiling water and tap water
Distilled water
Large 500 cm3 beaker
Colorimeter
2cm3 cuvettes
For
14 Examiners
Use
[Total: 12]
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
For
15 Examiners
Use
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
....
For
16 Examiners
Use
Free-response question
Write your answer to this question on the separate answer paper provided.
Your answer:
should be illustrated by large, clearly labeled diagrams, where appropriate;
must be in continuous prose, where appropriate;
must be set out in sections (a), (b) etc, as indicated in the question.
5 (a) Explain the normal functions of stem cells in a living organism. [6]
(b) Discuss the social and ethical concerns for the use of gene therapy. [6]
(c) Describe cystic fibrosis and how it can be treated using a non-viral gene delivery system. [8]
[Total: 20]
Answe
er all questiions.
Fig. 1.1
i. Wha
at does this show abou
ut the unkno
own piece off DNA? [2]
1. H
Has KpnI resstriction site;
2. K nique/ cuts unknown piece only on
KpnI restriction site is un nce;
3. 1000 bp fromm KpnI site ofo plasmid; (A: restrictio
on site is fo
ound at the 1/3 position
n along the
le
ength of unkknown DNA)
1349
For
2 Examiners
Use
iv. Wheen carrying out restriction mappingg of the unkknown DNA A, scientistss need to m
make sure th
hat
the restriction
r e
enzyme theyy have used
d has complletely digestted the DNA A.
Suggest how thhey could usse results frrom agarosee gel electro o show that this DNA has
ophoresis to
not been comp pletely digessted? [1]
1. R
Restriction ffragments a
add up to mo ore than tota
al length of original DN
NA;
2. P
Presence off undigested d 3000bp fraagment (+ some
s other smaller frag
gments)
(b) The urate transsporter is a crucial pro n the kidneyy. Fig. 1.2 below show
otein found primarily in ws
how
w genetic engineering ca an be used to clone the
e human ura ate transporter gene inn bacteria.
Human geno
omic DNA
Fig. 1.2
For
3 Examiners
Use
i. The human genomic DNA sample was digested with restriction enzyme. What is an important
assumption made in this procedure to clone the urate transporter gene? [1]
assumes restriction enzyme doesnt cut within the urate transporter gene rendering it inactive;
ii. Comment on making kidney the choice organ to extract the urate transporter gene in the
procedure above. [2]
2. urate transporter gene is present in all cells so can use any human tissue as starting material;
Or
3. procedure involves creating a genomic library so do not need to use a tissue with high levels
of urate transporter mRNA;
iii. The human DNA fragments are inserted into the gene coding for resistance to tetracycline.
What effect will this have? [2]
1. gene coding for resistance to tetracycline no longer functional / bacteria not resistant to
tetracycline/wtte;
iv. During replica plating, why is the velvet surface used? [1]
v. Use an arrow () to point to the bacterial colony containing the human DNA fragment. [1]
vi. State one disadvantage in using the bacterium as a host cell for expressing the urate
transporter gene. [1]
1. lack post-transcriptional modifications (source DNA / Gene of interest used cannot contain
introns)
[Total: 13]
For
4 Examiners
Use
2 Primordiaal dwarfism
m (PD) is a rrare autosommal recessivve disorder in which the lack of no
ormal growth is
not due to a deficiency of grow wth hormone e. In linkage
e analysis u
using RFLPPs, scientistss can exam
mine
segmentts of DNA fo or a haplotyype that is aassociated with PD. A haplotype refers to a group of ge ene
loci or ge
enetic marke
ers that is in gether from one parent on one chro
nherited tog omosome.
Fig. 2.1 shows a pe edigree of a family affeccted by PD followed byy haplotype analysis with polymorp
phic
microsattellite marke
ers on a se egment of chromosom me 3 for individuals III1 to II5 aand III1. Ea
ach
microsattellite marke
er has 7 diffe
erent knownn alleles.
Fig. 2.1
i. ide
entify all the microsatellite marker alleles
a that a
are associatted with prim
mordial dwa
arfism. [2]
1. e 2, 3D6 alle
3D5 allele ele 4, 3D7 allele 2, 3D8
8 allele 2;
(1 mark
m for 2 correctly
c ide
entified allele
es)
ii. ide
entify which descendantt is a recom
mbinant. [1]
II3
For
5 Examiners
Use
Exp
plain why th
he following 2 condition
ns are also n
necessary:
Condition 1: lo
oci of the miicrosatellite marker alle ed to the gene locus of the
ele must be tightly linke
disease allele;; [1]
1. So that the
e microsateellite markerr allele and tthe disease allele always(higher ch
hance) of co
o-
ng/(being inherited toge
segregatin ether);
ORR
2. To minimise the chance of cros ssing overr* at the reg gion betwee en the dise
ease allele and
a
marker allele so thaat the linkag ge of micro osatellite marker allele
e to disease allele is not
disrupted;
Condition 2: re
estriction sittes must flan
nk the micro
osatellite ma
arker allele.. [1]
ORR
2. Ensures th hat excised RFLP fragm ments will re ariable lengtths of each different allele
eflect the va
(due to the
eir difference
e in numberr of tandem repeats);
ii. Sug
ggest why tthe disease allele causing PD can only be ma
apped using linkage ana
alysis. [1]
Fig. 2.2
Fig. 2.3
For
6 Examiners
Use
1. Negatively-charged DNA migrate out of well towards the positive electrode/anode when
subjected to an electric field / current;
2. Meshwork of polymer fibers that makes up agarose gel impedes movement of DNA
fragments;
3. thus longer DNA fragments migrate slower towards the positive electrode than shorter DNA
fragments (or vice versa)
i. indicate on the RFLP allele 1 in Fig. 2.2 the position where the probe should hybridised to; [1]
ii. explain the banding pattern of individual II4 as seen in the PCR-RFLP analysis in Fig. 2.3. [2]
1. Using restriction enzyme BtgI for restriction digestion, RFLP allele 1 will be cut into two
fragments of sizes 200bp and 175bp;
2. No restriction digestion within RFLP allele 2 thus resulting in (one fragment) 375bp band;
3. 3 bands shown for Individual II4 as he is heterozygous;
[Total: 12]
For
7 Examiners
Use
3 The Syngonanthus mucugensis species has significant economic value for the Brazilian
ornamental dry flower business. However, extreme exploitation has rendered this species
endangered.
Attempts at conventional propagation of this species by seeding have generated little success
and studies are ongoing to develop alternative techniques that can assure propagation on a
commercial scale. In a particular experiment, the potential of three different explants (stem, leaf
and root) to form callus was studied using two plant growth regulators (BAP and NAA). The
data from the experiment are shown in Table 3.1 below.
Table 3.1
(a) i. identify which explant seemed most suitable for use in micropropagation. [1]
leaf
iii. In a separate experiment, the ability of the explant to undergo organogenesis was studied
using the same plant growth regulators. Data obtained is shown in Table 3.2.
For
8 Examiners
Use
Table 3.2
With reference to Table 3.2, explain which plant growth regulator has an inhibitory effect
on shoot regeneration. [3]
To create transgenic maize which can produce the Bacillus thuringiensis toxin, the recombinant
plasmid shown in Fig. 3.1 was constructed. The recombinant plasmid also contains the gene
for phosphomannose isomerase (PMI), an enzyme which allows plants cells to utilize mannose
as a carbon source.
Fig. 3.1
To produce transgenic maize using the plasmid shown in Fig. 3.1, the procedure shown in Fig.
3.2 was carried out.
For
9 Examiners
Use
Fig. 3.2
(b)i. explain why the sterilized explant was treated with cellulase and pectinase before
electroporation. [2]
ii. In the preparation of protoplasts, mannitol must be present. In the absence of mannitol,
no protoplasts are formed even if the sterilised explant was treated with cellulase and
pectinase.
State what happens to the protoplasts if mannitol was not used. [1]
For
10 Examiners
Use
a. The PM
MI gene serrves as the selectable marker* instead;
b. In med
dium with only manno ose as sole
e carbon ssource, tran
nsformed pllant cells
would have the PMI gene and survive O OR non-transformed plaant cells do not have
the PM
MI gene and
d will not surrvive;
[T
Total: 15]
Pllanning question
4 Thhe purple ccolour of b Beta vulgarris) is due to the watter soluble betacyanin
beet root (B n
pigment mole ecules that are found in
i the vacuo ole of intacct cells. Bee
et root pigm
ment is used
d
coommerciallyy as a food dye and heeat is typica
ally used ass a method to extract tthe pigmentt
fro
om intact be
eet root cells.
A colorimeter can be ussed to mea asure the absorbance of light of 550 5 nm by betacyanin n
soolution. The
e concentrattion of betaccyanin is prroportional tto its absorb
bance. The colorimeterr
is shown in Fig.
F 4.1 belo ow.
Cuveette holding
betacyan
nin solution
Cover
Filter that allows light of 550nm
m
L
Light sensorr to passs through thhrough
Bulb
Note:
Collorimeter 550nm is the
t waveleng gth of light
that the be
etacyanin abssorbs the
most. The 550nm light will pass
the betacyyanin solution
n in the
% abso
orbance cuvette annd then deteccted by a
shown by meter sensor. Thhe reading fro
om the
Fig
g. 4.1 meter is % absorbance e.
For
11 Examiners
Use
Using the information and your own knowledge, design an experiment to investigate the
effect of tempera sampleture on membrane permeability in beetroot.
Your plan must be based on the assumption that you have been provided with the following
which you must use.
Beet root
Cork borer gives a cylinder (e.g 1 cm diameter) of beet root tissue
Scalpel for cutting.
Thermometer for checking the temperature of water bath
Source of boiling water and tap water to create water bath of a certain temperature and
to add more for maintenance of temperature.
Distilled water for rinsing and immersing the beet root
Large 500 cm3 beaker used as a water bath
Colorimeter measures 550nm light absorbed by betacyanin pigment (absorbance) which
is a reflection of the concentration of betacyanin that has leaked out of beet root
2 cm3 cuvettes a small tube that holds solution whose absorbance is to be measured.
Cuvette will be placed into colorimeter. 2cm3 is the maximum volume the cuvette can hold.
[Total: 12]
1. Aim : To investigate the effect of temperature on membrane permeability in beetroot
(Main theory)
[T1] Betacyanin is found in beetroot cells is prevented from leaking out of cells by
membranes (vacuole & plasma membrane) which are made up of phospholipid
bilayer embedded with proteins
[T2] increasing temperature increases kinetic energy of phospholipids and membrane
becomes more fluid or
increasing temperature increases more intramolecular vibrations and membrane
proteins are denatured
(Measurable quantity)
[T3, T4 and T5 - max 2]
[T3] the degree of permeability of the membrane will be reflected by the amount of
betacyanin pigment leaking out of cells
RI 2013 Preliminary Examination 9648/03 [Turn over
1359
For
12 Examiners
Use
(Predicted trend)
[T5] Increasing temperature increases the absorbance, which means permeability of
the membrane is increased.
b) Annotated diagram
a. (what) Surface area of beetroot (how) Use similar sized beetroot sizes using
cork borer and scalpel (2mm height, 1cm diameter discs) as (why) increasing
surface area increases surface for pigment to leak out, thus affecting rate of
diffusion of pigment.
b. (what) Volume of distilled water in test tube (how) Use 10 cm3 of distilled water
as (why) different volume of water will affect the concentration of leaked
pigment.
c. (what) Duration of experiment (how) 20 min as (why) the greater the duration,
the longer the time where pigment may leak out.
d. (what) Wavelengths of light used in the colorimeter when measuring absorbance
(how) Use 550 nm as (why) different wavelengths may be absorbed differently
by the pigment, affecting accuracy of results.
[CV1] what and how variable 1;
[CV2] what and how variable 2;
[CVW] why for variables 1 and 2
For
13 Examiners
Use
1. Using a cork borer* (diameter 1cm), cut out cylinders of beetroot*. Cut 75 pieces
of 2 mm thick discs from the cylinder using scalpel*.
2. [B] Rinse the discs in running water until the water is colourless. (or idea of baseline
for calibration of colorimeter) [1]
3. Place 5 pieces of washed beetroot discs in test tube. Prepare 2 more test tubes with
beetroot discs to serve as replicates, (why) to check for anomalous results.
4. Add 10 cm3 of distilled water* into 3 separate test tubes and place them in the 500
cm3 beaker* with 30C water. Place the 3 test tubes with beetroot into the same
water bath. Add boiling or tap water*, where necessary, to attain and maintain the
temperature. Use thermometer * to monitor temperature.
5. [E] Allow 2 min of equilibration time for the (why) temperature in the test tube to
reach that of the water bath at 30C. [1]
6. Add the 5 beetroot discs to the 10 cm3 distilled water.
7. Incubate the 3 tubes in the 30C water bath for 20 min.
8. Decant the extract from tube and pour into liquid into a cuvette*.
9. Fill a second cuvette with distilled water.
10. Place a filter that results in light of 550nm into the colorimeter* and use the distilled
water to adjust the reading to zero absorbance. (do not mark for this)
11. Measure the % absorbance of solution using colorimeter.
12. Repeat steps 1-10 for 40oC, 50oC, 60oC, 70oC.
13. [RR] Repeat the entire experiment twice to check for reproducibility. [1]
For
14 Examiners
Use
[G] Graph showing intensity of colour of extract obtained from incubation at different
temperature [1]
Absorbance/ %
temperature / oC
Note:
trend accepted as long as there is increasing absorbance with increasing temp
Free-response question
Write your answer to this question on the separate answer paper provided.
Your answer:
should be illustrated by large, clearly labeled diagrams, where appropriate;
must be in continuous prose, where appropriate;
must be set out in sections (a), (b) etc, as indicated in the question.
5 (a) Explain the normal functions of stem cells in a living organism. [6]
For
15 Examiners
Use
(b) Discuss the social and ethical concerns for the use of gene therapy. [6]
1. Gene therapy is a method of treating genetic diseases which involves the
introduction of a normal functional allele into cells of an affected individual where it
will express the normal protein ;
2. Gene therapy which involves an alteration to the genes of somatic cells affects only
that individual, but an alteration to the genes of germline cells affect offspring and
successive generations ;
3. Social issue: injustice and unequal resource allocation as gene therapy is very
expensive. There are concerns that this treatment is being made available only to
those who can afford it ;
4. Ethical issue: There is concern that many gene therapy candidates are children who
are too young to understand the ramifications of gene therapy treatment and can
become unwitting participants ;
5. Ethical issue: Germ-line gene therapy involves research on early embryos which
may be considered by some as living and death of embryos in the process of gene
therapy (e.g. extraction of inner cell mass) is unethical ;
6. Ethical/social issue: Abuse of gene therapy for genetic enhancement could
exacerbate problems of social discrimination, social inequality and a lowered
tolerance for human diversity ;
(c) Describe cystic fibrosis and how it can be treated using non-viral gene delivery system. [8]
Cystic fibrosis description (max 4)
1. Cystic fibrosis (CF) is a autosomal recessive disease;
2. caused by mutation of cystic fibrosis transmembrane conductance regulator*
(CFTR/ CFTCR) gene;
3. The mutation of CFTR gene in chromosome 7 is a deletion of 3 bases resulting in
the loss of phenylalanine in the polypeptide;
4. A normal CFTR gene will code for a protein that function as a gated channel protein
to facilitate the transport of chloride ions;
5. as a result of this loss of function* mutation, channels no longer able to transport
chloride ions out of the epithelial cell (as in the lung);
6. causing thick mucus in lungs, resulting in blockage/congestion of airway in the lung
that reduces gaseous exchange leading to breathing difficulties
Or
pancreatic duct is choked by thick mucus preventing release of enzymes resulting in
indigestion ;
7. thick mucus provides suitable environment for bacteria growth which makes patient
susceptible to chronic lung infection resulting in death (lowering of life expectancy,
not living beyond 30years old);
Treatment (max 4)
8. to treat CF, a normal functioning allele* of CFTR is isolated and inserted into a
plasmid vector through recombinant techniques;
9. this DNA construct is then packaged in the aqueous core of the microscopic lipid
envelopes/phospholipid bilayer sphere forming liposomes* ;
10. delivered to epithelial cell in the lung by aerosol spray (nasal spray);
11. the liposome fuses with the plasma membrane of the epithelial cell lining the lung
and releases the DNA into the cell (this process is called lipofection);
12. the plasmid vector enters nucleus and the normal CFTR allele is transcribed and
translated;
13. to produce normal CFTR protein which can be incorporated into plasma membrane
to facilitate the transport of chloride;
[Total: 20]
RI 2013 Preliminary Examination 9648/03 [Turn over
1363
CANDIDATE
NAME
H2 BIOLOGY 9648/01
Paper 1 Multiple Choice 27 September 2013
1 hour 15 minutes
Additional Materials: Multiple Choice Answer Sheet
There are forty questions in this paper. Answer all questions. For each question, there
are four possible answers, A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the
separate Answer Sheet.
Each correct answer will score one mark. A mark will not be deducted for a wrong
answer.
Any rough working should be done on the Question Paper.
Calculators may be used.
_____________________________________________________________________
This Question Paper consists of 24 printed pages.
1. A ribosome consists of a large and a small subunit, each subunit containing ribosomal
RNA (rRNA) complexed with protein.
Which sequence of events concerning ribosomes is correct?
A Within the nucleolus rRNA and protein are synthesised and subunits formed. They
become membrane bound as they are exported through the nuclear envelope to
the cytoplasm and RER.
B rRNA and protein are synthesised in the Golgi body and are transported to the
nucleolus for subunit formation.
C rRNA is synthesised in the SER and proteins are synthesised by the RER. Subunit
formation occurs within the cytoplasm for free ribosomes and within RER for
attached ribosomes.
D rRNA synthesised within the nucleus is complexed with protein that has been
imported from cytoplasm. The subunits formed are exported to the cytoplasm via
the nuclear pores.
A 1 and 2 only
B 1, 2 and 3
C 1, 2 and 4
3. The diagrams show short sections of some common polysaccharides and modified
polysaccharides.
A 2 4 5 3 1
B 2 5 4 1 3
C 3 4 1 2 5
D 3 5 4 1 2
4. Ca
atechol is oxxidised to benzoquinon
b ne, as show
wn in the eq
quation, res ulting in darkening of
pe
eeled fruits.
Ca
atechol oxid dase is an enzyme wh hich is inhibited by pa
arahydroxybbenzoic acid (PHBA)
wh
hich is struccturally similar to catecchol.
It is also inhib
bited by phe
enylthiourea a (PTU) wh hich binds to
o a copper atom in the
e enzyme.
Thhe copper atom
a is esse
ential for the
e oxidative activity.
a
Th
he graph sh
hows the ratte of the rea
action with and
a without inhibitors.
w
with PHBA
A with
h PTU uninhibitted
River Valle
ey High Schoool Pg 4 of 24 Year 6 H2 Biology 9648 Paper 1
Preliminaryy Examination 2013
1367
A 50% 50%
5 0%
B 0% 10
00% 0%
C 50% 0%
0 50%
D 75% 0%
0 25%
6. Thhe diagram
m shows the synthesiss of a polynucleotide
e. Moleculee W is a nucleotide
n
trip
phosphate.
Which statem
ments are co
orrect?
1. The base in W could be the puriine, adenine
e
2. The base in Y is the purine, gua
anine
3. The base in X is the pyrimidine, cytosine
midine, urac
4. The base in X could be the pyrim cil
A 1 and 3 only
B 2 and 3 only
C 2 and 4 only
D 1, 2, 3 and
a 4
River Valle
ey High Schoool Pg 5 of 24 Year 6 H2 Biology 9648 Paper 1
Preliminaryy Examination 2013
1368
A 1 and 2 only
B 1 and 3 only
C 1, 3 and 4
D 2, 4 and 5
8. The petals of the morning glory flower are purple when the flower is in bud but become
blue as the flower opens. The colour change is caused by an increase in pH of the
vacuoles of the petal cells.
A mutation in a gene coding for a type of hydrogen ion (H+) pump in the vacuole
membranes of the petal cells results in flowers that are purple when open.
The difference in DNA sequence of the gene coding for the ion pump in plants with blue
or purple flowers is shown below.
Which statements explain the purple colour of the flowers of the mutant plant?
1. A frameshift mutation alters the sequence of amino acids in the ion pump.
2. The primary structure and the shape of the ion pump are altered.
3. The activity of the ion pump is altered by changes in its shape.
4. The mutant ion pump cannot pump H+ ions into the vacuoles of the petal cells
A 1 and 2
B 1 and 4
C 2 and 3
D 3 and 4
9. Ce
ell division is the means of almostt all growth and reprodu
uction.
Which graph correctly re
epresents a form of cell division th
hat maintainns genetic stability
s at
exxpense of va
ariation?
10. A certain (hyypothetical) organism is diploid, has eitherr blue or oorange winggs as the
co
onsequence e of one of its genes, a
and has eith
her long or short antennnae as a result
r of a
se
econd gene,, as shown below.
If an organism m is hetero
ozygous forr both genes, what will be the poossible chro
omosomes
an ound in one of her eggss?
nd alleles fo
A Two chrromosomes
s 12 with blu
ue and oran
nge wings alleles.
a
D Chromoosome 12 with
w blue an d orange wings
w alleles
s and chrom
mosome 19
9 with long
and sho
ort antennae
e alleles.
River Valle
ey High Schoool Pg 7 of 24 Year 6 H2 Biology 9648 Paper 1
Preliminaryy Examination 2013
1370
11. When a bacterial cell infected by a lambda phage gets co-infected with another lambda
phage at a later point in time, this may not result in the death of the bacterial cell. Which
of the following statement(s) is a possible mechanism(s) for the phenomenon?
1. One of the viruses makes a larger number of phages.
2. The transcription and translation of viral DNA is not initiated.
3. A repressor protein is synthesised to shut down replication of the phage.
4. Mutation of host genome results in the inability of lambda phage to enter host cell.
A 2 only
B 2 and 3 only
C 1 and 4 only
D 1 and 3 only
A mutation
B transformation
C transduction
D binary fission
13. Which of the following is / are true about trp and lac operons?
3. inducible repressible
A 2 only
B 1 and 4 only
C 1, 2 and 4
14. Use your knowledge and the information provided to work out which description of
telomeres and telomerase reverse transcriptase (TERT) is correct.
B Present in eukaryotes Inhibits the loss of telomeres from DNA during semi-
conservative replication
C Present in prokaryotes Inhibits the loss of telomeres from DNA during semi-
conservative replication
15. Which of the following statements about eukaryotic transcription are correct?
1. Attachment of RNA polymerase to promoter is achieved by interaction of transcription
factors.
2. Enhancers and silencers are DNA sequences found downstream of structural genes
and can regulate gene expression.
3. Attachment of activator proteins to enhancers increases the basal activity of the
promoter.
4. Attachment of repressor proteins to silencers suppresses the basal activity of
promoter.
A 1 and 2 only
B 3 and 4 only
C 1, 2 and 3
D 1, 3 and 4
16. The table shows a comparison of some aspects of the genomes and protein-coding
genes of the prokaryote bacterium Escherichia coli and the eukaryote fungus
Saccharomyces cerevisiae.
E. coli S. cerevisiae
Genome length / base pairs 4 640 000 12 068 000
Number of protein-coding genes 4300 5800
Proteins with roles in:
metabolism 650 650
energy release / storage 240 175
membrane transport 280 250
transcription 240 400
translation 180 350
cell structure 180 250
Which of the following statement(s) accounts for the differences in the number of protein-
coding genes?
1. Many catabolic pathways for using carbon compounds in prokaryotes.
2. The presence of introns.
3. The presence of membrane-bound organelles in eukaryotes.
4. The use of histones to package DNA in eukaryotes.
A 1 only
B 1 and 2 only
C 2, 3 and 4
D 1, 3 and 4
A 1 only
B 3 only
C 1 and 3 only
D 2 and 4 only
18. The table shows the results of a series of crosses in a species of small mammal.
What explains the inheritance of the range of phenotypes shown by these crosses?
19. In mice, the gene for dappled coat (D) and its recessive allele for plain coat (d), are
located on the X chromosome. The gene for straight whiskers (W) and its recessive
allele for bent whiskers (w) are autosomal.
A male mouse with plain coat and bent whiskers was mated on several occasions to the
same female and the large number of offspring consisted of males and females in equal
numbers in all combinations of phenotypes, as shown in the table.
Offspring
Dappled, straight whiskers
Dappled, bent whiskers
Plain, straight whiskers
Plain, bent whiskers
If this female mouse is mated to a male with dappled coat and bent whiskers.
What proportion of the offspring would have at least one dominant allele at each gene
locus?
A 1/8
B 3/8
C 1/4
D 3/4
What is the most likely genetic basis for the occurrence of this defect?
A Autosomal recessive
B Autosomal dominant
C Sex-linked recessive
D Sex-linked dominant
21. The foxglove plant has three different coloured flowers - purple, pink and white.
Coloured pigment is synthesised enzymatically from a white precursor as shown below:
white precursor pigment X pigment Y
E1 E2
Two genetically identical plants with white flowers were crossed. This produced an F1
generation with 2170 white-flowered, 530 purple-flowered and 180 pink-flowered plants.
The alleles are represented by the following symbols:
R: no production of pigment r: production of pigment
B: purple pigment b: pink pigment
Which statement correctly describes the relationship between the two genes?
23. Rubisco is the carbon dioxide-fixing enzyme. One rubisco molecule has eight active sites
where carbon dioxide fixation occurs, with each active site catalysing only three reduction
reactions per second.
The enzyme also catalyses, at the same active sites, the addition of oxygen to rubisco
bisphosphate (RuBP). This reaction is favoured when oxygen concentrations in the leaf
are high and carbon dioxide concentrations are low.
Fact Explanation
A On very hot, dry days stomata close to This reduces the availability of oxygen,
prevent water loss. increasing the production of 3-
phosphoglycerate.
24. The table below shows reactions occurring in a plant cell, and their respective locations.
A 2 only
B 4 only
C 2 and 3 only
D 1, 2 and 3
A 1 only
B 3 only
C 3 and 4 only
D 1, 3 and 4
26. In an experim
ment on osm mosis in plaant cells, th
he solute potential (ss), pressure
e potential
p) and wate
( er potential (w) of the cell were recorded in the table beelow.
Con
ndition of plant
p cell Pote
ential / kPa
s p w
Plasmoly
ysed -100
00 P Q
P Q R S
A +
+1000 -2
2000 +6
600 0
B -1000 -2
2000 0 -600
C 0 -1
1000 -6
600 -12
200
D 0 -1
1000 +6
600 0
27. Th
he diagram below illusttrates the m
main features of homeo
ostasis.
What are P, Q,
Q R and S?
?
P Q R S
A Fee
edback Recceptor / Controller / Effe
ector
De tector Integ
grator
C Fee
edback Recceptor / Effe
ector Contrroller /
De tector Integ
grator
River Valle
ey High Schoool Pg 16 of 24 Year 6 H2 Biology 9648 Paper 1
Preliminaryy Examination 2013
1379
Wh
hich of the following
f is true of both
h interaction
ns?
A Diffusion
n is involve
ed in the m
movement of
o chemicals M and N to their respective
r
target ce
ells.
B Chemica
al M is secrreted faster than chemical N.
D Both ch
hemicals M and N m ust bind to
o cell-surface receptoors on cell X and Y
respectively.
River Valle
ey High Schoool Pg 17 of 24 Year 6 H2 Biology 9648 Paper 1
Preliminaryy Examination 2013
1380
29. The figure below shows the time course of glucose uptake by the working rat heart in the
absence and presence of insulin. The lower the amount of total perfusate glucose, the
greater is the uptake of glucose by the rat heart.
From the given data, which of the following statements can be concluded to be correct?
1. Cells in the rats heart have receptors for insulin.
2. There is increased uptake of glucose by the rats heart in the presence of insulin.
3. Release of insulin is stimulated by increase in blood glucose level.
4. The rat is given a carbohydrate-rich meal prior to the experiment.
A 1 and 2 only
B 1 and 4 only
C 2 and 3 only
D 3 and 4 only
30. Which process triggers the uptake of Ca2+ ions in synaptic transmission?
31. Organisms are classified using taxons. The scientific names of three species of Hawaiian
honeycreeper are below.
Short-billed Honeycreeper, Cyanerpes nitidus
Shining Honeycreeper, Cyanerpes lucidus
Purple Honeycreeper, Cyanerpes caeruleus
Red-legged Honeycreeper, Cyanerpes cyaneus
What is the highest taxon that these honeycreepers have in common?
A genus
B order
C family
D class
32. The graphs represent the frequency of alleles in species, X, Y and Z during the after
selection.
A X only
B Y only
C Y and Z
D None of X, Y nor Z
River Valley High School Pg 19 of 24 Year 6 H2 Biology 9648 Paper 1
Preliminary Examination 2013
1382
A 1 and 2
B 1 and 4
C 2 and 3
D 3 and 4
Which plasmids would be suitable to use for genetic engineering using restriction
enzyme S?
A 1 and 4 only
B 2 and 3 only
C 1, 2 and 4
D 1, 3 and 4
River Valle
ey High Schoool Pg 22 of 24 Year 6 H2 Biology 9648 Paper 1
Preliminaryy Examination 2013
1385
36. Which of the following is not necessary for Polymerase Chain Reaction to occur?
1. dATP
2. RNA primers
3. DNA fragment
4. Ribonucleotides
A 1 only
B 2 and 4 only
C 1, 3 and 4
37. In parallel with the Human Genome Project, the DNA of a set of model organisms (such
as bacteria, roundworms, fruitflies, mice and chimpanzees) are being studied.
Which technique might be most useful in using the information from model organisms to
provide critical clues about the structure and function of human genes?
A Sequencing
B DNA fingerprinting
38. A key feature of most multicellular organisms is the ability to differentiate and produce
specialised cells.
Which row best describes the ability of zygotic cells to differentiate?
A Key
B = ability
C = no ability
39. It is possible to introduce an allele for a functioning CFTR protein into lung epithelial cells
of patients suffering from the genetically inherited condition cystic fibrosis.
Why this strategy can never provide a permanent cure for the patient?
B the DNA molecule that makes up the functioning allele is very unstable
40. Marker genes are often inserted into genetically engineered crop plant cells, along with
desired genes. Bacterial antibiotic resistance genes are sometimes used as marker
genes. These may include short DNA repeats to make them unstable so that they are
quite quickly eliminated by the genetically engineered crop plant cells.
Which is not a reason why elimination of such marker genes is favoured?
A It is theoretically possible for the antibiotic resistance marker gene in human food to
pass to bacteria in the human gut.
C The antibiotics may affect the growth and differentiation of the fields of crop plants.
H2 BIOLOGY 9648/02
Paper 2 Core Paper 20 September 2013
2 hours
Additional Materials: Answer Paper
_____________________________________________________________________
This Question Paper consists of 25 printed pages.
Fig. 1.1
(a) Using lines, indicated precisely in Fig. 1.1, a possible location where each of
the following molecules can be found:
A: chlorophyll
B: cellulose [2]
(b) (i) Identify the organelle labelled C and state a visible feature that
enabled your identification. [2]
1. (b) (ii) Explain how the functions of the two organelles, C and D, are linked. [2]
Fig. 1.2
(c) (i) Describe the function of the protein that forms the membrane channel. [3]
[Total: 10]
2. Yeast haploid cells secrete pheromones to signal mating, and respond by growing a
mating projection towards a potential mate. Upon contact of the two partner cells, these
fuse to form a diploid zygote.
Fig. 2.1 shows the pheromone-signaling pathway mediated by yeast G-protein coupled
receptor, Ste2. The activation of the pathway induces the expression of FUS1 gene which
is required for yeast mating.
Fig. 2.1
(a) With reference to Fig. 2.1, describe how factor triggers the activation of
Cdc42. [4]
2. (b) Suggest why factor cannot enter the yeast cell. [2]
Fig. 2.2 shows the Ste2 receptor on another yeast cell membrane.
Fig. 2.2
2. (d) Explain how Ste2 receptor remains embedded in the yeast cell membrane. [3]
[Total: 12]
3. PART I
Fig. 3.1
(a) Explain how lamivudine prevents HIV from multiplying in the body. [2]
3. Many drugs have been designed to make it possible for AIDS patients to improve their
overall health and extend their lives. However, most of these drugs have low efficacy due
to high variance in the HIV genome. Fig. 3.2 shows the partial cDNA sequence of
glycoprotein 120 (gp120) on two different strains of HIV found in a host cell. The difference
in the two DNA sequences is indicated via a box.
HIV Strain 1
61 ctgaaaatct cgaaaacaat gccaaaacca taatagtgca ccttaataaa tctgtagaaa
121 tcaattgtac cagaccctcc aacaatacaa gaacaagtat aactatagga ccaggacaag
181 tatggtatag aacaggagac ataataggaa atataagaaa agcatattgt gagattaatg
241 gaacaaaatg gaataaagtt ttaaaacagg taactgaaaa attgaaagag cactttaata
301 ataagacaat aatctttcaa ccac
HIV Strain 2
61 ctgaaaatct cgaaaacaat gccaaaacca taatagtgca ccttaataaa tctgtagaaa
121 tcaattgtac cagaccctcc aacactacaa gaacaagtat aactatagga ccaggacaag
181 tatggtatag aacaggagac ataataggaa atataagaaa agcatattgt gagattaatg
241 gaacaaaatg gaataaagtt ttaaaacagg taactgaaaa attgaaagag cactttaata
301 ataagacaat aatctttcaa ccac
Fig. 3.2
(b) Explain how the genomic variation shown in Fig. 3.2 affects the structure of
gp120 on the two strains of HIV. [3]
PART II
Fig. 3.3
(d) State two visible structural similarities between influenza virus and the virus
shown in Fig. 3.3. [2]
3. (e) Describe how the genome of influenza virus differs from that of the virus
shown in Fig. 3.3. [2]
[Total: 12]
4. PART I
Fig. 4.1
(a) Most of the chromatin is seen to be in the form of a fiber with a diameter of about
30 nm.
(i) Describe how DNA is packed into the 30 nm chromatin fibre. [2]
4. Processes such as transcription and replication require the two strands of DNA to come
apart temporarily, thus allowing access of polymerases to the DNA template. However, the
folding of chromatin into 30 nm fibers poses barriers to the enzymes that unwind and copy
DNA.
(b) Explain how the histones are removed transiently to permit replication or
transcription to proceed. [3]
PART II
Fig. 4.2 and Fig. 4.3 are diagrams showing DNA replication and transcription,
respectively.
Fig. 4.2
Fig. 4.3
River Valley High School Pg 13 of 25 Year 6 H2 Biology 9648 Paper 2
Preliminary Examination 2013
1401
4. (c) Explain why RNA primer is required for the synthesis of new strand in DNA [1]
replication.
(d) Describe two ways in which the functions of molecules P and Q are
[Total: 12]
5. In a particular variety of tomato plant, the allele for red fruit colour (A) is dominant over the
allele for orange fruit (a) and the allele for green base when ripe (B) is dominant over the
allele for no green base when ripe (b).
Two students, Eugene and Cornelius crossed plant with red fruit and green base when
ripe with pure bred plant with orange fruit and no green bases when ripe. The phenotypes
of 50 offspring of each of Eugenes and Corneliuss crosses were recorded and are shown
in Table 5.1.
Table 5.1
Phenotypes of offspring of test crosses
Red fruit with Red fruit with no Orange fruit with Orange fruit with
green base green base green base no green base
Eugenes cross 23 4 3 20
Corneliuss cross 3 21 23 3
(a) Describe briefly how a plant breeder ensures that the offspring produced are
only from the desired cross. [2]
5. (b) (ii) With reference to the table of probabilities provided, explain how the
value for the 2 test supports the hypothesis that the two genes are
independently segregating. [2]
degrees of probability, p
freedom 0.10 0.05 0.02 0.01 0.001
1 2.71 3.84 5.41 6.64 10.83
2 4.61 5.99 7.82 9.21 13.82
3 6.25 7.82 9.84 11.35 16.27
4 7.78 9.49 11.67 13.28 18.47
(c) Using the symbols given, state the genotypes of the tomato plants in
Eugenes and Corneliuss crosses. [2]
Eugenes cross:
Corneliuss cross:
5. (d) Draw a genetic diagram to explain the results of Corneliuss cross. [5]
[Total: 12]
6. PART I
Fig. 6.1
6. PART II
Arabidopsis thaliana is a small flowering plant native to Asia. A mutation in the gene
coding for NADP oxidase results in plants with short root hairs. NADP oxidase is an
enzyme that converts NADPH to NADP+.
Fig. 6.2 shows the root hairs in the two variant of A. thaliana.
Fig. 6.2
6. In a separate experiment, the length of root hairs in wild type and mutant A. thaliana were
measured at intervals, together with the activity of NADP oxidase in the tips of the root
hairs. The results are shown in Fig. 6.3.
Fig. 6.3
(c) With reference to Fig. 6.3, and your knowledge of photosynthesis, describe
and explain the difference in the growth of root hairs in the two types of
A. thaliana. [4]
[Total: 10]
7. Fig. 7.1 shows the arrangement of bones in the pentadactyl forelimbs of four vertebrates.
Fig. 7.1
(a) Explain how the relationship between the structures in Fig. 7.1 provides
evidence to support the theory of evolution. [2]
(b) Explain how fossil evidence can also be used as evidence to support the
idea that evolution has taken place? [2]
7. (c) Suggest how natural selection could have brought about the evolution of the
skeleton of a bats wing. [3]
The pipistrelle is the most common species of bat in Europe. Fig. 7.2 shows a map of
Canary Islands, a Spanish archipelago located just off the northwest coast of mainland
Africa. El Hierro is the most recent Canary Island, having appeared approximately
1.2 million years ago.
Fig. 7.2
7. It was originally thought that all pipistrelles belonged to the same species. However,
mtDNA reveals that there were two species: Pipistrellus maderensis and Pipistrellus kuhlii.
The data for both species are provided in Table 7.1.
Table 7.1
(d) Using the data in Table 7.1, suggest why pipistrelles were originally
classified as one species. [1]
Evolution of the two bat species, Pipistrellus maderensis and Pipistrellus kuhlii, was
studied by comparing ~1 kbp of mtDNA (from cytochrome b and 16S rRNA genes) from
the bats in different islands.
Sequence divergence of P. maderensis is the lowest between La Gomera and El Hierro as
compared to between La Gomera and the remaining islands (i.e. Tenerife and La Palma).
7. (e) (ii) suggest why no gene flow occurs between the P. maderensis on
La Gomera and El Hierro. [1]
[Total: 12]
8. (a) Describe the structure of the cell membrane and relate it to its properties. [7]
(b) Explain the significance of mitosis in growth, repair and asexual reproduction. [4]
(c) Outline the behaviour of chromosomes during meiosis I and explain the
significance of each phase in leading to genetic variation. [9]
[Total: 20]
9. (a) Discuss, using named examples, how dual control of gene expression is
achieved in Escherichia coli. [8]
(c) Explain how the structure of neurone facilitates impulse transmission. [8]
[Total: 20]
H2 BIOLOGY 9648/02
Paper 2 Core Paper 20 September 2013
2 hours
Additional Materials: Answer Paper
_____________________________________________________________________
This Question Paper consists of 25 printed pages.
Fig. 1.1
(a) Using lines, indicated precisely in Fig. 1.1, a possible location where each of
the following molecules can be found:
A: chlorophyll
B: cellulose [2]
(b) (i) Identify the organelle labelled C and state a visible feature that
enabled your identification. [2]
1. Golgi apparatus
2. Made up of stacks of flattened membrane bound sacs
3. Vesicles fusing with / budding off from / associated with structure
1. (b) (ii) Explain how the functions of the two organelles, C and D, are linked. [2]
Fig. 1.2
(c) (i) Describe the function of the protein that forms the membrane channel. [3]
[Total: 10]
2. Yeast haploid cells secrete pheromones to signal mating, and respond by growing a
mating projection towards a potential mate. Upon contact of the two partner cells, these
fuse to form a diploid zygote.
Fig. 2.1 shows the pheromone-signaling pathway mediated by yeast G-protein coupled
receptor, Ste2. The activation of the pathway induces the expression of FUS1 gene which
is required for yeast mating.
Fig. 2.1
(a) With reference to Fig. 2.1, describe how factor triggers the activation of
Cdc42. [4]
2. (b) Suggest why factor cannot enter the yeast cell. [2]
Fig. 2.2 shows the Ste2 receptor on another yeast cell membrane.
Fig. 2.2
2. (d) Explain how Ste2 receptor remains embedded in the yeast cell membrane. [3]
[Total: 12]
3. PART I
Fig. 3.1
(a) Explain how lamivudine prevents HIV from multiplying in the body. [2]
3. Many drugs have been designed to make it possible for AIDS patients to improve their
overall health and extend their lives. However, most of these drugs have low efficacy due
to high variance in the HIV genome. Fig. 3.2 shows the partial cDNA sequence of
glycoprotein 120 (gp120) on two different strains of HIV found in a host cell. The difference
in the two DNA sequences is indicated via a box.
HIV Strain 1
61 ctgaaaatct cgaaaacaat gccaaaacca taatagtgca ccttaataaa tctgtagaaa
121 tcaattgtac cagaccctcc aacaatacaa gaacaagtat aactatagga ccaggacaag
181 tatggtatag aacaggagac ataataggaa atataagaaa agcatattgt gagattaatg
241 gaacaaaatg gaataaagtt ttaaaacagg taactgaaaa attgaaagag cactttaata
301 ataagacaat aatctttcaa ccac
HIV Strain 2
61 ctgaaaatct cgaaaacaat gccaaaacca taatagtgca ccttaataaa tctgtagaaa
121 tcaattgtac cagaccctcc aacactacaa gaacaagtat aactatagga ccaggacaag
181 tatggtatag aacaggagac ataataggaa atataagaaa agcatattgt gagattaatg
241 gaacaaaatg gaataaagtt ttaaaacagg taactgaaaa attgaaagag cactttaata
301 ataagacaat aatctttcaa ccac
Fig. 3.2
(b) Explain how the genomic variation shown in Fig. 3.2 affects the structure of
gp120 on the two strains of HIV. [3]
PART II
Fig. 3.3
(d) State two visible structural similarities between influenza virus and the virus
shown in Fig. 3.3. [2]
3. (e) Describe how the genome of influenza virus differs from that of the virus
shown in Fig. 3.3. [2]
Number of molecules 1 8
AVP
[Total: 12]
4. PART I
Fig. 4.1 is an electron micrograph of chromatin maintained at the 30 nm higher-order fiber.
Fig. 4.1
(a) Most of the chromatin is seen to be in the form of a fiber with a diameter of
about 30 nm.
(i) Describe how DNA is packed into the 30 nm chromatin fibre. [2]
4. (b) Processes such as transcription and replication require the two strands of
DNA to come apart temporarily, thus allowing access of polymerases to the
DNA template. However, the folding of chromatin into 30 nm fibers pose
barriers to the enzymes that unwind and copy DNA.
1. histone acetylation
2. acetyl groups are attached to lysines in histone tails
3. the positive charges are neutralized
4. histone tails no longer interact with the neighbouring nucleosomes
5. chromatin has a more diffused structure
6. allows access of DNA polymerase and RNA polymerase for
replication and transcription, respectively
PART II
Fig. 4.2 and Fig. 4.3 are diagrams showing DNA replication and transcription respectively.
Fig. 4.2
Fig. 4.3
4. (c) Explain why RNA primer is required for the synthesis of new strand in DNA [1]
replication.
DNA polymerase can only join nucleotides; onto existing chain with free 3
OH group at one end
(d) Describe two ways in which the functions of molecules P and Q are
[Total: 12]
5. In a particular variety of tomato plant, the allele for red fruit colour (A) is dominant over the
allele for orange fruit (a) and the allele for green base when ripe (B) is dominant over the
allele for no green base when ripe (b).
Two students, Eugene and Cornelius crossed plant with red fruit and green base when
ripe with pure bred plant with orange fruit and no green bases when ripe. The phenotypes
of 50 offspring of each of Eugenes and Corneliuss crosses were recorded and are shown
in Table 5.1.
Table 5.1
Red fruit with Red fruit with Orange fruit Orange fruit
green base no green base with green with no green
base base
Eugenes cross 23 4 3 20
Corneliuss 3 21 23 3
cross
(a) Describe briefly how a plant breeder ensures that the offspring produced are
only from the desired cross. [2]
2 = + + + ;
= 8.82+ 5.78 + 7.22 + 4.50 = 26.32;
[1]
5. (b) (ii) With reference to the table of probabilities provided, explain how the
value for the 2 test supports the hypothesis that the two genes are
independently segregating.
degrees of probability, p
freedom 0.10 0.05 0.02 0.01 0.001
1 2.71 3.84 5.41 6.64 10.83
2 4.61 5.99 7.82 9.21 13.82
3 6.25 7.82 9.84 11.35 16.27
4 7.78 9.49 11.67 13.28 18.47
[2]
(c) Using the symbols given, state the genotypes of the tomato plants in
Eugenes and Corneliuss crosses. [2]
AB x ab Reject: different symbols used
Eugenes cross: ;;
a b ab
Ab x ab
Corneliuss cross: ;;
a B ab
(d) Draw a genetic diagram to explain the results of Corneliuss cross. [5]
Parental Red fruit with green x Orange fruit with no
phenotype: base; green base;
Parental Ab ab
genotype: aB ab
Gametes:
A b a B a b;
A B a b ;
Punnet
Parental gametes Recombinant gametes
square
A b a B A B a b
A b a B A B a b Correct
a b
a b a b a b a b genotype;;
Red fruit Orange Red fruit Orange Correct
with no fruit with with fruit with phenotype;;
green green green no green
base base base base
21 23 3 3 ;
Parental Recombinants ;
[Total: 12]
6. PART I
Fig. 6.1
6. PART II
Arabidopsis thaliana is a small flowering plant native to Asia. A mutation in the gene
coding for NADP oxidase results in plants with short root hairs. NADP oxidase is an
enzyme that converts NADPH to NADP+.
Fig. 6.2 shows the root hairs in the two variant of A. thaliana.
Fig. 6.2
6. In a separate experiment, the length of root hairs in wild type and mutant A. thaliana were
measured at intervals, together with the activity of NADP oxidase in the tips of the root
hairs. The results are shown in Fig. 6.3.
Fig. 6.3
(c) With reference to Fig. 6.3, and your knowledge of photosynthesis, describe
and explain the difference in the growth of root hairs in the two types of A.
thaliana. [4]
Describe
45 to 95 min,
1. Mean length of root hair for wild type A. thaliana increases from 10um to
38um
2. while that for mutant A. thaliana increases from 10um to 14um
3. Mean activity of NADP in wild type A. thaliana increases from 13au to
42au
4. while that in mutant A. thaliana decreases from 9au to 6au
Explain
5. NADP oxidase catalyses the conversion of NADPH to NADP+ for light
reaction of photosynthesis
Accept: Calvin cycle of photosynthesis
6. where ATP is synthesised; for cell growth / growth of root hair
Accept: synthesis of glucose (if Calvin cycle mentioned in point 5)
[Total: 10]
7. Fig. 7.1 shows the arrangement of bones in the pentadactyl forelimbs of four vertebrates.
Fig. 7.1
(a) Explain how the relationship between the structures in Fig. 7.1 provides
evidence to support the theory of evolution. [2]
(b) Explain how fossil evidence can also be used as evidence to support the
idea that evolution has taken place? [2]
7. (c) Suggest how natural selection could have brought about the evolution of the
skeleton of a bats wing. [3]
7. The pipistrelle is the most common species of bat in Europe. Fig. 7.2 shows a map of
Canary Islands, a Spanish archipelago located just off the northwest coast of mainland
Africa. El Hierro is the most recent Canary Island, having appeared approximately 1.2
million years ago.
Fig. 7.2
7.
It was originally thought that all pipistrelles belonged to the same species. However,
mtDNA reveals that there were two species: Pipistrellus maderensis and Pipistrellus kuhlii.
The data for both species are provided in Table 7.1.
Table 7.1
Species Mean body mass Mean wingspan Colour
(g) (cm)
P. maderensis 5.7 3.0 dark brown fur with light
wing markings
P. kuhlii 5.5 3.0 light brown to reddish
brown with light wing
markings
(d) Using the data in Table 7.1, suggest why pipistrelle were originally classified
as one species. [1]
Evolution of the two bat species, Pipistrellus maderensis, Pipistrellus kuhlii, was studied by
comparing ~1 kbp of mtDNA (from cytochrome b and 16S rRNA genes) from the bats in
different islands.
Sequence divergence of P. maderensis is the lowest between La Gomera and El Hierro as
compared to between La Gomera and the remaining islands (i.e. Tenerife and La Palma).
[Total: 12]
8. (a) Describe the structure of the cell membrane and relate it to its properties [7]
[4]
(b) Explain the significance of mitosis in growth, repair and asexual reproduction.
Growth
6. allows the growth and development of a zygote into a multicellular organism
7. forming new cells that are genetically identical to the existing cell(s)
Repair
8. produces new cells required to repair worn-out or damaged tissues
9. to return a tissue to its former condition
Asexual reproduction
10. to produce genetically identical daughter cells that can form new offspring
11. to reproduce rapidly in an environment that the parent plant is well adapted
to
12. colonises the habitat much more quickly than via sexual reproduction
13. AVP
(c) Outline the behaviour of chromosomes during meiosis I and explain the [9]
significance of each phase in leading to genetic variation.
[Total: 20]
9. (a) Discuss, using named examples, how dual control of gene expression is
achieved in Escherichia coli. [8]
Scenario 2
9. Negative gene regulation
10. by lac repressor protein
11. Lactose absent
12. thus no allolactose bound to lac repressor protein
13. allowing for synthesis of small amounts of lac repressor protein
14. Lac repressor protein is in its active conformation
15. Lac repressor protein binds to the operator
16. Lac operon switched off
Scenario 4
25. Positive gene regulation
26. by catabolite activator protein
27. Glucose present, lactose present
28. Level of cAMP is low
29. Level of CAP-cAMP complex is low / most CAP assumes inactive conformation
30. CAP-cAMP complex does not bind to / detaches from promoter
31. Low affinity of RNA polymerase for promoter
32. Low rate of transcription of structural genes
(c) Explain how the structure of neurone facilitates impulse transmission. [8]
Structure Function
11. AVP
[Total: 20]
CANDIDATE
NAME
H2 BIOLOGY 9648/03
Applications Paper and Planning Question 26 September 2013
Paper 3 2 hours
_____________________________________________________________________
This Question Paper consists of 17 printed pages.
Fig. 1.1
1. (a) (ii) Explain how the specific nucleotide sequence of the primer is
important for its role in PCR. [2]
(b) Distinguish between PCR and DNA replication in human skin cells. [2]
1. DNA amplified using PCR is then is cut by a specific restriction enzyme and separated
using gel electrophoresis. The DNA is then transferred to a nitrocellulose membrane,
before the addition of radioactive DNA probes for nucleic acid hybridisation. Fig. 1.2
shows the nucleic acid hybridisation process.
Fig. 1.2
1. (c) With reference to Fig. 1.2, explain the significance of the temperatures used
during nucleic acid hybridisation. [3]
1. (d) Suggest why several probes have to be used in order for DNA fingerprinting
to be effective. [2]
DNA fingerprinting is often used in paternity testing. This involves the investigation of
various Variable Number of Tandem Repeat (VNTR) loci in the individuals genome. The
table below shows the genotype of five individuals at each of the five loci examined.
Locus on chromosome
(f) (i) State the male(s) who may possibly be the father of the child. [1]
1. (f) (ii) Explain why the test above cannot conclude with absolute certainty
that a given male is the father of the child. [1]
[Total: 15]
2. In humans, the gene RPE65 encodes a protein responsible for regenerating visual
pigment in rod and cone cells after they have been exposed to light. A recessive allele of
this gene causes impaired vision from birth, progressing to complete blindness in early
adulthood. This condition is called LCA.
In 2008, trials were carried out into the possibility and safety of treating LCA using gene
therapy.
(a) Suggest and explain why LCA is suitable for treatment using gene therapy. [3]
Six adults with this condition were used in the study. Genetically modified adenoviruses (a
type of virus that can cause respiratory infections) were used as vectors. The vectors were
injected beneath the retina of one eye of each of the participants.
(b) Suggest two ways in which the genome of the adenoviruses used as vectors
would differ from that of normal adenoviruses. [2]
2. Improvements were found in the vision of all the participants, but the small number in the
trials made most of these improvements not statistically significant.
(c) Suggest why these trials were designed to include such a small number of
participants. [2]
Scientists have developed stem cell therapy for retinal disease in mouse. The adult stem
cells from donors form functional photoreceptors after transplantation in the adult diseased
mouse retina. The immune system of the mouse was suppressed to prevent them from
rejecting the foreign stem cells.
(e) Suggest how it is possible that adult stem cells could differentiate into the
range of cell types needed for repairing retina. [2]
2. (f) Suggest the advantages of using stem cells from donors as compared to the
use of adenoviruses in (b). [2]
[Total: 12]
3. Rice is the staple diet in many parts of the world. Rice plants produce the precursor of
vitamin A, -carotene, in their green tissues, but not in the edible endosperms of their
seeds. Adequate concentrations of vitamin A give protection from night blindness. Higher
concentrations act as an antioxidant that may give some protection from cancer and heart
disease.
Golden rice, which contains -carotene, was developed in Switzerland by genetically
modifying rice using genes from a daffodil (a flowering plant) and a bacterium. The rice
produces seeds containing -carotene.
Fig. 3.1 shows the DNA sequence used.
pro psy ter pro crt 1 ter pro Hyg resist ter
Key
pro - start site for polymerase enzymes
ter - end signal for polymerase enzymes
psy - gene from daffodil (a flowering plant)
crt 1 - gene from bacterium
Hyg resist - antibiotic resistance gene from a bacterium
Fig. 3.1
(a) Describe the role of the rice endosperm-specific promoter that was added to
psy and crt 1 in Step 1. [2]
3. (b) Explain how a length of DNA can be inserted into a plasmid in Step 2. [3]
(c) Explain the role of the Hyg resistance gene in this procedure. [1]
Field trials of genetically engineered crops, such as golden rice, hope to identify
any risks to the environment or to human health of growing and eating the crops.
(d) Suggest:
3. A group of adult volunteers were given a 500 g of labelled golden rice dose for three days
together with 10 g butter. Each gram of golden rice contains 1.6 ug of -carotene. Serum
samples from the volunteers were analysed for golden rice -carotene. The result of the
analysis was shown in Fig. 3.2.
Fig. 3.2
(e) (i) With reference to Fig. 3.2, explain the change in labelled -carotene. [2]
(iii) Suggest why children are not included in the study. [1]
(f) Suggest if the daily intake of golden rice by children will overcome the
problem of vitamin A deficiency. Explain your answer. [1]
[Total: 13]
4. Planning Question
You are required to plan, but not carry out, an investigation into the effect of the
independent variable, copper sulphate concentration, on amylase.
Amylase catalyses the hydrolysis of starch to glucose.
Copper sulfate can inhibit amylase.
The extent of inhibition depends on the concentration of the copper sulfate solution. A
student investigated the inhibition of amylase at concentrations of copper sulfate solution
greater than 3.0% and found that the enzyme was completely inhibited.
The student suggested the hypothesis:
Concentrations of copper sulfate solution below 3.0% will continue to inhibit the
enzyme.
You are required to investigate this hypothesis by carrying out a serial dilution of copper
sulfate solution which reduces the concentration by ten-fold between each successive
dilution.
Using this information and your own knowledge, design an experiment to test the students
hypothesis.
Your plan should:
have a clear and helpful structure such that the method you use is able to be repeated
by anyone reading it,
be illustrated by relevant diagrams, if necessary,
identify the independent and dependent variables,
describe the method with the scientific reasoning used to decide the method so that
the results are as accurate and reliable as possible,
include layout of results tables and graphs with clear headings and labels,
use the correct technical and scientific terms,
include reference to safety measures to minimise any risks associated with the
proposed experiment.
Your planning must be based on the assumption that you have been provided with the
following equipment and materials, which you must use:
1% amylase solution,
1% starch suspension,
copper sulfate (powder),
iodine in potassium iodide solution,
any normal laboratory glassware, e.g. test-tubes, beakers, measuring cylinders, glass
rod, etc.,
syringes,
timer e.g. stopwatch,
colourimeter,
cuvette.
[Total: 12]
Your answers:
should be illustrated by large, clearly labelled diagrams, where appropriate.
must be in continuous prose, where appropriate.
must be set out in sections (a), (b) etc., as indicated in the question.
5. (a) Distinguish between a genomic DNA library and cDNA library, and outline
their formation. [8]
(b) Gene therapy clinical trials have mostly shown to be unsuccessful in terms of
therapeutic interest. Explain why. [7]
(c) The genetic manipulation of plants and animals, and their use in agriculture,
is one the most controversial scientific development of recent times. What are
some moral issues associated with the rise of such technology? [5]
[Total: 20]
CANDIDATE
NAME
H2 BIOLOGY 9648/03
Applications Paper and Planning Question 26 September 2013
Paper 3 2 hours
_____________________________________________________________________
This Question Paper consists of 17 printed pages.
Fig. 1.1
1. (a) (ii) Explain how the specific nucleotide sequence of the primer is
important for its role in PCR. [2]
(b) Distinguish between PCR and DNA replication in human skin cells. [2]
1. DNA amplified using PCR is then is cut by a specific restriction enzyme and separated
using gel electrophoresis. The DNA is then transferred to a nitrocellulose membrane,
before the addition of radioactive DNA probes for nucleic acid hybridisation. Fig. 1.2
shows the nucleic acid hybridisation process.
Fig. 1.2
1. (c) With reference to Fig. 1.2, explain the significance of the temperatures used
during nucleic acid hybridisation. [3]
82C
1. Separation of DNA strands
2. by breaking hydrogen bonds
3. between complementary base pairs
65C
4. Annealing of radioactive DNA probe
5. to DNA fragment of interest
6. via complementary base pairing
7. between GCAT and CGTA
1. (d) Suggest why several probes have to be used in order for DNA fingerprinting
to be effective. [2]
DNA fingerprinting is often used in paternity testing. This involves the investigation
of various Variable Number of Tandem Repeat (VNTR) loci in the individuals
genome. The table below shows the genotype of five individuals at each of the five
loci examined.
Locus on chromosome
1. DNA sequences
2. repeated in tandem
3. a variable number of times
4. at certain loci
(f) (i) State the male(s) who may possibly be the father of the child. [1]
Male 3
Reject multiple answers
1. (f) (ii) Explain why the test above cannot conclude with absolute certainty
that a given male is the father of the child. [1]
[Total: 15]
2. In humans, the gene RPE65 encodes a protein responsible for regenerating visual
pigment in rod and cone cells after they have been exposed to light. A recessive allele of
this gene causes impaired vision from birth, progressing to complete blindness in early
adulthood. This condition is called LCA.
In 2008, trials were carried out into the possibility and safety of treating LCA using gene
therapy.
(a) Suggest and explain why LCA is suitable for treatment using gene therapy. [3]
Six adults with this condition were used in the study. Genetically modified
adenoviruses (a type of virus that can cause respiratory infections) were used as
vectors. The vectors were injected beneath the retina of one eye of each of the
participants.
(b) Suggest two ways in which the genome of the adenoviruses used as vectors
would differ from that of normal adenoviruses. [2]
Improvements were found in the vision of all the participants, but the small number
in the trials made most of these improvements not statistically significant.
(c) Suggest why these trials were designed to include such a small number of
participants. [2]
1. ref. to safety / not known if the technique might have side effects
2. rare condition
3. expense
4. AVP e.g. trial to see if delivery method works
2. Scientists have developed stem cell therapy for retinal disease in mouse. The adult stem
cells from donors form functional photoreceptors after transplantation in the adult diseased
mouse retina. The immune system of the mouse was suppressed to prevent them from
rejecting the foreign stem cells.
Multipotent cells can differentiate into a limited number of cell types (but not
into whole organism)
(e) Suggest how it is possible that adult stem cells could differentiate into the
range of cell types needed for repairing retina. [2]
(f) Suggest the advantages of using stem cells from donors as compared to the
use of adenoviruses in (b). [2]
1. not all of the cells in the retina has taken up the normal allele
2. while all the stem cells from a donor will contain the normal allele
3. viral vector used to introduce the normal allele elicit host immune
response
4. resulting in destruction of the vector
[Total: 12]
3. Rice is the staple diet in many parts of the world. Rice plants produce the precursor of
vitamin A, -carotene, in their green tissues, but not in the edible endosperms of their
seeds. Adequate concentrations of vitamin A give protection from night blindness. Higher
concentrations act as an antioxidant that may give some protection from cancer and heart
disease.
Golden rice, which contains -carotene, was developed in Switzerland by genetically
modifying rice using genes from a daffodil (a flowering plant) and a bacterium. The rice
produces seeds containing -carotene.
Fig. 3.1 shows the DNA sequence used.
pro psy ter pro crt 1 ter pro Hyg resist ter
Key
pro start site for polymerase enzymes
ter end signal for polymerase enzymes
psy gene from daffodil (a flowering plant)
crt 1 gene from bacterium
Hyg resist antibiotic resistance gene from a bacterium
Fig. 3.1
The following steps were taken to produce golden rice:
Step 1: a length of DNA (shown in Fig. 3.1) was made including a rice endosperm-
specific promoter, psy gene, crt 1 gene and Hyg resist gene,
Step 2: copies of this length of DNA were inserted into plasmids from the bacterium
Agrobacterium tumefaciens,
Step 3: A. tumefaciens containing the plasmids were mixed with rice embryos and
cultured in a medium containing the antibiotic Hyg,
Step 4: the embryos growing successfully on Hyg were grown into plantlets and then
plants.
(a) Describe the role of the rice endosperm-specific promoter that was added to
psy and crt 1 in Step 1. [2]
3. (b) Explain how a length of DNA can be inserted into a plasmid in Step 2. [3]
(c) Explain the role of the Hyg resistance gene in this procedure. [1]
1. To enable selection of the transgenic cells / cells that have taken up the
plasmid
2. only the cells with the new DNA can grow in the presence of the antibiotic
Field trials of genetically engineered crops, such as golden rice, hope to identify
any risks to the environment or to human health of growing and eating the crops.
(d) Suggest:
3. (d) (ii) one possible risk to human health of eating a genetically engineered
crop. [1]
allergy
long term toxicity
antibiotic resistance of gut bacteria if antibiotic marker used
gene transfer to, virus to human cells / gut bacteria, with unknown
effect
AVP
any one
A group of adult volunteers were given a 500 g of labelled golden rice dose for
three days together with 10 g butter. Each gram of golden rice contains 1.6 ug of -
carotene. Serum samples from the volunteers were analysed for golden rice -
carotene. The result of the analysis was shown in Fig. 3.2.
Fig. 3.2
(e) With reference to Fig. 3.2, explain the change in labelled -carotene. [2]
3. (e) (iii) Suggest why children are not included in the study. [1]
No
Children consume less than 150 grams of rice a day/ less than adult
[Total: 13]
4. Planning Question
You are required to plan, but not carry out, an investigation into the effect of the
independent variable, copper sulphate concentration, on amylase.
Amylase catalyses the hydrolysis of starch to glucose.
Copper sulfate can inhibit amylase.
The extent of inhibition depends on the concentration of the copper sulfate solution. A
student investigated the inhibition of amylase at concentrations of copper sulfate solution
greater than 3.0% and found that the enzyme was completely inhibited.
The student suggested the hypothesis:
Concentrations of copper sulfate solution below 3.0% will continue to inhibit the
enzyme.
You are required to investigate this hypothesis by carrying out a serial dilution of copper
sulfate solution which reduces the concentration by ten-fold between each successive
dilution.
Using this information and your own knowledge, design an experiment to test the students
hypothesis.
Your plan should:
have a clear and helpful structure such that the method you use is able to be repeated
by anyone reading it,
be illustrated by relevant diagrams, if necessary,
identify the independent and dependent variables,
describe the method with the scientific reasoning used to decide the method so that
the results are as accurate and reliable as possible,
include layout of results tables and graphs with clear headings and labels,
use the correct technical and scientific terms,
include reference to safety measures to minimise any risks associated with the
proposed experiment.
Your planning must be based on the assumption that you have been provided with the
following equipment and materials, which you must use:
1% amylase solution
1% starch suspension
copper sulfate (powder)
iodine in potassium iodide solution
any normal laboratory glassware, e.g. test-tubes, beakers, measuring cylinders, glass
rod, etc.,
syringes,
timer e.g. stopwatch,
colourimeter,
cuvette.
[Total: 12]
Introduction i.e. explanation of the dependent and independent variables involved [I=max 2]:
1. Amylase catalyses the hydrolysis of starch into glucose
2. Amylase has a specific active site
3. Starch fits into the active site to form an E-S complex
4. Resulting in the breakage of the glycosidic bonds
5. Copper sulfate inhibit amylase, prevent the binding of starch to the active site
6. The concentration of starch left can be measured by addition of iodine reagent
7. Measuring the colour intensity using a colourimeter
8. The intensity is proportional to the concentration of starch left and
9. inversely proportional to the rate of hydrolysis
Note: No mark for wrong concept
Method i.e. description of the method used including the scientific reasoning behind the method
/ relevant, clearly labelled diagrams: [M=max 3]
20. Preparation of 3.0% copper sulfate solution: dissolve 3.0 g of copper sulfate in 100 cm3
of distilled water.
21. Dilute the copper sulphate stock solution to give 10 cm3 each of the following
concentrations: 0.0003%, 0.003%, 0.03% and 0.3%.
22. Add 1 cm3 of 3.0% copper sulfate into the test tube labelled as 3.0%
23. Put 5 cm3 of starch suspension into the same test-tube.
24. Put 1 cm3 of amylase into the same test-tube.
25. Place the test tube in a water bath maintained at 37 C.
26. Mix and start the stopwatch.
27. At the end of 10 minutes, add 0.5 cm3 of iodine reagent and mix well.
28. Transfer 1 cm3 of the mixture to the cuvette and measure the colour intensity using the
colourimeter.
29. Record the reading in an appropriate table.
30. Repeat step 23 30 for the rest of copper sulfate concentration 0.0003%, 0.003%,
0.03%, 0.3% and control.
31. ensure that there are 3 replicates for each concentration of copper sulfate
32. Repeat the entire experiment twice times
Data manipulation i.e. Include layout of results tables and graphs with clear headings and
labels [D=max 2]
37. Absorbance
Your answers:
should be illustrated by large, clearly labelled diagrams, where appropriate.
must be in continuous prose, where appropriate.
must be set out in sections (a), (b) etc., as indicated in the question.
5. (a) Distinguish between a genomic DNA library and cDNA library, and outline
their formation. [8]
Formation
gDNA
1. Entire genome is cleaved
2. with a specific restriction endonuclease
3. Resulting fragments are inserted into plasmids before introducing into bacteria
cDNA
4. Total RNA
5. converted into single-stranded cDNA
6. Using reverse transcriptase
7. Resulting cDNA molecules are inserted into plasmids before introducing into bacteria
Differences
12. AVP
(b) Gene therapy clinical trials have mostly shown to be unsuccessful in terms of
therapeutic interest. Explain why. [7]
(c) The genetic manipulation of plants and animals, and their use in agriculture,
is one the most controversial scientific development of recent times. What are
some moral issues associated with the rise of such technology? [5]
1. Violation of natural organisms intrinsic values with the mixing of genes among species
/ tampering of genes
2. Animal welfare could be adversely affected due to little concern about whether animals
could withstand the additional burden of increased milk / meat production
3. Controversies on patent of GMO as patent of transgenic plants / animals reduces them
to the level of objects
4. Religious / dietary concerns with consuming animal genes in plants / relevant
examples
5. Labelling of GM food is not mandatory in some countries thus lack of awareness for
those who feel strongly against consumption of foreign DNA incorporated into their
food
6. AVP
[Total: 20]
1 hour 15 minutes
Additional materials:
Optical Mark Sheet
INSTRUCTIONS TO CANDIDATES
Write you name, CG and index number in the spaces at the top of this page.
On the Optimal Mark Sheet, enter your name, subject title, test name, class. For your
index number, enter your full NRIC number. Shade the corresponding lozenges on
the OMS according to the instructions given by the invigilators.
There are forty questions in this paper. Answer all questions. For each question,
there are four possible answers, A, B, C, D. Choose the one you consider correct
and record your choice in soft pencil on the OMS.
___________________________________________________________________
This question paper consists of 24 printed pages.
1
1479
A endoplasmic reticulum
B nucleus
C phagocytic vesicle
D secretory vesicle
Lipid A
Lipid B
Fig. 2
Similarity Difference
Lipid A Lipid B
A Presence of strong ester Presence of Absence of
bonds. phosphodiester phosphodiester
bond bond
B Hydrogen bonding between Presence of two Presence of three
hydrocarbon chains ester bonds ester bonds
C Presence of straight Amphipathic Hydrophobic
hydrocarbon chains
D Complete hydrolysis Contains Does not contain
releases three water phosphorus atom phosphorus atom
molecules
2
1480
Collagen Haemoglobin
A Contains mostly hydrophobic Contains mostly hydrophilic
amino acids amino acids
B Stabilised largely by numerous
Stabilised largely by numerous
hydrogen bonds ionic and hydrogen bonds, and
hydrophobic interactions
C Has primary and secondary Has primary, secondary,
structures only tertiary and quaternary
structures
D Three subunits wind together Each subunit has an active site
to form triple helix which binds haem
4. Which of the following accounts for why starch and glycogen are good
energy stores in living organisms?
5. Which of the following does not describe the active site of an enzyme?
3
1481
Fig. 7
4
1482
8. Which of the following does not explain how meiosis leads to genetic
variation?
A 1 and 3 only.
B 2 and 3 only.
C 3 and 4 only.
D 2, 3 and 4 only.
5
1483
Parent
strand 1
Daughter Daughter
strand X strand Y
Parent
strand 2
Fig. 10
11. Translation of the information on an mRNA into the amino acid sequence
of a polypeptide chain is an energy-requiring process, involving further
processes such as:
A 1 only.
B 1 and 3 only.
C 1, 3 and 4 only.
6
1484
12. The first five DNA triplets that code for a particular protein is shown below:
Fig. 12
With the aid of Fig. 12, what is the sequence of the protein encoded by
the DNA sequence above?
7
1485
13. Which of the following does not occur after lambda phage infection of an
E. coli host cell?
D The viral head and tail structures remain on the surface of the
host cell, and may be eventually degraded.
14. Fig. 14 below is a simple representation of the structure of HIV (not drawn
to scale). Structures W to Z are labelled as shown.
W
X
Fig. 14
Which of the following does not correctly describe the function of the
respective structures?
8
1486
Fig. 15
9
1487
1. Inducible
2. Contains more than one structural gene
3. Can be negatively controlled by repressor
4. Can be positively controlled by activator
Which of the above describe(s) both the lac and trp operons?
A 2 only.
B 2 and 3 only.
C 1, 2 and 3 only.
17. Which of the following is/are mostly likely to contain DNA sequences that
are tandemly repeating?
1. Centromere
2. Origin of replication
3. Promoter
4. Restriction Site
A 1 only.
B 1 and 3 only.
C 1, 2 and 3 only.
10
1488
Which of the following indicates the correct sequence of the steps above?
A 2, 3, 5, 4, 1
B 2, 3, 5, 1, 4
C 3, 2, 5, 4, 1
D 3, 5, 2, 1, 4
19. The following properties are common to both eukaryotic and prokaryotic
genomes, except
11
1489
12
1490
22. The pedigree chart below shows the inheritance of a genetic disease in a
family.
Key:
A autosomal dominant
B sex-linked dominant
C autosomal recessive
D sex-linked recessive
13
1491
product of gene A
white precursor coloured kernel
product of gene B
When 2 breeds of pure-breeding white wheat kernel are crossed, all the
F1 offspring show coloured kernel. When the F1 offspring are selfed, what
is the probability of the F2 offspring having the same phenotype as the F1
phenotype?
A 1 in 16
B 3 in 16
C 4 in 16
D 9 in 16
14
1492
Fig. 24
15
1493
25. In an experiment, chloroplast extracts are first treated with a chemical that
snatches away the electron that is accepted by the electron acceptor in
photosystem I. The extracts are then treated with 2 hours of light and are
provided with ample carbon dioxide and water.
Which of the following correctly shows the products that are formed after
the experiment?
O2 Reduced
ATP Glucose
NADP
A + +
B + + +
C +
D +
Key: (+) = present, () = absent
16
1494
26. Fig. 26 below illustrates several metabolic processes that occur within the
body. Table 26 contains three statements that describe some of these
processes.
Glycogen Glucose
P Q
Fructose 1,6-bisphosphate
Pyruvate
S T
Fig. 26
17
1495
28. Certain drugs act at the synapses and affect the action of neurotransmitter
substances. The table below shows the effects of four different drugs on a
synapse.
Drug Effect
1 Uncontrolled release of acetylcholine
2 Competes with acetylcholine at the receptor sites
3 Inhibits the enzyme acetylcholinesterase
4 Inhibits the opening of voltage-gated sodium ion channels
A 2 and 4 only.
B 3 and 4 only.
C 1, 2 and 4 only.
D 2, 3 and 4 only.
18
1496
29. The Guinea baboon and King colobus are two of the many Old World
monkeys that exist.
Animalia
Chordata
Mammalia
Primates
Cercopithecidae (sub: Cercopithecinae)
Papio
Papio papio (Guinea baboon)
Animalia
Chordata
Mammalia
Primates
Cercopithecidae (sub: Colobinae)
Colobus
Colobus polykomos (King colobus)
19
1497
30. The table shows the number of estimated nucleotide substitutions that
have occurred since the divergence of seven species a to g.
b c d e f g
a 39 72 128 126 159 269
b 81 130 128 158 268
c 129 127 157 267
d 56 154 271
e 151 268
f 273
A B
C D
20
1498
32. Which of the following statements is not consistent with the neutral theory
of molecular evolution?
21
1499
35. Which of the following is an outcome of the Human Genome Project that
has ethical implications?
22
1500
37. The ras oncogene is involved in a variety of human cancers. DNA isolated
from a number of normal and cancerous human tissues were digested
with EcoRI. A Southern blot was performed and the membrane was
probed with radioactive-labelled cloned ras DNA. After exposure to x-ray
film, the resulting autoradiograph is shown below.
1 2 3 4
10 kb
5 kb
1 kb
Lane Sample
1 white blood cells from a healthy human
2 lymphoma cells (cancerous)
3 bladder carcinoma cells (cancerous)
4 sarcoma cells (cancerous)
C In tissue 3, the mutation did not affect existing EcoRI sites within
the ras gene.
23
1501
A No insertional mutagenesis.
39. Which of the following methods can be used to introduce a foreign gene
into a plant cell?
1. By Agrobacterium-mediated transfection
2. By microinjection of naked DNA
3. Using a phage delivery vector
4. Using a gene gun
A 1 and 3 only.
B 1, 2 and 4 only.
C 1, 3 and 4 only.
40. There is concern regarding the escape of GM salmon into the wild
because they
24
1502
1 hour 15 minutes
Additional materials:
Optical Mark Sheet
INSTRUCTIONS TO CANDIDATES
Write you name, CG and index number in the spaces at the top of this page.
On the Optimal Mark Sheet, enter your name, subject title, test name, class. For your
index number, enter your full NRIC number. Shade the corresponding lozenges on
the OMS according to the instructions given by the invigilators.
There are forty questions in this paper. Answer all questions. For each question,
there are four possible answers, A, B, C, D. Choose the one you consider correct
and record your choice in soft pencil on the OMS.
___________________________________________________________________
This question paper consists of 24 printed pages.
1
1503
A endoplasmic reticulum
B nucleus
C phagocytic vesicle
D secretory vesicle
Lipid A
Lipid B
Fig. 2
Similarity Difference
Lipid A Lipid B
A Presence of strong ester Presence of Absence of
bonds. phosphodiester phosphodiester
bond bond
B Hydrogen bonding between Presence of two Presence of three
hydrocarbon chains ester bonds ester bonds
C Presence of straight Amphipathic Hydrophobic
hydrocarbon chains
D Complete hydrolysis Contains Does not contain
releases three water phosphorus atom phosphorus atom
molecules
2
1504
Collagen Haemoglobin
A Contains mostly hydrophobic Contains mostly hydrophilic
amino acids amino acids
B Stabilised largely by numerous
Stabilised largely by numerous
hydrogen bonds ionic and hydrogen bonds, and
hydrophobic interactions
C Has primary and secondary Has primary, secondary,
structures only tertiary and quaternary
structures
D Three subunits wind together Each subunit has an active site
to form triple helix which binds haem
4. Which of the following accounts for why starch and glycogen are good
energy stores in living organisms?
5. Which of the following does not describe the active site of an enzyme?
3
1505
Fig. 7
4
1506
8. Which of the following does not explain how meiosis leads to genetic
variation?
A 1 and 3 only.
B 2 and 3 only.
C 3 and 4 only.
D 2, 3 and 4 only.
5
1507
Parent
strand 1
Daughter Daughter
strand X strand Y
Parent
strand 2
Fig. 10
11. Translation of the information on an mRNA into the amino acid sequence
of a polypeptide chain is an energy-requiring process, involving further
processes such as:
A 1 only.
B 1 and 3 only.
C 1, 3 and 4 only.
6
1508
12. The first five DNA triplets that code for a particular protein is shown below:
Fig. 12
With the aid of Fig. 12, what is the sequence of the protein encoded by
the DNA sequence above?
7
1509
13. Which of the following does not occur after lambda phage infection of an
E. coli host cell?
D The viral head and tail structures remain on the surface of the
host cell, and may be eventually degraded.
14. Fig. 14 below is a simple representation of the structure of HIV (not drawn
to scale). Structures W to Z are labelled as shown.
W
X
Fig. 14
Which of the following does not correctly describe the function of the
respective structures?
8
1510
Fig. 15
9
1511
1. Inducible
2. Contains more than one structural gene
3. Can be negatively controlled by repressor
4. Can be positively controlled by activator
Which of the above describe(s) both the lac and trp operons?
A 2 only.
B 2 and 3 only.
C 1, 2 and 3 only.
17. Which of the following is/are mostly likely to contain DNA sequences that
are tandemly repeating?
1. Centromere
2. Origin of replication
3. Promoter
4. Restriction Site
A 1 only.
B 1 and 3 only.
C 1, 2 and 3 only.
10
1512
Which of the following indicates the correct sequence of the steps above?
A 2, 3, 5, 4, 1
B 2, 3, 5, 1, 4
C 3, 2, 5, 4, 1
D 3, 5, 2, 1, 4
19. The following properties are common to both eukaryotic and prokaryotic
genomes, except
11
1513
12
1514
22. The pedigree chart below shows the inheritance of a genetic disease in a
family.
Key:
A autosomal dominant
B sex-linked dominant
C autosomal recessive
D sex-linked recessive
13
1515
product of gene A
white precursor coloured kernel
product of gene B
When 2 breeds of pure-breeding white wheat kernel are crossed, all the
F1 offspring show coloured kernel. When the F1 offspring are selfed, what
is the probability of the F2 offspring having the same phenotype as the F1
phenotype?
A 1 in 16
B 3 in 16
C 4 in 16
D 9 in 16
14
1516
Fig. 24
15
1517
25. In an experiment, chloroplast extracts are first treated with a chemical that
snatches away the electron that is accepted by the electron acceptor in
photosystem I. The extracts are then treated with 2 hours of light and are
provided with ample carbon dioxide and water.
Which of the following correctly shows the products that are formed after
the experiment?
O2 Reduced
ATP Glucose
NADP
A + +
B + + +
C +
D +
Key: (+) = present, () = absent
16
1518
26. Fig. 26 below illustrates several metabolic processes that occur within the
body. Table 26 contains three statements that describe some of these
processes.
Glycogen Glucose
P Q
Fructose 1,6-bisphosphate
Pyruvate
S T
Fig. 26
17
1519
28. Certain drugs act at the synapses and affect the action of neurotransmitter
substances. The table below shows the effects of four different drugs on a
synapse.
Drug Effect
1 Uncontrolled release of acetylcholine
2 Competes with acetylcholine at the receptor sites
3 Inhibits the enzyme acetylcholinesterase
4 Inhibits the opening of voltage-gated sodium ion channels
A 2 and 4 only.
B 3 and 4 only.
C 1, 2 and 4 only.
D 2, 3 and 4 only.
18
1520
29. The Guinea baboon and King colobus are two of the many Old World
monkeys that exist.
Animalia
Chordata
Mammalia
Primates
Cercopithecidae (sub: Cercopithecinae)
Papio
Papio papio (Guinea baboon)
Animalia
Chordata
Mammalia
Primates
Cercopithecidae (sub: Colobinae)
Colobus
Colobus polykomos (King colobus)
19
1521
30. The table shows the number of estimated nucleotide substitutions that
have occurred since the divergence of seven species a to g.
b c d e f g
a 39 72 128 126 159 269
b 81 130 128 158 268
c 129 127 157 267
d 56 154 271
e 151 268
f 273
A B
C D
20
1522
32. Which of the following statements is not consistent with the neutral theory
of molecular evolution?
21
1523
35. Which of the following is an outcome of the Human Genome Project that
has ethical implications?
22
1524
37. The ras oncogene is involved in a variety of human cancers. DNA isolated
from a number of normal and cancerous human tissues were digested
with EcoRI. A Southern blot was performed and the membrane was
probed with radioactive-labelled cloned ras DNA. After exposure to x-ray
film, the resulting autoradiograph is shown below.
1 2 3 4
10 kb
5 kb
1 kb
Lane Sample
1 white blood cells from a healthy human
2 lymphoma cells (cancerous)
3 bladder carcinoma cells (cancerous)
4 sarcoma cells (cancerous)
C In tissue 3, the mutation did not affect existing EcoRI sites within
the ras gene.
23
1525
A No insertional mutagenesis.
39. Which of the following methods can be used to introduce a foreign gene
into a plant cell?
1. By Agrobacterium-mediated transfection
2. By microinjection of naked DNA
3. Using a phage delivery vector
4. Using a gene gun
A 1 and 3 only.
B 1, 2 and 4 only.
C 1, 3 and 4 only.
40. There is concern regarding the escape of GM salmon into the wild
because they
END OF PAPER
24
1526
CG _________
H2 BIOLOGY 9648
19 August 2013/ Monday
2 Hours
Additional materials:
INSTRUCTIONS TO CANDIDATES
Write your name, CG and index number in the spaces at the top of FOR EXAMINERS USE
this page and on all separate writing papers used.
Section A
Write in dark blue or black pen.
1 /10
You may use a soft pencil for any diagrams, graphs or rough
working. 2 /10
3 /10
Section A 4 /10
Answer all questions.
Write your answers in spaces provided on the question paper. 5 /13
6 /13
Section B 7 /10
Answer only one question out of two.
Write your answers on the separate answer paper provided. 8 /4
Section B
9 /20
The intended number of marks is given in brackets [ ] at the end of TOTAL /100
each question or part question.
______________________________________________________________________
1
1527
Question 1
Gene expression refers to genes being turned on and producing a product. The product
could be an enzyme, a structural protein, or a control molecule.
Eukaryotes can regulate their gene expression at various levels whereas prokaryotes
regulate gene expression predominantly at the transcriptional level.
2
1528
Figure 1.1
d) Name and describe the process that is shown in Figure 1.1. [2]
[Total: 10 marks]
3
1529
Question 2
a) Sex hormone estrogen promotes mammary epithelial cell proliferation by stimulating the
expression of genes encoding cell cycle regulatory proteins. Estrogen receptors (ER) are
intracellular receptors of estrogen. Estrogen-receptor complexes bind to estrogen response
elements (ERE) in enhancers. Estrogenic control of the cell cycle occurs by increasing the
expression of cyclin and myc C which promote cell cycle progression.
Figure 2.1
ii) Describe and explain how estrogen regulates gene expression. [4]
4
1530
b) There are two isoforms of estrogen receptors: ER and ER encoded by different genes.
Genomic DNA samples taken from women suffering from breast cancer were analysed for
the gene copy number present for the ER gene.
Figure 2.2
i) With reference to Figure 2.2, describe the effect of different ER gene copy number on
the women. [2]
c) Suggest an explanation as to why patient 2 developed cancer despite a low copy number.
[1]
5
1531
[Total: 10 marks]
6
1532
Question 3
a) A homozygous dominant black mouse was crossed with a homozygous recessive white
mouse. All the F1 offspring were black. When the F1 offspring were selfed, the ratio of black
to brown to white mice was 9:3:4.
7
1533
c) Table 3.1 shows the inheritance of kernel colour in wheat when 2 intermediate parents
were crossed. (AaBbCc x AaBbCc). The offspring contain seven different shades of kernel
color based on the number of capital letters in each genotype. The higher the number of
capital letters, the darker the shade of the wheat kernel.
ABC 6 5 5 5 4 4 3
ABc 5 4 4 3 4 3 3 2
AbC 5 4 4 3 4 3 3 2
Abc 4 3 3 2 3 2 2 1
aBC 5 4 4 3 4 3 3 2
aBc 4 3 3 2 3 2 2 1
abC 4 3 3 2 3 2 2 1
abc 3 2 2 1 2 1 1 0
Table 3.1
[Total: 10 marks]
8
1534
Question 4
a) Antibiotic medications are used to kill bacteria, which can cause illness and disease. They
have made a major contribution to human health. Many diseases that once killed people can
now be treated effectively with antibiotics. However, some bacteria have become resistant to
commonly used antibiotics.
Antibiotic resistant bacteria are bacteria that are not controlled or killed by antibiotics. Due to
mutation, they are able to survive and even multiply in the presence of an antibiotic. Most
infection-causing bacteria can become resistant to at least some antibiotics. Bacteria that
are resistant to many antibiotics are known as multi-drug resistant organisms (MROs).
Antibiotic resistance can cause serious disease and is an important public health problem. It
can be prevented by minimising unnecessary prescribing and overprescribing of antibiotics,
the correct use of prescribed antibiotics, and good hygiene and infection control.
i) Explain why a mutation acquired by a bacteria will most certainly affect its pheonotype. [2]
ii) Explain how natural selection has led to the emergence of such antibiotic resistant
bacteria. [4]
9
1535
b) According to the Red Queen hypothesis, sexual reproduction persists because it enables
many species to rapidly evolve new genetic defenses against parasites that attempt to live
off them.
Scientists have tested this idea by observing different groups of small fish Poecilopsis
species (Gila Topminnow) in Mexico.
Topminnows are constantly parasitized by black spot disease caused by black spot worms
that encyst in the skin. Parasitized topminnows rarely survive. The researchers found that
identical populations of the asexually reproducing topminnows harbored many more black-
spot worms than those reproducing sexually, a finding that fit the Red Queen hypothesis: the
sexual topminnows could devise new defenses faster by recombination than the asexually
reproducing clones.
However, it was observed that after a drought, the sexually reproducing topminnows were
more heavily parasitized than the cloned topminnows. This process of whereby chance
events cause the allele frequency to change unpredictably is known as genetic drift.
i)With reference to the example of topminnow, explain the concept of genetic drift and how it
can alter the populations gene pool significantly. [2]
10
1536
ii) Topminnows are brought by man to a new place with totally different environmental
conditions. Over time, speciation occurs and a new species of fish related to the topminnows
is discovered.
Explain how speciation occurred to give rise to the new species of fish. [2]
[Total: 10 marks]
11
1537
Question 5
Figure 5.1 shows a root tip of the onion plant. The meristematic region contains cells
undergoing rapid nuclear division.
Figure 5.1
(a) Explain the function of the type of nuclear division that is occurring in the cells found in
the meristematic region in Figure 5.1. [3]
12
1538
(b) Describe how two distinct daughter cells are formed at the end of nuclear division. [2]
A researcher randomly extracted two meristematic cells. He proceeded to analyse them and
found them to be genetically non-identical. He concluded and wrote down in his research log
book that this was due to independent assortment of chromosomes before non-identical
sister chromatids are pulled apart to opposite poles of the dividing cell.
(c) Do you agree with the researchers conclusion? Explain why. [3]
The graph in Figure 5.2 shows the amount of DNA in the nuclei of cells taken from the
meristematic region of the onion plant.
Figure 5.2
13
1539
(d) With reference to Figure 5.2, state precisely the molecular process that accounts for the
change in DNA amount in the nuclei of cells from 4au to 8 au. [1]
[Total: 13 marks]
14
1540
Question 6
(a) Figure 6.1 shows a generalized graph of the relationship between HIV copies and CD4
counts over the average course of untreated HIV infection.
+
CD4 Lymphocyte count (cells per L)
HIV RNA copies per mL of plasma
Figure 6.1
i) Describe the relationship between the graph of CD4+ Lymphocyte count and the
graph of HIV RNA copies. [1]
15
1541
iii) As indicated in the graph above, clinical latency refers to the period where HIV
infection remains undetected and patients are mostly symptom free.
Explain how the HIV virus enables itself to remain undetected during clinical latency.
[2]
(b) A population of E.Coli was grown on a culture medium containing a mixture of glucose
and lactose for over 4 hours. The growth curve was plotted onto the graph in Figure 6.2 as
shown.
Sugar B
metabolized
Sugar A
metabolized X
Figure 6.2
16
1542
ii) Outline the events that are taking place along the lac operon of E coli during the
metabolism of sugar after 3 hours. [4]
iii) Suggest an explanation for the plateau marked X in Figure 6.2. [1]
[Total: 13 marks]
17
1543
Question 7
Figure 7.1
i) Explain the difference in the shape of the graphs for Plant A and Plant B in Figure
7.1. [4]
18
1544
b) Plant B was extracted and placed into another environment. Conditions of the previous
and new environments are tabled below in Figure 7.2.
Condition Quantity
Previous New
Environment Environment
Amount of light 80% 0%
Amount of CO2 50% 0%
Amount of O2 21% 21%
Water availability Yes Yes
Figure 7.2
iii) Predict and explain briefly how the level of NADP+ and NAD+ in Plant B in this new
environment compares to that in the previous environment in part a) of the question.
[2]
[Total: 10 marks]
19
1545
Question 8
Radioactively-labelled amino acids were introduced into Cell A and Cell B. The muddle-
headed researcher could not recall the identities of the cells, which was either the gastric
epithelial cell or the cardiac muscle cell. The amount of radioactivity within three organelles
(golgi apparatus, ribosomes, rough endoplasmic reticulum) in both cells were monitored over
45 min and tabled as shown in Figure 8.1.
Radioactive levels / au
Cell A Cell B
0 min 15 min 30 min 45 min 0 min 15 min 30 min 45 min
Organelle 0 80 50 10 0 80 10 0
X
Organelle 0 0 20 15 0 60 25 5
Y
Organelle 0 0 0 5 0 0 60 20
Z
Figure 8.1
(b) Identify the cell types of cells A and B and explain your answer. [3]
[Total: 4 marks]
20
1546
Your answers should be illustrated by large, clearly labeled diagrams, where appropriate.
Your answers must be set out in sections (a), (b), etc as indicated in the question.
Question 9
a) Outline the differences between prokaryotic control of gene expression with the
eukaryotic model. [7]
c) Explain how the molecular structure of the axon membrane facilitates nervous
transmission along the axon. [8]
Question 10
c) Describe the processes through which genetic diversity can be achieved in bacteria.
[10]
END OF PAPER
21
1547
BLANK PAGE
22
1548
Question 1
Gene expression refers to genes being turned on and producing a product. The product
could be an enzyme, a structural protein, or a control molecule.
Eukaryotes can regulate their gene expression at various levels whereas prokaryotes
regulate gene expression predominantly at the transcriptional level.
OR
Post transcriptional modification in eukaryotes involve the addition of the 5 guanosine cap,
splicing as well as the addition of the 3 polyA tail. Explain what will happen to resulting
protein structure if a mutation occurs at the splice site of an intron. [3]
1. Small nuclear ribonucleoproteins (snRNPs) will not be able to recognize and bind to
splice site of the intron on the mRNA;
1. spliceosome (pre-mRNA-snRNP complex) is not formed;
2. Thus the intron is not excised out;
3. and the mature mRNA formed is longer than normal;to be translated to a much
longer polypeptide than usual;
4. which will not be folded to the same 3D conformation as the normal protein; on
functional protein
1549
d) Name and describe the process that is shown in Figure 1.1. [3]
Alternative splicing
Spliceosomes recognize the intron- exon junctions and remove all the introns;
Different pre-mRNA can be spliced into different mature mRNA by the inclusion of
different sets of exons
Resulting in different polypeptides
Question 2
a) Sex hormone estrogen promotes mammary epithelial cell proliferation by stimulating the
expression of genes encoding cell cycle regulatory proteins. Estrogen receptors (ER) are
intracellular receptors of estrogen. Estrogen-receptor complexes bind to estrogen response
elements (ERE) in enhancers. Estrogenic control of the cell cycle occurs by increasing the
expression of cyclin and myc C which promote cell cycle progression.
Figure 2.1
transcriptional level;
1551
ii) describe and explain how estrogen regulates gene expression. [4]
increases rate of transcription of cyclin and myc Cwhich causes cell division.
b) There are two isoforms of estrogen receptors: ER and ER encoded by different genes.
Genomic DNA samples taken from women suffering from breast cancer were analysed for
the gene copy number present for the ER gene.
Figure 2.2
1552
i) With reference to the Figure 2.2, describe the effect different ER gene copy number on
the women. [2]
Woman 2 and 5 had 1 copy of the gene but woman 2 had cancer while
woman 5 did not suffer from cancer
c) Suggest an explanation as to why patient 2 developed cancer despite a low copy number.
[1]
Loss of function of tumour suppressor genes both copies or alleles NOT both genes
[Total: 10 marks]
1553
Question 3
a) A homozygous black mouse was crossed with a homozygous recessive white mouse. All
the F1 offspring were black. When the F1 offspring were selfed, the ratio of black to brown to
white was 9:3:4.
F1 genotype AaBb
F1 phenotype AaBb x AaBb
Gametes AB AB
Ab Ab
aB aB
ab ab
Punett Square
AB Ab aB Ab
AB AABB AABb AaBB AaBb
black black black black
Ab AABb AAbb AaBb Aabb
black brown black brown
aB AaBB AaBb aaBB aaBb
black black white white
Ab AaBb Aabb aaBb Aabb
black brown white white
-Recessive epistasis
-2 recessive alleles for gene A will mask the effect of Gene B
-aa_ _ =white
-A_B_=black
-A_bb =brown
c) Table 3.1 shows the inheritance of kernel colour in wheat when 2 intermediate parents
were crossed. (AaBbCc x AaBbCc). The offspring contain seven different shades of kernel
color based on the number of capital letters in each genotype. The higher the number of
capital letters, the darker the shade of the wheat kernel.
ABC 6 5 5 4 5 4 4 3
ABc 5 4 4 3 4 3 3 2
AbC 5 4 4 3 4 3 3 2
Abc 4 3 3 2 3 2 2 1
aBC 5 4 4 3 4 3 3 2
aBc 4 3 3 2 3 2 2 1
abC 4 3 3 2 3 2 2 1
abc 3 2 2 1 2 1 1 0
Table 3.1
Question 4
a) Antibiotic medications are used to kill bacteria, which can cause illness and disease. They
have made a major contribution to human health. Many diseases that once killed people can
now be treated effectively with antibiotics. However, some bacteria have become resistant to
commonly used antibiotics.
Antibiotic resistant bacteria are bacteria that are not controlled or killed by antibiotics. Due to
mutation, they are able to survive and even multiply in the presence of an antibiotic. Most
infection-causing bacteria can become resistant to at least some antibiotics. Bacteria that
are resistant to many antibiotics are known as multi-resistant organisms (MROs).
Antibiotic resistance can cause serious disease and is an important public health problem. It
can be prevented by minimising unnecessary prescribing and overprescribing of antibiotics,
the correct use of prescribed antibiotics, and good hygiene and infection control.
i) Explain why a mutation acquired by a bacteria will most certainly affect its pheonotype. [2]
ii) Explain how natural selection has led to the emergence of such antibiotic resistant
bacteria. [4]
b) According to the Red Queen hypothesis, sexual reproduction persists because it enables
many species to rapidly evolve new genetic defenses against parasites that attempt to live
off them.
Scientists have tested this idea by observing different groups of small fish Poecilopsis
species (Gila Topminnow) in Mexico.
Topminnows are constantly parasitized by black spot disease caused by black spot worms
that encyst in the skin. Parasitized topminnows rarely survive. The researchers found that
identical populations of the asexually reproducing topminnows harbored many more black-
spot worms than did those producing sexually, a finding that fit the Red Queen hypothesis:
the sexual topminnows could devise new defenses faster by recombination than the
asexually producing clones.
However, it was observed that after a drought, the sexually reproducing topminnows were
more heavily parasitized than the cloned topminnows. This process of whereby chance
events cause the allele frequency to change unpredictably is known as genetic drift.
i) With reference to the example of topminnow Explain the concept of genetic drift and how it
can alter the populations gene pool significantly. [2]
-Genetic drift is the random change in allele frequencies due to chance factors/not due to
selection pressure
-Chance factor: Drought
-allele that make them resistant to parasite frequency decrease significantly => eventually
the entire population may be homozygous
1557
ii) Topminnows are brought by man to a new place with totally different environmental
conditions. Over time, speciation occurs and a new species of fish related to the topminnows
is discovered.
Explain how speciation occurred to give rise to the new species of fish. [2]
-Geographical isolation prevent the sub-group from interbreeding with the rest of the
population -> leading to genetic isolation -> no gene flow
-Different selection pressure
[Total: 10 marks]
1558
Question 5
Figure 5.1 shows a root tip of the onion plant. The meristematic region contains cells
undergoing rapid nuclear division.
Figure 5.1
(a) Explain the function of the type of nuclear division that is occurring in the cells found in
the meristematic region in Figure 5.1. [3]
Mitosis
Main function is to maintain genetic stability by maintaining the same number
and type of chromosomes during nuclear division
Thus enabling growth and cell regeneration in the meristamitic region of the
root tip.
(max 3)
1559
(b) Describe how two distinct daughter cells are formed at the end of nuclear division. [2]
Cytokinesis occurs
Golgi vesicles containing cellulose move along microtubules to the middle of
the cell;
Membranes of golgi vesicles fuse, cellulose deposited forms cell plate that
extends across the equator, forming two distinct daughter cells.
(max 2)
A researcher randomly extracted two meristematic cells. He proceeded to analyse them and
found them to be genetically non-identical. He concluded and wrote down in his research log
book that this was due to independent assortment of chromosomes before non-identical
sister chromatids are pulled apart to opposite poles of the dividing cell.
(c) Do you agree with the researchers conclusion? Explain why. [3]
Do not agree/ conclusion was Invalid, because mitosis is occurring in
meristematic cells instead of meiosis.
Independent assortment occurs during metaphase I of meiosis, where
bivalents/ pairs of homologous chromosomes line up randomly in two rows at
the equator.
However, during metaphase of mitosis, chromosomes with identical sister
chromatids align in a single row at the equator thus no independent
assortment occurs.
1560
The graph in Figure 5.2 shows the amount of DNA in the nuclei of cells taken from the
meristematic region of the onion plant.
Figure 5.2
(d) With reference to Figure 5.2, state precisely the molecular process that accounts for the
change in DNA amount in the nuclei of cells from 4au to 8 au. [1]
.
1561
[Total: 13 marks]
1562
Question 6
(a) Figure 6.1 shows a generalized graph of the relationship between HIV copies and CD4
counts over the average course of untreated HIV infection.
+
CD4 Lymphocyte count (cells per L)
HIV RNA copies per mL of plasma
Figure 6.1
i) Describe the relationship between the graph of CD4+ Lymphocyte count and the
graph of HIV RNA copies. [1]
Inverse relationship/ as the graph of CD4+ lymphocyte count decreases, the graph of
HIV RNA copies increases and vice versa.
iii) As indicated in the graph above, clinical latency refers to the period where HIV
infection remains undetected and patients are mostly symptom free.
Explain how the HIV virus enables itself to remain undetected during clinical latency.
[2]
Single stranded RNA genome of the HIV virus is able to be reverse transcribed to
form double stranded cDNA using reverse transcriptase enzyme from HIV virus;
Intergrase enzyme allows double stranded cDNA to be integrated with host cell
genome and replicate as host genome replicates; (not recognised as foreign/ not
transcribed to form viral proteins)
Therefore no clinical symptoms are caused, HIV infection is undetected.
(b) A population of E.Coli was grown on a culture medium containing a mixture of glucose
and lactose for over 4 hours. The growth curve was plotted onto the graph in Figure 6.2 as
shown.
Sugar B
metabolized
Sugar A
metabolized X
Figure 6.2
ii) Outline the events that are taking place along the lac operon of E coli during the
metabolism of sugar after 3 hours. [4]
After 3 hours, concentration of glucose is very low while concentration of lactose is
high, thus cAMP levels increases.
cAMP binds to the allosteric site on CAP, alters CAP to an active conformation.
1564
Active CAP binds to CAP binding site on DNA, bends the DNA to facilitate binding of
RNA polymerase to the promoter of the lac operon for transcription of structural
genes in lac operon.
At the same time, lactose is converted to allolactose inducer by b-galactosidase,
inactivating the lac repressor. Lac repressor does not bind to operator of lac operon.
iii) Suggest an explanation for the plateau marked X in Figure 6.2. [1]
Plateau X indicates a time delay as time is required for the lac operon to be
completely induced and the production of enzymes like beta-galactosidase.
[Total: 13 marks]
1565
Question 7
Figure 7.1
i) Explain the difference in the shape of the graphs for Plant A and Plant B in Figure
7.1. [4]
The maximum rate of photosynthesis in Plant A is higher than that in Plant B.
The horizontal leaves found on the top region of plant B block light from reaching the
leaves at the bottom region of plant B, while the lower leaves in plant A are not
blocked from light.
Hence only the chlorophyll of the leaves in the top region of plant B reach light
saturation point as compared to plant A where chlorophyll in all the leaves can reach
light saturation point eventually.
Less electrons emitted in plant B as compared to plant A, less ATP and NADPH
produced, lower rate of photosynthesis as compared to plant A.
OR
The rate of photosynthesis in plant B reaches a maximum at lower light intensity than
plant A.
The horizontal leaves found on the top region of plant B block light from reaching the
leaves at the bottom region of plant B, while the lower leaves in plant A are not
blocked from light.
At lower light intensity, all the chlorophylls in plant B that are exposed to light reach
light saturation point, while not all the chlorophyll in plant A have reached light
saturation point.
1566
b) Plant B was extracted and placed into another environment. Conditions of the previous
and new environments are tabled below in Figure 7.2.
Condition Quantity
Previous New
Environment Environment
Amount of light 80% 0%
Amount of CO2 50% 0%
Amount of O2 21% 21%
Water availability Yes Yes
Figure 7.2
iii) Predict and explain briefly how the level of NADP+ and NAD+ in Plant B in this new
environment compares to that in the previous environment in part a) of the question.
[2]
In the new environment, aerobic respiration is occurring, NADP+ level increases,
NADP+ is only used up and converted to NADPH during photosynthesis and not
aerobic respiration.
In the new environment, NAD+ level remains similar to that in the previous
environment, aerobic respiration occurs at a constant rate in both environments.
[Total: 10 marks]
1567
Question 8
Radioactively-labelled amino acids were introduced into Cell A and Cell B. The muddle-
headed researcher could not recall the identities of the cells, which was either the gastric
epithelial cell or the cardiac muscle cell. The amount of radioactivity within three organelles
(golgi apparatus, ribosomes, rough endoplasmic reticulum) in both cells were monitored over
45 min and tabled as shown in Figure 8.1.
Radioactive levels / au
Cell A Cell B
0 min 15 min 30 min 45 min 0 min 15 min 30 min 45 min
Organelle 0 80 50 10 0 80 10 0
X
Organelle 0 0 20 15 0 60 25 5
Y
Organelle 0 0 0 5 0 0 60 20
Z
(b) Identify the cell types of cells A and B and explain your answer. [3]
Cell A is the cardiac muscle cell while Cell B is the gastric epithelial cell.
Radioactivity from radioactive amino acids in cell A is mainly found in free ribosomes
(organelle X) and less found in bound ribosomes on RER (organelle Y), thus cell is
not a secretory cell and proteins made remain in the cell.
Radioactivity from radioactive amino acids in cell B is passed from ribosomes in RER
to the RER lumen to the Golgi apparatus, which lies on the secretory pathway of
protein synthesis, thus Cell B is a secretory cell gastric epithelial cell.
Essay
1568
Outline the differences between prokaryotic control of gene expression with the eukaryotic
model. [7]
i Presence of introns No introns no need for post Intorns => need for need
and therefore transcriptional modifications so for post transcriptional
spliceosome no spliceosome modifications
=>spliceosome
1569
Explain how the molecular structure of the axon membrane facilitates nervous
transmission along the axon. [8]
Phospholipid bilayer;
with a hydrophobic core;
Prevents direct entry of charged ions Na+, K+ into the axon;
Allows accumulation of ions on one side of the membrane;
Na+/K+ pump;
Actively transport ions against concentration gradient/ 3 Na+ out and 2 K+ in;
Maintains the resting membrane potential / maintain unequal concentration gradients
of Na+ and K+ across the membrane;
Along with the selective permeability of membrane to K+ over Na+ ions; OR
supported by more leak channels for K+ present than Na+ leak channels on the
membrane;
b) Form functional protein - newly synthesized proteins need to be modified for proper
assembly / functioning
f) E.g. Proteins are linked to ubiquitin that will target a protein for degradation.
j) Eg: modifications at terminus of amino acid chain help target proteins for
transporting to final destination in the cell / move across membranes/ tag proteins to
be incorporated in various cellular and organelle membranes
Question 10
1571
Similarities
I. Involves regeneration of the initial compound, Krebs cycle - oxaloacetate & Calvin
cycle - ribulose bisphosphate (RuBP);
III. Involve co-enzymes as electron and proton carriers, Krebs cycle NAD+ & FAD, In
Calvin cycle reduced NADP / NADPH.
Differences
1. Small genome
2. need to pack all essential genes;
3. save space;
4. Operons are a linear arrangement of genes and its regulatory sites;
5. arrangement allow genes that encode proteins that execute similar functions to
cluster together;
6. allows for proteins performing similar functions to be turn on together;
7. Allow for common mode of regulation;
Able to share common promoter;
c) Describe the processes through which genetic diversity can be achieved in bacteria.
[10]
mutation
Transformation (max 3)
1. Uptake of naked foreign DNA from surrounding external environment into
recipient bacteria cell
2. DNA binds to cell surface, facilitated by DNA binding proteins
3. Nuclease degrades one strand of double stranded foreign donor DNA, single
stranded DNA enters
4. Single stranded DNA is then integrated into the bacterial chromosome by
means of RecA proteins
5. Recombination between homologous regions
6. Can be either artificial or natural process
7. Cells must be competent.
Transduction (max 4)
8. Process by which DNA is transferred from donor bacterial cell to another
recipient by bacteriophages
9. Generalised and Specialised transduction both result from aberrations in the
phage reproductive cycle
10. Generalised transduction: random segment of host bacterial chromosome is
transferred to recipient bacterial cell
11. During assembly stage, a small piece of host cells degraded DNA is
packaged within the phage capsid in place of the phage genome.
12. Transducing phage infects recipient cell, injects the DNA acquired from donor
bacterium into recipient bacterium
13. Donor DNA is integrated into recipient bacterial chromosome by homologous
recombination.
14. Specialised transduction: occurs in temperate bacteriophages, involves
transfer of a specific set of bacterial genes from donor to recipient bacterium.
15. In the lysogenic cycle, the genome of a temperate phage integrates as a
prophage into the host bacteriums chromosome at a specific site.
16. When the phage genome is excised from the host bacteriums chromosomes,
sometimes a small region of the host bacterial DNA adjacent to the prophage
is excised together.
17. The phage DNA that incorporated some bacterial genes replicates and is
packaged to form a specialized transducing phage.
1573
18. Specialized transducing phage released during host cell lysis to infect a
recipient bacterial cell.
19. Foreign bacterial DNA subsequently integrated into the recipient bacterial
chromosome by homologous recombination.
Conjugation (max 3)
20. Transfer of F plasmid from F+ donor to F- recipient cell
21. Via sex pilus / conjugation tube encoded by genes in F plasmid
22. Sex pilus attaches to F- cell and retracts, forming cytoplasmic bridge
23. Nuclease cleaves one strand of double stranded F plasmid at Ori, single
stranded F DNA of F plasmid transferred
24. Rolling circle replication
25. Both cells end up with F plasmid and are thus both F+.
1574
9648
26 August 2013 / Monday
2 hours
Additional materials:
Answer paper
Write your name and index number in the spaces at the top of this page and on all
the work you hand in.
___________________________________________________________________
This question paper consists of 17 printed pages and 1 blank page
1
1575
Question 1
The results for all individuals, except those for the foetus, are shown below the
pedigree chart. The sizes of the DNA fragments obtained are as indicated.
Figure 1.1
i) The diagram below shows the 2 possible alleles of the gene. Indicate with
thick straight lines on the diagram the possible location recognized by the
probe that was added. [1]
RS RS
RS RS RS
ii) Which RFLP fragment did the mother (I-1) contribute to the diseased children?
[1]
2
1576
iii) What is the probability of the foetus having the disease? Explain your answer.
[2]
b) A different study was carried out on another family. Figure 1.2 below shows a
Southern blot with an RFLP detected by using a probe for a sequence located on
a sex chromosome. The variant exhibits two forms, one at 8 kb and one at 6 kb.
The mother, father and daughter are normal.
Figure 1.2
i) From Figure 1.2, deduce which son is abnormal and explain how you arrive
at your answer. [3]
3
1577
c) RFLP is widely used as a tool for disease detection. In disease detection, genetic
markers are often used to predict if a person is likely to suffer from a particular
disease.
i) Explain the features of genetic markers that allowed them to be used for the
indirect analysis of the inheritance of disease. [2]
..
..
..
..
..
..
i) Explain why genes, especially protein-encoding genes, are seldom used for genetic
fingerprinting. [2]
..
..
..
[Total: 11 marks]
4
1578
Question 2
PG production during fruit ripening was measured in plants with one and with two
antisense genes, and in normal plants. The results are shown in Figure. 2.2.
Figure 2.2
i) With reference to Figure 2.2, describe and explain the difference between normal
tomato plants and transformed plant with one anti-sense gene. [4]
..
..
..
..
..
..
[Total: 4 marks]
5
1579
Question 3
The potential difference against time graph was plotted as shown in Figure 3.1 below.
Figure 3.1
..
..
..
..
..
6
1580
ii) With reference to Figure 3.1, identify the cell with cystic fibrosis. Explain your
answer. [3]
..
..
..
..
..
..
iii) Describe how cystic fibrosis can be cured by gene therapy using a non-viral
vector. [4]
..
..
..
..
..
..
..
iv) Suggest two technical challenges preventing the effectiveness of gene therapy
for cystic fibrosis. [2]
..
..
..
..
7
1581
Figure 3.2
i) State two advantages of using the ex vivo method for gene therapy that is
illustrated in Figure 3.2. [2]
..
..
..
ii) Suggest and explain how you can improve the above gene therapy procedure in
order to sustain long-term success of the treatment. [2]
..
..
..
[Total: 15 marks]
8
1582
Question 4
a) There has been rampant speculation that the consumption of genetically modified
(GM) crop and livestock has impacted birth rates in the USA negatively. A study was
carried out in the USA to investigate the claim. Figure 4.1 shows a graphical plot of
the data obtained.
Figure 4.1
ii) Describe two threats that GM food can pose to human health. [2]
9
1583
b) The effectiveness of CpTi against insect pests was tested using two groups of
tobacco plants.
Equal numbers of each type of plant were infested with equal numbers of newly
hatched larvae of an insect pest and left for seven days.
The mean percentage of leaf area eaten and the mean mass of surviving insects
were then found. The results are shown in Figure. 4.2.
Figure 4.2
10
1584
ii) CpTi is a trypsin inhibitor. Suggest an explanation of the effect of the trypsin
inhibitor, CpTi, on insects.[3]
[Total: 10 marks]
11
1585
A millionaire has recently passed on and news of his death has become the talk of
the town. The deceased old man was known to be childless and thus his massive
fortune amounting $100 million was willed and donated to help the less fortunate
orphans at Chen Su Lan Childrens Home.
However, three days after his death, a man named Bernard Soon has stepped
forward and claimed to be his son. According to Bernard Soons allegations, the
deceased millionaire had an affair with his mother during a year-long work trip in the
1930s. However, both had lost contact over the years and had not met since. Mr
Bernard Soon has claimed that he has a picture of the millionaire and his mother, as
well as his mothers ring with the millionaires initials engraved onto it. Due to the
large amount of money involved, this case has been covered at length by the media.
Bernard Soon has hired you as the lead researcher to prove his identity. Plan an
investigation using RFLP analyses to confirm that Bernard Soon is indeed the son of
the millionaire.
Your planning must be based on the assumption that you have been provided the
following equipment and materials:
12
1586
13
1587
14
1588
15
1589
16
1590
b) Using specific example(s), compare viral and non-viral delivery systems in the
delivery of a functional CFTR allele.[6]
c) Describe the advantages and limitations of the Polymerase Chain Reaction (PCR).
[4]
END OF PAPER
17
1591
BLANK PAGE
18
1592
Question 1
The results for all individuals, except those for the foetus, are shown below the
pedigree chart. The sizes of the DNA fragments obtained are as indicated.
Figure 1.1
i) The diagram below shows the 2 possible alleles of the gene. Indicate on the
diagram the possible location recognized by the probe that was added. [2]
RS RS
RS RS RS
Which RFLP fragment did the mother (I-1) contribute to the diseased children? [1]
10 kb fragment
1593
ii) What is the probability of the foetus having the disease? Explain your answer. [2]
50% or probability
Mothers genotype is heterozygote; fathers genotype is homozygous recessive
so chance of receiving dominant allele
b) A different study was carried out on another family. Figure 1.2 below shows a
Southern blot with an RFLP detected by using a probe for a sequence located on a
sex chromosome. The variant exhibits two forms, one at 8 kb and one at 6 kb. The
mother, father and daughter are normal.
Figure 1.2
From Figure 1.2, deduce which son is abnormal and explain how you arrive at our
answer. [3]
1. Son 1
2. Sex linked disease. Y chromosome does not carry any allele FOR SEX LINKED
diseases. Hence male should only exhibit one band.
c) RFLP is widely used as a tool for disease detection. In disease detection, genetic
markers are often used to predict if a person is likely to suffer from a particular
disease.
i) Explain the features of genetic markers that allowed them to be used for the
indirect analysing of the inheritance of disease. [3]
i) Explain why genes especially protein-encoding genes are seldom used for genetic
fingerprinting. [2]
2. not able to differentiate between individuals if you use protein encoding region
[Total: 11 marks]
1595
Question 2
PG production during fruit ripening was measured in plants with one and with two
antisense genes, and in normal plants. The results are shown in Figure. 2.2.
Figure 2.2
With reference to Figure 2.2, describe and explain the difference between
normal tomato plants and transformed plant with one anti-sense gene. [4]
Question 3
In the lab, researchers performed experiments on two groups of nasal epithelial cells,
X and Y. To observe changes in nasal potential difference, the researchers perfused
a solution of amiloride (Am) into the nasal activity, followed by the subsequent
perfusion of the nasal cavity with a low chloride solution (LC).
The potential difference against time graph was plotted as shown in Figure 3.1 below.
Figure 3.1
ii) With reference to Figure 3.1, identify the cell with cystic fibrosis. Explain your
answer. [3]
Cell Y
The graph for cell Y did not show a positive spike/ change in potential
difference unlike the graph for cell X when LC (low chloride solution) was
perfused into nasal cavity, hence showing that chloride channels failed to
open properly and chloride ions could not exit cell.
Due to mutation of the CFTR gene that encodes a mutant CFTR channel
protein that does not allow movement of chloride ions thus no change in
potential difference.
iii) Describe how cystic fibrosis can be cured by gene therapy using a non-viral
vector. [4]
In vivo gene therapy method
Functional allele coding for CFTR on chromosome 7 is isolated from a
normal individual
Aerosol spray containing liposomes with the normal allele can be sprayed
into the nose and moith of CF patients
Membrane of liposomes fuse with the cell membrane of target lung
epithelial cells, releasing the normal CFTR allele into cytoplasm via
endocytosis
Normal CFTR protein is expressed and incorporated into target cells
membrane.
iv) Suggest two technical challenges preventing the effectiveness of gene therapy
for cystic fibrosis. [2]
Gene therapy is short-lived as target cells for CF treatment are epithelial
cells that are constantly being shed, thus repeat therapy is likely to be
required.
Use of viral vectors (adenovirus) can trigger host immune response.
Other less accessible organs like the liver and pancreas are also affected
by CF and is difficult for therapy to reach effectively.
Liposomes are not specific in their action and thus have a low
transfection efficiency.
(max 2)
1598
Figure 3.2
i) State two advantages of using the ex vivo method for gene therapy that is
illustrated in Figure 3.2. [2]
Allows for selection of successfully transfected cells;
Ease of transfection and culture of T lymphocytes in the lab;
Specific approach ensures that retrovirus targets the T lymphocytes
instead of other cells in the body.
ii) Suggest and explain how you can improve the above gene therapy procedure in
order to sustain long-term success of the treatment. [2]
Use blood stem cells extracted from bone marrow apart instead of T
lymphocytes.
Blood stem cells are able to differentiate into T lymphocytes and show
long-term self renewal so as to provide a sustained cure
1599
Question 4
a) There has been rampant speculation that the consumption of genetically modified
(GM) crop and livestock has impacted birth rates in the USA negatively. A study was
carried out in the USA to investigate the claim. Figure 4.1 shows a graphical plot of
the data obtained.
Figure 4.1
ii) Describe two threats that GM food can pose to human health. [2]
Vectors used in the process of engineering GM food might contain
antibiotic resistance that may be passed on to bacteria like E Coli in the
human gut.
GM food might contain allergens and can cause unwanted allergic
reactions in the body.
1600
b) The effectiveness of CpTi against insect pests was tested using two groups of
tobacco plants.
Equal numbers of each type of plant were infested with equal numbers of newly
hatched larvae of an insect pest and left for seven days.
The mean percentage of leaf area eaten and the mean mass of surviving insects
were then found. The results are shown in Figure. 4.2.
Figure 4.2
(ii) Suggest an explanation of the effect of the trypsin inhibitor, CpTi, on insects.
Refer to the lack of digestion of protein.
Enzyme inhibition, hence active sites not able to bind to substrate.
Insects would dies of malnutrition or starvation
[Total: 10 marks]
1601
Free-response question
2. Introduction of recombinant DNA molecule into living host (e.g. bacteria) [2 marks
max]
Via transformation;
Method of transformation;
Reason of method (to create permeability/ transient enlargement of pores);
Purpose of living host (provide enzyme machinery);
b) Using specific example(s), compare viral and non-viral delivery systems in the
delivery of a functional CFTR allele.[6]
Introductory statement:
Viral delivery systems for treatment of cystic fibrosis involves the use of
adenoviruses and adeno-associated viruses; Non-viral delivery system for
treatment of cystic fibrosis involves use of liposomes OR gene gun;
Similiarities:
Differences:
c) Describe the advantages and limitations of the Polymerase Chain Reaction (PCR).
[4]
Advantage:
sensitive;
amplification possible from trace amount of template DNA;
fast/efficient method of testing as 35 40 PCR cycles can be completed in several
hours/(ref to short times required for each PCR segment); [R: fast/efficient without any
elaboration];
use of thermostable DNA polymerase allows for automation of procedure without need
to add polymerase for every cycle;
allows amplification/replication of selected target region of DNA flanked
by/usingspecific PCR primers;
Programmable thermal cycler allows automation of PCR;
faster method of amplifying/cloning DNA sequence than conventional cell-based
cloning;
Reject: create many copies of DNA using small sample, sensitive allowing amplification of
small DNA
Disadvantage:
sensitive to contamination of template DNA by foreign/non-target nucleic acids;
may give false positives;
requires careful handling to prevent contamination;
by non-target nucleic acids;
Use of Taq DNA polymerase; may result in misincorporation errors in PCR products; as
(Taq DNA polymerase) lacks proof-reading activity / 35 exonuclease activity (to correct
misincorporated bases);
Needs preliminary knowledge of part of/nature of target sequence; before specific primers
can be designed;
Mutations in regions complementary to primer(s) may cause reduction in
annealing/amplification efficiency;
PCR products labile/unstable as they are not associated with histones;
1604
Procedure:
4. Taq polymerase.
5. Heat DNA mixture (95 oC)
separate double-stranded DNA into 2 complementary single-stranded DNA.
break hydrogen .
6. Cool (55 oC)
primer hybridization to DNA template, primer provide 3OH end
7. (72 oC) Replication and extension of the DNA in 5 to 3 direction
8. Each cycle is repeated. exponential increase of target DNA sequences.
10. Negatively charged DNA molecules will migrate toward the positive end of the
field (anode).
11. Separated according to their molecular size.
12. The smaller molecules move faster than the larger one
Probing [max 1]
Visualization [max1]
Conclusion [max1]
20. If Bernard Soon is indeed the child of the billionaire, then his RFLP bands
should match either the billionaires or his mothers/his bands should eb
accounted for by the billionaire or his mother.
1606
2
CANDIDATE
NAME
CIVICS GROUP 1 2
TUTOR
NAME
Biology 9648/ 01
Paper 1 Multiple Choice Tuesday, 24 September 2013
1 hour 15 minutes
Additional Materials: Optical Answer Sheet (OAS)
Write your name and Civics Group in the spaces at the top of this page and on any separate writing
paper used.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
J E
Match the organelles E, F, G, H and J associated with the cellular processes listed.
E F G H J
D Enzymes may require a non-protein cofactor or ion for catalysis to take place.
6. Which of the following does not describe the active site of an enzyme?
3 TTACGCTTCGAAATAGGAATATCATAGGCT 5
This sequence is cloned into a plasmid and transformed into a suitable host. What would
be the first four amino acids of a polypeptide generated from this sequence as expressed
by the host?
The mRNA codons for some amino acids are shown in the table below:
Arg CGA, CGG, AGA, AGG Leu CUU, CUC, CUA, CUG
Asp GAU, GAC Lys AAA, AAG
Ile AUU, AUC, AUA Phe UUU, UUC
Start AUG Ser UCA, UCG, AGU, AGC
Stop UAG, UGA, UAA Tyr UAU, UAC
A Met-Arg-Ser-Phe
B Met-Arg-Ser-Lys
C Met-Ile-Phe-Leu
D Met-Tyr-Lys-Asp.
10. Cells treated with colchicine often mutate. They fail to produce spindles during cell
division. What would be the result of this?
A chromosome deletion
B chromosome translocation
C gene deletion
D polyploidy
L M N P
L -- 0.18 0.10 0.20
M -- 0.15 0.37
N -- 0.24
P --
A L, M, N, P
B N, M, P, L
C M, L, P, N
D P, L, N, M
12. During a viral infection, attachment is usually specific to a particular cell type because
A the virus is attracted to the appropriate host cells by proteins secreted into the
extracellular fluid.
B the virus recognises and binds to specific molecules in the cytoplasm of the host
cell.
C the virus recognises and binds to specific molecules on the surface of the host
cell.
D the host cell produces channel proteins that provide passageways for the viruses
to enter the cytoplasm.
13. When glucose is absent and lactose is present, lactose binds to the operon's repressor.
Which statement best describes what happens subsequently?
Species 1 Species 2
A D
B C E F
A Bacterium D is resistant to penicillin due the transfer of the complete F plasmid and
penicillin resistant gene through transduction involving Bacterium A.
B Bacterium D is resistant to penicillin due to horizontal gene transfer involving a
bacteriophage and Bacterium A.
C Bacterium E acquired resistance to penicillin as a result of random mutation and
genetic transformation.
D Bacteria E and F are resistant to penicillin as a result of conjugation from Bacterium
D.
A 1 4 2 3
B 1 4 3 2
C 2 1 4 3
D 3 1 4 2
16. Skin colour in a variety of pumpkins is controlled by two pairs of alleles, Pp and Rr, which
segregate independently.
The allele P is dominant and must be present for the development of pigmentation in the
skin. Pumpkins without pigment are white. Allele R is dominant and produces a red
pigment in the skin. The recessive allele r gives a yellow colour.
A PPRR
B PpRR
C PPRr
D Pprr
17. Studies on the giant axon of the squid showed that bacteria toxin BAXIN results in an
increase in negativity of the postsynaptic membrane. What is the possible mode of action
of BAXIN?
B Analog of acetylcholine
D Mimicking of cholinesterase
18. The diagram shows the sequence of events occurring as an action potential arrives at the
synapse. The numbered arrows represent the movement of substances across the
membranes.
1 2 3 4 5
A K+ Na+ acetylcholine Ca+ K+
B K+ Na+ Ca+ acetylcholinesterase acetylcholine
C Na+ K+ Ca+ acetylcholine Na+
D Na+ K+ acetylcholinesterase acetylcholine Ca+
19. The diagram shows how a nerve cell and an endocrine cell interact with cell X and cell Y
respectively.
20. In the experiment shown in the diagram, the oxygen given off at X and Y will be labelled
with the isotopes _____ and _____ respectively.
X Y
16 16
A O O
16 18
B O O
18 16
C O O
18 18
D O O
22. To what extent can glucose be oxidised by the soluble portion of cytoplasm of muscle
cells, from which all organelles have been removed?
A Acetyl-CoA but no further
B Carbon dioxide and water
C Lactate but no further
D Pyruvate but no further
23. In which of the following changes is most energy released during the metabolism of
carbohydrates?
A Maltose to glucose
B Glucose to phosphoglyceraldehyde
24. Which of the following is true of gene regulation in both prokaryotes and eukaryotes?
A 3 2 4 5 1
B 3 4 2 1 5
C 4 2 3 5 1
D 4 3 2 1 5
26. As shown in the diagram below, acetylation of histones promotes loose chromatin
structure. Recent evidence has shown that chemical modification of histones play a direct
role in regulation of gene expression. Suggest how this works.
27. The hormone insulin binds to the tyrosine kinase receptors and initiates various signal
transduction pathway to generate cellular responses. Which of the following shows the
TPJC 9648/01/JC2 Prelim/2013 [Turn Over
1618
13
correct sequence of events, following the binding of insulin to the receptor?
A a,b,c
B c,b,a
C b,a,c
D c,a,b
29. Which of the following is a similarity between G-protein-linked receptors and tyrosine-
kinase receptors?
30. Which of the following increases the number of different alleles in a population?
A crossing over
B gene mutation
C random fusion of gametes
D random assortment of chromosomes in meiosis
31. The graph below shows data on a population of a species of moth which shows
32. Approximately 1 in 20 Europeans are heterozygous for a recessive allele responsible for
the genetic condition, cystic fibrosis (CF). People who are homozygous for CF have a
reduced life expectancy. Heterozygotes are more resistant to some bacterial infections of
the gut, such as typhoid fever, than homozygotes for the normal, dominant allele.
What could explain the high incidence of the recessive CF allele in the European
population?
D Mutation
33. What is one similarity and one difference between classification and phylogeny?
A Both organise organisms into groups based on their characteristics but phylogeny
takes into consideration the evolutionary relationships between groups.
C Both rely on physical characteristics of organisms but phylogeny does not require
scientific names.
D Both take into account the common ancestors of organisms but classification is
hierachical in nature.
34. Which uses of the information from the human genome project are generally considered
to be unethical?
A 1 and 3
B 1 and 6
C 2 and 5
D 3 and 4
35. The insulin gene and a plasmid with ampicilin and tetracycline resistant genes were cut
Three replica plates containing different antibiotics were obtained from the master plate.
The diagram below shows the results of the replica plates.
36. A student performed an experiment to determine if a particular gene has been inserted in
A ii iii i v iv.
B ii iii i iv v.
C iv v i ii iii.
D iii i ii iv v.
37. The genetically engineered super salmon was created from Atlantic salmon stocks and
are capable of growing to a large size in 14 months. Which of the following is not a
benefit intended from the crop?
B Minimising pollution
Which of the following options is not a characteristic of the form of treatment shown
above?
39. Germ-line gene therapy has not been prevalent in medical treatment because of many
reasons. Which of the following is/are implications of germ-line therapy?
40. A possible route of escape of an inserted gene from a genetically engineered crop of oil-
seed rape, Brassica napus, is into populations of the wild turnip, Brassica rapa.
Two populations of wild turnip growing next to large fields of a cultivar of oil-seed rape
were studied. Seeds were collected from these wild turnips plants and their DNA
analysed using restriction enzymes and electrophoresis.
T: P x Q
T: P x R
C T only QxR iv v i
2
CANDIDATE
NAME
CIVICS GROUP 1 2
TUTOR
NAME
Biology 9648/ 01
Paper 1 Multiple Choice Tuesday, 24 September 2013
1 hour 15 minutes
Additional Materials: Optical Answer Sheet (OAS)
Write your name and Civics Group in the spaces at the top of this page and on any separate writing
paper used.
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
J E
Match the organelles E, F, G, H and J associated with the cellular processes listed.
E F G H J
D Enzymes may require a non-protein cofactor or ion for catalysis to take place.
6. Which of the following does not describe the active site of an enzyme?
3 TTACGCTTCGAAATAGGAATATCATAGGCT 5
This sequence is cloned into a plasmid and transformed into a suitable host. What would
be the first four amino acids of a polypeptide generated from this sequence as expressed
by the host?
The mRNA codons for some amino acids are shown in the table below:
Arg CGA, CGG, AGA, AGG Leu CUU, CUC, CUA, CUG
Asp GAU, GAC Lys AAA, AAG
Ile AUU, AUC, AUA Phe UUU, UUC
Start AUG Ser UCA, UCG, AGU, AGC
Stop UAG, UGA, UAA Tyr UAU, UAC
A Met-Arg-Ser-Phe
B Met-Arg-Ser-Lys
C Met-Ile-Phe-Leu
D Met-Tyr-Lys-Asp.
10. Cells treated with colchicine often mutate. They fail to produce spindles during cell
division. What would be the result of this?
A chromosome deletion
B chromosome translocation
C gene deletion
D polyploidy
L M N P
L -- 0.18 0.10 0.20
M -- 0.15 0.37
N -- 0.24
P --
A L, M, N, P
B N, M, P, L
C M, L, P, N
D P, L, N, M
12. During a viral infection, attachment is usually specific to a particular cell type because
A the virus is attracted to the appropriate host cells by proteins secreted into the
extracellular fluid.
B the virus recognises and binds to specific molecules in the cytoplasm of the host
cell.
C the virus recognises and binds to specific molecules on the surface of the host
cell.
D the host cell produces channel proteins that provide passageways for the viruses
to enter the cytoplasm.
13. When glucose is absent and lactose is present, lactose binds to the operon's repressor.
Which statement best describes what happens subsequently?
Species 1 Species 2
A D
B C E F
A Bacterium D is resistant to penicillin due the transfer of the complete F plasmid and
penicillin resistant gene through transduction involving Bacterium A.
B Bacterium D is resistant to penicillin due to horizontal gene transfer involving a
bacteriophage and Bacterium A.
C Bacterium E acquired resistance to penicillin as a result of random mutation and
genetic transformation.
D Bacteria E and F are resistant to penicillin as a result of conjugation from Bacterium
D.
A 1 4 2 3
B 1 4 3 2
C 2 1 4 3
D 3 1 4 2
16. Skin colour in a variety of pumpkins is controlled by two pairs of alleles, Pp and Rr, which
segregate independently.
The allele P is dominant and must be present for the development of pigmentation in the
skin. Pumpkins without pigment are white. Allele R is dominant and produces a red
pigment in the skin. The recessive allele r gives a yellow colour.
A PPRR
B PpRR
C PPRr
D Pprr
17. Studies on the giant axon of the squid showed that bacteria toxin BAXIN results in an
increase in negativity of the postsynaptic membrane. What is the possible mode of action
of BAXIN?
B Analog of acetylcholine
D Mimicking of cholinesterase
18. The diagram shows the sequence of events occurring as an action potential arrives at the
synapse. The numbered arrows represent the movement of substances across the
membranes.
1 2 3 4 5
A K+ Na+ acetylcholine Ca+ K+
B K+ Na+ Ca+ acetylcholinesterase acetylcholine
C Na+ K+ Ca+ acetylcholine Na+
D Na+ K+ acetylcholinesterase acetylcholine Ca+
19. The diagram shows how a nerve cell and an endocrine cell interact with cell X and cell Y
respectively.
20. In the experiment shown in the diagram, the oxygen given off at X and Y will be labelled
with the isotopes _____ and _____ respectively.
X Y
16 16
A O O
16 18
B O O
18 16
C O O
18 18
D O O
22. To what extent can glucose be oxidised by the soluble portion of cytoplasm of muscle
cells, from which all organelles have been removed?
A Acetyl-CoA but no further
B Carbon dioxide and water
C Lactate but no further
D Pyruvate but no further
23. In which of the following changes is most energy released during the metabolism of
carbohydrates?
A Maltose to glucose
B Glucose to phosphoglyceraldehyde
24. Which of the following is true of gene regulation in both prokaryotes and eukaryotes?
A 3 2 4 5 1
B 3 4 2 1 5
C 4 2 3 5 1
D 4 3 2 1 5
26. As shown in the diagram below, acetylation of histones promotes loose chromatin
structure. Recent evidence has shown that chemical modification of histones play a direct
role in regulation of gene expression. Suggest how this works.
27. The hormone insulin binds to the tyrosine kinase receptors and initiates various signal
transduction pathway to generate cellular responses. Which of the following shows the
TPJC 9648/01/JC2 Prelim/2013 [Turn Over
1637
13
correct sequence of events, following the binding of insulin to the receptor?
A a,b,c
B c,b,a
C b,a,c
D c,a,b
29. Which of the following is a similarity between G-protein-linked receptors and tyrosine-
kinase receptors?
30. Which of the following increases the number of different alleles in a population?
A crossing over
B gene mutation
C random fusion of gametes
D random assortment of chromosomes in meiosis
31. The graph below shows data on a population of a species of moth which shows
32. Approximately 1 in 20 Europeans are heterozygous for a recessive allele responsible for
the genetic condition, cystic fibrosis (CF). People who are homozygous for CF have a
reduced life expectancy. Heterozygotes are more resistant to some bacterial infections of
the gut, such as typhoid fever, than homozygotes for the normal, dominant allele.
What could explain the high incidence of the recessive CF allele in the European
population?
D Mutation
33. What is one similarity and one difference between classification and phylogeny?
A Both organise organisms into groups based on their characteristics but phylogeny
takes into consideration the evolutionary relationships between groups.
C Both rely on physical characteristics of organisms but phylogeny does not require
scientific names.
D Both take into account the common ancestors of organisms but classification is
hierachical in nature.
34. Which uses of the information from the human genome project are generally considered
to be unethical?
A 1 and 3
B 1 and 6
C 2 and 5
D 3 and 4
35. The insulin gene and a plasmid with ampicilin and tetracycline resistant genes were cut
Three replica plates containing different antibiotics were obtained from the master plate.
The diagram below shows the results of the replica plates.
36. A student performed an experiment to determine if a particular gene has been inserted in
A ii iii i v iv.
B ii iii i iv v.
C iv v i ii iii.
D iii i ii iv v.
37. The genetically engineered super salmon was created from Atlantic salmon stocks and
are capable of growing to a large size in 14 months. Which of the following is not a
benefit intended from the crop?
B Minimising pollution
Which of the following options is not a characteristic of the form of treatment shown
above?
39. Germ-line gene therapy has not been prevalent in medical treatment because of many
reasons. Which of the following is/are implications of germ-line therapy?
40. A possible route of escape of an inserted gene from a genetically engineered crop of oil-
seed rape, Brassica napus, is into populations of the wild turnip, Brassica rapa.
Two populations of wild turnip growing next to large fields of a cultivar of oil-seed rape
were studied. Seeds were collected from these wild turnips plants and their DNA
analysed using restriction enzymes and electrophoresis.
T: P x Q
T: P x R
C T only QxR iv v i
2
CANDIDATE
NAME
CIVICS
GROUP
1 2
TUTOR
NAME
Biology 9648/ 02
Paper 2 Monday, 2 September 2013
2 hours
Candidates answer on the Question Paper
Additional Materials: Writing Paper
3 17
Section A
4 11
Answer all questions.
Section B 5 10
7 13
Section B
The number of marks is given in brackets [ ] at the end of each 20
8 OR
question or part question.
9 20
Total 100
Fig. 1.1 shows a simplistic outline of the processes of mitosis and meiosis.
(a) State four ways in which the behavior of chromosomes in meiosis differs from their behavior in mitosis.
[4]
Fig. 1.2
(a) With reference to Fig. 1.2, suggest the genetic disorder(s) the person whose karyotype is shown is
suffering from. [1]
(b) Describe the aberration that has occurred during cell and nuclear division that has resulted in the
inheritance of the extra chromosomes. [3]
[Total: 10]
Fig. 2.1 is a diagram showing part of a bacterial chromosome with a single origin of replication and two
replication forks which proceed in opposite directions until replication of the entire bacterial chromosome is
complete.
Fig. 2.1
(a) With reference to Fig. 2.1, explain why this replication is said to be semi-conservative. [2]
(b) With reference to Fig. 2.1, replication only occurs in a 5 to 3 direction, explain why this is so. [2]
Fig. 2.2
(d) Explain how telomeres shorten with each cell division. [3]
[Total: 10]
Fig. 3.1 shows a signaling pathway involving Ras protein, a proto-oncogene. Ras protein is involved in the
activation of PI3K a kinase which is a relay molecule for the downstream activation of subsequent molecules
within the phosphorylation cascade. The effect of this signaling pathway is the triggering of cell growth,
proliferation and survival.
Fig. 3.1
(a) With reference to Fig 3.1, describe how binding of Growth Factors could result in the activation of Ras
protein. [2]
Fig. 3.2
(d) Explain how a mutation in the PTEN gene could affect the structure of its product. [3]
(e) Suggest why some mutations of the PTEN gene have no effect on the activity of the PTEN protein. [3]
Fig. 3.3
(f) Suggest why the p53 protein only binds to certain parts of the DNA molecule. [3]
[Total: 17]
QUESTION 4
Fig. 4.1 shows some of the main structural features of the H7N9 influenza virus.
Fig. 4.1
The viral RNA genome contains genes (HA and NA) that codes for Haemagglutinin and Neuraminidase,
which are widely researched for the development of antiviral drugs.
In H7N9, the H refers to the type of haemagglutinin and the N refers to the type of neuraminidase present
as part of the viral envelope. The avian influenza A (H7N9) virus designation of H7N9 identifies it as having
HA of the H7 subtype and NA of the N9 subtype
After the influenza virus enters the host cells, the genes in the RNA segments are used as templates for
mRNA production
(a) Suggest the functions of haemagglutinin and neuraminidase in Influenza virus. [2]
(c) The viral RNA also contains PB2, PB1 and PA which code for the viral RNA polymerases. Explain why
such RNA segments are needed by the virus. [2]
(d) The influenza virus does not contain ribosomes. Despite this, the influenza virus is able to trigger
synthesis of viral proteins. Explain how does the influenza virus do so? [1]
Fig. 4.2
[Total: 11]
QUESTION 5
Carbon is essential to life. All of our molecular machines are built around a central scaffolding of organic
carbon. Unfortunately, carbon in the earth and atmosphere is locked in highly oxidized forms, such as
carbonate minerals and carbon dioxide gas. In order to be useful, this oxidized carbon must be "fixed" into
more organic forms, rich in carbon-carbon bonds and decorated with hydrogen atoms. Powered by the
energy of sunlight, plants perform this central task of carbon fixation.
Inside plant cells, the enzyme ribulose bisphosphate carboxylase (rubisco) forms the bridge between life and
the lifeless, creating organic carbon from the inorganic carbon dioxide in the air. Fig. 5.1 shows the structure
of ribulose bisphosphate carboxylase (rubisco).
Fig. 5.1
Fig. 5.2
(b) Explain how light energy assists in the process of carbon fixation in plants. [3]
(c) Explain why the CO2 assimilation rate levels off at higher light intensity. [3]
(c) With reference to Fig 5.2, suggest why the CO2 assimilation rate is declining as the light intensity
increases higher. [2]
[Total: 10]
Hair color is the pigmentation of hair follicles due to two types of melanin: eumelanin and pheomelanin.
Pheomelanin colors hair reddish-orange. Eumelanin, which has two subtypes of black or brown,
determines the darkness of the hair color. Generally, if more eumelanin is present, the color of the hair is
darker. If less eumelanin is present, the hair is lighter. Particular hair colors are associated with ethnic
groups.
The genetics of hair colors are not yet firmly established. According to one theory, at least two unlinked
gene pairs that control human hair color.
In Americans, gene B and R are involved in controlling the shades of hair colour. Gene B controls the
production of brown eumelanin. This gene has a dominant brown allele and a recessive blond allele.
Gene R controls the production of pheomelanin. This gene has a non-red allele (which suppresses
production of pheomelanin) which is dominant and the allele for red hair is recessive. Gene B is epistatic
over Gene R.
(a) State and explain the genotypes for a blonde hair phenotype. [3]
A couple, both with blonde hair, was filing for a divorce as the husband felt that her wife has cheated on
him. His rationale of saying so was based on the recent birth of their boy who has red-coloured hair.
(b) With the use of a genetic diagram, explain whether or not it is possible for two parents with blonde
hair to have an offspring with red-coloured hair. [4]
(c) The husband felt bad for doubting his wife. He wants to find our whether there is a significant
difference between what they observed in their baby boy and what is expected.
Explain whether it is possible to carry out a chi-square test in this case. [2]
[Total: 9]
Fig. 7.1 shows Honeycreepers of the Family Drepanididae from the Hawaiian Islands. These
Honeycreepers reside on the various Hawaiian Islands. Through a series of studies, these
Honeycreepers are found to be evolved from an ancestral Honeycreeper which resided originally on,
Kauai, one of the Hawaiian Islands.
Fig. 7.1
(a) Explain how these various species of Honeycreepers could have arisen. [4]
Many phylogenetic studies use mitochondrial DNA rather than nuclear DNA.
A new Honeycreeper (Fig. 7.2) has been found on one of the Hawaiian Islands. Based on its structural
features, Scientists are speculating that this new found Honeycreeper is also a descendant of the
ancestral Honeycreeper found on Kauai.
Fig. 7.2
(d) Suggest why it is not advisable to determine the phylogenetic relationship of this new found
Honeycreeper to the rest of them from the morphological features. [2]
[Total: 13]
QUESTION 8
(c) Discuss how the mitochondrion is adapted for carrying out respiration. [6]
QUESTION 9
(a) Compare the mode of infection of Influenza Virus and Human Immunodeficiency Virus. [6]
(c) Discuss how the prokaryote, E. coli, is able to respond to varying concentrations of lactose. [6]
End of Paper
2
CANDIDATE
NAME
CIVICS
GROUP
1 2
TUTOR
NAME
Biology 9648/ 02
Paper 2 Monday, 2 September 2013
2 hours
Candidates answer on the Question Paper
Additional Materials: Writing Paper
3 17
Section A
4 11
Answer all questions.
Section B 5 10
7 13
Section B
The number of marks is given in brackets [ ] at the end of each 20
8 OR
question or part question.
9 20
Total 100
Fig. 1.1 shows a simplistic outline of the processes of mitosis and meiosis.
(a) State four ways in which the behavior of chromosomes in meiosis differs from their behavior in mitosis.
[4]
Synapsis of homologous chromosomes forming a bivalent during prophase of meiosis I and not
during prophase in mitosis.
Chiasmata/ crossing over between non-sister chromatids during prophase of meiosis I and not
during prophase in mitosis.
[1 mark each]
Fig. 1.2
(a) With reference to Fig. 1.2, suggest the genetic disorder(s) the person whose karyotype is shown is
suffering from. [1]
(b) Describe the aberration that has occurred during cell and nuclear division that has resulted in the
inheritance of the extra chromosomes. [3]
[any 6]
Having extra copies of chromosomes would mean that there are extra set of genes within the cell
These extra genes could also be expressed through transcription and translation
Protein (gene product) formed would now be more than the normal level
Exert extra physiological effects on cell -> phenotypes that are aberrant or more pronounced.
[Total: 10]
Fig. 2.1 is a diagram showing part of a bacterial chromosome with a single origin of replication and two
replication forks which proceed in opposite directions until replication of the entire bacterial chromosome is
complete.
Fig. 2.1
(a) With reference to Fig. 2.1, explain why this replication is said to be semi-conservative. [2]
DNA unzips / DNA strands separate / ref. to H bonds break ;
Both strands / each strand acts as a template ;Each new molecule of DNA contains one new and
one old / original strand of DNA
[1 mark each]
(b) With reference to Fig. 2.1, replication only occurs in a 5 to 3 direction, explain why this is so. [2]
structure of active site of DNA polymerase is specific [1]
allows recognition of a 3 OH from a nucleotide to initiate the replication process ; [1/2]
active site fits nucleotide in a particular orientation (5 forms phosphodiester bond with 3) [1/2]
Fig. 2.2
[1 mark each]
(d) Explain how telomeres shorten with each cell division. [3]
Telomeres shorten in part because of the end replication problem that is exhibited during DNA
replication
Because DNA replication does not begin at either end of the DNA strand, but starts in the center
considering that all known DNA polymerases move in the 5' to 3' direction, one finds a leading and
a lagging strand on the DNA molecule being replicated.
Eventually when the last primer in the lagging strand is removed by DNA polymerase I and
replacing it with the correct DNA nucleotides
In the case at the position of the last primer, the 3OH group is absent.
RNA primer is removed but the gap is not replaced by DNA nucleotides.
[Total: 10]
Fig. 3.1 shows a signaling pathway involving Ras protein, a proto-oncogene. Ras protein is involved in the
activation of PI3K a kinase which is a relay molecule for the downstream activation of subsequent molecules
within the phosphorylation cascade. The effect of this signaling pathway is the triggering of cell growth,
proliferation and survival.
Fig. 3.1
(a) With reference to Fig 3.1, describe how binding of Growth Factors could result in the activation of Ras
protein. [2]
Binding of growth factors on the ligand binding site of the RTK causes the RTK to dimerise and
undergo cross phosphorylation -> RTK activated
Activated RTK will activate Ras protein by causing a displacement of the GDP with a GTP.
[1 mark each]
Proto-oncogenes code for proteins that stimulate normal cell growth and division.
An oncogene arises from a genetic change/mutated proto-oncogene that leads to an increase either
(1) in the amount of the proto-oncogenes protein product, or (2) in the activity of each protein
molecule.
PTEN is an enzyme that acts as a tumour suppressor by regulating cell cycle and induces apoptosis. PTEN
inhibits PI3K, a kinase, by dephosphorylating PI3K (refer to Fig. 3.1). Dephosphorylated PI3K is inactive and
will not activate downstream relay molecules of the phosphorylation cascade to induce cell division. Fig. 3.2
shows the structure of PTEN.
Fig. 3.2
(d) Explain how a mutation in the PTEN gene could affect the structure of its product. [3]
A point mutation which involves either an addition or deletion of a nucleotide leads to a
frameshift ;
This could lead to an early stop codon being transcribed leading to the formation of a truncated
protein.
Or the resulting protein coded could have a series of very different A.As and thereby folded
differently to result in a non-functional protein.
OR
If a substitution mutation occurs such that a nucleotide is changed this could result in a
missense mutation or nonsense mutation which would affect the structure of its product.
In a missense mutation the change in nucleotide codes for a different a.a which could have a
different R group nature and thereby interacts with the other a.as differently -> different folding
A nonsense mutation, the change in nucleotide codes for an early stop codon -> truncated
protein
In both cases, the product is non-functional due to the change in the 3D structure of PTEN.
(e) Suggest why some mutations of the PTEN gene have no effect on the activity of the PTEN protein. [3]
Change in a.a in region away from binding site ;
May not affect shape / binding properties ;
Ref. idea some a.a coded for by more than 1 codon / triplet of bases / ref. genetic code / some
codons degenerate ;
So (change in base / codon) may not change a.a / neutral ;
Fig. 3.3
(f) Suggest why the p53 protein only binds to certain parts of the DNA molecule. [3]
Specific shape of DNA binding domain of p53 protein ;
Corresponds to / complementary to shape of DNA molecule ;
Ref. to idea different sequences of bases (have different shapes) ;
Ref. to major and minor grooves of DNA ;
[Total: 17]
Fig. 4.1 shows some of the main structural features of the H7N9 influenza virus.
Fig. 4.1
The viral RNA genome contains genes (HA and NA) that codes for Haemagglutinin and Neuraminidase,
which are widely researched for the development of antiviral drugs.
In H7N9, the H refers to the type of haemagglutinin and the N refers to the type of neuraminidase present
as part of the viral envelope. The avian influenza A (H7N9) virus designation of H7N9 identifies it as having
HA of the H7 subtype and NA of the N9 subtype
After the influenza virus enters the host cells, the genes in the RNA segments are used as templates for
mRNA production
(a) Suggest the functions of haemagglutinin and neuraminidase in Influenza virus. [2]
recognises and bind to neuraminic acid residues on host cell membrane;
enable specificity in the type of host cells ( enable influenza to only attach to specific host cells
like respiratory cells);
Promote the release of progeny viruses from the host cell surface to infect other host cells
By cleaving the attachment/bond between the HA on influenza and neuraminic acid residues on
the host cell membrane;
(c) The viral RNA also contains PB2, PB1 and PA which code for the viral RNA polymerases. Explain why
such RNA segments are needed by the virus. [2]
Viral RNA polymerases required by the virus would not be present in the host cell;
Viral RNA polymerases able to recognise viral negative sense RNA
Synthesis of (+) sense RNA to serve as mRNA to make viral proteins;
RNA polymerases are required to replicate (-) Sense viral RNA;
(d) The influenza virus does not contain ribosomes. Despite this, the influenza virus is able to trigger
synthesis of viral proteins. Explain how does the influenza virus do so? [1]
Fig. 4.2
[Total: 11]
QUESTION 5
Carbon is essential to life. All of our molecular machines are built around a central scaffolding of organic
carbon. Unfortunately, carbon in the earth and atmosphere is locked in highly oxidized forms, such as
carbonate minerals and carbon dioxide gas. In order to be useful, this oxidized carbon must be "fixed" into
more organic forms, rich in carbon-carbon bonds and decorated with hydrogen atoms. Powered by the
energy of sunlight, plants perform this central task of carbon fixation.
Inside plant cells, the enzyme ribulose bisphosphate carboxylase (rubisco) forms the bridge between life and
the lifeless, creating organic carbon from the inorganic carbon dioxide in the air. Fig. 5.1 shows the structure
of ribulose bisphosphate carboxylase (rubisco).
Fig. 5.1
The primary sequence of the 16 polypeptide chains formed by having peptides held between the
amino acids
The folding of the individual polypeptides to form secondary structures (Alpha helices and Beta-
pleated sheets) and maintained by H bonds between the imino and carbonyl group.
These secondary structures will form tertiary structures with further compacting and folding and
these are held by hydrogen bonds, hydrophobic interaction, ionic bonds and disulphide bonds.
These tertiary structures will associate with each other to form rubisco with each tertiary structure
held by the same interactions as well.
Fig. 5.2
(b) Explain how light energy assists in the process of carbon fixation in plants. [3]
Light energy is harvested by the antenna complex and causes excitation of electrons in the
photosystem I and II
Put through the process of photophosphorylation
The excitation of electron of the PS I and II is captured by the primary electron acceptors of
each PS
This electron from PSII is passed down an electron transport chain to generate ATP through
chemiosmosis
The ATP formed will be used during the Calvin cycle during regeneration of RuBP
In a second ETC, NADP is reduced by NADP reductase to form reduced NAD -> needed for
Calvin cycle as a reducing power.
(c) Explain why the CO2 assimilation rate levels off at higher light intensity. [3]
CO2 assimilation rate levels off at high light intensity maximum rate as all photosystems are
saturated with light energy (limited amount of chlorophyll in the photosystems)
Maximum rate of photosynthesis occurs at high LI hence amount of CO2 assimilation now remained
constant due to the constant (maximum) amount of NADPH produced;
Light is no longer limiting factor, but other factor e.g. rate of carbon fixation is.
(c) With reference to Fig 5.2, suggest why the CO2 assimilation rate is declining as the light intensity
increases higher. [2]
As light intensity gets higher, the rate of production of oxygen from photolysis of water to
replace the lost of electrons in PS II may increase.
Oxygen produced within the plant cell will be greater than amount of carbon dioxide present and
Oxygen will bind rubisco preferentially and thereby leading to a decline in CO2 assimilation
[Total: 10]
Hair color is the pigmentation of hair follicles due to two types of melanin: eumelanin and pheomelanin.
Pheomelanin colors hair reddish-orange. Eumelanin, which has two subtypes of black or brown,
determines the darkness of the hair color. Generally, if more eumelanin is present, the color of the hair is
darker. If less eumelanin is present, the hair is lighter. Particular hair colors are associated with ethnic
groups.
The genetics of hair colors are not yet firmly established. According to one theory, at least two unlinked
gene pairs that control human hair color.
In Americans, gene B and R are involved in controlling the shades of hair colour. Gene B controls the
production of brown eumelanin. This gene has a dominant brown allele and a recessive blond allele.
Gene R controls the production of pheomelanin. This gene has a non-red allele (which suppresses
production of pheomelanin) which is dominant and the allele for red hair is recessive. Gene B is epistatic
over Gene R.
(a) State and explain the genotypes for a blonde hair phenotype. [3]
A couple, both with blonde hair, was filing for a divorce as the husband felt that her wife has cheated on
him. His rationale of saying so was based on the recent birth of their boy who has red-coloured hair.
(b) With the use of a genetic diagram, explain whether or not it is possible for two parents with blonde
hair to have an offspring with red-coloured hair. [4]
Woman Man
Parental phenotype Blonde Hair x Blonde Hair
1m
Parental genotype bbRr bbRr
Gametes
bR br bR br 1m
Offspring phenotype
(fertilization lines or bR br
punnett square needs
to be shown) bbRr
[1] for correct bbRR
bR Blonde Hair 1m
genotype and Blonde hair
phenotype
bbRr bbrr
br Blonde hair Red hair
Possible as the both parents might be heterozygous for the loci of Gene R.
(c) The husband felt bad for doubting his wife. He wants to find our whether there is a significant
difference between what they observed in their baby boy and what is expected.
Explain whether it is possible to carry out a chi-square test in this case. [2]
[Total: 9]
QUESTION 7
Fig. 7.1 shows Honeycreepers of the Family Drepanididae from the Hawaiian Islands. These
Honeycreepers reside on the various Hawaiian Islands. Through a series of studies, these
Honeycreepers are found to be evolved from an ancestral Honeycreeper which resided originally on,
Kauai, one of the Hawaiian Islands.
Fig. 7.1
(a) Explain how these various species of Honeycreepers could have arisen. [4]
Mutation
Spontaneous mutation or inherited variation in the genotype of these organisms provided
genetic variation of each organism
Natural Selection
Difference in selection pressure (e.g. food type) due to the different habitat that these forms
are found.
There would be one phenotype that would be at a selective advantage in the environment
as it is better adapted to the living conditions. They will survive, reproduce and pass on their
genes to offsprings.
Isolation
As these different forms are found on the different islands/ habitats, they are geographically
isolated. Interbreeding is prevented and hence, prevention of gene flow.
Our understanding of the phylogeny of species has been greatly improved through the use of molecular
techniques.
Many phylogenetic studies use mitochondrial DNA rather than nuclear DNA.
A new Honeycreeper (Fig. 7.2) has been found on one of the Hawaiian Islands. Based on its structural
features, Scientists are speculating that this new found Honeycreeper is also a descendant of the
ancestral Honeycreeper found on Kauai.
Fig. 7.2
(c) Suggest why it is not advisable to determine the phylogenetic relationship of this new found
Honeycreeper to the rest of them from the morphological features. [2]
(d) Outline how DNA can be studied to determine phylogeny of organisms. [5]
Studying DNA from different organisms is working on the principle of molecular homology
DNA samples can be extracted from target organisms or from the bone marrow of fossils. With
techniques of DNA sequencing technology, the DNA can be sequenced.
For basis of valid comparison the sequence of similar genes (for example, cytochrome c
oxidase gene) are compared amongst the organisms.
A data base of DNA sequences of genes could also be used to retrieve information of particular
organism of interest.
Degree of similarity in sequences/ degree which sequences of gene are conserved between
species are interpreted as DNA evidence for evolution.
Generally, a higher degree which sequences are being conserved a higher degree of
relatedness different species are to one another and vice versa.
TPJC 9648/02/JC2 PRELIM/2013 [Turn Over]
1689
22
[Total: 13]
QUESTION 8
Max 3 for differences Anaerobic Respiration Aerobic Respiration
Definition/ Components Glycolysis + Glycolysis + Link Reaction + Krebs Cycle
Fermentation + Oxidative phosphorylation
Oxygen requirement Absence of Oxygen Presence of Oxygen
ATP production 2 ATP 38 ATP
Electron carriers involved NAD only NAD and FAD
Location Cytoplasm only Cytoplasm and Mitochondria
Similarities [3 marks]
Starting materials is glucose
Both has glycolysis as a step in the process of oxidation of glucose
Both involves the use of electron carriers (NAD or FAD)
Carbon dioxide gas is produced in both processes
(c) Discuss how the mitochondrion is adapted for carrying out respiration. [6]
2. The immediate
bathing of the
cristae by the
matrix and the
great surface
6. The liquid matrix area provided by
contains most of the the cristae allow
7. Mitochondria enzymes controlling the the carriers
in active cells Krebs cycle and thus greater access
are larger and allows the enzymes to the substrates
contain more and the substrates to found in the
cristae. interact freely. matrix.
3. Elementary
particles
associated with
ATP synthesis are
found on the
matrix side of the
inner membrane
5. The selectively
permeable membrane 4. The inner membrane is impermeable to protons moving in
contains translocase
from the matrix. A proton pump in the inner membrane pumps
enzymes for the active protons from matrix into intermembrane space.
transport of ATP and
ADP through it.
The outer membrane is freely permeable to protons and
hence allows protons to move out of the mitochondria. Protons
accumulate outside the mitochondria and create a pH gradient.
The pH gradient allows protons to diffuse back into the
mitochondrion in which ATP is synthesized during the process.
TPJC 9648/02/JC2 PRELIM/2013 [Turn Over]
1692
25
QUESTION 9
(a) Compare the mode of infection of Influenza Virus and Human Immunodeficiency Virus. [6]
There are three mechanisms of gene transfer in prokaryotes, Conjugation, Transformation and
Transduction.
(c) Discuss how the prokaryote, E. coli, is able to respond to varying concentrations of lactose. [6]
The prokaryotes possess lac operon which contains the structural genes lac Z, lac Y and
lac A genes
Which codes for beta-galactosidase, lactose permease and lactose transacetylase
respectively
These structural genes are organised under the control of a single promoter and
operator
Expression of these genes are regulated depending on the level of lactose in the
environment.
When [lactose] low, some lactose is transported by the low levels of permease into
bacterial cells
Lactose converts to allolactose by beta-galactosidase
Allolactose binds to lac repressor to induce a change in conformation in repressor
Repressor unable to bind to operator
RNA polymerase can bind promoter to initiate transcription
When [lactose] high, more repressors are repressed by allolactose
These are occurring in absence of glucose, when glucose present -> glucose prevent
synthesis of cAMP
cAMP needed for activation of CAP
CAP needed to bind to CAP binding site for the recruitment of RNA polymerase to
initiate transcription.
End of Paper
2
CANDIDATE
NAME
CIVICS GROUP 1 2
TUTOR
NAME
Biology 9648/ 03
Applications Paper and Planning Question Friday, 20 September 2013
Paper 3
2 hours
Candidates answer on the Question Paper
Additional Materials are required: Writing Paper
1 15
Answer all questions.
2 15
3 10
At the end of the examination:
4 12
1. Fasten all answer scripts for Question 5 securely;
2. Hand in Paper 3 and the answer scripts for 5 20
Question 5 separately.
Total 72
One of the applications of RFLP analysis is for restriction mapping. BamH1, EcoRI and HindIII
restriction enzymes are used to map a 15kb bacterial DNA. Three reactions were set up to cut
the 15kb DNA sample, each with one of the three enzymes. After digestion with restriction
enzymes, the DNA fragments were separated into bands. Results of the reactions are shown
in Fig 1.1.
Describe briefly how, in such DNA analysis,
(i) DNA is separated into bands; [4]
(iii) Based on the information given and the results in Fig 1.1, which of the following map
(W, X, Y or Z) in Fig 1.2 is not a possible map? [1]
Map __________________________
E = EcoRI
B = BamHI
H = HindIII
W
Scale
(iv) With reference to the results shown in Fig 1.3, explain which of the following W, X Y or
Z is the correct map. [3]
Fig 1.3
Another application of RFLP analysis is for forensic scientist to identify criminals. Two
men (Suspect 1 and 2) were accused of kidnapping and raping a woman. RFLP
analysis was used to examine the genetic characteristics of the two suspects, the
victim, and semen from the vagina of victim. Two genetic loci, D4S139 (a) and D10S28
(b), were examined. These two loci are variable number of tandem repeats (VNTR).
(iii) Identify and explain the criminal with evidences shown in Fig 1.4. [3]
Children with severe combined immunodeficiency disorder (SCID) cannot produce the many
types of white blood cells that fight infections. This is because they do not have the functional
gene to make the enzyme, adenosine deaminase (ADA).
Researchers are currently exploring the possibility of using stem cells in therapy for SCID.
Some children with SCID have been treated with stem cells. Stem cells can divide and develop
into any type of blood cell, including white blood cells.
The treatment used with the children is described in Fig. 2.1.
Fig. 2.1
(a) Using the information given, state two reasons why stem cells were used in this
treatment. [2]
(b) Suggest the type and the potency of stem cells that were used in this treatment. [2]
Type: ___________________________________________________________________
Potency: _________________________________________________________________
Fig. 2.2
(d) Explain why a person treated by gene therapy may still have children who suffer from
SCID. [2]
Although the use of gene therapy for treatment of genetic disorders in humans seems
promising, there are still many concerns to be addressed.
(f) Explain the factors that may keep gene therapy from becoming an effective treatment
for genetic disorders. [3]
(g) Discuss one ethical and one social concern regarding the use of gene therapy. [2]
Genetic engineering is a technique for improving crop plants. It is a process by which a single
new gene can be added to the genes already present in the plants. One way of doing this is to
use a natural genetic engineer, a soil microorganism called Agrobacterium. This bacterium
possesses a plasmid which can be modified in the laboratory so that it becomes the carrier of
new genetic information.
For example, a gene coding for the ability to break down the herbicide glyphosate can be
introduced with the assistance of the enzymes restriction endonuclease and ligase. Once inside
the crop plant, the gene for glyphosate breakdown makes the plant resistant to the effects of
this herbicide. All surrounding weeds are destroyed when sprayed with glyphosate.
The flow-chart shows how the plasmid carrying this gene can be used to produce glyphosate-
resistant plants.
(a) One mature plant grows from each glyphosate-resistant plant cell. Explain why all
the cells of the mature plant contain the gene for glyphosate-resistance. [1]
(b) Outline the technique of tissue culture needed to obtain matured plants from the
transformed cells which are resistant to the herbicide. [3]
(c) Suggest and explain one possible problem associated with the use of herbicides
together with genetically modified, herbicide-resistant crop plants. [1]
In the process of anther culture, haploid plantlets are produced from immature anthers,
from which mature fertile homozygous plants are obtained. The process is shown
diagrammatically in the figure below.
(ii) State one precaution that would be taken when transferring material onto
culture medium 1 or 2. [1]
(iii) Suggest why variation may be generated in plantlets derived from the same
callus. [1]
(iv) Suggest how colchicine could bring about the doubling of chromosome
number in haploid cells. [1]
PLANNING QUESTION
You are required to plan, but not carry out, an investigation into the transformation of
Escherichia coli bacteria using the pGLO plasmid as shown below.
The GFP gene is regulated by a promoter of the arabinose operon. The operon can be
induced by the presence of arabinose. The successful uptake of the pGLO can be
detected by bacteria that florescence green under UV light.
Your planning must be based on the assumption that you have been provided with the
following equipment and materials which you must use:
microfuge tubes
different types of agar plates
foam microfuge tube holder
parafilm sealing tapes
stopwatch
thermometer
micropipettes and tips
incubator oven
transformation solution
plasmid DNA solution (pGLO)
competent Escherichia coli cells in microfuge tube
sterile water
tripod stand and bunsen burner
hot water and crushed ice
UV visualiser
Write your answer to this question on the separate answer paper provided.
Your answer:
should be illustrated by large, clearly labeled diagrams, where appropriate;
must be in continuous prose, where appropriate;
must be set out in sections (a), (b) etc., as indicated in the question.
QUESTION FIVE
(a) Describe PCR and compare and contrast with replication process. [8]
(b) Outline the process of gel electrophoresis and explain how it is able to separate
fragments of DNA. [9]
End Of Paper
2
CANDIDATE
NAME
CIVICS GROUP 1 2
TUTOR
NAME
Biology 9648/ 03
Applications Paper and Planning Question Friday, 20 September 2013
Paper 3
2 hours
Candidates answer on the Question Paper
Additional Materials are required: Writing Paper
1 15
Answer all questions.
2 15
3 10
At the end of the examination:
4 12
1. Fasten all answer scripts for Question 5 securely;
2. Hand in Paper 3 and the answer scripts for 5 20
Question 5 separately.
Total 72
One of the applications of RFLP analysis is for restriction mapping. BamH1, EcoRI and HindIII
restriction enzymes are used to map a 15kb bacterial DNA. Three reactions were set up to cut
the 15kb DNA sample, each with one of the three enzymes. After digestion with restriction
enzymes, the DNA fragments were separated into bands. Results of the reactions are shown in
Fig 1.1.
(iii) Based on the information given and the results in Fig 1.1, which of the following
map (W, X, Y or Z) in Fig 1.2 is not a possible map? [1] A
(iv) With reference to the results shown in Fig 1.3, explain which of the following W,
X Y or Z is the correct map. [3]
Fig 1.3
Y;;
TPJC 9648/02/JC2 Prelim/2013 [Turn Over
1711
3
When the 15kb DNA is cut with the two enzyme BamHI and EcoRI, there
are three bands, 5kb, 3kb and 2kb
the 5kb band is thicker- two copies of the 5kb
when cut with the BamH1 and HindIII, there are 3 bands, 7kb, 3kb and
2kb,
where 3kb is the doublet
When cut with enzyme EcoR1 and HindIII, there are 3 bands, 8kb, 5kb
and 2kb
(c) Another application of RFLP analysis is for forensic scientist to identify criminals. Two
men (Suspect 1 and 2) were accused of kidnapping and raping a woman. RFLP analysis
was used to examine the genetic characteristics of the two suspects, the victim, and a
vaginal aspirate. Two genetic loci, D4S139 (a) and D10S28 (b), were examined. These
two loci are variable number of tandem repeats (VNTR).
Fig 1.4 shows two autoradiograms of the DNA banding patterns. Three lanes of the
autoradiograms (on the far left, far right, and middle) display multiple bands called size
markers.
(iii) Identify the criminal with evidences shown in Fig 1.4. [3]
Suspect 2;
when genetic locus D4S139 were used, banding pattern of suspect two
(lane 4) is exactly the same as the semen from vagina (lane 7) in (a);
when genetic locus D10S28 were used, one DNA band (lowest band) in
suspect 1s matches the lowest band of the semen from the vagina,
however, there are two DNA bands from the suspect one which
correspond to the two out of three bands of the semen from the vagina,
which provides additional evidence against him;
(students could label the bands and explain using the labeled terms)
[Total: /15 marks]
Fig. 2.1
(a) Using the information given, state two reasons why stem cells were used in this
treatment.
Capable of dividing for long periods to generate replacements for cells that are unable to
produce ADA;
Unspecialised and can differentiate to specialized cell types such as white blood cells to
fight infection;
The stem cells used belongs to the child and there will be no / little risk of rejection /
triggering immune response; [any 2]
[2]
(b) Suggest the type and the potency of stem cells that were used in this treatment.
Type Adult / hematopoietic / blood stem cells;
Potency Multipotent;
[2]
Fig. 2.2
(e) Suggest why it is easier to perform gene therapy when a mutant allele is recessive
instead of dominant.
When mutant allele is recessive, addition of functional / normal dominant allele by gene
therapy will mask the effect of recessive allele /
If mutant allele is dominant, it has to be removed / repaired / inactivated to block
production of defective gene product;
[1]
Although the use of gene therapy for treatment of genetic disorders in humans seems
promising, there are still many concerns to be addressed.
(f) Explain the factors that may keep gene therapy from becoming an effective treatment
for genetic disorders.
Difficult to ensure that therapeutic gene is integrated into genome of host cells;
Incorrect insertion of therapeutic gene into genome of host cell results in cancer, as the
insertion is random;
Immune response may be triggered resulting in rejection because a foreign virus vector
is introduced;
Difficult to control expression of normal functional gene to give a fully functional protein;
[3]
(g) Discuss one ethical and one social concern regarding the use of gene therapy.
Ethical: Gene therapy may be viewed as tampering with nature and going against the
natural way of life;
Social: There may be genetic discrimination in the society as the issue of defining what
is a disability/disorder/disease is unclear;
The poor will be discriminated against because they cannot afford the expensive
treatment of gene therapy;
[2]
Genetic engineering is a technique for improving crop plants. It is a process by which a single
new gene can be added to the genes already present in the plants. One way of doing this is
to use a natural genetic engineer, a soil microorganism called Agrobacterium. This bacterium
possesses a plasmid which can be modified in the laboratory so that it becomes the carrier of
new genetic information.
For example, a gene coding for the ability to break down the herbicide glyphosate can be
introduced with the assistance of the enzymes restriction endonuclease and ligase. Once
inside the crop plant, the gene for glyphosate breakdown makes the plant resistant to the
effects of this herbicide. All surrounding weeds are destroyed when sprayed with glyphosate.
The flow-chart shows how the plasmid carrying this gene can be used to produce glyphosate-
resistant plants.
Use the information from the passage and your own knowledge to answer the following
questions.
(a) One mature plant grows from each glyphosate-resistant plant cell. Explain why all the
cells of the mature plant contain the gene for glyphosate-resistance. [1]
The cells are genetically identical / clone of the glyphosate cells due to mitotic
division of the cell.
The ratio of plant hormones will result in the plant tissues developing into
specialized tissues.
Suggest and explain one possible benefit and problem associated with the use of
herbicides together with genetically modified, herbicide-resistant crop plants. [1]
The production of toxins by the gene that can cause allergy in human beings
[Any 1 point]
Another technique required in plant biotechnology is plant tissue culture. Various organs or
tissues of a plant may be used in tissue culture to produce a large number of genetically
identical plants.
In the process of anther culture, haploid plantlets are produced from immature anthers, from
which mature fertile homozygous plants are obtained. The process is shown diagrammatically
in the figure below.
(ii) State one precaution that would be taken when transferring material onto culture
medium 1 or 2. [1]
(iii) Suggest why variation may be generated in plantlets derived from the same callus.
[1]
It can be due to chromosomal mutations
(iv) Suggest how colchicine could bring about the doubling of chromosome number in
haploid cells. [1]
Cause non-disjunction
PLANNING QUESTION
You are required to plan, but not carry out, an investigation into the effect of XXX
Your planning must be based on the assumption that you have been provided with the following
equipment and material which you must use:
a description of the method used including the scientific reasoning behind the method,
an explanation of the dependent and independent variables involved,
relevant, clearly labelled diagrams,
how you will record your results and ensure they are as accurate and reliable as
possible,
proposed layout of results tables and graphs with clear headings and labels,
the correct use of technical and scientific terms,
relevant risks and precautions taken.
Mark scheme
Note that it is a brief heat shock at 420C for 50s and there is ice before and after the step.
Many students specify an incubation period of 10 30 minutes at room temperature to 40 0C
instead which is for transduction.
5. a) Method of plating
Removal of suitable amount of bacteria appropriate plate spreader/ inoculating loop/
beads (spreading)
Write your answer to this question on the separate answer paper provided.
Your answer:
should be illustrated by large, clearly labeled diagrams, where appropriate;
must be in continuous prose, where appropriate;
must be set out in sections (a), (b) etc., as indicated in the question.
QUESTION FIVE
(a) Describe PCR and compare and contrast with replication process. [6]
(b) Outline the process of gel electrophoresis and explain hot is is able to separate
fragments of DNA.
[9]
Answers
(a) Describe PCR and compare and contrast with replication process. [6]
1st step: One to several minutes at 94-96 degrees C, during which the DNA is denatured
into single strands by breaking of hydrogen bonds.
2nd step: One to several minutes at 50-65 degrees C, during which the primers hybridize
or "anneal" (by way of hydrogen bonds) to their complementary sequences on either
side of the target sequence.
3rd step: One to several minutes at 72 degrees C, during which the Taq polymerase binds
and extends a complementary DNA strand from each primer, using the single stranded
DNA as a template.
Replication PCR
primer RNA primers DNA primers
enzyme DNA polymerase III & I Taq DNA polymerase
proofreading yes no
Temperature dependent no yes
Biological molecules such as DNA, RNA and proteins are electrically charged
particles at a given pH.
DNA samples are first mixed with a loading dye which increases its density and
helps the DNA to sink to the bottom of the well.
Loading dye also helps to monitor the progress of the electrophoresis as DNA is
invisible.
Markers are usually run in the 1st lane. Markers are mixtures of DNA fragments of
known sizes. By comparing the markers fragment against the unknown fragments,
we can estimate the sizes of the unknown fragments.
Samples are loaded into wells with the help of a micropipette.
Step 4: Visualization
Before the band reaches the end of the gel, current will be switched off.
Gel is then stained with DNA binding dye (ethidium bromide which is
carcinogenic).
Separated DNA fragments can been clearly under the UV light.
TPJC 9648/02/JC2 Prelim/2013 [Turn Over
1723
15
DNA fingerprinting
The length of the chloroplast along the line shown is 80 mm. The actual length of the
chloroplast is 10 m.
2 The flow chart shows processes which take place inside animal cells.
phagocytosis
A W, X, Y and Z
B W and X only
C X and Y only
D Y and Z only
3 Lipid membranes can be formed in the laboratory by painting phospholipids over a PTFE
sheet with a hole in it.
Such a lipid membrane is impermeable to water-soluble materials including charged ions such
as Na+ or K+. In one experiment with Na+ ions, no current flowed across the membrane until a
substance called gramicidin was added, at which time current flowed.
Which statement is consistent with this information and your knowledge of membrane
structure?
B a non-polar lipid which passes all the way through the membrane.
4 Iodine test gives a blue-black colour in the presence of starch. The time taken for the blue-
black colour of a fixed amount of starch to disappear was recorded over a range of
temperature.
5 The diagram shows four different amino acids, each with a different R group (side chain).
Which amino acid could form a hydrophobic interaction between their R groups?
A 1 and 2 only
B 1 and 3 only
C 2 and 4 only
D 3 and 4 only
6 A living cell from the lung epithelium of a newt is shown at different stages of mitosis in the
micrographs (A to F) below. Identify the correct sequence of these micrographs.
A DECAFB
B EDCAFB
C ECDAFB
D EDCBAF
7 Human immunodeficiency virus (HIV) is a retrovirus. After infecting a host cell, viral DNA is
produced which is incorporated into the DNA of the host cell. The modified host genome now
codes for the production of new HIV particles.
Which could be used as a potential treatment to slow down the spread of HIV?
3. restriction endonucleases
4. reverse transcriptase
8 Which of the following shows the possible effects of a single nucleotide substitution in each of
the following locations in a gene on the production of the protein it codes for?
Transcription Middle of an
Promoter Start codon Stop codon
terminator intron
Protein product Too much Protein product Protein product No protein
A is longer than protein product is normal is shorter than product is
normal is produced normal produced
No protein Protein product Protein product Protein product Too much
B product is is shorter than is longer than is normal protein product is
produced normal normal produced
Protein product Protein product Protein product Too much Protein product
C is normal is longer than is shorter than protein product is longer than
normal normal is produce normal
Too much Protein product No protein Protein product Protein product
D protein product is normal product is is longer than is normal
is produced produced normal
9 Sex determination in some insects such as bees and wasps is not controlled by sex
chromosomes.
Using the diagram, which row in the table shows how sex is determined in these insects?
P Q R S
A n 2n mitosis meiosis
B n n mitosis mitosis
C 2n n meiosis meiosis
D 2n 2n meiosis mitosis
10 Meselson and Stahl found that in dividing cells, DNA is copied by semi-conservative
replication. At the time of their discovery it was thought that DNA might be copied in one of
three ways. In the diagram, the original DNA strands are shown by solid lines and the copy
strands by dotted lines.
Which set of results would have proved that the DNA replication was conservative?
A Key
11 Multiple proteins are involved in the process of blood clotting. The diagram below shows how
factor V functions as a co-factor in blood clotting.
Thrombin goes on to cleave fibrinogen to form fibrin, which helps in blood clot formation.
Another protein that is involved in blood clotting is activated protein C (aPC), a natural
anticoagulant that acts to limit the extent of clotting by cleaving and degrading factor V. A
mutation in factor V protein results in a variant protein called factor V Leiden. The Leiden
variant of the protein is resistant to degradation by aPC.
Which of the following option shows the mode of inheritance of the Leiden allele, the correct
type of mutation this is and the result this mutation will have on blood clotting?
Mode of
Type of mutation Result on blood clotting
inheritance
A Dominant Gain-of-function Blood clots more easily
B Dominant Loss-of-function Blood clots less easily
C Recessive Gain-of-function Blood clots less easily
D Recessive Loss-of-function Blood clots more easily
12 Mature mRNA and DNA are extracted from the same cells and mixed in conditions that favour
the mRNA and complementary parts of the DNA becoming linked. Some parts of the DNA
remain as double-stranded DNA. Other parts of the DNA form equal numbers of single-
stranded DNA loops and double-stranded DNA-mRNA loops.
13 Some studies suggest that smoking increases the risk of developing lung cancer. The two
graphs show the percentage of smokers and the deaths from lung cancer in men of two age
groups between 1950 and 1998.
A Deaths from lung cancer in men aged 35-59 decreased by 50% over the period of the
study.
B Deaths from lung cancer in men aged 60-74 increased up to 1970.
C The data for men aged 60-74 between 1950 to 1970 suggests that lung cancer takes
up to 20 years to develop.
D The number of men aged 35-59 who were smokers decreased by approximately 60%
over the period of the study.
A All eukaryotic genes are transcribed continuously because they are not packaged by
histones.
B DNA must be selectively released from its histone packaging before transcription can
occur in bacteria.
C Histones package prokaryote chromatin into the nucleosomes that form the bulk of the
chromosome.
15 Which of the following statements about RNA splicing of a single pre-mRNA are correct?
3. Different gene products can be formed at the same time within the same cells.
A 2 and 4 only
B 3 and 5 only
C 1, 2 and 4 only
D 1, 3 and 5 only
16 Staphylococcus aureus is a common bacterium, found on human skin. There are many strains
of S. aureus. The antibiotic methicillin was used to treat infection by S. aureus. Now there are
at least 15 different strains of MRSA (methicillin resistant Staphylococcus aureus).
Which of the following are valid reasons for the emergence of 15 different strains of MRSA?
1. The bacteria mutated when it was exposed to methicillin, thus becoming resistant.
3. The bacteria may have been exposed to a virus that carried a methicillin-resistant
gene and underwent specialised transduction.
A 1 and 2 only
B 2 and 3 only
C 1, 2 and 4 only
D 2, 3 and 4 only
17
With reference to the lambda phage shown in the diagram above, which of the following
statements are false?
1. The genetic material of the virus can be either DNA or RNA.
2. The adsorption of viral particles to host cell is a chemical interaction in which
strong covalent bonds are formed between the tail fibres of the virus and
complementary receptor sites on the host cell wall.
3. Once the viral genetic material has reached the cytoplasm of the host cell, viral
proteins will be degraded.
4. The host genes can be transferred by the virus to another host cell through the
process of generalized transduction.
5. Mature infective virions have spontaneously assembled and are ready to leave
host cell to infect other cells.
6. The virus is able to multiply via both the lytic and lysogenic cycles.
A 1 and 5 only
B 2 and 4 only
C 1, 2 and 5 only
D 1, 5 and 6 only
18 Ribonuclease is an enzyme that digests RNA. The first five amino acids of the functioning
molecule of ribonuclease are:
lys glu thr ala ala .............
The mRNA of the gene coding for ribonuclease, for the first 15 nucleotides, has the following
sequence.
AUGAAGGAAACUGCU
19 Researchers studied the regulation of a hormone-responsive gene isolated 750 base pairs of
DNA immediately preceding the start site of transcription (+1). They demonstrated that if
these sequences are cloned upstream of the bacterial chloramphenicol acetyltransferase
(CAT) gene and the DNA then introduced into mammalian cells, CAT enzyme activity
increases in response to hormone treatment.
To define the sequences involved in the regulation of this gene, they made a series of
deletions containing various lengths of the 5 regulatory sequences. They cloned these
truncated DNA fragments upstream of the CAT gene as shown in the figure below,
introduced the constructs into mammalian cells, and assayed for CAT enzyme activity in the
absence (-) and presence (+) of hormone. The figure below gives the results of a
representative experiment.
Hormone: - +
+1
-742
CAT gene 21 212
-638
CAT gene 27 228
-424
CAT gene 5 54
-315
CAT gene 6 69
-116
CAT gene 5 7
-27
CAT gene 0.2 0.2
Assuming that there is a single responsive regulatory element in the gene, that element is
located between
20 Downs syndrome can be caused by a trisomy of chromosome 21, but can also result from
translocation of chromosome 21 onto chromosome 13, forming a single chromosome 13-21.
The diagram shows chromosomes 13 and 21 in the nucleus of a diploid (2n) testis cell from a
phenotypically normal male carrier of a 13-21 translocation. This cell has a chromosome
number of 45.
Which is not a likely outcome of fertilisation of normal oocytes by sperm from this male?
What is the probability that Individual I will be a girl with blood group B and Rh positive
blood?
A 1 in 16
B 1 in 8
C 1 in 4
D 1 in 2
22 In a species of plant, the allele for hairy stems is dominant to the allele for smooth stems. The
allele for purple stems is dominant to the allele for green stems. A plant was self-fertilised and
the offspring appeared in the ratio 9 hairy, purple stem: 3 hairy, green stem: 3 smooth, purple
stem: 1 smooth, green stem.
The offspring with smooth, green stems were crossed to all the other offspring.
What proportion of these crosses would be expected to produce offspring in the ratio 1 hairy,
purple stem: 1 hairy, green stem: 1 smooth, purple stem: 1 smooth, green stem?
A 4/15
B 5/15
C 6/15
D 9/15
23 Albino horses have recessive alleles which cannot be transcribed to produce pigmentation.
Geneticists studying horses have found a different allele of the same gene which predisposes
carriers to premature aging of the hair follicles. This allele is dominant, so, even when born
with pigmented hair, the coats of horses with this allele will gradually turn white over the first 6
to 8 years of life.
Which white female horse would be best to use in crosses to determine the genotype of a
ten-year-old, white male horse?
B an unrelated, three-year-old-female
24 A plant of genotype SSrr with hairy leaves and white flowers was crossed with a plant of
genotype ssRR with smooth leaves and red flowers. The F1 plants were allowed to self-
fertilise. A 2 test was carried out on the results obtained for the F2 generation.
Difference between
Probability expected and observed Null hypothesis
results
A between 0.001 and 0.01 Significant accept
B between 0.001 and 0.01 Not significant reject
C between 0.01 to 0.05 Significant reject
D Between 0.01 to 0.05 Not significant reject
25 Two pairs of allele govern the colour of onion bulbs. A pure-breed red strain crossed with a
pure-breed white strain produces all red coloured bulbs in F1 progeny. Self-crossing of F1
generation produced 47 white, 38 yellow and 109 red bulbs. What does this experiment
demonstrate?
A recessive epistasis
B dominant epistasis
C codominance
The results of the linkage analysis are shown in the figure below. Different alleles present at
various individuals VNTR loci are denoted using different numbers.
A Individual I-1 is unaffected as he does not possess two copies of allele 5 for VNTR
locus Q.
B Individual II-2 is affected as he inherited two copies of allele 8 for VNTR locus R.
C Individual II-5 is unaffected as she did not inherit allele 2 for VNTR locus Q.
D Individual II-6 is affected as he inherited two copies of allele 6 for VNTR locus P.
27 Two pure-bred lines of two varieties of maize were crossed. The length of each of the cobs by
the two parental varieties and their offspring were measured. The number of cobs in each
length category was counted.
What is the cause of the phenotypic variation in cob length within the two parental varieties
and their offspring?
28 The graph shows the absorption spectra of some pigments found in chloroplasts.
1. Having several pigments, rather than one, increases the efficiency of photosynthesis.
2. Most leaves are green as chlorophyll absorbs light in the blue and red regions of the
spectrum.
3. Photosynthesis will be fastest in light at the red end of the spectrum, as red light has
higher energy than blue light.
4. Prior to leaf fall, chlorophyll is broken down, leaving carotenoids which makes leaves
look yellow or red.
A 1 and 2 only
B 1 and 3 only
C 1, 2 and 4 only
D 2 and 4 only
29 The diagram shows the electron transport chain embedded in thylakoid membranes of
chloroplasts.
DCMU and paraquat are inhibitors of electron transport chain at the positions indicated in the
diagram. These two inhibitors are added separately to isolated chloroplasts.
Which of the following correctly represents the results in the presence of DCMU and
paraquat?
A 1, 4, 5 and 7
B 1, 4, 5 and 9
C 2, 4, 5 and 7
D 4, 5, 7 and 9
31 A person has malfunctioning -cells in the islets of Langerhans. What will be the levels of
glucose, insulin and glucagon in the blood after that person has eaten a meal rich in
carbohydrates?
32 The ability of organisms to respond rapidly to stimuli is limited by the speed of the impulses in
their neurones.
The axons of invertebrate neurones lack a myelin sheath. The axons of most vertebrate
neurons are myelinated.
The graphs show the speed of impulses in these two types of axon.
1. The action potential in myelinated axons is greater than the action potential in non-
myelinated axons.
4. The presence of myelin increases the speed at which impulses are conducted.
A 1, 2 and 3 only
B 1, 2 and 4 only
C 2, 3 and 4 only
D 3 and 4 only
33 The diagram shows part of a phylogenetic classification of four species into taxonomic groups.
Which row correctly describes the order M in comparison with genera I and J?
Which of the following methods would be best to determine whether the phenotypic variation
in Achillea lanulosa is due to genotypic variation?
A Assessing the amount of phenotypic variation within populations along the entire
altitudinal range
B Determining whether phenotypic differences are maintained when plants from different
altitudes are grown under the same environmental conditions
2. Organisms with similar base sequences in their DNA are closely related to
each other.
4. The proportional rate of fixation of mutations in one gene relative to the rate of
fixation of mutations in other genes stays the same in any given line of
descent.
Which statements, when taken together, suggest the existence of a molecular clock
that enables scientists to estimate the time at which one species might have diverged
from another?
36 The table shows the number of estimated nucleotide substitutions that have occurred since
the divergence of seven species a to g.
b c d e f g
a 39 72 128 126 159 269
b 81 130 128 158 268
c 129 127 157 267
d 56 154 271
e 151 268
f 273
Which of the following phylogenetic trees best shows the relationship among these seven
species?
37 In obtaining the gene that codes for human actin, reverse transcriptase was used.
Why is reverse transcriptase not used for obtaining the gene that produces a human sodium
ion channel protein?
B The amino acid sequence for this protein is not known, so this is a gene that has not
yet been located by the human genome project.
C The antibiotic resistance genes transferred by reverse transcriptase with the insulin
gene may be transferred to pathogens.
D The sodium ion channel protein gene is expressed at low levels in human cells, so the
mRNA produced is swamped by other mRNA.
5 AATCGCCGAGCTCGGTTACG(Nx)TAGGCATCTCGAGCCTAGG 3
Which pair of primers will be effective for PCR amplification of the gene?
P: 5 AATCGCC 3
Q: 5 ATCCGTA 3
R: 5 TAGGCAT 3
S: 5 TTAGCGG 3
T: 5 CCTAGGC 3
A P and Q
B P and R
C P and T
D Q and S
39 pGEM-T is a 7.25kb plasmid cloning vector often used in creating recombinant DNA. It
contains two selectable marker genes, TetR and lacZ. The figure below shows a portion of the
multiple cloning site (MCS) of the cloning vector. It is located within the lacZ gene.
Using SacII as the restriction enzyme, a 2.31kb insert (gene of interest) is cloned into the
MCS shown above, and the recombinant plasmid is transformed into E. coli cells. The
transformants are then plated on medium containing tetracycline and X-Gal. The following
result is obtained.
Colonies X and Y are isolated and the plasmid DNA from the colonies is extracted. The
extracted plasmids are then digested with SacII. Which of the following correctly shows the
fragments obtained?
Colony X Colony Y
A A 9.56kb fragment A 7.25kb fragment
40 When a fertilized egg begins development, the outcome of the first three cell cycles is shown
as follows:
The localization of a specific protein during each of the above four early developmental
stages is examined. This protein is required for the formation of ectoderm. The location of the
protein is indicated by grey shading.
At the four-cell stage, are the four cells equivalent in terms of the different fates their daughter
cells can take on, and why?
Yes or No to the
four-cell
Justification
equivalence in
terms of their fates
The protein required for ectoderm formation is found only in the
upper two cells; therefore, only these two cells can become
A No ectoderm. The lower two cells can continue to differentiate to
become mesoderm or endoderm at this point, but cannot become
ectoderm.
The protein required for ectoderm formation is found only in the
upper two cells. These proteins can be transported to the other
B No
two lower cells such that the mesoderm or endoderm can be
formed.
The protein required for ectoderm is needed for differentiation of
C Yes the other germ layers since the ectodermal cells still remain
totipotent and can take on any developmental pathway.
The protein required for ectoderm is needed only by the upper
D Yes two cells since the lower two cells can differentiate to become
mesoderm or endoderm at this point.
1 B 2 A 3 C 4 C 5 D
6 B 7 B 8 D 9 A 10 D
11 A 12 B 13 D 14 D 15 A
16 B 17 C 18 A 19 D 20 D
21 B 22 A 23 A 24 C 25 A
26 C 27 B 28 C 29 D 30 B
31 B 32 C 33 A 34 A 35 B
36 D 37 D 38 C 39 A 40 A
Section A
1 Enzyme X digests a sugar. Fig. 1.1 shows the rate of reaction of enzyme X and a mixture
of enzyme X and substance Y on the sugar. Both reactions were carried out in a conical
flask.
Fig. 1.1
(a) With reference to Fig. 1.1, describe and explain the effect of substance Y on
the enzymatic reaction. [3]
1754
3
(b) Substance Y was found in one of the products of the reaction catalysed by
enzyme X after the substrate concentration, A, in Fig.1.1.
Predict how the trend of the graph for enzyme X only would continue after
sugar concentrations greater than A. Sketch the part of the graph in Fig. 1.1. [1]
Enzyme X may be immobilised in alginate beads. Fig. 1.2 shows a comparison between
the activity of free enzyme X and immobilised enzyme X over a range of temperatures.
Equal concentrations of free enzyme X and immobilised enzyme X were used.
Fig. 1.2
1755
4
(i) describe and explain the effect of temperature on the activity of free
enzyme X. [3]
(ii) describe and explain the differences between the activity of free
enzyme X and immobilised enzyme X up to 40 C. [2]
1756
5
The oil stored in the seeds of the castor oil plant Ricinus communis has been used in the
production of pharmaceutical products such as zinc and castor oil cream, and as a
lubricant. However, Ricinus seeds also produce a poisonous protein ricin, which is
classified as an agent of bioterrorism.
Fig. 1.3 shows the structure of ricin which consists of two polypeptides the A chain of
ricin (RTA, ricin toxin A) joined to a B chain (RTB, ricin toxin B).
RTA
RTB
Fig. 1.3
1757
6
(e) The RTB component of ricin has two binding sites specific for galactose. This
enables RTB to bind to cell surface components that contain galactose. This
is the first step of cellular intoxication. Identify a structure found on the
mammalian cell surface that makes it a good target for ricin. [1]
The two polypeptides RTA and RTB are covalently linked by a disulfide
bond between two cysteine residues. Reduction of ricin into its subunits, RTA
and RTB, is catalysed by protein disulfide isomerase (PDI), an enzyme that
resides in the lumen of the endoplasmic reticulum. PDI breaks the interchain
disulfide bond.
Fig. 1.4
9648/ 02 / Preliminary Examination / YJC 2013
1758
7
(i) Explain why the reduction process shown in Fig. 1.4 is necessary
before RTA can exhibit its catalytic activity. [2]
(ii) Suggest one way in which plant ribosomes in the seed cells are
protected from the effect of ricin. [1]
[Total: 17]
1759
8
outer membrane
inner membrane
cristae
matrix
intermembrane space
Fig. 2
State two similarities between the organelle above and a typical prokaryotic
cell like E. coli. [2]
1760
9
-
(b) (i) Mutants that are lac Y , meaning that the lac Y gene is inactivated,
retain the capacity to synthesise -galactosidase. However, even
though the lac I gene encoding for the repressor protein is still intact,
-galactosidase can no longer be induced by adding lactose to the
medium. Explain why this is so. [4]
(ii) Positive control of the lac operon results from breakdown of glucose,
which alters the levels of cyclic adenosine monophosphate (cAMP) in
the cell. cAMP binds to a catabolite activator protein (CAP), forming a
CAP-cAMP complex which increases the affinity of RNA polymerase
for the lac promoter. However, this mechanism will not cause
upregulation (genetic regulation that leads to an increase in gene
expression) of the lac operon in the absence of lactose. Explain why
this is so. [2]
1761
10
(c) Why is any bacterial gene capable of being transferred during generalised
transduction? [3]
[Total: 12]
1762
11
3 The human papillomavirus (HPV) is a small non-enveloped virus that has a double-
stranded circular DNA genome. Some HPVs have been well established as the main risk
factor of cervical cancers.
The HPV genome is replicated in the nucleus of infected cells in the form of a circular
DNA (episome). The HPV E2 gene encodes a transcription factor E2 that suppresses
transcription of HPV E6 and E7, which are viral oncogenes. In certain instances during
the replication cycle of HPV, the viral DNA can be linearised and integrated into
chromosomal DNA of host cells. A breakpoint that disrupts the HPV E2 gene will prevent
the synthesis of E2 proteins that normally regulate the transcription of E6 and E7.
Fig. 3.1 illustrates the integration of HPV DNA into the host chromosome.
Fig. 3.1
Part of the HPV genome consisting of the long control region (LCR), E6 gene and E7
gene is integrated into the host DNA (Fig 3.2). The LCR contains a variety of regulatory
sequences that will regulate viral replication and gene expression. The HPV E6 and E7
genes are consistently expressed, whereas the remaining HPV genes are often deleted
or not transcribed after integration.
Fig. 3.2
9648/ 02 / Preliminary Examination / YJC 2013
1763
12
(a) With reference to the information provided and Fig. 3.2, suggest how a dual-
cistronic E6-E7 mRNA transcript is produced. [2]
Fig. 3.3
(b) With reference to Fig. 3.3, describe how the absence of E2 and hence an
increase in E6 and E7 protein synthesis, can result in the degradation of p53
and pRb. [2]
1764
13
(c) Explain why the degradation of p53 may lead to tumour formation. [3]
[Total: 11]
1765
14
4 Wing colour in a butterfly species is determined by two alleles, one coding for red
pigment and another coding for yellow pigment.
When true breeding yellow butterflies are mated with true breeding red butterflies, the
wings of male progeny are always orange. Female progeny always have the same wing
colour as their fathers.
(a) Using suitable symbols, draw two different genetic diagrams in the space
below to fully explain the results obtained in the progeny. [5]
1766
15
(b) Explain the mode of inheritance of wing colour in the butterfly species. [3]
(c) Observed results of the above genetic cross differ from the expected results.
Suggest two reasons why such a discrepancy occurs, referring only to events
that occur after meiosis. [2]
[Total: 10]
1767
16
Fig. 5
9648/ 02 / Preliminary Examination / YJC 2013
1768
17
(i) explain the role of hexokinase in the first step of glycolysis. [2]
(iii) describe how a named organism obtains energy for survival in the
absence of oxygen from glycolysis. [2]
1769
18
[Total: 10]
1770
19
6 Cry toxins are produced by the soil bacterium Bacillus thuringiensis (Bt). By genetic
engineering, Cry toxin gene can be incorporated into commercially important crops to
specifically kill insect pests without affecting other organisms.
Cry toxins are believed to cause death in target insects by oligomerising into pore
complexes in cell surface membrane of midgut epithelial cells.
(a) Explain how formation of pores in the cell surface membrane of midgut
epithelial cells causes death in target insects. [1]
Another mechanism of action of Cry toxin in midgut epithelial cells of target insects has
been proposed. Fig. 6 shows the proposed magnesium ion-dependent signalling
cascade. Single-pass membrane receptors that cross the membrane only once, such as
aminopeptidase N (APN) receptors and cadherin-like receptors, are involved. Cry toxins
eventually lead to destabilisation of the cytoskeleton and ion channels in the cell
membrane causing cell death.
Fig. 6
1771
20
(b) (i) With reference to Fig. 6, describe the proposed cell signalling cascade
of Cry toxin. [4]
(ii) State one advantage and one disadvantage of a signalling cascade. [2]
1772
21
(c) Suggest why Cry toxins only kill target insects and not other organisms. [1]
[Total: 10]
1773
22
7 Antifreezes are specialised proteins that prevent the organisms that have them from
freezing in the polar oceans of the Arctic and the Antarctic. One of these proteins is the
antifreeze glycoprotein (AFGP), which is produced in some fish species. The AFGP
proteins protect the fish by lowering their bodies freezing point temperature so that it is
lower than that of the surrounding seawater. This prevents ice crystals from forming
within the fishes body tissues when fish in icy waters drink and feed, which would be
lethal.
Fig. 7
9648/ 02 / Preliminary Examination / YJC 2013
1774
23
With the separation of Antarctica from South America, water temperatures began to drop,
reaching freezing levels about 1015 million years ago. At this time, it is thought that the
modern day notothenioids were represented by a single species in which the gene for
AFGP may have arisen.
Today the seawater temperature around Antarctica seldom varies more than a few
degrees above freezing. These waters are now dominated by the notothenioids, of which
there are more than 100 species.
AFGP is also found in a species of arctic fish, the Arctic cod. This species is unrelated to
the notothenioids, and its AFGP probably evolved about 45 million years ago during the
glaciation of the Arctic seas. The Arctic cod and the notothenioids separated long before
the antifreeze glycoproteins developed.
Researchers have found that the gene for AFGP in the Antarctic notothenioids is quite
different in its origin and in its location within the genome from the gene expressing
AFGP in the Arctic cod. However, their AFGPs are virtually identical and they both
contain the same repeating sequence of three amino acids (threonine-alanine-alanine).
(a) Explain how natural selection could have brought about the evolution of
antifreeze glycoprotein (AFGP) in the notothenioids in the seawater around
Antarctica. [5]
1775
24
(b) (i) What is the term used to describe the evolutionary pattern observed in
the Antarctic notothenioids and the Arctic cod? [1]
(ii) Explain how the evolutionary pattern you have identified in (b)(i)
resulted in the evolution of virtually identical AFGPs in the Antarctic
notothenioids and the Arctic cod. [4]
[Total: 10]
1776
25
Section B
8 (a) Outline the roles of phospholipids, cholesterol and glycolipids in the cell [6]
surface membrane.
(b) Explain how the molecular structure of haemoglobin is related to its function. [7]
(c) Describe the structural differences between collagen and cellulose. [7]
1777
2
Section A
1 Enzyme X digests a sugar. Fig. 1.1 shows the rate of reaction of enzyme X and a mixture
of enzyme X and substance Y on the sugar. Both reactions were carried out in a conical
flask.
Fig. 1.1
(a) With reference to Fig. 1.1, describe and explain the effect of substance Y on
the enzymatic reaction. [3]
1778
3
(b) Substance Y was found in one of the products of the reaction catalysed by
enzyme X after the substrate concentration, A, in Fig.1.1.
Predict how the trend of the graph for enzyme X only would continue after
sugar concentrations greater than A. Sketch the part of the graph in Fig. 1.1. [1]
Enzyme X may be immobilised in alginate beads. Fig. 1.2 shows a comparison between
the activity of free enzyme X and immobilised enzyme X over a range of temperatures.
Equal concentrations of free enzyme X and immobilised enzyme X were used.
Fig. 1.2
1779
4
(i) describe and explain the effect of temperature on the activity of free
enzyme X. [3]
(ii) describe and explain the differences between the activity of free
enzyme X and immobilised enzyme X up to 40 C. [2]
Description
From 20 to 40 C, activity of immobilised enzyme is lower than free
enzymes (reference to any suitable data range) and the maximum activity
of immobilised enzyme (0.80 A.U at 35 C) is lower than that of free
enzyme (0.95 A.U. at 40C/ between 40 to 45 C);
[1 mark each, max 1 mark]
Explanation
Enzymes immobilised in alginate beads diffuse out from beads less easily
to come into contact with sugar substrate/ less able to move and collide
successfully with substrates leading to fewer enzyme-substrate complexes
formed;
Products formed within the beads diffuse out less easily and accumulate
leading to end-product inhibition.
[1 mark each, max 1 mark]
1780
5
The oil stored in the seeds of the castor oil plant Ricinus communis has been used in the
production of pharmaceutical products such as zinc and castor oil cream, and as a
lubricant. However, Ricinus seeds also produce a poisonous protein ricin, which is
classified as an agent of bioterrorism.
Fig. 1.3 shows the structure of ricin which consists of two polypeptides the A chain of
ricin (RTA, ricin toxin A) joined to a B chain (RTB, ricin toxin B).
RTA
RTB
Fig. 1.3
1781
6
(e) The RTB component of ricin has two binding sites specific for galactose. This
enables RTB to bind to cell surface components that contain galactose. This
is the first step of cellular intoxication. Identify a structure found on the
mammalian cell surface that makes it a good target for ricin. [1]
Glycoprotein
The two polypeptides RTA and RTB are covalently linked by a disulfide
bond between two cysteine residues. Reduction of ricin into its subunits, RTA
and RTB, is catalysed by protein disulfide isomerase (PDI), an enzyme that
resides in the lumen of the endoplasmic reticulum. PDI breaks the interchain
disulfide bond.
Fig. 1.4
9648/ 02 / Preliminary Examination / YJC 2013
1782
7
(i) Explain why the reduction process shown in Fig. 1.4 is necessary
before RTA can exhibit its catalytic activity. [2]
In intact ricin, the RTB polypeptide hides the catalytic site of RTA;
Only after RTA is separated from RTB (after the reduction process)
does RTA exhibit its catalytic activity.
(ii) Suggest one way in which plant ribosomes in the seed cells are
protected from the effect of ricin. [1]
Either one:
[Total: 17]
1783
8
outer membrane
inner membrane
cristae
matrix
intermembrane space
Fig. 2
State two similarities between the organelle above and a typical prokaryotic
cell like E. coli. [2]
1784
9
-
(b) (i) Mutants that are lac Y , meaning that the lac Y gene is inactivated,
retain the capacity to synthesise -galactosidase. However, even
though the lac I gene encoding for the repressor protein is still intact,
-galactosidase can no longer be induced by adding lactose to the
medium. Explain why this is so. [4]
The lac Y gene codes the enzyme permease which enables cells to take
up lactose efficiently. [1]
Mutants that are lac Y- do not have the enzyme permease cells cannot
take up lactose which will thus not be converted to allolactose; [1]
Which is required to bind to the allosteric site of the lac repressor protein
to inactivate it; [1]
[max 2m]
Hence the repressor protein continues to occupy the operator site on the
lac operon; [1]
RNA polymerase is blocked from accessing the promoter site, thus the
structural gene which encodes -galactosidase cannot be transcribed.
[1]
(ii) Positive control of the lac operon results from breakdown of glucose,
which alters the levels of cyclic adenosine monophosphate (cAMP) in
the cell. cAMP binds to a catabolite activator protein (CAP), forming a
CAP-cAMP complex which increases the affinity of RNA polymerase
for the lac promoter. However, this mechanism will not cause
upregulation (genetic regulation that leads to an increase in gene
expression) of the lac operon in the absence of lactose. Explain why
this is so. [2]
1785
10
(c) Why is any bacterial gene capable of being transferred during generalised
transduction? [3]
During generalised transduction, the phage infects the cell and the
bacterial chromosome is fragmented. [1]
While viral particles are being assembled, any one of the bacterial
chromosome gene fragments can possibly be incorporated within the viral
protein coat. [1]
This is because it is the amount of DNA and not the information content of
the DNA that governs viral particle formation. [1]
Max 2 marks
When the new phage carrying the bacterial gene infects another cell, it
brings with it the new bacterial gene. [1]
[Total: 12]
1786
11
3 The human papillomavirus (HPV) is a small non-enveloped virus that has a double-
stranded circular DNA genome. Some HPVs have been well established as the main risk
factor of cervical cancers.
The HPV genome is replicated in the nucleus of infected cells in the form of a circular
DNA (episome). The HPV E2 gene encodes a transcription factor E2 that suppresses
transcription of HPV E6 and E7, which are viral oncogenes. In certain instances during
the replication cycle of HPV, the viral DNA can be linearised and integrated into
chromosomal DNA of host cells. A breakpoint that disrupts the HPV E2 gene will prevent
the synthesis of E2 proteins that normally regulate the transcription of E6 and E7.
Fig. 3.1 illustrates the integration of HPV DNA into the host chromosome.
Fig. 3.1
Part of the HPV genome consisting of the long control region (LCR), E6 gene and E7
gene is integrated into the host DNA (Fig 3.2). The LCR contains a variety of regulatory
sequences that will regulate viral replication and gene expression. The HPV E6 and E7
genes are consistently expressed, whereas the remaining HPV genes are often deleted
or not transcribed after integration.
Fig. 3.2
9648/ 02 / Preliminary Examination / YJC 2013
1787
12
(a) With reference to the information provided and Fig. 3.2, suggest how a dual-
cistronic E6-E7 mRNA transcript is produced. [2]
Fig. 3.3
(b) With reference to Fig. 3.3, describe how the absence of E2 and hence an
increase in E6 and E7 protein synthesis, can result in the degradation of p53
and pRb. [2]
E6 binds to p53 in the cytosol and results in the binding of E6AP ubiquitin
ligase, which ubiquitinates p53 which promotes its degradation in the
proteasome;
E7 binds to pRb in the cytosol and recruits cullin 2 ubiquitin ligase, which
ubiquitinates pRb which promotes its degradation in the proteasome;
9648/ 02 / Preliminary Examination / YJC 2013
1788
13
(c) Explain why the degradation of p53 may lead to tumour formation. [3]
Cells with high levels of telomerase, which adds specific DNA sequence
repeats / more specific repeating DNA units OR telomeric repeats;
to telomeres / DNA strands in telomere regions at the ends of
chromosomes;
thus elongating telomeres OR preventing telomeres from shortening OR
preventing shortening of chromosomes to critical length beyond which cell
division can no longer occur;
[Total: 11]
1789
14
4 Wing colour in a butterfly species is determined by two alleles, one coding for red
pigment and another coding for yellow pigment.
When true breeding yellow butterflies are mated with true breeding red butterflies, the
wings of male progeny are always orange. Female progeny always have the same wing
colour as their fathers.
(a) Using suitable symbols, draw two different genetic diagrams in the space
below to fully explain the results obtained in the progeny. [5]
ZY represents Z chromosome with the allele that codes for yellow pigment in wings
ZR represents Z chromosome with the allele that codes for red pigment in wings
W represents W chromosome
[1 mark for correct key]
Scenario 1
Parental phenotypes Female, yellow X Male, red
Y
Parental genotypes Z W X Z RZ R
Gametes ZY W ZR
Scenario 2
Parental phenotypes Female, red X Male, yellow
Parental genotypes Z RW X Z YZ Y
Gametes
ZR W ZY
1790
15
(b) Explain the mode of inheritance of wing colour in the butterfly species. [3]
In the butterfly species, the female is the heterogametic sex. Females with
the ZY allele (ZYW) would have yellow wings whereas those with the ZR
allele (ZRW) would have red wings. (Hint: Female progeny always have
the same wing colour as their fathers.)
The male is the homogametic sex. Males with genotype ZYZY would have
yellow wings and those with genotype ZRZR would have red wings.
The alleles ZY and ZR exhibit incomplete dominance relative to each other.
Hence, males with the genotype ZYZR have an intermediate phenotype of
orange wings.
[1 mark each]
(c) Observed results of the above genetic cross differ from the expected results.
Suggest two reasons why such a discrepancy occurs, referring only to events
that occur after meiosis. [2]
[Total: 10]
1791
16
Fig. 5
9648/ 02 / Preliminary Examination / YJC 2013
1792
17
(i) explain the role of hexokinase in the first step of glycolysis. [2]
(iii) describe how a named organism obtains energy for survival in the
absence of oxygen from glycolysis. [2]
1793
18
[Total: 10]
1794
19
6 Cry toxins are produced by the soil bacterium Bacillus thuringiensis (Bt). By genetic
engineering, Cry toxin gene can be incorporated into commercially important crops to
specifically kill insect pests without affecting other organisms.
Cry toxins are believed to cause death in target insects by oligomerising into pore
complexes in cell surface membrane of midgut epithelial cells.
(a) Explain how formation of pores in the cell surface membrane of midgut
epithelial cells causes death in target insects. [1]
The pores allow ions and water to diffuse freely into the cells causing
changes in membrane permeability leading to cell swelling/ cell lysis and
death of midgut epithelial cells in target insects.
Another mechanism of action of Cry toxin in midgut epithelial cells of target insects has
been proposed. Fig. 6 shows the proposed magnesium ion-dependent signalling
cascade. Single-pass membrane receptors that cross the membrane only once, such as
aminopeptidase N (APN) receptors and cadherin-like receptors, are involved. Cry toxins
eventually lead to destabilisation of the cytoskeleton and ion channels in the cell
membrane causing cell death.
Fig. 6
1795
20
(b) (i) With reference to Fig. 6, describe the proposed cell signalling cascade
of Cry toxin. [4]
When Cry toxin (ligand) binds to the receptor, the receptor is activated and
cause the membrane-bound G-protein (at the cytoplasmic end) to
exchange its GDP with a GTP in the presence of Mg2+;
(Reject Reference to G protein-coupled receptors (GPCR). Receptors of
Cry toxins are not GPCR as they only pass the membrane once unlike
GPCR that are multi-pass membrane receptors which pass membrane
seven times.)
-subunit of G protein, G , dissociates from its - and - subunits and
Advantage
amplification of signalling cascade: One signal gives rise to multiple
cellular responses;
Disadvantage
Prone to error: error along any part of the cascade would result in
undesirable consequences;
OR
Non-specificity of response causes wastage of energy/ resources.
[1mark each]
1796
21
(c) Suggest why Cry toxins only kill target insects and not other organisms. [1]
Membrane receptors that bind to Cry toxins are only expressed in the
midgut epithelium cells of target insects and not in that of other organisms;
OR
Conditions of gastrointestinal tract such as pH and ion balance that
facilitate activation of Cry signalling cascade in insects are different in
other organisms.
[1 mark]
[Total: 10]
1797
22
7 Antifreezes are specialised proteins that prevent the organisms that have them from
freezing in the polar oceans of the Arctic and the Antarctic. One of these proteins is the
antifreeze glycoprotein (AFGP), which is produced in some fish species. The AFGP
proteins protect the fish by lowering their bodies freezing point temperature so that it is
lower than that of the surrounding seawater. This prevents ice crystals from forming
within the fishes body tissues when fish in icy waters drink and feed, which would be
lethal.
Fig. 7
9648/ 02 / Preliminary Examination / YJC 2013
1798
23
With the separation of Antarctica from South America, water temperatures began to drop,
reaching freezing levels about 1015 million years ago. At this time, it is thought that the
modern day notothenioids were represented by a single species in which the gene for
AFGP may have arisen.
Today the seawater temperature around Antarctica seldom varies more than a few
degrees above freezing. These waters are now dominated by the notothenioids, of which
there are more than 100 species.
AFGP is also found in a species of arctic fish, the Arctic cod. This species is unrelated to
the notothenioids, and its AFGP probably evolved about 45 million years ago during the
glaciation of the Arctic seas. The Arctic cod and the notothenioids separated long before
the antifreeze glycoproteins developed.
Researchers have found that the gene for AFGP in the Antarctic notothenioids is quite
different in its origin and in its location within the genome from the gene expressing
AFGP in the Arctic cod. However, their AFGPs are virtually identical and they both
contain the same repeating sequence of three amino acids (threonine-alanine-alanine).
(a) Explain how natural selection could have brought about the evolution of
antifreeze glycoprotein (AFGP) in the notothenioids in the seawater around
Antarctica. [5]
1799
24
(b) (i) What is the term used to describe the evolutionary pattern observed in
the Antarctic notothenioids and the Arctic cod? [1]
Convergent evolution
(ii) Explain how the evolutionary pattern you have identified in (b)(i)
resulted in the evolution of virtually identical AFGPs in the Antarctic
notothenioids and the Arctic cod. [4]
[Total: 10]
1800
25
Section B
8 (a) Outline the roles of phospholipids, cholesterol and glycolipids in the cell [6]
surface membrane.
Phospholipids
Cholesterol
Glycolipids
1801
26
(b) Explain how the molecular structure of haemoglobin is related to its function. [7]
Structure Function
Each subunit is made up of a protein The ability of the haem group to bind
component called globin and a non-protein to oxygen allows oxygen to be
component called haem group. transported in the blood to parts of
The haem group contains an iron ion (Fe2+) the body via the circulatory system.
and a porphyrin ring that binds O2.
The haemoglobin molecule has a quaternary The proportion of globin chains are
structure with 4 polypeptide subunits (2 - necessary for the normal function of
chain and 2 -chain subunits) that are held haemoglobin.
together by bonds such as hydrogen bonds,
hydrophobic interactions and ionic bonds.
Polypeptide subunits up of amino acids that Amphoteric - Haemoglobin can act
have amino (-NH3+) and carboxyl (-COO-) as buffer molecules by accepting
groups which allow them to act as both an acid hydrogen ions, enabling large
and a base. quantities of carbonic acid to be
carried to the lungs without any
major alteration in the blood pH
(buffering blood pH).
[1 mark per bulleted point, max 7]
1802
27
(c) Describe the structural differences between collagen and cellulose. [7]
Collagen Cellulose
Collagen is a polymer made up of amino Cellulose is a polymer made up of
acids. -glucose monomers.
Compose of three repeat units of amino Compose of one repeat unit of glucose.
acids (Gly-Pro-Hydroxyproline). (only -glucose)
Monomers of collagen (amino acids) are Monomers of cellulose (-glucose) are
linked via peptide bonds. linked via glycosidic bonds.
Collagen is composed of three helical Cellulose chain is made up of a single
polypeptide chains twisted together to straight and unbranched chain of -
form a triple helix / tropocollagen. glucose polymer.
Inter-chain H-bonding maintains the Inter-chain H-bonding maintains the
stability of within a single triple helix / stability between parallel chains of
tropocollagen. cellulose molecules this cross-
linking by hydrogen bonds form
microfibrils.
H-bonding is between -C=O groups of H-bonding is between OH / hydroxyl
proline residues on one chain and NH groups attached to carbon atom 3 on
groups of glycine residues on an one chain and carbon atom 6 on a -
adjacent polypeptide chain. glucose on an adjacent chain.
Each tropocollagen crosslinks with a No covalent cross-links exist between
neighbouring tropocollagen running parallel the cellulose microfibrils.
to it via covalent bonds formed
between R groups of lysine residues on
adjacent tropocollagen forming collagen
fibrils
[1 mark per point of comparison]
1803
28
Chromosomal mutation:
1804
29
1. Cystic fibrosis (CF) is an inherited disease where the mucus glands are
affected.
2. inherited in an autosomal recessive pattern;
1805
30
1. Mitosis maintains genetic stability by ensuring that the two daughter cells
contain exactly the same number of chromosomes as the parent cell.
2. Genetically identical
3. The chromatin of the parental nucleus replicate during S phase of
interphase before mitosis begins.
4. All chromosomes align at the equator during metaphase...
5. ...to ensure that the sister chromatids are shared equally between the two
daughter nuclei after anaphase occurs.
6. The division of the centromere ensures that one sister chromatid of each
chromosome will move to opposite poles.
7. There is no association between homologous pairs of chromosomes /
bivalents do not form, therefore no chiasmata are formed at prophase I.
8. There is thus no crossing over which would have resulted in genetic
variation/recombination of alleles.
[max 7]
1806
2
1 The Sunda slow loris (Nycticebus coucang) is a primate native to forests of Indonesia,
western Malaysia, southern Thailand and Singapore. Listed as Vulnerable" on the
International Union for Conservation of Nature (IUCN) Red List, its population is fast
declining due to extensive habitat loss and illegal poaching for pet trade.
In order to understand more about the species before it is extinct, molecular research
work is conducted by a wildlife conservation research facility. A gene of interest from the
species and a bacterial plasmid vector are cleaved using the same restriction enzyme
and ligated before being cloned in a bacterial host model organism for further analysis.
The restriction enzyme used in the experiment generates sticky ends while the bacterial
plasmid used contains marker genes.
1807
3
The Sunda slow loris is protected by law under the Convention on International Trade in
Endangered Species of Wild Fauna and Flora (CITES) signed by many countries. It is an
offence to be in possession or to trade in any illegally imported or acquired CITES
species.
Before the Sunda slow loris is sold as pet, its teeth are often removed to prevent injury to
potential buyers. However, this frequently results in infection and death of the animal. In
a recent search of the home of an alleged wildlife trader, no live animal was recovered
except three removed teeth of suspected slow loris species.
DNA from dental pulp extracted from these teeth were analysed based on several
Variable Number Tandem Repeat (VNTR) loci. Fig. 1.1 shows the genetic fingerprints of
the three teeth found, labelled as Teeth 1, Teeth 2 and Teeth 3, and teeth known to be
taken from a Sunda slow loris.
Fig. 1.1
1808
4
(ii) With reference to Fig. 1.1, which tooth is most likely removed from the
Sunda slow loris? Explain your answer. [2]
(iii) Rescued captive Sunda slow lorises that have their teeth removed
could not be reintroduced into the wild, as they are unlikely to survive.
Attempts at breeding Sunda slow lorises in captivity in zoos were
made. However, animals continuously bred in captivity might
experience inbreeding depression.
[Total: 11]
1809
5
2 Cystic fibrosis (CF) is one of the most common genetic disorders in the United States. It
is estimated that 30,000 Americans are living with CF and approximately 1,000 new
cases are diagnosed every year. CF is caused by mutations in a gene located on
chromosome 7.
In the early 1980s, attempts were made to map the CF gene on chromosome 7 using
DNA markers.
The relationship between the CF gene and two DNA markers DM1 and DM2 were
studied in a family with many affected children. DNA were extracted from these
individuals and cut with two different restriction enzymes, BamHI and EcoRI, separately.
The products of digestion were separated using gel electrophoresis and the RFLP
banding patterns is shown in Fig. 2.1 below.
Figure 3.1
(Note: BamHI was used on DM1 and EcoRI on DM2)
Fig. 2.1
1810
6
(b) (i) Using the information provided in Fig. 2.1, deduce which marker is
more suitable in detecting the presence of CF. [3]
1811
7
(c) An experiment using a non-viral vector to deliver the cystic fibrosis transmembrane
conductance regulator (CFTR) gene was carried out on five individuals with CF.
Three doses of plasmids bearing the CFTR gene were administered to the patients
at four-week intervals. After each dose, tests were carried out on the patients to
detect the following: plasmid-derived CFTR DNA, plasmid-derived CFTR mRNA,
plasmid-derived CFTR protein and CFTR protein function. The results are shown in
Table 2.2, with positive samples marked +.
Table 2.2
1 + + + + + +
2 + + + +
4 + + + + + +
5 + + + + + +
1812
8
(iii) From your answer in (c)(i) and (c)(ii), determine whether gene delivery
or transcription of the delivered gene was the more significant obstacle
to successful gene therapy. [1]
(iv) Suggest an alternative delivery method that can help address the
obstacle discussed in (c)(iii). [1]
(d) Currently, gene therapy involves the introduction of the normal allele into somatic
cells of individuals suffering from CF.
(ii) Explain why gene therapy provides a possible cure for CF but not stem
cell therapy. [2]
[Total: 15]
1813
9
3 A number of diseases, such as dengue fever, are spread by mosquitoes. The incidence
of this disease has increased dramatically in recent years and this has been linked
with the spread of the mosquito, Aedes aegypti.
In 2010, in the Cayman Islands and in Malaysia, GM male mosquitoes were released
into the wild to mate with females. All the resulting offspring died in the larval stage.
In Malaysia, both GM male and non-GM male mosquitoes were released in order to
compare their dispersal and life span in the wild. The GM mosquitoes could be identified
because they also carried a gene for green fluorescent protein (GFP).
(a) Explain why, in many examples of gene technology, fluorescent markers are
used in preference to antibiotic resistance genes. [1]
(b) In addition to the gene for GFP, the DNA that has been added to the GM
mosquitoes consists of
a promoter
a gene coding for a toxic protein, tTA
a binding site for tTA.
When a GM mosquito larva hatches from an egg, the promoter induces the
production of only a small amount of tTA, so that the larva does not die
immediately. In a process of positive feedback, the tTA produced binds to the
DNA as shown in Fig. 3.1. This increases the expression of the gene until the
increased concentration of tTA kills the larva.
Fig. 3.1
1814
10
(ii) Switching on the gene coding for tTA in the mosquito larvae, rather
than in the eggs, increases the effectiveness of this method of
controlling mosquito numbers.
(c) GM mosquitoes carrying the tTA gene can live and reproduce normally when fed
on a diet containing an added chemical, A.
(ii) suggest why there is little danger of the gene carried by these GM
mosquitoes being passed to other organisms from GM mosquitoes
which escape or are released into the wild. [1]
1815
11
In 1907, scientists found that a common plant tumour was caused by the invasion of a
bacterium called Agrobacterium tumefaciens. They discovered that the tumour was
caused when plasmids from the bacteria were taken into the DNA of the host plants cells
and expressed. By 1983, biotechnologists were able to introduce genes into plant cells
using modified plasmids that do not result in tumour formation. Fig. 3.2 shows the
procedure of transforming Brassica using this method.
Fig. 3.2
1816
12
(d) With reference to Fig. 3.2, explain why carbenicillin and kanamycin were
added in the various media. [3]
(e) Explain why plant tissue culture technique is used to regenerate the
transformed plants. [2]
(f) State the difference in composition between the root initiation medium and the
shoot outgrowth medium. [1]
(g) Suggest why seeds were used instead of explants from adult Brassica plants,
as starting plant material for this procedure. [1]
[Total: 14]
1817
13
4 Planning question
The yield of many cultivated varieties of crop plants such as the onion, Allium cepa, is
reduced by the presence of relatively high concentrations of salts, particularly sodium
chloride, in the soil. There are, however, salt-tolerant varieties of onion that can be grown
successfully in such places. One possible explanation for this is that the fluid in the cell
vacuoles of plants of the tolerant varieties differs in solute potential from that of non-
tolerant varieties.
Plan an investigation to find out whether or not the solute potentials of the cell vacuoles
of epidermal cells of the bulbs of salt-tolerant onions differ from those of their non-
tolerant counterparts.
You are provided with the following equipment. Choose your equipment from this list.
You may not use any additional equipment.
an unlimited supply of 1.0 mol dm3 sodium chloride solution
an unlimited supply of bulbs of two varieties of onion, one salt- tolerant and the
other non-tolerant
unlimited supply of distilled or deionised water
beakers of various sizes
glass specimen tubes
microscope slides and coverslips
volumetric flasks and measuring cylinders of various sizes
graduated pipettes of various sizes, and pipette fillers
dropping pipettes
light microscope with low (100), medium (200) and high (400)
magnification and built-in illumination
wash bottle
marker pen
stopwatch
scalpel
forceps
glass rods for stirring
mounted needles
iodine in potassium iodide solution
[Total: 12]
1818
14
1819
15
1820
16
1821
17
Free-response question
Your answers should be illustrated by large, clearly labelled diagrams, where appropriate.
Your answers must be in continuous prose, where applicable.
Your answers must be set out in sections (a), (b) etc., as indicated in the question.
5 (a) Outline how a named protein can be produced by genetic engineering for the [6]
treatment of diabetes mellitus.
(b) Discuss the benefits and associated ethical implications of the human [8]
genome project.
(c) Describe and give examples of unique features of zygotic stem cells, [6]
embryonic stem cells and adult stem cells.
1822
2
1 The Sunda slow loris (Nycticebus coucang) is a primate native to forests of Indonesia,
western Malaysia, southern Thailand and Singapore. Listed as Vulnerable" on the
International Union for Conservation of Nature (IUCN) Red List, Its population is fast
declining due to extensive habitat loss and illegal poaching for pet trade.
In order to understand more about the species before it is extinct, molecular research
work is conducted by a wildlife conservation research facility. A gene of interest from the
species and a bacterial plasmid vector are cleaved using the same restriction enzyme
and ligated before being cloned in a bacterial host model organism for further analysis.
The restriction enzyme used in the experiment generates sticky ends while the bacterial
plasmid used contains marker genes.
1823
3
The Sunda slow loris is protected by law under the Convention on International Trade in
Endangered Species of Wild Fauna and Flora (CITES) signed by many countries. It is an
offence to be in possession or to trade in any illegally imported or acquired CITES
species.
Before the Sunda slow loris is sold as pet, its teeth are often removed to prevent injury to
potential buyers. However, this frequently results in infection and death of the animal. In
a recent search of the home of an alleged wildlife trader, no live animal was recovered
except three removed teeth of suspected slow loris species.
DNA from dental pulp extracted from these teeth were analysed based on several
Variable Number Tandem Repeat (VNTR) loci. Fig. 1.1 shows the genetic fingerprints of
the three teeth found, labelled as Teeth 1, Teeth 2 and Teeth 3, and teeth known to be
taken from a Sunda slow loris.
Fig. 1.1
1824
4
(ii) With reference to Fig. 1.1, which tooth is most likely removed from the
Sunda slow loris? Explain your answer. [2]
Teeth 2;
(iii) Rescued captive Sunda slow lorises that have their teeth removed
could not be reintroduced into the wild, as they are unlikely to survive.
Attempts at breeding Sunda slow lorises in captivity in zoos were
made. However, animals continuously bred in captivity might
experience inbreeding depression.
[Total: 11]
1825
5
2 Cystic fibrosis (CF) is one of the most common genetic disorders in the United States. It
is estimated that 30,000 Americans are living with CF and approximately 1,000 new
cases are diagnosed every year. CF is caused by mutations in a gene located on
chromosome 7.
In the early 1980s, attempts were made to map the CF gene on chromosome 7 using
DNA markers.
The relationship between the CF gene and two DNA markers DM1 and DM2 were
studied in a family with many affected children. DNA were extracted from these
individuals and cut with two different restriction enzymes, BamHI and EcoRI, separately.
The products of digestion were separated using gel electrophoresis and the RFLP
banding patterns is shown in Fig. 2.1 below.
Figure 3.1
(Note: BamHI was used on DM1 and EcoRI on DM2)
Fig. 2.1
1826
6
(b) (i) Using the information provided in Fig. 2.1, deduce which marker is
more suitable in detecting the presence of cystic fibrosis? [3]
Either
Becos for DM1, 7 out of 8 (88%) of the CF individuals have the only one
5kb band/ homozygous for the 5 kb fragments;
5 out of 8 (62.5%) of the CF individuals have only one 4kb band/
homozygous for the 4 kb fragments for DM2;
Or
For DM1 - All CF individuals have only one 5kb band/ homozygous for
the 5 kb fragments except II-3 who has 2 bands 5kb and 7 kb;
For DM2 - 5 CF individuals have only one 4kb band/ homozygous for
the 4 kb fragments and 4 CF individuals have 2 bands 3kb and 4kb /
about equal number of CF individuals and normal individuals have a
single 4kb band as well as 2 bands 3kb and 4kb;
(So the inheritance of the DM1/5kb fragment is more consistent
compared to DM2)
Higher tendency for the 5kb fragment to be inherited together with the CF
gene;
Hence lower number of recombinants (individuals II-3 and II-10 compared
to DM2 (II-1,2,,6,7 and 10);
[max 2]
1827
7
(c) An experiment using a non-viral vector to deliver the cystic fibrosis transmembrane
conductance regulator (CFTR) gene was carried out on five individuals with cystic
fibrosis (CF). Three doses of plasmids bearing the CFTR gene were administered
to the patients at four-week intervals. After each dose, tests were carried out on the
patients to detect the following: plasmid-derived CFTR DNA, plasmid-derived CFTR
mRNA, plasmid-derived CFTR protein and CFTR protein function. The results are
shown in Table 2.2, with positive samples marked +.
Table 2.2
1 + + + + + +
2 + + + +
4 + + + + + +
5 + + + + + +
8/15= 53.3%
7/8= 87.5%
(iii) From your answer in (c)(i) and (c)(ii), determine whether gene delivery
or transcription of the delivered gene was the more significant obstacle
to successful gene therapy. [1]
gene delivery
1828
8
(iv) Suggest an alternative delivery method that can help address the
obstacle discussed in (c)(iii). [1]
(d) Currently, gene therapy involves the introduction of the normal allele into somatic
cells of individuals suffering from CF.
(ii) Explain why gene therapy provides a possible cure for CF but not stem
cell therapy. [2]
Multiple organs affected lungs, pancreas etc. / many different cell types
are involved;
not all organs involved have stem cells that can be used for stem cell
therapy/ difficulty in extracting the stem cells for use; Difficulty in obtaining
stem cells that are able to differentiate into many different types of cells;
[Total: 15]
1829
9
3 A number of diseases, such as dengue fever, are spread by mosquitoes. The incidence
of this disease has increased dramatically in recent years and this has been linked
with the spread of the mosquito, Aedes aegypti.
In 2010, in the Cayman Islands and in Malaysia, GM male mosquitoes were released
into the wild to mate with females. All the resulting offspring died in the larval stage.
In Malaysia, both GM male and non-GM male mosquitoes were released in order to
compare their dispersal and life span in the wild. The GM mosquitoes could be identified
because they also carried a gene for green fluorescent protein (GFP).
(a) Explain why, in many examples of gene technology, fluorescent markers are
used in preference to antibiotic resistance genes. [1]
(b) In addition to the gene for GFP, the DNA that has been added to the GM
mosquitoes consists of
a promoter
a gene coding for a toxic protein, tTA
a binding site for tTA.
When a GM mosquito larva hatches from an egg, the promoter induces the
production of only a small amount of tTA, so that the larva does not die
immediately. In a process of positive feedback, the tTA produced binds to the
DNA as shown in Fig. 3.1. This increases the expression of the gene until the
increased concentration of tTA kills the larva.
Fig. 3.1
1830
10
(ii) Switching on the gene coding for tTA in the mosquito larvae, rather
than in the eggs, increases the effectiveness of this method of
controlling mosquito numbers.
GM larvae do not die immediately thus this gives longer time for tTA
production / tTA to build up;
so tTA can gets into environment (when GM larvae die) and kills non-
GM larvae;
(c) GM mosquitoes carrying the tTA gene can live and reproduce normally when fed
on a diet containing an added chemical, A.
(ii) suggest why there is little danger of the gene carried by these GM
mosquitoes being passed to other organisms from GM mosquitoes
which escape or are released into the wild. [1]
1831
11
In 1907, scientists found that a common plant tumour was caused by the invasion of a
bacterium called Agrobacterium tumefaciens. They discovered that the tumour was
caused when plasmids from the bacteria were taken into the DNA of the host plants cells
and expressed. By 1983, biotechnologists were able to introduce genes into plant cells
using modified plasmids that do not result in tumour formation. Fig. 3.2 shows the
procedure of transforming Brassica using this method.
Fig. 3.2
1832
12
(d) With reference to Fig. 3.2, explain why carbenicillin and kanamycin were
added in the various media. [3]
Carbenicillin and kanamycin are antibiotics, which were added to select for
the growth of transformed Brassica;
OR
Carbenicillin and kanamycin are antibiotics; carbenicillin is added to inhibit
the growth of A. tumefaciens attached to the explants and kanamycin
added subsequently to select for the growth of transformed Brassica;
The genetic markers on the plasmid are therefore genes resistant to
carbenicillin and kanamycin;
Only successfully transformed cells/ plantlets will survive in culture;
(e) Explain why plant tissue culture technique is used to regenerate the
transformed plants. [2]
(Any 2:)
They have the advantage of being free from fungal or bacterial infections;
Quick production of mature plants;
Regeneration of whole plants from genetically modified explants;
Amount of space required for field trials to determine which plants have
desirable traits is reduced;
(f) State the difference in composition between the root initiation medium and the
shoot outgrowth medium. [1]
(g) Suggest why seeds were used instead of explants from adult Brassica plants,
as starting plant material for this procedure. [1]
Seeds are easier to surface sterilise than adult plant parts/ more effective
surface sterilisation
OR
OR
[Total: 14]
9648/ 03 / Preliminary Examination / YJC 2013
1833
13
4 Planning question
1834
14
1835
15
Free-response question
Your answers should be illustrated by large, clearly labelled diagrams, where appropriate.
Your answers must be in continuous prose, where applicable.
Your answers must be set out in sections (a), (b) etc., as indicated in the question.
5 (a) Outline how a named protein can be produced by genetic engineering for the [6]
treatment of diabetes mellitus.
1836
16
(b) Discuss the benefits and associated ethical implications of the human [8]
genome project.
Risk assessment for certain diseases. Risk profiles for diseases may be
Knowledge of genetic variations can help accessible to insurers, employers,
prevent / treat these diseases. schools etc. / individuals privacy
infringed. May be used in
discriminatory manner/ stigmatization/
social risks.
Psychological impact due to an
individuals genetic differences.
Doctors, other health service providers,
patients and the public must be
educated to make informed choices,
and be aware of scientific capabilities
and limitations.
Standards and quality-control
measures in testing procedures must
be enforced to ensure reliability of
tests. Proper counselling must be done
in conjunction with risk profiling and
where there is no treatment for certain
diseases.
Reproductive issues / decision
making / rights and potentially
controversial procedures e.g.
eugenics, foetal genetic testing and
abortion.
1837
17
(c) Describe and give examples of unique features of zygotic stem cells, [6]
embryonic stem cells and adult stem cells.
Functions :
o Zygotic stem cell has the potential to differentiate into all the
cells that form the complete organism plus the extra-embryonic
tissues which include the placenta and amnion.
o These cells give rise to form all cells in the body of the
organism therefore they have limited ability to self-renew .
o Functions :
Outer layer forms the placenta .
Inner cell mass (ICM) forms the three primary germ
layers: ectoderm, endoderm and mesoderm, which
later form all the tissues of the human body.
give rise to various organs in organism / multiple
1838
18
3. Adult stem cells [E.g. Blood stem cells, Stromal Stem cells, Gut
Epithelium stem cells]
o Blood stem cells are multipotent. / Found in each tissues or
organs which help to replenish worn-out or damaged cells.
o They have the ability to differentiate into a limited range of cell
type and so are not pluripotent or totipotent .
o Found in bone marrow or blood/skin etc
o Functions:
Responsible for constant renewal of blood.
Give rise to all the blood cell types