Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
An Integrated Approach
Third edition
Gurcharan Singh
University of Delhi
Delhi, INDIA
CIP data will be provided on request
ISBN 978-1-57808-668-9
The author and the publisher make no warranty of any kind, expressed or implied, with regard to programs
contained in this companion CD. The authors and publisher shall not be liable in any event for incidental
or consequential damages in connection with, or arising out of, the furnishing, performance, or use of these
programs.
All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or
transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, without
the prior permission of the publishers, in writing. The exception to this is when a reasonable part of the
text is quoted for purpose of book review, abstracting etc.
This book is sold subject to the condition that it shall not, by way of trade or otherwise be lent, re-sold,
hired out, or otherwise circulated without the publishers prior consent in any form of binding or cover
other than that in which it is published and without a similar condition including this condition being
imposed on the subsequent purchaser.
Chapter 6
Preface
This third edition of integrated information on Plant Systematics has largely been influenced
by the developments of the first few years of twenty first century. Past two decades have
seen development of new tools of biotechnology, vigorous utilization of molecular data in
understanding phylogeny, and redefining affinities and arrangements of plant groups. Recent
years have also seen disappearance of gaps between numerical and cladistic methodologies,
and integration of former into the latter for complete understanding of phylogenetic
relationships. These trends have largely influenced the combination of numerical and
cladistic methods under one chapter, and enlarged discussion on Molecular Systematics,
discussing new concepts, tools and recent achievements. New chapters on Pteridophytes
and Gymnosperms have been added for complete understanding of systematics of vascular
plants.
It is being increasingly realized that actual photographs of plants and plant parts enable
better understanding of taxonomic information, the trend usefully exploited by recent
publications by Simpson (2006) and Judd et al. (3rd ed., 2008). The present edition
incorporates more than 500 colour photographs of plants from diverse families of plants.
High-resolution images of these as also the additional plants have been provided in the
CD-ROM being supplied along with the book, latter including 772 photographs. This has
largely been possible through the kind courtesy of my son Manpreet Singh and daughter-
in-law Komal, who sponsored my recent visit to California, and provided me the opportunity
to visit and photograph temperate plants in and around California. The book as such contains
images of both tropical plants (largely from Delhi), temperate American plants and plants
from other parts of the World growing in the Botanical Gardens of University of California
and San Francisco Botanical Garden. I wish to record the help rendered by the members of
TAXACOM in the identification of some of the American plants.
The focus of the present edition has been to further consolidate the information on the
principles of plant systematics, include detailed discussion on all major systems of
classification, and significantly, also include discussion on the selected families of vascular
plants, without sacrificing the discussion on basic principles. The families included for
discussion are largely those which have wide representation, as also those that are less
iv Plant Systematics
known but significant in evaluating the phylogeny of angiosperms. The discussion of the
families also has a considerable focus on their phylogenetic relationships, as evidenced by
recent cladistic studies, with liberal citation of molecular data. Several additional families
have been included for detailed discussion in the present volume.
Recent internet revolution has greatly helped in propagating taxonomic information,
with numerous searchable databases, online programs for identification and data analysis
available for ready reference. The information concerning these has been included at
appropriate places in various chapters for easy utilization. In light of this, the separate
chapter on web has been omitted. The outputs of computer programs, especially used in
molecular studies and construction of phylogenetic trees has been included based on actual
or hypothetical data. This will acquaint readers with the handling of raw data and working
of computer programs.
The author has attempted to strike a balance between classical fundamental
information and the recent developments in plant systematics. Special attention has been
devoted to the information on botanical nomenclature, identification and phylogeny of
angiosperms with numerous relevant examples and detailed explanation of the important
nomenclatural problems. An attempt has been made to present a continuity between orthodox
and contemporary identification methods by working on a common example. The information
on methods of identification using computers has been further enhanced to help better on-
line identification.
For providing me inspiration for this book, I am indebted to my undergraduate students,
who helped me to improve the material through frequent interactions. I am also indebted
to my wife Mrs. K.G. Singh for constant support and bearing with my overindulgence with
this book. I also wish to acknowledge the help rendered by my son Kanwarpreet Singh at
various stages.
I wish to record thanks to all the colleagues whose inputs have helped me to improve
the information presented here. I also wish to place on record sincere thanks to Dr. Jef
Veldkamp for valuable information on nomenclature, Dr. Gertrud Dahlgren for photographs
and literature, Dr. P.F. Stevens for literature on APG II and trees from his APweb, Dr.
Robert Thorne for making available his 2007 classification, Dr. James Reveal for his help
on nomenclatural problems, Dr. D.L. Dilcher for his photograph, Dr. Julie Barcelona and
Harry Wiriadinata for photographs of Rafflesia, the authorities of New York Botanical Garden,
Missouri Botanical Garden, USA, Royal Botanic Gardens Kew and University of California,
Santa Cruz, for photographs used in the book.
Preface iii
Embryology 154
Families marked out by distinct embryological features 154
Specific examples of the role of embryological data 155
Palynology 156
Pollen aggregation 156
Pollen wall 157
Pollen aperture 157
Micromorphology and Ultrastructure 159
Micromorphology 159
Ultrastructure 161
Chromosomes 164
Chromosomal number 164
Chromosomal structure 167
Chromosomal behaviour 168
Chemotaxonomy 168
Primary metabolites 169
Secondary metabolites 169
Non-semantide Macromolecules 178
Proteins 178
Molecular systematics 184
Molecular evolution 184
Location of molecular data 186
Molecular techniques 187
DNA polymorphism 199
Examples of molecular studies 204
Gene trees 209
8. DEVELOPING CLASSIFICATIONS 210264
Phenetic methods 210
Principles of taxometrics 211
Cladistic methods 212
Phylogenetic terms 213
Phylogenetic diagrams 221
Phylogeny and classification 225
Phylogenetic data analysis 229
Taxa-Operational Units 229
Characters 229
Measure of similarity 234
Construction of trees 237
The Consensus tree 251
Automated trees 258
Gene trees and species trees 262
Developing classification 263
9. PHYLOGENY OF ANGIOSPERMS 265296
Origin of Angiosperms 265
What are Angiosperms? 265
What is the age of Angiosperms? 266
What is the place of their origin? 268
Are angiosperms monophyletic or polyphyletic? 270
Contents ix
Aspleniaceae 379
Dryopteridaceae 380
Polypodiaceae 382
12. FAMILIES OF GYMNOSPERMS 384406
Cycadales
Cycadaceae 386
Zamiaceae 387
Ginkgoales
Ginkgoaceae 389
Coniferales
Pinaceae 391
Cupressaceae 393
Podocarpaceae 395
Araucariaceae 396
Taxaceae 398
Gnetales
Ephedraceae 399
Gnetaceae 401
13. MAJOR FAMILIES OF ANGIOSPERMS 407678
Angiosperms roll of honour 408
Chloranthidae 409
Amborellaceae 409
Chloranthaceae 411
Austrobaileyaceae 413
Winteraceae
Illiciaceae 415
Cabombaceae 417
Nymphaeaceae 419
Ceratophyllaceae 421
Magnoliidae 423
Magnoliaceae 423
Degeneriaceae 425
Annonaceae 427
Calycanthaceae 429
Lauraceae 431
Winteraceae 433
Saururaceae 435
Piperaceae 437
Alismatidae 439
Acoraceae 439
Araceae 441
Butomaceae 443
Alismataceae 445
Hydrocharitaceae 447
Potamogetonaceae 449
Liliidae 451
Pandanaceae 451
Dioscoreaceae 453
Smilacaceae 455
Contents xi
Liliaceae 473
Orchidaceae 475
Iridaceae 478
Asphodelaceae 480
Alliaceae 482
Subfamily 484
Agavaceae 485
Commelinidae 487
Arecaceae 488
Commelinaceae 490
Musaceae 492
Zingiberaceae 494
Cannaceae 496
Juncaceae 498
Cyperaceae 500
Poaceae 502
Ranunculidae 505
Paeoniaceae 505
Berberidaceae 507
Ranunculaceae 509
Papaveraceae 512
Hamamelididae 514
Saxifragaceae 514
Fagaceae 517
Betulaceae 519
Casuarinaceae 521
Caryophyllidae 523
Portulacaceae 524
Cactaceae 526
Nyctaginaceae 528
Aizoaceae 530
Chenopodiaceae 532
Amaranthaceae 534
Caryophyllaceae 536
Polygonaceae 538
Droseraceae 540
Rosidae 542
Celastraceae 543
Violaceae 545
Salicaceae 547
Cucurbitaceae 550
Clusiaceae 552
Euphorbiaceae 554
Oxalidaceae 557
Zygophyllaceae 559
Geraniaceae 561
Rosaceae 563
Fabaceae 566
Myrtaceae 572
xii Plant Systematics
Lythraceae 574
Onagraceae 577
Malvidae 579
Malvaceae 580
Grewiaceae 583
Dipterocarpaceae 584
Rhamnaceae 586
Ulmaceae 588
Moraceae 590
Urticaceae 592
Rafflesiaceae 595
Capparaceae 597
Cleomaceae 599
Brassicaceae 600
Rutaceae 603
Meliaceae 605
Anacardiaceae 607
Sapindaceae 610
Asteridae 612
Hydrangeaceae 613
Cornaceae 627
Balsaminaceae 629
Polemoniaceae 631
Ebenaceae 633
Sapotaceae 635
Primulaceae 637
Ericaceae 639
Adoxaceae 642
Apiaceae 644
Araliaceae 646
Asteraceae 649
Lamiidae 652
Solanaceae 652
Convolvulaceae 655
Boraginaceae 657
Rubiaceae 659
Apocynaceae 661
Plantaginaceae 664
Lamiaceae 666
Verbenaceae 669
Bignoniaceae 671
Acanthaceae 673
Scrophulariaceae 675
REFERENCES 669702
INDEX 703742
Contents xiii
Stems 85
Leaves 86
Inflorescences 87
Fruits 88
Pteridophytes 403
Selaginellaceae, Osmundaceae, Blechnaceae 403
Gymnosperms
Cycadaceae, Zamiaceae 404
Ginkgoaceae, Pinaceae, Cupressaceae 405
Angiosperms 457
Chloranthidae 457
Magnoliidae 458
Araceae, Alismataceae, Hydrocharitaceae, Liliaceae 459
Iridaceae, Asphodelaceae, Alliaceae 460
Hyacinthaceae, Agavaceae, Asparagaceae, Nolinaceae 461
Arecaceae, Musaceae, Commelinaceae, Cyperceae, Poaceae 462
Paeoniaceae, Berberidaceae, Papaveraceae 463
Ranunculaceae 464
Grossulariaceae, Fagaceae, Nothofagaceae, Betulaceae 465
Portulacaceae, Cactaceae, Nyctaginaceae, Aizoaceae 466
Chenpodiaceae, Amaranthaceae, Caryophyllaceae, Polygonaceae 467
Celastraceae, Violaceae, Cucurbitaceae, Begoniaceae 468
Clusiaceae, Euphorbiaceae, Oxalidaceae 469
Geraniaceae, Rosaceae 470
Fabaceae 471
Myrtaceae, Lythraceae, Onagraceae 472
Malvaceae, Rhamnaceae, Moraceae 615
Rafflesiaceae, Brassicaceae 616
Rutaceae, Anacardiaceae, Meliaceae 617
Sapindaceae 618
Hydrangeaceae, Polemoniaceae, Cornaceae, Primulaceae 619
Ericaceae, Adoxaceae 620
Apiaceae, Araliaceae 621
Asteraceae 622
Solanaceae, Convolvulaceae, Boraginaceae 623
Rubiaceae, Apocynaceae 624
Plantaginaceae, Lamiaceae 625
Verbenaceae, Bignoniaceae, Acanthaceae, Scrophulariaceae 626
Chapter 1
Plants, Taxonomy and Systematics
Taxonomy (or systematics) is basically con- a single largest, most inclusive group. Clas-
cerned with the classification of organisms. sifying organisms and diverse forms of life
Living organisms are placed in groups on the is challenging task before the biologists.
basis of similarities and differences at the
organismic, cellular, and molecular levels.
The United Nations Environment PLANTS AND KINGDOMS OF LIFE
Programmes Global Biodiversity Assessment Plants are mans prime companions in this
estimates the number of described species universe, being the source of food and en-
of living organisms as approximately 1.75 ergy, shelter and clothing, drugs and bever-
million. The list grows longer every year. Clas- ages, oxygen and aesthetic environment, and
sifying these organisms has been a major as such they have been the dominant com-
challenge, and the last few decades have seen ponent of his taxonomic activity through the
a lot of realignments as additional ultrastruc- ages. Before attempting to explore the diver-
tural and molecular information piles up. sity of plant life it is essential to understand
These realignments have primarily been the as to what is our understanding of the term
result of realization that the branches of the Plant, and the position of plants in the web
phylogenetic tree must be based on the con- of life. Traditionally the plants are delimited
cept of monophyly, and each taxonomic as organisms possessing cell wall, capable
group, kingdoms included, should be mono- of photosynthesis, producing spores and
phyletic. having sedentary life. A lot of rethinking has
Before attempting to classify the various resulted in several different interpretations
organisms, it is necessary to identify and of the term plant.
name them. A particular group of individu-
als, unique in several respects, is given a
unique binomial, and is recognized as a spe- Two Kingdom System
cies. These species are grouped into taxo- The living organisms were originally grouped
nomic groups, which are successively as- into two kingdoms. Aristotle divided all liv-
signed the ranks of genera, families, orders, ing things between plants, which generally
and the process continues till all the spe- do not move or have sensory organs, and
cies have been arranged (classified) under animals. Linnaeus in his Systema naturae
2 Plant Systematics
published in 1735 placed them under proposal, however, was not taken up imme-
Animalia (Animals) and Vegetabilia (Plants) diately, because another classification was
as two distinct kingdoms (Linnaeus placed proposed by Herbert Copeland (1938), who
minerals in the third kingdom Mineralia). gave the prokaryotes a separate kingdom,
Linnaeus divided each kingdom into classes, originally called Mycota but later referred to
later grouped into phyla for animals and di- as Monera or Bacteria. Copeland later on
visions for plants. When single-celled organ- (1956) proposed a four-kingdom system
isms were first discovered, they were split placing all eukaryotes other than animals
between the two kingdoms: mobile forms in and plants in the kingdom Protoctista, thus
the animal phylum Protozoa, and colored recognizing four kingdoms Monera,
algae and bacteria in the plant division Thal- Protoctista, Plantae and Animalia. The im-
lophyta or Protophyta. As a result, Ernst portance of grouping these kingdoms in two
Haeckel (1866) suggested creating a third empires, as suggested earlier by Chatton
kingdom Protista for them, although this was popularized by Stanier and van Niel
was not very popular until relatively recently (1962), and soon became widely accepted.
(sometimes also known as Protoctista).
Haeckel recognized three kingdoms: Pro- Five Kingdom System
tista, Plantae and Animalia.
American biologist Robert H. Whittaker
(1969) proposed the removal of fungi into a
Two Empires Three Kingdoms separate kingdom thus establishing a five
The subsequent discovery that bacteria are kingdom system recognizing Monera, Pro-
radically different from other organisms in tista, Fungi, Plantae and Animalia as dis-
lacking a nucleus, led Chatton (1937) to pro- tinct kingdoms. The fungi like plants have
pose a division of life into two empires: or- a distinct cell wall but like animals lack
ganisms with a nucleus in Eukaryota and autotrophic mode of nutrition. They, how-
organisms without in Prokaryota. Prokary- ever, unlike animals draw nutrition from
otes do not have a nucleus, mitochondria or decomposition of organic matter, have cell
any other membrane bound organelles. In wall reinforced with chitin, cell membranes
other words neither their DNA nor any other containing ergosterol instead of cholesterol
of their metabolic functions are collected to- and have a unique biosynthetic pathway for
gether in a discrete membrane enclosed area. lysine. The classification was followed widely
Instead everything is openly accessible within in textbooks.
the cell, though some bacteria have internal
membranes as sites of metabolic activity
these membranes do not enclose a separate Six or Seven Kingdoms?
area of the cytoplasm. Eukaryotes have a Subsequent research concerning the organ-
separate membrane bound nucleus, numer- isms previously known as archebacteria has
ous mitochondria and other organelles such led to the recognition that these creatures
as the Golgi Body within each of their cells. form an entirely distinct kingdom Archaea.
These areas are separated off from the main These include anaerobic bacteria found in
mass of the cells cytoplasm by their own harsh oxygen-free conditions and are geneti-
membrane in order to allow them to be more cally and metabolically completely different
specialized. The nucleus contains all the from other, oxygen-breathing organisms.
Eukaryote cell DNA, which gets organized These bacteria, called Archaebacteria, or
into distinct chromosomes during the pro- simply Archaea, are said to be living fossils
cess of mitosis and meiosis. The energy is that have survived since the planets very
generated in mitochondria. The exception to early ages, before the Earths atmosphere
this rule are red blood cells which have no even had free oxygen. This together with the
nucleus and do not live very long. Chattons emphasis on phylogeny requiring groups to
Plants, Taxonomy and Systematics 3
be monophyletic resulted in a six kingdom isms, but they differ in their treatment. Ross
system proposed by Carl Woese et al. (1977). (2002, 2005) recognized Archaebacteria and
They grouped Archaebacteria and Eubacteria Eubacteria as separate kingdoms, named as
under Prokaryotes and rest of the four king- Protomonera and Monera, respectively again
doms Protista, Fungi, Plantae and Animalia under separate superkingdoms (domains of
under Eukaryotes. They subsequently (1990) earlier authors) Archaebacteriae and
grouped these kingdoms into three domains Eubacteria. He added seventh kingdom
Bacteria (containing Eubacteria), Archaea Myxomycophyta of slime moulds under
(containing Archaebacteria) and Eukarya superkingdom Eukaryotes. Two additional
(containing Protista, Fungi, Plantae and superkingdoms of extinct organisms Pro-
Animalia). genotes (first cells) and Urkaryotes (prokary-
Margulis and Schwartz (1998) proposed otic cells that became eukaryotes) were added:
term superkingdom for domains and recog-
nized two superkingdoms: Prokarya Superkingdom Progenotes....
(Prokaryotae) and Eukarya (Eukaryotae). ....first cells now extinct
Former included single kingdom Bacteria
(Monera) divided into two subkingdoms
Superkingdom Archaebacteriae
Archaea and Eubacteria. Eukarya was Kingdom Protomonera...archaic bacteria
divided into four kingdoms: Protoctista (Pro- Superkingdom Eubacteria
tista), Animalia, Plantae and Fungi. Kingdom Monera........bacteria
Several recent authors have attempted to Superkingdom Urkaryotes
recognize seventh kingdom of living organ- ...prokaryoti cells that became eukaryotes
Figure 1.1 Seven kingdoms of life and their possible phylogeny (after Patterson & Sogin 1992).
4 Plant Systematics
Dinoflagellates
Glaucophytes
Gymnosperms
Pteridophytes
Angiosperms
Euglenoides
Brown algae
Green algae
Bryophytes
Red algae
Bacteria
Animalia
Fungi
Carpel, stamen
Seeds
Secondary growth
Vascular tissue
Sporophyte independent
Embryo
Chloroplast Chloroplast Gametangia
(secondary (secondary Cuticle
Endosymbiosis) Endosymbiosis) Green chloroplast
Chloroplast
(primary endosymbiosis)
Mitochondria
Cytoskeletal elements: actin, myosin, tubulin
ER, Golgi, lysosomes
Mitosis , Meiosis
Membrane bound nucleus
Linear DNA, with histones
Figure 1.2 Cladogram showing the evolution of major groups of organisms and the associated
apomorphies. Chloroplast evolution has occurred twice, once (primary endosymbiosis)
eukaryote cell engulfing a photosynthetic bacterial cell, and elewhere (secondary
endosymbiosis) eukaryotic cell engulfing an eukaryotic cell containing chloroplast.
engulfed an eukaryotic cell containing a curred, along with the thylakoid structure
chloroplast. This common evolutionary se- and a variety of storage products
quence is shared by green plants (includ-
ing green algae; green chloroplast), red al- The Plant Kingdom
gae (red chloroplast) and brown algae and
their relatives (commonly known as It is now universally agreed that members
stramenopiles; brown chloroplast), in which of the plant kingdom include, without doubt
diversification of chloroplast pigments oc- the green algae, liverworts and mosses, pteri-
Plants, Taxonomy and Systematics 7
known taxon, and assigning a correct rank Whereas the fresh specimens can be de-
and position in an extant classification. In scribed conveniently, the dry specimens need
practice, it involves finding a name for an to be softened in boiling water or in a wet-
unknown specimen. This may be achieved by ting agent before these could be described.
visiting a herbarium and comparing unknown Softening is often essential for dissection of
specimen with duly identified specimens flowers in order to study their details.
stored in the herbarium. Alternately, the
specimen may also be sent to an expert in Nomenclature
the field who can help in the identification. Nomenclature deals with the determination
Identification can also be achieved using of a correct name for a taxon. There are
various types of literature such as Floras, different sets of rules for different groups of
Monographs or Manuals and making use of living organisms. Nomenclature of plants
identification keys provided in these sources (including fungi) is governed by the Inter-
of literature. After the unknown specimen national Code of Botanical Nomenclature
has been provisionally identified with the (ICBN) through its rules and recommenda-
help of a key, the identification can be fur- tions. Updated every six years or so, the
ther confirmed by comparison with the de- Botanical Code helps in picking up a single
tailed description of the taxon provided in the correct name out of numerous scientific
literature source. names available for a taxon, with a particu-
A method that is becoming popular over lar circumscription, position and rank. To
the recent years involves taking a photo- avoid inconvenient name changes for cer-
graph of the plant and its parts, uploading tain taxa, a list of conserved names is
this picture on the website and informing provided in the Code. Cultivated plants are
the members of appropriate electronic Lists governed by the International Code of No-
or Newsgroups, who can see the photograph menclature for Cultivated Plants (ICNCP),
at the website and send their comments to slightly modified from and largely based on
the enquirer. Members of the fraternity could the Botanical Code.
thus help each other in identification in a Names of animals are governed by the In-
much efficient manner. ternational Code of Zoological Nomenclature
(ICZN); those of bacteria by International
Description Code for the Nomenclature of Bacteria
The description of a taxon involves listing (ICNB), now called Bacteriological Code (BC).
its features by recording the appropriate A separate Code exists for viruses, named
character states. A shortened description the International Code of Virus Classifica-
consisting of only those taxonomic charac- tion and Nomenclature (ICVCN).
ters which help in separating a taxon from With the onset of electronic revolution and
other closely related taxa, forms the diag- the need to have a common database for liv-
nosis, and the characters are termed as di- ing organisms for global communication a
agnostic characters. The diagnostic char- common uniform code is being attempted.
acters for a taxon determine its circumscrip- The Draft BioCode is the first public expres-
tion. The description is recorded in a set pat- sion of these objectives. The first draft was
tern (habit, stem, leaves, flower, sepals, pet- prepared in 1995. After successive reviews
als, stamens, carpels, fruit, etc.). For each the fourth draft, named Draft BioCode (1997)
character, an appropriate character-state is prepared by the International Committee for
listed. Flower colour (character) may thus be Bionomenclature was published by Greuter
red, yellow, white, etc. (states). The descrip- et al., (1998) and is now available on the web.
tion is recorded in semi-technical language The last decade of twentieth century also saw
using specific terms for each character state the development of rankless PhyloCode
to enable a proper documentation of data. based on the concepts of phylogenetic
10 Plant Systematics
systematics. It omits all ranks except spe- (a taxonomic group assigned to any rank; pl.
cies and clades based on the concept of rec- taxa), dividing a taxon into smaller units,
ognition of monophyletic groups. The latest uniting two or more taxa into one, transfer-
version of PhyloCode (PhyloCode4b, 2007) is ring its position from one group to another
also available on the web. and altering its rank. Once established, a
classification provides an important mecha-
Phylogeny nism of information storage, retrieval and
Phylogeny is the study of the genealogy and usage. This ranked system of classification
evolutionary history of a taxonomic group. is popularly known as the Linnaean sys-
Genealogy is the study of ancestral relation- tem. Taxonomic entities are classified in
ships and lineages. Relationships are de- different fashions:
picted through a diagram better known as a 1. Artificial classification is utilitarian,
phylogram (Stace, 1989), since the com- based on arbitrary, easily observable
monly used term cladogram is more appro- characters such as habit, colour, num-
priately used for a diagram constructed ber, form or similar features. The
through cladistic methodology. A phylogram sexual system of Linnaeus, which fits
is a branching diagram based on the degree in this category, utilized the number
of advancement (apomorphy) in the descen- of stamens for primary classification
dants, the longest branch representing the of the flowering plants.
most advanced group. This is distinct from a 2. Natural classification uses overall
phylogenetic tree in which the vertical scale similarity in grouping taxa, a concept
represents a geological time-scale and all liv- initiated by M. Adanson and culminat-
ing groups reach the top, with primitive ones ing in the extensively used classifi-
near the centre and advanced ones near the cation of Bentham and Hooker. Natu-
periphery. Monophyletic groups, including all ral systems of the eighteenth and
the descendants of a common ancestor, are nineteenth centuries used morphol-
recognized and form entities in a classifica- ogy in delimiting the overall similar-
tion system. Paraphyletic groups, wherein ity. The concept of overall similarity
some descendants of a common ancestor are has undergone considerable refine-
left out, are reunited. Polyphyletic groups, with ment in recent years. As against the
more than one common ancestor, are split sole morphological features as indica-
to form monophyletic groups. Phenetic infor- tors of similarity in natural systems,
mation may often help in determining a phy- overall similarity is now judged on the
logenetic relationship. basis of features derived from all the
available fields of taxonomic informa-
Classification tion (phenetic relationship).
Classification is an arrangement of organ- 3. Phenetic Classification makes the
isms into groups on the basis of similari- use of overall similarity in terms of a
ties. The groups are, in turn, assembled into phenetic relationship based on data
more inclusive groups, until all the organ- from all available sources such as mor-
isms have been assembled into a single phology, anatomy, embryology, phy-
most inclusive group. In sequence of in- tochemistry, ultrastructure and, in
creasing inclusiveness, the groups are as- fact, all other fields of study. Phenetic
signed to a fixed hierarchy of categories classifications were strongly advo-
such as species, genus, family, order, class cated by Sneath and Sokal (1973) but
and division, the final arrangement consti- did not find much favour with major
tuting a system of classification. The pro- systems of classification of higher
cess of classification includes assigning ap- plants. Phenetic relationship has,
propriate position and rank to a new taxon however, been very prominently used
Plants, Taxonomy and Systematics 11
Africa are amongst the richest areas of the This development is helpful in the prepa-
world in terms of floristic diversity but ration of Floras and Monographs. It also aids
amongst the poorest as far as the economic in better understanding of the degree of
resources to pursue complete documenta- variation within a species. Two or more her-
tion of systematic information. The whole barium specimens may appear to be suffi-
of Europe, with more than 30 m square ciently different and regarded as belonging
kilometres of landscape and numerous rich to different species on the basis of a few
nations with their vast economic resources, available herbarium records, but only a field
have to account for slightly more than 6 thou- study of populations involving thousands of
sand species of vascular plants. India, on the specimens can help in reaching at a better
other hand, with meager resources, less understanding of their status. If there are
than one tenth of landscape, has to account enough field specimens to fill in the gaps
for the study of at least four times more of in variation pattern, there is no justifica-
the vascular plants. A small country like tion in regarding them as separate species.
Colombia, similarly, has estimated 4,5000 On the other hand, if there are distinct gaps
different species, with only a few botanists in the variation pattern, it strengthens
to study the flora. Great Britain, on the other their separate identity. In fact, many plants,
hand, has approximately 1370 taxa (Wood- described as species on the basis of limited
land, 1991), with thousands of professional material in the pioneer phase, are found to
and amateur botanists available to document be variants of other species in the consoli-
the information. It is not strange, as such, dation phase. Most parts of central Europe,
that there is lot of disparity in the level of North America and Japan are experienc-
advancement concerning knowledge about ing this phase.
respective floras. Taxonomic advancement
today can be conveniently divided into four Experimental or
distinct phases encountered in different
parts of the world:
Biosystematic Phase
During this phase, the herbarium records
Exploratory or Pioneer Phase and variation studies are complete. In addi-
This phase marks the beginning of plant tax- tion, information on biosystematics (stud-
onomy, collecting specimens and building ies on transplant experiments, breeding
herbarium records. The few specimens of a behaviour and chromosomes) is also avail-
species in the herbarium are the only record able. Transplant experiments involve col-
of its variation. These specimens are, how- lecting seeds, saplings or other propagules
ever, useful in a preliminary inventory of from morphologically distinct populations
flora through discovery, description, naming from different habitats and growing them
and identification of plants. Here, morphol- under common environmental conditions. If
ogy and distribution provide the data on the differences between the original popu-
which the systematists must rely. Taxo- lations were purely ecological, the differ-
nomic experience and judgement are par- ences would disappear under a common en-
ticularly important in this phase. Most ar- vironment, and there is no justification in
eas of tropical Africa and tropical Asia are regarding them as distinct taxonomic enti-
passing through this phase. ties. On the other hand, if the differences
still persist, these are evidently genetically
Consolidation or Systematic fixed. If these populations are allowed to grow
together for several years, their breeding
Phase behaviours would further establish their sta-
During this phase, herbarium records are tus. If there are complete reproductive bar-
ample and enough information is available riers between the populations, they will fail
concerning variation from field studies. to interbreed, and maintain their separate
14 Plant Systematics
Nomenclature deals with the application of a are allowed across the codes. The generic
correct name to a plant or a taxonomic group. name Cecropia applies to showy moths as also
In practice, nomenclature is often combined to tropical trees. Genus Pieris, similarly, re-
with identification, since while identifying an fers to some butterflies and shrubs.
unknown plant specimen, the author chooses During the last decade, there have been
and applies the correct name. The favourite attempts at developing unified code for all liv-
temperate plant is correctly identified ing organisms, for convenient handling of
whether you call it Seb (vernacular Hindi combined database for all organisms. Draft
name), Apple, Pyrus malus or Malus malus, but BioCode and PhyloCode, have been con-
only by using the correct scientific name certed efforts in this direction, but it will take
Malus domestica does one combine identifi- a long time before acceptability of these
cation with nomenclature. The current ac- endeavours can be determined.
tivity of botanical nomenclature is governed
by the International Code of Botanical Nomen-
clature (ICBN) published by the International NEED FOR SCIENTIFIC NAMES
Association of Plant Taxonomy (IAPT). The Scientific names formulated in Latin are pre-
Code is revised after changes at each Inter- ferred over vernacular or common names
national Botanical Congress. The naming of since the latter pose a number of problems:
the animals is governed by the International 1. Vernacular names are not available for
Code of Zoological Nomenclature (ICZN) and all the species known to man.
that of bacteria by the International Code for 2. Vernacular names are restricted in
the Nomenclature of Bacteria (ICNB; now their usage and are applicable in a
known as Bacteriological Code-BC). Virus single or a few languages only. They
nomenclature is governed by International are not universal in their application.
Code of Virus Classification and Nomencla- 3. Common names usually do not provide
ture (ICVCN). Naming of cultivated plants is information indicating family or ge-
governed by the International Code of Nomen- neric relationship. Roses belong to the
clature for Cultivated Plants (ICNCP), which genus Rosa; woodrose is a member of
is largely based on ICBN with a few additional the genus Ipomoea and primrose be-
provisions. Whereas within the provisions of longs to the genus Primula. The three
a particular code no two taxa can bear the genera, in turn, belong to three differ-
same correct scientific name, same names ent familiesRosaceae, Convolvu-
16 Plant Systematics
point; tautonym was not accepted, and Latin IIB. Nomina familiarum bryophytorum et
diagnosis was made essential for new spe- spermatophytorum conservanda
cies. In addition, a list of conserved generic IIIA. Nomina generica conservanda et
names (Nomina generic conservanda) was rejicienda
approved. Not satisfied with the Vienna Code IIIB. Nomina specifica conservanda et
also, adherents of the Rochester Code adopted rejicienda
the American Code (1907), which did not ac- IV. Nomina utique rejicienda (A. Algae,
cept the list of conserved names and the re- B. Fungi, C.Bryophyta, D. Pterido-
quirement for Latin diagnosis. phyta, E. Spermatophyta)
It was not until the 5th International Bo- V. Opera utique oppressa
tanical Congress (IBC) at Cambridge (1930) The last three useful appendices were in-
that the differences were finally resolved and cluded for the first time in the Tokyo Code.
a truly International Code evolved, accept- The first (IIIB) includes the names of con-
ing the concept of type method, rejecting the served and rejected specific names; the sec-
tautonyms, making Latin diagnosis manda- ond (IV) lists the names and all combinations
tory for new groups and approving conserved based on these names, which are ruled as
generic names. The Code has since been rejected under Art. 56, and none is to be used;
constantly amended at each International and the last (V) the list of publications (and
Botanical Congress. The 15th IBC was held the category of taxa therein) which are not
at Tokyo in 1993, 16th at St Louis in 1999 validly published according to the Code.
(published by Greuter et al., 2000). The Code Principles form the basis of the system of
discussed in the following pages is based on botanical nomenclature. There are 62 main
the 17th International Botanical Congress rules (set out as articles) and associated rec-
held at Vienna in 2005 (Published by McNeill ommendations. The object of the rules is to
et al., 2006- Code is generally published one put the nomenclature of the past into order
year after the Congress). The 18th Interna- and provide for that of the future; names con-
tional Botanical Congress would be held in trary to the rules cannot be maintained. Rec-
Melbourne, Australia in 2011. ommendations deal with subsidiary points,
and are meant for uniformity and clarity.
CONTENTS OF BOTANICAL CODE Names contrary to the recommendations
Publication of the Code is based on the real- cannot, on that account, be rejected, but they
ization that botany requires a precise and are not examples to be followed. Conserved
simple system of nomenclature used by bota- names include those that do not satisfy the
nists in all countries. The Code aims at pro- principle of priority but are sanctioned for use.
vision of a stable method of naming taxonomic The various rules and recommendations are
groups, avoiding and rejecting the use of discussed here under relevant headings.
names which may cause error or ambiguity
or throw science into confusion. Preamble Preamble
highlights the philosophy of the botanical 1. Botany requires a precise and simple
Code. The Code is divided into 3 divisions: system of nomenclature used by bota-
I. Principles nists in all countries, dealing on the
II. Rules and recommendations one hand with the terms which denote
III. Provisions for the governance of the Code the ranks of taxonomic groups or units,
In addition, the Code includes the follow- and on the other hand with the scien-
ing appendices: tific names which are applied to the
I. Names of hybrids individual taxonomic groups of plants.
IIA. Nomina familiarum algarum, The purpose of giving a name to a
fungorum, pteridophytorum et taxonomic group is not to indicate its
fossilium conservanda et rejicienda characters or history, but to supply a
18 Plant Systematics
belonging to any rank. The system of nomen- division, -opsida a class, -opsidae or -idae a
clature provides a hierarchical arrangement subclass, -ales an order, -ineae a suborder
of ranks. Every plant is treated as belonging and -aceae a family. The detailed hierarchy
to a number of taxa, each assigned a particu- of ranks and endings with examples is given
lar rank. Onion thus belongs to Allium cepa in Table 2.1. Stevens (2005) describes this
(species rank), Allium (genus rank), Alliaceae system of naming where endings determine
(family rank) and so on. The seven principal ranks of taxa and suggest relative positions
obligatory ranks of taxa in descending se- of groups in local hierarchy as flagged hier-
quence are: kingdom (regnum), division or archy.
phylum (divisio, phylum), class (classis), or- The names of the groups belonging to ranks
der (ordo), family (familia), genus (genus), and above the level of genus are uninomials in
species (species). The ending of the name the plural case. Thus, it is appropriate to say
indicates its rank: ending -bionta denotes a Winteraceae are primitive and inappropri-
kingdom, -phyta a division, -phytina a sub- ate when we say Winteraceae is primitive.
Bauhin, Benthamia and Benthamida for The generic name of a tree, whatever be
Bentham, Darwinia for Darwin, the ending, takes a feminine form, since
Hutchinsonia for Hutchinson, Lamarckia trees are generally feminine in classical
for Lamarck and Linnaea for Linnaeus. Latin. Pinus, Quercus and Prunus are, thus,
It may also be used for head of a state all feminine genera. If two words are used to
such as Victoria for Queen Victoria of form a generic name, these have to be joined
England, Washingtonia for King George by a hyphen (generic name Uva-ursi). In case,
Washington, and Zinobia for Queen however, the two words were combined into
Zinobia of Palmyra. The names com- one word by the original author, the use of
memorating a person, man or woman hyphen is not needed (generic name
always take the feminine form. The Quisqualis). The name of a genus may not
name of a genus is constructed by add- coincide with a technical term currently used
ing -ia if name of a person ends in a in morphology unless it was published before
consonant (Fuchsia after Fuchs), -a if 1 January 1912 and was accompanied by a
it ends in a vowel (Ottoa after Otto), but specific name published in accordance with
-ea is added if it ends in -a (Collaea af- the binary system of Linnaeus. The generic
ter Colla). If the name ends in -er both name Tuber (published in 1780 was accom-
are permitted (Kernera for Kerner; panied by a binary specific name Tuber
Sesleria for Seslar). For Latinized per- gulosorum F. H. Wigg.) and is, therefore, val-
sonal names ending with -us, this ter- idly published. On the other hand the intended
mination is dropped before adding ap- generic names Lanceolatus (Plumstead,
propriate ending (Linnaea after 1952) is, therefore, not validly published.
Linnaeus, Dillenia after Dillenius). The Words such as radix, caulis, folium, spina,
name may also be formed directly as etc., cannot now be validly published as ge-
in case of Victoria and Zinobia, as indi- neric names.
cated above.
2. Based on a place such as Araucaria Species
after Arauco a province of Chile, The name of a species is a binomial: con-
Caucasia for Caucasus in Russia, sisting of two words, a generic name followed
Salvadora for EL Salvadore, Arabis for by a specific epithet. The Code recommends
Arabia and Sibiraea for Siberia. The that all specific epithets should begin with a
name could also be based on names of lower case initial letter. An upper case ini-
two places such as Austroamericium tial letter is sometimes used, however, for
(Australia and America) or place and specific epithets derived from a persons
author such as Austrobaileya (Austra- name, former generic name or a common
lia and Bailey) name. The Code discourages such usage for
3. Based on an important charac- specific epithets. A specific epithet may be
ter such as yellow wood in Zanthoxy- derived from any source or composed arbi-
lum, liver-like leaves in Hepatica, trarily. The following sources are commonly
marshy habit of Hygrophila, trifoliate used:
leaves of Trifolium, and spiny fruit of 1. Name of a person. The specific epithet
Acanthospermum. named after a person may take geni-
4. Aboriginal names taken directly tive (possessive) or an adjectival form:
from a language other than Latin with- (i) When used in the genitive form the
out alteration of ending. Narcissus is epithet takes its form depending on
the Greek name for daffodils named the ending of the persons name. For
after the famous Greek god Narcissus, names ending in a vowel or -er the
Ginkgo a Chinese, Vanda a Sanskrit letter -i is added for a male person
and Sasa a Japanese aboriginal name. (roylei after Royle, hookeri after
22 Plant Systematics
Hooker), -ae for female person (laceae adding the appropriate genitive end-
after Lace), and -orum for more than ing. The specific epithets in
one persons with the same surname genitive form are not related to the
(hookerorum after Hooker & Hooker). gender of the genus. Illustrative ex-
If the name, however, ends in -a amples are listed in Table a.
then -e is added (paulae after Paula). (ii) When used in adjectival form, the
If the name ends in a consonant -ii epithet takes its ending from the
is added male person (wallichii after gender of the genus after adding -
Wallich), -iae for a female person ian if name of the person ends in a
(wilsoniae after Wilson), and -iorum consonant, adding -an if the name
for more than one persons with same ends in a vowel except when it ends
surname and at least one male in -a, wherein -n is added. Illustra-
(verlotiorum after Verlot brothers), and tive examples are given in Table b.
-iarum if both are female (brauniarum 2. Place. The specific epithet may, simi-
for Braun sisters). For names of the larly, be formed by using the place
persons already in Latin (e.g. name as an adjective, when again the
Linnaeus), the Latin ending (-us in genus determines the ending after the
this case) has to be dropped before addition of -ian or -ic and then the rel-
Table a
Table c
Place Genus Gender Specific epithet Binomial
evant gender ending as determined by adjectival form in species of the same ge-
the genus. The specific epithet is also nus is to be avoided, e.g. Iris hookeri and
formed by adding -ensis (for masculine I. Hookeriana; Lysimachia hemsleyana Oliv.
and feminine genera, e.g. Hedera and L. hemsleyi Franch.
nepalensis, Rubus canadensis) or -ense
(for neuter genera, e.g. Ligustrum Infraspecific taxa
nepalense) to the place name. Different The names of subspecies are trinomials and
situations are illustrated in Table c. are formed by adding a subspecific epithet
3. Character. Specific epithets based on to the name of a species, e.g. Angelica
a character of the species are always archangelica ssp. himalaica. A variety
in adjectival form and derive their (varieta) within a subspecies may accord-
gender from the genus. A name based ingly be quadrinomial as in Bupleurum
on a white plant part may take the falcatum ssp. eufalcatum var. hoffmeisteri, or
form alba (Rosa alba), album (Chenopo- it may just be a trinomial when no subspe-
dium album) or albus (Mallotus albus). cies is recognized within a species as in
A common epithet used for cultivated Brassica oleracea var. capitata. A forma may
plants may similarly take the form also be assigned a name in a similar man-
sativa (Oryza sativa), sativum (Allium ner, e.g. Prunus cornuta forma villosa. The
sativum) or sativus (Lathyrus sativus) formation of the infraspecific epithet follows
depending on the gender of the genus the same rules as the specific epithet. In-
to which the epithet is assigned. Some fraspecific name may sometimes be a poly-
epithets, however, such as bicolor (two- nomial as Saxifraga aizoon var. aizoon
coloured) and repens (creeping) remain subvar. brevifolia f. multicaulis subf. surculosa
unchanged, e.g. Ranunculus repens, Engl. & Irmsch.
Ludwigia repens and Trifolium repens.
4. Noun in apposition. A specific epithet
may sometimes be a noun in apposi- The Type Method
tion carrying its own gender, and usu- The names of different taxonomic groups are
ally in the nominative case. Binomial based on the type method, by which a cer-
Pyrus malus is based on the Greek tain representative of the group is the source
name malus for common apple. In Al- of the name for the group. This representa-
lium cepa, similarly, cepa is the Latin tive is called the nomenclatural type or sim-
name for onion. ply the type, and methodology as typifica-
Both the generic name and the spe- tion. The type need not be the most typical
cific epithet are underlined when writ- member of the group, it only fixes the name
ten or typed. When printed, they are of a particular taxon and the two are perma-
in Italics or boldface. After the generic nently associated. Type may be correct name
name in a species has been spelled or even a synonym. Thus the tea family name
out at least once, if used for other spe- (Theaceae) is derived from synonym Thea
cies, it may be abbreviated using the although the correct name for the genus is
initial capital, e.g. Quercus dilatata, Camellia. Mimosa is the type for family
Q. suber, Q. Ilex, etc. A specific epithet Mimosaceae, but unlike most representatives
is usually one word but when consist- of the family that have pentamerous flow-
ing of two words, these must be hy- ers, the genus Mimosa has tetramerous flow-
phenated as in Capsella bursa-pastoris ers. The family Urticaceae, similarly, has
and Rhamnus vitis-idaea, or else the Urtica as its type. When the originally large
two words may be combined into one family was split into a number of smaller
as in Narcissus pseudonarcissus natural families, the name Urticaceae was
Although not leading to rejection, the use retained for the group containing the genus
of same name in genitive form as well as Urtica, since the two cannot be separated.
24 Plant Systematics
The other splitter groups with family rank the same person. Often the collection
got the names Moraceae, Ulmaceae and number is also the same, differenti-
Cannabaceae with type genera Morus, Ulmus ated as a, b, c, etc.
and Cannabis, respectively. The family 3. Syntype: Any one of the two or more
Malvaceae has seen a lot of realignments, specimens cited by the author when
with Tiliaceae sometimes merged with no holotype was designated, or any one
Malvaceae. Thorne (2003) shifts Tilia to of the two or more specimens simulta-
Malvaceae, but retains rest of the genera. neously designated as types. Duplicate
This necessitates name change for former of a syntype is an isosyntype.
Tiliaceae (excluding genus Tilia) to 4. Paratype: A paratype is a specimen
Grewiaceae, with Grewia as the type genus. cited in the protologue that is neither
The type of a family and the higher groups the holotype nor an isotype, nor one of
is ultimately a genus, as indicated above. A the syntypes if two or more specimens
type of a particular genus is a species, e.g. were simultaneously designated as
Poa pratensis for Poa. The type of name of a types.
species or infraspecific taxon, where it ex- 5. Lectotype: A specimen or any other el-
ists, is a single type specimen, preserved in ement selected from the original ma-
a known herbarium and identified by the terial cited by the author when no
place of collection, name of the collector and holotype was originally selected or
his collection number. It may also be an il- when it no longer exists. A lectotype is
lustration of the plant. The Code recognizes selected from isotypes or syntypes. In
several kinds of type, depending upon the lectotype designation, an isotype must
way in which a type specimen is selected. be chosen if such exists, or otherwise
These include: a syntype if such exists. If no isotype,
1. Holotype: A particular specimen or il- syntype or isosyntype (duplicate of
lustration designated by the author of syntype) is extant, the lectotype must
the species to represent type of a spe- be chosen from among the paratypes if
cies. For the purpose of typification, a such exist. If no cited specimens ex-
specimen is a gathering, or part of a ist, the lectotype must be chosen from
gathering, of a single species or among the uncited specimens and
infraspecific taxon made at one time, cited and uncited illustrations which
disregarding admixtures. It may con- comprise the remaining original ma-
sist of a single plant, parts of one or terial, if such exist.
several plants, or of multiple small 6. Neotype: A specimen or illustration se-
plants. A specimen is usually mounted lected to serve as nomenclatural type
either on a single herbarium sheet or as long as all of the material on which
in an equivalent preparation, such as the name of the taxon was based is
a box, packet, jar or microscope slide. missing; a specimen or an illustration
Type specimens of names of taxa must selected when no holotype, isotype,
be preserved permanently and may not paratype or syntype exists.
be living plants or cultures. However, 7. Epitype: A specimen or illustration se-
cultures of fungi and algae, if preserved lected to serve as an interpretative type
in a metabolically inactive state (e.g. when the holotype, lectotype or previ-
by lyophilization or deep-freezing), are ously designated neotype, or all origi-
acceptable as types. It is now essen- nal material associated with a validly
tial to designate a holotype when pub- published name, is demonstrably am-
lishing a new species. biguous and cannot be critically iden-
2. Isotype: A specimen which is a dupli- tified for purposes of the precise appli-
cate of the holotype, collected from the cation of the name of a taxon. When
same place, at the same time and by an epitype is designated, the holotype,
Botanical Nomenclature 25
lectotype or neotype that the epitype G. Bentham, Hook. for William Hooker,
supports must be explicitly cited. Hook.f. for Sir J. D. Hooker (f. stands for fil-
In most cases in which no holotype was ius, the son; J. D. Hooker was son of Will-
designated there will also be no paratypes, iam Hooker), R.Br. for Robert Brown, Lam.
since all the cited specimens will be for J. P. Lamarck, DC. for A. P. de Candolle,
syntypes. However, when an author has des- Wall. for Wallich, A. DC. for Alphonse de
ignated two or more specimens as types, any Candolle, Scop. for G. A. Scopoli and Pers.
remaining cited specimens are paratypes for C. H. Persoon.
and not syntypes.
Topotype is often the name given to a Single author
specimen collected from the same locality The name of a single author follows the name
from which the holotype was originally col- of a species (or any other taxon) when a
lected. single author proposed a new name, e.g.
In cases where the type of a name is a
Solanum nigrum L.
culture permanently preserved in a meta-
bolically inactive state, any living isolates
obtained from that should be referred to as Multiple authors
ex-type (ex typo), ex-holotype (ex holotypo), The names of two or more authors may be as-
ex-isotype (ex isotypo), etc., in order to make sociated with a name for a variety of reasons.
it clear they are derived from the type but These different situations are exhibited by
are not themselves the nomenclatural type. citing the name of the authors differently:
When an infraspecific variant is recog- 1. Use of et: When two or more authors
nized within a species for the first time, it publish a new species or propose a new
automatically establishes two infraspecific name, their names are linked by et,
taxa. The one, which includes the type e.g. Delphinium viscosum Hook.f. et
specimen of the species, must have the Thomson.
same epithet as that of the species, e.g. Aca- 2. Use of parentheses: The rules of bo-
cia nilotica ssp. nilotica. Such a name is called tanical nomenclature specify that
an autonym, and the specimen an whenever the name of a taxon is
autotype. The variant taxon would have its changed by the transfer from one ge-
own holotype and is differentiated by an epi- nus to another, or by upgrading or down-
thet different from the specific epithet, e.g. grading the level of the taxon, the origi-
Acacia nilotica ssp. indica. nal epithet should be retained. The
It must be borne in mind that the applica- name of the taxon providing the epithet
tion of the type method or typification is a is termed a basionym. The name of the
methodology different from typology, which original author or authors whose epi-
is a concept based on the idea that does not thet is being used in the changed name
recognize variation within the taxa, and be- is placed within parentheses, and the
lieves that an idealized specimen or pattern author or authors who made the name
can represent a natural taxon. This concept change outside the parentheses, e.g.
of typology was very much in vogue before Dar- Cynodon dactylon (Linn.) Pers., based on
win put forward his ideas about variations. the basionym Panicum dactylon Linn.,
the original name for the species.
Author Citation 3. Use of ex: The names of two authors
For a name to be complete, accurate and are linked by ex when the first author
readily verifiable, it should be accompanied had proposed a name but was validly
by the name of the author or authors who published only by the second author,
first published the name validly. The names the first author failing to satisfy all or
of the authors are commonly abbreviated, some of the requirements of the Code,
e.g. L. for Carolus Linnaeus, Benth. for e.g. Cerasus cornuta Wall. ex Royle.
26 Plant Systematics
4. Use of in: The names of authors are 1. sp. nov. for species nova, a species new
linked using in when the first author to science; Tragopogon kashmirianus
published a new species or a name in G. Singh, sp. nov. (published in 1976).
a publication of another author, e.g. 2. comb. nov. for combinatio nova, a
Carex kashmirensis Clarke in Hook.f. name change involving the epithet of
Clarke published this new species in the basionym, name of the original au-
the Flora of British India whose author thor being kept within parentheses;
was Sir J. D. Hooker. Vallisneria natans (Lour.) Hara comb.
5. Use of emend: The names of two au- nov. (published in 1974 based on
thors are linked using emend. Physkium natans Lour., 1790).
(emendavit: person making the correc- 3. comb. et stat. nov. for combinatio et
tion) when the second author makes status nova, when a new combination
some change in the diagnosis or in cir- also involves the change of status. Epi-
cumscription of a taxon without alter- thet of the basionym will accordingly
ing the type, e.g. Phyllanthus Linn. be used in the combination intended;
emend. Mull. Caragana opulens Kom. var. licentiana
6. Use of square brackets: Square (Hand.-Mazz.) Yakovl. comb. et stat.
brackets are used to indicate nov. (published in 1988 based on C.
prestarting point author. The generic licentiana Hand.-Mazz., 1933; new com-
name Lupinus was effectively published bination also involved change of sta-
by Tournefort in 1719, but as it hap- tus from a species C. licentiana to a
pens to be earlier than 1753, the start- variety of Caragana opulens Kom.).
ing date for botanical nomenclature 4. nom. nov. for nomen novum, when the
based on Species plantarum of original name is replaced and its epi-
Linnaeus, the appropriate citation for thet cannot be used in the new name;
the genus is Lupinus [Tourne.] L. Myrcia lucida McVaugh nom. nov. (pub-
When naming an infraspecific taxon, the lished in 1969 to replace M. laevis O.
authority is cited both for the specific Berg, 1862, an illegitimate homonym
epithet and the infraspecific epithet, e.g. of M. laevis G. Don, 1832).
Acacia nilotica (L.) Del. ssp. indica (Benth.) These abbreviations are, however, used
Brenan. In the case of an autonym, how- only when first published. In future refer-
ever, the infraspecific epithet does not bear ences, these are replaced by the name of
the authors name since it is based on the the publication, page number and the year
same type as the species, e.g. Acacia nilotica of publication for full citation, or at least the
(L.) Del. ssp. nilotica. year of publication. Thus when first pub-
lished in 1976 as a new species, Tragopogon
Publication of Names kashmirianus G. Singh sp. nov. appeared in
a book titled Forest Flora of Srinagar on page
The name of a taxon, when first published, 123, figure 4, any successive reference to
should meet certain requirements so as to this species would appear as: Tragopogon
become a legitimate name for consideration kashmirianus G. Singh, Forest Flora of
when deciding on a correct name. A valid Srinagar, p 123, f. 4, 1976 or Tragopogon
publication should satisfy the following kashmirianus G. Singh, 1976. The other
requirements: names would be cited as Vallisneria natans
(Lour.) Hara, 1974, Caragana opulens Kom.
Formulation var. licentiana (Hand.-Mazz.) Yakovl., 1988
A name should be properly formulated and and Myrcia lucida McVaugh, 1969, specify-
its nature indicated by a proper abbreviation ing the year of publication. A new combina-
after the name of the author: tion, or an avowed substitute (replacement
Botanical Nomenclature 27
name, nomen novum), published on or after tion, the herbarium or institution in which
1 January 1953 based on a previously and the type is conserved must be specified.
validly published name is not validly pub- Names published on or after 1 January 2007
lished unless its basionym (name-bringing would require a specimen (and not a mere
or epithet-bringing synonym) or the replaced illustration) as type, except only for micro-
synonym (when a new name is proposed) is scopic algae or microfungi for which preser-
clearly indicated and a full and direct refer- vation of a type was technically difficult, and
ence given to its author and place of valid where illustration is accepted as type. On or
publication, with page or plate reference and after 1 January 2001, lectotypification or
date. Authors should cite themselves by neotypification of a name of a species or in-
name after each new name they publish fraspecific taxon is not affected unless indi-
rather than refer to themselves by expres- cated by use of the term lectotypus or
sions such as nobis (nob.) or mihi (m.). neotypus, its abbreviation, or its equivalent
in a modern language. The specimen selected
Latin diagnosis as type should belong to a single gathering.
Echinocereus sanpedroensis (Raudonat &
Names of all new species (or other taxa new Rischer, 1995) was based on a holotype con-
to science) published 1 January 1935 on- sisting of a complete plant with roots, a de-
wards should have a Latin diagnosis (Latin tached branch, an entire flower, a flower cut
translation of diagnostic features). Full de- in halves, and two fruits, which according to
scription of the species in any language can the label were taken from the same cultivated
accompany the Latin diagnosis. A descrip- individual at different times and preserved,
tion in any language, not accompanied by a in alcohol, in a single jar. This material be-
Latin diagnosis is allowed for publications longs to more than one gathering and can-
before 1 January 1935. For publications be- not be accepted as a type. Raudonat &
fore 1 January 1908, an illustration with Rischers name is thus not validly published.
analysis without any accompanying descrip-
tion is valid. Thus description in any lan- Effective publication
guage is essential from 1 January 1908 on-
wards and this accompanied by a Latin di- The publication becomes effective by distri-
agnosis from 1 January 1935. For name bution in printed form, through sale, ex-
changes or new names of already known spe- change or gift to the general public or at least
cies, a full reference to the original publica- the botanical institutions with libraries ac-
tion should be made. cessible to botanists generally. It is not af-
fected by communication of new names at a
public meeting, by the placing of names in
Typification collections or gardens open to the public; by
A holotype should be designated. Publica- the issue of microfilm made from manu-
tion on or after 1 January 1958 of the name scripts, typescripts or other unpublished ma-
of a new taxon of the rank of genus or below terial, by publication on-line, or by dissemi-
is valid only when the type of the name is nation of distributable electronic media. The
indicated. For the name of a new taxon of publication in newspapers and catalogues (1
the rank of genus or below published on or January 1953 onwards) and seed exchange
after 1 January 1990, an indication of the lists (1 January 1977 onwards) is not an ef-
type must include one of the words typus fective publication. A theses submitted for a
or holotypus, or its abbreviation, or even its higher degree on or after 1 January, 1953 is
equivalent in a modern language. For the considered effectively published, only if it car-
name of a new species or infraspecific taxon ries a statement of its publication or an in-
published on or after 1 January 1990 whose ternal evidence (e.g. an ISBN, or a commer-
type is a specimen or unpublished illustra- cial publisher). Publication of handwritten
28 Plant Systematics
material, reproduced by some mechanical algae, but Vienna Code extended this provi-
or graphic process (indelible autograph) sion also to organisms subsequently recog-
such as lithography, offset, or metallic etch- nized as fungi. The provision has benefitted
ing before 1 January 1953 is effective. Salvia the recognition of Microsporidia, long con-
oxyodon Webb & Heldr. was effectively pub- sidered protozoa and now recognized as fungi.
lished in an indelible autograph catalogue Similarly the species of Pneumocystis, not
placed on sale (Webb & Heldreich, Catalogus validly published because of lack of Latin
plantarum hispanicarum ... ab A. Blanco diagnosis or description, are now treated as
lectarum, Paris, Jul 1850, folio). The Journal validly published, since Latin requirement
of the International Conifer Preservation Soci- is not mandatory under Zoological Code,
ety, Vol. 5[1]. 1997 (1998), consists of du- which originally covered these mammalian
plicated sheets of typewritten text with hand- pathogens, now treated as fungi.
written additions and corrections in several The Tokyo Code included a rule (Art. 32.
places. The handwritten portions, being in- 1-2), subject to ratification by the XVI Inter-
delible autograph published after 1 January national Botanical Congress (St Louis, 1999)
1953, are not effectively published. Intended according to which new names of plants and
new combinations (Abies koreana var. fungi would have to be registered in order to
yuanbaoshanensis, p. 53), for which the be validly published after the 1st of January
basionym reference is handwritten are not 2000. A trial registration had already begun,
validly published. The entirely handwritten on a non-mandatory basis, for a two-year pe-
account of a new taxon (p. 61: name, Latin riod starting 1 January 1998. The proposal
description, statement of type) is treated as was, however, voted out at St. Louis and all
unpublished. references to the registration deleted from
The date of a name is that of its valid pub- the Code.
lication. When the various conditions for A correction of the original spelling of a
valid publication are not simultaneously ful- name does not affect its date of valid publi-
filled, the date is that on which the last con- cation.
dition was fulfilled. However, the name must
always be explicitly accepted in the place of
its validation. A name published on or after
Rejection of Names
1 January 1973 for which the various con- The process of selection of correct name for
ditions for valid publication are not simulta- a taxon involves the identification of illegiti-
neously fulfilled is not validly published un- mate names, those which do not satisfy the
less a full and direct reference is given to rules of botanical nomenclature. A legitimate
the places where these requirements were name must not be rejected merely because
previously fulfilled. it, or its epithet, is inappropriate or disagree-
In order to be accepted, a name of a new able, or because another is preferable or bet-
taxon of fossil plants published on or after 1 ter known or because it has lost its original
January 1996 must be accompanied by a meaning. The name Scilla peruviana L. (1753)
Latin or English description or diagnosis or is not to be rejected merely because the spe-
by a reference to a previously and effectively cies does not grow in Peru. Any one or more
published Latin or English description or di- of the following situations leads to the rejec-
agnosis. tion of a name:
For groups originally not covered by ICBN, 1. Nomen nudum (abbreviated nom.
the Code accepts them as validly published nud.): A name with no accompanying
if they meet the requirements of the perti- description. Many names published by
nent non-botanical Code, but are now Wallich in his Catalogue (abbreviated
recognized as organisms covered under bo- Wall. Cat.) published in 1812 were no-
tanical Code. This provision earlier covered men nudum. These were either vali-
organisms subsequently recognized as dated by another author at a later date
Botanical Nomenclature 29
based on the earlier name Amygdalus 1-5-1753. The starting dates for different
communis Linn. It was discovered by groups include:
Webb that the binomial Prunus commu- Seed plants, Pteridophytes, Sphagnaceae
nis had already been used by Hudson Hepaticae, most Algae, slime moulds
in 1762 for a different species render- and lichens...............................1-5-1753
ing P. communis (L.) Archangeli a later Mosses (excluding Sphagnaceae)
homonym which had to be conse- .................................................1-1-1801
quently rejected. Webb accordingly Fungi .......................................31-12-1801
used the next available basionym Fossils .....................................31-12-1820
Amygdalus dulcis Mill., 1768 and made Algae (Nostocaceae)....................1-1-1886
a combination Prunus dulcis (Mill.) Algae (Oedogoniaceae)................1-1-1900
Webb, 1967 as the correct name for The publications before these dates for re-
almond. Another binomial, Prunus spective groups are ignored while deciding
amygdalus Batsch, 1801, cannot be the priority.
taken up as it ignores the earlier epi- Starting date for suprageneric names was
thets. The citation for almond would set at Vienna Congress as 4 August, 1789,
thus be: the date of publication of de Jussieus Gen-
Prunus dulcis (Mill.) Webb, 1967 era Plantarum. Double author citation is not
Amygdalus dulcis Mill., 1768 justified or permitted at suprageneric ranks.
basionym
A. communis L., 1753 Not above family rank
P. communis (L.) Arch., The principle of priority is applicable only up
1882 (non Huds., 1762)
to the family rank, and not above.
P. amygdalus Batsch, 1801
When two or more names simultaneously Not outside the rank
published are united, the first author to In choosing a correct name for a taxon,
make such a merger has the right of choos- names or epithets available at that rank need
ing the correct name from these. Brown, to be considered. Only when a correct name
1818 was the first to unite Waltheria at that rank is not available, can a combina-
americana L., 1753 and W. indica L., 1753. tion be made using the epithet from another
He adopted the name W. indica for the com- rank. Thus at the level of section the correct
bined species, and this name is accordingly name is Campanula sect. Campanopsis R.
treated as having priority over W. americana. Br., 1810 but when upgraded as a genus the
The generic names Thea L. and Camellia L. correct name is Wahlenbergia Roth, 1821 and
are treated as having been published simul- not Campanopsis (R. Br.) Kuntze, 1891. The
taneously on 1 May 1753. The combined ge- following names are synonyms:
nus bears the name Camellia, since Sweet,
Lespedza eriocarpa DC. var. falconeri
1818, who was the first to unite the two gen-
........................................... Prain, 1897
era, chose that name, and cited Thea as a
L. meeboldii ..................... Schindler, 1911
synonym.
Campylotropis eriocarpa var. falconeri
(Prain) ................................. Nair, 1977
Limitations to the principle C. meeboldii (Schindler) . Schindler, 1912
of priority The correct name at the species level un-
Application of the principle of priority has der the genus Campylotropis would be C.
the following limitations: meeboldii, ignoring the earlier epithet at the
varietal level. If treated as a variety, the cor-
Starting dates rect name would be C. eriocarpa var. falconeri,
The principle of priority starts with the Spe- based on the earliest epithet at that rank.
cies plantarum of Linnaeus published on Under the genus Lespedza, at the species
Botanical Nomenclature 33
level the correct name would be L. meeboldii, same date of publication are united, the au-
whereas at the varietal level, it would be thor who unites them first has the choice of
L. eriocarpa var. falconeri. selecting the correct binomial. For a long
Magnolia virginiana var. foetida L., 1753 time it was known that the first persons to
when raised to specific rank is called M. gran- unite the two species were Fiori and Paoletti
diflora L., 1759, not M. foetida (L.) Sarg., 1889. in 1896 who selected T. aestivum L. as the
correct name. It was pointed out by
Nomina Conservanda Kergulen (1980), however, that the first per-
Nomina conservanda (abbreviated as nom. son to unite these two species was actually
cons.): Strict application of the principle of Mrat (1821) and he had selected
priority has resulted in numerous name T. hybernum L. and not T. aestivum. This
changes. To avoid name changes of well- discovery led to the danger of T. aestivum L.
known families or generaespecially those being dropped in favour of T. hybernum L.
containing many speciesa list of conserved A proposal for conserving the name
generic and family names has been prepared T. aestivum L. was thus made by Hanelt and
and published in the Code with relevant Schultze-Motel (1983), and being the num-
changes. Such nomina conservanda are to ber one economic plant this was accepted at
be used as correct names replacing the ear- the Berlin Congress, removing any further
lier legitimate names, which are rejected danger to the name Triticum aestivum L.
and constitute nomina rejicienda (abbrevi- In 1768 P. Miller proposed a new name,
ated nom. rejic.). The family name Theaceae Lycopersicon esculentum for tomato, a species
D. Don, 1825 is thus conserved against described earlier by Linnaeus (1753) as
Ternstroemiaceae Mirbe, 1813. The genus Solanum lycopersicum. Karsten (1882) made
Sesbania Scop., 1777 is conserved against the name change Lycopersicum lycopersicum
Sesban Adans., 1763 and Agati Adans., 1763. (L.) Karst., retaining the epithet used by
Linnaeus, but since the name became a
Conservation of names of species tautonym it was not considered the correct
In spite of several protests from agricultural name for tomato. Nicolson (1974) suggested
botanists and horticulturists, who were dis- an orthographic correction Lycopersicon
gusted with frequent name changes due to lycopersicum (L.) Karst., suggesting that
the strict application of the principle of pri- Lycopersicon and lycopersicum are ortho-
ority, taxonomists for a long period did not graphic variants. Since the name
agree upon conserving names at the species Lycopersicon lycopersicum was no longer a
level. The mounting pressure and the dis- tautonym, it was accepted as the correct
covery that Triticum aestivum was not the cor- name. But since Lycopersicon esculentum
rect name of common wheat, compelled tax- Mill., 1768 was a more widely known name,
onomists to agree at the Sydney Congress a proposal for its conservation was made by
in 1981 upon the provision to conserve Terrel (1983) and accepted at the Berlin Con-
names of species of major economic impor- gress along with that of Triticum aestivum L.
tance. As a result, Triticum aestivum Linn. A list from a mere 5 in Tokyo Code has grown
was the first species name conserved at Ber- to nearly 60 for Spermatophyta alone. Names
lin Congress in 1987 and published in sub- listed in this Appendix fall under the special
sequent Code in 1988. Another species name provisions of Art. 14.4. Neither a rejected
also conserved along with was Lycopersicon name, nor any combination based on a re-
esculentum Mill. jected name may be used for a taxon that
Linnaeus described two species, Triticum includes the type of the corresponding con-
aestivum and T. hybernum in his Species served name (Art. 14.7; see also Art. 14 Note
plantarum, both bearing the same date of 2). Combinations based on a conserved name
publication in 1753. According to the rules are, therefore, in effect, similarly conserved.
of nomenclature when two species with the Given below are the major examples of
34 Plant Systematics
species names which have been declared cated by including the sexual symbols
nomina conservanda (each name followed by ( : female; : male) in the formula, or by
the (=) sign, indicating taxonomic synonym placing the female parent first. If a non-al-
or a (= =) sign, indicating nomenclatural syn- phabetical sequence is used, its basis should
onym and then the binomial against which be clearly indicated.
it has been conserved). Some names listed A hybrid may either be interspecific (be-
as conserved have no corresponding nomina tween two species belonging to the same ge-
rejicienda because they were conserved solely nus) or intergeneric (between two species
to maintain a particular type: belonging to two different genera). A binary
name may be given to the interspecific hy-
Allium ampeloprasum L., 1753 brid or nothospecies (if it is self-perpetuat-
(=) Allium porrum L., 1753 ing and/or reproductively isolated) by plac-
Amaryllis belladonna L. ing the cross sign (if mathematical sign is
available it should be placed immediately
Bombax ceiba L. before the specific epithet, otherwise x in
Carex filicina Nees, 1834 lower case may be used with a gap) before
(=) Cyperus caricinus D. Don, 1825 the specific epithet as in the following cases
Hedysarum cornutum L., 1763 (hybrid formula may be added within the
(= =) Hedysarum spinosum L., 1759 parentheses if the parents are established):
1. Salix x capreola (S. aurita S. caprea)
Lycopersicon esculentum Mill., 1768
or Salix capreola (S. aurita S. caprea)
(= =) Lycopersicon lycopersicum (L.)
2. Rosa x odorata (R. chinensis R.
H. Karsen, 1882
gigantea) or Rosa odorata (R. chinensis
Magnolia kobus DC., 1817 R. gigantea)
Silene gallica L., 1753 The variants of interspecific hybrids are
(=) Silene anglica L., 1753 named nothosubspecies and nothovarieties,
(=) Silene lusitanica L., 1753 e.g. Salix rubens nothovar. basfordiana.
(=) Silene quinquevulnera L., 1753 For an intergeneric hybrid, if given a dis-
Triticum aestivum L., 1753 tinct generic name, the name is formed as
(=) Triticum hybernum L.,1753. a condensed formula by using the first part
(or whole) of one parental genus and last part
(or whole) of another genus (but not the whole
Names of Hybrids of both genera). A cross sign is placed before
Hybridity is indicated by the use of the mul- the generic name of the hybrid, e.g.
tiplication sign, or by the addition of the pre- Triticosecale (or x Triticosecale) from Triticum
fix notho- to the term denoting the rank of and Secale, Pyronia (or x Pyronia) from Pyrus
the taxon, the principal ranks being and Cydonia, and Agropogon from Agrostis and
nothogenus and nothospecies. A hybrid Polypogon. The names may be written as un-
between named taxa may be indicated by der:
placing the multiplication sign between the 1. Triticosecale (Triticum Secale)
names of the taxa; the whole expression is 2. Pyronia (Pyrus Cydonia)
then called a hybrid formula:
The nothogeneric name of an interge-
1. Agrostis Polypogon neric hybrid derived from four or more gen-
2. Agrostis stolonifera Polypogon era is formed from the name of a person to
monspeliensis which is added the termination -ara; no such
3. Salix aurita S. caprea name may exceed eight syllables. Such a
It is usually preferable to place the names name is regarded as a condensed formula:
or epithets in a formula in alphabetical or- Potinara (Brassavola Cattleya Laelia
der. The direction of a cross may be indi- Sophronitis)
Botanical Nomenclature 35
The nothogeneric name of a trigeneric hy- tal letter, and is not a Latin but rather a com-
brid is either: (a) a condensed formula in mon name. It is either preceded by cv. as in
which the three names adopted for the pa- Rosa floribunda cv. Blessings or simply within
rental genera are combined into a single single quotation marks, e.g. Rosa floribunda
word not exceeding eight syllables, using the Blessings. Cultivars may also be named
whole or first part of one, followed by the directly under a genus (e.g. Hosta Decorata),
whole or any part of another, followed by the under a hybrid (e.g. Rosa paulii Rosea) or
whole or last part of the third (but not the directly under a common name (e.g. Hybrid
whole of all three) and, optionally, one or two Tea Rose Red Lion). The correct nothogeneric
connecting vowels; or (b) a name formed like name for plants derived from the Triticum
that of a nothogenus derived from four or Secale crosses is Triticosecale Wittmack
more genera, i.e., from a personal name to ex A. Camus. As no correct name at the spe-
which is added the termination -ara: cies level is available for the common crop
Sophrolaeliocattleya (Sophronitis triticales, it is recommended that crop triti-
Laelia Cattleya) cales be named by appending the cultivar
When a nothogeneric name is formed name to the nothogeneric name, e.g.
from the name of a person by adding the ter- Triticosecale Newton. Since 1 January 1959
mination -ara, that person should preferably new cultivar names should have a descrip-
be a collector, grower, or student of the group. tion published in any language and these
A binomial for the intergeneric hybrid may names must not be the same as the botani-
similarly be written as under: cal or common name of a genus or a species.
Thus, cultivar names Rose, Onion, etc., are
Agropogon lutosus (Agrostis stolonifera
not permitted as the name of a cultivar. It is
Polypogon monspeliensis)
recommended that cultivar names be regis-
It is important to note that a binomial for tered with proper registering authorities
an interspecific hybrid has a cross before the to prevent duplication or misuse of cultivar
specific epithet, whereas in an intergeneric names. Registering authorities exist sepa-
hybrid, it is before the generic name. Since rately for roses, orchids and several other
the names of nothogenera and nothotaxa groups or genera.
with the rank of a subdivision of a genus
are condensed formulae or treated as such,
they do not have types. UNIFIED BIOLOGICAL NOMEN-
Since the name of a nothotaxon at the CLATURE
rank of species or below has a type, state- Biology as a science is unusual in the sense
ments of parentage play a secondary part in that the objects of its study can be named
determining the application of the name. according to five different Codes of nomen-
The grafts between two species are indi- clature: International Code of Zoological
cated by a plus sign between two grafted spe- Nomenclature (ICZN) for animals, Interna-
cies as, for example, Rosa webbiana + R. flo- tional Code of Botanical Nomenclature
ribunda. (ICBN) for plants, International Code for the
Nomenclature of Bacteria (ICNB) now called
Names of Cultivated Plants Bacteriological Code (BC) for bacteria,
The names of cultivated plants are governed International Code of Nomenclature for Cul-
by the International Code of Nomenclature tivated Plants (ICNCP) for plants under
for Cultivated Plants (ICNCP), last published cultivation, and International Code of Virus
in 1995 (Trehane et al.). Most of the rules Classification and Nomenclature (ICVCN) for
are taken from ICBN with additional recog- viruses. For the general user of scientific
nition of a rank cultivar (abbreviated cv.) for names of organisms, there is thus inher-
cultivated varieties. The name of a cultivar ent confusion in many aspects of this situa-
is not written in Italics, it starts with a capi- tion: different sets of rules have different con-
36 Plant Systematics
name which must be adopted for it after fulfillment of the present require-
under the rules. In ranks not belong- ments for valid publication.
ing to the family group, genus group, 5. Typification: The type of a nominal
or species group, any established name taxon in the rank of genus or subdivi-
of a taxon adopted by a particular au- sion of a genus is a nominal species.
thor is an accepted name. In this Code, The type of a nominal taxon of the fam-
unless otherwise indicated, the word ily group, or of a nominal taxon of a
name means an established name, higher rank whose name is ultimately
whether it be acceptable or unaccept- based on a generic name, is the nomi-
able. The name of a taxon consisting nal genus. For the names of
of the name of a genus combined with superspecies, species or infraspecific
one epithet is termed a binomen; the taxon is a specimen in a museum jar,
name of a species combined with an herbarium sheet, slide preparation, or
infraspecific epithet is termed a mounted set of freeze-dried ampoules.
trinomen; binomina or trinomina are It should be in metabolically inactive
also termed combinations. state. Type designations must be pub-
4. Establishment of names: In order to lished and registered. The typeless
be established on or after 1 January (descriptive) names do not have a
200n, a name of a taxon must be pub- representative type and are formed
lished as provided for by the rules for based on some character/s, apply to
publication, which are essentially taxa defined by circumscription, and
similar to the Effective publication in may be used unchanged at different
botany. The rules for establishment ranks above the rank of a family.
(valid publication of Botanical Code) are 6. Registration: Registration is affected
generally similar to the Botanical Code by submitting the published matter
with certain changes. The new taxon that includes the protologue(s) or
may have a Latin or English descrip- nomenclatural acts to a registering
tion or diagnosis (thus Latin diagnosis office designated by the relevant inter-
is not mandatory). Change of rank national body. It is pertinent to men-
within the family group or genus group, tion that this requirement was based
or elevation of rank within the species on the Botanical Code (Tokyo Code,
group do not require the formal estab- 1994) where it has already been aban-
lishment of a new name or combina- doned (St. Louis Code, 2000), removing
tion. In order to be established, a name all references to registration in the
of a new fossil botanical taxon of spe- Botanical Code. The date of a name is
cific or lower rank must be accompa- that of its registration, which is the
nied by an illustration or figure show- date of receipt of the relevant matter
ing diagnostic characters, in addition at the registering office. When alter-
to the description or diagnosis, or by a native (homotypic) names are proposed
bibliographic reference to a previously simultaneously for registration for one
published illustration or figure. This re- and the same taxon (same rank and
quirement also applies to the names same position) neither is considered
of new non-fossil algal taxa at these to be submitted. When one or more of
ranks. Only if the corresponding genus the other conditions for establishment
or species name is established can the have not been met prior to registration,
name of a subordinate taxon. Establish- the name must be resubmitted for reg-
ment (valid publication) under the istration after these conditions have
BioCode includes registration of been fulfilled.
names in the family group, genus 7. Precedence (priority): For purposes
group and species group as a last step of precedence, the date of a name is
38 Plant Systematics
either the date attributed to it in an contexts where such citations are nei-
adopted List of Protected Names or, for ther informative nor really appropriate.
unlisted names, the date on which it This may be a timely change, since the
was validly published under the botani- current attitude is showing signs of
cal or bacteriological Code, or became cracking (Garnock-Jones and Webb,
available under the zoological Code, or 1996). Art. 40.1 is so worded as to re-
was established under the present flect this new attitude.
Code. Limitations of priority that un- 10. Hybrids: The Appendix for Hybrids in
der previous Codes affected names in the Botanical Code is replaced by a
certain groups or of certain catego- single Article in the Draft BioCode.
rieseven if not provided for in the This extreme simplification should in
present Codestill apply to such no way disrupt the present and future
names if they were published before 1 usage of hybrid designations, but has
January 200n The limitations to prec- some philosophical changes as its
edence are largely similar to botany. basis. Most importantly, taxonomy and
Conservation and rejection procedures nomenclature are disentangled, in
would remain largely the same as at conformity with Principle I. Cultivated
present. The botanical process of sanc- plants are not covered under the
tioning concerns old names only and BioCode.
need be provided for in a future
BioCode. PhyloCode
8. Homonymy: The major change with
respect to the homonymy rule would The PhyloCode is being developed by Inter-
be that in future, it would operate national Committee on Phylogenetic Nomen-
across the kingdoms. In order that this clature on the philosophy of Phylogenetic
provision be applicable, it is necessary taxonomy replacing the multirank Linnaean
that lists of established generic names system with a rankless system recognizing
of all organisms be publicly available, only species and clades. It is intended to
ideally in electronic format; most such, cover all biological entities, living as well as
apparently, already exist, but are not fossil. Underlying principle of the PhyloCode
yet generally accessible. A list of is that the primary purpose of a taxon name
across-kingdom generic homonyms in is to provide a means of referring unambigu-
current use is being prepared, and, as ously to a taxon, not to indicate its relation-
a next step, a list of binomina in the ships. The PhyloCode grew out of recogni-
corresponding genera is planned, so tion that the current Linnaean system of no-
that future workers may avoid the crea- menclatureas embodied in the pre-exist-
tion of new (illegal) homonymous ing botanical, zoological, and bacteriological
binomina. Existing across-kingdom Codesis not well suited to govern the nam-
homonyms would not lose their status ing of clades and species, the entities that
of acceptable names, but would be compose the tree of life and are the most sig-
flagged for the benefit of biological in- nificant entities above the organism level.
dexers and users of indexes. Existing Rank assignment is subjective and biologi-
names are not affected by the proposed cally meaningless. The PhyloCode will pro-
rules. The practice of Secondary vide rules for the express purpose of naming
Homonymy in ICZN is not followed in the parts of the tree of lifeboth species and
BioCode. cladesby explicit reference to phylogeny.
9. Author citation: The Draft BioCode In doing so, the PhyloCode extends tree-
signals a departure from the botanical thinking to nomenclature. The PhyloCode
tradition of laying great emphasis on is designed so that it can be used concur-
the use of author citations, even in rently with the pre-existing Codes or (after
Botanical Nomenclature 39
rules governing species names are added) well, by removing the linkage to a genus
as the sole code governing the names of taxa, name. Under the PhyloCode, phylogenetic
if the scientific community ultimately de- position can easily be indicated by associat-
cides that it should. ing the species name with the names of one
The starting date of the PhyloCode has not or more clades to which it belongs. Another
yet been determined and is cited as 1 Janu- benefit of phylogenetic nomenclature is that
ary 200n in the draft Code. Rules are pro- abandonment of ranks eliminates the most
vided for naming clades and will eventually subjective aspect of taxonomy. The arbitrary
be provided also for naming species. In this nature of ranking is not widely appreciated
system, the categories species and clade by non-taxonomists.
are not ranks but different kinds of biologi- The PhyloCode is designed so that it can
cal entities. A species is a segment of a popu- be used concurrently with the rank-based
lation lineage, while a clade is a monophyl- codes or (after rules governing species
etic group of species. Fundamental differ- names are added) as the sole code govern-
ences between the phylogenetic and tradi- ing the names of taxa, if the scientific com-
tional systems in how supraspecific names munity ultimately decides that it should.
are defined lead to operational differences The intent is not to replace existing names
in the determination of synonymy and hom- but to provide an alternative system for gov-
onymy. For example, under the PhyloCode, erning the application of both existing and
synonyms are names whose phylogenetic newly proposed names. In developing the
definitions specify the same clade, regard- PhyloCode, much thought has been given to
less of prior associations with particular minimizing the disruption of the existing
ranks; in contrast, under the pre-existing nomenclature. Thus, rules and recommen-
Codes, synonyms are names of the same dations have been included to ensure that
rank based on types within the group of con- most names will be applied in ways that ap-
cern, regardless of prior associations with proximate their current and/or historical
particular clades. The requirement that all use. However, names that apply to clades
established names be registered will reduce will be redefined in terms of phylogenetic
the frequency of accidental homonyms. relationships rather than taxonomic rank
Phylogenetic nomenclature was pre- and therefore will not be subject to the sub-
sumed to have several advantages over the sequent changes that occur under the rank-
traditional system. In the case of clade based systems due to changes in rank. Be-
names, it eliminates a major source of in- cause the taxon membership associated
stability under the pre-existing Codes with particular names will sometimes dif-
name changes due solely to shifts in rank. fer between rank-based and phylogenetic
It also facilitates the naming of new clades systems, suggestions are provided for indi-
as they are discovered and not waiting till a cating which code governs a name when
full classification is developed as in the case there is a possibility of confusion.
of existing Codes. This is a particularly sig- The concept of PhyloCode was first intro-
nificant when new advances in molecular duced by de Queiroz and Gauthier (1992). The
biology and computer technology have led to theoretical development of PhyloCode re-
a burst of new information about phylogeny, sulted from a series of papers from 1990 on-
much of which is not being translated into wards and three symposia first in 1995, the
taxonomy at present. The availability of the second in 1996 at the Rancho Santa Ana
PhyloCode will permit researchers to name Botanic Garden in Claremont, California,
newly discovered clades much more easily U.S.A., organized by J. Mark Porter and en-
than they can under the pre-existing Codes. titled The Linnean Hierarch: Past Present
At present PhyloCode has rules only for and Future, and the third at the XVI Inter-
clades but when extended to species, it will national Botanical Congress in St. Louis,
improve nomenclatural stability here as Missouri, U.S.A. (1999), entitled Overview
40 Plant Systematics
Table 2.2 Equivalence table of nomenclatural terms used in the Draft PhyloCode, the Draft
BioCode and the current biological codes (excluding Code for Viruses).
oircedence of names
published published effectively published effectively published published
precedence precedence priority priority precedence
earlier earlier senior earlier senior
later later junior later junior
Nomenclatural status
established established validly published validly published available
converted
acceptable acceptable legitimate legitimate potentially valid
registration registration validation -
Taxonomic status
accepted accepted correct correct valid
that serve to specify the clade to which one that is explicitly excluded from it.
the name applies. All specifiers used All specifiers in node-based and
in node-based and stem-based defini- apomorphy-based definitions are inter-
tions of clade names, and one of the nal, but stem-based definitions must
specifiers used in apomorphy-based always have at least one specifier of
definitions of clade names, are species each type. When a species is used as a
or specimens. The other specifier used specifier, the author and publication
in an apomorphy-based definition of a year of the species name must be cited.
clade name is a synapomorphy. If sub- When a type specimen is used as a
ordinate clades are cited in a specifier, the species name that it typi-
phylogenetic definition of a more inclu- fies and the author and publication year
sive clade, their specifiers must also of that species name must be cited.
be explicitly cited within the definition 7. Precedence: Although the entity to
of the more inclusive clade. An inter- which precedence applies in this code
nal specifier is one that is explicitly is referred to as a name, it is really
included in the clade whose name is the combination of a name and its defi-
being defined; an external specifier is nition. In different cases, one or the
44 Plant Systematics
It would be total chaos to study and document the groups have been assigned categories
information about more than a quarter mil- and named, the process of classification is
lion species of vascular plants if there were complete, or the taxonomic structure of the
no proper mechanism for grouping the same. whole largest most inclusive group has been
Whatever may be the criterion for classifi- achieved. Because of the hierarchical ar-
cationartificial characters, overall mor- rangement of categories to which the groups
phology, phylogeny or phenetic relationship are assigned, the classification achieved
the basic steps are the same. The organ- is known as hierarchical classification.
isms are first recognized and assembled into This concept of categories, groups and taxo-
groups on the basis of certain resemblance. nomic structure can be illustrated in the
These groups are in turn assembled into form of a box-in-box figure (Figure 3.1) or a
larger and more inclusive groups. The pro- dendrogram (resembling a pedigree chart,
cess is repeated until finally all the organ- Figure 3.2).
isms have been assembled into a single,
largest most inclusive group. These groups TAXONOMIC GROUPS, CATEGO-
(Taxonomic groups or Taxa) are arranged
in order of their successive inclusiveness,
RIES AND RANKS
the least inclusive at the bottom, and the Taxonomic groups, categories and ranks are
most inclusive at the top. inseparable once a hierarchical classifica-
The groups thus formed and arranged are tion has been achieved. Rosa alba is thus
next assigned to various categories, having nothing else but a species and Rosa is noth-
a fixed sequence of arrangement (taxo- ing other than a genus. However, the dif-
nomic hierarchy), the most inclusive group ferences do exist in concept and application.
assigned to the highest category (generally The categories are like shelves of an
a division) and the least inclusive to the low- almirah, having no significance when
est category (usually a species). The names empty, and importance and meaning only
are assigned to the taxonomic groups in such after something has been placed in them.
a way that the name gives an indication of Thereafter, the shelves will be known by
the category to which it is assigned. Rosales, their contents: books, toys, clothes, shoes
Myrtales, and Malvales all belong to the or- etc. Categories in that sense are artificial
der category and Rosaceae, Myrtaceae and and subjective and have no basis in reality.
Malvaceae to the family category. Once all They correspond to nothing in nature. How-
Hierarchical Classification 47
Figure 3.1 Processes of assembling taxonomic groups according to the hierarchical system, de-
picted by box-in-box method. In the above example, there are 18 species grouped into
10 genera, 6 families, 4 orders, 3 subclasses, 2 classes and 1 division.
ever, they have a fixed position in the hier- with ending aceae signifies a family which
archy in relation to other categories. But among others also includes roses, belong-
once a group has been assigned to a particu- ing to the genus Rosa) we establish the po-
lar category the two are inseparable and the sition of taxonomic groups in the hierarchi-
category gets a definite meaning because it cal system of classification. Some important
now includes something actually occurring characteristics, which enable a better un-
in nature. The word genus does not carry a derstanding of the hierarchical system of
specific meaning but the genus Rosa says a classification, are enumerated below.
lot. We are now talking about roses. There 1. Different categories of the hierarchy
is practically no difference between category are higher or lower according to
and rank, except in the grammatical sense. whether they are occupied by more
Rosa thus belongs to the category genus, inclusive or less inclusive groups.
and has generic rank. If categories are like Higher categories are occupied by more
shelves, ranks are like partitions, each sepa- inclusive groups than those occupying
rating the given category from the category lower categories.
above. Taxonomic groups, on the other hand, 2. Plants are not classified into catego-
are objective and non-arbitrary to the extent ries but into groups. It is important to
that they represent discrete sets of organ- note that a plant may be a member of
isms in nature. Groups are biological enti- several taxonomic groups, each of
ties or a collection of such entities. By as- which is assigned to a taxonomic cat-
signing them to a category and providing an egory, but is not itself a member of any
appropriate ending to the name (Rosaceae taxonomic category. A plant collected
48 Plant Systematics
Figure 3.2 Dendrogram method for depicting the hierarchical system based on same hypothetical
example as in Figure 3.1.
from the field may be identified as Poa guish the taxa. Dicots are thus
annua (assigned to species category). conveniently separated from monocots
It is a member of Poa (assigned to by possession of two cotyledons,
genus category), Poaceae (assigned to pentamerous flowers, reticulate vena-
family category) and so on, but the plant tion and vascular bundles in a ring as
cant be said to be belonging to the spe- against one cotyledon, trimerous flow-
cies category. ers, parallel venation and scattered
3. A taxon may belong to other taxa, but vascular bundles in monocots. But
it can be a member of only one category. when taken individually, Smilax is a
Urtica dioica, thus, is a member of monocot with reticulate venation and
Urtica, Urticaceae, Urticales, and so on, Plantago is a dicot with parallel vena-
but it belongs only to species category. tion. Similarly Nymphaea, is a dicot
4. Categories are not made up of lower with scattered bundles, and the flow-
categories. The category family is not ers are trimerous in Phyllanthus,
made up of the genus category, since which is a dicot.
there is only one genus category.
5. The characters shared by all members
of a taxon placed in a lower category
UTILIZATION OF CATEGORIES
provide the characters for the taxon Taxonomic categories possess only relative
immediately above. Thus, the charac- value and an empty category has no founda-
ters shared by all the species of Brassica tion in reality and obviously cant be defined.
make up the characters of the genus An important step in the process of classifi-
Brassica. The characters shared by cation is to assign taxa to an appropriate
Brassica and several other genera form category. It thus becomes imperative to
distinguishing characters of the fam- decide what should be the properties of taxa
ily Brassicaceae. It is important to note to be included in a particular category? Only
that the higher a group is placed in the with a proper utilization of the concept of
hierarchy, the fewer will be the char- categories can their application in hierar-
acters shared by the subordinate units. chical systems be meaningful. The problem
Many higher taxa, as such (e.g. Dicots: is far from resolved. An attempt will be made
Magnoliopsida) can only be separated here to discuss the relevant aspects of the
by a combination of characters; no sin- inclusion of type of entities or groups of
gle diagnostic character may distin- entities under different categories.
Hierarchical Classification 49
Unfortunately, ideal species are rare pose of nomenclature, all organisms must
among the plant kingdom and the greater be referable to species. Species, by this
majority of species pose situations contrary concept, can be defined by the language of
to one or more of the above criteria. formal relations and not by property
of their organisms. The concept considers
Idea of Transmutation species to be a category in taxonomic hier-
This is an ancient Greek idea which per- archy and may correspond to a specific name
sisted as late as the seventeenth century. in the binomial system of nomenclature.
Greeks believed in the transmutation of The concept is logically sound but scientifi-
wheat into barley, Crocus into Gladiolus, bar- cally irrelevant since the ultimate aim is
ley into oats, and many other plants, under to place a particular group of individuals in
certain conditions. The supporters of this a species.
notion often included professional botanists
like Bobart (who swore that Crocus and Typological Species Concept
Gladiolus, as likewise the Leucojum, and This concept was first proposed by John Ray
Hyacinths by a long standing without re- (1686) and further elaborated by C. Linnaeus
planting have in his garden changed from in Critica botanica (1737). Linnaeus refuted
one kind to the other) as reported by Robert the idea of transmutation of species.
Sharrock (1660) in his book History of the Linnaeus believed that although there is
propagation and improvement of vegetables by some variation within a species, the spe-
the concurrence of art and nature. Sharrock cies by themselves are fixed (fixity of spe-
fortunately, however, on investigation did cies) as created by the Almighty Creator. The
not find any proof of this in the field. So called species, according to the concept, is a group
transmutation can be explained as nothing of plants which breed true within their
other than the result of unintentional mix- limits of variation. Towards the later part
ing of seeds or other propagules of another of his life, however, Linnaeus moved away
plant with a particular crop before plantation. from idea of fixity of species and was con-
The present author had a glimpse of this vinced that species can arise by hybridiza-
fallacy while studying the weeds in saffron tion. In his later publication (Fundamenta
(Crocus sativus) fields of Kashmir valley. With fructificationis, 1762), Linnaeus imagined
a few vegetative specimens of Iris reticulata that at the time of creation, there arose as
(whose corms and leaves are closely similar many genera as were the individuals. These,
to saffron; the flowers are quite distinct) in in the course of time, were fertilized by oth-
his hand, the author tried in vain to con- ers and thus arose species until so many
vince the saffron grower (who always thinks were produced as now exist. These species
that he knows more about his crop) that the were sometimes fertilized by other species
plant he was carrying was not saffron. The of the same genus, giving rise to varieties.
author managed to escape the assault but The typological concept, however, should not
was more convinced that this Iris (which does be confused with typification, which is a dis-
not grow elsewhere in Kashmir valley) would tinct methodology of nomenclature, provid-
have come unintentionally from Persia ing names to taxonomic groups.
where it grows commonly, and from where
the Kashmir saffron is supposed to have been Taxonomic Species Concept
introduced. The concept of transmutation is
The doctrine of fixity was challenged by
now firmly rejected.
Lamarck (1809) and finally Darwin (1859),
who recognized continuous and discontinu-
Nominalistic Species Concept ous variation and developed his taxonomic
This nominalistic species concept is also species concept based on morphology, more
only of academic interest now. For the pur- appropriately known as the Morphological
Hierarchical Classification 51
species concept. According to this concept, 1. It is useful for general taxonomic pur-
the species is regarded as an assemblage poses especially the field and
of individuals with morphological fea- herbarium identification of plants.
tures in common, and separable from 2. The concept is very widely applied and
other such assemblages by correlated most species have been recognized
morphological discontinuity in a number using this concept.
of features. The supporters of this view be- 3. The morphological and geographical
lieve in the concept of continuous and dis- features used in the application of this
continuous variations. The individuals of a concept can be easily observed in
species show continuous variation, share populations.
certain characters and show a distinct dis- 4. Even experimental taxonomists who do
continuity with individuals belonging to an- not recognize this concept, apply this
other species, with respect to all or some of concept in cryptic form.
these characters. 5. The greater majority of species recog-
Du Rietz (1930) modified the taxonomic nized through this concept correspond
species concept by also incorporating the role to those established after experimen-
of geographic distribution of populations and tal confirmation.
developed the morpho-geographical species The concept, however, also has some
concept. The species was defined as the inherent drawbacks:
smallest population that is permanently 1. It is highly subjective and different
separated from other populations by dis- sets of characters are used in differ-
tinct discontinuity in a series of biotypes. ent groups of plants.
The populations recognized as distinct spe- 2. It requires much experience to prac-
cies and occurring in separate geographical tice this concept because only after
areas are generally quite stable and remain considerable observation and
so even when grown together. There are, experience can a taxonomist decide
however, examples of a few species pairs the characters which are reliable in a
which are morphologically quite distinct, particular taxonomic group.
well adapted to respective climates, but 3. The concept does not take into account
when grown together, they readily interbreed the genetic relationships between
and form intermediate fertile hybrids, bridg- plants.
ing the discontinuity gap between the spe-
cies. Examples are Platanus orientalis of the Biological Species Concept
Mediterranean region and P. occidentalis of The biological species concept was first de-
E. United States. Another well-known pair veloped by Mayr (1942) who defined species
is Catalpa ovata of Japan and China and C. as groups of actually or potentially inter-
bignonioides of America. Such pairs of spe- breeding natural populations, which are
cies are known as vicarious species or reproductively isolated from other such
vicariants and the phenomenon as groups. The words actually or potentially,
vicariance or vicariism. being meaningless, were subsequently
Morphological and morpho-geographical dropped by Mayr (1969). Based on the same
types of taxonomic species have been widely criteria, Grant (1957) defined species as a
accepted by taxonomists who even take into community of cross-fertilizing individuals
account the data from genetics, cytology, linked together by bonds of mating and
ecology, etc., but firmly believe that species reproductively isolated from other species
recognized must be delimited by morpho- by barriers to mating. The recognition of
logical characters. biological species thus involve: (a) inter-
The taxonomic species concept has sev- breeding among populations of the same
eral advantages: species; and (b) reproductive isolation
52 Plant Systematics
share a common history of descent, not lished by Linnaeus. Microspecies are dis-
shared by other demes. The identity of spe- tinct from cryptic species, which are mor-
cies is based on recognition systems that phologically similar but cytologically or physi-
operate at various levels. In sexually repro- ologically different. Stace (1989) uses the
ducing species, such systems include rec- term semi-cryptic species for the latter.
ognition because of phenotypic, behavioural
and biochemical differences. In asexual spe- Biosystematic Species
cies phenotypic, genotypic differences main-
tain the identity of species. Identity in both
Concept
sexual and asexual species may also be due The term biosystematic species has been
to distinct ecological roles. Viewed from the used by Grant (1981) to refer to the catego-
standpoint of evolutionary species concept, ries based on fertility relationships as de-
however, the important question is not termined by artificial hybridization experi-
whether two species hybridize, but whether ments. Ecotype refers to all members of a
two species do or do not lose their distinct species that represent a product of genetic
ecological and evolutionary roles. If, despite response of a species towards a particular
some hybridization, they do not merge, then habitat. The ecotypes, which are able to
they remain separate species in the evolu- exchange genes freely without loss of fertil-
tionary perspective. ity or vigour in the offsprings, form an
Several other terms have been proposed ecospecies. An ecospecies corresponds to a
to distinguish species based on specific cri- taxonomic species. A group of ecospecies
teria. Grant (1981) recognizes microspecies capable of limited genetic exchange consti-
as populations of predominantly uniparen- tutes a coenospecies. A coenospecies is con-
tal plant groups which are themselves uni- sidered equivalent to a subgenus. A group of
form and are slightly differentiated morpho- related coenospecies between which hybrid-
logically from one another; they are often ization is possibledirectly or through in-
restricted to a limited geographical area. termediates constitutes a comparium,
Microspecies develop in inbreeding species, which is considered equal to a genus. Com-
but are usually not stable over longer peri- plete sterility barriers exist between genera.
ods. They may undergo cross-fertilization
sooner or later forming recombinant types Infraspecific ranks
which themselves become new The species is regarded as the basic unit of
microspecies. Several microspecies have classification and many works, including the
been found in Erophila verna mostly repre- Flora of USSR, do not recognize infraspecific
senting single biotypes or groups of similar taxa. Many European, American and Asian
biotypes some of which are marked by only Floras, however, do recognize taxa below
one or two characters. These may be dis- the rank of species. The international Code
tinguished as clonal microspecies (repro- of Botanical Nomenclature recognizes five
ducing by vegetative propagation, e.g. infraspecific ranks: subspecies, variety
Phragmites), agamospermous microspecies (Latin, varietas), subvariety, form (Latin,
(reproducing by agamospermy, e.g. Rubus), forma) and subform. Of these, three (sub-
heterogamic microspecies (reproducing by species, variety and form) have been widely
genetic systems, e.g. Oenothera biennis or used in the literature.
Rosa canina), and autogamous microspecies Du Rietz (1930) defined subspecies as a
(predominantly autogamous and chromo- population of several biotypes forming
somally homozygous, e.g. Erophila). The term more or less a distinct regional facies of a
microspecies was first suggested by Jordan species. Facies stands for race. Morphologi-
(1873) and as such they are often termed as cally distinct but interfertile populations of
Jardanons to distinguish them from a species growing in different geographical
Linnaeons, the normal species, first estab- regions are maintained as distinct subspe-
54 Plant Systematics
cies due to the geographical isolation of the by cytogenetic and geographic infor-
species. mation in relation to morphology.
Du Rietz defined variety as a population 2. The genera should not be distinguished
of several biotypes, forming more or less a on a single character but a sum total
local facies of a species. The term variety of several characters. In a number of
is commonly used for morphologically dis- cases, genera are easily recognized on
tinct populations occupying a restricted geo- the basis of adaptive characters (adap-
graphical area. Emphasis is on a more lo- tations in response to ecological
calized range of the variety, compared with niches), as in the case of establishing
the large-scale regional basis of a subspe- aquatic species of Ranunculus under a
cies. Several varieties are often recognized separate genus Batrachium.
within a subspecies. The term variety is also 3. There is no size requirement for a
used for variations whose precise nature is genus. It may include a single species
not understood, a treatment often necessary (monotypic genus) as Leitneria,
in the pioneer phase of taxonomy. Ginkgo, Milula or many (Polytypic
Forma is often regarded as sporadic genus): Euphorbia (2100 species),
variant distinguished by a single or a few Astragalus (2000) Carex (1800), Senecio
linked characters. Little taxonomic signifi- (1500) and Acacia (1300) being the
cance is, however, attached to minor and examples of large genera. The genus
random variations upon which the forms are Senecio was earlier included more than
normally based. 2500 species, but it has now been split
into several genera. The only impor-
Genus tant criterion is that there should be a
decided gap between the species of two
The concept of genus is as old as folk
genera. If the two genera are not
science itself as represented by names
readily separable, then they can be
rose, oak, daffodils, pine and so on. A genus
merged into one and distinguished as
represents a group of closely-related spe-
subgenera or sections. Such an
cies. According to Rollins (1953), the func-
exercise should take into considera-
tion of the genus concept is to bring together
tion the concept in other genera of the
species in a phylogenetic manner by family, size of the genus (it is more
placing the closest related species within convenient to have subgenera and
the general classification. When attempt- sections in a larger genus) and
ing to place a species within a genus, the traditional usage.
primary question would be, is it related to 4. When generic limits are being drawn,
the undoubted species of that genus? Mayr it is absolutely necessary that the
(1957) defined genus as a taxonomic cat- group of species should be studied
egory which contains either one species throughout the range distribution of
or a monophyletic group of species, and the group, because characters stable
is separable from other genera by a de- in one region may break down
cided discontinuity gap. It was earlier elsewhere.
believed that a genus should always be
readily definable on the basis of a few tech- Family
nical floral characters. A more rational A family, similarly, represents a group of
recognition should take the following closely-related genera. Like genus, it is also
criteria into consideration: a very ancient concept because the natural
1. The group, as far as possible, should groups now known as families, such as
be a natural one. The monophyletic legumes, crucifers, umbels, grasses have
nature of the group should be deduced been recognized by laymen and taxonomists
Hierarchical Classification 55
alike for centuries. Ideally, families should fication. Although there is no marked dis-
be monophyletic groups. Like the genus, the continuity between Lamiaceae (Labiatae)
family may represent a single genus and Verbenaceae, the two are maintained
(Podophyllaceae, Hypecoaceae, etc.) or as distinct families. The same tradition
several genera (Asteraceae: nearly 1100). prevents taxonomists from splitting
Most taxonomists favour broadly-conceived Rosaceae, which exhibits considerable
family concepts that lend stability to classi- internal differences.
56 Plant Systematics
Chapter 4
Descriptive Terminology
Figure 4.1 Roots. A: Fusiform fleshy root of Raphanus sativus; B: Conical fleshy root of Daucus
carota; C: Napiform fleshy root of Brassica rapa; D: Root-tuber of Ipomoea batatas;
E: Fasciculated tuberous roots of Dahlia; F: Nodulose roots of Curcuma amada;
G: Moniliform roots; H: Pneumatophores of Avicennia; I: Stilt roots of Zea mays;
J: Stilt roots of Pandanus; K: Prop roots of Ficus benghalensis; L: Aerial roots of
Dendrobium; M: Haustorial roots of Viscum, sending haustoria only into the host xy-
lem; N: Mycorrhizal roots of Pinus.
orchids) or may largely form a mantle over large hanging prop roots of Ficus species are
the root with a few hyphae penetrating be- often used in bungee jumping sport.
tween the outer cells (ectotrophic mycor- Stilt: Adventitious roots arising from the
rhizae found in conifers). In specialized VAM lower nodes of the plant and penetrating the
(vesicular arbuscular mycorrhizae) found soil in order to give increased anchorage as
in grasses, the fungal hyphae penetrate cor- in maize (Zea mays), screw-pines (Pandanus)
tical cells, forming a hyphal mass called and Rhizophora.
arbusculum.
Respiratory: Negatively geotropic roots of
some mangroves (e.g. Avicennia) which grow
STEMS
vertically up and carry specialized lenticels Stems represent the main axes of plants,
(pneumathodes) with pores for gaseous ex- being distinguished into nodes and intern-
change. Such roots are also known as pneu- odes, and bearing leaves and axillary buds
matophores. at the nodes. The buds grow out into lateral
Prop: Elongated aerial roots arising from shoots, inflorescences or flowers. A plant
horizontal branches of a tree, striking the may lack stem (acaulescent) or have a dis-
ground and providing increased anchorage tinct stem (caulescent). The latter may be
and often replacing the main trunk as in aerial (erect or weak) or even underground.
several species of Ficus (e.g. the great Acaulescent: Apparently a stemless plant
banyan tree F. benghalensis in the Indian having very inconspicuous reduced stem.
Botanical Garden at Sibpur, Kolkata). The The reduced stem may often elongate at the
Descriptive Terminology 59
time of flowering into a leafless flowering (iii) Axillary (lateral) bud: Bud located in
axis, known as scape as found in onion. the axil of a leaf.
Arborescent: Becoming treelike and woody, (iv) Bulbil: Modified and commonly en-
usually with a single main trunk. larged bud meant for propagation. In
Ascending: Stem growing upward at about Agave and top onion (Allium x proliferum)
45-60o angle from the horizontal. flower buds get modified into bulbils.
(v) Dormant (winter) bud: Inactive well
Bark: Outside covering of stem, mainly the
protected bud usually to survive win-
trunk. Bark may be smooth, exfoliating
ter in cold climates.
(splitting in large sheets), fissured (split or
(vi) Flower bud: Bud developing into flower.
cracked), or ringed (with circular fissures).
(vii) Mixed bud: A bud bearing both em-
Bud: Short embryonic stem covered with bud bryonic leaves and flowers.
scales and developing leaves and often found (viii) Naked bud: Not covered by bud scales.
in leaf axils. Buds are frequently helpful in (ix) Pseudoterminal bud: Lateral bud near
identification and may present considerable the apex appearing terminal due to
diversity: death or non-development of terminal
(i) Accessary bud: An extra bud on either bud.
side (collateral bud) or above (super- (x) Scaly (covered) bud: Covered by bud
posed bud or serial bud) the axillary scales.
bud. (xi) Terminal bud: Located at stem tip.
(ii) Adventitious bud: Bud developing (xii) Vegetative bud: Bearing embryonic
from any place other than the node. leaves.
Figure 4.2 Buds. A: Axillary bud with 2 collateral buds in Acer; B: Axillary bud and a superposed
bud in Juglans regia; C: Scaly bud of Ficus covered with bud-scale; D: Winter buds in
Salix; E: Terminal bud with two collateral buds; G: Intrapetiolar bud hidden by petiole
base; H: Same with petiole removed; I: Bulbil developing from one flower of Agave;
J: Pseudoterminal bud, taking terminal position due to death or non-development of
terminal bud; K: Vegetative bud of Brassica oleracea var. capitata (cabbage).
60 Plant Systematics
Figure 4.3 Stem, subaerial and underground modifications. A: Tunicated bulb of Allium cepa; B:
Same in vertical section, showing concentric layers of leaf sheaths; C: Scaly bulb of
Lilium with separate fleshy leaf sheaths; D: Stem tuber of Solanum tuberosum with eye
buds; E: Rhizome of Zingiber officinale with fleshy branched horizontal stem; F: Corm of
Crocus sativus covered with scale leaves; G: Same in longitudinal section showing the
solid inside as opposed to the bulb; H: Runner of Oxalis, rooting at nodes; I: Stolon of
Fragaria vesca, arching down to strike roots at nodes; J: Sucker in Chrysanthemum,
underground and rising up to produce shoot; K: Offset in Eichhornia crassipes, like
runner but shorter and thicker.
(i) Bulb: A reduced stem surrounded by Spine is like a thorn but generally weaker
thick fleshy scale leaves. The leaves and developing from the leaf or stipule.
may be arranged in a concentric man- Thorns may bear leaves (Duranta), flowers
ner surrounded by a thin membranous (Prunus), or may be branched (Carissa).
scale leaf (tunicated bulb of onion Weak: Plant not strong enough to grow erect:
Allium cepa) or leaves only overlapping (i) Creeper: Growing closer to ground and
along margins (scaly or imbricate bulb often rooting at the nodes, as in Oxa-
of garlicAllium sativum). lis.
(ii) Corm: A vertical fleshy underground (ii) Trailer: Trailing along the surface and
stem covered with some scale leaves often quite long. They are usually pros-
and with a terminal bud, as in Gladi- trate or procumbent, lying flat on
olus. ground as in Basella, but sometimes
(iii) Rhizome: A horizontal dorsiventral decumbent when the tips start grow-
fleshy underground stem with nodes ing erect or ascending, as in Portulaca.
and internodes and covered with scale (iii) Climber: Weak plant which uses a sup-
leaves, as in Ginger. port to grow up and display leaves to-
(iv) Stem tuber: Underground portions of wards sunlight. This may be achieved
stem modifies into tubers as in potato. in a number of ways:
Thorn: Branch or axillary bud modified into (a) Twiner (stem climber): Stem coil-
a hard sharp structure, being deep-seated ing round the support due to spe-
and having vascular connections as opposed cial type of growth habit, as in Ipo-
to prickles which are mere superficial out- moea and Convolvulus.
growths without vascular connections. (b) Root climber: Climbing with the
help of adventitious roots which
cling to the support, as in species
of Piper.
(c) Tendril climber: Climbing with the
help of tendrils which may be modi-
fied stem (Passiflora, Vitis), modi-
fied inflorescence axis (Antigonon),
modified leaf (Lathyrus aphaca),
modified leaflets (Pisum sativum),
modified petiole (Clematis), modified
leaf tip (Gloriosa), modified stipules
(Smilax) or even modified root
(Parthenocissus).
(d) Scrambler: Spreading by leaning
or resting on support, as in Rose.
(e) Thorn climber: Climbing or reclin-
ing on the support with the help of
thorns, as in Bougainvillea.
(f) Hook climber: Climbing with the
Figure 4.4 Stem, aerial modifications. A: Phyl- help of hooked structures (Galium).
loclade of Opuntia; B: Cladodes in
Asparagus; C: Portion enlarged to LEAVES
show whorl of cladodes in axil of
scale-leaf; D: Phylloclades of Leaves are green photosynthetic organs of a
Ruscus, leaf-like and bearing flow- plant arising from the nodes. Leaves are usu-
ers; E: Thorn of Prunus; F: Tendril ally flattened, either bifacial (dorsiventral)
of Luffa. with adaxial side (upper surface facing stem
62 Plant Systematics
axis) different from abaxial side (lower sur- all leaves are found to lie in a fixed number
face facing away from stem axis) or may be of vertical rows or orthostichies. The ar-
unifacial (isobilateral) with similar adaxial rangement commonly agrees with the Fi-
and abaxial surfaces. A leaf is generally dif- bonacci series (Schimper-Brown series),
ferentiated into a leaf blade (lamina) and a wherein numerator and denominator in
petiole. A leaf with a distinct petiole is termed each case are obtained by adding up the pre-
petiolate, whereas one lacking a petiole is ceding two (1/2, 1/3, 1+1/2+3=2/5, 1+2/
sessile. A petiole may be winged (Citrus), 3+5=3/8, and so on) In grasses the leaves
swollen (Eichhornia), modified into tendril are in two rows (2-ranked, distichous or
(Clematis), spine (Quisqualis) or become modi- phyllotaxy), so that the third leaf is above
fied into a flattened photosynthetic phyllode the first leaf. Sedges have three rows of
(Australian Acacia). Two small stipules may leaves (3-ranked, tristichous, or 1/3 phyl-
be borne at the base of the petiole. The leaf lotaxy), the fourth leaf above the first leaf.
terminology affords a wide diversity. The leaf China rose and banyan show pentastichous
base may sometimes be sheathing or arrangement, where the sixth leaf lies above
pulvinate (swollen). the first one, but in doing so leaves complete
two spirals and the phyllotaxy is known as
Leaf arrangement 2/5 phyllotaxy. Carica papaya depicts
octastichous arrangement, wherein the
(Phyllotaxy) ninth leaf lies above the first one and three
Alternate: Bearing one leaf at each node. spirals are completed in doing so, thus a
The successive leaves usually form a spiral 3/8 phyllotaxy. Leaf bases of date palm and
pattern, in mathematical regularity so that sporophylls of pinecone are closely packed
Descriptive Terminology 63
and internodes are extremely short making A Simple leaf may be undivided or in-
it difficult to count the number of rows cised variously depending upon whether the
(orthostichies). Such an arrangement is incision progresses down to the midrib (pin-
known as parastichous. nate) or towards the base (palmate):
Imbricated: The leaves closely overlapping (i) Pinnatifid: The incision is less than
one another, as in Cassiope. halfway towards the midrib.
Opposite: Bearing pairs of leaves at each (ii) Pinnatipartite: The incision is more
node. The pairs of successive leaves may be than halfway towards the midrib.
parallel (superposed) as in Quisqualis or at (iii) Pinnatisect: The incision reaches al-
right angles (decussate) as in Calotropis and most the midrib.
Stellaria. (iv) Palmatifid: The incision is less than
Whorled (verticillate): More than three halfway towards the base.
leaves at each node as in Galium, Rubia and (v) Palmatipartite: The incision is more
Nerium. than halfway towards the base of leaf
Radical: Leaves borne at the stem base of- blade.
ten forming a rosette (rosulate) in reduced (vi) Palmatisect: The incision reaches
stems, as in Primula and Bellis. almost the base of leaf blade.
Cauline: Leaves borne on the stem. (vii) Pedate: Deeply palmately lobed leaves
Ramal: Leaves borne on the branches. with lobes arranged like the claw of a
bird.
Leaf duration A compound leaf has incision reaching
Leaves may stay and function for few days the midrib (or leaf base) so that there are
to many years, largely determined by the ad- more than one distinct blades called as leaf-
aptation to climatic conditions: lets or pinnae. It may similarly be pinnate
Caducuous (fugacious): Falling off soon af- when the leaflets are borne separated along
ter formation, as in Opuntia. the rachis (cf. midrib of simple leaf) or pal-
Deciduous: Falling at the end of growing sea- mate when the leaflets arise from a single
son so that the plant (tree or shrub) is leaf- point at the base. Pinnate compound leaves
less in winter/dormant season. In tropical may be further differentiated:
climate, the tree may be leafless for only a (i) Unipinnate (simple pinnate): The
few days. Salix and Populus are common ex- leaflets are borne directly along the
amples. rachis. In paripinnate leaf (Cassia),
Evergreen (persistent): Leaves persisting the leaflets occur in pairs and as such
throughout the year, falling regularly so that the terminal leaflet is missing and
tree is never leafless, as in mango, pines there are even numbers of leaflets. In
and palms. It must be noted that whereas an imparipinnate (Rosa) leaf, on the
the term persistent is used for the leaves, other hand, there is a terminal leaf-
the term evergreen is commonly associated let, resulting in odd number of leaflets.
with trees with such leaves. (ii) Bipinnate (twice pinnate): The pin-
Marcescent: Leaves not falling but wither- nae (primary leaflets) are again divided
ing on the plant, as in several members of into pinnules, so that the leaflets
Fagaceae. (pinnules) are borne on the primary
branches of the rachis as in Mimosa
Leaf incision/type of leaves pudica.
A leaf with a single blade (divided or not) is (iii) Tripinnate (thrice pinnate): The dis-
termed simple, whereas one with two or section goes to the third order so that
more distinct blades (leaflets) is said to be the leaflets are borne on secondary
compound. branches of the rachis as in Moringa.
64 Plant Systematics
Figure 4.6 Leaf incision. A: Undivided with pinnate venation; B: Pinnatifid; C: Pinnatipartite;
D: Pinnatisect; E: Pinnate compound- imparipinnate leaf of Rosa; F: Pinnate com-
pound-paripinnate leaf of Cassia; G: Bipinnate leaf of Acacia nilotica; H: Pinnate-trifo-
liate leaf of Medicago, note middle leaflet with longer petiolule; I: Tripinnate leaf of
Moringa; J: Triternate leaf of Thalictrum; K: Undivided with palmate venation;
L: Palmatifid; M: Palmatipartite; N: Palmatisect; O: Palmate compound-digitate;
P: Unifoliate leaf of Citrus; Q: Bifoliate; R: Trifoliate leaf of Trifolium, note all leaflets
with equal petiolules as opposed to pinnate trifoliate leaf; S: Trifoliate leaf of Oxalis;
T: Quadrifoliate leaf of Marsilea; U: pedate leaf of Vitis pedata.
(iv) Decompound: Here the dissections go lower two leaflets are reduced and the
beyond the third order, as in Fennel. terminal leaflet looks like a simple
The term is sometimes used for leaves leaf but has a distinct joint at base, as
more than once compound. seen in Citrus plants.
(v) Ternate: The leaflets are present in (ii) Bifoliate (binnate): A leaf with two
groups of three. Leaf may be ternate leaflets, as found in Hardwickia.
(pinnate with three leaflets, i.e. (iii) Trifoliate (ternate): A leaf with three
trifoliate), biternate (twice pinnate leaflets, as in Trifolium. The trifoliate
with three pinnae and three pinnules) leaf of Medicago and Melilotus has ter-
triternate or decompound ternate. minal leaflet with a longer petiolule
Palmate compound leaf does not have a ra- (stalk of leaflet) than basal leaflets and
chis and the leaflets arise from the top of is accordingly a pinnate trifoliate leaf.
the petiole: (iv) Quadrifoliate: A leaf with four leaflets,
(i) Unifoliate: A modified situation in as in Paris and aquatic pteridophyle
commonly a trifoliate leaf when the Marsilea.
Descriptive Terminology 65
(v) Multifoliate (Digitate): A leaf with Hastate: Shaped like an arrow head with two
more than four leaflets, as in Bombax. basal lobes directed outwards, as in
Typhonium; also referring to hastate leaf
Stipules base.
The leaves of several species bear two small Lanceolate: Shaped like a lance, much
stipules as outgrowths from the leaf base. longer than broad and tapering from a broad
Leaves with stipules are termed stipulate base towards the apex, as in bottle-brush
and those without stipules as exstipulate. plant (Callistemon lanceolatus).
They show a lot of structural diversity: Linear: Long and narrow with nearly paral-
Free-lateral: Free and lying on either side lel sides as in grasses and onion.
of the petiole base, as in china-rose (Hibis- Lunate: Shaped like half-moon, as in
cus rosa-sinensis). Passiflora lunata.
Adnate: Attached to the base of petiole for Lyrate: Lyre-shaped; pinnatifid with large
some distant, as in Rose. terminal lobe and smaller lower lobes, as in
Intrapetiolar: The two stipules are coher- Brassica campestris.
ent to form one, which lies in the axil of a Oblanceolate: Like lanceolate but with
leaf as in Gardenia. broadest part near apex.
Interpetiolar: A stipule lying between the Obcordate: Like cordate but with broadest
petioles of two adjacent leaves, commonly part and notch at apex, as in Bauhinia.
due to fusion and enlargement of two adja- Oblong: Uniformly broad along the whole
cent stipules of different leaves as found in length as in banana.
several members of Rubiaceae like Ixora. Obovate: Ovate, but with broadest part near
Ochreate: The two stipules united and form- the apex, as in Terminalia catappa.
ing a tubular structure ochrea, found in fam- Ovate: Egg-shaped, with broadest part near
ily Polygonaceae. the base, as in Sida ovata.
Foliaceous: Modified and enlarged to func- Orbicular (rotund): Circular in outline. The
tion like leaves as in Lathyrus aphaca, where peltate leaf of Nelumbo is orbicular in out-
the whole leaf blade is modified into tendril line.
and stipules are foliaceous.
Pandurate: Fiddle shaped; obovate with si-
Tendrillar: Stipules modified into tendrils nus or indentation on each side near the
as in Smilax. base and with two small basal lobes, as in
Spiny: Stipules modified into spines as in Jatropha panduraefolia.
Acacia. Peltate: Shield shaped with petiole attached
to the lower surface of leaf (and not the mar-
Leaf shape (outline of lamina) gin), as in Nelumbo.
The shape of leaf/leaflet blade shows con- Reniform: Kidney-shaped, as Centella
siderable variability and is of major taxo- asiatica.
nomic value.
Runcinate: Oblanceolate with lacerate or
Acicular: Needle shaped, as in pine. parted margin, as in Taraxacum.
Cordate: Heart shaped, with a deep notch at Sagittate: Shaped like an arrowhead with
base, as in Piper betle. two basal lobes pointed downwards, as in
Cuneate: Wedge-shaped, tapering towards Sagittaria and Arum; also referring to sagit-
the base, as in Pistia. tate leaf base.
Deltoid: Triangular in shape. Spathulate (spatulate): Shaped like a
Elliptical: Shaped like an ellipse, a flattened spatula, broadest and rounded near the apex,
circle usually more than twice as long as gradually narrowed towards the base, as in
broad, as in Catharanthus roseus. Euphorbia neriifolia.
66 Plant Systematics
Figure 4.7 Leaf outline. A: Acicular; B: Subulate; C: Linear, common in grasses; D: Lanceolate;
E: Oblong; F: Spathulate; G: Cordate; H: Ovate; I: Obovate; J: Oblanceolate; K: Peltate;
L: Reniform; M: Hastate; N: Runcinate; O: Lunate; P: Sagittate; Q: Pandurate;
R: Deltoid; S: Lyrate; T: Elliptic.
Subulate: Awl-shaped, tapering from a broad Double serrate (bi-serrate): The serrations
base to a sharp point. are again serrate similarly as in Ulmus.
Entire: Smooth, without any indentation, as
Leaf margin in Mango.
The edge of a leaf blade is known as margin Retroserrate: Teeth pointed downwards.
and may show any of the following conditions: Revolute: Margin rolled down.
Crenate: With low rounded or blunt teeth, Serrate: With sharp teeth pointing upward
as in Kalanchoe. like saw, as seen in rose.
Crisped: Margin strongly winding in verti- Serrulate: Minutely or finely serrate.
cal plane giving ruffled appearance to leaf. Sinuate: Margin winding strongly inward as
Dentate: With sharp teeth pointing out- well as outward.
wards. Undulate (repand, wavy): Margin winding
Denticulate: Minutely or finely dentate. gradually up and down and wavy, as in
Double crenate (bi-crenate): Rounded or Polyalthia.
blunt teeth are again crenate
Double dentate: Sharp outward teeth are Leaf base
again dentate. The term bi-dentate, though In addition to the terms cordate, cuneate,
sometimes used here, is inappropriate, as hastate, sagittate already described above
it more correctly refers to a structure bear- when referring to the leaf base, the follow-
ing two teeth. ing additional terms are frequently used:
Descriptive Terminology 67
Figure 4.8 Leaf margin. A: Entire; B: Crenate; C: Crenulate; D: Dentate; E: Denticulate; F: Ser-
rate; G: Serrulate; H: Bi-serrate; I: Undulate; J: Sinuate; K: Crispate.
Figure 4.9 Leaf apex and leaf base. Leaf apex. A: Acute; B: Acuminate; C: Aristate; D: Caudate;
E: Emarginate; F: Retuse; G: Rounded; H: Mucronate; I: Truncate; J: Obtuse;
K: Cirrhose. Leaf base. L: Attenuate; M: Amplexicaul; N: Connate-perfoliate; O: Per-
foliate; P: Cuneate; Q: Auriculate; R: Cordate; S: Truncate; T: Decurrent.
Retuse: With a slight notch generally from Lanate: Wooly, with long intertwined hairs.
an obtuse apex, as in Crotalaria retusa. Pilose: Covered with long distinct and scat-
Truncate: Appearing as if cut straight across tered hairs.
as in Paris. Puberulent: Minutely pubescent.
Pubescent: Covered with soft short hairs.
Leaf surface Rugose: With wrinkled surface.
The surface of leaves, stems and other or- Scabrous: Surface rough due to short rough
gans may present a variety of surface points.
indumentation, whose characteristics are Scurfy: Covered with scales.
highly diagnostic in several taxa. The sur- Sericeous: Covered with soft silky hairs, all
face may be covered by trichomes (hairs, directed towards one side.
glands, scales, etc.) arranged variously:
Stellate: Covered with branched star-shaped
Arachnoid: Covered with entangled hairs hairs.
giving a cobwebby appearance.
Strigose: Covered with stiff appressed hairs
Canescent: Covered with grey hairs. pointing in one direction.
Ciliate: With marginal fringe of hairs. Tomentose: Covered with densely matted
Floccose: Covered with irregular tufts of soft hairs, wooly in appearance.
loosely tangled hairs. Velutinous: Covered with short velvety
Glabrate: Nearly glabrous or becoming gla- hairs.
brous with age Villous: Covered with long, fine soft hairs,
Glabrous: Not covered with any hairs. Some- shaggy in appearance.
times but not always synonymous with The hairs covering the surface may be
smooth surface. unicellular or multicellular, glandular or
Glaucous: Surface covered with a waxy coat- nonglandular. The hairs may be un-
ing, which easily rubs off. branched or branched variously. They may
Glandular: Covered with glands or small bear one row of cells (uniseriate), two rows
secretory structures. (biseriate) or several rows (multiseriate).
Glandular-punctate (gland-dotted): Surface Some species of plants, especially some aca-
dotted with immersed glands, as in Citrus. cias bear specialized glands domatia at the
Hirsute: Covered with long stiff hairs. leaf base, which house ants which protect
Hispid: Covered with stiff and rough hairs. plants from herbivores.
Descriptive Terminology 69
INFLORESCENCE
Racemose types
The following variations of the racemose type
Inflorescence is a modified shoot system are commonly encountered:
bearing flowers (modified shoots). The term
Raceme: A typical racemose inflorescence
inflorescence appropriately refers to the ar-
with single (unbranched) axis bearing flow-
rangement of flowers on the plant. The flow-
ers on distinct pedicels, as in Delphinium.
ers may either occur singly (in leaf axils
solitary axillary or terminal on the stem Panicle: Branched raceme, the flowers be-
solitary terminal) or may be organized into ing borne on the branches of the main axis,
distinct inflorescences. Two principal types as in Yucca.
of inflorescences are differentiated. In race- Spike: Similar to raceme but with sessile
mose (indeterminate or polytelic), inflores- flowers, as in Adhatoda.
cence the axis is of unlimited growth, api- Spadix: Variation of a spike where the axis
cal bud continuing to grow, thus bearing old- is fleshy and the flowers are covered by a
est flower towards the base and youngest to- large bract known as spathe, as found in
wards the top. In cymose (determinate or Alocasia and Arum.
70 Plant Systematics
Figure 4.11 Inflorescence: racemose types. A: Raceme of Linaria; B: Corymbose raceme of Bras-
sica; C: Corymb of Cassia; D: Panicle of Yucca; E: Umbel of Prunus; F: Compound
umbel of Foeniculum; G: Catkins of Betula; H: Spike of Achyranthes; I: Spadix of
Colocasia; J: Capitulum of Helianthus.
Descriptive Terminology 71
Figure 4.12 Inflorescence: cymose and specialized types. Cymose types. A: Helicoid cyme of
Heliotropium; B: Scorpioid cyme of Ranunculus bulbosus; C: Biparous cyme of Dianthus;
D: Multiparous cyme of Viburnum. Specialized types. E: Verticillaster of Salvia; F:
Cyathium of Euphorbia; G: Hypanthodium of Ficus cunia.
Figure 4.13 Insertion of floral parts. A: Hypogynous with superior ovary; B: Perigynous with cup-
shaped hypanthium and superior ovary; C: Perigynous with flask-shaped hypanthium,
ovary superior; D: Perigynous with partially immersed semi-inferior ovary; E: Epigy-
nous with inferior ovary, without free hypanthium above the ovary; F: Epigynous with
inferior ovary and with free hypanthium above the ovary.
Subsessile: Pedicel much shorter, often all parts of perianth) more or less of the
shorter than flower. same shape and size.
Sessile: Pedicel absent. Zygomorphic: Asymmetrical flower,
Complete: All the four floral whorls present. which may be divided into equal halves
by one or more but not all vertical planes.
Incomplete: One or more floral whorl
In practice such flower has parts of calyx
lacking.
and/or corolla (or perianth) of different
Symmetry: Symmetry of a flower is largely shapes and sizes.
based on relative shapes and sizes of sepals Sexuality
(or calyx lobes) in calyx whorl and/or rela- Bisexual (perfect): Bearing both stamens
tive shapes and sizes of petals (or corolla and carpels.
lobes) in the corolla whorl. Unisexual (imperfect): Bearing either
Actinomorphic: Symmetrical flower stamens or carpels.
which can be divided into equal halves Staminate (male): Bearing stamens only.
when cut along any vertical plane. In prac- Pistillate (female): Bearing carpels only.
tice an actinomorphic flower has all parts Dioecious: With male and female flowers
of the calyx and all parts of the corolla (or on the different plants.
Descriptive Terminology 73
Monoecious: With male and female flow- Spirocyclic: Calyx and corolla cyclic but sta-
ers on the same plant. mens and carpels spirally arranged, as in
Polygamous: With male, female and bi- Ranunculaceae.
sexual flowers on the same plant.
Insertion: Insertion of floral parts on the Calyx
thalamus not only determines the shape of
Description of the calyx starts with the num-
the thalamus, it also reflects on the rela-
ber of sepals in same whorl (5typical on
tive position of floral whorls, as also whether
dicots, 3typical of monocots), in two whorls
the ovary is superior (and, consequently,
(2+2, as in crucifers) or forming two lips (1/
other whorls inferior) or inferior (and, con-
4 in Ocimum, 3/2 in Salvia):
sequently, other whorls superior):
Polysepalous (aposepalous, chorisepa-
Hypogynous: The thalamus is convex so
lous): Sepals free, and consequently more
that the other floral parts are inserted be-
than one units (polymany).
low the ovary. The ovary in this case is
superior and other floral whorls inferior. Gamosepalous: Sepals fused. Once the ca-
There is no hypanthium. lyx is gamosepalous, it commonly gets dif-
ferentiated two parts: calyx tube, the fused
Perigynous: The thalamus is depressed
part and calyx lobes (no longer sepals), the
to the extent that the level of ovary is lower
free part. The shape of the calyx tube should
than the other whorls and the thalamus
be described. It may be campanulate (bell-
forms either a saucer-shaped, cup-shaped
shaped as in Hibiscus), urceolate (urn-
or flask-shaped hypanthium. It must be
shaped as in fruiting calyx of Withania ), tu-
noted that although hypanthium sur-
bular (tube-like as in Datura), or bilabiate
rounds the ovary, it is free from the ovary,
(two-lipped as in Ocimum).
the other floral whorls are borne along the
rim of the hypanthium, yet the ovary is Caducous: Falling just after opening of flow-
morphologically still superior and other flo- ers.
ral whorls inferior. The ovary may some- Deciduous: Falling along with petals in ma-
times be partially immersed and thus ture flower.
semi-inferior. Persistent: Persisting in fruit.
Epigynous: the hypanthium is fused with Accrescent: Persisting and enlarging in
the ovary, so that the other floral whorls fruit.
appear to arise from the top of the ovary. Aestivation: Arrangement of sepals (or pet-
The ovary is obviously inferior and other als) in the flower bud. Term vernation is used
floral whorls superior. There may or may exclusively for arrangement of young leaves
not be a free hypanthium above the ovary; in a bud. The following main types of aesti-
in the former case, other floral parts ap- vation are met:
pear to arise from the top of ovary.
(i) Valvate: Margins of sepals or calyx
Pentamerous: Five members in each floral lobes not overlapping.
whorl (excluding stamens and carpels), typi- (ii) Twisted: Overlapping in regular pat-
cal of dicots. tern, with one margin of each sepal
Tetramerous: Four members in each floral overlapping and other being over-
whorl, as in crucifers. lapped.
Trimerous: Three members in each floral (iii) Imbricate: With irregular overlapping.
whorl, as in monocots. In Quincuncial imbricate, two sepals
Cyclic (tetracyclic): Calyx, corolla, are with both margins outer, two with
androecium and gynoecium in four separate both margins inner, and fifth with one
whorls. outer and one inner margin.
74 Plant Systematics
Figure 4.14 Aestivation of calyx and corolla parts. A: Valvate; B: Twisted; C: Imbricate;
D: Quincuncial imbricate; E: Vexillary.
each of the two anther lobes, carried on a Epipetalous: Filaments attached to the
filament. The two anther lobes are often petals, a characteristic feature of sym-
joined with the help of a connective, which petalous families.
in some primitive families, is a continua- Epiphyllous (epitepalous): Filaments at-
tion of the filament. The description of tached to the perianth.
androecium, likewise, starts with the num- Relative size: Stamens in a flower are gen-
ber of stamens in a single or more whorls. erally of the same size, but the following
Major descriptive terms include: variations may be encountered in some
Fusion: Stamens may generally be free, but flowers:
if fused it can take a variety of forms: Didynamous: Four stamens, two shorter
Polyandrous: Stamens free throughout. and two longer, as in Ocimum.
Monadelphous: Filaments of all stamens Tetradynamous: Six stamens, two shorter
united in a single group, as in family in outer whorl and four longer in inner
Malvaceae. whorl, as in crucifers.
Diadelphous: Filaments of stamens Heterostemonous: Same flower with sta-
united in two groups, as in Lathyrus. mens of different sizes, as in Cassia.
Polyadelphous: Filaments united in more Diplostemonous: Stamens in two whorls,
than two groups, as in Citrus. the outer whorl alternating with petals as
Syngenesious (synantherous): Filaments in Murraya.
free but anthers connate into a tube, as Obdiplostemonous: Stamens in two whorls
in family Asteraceae. but outer whorl opposite the petals, as in the
Synandrous: Stamens fused completely family Caryophyllaceae.
through filaments as well as anthers, as Antipetalous: Stamens opposite the petals,
in Cucurbita. as in the family Primulaceae.
76 Plant Systematics
Bithecous: Stamen with two anther lobes (iv) Versatile: Filament attached nearly at
(each anther lobe at maturity becomes the middle of connective so that an-
unilocular due to coalescence of two adja- ther can swing freely as, in Lilium and
cent microsporangia) so that anther is two- grasses.
celled at maturity. Dehiscence: Anther dehiscence commonly
Monothecous: Stamen with single anther occurs by the formation of sutures along the
lobe so that mature anther is single-celled, point of contact of two anther sacs, but con-
as in family Malvaceae. siderable variation in their location may be
Attachment: Common modes of attachment found:
of filament to the anther include: Longitudinal: The two sutures extend
(i) Adnate: Filament continues into con- longitudinally, one on each anther lobe as
nective which is almost as broad, as in Datura.
found in Ranunculus. Transverse: Suture placed transversely,
(ii) Basifixed: The filament ends at the as in monothecous anthers of family
base of anther (when connective ex- Malvaceae.
tends up to base of anther) or at least
Poricidal (apical pores): Anther opening
base of connective (when anther lobes
by pores at the tip of anther, as in Solanum
extend freely below the connective).
nigrum.
The resultant anther is erect, as in
Brassica. Valvular: Portions of anther wall opening
(iii) Dorsifixed: Filament attached on the through flaps or valves, as in Laurus.
connective above the base. The result- Centripetal: Developing from the outside to
ant anther is somewhat inclined, as the inside so that the oldest stamens are
in Sesbania. towards the periphery.
Descriptive Terminology 77
Centrifugal: Developing from centre to- number of rows of ovules (placental lines)
wards the periphery, so that the oldest flow- would equal the number of united carpels. A
ers are towards the centre. solitary carpel would obviously have a single
Included: Stamens are shorter than the co- chamber with a single ovule or a single row
rolla. of ovules. On the other hand, if ovary is more
Exserted: Stamens protruding far beyond the than one chambered, it obviously has more
petals as in Umbellifers. than one carpels, and the number of cham-
bers would indicate the number of carpels.
Introrse: Slits of the anther facing towards
There are, however, atypical cases. Single
the centre.
chambered ovary may have a central column
Extrorse: Slits of the anther facing towards bearing ovules (since septa disappeared), or
outside. in a single chambered ovary there may be
Androphore: Extension of thalamus bearing single large ovule because all others (from
stamens. one or more placental lines) have disap-
Gynostegium: Structure formed by the fu- peared. In both these cases, the number of
sion of stamens with the stigmatic disc, as carpels can be known by counting the num-
in family Asclepiadaceae. ber of free styles, or if style is one the num-
Gynostemium: Structure formed by fusion ber of stigmas or stigmatic lobes. In extreme
of stamens with gynoecium, as in family cases, even this may not help, as in Anagallis
Orchidaceae. arvensis, when the number of suture lines
on the fruit would help. The number of car-
pels are represented as monocarpellary (car-
Gynoecium pel one), bicarpellary (carpels two),
Gynoecium represents a collection of car- tricarpellary (carpels three), tetracarpellary
pels in a flower. The distinction between (carpels four), pentacarpellary (carpels five),
carpel and pistil is often ambiguous. In and multicarpellary (carpels more than
reality the carpels are components of a five). The number of chambers similarly are
gynoecium whereas the pistils represent represented as unilocular, bilocular,
visible units. Thus, if carpels are free, there trilocular, tetralocular, pentalocular and
would be as many pistils (simple pistils). On multilocular. Gynoecium with free carpels
the other hand, if the carpels are united (and is apocarpous, whereas one with fused car-
obviously more than one), the flower would
have only one pistil (compound pistil). Each
carpel is differentiated into a broad basal
ovary containing ovules, an elongated style,
and pollen-receptive apical part stigma. Any
attempt to describe gynoecium requires a
transverse section through the ovary. An
additional longitudinal section is always
helpful.
Figure 4.18 Placentation. A: Marginal; B: Parietal with 3 carpels; C: Parietal with false septum in
crucifers (parietal-axile); D: Parietal with false septa in cucurbits; E: Basal; F: Api-
cal; G: Axile; H: Axile with false septa in Datura; I: Free central with usual central
column attached at the base and top of the ovary; J: Free central in Primulaceae in
Longitudinal section showing placental column projecting from the base; K: Superfi-
cial in Nymphaea.
Ovule
Ovule represents megasporangium, at-
tached to the placenta by funiculus, which
joins the ovule at the hilum. Base of the
ovule is known as chalaza, and the tip as
micropyle. Ovule has a female gametophyte
(embryo sac) surrounded by nucellus, in
turn, enveloped by two integuments. The fol-
lowing terms are commonly associated with
ovules:
Orthotropous (atropous): Straight erect
ovule with funiculus, chalaza and micro-
Figure 4.19 Style and stigma. A: Lateral style; pyle in one line, as in family Polygonaceae.
B: Gynobasic style; C: Bifid feath- Anatropous: Inverted ovule with micro-
ery stigma in Poaceae; D: Sessile pyle facing and closer to funiculus, as in
and radiate stigma of Papaver; E: Ricinus.
Tripartite funnel-shaped stigma of
Amphitropous: Ovule placed at right
Crocus; F: Capitate stigma of
Alchemilla; G: Discoid stigmas of
angles to the funiculus, as in Ranunculus.
Hibiscus; H: Bifid stigma in Campylotropous: Curved ovule so that
Asteraceae. micropyle is closer to chalaza, as in
Brassicaceae.
Terminal style: Arising from the tip of ovary, Circinotropous: Funiculus very long and
the most common type. surrounding the ovule, as in Opuntia.
Gynobasic style: Arising from central base Hemianatropous (hemitropous): Body
of the ovary, as in family Lamiaceae. half-inverted so that funiculus is attached
Capitate: Stigma appearing like a head. near middle with micropyle terminal and
Lateral style: Style arising from the side of at right angles.
the ovary, as in Mangifera and Alchemilla. Bitegmic: Ovule with two integuments,
common in polypetalous dicots.
Stylar beak: Persistent style, extended into
a long beak Unitegmic: Ovule with single integu-
ment, common in sympetalous dicots.
Pistillode: Sterile pistil, devoid of any fer-
Crassinucellate: Ovule with massive
tile ovules, as in ray floret of radiate head of
nucellus, found in primitive polypetalous
Helianthus.
dicots.
Radiate stigma: Sessile disc like with radi-
Tenuinucellate: Ovule with thin layer of
ating branches, as in Papaver.
nucellus, as in sympetalous dicots.
Stylopodium: Swollen basal part of style sur-
rounded by nectary persisting in fruit of um- FRUITS
bellifers.
A fruit is a matured and ripened ovary,
Sessile stigma: Seated directly on ovary, wherein the ovary wall gets converted into
style being reduced as in Sambucus. the fruit wall pericarp (differentiated into
Discoid stigma: Disc-shaped stigma. outer epicarp, middle mesocarp and inner
Globose stigma: Stigma spherical in shape. endocarp), and the ovules into seeds. Three
80 Plant Systematics
Figure 4.21 Fruits. A: Achene of Ranunculus; B: Cypsela of Ageratum with scaly pappus;
C: Nut of Castanea; D: Pod of Pisum; E: Single follicle of Calotropis; F: Siliqua of Bras-
sica; G: Silicula of Capsella bursa-pastoris; H: Capsule of Datura; I: Cremocarp in
umbellifers; J: A pair of lomentum fruits in Mimosa; K: Double samara of Acer;
L: Capsule of Primula dehiscing by apical teeth (denticidal); M: Operculate capsule of
Papaver with poricidal dehiscence; N: Pyxis of Celosia with circumscissile dehiscence;
O: Capsule of Abelmoschus esculentus with loculicidal dehiscence; P: Pome of Malus
pumila; Q: Hip of Rosa with etaerio of achenes inside; R: Drupe of Prunus; S: Berry of
Lycopersicon esculentum; T: Pseudocarp of Fragaria, an accessary fruit with etaerio of
achenes; U: Etaerio of drupes in Rubus; V: Syconium of Ficus developing from
hypothodium inflorescence; W: Sorosis of Morus.
82 Plant Systematics
instead of dehiscing, rather splits into num- Utricle: Similar to nut but with papery
ber of segments, each containing one or more often inflated pericarp as in Chenopo-
seeds. Common examples of schizocarpic dium.
fruits are: Fleshy indehiscent fruits: Such fruits
Cremocarp: Fruit developing from have fleshy and juicy pericarp even at
bicarpellary syncarpous inferior ovary and maturity. Common examples are:
splitting into two one seeded segments Drupe: Fruit with usually skinny epi-
known as mericarps, as in umbellifers. carp, fibrous or juicy mesocarp and hard
Carcerulus: Fruit developing from stony endocarp, enclosing single seed, as
bicarpellary syncarpous superior ovary seen in mango, plums and coconut.
and splitting into four one seeded seg- Berry: Fruit with uniformly fleshy peri-
ments known as nutlets, as in family carp with numerous seeds inside, as
Lamiaceae. seen in Solanum, tomato and brinjal.
Double samara: Fruit developing from syn-
Pepo: Fruit formed from inferior ovary of
carpous ovary, two or four chambered,
cucurbits with epicarp forming tough
pericarp of each chamber forming a wing,
rind.
fruit splitting into one-seeded winged seg-
ments as in maple (Acer). It must be noted Hesperidium: Fruit developing from su-
that single samara of Fraxinus, is a single- perior ovary with axile placentation, epi-
seeded dry winged indehiscent fruit and carp and mesocarp forming common rind
not a schizocarpic fruit. and endocarp produced inside into juice
Regma: Fruit developing from vesicles, as seen in citrus fruits.
multicarpellary syncarpous ovary and Pome: Fruit developing from inferior
splitting into one-seeded cocci, as in Rici- ovary, an example of accessory (false)
nus and Geranium. fruit, wherein fleshy part is formed by
thalamus and cartilaginous pericarp is
inside, as seen in apple.
Indehiscent fruits
Balausta: Fruit developing from inferior
Such fruits do not split open at maturity.
ovary, pericarp tough and leathery, seeds
They may be dry or fleshy:
attached irregularly, succulent testa be-
Dry indehiscent fruits: Such fruits have ing edible, as seen in pomegranate
dry pericarp at maturity, and are repre-
(Punica granatum).
sented by:
Achene: Single seeded dry fruit develop-
ing from a single carpel with superior Aggregate fruits
ovary. Fruit wall is free from seed coat. Aggregate fruits develop from multi-carpel-
Achenes are often aggregated, as in fam- lary apocarpous ovary. Each ovary forms a
ily Ranunculaceae. fruitlet, and the collection of fruitlets is
Cypsela: Single seeded dry fruit, simi- known as etaerio. Common examples are
lar to (and often named achene) but de- etaerio of achenes in Ranunculaceae,
veloping from bicarpellary syncarpous in- etaerio of follicles in Calotropis, etaerio of
ferior ovary, as in family Asteraceae. drupes in raspberry (Rubus) and etaerio of
Caryopsis: Fruit similar to above two but berries in Polyalthia. In Rose the etaerio of
fruit wall fused with seed coat as seen achenes is surrounded by a cup like hy-
in grasses. panthium forming a specialized accessory
Nut: One-seeded, generally large fruit de- fruit known as hip. The fruit of strawberry
veloping from multicarpellary ovary and (Fragaria), though also an etaerio of
with hard woody or bony pericarp, as seen achenes, is an accessory fruit, the edible
in Quercus and Litchi. part being the fleshy thalamus.
Descriptive Terminology 83
Figure 4.23 Floral formulae of some representative species of few families of angiosperms de-
picting diversity of features depicted. The important features on which each formula
is based are shown in the right column.
trorse or introrse, and more importantly, a anterior side. The remaining components
section through the ovary, depicting the type of the flowerdepending upon whether they
of placentation, the number of ovules vis- are closer to the mother axis or the bract
ible in a section, and the presence or ab- occupy postero-lateral and antero-lateral po-
sence of a nectary. It also if some stamens sitions, respectively. The members of differ-
are nonfunctional (represented by ent floral whorls are shown arranged in con-
staminodes) and whether the ovary is func- centric rings, calyx being the outermost and
tional or represented by a pistillode. the gynoecium the innermost. A large ma-
The branch (or the inflorescence axis) bear- jority of dicot flowers are pentamerous, and
ing the flower is known as mother axis, and as such the five members of each whorl (ex-
the side of flower facing it as posterior side. cluding gynoecium in the centre) are ar-
The bract, if present is opposite the mother ranged such a way that four of them occur
axis, and the side of flower facing it is the in pairs (members of each pair occupying
Descriptive Terminology 85
Figure 4.24 Stems. A: Arboreus stem (trunk) of Cyclobalanopsis glauca; B: Tendril climbing stem
of Luffa cylindrica; C: Scandent stem of Allamanda violacea; D: Creeping stem of Zebrina
pendula; E: Offset of Eichhornia crassipes; F: Runner of Oxalis corniculata; G: Twining
stem of Jacquemontia pentantha; H: Succulent stem of Echinopsis terescheckii; I: Rhi-
zome of Zingiber officinale; J: Phylloclade of Ruscus aculeatus; K: Bulb of Allium cepa;
L: Tuber of Solanum tuberosum; M: Corm of Alocasia; N: Phylloclade of Opuntia elatior.
86 Plant Systematics
Figure 4.27 Fruits. A: Dehisced capsule of Gossypium hirsutum with exposed hairy seeds;
B: Capsule of Papaver orientale; C: Dehisced capsule of Chiranthodendron pentadactylon;
D: Etaerio of achenes of Anemone occidentalis; E: Double samara of Acer griseum;
F: Pod of Dalbergia sissoo; G: Cypsela of Haplopappus macrocephalus; H: Cypsela of
Sonchus oleraceous; I: Schizocarp of Abutilon indicum; J: Carcerulus of Salvia splensens;
K: Drupe of Juglans nigra; L: Drupe of Prunus persica; M: Pome of Malus pumila;
N: Same in Longitudinal section; O: Pod of Clitoria ternatea; P: Hesperidium of Citrus
sinensis; Q: Same in Transverse section; R: Berry of Lycopersicon esculentum; S: Same
in Transverse section; T: Berry of Ribes menziesii; U: Etaerio of drupes of Rubus nepalensis;
V: Pepo of Cucumis sativus in Transverse section; W: Whole pepo;
X: Accessory fruit of Fragaria vesca; Y: Siliqua of Brassica campestris; Z: Dehisced
capsule of Stellaria media; a: Pod of Leucaena leucocephala; b: Multiple fruit of Liquidam-
bar styracifolia; c: Multiple fruit of Arbutus unedo; d: Balausta of Punica granatum.
Descriptive Terminology 89
Figure 4.28 Floral diagrams of some representative members of major families. A: Brassica
campestris (Brassicaceae); B: Stellaria media (Caryophyllaceae); C: Hibiscus rosa-sinensis
(Malvaceae); D: Lathyrus odoratus (Fabaceae-Faboideae); E: Acacia nilotica (Fabaceae-
Mimosoideae); F: Foeniculum vulgare (Apiaceae); G: Ray floret of Helianthus annuus
(Asteraceae); H: Disc floret of H. annuus; I: Calotropis procera (Apocynaceae-
Asclepiadoideae); J: Withania somnifera (Solanaceae); K: Ocimum basilicum (Lamiaceae);
L: Male flower of Morus alba (Moraceae); M: Female flower of M. alba; N: Narcissus
pseudo-narcissus (Amaryllidaceae); O: Avena sativa (Poaceae), floral diagram of spike-
let; P: Zea mays (Poaceae), floral diagram of female spikelet; Q: Z. mays, floral dia-
gram of male spikelet.
complementary position) the fifth one is the diagram by anthers, each with two anther
odd member. It is also to be remembered lobes (shown by a deep fissure) and latter, in
that in large majority of dicots (except turn, with two anther sacs (with a less
Fabaceae and few others), the odd sepal oc- deeper cleft). The lobes face towards the out-
cupies posterior position (of the remaining side in extrorse anthers and towards the
four, two form antero-lateral pair, and the ovary in introrse anthers. Epipetalous sta-
remaining two the postero-lateral pair). The mens are shown by a line joining the an-
different whorls usually alternate each thers with the petals. A few representative
other, and accordingly the odd petal occupies types of floral diagram are shown in Figure
anterior position, the petals alternate with 4.28.
sepals. The stamens accordingly alternate The floral diagram summarizes the infor-
with petals and are opposite the sepals. In mation about the presence or absence of
flowers with two whorls of stamens, the outer bracts and bracteoles, number, fusion and
whorl alternates with petals, whereas the aestivation of sepals and petals (or tepals if
inner is opposite the petals (because it al- there are no separate sepals and petals, as
ternates with the outer whorl of stamens). shown in Moraceae). The calyx and corolla
The stamens are represented in the floral forming bilabiate arrangement are appropri-
90 Plant Systematics
ately shown with the number of lobes in up- for the entire cyathium may be drawn,
per and lower lip (as seen in Lamiaceae). supplemented by floral diagrams of male and
The stamens with united filaments are de- female flowers. In family Poaceae also, it is
picted by joining anthers via lines (diadelp- helpful to make a floral diagram for the
hous condition in Fabaceae-Faboideae), whole spikelet (shown in Avena sativa), or
whereas the united anthers are shown by separate diagrams for male and female
physically touching anther margins. In fami- spikelets if the male and female flowers oc-
lies with complex floral arrangement such cur in separate inflorescences or at least
as the cyathium in Euphorbia, floral diagram separate spikelets (shown in Zea mays).
Chapter 5
Process of Identification
Recognizing an unknown plant is an impor- properly prepared, can retain their essen-
tant constituent taxonomic activity. A plant tial features for a very long period, proving
specimen is identified by comparison with to be immensely useful for future scientific
already known herbarium specimens in a studies, including compilation of floras, taxo-
herbarium, and by utilizing the available lit- nomic monographs and, in some cases, even
erature and comparing the description of the experimental studies, since the seeds of
unknown plant with the published descrip- several species can remain viable for many
tion/s. Since the bulk of our plant wealth years even in dry herbarium specimens.
grows in areas far removed from the cen-
tres of botanical research and training, it Fieldwork
becomes imperative to collect a large num-
The fieldwork of specimen preparation in-
ber of specimens on each outing. For proper
volves plant collection, pressing and partial
description and documentation, these speci-
drying of the specimens. The plants are col-
mens have to be suitably prepared for incor-
lected for various purposes: building new
poration and permanent storage in a her-
herbaria or enriching older ones, compila-
barium. This goes a long way in compiling
tion of floras, material for museums and
floristic accounts of the different regions of
class work, ethnobotanical studies, and in-
the world. The availability of the specimens
troduction of plants in gardens. In addition,
in the herbaria often provides reasonable in-
bulk collections are done for trade and drug
formation about the abundance or rarity of
manufacture. Depending on the purpose, re-
a species, and helps in preparing lists of rare
sources, proximity of the area and duration
or endangered species, and also provides suf-
of studies, fieldwork may be undertaken in
ficient inputs for efforts towards their con-
different ways:
servation.
Collection trip: Such a trip is of short dura-
SPECIMEN PREPARATION tion, usually one or two days, to a nearby
A specimen meant for incorporation in a her- place, for brief training in fieldwork, vegeta-
barium needs to be carefully collected, tion study and plant collection by groups of
pressed, dried, mounted and finally properly students.
labelled, so that it can meet the demands of Exploration: This includes repeated visits
rigorous taxonomic activity. Specimens, to an area in different seasons, for a period
92 Plant Systematics
Equipment
The equipment for fieldwork may involve a
long list, but the items essential for collec-
tion include plant press, field notebook, bags,
vasculum, pencil, cutter, pruning shears,
knife and a digging tool (Figure 5.1).
Figure 5.2 Plant press containing pressed
specimens. Vasculum placed
Plant Press alongside (Photograph courtesy
A plant press consists of two wooden, plywood Mr. S. L. Kochhar).
or wire mesh planks, each 12 inches X 18
inches (30 cm X 45 cm), between which are camp or the organization, is called the dry-
ing press. It is much heavier and has an
increased number of corrugated sheets, one
alternating each folded blotter containing
one folded newspaper. In countries such as
India which use thick coarse paper for news-
print, blotters can be dispensed with, in at
Figure 5.1 Common implements helpful in col-
least subsequent changes, as the paper
lection. A: Trowel; B: Prunning soaks sufficient moisture and serves the
shears; C: Knife; D: Pickaxe. purpose of blotters as well.
Vasculum Collection
A vasculum is a metallic box with a tightly- The specimen collected should be as com-
fitted lid and a shoulder sling. It is used to plete as possible. Herbs, very small shrubs,
store specimens temporarily before press- as far as possible, should be collected com-
ing, and also to store bulky parts and fruits. plete, in flowering condition, along with
It is generally painted white to deflect heat leaves and roots. Trees and shrubs should
be collected with both vegetative and flower-
ing shoots, to enable the representation of
Department of Botany both leaves and flowers. All information con-
cerning the plant should be recorded in the
University of Kashmir
field notebook and a tag from the sheet at-
Srinagar- 190006 tached to the concerned specimen. It is ad-
visable to collect a few specimens of each
species from the site, to ensure that reserve
specimens are available if one or more get
Date: 14- 3- 1970 No. 1068 destroyed, and also to ensure that duplicates
can be deposited in different herbaria, when
finally mounted on sheets.
Name: Iris ensata
Local Name: KRISHM
Family: Iridaceae Pressing
Locality: Harwan, Kashmir The specimens should be placed in the field
Altitude: 1900 m press at the first opportunity, either directly
Habitat: Open grassland meadow after collection, or sometimes after a tem-
Collector: Gurcharan Singh porary storage in a vasculum or a polythene
Determinavit: Self
bag. A specimen shorter than 15 inches (38
Notes: Perennial herb, forming
isolated patches, flowers
light blue.
a b c d
No. 1068 No. 1068 No. 1068 Figure 5.4 a-c: Different methods of folding
longer herbaceous plants; d, use
of flexostat slips for holding plants
in folded condition. Note that the
tip of the plant (arrow) would al-
Figure 5.3: A sheet from field notebook with ways be erect for convenient study
relevant entries. of this important portion with
leaves and flowers.
and affords easy detection when left in the
field. Being bulky, the vasculum is com- cm) should be kept directly in the folded
monly substituted by a polythene bag, newspaper after loosely spreading the leaves
which is almost weightless. A number of and branches. Herbs, which are generally
polythene bags can be carried for easy stor- collected along with the roots, if longer than
age, as these can be readily made airtight 15 inches, can be folded in the form of a V,
using a rubber band and, as such, the plants N or W (Figure 5.4, a-c), always ensuring that
retain their freshness for many hours. the terminal part of the plant with leaves,
94 Plant Systematics
flowers and fruits, is erect, and when finally Such specimens are collected in bags and
mounted, the specimens can be easily stud- made to float in a tray filled with water, at
ied, without having to invert the herbarium the bottom of which a white sheet of paper
sheet. Specimens of grasses and some other is placed. The paper is lifted gently, carry-
groups, which show considerable elasticity, ing the specimen along and placed in a blot-
are difficult to hold in a folded condition. ter and pressed. As the slender water plant
These specimens can be managed by using sticks to the paper, the sheet along with the
flexostat (a strip of stiff paper or card with specimen is shifted from one blotter to an-
2.5 cm long slit). One flexostat inserted at other during the process of drying, and fi-
each corner (Figure 5.4 d) holds the speci- nally pasted on the herbarium sheet as such.
men in place. Succulents and cacti have a large amount
To press bulky fruits, these may be thinly of proliferated parenchyma storing water
sliced. Large leaves can be trimmed to re- and, unless special care is taken, these
tain any lateral half. It is useful to invert some plants readily rot and fungal infection sets
leaves so that the under surface of the leaves in. Such plants are handled by giving slits
can also be studied from a pressed leaf. on thick organs and scooping out the succu-
lent tissue or, alternately, salt is sprinkled
Handling special groups on the slits to drive out the moisture. The
plants may also be killed by pretreatment
A few groups of plants such as conifers, wa- with ethyl alcohol or formaldehyde.
ter plants, succulents and mucilaginous Mucilaginous plants such as members
plants pose problems during collection and of the family Malvaceae stick to the blotters
need special methods. and are difficult to process. These plants
Conifers, although easy to collect and should be placed between waxed or tissue
press, pose problems during drying. The tis- paper or else folds of muslin cloth. Only the
sues of conifers remain living for a long time blotter should be changed every time the
and progressive desiccation during pressing press is opened and the specimen separated
and drying initiates an abscission layer at from the tissue paper or muslin only when
the base of leaves and sporophylls. As such a fully dry.
dry twig readily disintegrates, losing its leaves Aroids and bulbous plants continue to grow
with a slight touch, a problem occasionally even in a press even after they have pre-
encountered in Abies, Picea, Cedrus, and sev- sumably been properly pressed and dried.
eral other genera. Before pressing, such twigs These should be killed with ethyl alcohol and
should be immersed in boiling water for one formaldehyde prior to pressing.
minute, a pretreatment that kills the tissues
and prevents the abscission formation dur- Drying
ing drying. Page (1979) has suggested pre-
treatment method involving immersion in Drying of pressed plant specimens is a slow
70% ethyl alcohol for 10 minutes, followed by process if no artificial heat is used.
immersion in 50% aqueous glycerine solu-
tion for four days. Since the pretreatment re- Natural Drying
moves the bloom and waxes, and results in a Natural drying of specimens is a slow pro-
slight colour change, an untreated portion of cess, which may take up to one month for
the plant should also be preserved, kept in a complete drying. The plants, freshly col-
small pouch and attached to the herbarium lected, are placed in a press without corru-
sheet along with the pretreated specimen, gated sheets and the press is locked for 24
for reference. hours. During this sweating period, plants
Water plants, especially with submerged lose some moisture, become flaccid and can
leaves, readily collapse due to the absence be easily rearranged. The folded sheet con-
of cuticle and are difficult to press normally. taining the specimen is lifted and placed in
Process of Identification 95
a fresh dry folded blotter. In countries using drying. This solar drier, with practically no
thick coarse newsprint, changing the news- operational cost, should provide a right step
paper is also necessary, and the plant should towards energy conservation.
be carefully transferred from one newspa- The rapid drying of specimens using arti-
per to another. The use of a blotter in such ficial heat has, however, inherent limita-
a case can be dispensed with, especially af- tions of rendering plants brittle, loss of bloom
ter one or two changes. The change of blot- and some colour change in leaves.
ters or newspaper sheets is repeated every In arid regions, plants can be dried par-
few days, increasing the interval between tially during travel, by placing the press hori-
the changes successively until the speci- zontally on the luggage rack of the vehicle,
mens are fully dry. The whole process of dry- with the corrugate ducts facing front, forc-
ing may take about 10 days to one month, ing the dry wind through the corrugates as
depending on the specimens and the climate the vehicle moves forward.
of the area. Specimens pressed and dried are next
mounted on herbarium sheets, and properly
Drying With Artificial Heat labelled before these can be incorporated in
Drying with the help of artificial heat takes a herbarium.
12 hours to two days. The specimens, after
the initial sweating period in the field press, HERBARIUM METHODS
are transferred to a drying press, with an A herbarium is a collection of pressed and
ample number of corrugated sheets, usually dried plant specimens, mounted on sheets
one alternating every folded blotter contain- bearing a label, arranged according to a
ing one specimen. The press is kept in a sequence and available for reference or
drier, a cabinet in which a kerosene lamp study. In practice, it is a name given to a
or electric bulb warms the air, drying the place owned by an institution, which main-
specimens by movement through the cor- tains this orderly collection of plant speci-
rugates. Use of a hot air blower in the cabi- mens. Most of the well-known herbaria
net speeds up circulation of the hot air and, of the world made their beginning from
consequently, faster drying is achieved. botanical gardens.
Sinnott (1983) developed a solar powered
drier capable of drying 100 specimens on a
sunny day, and attaining a temperature of Botanical gardens
up to 600 Celsius in the centre of the press. Although gardens existed in ancient China,
The unit consists of a flat plate collector and India, Egypt and Mesopotamia, these gar-
a drying box to hold the press. The collector dens were not botanical gardens in the true
is composed of a wooden frame, a blackened sense. They existed for growing food plants,
aluminium absorber plate, insulation and a herbs, and ornamentals for aesthetic, reli-
glass or Plexiglas glazing to retain and chan- gious and status reasons. The famous hang-
nel heat into the drying box. One-inch space ing gardens of Babylon in Mesopotamia is a
is provided between the glazing and the ab- typical example. The first garden for the pur-
sorber plate. The air enters the collector at pose of science and education was main-
the open bottom of the collector panel, is tained by Theophrastus in his Lyceum at
heated by conduction from the absorber, Athens, probably bequeathed to him by his
rises by convection into the drying box, teacher, Aristotle. Credit for establishment
moves through the corrugates and finally of the first modern botanical garden belongs
exits from the uncovered top of the drying to Luca Ghini (ca 1490-1556), a professor of
box, taking with it moisture from the plant botany who developed it at Pisa, Italy in 1544.
specimens. Drying is accomplished in a These were followed by botanical gardens at
single day, occasionally two days for complete Padua and Florence in 1545.
96 Plant Systematics
corporation chartered by the State. David tanical garden and botanical research and
Hosak founded the garden in 1801 as Algin resource centre in the world. The garden was
Botanic Garden. developed in the 1600s by Kew House owned
Professor N. L. Britton, the most produc- by Richard Bennet. The widow of the Prince
tive taxonomist of his time, directed the idea of Wales commissioned the garden in 1759
and William Aiton took over as its superin-
tendent. Sir Joseph Banks introduced large
collections from different parts of the world.
In 1841, the management of the garden was
transferred from the crown to the parliament
and Sir William Hooker became its first offi-
cial director. He was mainly responsible for
the advancement of the garden, enlarging
it from a mere 6 ha. to more than 100 ha.
and building a palm house. Sir J. D. Hooker,
who succeeded his father as its Director,
added rhododendrons, and also authored sev-
eral important publications. John
Figure 5.5 Haupt conservatory complex of New Hutchinson worked and developed his fa-
York Botanical Garden. mous system of classification here.
of advancement of botanical knowledge The garden (Figure 5.6) has since grown
through research at this botanical garden. into a premier Research and Educational
The garden (Figure 5.5) today covers 100 ha.
in the heart of New York City along the Bronx
River. In addition 778 ha. Mary Flager Cary
Arboretum at Millbrook has been added to
the jurisdiction of the garden. There are
15,000 species distributed in the demonstra-
tion gardens, Montgomery conifer collection,
Stout day lily garden, Havemeyer lilac
collection, Rhododendron and Azalea collec-
tion, Everett rock garden, herb garden, rose
garden, arboretum and conservatory com-
plex. The garden has a systematic arrange-
ment of trees and shrubs that make it a
place of interest for the general public as well
as botanists and horticulturists. The garden
plays a major role in conservation of rare
and endangered species. The garden has a
well-maintained herbarium of over 5 million
specimens from all over the world, but mainly Figure 5.6 Princess of Wales House at Royal
from the New World. The library houses over Botanic Gardens Kew.
200,000 volumes and over 500,000 items
(including pamphlets, photographs, letters, Institute with excellent herbarium and
etc.). It also maintains a huge botanical library. Originally the garden covered an area
database. of 120 ha. The outstation of the Royal Botanic
Gardens, Kew at Wakehurst Place near
Royal Botanic Gardens, Kew: More Ardingly in West Sussex is a rural estate of
popularly known as Kew Gardens, this his- 202 ha. with an Elizabethan mansion, and
torical garden is undoubtedly the finest bo- was acquired in 1965. The Royal Botanic
98 Plant Systematics
Gardens Kew has directed and financed its mature temperate trees. Tropical plants are
development so that Wakehurst Place now maintained indoors, including Aroid House,
makes a vital contribution in maintaining Palm House, Filmy Fern House etc. Several
the international reputation of the Living interesting plants such as Victoria amazonica
Collections Department (LCD). In particular from South America and Welwitschia
the practical in-situ conservation policies mirabilis from Angola are also growing here.
pursued, and the rich and diverse plant col- Kew Herbarium, undoubtedly the most fa-
lections, which are maintained, add greatly mous herbarium of the world, maintains over
to the LCDs activities. The environmental 6 million specimens of vascular plants and
conditions of the High Weald of Sussex con- fungi from every country in the world. There
trast with those of Kew by offering varied to- are over 275,000 type specimens as well.
pography, higher rainfall and more diverse The library at Kew is very extensive with
and moisture retentive soils. These com- over 750,000 books and journals a resource
bine together to provide a range of microcli- for all Kews research work. Kew Bulletin and
mates, which make possible the successful Index Kewensis are its two continuing pre-
cultivation of a great diversity of plants, mier publications.
many of which do not thrive at Kew. Kew maintains databases on plant names,
There are substantive differences in the taxonomic literature, economic botany,
layout and content of the collections at plants for arid lands and on plant groups of
Wakehurst Place which act to complement special economic and conservation value.
those at Kew. In particular the botanical Kew also makes about 10, 000 identifications
collections are laid out in a floristic manner a year through its Herbarium service and
reflecting the way that temperate plant provides specialist advice on taxonomy and
communities have evolved. The botanical nomenclature in difficult cases. Kew is in-
collections are supported by extensive volved in major biodiversity research
ornamental displays exploiting the wide programmes in many parts of the world, in-
range of available biotopes and acting as pri- cluding tropical and West Asia, SE Asia, Af-
mary visitor attractants. A final element of rica, Madagascar, South America, and the
the woodland cover is forestry plots compris- Pacific and Indian Oceanic islands. The Her-
ing high forest and Christmas tree planta- barium runs an international Diploma
tions. Jodrell Laboratory at Kew has estab- Course in Herbarium Techniques. The Gen-
lished itself as the world centre in the study eral Catalogue now contains over 122,000
of plant anatomy, cytogenetics and plant records and is available throughout RBG Kew
biochemistry. on the network.
The Royal Botanic Gardens Living collec-
tions at Kew and Wakehurst Place are a mul- Missouri Botanical Garden, USA:
tilevel encyclopaedic reference collection re- Considered one of the top three botanical
flecting global plant diversity and providing gardens in the world, the Missouri Botani-
a reference source which serves all the as- cal Garden is a National Historical Landmark
pects of botanical and horticultural science and a centre for botanical research, educa-
within Kew, Great Britain and throughout tion and horticultural display. The garden
the world. It is probably the largest and most was founded by an Englishman Henry Shaw
diverse living collection in the world. The and opened to public in 1859 with active help
two sites provide quite different environ- from Asa Gray and Sir William Hooker and
ments, allowing the development of two dif- Enelmann. Today, the garden covers 79
fering but complementary collections. The acres and operates the worlds most active
living collections at Kew are most diverse tropical botany research programme.
with 351 families, 5465 genera and over Under the leadership of Dr Peter Raven,
28,000 species growing successfully. The ar- its Director, the Garden plays a leading role
boretum covers the greatest area with large in strategies of conservation and sustain-
Process of Identification 99
able living. The garden is known for its The Missouri Botanic Garden is one of the
Climatron conservatory, a geodesic green- worlds leading research centres for botani-
house dome with climatic control, support- cal exploration and research, with nearly 25
ing a vibrant tropical rainforest, under a 0.5 major flora projects. The information is
acre roof (Figure 5.7). It also has a Japanese shared via website TROPICOS, the worlds
Garden (Seiwa-en) covering 14 acres, the largest database, containing more than
largest Japanese strolling Garden in North 920,000 scientific plant names and over
1,800,000 specimen records. The gardens
highly regarded education programme seeks
to improve science instruction in the St.
Louis region, reaching more than 137,000
students each year.
With more than 5.3 million specimens
(mosses, ferns, gymnosperms, and an-
giosperms), the herbarium ranks second in
the USA and 6th in the world. It has collec-
tions dating back to mid 1700s. The her-
barium specializes in having collections of
G. Boehmer, Joseph Banks, D. Solander (who
accompanied Captain Jamers Cook in his
first voyage around the world), and Charles
Darwin. During the last five years, the her-
barium has added an average of 120,000
mounted specimens per year to its collec-
tion. In addition to the many gift specimens
sent to the specialists, this herbarium loans
an average of 34,000 specimens annually,
and borrows about 27,000 specimens. The
herbarium staff also provides identifications
from their area of expertise. The pace of de-
velopment of the herbarium can be judged
from the fact from being number 13th in the
world in 1990 (Woodland, 1991), the her-
barium today has risen to number six. The
reference library of the garden has over
220,000 volumes, including many rare
Figure 5.7 Climatron at the Missouri Botani- books.
cal Garden, a Geodesic dome with Among its major research activities in-
Climatic control and supporting clude Flora of North America project, five vol-
tropical rainforest. (Photograph by
umes having already been published, cov-
Jack Jennings/Courtesy the Mis-
souri Botanical Garden). ering the plants of USA, Canada and
Greenland. The garden also coordinates Flora
of China project, 25 volumes being planned,
America, with a proud collection of to be completed in 15 years starting from
Hamerocallis, Iris, roses, Hosta, and several 1994.
economic plants (Figure 5.8). There are also
Chinese, English German and Victorian Gar- Pisa Botanical Garden, Italy: The
dens. Over 4,000 trees thrive on the Pisa Garden, developed by Luca Ghini in
grounds, including some rare and unusual 1544, is credited as the first modern botani-
varieties. cal garden. The garden was known for the
100 Plant Systematics
centre of Cambridge. It was moved to the Although the herbarium technique was a
present location in 1831 when Prof. J.S. well-known botanical practice at the time of
Henslow established it on newly-acquired Linnaeus, he departed from the convention
land of the University covering 40 acres. The of mounting and binding the specimens into
garden is artistically landscaped with sys- volumes. He mounted specimens on single
tematic plantings, winter-hardy trails, an al- sheets, storing them horizontally, a practice
pine garden and a chronological bed. The followed even today.
latter is in the form of a narrow bed (300 x 7 From isolated personal collections, her-
feet) divided into 24 sections, each contain- baria have grown into large institutions of
ing plants introduced during a 20-year pe- national and international stature with mil-
riod. Tropical houses are one of the major lions of specimens from different parts of the
attractions of the garden and contain palms world. Index Herbariorum, edited by Patricia
and other tropical plants. Holmgren (Figure 5.10) (Holmgren,
Holmgren, & Barnett, 1990) lists the worlds
Herbaria important herbaria. Each herbarium is iden-
tified by an abbreviation that is valuable in
It was again Luca Ghini who initiated the
locating the type specimens of various spe-
art of herbarium making by pressing and
cies. The major herbaria of the world with
sewing specimens on sheets of paper. This
approximate number of specimens in the or-
art was disseminated throughout Europe by
der of importance are listed in the table 5.1.
his students who mounted sheets and bound
In India Central National Herbarium (CAL)
them into book volumes.
of the Indian Botanic Garden, Botanical Sur-
vey of India, Kolkotta has over 1.3 million
specimens. The herbarium of Forest Re-
search Institute, Dehradun (DD) and National
Botanical Research Institute, Lucknow
(LUCK) are other major herbaria in India,
with collections from all over the world.
Roles of a Herbarium
From a safe place for storing pressed speci-
mens, especially type material, herbaria
have gone a long way in becoming major cen-
tres of taxonomic research. Additionally,
herbaria also form an important link for re-
search in other fields of study. The classifi-
cation of the world flora is primarily based
on herbarium material and associated lit-
erature. More recently, the herbaria have
gained importance for sources of informa-
tion on endangered species and are of pri-
mary interest to conservation groups. The
major roles played by a herbarium include:
Figure 5.10 Patricia K. Holmgren Director
Emerita of the Herbarium, New
1. Repository of plant specimens: Pri-
York Botanical Garden, the edi- mary role of a herbarium is to store
tor of Index Herbariorum and 2 dried plant specimens, safeguard
volumes of Intermountain Flora. these against loss and destruction by
(Courtesy New York Botanical insects, and make them available for
Garden, Bronx). study.
102 Plant Systematics
Table 5.1 Major herbaria of the world, listed in the order of number of specimens.
a) Deep freezing not only to treat in- moth, cigarette beetles and ware-
coming specimens but also to kill house beetles.
insects in the herbarium. The e) Insect electrocuters are useful for
bundles of specimens are placed detecting and controlling flying
in plastic bag, the bag sealed, and insects. These emit ultraviolet
the bundle placed in freezer for light that attracts flying insects
several days. The bag (sealed) is particularly flies and moths.
next left at room temperature for Where fumigation is essential
7-10 days to allow any eggs to use of safer fumigants like
hatch and then refrozen for 3-4 Pyrethrin, sulphuryl fluoride
days. (Vikane), dichlorovos (no pest,
b) Anoxic treatment, involves the Vapona resin strips or Raid strips
usage of bag impermeable to oxy- are suitable for herbarium cases;
gen and containing specimens one-third of a strip is placed in
and a oxygen scavanger. The pest each herbarium case for seven to
is killed by depriving it of oxygen. ten days twice a year.), carbon di-
oxide and cyanogen (often used
synergistic with carbon dioxide).
Dowfume-75 has been cleared by
the Environmental Protection
Agency for use in herbaria.
Virtual Herbarium
Virtual herbarium is a database of consist-
ing of images of Herbarium specimens and
the supporting text, available over the
internet. It is a huge advancement in her-
barium use and design, coupling physical
specimens directly with internet and inte-
grating complete specimen data, with
Figure 5.13 The researchers comparing speci- resources or information generation and
mens inside the herbarium at the retrieval. Although a virtual herbarium
Missouri Botanical Garden.
cannot exist without a physical herbarium,
(Photograph by Jack Jennings/
Courtesy the Missouri Botanical
it enjoys several advantages over a physical
Garden.) herbarium:
1. Images being available electronically,
c) Small sticky trap placed in hidden user may not have to handle physical
areas of the herbarium and her- specimens, thus reducing the damage
barium cases to trap insects. Such substantially.
traps should be checked regularly 2. Whereas it may take months to sort
for insects trapped. out specimens of a collector or a coun-
d) Pheromone traps involve the use try in a physical herbarium, the same
of natural scents which insects can be done done in few seconds
use to communicate with each through a virtual herbarium.
other. Certain insects are at- 3. Virtual herbarium greatly increases
tracted to these traps from the the user interaction. Only few hun-
surrounding area and are very ef- dred visitors may visit a physical
fective. Specific traps are available herbarium in a month, but during the
for drug store beetles, Indian meal same period thousands of users can
Process of Identification 107
The AVH is accessed via the website of ceeding and as of June 2006 the database
any participating herbarium. A gateway at consisted of c193,600 specimens. Further
each of these herbaria links to the databases digitization is likely to focus on type speci-
of all the other herbaria, consolidating the mens. A potential c7,000,000 specimens
combined data into a nation-wide view of the (c275,000 types) may eventually be digitized.
botanical information. Most data related to
specimens will be stored by the custodial IDENTIFICATION METHODS
institution, and there will be some re-
Identification of an unknown specimen is a
sources, such as the scientific names data-
common taxonomic activity, and often com-
base (Australian Plant Names Index, APNI)
bined with determination of a correct name.
which will be common to all. More than 70%
The combined activity is appropriately re-
of the specimens housed in Australian her-
ferred as specimen determination. Before
baria have been databased, providing a com-
the specimen can be identified, it is desir-
prehensive resource for accurate depiction
able to describe it and prepare a list of char-
of geographic distribution and occurrence,
acter-states, mainly pertaining to floral
historical mapping, information valuable for
structure. Whereas fresh specimens may be
understanding the threatening processes of
described more conveniently, the dried
vegetation clearance and weed invasion.
specimens may be softened by immersing
Flexible on-line search options allow you to
in water or a wetting agent such as aero-
customise the data you generate to suit your
sol OT (dicotyl sodium sulfosuccinate 1 per
requirements.
cent, distilled water 74 per cent and Metha-
Australias Virtual Herbarium provides
nol 25 per cent). Pohls softening agent is
the opportunity to deliver descriptions of the
an excellent detergent solution for soften-
flora dynamically linked to data and infor-
ing flowers and fruits for dissection. The
mation from across the continent, and dis-
identification of an unknown plant may be
tributed on-line as an electronic Australian
achieved by comparison with identified her-
Flora - a one-stop source of current infor-
barium specimens or through the help of
mation on the plants, algae and fungi of the
taxonomic literature. Both methods may be
entire Australian continent. New observa-
combined for a more reliable identification.
tions can be released with minimal delay
The unknown specimen meant for iden-
as they are confirmed and recorded in the
tification is sent to a herbarium, where an
database.
expert on the plant group examines and iden-
The Strong ePIC database software of Royal tifies it by comparison with duly identified
Botanic Gardens, Kew also provides a win- specimens (Figure 5.13). The user can also
dow for digitized herbarium specimens. The visit a herbarium and personally compare
Herbariums core digital collection and identify his specimens.
programme was initiated in 2002 and since Computers have entered in a big way into
then digital resources have grown at an in- solving identification problems. Electronic
creasing rate, as well as central Herbarium revolution in recent years has opened up a
Catalogue, have an image server and many new, faster and more reliable method of iden-
project databases with information about tification. The photograph, description or
specimens that were built before the Cata- illustration of parts can be put up on a
logue became available. These are being website, with information to a relevant
moved into the Catalogue as resources per- e-mail list, whose members can help in
mit. Label data from dry and spirit specimens achieving identification within hours.
of flowering plants, ferns and gymnosperms
held in Kew's herbarium are being uploaded.
Information recorded includes the plant Taxonomic literature
name, collection and determination data, Various forms of literature incorporating
locality and type status. Digitization is pro- description, illustrations and identification
Process of Identification 109
but also an identification tool. This website A revision is less comprehensive than a
allows you to search for a plant name across monograph, incorporating less introductory
the whole Flora, which would otherwise material and including a synoptic literature
entail looking up separate indexes. It also review. A revision includes a complete syn-
allows the creation of lists of: endemics, spe- onymy but the descriptions are shorter and
cies from a particular division or country, often confined to diagnostic characters. The
species that match a particular habit and of geographical scope is usually worldwide.
species that occur at a specific altitude. As A conspectus is an effective outline of a
far as posible no changes have been made revision, listing all the taxa, with all or ma-
to the information existing in the original jor synonyms, with or without short diagno-
text and the information is presented in the sis and with a brief mention of the geographi-
same way as in the original. cal range. Species plantarum of C. Linnaeus
(1753) is an ideal example.
Manuals A synopsis is a list of taxa with much
A manual is a more exhaustive treatment abbreviated diagnostic distinguishing state-
than a Flora, always having keys for identi- ments, often in the form of keys.
fication, description and glossary but gener-
ally covering specialized groups of plants. Icones (Illustrations)
Examples: Manual of Cultivated Plants by Illustrations, often with detailed analysis of
L.H. Bailey (1949), Manual of Cultivated Trees the parts are usually published along with
and Shrubs Hardy in North America by the text in Floras and Monographs, but may
A. Rehder (1940) and Manual of Aquatic Plants sometimes be compiled exclusively and of-
by N.C. Fassett (1957). ten serve as useful tools for identification.
A manual differs from a monograph in the In fact, many species of plants based on pub-
sense that the latter is a detailed taxonomic lished illustrations only, without any accom-
treatment of a taxonomic group. panying description or diagnosis before 1
January 1908 have been accepted as validly
Monographs published. Two principal compilations of
Icones are Hookers Icones and Wights Icones.
A monograph is a comprehensive taxonomic
Others of interest include Illustrations of
treatment of a taxonomic group, generally a
plants from Europe (Hegi, 1906-1931), North
genus or a family, providing all taxonomic
America (Gleason, 1963), Pacific states
data relating to that group. Usually the
(Abrams, 1923-1960), Pacific coast trees
geographical scope is worldwide since it is
(McMinn and Maino, 1946), Germany
impossible to discuss a taxon without includ-
(Garcke, 1972), Korea (Lee, 1979).
ing all its members, and often all its
species, subspecies, varieties and forms are
discussed. The monograph also includes an Journals
exhaustive review of literature, as also a Whereas Floras, manuals and monographs
report on authors research work. A mono- are published after a lot of taxonomic input
graph includes all information related to and it may take several decades before they
nomenclature, designated types, keys, are revised, if at all, taxonomic journals pro-
exhaustive description, full synonymy and vide information on the results of ongoing
citation of specimens examined. Examples: research. A continuous update on additional
The Genus Pinus by N.T. Mirov (1967), The taxa described or reported from a region,
Genus Crepis by E. B. Babcock (1947), A Mono- nomenclatural changes and other taxonomic
graph of the Genus Avena by B.R. Baum information is essential for continuance of
(1977), The Genus Datura by A.F. Blakeslee taxonomic activity. Reference to a publica-
et al., (1959) and The Genus Iris by W.R. Dykes tion in a journal includes volume number
(1913). (all issues within a year bear the same
Process of Identification 111
volume number; trend not followed by a few ral History), Paris; a peer-reviewed journal
journals), issue number (numbered within of plant biology, devoted to the inventory,
a volume, a monthly journal would have 12 analysis and interpretation of vascular
issues, quarterly 4 issues and so on) and plants biodiversity; publishes original
page numbers on which a particular article results, in French or English, of botanical
appears. Common journals devoted largely research, particularly in systematics and
to taxonomic research include: related fields; two issues appear each year.
Adansonia continues as from 1997 the Bul-
Taxon- The journal of the International letin du Musum national d'Histoire naturelle,
Association for Plant Taxonomy devoted to section B, Adansonia, Botanique, phytochimie.
systematic and evolutionary biology with Other important taxonomic journals in-
emphasis on botany; published quarterly by clude Journal of the Arnold Arboretum
the International Bureau for Plant Taxonomy (Harvard), Bulletin Botanical Survey of India
and Nomenclature, Botanisches Institut der (Calcutta), Botanical Magazine (Tokyo) and
Universitaet Wien, Austria. Systematic Botany (New York).
Kew Bulletin- International peer-re-
viewed Journal of Plant Taxonomy; published Supporting literature
in four parts in one year by Royal Botanic With a large amount of research material
Gardens, Kew; containing original articles being published throughout the world, there
of interest mainly to vascular plant and is always need for supporting literature to
mycological systematists; each part illus- give consolidated information about the
trated with line drawings and photographs works published the world over. They also
and also features a Book Review and Notices help in tracking down material concerning
section. a particular taxon covering a certain period.
Taxonomic Literature, an exhaustive series
Plant Systematics and Evolution- of Regnum vegetabile, covers full bibliographi-
Published by Springer, Wien from 1974 on- cal details of literature extremely helpful in
wards; originally started in 1851 under the searching type material, priority of names,
name sterreichisches Botanisches dates of publication and biographic data on
Wochenblatt was published between 1958 to authors. Originally published in 1967, it is
1973 as sterreichische Botanische Zeitschrift; under constant revision with 3 supplements
devoted to publishing original papers and of the 2nd edition published between 1992-
reviews on plant systematics in the broad- 97 (Stafleu and Mennega).
est sense, encompassing evolutionary,
phylogenetic and biogeographical studies at Abstracts or Abstracting journals:
the populational, specific, higher taxonomic These provide a summary of different
levels; taxonomic emphasis is on green articles published in various journals
plants; volumes each with four numbers throughout the world. Biological Abstracts and
published randomly, usually 6-7 volumes in Current Advances in Plant Science are more
one year. general in approach. The Kew Record of
Taxonomic Literature covers all articles
Botanical Journal of Linnaean relevant to taxonomy.
Society- Published on behalf of Linnean
Society by Blackwell Synergy, London; three
Index: An Index provides an alphabetic
volumes with four monthly issues each pub- listing of taxa with reference to their publi-
lished in one year; publishes original re- cation. Index Kewensis is by far the most
search papers in the plant sciences. important reference tool, first published in
2 volumes from Royal Botanic Gardens, Kew
Adansonia- Published by Musum na- (1893-1895), covering names of species and
tional d'Histoire naturelle (Museum of Natu- genera of seed plants published between
112 Plant Systematics
1753 and 1885. Regular Supplements used with bibliographic references to the place of
to be published every 5 years and 18 Supple- first publication. At the beginning of the
ments appeared up to 1985. Supplement 19 nineteen eighties the data was transferred
was published in 1991 covering the years to a computer database which continues to
1986 to 1990. Since then the listing has expand at the rate of approximately 6000
been published annually under the title Kew records per year. To make this data gener-
Index. ally available, it was decided to publish the
Index Kewensis (Figure 5.14) is a list of new whole Index Kewensis as a CD-ROM in 1993.
and changed names of seed-bearing plants This contains almost 968,000 records.
Process of Identification 113
Illustrations of vascular plants can be lo- was produced by Dr. Hu Shiu-ying (Arnold
cated through Index Londinensis, which con- Arboretum of Harvard University) and his
tains information up to 1935. More recent staff. The Hu Card Index was prepared in the
information can be found in the 2-volume early 1950s when the Arnold Arboretum un-
work Flowering Plant Index of Illustrations and dertook a project to prepare a flora of China.
Information compiled by R. T. Isaacson (1979). Royal Botanic Gardens Kew, The Harward
A listing of all generic names can be found University Herbaria, and the Australian
in Index Nominum Genericorum (ING) a 3-vol- National Herbarium, under the collaborative
ume work published in 1979 under the se- project, have developed International Plant
ries Regnum Vegetabile. The first supplement Names Index (IPNI), a single web database
appeared in 1986. It has now been put on which combines citation data for seed plants
the database and can be directly accessed from Index Kewensis, the Gray Herbarium
through the Internet. Card Index, and the Australian Plant Names
Index Holmiensis (earlier Index Holmensis) Index (APNI). It provides information on
is an alphabetic listing of distribution maps names and associated basic bibliographical
found in taxonomic literature of vascular details of all seed plants. Its goal is to elimi-
plants. It commenced publication in 1969. nate the need for repeated reference to pri-
Gray Herbarium Card Index is information mary sources for basic bibliographic infor-
on cards, which has now been set up on a mation about plant names. The data are
database. Usually on the same pattern as freely available and are gradually being stan-
Index Kewensis, the Index has been pub- dardized and checked. IPNI is intended to be
lished in 10 volumes between 1893 and a dynamic resource, depending on direct
1967. A 2-volume supplement was published contributions by all members of the botani-
by G. K. Hall in 1978. The Gray Herbarium cal community.
Index Database currently includes 350,000 Numerous valuable Dictionaries have
records of New World vascular plant taxa at been published but by far the most useful is
the level of species and below. The Index in- Dictionary of Flowering Plants and Ferns pub-
cludes from its 1886 starting point, the lished by J. C. Willis. The 8th edition revised
names of plant genera, species and all taxa by Airy Shaw appeared in 1973. The book
of infraspecific rank. The Gray Index has in contains valuable information concerning
common with Index Kewensis its involve- genera and families providing name of the
ment with taxon names, although they dif- author, distribution, family and the number
fer in biological and geographical coverage. of species in the genus.
The Gray Index covers vascular plants of the
Americas; Index Kewensis includes seed
plants worldwide. Only the Gray Index has Taxonomic Keys
nomenclatural synonyms cross-referenced Taxonomic keys are aids for rapid identi-
to basionyms. The information is now ac- fication of unknown plants. They consti-
cessible over the Internet via keyword tute important component of Floras, manu-
searches from the E-mail Data Server and als, monographs and other forms of litera-
through the Biodiversity and Biological Col- ture meant for the identifying plants. In ad-
lections Gopher. Indices covering other dition, identification methods in recent
groups of plants have also been published: years have incorporated the usage of keys
Index Filicum for Pteridophytes, and Index based on cards, tables and computer pro-
Muscorum for Bryophytes. grams. The latter are primarily designed for
The Hu Card Index is a file of 158,844 cards identification by non-professionals. These
for Chinese plant names, now housed in the keys are fundamentally based on characters,
Harvard University Herbaria building where which are stable and reliable. The keys are
it is available for use in person. The Index helpful in a faster preliminary identifica-
114 Plant Systematics
tion, which can be backed up by confirma- ated, spur absent, petals without
tion through comparison with the detailed nectary.
description of the taxon provisionally iden- 3. Anemone: Plants herbaceous, fruit
tified with. Before identification is at- achene, calyx not differentiated, peri-
tempted, however, it is necessary that the anth petaloid, spur absent.
unknown plant is carefully studied, de- 4. Clematis: Plants woody, fruit achene,
scribed and a list of its character states pre- calyx not differentiated, perianth
pared. Based on the arrangement of charac- petaloid, spur absent.
ters and their utilization, two types of iden- 5. Caltha: Plants herbaceous, fruit folli-
tification keys are differentiated: cle, calyx not differentiated, perianth
1. Single-access or sequential keys; and petaloid, spur absent.
2. Multi-access or multientry keys 6. Delphinium: Plants herbaceous, fruit
(polyclaves). follicle, calyx not differentiated, peri-
anth petaloid, spur one in number.
Single Access or Sequential 7. Aquilegia: Plants herbaceous, fruit fol-
licle, calyx petaloid, not differentiated
Keys from corolla, spurs five in number.
Single-access keys are usual components of Based upon the above information the fol-
Floras, manuals, monographs and other lowing couplets and leads can be identified:
books meant for identification. The keys are
1. Plants woody
based on diagnostic (important and conspicu-
Plants herbaceous
ous) characters (key characters) and as such
2. Fruit achene
the keys are known as diagnostic keys. Most
Fruit follicle
of the keys in use are based on pairs of con-
3. Calyx and corolla differentiated
trasting choices and as such are dichoto-
Calyx and corolla not differentiated
mous keys. They were first introduced by J.
4. Spur present
P. Lamarck in his Flore Francaise in 1778.
Spur absent
The construction of a dichotomous key starts
5. Number of spurs 1
with the preparation of a list of reliable char-
Number of spurs 5
acters for the taxon for which the key is to be
6. Petal with nectary at base
constructed. For each character the two con-
Petal without nectary at base
trasting choices are determined (e.g., habit
woody or herbaceous). Each choice constitutes It must be noted that three choices are
a lead and the two contrasting choices form available for spur (absent, one, five). It has
a couplet. For characters having more than been broken into two couplets to maintain
two available choices the character can be the dichotomy. Based on the arrangement
split to make it dichotomous. Thus if flowers of couplets and their leads, three main types
in a taxon could be red, yellow or white the of dichotomous keys are in use: Yoked or
first couplet would constitute flowers red vs. Indented key, Bracketed or parallel key,
non-red and the second couplet flowers and Serial or numbered key.
yellow vs. white. We shall illustrate the 1. Yoked or Indented key: This is one of
construction of keys taking an example from the most commonly used keys in Floras and
family Ranunculaceae. The diagnostic manuals especially when the keys are
characters of some representative genera are smaller in size. In this type of key, the state-
listed below: ments (leads) and the taxa identified from
1. Ranunculus: Plants herbaceous, fruit them are arranged in visual groups or yokes
achene, distinct calyx and corolla, spur and additionally the subordinate couplets are
absent, petal with nectary at base. indented below the primary one at a fixed
2. Adonis: Plants herbaceous, fruit distance from the margin, the distance in-
achene, calyx and corolla differenti- creasing with each subordinate couplet. We
Process of Identification 115
Figure 5.15 Portion of a polythetic key of the yoked type used in Flora Europaea for genus Sonchus
(vol. 4, p. 327).
shall select the fruit type as the first cou- those appearing on a single page, but if the
plet, as it divides the group into two almost key is very long running into several pages,
equal halves and the taxa excluded would be an Indented key exhibits important draw-
almost equal whether the fruit in the un- backs. Firstly, it becomes difficult to locate
known plant is an achene or a follicle. The the alternate leads of initial couplets, as they
yoked or indented key for the taxa under con- may appear on any page. Secondly, with the
sideration is shown below: number of subordinate couplets increasing
substantially, the key becomes more and
1. Fruit achene. more sloping, thus reducing the space avail-
2. Calyx differentiated from corolla. able for writing leads. This may result in
3. Petal with basal nectary 1. Ranunculus wastage of a substantial page space. The
3. Petal without basal nectary..2. Adonis problem is clearly visible in Flora Europaea
2. Calyx not differentiated from corolla. where attempts to reduce the indentation
4. Plants woody......4. Clematis distance in longer keys has further compli-
4. Plants herbaceous..3. Anemone cated the usage of keys. These two disad-
1. Fruit follicle. vantages are taken care of in the Parallel or
5. Spur present. Bracketed key.
6. Number of spurs 1......6. Delphinium 2. Bracketed or Parallel key: This type
6. Number of spurs 5......7. Aquilegia of key has been used in larger floras such
5. Spur absent....5. Caltha as Flora of USSR, Plants of Central Asia, and
Flora of British Isles. The two leads of a cou-
It is important to note that all genera with plet are always together and the distance
achene fruit appear together and form vi- from the margin is always the same. Sev-
sual groups; leads of subordinate couplets are eral variations of this are used wherein the
at increasing distance from the margin and second lead of the couplet is not numbered,
the leads of initial couplets are far separated, as in Flora of British Isles or else the second
whereas those of subsequent subordinate lead is prefixed with a + sign as in Plants of
couplets are closer. Such an arrangement Central Asia. The arrangement of couplets
is very useful in shorter keys, especially in this type of key is useful for longer keys
116 Plant Systematics
vegetative and reproductive charac- 3. The single character used in the cou-
ters separately. As trees commonly plet may be exceptional. Such likeli-
have leaves throughout the major part hood is not possible when more than
of the year, and flowers appear briefly one character is used.
when in many trees leaves are not yet
developed, such separate keys are Multi-Access Keys (Polyclaves)
essential for identification round the Such multientry order-free keys are user-
year. oriented. Many choices of the sequence of
7. Avoid usage of vague statements. characters are available. Eventually, it is the
Statements such as Flowers large vs. user who decides the sequence in which to
Flowers small may often be confus- use the characters, and even if the infor-
ing during actual identification. mation about a few characters is not avail-
8. An initial couplet should be selected able, the user can go ahead with identifica-
in such a way that it divides the group tion. Interestingly, identification may often
into more or less equal halves, and the be achieved without having to use all the
character is easily available for study. characters available to the user. Such iden-
Such a selection would make the tification methods often make use of cards.
process of exclusion faster, whichever Two basic types of cards are in use:
lead is selected.
9. For dioecious plants, it is important Body-punched cards
to have two keys based on male and These cards are also named window cards
female flowers separately. or peek-a-boo cards, and make use of cards
10. The leads should be prefixed by num- with appropriate holes in the body of the card
bers or letters. This makes location (Figure 5.16). The process involves using one
of leads easier. If left blank, the loca- card for one attribute (character-state). In
tion of leads is very difficult, especially our example we shall need 11 cards (we have
in longer keys. chosen only diagnostic characters above,
The keys described above have a single whereas our list in polyclaves could include
character included in a couplet, with two more characters, and thus more cards to
contrasting statements about the character make it more flexible).
in the two leads. Such keys are known as It should be noted that we selected 12 leads
monothetic sequential keys. The common- and 6 couplets, with 4 leads for spur. Now we
est forms of keys used in floras, however, shall need only three actual attributes: spur
have at least some couplets (Fig 5.15) with absent, spur 1 and spurs 5. Numbers are
several statements about the different char- printed on the cards corresponding to the
acters in each lead. These keys are known taxa for which the identification key is
as polythetic sequential keys. Such meant. In our example, we use only 7 of these
polythetic keys, also known as synoptic keys numbers corresponding to our 7 genera. On
are especially useful for constructing keys each card, holes are punched corresponding
for higher categories. Such keys have three to the taxa in which that attribute is present.
basic advantages over the monothetic keys: In our example card Habit woody will have
1. One or more characters may be only one hole at number 4 (genus Clematis),
unobservable due to damage or non- and the card Habit herbaceous will have
occurrence of requisite stage in the holes at 1,2,3,5,6,7 (all seven except num-
specimen. In such cases, a monothetic ber 4). Once the holes are punched at appro-
key becomes useless. priate positions in all the cards, we are ready
2. User can make a mistake in deciding for identification. The user studies the un-
about a single character. This error known plant and makes a list of characters,
gets minimized if more than one according to the sequence he wishes and the
character is used. characters that are available to him.
118 Plant Systematics
Figure 5.16 A body-punched card for herbaceous habit for the seven representative genera of
Ranunculaceae: 1- Ranunculus, 2- Adonis, 3- Anemone, 4- Clematis, 5- Caltha,
6- Delphinium, 7- Aquilegia. Note the diagonal trim on upper left corner of card for
proper alignment of cards.
The user starts the identification process hole is clipped out to form an open notch in-
by picking up the first card concerning the stead of a circular hole along the edge.
first attribute in his list of attributes of the For actual identification, all the cards are
unknown plant. He next picks up the sec- held together as a pack. A needle is inserted
ond card concerning the second attribute in the hole corresponding to the first at-
from his list and places it over the first card. tribute of the unknown plant. As this needle
This will close some holes of the first card is lifted up the taxa containing this attribute
and some of the second card. Only those would fall down, and those lacking that at-
holes will remain open which correspond tribute would remain in the pack lifted by
to the taxa, which contain both the at- the needle. The latter are rejected. The
tributes. The third card is subsequently cards falling down are again arranged in a
placed over the first two and the process is pack, the needle inserted in the hole corre-
repeated with additional cards until finally sponding to the next attribute of the un-
only one hole is visible through the pack of known plant. The process is repeated until
selected cards. The taxon to which this hole finally a single card falls down. The taxon,
corresponds is the identification of the un- which this card represents, is the identifi-
known plant. cation of the unknown plant.
Note that we may not have to explore all
Edge-punched cards attributes of the unknown plant; identifica-
An edge-punched card differs from the body tion may be achieved much before we have
punched card in that there is one card for reached the end of the list of attributes of
each taxon and holes are punched all along the unknown plant.
the edge of the card, one for each attribute.
In our example here, we shall need seven Tabular keys
cards, one for each genus. These holes are Tabular keys are essentially similar to the
normally closed along the edge (Figure 5.17). polyclaves in the sense that they can take
For each attribute, present in the taxon the care of exhaustive lists of attributes and are
Process of Identification 119
Figure 5.17 Edge-punched card for genus Ranunculus. Only the attributes represented in the
example above are pictured. Many more attributes could be added along the vacant
holes to make the identification process more versatile.
easier to use. The data are incorporated, formulae are arranged in alphabetic order
however, not on cards but in tables with taxa in the same manner as words in a dictio-
along the rows and attributes along the col- nary. Based on the attributes of the
umns. The attributes represented in each unknown plant, its taxonomic formula is
taxon are pictured with the help of appropri- constructed. The next step is as simple as
ate symbols or drawings (Figure 5.18). The locating a word in the dictionary. The
attributes not represented in a taxon show formula is located in the alphabetic list and
a blank space in the column. Thus the table its identification read against the formula.
will have as many rows as taxa and as many The above example of Ranunculaceae
columns as the number of attributes for could be extended here by assigning alpha-
which information is available. bets to the attributes: A: Woody; B: Herba-
The identification process begins with a ceous; C: Achene; D: Follicle; E: Spur absent;
strip of paper whose width is equal to each F: Spur 1; G: Spurs 5; H: Calyx differentiated
row and vertical lines separated by the width from corolla; I: Calyx not differentiated from
of the columns. The attributes present in corolla, only perianth present; J: Nectary
the unknown plant are pictured on this strip present; K: Nectary absent.
of paper. The strip of paper is next placed The seven representative genera would
towards the top of the table and slowly low- thus have the formulae as given below:
ered and compared with each row. The row ACEIK ..........................Clematis
with which the entries match represents the BCEHJ .........................Ranunculus
identification of the unknown plant. BCEHK .........................Adonis
BCEIK ........................Anemone
Taxonomic formulae BDEIK ........................Caltha
A taxonomic formula is really an alphabetic BDFIJ .......................Delphinium
formula based on a specific combination of BDGIK .........................Aquilegia
alphabets. The various attributes in this Such formulae are really useful in the
method are coded with alphabets. Each taxon identification process and have been incor-
thus gets a unique alphabetic formula. These porated in the written version of the multi-
120 Plant Systematics
Figure 5.18 Tabular key for the identification of representative genera of family Ranunculaceae.
Only selected attributes as in the above example are pictured. More attributes could
be added in additional columns to make the identification process more versatile.
access key to the Genera of Apiaceae in the tween the user and the computer. The com-
Flora of Turkey (Hedge and Lamond, 1972). puter program starts with the first couplet
of the key, enquires about the attribute in
Computers in Identification the unknown plant and on the information
Over the years, computers have been in- provided, and handles the key asking rel-
creasingly used in data collection, process- evant questions until finally the actual iden-
ing and integration. They have also found tification is achieved.
use in a big way in scanning and identify-
ing human ailments, which has greatly
Computer-Constructed Keys
helped health management programmes. Appropriate programs may be developed
Computers have also found use in plant iden- which can construct a taxonomic key based
tification, whereby we no longer need on the taxonomic information about the taxa,
trained botanists for this task. The follow- in the same way and based on the same logic
ing main approaches are used in computer which is used by man to construct keys
identification: manually. Such keys permanently stored in
a computer can be handled as above for the
Computer-Stored Keys step-wise process of identification.
Dichotomous keys are constructed in the Simultaneous Character-set
usual manner, fed into a computer and run
using an appropriate program, which may Identification
be appropriately designed for step-wise pro- Taxonomic keys are an aid to rapid identifi-
cessing of the key through a dialogue be- cation and always provide only a provisional
Process of Identification 121
Figure 5.19 Identification window of the Intkey (version 5) for the seven genera of Ranunculaceae.
Selection of character state herbaceous (shown in the panel of used characters)
leads to the rejection of one taxon (Clematis, which has woody habit) shown in the
panel of eliminated taxa. Selection further character states of the known plant would
eliminate further taxa till only one identified taxon remains.
ing one can also be used, some even down- description to the character. Select the char-
loaded from the internet). Create a new folder acter type from the list of Unordered
under Delta directory and give it an appro- multistate (Say for flower colour with char-
priate name. Open Delta Editor and click acter states yellow, red, white, etc.;
New Dataset from menu. This will open multistate includes binary characters also
Attribute editor with 4 panels. A click in the such as woody and herbaceous habit), Or-
upper left panel will open Item editor for the dered multistate (height range such as
first taxon. Enter its name (images, com- 1-10 cm, 11-20 cm, 21-30 cm, etc.; similarly
ments and change of settings can be added two states with plants up to 20 cm tall and
later on) and click Done to come back to the more than 20 cm tall), Integer numeric (say
Attribute editor (else add image, sound, leaves per node), Real numeric (seed size
change settings and then click done). Now say 2.4 cm) or text information (say about
click in the upper right panel will open habitats). If Multistate character has been
}character editor. Give appropriate name or selected (ordered or unordered), click states
Process of Identification 123
tab (if not already done), enter first Charac- Action sets again, select Translate into Key
ter state in the lower right panel, it will Format and click Run and proceed similarly.
automatically be defined in the left panel. Now open Action sets again, change Tab from
Now click below this entry in the left panel Confor to Key, select Confirmatory charac-
and enter second Character state in the ter RTF and click Run. In the Action sets
right panel. Repeat this till all states (pos- again now change the Tab back to Confor,
sible in the other taxa included in the iden- select Translate into Intkey format and
tification process, but yet to be entered) have click Run. Go to the Action sets for the last
been entered. Next select character Num- time, change to Intkey Tab, select Intkey
ber 2, give it a name, and select type. If the initializing File and click Run. The process
numeric (real or integer) has been selected, will complete and Intkey program window
states tab wont appear. You will select the will open (dont forget to add dataset to the
unit (cm, mm, leaves per node). For text char- Intkey Index when prompted when you close
acter, add appropriate notes in the notes tab. Intkey program; or else add dataset when you
After all the characters have been selected, open Intkey program window next time) with
click Done to go back to the Attribute editor. four panes with the list of characters in the
Now click in the left upper panel to add upper left pane and the list of taxa in the
the second taxon and repeat this till all the upper right pane, both lower panes being
taxa have been added. The Attribute editor empty.
will now show a list of taxa in the upper left Using Intkey program window, one can
panel and the characters (identified as high- identify an unknown plant from this group
lighted U-unordered multistate, O-ordered of taxa by reading the first character in the
multistate, I-integer numeric, R-real unknown plant, clicking the appropriate
numeric and T-text) in the upper right panel. character in the left upper pane and
Any character missing from the list can be clicking or entering the right choice of the
added and appropriately defined. Now select character state when prompted. This will
taxa one by one. For each taxon, enter (verify) eliminate and show certain taxa in the lower
the state in the right panel after expanding right pane and the used character in the
the character icon (+ not expanded, ex- lower left pane (Figure 5.19). As you use more
panded) till information for all the taxa has and more characters, some more taxa will
been entered. Save the dataset under the be rejected and the process will end when a
folder already created in the beginning. You single identified taxon is remains in the
can open the dataset now to add any images, upper right pane. You can click i (informa-
comments or change settings if desired. The tion) icon to view image (if added) or read
identification program needs a large full description of taxon.
number of files in the folder created for a Intkey can also be used to access Delta
particular dataset. The following procedure data and images over the internet. For this
will create these files automatically. data files (such as iitems, ichars), intkey.ini,
Open Dataset in the Delta editor and click contents.ind (together with rtf files), and
File-->Export directive. Delta Files to export image files (optional) are put in a zip file (or
dialogue box appears. Click OK, subse- self extracting zip file) and uploaded to the
quently Done and then Close (if necessary website along with startup file (*.ink; which
from X on top). Open Delta editor (if closed). contains the information and the path of
Click view-->Action sets. Print character list uploaded files of the project), intkey.ini,
appears. See that the Confor Tab is active. imagePath (optional) and InfoPath(optional).
Select Print character list-RTF. Click Run. A data-set index file or link in WWW page
In the next dialogue Box click Yes. Go to Ac- must point to the special startup file (*.ink;
tion sets again, select Translate into Natu- not intkey.ini or intkey.ink). The startup file
ral Language-RTF-Single file for all taxa and tells Intkey where the data set and its asso-
click Run, subsequently click Yes. Go to ciated images are found on the website.
124 Plant Systematics
When a person using an internet browser up the identification window with four
clicks on a link to an intkey startup file, the panels, like Intkey. Character panel is
browser activates Intkey and passes it a copy upper left window, but right upper panel
of startup file. Intkey itself then retrieves shows character states, lower right panel the
the actual data set from the web, extracts the matching items panel showing match-
its contents, and begins identification. For ing or remaining taxa (click any taxon to get
this web applicability, however, Intkey has its full description) and the lower left panel
to be installed on both Web server and each the query criteria panel: display of previous
each client PC, and an association of files (used) character state selections. NaviKey
has to be developed by the manager of Web also allows checkbox matching options to: a)
server, where the project files are located. Restrict view on used characters and
Intkey based web applications are avail- character states of remaining items. b) Re-
able for several families and Genera from tain items unrecorded for the selected char-
Flora of China, Families of the World (Watson acters. c) Retain items matching at least
and Dallwitz), Grass Genera of the World one selected state of resp. characters. d) Use
(Watson and Dallwitz), Grass Species of the extreme interval validation, and e) Use
World (RBG, Kew), Tree and Shrub Genera of overlapping interval validation.NaviKey does
Borneo (J.K. Jarvie & Ermayanti), indentifica- not display the list of excluded taxa but the
tion facility for the vascular flora of Western total number of taxa and number remain-
Australia, and is available in FloraBase. Ad- ing are displayed.
ditionally, interactive keys (using Intkey) to The use of software as web application is
the families and genera of flowering plants very convenient. Just fill in the title and
in Western Australia are soon to be added subtitle of the project being developed in
to FloraBase, with specialist keys for cer- NaviKeyAppletWebpageTemplate.html using
tain significant genera also well advanced. html editor (say Frontpage), upload the whole
folder to your website, and provide a link to
NaviKey NaviKey.html page. As this page opens, the
Navikey is a simple Java based interactive java application gets loaded and the program
identification key, a free program, which is ready for interactive identification.
works on Delta flat files (chars, items and NaviKey identifications are available for
specs- present in your folder if you have de- several families and genera of Flora of China
veloped a database ready for identification and genus Arisaema (Guy Gusman & Eric
through Intkey, as detailed in preceding Gouda) and Flowering Plant Families of
paragraphs). NaviKey v. 4 is developed in the Jamaica (Gerald Guala & Jimi Sadle)
frame of BIOTa Africa project (An Interna-
tional Research Network on biodiversity, Lucid Systems
sustainable use and conservation) by Dieter Lucid software (Lucid3) is a commercial
Neubacher and Gerhard Rambold (University powerful and widely acclaimed Lucid
of Bayreuth, Germany), based on an earlier Professional identification and diagnostic
version (NaviKey v. 2.3 by Michael Bartley software developed by Centre for Biological
and Noel Cross, Harvard University Her- Information Technology, The University of
barium, Boston, USA). The program can be Queensland, Brisbane Australia. The Lucid3
downloaded from www.NaviKey.net and can system comprises a Builder and Player for
be used both as stand alone application or creating and deploying effective and power-
as web application. After downloading the ful identification and diagnostic keys. It
and unzipping the the file, the folder will have allows creation of interactive, random-ac-
a number of files on your computer. Simply cess keys that can be deployed over the World
add the three flat files of your project to this Wide Web or CD.
folder. For using it as stand alone applica- The key when used for the identification
tion simply click NaviKey.jar, and it will open of an unknown specimen progressively
Process of Identification 125
eliminates entities that do not match the XID System allows the user to randomly
chosen features until only one or a few pos- select characteristics that are consistent
sible entities remain. Further information with their specimen and skill level. If the user
and images can be accessed to confirm the cannot decide upon a characteristic, they may
identification. query the program, which will provide a list
The basic elements of a Lucid3 key are: a of suggestions in order of ease of use, effec-
list of entities; a list of features and states tiveness, and items remaining.In general,
that may be used to describe those entities; much more data is included on each item/
a matrix of score data for the features asso- species than is necessary to identify it. With
ciated with each of the entities for the fea- this abundance of data, the user can identify
tures; and various attachments ( images, any of the items/species using the charac-
web pages etc) for the entities and features, teristics most obvious and easy to describe.
to provide extra information to users. With each characteristic entered by the user,
The Lucid3 Builder provides all the tools the program eliminates all species that do
necessary to create the entity and feature not have the combination of features entered.
lists, encode the score data, and attach in- XID also offers 1000 Weeds of North
formation files to items. The package in ad- America CD ROM. This is the most compre-
dition includes Lucid Phoenix, a computer hensive weed identification reference ever
based dichotomous or pathway key Builder published in North America. Contains 140
and Player that enables traditional paper grass-like and 860 broadleaf weeds, features
based identification keys to be published on include Interactive key, color photos of all
the Internet or CD. Phoenix keys are inter- species, illustrated glossary of terms, page
active, can be enhanced with multimedia, number references to over 40 weed refer-
and delivered across the Internet seamlessly. ence books, searchable geographic data,
Additional Fact Sheet Fusion software is a and State level distribution maps.
tool to facilitate the rapid generation of
standardised fact sheets in HTML (Hyper ActKey
Text Markup Language) or XML (eXtensible ActKey is a web based interactive identifi-
Markup Language). cation program developed by Hong Song of
the Missouri Botanical Garden. This Java-
XID (Expert Identification based program uses MySQL as the database
Systems) server, and can handle data sets in DELTA,
XID Services Inc. produces commercial soft- MS Excel, MS Access and Lucid formats.
ware with emphasis on biological sciences, ActKey identification is available for the
and is one of the leading providers of expert floras of China, North America, Madagascar,
identification systems for major universi- Borneo, at the Harvard University Herbaria
ties and botanical gardens in United States. Editorial Center, and hosted at eFlora
XID offers two identification packages: website. Examples include several keys to the
Pankey, a DOS bassed identification pro- large and medium-sized genera of China (also
gram, and XID Authoring Systems, Windows in Chinese); the genera of Brassi-caceae of
based databases and Program for Identifica- the world by Ihsan Al-Shehbaz; Salix
tion. The XID Authoring System allows au- (Salicaceae) of North America by George W.
thors to create their own smart key or ran- Argus (also in Chinese); angiosperm families
dom access expert system for the identifi- by B. Hansen and K. Rahn (also in Chinese
cation of plants, animals, or any other ob- and Spanish); Trilliaceae (Trillium and Paris)
ject. The elegant simplicity of the XID Sys- of the world by Susan B. Farmer, the generic
tem makes it extremely user friendly, and tree flora of Madagascar by George Schatz,
is as useful for school teacher as for the pro- and the trees & shrubs of Borneo by James
fessional scientist. K. Jarvie & Ermayanti, respectively.
126 Plant Systematics
It is now a universally agreed upon fact that dynamic structure. Clausen et al. (1945)
different species are not fixed entities but regard genetics, cytology, comparative
systems of populations which exhibit varia- morphology and ecology as furnishing the
tion and wherein no two individuals are iden- critical data which together, when applied
tical. This concept of variations was first pro- to the study of organic evolution, make up
posed by Lamarck and further developed by biosystematics. These two different
Darwin, culminating in his famous book Ori- approaches aim at the same problem, the
gin of Species (1859). Systematics is a unique study of variations.
natural science concerned with the study of The study of biosystematics, mainly the
individual, population and taxon relation- experimental systematics and population
ships for purposes of classification. The study genetics approach the common aim, al-
of plant systematics is based on the premise though the methodology is different. The ex-
that in the tremendous variation in the perimental systematist usually begins with
plant world, there exist conceptual discrete classical interpretation of species and works
units (usually named as species) that can backwards so as to understand the genetic
be recognized, classified, described, and mechanisms involved. The population ge-
named, on the further premise that logical neticist, on the other hand, begins with raw
relationships developed through evolution population, discarding any classical concept
exist among these units. in mind. He works into a series of group con-
The studies on variations, experimental cepts which may or may not be comparable
studies and hybridization studies in light of to the taxonomists concept of species.
genetic information are commonly covered
under the term biosystematics. The term
was first proposed by Camp & Gilly (1943 as TYPES OF VARIATION
Biosystematy) to delimit natural biotic units The recognition of taxonomic units is based
and to apply to these units a system of on the identification of the occurrence and
nomenclature adequate to the task of con- the degree of discontinuity in variation in
veying precise information regarding their the populations. The variation may be con-
defined limits, relationships, variability and tinuous when the individuals of a popula-
Variation, Biosystematics, Population Genetics and Evolution 129
tion are separable by infinitely small differ- ronmental conditions. Such populations are
ences in any of the attributes. In a discon- named ecophenes. In Epilobium; the
tinuous variation, however, there is a dis- sun-plants have small, thick leaves, many
tinct gap between two populations, each hairs and a short stature, whereas the
showing its own continuous variation for a shade-plants have larger thinner leaves
particular attribute. The discontinuity be- with fewer hairs and a taller stature.
tween the populations primarily results from
isolation in nature. Isolation plays a major Genetic variation
role in establishing and widening the gap
between the populations, allowing evolution Genetic variation may result from mutation
to take its destined course with no distur- or recombination. Mutation is the occur-
bance. Variation in plants includes three rence of heritable change in the genotype of
fundamental types: developmental, environ- an organism that was not inherited from its
ancestors. It is the ultimate source of
mental and genetic.
variation in a species and replenishes the
supply of genetic variability. A mutation may
Developmental variation be as minute as the substitution of a single
A distinct change in attributes is often found nucleotide pair in the DNA (point mutation),
during different stages of development. Ju- change in a sequence nucleotides control-
venile leaves of Eucalyptus, Salix and Populus ling gene action (Gene mutation) or as great
are often different from the mature leaves, as a major change in the chromosome
and may often cause much confusion, but structure (chromosomal mutation).
may prove equally useful when both types of Chromosomal mutation may be due to
leaves are available from a plant. The first deletion, inversion, aneuploidy or polyploidy.
leaves of Phaseolus are opposite and simple, Recombination is a reassortment of chromo-
the later ones alternate and pinnately com- somes, bringing together via meiosis and
pound. As the seedling stage is most critical fertilization the genetic material from
in a plants life, the characters present dur- different parents and producing a new
ing this period surely have survival value. genotype.
Takhtajan proposed a neotenous origin for
angiosperms on the assumption of juvenile VARIANCE ANALYSIS
simple leaves of seed ferns having persisted Since no two individuals in a population are
in the adult forms, which were the direct similar, there is need for some objective
progenitors of angiosperms. analysis for useful comparison. It is, how-
ever, often impossible to collect information
Environmental variation about all the individuals of a population, and
Environmental factors often play major role as such is reasonable to analyse a repre-
in shaping the appearance of a plant. sentative sample. It is essential that this
Heterophylly is the common manifestation sample should represent random subset of
of environmental variation. The submerged the population. The simplest tool is to
leaves of Ranunculus aquatilis are finely calculate the mean or average by adding the
dissected, whereas the emergent leaves of series of values and dividing the total by the
the same plant are broadly lobed. The first number of values. The formula for calculat-
submerged leaves of Sium suave are pin- ing the mean is:
nately dissected and flaccid; the older SX i
emerged leaves are pinnately compound and X =
n
stiff. The individuals of a species often
exhibit phenotypic plasticity, expressing where X represents the mean, S summation
different phenotypes under different envi- of all values of X, Xi represents the individual
130 Plant Systematics
Table 6.1 Mean, variance and standard devia- removed from mean, the variance would be
tion of two samples based to plant higher. The variance may either be calcu-
height. The two samples have the lated for a population, or a sample from the
same mean but different variance population. The variance for a population
and standard deviation, highlighting
may be calculated as:
the significance of these calcula-
tions. n
2
(X i X )
i =1
Height (cm) (X i - X) (X i - X) 2 I2 =
: E n
Sample Sample Sample Sample Sample Sample
A B A B A B
To obtain the variance, the difference be-
18 22 18 15 = 3 22 15 = 7 9 49 tween each value of the attribute (X) and the
14 10 14 15 = -1 10 15 = -5
mean is squared and a sum of these squares
1 25
is divided by the number of observation (n).
16 06 16 15 = 1 06 15 = -9 1 81 For calculating sample variance (s2) the sum
15 16 15 15 = 0 16 15 = 1 0 1 of squares is divided by n 1 instead of n.
The formula for sample variance may be
17 12 17 15 = 2 12 15 = -3 4 9
written as:
19 19 19 15 = 4 19 15 = 4 16 16 n
2
(Xi X )
12 11 12 15 = -3 11 15 = -4 9 16 i =1
s2 =
14 27 14 15 = -1 27 15 = 12 1 144 n 1
For the calculation of sample variance,
13 14 13 15 = -2 14 15 = -1 4 1
the reason for dividing by n 1 and not by n,
16 21 16 15 = 1 21 15 = 6 1 36 is related to the degrees of freedom. If we
14 09 14 15 = -1 09 15 = -6 1 36
have a single value we cant compare it, if
we have two we have one comparison
12 13 12 15 = -3 13 15 = -2 9 4 (2 1), if we have three values we have two
:E = 180 180 comparisons (3 1), and if there are n
values, n 1 comparisons are possible. While
Mean
X = 15 15 calculating population variance, with large
number of values , the difference of one
Variance 5 = (X i - X) 2 = 5.09 38
n-1 would be irrelevant, and as such the sum is
Standard deviation 5 = 5 2.256 6.17 divided directly by n. Two samples may have
the same mean, but different variance (Table
6.1). The square root of variance is repre-
values of an attribute under study and n sented by standard deviation. Latter is
represents the number of values. Thus, five often preferred over the variance because it
plants of a species with height 15 cm, 12 shares the same units as the original mea-
cm, 10 cm, 22 cm and 16 cm would have a surements, whereas the variance is in the
mean of 15 cm ((15+12+10+22+16)/5). The units squared. The reason for first squaring
extent of variation within a population of a the values and then determining the square
species is best represented by determining root, is to obtain the real picture of
the variance. It is a measure of the spread variation. If simple difference of each value
of individual observations around the mean, and mean is summed, the negative values
i.e. how variable the individuals and their (measurements lower than the mean) may
measurements are. It is defined as the av- get cancelled by positive values (measure-
erage squared deviation from the mean. If ments higher than the mean), and the
various individuals were not far from this result would be zero, and thus meaningless.
mean the variance would be minimum. On The squaring converts all values to plus and
the other hand, if many individuals were far thus a real diversion from the mean on
Variation, Biosystematics, Population Genetics and Evolution 131
either side is taken into account. We may This is significant in economical plants
thus determine the standard deviation of a where it is important to determine whether
population as: the attributes are related to environmental
variations or genotype. If former is true, it
I2 = I2 is advisable to improve cultural practices, if
and that for a sample as: it is related to genotype, selective breeding
would be the answer.
s2 = s2
For our sample data, the sample variance REPRODUCTIVE SYSTEMS
would be [(15-15)2 + (12-15)2 + (10-15)2 + The diverse mechanisms of reproduction in
(22-15)2 + (16-15)2]/4 = 21 and the sample seed plants can be classified under four
standard deviation major categories. Allogamy involves cross-
21 = 4.5825 fertilization between closely related indi-
viduals growing at a suitable distance from
The determination of sample size from a
each other, and results in the formation of
population is crucial for the calculation of
hybrids. Cross-fertilization promotes het-
variance and standard deviation. Sample
erozygosity, resulting in considerable varia-
size n can be computed from magnitude of
tion and diversity in individuals. Autogamy
standard deviation (this can be estimated
involves self-fertilization, resulting in inbred
from the smallest and the largest value of
offsprings. It promotes homozygosity, yield-
an attribute (say smallest 5, largest 45,
ing uniform populations. Agamospermy in-
mean 25, deviation 20), level of confidence
volves production of seeds resulting from the
desired (z, say 0.95%) and maximum width
development of embryos from maternal tis-
of units from true value (d, say 5):
sue without fertilization. Finally, the repro-
z2 I2 duction may result from vegetative propa-
n = gation of somatic regions such as shoot seg-
d2 ments, bulbs, rhizomes, corms and other veg-
For the above parameters the adequate etative structures. Both allogamy and auto-
sample size is (0.95 x 0.95) = 0.902 x (20 x gamy are examples of sexual reproduction,
20) = 360.8/(5 x 5) = 14.4. Thus 15 would be involving meiosis and fertilization. The last
ideal sample size with these parameters. two, circumvent sexual reproduction and
The analysis of variance data is often com- multiplication occurs through asexual re-
plicated, especially where more than one production, and are often termed apomixis.
factors are responsible for variation. The The products of asexual reproduction are
technique of Analysis of variance (ANOVA) known as ramets, where as products of
developed by Sir Ronald Fisher (1930) is com- sexual reproduction, which show genetic
monly used for dividing the variance into
variation as genets.
components. It is a powerful statistical pro-
cedure for determining whether the differ-
ences from the mean are significant, i.e. Outbreeding
larger than expected by chance. Thus for Outbreeding, as mentioned earlier is largely
example, if probability value of less than responsible for genetic and phenetic diver-
0.002 (There is less than one per cent sity in populations. It is also known as out-
chance than variation obtained is due to crossing, allogamy or xenogamy. It enables
chance) is obtained through variance analy- plants to adapt to wide range of environmen-
sis, the results are due to factors others than tal conditions, and increases likelihood of
chance. The analysis involves partitioning survival and evolutionary change. A variety
the variance and comparing the role of vari- of mechanisms promote outbreeding. These
ous factors (environmental, genetical, etc.). are briefly described below:
132 Plant Systematics
1. Dioecy: The phenomenon involves the lization between the gametes derived
occurrence of unisexual flowers, with from the same flower. Gametophytic
male and female flowers in different self-incompatibility results from
individuals. Some variations of this genetic composition of male gameto-
are also encountered as for example, phyte, and sporophytic self-incompat-
some individuals having male flowers ibility by genetic composition of
others bisexual flowers (androdioecy), sporophytic tissue such as style and
some individuals having female flow- stigma.
ers others bisexual flowers
(gynodioecy), or some individuals Hybridization
having male flowers others female and
still others bisexual flowers (trioecy). Although occurrence of breeding barriers is
2. Dichogamy: The situation reflects the dominant criterion for distinction between
maturation of male and female floral the species, several cases of interspecific
parts at different times. In some mem- hybridization have been reported. Based on
bers of Apiaceae and Asteraceae, pol- the studies of the Flora British Isles, Stace
len grains mature and are released (1989) concluded that there are approxi-
before gynoecium is mature and re- mately 70, 000 different naturally occurring
ceptive, the phenomenon known as interspecific hybrids, accounting for more
protandry. In others, like members of than one fourth of the total number of
Chenopodiaceae, the gynoecium is species of seed plants on this planet.
mature and receptive before the pol- Natural hybridization is common in Salix,
len maturation and release, a feature Helianthus, Quercus, Senecio and Tragopogon.
known as protogyny. It is more common in perennials as
3. Herkogamy: It results from physical compared to annuals.
separation and stamens and carpels. Hybridization between different species
This could be achieved by heterostyly, usually results in sterile offsprings, due to
differences in the length of stamens failure of pairing at meiosis, but in several
and carpels. In the phenomenon genera like Senecio and Tragopogon, inter-
known as distyly some flowers have specific hybridization is often followed by
short style and longer stamens (thrum chromosomal duplication, the resulting poly-
flowers), whereas others have long ploid (Allopolyploid; Amphiploid) genera-
style and short stamens (Pin flowers). tion is sexually stable due to normal meio-
In a rarer situation known as trisyly, sis of paired genomes. Many such polyploid
three types of stamen and carpel species with distinct characters have been
lengths occur. In other cases the style reported in these genera.
is curved away from stamens, either Occurrence of intergeneric hybrids is
towards right (right-handed flowers) or much rarer, and there may be less than 300
left (left-handed flowers), the situation naturally intergeneric hybrids world-wide.
known as enanciostyly. In some gen- Such hybrids are reported mostly in Poaceae
era like Mimulus, the stigmas close and Orchidaceae, although in the latter fam-
after being touched by a pollinator, ily there are many artificially synthesized
thus preventing pollination from intergeneric hybrids, often involving five
same flower (movement herkogamy). In different genera.
others like Kalmia, the pollinator trig-
gers the movement of one or more sta- Introgressive hybridization
mens, dusting insect with pollen (trig- The process of introgressive hybridization,
ger herkogamy). also known as introgression involves the
4. Self-incompatibility: The phenom- gradual infiltration of one species into that
enon refers to the prevention of ferti- of another, and commonly involves species
Variation, Biosystematics, Population Genetics and Evolution 133
with some degree of reproductive isolation. share intermediate area largely occupied by
The phenomenon involves three steps: the products of hybridization. Juniperus
formation of F1 hybrids, their backcrossing virginiana, a mesophytic tree of eastern North
with one or another parental species, and America has shown introgression of bushy
natural selection of certain favourable re- xerophyte J. ashei from dolomitic outcrops
combinant types. The hybrids generally pro- in Texas and Okhlahoma. Throughout the
duce a lot of variability through backcross- intermediate area are seen plants with
ing and F2 segregation, and may produce hy- partial recombination of characters between
brid swarms., occupying a variety of habi- the two well differentiated species.
tats. Backcrossing with parental species fre- It must be mentioned that the process of
quently results in reversion of hybrid off- introgression may lead to the development
springs towards parental types. Backcross- of variants with no taxonomic status, their
ing may also result in movement of genes recognition as ecotypes, subspecies, or if the
from one species to another via the hybrids intermediate species is sufficiently distinct,
and backcrosses. Introgression may lead to recognition as distinct species.
three diverse consequences. In some cases,
as Gilia capitata, it may lead to merging of Recognition of Hybrids
species. The species has eight geographi-
cal races, of which three are believed to have The identification of hybrid nature of an off-
been distinct in Pliocene. Subsequent gene spring is possible through the use of some
flow led to intergrading races, and as such important criteria.
they are included under single species. In-
Phenetic intermediacy: Hybrids tend
trogression may also transfer genetic ma-
to have phenetic intermediacy between the
terial from one species to another without
putative parents. It is easier to recognize
merging them. Introgressants, which get
morphological characters, which can be plot-
stabilized, may lead to the formation of new
ted on a scatter diagram (Figure 6.1). Hybrids
species.
can also detected by calculating hybrid in-
Two types of introgression are commonly dex. A list of characters by which the two
recognized. Sympatric introgression com- species differ is prepared. Each character-
monly occurs between species occurring in state of one species is assigned zero score,
the same general geographical area, but whereas each contrasting character-state of
occupying different habitats. In California another species given a score of 2. The
the introduced Helianthus annuus has hybrid index of each species is calculated by
introgressed with native serpentine species summing up the score. Thus one species will
H. bolanderi, and the vigorous weedy vari- have hybrid index of 0, and another species
ant of latter has spread into irrigated areas. 2n (n refers to the number of characters by
Such introgression usually results in the which two species differ).
wider spread of one species as compared to
another. In England, for example Silene alba Reduced fertility: Hybrids between dif-
is spreading in weedy areas, whereas S. ferent species commonly tend to have re-
dioica, a woodland species is contracting. In duced fertility, some being totally sterile.
Scotland, on the other hand, the more hu- The degree of sterility is reflected upon the
mid climate allows S. dioica to flourish out- degree of heterozygosity between genomes
side woodlands, on hedgebanks and cliff of parental species. A hybrid which perishes
ledges. at zygote stage would represent maximum
Allopatric introgression occurs heterozygosity, whereas a hybrid which
between species which are now fully manages to produce viable seeds, although
allopatric, but had contact in the past. Such less vigorous than either parents, would
species are centered in different areas but depict least heterozygosity between parents.
134 Plant Systematics
Stabilization of hybrids
11 10
C
through a number of methods. Commonest
6
Apomixis
The phenomenon of apomixis in a broader POPULATION GENETICS
sense includes non-sexual reproduction, Population genetics deals with the applica-
either through vegetative propagation (veg- tion of genetic principles to populations of a
etative apomixis) or agamospermy, where particular species. A population constitutes
136 Plant Systematics
Table 6.2 Chi-square table showing the relationship between Chi-square vales, degrees of free-
dom and the probability. For a particular degree of freedom the nearest Chi-square
value is located from the row, the the appropriate probability value read from the top
row. Probability values lower than 0.05 are highly significant and do not support the
hypothesis being tested. The values higher than 0.05 support the hypothesis.
freedom
Degrees of
Probability
0.95 0.90 0.70 0.50 0.30 0.20 0.10 0.05 0.01 0.001
Chi-square values
1 0.004 0.016 0.15 0.46 1.07 1.64 2.71 3.84 6.64 10.83
2 0.10 0.21 0.71 1.39 2.41 3.22 4.61 5.99 9.21 13.82
3 0.35 0.58 1.42 2.37 3.67 4.64 6.25 7.82 11.35 16.27
4 0.71 1.06 2.20 3.36 4.88 5.99 7.78 9.49 13.28 18.47
5 1.15 1.61 3.00 4.35 6.06 7.29 9.24 11.07 15.09 20.52
6 1.64 2.20 3.83 5.35 7.23 8.56 10.65 12.59 16.81 22.46
7 2.17 2.83 4.67 6.35 8.38 9.80 12.02 14.07 18.48 24.32
8 2.73 3.49 5.53 7.34 9.52 11.03 13.36 15.51 20.09 26.13
9 3.33 4.17 6.39 8.34 10.66 12.24 14.68 16.92 21.67 27.88
10 3.94 4.87 7.27 9.34 11.78 13.44 15.99 18.31 23.21 29.59
15 7.26 8.55. 11.72 14.34 17.32 19.31 22.31 25.00 30.58 37.70
20 10.85 12.44 16.27 19.34 22.78 25.04 28.41 31.41 37.57 45.32
30 18.49 20.60 25.51 29.34 33.53 36.25 40.26 43.77 50.89 59.70
50 34.76 37.69 44.31 49.34 54.72 58.16 63.17 67.51 76.15 86.66
fusion of A and a gametes of either parent (five assumptions) the frequencies of the
would be AA, Aa, Aa and aa. In terms of alleles dons change over time. The law also
allele frequencies the genotypes could be concluded that as long as mating is random,
written as: the genotype frequencies remain in the
proportion of p2, 2pq and q2. The sum of
AA: p2 AA: 2pq aa: q2 genotype frequencies equals 1, i.e. p2 + 2pq
The foundations for these calculations-a + q2 =1. The allelic frequencies remain con-
landmark contribution in population genet- stant from generation to generation, in
ics- were laid by Godfrey Hardy and Wilhelm such randomly mating populations.
Weinberg, independently in 1908. The law Although it is difficult for a population to
is based on assumptions that in a infinitely be infinitely large in size, but a fairy large
large, randomly mating population, free from population satisfies the requirement. If the
mutation, migration and natural selection size of the population is limited, chance
138 Plant Systematics
deviations from the expected rates can re- the expected values. It helps us to conclude
sult in changes in allelic frequency, a phe- whether the departure is within the prob-
nomenon known as genetic drift. It must ability limits, or due to some other phenom-
also be remembered, however, that random enon operating on the population. Goodness
mating does not always mean that popu- of fit is conventionally measured in terms
lations must be interbreeding randomly of chi-square . It is calculated as follows:
for all the traits for the law to hold true. In
human populations, for example, where mar- S (Observed value Expected value)2
c2 =
riages are chosen on the basis of religion, Expected value
cast and colour, the mating partners do not Supposing phenotype X represents a
select blood groups or other such traits, population heterozygous for one pair of
which may thus satisfy the Hardy Weinberg alleles, and Y homozygous recessive.
law. The law thus applies to any locus for Mating between the two is expected to
which random mating occurs, even if mat- produce progeny with the two phenotypes in
ing is nonrandom for other loci (traits). the ratio of 1:1 ( X = A + a, Y = a + a; pheno-
For Hardy-Weinberg law to apply, the popu- types Aa, Aa, aa, aa; X = 2, Y = 2). Supposing
lations must be free from mutation, migra- there is a progeny of 30 individuals with 18
tion and natural selection. It is important to of X phenotype and 12 of Y phenotype,
note that the condition of no evolutionary whereas the expected number for each phe-
change applies only to the trait (locus) in notype is 15.
question. A population may be subject to evo-
lutionary processes acting on some genes, (18 15)2 (12 15)2 9 9
while still meeting the Hardy-Weinberg as- c2 = + = + = 12
15 15 15 15
sumptions for other loci. The populations
which satisfy the requirements of the law Closer the observed values are to the
are said to be in genetic equilibrium or expected, lower the value of c2. If the two
Hardy-Weinberg equilibrium. If the ob- match perfectly the values would be zero,
served genotype proportions are different although it never happens in nature. Once
from the expected, one or more assumptions the c2 value has been calculated, the good-
of the law have been violated. ness of fit of this value to the expected num-
bers is determined. Two parameters are
Null hypothesis and Chi- essential for this interpretation. First the
number of degrees of freedom for a particu-
Square Test lar c2 test is calculated, as number of classes
A population with random mating should rep- of data minus one. In our case there are two
resent the progeny with numbers of various classes of data (phenotypes X and Y), hence
phenotypes closer to the expected numbers. one degree of freedom. The second param-
For any population analysis it is important eter is the probability p, which can be deter-
to determine, whether the observed values mined from graph of the Chi-square test. The
match (fit) the expected values or not. Null graph shows range of c2 values along the X
hypothesis states that there is no real dif- axis, probability along the Y axis and curves
ference between the observed and the pre- of different degrees of freedom running from
dicted data. If the statistical analysis shows base towards the right top. The vertical line
that the difference between predicted and starting from the specific c2 value is located
observed values is due to chance, the null at the point it touches the relevant curve,
hypothesis is proved, if not, it is rejected. and a horizontal line from this point towards
Although we could never expect a perfect the left touching the Y axis determines the
match, the calculation of goodness of fit, probability values. The probability can also be
gives us an indication of the departure from read from the statistical table for
Variation, Biosystematics, Population Genetics and Evolution 139
Extension of Hardy-Weinberg F =
(Observed heterozygosity Expected heterozygosity)
Expected heterozygosity
Law
Hardy-Weinberg Law may also be extended Greater the value of F, the greater the
to situations such as multiple alleles and reduction in heterozygosity relative to that
sex-linked alleles. Consider a population expected from the Hardy-Weinberg expecta-
with three alleles A, B and C with allele tion. If genotypes are in Hardy-Weinberg pro-
frequencies of p, q and r respectively. The portions, F = 0, because observed heterozy-
frequencies of various genotypes would be gosity equals expected one. In self-fertiliza-
represented as: tion, common in plants, however, the de-
creases with every generation and homozy-
(p + q + r )2 = p2 (AA) + 2pq(AB) + q2 (BB) gosity increases consequently. Supposing we
+ 2pr (AC) + 2qr (BC) + r 2 (CC) start with a completely heterozygous popu-
lation Aa reproducing by self-fertilization.
In a population with allele frequencies of After one generation the progeny will con-
p = 0.52, q = 0.31 and r = 0.17, the following sist of 1/4 AA, 1/2 Aa and 1/4 aa. In next
genotypes are frequencies are expected if the generation homozygotes AA will produce only
population is in Hardy-Weinberg equilib- AA progeny, aa will produce only aa progeny,
rium: whereas only heterozygotes will again seg-
AA = p2 = (0.52)2 = 0.27 regate into half heterozygotes and half ho-
AB = 2pq = 2(0.52 x 0.31) = 0.32 mozygotes (1/4 AA, 1/4 aa). This will reduce
heterozygotes to 1/4 of the total population.
BB = q2 = (0.31)2 = 0.10
After large number of generations, there will
AC = 2pr = 2(0.52 x 0.17) = 0.18 be no heterozygotes, and the population will
BC = 2qr = 2(0.31 x 0.17) = 0.11 be divided into half AA and half aa.
CC = r 2 = (0.17)2 = 0.03 It should, however, be noted that although
The law can similarly be applied to genotype frequencies change from one gen-
sex-linked alleles. In human populations, for eration to another, the allele frequencies
example males are XY and females XX. For remain constant.
X-linked alleles the female genotypes show
normal Hardy-Weinberg distribution, whereas EVOLUTION
the male genotypes are distributed in the Evolution consists of progressive changes in
same frequencies as respective alleles the gene pool, associated with progressive
140 Plant Systematics
Mutation Migration
It is now agreed that variation in heritable Migration is similar to mutation in that new
traits results from mutations. Mutation is alleles are introduced into the local popula-
an important process in evolution. It was tion, although the new alleles are derived
earlier believed that variations result mostly from another population, and not from
from adaptive inheritable change induced by mutation within the same population. In
environment. This adaptation theory, populations with no migrations, the genetic
based on Lamarckism, believed in the changes cause considerable differentiation
inheritance of acquired characteristics. The in subpopulation of a population. This
middle of twentieth Century saw the emer- genetic differentiation among subpopula-
gence of mutation theory, to explain tions gets minimized when exchange of
changes in several bacterial populations. individuals through migration occurs. Only
Although some mutations occur only in the a small amount of migration is sufficient to
somatic cells, and not passed to the next prevent the accumulation of high level of
generation (somatic mutation), others genetic differentiation. However, in spite of
occurring in germ cells are transmitted from migration, the genetic differentiation may
one generation to another (genetic muta- continue if other evolutionary forces, such
tion; germ-line mutation). A mutation may as natural selection for adaptation to local
involve changes within the same base type environment, are operating.
(purine to purine; pyrimidine to pyrimidine),
when its is known as transition mutation;
in others it may involve changes from a Random Genetic Drift
purine to a pyrimidine or vice versa, when Although population is supposed to be
it is termed transversion mutation. A infinite in size as per Hardy-Weinberg Law,
mutation in which base pair change in DNA in practice they are finite or limited in size,
causes a change in mRNA codon so that a although large enough so that chance
different amino acid is inserted into the factors have little effects on allelic frequen-
polypeptide chain constitutes missense cies. Some populations, however, may be
mutation. On the other hand, a change that small and the chance factors may produce
results in mRNA codon for an amino acid to large changes in allelic frequencies. Ran-
stop is known as nonsense mutation. dom change in allelic frequency due to
Most of the newly arising mutations are chance is called random genetic drift or
harmful to the organism, and are eliminated simply genetic drift. Ronald Fisher and
from the population in successive genera- Sewall Wright, who laid the foundations of
tion. Some mutations may result in amino population genetics, were the first to describe
acid changes that cause detectable change how genetic drift affects the evolution of
in structure or function of the organism. populations.
Such neutral mutations also do not partici- Imagine a small population with equal
pate in evolution. Similarly a base pair may number of individuals with either of the two
change mRNA codon that inserts the same biallelic traits. In a population of twenty
Variation, Biosystematics, Population Genetics and Evolution 141
individuals, say 15 carry homozygous domi- les may bounce a bit, but do not stray too
nant genotype, 5 heterozygous genotype and much from steady state.
10 homozygous recessive genotype. the
frequency of a allele would be 5 + 20 = 25, Natural Selection
i.e. 0.62. Supposing all the individuals
carrying the dominant allele (AA or Aa Natural selection is the deriving force of
genotypes) perish, the population will be left adaptive evolution. The theory of natural
with only a allele, and hence allelic selection was first developed independently
frequency of a equals 1. The genetic drift, by Charles Darwin and Alfred Russel Wallace
and consequently evolution has occurred in and presented at the Linnean Society of
the population due to chance. London in 1858. Darwin further pursued this
In addition to random factors such as theory and published in his famous book, The
floods, fires or cyclones which cause genetic Origin of Species (1859). The theory has
drift due to mortality, the genetic drift may undergone considerable refinement through
also result from other causes. In small popu- the incorporation of genetic concepts in the
lations, although large number of gametes succeeding years. The theory is based on two
are produced, only a few will participate in premises. First- In all organisms, more
fertilization and represented in the zygotes offspring are produced than survive and
of next generation. This process of random reproduce (originally proposed by Thomas
sampling (sampling error) of gametes from Malthus); Second- Organisms differ in their
generation to generation, may result in ability to survive and reproduce, and some of
changes in allele frequencies by chance, these differences are due to genotype. It is
and consequent genetic drift. deduced that in every generation, the
Genetic drift may cause a number of evo- genotypes that promote survival in the
lutionary changes in addition to changes in prevailing environment (favoured
allelic frequencies. As different populations genotypes) must be present in excess among
may experience genetic drift in different individuals of reproductive age , and hence
directions, and as a result, the populations the favoured genotypes will contribute
diverge in allelic frequencies. Also, we disproportionally to the offsprings of the next
expect more genetic drift in smaller popula- generation. As a result of this process, the
tions as compared to larger populations. alleles that enhance survival and
reproduction increase in frequency from
generation to generation, and the population
Mutation versus Random becomes progressively better equipped to
Genetic Drift survive and reproduce in the prevailing
Mutation continues to introduce new genetic environment (Survival of the fittest). This
changes in populations, whereas random progressive genetic improvement constitutes
genetic drift removes certain traits from the the process of evolutionary adaptation.
population. How does the balance between
two opposite forces is achieved? Infinite Darwinian Fitness and
alleles model attempts to explain this
balance. According to this model, each Fitness Coefficient
mutation in a gene is assumed to generate For natural selection to operate, survival of
a novel allele that has never been seen the fittest is not the only criteria, the popu-
before. The model also assumes that lation should be able to reproduce and pass
random genetic drift occurs by the repeated on the fit genes to the next generation. The
random sampling, as described earlier. In relative reproductive ability of a genotypes
this situation the mutation and genetic drift is represented as Darwinian fitness. It is
balance each other, and an equilibrium is represented by W, and when comparing
reached. In this state of balance, some alle- populations, the one able to produce most
142 Plant Systematics
offspring is given value of 1. Other popula- being recessive, s equals 1, and the num-
tions are assigned value relative to this. ber of a alleles eliminated by selection will
Supposing out of the four populations A be proportional to q2s according to Hardy-
produces 15 offspring, B 10, C 8 and D 5 Weinberg proportions, where as the number
offspring. The population A will be assigned of new a alleles introduced by mutation will
W value of 1, B 10/15 = 0.66, C 8/15 = 0.53, be proportional to m. At equilibrium the two
and D 5/15 = 0.33. should balance and as such q2s = m
It is, however, important to consider the
t
q =
number of offspring surviving, rather than
number produced. Darwinian fitness can s +t
also be used to calculate Selection coeffi-
cient, which is a measure of relative where q stands for equilibrium value. In
intensity of selection against a genotype, or those cases where the harmful allele shows
selective disadvantage of a disfavoured partial dominance in having small detri-
genotype. It is symbolized as s and calculat- mental effect on fitness of the heterozygous
ed as: carriers then the fitness of genotypes AA,
Aa and aa can be written as 1 : 1 - hs : 1 - s,
s=1-W
where hs stands for selection coefficient
Thus for above populations the selection against heterozygous carriers, h refers to
coefficient would be calculated as: Popula- the degree of dominance. When h = 1, the
tion A s = 1- 1 = 0, B 1 - 0.66 = 0.44, C 1 - 0.53 harmful allele is completely dominant, but
= 0.47, D 1 - 0.33 = 0.67. Thus Population A when h = 0 it is completely recessive, and
has zero selective disadvantage, B 44%, C when h = 1/2 the fitness of heterozygous
47%, and D 67% selective disadvantage. genotype is average of homozygous geno-
Whereas the estimation of fitness is types. For most harmful alleles that show
relatively easier with microorganisms with partial dominance, the value of h is smaller
shorter life span, the same in higher than 1/2.
organisms may take several years of study.
In such organisms it is convenient to divide Heterozygote superiority
fitness into its component parts, and
Whereas in most cases of selection, the
estimate these parts separately. The
fitness of heterozygote is intermediate
commonly used components include:
between dominant and recessive genotypes,
viability, the probability that the zygote of a
or equalling one of them, some cases of se-
genotypes survives up to reproductive stage,
lection lead to superior heterozygote. The
and fertility, the average number of offspring
phenomenon is known as overdominance,
produced by a genotype during the reproduc-
heterozygote superiority or heterosis. An
tive period.
equilibrium of allelic frequencies is main-
tained, because both alleles are favoured in
Selection-Mutation Balance heterozygous state. Selection will lead to
The process of natural selection reduces the changes in allelic frequencies, but once the
frequency of harmful alleles in a population. equilibrium is reached, the frequencies will
These harmful alleles, however, are never stabilize. With overdominance the fitness of
eliminated, since mutations from wild types genotypes AA, Aa and aa may be written as
continuously produce harmful alleles. These 1 - s : 1 : 1 - t, where s and t are the selection
two opposite forces maintain an equilibri- coefficients against AA and aa, respectively.
um within a population. In selection- The proportion of A alleles eliminated by
mutation balance new mutations exactly off- selection in event of random mating is p2s/
set selective eliminations. In populations p = ps, and the proportion of a alleles elim-
(with A a alleles) with harmful (lethal) allele inated by selection is q2t/q = qt. When the
Variation, Biosystematics, Population Genetics and Evolution 143
equilibrium is reached and the selective views concerning the evolution of species.
elimination of the two alleles is balanced. Kimura (1968) proposed neutral theory of
evolution, according to which most genetic
ps = qs
variation observed in natural populations
t due to accumulation of neutral mutations.
p =
s +t Whereas the nonneutral mutation affects
the phenotype of the organism and can be
With overdominance of one allele, the
acted upon by natural selection, the neu-
allele frequencies ultimately reach equilib-
tral mutation does not affect the phenotype
rium, but the rate of approach depends on
of the organism and not acted on by natural
magnitudes of s and t. The equilibrium is
selection. Since neutral mutations do not
reached much faster, when there is a strong
affect phenotype, they spread throughout a
selection against homozygotes.
population according to their frequency of
appearance and to genetic drift. This non-
Molecular evolution Darwinian evolution has been called as
Molecular evolution involves changes in survival of the luckiest as opposed to sur-
populations at the level of DNA and protein vival of the fittest as advocated by Darwin-
sequences. It attempts to correlate these ian theory. Although Kimura agreed with
changes with evolution of new genes and Darwin that natural selection is responsible
organisms. Whereas the population genet- for adaptive changes in species during
ics is concerned with changes in gene fre- evolution, but he stressed that modern
quencies from generation to generation, the variation in gene sequences is explained by
molecular evolution considers much longer neutral variation rather than adaptive
time frames, associated with speciation. variation.
The field of molecular evolution is In further elaboration of their theory,
multidisciplinary, involving data from genet- Kimura et al., (1974) developed five prin-
ics , ecology, evolutionary biology, statistics ciples that govern the evolution of genes at
and even computer science. The analysis of molecular level:
molecular data can help in unravelling the 1. For each protein, the rate of evolution,
historical records preserved in genomes, and in terms of amino acid substitutions,
identifying the dynamics behind evolution- is approximately constant with regard
ary processes to understand and reconstruct to neutral substitutions that do not
the chronology of change. affect protein structure or function.
Molecular evolution mostly operates by 2. Proteins that are functionally less im-
substitutions that lead to the change of codon portant for the survival of an organ-
for one amino acid to another. Leucine codon ism, or parts of a protein that are less
CUU, for example can be changed to isoleu- important for its function, tend to
cine codon AUU by change in single base evolve faster than more important pro-
pair of DNA, where the change to codon for teins or regions of a protein. In other
chemically dissimilar asparagine (AAU), two words, during evolution, less important
base pair changes must occur. The meth- proteins will accumulate amino acid
ods of analysing DNA sequence data, and its substitutions more rapidly than impor-
utilization in phylogenetic analysis is tant proteins.
discussed in detail in the chapter on 3. Those amino acid substitutions that
Molecular Systematics. do not disrupt the existing structure
and function of a protein (conserva-
tive substitutions) occur more fre-
Neutral Theory of Evolution quently in evolution than those which
Molecular studies over the last few decades disrupt (disruptive substitutions) ex-
have also seen emergence of alternate isting structure and function.
144 Plant Systematics
4. Gene duplication must always precede America) are well established species
the emergence of a gene having a new but readily interbreed when brought
function. into the same area (vicarious species).
5. Selective elimination of definitively 2. Ecological isolation: Two species
deleterious mutations and random fix- occupy the same general area but
ing of selectively neutral or very occupy different habitats. Silene alba
slightly deleterious alleles occur far grows on light soils in open places
more frequently in evolution than while S. dioica on heavy soils in shade.
Darwinian selection of definitely ad- Their habitats rarely overlap, but
vantageous mutants. when they do, hybrids are encoun-
Although, the DNA sequencing of tered.
hundreds of thousands of different genes 3. Seasonal isolation: Two species oc-
from thousands of species has provided cur in the same region but flower at
compelling support for the five principles, different seasons. Sambucus racemosa
there are, however, some geneticists called and S. nigra flower nearly 7 weeks
selectionists, who oppose neutralist theory. apart.
It is, however, agreed by all that genetic drift 4. Temporal isolation: Two species
and natural selection both play key roles in flower during the same period but dur-
evolution. ing different times of the day. Agrostis
tenuis flowers in the afternoon,
Speciation whereas A. stolonifera flowers in the
morning.
Speciation is a general term for a number
5. Ethological isolation: Two species
of different processes which involve the pro-
are interfertile but have different
duction of new species. The speciation com-
pollinators. Humming-birds for exam-
monly results from the development of bar-
ple, are attracted to red flowers and
riers to gene flow. Different types are isolat-
hawk-moths to white ones.
ing mechanisms are responsible for the de-
6. Mechanical isolation: Pollination be-
velopment of barriers.
tween two related species is prevented
by structural differences between flow-
Isolating Mechanisms ers, as for example between Ophrys
Isolation is the key factor preventing inter- insectifera and O. Apifera.
mixing of distinct species through preven-
II. Post-pollination Mechanisms
tion of hybridization. Based on whether iso-
lating mechanisms operate before or after 1. Gametophytic isolation: This is the
sexual fusion, two main types of mecha- commonest isolating mechanism
nisms are distinguished: prezygotic mecha- wherein cross-pollination occurs but
nisms and postzygotic mechanisms. A de- the pollen tube fails to germinate or if
tailed classification of isolating mechanisms germinated, it cant reach and pen-
etrate the embryo sac.
is presented below.
2. Gametic isolation: In such cases, re-
A. Prezygotic mechanisms ported in several crop plants, the pol-
(operating before sexual fusion) len tube releases the male gametes
into the embryo sac, but gametic and/
I. Pre-pollination Mechanisms or endospermic fusion does not occur.
1. Geographical isolation: Two species
are separated geographically by a gap B. Postzygotic mechanisms
larger than their pollen and seed dis- (operating after sexual fusion)
persal. Platanus orientalis (Mediterra- 1. Seed incompatibility: The zygote or
nean region) and P. occidentalis (North even immature embryo is formed but
Variation, Biosystematics, Population Genetics and Evolution 145
Ancestral species
Ancestral species
Environmental differentiation
Race A Race B
Reproductive
Isolation
Species B Reproductive isolation Species A
A B
tion after they meet rather than the somal modifications. The resultant
period of sympatry reinforcing differ- chromosome arrangement must be
ences between them. fully viable in the homozygous state
4. Parapatric speciation: This occurs but of reduced viability in the hetero-
when two populations of an ancestral zygous state.
species differentiate despite the fact 6. Sympatric speciation: The examples
that no complete disjunction has oc- of sympatric speciation due to hybridi-
curred. The daughter species may zation and apomixis have been dis-
share a small fraction of their respec- cussed under abrupt speciation. The
tive ranges and interbreed within this process of ecological sympatric
narrow contact zone and yet still dif- speciation is a slow one of gradual
ferentiate. speciation. The ecological differences
5. Stasipatric speciation: This is simi- in the habitats result in adaptive
lar to parapatric speciation except that radiations in populations which gradu-
it results from spontaneous chromo- ally evolve into new species.
Chapter 7
Taxonomic Evidence
Over the last few decades, the affinities be- last two centuries, more and more micro-
tween plant groups have been redefined as scopic characters of morphology were incor-
more and more information is accumulated porated. Although floral morphology has been
from various sources. Newer approaches in the major material for classifications, other
recent years include (a) increasing reliance morphological characters have also contrib-
on phytochemical information (Chemotax- uted in specific groups of plants. The diver-
onomy); (b) studies on ultrastructure and sity of morphological features has already
micromorphology; (c) statistical analysis of been discussed in detail under Descriptive
the available data without much a priori terminology in Chapter Four.
weighting and providing a synthesis of all
the available information (Taxometrics); Habit
and (d) analysis of phylogenetic data to con- Life-formsthough of little significance to
struct phylogenetic relationship diagrams taxonomyallow a means of estimating
(Cladistics). The aforesaid disciplines con- adaptiveness and ecological adjustment to
stitute the major modern trends in tax- the habitat. In Pinus, bark characters are
onomy. Data continues to flow from differ- used for identification of species. Woody and
ent disciplines, so that the process of analy- herbaceous characters have been the pri-
sis and synthesis is an ongoing activity. Tax- mary basis of recognition of Lignosae and
onomy (Systematics) is as such a field of Herbaceae series within dicots by
unending synthesis. The following disci- Hutchinson (1926, 1973).
plines have contributed to a greater or lesser For several decades it was believed that
extent to a better understanding of taxo- trees or shrubs with simple leaves repre-
nomic affinities between plants. sented the most primitive condition within
angiosperms. Increased evidence over the
last decade, however, is pointing towards the
MORPHOLOGY assumption that the perennial herbaceous
Morphology has been the major criterion for condition in paleoherbs such as Cerato-
classification over the last many centuries. phyllaceae, Nymphaeaceae and Piperaceae
The initial classifications were based on represents the archetype of the most primi-
gross morphological characters. During the tive angiosperms.
150 Plant Systematics
single opening, or compound with several associated gaps (lacunae) left in the vascu-
openings. Latter with elongated openings in lar cylinder of stem at each node are dis-
a row like a ladder is known as scalariform, tinctive for several groups. The node may
a common type in primitive angiosperms. have single gap (unilacunar) from single leaf
trace or three leaf traces (two additional com-
monly entering stipules) or three gaps (trila-
cunar) associated with three leaf traces (Fig-
ure 7.1) The genus Illicium has been sepa-
rated from Winteraceae because of unilacu-
nar nodes, continuous pseudosiphonostele
and the absence of granular material in sto-
matal depressions.
Trichomes
Figure 7.1 Nodal anatomy. A: Unilacunar node Trichomes constitute appendages of epider-
with one leaf trace; B: Trilacunar mis which may be non-glandular or glandu-
node with three leaf traces; C: lar. Non-glandular trichomes may be in the
Unilacunar node with three leaf
form of simple unicellular or multicellular
traces.
hairs (common in Brassicaceae, Lauraceae
and Moraceae), in the form of vesicles,
Vessels are absent in Gymnosperms, but peltate hairs (Olea) or flattened scales.
present in Angiosperms. It is commonly be-
lieved that there has been a progressive evo-
lution in angiosperms from tracheids to long,
narrow vessel elements with slanted, sca-
lariform perforation plates, to short, broad
vessel elements with simple perforation
plates. Studies on wood anatomy have con-
tributed largely in arriving at the conclusion
that Amentiferae constitute a relatively ad-
vanced group, and that Gnetales are not
ancestral to angiosperms. Bailey (1944) con-
cluded that vessels in angiosperms arose
from tracheids with scalariform pitting,
whereas in Gnetales they arose from trac-
heids with circular pitting, thus suggesting
an independent origin of vessels in these
two groups. Demonstration of vessel-less
angiosperms (Winteraceae, Trochoden-
draceae), also having other primitive fea-
tures, has led to the conclusion that
angiosperm ancestors were vessel-less. The
separation of Paeonia into a distinct family
Figure 7.2 Trichomes. A: Simple unicellular
Paeoniaceae and Austrobaileya into a sepa-
hair; B: Multicellular hair; C:
rate family Austrobaileyaceae has been sup- Scale; D: Candelabra trichome of
ported by studies of wood anatomy. Verbascum; E: Vesicular hair of
Nodal anatomy has considerable signifi- Atriplex; F: Peltate hair; G: Stellate
cance in angiosperm systematics. The num- hair Styrax; H: Secretary gland of
ber of vascular traces entering leaf base and Thymus; I: Stinging hair of Urtica.
152 Plant Systematics
Figure 7.3 Stomatal apparatus in Angiosperms. A: Anomocytic type with epidermal cells around
stomata not differentiated; B: Paracytic type with two or more cells parallel to the
guard cells differentiated as subsidiary cells; C: Diacytic type with two subsidiary
cells at right angles to the guards cells; D: Anisocytic type with three subsidiary cells
of unequal size; E: Actinocytic type with stomata surrounded by a circle of radiating
cells; F: Tetracytic type with four subsidiary cells; G: Cyclocytic type with concentric
rings of subsidiary cells; H: Graminaceous type with dumb-bell shaped guard cells
with two small subsidiary cells parallel to the guard cells.
Branched hairs may be dendroid, stellate stinging hairs of Urtica are highly special-
(Styrax) or candelabrum-like (Verbascum). ized with silica tip which readily breaks
Glandular trichomes may be sessile or when hair is touched. The broken tip is
stalked and present a variety of forms. sharp like a syringe and easily penetrates
Unicellular glandular hairs of Atriplex are the skin injecting irritating cell contents.
bladder-like (Figure 7.2) with few-celled stalk Trichomes hold considerable promise in
and basal cell and they secrete salt. Others systematics of angiosperms. Trichomes
may secrete nectar (calyx of Abutilon), mu- have been of considerable help in Cruciferae
cilage (leaf base of Rheum and Rumex). The (Schulz, 1936), especially in the genera
Taxonomic Evidence 153
Arabis and Arabidopsis. Trichome characters stomata in the former as against anomocytic
are very useful in the large genus Astraga- in the latter. The stomatal features, how-
lus (with more than 2000 species). The Hi- ever, are not always reliable. In Streptocarpus
malayan species Hedera nepalensis is dis- (Sahasrabudhe and Stace, 1979) cotyledons
tinguished from its European relative H. have anomocytic while mature organs have
helix in having scaly trichomes as against anisocytic stomata. In Phyla nodiflora (syn
stellate in the latter. In family Combretaceae = Lippia nodiflora) the same leaf may show
the trichomes are of immense significance anomocytic, anisocytic, diacytic and
in classification of genera, species or even paracytic stomata (Pant and Kidwai, 1964).
varieties (Stace, 1973). Trichomes are also
diagnostic characters for many species of Ver- Leaf anatomy
nonia (Faust and Jones, 1973).
The florets of Poaceae are reduced and do
not offer much structural variability. Leaf
Epidermal features anatomy has been of special taxonomic help
Epidermal features are also of considerable in this family. The occurrence of the C-4
taxonomic interest (SEM epidermal features pathway and its association with Kranz
are discussed under ultrastructure and anatomy (dense thick-walled chlorenchy-
micromorphology). Prat (1960) demonstrated matous bundle sheath, mesophyll simple),
that one can distinguish a Festucoid type has resulted in revised classification of sev-
(simple silica cells, no bicellular hairs) and eral genera of grasses. Melville (1962, 1983)
Panicoid type (complicated silica cells, developed his gonophyll theory largely on the
bicellular hairs) of epidermis in grasses. basis of the study of venation pattern of
Stomatal types (Figure 7.3) are distinctive leaves and floral parts. The rejection of San-
of certain families such as Ranunculaceae miguelia and Furcula as angiosperm fossils
(anomocytic), Brassicaceae (anisocytic), from the Triassic has largely been on the
Caryophyllaceae (diacytic), Rubiaceae (para- basis of detailed study of the venation pat-
cytic), and Poaceae (graminaceous). Ano- tern of leaves (Hickey and Doyle, 1977). The
mocytic type has ordinary epidermal sur- more recent rediscovery of Sanmiguelia from
rounding the stomata. In others the epider- the Upper Triassic of Texas (Cornet 1986,
mal cells surrounding the stomata are dif- 1989) points to presumed angiosperm incor-
ferentiated as subsidiary cells. There may porating features of both monocots and
be two subsidiary cells at right angles to the dicots. Discovery of the Late Triassic Pan-
guard cells (diacytic), two are more parallel naulika (Cornet) from the Virginia-North
to the guard cells (paracytic), or three sub- Carolina border has reopened the possibili-
sidiary cells of unequal size (anisocytic). ties of Triassic origin of angiosperms.
Other types include actinocytic type with
stomata surrounded by a ring of radiating
cells, cyclocytic with more than one con- Floral anatomy
centric rings of subsidiary cells and tetra- Floral anatomy has been one of the thor-
cytic with four subsidiary cells. The stomatal oughly explored areas, with significant con-
complex of Poaceae is distinctive in having tributions to the understanding of the phy-
two dumb-bell shaped guard cells with two logeny of angiosperms. Vascular traces in
small subsidiary cells parallel to the guard the carpels of various genera of the family
cells. Ranunculaceae have confirmed the origin
Stace (1989) lists 35 types of stomata in of achene (Ranunculus, Thalictrum, etc.) from
vascular plants. Closely related families follicle (Delphinium, Aquilegia, etc.) through
Acanthaceae and Scrophulariaceae are successive reduction in the number of
distinguished by the presence of diacytic ovules ultimately to one. The additional
154 Plant Systematics
traces which would have gone to other species. Floral anatomy also supports the
ovules, now aborted, can be observed in separation of Menyanthes from Gentianaceae
many genera. There, thus, is no justifica- into a distinct family Menyanthaceae. The
tion for Hutchinsons separation of achene- genus Centella is separated from Hydrocotyle
bearing genera and follicle-bearing genera on the basis of inflorescence being a cyme,
into separate families Ranunculaceae and and ovules receiving vascular supply from
Helleboraceae, respectively. alternate bundles. In Hydrocotyle, the inflo-
Melville (1962, 1983) developed his rescence is an umbel and the ovules receive
gonophyll theory after studying the vascu- vascular supply from fusion of two adjacent
lature of carpel and other floral parts through bundles. Paeonia is a classical example of a
the clearing technique. He believed the an- genus, which was removed from family
giosperm carpel to be a modified dichotomous Ranunculaceae into a distinct family
fertile branch adnate to the petiole of a leaf. Paeoniaceae. The separation has been sup-
Sporne (1971) cautioned against such a dras- ported by evidence from morphology, embry-
tic conclusion citing the example of bath- ology and chromosomes. Floral anatomy also
room loofah. supports this separation, as both sepals and
The genus Melandrium was segregated petals have many traces, carpels have five
from Silene on the basis of the ovary being traces and the stamens are centrifugal. De-
unilocular as against partly septate in Silene. velopmental studies have indicated that
Detailed floral anatomy revealed that in all some flowers, such as Apiaceae and
the species of both genera, the ovary is mul- Ericaceae, that appear to have free petals,
tilocular, at least in the early stages of de- are gamopetalous early in development.
velopment. The septa break down to various They are, therefore, considered to have
degrees in different species as the ovary de- evolved from gamopetalous ancestors.
velops. Thus structurally, the ovaries are
similar. The two genera were consequently
merged into the single genus Silene. EMBRYOLOGY
The inferior ovary in angiosperms has
been formed in two ways: appendicular ori- Embryology has made a relatively lesser
gin (formed by fusion of calyx, corolla and contribution in understanding taxonomic
their traces to the ovary wall; in this case, affinities. This is primarily because of long
all vascular traces have normal orientation, preparatory work needed for embryological
i.e. phloem towards the outside) or by axial studies. More often, the study of hundreds
invagination (formed by depression of the of preparations may reveal just a single
thalamus; the inner vascular traces have embryological characteristic of any signifi-
reverse orientation, i.e. phloem towards the cance. It may take many years of laborious
inside). Studies on floral anatomy have con- and painstaking research to study even a
firmed that in a large majority of families, few representatives of a family. The embryo-
the inferior ovary is of appendicular origin. logical features of major significance include
Only in a few cases (Rosa, Cactaceae, etc.) microsporogenesis, development and struc-
is the origin by axial invagination of the ture of ovule, embryo sac development,
thalamus. endosperm and embryo development.
Floral anatomy has also supported the
inclusion of Acer negundo under Acer, and Families marked out by dis-
does not support its separation into a
distinct genus Negundo. Although this spe-
tinct embryological features
cies is specialized in having a dioecious A number of families of angiosperms are
habit and anemophily, the anatomy of the characterized by unique embryological fea-
flower shows unspecialized features of other tures found in all members. These include:
Taxonomic Evidence 155
angiospermous character, the anther has a est. The number of nuclei present at the time
distinct endothecium and glandular tape- of shedding is also significant. Most primi-
tum, pollen grains shed at the 2-celled stage, tive angiosperms are shed at 2-nucleate
embryo sac of the Polygonum type, endosperm stage, whereas in more advanced groups
cellular, and the division of zygote trans- pollen is shed at 3-nucleate stage.
verse. This confirms that the genus Angiosperms mostly have pollen grains of
Exocarpos is undoubtedly an angiosperm, radial symmetry, bilateral symmetry being
and a member of the family Santalaceae, found in several gymnosperms. Most pollen
with no justification for its removal to a dis- grains are globose in shape, although boat-
tinct family. The genus is as such placed in shaped, ellipsoidal and fusiforms are also
Santalaceae in all the major systems of clas- met in different angiosperms. Since most
sification. pollen grains at least in early stages form
tetrads, the outer end of grain is termed
Loranthaceae distal pole, whereas the inner end where
grains meet as proximal pole, and the line
The family Loranthaceae is traditionally
joining the two poles as polar axis. The line
divided into two subfamiliesLoranthoideae
running around the pollen at right angles to
and Viscoideaelargely on the basis of pres-
the polar axis is termed as equator.
ence of a calyculus below the perianth in
the former and its absence in the latter.
Maheshwari (1964) noted that the Pollen aggregation
Loranthoideae has triradiate pollen grains, Microsporogenesis yields four microspores
Polygonum type of embryo sac, early embryog- which mature into pollen grains. In large
eny is biseriate, embryo suspensor present, majority of angiosperms the pollen grains
and viscid layer outside the vascular supply separate prior to release. Such single
in fruit. As against this, Viscoideae have pollen grains are known as monads. In rare
spherical pollen grains, Allium type of cases pollen grains are released fused in
embryo sac, early embryogeny many tiered, pairs, when they are known as dyads. In
embryo suspensor absent, and viscid layer many angiosperms the four microspores do
inside the vascular supply of fruit. He thus not separate and the pollen grains form a
advocated separation of the two as distinct tetrad. Five different types of tetrads are
families Loranthaceae and Viscaceae. The differentiated:
separation was accepted by Takhtajan (1980, 1. Tetrahedral tetrad- four pollen grains
1987, 1997), Dahlgren (1980), Cronquist form a tetrahedron: four grains com-
(1981, 1988) and Thorne (1981, 1992). pacted in a sphere. Such pollen grains
are found in family Ericaceae.
2. Linear tetrad- four pollen grains
PALYNOLOGY arranged in a straight line as in genus
The pollen wall has been a subject of con- Typha.
siderable attention, especially in an attempt 3. Rhomboidal tetrad- four pollen grains
to establish the evolutionary history of in one plane, with two separated from
angiosperms. Some families, such as one another by close contact of the
Asteraceae, show different types of pollen other two.
grains (eurypalynous), whereas several 4. Tetragonal tetrad- four grains are
others have a single morphological pollen in one plane and equally spaced as in
type (stenopalynous). Such stenopalynous Philydrum.
groups are of considerable significance in 5. Decussate tetrad- four grains in two
systematic palynology. Pollen grains present pairs, arranged at right angles to one
a number of features of taxonomist inter- another, as in genus Lachnanthes.
Taxonomic Evidence 157
Figure 7.5 SEM of pollen grains. A: Nonaperturate pollen grain of Persea americana; B: Monosulcate
pollen grain of Magnolia grandiflora; C: Monoporate pollen grain of Siphonoglossa; D:
Tricolporate pollen grain of Scaevola glabra; E: Polyporate spinose pollen grain of Ipomoaea
wolcottiana; F: Tricolpate pollen grain of Disanthus cercidifolius. (A, after Fahn, 1982; C,
after Mauseth, 1998 courtesy R. A. Hilsenbebeck, Sul Ross State University; F, after
Endress, 1977; rest, after Gifford and Foster, 1988).
at poles is termed syncolpate. Aperture several genera with wind pollination. The
having three branches is termed tricho- vestigial scattered patches of adhesive layer
tomosulcate. on wind pollinated pollen have been consid-
Monocolpate condition is widely spread in ered as evidence of the derivation of
primitive dicots and a majority of monocots. anemophily from entomophily.
The pollen of anemophilous plants is Fossil studies over the last three decades
usually small, rounded, smooth, rather thin- have confirmed monosulcate pollen of
walled and dry with shallow furrows. Anemo- Clavitopollenites described (Couper, 1958)
philous pollen is found in Populus, Poaceae, from Barremian and Aptian strata of the
Cyperaceae, Betulaceae and several other Early Cretaceous of southern England (132
families. Insect- and bird-pollinated pollen, to 112 Mya) to be the oldest recorded
on the other hand, is large, sculptured and angiosperm fossil with distinct sculptured
often coated with adhesive waxy or oily exine, resembling the pollen of extant
substance. The pollen of Asteraceae is genus Ascarina.
generally highly elaborate but simplification Brenner and Bickoff (1992) recorded
towards loss of sculpturing has occurred in similar but inaperturate pollen grains from
Taxonomic Evidence 159
the Valanginian (ca 135 Mya) from the Helez through Transmission Electron Microscopy
formation of Israel, now considered being the (TEM). On an average basis, the resolution
oldest record of angiosperm fossils (Taylor power of SEM is 250A (20 times as good as
and Hickey, 1996). This last discovery has optical microscope, but 20 times lesser than
led to the belief that the earliest angiosperm TEM). Behnke and Barthlott (1983) have
pollen were without an opening, the made extensive studies of SEM and TEM
monosulcate types developing later. characters. In most of the examples stud-
Many claims of angiosperm records from ied, Electron Microscopy (EM) characters
the strata, earlier than the Cretaceous were proved to be stable and unaffected by envi-
made, but largely rejected. Erdtman (1948) ronmental conditions.
described Eucommiidites as a tricolpate di-
cotyledonous pollen grain from the Jurassic.
This, however, had bilateral symmetry in-
Micromorphology
stead of the radial symmetry of angiosperms SEM studies have been made primarily on
(Hughes, 1961) and a granular exine with pollen grains, small seeds, trichomes and
gymnospermous laminated endexine (Doyle surface features of various organs. In most
et al., 1975). Among examples of the role of of these organs (except pollen grains), the
pollen grains in systematics is Nelumbo studies involved the epidermis. The value
whose separation from Nymphaeaceae into of epidermal studies lies in the fact that an
a distinct family Nelumbonaceae is largely epidermis covers almost all the organs and
supported by the tricolpate pollen of Nelumbo is always present, even in herbarium speci-
as against the monosulcate condition in mens. The epidermis is thick and stable in
Nymphaeaceae. SEM preparations and is little affected by
Brenner (1996) proposed a new model for environment. However, it is important to
the evolutionary sequence of angiosperm pol- note that only comparable epidermis should
len types. The earliest angiosperm pollen be studied (e.g. petals of all plants, leaves of
(from the Valanginian or earlier) was small, all plants, not petals of some and leaves of
circular, tectate-columellate and without an others). Most of SEM studies have been con-
aperture. In the Hauterivian, there was pos- centrated on seed-coats which are usually
sible occurrence of thickening of the intine thick-walled and stable in vacuum, thus fa-
coupled with thickened endexine and evo- cilitating quick preparation for SEM exami-
lution of the sulcus. A considerable diversi- nation without the need for complicated de-
fication of these monosulcate pollens oc- hydration techniques. The micromorphology
curred in the Barremian. Tricolpate pollen of the epidermis includes the following as-
evolved in northern Gondwana in the lower pects:
Aptian. Multicolpate and multiporate pollen
arose at a later stager. Primary Sculpture
This refers to the arrangement and shape
of cells. The arrangement of cells is spe-
MICROMORPHOLOGY AND cific for several taxa. In Papaveraceae, seed-
ULTRASTRUCTURE coat cells by a particular arrangement form
Although widely used in lower plants, elec- a reticulate supercellular pattern (Figure
tron microscopy has been a comparatively 7.6-D), which is a family character. The
new approach for flowering plants. The finer members of Caryophyllaceae, Portulacaceae
details of external features (micromorphol- and Aizoaceae exhibit a specific arrange-
ogy) have been explored in the recent years ment and orientation of smaller and larger
by Scanning Electron Microscopy (SEM), cells known as centrospermoid pattern.
whereas the minute details of cell contents There is specific distribution of long and
(ultrastructure) have been discerned short cells over the veins in the family
160 Plant Systematics
Figure 7.6 SEM seed characteristics of angiosperms. A: Seed of Sceletium campactum (Aizoaceae)
showing centrospermoid cell arrangement; B: Seed-coat of Aeginatia indica
(Orobanchaceae) with isodiametric deeply concave cells and reticulate secondary struc-
ture; C: Single isodiametric tetragonal cell of seed-coat of Matucana weberbaueri
(Cactaceae) with heavy secondary sculpturing; D: Seed of Eschscholzia californica
(Papaveraceae) with cells arranged to form a supercellular net-like pattern; E: Seed-
coat of Jacaranda macarantha (Bignoniaceae) with stellate epicuticular sculpture; F:
Seed of Dichaea sp. (Orchidaceae) almost one cell long with heavy marginal thicken-
ings and irregular secondary sculpture. (From Barthlott, 1984).
Figure 7.7 Various forms of sieve-tube plastids and their possible evolution (After Behnke and
Barthlott, 1983).
Figure 7.10 Ideogram of the somatic complement of Allium ampeloprasm. Of the 32 somatic chro-
mosomes, 8 show secondary constriction (courtesy Prof. R. N. Gohil).
contain only diploids, one diploids and would exhibit the problem of pairing at
tetraploids and one all three levels of ploidy. meiosis but the hybridization followed by du-
It is presumed that tetraploid and hexaploid plication leading to hexaploidy can form a
species of Vulpia arose from diploid progeni- perfectly normal independent species. Such
tors. The duplication of chromosome num- facts have led to the detection of hybrids or
ber of a diploid species may form a tetraploid confirmation of suspected hybrids. Senecio
(autopolyploid). Such a polyploid, however, (Asteraceae) includes the diploid S. squalidus
does not show any or at most may show (2n = 20), the tetraploid S. vulgaris (2n = 40)
minor differences from the diploid species, and the hexaploid S. cambrensis (2n = 60).
and is rarely recognized as an independent The last is intermediate in morphology
taxonomic entity. The hybrid between two between the first two and is found in the
diploid species contains one genome from area where these two grow. Additionally,
either parent and thus, generally doesnt sterile triploid hybrids between two species
survive because of failure of chromosomal have been reported. It seems clear that S.
pairing during meiosis. Hybridization cambrensis is an allohexaploid between the
followed by duplication of chromosomes other two species (Stace, 1989). Similarly,
establishes a tetraploid (allopolyploid; based on chromosome number and karyo-
amphiploid) with normal pairing as both type, Owenby (1950) concluded that
genomes are in pairs. Such a tetraploid Tragopogon mirus (2n = 24), a tetraploid
hybrid with distinct characteristics may be species arose as an amphiploid between two
recognized as an independent species. diploid species, T. dubius and T. porrifolius
A triploid hybrid between a diploid species (2n = 12).
and a tetraploid species may, similarly, not Whereas a species generally shows a
survive as genome from the diploid parent single chromosome number, certain
Taxonomic Evidence 167
populations or infraspecific taxa (subspecies, similarity. This was supported by the distinc-
variety, forma) may sometimes show a tive bimodal karyotype of Agavaceae con-
different chromosome number (or even differ- sisting of 5 large chromosomes and 25 small
ent chromosomal morphology). Such popula- ones. Rudall et al. (1997) advocated the
tions or infraspecific taxa constitute transfer of Hosta (placed in Hostaceae;
cytotypes. Hesperocallidaceae by Thorne, 1999),
Camassia and Chlorogalum (both placed un-
der Liliaceae by Hutchinson, 1973;
Chromosomal structure Hyacinthaceae by Thorne, 1999) to family
Chromosomes show considerable variation Agavaceae on the basis of possession of bi-
in size, position of centromere (Figure 7.9) modal karyotype, a suggestion incorporated
and presence of secondary constriction. The by Judd et al. (2002) and Thorne (2003).
chromosomes are commonly differentiated Rousi (1973), from his studies on the genus
as metacentric (with centromere in middle), Leontodon, showed that data on the basic
submetacentric (away from middle), acro- number, chromosome length, centromeric
centric (near the end) or telocentric (at the position and the occurrence of satellites
end). The chromosomes are also character- provide evidence for the relegation of the
ized by their size. In addition the occurrence former genus Thrincia (x = 4) as a section of
and position of secondary constriction, subgenus Apargia along with section
which demarcates a satellite is important Asterothrix (x = 4, 7). The subgenus Leontodon
in chromosomal identification and charac- is distinct with x = 6 or 7, and a different
terization. The identification of satellites is chromosome morphology.
often difficult, and especially when the sec- Cyperaceae and Juncaceae were earlier
ondary constriction is very long, a satellite placed far apart due to distinct floral struc-
may be counted as a distinct chromosome. ture. Both families have small chromosomes
This situation has often led to erroneous without distinctive centromeres, the latter
chromosome counts. The structure of the may be diffuse or non-localized. These fami-
chromosome set (genome) in a species is lies as such are now considered to be closely
termed karyotype and is commonly dia- related. Such chromosomes (holocentric
grammatically represented in the form of an chromosomes) do not depend on a discrete
ideogram (Figure 7.10) or karyogram. An centromere for meiosis and mitosis and may
analysis of a large number of studies has undergo fragmentation with no deleterious
led to the conclusion that a symmetrical effect. This may result in variable chromo-
karyotype (chromosomes essentially simi- somal counts. In the Luzula spicata group,
lar and mainly metacentric) is primitive and chromosomal counts are reported to be
an asymmetric karyotype (different types 2n = 12, 14, and 24. Interestingly, the total
of chromosomes in a genome) advanced, the chromosomal volume is the same and the
latter commonly found in plants with spe- higher chromosome number is the result of
cialized morphological features, such as Del- fragmentation (agmatoploidy) of these
phinium and Aconitum. holocentric chromosomes. Different chromo-
An interesting example of utilization of some numbers may often occur in different
chromosomal information is family cells of the same root-tip (mixoploidy). The
Agavaceae. The family contains about 16 occurrence of accessory chromosomes
genera such as Agave (and others formerly (known as B-chromosomes) in higher plants
placed in Amaryllidaceae due to inferior generally does not have a significant effect
ovary) and Yucca (and others formerly placed on morphology and, thus, is of little taxo-
in Liliaceae due to superior ovary). These nomic importance. B-chromosomes in bryo-
genera were shifted and brought into phytes, contrarily, are very small (termed m-
Agavaceae on the basis of great overall chromosomes) and often highly diagnostic.
168 Plant Systematics
eighteenth and nineteenth centuries. The The utilization of studies on DNA and RNA
greatest interest has been generated over for understanding of phylogenetic relations
the last 40 years, however, with the devel- has received a great boost over the last de-
opment of improved techniques for studying cade, meriting the establishment of a new
biological molecules, especially proteins and field referred to as Molecular Systematics,
nucleic acids. In recent years, interest has and would be dealt separately after chemot-
focused on the study of allelochemy and re- axonomy. Only proteins would be described
alization of the concept that the animal king- in this section.
dom and the plant kingdom have experi-
enced a chemical coevolution. Plants con-
tinuously evolve new defensive chemical Primary metabolites
mechanisms to save themselves from preda- Primary metabolites include compounds,
tors, and animals evolve methods to over- which are involved in vital metabolic path-
come these defenses. In the process, some ways. Most of them are universal in plants
plant species have developed animal hor- and of little taxonomic importance. Aconitic
mones, thus disturbing the hormonal levels acid and citric acid, first discovered from Ac-
of animals if ingested. onitum and Citrus respectively, participate in
A large variety of chemical compounds are Krebs cycle of respiration and are found in
found in plants and quite often the biosyn- all aerobic organisms. The same is true of
thetic pathways producing these compounds the 22 or so amino acids forming proteins,
differ in various plant groups. In many in- and the sugar molecules, which are involved
stances the biosynthetic pathways corre- in the Kalvin cycle of photosynthesis. The
spond well with existing schemes of classi- quantitative variations of these primary me-
fication based on morphology. In other cases, tabolites may, however, be of taxonomic sig-
the results are at variance, thus calling for nificance sometimes. In Gilgiochloa indurata
revision of such schemes. The natural (Poaceae), alanine is the main amino acid
chemical constituents are conveniently di- in leaf extracts, proline in seed extracts and
vided as under: asparagine in flower extracts. Rosaceae is
similarly rich in arginine.
Micromolecules: Compounds with low mo-
lecular weight (less than 1000).
Primary metabolites: Compounds in- Secondary metabolites
volved in vital metabolic pathwayscit-
Secondary metabolites perform non-vital
ric acid, aconitic acid, protein amino
functions and are less widespread in plants
acids, etc.
as compared to primary metabolites. These
Secondary metabolites: Compounds
are generally the by-products of metabolism.
which are the by-products of metabo-
They were earlier considered to be waste
lism and often perform non-vital func-
products, having no important role. Recently,
tions non-protein amino acids, phe-
however, it was realized that they are im-
nolic compounds, alkaloids, glucosino-
portant in chemical defense against preda-
lates, terpenes, etc.
tors, pathogens, allelopathic agents and also
Macromolecules: Compounds with high help in pollination and dispersal (Swain,
molecular weight (1000 or more). 1977). Gershenzon and Mabry (1983) have
Non-semantide macromolecules: provided a comprehensive review of the sig-
Compounds not involved in information nificance of secondary metabolites in higher
transferstarches, celluloses, etc. classification of angiosperms. The following
Semantides: Information carrying mol- major categories of secondary metabolites
eculesDNA, RNA and proteins. are of taxonomic significance:
.
170 Plant Systematics
Figure 7.12 Structure of anthocyanin forming molecules, differing in right three positions, middle
position absent in Cyanidin, Paeonidin and Pelargonidin, but having OH in Malvidin,
Delphinidin and Petunidin. Cyanidin has OH at both other positions, Paeonidin has
one replaced by OCH3, Pelargonin upper is missing, Malvidin has both replaced by
OCH3, Delphinidin has OH at both and Petunidin one having OH and other OCH3.
Lignin is a highly branched polymer of beakers to dryness on water bath uncovered; to each
add 1% methanolic HCl; load each sample on two
three simple phenolic alcohols. Whereas
circular whatman (No. 1) filter paper, load spot in
gymnosperm lignin is composed of coniferyl centre using Forestall solvent: HCl, Acetic acid and
alcohol subunits, the angiosperm lignin is water (3:10:30); mark spots visually; observe one
a mixture of coniferyl and sinapyl alcohol set of chromatograms of A and B under UV; expose
second set to ammonia vapours by rotating discs
subunits. The alcohols are oxidized to free
over open mouth of NH3 bottle and observe under
radicals by peroxidase enzyme, and the freed UV. Phenyl propanoids can be detected similarly
radicals react to form lignin. except that extraction is done using diethyl ether
instead of ethyl estate, only organic layer is retained
Flavonoids, the more extensively studied and the solvent use for chromatography is BAW
compounds, are based on a flavonoid nucleus (Butanol : Acetic acid: Distilled water-4:1:5) .
consisting of two benzene rings joined by a Common examples are flavonols (mainly
C3 open or closed structure (Figure 7.11). colourless and commonly occurring as
(Presence of flavonoids can be detected as fol- co-pigments, yield bright yellow spot in chro-
lows: Finely chop 5 gm of flower petals or tepals in
beaker; add 20 ml of 2N HCl, cover with aluminium matogram after acid hydrolysis), flavones
foil, and heat at 80-90 degree centigrade for 30-40 (similar, yield dull brown spots),
minutes in water bath; filter and extract filtrate with glycoflavones, biflavonyls (similar, yield dull
15-20 ml ethyl acetate in separating funnel, shake
absorbing spots on BAW), isoflavones
and allow solvent to evaporate; two layers are formed,
upper organic and lower inorganic aqueous layer (colourless, often found in roots of legumes),
(mostly anthocyanins); collect them in two separate flavanones (colourless, occur in leaves,
beakers; label beaker with upper organic layer as B; citrus fruits, yield red colour with HCl), cha-
if aqueous layer is coloured heat for 5-10 minutes to
lcones or aurones (usually occur in yellow
expel ethyl acetate; put back in separating funnel,
add 2-4 ml of amyl alcohol, shake, transfer upper flowers, yield red colour with NH3), Antho-
organic layer to beaker and mark it as A; heat both cyanins (red, blue coloured water soluble)
172 Plant Systematics
and leucoanthocyanins (mainly colourless, and having quite distinct metabolic pathways
mainly in heartwood and leaves of trees, yield of synthesis. However, they carry the same
anthocyanins). functions as anthocyanins. Betalains are
Anthocyanins and Anthoxanthins are mutually exclusive with anthocyanins, and
important pigments in the cell sap of petals concentrated in the traditional group Cen-
providing red, blue (anthocyanins), and yel- trospermae of Engler and Prantl, now recog-
low (anthoxanthins) colours in a large num- nized as order Caryophyllales. Of the nine
ber of families of angiosperms. They are families which contain betalains, seven
formed by anthocyanadins combining with were included in Centrospermae, Cactaceae
different sugars at different places. Six main placed in Cactales or Opuntiales and the
categories (Figure 7.12) of anthocyanin form- ninth was placed in Sapindales. Traditional
ing molecules are recognized providing dif- Centrospermae also included Gyrostemo-
ferent colours: Cyanidin-magenta; naceae, Caryophyllaceae and Molluginaceae
Pelargonidin-orange-red; Delphinidin- which lack betalains and contain anthocya-
purple, blue, mauve; Petunidin-purplish; nins instead. Mabry et al., (1963) on the
Paeonidin-magenta and Malvidin-purple. basis of separate structure and metabolic
These pigments are absent in some fami- pathways, suggested the placement of only
lies and replaced by highly different com- betalain-containing families in Centrosper-
pounds, betacyanins and betaxanthins (to- mae, thus advocating the inclusion of
gether known as betalains), which consist Cactaceae and Didiereaceae and exclusion
of heterocyclic nitrogen-containing rings of Gyrostemonaceae, Caryophyllaceae and
Taxonomic Evidence 173
Alkaloids
Alkaloids are organic nitrogen-containing
bases, usually with a heterocyclic ring of
some kind. They form one of the largest class
of secondary metabolites, with nearly 10,000
different types reported. They are insoluble
in water but soluble in organic solvents, but
Figure 7.14 Main Examples of alkaloids found their salts are soluble in water and insoluble
in the plant kingdom. The distri- in organic solvents. Their distribution is
bution of some is highly specific.
restricted to some 20% of angiosperms. They
are mostly present in storage tissues, seeds,
genus Iris. The chemical evidence supported fruits and roots. They act as chemical
the division into various sections, but defence of plants against herbivory, and
I. flavissima, originally placed in the section allelopathic reactions between plants.
Pogoniris resembled species of the section Alkaloids are generally classified on the
Regelia on the basis of phenolic charac- basis of predominant ring system present in
teristics. Chromosomal evidence also the molecule. They are synthesized from a
supported this transfer. few common amino acids like tyrosine, tryp-
The technique of two-directional paper tophan, ornithine, argenine and lysine.
chromatography, which brings about a more Tobacco alkaloid Nicotine (Nicotiana) is
pronounced separation of flavonoids, has synthesized from nicotinic acid and caffeine
proved very useful in taxonomic studies. (coffee beans and tea leaves) from purine.
Hymenophyton (Bryophytes) was considered Isoquinolene alkaloids morphine, codeine
by some researchers to be a monotypic and papaverine are found in opium poppy
genus, but by others to include two species. (Papaver somniferum). Their distribution is
Markham et al., (1976) on the basis of rapid often specific and thus taxonomically signifi-
flavonoid extraction, two-dimensional cant (Figure 7.14). Conalium is the simplest
chromatographic analysis and identification known alkaloid found in Conium maculatum
(Figure 7.13) concluded that the genus (Apiaceae). Alkaloids are present in special-
contains two distinct species, H. leptodotum ized parts of plant. Higher nicotine content
Taxonomic Evidence 175
concentrate on water bath at 100 degree centigrade
to one fourth volume; add NH4OH or NH3 dropwise
till pH rises to 9-10 and precipitate alkaloids;
centrifuge at 2000 rpm for 5-10 minutes; wash with
1% NH 4 OH; dissolve in few drops of ethanol;
repeat above steps with tea, cigarette and coffee as
control; take circular Whatman paper No. 1, immerse
in 5% Sodium dihydrogen citrate for 5 minutes, dry
in oven; make pore in centre of disc, mark circle of
1 cm, load extract and run chromatogram using
solvent (butanol 217 ml, water 32 m, acetic acid
1.2 gm); and dry; on one chromatogram spray
Iodoplatinate reagent (10 ml 5% Platinum chloride,
add 240 ml 2% KI, make final volume to 500 ml
with water) and to other Dragendroffs reagent (make
two solutions, one 0.6 gm Bismith subnitrate
+ 2 ml HCl+ 1m water; second 6 gm KI dissolved in
10 ml water; mix two solutions and filter, add 7 ml
conc. HCl and 15 ml water, dilute to 400 ml with
water); dry chromatograms and observe colour un-
der UV; calculate Rf value. For Solvent extraction
method take 2 gm of chopped plant material in a
beaker containing 20 ml methanol; heat on water
bath for 30 minutes at 70 degree centigrade, cover-
ing beaker with aluminium foil to prevent evapora-
tion of methanol; filter, suspend residue in 2 ml
methanol, add 12 ml HCl to break cell wall and
release cell sap, shake and filter; wash residue with
8 ml of 1% HCl, and filter; collect all three filtrate,
add NH 4 OH or NH 3 and adjust pH to 10-11; add
precipitate formed in separating funnel, and add
chloroform, shake and collect lower organic layer;
repeat procedure with chloroform, and label all col-
lected solution as A; to acqeous layer in separating
funnel add a pinch of sodium sulphate and 20 ml of
mixture of ethanol and chloroform (2: 3 ratio);
Figure 7.15 Glucosinolates. A: Mustard oil collect and label organic layer as B; put solutions A
glucosid; B: Glucocapparine; and B in test tubes heat in water bath till volume is
C: General structure of Gluco- reduced to about 2 ml; add 2 ml of 1% HCl and 2 ml
sinolates. of chloroform in both test tubes, two layers are
formed; collect upper layer using dropper; if turbid
which a number of species are used as food can be fixed in the cap of screw vial; place strips in
in some areas of the world. They are hydroly- picric acid (5.7 gm in 500 ml of distilled water,
saturated with sodium bicarbonate and filtered) for
sed by various enzymes to release hydrogen 5 minutes and dry with drier or in oven, paste strips
cyanide, the process known as cyanogenesis, in the cap of the vial; put chopped leaves or plant
and the plants as cyanogenic plants. Cassava material in so as cover the entire base of vial, add
and sorghum are especially important staple 2-3 drops of distilled water and 1-2 drops of tolu-
ene, crush material with glass rod; cap the vial;
foods containing cyanogenic glycosides. picrate paper in cap should not touch plant tissue
There are approximately 25 cyanogenic or walls of vial; incubate at 60 0 C for 2 hours ;
glycosides known. The major cyanogenic observe the change of paper colour to red. Ferrous
glycosides found in the edible parts of plants hydroxide paper test: Dip rectangular strips of
Whatman paper in 10% FeSO4 solution for 5 min-
used for human or animal consumption utes, remove and dry; next immerse in 20% NaOH
include Amygdalin (Figure 7.16; almonds, solution for 20-30 seconds and dry, and fix in o cap
Prunus dulcis), Dhurrin (Sorghum album, of vial; put crushed leaves in vial, add 2-3 drops of
S. bicolor). Linamarin (cassava, Manihot distilled water and 2-3 drops of toluene, crush us-
ing glass rod; cap the vial and incubate at 600 for 2
esculenta; lima beans, Phaseolus lunatus), hours; immerse strips in 30% H2SO4; observe colour
Lotaustralin (cassava, Manihot cartha- change to prussian blue due to formation of sodium
ginensis; lima beans, Phaseolus lunatus). ferric ferrocyanide.
Prunasin (stone fruits, Prunus avium, P. padus,
P. persica, P. macrophylla), and Taxiphyllin Terpenes
(bamboo shoots, Bambusa vulgaris). The po- Terpenes include a large group of compounds
tential toxicity of a cyanogenic plant depends derived from the mevalonic acid precursor
primarily on the potential that its consump- and are mostly polymerized isoprene deriva-
tion will produce a concentration of HCN that tives. Common examples are camphor
is toxic to exposed animals or humans. Hy- (Cinnamomum), menthol (Mentha), and caro-
drogen cyanide is released from the cyano- tenoids (Figure 7.17). They seem to have a
genic glycosides when fresh plant material definite role in the allelopathic effects of
is macerated as in chewing, which allows plants. They are lipid soluble found in single
enzymes and cyanogenic glycosides to come membrane bound liposomes, in glandular
together, releasing hydrogen cyanide. Cya- cells as essential oils, and can be easily
nides inhibit the oxidative processes of cells extracted with petroleum ether and chloro-
causing them to die very quickly. Because form, and can be separated by GLC (Gas Liq-
the body rapidly detoxifies cyanide, an adult uid Chromatography), enabling qualitative
human can withstand 50-60 ppm for an hour as well as quantitative measure of chemi-
without serious consequences. However, cal differences.
exposure to concentrations of 200-500 ppm Terpenes are isomeric unsaturated hydro-
for 30 minutes is usually fatal. Whereas most carbons of the basic 5-carbon isoprene
of the cyanogenic glycosides are widely (CH2=C(CH3)-CH=CH2) present in Hamame-
spread, others such as cyclopentenoid cya- lis japonica. Terpenoids, the common group
nogenic glycosides are restricted in distribu- of terpenes are distinguished as 10-Carbon
tion mainly to Flacourtiaceae, Passifloraceae, Monoterpenoids (Fennel, Menthol-Mentha,
Turneraceae, and Malesherbiaceae. Leucine Gymnosperms), 15-C Sesquiterpenoids
derived cyanogenic glycosides are found in (Asteraceae as sesquiterpenol, ABA, some
Rosaceae, Fabaceae, and Sapindaceae. Sev- essential oils), 20-C Diterpenoids (Taxus-
eral families belonging to Magnoliales and Taxol, gibbrellins), 30-C Triterpenoids
Laurales contain Cyanogenic glycosides de- (sterols, steroids, saponins, betulin in Betula
rived from tyrosine. papyrifera), 40-C Tetraterpenoids (Caro-
Presence of cyanogenic glycosides can be tested
by two methods. Picrate paper test: Cut Whatman tenoids) and poly-C Polyterpenoids (Rubber).
no. 1 filter paper into rectangular strips so that they They have been largely used in distinguishing
178 Plant Systematics
specific and subspecific entities, geographic lies. The occurrence of iridoids in several
races and detection of hybrids. Studies in unrelated families, e.g. Hamamelidaceae
Citrus have focused on determination of the and Meliaceae, however, suggests that
origin of certain cultivars. Studies on iridoids could have arisen independently sev-
Juniperus viginiana and J. ashei have refuted eral times in the evolution of angiosperms.
previous hypotheses about extensive hybrid- The occurrence of a distinctive iridoid
ization and introgression between the two aucubin in Budleja has been taken to sup-
species. Their distribution in Pinus has been port its transfer from Loganiaceae to
used (Mirov, 1961) to understand relation- Budlejaceae. Aucubin and geniposide, have
ships. P. jeffreyi has been considered a vari- shown antitumoral activities.
ety of P. ponderosa, but turpentine distribu- Iridioid presence in plant tissues can be tested
tion showed that it strongly resembles the using Trim-Hill Reagent. Take 5 gm of chopped leaves
in a beaker containing 5 ml of 1 % HCl; heat on
group Macrocarpae and not Australes to which water bath at 40-500C for 30 minutes; filter using
P. ponderosa belongs. A major contribution of coarse filter paper; take 0.1 ml of filtrate in a test
terpenoid chemistry has been the use of ses- tube; add 1 ml Trim-Hill Reagent (THR: 10 ml acetic
quiterpene lactones in the family acid, 1 ml 0.2 % CuSO4 and 0.5 ml conc. HCl); warm
over spirit lamp for few seconds; change of colour
Compositae. Many tribes within the family commonly to yellow, orange or red confirms presence
are characterized by distinct types of sesquit- of iridoids. Quantitative estimation can be done by
erpene lactones they produce. This helped to reading absorption at 609 nm, concentration calcu-
establish that genus Vernonia has two cen- lated on the basis of standard curve of aucubin.
tres of distributionone in the Neotropics Cronquist (1977) proposed that chemical
and the other in Africa. Similarly, studies on repellents had an important role in the evo-
Xanthium strumarium (McMillan et al., 1976) lution of major groups of dicots. The alkaloid
have thrown some light on the origin of Old Isoquinolene of Magnoliidae gave way to
World and New World populations. Old World tannins of Hamamelidae, Rosidae and
populations produce xanthinin/ or Dilleniidae, which in turn gave way to the
xanthinosin, whereas the New World popula- most effective iridoids in Asteridae, the fam-
tions contain xanthinin or its stereoisomer ily Compositae developing the most effective
xanthumin. Plants of the chinense complex sesquiterpene lactones.
(from Louisiana) contain xanthumin and are
believed to be the source of introduced Non-Semantide
chinense populations in India and Australia. Macromolecules
Triterpenoids occur in several families.
Betulin occurs only in bark of white birch In addition to DNA and RNA, which will be
(Betula papyrifera) and its relatives, is wa- dealt under Molecular systematics, the mac-
terproof highly flammable, and is taxonomi- romolecules include proteins , and complex
cally useful at species level. Triterpene sa- polysaccharides such as starches and
ponins occur in Apiaceae and Pittosporaceae celluloses. Starches are commonly found in
and support their close relationship. the form of grains which may be concentric
Iridoids constitute another important (Triticum, Zea) or eccentric (Solanum
group of terpenes (mostly monoterpene lac- tuberosum) and present anatomical charac-
tones). They are present in over 50 families teristics which can be seen under a micro-
and their presence is correlated with sym- scope. Detailed studies of starch grains
petaly, unitegmic tenuinucellate ovules, under SEM also hold promise for taxonomic
cellular endosperm and endosperm hausto- significance.
ria. Assuming that independent origin of sev-
eral groups with this combination of inde- Proteins
pendent attributes is unlikely, Dahlgren Proteins, together with nucleic acids, are
brought together all iridoid-producing fami- often called Semantides, which are primary
Taxonomic Evidence 179
constituents of living organisms and are species A, but when mixed with the protein
involved in information transfer. Based on extract of species B, the degree of precipitin
their position in the information transfer reaction would depend on the similarity
DNA is a primary semantide, RNA second- between the proteins of the two species.
ary semantide and proteins the tertiary The antiserum obtained from the mam-
semantides. Semantides are popular mal normally contains several immunoglo-
sources of taxonomic information, and most bulins that can bind to the same antigen, is
of this information has come from proteins. said to be polyclonal. This is because an
The information about DNA and RNA will be antigen activates several different lympho-
discussed under Molecular Systematics in cytes within the animal, each producing a
the next section; only proteins are being different antibody for the same antigen.
discussed here. Techniques have now been developed which
Proteins are complex macromolecules can generate monoclonal antibodies. In a
made up of amino acids linked into a chain method developed by Milstein and Khler
by peptide bond, thus forming a polypeptide (1975), antibody-producing lymphocyte of
chain, organized into a three dimensional mammal (which can not grow and divide in
structure. Because of their complex struc- cultures) was fused with malignant myoloma
ture, special techniques are necessary for the cell (cancer cell which can grow rapidly in
isolation, study and comparison of proteins. cultures) to produce hybrid cells called hy-
These methods include serology, electro- bridoma. These hybridomas can grow, pro-
phoresis and amino acid sequencing. liferate and produce large amount of mono-
clonal antibody.
Serology Antigens are mostly extracted from seeds
and pollen. In early works, crude total com-
The field of systematic serology or serotaxo-
parison of precipitin reactions was done but
nomy had its origin towards the turn of the
now more refined methods have been
twentieth century with the discovery of
developed which can bring about individual
serological reactions and development of the
antigen-antibody reactions. Major methods
discipline of immunology. Precipitin reactions
include:
were first reported by Kraus (1897). The
technique was originally applied by J. Bordet
(1899) in his work on birds, when he reported
that immune reactions are relatively specific
and the degree of cross reactivity was essen-
tially proportional to the degree of relation-
ship among organisms. The present tech-
nique of serology is based on immunological
reactions shown by mammals when invaded
by foreign proteins. In the study of estimat-
ing relationships between plants, the plant
extract of species A containing proteins (an-
tigens) is injected into a mammal (usually a
rabbit, mouse or goat). The latter will develop
antibodies, each specific to an antigen with
Figure 7.18 Double-diffusion serology. A: An-
which it forms a precipitin reaction, coagu-
tigens and antibodies moving
lating and thus making it non-functional. towards each other on the gel.
These antibodies are extracted from the body 1-10 refer to antigen mixtures from
of the animal as antiserum. This antiserum ten different taxa; B: Resultant
is capable of coagulating all proteins in precipitant lines.
180 Plant Systematics
Radio-immunoassay (RIA)
In this technique the antibodies or antigens
are labelled with radioactive molecules
enabling their detection even when present
in minute quantities.
Enzyme-linked immunosorbent
assay (ELISA)
In this technique either the antibodies or
antigens are labelled linked with enzymes,
Figure 7.19 Immuno-electrophoresis. A: Anti- thus enabling detection even in very small
gen separation by electrophoresis;
quantities.
B: Antibodies and separated anti-
gens diffusing towards each other;
It must be noted that there are specific
C: Resultant precipitant lines. sites on proteins (determinants), which are
capable of initiating production of immu-
noglobulins in specific cells of mammals.
Double-diffusion serology Determinants are regions consisting of
In this technique the antigen mixture and 10-20 amino acids and one protein may com-
antiserum are allowed to diffuse towards one prise several different determinants and
another in a gel (Figure 7.18). The different thus several antigens.
proteins travel at different rates and thus Extensive studies of the immunoelectro-
the reactions occur at different places on the phoretic patterns of the genus Bromus were
gel. This method allows comparison of done by Smith (1972, 1983). Results showed
precipitin reactions of several antigen mix- that North American diploids of the genus
tures from different taxa simultaneously on are reasonably diverse. The study also high-
the same gel. In a modification of this lighted that antisera raised from different
method, the antiserum is placed in a circu- species could provide different results. On
lar well surrounded by a ring of several wells the basis of serological studies, Smith
containing the samples of antigens. established the distinct identity of
B. Pseudosecalinus, previously recognized as
Immuno-electrophoresis a variety of B. secalinus. This separation was
In this technique the antigens are first supported by cytological evidence also.
separated unidirectionally in a gel by elec- Serological studies have also supported the
trophoresis and then allowed to travel removal of Nelumbo from Nymphaeaceace
towards the antiserum (Figure 7.19). This into a separate family Nelumbonaceae,
method enables a better separation of con- placement of Hydrastis in Ranunculaceae
stituent reactions but has the limitation that (and not Berberidaceae), and merger of
only one antigen mixture can be handled on Mahonia with Berberis (Fairbrothers, 1983).
a single gel. Serology may be done through compari-
son of protein mixtures or the comparison
Absorption of single isolated and purified proteins.
Protein mixtures from different species Schneider and Liedgens (1981) developed a
often contain a large number of common pro- complex but excellent procedure of mono-
teins, especially those involved in common clonal culture of antibodies, but unfortu-
metabolic processes. The antibodies for nately used this for construction of a phylo-
these common proteins (antigens) are first genetic tree not parallel with accepted evo-
removed from the antiserum so that there lutionary schemes. Fairbrothers (1983) cau-
is a more logical comparison of precipitin tioned that an evolutionary tree should not
reactions. be constructed on the reactions of a single
Taxonomic Evidence 181
enzyme or a single species. Lee (1981) remove water; pour 5% Stacking gel (0.82 ml
using purified protein for antigen and using Acrylamide-bisacrylamide, 3.27 ml distilled water,
0.625 ml 0.5 M Tris-HCl, 0.05 ml 10% SDS, 0.25 ml
different techniques concluded that Franse- 10% APS, 5l TEMED) up to one third volume of
ria (Asteraceae) should be merged with glass mould, insert comb carefully so that bubbles
Ambrosia. are not formed, allow to polymerize for 30 min; in-
stall gel assembly into electrophoresis apparatus;
add 5X SDS Running buffer (6.026 g Tris, 28.8 g
Electrophoresis Glycerine, 2 g SDS; make to 200 ml with distilled
The technique of serology serves to compare water) in upper and lower chamber, remove the comb
from under the buffer; load protein samples of
the degree of similarity between the protein different concentrations into wells by micropipette
mixtures of different species and does not in- (also load molecular weight marker proteins in one
volve the identification of proteins. The sepa- lane); connect electrodes and run current of 20 mA
ration and identification of proteins can be for 10-15 min, increase current to 40 mA, track the
mobility of sample; disconnect power, remove gel
done by electrophoresis. Separation is based carefully; stain gel with Coommassie Blue stain
on the amphoteric properties of proteins (200 ml methanol, 50 ml glacial acetic acid, 250 ml
whereby they are positively or negatively water, 0.25% Coommasie Blue) for 15-30 min;
charged to various extents according to the destain gel till bands are visible.
Method for Western blotting: Use gel from elec-
pH of the medium, and will travel through gel trophoresis without staining; make cut at bottom of
at various speeds across a voltage gradient, gel for orientation; cut nitrocellulose sheet to the
usually carried out in a polyacrylamide gel size of gel and dip in transfer buffer (14 g glycerine,
(polyacrylamide gel electrophoresisPAGE). 3 g Tris base, 0.75 g SDS, 100 ml methanol, make
volume to 1 litre with distilled water); soak sponge
The procedure involves homogenizing the tis- in transfer buffer and place wet sponge on gel
sues (containing proteins) in a buffer solu- holder; place Whatman paper on sponge; place gel
tion. Sample is loaded into wells in the cen- over Whatman paper avoiding air bubbles; keep
tre of the gel. The current is run for a spe- membrane with shining surface towards gel and
roll with glass pipette; place Whatman 3 mm paper
cific time, and the proteins run up to differ- over the membrane and a second sponge over the
ent points on the gel. The gel, usually 1 cm paper; place assembly in transfer tank containing
thick, is cut into three thin slices, each about sufficient transfer buffer to completely cover the blot;
3 mm thick. These slices are subjected to place assembly in case with gel facing the cathode
and membrane the anode; run current for 4 hours
different staining techniques and proteins at 36 V; lift membrane and stain with Poinceau S
are identified using various criteria. In com- Staining Solution.
monly used Western blot technique the pro-
tein bands are transferred from the gel to In the technique of isoelectric focusing,
nitrocellulose membrane for further process- a gel of a single pore size, is set up with a pH
ing. In disc-electrophoresis, a gel of larger gradient (usually 3-10), so that proteins
pores is placed over a gel of smaller pores. come to lie on the gradient corresponding to
The former is used for crude separation and their iso-electric point. These can be sub-
the latter for a complete separation. sequently separated more completely by disc-
electrophoresis. Isoelectric focusing of
Method for SDS-PAGE Electrophoresis: Prepare
Rubisco (Ribulose 1, 5 diphosphate carboxy-
working concentrations of 2, 5, 10 and 25 g of lase) has been very useful in determining
protein sample by diluting the stock solution; add relationship between species of Avena,
loading buffer (5 ml 0.5 M Tris, pH 6.8, 8 ml 50% Brassica, Triticum, and several other genera.
Glycerol, 8 ml 10% SDS, bromophenol blue, 2 ml
mercaptoethanol added immediately before load-
It is an excellent protein for helping to evalu-
ing); boil for 5 min; store in ice; clean, dry and ate hybridization.
assemble glass plates of casting assembly; prepare Electrophoretic studies have supported the
10% resolving gel (3.24 ml Acrylamide-bisacrylamide, origin of hexaploid wheat (Triticum aestivum)
3.5 ml distilled water, 2.5 ml 1.5 M Tris-HCl, 0.1
ml 10% SDS, 0.5 ml 10% APS, 10l TEMED) and
from Aegilops tauschii and T. dicoccum. Johnson
pour into assembly up to its two third position; over- (1972), working on storage proteins showed
lay with water ; allow gel to polymerise for 30 min, that T. aestivum (AABBDD) and T. dicoccum
182 Plant Systematics
Figure 7.20 Cladogram of 25 species of seed plants based on the ancestral sequence method
used by Boulter (1974) (after Boulter).
(AABB) possess all proteins of the A genome morphological and cytological data. By mixing
of the diploid T. monococcum (AA). They also proteins of A. tauschii and T. dicoccum it
share proteins of the B genome of uncertain was seen that the electrophoretic properties
origin. The D genome is believed to have of the mixture closely resemble those of
come from Aegilops tauschii as evidenced by T. aestivum, thus proving the origin of the
Taxonomic Evidence 183
latter from the two previous species. Electro- differences between the proteins result from
phoretic studies have also helped to assess different sequences of amino acids in the
species relationships in Chenopodium polypeptide chain. It is now possible to break
(Crawford and Julian, 1976), by combining off the amino acids from the polypeptide
data from flavonoids with proteins. A flavonoid chain one by one, identify each chromato-
survey of seven species showed that in some graphically and build up the sequence of
taxa, the flavonoid data were fully compatible amino acids step by step. Cytochrome c is
with interspecific protein differences, but in the most commonly used molecule and out
some cases, did not agree. Thus, Chenopo- of 113 amino acids, 79 vary from species to
dium atrovirens and C. leptophyllum had species, but alteration of even one of the
identical flavonoid patterns but could be other 34 destroys the functioning of the
distinguished by their different seed protein molecule. Being present in all aerobic or-
spectra. C. desiccatum and C. atrovirens, on the ganisms, it is ideal for comparative studies.
other hand, were closely similar in seed Boulter (1974) constructed a cladogram
proteins but differed in flavonoids. Both (Figure 7.20) of 25 species of spermatophytes
flavonoid and protein evidence, however, dis- using the ancestral sequence method.
tinguished C. hians from C. leptophyllum, thus Ginkgo biloba, the only gymnosperm used
providing support to their recognition as sepa- occupied isolated position in the cladogram.
rate species. Vaughan et al., (1966) through Ginkgo with an isolated phylogenetic posi-
the study of serology and electrophoresis have tion is no new discovery, but rather a long
shown that Brassica campestris and B. oleracea established fact. But the fact that amino acid
are closer to each other than to B. nigra. sequencing also produces a similar
Electrophoresis has also made possible cladogram establishes the significance of
the separation of allozymes (different forms such studies in understanding phylogeny.
of the same enzyme with different alleles Recent data from various fields have
at one locus) and isozymes (or isoenzymes pointed to the merger of Aegilops with
with different alleles at more than one Triticum. Autran et al., (1979) on the basis of
locus). Barber (1970) showed that certain N-terminal amino acid sequencing supported
polyploids possess isozymes of all their this merger. In general, the number of amino
progenitors plus some new ones. Backman acid differences is roughly parallel to the
(1964) crossed two strains of maize, each distance between the organisms in tradi-
with three different isozymes. F1 possessed tional classifications, suggesting that the
all six isozymes. The hybrids thus show method is broadly reliable. There are, how-
molecular complementation. ever, certain contradictions. The number of
Studies of the genus Tragopogon have con- differences between the cytochrome c of Zea
firmed that the tetraploid T. mirus is a hybrid mays and Triticum aestivum (both members of
between two diploid species, T. dubius and the same family Poaceae) is greater than
T. porrifolius. Whereas the parental diploids between Zea mays and certain dicotyledons.
were found to be divergent at close to 40 per It has been found that cytochrome c and
cent of the 20 enzyme loci examined, the plastocyanin (another protein commonly
tetraploid hybrid possessed completely addi- used in amino acid sequencing studies) can
tive enzyme patterns. The evidence thus sup- exhibit a large number of parallel substitu-
ported the recognition of a hybrid on the basis tions (identical changes from one amino acid
of morphological and chromosomal evidence. to another at the same position in the pro-
tein in different organisms), thus rendering
them unsuitable for constructing phylog-
Amino acid sequencing enies. The practical solution is to use evi-
Since only 22 amino acids are known to be dence from a wide range of proteins, prefer-
the constituents of proteins, the primary ably using different techniques.
184 Plant Systematics
cades, starting with comparison of whole hydroxyapatite. Any radioactive strands (A)
DNA molecules. It is now possible to break that have separated from the DNA duplexes
DNA at specific sites, generate maps of in- pass through the column, and the amount is
dividual genes, determine sequence of measured from their radioactivity. A graph
genes, and make multicopies of a DNA showing the percentage of ssDNA at each
through Polymerase chain reaction (PCR) temperature is drawn. The temperature at
technique. These help in generating enough which 50% of the DNA duplexes (dsDNA) have
molecular data for comparison. been denatured (T50H) is determined.
Bolton (1966) found that only half nucle-
Total DNA/DNA otide sequences in the DNA of Vicia villosa
are similar (homologous) with those of Pisum,
hybridization while only 1/5th are homologous between
The early studies on utilization of nucleic Phaseolus and Pisum. In the technique of
acids in systematics involved DNA/DNA hy- DNA/RNA hybridization, the RNA is hybrid-
bridization using the whole DNA for study. ized with the complementary DNA of related
In a method developed by Bolton and plants. Mabry (1976) used this technique in
Mecarthy (1962), the extracted DNA is Centrospermae (Caryophyllales) and con-
treated to make it single stranded. The DNA cluded that the family Caryophyllaceae (al-
of another organism is, similarly, made though lacking betalains) is quite close to
single stranded. The two are subsequently betalain-containing families, but not as
allowed to hybridize in vitro. The degree of close as the latter are to each other.
reassociation (annealing) expresses the de-
gree of similarity in sequences of nucle- Chromosome painting
otides of the two organisms. Procedure in- The technique of chromosome painting pro-
volves heating DNA so that it becomes de- vides another way to compare entire ge-
natured into single strands (ssDNA). The nomes. A fluorescent label is attached to the
temperature is lowered just enough to allow DNA of individual chromosomes of one spe-
the multiple short sequences of repetitive cies. These chromosomes are exposed to the
DNA to rehybridize back into double-stranded chromosomes of another species. The re-
DNA (dsDNA). The mixture of ssDNA (repre- gions of gene homology will hybridize taking
senting single genes) and dsDNA (represent- up the fluorescent label and the painted
ing repetitive DNA) is passed over a column chromosomes can be examined under a mi-
packed with hydroxyapatite. The dsDNA croscope. The method is a modification of
sticks to the hydroxyapatite; ssDNA does not fluorescence in situ hybridization (FISH).
and flows right through. The purpose of this Chromosome painting studies in humans
step is to be able to compare the informa- have shown that human chromosome 6 has
tion-encoding portions of the genome counterparts in chromosome 5 of chimpan-
mostly genes present in a single copy zee, chromosome 7 of pig and chromosome
without having to worry about varying
23 of cow as few examples.
amounts of noninformative repetitive DNA.
The ssDNA of species A is made radioactive.
The radioactive ssDNA is then allowed to Unravelling DNA Structure
rehybridize with nonradioactive ssDNA of Understanding DNA structure involves
the same species (A) as well as in a sepa- complex procedure to unravel the arrange-
rate tube the ssDNA of species B. After ment of genes in DNA, and sequence of
hybridization is complete, the mixtures arrangement of nucleotides which differen-
(A/A) and (A/B) are individually heated in tiates different genes and the DNA of differ-
small (23C) increments. At each higher ent organisms. The procedure involves some
temperature, an aliquot is passed over distinct steps.
Taxonomic Evidence 189
DNA Cleaving
This technique is a landmark development
of 1970s that can be used to generate physi-
cal maps of individual genes or the entire
genome. The DNA extracted from a species
is cut (cleaved) at specific points (recogni-
tion-site; restriction site), yielding restric-
tion fragments using restriction endonu-
cleases (REs). The specific enzymes are
named using the first letter of the genus and
the first two letters of the species of the bac-
terium from which the enzyme is isolated.
Thus, enzyme EcoRI which cleaves DNA at
every site where it finds sequence GAATTC
(Figure 7.23) is obtained from Escherichia
coli. HindIII obtained from Haemophilus
influenzae strain Rd cleaves DNA at AAGCTT,
and BamHI from Bacillus amyloliquefaciens
cleaves GGATCC. More than 400 restriction
enzymes have already been isolated. Their
natural function is to inactivate invading vi-
ruses by cleaving the viral DNA. Majority of
restriction enzymes recognize a 6-nucle-
otide sequence, but others recognize 4-
nucleotide sequence. Thus AluI (from
Arthrobacter luteus) recognizes AGCT, TaqI
(from Thermus aquaticus) TCGA, and HaeIII
(from Haemophilus aegypticus) GGCC.
Each restriction enzyme can recognize a
sequence four to six nucleotides long, hav-
ing twofold rotational symmetry, because it
can be rotated 1800 without change in the
base sequence. Thus, sequence recognized
by EcoliRIif read from 5 to 3 in both strands,
of DNA segmentwould read GAATTC, but
if read from 3 to 5 in both strands it would Figure 7.23 Cleavage of DNA using EcoRI re-
read CTTAAG. This symmetry is known as striction enzyme. The enzyme gives
palidrome (as, for example, in nonsense staggered cuts to ensure compli-
phrase: AND MADAM DNA that is read simi- mentary single stranded termini.
larly from both ends). This feature combined
with the fact that most restriction enzymes
give staggered cuts (and not straight cuts) middle of the recognition sequence, result-
wherein they cut two strands of DNA at dif- ing in blunt end or flush end.
ferent points, produces complementary The use of restriction enzymes allows the
single-stranded termini that can be rejoined DNA to be dissected into a precisely-defined
later using enzyme DNA ligase. Such set of specific segments. Using different
enzymes produce sticky ends or cohesive enzymes, sites cleaved by different enzymes
ends. Others like AluI and HaeIII, however, can be identified and ordered into a restric-
make simple double stranded cut in the tion map or physical map.
190 Plant Systematics
Method of DNA Cleaving: Label three sterile and complementary ends of two different
microfuge tubes as E (for EcoRI), H (for HindIII) and l DNA molecules join to form double stranded
(for control). In tube E add 12l distilled water, 2l
of 10 X Buffer (prepared by dissolving 108 g Tris, 55 recombinant DNA, in the presence of DNA
g Borate and 7.4 g EDTA in 700 ml of distilled wa- ligase. For successful cloning, one of the
ter, adjust pH to 8.3 and sterilize by autoclaving), parental DNAs incorporated into recombi-
5ml of lamda DNA (1mg) and 1l of EcorRI restriction nant DNA molecule is capable of self-repli-
enzyme ( 2 U). In tube H add same chemicals except
1l of HindIII restriction enzyme ( 2 U) instead of cation, and is known as cloning vector. In
EcorRI. In l tube add same chemicals but replace practice, the gene or DNA fragment of
distilled water for restriction enzyme. Flick all tubes interest is inserted into a specially-chosen
to mix well and spin for 5 minutes in microfuge. cloning vector, which is used as a vehicle
Incubate all tubes at 37oC for 60 minutes in water
bath. Stop reaction by incubating tubes at 65oC for 5 for carrying foreign DNA into a suitable host
minutes. Subject contents of all three tubes to agar- cell, such as a bacterium.
ose gel electrophoresis for 1 hour at 100 V. Stain the
gel with ethidium bromide. Fragments with be lined
in each lane according to size. These can be com- Plasmid vector
pared and suitably analysed.
Plasmids are extra-chromosomal double-
Method of Agarose Gel Electrophoresis: Prepare stranded circular DNA molecules present in
1% agarose in 1X TBE buffer; heat the mixture on a microorganisms, especially bacteria. The
hot plate or microwave until the solution becomes plasmid chosen as vector contains a gene for
clear; add Ethidium bromide (EtBr) (0.5 g/ml in
antibiotic resistance. In the most commonly-
0.5X TBE buffer) to agarose solution when it cools
to 45-50 0C; clean the casting tray, place on table employed technique (Figure 7.24-I), the re-
and adjust equilibrium bubble; position the comb 1 combinant plasmids (with foreign DNA in-
mm above the plate; pour solution into gel tray en- serted into plasmid) are added to an E. coli
suring that there is no bubble between or under the
bacterial culture pretreated with calcium
teeth of the comb; allow the gel to set; pour some 1X
TBE buffer over the gel; remove the comb; mix 1.5 ions. When subjected to brief heat shock,
l each of DNA sample and bromophenol blue track- such bacteria are stimulated to take up DNA
ing dye (dissolve 70 g sucrose in 50 ml distilled from their surrounding medium. Once within
water by heating, add 0.25 g bromophenol blue and
the bacterial cell, the plasmid replicates au-
20 ml 0.5M EDTA, raise volume to 100 ml) and
slowly load mixture into wells; connect assembly tonomously and is passed on to the progeny
with power supply and run the gel at voltage of 80 during cell division. The bacteria containing
V until the dye has travelled 75% of the distance; recombinant plasmid can be separated by
turn off the equipment, remove the gel and view
treatment with an antibiotic which removes
under UV; alternately stain gel with 0.025% meth-
ylene blue for 20-30 minutes, destain with luke- bacterial cells without plasmid. Because a
warm water for 30 minutes and observe under white large number of different recombinant plas-
light. mids are formed, incorporating different seg-
ments, the one of interest can be separated
DNA Cloning by combined procedure of replica plating and
A detailed analysis of DNA requires avail- in situ hybridization (Figure 7.24-III).
ability in sufficient quantity of DNA or its Through replica plating, numerous dishes
restriction fragments. DNA cloning is a with representatives of the same bacterial
technique to produce large quantities of a colony are prepared. In one of the replica
specific DNA segment. plates, cells are lysed and DNA fixed on to
The technique of cloning has largely been surface of nylon or nitrocellulose membrane.
made possible through recombinant DNA DNA is next denatured; membrane is incu-
technology. The DNA molecules from two dif- bated with labelled single stranded DNA
ferent sources are treated with restriction probe, containing complementary sequence
enzyme that makes staggered cuts in DNA, being sought. The unhybridized probe is
leaving single-stranded tails in either of the washed away, and the location of labelled
cleaved DNA. These tails act as sticky ends hybrids determined by autoradiography. In
Taxonomic Evidence 191
Figure 7.24 DNA Cloning. I. Cloning using plasmid vector. A: DNA fragment of an organism;
B: Cleaved plasmid DNA; C: Recombinant DNA molecule (5-10 kb); D: Bacterium;
E: Bacterium with recombinant DNA. II. Cloning eukaryotic DNA using lambda ph-
age. A: Mutant strain of lambda phage with DNA having two EcoRI cleavage sites;
B: Extracted DNA of phage treated with EcoRI; C: Two fragments of phage DNA,
middle segment discarded; D: DNA segment from eukaryotic cell (about 25 kp);
E: Recombinant DNA; F: Recombinant DNA packed into phage head; G: Culture dish
with bacterial culture with clear plaques of phage infection. III: Combined procedure
of replica plating and in situ hybridization. A: Dish with bacterial colonies; B: Trans-
ferring bacterial cells from dish (a) to a filter paper (b); C: Filter paper with bacterial
colonies; D: inoculating empty culture dish by pressing filter paper; E: Dish with
bacterial colonies; F: Culture dish with bacterial colonies for replica plating;
G: Nitrocellulose membrane with replica of bacterial colonies; H: DNA separated by
lysis of cells and denatured to become single stranded adhering to membrane;
I: Radiograph of labelled hybrid.
192 Plant Systematics
refined technique of fluorescence in situ A yeast gene can be cloned in shuttle vec-
hybridization (FISH), probe labelled with tor, subjected to site-specific mutagenesis
fluorescent dyes is used, and labelled hybrids in E. coli, and then moved back to the yeast
localized with fluorescent microscope. to examine the effects of induced modifica-
The live representatives of the identified tions in native host cells.
clones can be found on corresponding sites
on the original plates, these cells are grown Artificial chromosome vectors
into large colonies, which serve to amplify Attempts have been made over the recent
recombinant DNA plasmid. After sufficient years to develop vectors which can accom-
amplification, the DNA is extracted and modate DNA sequences larger than 45 kb.
recombinant plasmid DNA is separated from One of the most important of these vectors is
bacterial DNA. The recombinant plasmid DNA YAC (yeast artificial chromosome), which
is again treated with the same restriction can accept DNA fragments as large as 1000
enzyme that releases plasmid DNA from the kb. More recently the use of BAC (bacterial
cloned DNA segments. Latter can be sepa- artificial chromosome) has become more
rated from plasmid DNA by centrifugation. common. BACs are specialized bacterial
plasmids (F factors) that contain bacterial
Bacteriophage vector origin of replication, and can accommodate
Bacteriophage (lambda) is commonly used up to 300 kb of DNA segments.
as a vector. The DNA of the phage is linear
50 kb in length. During treatment with re- Amplification through PCR
striction enzyme middle 15 kb segment of The earlier procedures for obtaining a large
phage DNA which contains genes for lysis and quantity of DNA were very cumbersome, in-
can be dispensed with is replaced with foreign volving the cloning of genes into bacteria,
DNA. The resultant recombinant DNA is which replicate genes along with their own
packed into phage heads in vitro (Figure 7.24-II). genome. The development of PCR (poly-
Phage particles can inject the recombi- merase chain reaction) technique has now
nant DNA molecules into E. coli cells, where made it possible to obtain large number of
they will replicate and produce clones of re- copies of a gene using enzyme in place of
combinant DNA molecules. As lambda heads bacteria. Small pieces of single-stranded
can accommodate molecules of only 45 to 50 DNA with known sequence are used as prim-
kb size, it can accommodate inserts (foreign ers (Figure 7.25). These primers are built
DNA fragments) of only 10-15 kb. from templates of short regions of DNA that
occur at either end (flanking) of DNA seg-
Cosmid vector ment of interest, do not occur any where else
in genome (unique), and are invariable (con-
For inserting larger DNA insertion, cosmid
served) in all taxa to be investigated. The
vectors are used. A cosmid is a hybrid be-
extracted DNA from a species is mixed with
tween plasmid and lambda phage. Cosmids
the primer, DNA polymerase (usually taq
combine plasmids ability to replicate au-
polymerase, which can tolerate heat), buff-
tonomously with in vitro packaging capacity
ers, salts and free nucleotides in a tube. The
of lamda phage. A cosmid vector can carry
mixture is alternately heated and cooled.
out inserts of 35 to 45 kb. Heating denatures DNA making it single-
stranded. The subsequent cooling allows
Eukaryotic shuttle vectors primers to bind to the complementary DNA
Some of the most useful cloning vectors are sequences. Polymers are designed so that
shuttle vectors that can replicate in both E. they can not bind with each other. The tem-
coli and another species. Such shuttle vec- perature is then raised to make polymerase
tors are very useful for genetic dissections. active, bind to the already formed complex
Taxonomic Evidence 193
DNA libraries
DNA libraries are collections of cloned DNA
fragments. Two basic types of DNA libraries
can be created. Genomic libraries are pro-
duced from the total DNA extracted from the
nuclei and contain all of the DNA sequences
of the species. cDNA libraries (cDNA
complementary DNA) on the other hand, are
derived from DNA copies of usually the mes-
senger RNA, and thus represent DNA se-
quences which are expressed in the species.
This is significant because a large number
of DNA sequences do not express them-
selves, and are of little significance. Some-
times, individual chromosomes of an organ-
ism are isolated by a procedure that sorts
chromosomes based on size and the DNA
content. The DNAs from the isolated chro-
mosomes are then used to construct chro-
mosome-specific DNA libraries, which fa-
cilitates the search for a gene that is known
to reside on a particular chromosome. This
is particularly useful for organisms with
large genomes, such as humans.
To construct a DNA library, the DNA from Figure 7.25 Polymerase chain reaction tech-
a species is randomly cleaved using enzymes nique.
194 Plant Systematics
which recognize short nucleotide sequences, probe. The segments of different sizes can
the fragments are incorporated into lambda be ordered to generate physical maps.
phage and multiple copies of each recombi- Method: Perform gel electrophoresis of DNA sample;
nant DNA obtained. These are stored and con- look for fluorescent bands; treat gel with 200 ml of
stitute a permanent collection of all DNA se- 0.25 M HCl for 15 minutes; rinse with distilled
quences present in the genome of a species. water and treat twice with 200 ml denaturing solu-
tion (DS: 1 M NaCl, 0.5 M NaOH) for 15 minutes
To construct a cDNA library using mRNA, a each; neutalize the gel by soaking in 200 ml of
complementary stand of DNA is constructed Neatralising solution (2.5 M NaCl, 0.5 M Tris-HCl
by reverse transcriptase. RNA-DNA duplexes (60.5 g/l), adjust pH to 7.4 with conc. HCl) for
are converted into double-stranded DNA mol- 15 minutes; Lay transfer buffer TB (20 X SSC, 3 M
NaCl (175 g/l), 0.3 M Tri Sodium Citrate (88 g/l)),
ecules by combined activity of ribonuclease prewetted double layer of Whatman paper onto trans-
H, DNA polymerase I, and DNA ligase. The fer tray, so as to reach both ends of reservoir; put
double-stranded DNA is incorporated into gel upside down on Whatman paper, roll gently with
lambda phage and further processed as de- pipette to remove bubbles; place TB-prewetted ny-
lon membrane on the gel; put 3 layers of TB-
tailed above. prewetted Whatman paper on top of it; place 1 dry
Whatman paper on top; put 3 layers of blotting
papers on top of Whatman papers; pour 200-400 ml
Gene Mapping 20X SSC buffer into tray; add 10-20 cm layers or
Above techniques contribute in developing 2/3 of a pack of paper towels; place 500g weight on
the physical maps of gene. Whereas restric- top and allow the transfer for 12-16 hours; take out
membrane from assembly; crosslink DNA on nylon
tion enzymes enable cleavage at specific membrane by exposing it to UV light for 3-5 min-
sites, the cloning and amplification tech- utes; for detection either expose membrane to
niques help in obtaining a large number of X-Ray film or else stain the membrane with 0.025%
copies of fragments. methylene blue for 20 minutes and then destain in
water.
Identification of the location of genes and
DNA sequences on restriction fragments The technique of Northern blot hybrid-
separated by gel electrophoresis constitutes ization, (so named as it is opposite of South-
an important step of genome mapping. The ern blot technique), is used to hybridize RNA
process of gene mapping has been simpli- molecules separated by electrophoresis.
fied with the availability of cloned organelle Denaturing is affected by formaldehyde, and
genomes which are used as probes. In the after transfer to the membrane, the RNA
commonly used Southern blot hybridiza- blot is hybridized either with RNA probe or
tion method (named after E. M. Southern, DNA probe.
who published it in 1975), a cloned piece of The procedure of gene mapping is suffi-
chloroplast DNA (to be used as probe) is la- ciently complex. It involves crossing two plants,
belled with radioactive phosphorus and de- selfing F1 and producing a large number of
natured to produce single-stranded DNA. F2 plants. Genotypes of parents and offsprings
The cleaved DNA from the specific species, are determined using various markers.
after electrophoretic separation of frag- Although physical maps can be constructed by
ments, is placed on a nylon or nitrocellu- identifying and aligning overlapping DNA
lose membrane, and denatured by using fragments, more elaborate genetic maps are
alkaline solution and finally immobilized by constructed using genetic markers.
drying or UV irradiation. It is renatured and Genetic map can be unified with physical
allowed to bind to the radioactive probe on map using molecular markers. The physical
a nylon membrane. Only matching se- map thus obtained will afford single frame-
quences will bind, and carry the radioac- work for organizing and integrating diverse
tive tag. When transferred to an X-ray film types of genetic information, including the
the bound bands will appear as dark bands, position of chromosome bands, chromosome
which will show the positions of DNA se- breakpoints, mutant genes, transcribed
quences that have hybridized with the regions, and DNA sequences.
Taxonomic Evidence 195
Figure 7.26 Structure of DNA. One of the four bases is joined to a deoxyribose sugar to form
nucleoside, which links with a phosphate to yield a nucleotide. A long chain of nucle-
otides forms the DNA strand having OH (3 terminus) group at one end and phosphate
(5 terminus) at the other end. Purines bases have double ring structure, whereas
pyrimidines have single ring structure.
Arabidopsis thaliana, developing into a strong cence as they pass through the well (tube or
genetic tool. Two main procedures of DNA gel). The output is directly analyzed by a com-
sequencing are commonly used. puter, which analyses, records and prints
In the first procedure developed by Allan out the results.
Maxam and Walter Gilbert, the DNA chain The PCR product can be sequenced di-
is cleaved using four different chemical rectly using restriction enzymes. Since re-
reactions, each targeting A, G, C or C+T. In striction sites are spread at several places
the second procedure developed by Fred on the DNA, the results are less sensitive
Sanger (chain termination method) and col- to local vagaries of selection or differences
leagues, there is in vitro synthesis of DNA in in mutation rate. Sequencing of both the
presence of radioactive nucleotides and spe- strands often minimizes errors.
cific chain terminators to generate four
populations of radioactively-labelled frag- Analysis of Sequence data
ments that end with As, Gs, Cs and Ts, re- For the analysis of changes at the level of
spectively. nucleotides and the amino acids, the align-
The procedure begins with obtaining iden- ment of DNA sequences derived from differ-
tical DNA fragments up to about 500 bp us- ent taxa constitutes an important step. Align-
ing a restriction enzyme. The preparation ment helps in detection of insertion, dele-
is divided into four samples. Each sample is tion or substitutions of one or more base
denatured into single strands, incubated pairs at different sites within a DNA. When
with a short radioactively-labelled oligo- comparing two sequences with L positions
nucleotide complementary to 3 end of single (nucleotides), of which D positions are dif-
strands. To each sample is also added DNA ferent, the evolutionary distance counted A
polymerase and all the four deoxyribonu- number of different models have been pro-
clease triphosphate precursors (dNTPs). To posed to explain evolutionary distance be-
one sample is now added chain terminator tween two sequences on account of nucle-
ddATP (2, 3 -dideoxyadenosine triphos-
otide changes.
phate), to the second ddGTP (2, 3 -
dideoxyguanosine triphosphate), to the third
ddCTP (2, 3 -dideoxycytidine triphosphate),
Jukes-Cantor Model
and to the fourth ddTTP (2, 3 - T. Jukes and C. Cantor (1969) realized, even
dideoxythymidine triphosphate). The first before the DNA sequences were available for
sample after reaction will have all the seg- analysis, that alignments between se-
ments terminated at As, the second at Gs, quences with many differences might cause
the third at Cs and the fourth at Ts. The frag- a significant underestimation of the actual
ments are separated on gel electrophoresis, number of substitutions that occurred since
and their positions determined by autorad- sequences last shared a common ancestor.
iography. Different bands, representing dif- They assumed that each nucleotide was as
ferent segments will be arranged like a lad- likely to change into any of the other three
der. By reading the ladder, a complete nucle- nucleotides. A can thus equally well change
otide sequence of DNA chain can be deter- into T, C or G. Based on this assumption they
mined. In conventional slab-gel procedure, created a mathematical model in which rate
four different samples are loaded in four dif- of change to any one of the three alterna-
ferent wells on a gel. Nowadays, automated tive nucleotides was assumed to be a, and
DNA sequencing machines are used which the overall rate of substitution for any given
make use fluorescent dyes instead of radio- nucleotide was 3a. According to this model,
active nucleotide. The products of all four if a site within a gene was occupied by a
samples are run through single well, and C (t = 0), then the probability (P ) that this
photocells are used to detect the fluores- site would still be same nucleotide at time
Taxonomic Evidence 197
1 (t = 1) would be PC(1) = 1 - 3a. On the other If evolutionary rates between species are
hand if C changed to some other nucleotide, similar, substitution rates can help in cal-
the probability that after time t, the site would culating the dates of evolutionary events.
contain C can be calculated as:
Kimura two-parameter (K2P) Model
PC(t) = (3/4)e-4at
The model was proposed by M. Kimura (1980)
The probability rate matrix for the
and accounts for different rates of nucle-
changes in four nucleotides can be repre-
otide changes involving transitions and
sented as under:
transversions. Supposing we assign value a
for transitions and b for transversions, the
A G C T probability rate matrix would be represented
A 1-3a a a a as:
G a 1-3a a a
A G C T
C A 1-a-2b a b b
a a 1-3a a
T a a a 1-3a G a 1-a-2b b b
C b b 1-a-2b a
B CTCCAAGTCTCTCACTG - - - - - - TCGTCAGTT 1 3 1 5 0
C CTCCAAGACTCTCAGTGGTTCAATCGTCTGTT 1 0 2 4 3
D GTCCAAGTCTCTCACTGGTTCAATCGTCTGTT 2 3 1 4 3
Figure 7.27 Alignment of a DNA sequence for 32 nucleotide positions in four species. nucle-
otides at a particular position showing variation can be coded as characters, and are
shown in bold. The codes assigned to nucleotide states are A=0, C=1, G=2 and T=3.
Character number four here involves deletion of a particular sequence in species B.
Presence of this deletion is coded as 5 and absence of deletion as 4. Computer
programs (such as DNADIST and DNAPARS of PHYLIP) are available which can read
DNA sequence data directly.
be used for a particular set of taxa. In phylo- from A to G or vice versa; or from C to T and
genetic analysis each nucleotide position is vice versa) are more common than
considered as one character, and each of the transversions (A to T, A to C, G to C, G to T; C
four nucleotides as one character state. A to A, C to G, T to A, T to G). The latter are
large number of nucleotide positions, how- often given more weight depending upon the
ever dont show variation among taxa, and of frequency of distribution in the taxa, more
others that are variable are often uninfor- frequently the transitions are distributed,
mative because of being autapomorphic for a greater weight is consequently given to
given taxon. This leaves only a small propor- transversions. Thus if transitions occur 4
tion of nucleotide positions that can be used times more than transversions, a transition
for phylogenetic analysis. Chromosomal mu- may be given weight of 1 and transversion a
tations such as additions, deletions and weight of 4. Computer programs such as
translocations are identified as evolutionary DNAPARS, DNADIST, etc. of PHYLIP are avail-
novelty, and are generally given more able, which can read and analyse the DNA
weightage than individual nucleotides (Fig- sequence data directly. Details are described
ure 7.27). Such chromosomal changes rep- under chapter on Developing Classifications.
resenting apomorphy are important and of- Whereas alignment of simple chloroplast
ten used in establishing a lineage. Thus all genes such as rbCL is easier, others such
members of subfamily Faboideae lack one of as genes encoding RNAs, secondary struc-
the inverted repeats found in the chloroplast ture (folding) of the molecule is also ac-
DNA of most angiosperms. counted for. The nucleotide differences that
In our example illustrated in Figure 7.27, result in major changes in the structure of
the four nucleotides are given coding from 0 a product, such as ribosomal RNA or a pro-
to 3 for different nucleotides. Other strate- tein, and may have greater effect in the plant
gies could also be used. Transitions (change function, often receive greater weight than
Taxonomic Evidence 199
I SNP
II SNP
SNP SNP
Figure 7.28 The effect of the location of SNPs in the restriction sites in two DNA molecules.
DNA with TA nucleotide pair shows normal cleaving with EcoRI, resulting in two
restriction fragments. In another DNA (II) substitution of CG pair prevents cleaving
resulting in single large cleavage fragment. This results in unequal fragments in
different DNA molecules.
those changes that do not affect the func- ously developed. Some of the commonly used
tion. Several computer algorithms are avail- procedures are discussed below.
able to evaluate and handle such analysis.
Single-Nucleotide
DNA Polymorphism Polymorphisms (SNPs)
Utilization of sequence data in phylogenetic DNA differences in a population may often be
analysis involves the identification of unique the result of differences in single nucleotide
sequences which show certain differences in pair at a particular locus, say from C-G to T-
different organisms or populations. These A. This may result in three genotypes in a
sequences, which could be used as genetic population: homozygous with C-G at corre-
markers in identification of character-state sponding sites on both homologous chromo-
differences between the target taxa, and somes, homozygous with T-A at correspond-
ultimate construction of phylogenetic trees. ing sites on both homologous chromosomes,
The phenomenon is also known as DNA and heterozygous with C-G in one chromo-
Fingerprinting or DNA polymorphism. The some and T-A in homologous chromosome.
technique is now widely used in forensic However, all SNPs are not located on coding
investigations. A variety of methods have sequences or genes. In human genome, for
been developed to detect this polymorphism. example, any two randomly chosen DNA mol-
Each method has its own advantages and ecules differ at one SNP site about every 1000-
limitations, and suitable for a particular 3000 bp in protein coding DNA, but 500-1000
situation. New methods are being continu- bp in noncoding DNA segments. SNPs are
200 Plant Systematics
A B C D Random Amplified
Polymorphisms (RAPDs)
1
RAPD method is commonly used for popula-
2 tion studies and involves short (10bp)
random PCR primers that will bind to the
matching sequences on genome. The ap-
3 proach is useful for species where cloned
DNA probes are not available (essential for
4 Southern blotting method), or where DNA se-
5 quences are not known (necessary for PCR
amplification where oligonucleotide prim-
ers have to be constructed). The method uses
6 PCR primers of 8-10 nucleotides with
random sequence. These primers are tried
7 singly or in pairs in PCR reactions to am-
8 plify segments of DNA from a species. These
short primers anneal at multiple sites on
9 DNA, and those that anneal at suitable dis-
tance are able to amplify unknown region
between them. The presence or absence of
10 such amplified regions in different individu-
11 als can be suitably coded for analysis. The
procedure helps in identifying different geno-
types in the population. The morphologic
12 characters of interest are mapped accord-
ing to their linkage to markers. The results
13 of one of several primers used are shown in
Figure 7.30. Gel electrophoresis yields 13
Figure 7.30 Results of one of the several prim- bands, of which four show polymorphism, the
ers used for RAPD procedure on rest nine are monomorphic. Each of the poly-
DNA from four species. A total of morphic allele can be represented similarly
13 bands appear on electrophore- as + for the presence of band, - for its ab-
sis gel, 4 show polymorphism in sence, and if + is dominant, both genotypes
species compared , whereas 9 are
+/+ and +/ will show this band, whereas it
monomorphic.
will be lacking in / genotype. Thus for the
last band in the gel species B and C have /
two fragments from homologous chromo- genotype, where as A and D are either +/+
somes, one of 3000 bp length and another of or +/.
5000 bp length.
RFLP analysis, however, contains much Amplified Fragment Length
lesser data than complete DNA sequencing,
accounting only for presence or absence of Polymorphisms (AFLPs)
sites 6-8 base pairs long, but the method AFLP (amplified fragment length polymor-
affords advantage of surveying larger seg- phism) technology is used for nucleic acid
ments of DNA. The use of this method has, fingerprinting, exploiting molecular genetic
however, declined with the development of variations existing between closely related
improved and less expensive sequencing genomes in the form of restriction fragment
techniques in the recent years. length polymorphisms.
202 Plant Systematics
SPECIES A
3 A-T-C-G-G-T-T-G-T-G-T-G-T G-T-G-T-G-T-G-A-G-G-T-T-A 5
SPECIES B
5 T-A-G-C-C-A-A-C-A-C-A-C-A C-A-C-A-C-A-C-T-C-C-A-A-T 3
3 A-T-C-G-G-T-T-G-T-G-T-G-T-G-T G-T-G-T-G-T-G-T-G-A-G-G-T-T-A 5
5 T-A-G-C-C-A-A-C-A-C-A-C-A-C-A C-A-C-A-C-A-C-A-C-T-C-C-A-A-T 3
Primer 5 T-A-G-C-C-A-A
3 A-T-C-G-G-T-T-G-T-G-T-G-T G-T-G-T-G-T-G-A-G-G-T-T-A 5
5 T-A-G-C-C-A-A-C-A-C-A-C-A C-A-C-A-C-A-C-T-C-C-A-A-T 3
G-A-G-G-T-T-A 5 Primer
Primer 5 T-A-G-C-C-A-A
3 A-T-C-G-G-T-T-G-T-G-T-G-T-G-T G-T-G-T-G-T-G-T-G-A-G-G-T-T-A 5
5 T-A-G-C-C-A-A-C-A-C-A-C-A-C-A C-A-C-A-C-A-C-A-C-T-C-C-A-A-T 3
G-A-G-G-T-T-A 5 Primer
5 T-A-G-C-C-A-A-C-A-C-A-C-A C-A-C-A-C-A-C-T-C-C-A-A-T 3
3 A-T-C-G-G-T-T-G-T-G-T-G-T G-T-G-T-G-T-G-A-G-G-T-T-A 5
5 T-A-G-C-C-A-A-C-A-C-A-C-A C-A-C-A-C-A-C-T-C-C-A-A-T 3
3 A-T-C-G-G-T-T-G-T-G-T-G-T G-T-G-T-G-T-G-A-G-G-T-T-A 5
5 T-A-G-C-C-A-A-C-A-C-A-C-A-C-A C-A-C-A-C-A-C-A-C-T-C-C-A-A-T 3
3 A-T-C-G-G-T-T-G-T-G-T-G-T-G-T G-T-G-T-G-T-G-T-G-A-G-G-T-T-A 5
5 T-A-G-C-C-A-A-C-A-C-A-C-A-C-A C-A-C-A-C-A-C-A-C-T-C-C-A-A-T 3
3 A-T-C-G-G-T-T-G-T-G-T-G-T-G-T G-T-G-T-G-T-G-T-G-A-G-G-T-T-A 5
Figure 7.32 VNTR procedure. Specific primers to flank regions of tandem repeats are constructed
and used for PCR amplification of DNA segments with tandem repeats, for compari-
son of different species.
length of repeating unit, and in minimum ers that flank tandem repeats, and then
and maximum number of tandem copies using PCR technology to generate multiple
occurring in the DNA of a population. A re- copies of tandem repeat DNA, whose length
peating sequence of 2-9 bp is often known can be determined by gel electrophoresis
as microsatellite or SSLP (Simple se- (Figure 7.32). VNTR technology generates
quence length polymorphism), whereas data quickly and efficiently and is often
one of 10-60 bp as minisatellite. If these used for population studies, for examining
repeated sequences show variation within relationships within a species, or between
a population or a species, they are known closely related species.
as variable number tandem repeats STRP is very useful in mapping, as a large
(VNTRs). At a given locus in different indi- number of alleles present in the population
viduals, the length of tandem repeats may often have high proportion of genotypes that
vary, because of irregularities of crossing are heterozygous for different alleles. STRPs
over and replication, and as such can be are widely used in DNA typing (DNA finger-
used as genetic marker. Identification of printing) involving identification of human
microsatellites involves constructing prim- individuals in criminal investigation.
204 Plant Systematics
(A) Rice (B) Wheat (C) Maize (D) Fox tail (E) Sugar cane (F) Sorghum (G) Ancestral
millet cereal
5 II
Figure 7.34 Grass genome evolution. I: Conserved linkages (synteny groups) between the rice
genome and other grass species. A: Rice genome with chromosomes divided into
blocks of linked genes; B: Wheat genome with chromosomes showing correspondance
with rice segments; C: Maize genome with duplicated blocks indicating ancient tet-
raploidy; D: Foxtail millet genome; E: Sugar cane genome; F: Sorghum genome;
G: Inferred or reconstructed order of segments in a hypothetical ancestral creal
genome cosisting of a single chromosome pair. II. Circular arrangement of synteny
groups in above grasses. Thin dashed lines indicate connections between blocks of
genes. (After Moore et al., 1995).
206 Plant Systematics
DNA, found a support for an expanded order Because of the synteny groups in the
Malvales, including most of the genera pre- genomes, homologous genes can often be
viously included in Sterculiaceae, Tiliaceae, identified by location alone. It must, how-
Bombacaceae and Malvaceae. They propose ever, remembered that the circular diagram
to merge Sterculiaceae, Tiliaceae and is only for convenient representation; there
Bombacaceae with Malvaceae and subdivide is not indication that the ancestral grass
this enlarged family Malvaceae into nine chromosome was actually circular. It was a
subfamilies based on molecular, morphologi- normal linear chromosome.
cal and biogeographical data. A large number of workers have targeted
the family Poaceae using different criteria
Grass Genome and techniques. All molecular phylogenies
point to the Stipeae to be an early-diverging
Genome analysis of cereal grasses has lineage. The morphological characters of the
provided useful information. Of the common Stipeae are thus a mixture of synapo-
cereal grasses, rice has the smallest ge- morphies linking them with pooids and
nome (400 mb). Maize genome is 2500 mb, symplesiomorphies, which they share with
whereas the largest genome is found in many other grasses. The studies based on
wheat (17,000 mb). In spite of large varia- chloroplast gene: cpRFLP (Davis and Soreng,
tions in chromosome number and genome 1993), ndhF sequences (Catalan et al., 1997),
size, there are a number of genetic and and nuclear genes: through ITS (Hsiao et al.,
physical linkages between single-copy genes 1994), phytochrome b (Mathews and
that are remarkably conserved amid a back- Sharrock, 1996), and granule bound starch
ground of very rapidly evolving repetitive synthase I (Mason-Gamer et al., 1998) all
DNA sequences. By comparison of rice chro- supported the same placement of Stipeae.
mosomes numbered R1 to R12 (Figure 7.34-I), Similar studies of comparison of results from
with conserved regions marked in lower chloroplast DNA and nuclear DNA in
case (R1a, R1b, etc.), it is found that con- Triticeae, however, produced different
served regions homologous to rice are found results, although two chloroplast phylogenies
in other cereals. The wheat monoploid chro- constructed from RFLP (Mason-Gamer and
mosome set is designated W1 through W7. Kellog, 1996) and rpoA sequences (Petersen
One region of W1 contains single-copy se-
and Seberg, 1997) produced similar results.
quences that are homologous to those in
rice segment R5a, another contains single-
copy sequences that are homologous to those New World Tetraploid
in rice segment R10, and still another
contains single-copy sequences homologous Cottons
to those in rice segment R5b. Each of such Genomic studies in genus Gossypium
conserved physical and genetic linkages is (Wendel et al., 1995) using isozymes,
called a synteny group. It is notable that nuclear ITS sequences, and chloroplast re-
maize genome has repetition of segments, striction site analysis, indicated that New
confirming that maize is a complete, very orld diploids are monophyletic, as are the Old
ancient tetraploid with two duplicated World diploids. The New World tetraploid cot-
genome blocks rearranged relative to each tons, including G. hirsutum were formed by
other. allopolyploidy of genomes A (from the Old
Simultaneous comparison of above cereal World) and D (from the New World). It was
grass genomes is better represented with the found that H. hirsutum has a chloroplast de-
help of a circular diagram (Figure 7.34-II). rived from one of the African species, and it
The segments are arranged into a circle in must have acquired it only about 1-2 mil-
the same order in which they were aligned lion years ago, well after the formation of the
in the hypothetical ancestral chromosome. Atlantic Ocean.
Taxonomic Evidence 207
Accordingly, in ap2 mutants, ag expression single copy region), for b subunit of ATP syn-
spreads to whorls 1 and 2, and, in ag mu- thase (AtpB), ITS region of ribosome, phyto-
tants, ap2 expression spreads to whorls 3 and chrome B, and granule bound starch
4. This assumption enables us to explain the synthaseI. An encouraging congruence of re-
phenotypes of single and even double mu- sults of these diverse studies was met in
tants. This pattern of gene expression has tribe Stipeae of grasses. In other cases, re-
been assayed by in situ hybridization of RNA sults from chloroplast phylogeny and nuclear
in floral cells with labelled probes for each of phylogeny did not agree, suggesting caution
the genes. The results confirm the above as- in relying on any attribute singly for con-
sumption of repressive action of concerned structing molecular phylogenies. The gene
genes. It is significant that triple mutation trees constructed from rbcL have great util-
involves all the genes. The phenotype of ap2 ity in angiosperms. Chase et al., (1993) at-
pi ag triple mutant does not have any nor- tempted to yield the phylogeny of all seed
mal floral organs. There are concentric plants using 499 rbcL sequences. The analy-
whorls of leaves instead. sis proved a few sequences to be pseu-
dogenes, and entire families were repre-
Gene trees sented by single sequences. The data set
Molecular systematics presents powerful have been reanalyzed by other authors to
tools for constructing phylogenetic trees. yield parsimonious trees (Rice et al., 1997).
Commonly used methods over the recent RbcL data has supported that Caryophyllidae
years include studies on chloroplast DNA is monophyletic. It has also supported the
using restriction site polymorphism (cpRFLP), union of family pairs Asclepiadaceae-
analysis of chloroplast gene for subunit F of Apocynaceae, Araliaceae-Apiaceae, and
NADP dehydrogenase (ndhF, in the small copy Brassicaceae-Capparaceae. The data also
region), for a and b subunits of RNA supported the polyphyletic nature of Saxifra-
polymerase II (rpoA and rpoC2, in a large gaceae and Caprifoliaceae.
210 Plant Systematics
Chapter 8
Developing Classifications
character-state in common by two or more These families are primitive because they
taxa) does not necessarily indicate monophy- possess primitive characters (or character-
ly. Synapomorphy (possession of derived or states) and primitive characters (or charac-
apomorphic character-state in common by ter-states) are those which are possessed by
two or more taxa), on the other hand, is a these primitive families. Over the recent
more reliable indicative of monophyly. It is years, a better understanding of these con-
thus common to use homologous shared and cepts has become possible. It is generally
derived character-states for cladistic stud- accepted that evolution has proceeded at dif-
ies. Before analysing the methodology of han- ferent rates in different groups of plants so
dling data for phylogenetic analysis, it is im- that among the present-day organisms,
portant to understand the major terms and some are more advanced than others. The
concepts used in Phylogenetic Systematics. first step in the determination of relative ad-
vancement of characters, is to ascertain
which characters are plesiomorphic and
Phylogenetic Terms which are apomorphic. Stebbins (1950) ar-
gued that it is wrong to consider the charac-
Many important terms have been repeatedly
ters as separate entities, since it is through
used in discussions on the phylogeny of an-
the summation of characters peculiar to an
giosperms, with diverse interpretation,
individual, that natural selection operates.
which has often resulted in different sets of
Sporne (1974) while agreeing with this, be-
conclusions. A prominent case in point is
lieved that it is scarcely possible initially to
Melville (1983), who regards the angiosperms
avoid thinking in terms of separate charac-
as a monophyletic group. His justification
ters, which can be treated better statistically.
several ancestral forms of the single fossil
Given insufficient fossil records of the ear-
group Glossopteridae gave rise to an-
liest angiosperms, comparative morphology
giospermsrenders his view as polyphyletic
has been largely used to decide the relative
in the eyes of the greater majority of authors
advancement of characters. Many doctrines
who believe in the strict application of the
have been proposed but unfortunately most
concept of monophyly. The involvement of
rely on circular reasoning. Some of the
more than one ancestor makes angiosperms
important doctrines are described below:
a polyphyletic group, a view that has been
The Doctrine of conservative regions
firmly rejected. A uniform thorough evalua-
holds that certain regions of plants have
tion of these concepts is necessary for proper
been less susceptible to environmental in-
understanding of angiosperm phylogeny. fluence than others and, therefore, exhibit
primitive features. Unfortunately, however,
Plesiomorphic and over the years, every part of the plant has
Apomorphic Characters been claimed as conservative region. Also,
the assumption that a flower is more con-
A central point to the determination of the servative than the vegetative parts is derived
phylogenetic position of a particular group from classifications which are based on this
is the number of primitive (plesiomorphic) assumption.
or advanced (apomorphic) characters (al- The doctrine of recapitulation holds that
though the term character is often used early phases in development are supposed
broadly in literature, more appropriately to exhibit primitive features, i.e. ontogeny
primitive or advanced and similarly repeats phylogeny. Gunderson (1939) used
plesiomorphic and apomorphic refer to dif- this theory to establish the following
ferent character-states of a character, and evolutionary trends: polypetaly to gamopetaly
not different characters) that the group con- (since the petal primordia are initially
tains. In the past, most conclusions on primi- separate, the tubular portion of the corolla
tiveness were based on circular reasoning: arises later); polysepaly to gamosepaly;
214 Plant Systematics
the phylogeny of angiosperms has been con- homologous with leaves because their de-
siderably advanced with the recent develop- velopment is identical.
ment of cladistic methods. These employ a During the latter half of the present cen-
distinct methodology, somewhat similar to tury, phylogenetic interpretation has been
taxometric methods in certain steps in- applied to these terms. Simpson (1961) de-
volved, leading to the construction of cla- fined homology as the resemblance due to
dograms depicting evolutionary relation- inheritance from a common ancestry. Anal-
ships within a group. Certain groups of an- ogy, similarly, represents functional simi-
giosperms are reported to have a combina- larity and not due to inheritance from a
tion of both plesiomorphic and apomorphic common ancestry. Mayr (1969) similarly de-
characters, a situation known as fined homology as the occurrence of simi-
heterobathmy. Tetracentron has primitive lar features in two or more organisms,
vesselless wood but the pollen grains are ad- which can be traced to the same feature
vanced, being tricolpate. in the common ancestor of these organ-
isms. It is, as such, imperative that homol-
Homology and Analogy ogy between two organisms can result only
from their having evolved from a common
Different organisms resemble one another ancestor, and the ancestor must also con-
in certain characters. Taxonomic groups or tain the same feature or features for which
taxa are constructed based on overall resem- the two organisms are homologous.
blances. The resemblances due to homology Wiley (1981) has provided a detailed in-
are real, whereas those due to analogy are terpretation of these terms. Homology may
generally superficial. A real understanding either be between two characters, two char-
of these terms is, thus, necessary in order acter states, or between two organisms for a
to keep organisms with superficial resem-
blance in separate groups. The two terms
as such play a very important role in under-
standing evolutionary biology.
These terms were first used and defined
by Owen (1848). He defined Homology as
the occurrence of the same organ in dif-
ferent animals under every variety of Figure 8.2 Homology between characters (or
forms and functions. He defined Analogy character states). In the first ex-
as the occurrence of a part or an organ ample, character A is plesiomorphic
in one animal which has the same func- and B is apomorphic. In the second
tion as another part or organ in a differ- example, B is apomorphic in rela-
ent animal. If applied to plants, the rhizome tion to A but plesiomorphic in rela-
of ginger, the corm of colocasia, tuber of tion to C as all three belong to an
potato, and runner of lawn grass are all evolutionary transformation series.
homologous, as they all represent a stem.
The tuber of potato and the tuber of sweet particular character or character state. Two
potato, on the other hand, are analogous as characters (or character-states) are
the latter represents a root. homologous if one is directly derived from
Darwin (1959) was the first to apply these the other. Such a series of characters is
terms to both animals and plants. He defined called an evolutionary transformation
homology as that relationship between series (also called morphoclines or
parts which results from their develop- phenoclines). The original, pre-existing
ment from corresponding embryonic parts. character (or character- state) is termed
The parts of a flower in different plants are plesiomorphic and the derived one as
thus homologous and these, in turn, are apomorphic or evolutionary novelty.
216 Plant Systematics
Three or more character-states may be 4. When the same relatively simple char-
homologous if they belong to the same evo- acter is found in a large number of
lutionary transformation series (ovary su- species, it is probably homologous in
perior>half-inferior> inferior). The terms all the species. Sets of characters may
plesiomorphic and apomorphic are, however, similarly be homologous.
relative. In an evolutionary transformation 5. If two organisms share the characters
series representing characters A, B and C of sufficient complexity and judged
(Figure 8.2), B is apomorphic in relation to A homologous, other characters shared
but it is plesiomorphic in relation to C. by the organisms are also likely to be
Two or more organisms may be homolo- homologous.
gous for a particular character (or charac-
A B C AA BB CC
ter-state) if their immediate common ances-
tor also had this character. Such a charac-
ter is called shared homologue. If the char-
acter-state is present in the immediate com-
mon ancestor, but not in the earlier ances-
tor (Figure 8.3), i.e. the character-state is a
derived one, the situation is known as
synapomorphy. If the character-state is
I II
present in the immediate common ances-
tor, as well as in the earlier ancestor, i.e. it
is an original character-state, the situation
is known as symplesiomorphy (note sym-).
The homology between different organ- Figure 8.3 Homology between two organisms
isms is termed special homology, as repre- B and C. In diagram I, similarity is
sented by different types of leaves in differ- due to symplesiomorphy as the
ent species of plants. Different leaves in the character was unchanged in the
same plant such as foliage leaves, bracts, previous ancestor. In II, it is due
floral leaves would also be homologous, rep- to synapomorphy as the previous
ancestor had a plesiomorphic char-
resenting serial homology. The following
acter and the two now share a de-
criteria may be helpful in identifying homol- rived character.
ogy in practice:
1. Morphological similarity with respect Parallelism and convergence
to topographic position, geometric po- Unlike homology, if the character shared by
sition, or position in relation to other two organisms is not traced to a common an-
parts. A branch, for example, occurs cestor, the similarity may be the result of
in the axil of a leaf, although it may homoplasy (sometimes considered synonym
be modified in different ways. of analogy). It can result in three different
2. Similar ontogeny. ways. One, the organisms have a common
3. Continuation through intermediates, ancestor but the character-state was not
as for example, the evolution of mam- present in their common ancestor (parallel-
malian year from gills of fishes, evo- ism). It could also result from two different
lution of achene fruit from follicle in characters in different ancestors evolving
Ranunculaceae. Similarly, vessels into identical character-states (conver-
having evolved from tracheids, the gence). Similarity could also arise from loss
primitive forms of vessels are more of a particular character (reversal), thus
like tracheids, with elongated nar- reverting to ancestral condition (loss of pe-
rower elements with oblique end rianth in some families). All the three situ-
walls. ations represent false synapomorphy
Developing Classifications 217
Figure 8.7 The application of cutting rules to distinguish between monophyly, paraphyly and
polyphyly. The group is represented by lighter portion of the tree. Monophyletic group
can be separated by a single cut below the group, a paraphyletic group by one cut
below the group and one or more higher up. A polyphyletic is separated by more than
one cut below the group. A monophyletic group represents one complete branch, a
paraphyletic group one larger portion of the branch; whereas the polyphyletic group
represents more than one pieces of a branch (based on Dahlgren et al., 1985).
Hennig) and those that are paraphyletic group, i.e., it represents more than one
and do not contain all descendants of the piece of a branch.
most recent common ancestor of the group. Gerhard Haszprunar (1987) introduced the
A polyphyletic group, according to him, is term orthophyletic while discussing the phy-
one whose most recent ancestor is not cla- logeny of Gastropods. An orthophyletic group
distically a member of that group. The is a stem group, i.e. a group that is
terms holophyletic and monophyletic are paraphyletic because a single clade (the
now considered synonymous. Diagrammatic crown group), has been excluded. The term
representations of Ashlocks concept of has not been followed in other groups, espe-
polyphyly, monophyly and paraphyly is pre- cially in botanical systematics. Sosef (1997)
sented in Figure 8.6. compares the existent hierarchical models
An excellent representation of mono- of classification. He argues that a phyloge-
phyly, paraphyly and polyphyly is presented netic tree can be subdivided according to a
by cutting rules, devised by Dahlgren and monophyletic hierarchical model, in which
Rasmusen (1983). The distinction is based only monophyletic units figure or, according
on how the group is separated from a repre- to a Linnaean hierarchical model, in which
sentative evolutionary tree (Figure 8.7). A both mono- and paraphyletic units occur.
monophyletic group is separated by a Most present-day phylogeneticists try to fit
single cut below the group, i.e. it repre- the monophyletic model within the set of no-
sents one complete branch. A paraphyletic menclatural conventions that fit the Lin-
group is separated by one cut below the naean model. However, the two models are
group and one or more cuts higher up, i.e. intrinsically incongruent. The monophyletic
it represents one piece of a branch. A poly- model requires a system of classification of
phyletic group, on the other hand, is sepa- its own, at variance with currently accepted
rated by more than one cut below the conventions. Since, however, the mono-
Developing Classifications 221
phyletic model is unable to cope with reticu- a polyphyletic group, because they are derived
late evolutionary relationships; it is from two separate ancestors at level m. If,
unsuited for the classification of nature. The however, A, B, and C are under one group, B
Linnaean model is to be preferred. This and C would still now be components of a
renders the acceptance of paraphyletic paraphyletic group, because one descendant
supraspecific taxa inevitable. of the common ancestor at level n is kept out
As is true for the distinction between par- of the group. A natural group would be one,
allelism and convergence, similarly, the con- which includes all descendents of the com-
cepts of paraphyly and polyphyly (both of which mon ancestor, or the group is monophyletic.
are rejected by modern phylogenetic system-
atics while constructing classification), hold
good, when the former is applied to a group of Phylogenetic Diagrams
closely related organisms and latter to dis- The affinities between the various groups
tantly related organisms. The concepts of plants are commonly depicted with the
become ambiguous when a small group of help of diagrams, with several innovations.
organisms is considered. In Figure 8.6-III, These diagrams also help in understanding
taxa B and C if brought togetherwould form the classification of included taxa. An
Figure 8.8 A phylogenetic tree representing the evolutionary history of plants including angio-
sperms. The vertical axis represents the geological time scale. Only extant (living)
plants are shown reaching the top.
222 Plant Systematics
Figure 8.10 Mapping of pollen grain dispersal stage in different dicotyledons on a two-dimen-
sional diagram (Dahlgrenogram) of Dahlgren, representing transverse section through
the top of a phylogenetic shrub. Pollen grain dispersal in 2-celled stage (unshaded),
3-celled stage (dotted), or mixed (hatched). (Courtesy Gertrud Dahlgren).
the top plane (cross-section of the top) pre- thetical pathway of changes within a group
sented as a two-dimensional diagram (Fig- that explains the present phenetic pattern,
ure 8.10), and this has been very useful in using the principle of parsimony. A cla-
mapping the distribution of various charac- dogram is a representation of the inferred
ters in different groups of angiosperms, and historical connections between the entities
the comparison of these provides a good as evidenced by synapomorphies. The verti-
measure of correspondence of various char- cal axis of the cladogram is always an
acters in phylogeny. This diagram has been implied, but usually non-absolute time scale.
popularly known as Dahlgrenogram. Cladograms are ancestor-descendant
Thornes diagram (2000) is similarly the sequences of populations. Each bifurcation
top view of a phylogenetic shrub (Figure of the cladogram represents a past specia-
10.23), in which the centre representing the tion that resulted in two separate lineages.
extinct primitive angiosperms, now absent, It must be pointed out, however, that
is empty. considerable confusion still exists between
A cladogram represents an evolutionary application of the terms cladogram and
diagram utilizing cladistic methodology, phylogenetic tree. Wiley (1981) defines a cla-
which attempts to find the shortest hypo- dogram as a branching diagram of entities
224 Plant Systematics
Figure 8.11 Tree (cladogram) for different families of the order Alismatales. Support indicated
for branches refers to bootstrap support, discussed in subsequent pages. (Repro-
duced from APweb vesion 7 (June , 2008), with permission from Dr P. F. Stevens.)
A B C D E F G H
I
Figure 8.12 Evolutionary history of a hypothetical group of organisms which started with the
ancestral species with woody habit, alternate leaves, cymose inflorescence, 5 red
petals, 5 stamens, 2 free carpels and dry fruit with many seeds. Eleven character
state transformations at different stages have resulted in 8 present day species.
Note that two of the changes (carpel union and loss of three stamens) have occurred
twice, and as such only nine genetic switches are involved. The ancestral species
at levels I , IA, II, III an IV have disappeared.
Having known the evolutionary history of genus, and include all 8 species (2 genera)
the group, we could use synapomorphy and in one family (and, of course, depending upon
the concept of monophyly. Assuming that all the degree of diversity from related families,
eight lineages (groups of populations) are suf- this could still be a constituent of a mono-
ficiently distinct to be recognized as distinct typic order). The third option would be to have
species, we would have eight species. The a single genus of eight species.
simplest way would be to group these eight Note the importance of synapomorphy in
species into four genera, each having a com- determining monophyly. Character-states
mon ancestor. Two of these common ances- alternate leaves, cymose inflorescence and
tors have disappeared, but two are still liv- 5 petals (character-states of different char-
ing and would also be included in the respec- acters not same) have been passed un-
tive genera (it will be more appropriate to changed in all the eight descendents (spe-
regard E as ancestral to F and G ancestral to cies), which as such are symplesiomorphic
H). These could be further assembled into for each of these, and this symplesiomorphy
two families of four species each (two gen- will be valid between any two (or more)
era each) having a common ancestor at level species that you choose to combine into a
IA and II, and these two families into one genus, say, D and E, or C and F, or say
order with a common ancestor at level I. ABCDE. On the other hand, if we consider
Please note that common ancestor at level only synapomorphy, the monophyly is easily
I, IA, II, III and IV are also no longer living. deciphered. A and B are accordingly
The second option would be to include synapomorphic for yellow petals, C and D for
ABCD in one genus, and EFGH in another white petals, E and F for one carpel and
Developing Classifications 227
Stamens 2
Stamens >2
Carpels united
Carpels free
C
B Plants woody
Plants herbaceous
Plants woody
Carpels united
Carpels free
Stamens 2
Stamens >2
Plants herbaceous
Stamens 2
Stamens >2
Carpels united
Plants herbaceous
Carpels free
Plants woody
D
Carpels
Stamens
Habit
A
E
Figure 8.13 Diagrams based on evolutionary pattern depicted in Figure 10.11. A: Venn diagram
based on the assumption that there are 21 woody species of which, 13 are with
united carpels, and 8 with free carpels. Of the 13 with united carpels, 7 have 2
stamens whereas 6 have more stamens. B: An unrooted tree based on Venn dia-
gram. C: A possible rooted tree, if evolutionary history of the group was not known,
15 possible rooted trees could be drawn. D. Rooted tree based on knowledge that
herbaceous habit arose from woody habit, and we know further evolution of woody
species. Other possibilities are discussed subsequently. E: Data matrix of above,
where the number of species are not indicated.
228 Plant Systematics
G and H for united carpels. Similarly, A, B, C leaves, cymose inflorescence and five pet-
and D are synapomorphic for herbaceous als. The species at level IA and above addi-
habit. The development of fleshy fruit in A, tionally share woody habit, VI and above ad-
single seed in C, 10 stamens in F represent ditionally united carpels, V and above one
the occurrence of a derived character state carpel (and not fused carpels). Similarly, spe-
in a single taxon, and termed as cies at level II and above share herbaceous
autapomorphy. Such character states are habit (instead of woody habit) in addition to
not helpful in cladogram construction, al- three common, at level III and above addi-
though indicative of divergence. Develop- tionally yellow petals, and at level IV and
ment of 2 stamens in D and H independently above additionally (in place of yellow petals)
represents homoplasy, and may lead to ar- white petals.
tificial grouping of these two, if history of the The situation depicted above can be more
group was not properly known. It must, how- easily represented through the concept of
ever, be noted that symplesiomorphy may nested groups, more conveniently repre-
sometimes be helpful in detecting mono- sented as a set of ovals, a Venn diagram (Fig-
phyly, especially where in some other taxa, ure 8.13A). The diagram drawn here is based
it has evolved into another character-state. on the assumption that we have informa-
As such, out of the four plesiomorphic char- tion from a large group in which there are
acter-states listed here, only the woody habit 21 woody species of which 13 are with united
has changed to herbaceous habit, and as carpels and 8 with free carpels. Of the 13
such in the remaining taxa (E, F, G and H) with united carpels 7 have 2 stamens where
symplesiomorphy of woody character-state as 6 have more stamens.
identifies monophyly of the group ABCD. It The information is presented in the form
must be remembered that synapomorphy of an unrooted network (unrooted tree) (Fig-
and symplesiomorphy are a reflection of ho- ure 8.13B). The herbaceous species are
mology for a particular character-state (or shown towards the left of left double arrow,
more than one character-states, each be- and the woody species towards the right.
longing to a different character). Similarly, the species towards the left of the
All above options would render (genus, fam- middle double arrow are with free carpels
ily or order) monophyletic groups, the ulti- while those towards the right with fused car-
mate goal of phylogenetic systematics. Any pels. The species towards the left of the right
other options wont work. Keeping D and E double arrow have more than 2 stamens and
in one genus (or CDE or DEF) would make it those towards the right just 2 stamens.
polyphyletic, promptly rejected once de- It must be noted that in constructing the
tected, because the group is derived from above Venn diagram and the unrooted net-
more than one ancestor. Keeping ABC un- work, only three character-state transforma-
der one genus, or FGH under one genus tions are accounted for. We have completely
would make paraphyletic groups because left out grouping of herbaceous plants and
we are not including all the descendents of the woody plants with a single carpel. Inclu-
the common ancestor (we are leaving out D sion of these would make the diagrams
in first genus and E in second). In the same much more complicated, and present sev-
way, putting more than four species (but less eral alternatives. Also, the more meaning-
than eight) under the same genus would ful trees have to be rooted (the most primi-
make it paraphyletic. Paraphyletic taxa are tive end at the base), to reflect the phylog-
strongly opposed by phylogenetic system- eny. Even with the phylogenetic history of
atists; the classical case is the demise of the group known, there could be several
traditional division of angiosperms into variations of the rooted tree, two simple ones
monocots and dicots, over the last decade. being shown in the Figure 8.13C and 8.13D.
It must be noted that all eight species If we did not know the evolutionary history
whatever way you classify share alternate of the group, a number of variations would be
Developing Classifications 229
A B A B
A B
I
A B C C C D
II III
B A C A B C
A C B A C B
IV
B A C
B C A
A B
C A B
B A
V
C B A
VI
Figure 8.14 Ordering and polarity of character states. I: Binary character with single possible
switch. II: Unordered three-state character with single possible switch. III: Unor-
dered Four-state character with single possible switch. IV: Ordered three-state char-
acter with two possible switches and three possible morphoclines. V: Polarized bi-
nary character with two possible morphoclines. VI: Ordered and Polarized three-
state character with 6 possible morphoclines.
A B C A B C D A B C D
A 0 1 2 A 0 1 2 3 A 0 1 1 1
B 1 0 1 B 1 0 1 2 B 1 0 1 1
C 2 1 0 C 2 1 0 1 C 1 1 0 1
D 3 2 1 0 D 1 1 1 0
I
II III
A B A B C D
A 0 1 A 0 1 5 5
B 1 0 B 1 0 5 5
C 5 5 0 1
IV
D 5 5 1 0
V
Figure 8.15 Data matrix of coded character states. I: Ordered three-state character. II: ordered
four-state character. III: Unordered character. IV: Binary character. V: Differential
weighting to character state changes; imagine A and B represent Purines (Adenine
and Guanine), C and D Pyrimidines (Cytosine and Thymine), purine to purine or
pyrimidine to pyrimidine change (transition) is given 1 step weight, but purine to
pyrimidine change or reverse (transversion) given 5 steps weight.
Ingroup comparison (also known as com- after the polarity criterion is included and
mon ground plan or commonality principle) the selection of single appropriate mor-
is based on the presumption that in a given phocline representing the true sequence
group (presumably monophyletic), the primi- even more challenging.
tive structure would tend to be more com-
mon. Thus all 8 species of cladogram in Fig- Character Weighting and
ure 8.12 share plesiomorphic character
states: alternate leaves, cymose inflores- Coding
cence and five petals. Five species have The coding of character states is done by
plesiomorphic 5 stamens, two derived 2 sta- assigning non-negative integer values. Bi-
mens and one with 10 derived stamens. nary characters are conveniently assigned
Similarly four species have red petals and 0 and 1 for two states. If possible to distin-
two each with white and yellow petals. It is guish, plesiomorphic state is assigned 0 and
assumed that the evolution of a derived con- apomorphic state 1 code (Figure 8.15-IV). It
dition will occur in only one of potentially is often assumed that whereas the same
numerous lineages of the group; thus the character-state may arise more than once
ancestral condition will tend to be in the ma- within a group between closely related spe-
jority. As is evident from Figure 8.14, the cies (parallelism), or between remotely re-
number of possible morphoclines increases lated species (convergence; the distinction
Developing Classifications 233
Table 8.1 A portion of the data matrix with hypothetical t OTUs and n characters. Binary coding
involves for state a and 1 for state b. The NC code stands for characters not comparable
for that OTU. In this analysis a total of 100 characters were used but only nine are
pictured here.
Characters
1-triporate 0-monosulcate
1-unitegmic 0-bitegmic
0-woody 1-herbaceous
0-simple 1-compound
0-terrestrial 1-aquatic
0-superior 1-inferior
1-PI-type 0-PII-type
0-follicle 1-achene
0-free 1-united
Plastids
Carpels
Habitat
Leaves
OTUs (t)
Pollen
Ovary
Ovule
Habit
Fruit
1. 1 0 1 1 0 1 1 1 1
2. 1 0 1 1 1 1 0 0 1
3. 0 NC 0 1 0 0 1 1 1
4. 1 1 1 0 1 0 0 0 0
5. 1 0 1 1 0 1 1 0 1
6. 1 1 0 1 1 NC 0 1 0
7. 0 1 1 0 1 1 0 0 1
8. 0 0 0 1 0 0 1 1 1
9. 1 1 1 0 0 1 1 0 0
10. 0 0 0 1 1 0 1 1 1
11. 1 0 1 1 0 1 0 0 1
12. 1 1 0 0 1 1 0 0 1
13. 0 0 1 0 1 0 1 0 1
14. 1 0 1 0 1 0 1 0 1
15. 0 1 1 0 0 1 1 0 0
is often given more weighting over a simple Similarly sympetalous members tend to
character. It may be assumed that leaf have epipetaly and tenuinucellate ovules.
anatomy may not change easily but hairi- Such correlated characters receive lesser
ness may change readily. The number of weighting. If two characters are correlated,
steps between two character states is con- each gets 1/2 weighting, if three 1/3 weight-
veniently represented through character ing and so on.
step matrix (Figure 8.15). One may, how- It is always advisable to identify and in-
ever, be tempted to count leaf anatomy char- clude the most ancestral taxon (outgroup) as
acter as equivalent to two changes in hairi- last taxon (or first taxon, as certain programs
ness. This may often be the result of bias to choose first taxon for rooting) in the list of
obtain desired results. It is reasonable, how- taxa. If it is possible to identify plesiomorphic
ever, to adopt the approach of numerical tax- and apomorphic character-states, 0 repre-
onomy to give equal weighting to all the sents plesiomorphic character-state and 1
characters in the preliminary analysis, the apomorphic character-state of a particu-
identify those characters which show the lar character. Outgroup taxon in the matrix
least homoplasy and give them more gets 0 code for all character states (Table 8.4).
weightage in the subsequent analysis, a pro- For multistep changes, or unlikely events
cess known as successive weighting. This appropriate codes as indicated in Figure 8.15
avoids a bias towards a particular charac- are transferred to the matrix. Outgroup taxon
ter, and as such enables rational treatment in the matrix is essential in final rooting of
of available data. the most parsimonious cladogram (tree).
Residual weighting involves excluding a
character from the list when information for
a large number of taxa is not available, or is
irrelevant. But in certain cases, information
Measure of similarity
may be available for a particular character Once the data have been codified and
for large number of OTUs but not for a few. entered in the form of a matrix, the next step
Alternately, the information may be irrel- is to calculate the degree of resemblance
evant for a few taxa (say, the number of spurs between every pair of OTUs. A number of
in a taxon, which lacks spurs). Such char- formulae have been proposed by various
acters are used in analysis but for the taxa authors to calculate similarity or dissimi-
for which information is not available or is larity (taxonomic distance) between the
irrelevant, an NC code (Not Comparable) is OTUs. If we are calculating the similarity
entered in the matrix. Whenever the NC (or dissimilarity) based on binary data coded
code is encountered, the program bypasses as 1 and 0, the following combinations are
that particular character for comparing the possible.
concerned taxon. For data handling by com-
puters, the NC code is assigned a particular
(not 0 or 1) numeric value. Such residual
weighting should, however, be avoided when
appreciable number of taxa are not compa-
rable for a particular character. The coded
data may be entered in the form of a matrix
with t number of rows (OTUs) and n num-
ber of columns (character-states) with the
dimension of the matrix (and the number of Number of matches m=a+d
attributes) being t x n (Table 8.1). Number of positive matches a
Certain characters in plants evolve Number of mismatches u =b+c
together. Occurrence of stipules and Sample size n = a + b + c + d = m + u
trilacunar nodes is usually correlated. j and k are two OTUs under comparison
Developing Classifications 235
Table 8.2 Similarity matrix of the representative hypothetical taxa presented as percentage
simple matching coefficient.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
OTUs
1 100
2 47.0 100
12 48.0 47.0 49.0 50.0 58.0 42.0 81.0 30.0 96.0 94.0 75.0 100
13 47.0 44.0 49.0 49.5 59.0 44.0 68.0 41.0 81.0 83.0 62.0 81.0 100
14 55.0 46.0 55.0 51.5 57.0 44.0 72.0 39.0 81.0 81.0 72.0 81.0 74.0 100
15 56.0 45.0 57.0 53.0 54.0 44.0 67.0 40.0 78.0 72.0 67.0 74.0 67.0 87.0 100
Table 8.3 Dissimilarity matrix of the representative hypothetical taxa based on the similarity
matrix in Table 8.2.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
OTUs
1 0.0
2 53.0 0.0
3 46.0 53.0 0.0
4 51.0 46.0 48.0 0.0
5 50.0 49.0 56.0 51.5 0.0
6 54.0 41.0 54.0 53.0 52.0 0.0
7 53.0 52.0 52.0 54.0 35.0 53.0 0.0
8 44.0 49.0 44.0 48.5 54.0 42.0 75.0 0.0
9 50.0 55.0 51.0 50.0 40.0 60.0 21.0 70.0 0.0
10 50.0 55.0 46.0 49.5 42.0 59.0 23.0 64.0 8.0 0.0
11 47.0 46.0 51.0 54.5 35.0 49.0 8.0 69.0 25.0 27.0 0.0
12 52.0 53.0 51.0 50.0 42.0 58.0 19.0 70.0 4.0 6.0 25.0 0.0
13 53.0 56.0 51.0 50.5 41.0 56.0 32.0 59.0 19.0 17.0 38.0 19.0 0.0
14 45.0 54.0 45.0 48.5 43.0 56.0 28.0 61.0 19.0 19.0 28.0 19.0 26.0 0.0
15 44.0 55.0 43.0 47.0 46.0 56.0 33.0 60.0 22.0 28.0 33.0 26.0 33.0 13.0 0.0
Developing Classifications 237
the distance (and, consequently, the simi- replace intuition with analysis. The method
larity) between every pair of taxa, including was based on determining the apomorphic
the hypothetical ancestor. The distance is character-states present within a taxon and
calculated as the total number of character- then linking the subtaxa based on relative
state differences between two concerned degree of apomorphy. Interestingly, whereas
taxa, the data presented as t x t matrix the method found little favour with zoologists,
(Table 8.5). it has been used in many botanical studies.
This method is closer to taxometric meth- Kluge and Farris (1969) and Farris (1970)
ods, because both plesiomorphic and developed a comprehensive methodology for
apomorphic character-states are given the development of Wagner trees, based on
equal weightage, but the inclusion of hypo- the principle of parsimony. The method is
thetical ancestor is always crucial for the the basis of many phylogeny computer algo-
study. rithms currently in use. A given dataset
Another method of calculating distance may, however, yield many possible equally
involves calculation of the number of parsimonious trees due to homoplasy, as
apomorphic character-states common be- more than one character-state change may
tween the pairs of concerned taxa, ignoring occur during the evolutionary process of a
the possession of plesiomorphic character- particular group of organisms.
states in common (Table 8.6). Since only The following steps are involved in the
synapomorphy is likely to define monophyl- analysis:
etic groups, this method is closer to the
original cladistic concept. 1. Determine which of the various char-
acters (or character-states) in a series
of character transformations are
Construction of Trees apomorphic.
Different methods are available for the final 2. Assign the score of 0 to the
analysis of cladistic information. Three of plesiomorphic character and 1 to the
these commonly used in phylogenetic analy- apomorphic character in each trans-
sis include Parsimony-based methods, Dis- formation series. If the transformation
tance methods and Maximum likelihood series contains more than two homo-
method. logues, then these intermediate
apomorphies may be scaled between
0 and 1. Thus, a transformation se-
Parsimony-based methods ries of three characters may be scored
The methods are largely based on the bio- as 0, 0.5 and 1 (or 0, 1 and 2 depend-
logical principle that mutations are rare ing on the weighting assigned).
events. The methods attempt to minimise 3. Construct a table of taxa (EUs) and
the number of mutations that a phylogenetic coded characters (or character-states:
tree must invoke for all taxa under consid- see Table 8.3).
eration. A tree that invokes minimum num- 4. Determine the divergence index for
ber of mutations (changes) is considered to each taxon by totalling up the values.
be the tree of maximum parsimony. The Since apomorphic character-states
evolutionary polarity of taxa is decided for are coded 1, the divergence index in
construction of such trees. The Wagner effect represents the number of
groundplan divergence method, an apomorphies (character-states) in a
example of this, was first developed by H. W. taxon, except in cases of weighted cod-
Wagner in 1948 as a technique for deter- ing. For the data matrix in Table 8.4,
mining the phylogenetic relationships the divergence index for 15 taxa would
among organisms that he hoped would be calculated as:
238 Plant Systematics
Table 8.4 Data matrix of t taxa and n characters scored as 0 (plesiomorphic) and 1 (apomorphic)
character-states. Multistate character is assigned 0 for ancestral state, 1 for interme-
diate and 2 for most advanced state.The matrix is similar to Table 9.1 but only 9 char-
acters pictured are used for calculations. Also the last taxon included is the hypotheti-
cal ancestor in which all character-states are scored as 0 (plesiomorphic), as it is
presumed that the ancestor would possess all characters in a plesiomorphic state.
Characters
1-triporate 0-monosulcate
1-unitegmic 0-bitegmic
0-woody 1-herbaceous
0-terrestrial 1-aquatic
0-superior 1-inferior
1-PI-type 0-PII-type
0-follicle 1-achene
0-free 1-united
Taxa (t)
Plastids
Carpels
Habitat
Leaves
Pollen
Ovary
Ovule
Habit
Fruit
1. 1 0 1 1 0 1 1 1 1
2. 1 0 1 1 1 1 0 0 1
3. 0 1 0 1 0 0 1 1 1
4. 1 1 1 0 1 0 0 0 0
5. 1 0 1 2 0 1 1 0 1
6. 1 1 0 1 1 1 0 1 0
7. 0 1 1 0 1 1 0 0 1
8. 0 0 0 1 0 0 1 1 1
9. 1 1 1 0 0 1 1 0 0
10. 0 0 0 1 1 0 1 1 1
11. 1 0 1 2 0 1 0 0 1
12. 1 1 0 0 1 1 0 0 1
13. 0 0 1 0 1 0 1 0 1
14. 1 0 1 0 1 0 1 0 1
15. 0 0 0 0 0 0 0 0 0
Eus 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
____________________________________________________________
1 0
2 3 0
3 4 7 0
4 7 4 8 0
5 2 3 6 7 0
6 5 5 6 4 7 0
7 6 3 7 3 6 6 0
8 3 6 1 8 5 6 7 0
9 4 5 7 3 4 6 4 7 0
10 4 5 2 7 6 5 6 1 8 0
11 3 2 7 6 1 6 5 6 5 7 0
12 6 3 7 3 6 4 2 7 4 6 5 0
13 5 4 5 4 5 8 3 4 5 3 6 5 0
14 4 3 6 3 4 7 4 5 4 4 5 4 1 0
15 7 6 5 4 7 6 5 4 5 5 6 5 4 5 0
EUs 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
____________________________________________________________
1 X
2 5 X
3 4 2 X
4 2 3 0 X
5 5 4 2 2 X
6 3 3 2 2 2 X
7 3 4 1 3 3 2 X
8 4 2 4 0 2 2 1 X
9 4 3 1 3 4 2 3 1 X
10 4 3 4 1 2 3 2 4 1 X
11 4 4 1 2 5 2 3 1 3 1 X
12 3 4 1 3 3 3 4 1 3 2 3 X
13 3 3 2 2 3 1 3 2 2 3 2 2 X
14 4 4 2 3 4 2 3 2 3 3 3 3 4 X
15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 X
____________________________________________________
240 Plant Systematics
Plants herbaceous
Petals yellow
Plants woody
Carpels free
Petals red
Carpels united
Carpels free
Stamens >2
Stamens 2
C
Plants woody
Plants herbaceous R Plants herbaceous Plants woody
Petals yellow Carpels united
B A
Figure 8.17 A: The Venn diagram for woody species, the same as Figure 10.12A. B: The Venn
diagram for a small portion of the herbaceous lineage of assumed 15 species of
which 6 are with red petals and 9 with yellow petals, latter with 4 species having
united carpels and 5 free carpels. C: Extension of the unrooted tree of Figure 10.12B
to include the species depicted in the Venn diagram B here. There are 5 actual
character state changes but with 4 switches as united carpels have arisen twice.
Developing Classifications 241
Plants herbaceous
Petals yellow
Petals red
Plants woody
Carpels united
Carpels free
Stamens >2
Stamens 2
Plants woody
Plants herbaceous
Petals red
Petals yellow
Figure 8.18 Possible variation of the unrooted tree presented n figure 10.14C, if we did not have
any idea about the evolutionary history of the group. Note that tree length has
increased to six, and habit has changed twice from woody to herbaceous and from
red to yellow petals. Such homoplasious situations are uncommon.
gram for the herbaceous species and the being included in the tree, the number of
extended unrooted tree is presented in the options would increase. Also we have to con-
Figure 8.17-C. It must be noted that here vert each unrooted tree into a rooted tree
we know the evolutionary history of the so that the most primitive basal end of the
groupwhich normally is never knownand tree is known, and different lineages pre-
the aim of phylogenetic analysis is to recon- sented as the more advanced branches. This
struct and depict this evolutionary history brings in many more options, as indicated
through trees. The unrooted tree here has earlier. In our example, where we know the
five character-state changes (actual history of the tree, the tree can be rooted at
changes, tree length) involved. The change R, as indicated by an arrow (Figure 8.17-C),
from free to united carpels has occurred but in a large majority of cases, it is a com-
twice, and as such there are only four ge- plicated process, and a lot of hypotheses,
netic switches involved. If we did not have strategies and algorithms come into play.
the knowledge about the evolutionary his- A number of sophisticated computer algo-
tory of the group, we would try a number of rithms are available which compare trees
variations. One possible variation of the and calculate their lengths. The widely used
unrooted tree would be to link 4 herbaceous ones include NONA, PAUP, and PHYLIP.
species with united carpels to the woody spe- These programs determine the number of
cies with united carpels, thus presenting a possible trees, and then sort out the short-
single change of free to united carpels. But est of all these. If we are dealing with three
this brings in further changes. Now, change species, three rooted trees are possible [A
from woody habit has occurred twice, change (B, C)], [B (A, C)] and [C (A, B)] (Figure 8.19),
from red to yellow petals has occurred twice, if 4 taxa are mapped the 15 trees are pos-
and more significantly the number of actual sible, 5 then 105, for 10 taxa 34,459,425 trees
changes (tree length) has increased to six and so on.
(Figure 8.18), with same four genetic The number of possible rooted trees for n
switches involved. With more descendents number of taxa can be calculated as:
242 Plant Systematics
A B A B C B A C C B A B
A
I II III IV
A C B D C
A B C D A C B D A B C D
VI VII VIII IX
Figure 8.19 Possible number of rooted and unrooted trees. I: Single rooted tree for two taxa.
II-IV: Three possible rooted trees for three taxa. V: One possible unrooted tree for
three taxa. VI-IX: Some of the possible 15 rooted trees for four taxa.
order of decreasing similarity. The earlier technique or minimum method), the can-
methods of cluster analysis were cumber- didate OTU for admission to a cluster has
some and involved shifting of cells with simi- similarity to that cluster equal to the simi-
lar values in the matrix so that OTUs with larity to the closest member within the clus-
closely similar similarity values were ter. The connections between OTUs and clus-
brought together as clusters. Today, with the ters and between two clusters are estab-
advancement of computer technology, pro- lished by single links between pairs of OTUs.
grams are available which can perform an This procedure frequently leads to long strag-
efficient cluster analysis and help in the con- gly clusters in comparison with other SAHN
struction of cluster diagrams or pheno- cluster methods. The phenogram for our data
grams. The various clustering procedures using this strategy is shown in Figure 8.20.
are classified under two categories. The highest similarity value in our ma-
trix (see Table 8.2) is 96.0 between OTUs 9
Agglomerative methods and 12, and as such they are linked at that
Agglomerative methods start with t clusters level. The next similarity value of 94.0 is
equal to the number of OTUs. These are suc- between OTUs 10 and 12, but since 12 has
cessively merged until a single cluster has already been clustered with 9, 10 will join
finally been formed. The most commonly this cluster linked at 94.0. The process is
used clustering method in biology is the Se- repeated till all OTUs have been agglomer-
quential Agglomerative Hierarchic Non- ated into single cluster at similarity value
overlapping clustering method (SAHN). The of 53.0.
method is useful for achieving hierarchical In the complete linkage clustering
classifications. The procedure starts with method (farthest neighbour or maximum
the assumption that only those OTUs would method) the candidate OTU for admission
be merged which show 100% similarity. As to a cluster has similarity to that cluster
no two OTUs would show 100% similarity, equal to its similarity to the farthest mem-
we start with t number of clusters. Let us ber within the cluster. This method will gen-
now lower the criterion for merger as 99% erally lead to tight discrete clusters that join
similarity; still no OTUs would be merged as others only with difficulty and at relatively
in our example the highest similarity re- low overall similarity values.
corded is 96.0%. The best logical solution In the average linkage clustering
would be to pick up the highest similarity method, an average of similarity is calcu-
value (here 96.0) and merge the two con- lated between a candidate OTU and a clus-
cerned OTUs (here 9 and 12). By inference, ter or between two clusters. Several varia-
if our criterion for merger is 96.0 we will tions of this average method are used. The
have t-1 clusters. Subsequently the next unweighted pair-group method using arith-
lower similarity value is picked up and the metic averages (UPGMA) computes the av-
number of clusters reduced to t-2. The pro- erage similarity or dissimilarity of a candi-
cedure is continued until we are left with a date OTU to a cluster, weighting each OTU
single cluster at the lowest significant simi- in the cluster equally, regardless of its struc-
larity value. Since at various steps of clus- tural subdivision. The method originally
tering a candidate OTU for merger would developed for the procedures of numerical
cluster with a group of OTUs, it is important taxonomy has been applied in phylogenetic
to decide the value that would link the clus- analysis with relevant modifications, and
ters horizontally in a cluster diagram. A used for the construction of trees. UPGMA
number of strategies are used for the method procedure begins with as many
purpose. clusters as the number of taxa. The two taxa
In the commonly used single linkage with minimum distance merged to reduce
clustering method (nearest neighbour the number of clusters by one. In the next
244 Plant Systematics
Figure 8.20 Cluster diagram of 15 OTUs based on similarity matrix in Table 8.2 using single
linkage strategy.
step average distance between new cluster now recalculated as presented in step 2
and remaining taxa are determined by tak- matrix. The lowest distance in this matrix
ing the average distance between these two is 4 between D and F which are united into
members and all other remaining taxa, one cluster. With this merger the distance
weighting each taxon in the cluster equally between taxa/clusters is recalculated and
regardless of its structural subdivision, and presented in step 3 matrix. The lowest
merging the taxon with smallest distance distance 5.5 is now between clusters (AE)B
to the first cluster. The process is repeated and DF, which are next united. Finally the
with this new cluster of three taxa, and the distance between this enlarged cluster and
procedure continues till all the taxa are C is recalculated as presented in step 4
merged, the most distant taxon joining last matrix. Finally the two clusters (((AE)B)(DF))
of all. From measure of similarity or dissimi- and C are united at distance of 6.5 to form
larity of taxa (OEUs) as presented in Table final cluster ((((AE)B)(DF))C). The resulting
8.5 and 8.6, a network presenting minimum phenogram and reconstructed phylogenetic
dissimilarity is constructed. Analysis of data tree constructed from the analysis are
from first six taxa of table 8.4 is presented presented in Figure 8.21.
in Figure 8.21. The procedure begins by unit- The distance matrix can similarly be gen-
ing nearest taxa A and E (with minimum erated from single nucleotide differences
distance of 2). Next matrix in now con- between homologous DNA sequences
structed in which distance between (AE) and derived from different species. Six such hy-
rest of the taxa is recalculated. The lowest pothetical sequences from different species
value in this matrix (step 1 matrix) is be- are presented in Figure 8.22. The distance
tween (AE) and E, which are next united at matrix is based on number nucleotide dif-
distance level 3 into (AE)B. The distance be- ferences between different sequences. A and
tween this cluster and rest of the taxa is F with lowest distance are merged, followed
Developing Classifications 245
Taxa A B C D E F
Taxa AE B C D F Taxa (AE)B C D F
A 0
AE 0 (AE)B 0
B 3 0
B 3 0 C 6 0
C 4 7 0
C 5 7 0 D 5.5 8 0
D 7 4 8 0
D 7 4 8 0 F 5.5 6 4 0
E 2 3 6 7 0
F 6 5 6 4 0 Step 2 matrix
F 5 5 6 4 7 0
Step 1 matrix
Distance Matrix A E B D F C
Taxa (AE)B FD C
7
(AE)B 0
distance
6
FD 5.5 0
5
4
C 6 7 0
Step 3 matrix
3
2
Taxa ((AE)B)(FD) C
1
0
((AE)B)(FD) 0
A E B D F C
C 6.5 0 Taxa
Phylogenetic tree
Phenogram
Figure 8.21 Construction of phenogram and phylogenetic tree (cladogram) based on distance
matrix concerning first six taxa in Table 8.4 using UPGMA clustering method. The
taxa with minimum distance are united and treated as single cluster in next matrix,
and distance values recalculated as average of distance from either of united taxa.
The procedure repeated till all taxa are united. The phylogenetic tree is constructed
based on sequence of clustering of taxa.
by recalculation of new matrix in which A Figure 8.23 presents results of RAPD analy-
and F form one cluster and value of each sis of 8 taxa, where only polymorphic bands
taxon is calculated as average distance from are shown, monomorphic bands being omit-
A and F. Now lowest value is shared by B and ted. The distance matrix based on similar-
D which form second cluster. The values are ity matrix was processed using PHYLIP, as
recalculated similarly , and successively C shown in Figure 8.24. Distance methods are
joins AF cluster, and then E joins (AF)C suitable for handling both morphological and
cluster. The two clusters are finally merged molecular data, or a combination of both.
to enable construction of phylogenetic tree These methods use all data with usually
either as phenogram or as cladogram. Some equal importance, whereas the parsimony
types of genetic polymorphism data such as methods use only informative molecular
RAPD are best handled when sharing of 0 data. In general for a site to be informative,
code by two taxa in the matrix is ignored when handling sequence data, irrespective
when both taxa lack a given polymorphic of how many sequences are aligned, it has
band in gel electrophoresis. Jaccard coeffi- to have at least two different nucleotides,
cient is best suited for handing such data. and each of these nucleotides has to be
246 Plant Systematics
10 20 30 40 50
A GCCAACGTCG ATGCCACGTT GTTTAGCACC GGTTCTTGTC CGATCACAGA TGT
B GCCAACAATG ATACCACGCC GTCCAGCACC GATTCTCGTC CGAGTACCGA TGT
C GGTAACGTCA ATGGGACGTT GTCCAGCACC GGTTCATGTC CAAGCAGAGA TGT
D GCCAACATTG ATACCACGCC GTTTAGCTGC GACACTCGTC CGATCACCAA TGT
E GCTAACGACA ATACCAGGCT GTCCAGCTCC GGTTTACGTC CGAGCACAGA TGT
F GCCAACATCG ATGGGACGTT GTTTAGCTCC GATTCATGTC CAATCACCAA TGT
Taxa (AF)C BD E A F C E B D
A F C E B D
(AF)C 0 0
BD 16.75 0
E 13.5 15 0 5
Matrix step 3
10
Taxa ((AF)C)E BD 15
((AF)C)E 0
20 Phenogram
BD 15.875 0
Cladogram
Final Matrix
((((A,F:9),C:11.5),E:13.5),:15.875 (B,D:10));
Figure 8.22 Construction of phylogenetic tree based on single nucleotide differences in hypo-
thetical DNA sequences of six species. Distance matrix is constructed based on
the number of nucleotide differences between each pair of DNA sequences and
presented in distance matrix. Further analysis proceeds as detailed in Figure 8.21,
and also in the text on these pages.
present at least twice. Thus in the sequence lution occurring in different lineages. Some
data presented in Figure 8.22, out of 28 sites distance methods such as transformed dis-
showing nucleotide differences in six se- tance method and neighbour-joining
quences, there are only 12 informative sites method, although more complex are capable
which can be used in parsimony analysis. of incorporating different rates of evolution
Procedures based on UPGMA method, how- within the lineages.
ever, dont account for different rates of evo-
Developing Classifications 247
R A B C D E F G H
A B C D E F G H
1
1 1 1 0 0 1 0 1 1
2
2 0 1 1 1 0 1 1 0
3 3 1 0 1 0 1 1 0 1
4 4 0 1 1 0 1 0 1 0
5 1 1 0 1 0 1 0 1
5
6 0 1 0 1 0 1 1 1
6
7 0 1 1 0 1 1 1 0
7
8 1 0 1 1 1 0 0 1
8
9 9 1 1 0 1 0 0 1 0
10 1 1 1 0 1 1 0 1
10
11 1 0 1 0 0 0 0 0
11
12 1 1 0 1 0 1 0 1
12 13 0 0 1 1 1 1 1 1
13 II
I
1 2 3 4 5 6 7 8 9 10 11 12 13 A B C D E F G H
A 1 0 1 0 1 0 0 1 1 1 1 1 0 A 1.0
B 1 1 0 1 1 1 1 0 1 1 0 1 0 B 0.46 1.0
C 0 1 1 1 0 0 1 1 0 1 1 0 1 C 0.33 0.30 1.0
III IV
Figure 8.23 Phylogenetic analysis of data concerning polymorphic bands from gel electrophore-
sis from DNA of 8 taxa. I: Polymorphic bands of DNA from 8 taxa (A-H), R represent-
ing reference bands; II: Binary coded matrix of the polymorphic bands; III: The same
matrix presented in conventional format; IV: Lower triangular matrix of similarity
matrix using Jaccard coefficient, wherein sharing of 0 state (absence of bands) is
ignored. Further handling of data using UPGMA program of PHYLIP is presented in
Figure 8.24.
III IV
Figure 8.24 Construction of phylogenetic tree based on polymorphic bands from gel electrophoresis
from DNA of 8 taxa using UPGMA program of PHYLIP; I: Square distance generated
from Figure 8.23-IV, each value calculated 1-similarity value. II: Outtree file gener-
ated by UPGMA option of NEIGHBOUR program; III: Upright square tree (Phenogram)
plotted through DRAWGRAM program; IV: Cladogram, but with branch lengths
omitted.
calculating chi square value between every For each character the sum of chi-square is
pair of characters using the formula: computed and the character showing maxi-
mum chi square value is chosen as the first
2 n (ad bc)2 differentiating character. The whole set of
X hi =
[(a + b)(a + c)(b + d)(c + d)] OTUs is divided into two clusters, one con-
taining the OTUs which show the charac-
where i stand for the character being com- ter-state a and another containing OTUs
pared and h for any character other than i. which show the character-state b. Within
Developing Classifications 249
each cluster, again, the character with the culated similarity values as 100 minus simi-
next value of the sum of chi square is se- larity (if similarity values are in percent-
lected and the cluster subdivided into two age) or 1 minus similarity (if similarity val-
clusters as before. The process is repeated ues range between 0 to 1). A dissimilarity
till further subdivision is not significant. matrix based on Table 8.2 is presented in
Table 8.3.
Hierarchical classifications The first step in the ordination starts with
The phenogram constructed using any tech- construction of the x-axis (horizontal axis).
nique or strategy can be used for attempt- In the commonly used method of polar ordi-
ing hierarchical classification, by deciding nation, the two most distant OTUs are se-
about certain threshold levels for different lected as the end points (A and B) on x-axis.
ranks. One may tentatively decide 85 per In our example, these are OTU 8 and 7 with
cent similarity as the threshold for the spe- a distance (dissimilarity value) of 75. The
cies, 65 for genera and 45 for families and position of all other OTUs on this axis can
recognize these ranks on the basis of num- be plotted one by one. OTU 10 has a distance
ber of clusters established at that thresh- of 64 from A (OTU 8) and a distance of 23
old. Whereas such an assumption can help from B (OTU 7). A compass with a radius of
in hierarchical classification, the point of 64 units is swung from A and a compass with
conflict would always be the threshold level a radius of 23 units is swung from B, form-
for a particular rank. Some may argueand ing two arcs. A line joining the intersection
are justified in doing soto suggest 80 per of two arcs forms a perpendicular on the x-
cent (or any other value) as the threshold axis, and the point at which the line crosses
for species. It is more common, therefore, the x-axis is the position of the OTU. The
to use terms 85 per cent phenon line, 65 distance between the x-axis and the point of
per cent phenon line, and 45 per cent intersection of arcs is the poorness of fit of
phenon lines. These terms may conve- the concerned OTU. The location of OTU on
niently be used till such time that sufficient the axis from the left (point A) can also be
data are available to assign them formal taxo- calculated directly instead of plotting:
nomic ranks to the various phenon lines.
The results of cluster analysis are com- L2 + dAC2 dBC2
x =
monly presented as dendrograms known as 2L
phenograms. They can also be presented as where x is the distance from the left end, L
contour diagrams (Figure 8.25), originally is the dissimilarity value between A and B
developed under the name Wroclaw dia- (length of x-axis), dAC is dissimilarity be-
gram by Polish phytosociologists. The con- tween A and the OTU under consideration
tour diagram may also incorporate the and dBC as the dissimilarity between B and
levels at which clustering has taken place. the OTU under consideration. The poorness
of fit (e) of this OTU can be calculated as:
Ordination
Ordination is a technique which determines e = dAC2 x 2
the placement of OTUs in two-dimensional
or three-dimensional space. The results of After the position of all OTUs has been de-
two-dimensional ordination are conve- termined and the poorness of fit calculated,
niently represented with the help of a scat- a second axis (vertical axis or y-axis) has to
ter diagram and those of three-dimensional be calculated. For this, the OTU with the
ordination with the help of a three-dimen- highest poorness of fit (most poorly fitted to
sional model. The procedure works on dis- x-axis) is selected and this forms the first
tance values calculated directly from the reference OTU of y-axis. The second refer-
coded data or indirectly from the already cal- ence OTU is selected as that one with the
250 Plant Systematics
gies yield several trees, all presenting short- Majority-rule consensus tree
est pathways, based on parsimony but with
Majority-rule consensus tree shows all the
different linkages among the taxa (OEUs),
groups which appear in a majority of trees,
and often presenting different evolutionary
say, more than 50 per cent of the trees. It is
history. Molecular studies of Clusiaceae by
useful to indicate for each group on the con-
Gustafsson et al., (2002) for example, includ-
sensus tree the percentage number of the
ing 1409 nucleotides of chloroplast gene rbcL
most parsimonious trees in which the group
positions using PAUP*4.0b8a parsimony
appeared. Such a consensus tree, however,
analysis method, yielded 8473 most parsi-
provides a partial summary of the phyloge-
monious trees for the 26 species compared.
netic analyses, and may be inconsistent with
Interestingly, the number of trees generated
was so large that search for trees 3 steps the trees from which it is derived.
longer than most parsimonious trees was
aborted. More significantly different data Semi-strict consensus tree
sets (molecular, morphology) may yield dif- A semi-strict consensus tree is useful when
ferent trees. While selecting the consensus comparing trees from different data sets, or
tree, the commonest approach is to identify with different terminal taxa. The consensus
the groups, which are found in all the short tree developed indicates all the relationships
listed trees, and build a consensus tree. This supported by both type of trees or any one of
could be achieved in different ways. these, but not contradicted by any. Thus, in
Figure 8.27, tree II does not give us any in-
Strict consensus tree formation about the time of origin of E, F and
G, the tree I indicates that they originated
A more conservative approach in building a successively. Similarly, tree I does not indi-
consensus tree involves including only cate any close relationship between C and
monophyletic groups that are common to all D, whereas the tree II does. The semi-strict
the trees. The tree developed this way is consensus tree IV as such presents such in-
known as strict consensus tree. Consider formation, not contradicted by either tree.
the two most parsimonious trees (although
there could often be numerous trees of same
shortest length available for comparison) as
Evaluating consensus tree
shown in Figure 8.27-I and 8.27-II. Developing a consensus tree involves the
Imagine that all groups A to J are mono- use of intuition, making guesses and devel-
phyletic. Tree I shows that A and B are very oping hypothesis. A number of evaluation
closely related, and so are H and I. C, D, E, strategies are used to test the soundness of
and F are shown arising successively and the tree and measuring support for either
are related in that sequence. Tree II shows the tree as a whole or for its individual
a similar relationship between H and I, and branches. These values are generally pub-
between A and B (but group J is shown re- lished along with the tree, to allow the fair
lated to these two). The tree also shows that assessment of the final results for compari-
C and D are closely related. As relationships son of trees based on different datasets.
between E, F, and G are ambiguous, they are
shown arising from the same point in evo- Consistency Index
lutionary history. The consensus tree III The principle of Parsimony is based on a ba-
would thus omit taxon J (which is absent sic rule of science known as Ockhams ra-
from tree I), show A and B, as also H and I as zor, which says do not generate a hypoth-
in the two trees I and II. The other taxa C, esis any more complex than is demanded
D, E, F, and G are shown arising from the by the data. Some information in the data
same point. may be representing homoplasy (reversals,
Developing Classifications 253
A B C D E F G H I A B J C D E F G H I
I II
A B C D E F G H I A B C D E F G H I
III IV
Figure 8.27 Two most parsimonious trees for a particular group of organisms, with monophyletic
taxa A to J. I: showing C, D, E and F arising successively. II: E, F, G are shown
arising at the same time from a common point, C and D being closely related.
III: Strict consensus tree of trees I and II. IV: Semi-strict consensus tree of trees
I and II.
parallelisms). Dollo parsimony (as indicated changes. In the tree shown in Figure 8.13B,
above) minimizes the use of homoplasious there are three character-state changes,
characters. The commonest measure of ho- each involving one switch, and, as such, the
moplasy is the Consistency Index (CI), consistency index would measure 3/3 = 1.
which is calculated by dividing the number The tree shown in Figure 8.17C has five
of genetic switches by actual genetic actual character-state changes (tree length
changes on the tree. is 5), but it involves only four genetic
switches. As carpel fusion has occurred
Consistency Index CI = Min /L twice, the consistency index would accord-
ingly be 4/5 = 0.8. In the tree shown in
Min stands for the minimum possible tree Figure 8.18, the number of genetic switches
length or genetic switches, and L for the ac- remains the same as four but the tree
tual tree length or actual number of genetic length has increased to six due to two
254 Plant Systematics
parallel (or convergent) evolutions; the CI changes in the character with actual num-
would be calculated as 4/6 = 0.66. ber of changes in the character. RI is com-
Consistency Index may also be calculated puted by first calculating the maximum pos-
for individual characters. In Figure 8.13B as sible tree length, if the apomorphic charac-
such CI for all characters is one, while in ter-state originated independently in every
8.17-C, it is 0.5 for carpel fusion (minimum taxon that it appears in, or say, the taxa are
number of changes possibleone for binary unrelated for the said character-state. The
character divided by actual number of value of RI is calculated as:
changeshere 2 since the character has
changed twice) and 1 for rest. In Figure 8.18, Retention Index RI = (Max L)/(Max Min)
CI is 0.5 for habit and petal colour, and 1 for
stamen number and carpel fusion. The char- Max stands for the maximum tree length
acters that lower the CI of a tree (or which possible, L the actual tree length and Min
have lower CI) are considered to be the minimum tree length possible. The tree
homoplasious. The inclusion of a larger in Figure 8.17-C thus has a maximum pos-
number of homoplasious characters in the sible tree length of 9 (minimum length of 4
analysis lowers CI for the tree and contra- and actual length of 5 as we already know)
dicts phylogeny. There may also be a char- and the RI would be (9-5)/(9-4) = 0.8. Higher
acter, which changes only in one (or a very the RI, sounder is the tree.
few) species, and may be of no relevance in
others. Suppose one species develops spiny Bremer Support (Decay Index)
fruits. The length or number of spines would
The principle of parsimony, followed in phy-
not be of any relevance in rest of the spe-
logenetic analyses, aims at selecting the
cies without spines. Such a situation (a
shortest tree. Some parts of the tree may
single species having a particular charac-
beore reliable than others. This is commonly
ter) is known as autapomorphy. Since such
evaluated by comparing the shortest tree
a character has changed only once, it gives
with those one or more steps longer. Decay
CI of 1, and as such the inclusion of many
index or Bremer Support is the measure of
such characters would increase the consis-
tency index of the tree, and provide false how many extra steps are needed before the
support. Such uninformative characters are original clade (group) is not retained. Thus
as such omitted before calculating CI. if an internode has decay index of 3, then
The Consistency index values are often the clade (monophyletic group) arising from
dependent on the number of taxa analyzed. it is maintained even in the cladogram 3
Any increase in number of taxa lowers CI steps longer than the shortest tree (see Fig-
values, and this is true for data from differ- ure 8.29). Certain branches of the tree which
ent sources, morphological or molecular. appear in the shortest tree, but disappear,
or collapse in the tree one step longer, are
Retention Index not drawn in the strict consensus tree.
Although theoretically the value of CI could Greater the decay index value, more robust
range between 0 and 1, it rarely goes below is that internode of the cladogram.
0.5. For a character that, has changed five Branches of the tree may also be tested
times on a tree (this is a remote possibil- by comparing the number of genetic changes
ity), CI will be 0.2. More so, the value of CI leading up to a particular group, and the
for a tree, very rarely may go below 0.5, and CI of individual characters involved. Doyle
the values thus range between 0.5 and 1. et al., (1994) on the basis of morphological
The Retention Index (RI) corrects this nar- data, developed a tree having 18 character
row range of CI by comparing maximum (and changes leading to angiosperms. Of these
not minimum as in CI) possible number of 18 characters 11 had CI of 1, thus
Developing Classifications 255
supporting the view that angiosperms form volves sampling fewer than the full number
a unique group of plants. of characters. The user is asked for the frac-
tion of characters to be sampled. Block-
Bootstrap Analysis bootstrapping is useful for handling corre-
Any realistic analysis requires that the data lated characters. When this is thought to
used is randomized. Many techniques are have occurred, we can correct for it by sam-
available for randomizing the data. Bootstrap pling, not individual characters, but blocks
analysis is the commonly used method de- of adjacent characters. Block bootstrap and
veloped by Bradley Efron (1979). Its use in was introduced by Knsch (1989). If the cor-
phylogeny estimation was introduced by relations are believed to extend over some
Felsenstein (1985). Matrix in the Figure number of characters, you choose a block
8.28-A contains information on the basis of size, B, that is larger than this, and choose
which the unrooted tree in Figure 8.17-C is N/B blocks of size B. In its implementation
constructed. Without touching the rows, any here the block bootstrap wraps around at
column is chosen at random to become the the end of the characters (so that if a block
first column; similarly any other as second starts in the last B-1 characters, it contin-
and the process is repeated till the number ues by wrapping around to the first charac-
of columns in the new matrix is the same as ter after it reaches the last character). Note
in the original matrix. As the columns are also that if you have a DNA sequence data
picked up from the original matrix, the new set of an exon of a coding region, you can
matrix may contain some characters repre- ensure that equal numbers of first, second,
sented several times (the same column may and third coding positions are sampled by
have been picked up at random more than using the block bootstrap with B = 3. Partial
once), while others may have been omitted block-bootstrapping is similar to partial
(the columns were not picked up at all). The bootstrapping except sampling blocks rather
method is known as random sampling with than single characters.
replacement. The resultant matrix B shows Jackknife analysis (Jackknifing) is
that character carpel fusion was picked up similar to bootstrap analysis but differs in
twice, whereas the random selection process that each randomly selected character may
missed the stamen number. be resampled only once, and not multiple
Repeating the method of random selection, times, and the resultant resampled data
multiple such matrices (usually more than matrix is smaller than the original. Delete-
100) are constructed, and for each matrix half-jackknifing involves sampling a ran-
the most parsimonious tree/trees found. dom half of the characters, and including
The consensus tree is developed from these them in the data but dropping the others.
most parsimonious trees. In this consensus The resulting data sets are half the size of
tree, the percentage number of trees (gen- the original, and no characters are dupli-
erated by bootstrap analysis) that contain cated. The random variation from doing this
that clade is indicated as bootstrap support should be very similar to that obtained from
value of that clade. Bootstrap analysis based the bootstrap. The method is advocated by
on the assumption that differential weight- Wu (1986). Delete-fraction jackknifing was
ing by resampling of the original data will advocated by Farris et. al. (1996) and involves
tend to produce same clades if the data are deleting a fraction 1/e (1/2.71828). This
good, and reflect actual phylogeny and very retains too many characters and will lead to
little of homoplasy. A bootstrap value of 70 overconfidence in the resulting groups when
per cent or more is generally considered as there are conflicting characters. This and
good support to the clade. the preceding options form a part of the
Several variations of bootstrap analysis SEQBOOT program of Phylip software, and
are available. The partial bootstrapping in- the user is asked to supply the fraction of
256 Plant Systematics
Stamens
Carpels
Carpels
Carpels
A B
Petals
Petals
Habit
Habit
Herbaceous United >2 Yellow Yellow United Herbaceous United
Plants Plants
Figure 8.28 A: Matrix based on the tree 9:16A. B: One possible matrix after procedure of random
sampling with replacement.
characters that are to be retained. The pro- fore. It shuffles the character order sepa-
gram also offers permuting method, with rately for each species.
following alternatives. Permuting species It is a common practice, and conse-
within characters involves permuting the quently more informative, to indicate the
columns of the data matrix separately. This branch length (number of steps needed to
produces data matrices that have the same reach that clade), bootstrap or jackknife sup-
number and kinds of characters but no taxo- port and Bremer support (decay index) for
nomic structure. It is used for different pur- each clade in the consensus tree (Figure
poses than the bootstrap, as it tests not the 8.29).
variation around an estimated tree but the
hypothesis that there is no taxonomic struc- Effect of Different Outgroups
ture in the data: if a statistic such as num- An important component of procedures gen-
ber of steps is significantly smaller in the erating rooted trees is the incorporation of
actual data than it is in replicates that are an outgroup in the analysis. In morphologi-
permuted, then we can argue that there is cal data, the outgroup choice can influence
some taxonomic structure in the data phylogenetic inference. In molecular data,
(though perhaps it might be just the pres- one specific concern is the levels of se-
ence of a pair of sibling species). Permuting quence divergence between outgroups and
characters simply permutes the order of the ingroups and the subsequent possibility of
characters, the same reordering being ap- spurious long-branch attraction (Albert et al.,
plied to all species. It is included as a pos- 1994). The robustness of tree can be tested
sible step in carrying out a permutation test by using randomly-generated outgroup se-
of homogeneity of characters (such as the quences, excluding all outgroups, and using
Incongruence Length Difference test). Per- outgroups selectively. Sytsma and Baum
muting characters separately for each spe- (1996), investigating the molecular phylog-
cies permute data so as to destroy all phylo- enies of angiosperms, found that removal of
genetic structure, while keeping the base all outgroups generated 27 shortest unrooted
composition of each species the same as be- trees. Using Ginkgo only as outgroup yielded
Developing Classifications 257
Ranunculus repens
Aquilegia formosa
Piper amalago
-G +1 80 * Piper marginata
60
Peperomia metallica
+4
90 Saururus cernuus
+2 Gymnotheca chinensis
81 +1
-A 22 Houttuynia cordata
+3
29**
94 Anemopsis californica
Acorus calamus
>5
-G
96 Lilium tigrinum
28** +1
76 Scilla violacea
Cabomba caroliniana
28 Lactoris fernadeziana
-G
16 ***
Saruma henryii
Chloranthus spicatus
+3
53 Magnolia denudata
+1
74 Illicium floridanum
Figure 8.29 Tree developed from the study of 16 species of paleoherbs and 2 outgroup taxa, using
58 morphological and ontogenetic characters. The cladogram requires 214 steps and
has CI = 0.51 and RI = 0.65. Bootstrap values are underlined and indicated below a
branch. Decay Index is indicated above the branch. Ranunculus repens and Aquilegia
formosa were chosen as outgroup taxa. (Drawn from Tucker and Douglas, 1996).
258 Plant Systematics
lineages identical with baseline study (which These programs are basically similar to
included all outgroups); when only conifers those designed for development of
were used as outgroup, the consensus tree phenograms, but differing essentially in the
was less resolved and many nodes collapsed. requirement to select one taxon for rooting
Use of Gnetales us outgroup increased the in most programs. PHYLIP (Phylogeny In-
number of steps needed to yield baseline to- ference package), is a commonly used set of
pologies, and interestingly, Ceratophyllum is programs for inferring phylogenies (evolu-
shown as sister to all angiosperms except tionary trees) by parsimony, compatibility,
eudicots. distance matrix methods, and likelihood. It
can also compute consensus trees, compute
Effect of Lineage Removal distances between trees, draw trees,
Lineage removal strategy highlights the resample data sets by bootstrapping or
problems of lineage extinction, which often jacknifing, edit trees, and compute distance
leads to a particular group (especially criti- matrices. It can handle data that are nucle-
cal in angiosperms where fossil record is otide sequences, protein sequences, gene
meager) not being sampled in analysis, thus frequencies, restriction sites, restriction
giving distorted phylogenies. The same may fragments, distances, discrete characters,
also be true for extant taxa, for which very and continuous characters. Distance matrix
little data is available. The removal of all ma- can be generated using programs such as
jor lineages, one at a time (Sytsma and DNADIST (which handles nucleotide se-
Baum, 1994), provided useful information. quence data; it gives you choice to set
The removal of Ceratophyllum, paleoherbs IIb weightage for transversions/transitions),
(Chloranthaceae, and Magnoliales) had no PRODIST (which works with protein se-
effect on the remaining angiosperm topol- quences) and RESTDIST (which works with
ogy, whereas the removal of paleoherbs I restriction site data). The most commonly
(Aristolochiales and Illiciales), Laurales and used programs of PHYLIP for handling dis-
eudicots showed substantial changes. tance matrix data include FITCH, KITSCH,
and NEIGHBOR These deal with data which
Effect of Exemplars comes in the form of a matrix of pairwise
The large computational load in handling a distances between all pairs of taxa NEIGH-
large data is often reduced by using place- BOR offers UPGMA option in which no taxon
holders or exemplars. These are often used needs to be selected for rooting, whereas
to represent large lineages. The use of ex- neighbor-joining option of this program, as
emplars can warn about the possible arti- well as FITCH and KITSCH need one taxon
facts when sparsely-sampled lineages ap- to be selected for rooting, otherwise by de-
pear in basal positions. In such cases, more fault first taxon is used for rooting. The
taxa can be added to the data set for further outtree generated by these programs can be
analyses. But in the case of basal clade plotted using DRAWGRAM or DRAWTREE,
where a large number of taxa are extinct, latter plotting only unrooted trees.
the results could be ambiguous. The results DRAWGRAM provides a variety of options to
from angiosperms have shown that clades choose from. The trees can be drawn hori-
shift around with ease when the number of zontal or vertical, branches square
taxa sampled for each lineage is reduced, (phenogram), v-shaped (cladogram), curved
and the use of exemplars at times could give or circular. The branch lengths may be de-
picted (phylogram) on the tree. The DNA se-
misleading results.
quence data presented in Figure 8.22 was
analysed using PHYLIP programs. Outputs
Automated Trees are presented in Figure 8.30. DNA sequence
A number sophisticated computer programs data can also be handled by DNAPARS pro-
are available to construct phylogenetic trees. gram which performs Parsimony analysis
Developing Classifications 259
6 53
T a xona G C C A A C G TC G A TG C C A C G TT G T T T A G C A C C G G T T C T TG T C C G A TC A C A G A T G T
T a xonb G C C A A C A A TG A TA C C A C G C C G TC C A G C A C C G A T TC TC G TC C G A G TA C C G A T G T
T a xon c G G TA A C G TC A A T G G G A C G T T G TC C A G C A C C G G TTC A T G T C C A A G C A G A G A T G T
I
T a xond G C C A A C A T TG A T A C C A C G C C G T T TA G C T G C G A C A C TC G TC C G A TC A C C A A T G T
T a xon e G C TA A C G A C A A TA C C A G G C T G TC C A G C TC C G G T T T A C G TC C G A G C A C A G A T G T
T a xon f G C C A A C A TC G A T G G G A C G T T G TT T A G C TC C G A T TC A T G TC C A A TC A C C A A TG T
6
T a xona 0.000000 0.297888 0.25384 4 0.301576 0.3066 45 0.1 9972 8
T a xonb 0.297888 0.000000 0.47056 0 0.229212 0.2766 09 0.4 0160 4 ((((T a xona:0 .09986,Ta xon f:0 .09986):0.03265,T a xon c:0 .13251):0.04302,
T a xon c 0.253844 0.470560 0.00000 0 0.736034 0.2861 12 0.2 7619 9 T a xon e:0 .17553):0.02684,(Ta xonb:0 .11461,T a xond:0 .11461):0 .08776);
T a xond 0.301576 0.229212 0.73603 4 0.000000 0.4750 79 0.2 7852 7 III
II
T a xon e 0.306645 0.276609 0.28611 2 0.475079 0.0000 00 0.4 6043 6
T a xon f 0.199728 0.401604 0.27619 9 0.278527 0.4604 36 0.0 0000 0
IV
T a xon o G G C A A C G A C G A T A C C A C G T T G T T TA G C TC C G G TT C TC G TC C C A G C A G C C A T G T
Figure 8.30 Analysis of the DNA sequence data presented in Figure 8.22 using PHYLIP. I: Infile,
first line indicating number of taxa and number of nucleotides in each sequence;
II: Square distance matrix (outfile) generated by DNADIST program; III: Outtree file
generated by NEIGHBOR program using UPGMA option; IV: DNA sequence of the
7th hypothetical taxon (taxono) used for rooting; V-VI: Square tree (Phenogram) and
V-shaped tree (cladogram); VII: Unrooted tree of same; VIII-XVI: Diagrams based on
7-taxa sequences; VIII: Phenogram, UPGMA option; IX-XI: Phylogram, Phenogram
and Cladogram based on neighbour-joining option of NEIGHBOR; XII: Phenogram
based on DNAML program; XIII: Phenogram based on FITCH program; XIV: Phenogram
based on KITSCH program; XV: Tree (Phenogram) generated based on DNAPARS
program; XVI: Majority-rule consensus tree based on CONSENSE program, using
outtree files of above six programs. (All trees except VII (plotted using DRAWTREE)
plotted using different options of DRAWGRAM program).
260 Plant Systematics
15 9
Taxon1 101001111
Taxon2 101011001
Taxon3 010000111
Taxon4 111010000
Taxon5 101101101
Taxon6 110011010
Taxon7 011011001
Taxon8 000000111
Taxon9 111001100
B C
Taxon10 000010111
Taxon11 101101001
Taxon12 110011001
Taxon13 001010101
Taxon14 101010101
Taxon15 000000000
Figure 8.31 Construction of trees using MIX program of PHYLIP based on matrix in the Table
8.4. A: Input file with fourth character converted into binary (simple and compound
leaves) character. Out of the 34 parsimonious trees generated by Mix, Consensus
tree generated by CONSENSE program presented as Phenogram (B), Cladogram
(C) and Phylogram (D).
and selects the best tree. It gives you choice allows the user to choose an initial tree, and
to select the number of trees to be saved, displays this tree on the screen. The user
10000 being the default. The program di- can look at different sites and the way the
rectly yields the outtree file. PROTPARS, nucleotide states are distributed on that
similarly performs Parsimony analysis of tree, given the most parsimonious recon-
Protein sequences. The protein sequences struction of state changes for that particu-
are given by the one-letter code used by the lar tree. The user then can specify how the
late Margaret Dayhoffs group in the Atlas of tree is to be rearranged, rerooted or written
Protein Sequences, and consistent with the out to a file. By looking at different rearrange-
IUB standard abbreviations. DNAMOVE ments of the tree the user can manually
which handles data similar to DNAPARS, search for the most parsimonious tree, and
Developing Classifications 261
can get a feel for how different sites are af- quencies contains number of species (or
fected by changes in the tree topology. populations) and number of loci , where as
DNAML program carries out analysis of DNA the second line contains number of alleles
sequences using Maximum Likelihood for each locus. the default number of data
Method. The program uses both informative for each species (A-all) contains one allele
and non-informative sites and yields the less for each locus. thus for three loci with
outtree file directly. RESTML similarly 2, 3 and 2 alleles respectively there would
handles restriction site data using maxi- be four values. Without A option, there
mum likelihood method. Binary data coded should be 7 values. The values in dataset
as 0 (ancestral state) and 1 (advanced state) are preceded and followed by blanks. The data
is handled by MIX, which performs parsimony from continuous characters does not contain
analysis and generates outtree which can the second line, the data would include num-
be plotted using DRAWGRAM. Input data ber of species and the number of characters
from Table 8.4 and most parsimonious tree in the first line (only line above species
generated using MIX program is presented data).
in Figure 8.31. For this analysis fourth PHYLIP also offers programs to yield con-
multistate character was converted into bi- sensus tree (CONSENSE), Bootstrapping
nary character (simple and compound (SEQBOOT) and a host of related programs.
leaves). Using Wagner parsimony the pro- The following information may be useful in
gram was able to generate 34 trees. Taxon handling DNA sequence data.
15 was used for rooting. CONSENSE program Prepare infile of DNA sequences in which
was used to select the majority rule consen- taxon name takes 10 characters followed by
sus tree. MOVE handles binary data and is sequences in groups of 10 (separated by a
an interactive program which allows the space), last three nucleotides being termi-
user to choose an initial tree, and displays nating codon. First taxon should be one in-
this tree on the screen. The user can look tended as one used for rooting. Number of
at different characters and the way their taxa (sequences used) and number of nucle-
states are distributed on that tree, given the otides in each sequence forms first line of
most parsimonious reconstruction of state file. Longer sequences can be interleaved
changes for that particular tree. The user (giving first part of sequences of all taxa and
then can specify how the tree is to be then next part of all taxa) or aligned (finish-
rearraranged, rerooted or written out to a ing one sequence and then going to second).
file. By looking at different rearrangements Save this file in text format in notepad (ANSI
of the tree the user can manually search code should be used; is default in notepad).
for the most parsimonious tree, and can get Distance matrix can be prepared using
a feel for how different characters are af- dnadist.exe program. When program asks for
fected by changes in the tree topology. infile, type above file name along with .txt
Multistate data can similarly be handled ending. Choose the ratio of transitions and
by PARS, and can be converted into binary transversions, so that program can handle
data by FACTOR program. Data from Gene it accordingly. You can also choose distance
frequencies and continuous characters is model such as F84, Kimura, Jukes-Cantor
handled by CONTML (constructs maximum and Logdet. Give name of your output file
likelihood estimates of the phylogeny; (preferably in txt format so that you can open
handles both types of data), GENDIST (com- and see it in notepad). The file can be saved
putes genetic distances for use in the dis- as square matrix or only lower triangle. The
tance matrix programs; handles data from above file can be used for generating clus-
gene frequencies) and CONTRAST (exam- ters through Fitch, Kitsch, and Neighbor pro-
ines correlation of traits as they evolve along grams. Each program searches for the short-
a given phylogeny; handles continuous char- est tree. When program asks for infile, type
acters data). The data matrix for gene fre- the name of above output file. Give name of
262 Plant Systematics
A B C D E F G H I A B C D E F G H I
m m
n n
o o
p I p II
Figure 8.32 Attempts towards construction of monophyletic groups. I: Strict consensus tree as
presented in the Figure 8.27-III. With poorly resolved phylogenies, the separation of
H and I in a group distinct and of the same rank as group CDEFG would create a
paraphyly, as HI are left out of the descendents of common ancestor o. II: A consen-
sus tree (hypothetical) with better resolved phylogenies. Both groups CDEFG and HI
are monophyletic and, in turn could be assembled into more inclusive group with
common ancestor at level o, now containing all descendents of the common ances-
tor. This group (CDEFG, HI) and AB (also monophyletic) could be assembled into one
most inclusive monophyletic group, containing all descendents of the common an-
cestor at p.
output file (of this program) or simply ask for paint file to save as image file in Paint. You
replacement if program reports that file is can change options by clicking File->change
already present. Neighbour provides a choice parameters in tree preview and go back to
between Neighbour-joining (in which one drawgram to generate other types of trees.
taxon is to be chosen for rooting) and UPGMA Binary data can similarly be input in infile
(in which no taxon for rooting has be se- with just replacing nucleotide alphabets with
lected). After selection of choice press Y. Pro- binary 0 and 1 data as presented in Table
gram will generate outtree file, if already 8.31 and handled by various programs men-
present replace it. You can read this file if tioned earlier.
saved in txt format. The above outtree file
can be used for plotting trees using
DRAWGRAM or DRAWTREE programs. Draw Gene Trees and Species Trees
program asks for intree file. Type in the Traditional the phylogenetically trees are
name of above outtree file. It will next ask constructed using data from multiple char-
for name of font file. Type font1 or any other acters, and if genetic data is used, from
within the Phylip folder. The program pro- analysis of multiple genes. Such trees, ap-
vides you number of choices including propriately known as species trees reflect
phenogram and cladogram. It also provides the evolutionary history of related groups of
choice between indicating branch lengths species, and consequently a single species.
(construction of conventional phylogram) or A phylogenetic tree based on the divergence
not (conventional phenograms and cla- observed within a single homologous gene
dograms where taxa end at same height). is most appropriately called a gene tree. The
On typing Y tree preview will appear. Press genes commonly used for the construction
Print screen on keyboard and paste on new of gene trees have been described in
Developing Classifications 263
chapter 7. Although they have been broadly Consider the strict consensus tree rep-
used in recent years in the construction of resented in the Figure 8.27-III. This tree is
phylogenies, a single gene may not always reproduced in the Figure 8.32-I. As noted
reflect relationships between species, be- earlier, the phylogenetic relationships be-
cause divergence within genes, especially tween taxa (these could be different species,
the sequence polymorphism occurs before genera, etc.) C, D, E, F, and G are poorly re-
the splitting of populations that give rise to solved, and as such they are shown arising
new species. from the common point, and consequently
common ancestor as level o. Although H and
I form a distinct group with a common an-
Developing Classification cestor as m, but leaving these two out of the
group including CDEFG would render latter
Once the phylogeny of a group has been de-
as paraphyletic (cf. traditional separation of
veloped, the evolutionary process within the
dicots and monocots). The safest situation
group can be reconstructed, the morphologi-
would be to include all the seven taxa into
cal, physiological and genetic changes can
one group, which may be regarded as belong-
be described, and the resultant information
ing to the same rank as the group including
used in the classification of the group. Phy-
A and B. All the nine taxa may next be in-
logenetic classifications are based on the
cluded into the single most inclusive group
recognition of monophyletic groups and avoid
with common ancestry at level p. We are thus
including paraphyletic and often completely
able to construct groups at two ranks only.
reject paraphyletic groups. Such classifica-
Now supposing the phylogenies of the taxa
tions are superior over classifications based
were better resolved and we had obtained a
on overall similarity in several respects:
consensus tree as shown in Figure 8.32-II.
1. Such a classification reflects the ge- Now taxa C,D,E,F and G belong to a lineage
nealogical history of the group much which diverged from the main lineage, suc-
more accurately. cessive to the divergence of the lineage
2. The classification based on mono- formed by A and B. Placement of H and I into
phyletic groups is more predictive and one group HI would not create any problem
of greater value than classification as both this group as well as the group
based on some characteristics. CDEFG are monophyletic with separate com-
3. Phylogenetic classification is of ma- mon ancestors at level m and q, respectively.
jor help in understanding distribution The groups CEDFG and HI could next be as-
patterns, plant interactions, pollen sembled into group CDEFGHI with common
biology, dispersal of seeds and fruits. ancestor at o. Note that the group AB can
4. The classification can direct the next be merged with CDEFGHI to form single
search for genes, biocontrol agents most inclusive group ABCDEFGHI. Now we
and potential crop species. have been able to construct taxa at three
5. The classification can be of consider- ranks instead of two from tree I.
able help in conservation strategies. Supposing the taxa A to I included in the
The evolutionary history of the of the group tree, are different species. From tree II, thus
of 8 living species shown in Figure 8.12 was we are able to recognize three genera AB,
known with precise point of character trans- CDEFG and HI. The last two are next as-
formations, and the construction of mono- sembled into family CDEFGHI and the
phyletic groups, assembled into successively former a monotypic family AB. The other al-
more inclusive groups, did not pose much ternative was to place A and B in two sepa-
problem. But it is often not the case. Even, rate monotypic genera (depending on the de-
most resolved consensus trees are often gree of morphological and genetic divergence
ambiguous in several respects. obtained) which are then assembled into
264 Plant Systematics
family AB. The two families may next be as- affinities with very poor support, with highly
sembled into order ABEDEFGHI. There could unstable position.
be other possibilities also. The second rank The final decisions on the recognition of
could be a subfamily and the third a family. groups are, however, often based on personal
Similarly, a third rank could be a suborder interpretation of phylogenies. Chloranthus,
instead of an order. These final decisions in this tree as well in several others, is
are often made, based on the size of the closer to Magnolia (Magnoliales) and Laurus
group, degree of divergence, and the reliabil- (Laurales), but often finds different treat-
ity of characters. All the groups recognized ment. APG II places Chloranthaceae after
above would be monophyletic at the respec- Amborellaceae at the start of Angiosperms.
tive ranks. Judd et al., had earlier (1999) placed
Next, let us look at the tree shown in the Chloranthaceae under order Laurales of
Figure 8.29, a study on paleoherbs. Ranun- Magnoliid complex, but have now (2008)
culus and Aquilegia were used as outgroup shifted the family among basal ANITA Grade
representing family Ranunculaceae; their with uncertain position. APweb of Stevens
isolated position from paleoherbs is clearly (2008), which places the family under order
depicted in the tree. Paleoherbs constitute Chloranthales. Thorne had earlier (1999,
a group of taxa of uncertain affinities, which 2000) placed Chloranthaceae in
have been placed differently in various clas- Magnoliidae>Magnolianae
sification schemes, but a few points seem >Magnoliales> Chloranthineae (other sub-
to have been resolved. Piper, and Peperomia orders within the order being Magnoliineae,
(both belong to Piperaceae) form a distinct and Laurineae), but subsequently (2003) in-
group, and so do Saururus, Gymnotheca, cluded the family after Amborellaceae un-
Houttuynia and Anemopsis (all four belonging der order Chloranthales, the first order of
to Saururaceae), and the two families a well Magnoliidae, finally (2006, 2007) separated
supported (bootstrap support of 90 per cent). under subclass Chloranthidae, a placement
This was confirmed by comparison of seven somewhat similar to APG II. Further discus-
published trees of paleoherbs. Cabomba, sion on angiosperm affinities will be
Lactoris and Saruma have least resolved resumed in the next chapter.
Chapter 9
Phylogeny of Angiosperms
Angiosperms form the most dominant group giosperms dominate all major terrestrial veg-
of plants with at least 253,300 species etation zones, account for the majority of pri-
(Thorne, 2007), a number much greater mary production on land, and exhibit bewil-
than all other groups of plants combined to- dering morphological diversity. Unfortu-
gether. Not only in numbers, angiosperms nately, much less is known about the origin
are also found in a far greater range of habi- and early evolution of angiosperms, result-
tats than any other group of land plants. The ing in a number of different views regarding
phylogeny of angiosperms has, however, their ancestors, the earliest forms and
been a much-debated subject, largely be- course of evolution. The origin of an-
cause of very poor records of the earliest an- giosperms may be conveniently discussed
giosperms. These earliest angiosperms prob- under the following considerations.
ably lived in habitats that were not best
suited for fossilization. Before trying to What are Angiosperms?
evaluate the phylogeny, it would be useful
Angiosperms form a distinct group of seed
to have an understanding of the major terms
plants sharing a unique combination of char-
and concepts concerning phylogeny in gen-
acters. These important characters include
eral, and with respect to angiosperms in
carpels enclosing the ovules, pollen grains
particular.
germinating on the stigma, sieve tubes with
companion cells, double fertilization result-
ing in triploid endosperm, and highly reduced
ORIGIN OF ANGIOSPERMS male and female gametophytes. The an-
The origin and early evolution of an- giosperms also have vessels. The pollen
giosperms are enigmas that have intrigued grains of angiosperms are also unique in
botanists for well over a century. They con- having non-laminate endexine and ectexine
stituted an abominable mystery to Darwin. differentiated into a foot-layer, columellar
The mystery is slowly being sleuthed and layer and tectum (tectum absent in
at the present pace of Sherlock Holms re- Amborellaceae). The angiosperm flower typi-
search, it may be no more mysterious cally is a hermaphrodite structure with car-
within the next two decades than for any pels surrounded by stamens and the latter
other major group. With the exception of co- by petals and sepals, since insect pollina-
nifer forest and moss-lichen tundra, an- tion prevails. Arbuscular mycorrhizae are
266 Plant Systematics
also unique to angiosperms (except anemophily. In spite of these and other ex-
Amborellaceae, Nymphaeales and ceptions, this combination of characters is
Austrobaileyales). The vessel elements of an- unique to angiosperms and not found in any
giosperms typically possess scalariform per- other group of seed plants.
forations.
There may be individual exceptions to What is the age of
most of these characters. Vessels are absent
in some angiosperms (Winteraceae) while Angiosperms?
some gymnosperms have vessels (Gnetales). The time of origin of angiosperms is a mat-
The flowers are unisexual without perianth ter of considerable debate. For many years,
in several Amentiferae, which also exhibit the earliest well-documented angiosperm
Phylogeny of Angiosperms 267
fossil was considered to be the form-genus other fossil pollens from the Jurassic age at-
Clavitopollenites described (Couper, 1958) tributed to Nymphaeaceae ultimately turned
from Barremian and Aptian strata of Early out to be gymnosperms.
Cretaceous (Table 9.1) of southern England In the last few years Sun et al., (1998,
(132 to 112 mya-million years), a 2002) have described fossils of Archaefructus
monosulcate pollen with distinctly sculptured from Upper Cretaceous (nearly 124 mya) of
exine, resembling the pollen of the extant China, with clearly defined spirally arranged
genus Ascarina. Brenner and Bickoff (1992) conduplicate carpels enclosing ovules, a fea-
recorded similar but inaperturate pollen ture not reported in earlier angiosperms.
grains from the Valanginian (ca 135 mya) of The fruit is a follicle. This is considered to
the Helez formation of Israel, now consid- be the oldest record of angiosperm flower.
ered to be the oldest record of angiosperm Several vegetative structures from the
fossils (Taylor and Hickey, 1996). Also found Triassic were also attributed to angiosperms.
in Late Hauterivian (Brenner, 1996) of Is- Brown (1956) described Sanmiguilea leaves
rael (ca 132 mya) were Pre-Afropollis (mostly from the Late Triassic of Colorado and sug-
inaperturate, few weakly monosulcate), gested affinity with Palmae. A better under-
Clavitopollenites (weakly monosulcate to standing of the plant was made by Cornet
inaperturate), and Liliacidites (monosulcate, (1986, 1989), who regarded it as a presumed
sexine similar to monocots). From Late primitive angiosperm with features of mono-
Barremian have been recorded Afropollis and cots and dicots. Although its angiosperm ve-
Brenneripollis (both lacking columellae) and nation was refuted by Hickey and Doyle
Tricolpites (the first appearance of tricolpate (1977), Cornet (1989) established its an-
pollen grains) giosperm venation and associated reproduc-
The number and diversity of angiosperm tive structures. Our knowledge of this con-
fossils increased suddenly and by the end of troversial taxon, however, is far from clear.
the Early Cretaceous (ca 100 mya) period Marcouia leaves (earlier described as
major groups of angiosperms, including her- Ctenis neuropteroides by Daugherty, 1941) are
baceous Magnoliidae, Magnoliales, Laurales, recorded from the Upper Triassic of Arizona
Winteroids and Liliopsida were well repre- and New Mexico. Its angiosperm affinities
sented. In Late Cretaceous, at least 50 per are not clear.
cent of the species in the fossil flora were Harris (1932) described Furcula from the
angiosperms. By the end of the Cretaceous, Upper Triassic of Greenland as bifurcate leaf
many extant angiosperm families had ap- with dichotomous venation. Although it
peared. They subsequently increased expo- seems to approach dicots in venation and
nentially and constituted the most dominant cuticular structure, it has several non-an-
land flora, continuing up to the present. giospermous characters including bifurcat-
The trail in the reverse direction is in- ing midrib and blade, higher vein orders with
complete and confusing. Many claims of an- relatively acute angles of origin (Hickey and
giosperm records before the Cretaceous were Doyle, 1977).
made but largely rejected. Erdtman (1948) Cornet (1993) has described Pannaulika,
described Eucommiidites as a tricolpate di- a dicot-like leaf form from Late Triassic
cotyledonous pollen grain from the Jurassic. from the Virginia-North Carolina border. It
This, however, had bilateral symmetry in- was considered to be a three-lobed palmately
stead of the radial symmetry of angiosperms veined leaf. The associated reproductive
(Hughes, 1961) and granular exine with gym- structures were attributed to angiosperms
nospermous laminated endexine (Doyle et but it is not certain that any of the repro-
al., 1975). This pollen grain was also discov- ductive structures were produced by the
ered in the micropyle of seeds of the female plant that bore Pannaulika. Taylor and
cone of uncertain but clearly gymnosper- Hickey (1996), however, do not accept its
mous affinities (Brenner, 1963). Several angiosperm affinities, largely on the basis
268 Plant Systematics
of the venation pattern, which resembles was made by Martin et al., (1989) using nine
more that of ferns. Much more information angiosperm sequences from gapC, the
is needed before the Triassic record of an- nuclear gene encoding GADPH (cytosolic
giosperms can be established. glyceraldehydes-3-phosphate dehydroge-
Cornet (1996) described Welwitschia like nase). The observed number of
fossil as Archaestrobilus cupulanthus from the nonsynonymous substitutions between each
Late Triassic of Texas. The plant had simi- pair of species (Ka) was compared to esti-
larly constructed male and female spikes, mated rates of Ka (substitutions per site per
each possessing hundreds of spirally ar- year) inferred from known divergence times
ranged macrocupules. The fossil has revived (e.g. plants-animals, plants-yeast, mammal-
renewed interest in gnetopsids. chicken, human-rat). The results implied
Given the inconclusive pre-Cretaceous separation of monocots and dicots at 319 +
record of angiosperms, it is largely believed 35 mya, a dicot radiation at 276 + 33 mya,
that angiosperms arose in the Late Juras- and cereal grass divergence at 103 + 22 mya.
sic or very Early Cretaceous (Taylor, 1981) The results were questioned by several au-
nearly 130 to 135 mya ago (Jones and thors, since the study used a single gene.
Luchsinger, 1986). Wolfe et al., (1989) attempted to date the
Melville (1983), who strongly advocated his monocot-dicot split using a large number of
gonophyll theory, believed that angiosperms genes in chloroplast genome and using a
arose nearly 240 mya ago in the Permian three-tiered approach. They suggested Late
and took nearly 140 mya before they spread Triassic (200 mya) as the likely estimate of
widely in Cretaceous. The Glossopteridae monocot-dicot split. Martin et al., (1993) pro-
which gave rise to angiosperms met with a vided new data to support Carboniferous ori-
disaster in the Triassic and disappeared, this gin (~300 Mya) of angiosperms. They used
disaster slowing down the progress of an- both rbcL and gapC sequences for this study.
giosperms slow until the Cretaceous when Sytsma and Baum (1996) conclude that the
their curve entered an exponential phase. results strongly caution using the molecu-
This idea has, however, found little favour. lar clock for dating unless extensive sam-
There has been increasing realization in pling of taxa and genes with quite different
recent years (Troitsky et al., 1991; Doyle and molecular evolution is completed. Thus, the
Donoghue, 1993; and Crane et al., 1995) to resolution of angiosperm phylogeny may
distinguish two datesone in the Triassic have to wait for a more complete molecular
when the stem angiosperms (angiophytes data and its proper appraisal.
sensu Doyle and Donoghue, 1993 or
proangiosperms sensu Troitsky et al., 1991) What is the place of their ori-
separated from sister groups (Gnetales,
Bennettitales and Pentoxylales) and the sec-
gin?
ond in the Late Jurassic when the crown It was earlier believed that angiosperms
group of angiosperms (crown angiophytes) arose in the Arctic region (Seward, 1931),
split into extant subgroups (Figure 9.1). with subsequent southwards migration.
Axelrod (1970) suggested that flowering
plants evolved in mild uplands (upland
Molecular Dating theory) at low latitudes. Smith (1970) located
There have been a number of attempts to the general area of South-East Asia, adja-
estimate the time of divergence of an- cent to Malaysia as the site where an-
giosperms (node B in Figure 9.1) by applying giosperms evolved when Gondwana and
a molecular clock to nucleotide sequence Laurasia were undergoing initial fragmen-
data. The results mostly pointing to much tation. Stebbins (1974) suggested that their
earlier origin of angiosperms have, however, origin occurred in exposed habitats in ar-
been contradictory. The first detailed attempt eas of seasonal drought. Takhtajan (1966,
Phylogeny of Angiosperms 269
1980), who believed in the neotenous origin became widespread following changing sea
of angiosperms, suggested that angiosperms levels during the Early Cretaceous.
arose under environmental stress, probably Although agreeing with the role of envi-
as a result of adaptation to moderate sea- ronmental stress, many authors in recent
sonal draught on rocky mountain slopes in years (Hickey and Doyle, 1977; Upchurch and
areas with monsoon climate. Wolfe, 1987; Hickey and Taylor, 1992) have
Retallack and Dilcher (1981) believed that suggested that early angiosperms lived along
the earliest angiosperms were probably stream- and lake-margins (lowland theory).
woody, small-leaved plants occurring in the Later, they appeared in more stable
Rift valley system adjoining Africa and South backswamp and channel sites, and lastly, on
America. Some of these angiosperms river terraces. Taylor and Hickey (1996)
adapted to the coastal environments and suggested that ancestral angiosperms were
Gnetales
Angiosperms
Caytoniaceae
Bennettitales
Cenozoic
Pentoxylon
Cretaceous
II
Jurassic
Triassic
Figure 9.1 Phylogenetic tree of anthophytes (angiosperm lineage and sister groups). Point (I)
marks when angiosperm lineage separated from sister groups in the Late Triassic,
and (II) marks the splitting of crown angiosperms into extant subgroups in the Late
Jurassic. Dotted line represents conclusions for which fossil record is not available
(diagram based on Doyle and Donoghue, 1993).
270 Plant Systematics
The bisexual flower of Magnoliales has been Cycadeoidea, which had an elongated recep-
considered to have evolved from such a struc- tacle with perianth-like bracts, a whorl of
ture. Also agreeing with this general prin- pollen-bearing microsporophylls surrounding
ciple, various authors have tried to identify the ovuliferous region having numerous
different gymnosperm groups as possible ovules and interseminal scales packed
angiosperm ancestors: together. There were, however, signs of
abscission at the base of the male structure,
which would have shed, exposing the ovular
Cycadeoidales (Bennettitales) region.
The group, now better known as The plant was believed to look like cycads
Cycadeoidales, appeared in the Triassic and with a short compact trunk and a crown of
disappeared in the Cretaceous. Their poten- pinnate compound leaves (Figure 9.2-A). It
tial as angiosperm ancestors was largely was earlier suggested that the microsporo-
built upon the studies of Wieland (1906, phylls opened at maturity but the subsequent
1916). Lemesle (1946) considered the group studies of Crepet (1974) showed that
to be ancestral to angiosperms, primarily be- microsporophylls were pinnate, and distal
cause of the hermaphrodite nature of tips of pinnae were fused, the opening of the
Figure 9.2 Cycadeoidea. A: Suggested reconstruction of plant with a compact trunk and numer-
ous pinnate leaves. B: Suggested reconstruction of the cone cut open to show the
arrangement of microsporangia. Ovulate receptacle is in the centre (A, after Delevoryas,
1971; B, after Crepet, 1974).
272 Plant Systematics
Figure 9.6 Pentoxylales. A: Suggested reconstruction of Pentoxylon sahnii with strap-shaped leaves.
B: Suggested reconstruction of seed cones (From Sahni, 1948).
and assumed that vessels were lost in sev- macrocupule had an axially curled (tubular)
eral early lines. Muhammad and Sattler bract-like organ with a narrow shaft and
(1982) found scalariform perforations in ves- expanded funnel shaped apex. The
sel-elements of Gnetum, suggesting that an- macrocupules contained an ovule (or seed)
giosperms may be derived from Gnetales af- surrounded by sterile scales. Three to four
ter all. Carlquist (1996), however, concludes very small bracts were present attached
that this claim from Gnetum does not hold near the base and surrounding the
when large samples are examined. macrocupule.
The basal group of angiosperms accord- Each male macrocupule contained fila-
ing to this theory included amentiferous- ment like appendages instead of sterile
hamamelid orders Casuarinales, Fagales, scales within. Outside, the macrocupule was
Myricales and Juglandales. It is significant crowded with numerous bivalved mi-
to note that Wettstein (1907) also included crosporophylls, each with four pollen sacs
in this basal group, Chloranthaceae and attached to an inflated stalk. On the out-
Piperaceae, which have been inviting con- side of the female macrocupule were present
siderable attention in recent years. gland-like structures resembling the stalks
The importance of Gnetopsids in an- bearing pollen sacs on the male
giosperm phylogeny has been further macrocupule. This suggests an origin from
strengthened by the discovery of Welwitschia a bisexual macrocupule. The pollen grains
like fossil described by Cornet (1996) as are radially symmetrical and monosulcate.
Archaestrobilus cupulanthus from the Late The plant is regarded as a gnetophyte more
Triassic of Texas (Figure 9.5). The plant had primitive than extant Gnetales.
similarly constructed male and female Ephedra is generally considered to be the
spikes, each possessing hundreds of spirally most primitive of the three living genera of
arranged macrocupules. Male spikes were gnetopsids. Cornet believes that
borne in clusters of three, whereas female Archaestrobilus possessed characters that
spikes occurred singly. Each female may be plesiomorphic even for Ephedra, such
Phylogeny of Angiosperms 275
as radial symmetry of floral parts which are gins (i.e. angiosperms are polyphyletic). In
spirally arranged and not opposite. He be- most Magnoliidae and their dicotyledonous
lieves that Bennettitales, Gnetales, derivatives, they are modified pluriaxial sys-
Pentoxylales and angiosperms had a com- tems (holanthocorms) that originated from
mon ancestry sometimes before Late Trias- the gnetopsids via the Piperales, whereas
sic. Gnetales are relatives of angiosperms the modification of an originally uniaxial sys-
and Bennettitales that underwent drastic tem (gonoclad or anthoid) gave rise to flow-
floral reduction and aggregation in response ers of Chloranthaceae. Meeuse (1963) pos-
to wind pollination. tulated a separate origin of monocotyledons
Taylor and Hickey (1996) have presented from the fossil order Pentoxylales through
a hypothesis for the derivation of the flower the monocot order Pandanales.
of Chloranthaceae from the inflorescence Pentoxylales (Figure 9.6) were described
unit (anthion) of gnetopsids, with consider- from the Jurassic of India and New Zealand.
able reduction in the reproductive parts. The stem (Pentoxylon) had five conducting
strands. The pollen-bearing organ (Sahnia)
was pinnate: free above and fused into a cup
Anthocorm Theory below. The seed-bearing structure was simi-
This theory is a modified version of the lar to a mulberry with about 20 sessile seeds,
pseudanthial theory and was proposed by each having an outer fleshy sarcotesta and
Neumayer (1924) and strongly advocated by the inner hard sclerotesta. The sarcotesta
Meeuse (1963, 1972). According to this was considered homologous to the cupule of
theory, the angiosperm flower (functional seed ferns. The carpel of angiosperms was
reproductive unit) has several separate ori- regarded as a composite structure being an
276 Plant Systematics
_____Anthophytes_________________________________________________
______Angiophytes (possible)___________________
___Crown Angiophytes
Triassic Jurassic
reticulate reticulate
Bennettitaleans Gnetopsids pollen Sanmiguillia pollen Angiosperms
Figure 9.8 A consensus phylogeny of Anthophytes proposed by Taylor and Hickey (1996). Note
that Pentoxylon has been excluded from sister groups (now only Bennettitaleans and
Gnetopsids) of angiophytes.
Figure 9.9 Dr D. L. Dilcher palaeobotanist with the Florida Museum of Natural History at the
University of Florida, who has pioneered research on Angiosperm fossils with speci-
men (above left) and reconstruction (above right) of recently described (Sun, Dilcher
et al., 2002) Archaefructus sinensis, believed to be the oldest angiosperm fossil nearly
124 mya old.
278 Plant Systematics
Magnoliids
Figure 9.12 Flower and a twig of Magnolia The alternative Besseyan School (Ranalian
campbellii with elongated fruiting School) considers the Ranalian complex (in-
axis (reproduced with permission cluding Magnoliales), having bisexual flow-
from Oxford University Press). ers with free, equal, spirally arranged floral
parts, representative of the most primitive
angiosperms.
flowers of Magnoliales to be the most primi-
tive). During the last few years the Magnoliaceae
paleoherbs are emerging as the strong con-
Bessey (1915), Hutchinson (1959, 1973),
tenders. The candidate basal groups are dis-
Takhtajan (1966, 1969) and Cronquist (1968)
cussed below:
all believed that large solitary flower of Mag-
nolia (Figure 9.12) (Magnolia the primitive
Casuarinaceae theory) with an elongated floral axis bear-
According to the Englerian Schoolthe ing numerous spirally arranged stamens and
view now largely rejected Amentiferae with carpels, is the most primitive living repre-
reduced unisexual flowers in catkins (or sentative. The stamens of Magnolia and
aments) constitute the most primitive liv- other closely related genera are laminar,
ing angiosperms. Engler, as well as Rendle perianth undifferentiated, and pollen grains
(1892) and Wettstein (1935) considered monosulcate and boat-shaped. In the sub-
sequent works, however, Takhtajan agreed
that the flower of Magnolia is more advanced
than those found in Winteraceae and
Degeneriaceae.
Winteraceae
After several decades of Magnolia being con-
sidered as the most primitive living an-
giosperm, the view was challenged by
Gottsberger (1974) and Thorne (1976), who
considered the most primitive flowers to
have been middle sized, with fewer stamens
and carpels, and grouped in lateral clusters
Figure 9.13 Winteraceae Flowering twig of as in the family Winteraceae, to which such
Drimys winteri. primitive genera as Drimys (Figure 9.13)
282 Plant Systematics
Degeneriaceae
Takhtajan, who was earlier a strong sup- Figure 9.14 Degeneriaceae. Degeneria vitiensis.
A: Branch with flowers; B: Sta-
porter of Magnolia as the most primitive liv-
men; C: Transverse section of car-
ing angiosperm, has abandoned this view in pel; D: Fruit.
favour of Degeneriaceae and Winteraceae
to be the basal angiosperm families, but has
maintained since 1980 to regard
Degeneriaceae as the most primitive. ous spirally arranged tepals, and few ovulate
Degeneriaceae (Figure 9.14) may be rec- carpels. Food bodies terminating the stamen
ognized by their spiral, entire, exstipulate connectives indicate beetle pollination.
leaves and large, axillary flowers with many The family (Figure 9.15) is regarded as the
tepals and a single carpel. Vessel elements most basal family of Laurales. It is interest-
have scalariform perforations. Leaves are ing to note that genus Idiospermum (which
spirally arranged and pollen boat-shaped. The was recognized as new genus based on
most significant plesiomorphic features in- Calycanthus australiensis by S. T. Blake in
clude stigma running the entire length of 1972) was considered as the most primitive
the carpel, laminar stamens with three flowering plant by these authors. Endress
veins, the fruit a follicle and embryo with 3 (1983) had described In all respects,
to 4 cotyledons. Ideospermum gives the impression of a
strange living fossil.
Calycanthaceae
Suggestions have also come projecting Paleoherbs
Calycanthaceae (Loconte and Stevenson, The last decade of the twentieth century has
1991) as basic angiosperms with a series of seen the strong development of an alterna-
vegetative and reproductive angiosperm tive herbaceous origin hypothesis for an-
plesiomorphies such as shrub habit, giosperms (Taylor and Hickey, 1996) origi-
unilacunar two-trace nodes, vessels with nally developed as paleoherb hypothesis. The
scalariform perforations, sieve-tube ele- most primitive angiosperms are considered
ments with starch inclusions, opposite to be rhizomatous or scrambling perennial
leaves, strobilar flowers, leaf-like herbs with simple net-veined leaves, flow-
bracteopetals, poorly differentiated numer- ers in racemose or cymose inflorescences,
Phylogeny of Angiosperms 283
Chloranthaceae
Taylor and Hickey (1996) consider
Chloranthaceae (Figure 9.16) the basic an-
giosperm family. The family shows several
plesiomorphic characters such as flowers in
an inflorescence, plants dioecious, carpels
solitary, placentation apical, and fruit
drupaceous with small seeds. The family is
the oldest in the fossil record, the fossil ge-
nus Clavitopollenites being assigned to
Figure 9.15 Calycanthaceae. Calycanthus Chloranthaceae and closer to the genus
occidentalis. A: Flowering twig Ascarina. The stems of Sarcandra are primi-
with solitary terminal flower. B:
tively vesselless, but Carlquist (1996) has
L. S. of flower showing free car-
pels. C: Flower with some
reported vessels in this genus. The family
tepals and stamens removed. is considered to be earliest to record wind
pollination in angiosperms.
The plants are mostly herbaceous, some
with free carpels containing one or two species being shrubs. The flowers are highly
ovules. A number of families are included reduced, subtended by a bract and without
in the group. Thorne (2000) had placed all of any perianth, and arranged in decussate
them under Magnoliales, along with Magno-
liaceae and Winteraceae. In his later revi-
sion (2003), however, placed Amborellaceae
and Chloranthaceae (together with Trime-
niaceae and Austrobaileyaceae) under Chlo-
ranthales, the first order of Magnoliidae
(and accordingly angiosperms), the families
arranged in that order. Subsequently (2006,
2007) he separated them under distinct sub-
class Chloranthidae, at the begining of an-
giosperms. The family Ceratophyllaceae is
placed after the monocot families, towards
the beginning of Ranunculidae. The place-
ment of Amborellaceae at the beginning of
angiosperms is found in the classification Figure 9.16 Chloranthaceae. A: Ascarina
lanceolata, flowering branch.
schemes of Judd et al. (2003), APG II (2003)
B: A male flower C: fruit D: Bi-
and APweb (Stevens, 2003). The position of sexual flower of Chloranthus
the other two families is, however, not set- henryi with bract, three stamens
tled. Judd. et al. and APweb consider both and pistil with tufted stigma.
Chloranthaceae (towards the end of basal E: Bisexual flower of Sarcandra
families before Magnoliid complex) and Cer- glabra.
284 Plant Systematics
differentiation of stigmatic region for receiv- ingested by the insect larvae elevate the
ing pollen, and the distinct style to keep the level of hormone, resulting in their develop-
stigma within the reach of insects. To suite ment into abnormal asexual adults. The lar-
to the floral mechanisms the early beetles vae as such, learn to avoid such plants.
were slowly replaced by higher insects such Some plant products help insects against
as moths, butterflies, bees, wasps and flies, predators. Monarch butterfly, for example,
coinciding with the floral diversification of ingests cardiac glucoside from milkweed
angiosperms. Asclepias. Such butterflies if ingested by
Beetle pollinated flowers are typically dull blue jays make latter violently sick. Blue
or white with fruity odours, edible petals and jays learn to recognize the toxic brightly
heavily protected seeds. Bee pollinated flow- coloured monarch butterflies. The milkweed,
ers are brightly coloured (blue or yellow but thus helps to protect monarch butterfly from
not red) with honey guides and with lot of pol- blue jay.
len and nectar. Butterfly pollinated flowers are
red, blue or yellow. Moth pollinated flowers Basic evolutionary trends
mostly open at night and have heavy fra-
grance to attract moths. Moth and Butterfly Evolution within Angiosperms has proceeded
pollinated flowers generally have long corolla along different lines in different groups. Nu-
tubes with nectaries at the base. Bird polli- merous trends in the evolution of an-
nated flowers are bright red or yellow, pro- giosperms have been recognized from com-
duce large amount of nectar, with little or no parative studies of extant and fossil plants.
fragrance. Bat pollinated flowers are dull The general processes involved in attaining
coloured, open at night and have fruity odour. diversity of angiosperms are underlined be-
low.
Biochemical coevolution
Plants and their insect predators are believed
Fusion
to have undergone adaptive radiation in During the course of evolution in an-
stepwise manner, with the plant groups giosperms, fusion of different parts has led
evolving new and highly effective chemical to floral complexity. Fusion of like parts has
defenses against herbivores and the latter led to the development of gamosepaly,
continually evolving means of overcoming gamopetaly, synandry and syncarpy in vari-
these defenses. Mustard oils of Brassicaceae ous families of angiosperms. Stamens have
are toxic for many animals, yet they attract shown fusion to different degrees: fusion of
other herbivores such as cabbage worm filaments only (monadelphous condition in
which uses the mustard oils to locate the Malvaceae), fusion of anthers only
cabbage plant for laying its eggs. The chemi- (syngenesious condition found in
cal hypericin in genus Hypericum repels al- Asteraceae) or complete fusion (synandry as
most all herbivores but the beetle genus in Cucurbita). Carpels may similarly be fused
Chrysolina can detoxify hypericin and use it only by ovaries (Synovarious:
to locate the plant. Caryophyllaceae), only by styles (synstylous:
The evolution of new chemical defense of Apocynaceae) or complete fusion of both ova-
plant has resulted in plants often acquiring ries and styles (Synstylovarious: Solanaceae,
the growth hormones found in insect larvae. Primulaceae). Fusion of unlike parts has re-
Proper levels of juvenile hormone in insect sulted in an epipetalous condition (fusion of
larvae are essential for the hatching of in- petals and stamens), formation of
sect larvae into normal sexual adults. Sev- gynostegium (the fusion of stamens and gy-
eral species of plants such as Ageratum con- noecium: Asclepiadaceae) and formation of
tain hormone juvabione, similar to the ju- an inferior ovary (fusion of calyx with ovary:
venile hormone of insects. Such plants if Apiaceae, Myrtaceae, etc.).
Phylogeny of Angiosperms 287
Reduction Remoration
Relatively simple flowers of many families The term was suggested by Melville (1983)
have primarily been the result of reduction. to refer to evolutionary retrogression found
The loss of either stamens or carpels has in angiosperms and their fossil relatives.
resulted in unisexual flowers. The loss of one The fertile shoots of angiosperms, accord-
perianth whorl has resulted in ing to him, show venation pattern changes
monochlamydeous forms, and their total ab- progressively from vegetative leaves through
sence in achlamydeous forms. There has successive older evolutionary stages in
also been individual reduction in the num- bracts and sepals, and the most ancient in
ber of perianth parts, number of stamens and petals. The innermost parts in a bud as such
carpels. Within the ovary different genera represent the most primitive evolutionary
have shown reduction in the number of condition, and the outermost the most re-
ovules to ultimately one, as seen in the cent condition.
transformation of follicle into achene within There has been some shift in the under-
the family Ranunculaceae. There has also standing of angiosperm phylogeny to support
been reduction in the size of flowers, mani- the stachyosporous origin of angiosperm
fested in diverse families such as carpel (Taylor and Kirchner, 1996). With the
Asteraceae and Poaceae. Reduction in the acceptance of such a viewpoint, the repro-
size of seeds has been extreme in ductive axis with many flowers, few carpels
Orchidaceae. Male flower of Euphorbia pre- per flower and few ovules per carpel are an-
sents a single stamen, there being no peri- cestral. Evolution proceeded along two direc-
anth or any trace of a pistillode, only a joint tions from this: one with few flowers, each
indicates the position of thalamus and the of which had many carpels and few ovules
demarcation between the pedicel and the and the other with few flowers, each
filament. containing few carpels and many ovules. The
evolutionary trends in angiosperms are thus
Change in Symmetry often complicated and frequent reversal of
From simple radially symmetrical actino- trends may be encountered, as for example
morphic flowers in primitive flowers devel- the secondary loss of vessels in some
oped zygomorphic flowers in various fami- members.
lies to suit insect pollination. The size of
corolla tube and orientation of corolla lobes Xylem evolution
changed according to the mouthparts of the Xylem tissue of angiosperms largely consists
pollinating insects, with striking specializa- of dead tracheids and vessels, supporting fi-
tion achieved in the turn-pipe mechanism bers and living ray cells. Tracheids are elon-
of Salvia flowers, and female wasp like flow- gate, imperforate water conducting cells
ers of orchid Ophrys. found in almost all lower vascular plants,
gymnosperms and angiosperms. Vessels are
Elaboration perforate elements largely restricted to an-
This compensating mechanism has been giosperms, although also found in extant
found in several families. In Asteraceae and gnetopsids, some species of Equisetum, Se-
Poaceae, the reduction in the size of flowers laginella, Marsilea and Pteridium. The pres-
has been compensated by an increase in the ence of vessels in gnetopsids, the closest
number of flowers in the inflorescence. relatives of angiosperms, had given rise to
Similarly, reduction in the number of ovules the speculation that the latter arose from
has been accompanied by an increase in the former. The studies of Bailey and associates,
size of ovule and ultimately seed, as seen in however, showed that the vessels in the two
Juglans and Aesculus. groups arose independently. In gnetopsids,
288 Plant Systematics
Figure 9.19 Presumed evolutionary transformation of gymnosperm tracheid with circular pitting
(A) to angiosperm tracheid with scalariform pitting (B), further to vessel-element
with oblique perforation plate with numerous scaraliform bars (C). Further shorten-
ing and broadening of vessel-element, perforation plate becoming more and more
horizontal and reduction in the number of bars in the perforation plate ultimately
led to shortest, broad vessel element with transverse simple perforation plate. Ves-
sel-element E shows one scalariform and one simple perforation plate. Note con-
spicuous tails, a reminder of tracheids in vessel-elements D, E and F with still
oblique perforation plates. J represents the vessel-element of Quercus alba, being
more broader than long and with a simple large perforation.
they developed from tracheids with circular Because all fossil and almost all extant
pitting and in angiosperms from tracheids gymnosperms possess tracheids with circu-
with scalariform pitting. It is also pointed out lar-bordered pitting, it has led to the conclu-
by Carlquist (1996) that circular pitting in sion that the tracheid is the most primitive
the vessels of gnetopsids, as also the gym- type of tracheary element in the an-
nosperm tracheids in general, is different giosperms. As tracheids have given rise to
from angiosperms in having pits with torus vessel elements, the most primitive type of
and pit margo with pores much larger than vessels have long narrow vessel elements
those of angiosperms. Although some an- with tapering ends. The tracheids in an-
giosperms do have pit membrane with torus, giosperms have scalariform pitting, and as
the pit margo is always absent. such it is assumed that these tracheids
Phylogeny of Angiosperms 289
arose from tracheids of gymnsperms with stem metaxylem by Takahashi, 1988). This
circular pitting. In the transformation of tra- led Carlquist to conclude that vessels have
cheids with scalariform pitting to vessel el- originated numerous times in dicotyledons.
ements with scalariform pitting, the earli- It had often been held that vessels arose
est elements had perforation plates with nu- first in the secondary xylem and later in the
merous scalariform bars. During further evo- metaxylem, and that specialization has
lution of vessels, elements became smaller gradually advanced from the secondary to
and broader, and perforation plates more primary xylem. Carlquist pointed out that
horizontal. There has been an accompanied scalariform pitting is widespread in the met-
reduction in the number of scalariform bars, axylem of vascular plants and if primitive
resulting in shortest broadest vessel ele- angiosperms were herbs, in accord with
ments with simple perforation plate and paleoherb hypothesis, metaxylem would be
transverse end wall (Figure 9.19) in most expected to have scalariform pitting of
advanced forms. Hamamelididae were once tracheary elements. The development of
regarded to be primitive due to their simple woody habitif featured paedomorphosis
floral structure, but have advanced vessel would extend scalariform patterns in second-
elements and thus considered advanced ary xylem.
over Magnoliidae with primitive elongated
narrow vessel elements. This is supported
by studies on floral anatomy and palynology. Stamen Evolution
Carlquist (1996), based on a survey of wood The most primitive type of Stamen in an-
anatomy, has identified a number of distinct giosperms represented in genera like Degen-
evolutionary trends in angiosperms. The eria, Austrobaileya, Himantandra and Magno-
cambial initials have shortened, the ratio lia (Figure 9. 20) and other primitive genera
of length accompanying fibers to vessel ele- is laminar, 3-veined leaf-like organ without
ments (F/V ratio) has shown an increase any clear cut distinction of fertile and ster-
from 1.00 in primitive dicotyledons to about ile parts. The pollen sacs (sporangia) are
4.00 in the most specialized woods, and an- borne near the centre either on the abaxial
gular outline of vessels changed to circular (dorsal) side (Degeneria, Annonaceae and
outline together with widening of their di- Himatandraceae) or on adaxial (ventral) side
ameter. There was also a progressive reduc- (Austrobaileya and Magnolia). Semilaminar
tion in the number of scalariform bars, ulti- stamens occur in some other primitive fam-
mately resulting in simple perforation, fa- ilies like Nymphaeaceae, Ceratophyllaceae
cilitating an easier flow of water. The lat- and Eupomatiaceae. In further specializa-
eral walls showed a shift from scalariform to tion of stamen, there has been reduction of
the opposite circular pits and finally to al- sterile tissues and retraction of marginal
ternate circular pits, so as to provide better areas. The proximal part became filament
mechanical strength. Imperforate tracheids and distal part the anther. The midvein re-
have shown a shift to fibre-tracheids to fi- gion formed the connective, and distal part
nally libriform fibres. Shortening of fusiform the appendage, as seen in several genera.
initials is correlated with storeying of woods. In primitive families, connective forms a
It is interesting to note that cladistic stud- major part of anther. In more advanced fami-
ies have shown that present-day vessel-less lies, the connective is highly reduced
angiosperms do not form a single clade and (Acanthaceae, Plantaginaceae) or may be
are distributed in diverse groups such as almost absent. In some families such as
Hamamelidales (Trochodendron and Betulaceae, the connective as well as the
Tetracentron), Magnoliales (Amborellaceae, upper part of filament may become divided
Winteraceae), and Laurales (Sarcandra: Ves- and two anther lobes get separated. In more
sels have been, however, reported in root primitive families the connective is
secondary xylem by Carlquist, 1987 and in produced above into an appendage which
290 Plant Systematics
Figure 9.20 Evolution of stamen in angiosperms. A-D: Primitive laminar stamens without clear
distinction of anthers and filaments; A: Austrobaileya scandens with adaxial pollen
sacs (microsporangia); B: Himantandra baccata with abaxial pollen sacs; C: Degeneria
vitiensis with abaxial pollen sacs; D: Magnolia maingayi with adaxial pollen sacs;
E: Laminar stamen of Magnolia nitida with marginal pollen sacs and prolonged sterile
appendage; F: Semilaminar stamen of Michelia fuscata with marginal pollen sacs and
narrowed filament; G: Outer semilaminar stamen of Nymphaea odorata with petaloid
filament and narrow anthers; H: inner stamen with narrower filament and differen-
tiated anther region; I: Stamen of Illicium parviflorum with reduced anther region and
broad filaments; J: Stamen of Opuntia pusilla with well differentiated anthers and
filament; K: Stamen of Poa pratensis with reduced connective and thread-like
filament; L: Stamen of Penstemon canescens with well-defined filament and large
anthers with distinct anther lobes but reduced connective; M: Stamen of Betula nigra
with divided connective and filament.
Figure 9.21 Two different models for evolution of exine and pollen grains in Angiosperms. Walker
and Walker, 1984 (on left). A: Exine of ancestral gymnosperm with homogenous
sexine and laminated nexine; B: Same but sexine with granular infratectal layer;
C: Pollen grain of same, boat shaped and monosulcate; D: Exine of most primitive
angiosperm with smooth sexine and disappearance of laminated nexine; E: Same
but with homogenous sexine; F: Monosulcate pollen of same; G: Exine with develop-
ment of tectum, infratectal layer and homogenous nexine; H: Same but with loss of
tectum.: I: Monosulcate pollen grain with intectate exine. Brenner, 1996 (on right).
I: Exine of early angiosperm, tectate-columellate and without aperture; II: Exine
with initiation of endexine (shaded solid black); III. Nonaperturate early pollen with
circular outline; IV: Exine with complete endexine layer and initiation of sulcus;
V: Exine with developed sulcus; VI: Monosulcate pollen of basal angiosperms;
VII: Monosulcate boat-shaped pollen of Magnoliids and monocots; VIII: Circular
monosulcate pollen of dicots; IX: Tricolpate pollen of Eudicots which might have
developed from monosulcate or inaperturate forms; X: Uniporate pollen; XI: Uniporate
pollen of Winteraceae in tetrads. (Modified from Brenner, 1996).
292 Plant Systematics
shows two independent vascular supplies lar in outline, tectate columellate, and with-
derived from opposite sides of the receptacle, out aperture. A possible intine thickening
as opposed to families where splitting of sta- was accompanied by developments of endex-
mens occurs. ine layer above intine in Hauterivian. The
next step involved evolution of sulcus and
divergence of monocot and dicot pollen types
Pollen grain evolution from basic dicot stock. In Barremian diver-
A large number of families in monocots and sification of monosulcate pollen grains oc-
several primitive dicots of the magnoliid curred with migration to different geographi-
complex bear monosulcate pollen grains, a cal regions. In Lower Aptian tricolpate pol-
condition generally considered to be the len evolved from either monosulcate or
primitive one in angiosperms. Walker and inaperturate forms in northern Gondwana,
Doyle (1975) and Walker and Walker (1984) resulting in evolution of eudicots.
suggested that the primitive angiosperm It is suggested by Brenner that the for-
pollen grain is large- to medium-sized, boat- mation of sulcus during Early Cretaceous
shaped, smooth-walled, with homogenous or may have been an adaptation that was a
granular infratectal layer, the tectum being more effective way of releasing recognition
absent (pollen atectate) and endexine (a proteins involved in pollen-tube development
layer unique to angiosperms, being absent while the later development of tricolpate con-
in gymnosperms) either missing or poorly dition in the Aptian would be a further ex-
developed under the apertural area. This tension of this process.
type of pollen is found among extant an- The formation of endexine before aperture
giosperms in Annonaceae, Degeneriaceae development may reflect the development of
and Magnoliaceae. The prototype of this was intine thickening, which is related to sul-
gymnosperm pollen which was monosulcate, cus development. In extant angiosperms, the
large, boat-shaped with laminated nexine, intine beneath the aperture stores recogni-
homogenous sexine or with granular tion proteins.
infratectal layer (Figure 9.21), a pollen type
common in Bennettitales, Gnetopsids (ex-
cluding Gnetum) and Pentoxylon. In evolution Carpel evolution
of angiosperm pollen from this, the lami- Carpel is a structure unique to angiosperms
nated nexine disappeared, nexine became enclosing and protecting ovules. The evolu-
granular to tectate with columella and re- tion of carpel probably played a major role in
ticulate surface to those with intectate diversity and success of angiosperms as it
collumellae. not only protected seeds from predators, but
Brenner and Bickoff (1992) recorded glo- also carried associated benefits. These in-
bose inaperturate pollen grains from the cluded seed dissemination via the evolution
Valanginian (ca 135 mya) of the Helez for- of numerous dispersal mechanisms, effec-
mation of Israel, now considered to be the tive fertilization by transport of pollen grains
oldest record of angiosperm fossils. These to the stigma and growth of a pollen tube,
pollen grains resemble those of Gnetum in promotion of outbreeding by insect pollina-
general shape and lack of aperture, and also tors through the evolution of special struc-
found in Chloranthaceae, Piperaceae, and tural mechanisms and through the devel-
Saururaceae, which are gaining increased opments of intraspecific and interspecific
attention as basal angiosperm families. This incompatibilty.
led Brenner (1996) to postulate a new model It is more common in recent years to dif-
for the evolution of angiosperm pollen. The ferentiate three types of carpels, a termi-
earliest pollen in angiosperms, developed in nology developed by Taylor (1991). Ascidiate
Valanginian or earlier from stock that also carpels have ovules attached proximally to
gave rise to Gnetum, had small pollen, circu- the closure, plicate ones have ovules
Phylogeny of Angiosperms 293
Figure 9.22 Phyllosporous concept of carpel evolution. A-I, conduplicate closure; J-N, involute
closure; O-U, closer along margins. A: Carpel of Drimys piperita with long stigmatic
crest; B: Transverse section of same showing partially closed margins; C: Trans-
verse section of carpel of Degeneria vitiensis with flared up margins and conspicuous
papillose growth; D-F: Stages in conduplicate closing of carpel with disappearance of
stigmatic region (broken lines) from the body of carpel and its localization towards
the tip, resulting in marginal placentation; G: Fusion of adjacent carpels by lateral
cohesion of open conduplicate carpels forming parietal placentation; H: Fusion by
adnation of free margins of conduplicate carpels to the thalamus forming axile pla-
centation; I: Fusion by cohesion of ventral surfaces of the carpels formong axile
placentation. J-K: Involute closing of carpels by meeting of dorsal surfaces of car-
pels. M-N: Examples of fused carpels with involute closure. L: Erythraea centaurium;
M: Isanthus brachiatus; N: Limnophila heterophylla. O-Q: Closure by fusing margins of
carpel with ultimate merging of ventral bundles; R: Fusion of margins of adjacent
opens carpels with merging of ventral bundles and formation of parietal placenta-
tion. S-U: Fusion of sides of closed carpels with merging of adjacent lateral bundles
and ventral bundles resulting in axile placentation. (A-H based on Bailey and Swamy,
1951; J-N based on Eames, 1961; O-U after Eames and MacDaniels, 1947).
294 Plant Systematics
apex to base of carpel (decurrent) as in some tively primitive families. The ovules in
species of Drimys, Himantandra and these carpels derive their vascular supply
Degeneria. In Degeneria and Butomus, the chiefly from a smaller meshwork of the
double nature of the crest is evident in mar- bundles, and rarely from dorsal bundle or
gins flaring back from the line of contact. In ventral bundles. There was consequent re-
Degeneria and Drimys, the margins of car- duction in the number of ovules and their
pels are incompletely closed by interlocking restriction to submarginal position with vas-
papillose cells of the stigmatic crest. The cular supply coming from ventral bundles.
carpels have three traces, one dorsal and two The evidence of this transition is seen in
ventral, the latter providing vascular supply Winteraceae and Degeneriaceae.
to ovules. From this type of carpel, the closed Closing of carpels may also result from
carpel of other angiosperms developed by clo- fusing of incurved margins of carpels. Pro-
sure of adjacent adaxial surfaces (Figure gressive fusion results in final fusion of ad-
9.22 D-F) and concentration of stigmatic jacent ventral bundles (Figure 9.22 O-P) in
margins to the upper part of the carpel, re- follicular carpel. Fusion of margins of adja-
duction in the number of ovules and their cent open carpels results in parietal placen-
restriction to lower part differentiating as tation with only ventral bundles ultimately
ovary, the middle sterile portion forming the merging, whereas the fusion of sides of
style. The fusion of adjacent carpels in the closed carpels results in axile placentation
formation of syncarpous gynoecium may with both adjacent lateral bundles as well
have proceeded along different directions. as ventral bundles merging.
Lateral cohesion of open conduplicate car- Involute closing of carpels was advocated
pels resulted in unilocular ovary with pari- by Joshi (1947), Puri (1960) and several other
etal placentation (Figure 9.22 G). Axile pla- workers. In such carpels, the margins of the
centation (with number of locules equalling carpel are involuted and abaxial (and not
the number of fusing carpels) may have re- adaxial surfaces) or margins are in contact.
sulted from adnation of free margins to the The example of such carpels involved in the
thalamus (Figure 9.22 H) or cohesion of ven- formation of syncarpous gynoecium is seen
tral sutures of carpels (Figure 9.22 I). Differ- in several genera (Figure 9.22 L-N). Although
ent families of angiosperms exhibit differ- there have been suggestions that involute
ent degrees of fusion, some like types may have evolved from conduplicate
Caryophyllaceae with free styles and stig- types, Eames (1961) considered it highly un-
mas, others like Solanaceae with complete likely, as such a derivation would involve
fusion of ovaries, styles and stigmas. Free change from contact by adaxial sides to con-
central placentation may result from disso- tact by abaxial sides, a major change, far
lution of septa from ovary with axile placen- more complicated and circuitous than usu-
tation (Caryophyllaceae) the placental col- ally found in evolutionary derivation. He
umn being attached to the base and top of suggested that several independent closure
the ovary. It may also result from protruding of carpels occurred in different phylogenetic
thalamus carrying the placenta from the lines.
base of the ovary (Primulaceae). The basal The theory that the carpel is a peltate
placentation with the number of ovules re- leaf was strongly advocated by Baum and
duced to basal one may be derived from one Leinfellner (1953). The peltate form of car-
(Alismataceae) or more than one carpels pel is assumed to have arisen by turning up-
(Asteraceae). ward (ventrally of the basal lobes of the
Laminar placentation with ovules scat- lamina and their fusion, margin to margin,
tered over the entire inner surface of the as in the formation of peltate leaves. A trans-
ovary wall is considered to be the most primi- verse meristem, known as cross zone, de-
tive type, present in Nymphaeaceae, velops where the two marginal meristems
Cabombaceae, Butomaceae and other rela- meet. As the carpel primordium elongates,
Phylogeny of Angiosperms 295
ascidiate with marginal stigma and basal to theory (axial theory) developed by German
slightly lateral placentation of one or two school of botanists and supported by Schleide,
orthotropous ovules. The evolution of curved Eichler, Sachs and others, according to which
ovules and placement of the ovules in other inferior ovary resulted from invagination of
positions was to direct the micropyle away the floral receptacle which surrounds the
from the stigma or pollen-tube transmission- ovary.
tissue. They suggested that reproductive The accumulating anatomical evidence
axes with many flowers, few carpels per has shown that inferior ovary has evolved a
flower, and few ovules per carpel were an- number of times in different groups of an-
cestral (Figure 9.23). giosperms, in some due to adnation of floral
From such an ancestral type developed parts and in others due to axial invagina-
two types of inflorescences: one with few tion. In certain plants like Hedera, separate
flowers, each of which had many carpels and traces related to different floral organs are
few ovules and the other with few flowers found, in others like Juglans, different stages
each containing few carpels and many of bundle fusion can be found in the inferior
ovules. ovary. Such plants also have normal orien-
tation of vascular bundles (phloem outside,
Gonophyll theory xylem inside) and evidently, the inferior
ovary is appendicular in origin.
Melville (1962, 1983) developed his gonophyll
An axial invagination of floral receptacle
theory largely on the basis of studies of vas-
will eventually result in inverted vascular
culature in leaves and floral whorls. This
bundles (xylem on outside, phloem inside)
theory is a variation of stachyosporous ori-
in the inner part of inferior ovary, with nor-
gin. According to him, the ovary consists of
mal orientation in the outer part. This has
sterile leaves and ovule-bearing branches
been observed in the inferior ovaries of
attached to the petiole of the leaf. Each leaf,
Cactaceae and Santalaceae. In others like
together with the fertile branch, is consid-
Rosa, the lower part of the fleshy receptacle
ered a unit and termed as gonophyll instead
has invaginated receptacular tissue
of carpel. This theory has already been dis-
whereas the upper portion consists of fused
cussed under probable ancestors of an-
floral parts. The adnation of floral parts
giosperms. above or surrounding the ovary in a large
number of plants forms hypanthium, a
structure distinct from but often confused
Evolution of Inferior ovary with the calyx tube, the latter involving
It has been universally agreed that the in- the cohesion of sepals only. The develop-
ferior ovary in angiosperms is a derived ment of inferior ovary has occurred within
state. The nature of origin of this type had several families, as genera with superior
two opposing views. Linnaeus, de Candolle ovary and those with inferior ovary may
and many early botanists believed in the be encountered in the same family as
origin of an inferior ovary through adnation seen in Rosaceae, Gesneriaceae,
of bases of outer floral whorls to the gyno- Nymphaeaceae and several others. In
ecium, a view known as appendicular Nymphaeaceae, Nuphar has superior
theory (Candollean theory, concrescence ovary, Nymphaea semi-inferior and
theory). Others believed in the receptacular Euryale superior ovary.
Chapter 10
Systems of Classification
melons and cotton were grown during the Leucippus or Alcippus, Theophrastus then
Vedic Period (2000 BC to 800 BC). Indians ob- proceeded to Athens, and became a mem-
viously knew about descriptive botany and ber of the Platonic circle. After Platos death,
cultural practices. The first world symposium he attached himself to Aristotle , and after
on medicinal plants was held in the Hima- the latters death, he inherited his library
layan region in the seventh century BC. The and the garden. He rose to become the head
Atharva Veda, written around 2000 BC de- of the Lyceum at Athens.
scribes the medicinal uses of various plants. Theophrastus (Figure 10.1) is credited with
having authored more than 200 works most
TheophrastusFather of botany of which survive as fragments or as quota-
Theophrastus (372 BC to 287 BC), the suc- tions in the works of other authors. Two of
cessor of Aristotle in the Peripatelic School his botanical works have survived intact, how-
(those following the philosophy propagated by ever, and are available in English translations:
Aristotle), was a native of Eresus in Lesbos. Enquiry into plants (1916) and The Causes of
plants (1927). Theophrastus described about
500 kinds of plants, classified into four major
groups: the trees, shrubs, subshrubs and
herbs. He also recognized the differences be-
tween flowering plants and non-flowering
plants, superior ovary and inferior ovary, free
and fused petals and also fruit types. He was
aware of the fact that many cultivated plants
do not breed true. Several names used by
Theophrastus in his De Historia plantarum,
e.g. Daucus, Crataegus and Narcissus, to name
a few, are in use even today.
Theophrastus was fortunate to have the
patronage of Alexander the Great. During his
conquests, Alexander made arrangements
to send back materials to Athens, enabling
Theophrastus to write about exotic plants
such as cotton, cinnamon and bananas. Bo-
tanical knowledge at the Lyceum in Athens
thus flourished during this truly golden age
of learning, whose botanical advance
Theophrastus was privileged to steer.
ParasaraIndian scholar
Parasara (250 BC to 120 BC) was an Indian
Figure 10.1 Theophrastus (372 BC to 287 BC)
the Greek philosopher, credited to
scholar who compiled Vrikshayurveda (Sci-
be the father of botany, wrote ence of plant life), one of the earliest works
more than 200 manuscripts. dealing with plant life from a scientific stand-
point, a manuscript discovered a few decades
His original name was Tyrtamus, but he ago. The book has separate chapters on mor-
later became known by the nickname phology, properties of soil, forest types of In-
Theophrastus given to himit is saidby dia and details of internal structure, which
Aristotle, to indicate the grace of his con- suggest that the author possessed a magni-
versation. After receiving his first introduc- fying apparatus of some kind. He also
tion to philosophy in Lesbos from one described the existence of cells (rasakosa)
Systems of Classification 299
in the leaf, transportation of the soil solu- Cicilia. Being a physician in the Roman
tion from the root to the leaves where it is army, he travelled extensively and gained
digested by means of chlorophyll [ranjakena firsthand knowledge about plants used for
pacyamanat] into nutritive substance and treating various ailments. He wrote a truly
the by-products. Plants were classified into outstanding work, Materia medica, present-
numerous families [ganas] on the basis of ing an account of nearly 600 medicinal
morphological features not known to the Eu- plants, nearly 100 more than Theophrastus.
ropean classification until the eighteenth Excellent illustrations were added later. Writ-
century. Samiganyan [Leguminosae] were ten in a straightforward style, the book was
distinguished by hypogynous flowers, five an asset for any literate man for the next 15
petals of different sizes, gamosepalous calyx centuries. No drug was recognized as genu-
and fruit being a legume. Svastikaganyan ine unless mentioned in Materia medica. It
[Cruciferae] similarly, were differentiated as is no less a tribute to Dioscorides that a
having calyx resembling a swastika, ovary beautiful illustrated copy of the book was pre-
superior, 4 free sepals and petals each, six pared for Emperor Flavius Olybrius Onycius
stamens of which 2 are shorter and 2 car- around 500 AD, who presented it as a gift to
pels forming a bilocular fruit. Unfortunately, his beautiful daughter Princess Juliana
this great scientific advance did not reach Anicia. The manuscript, better known as
Europe at that time, where scientific knowl- Codex Juliana, is a prize manuscript pre-
edge was just making its debut. served in Vienna. Materia medica was not a
Among the other Indian scholars, Caraka deliberate attempt at classification but le-
(CharakaIst century AD) wrote Caraka gumes, mints and umbels were described as
samhita (Charaka samhita) in which he rec- separate groups.
ognized trees without flowers, trees with
flowers, herbs which wither after fructifica- Medieval Botany
tion and other herbs with spreading stems
as separate groups. This huge treatise on During the Middle Ages (fifth to fifteenth
Indian medicine, containing eight divisions, century AD), little or no progress was made
is largely based on a much earlier treatise in botanical investigation. During this dark
published by Agnivesh. A. C. Kaviratna period in history, Europe and Asia witnessed
translated it into English in 1897. wars, famine and epidemics, and the only
worthwhile contribution was copying and re-
Caius Plinius Secundus copying of earlier manuscripts, unfortu-
nately often with errors added. The straw-
Pliny the Elder berry plant was thus shown to have five leaf-
The decline of the Greek Empire witnessed lets instead of three in several manuscripts.
the emergence of the Romans. Pliny (23 AD The manuscripts were lost at a faster rate
to 79 AD), a naturalist who served under the than they could be copied.
Roman army, attempted a compilation of ev-
erything known about the world in an exten- Islamic Botany
sive 37-volume work Historia naturalis, 9 vol- The ascent of the Muslim Empire between
umes of which were devoted to medicinal 610-1100 AD saw the revival of literacy.
plants. In spite of a few errors and fanciful Greek manuscripts were translated and pre-
tales from travellers, the Europeans held this served. Being practical people, they concen-
work in reverential awe for many centuries. trated on agriculture and medicine and pro-
Pliny died during the eruption of Vesuvius. duced lists of drug plants. Ibn-Sina, better
known as Avicenna authored Canon of medi-
Pedanios Dioscorides cine, a scientific classic along the lines of
Dioscorides (first Century AD), of Greek par- Materia medica. Another Muslim scholar, Ibu-
entage, was a native of the Roman province al-Awwan, in the twelfth century described
300 Plant Systematics
nearly 600 plants, and interpreted their German Fathers of Botany. Otto Brunfels
sexuality as well as the role of insects in fig (1464-1534) wrote Herbarium vivae eicones in
pollination. Although Muslim scholars pro- three volumes (1530-1536), a herbal that
duced several practical lists of drug plants, marked the beginning of modern taxonomy,
but did not develop any significant scheme and contained excellent illustrations pre-
of classification. pared from living plants. The text, however,
was of little value, comprising extracts from
Albertus Magnus earlier writers. Jerome Bock (Hieronymus
Doctor Universalis Tragus), who lived between 1498 and 1554,
wrote New kreuterbuch in 1539, which con-
Albertus Magnus (1193-1280 AD), called Doc- tained no illustrations but did include accu-
tor Universalis by his contemporaries and rate descriptions based on firsthand knowl-
Aristotle of the Middle Ages by historians, edge, also mentioning the localities and
is the best remembered naturalist of that habitats. He described 567 species classi-
period. He wrote on many subjects. The bo- fied as herbs, shrubs and trees. The herbal,
tanical work De vegetabilis dealt with me- written in German, was widely understood
dicinal plants and provided descriptions of as compared to the manuscripts of earlier
plants based on firsthand information. scholars, which were in Greek and Latin,
Magnus is believed to be the first to recog- languages which had by then become
nize monocots and dicots based on stem obsolete. Leonard Fuchs (1501-1566),
structure. He also separated vascular and regarded as more meritorious than his
non-vascular plants. contemporaries, wrote De Historia stirpium
in 1542, containing descriptions as well as
Renaissance illustrations of 487 species of medicinal
The fifteenth century saw the onset of the plants (Figure 10.2).
Renaissance in Europe, with technical in- Valerius Cordus (1515-1544), whose tragic
novations, mainly the printing machine and early death prevented him from becoming the
the science of navigation. Invention of the greatest of all herbalists, undertook to study
printing machine with movable type around plants from living material. He travelled in
1440 ensured wide circulation of manu- the forests of Germany and Italy, where un-
scripts. Navigation led to the successful ex- fortunately he fell ill and died at the young
ploitation of botanical wealth from distant age of 29. His work Historia plantarum, pub-
places. lished in 1561, many years after his death,
contained accurate descriptions of 502 spe-
cies, 66 apparently new. He was perhaps the
Herbalists first to show how to describe plants from na-
Printing made books cheap. The first to be- ture accurately. Unfortunately, Konrad
come popular were medically-oriented books Gesner, the editor of his work chose to add
on plants. Specialists started producing their illustrations, which were not only of poor qual-
own botanical-medical books, which were ity, but also wrongly identified, and the work
easily understood as compared to ancient suffered for no fault of Valerius Cordus
manuscripts. These came to be known as At the times when herbals flourished in
herbals and the authors who wrote these Germany, Pierandrea Mathiola was active
were known as herbalists. The first herb- in Italy, producing Commentarii in sex libros
als were published under the name Gart der Pedacii Dioscorides in 1544, adding many il-
Gesundheit or Hortus sanitatus. These were lustrations, though it was a commentary on
cheaply done and of poor quality. The out- Dioscorides. The Dutch Big Three
standing herbals came from German herb- Rembert Dodoens, Carolus Clusius and
alists Otto Brunfels, Jerome Bock, Valerius Mathias de Lobelspread the botanical
Cordus and Leonard Fuchs, constituting the knowledge to Holland and France through
Systems of Classification 301
Early Taxonomists
With renewed interest in plants and exten-
sive explorations of Europe, Asia, Africa and
the New World, the list of plant names in-
creased enormously, signifying the need for
a formalized scheme of classification, nam-
ing and description of plants. Botany, hith-
erto dependent on medicine, started to
spread its wings as a science per se.
Gaspard (Caspar) Bauhin (1560- John Ray was the first to group together
1624) Legislateur en botanique plants that resembled one another and sepa-
rated those that differed more. His classifi-
A Swiss botanist, Bauhin travelled exten- cation was a great advancement in plant sci-
sively and formed a herbarium of 4000 speci- ences. It was evidently ahead of his time,
mens. He published Phytopinax (1596), groping at what later developed as natural
Prodromus theatri botanici (1620) and, lastly, systems, which were perfected by de Jussieu,
Pinax theatri botanici (1623), containing a list
de Candolle and Bentham and Hooker.
of 6000 species of plants giving synonyms
(other names used for a species by earlier J. P. de Tournefort (1656-1708)
authors) and introducing the binomial no-
Father of genus concept
menclature for several species which he
named. He sought to clarify in a single pub- A French botanist, de Tournefort studied un-
lication the confusion regarding multiplic- der Pierre Magnol in the University of
ity of names for all species known at that Montpellier and later became the professor
time. Although he did not describe genera, of botany at Jardin du Roy in Paris and later,
he did recognize the difference between spe- Director of Jardin des Plantes in Paris. He
cies and genera and several species were published Elements de botanique in 1694,
included under the same generic name. His including 698 genera and 10,146 species. A
elder brother Jean Bauhin (1541-1613) had Latin translation of this work with additions
earlier compiled a description of 5000 plants was published as Institutions rei herbariae in
with more than 3500 figures, a work pub- 1700. Tournefort travelled extensively in
lished under the name Historia plantarum Greece and Asia Minor and brought back
universalis in 1650-51, several years after 1356 plants, which were fitted into his sys-
his death. It is tragic that the two brothers tem by his admirers. He was perhaps the
never collaborated and rather worked on first to give names and description of gen-
identical lines independently. era, merely listing the species. Casper
Bauhin, who did recognize genera and spe-
cies, provided no such description.
John Ray (1627-1705) Tournefort was, thus, the first to establish
Ray was an English botanist who travelled genera. His system of classification, though
extensively in Europe and published numer- inferior to that of Ray, was useful for identi-
ous works, the most significant being fication, recognizing petaliferous and apeta-
Methodus plantarum nova (1682) and Historia lous flowers, free and fused petals, and regu-
plantarum (1686-1704), a three-volume work. lar and irregular flowers. No doubt the sys-
The last edition of Methodus, published in tem became very popular in Europe during
1703, included 18000 species. Ray divided the eighteenth century.
the plant kingdom as shown in the outline
of his classification presented in Table 10.1.
SEXUAL SYSTEM
Table 10.1 Outline of classification of plants
published by John Ray in Historia A turning point in the classification ap-
plantarum (1686-1704). proach was establishing the fact of sexual-
ity in flowering plants by Camerarius in
1. Herbae (Herbs)
A. Imperfectae (Cryptogams)
1694. He concluded that stamens were male
B. Perfectae (Seed plants) sex organs and pollen was necessary for seed
i. Monocotyledons set. He showed that the style and ovary form
ii. Dicotyledons female sex organs of a flower. The thought
2. Arborae (Trees) regarding sexuality in plants, ridiculed by
A. Monocotyledons the church hitherto, once established saw
B. Dicotyledons renewal in botanical interest, amply
Systems of Classification 303
exploited by Linnaeus for classifying sor Rudbeck. Under the able guidance of Prof.
flowering plants. Rudbeck, Linnaeus published his first paper
on the sexuality of plants in 1729. Following
Carolus Linnaeus Father of favourable publicity of his paper, he was ap-
taxonomy pointed as Demonstrator and subsequently
promoted as Docent. In 1730, he published
Carolus Linnaeus (1707-1778), was also Hortus upplandicus, enumerating the plants
known as Carl Linnaeus, Carl Linne, or Carl in the Uppsala Botanical Garden according
Von Linne. Whereas Darwin dominated bo- to the Tourneforts system. Faced with prob-
tanical thinking during the nineteenth cen- lem of increasing numbers of plants which
tury, Linnaeus did so during the eighteenth. he found hard to fit in Tourneforts system,
Carl Linne, Latinized as Carl Linnaeus or he published a revised edition of Hortus
Carolus Linnaeus (Figure 10.3), born in upplandicus with plants classified according
Rashult, Sweden on 23 May 1707, had botany to his own sexual system.
attached to him at birth, since Linnaeus is Linnaeus was sent on an expedition to
the Latin for Linn or Linden tree (Tilia spp.). Lapland in 1732, a trip that widened his
His father, a country Parson, wanted his son knowledge. He brought back 537 specimens.
to become a priest, but Linnaeus chose to The results of the expedition were later pub-
enter the University of Lund in 1727 to learn lished as Flora Lapponica (1737). Linnaeus
medicine. Although he had no money to buy went to the Netherlands in 1735 and ob-
books, his dedication impressed Professor tained an M. D. degree from the University
Kilian Stobaeus, who not only allowed him of Haderwijk. While in the Netherlands, he
full use of his library but also gave him free met several prominent naturalists includ-
boarding at his house. Lund not being a suit- ing John Frederick Gronovius and Hermann
able place for Medicine, Linnaeus shifted to Boerhaave, the former financing the publi-
the University of Uppsala in 1729. In recog- cation of Systema naturae (1735), presenting
nition of his enthusiasm for plants, Dean Olaf an outline of the sexual system of Linnaeus.
Celsius introduced him to botanist Profes- He became the personal physician of a
wealthy person named George Clifford who
was the Director of the Dutch East India
Company, and this gave Linnaeus an oppor-
tunity to study numerous tropical and tem-
perate plants grown by Clifford in his gar-
den. It was at Cliffords expense that
Linnaeus published several manuscripts,
including Hortus cliffortianus and Genera
plantarum (1737). Linnaeus then went to
England, where he met Professor John Jacob
Dillen, who initially thought of Linnaeus as
this is he who is bringing all botany into
confusion, but he soon became the advocate
of the Linnaean system in England. He also
met the de Jussieu brothers in France.
Following the death of Professor Rudbeck,
Linnaeus was appointed Professor of medi-
cine and botany at the University of Uppsala,
Figure 10.3 Carolus Linnaeus (1707-1778), the a position he held until his death in 1778.
Father of taxonomy (reproduced He published his best known Species
with permission from Royal plantarum in 1753. His growing fame and
Botanic Gardens Kew). publications attracted large number of
304 Plant Systematics
DIADELPHIA.
H E X A N D R I A,
FUMARIA.
*Corollis bicalcaratis,
I. FUMARIA Scapo nudo. Hort. Cliff. 251: * Gron. cucullaria,
virg. 171. Rov.lugdb,. 393
Fumaria tuberosa insipida. Corn. canad. 127.
Fumaria siliquosa, radice grumosa, flore bicorporeo ad
labia conJucto, virginiana. Plak, alam. I62. t. 90. f
3 Raj. suppl. 475
Cucullaria. Juss. act. paris . 1743
Habitat in Virginia, Canada 2:
Radix tuberosa;Folium radicale tricompositum. Scapus
nudus, Racemo simplici; bracteae vix ullae; Nectarium
duplex corollam basi bicornem efficiens.
2. FUMARIA floribus postice bilobis, caule folioso. spectabilis.
Habitat in Sibiria. D. Demidoff:
Planta eximia floribus speciofissimis, maximis. Habitus
Fumariae bulbosae, sed majora omnia. Rami ex alis ra-
rioris. Caulis erectus. Racemus absque bracteis. Co-
rollae magnitudine extimi articuli pollicis, pone in du-
os lobos aequales, rotundatos divisae.
* Corollis unicalcaratis.
3. FUMARIA caule simplici, bracteis longitudine florum bulbosa
Figure 10.4 A portion of a page from Species plantarum of Linnaeus (1753). Specific epithet (trivial
name) is indicated towards the margin.
students, their number increasing every Among his enthusiastic students were Pe-
year and the botanical garden at Uppsala en- ter Kalm and Peter Thunberg. Kalm collected
riched considerably. plants extensively in Finland, Russia and
Linnaeus botanical excursions every America and when he returned with bundles
summer also included an annotator to take of collection from America, Linnaeus was
notes, a Fiscal to maintain discipline and bedridden, but forgot his ailment and trans-
marksmen to shoot birds. At the end of each ferred his concern to plants. Thunberg col-
trip, they marched back to the town with lected extensively in Japan and South Africa.
Linnaeus at the head, aided with French Linnaeus first outlined his system in
horns, kettledrums and banners. Systema naturae, which classified all known
In recognition of his contributions, plants, animals and minerals. In his Gen-
Linnaeus was made Knight of the Polar era plantarum, he listed and described all the
Star in 1753, the first Swedish scientist to plant genera known to him. In Species
get this honour. In 1761, he was granted the plantarum, he listed and described all the
patent of nobility and from this date came known species of plants. For each species
to be known as Carl von Linne. there was (Figure 10.4):
Systems of Classification 305
Table 10.2 Outline of the 24 classes recognized by Linnaeus in his Species plantarum (1753) on
the basis of stamens.
Classes
1. Monandria- stamen one
2. Diandria- stamens two
3. Triandria- stamens three
4. Tetrandria- stamens four
5. Pentandria- stamens five
6. Hexandria- stamens six
7. Heptandria- stamens seven
8. Octandria- stamens eight
9. Ennandria- stamens nine
10. Decandria- stamens ten
11. Dodecandria- stamens 11-19
12. Icosandria- stamens 20 or more, on the calyx
13. Polyandria- stamens 20 or more, on the receptacle
14. Didynamia- stamens didynamous; 2 short, 2 long
15. Tetradynamia- stamens tetradynamous; 4 long, 2 short
16. Monadelphia- stamens monadelphous; united in 1 group
17. Diadephia- stamens diadelphous; united in 2 groups
18. Polyadelphia- stamens polyadelphous; united in 3 or more groups
19. Syngenesia- stamens syngenesious; united by anthers only
20. Gynandria- stamens united with the gynoecium
21. Monoecia- plants monoecious
22. Dioecia- plants dioecious
23. Polygamia- plants polygamous
24. Cryptogamia- flowerless plants
today. Linnaeus did aim at natural classifi- based on the idea conceived by Adanson and
cation and in the 6th edition of his Genera now developed into Neo-Adansonian
plantarum (1764), he appended a list of 58 principles.
natural orders. It was, however, left to
others to carry forward. Linnaeus had done Jean B. P. Lamarck (1744-1829)
his job according to the demands of the day.
Following Linnaeus death in 1778, his A French naturalist, Jean B. P. Lamarck
son Carl received the post of Professor as authored Flore Francaise (1778), which in ad-
well as the collections at Uppsala. When the dition to a key for identification of plants,
latter died in 1783, the collections went to contained principles concerning the natu-
the widow of Linnaeus, whose sole aim was ral grouping of species, orders and families.
to sell it the highest bidder. Fortunately, He is better known for his evolutionary
this highest bidder of 1000 guineas was theory, Lamarckism.
J.E. Smith, an English botanist. Smith
founded the Linnaean Society of London in de Jussieu family
1788 and handed over the herbarium to this
Four well-known botanists belonged to this
society. Herbarium specimens have since
prominent French family. Of the three broth-
been photographed and are available in
ersAntoine (1686-1758), Bernard (1699-
microfiche.
1776) and Joseph (1704-1779), the youngest
The Linnaean classification remained
spent many years in South America, where
dominant for a long time. The 5th edition of
after losing his collections of five years, he
Species plantarum appeared as late as in
became insane. The elder two studied at the
1797-1805, greatly enlarged and edited by
University of Montpellier under Pierre
C.L. Wildenow in four large volumes.
Magnol. Antoine succeeded Tournefort as
Director de Jardin des Plantes, Paris and
later added Bernard to the staff. Bernard
NATURAL SYSTEMS started arranging plants in the garden at La
Linnaeus had provided a readily referable Trianon, Versailles, according to the classi-
cataloguing scheme for a large number of fication that was initially similar to
plants, but it soon became evident that Fragmenta methodi naturalis of Linnaeus with
unrelated plants came together in such some similarities to Rays Methodus
groupings. A need was realized for a more plantarum, introducing changes, so that
objective classification. France, which was when finally set, it had no resemblance with
undergoing an intellectual ferment and the Linnaean system. Bernard based his
where the Linnaean system never became classification on the number of cotyledons,
popular, took the lead in developing natural presence or absence of petals and their fu-
systems of classification. sion. He never published his system and it
was left to his nephew Antoine Laurent de
Jussieu (1748-1836; Figure 10.5) to publish
Michel Adanson (1727-1806) this classification, along with his own
A French botanist, unimpressed with artifi- changes in Genera plantarum (1789).
cial choice of characters, Michel Adanson In this classification, the plants were di-
devised a classification of both animals and vided into three groups, further divided on
plants, on the equal use of as many features corolla characteristics and ovary position to
as possible. In his two-volume work Familles form 15 classes and 100 orders (till the be-
des plantes (1763), he recognized 58 natu- ginning of present century class and order
ral orders according to their natural affini- were mostly used as names of categories now
ties. Present-day Numerical taxonomy is understood as order and family, respectively).
Systems of Classification 307
Table 10.4 Outline of the system of classification presented by Bentham and Hooker in Genera
plantarum (1862-1883).
2. Heteromerae (ovary superior, stamens in one or two whorls, carpels more than 2)
3 orders: Ericales, Primulales and Ebenales
Subclass 3. Monochlamydeae (flowers apetalous; perianth lacking or if present not differentiated into
sepals and petals)
Series 1. Curvembryeae (embryo coiled, ovule usually 1)
2. Multiovulatae aquaticae (aquatic plants, ovules many)
3. Multiovulatae terrestres (terrestrial plants, ovules many)
4. Microembryeae (embryo minute)
5. Daphnales (carpel 1, ovule 1)
6. Achlamydosporae (ovary inferior, unilocular, ovules 1-3)
7. Unisexuales (flowers unisexual)
8. Ordines anomali (relationship uncertain)
Merits
The fact notwithstanding that the system
does not incorporate phylogeny and is more
than 100 years old, it still enjoys a reputa-
tion of being a very sound system of classifi-
Figure 10.8 Sir Joseph Dalton Hooker (1817-
1911), the famous British botanist cation, owing to the following merits:
who co-authored Genera Plantarum 1. The system has great practical value
with George Bentham, besides for identification of plants. It is very
authoring the 7- volume Flora of easy to follow for routine identifica-
British India and several other pub- tion.
lications. He was the Director of 2. The system is widely followed for the
the Royal Botanic Gardens, Kew arrangement of specimens in the her-
(reproduced with permission from baria of many countries, including
Royal Botanic Gardens, Kew).
Britain and India.
3. The system is based on a careful com-
parative examination of actual speci-
The Genera plantarum of Bentham and mens of all living genera of seed plants
Hooker provided the classification of seed and is not a mere compilation of
plants describing 202 families and 7569 gen- known facts.
era. They estimated the seed plants to in- 4. Unlike de Candolle, the Gymno-
clude 97,205 species. The classification was sperms are not placed among dicots
a refinement of the systems proposed by A. but rather in an independent group.
P. de Candolle and Lindley, which in turn 5. Although the system is not a
were based on that of de Jussieu. The de- phylogenetic one, Ranales are placed
limitation of families and genera was based in the beginning of Dicotyledons. The
on natural affinities and was pre-Darwinian group Ranales (in the broader sense
in concept. The descriptions were based on including families now separated
personal studies from specimens and not a under order Magnoliales) is generally
mere compilation of known facts, an asset regarded as primitive by most of the
which made the classification so popular and leading authors.
authentic. Many important herbaria of the 6. Dicotyledons are placed before the
world have specimens arranged according to Monocotyledons, a position approved by
this system. all present-day authors.
Systems of Classification 311
flowers, but the family is placed towards Cryptogamae and Phanerogamae, the latter
the beginning of Monocotyledons. further subdivided into Gymnospermae and
9. In Gamopetalae, Inferae with an in- Angiospermae. Angiospermae was divided
ferior ovary is placed before the other into two classes: Monocotyledons and Dicoty-
two series having a superior ovary. ledons. Only two groups Choripetalae and
The inferior ovary is now considered Sympetalae were recognized in Dicotyledons.
to have been derived from a superior Gymnosperms thus found their separate iden-
ovary. tity before angiosperms, Monochlamydeae
10. The system divides angiosperms into found itself abolished and dispersed among
dicotyledons and monocotyledons, the two groups. Monocotyledons, strangely,
whereas the modern phylogenetic sys- found a place before Dicotyledons.
tems place paleoherb families and
Magnoliids before monocotyledons and Adolph Engler and
Eudicots. Karl A Prantl
This is a system of classification of the en-
tire plant kingdom, proposed jointly by two
PHYLOGENETIC SYSTEMS German botanists: Adolph Engler (1844-
The publication of The Origin of species by 1930) (Figure 10.9) and Karl A. E. Prantl (1849-
Charles Darwin, with every copy of the first 1893). The classification was published in a
edition sold on the first day, 24 November monumental work Die Natrlichen
1859 revolutionized biological thinking. The pflanzenfamilien in 23 volumes (1887-1915).
species was no longer regarded as a fixed Engler was Professor of Botany at the Uni-
entity having remained unchanged since its versity of Berlin and later Director, Berlin
creation. Species were now looked upon as Botanic Garden. The system provided clas-
systems of populations, which are dynamic sification and description down to the genus
and change with time to give rise to lineages level, incorporating information on morphol-
of closely-related organisms. Once the ex- ogy, anatomy and geography.
istence of this evolutionary process was ac- The system is commonly known under
knowledged, the systems of de Candolle as Englers name, who first published classifi-
also of Bentham and Hooker were found to cation up to the family level under the title
be inadequate and classifications, which Syllabus der pflanzenfamilien in 1892. This
made an attempt to reconstruct evolution- scheme was constantly revised by Engler and
ary sequence, found immediate takers. continued by his followers after his death,
the latest 12th edition appearing in 2 volumes,
Transitional systems 1954 (ed. H. Melchior and E. Werdermann)
and 1964 (ed. M. Melchior). In this last edi-
The early systems were not intended to be tion, however, dicots were placed before
phylogenetic. Rather, they were attempts to monocots.
rearrange earlier natural systems in the Engler also initiated an ambitious plan of
light of the prevalent phylogenetic theories. providing taxonomic monographs of various
families up to species level under the title
A.W. Eichler Das pflanzenreich. Between 1900 and 1953,
Eichler (1839-1887) was a German botanist 107 volumes were published covering 78
who proposed the rudiments of a system in families of seed plants and one family
1875. This was elaborated into a unified sys- (Sphagnaceae) of mosses.
tem covering the entire plant kingdom and This system, often considered the begin-
finally published in the third edition of Syl- ning in phylogenetic schemes, was not
labus der vorlesungen(1883). The plant strictly phylogenetic in the modern sense. It
kingdom was divided into two subgroups: was an arrangement of linear sequence
Systems of Classification 313
starting with the simplest groups and the beginning of dicots, also did not find
arranged in the order of progressing com- much subsequent support. The system
plexity. In doing so, unfortunately, Engler (Table 10.5) became very popular, like that
misread angiosperms, where in many of Bentham of Hooker, due to its comprehen-
groups, the simplicity is a result of evolu- sive treatment and is still being followed in
tionary reduction. many herbaria of the world. Some recent flo-
The system, however, had significant im- ras including Flora Europaea (1964-1980) fol-
provements over Bentham and Hooker: Gym- low this system.
nosperms were placed before angiosperms, In this scheme of classification, the plant
group Monochlamydeae was abolished and kingdom was divided into 13 divisions (in
its members distributed along with their the 11th edition of Syllabus der pflanzen-
polypetalous relatives, and many large un- familien published in 1936, 14 divisions and
natural families were split into smaller in the 12th edition edited by Melchior 17 divi-
natural families. The placement of mono- sions were recognized), of which the first 11
cots before dicots, another change made by dealt with Thallophytes, the 12 th
this system did not, however, get subsequent Embryophyta Asiphonogama (embryo
support. The placement of the so-called group formed, no pollen tube) included Bryophytes
Amentiferae comprising families and Pteridophytes. The 13th and last division
Betulaceae, Fagaceae, Juglandaceae, etc. in Embryophyta Siphonogama (embryo formed,
pollen tube developing) included seed plants.
Merits
The classification of Engler and Prantl has
the following improvements over that of
Bentham and Hooker:
1. This was the first major system to in-
corporate the ideas of organic evolu-
tion, and the first major step towards
phylogenetic systems of classification.
2. The classification covers the entire
plant kingdom and provides descrip-
tion and identification keys down to
the level of family (in Syllabus der
pflanzenfamilien), genus (in Die
Natrlichen pflanzenfamilien) and even
species for large number of families
(in Das pflanzenreich). Valuable illus-
trations and information on anatomy
and geography are also provided.
3. Gymnosperms are separated and
placed before angiosperms.
4. Many large unnatural families of
Bentham and Hooker have been split
Figure 10.9 Adolph Engler (1844-1930), the into smaller and natural families. The
famous German botanist who
family Urticaceae is thus split into
produced the most comprehen-
sive classification of the plant Urticaceae, Ulmaceae and Moraceae.
kingdom along with K. Prantl in 5. Abolition of Monochlamydeae has re-
a 20-volume work Die Natrlichen sulted in bringing together several
pflanzenfamilien (1887-1915). closely related families. Family
314 Plant Systematics
Table 10.5 An outline of the system of classification presented by Engler and Prantl.
Plant Kingdom
Division 1. }
} .........Thallophytes
Division 11. }
Division 12. ............ Embryophyta Asiphonogama
Subdivision 1. Bryophyta
Subdivision 2. Pteridophyta
Division 13. ........... Embryophyta Siphonogama
Subdivision 1. Gymnospermae
Subdivision 2. Angiospermae
Class 1. Monocotyledoneae11 orders, 45 families
Order 1. Pandanales (first family Pandanaceae)
.......................
Order 11. Microspermae (last family Orchidaceae)
Class 2. Dicotyledoneae 44 orders, 258 families
Subclass 1. Archichlamydeae (petals absent
or free)33 orders, 201 families
Order 1. Verticillatae (family Casuarinaceae only))
.......................
Order 33. Umbelliflorae (Last family Cornaceae)
Table 10.6 Comparison of classification system of Bentham and Hooker with that of Engler and
Prantl.
11. Closely related families Caryophyllaceae, 11. Family Illecebraceae is merged with Caryophyllaceae.
llecebraceae and Chenopodiaceae are kept apart, the Chepodiaceae and Caryophyllaceae are placed in the
first under Polypetalae and the other two under same order Centrospermae.
Monochlamydeae.
12. Closely related families Amaryllidaceae and 12. Liliaceae and Amaryllidaceae placed in the same order
Liliaceae placed in separate series Epigynae and Liliiflorae.
Coronarieae, respectively.
13. Many larger families, e.g. Urticaceae, 13. Several larger families of Bentham and
Saxifragaceae and Euphorbiaceae are unnatural Hooker split into smaller homogeneous families.
heterogeneous groups. Urticaceae split into Urticaceae, Ulmaceae and
Moraceae.
Table 10.7 Outline of the classification of angiosperms proposed by Charles Bessey (1915).
Subclass 2. Cotyloideae
Superorder 1. Apopetalae (7 orders)
Superorder 2. Sympetalae (3 orders)
318 Plant Systematics
Figure 10.11 Besseyan cactus or Opuntia Besseyi showing the relationship of orders recog-
nized by Bessey
were, however, placed before monocots. of his conclusions on phylogeny have been
Magnoliaceae were separated from Ranales adopted in subsequent classifications.
and placed in a separate order Annonales.
Alfred Rendle
Wettstein Rendle (1865-1938), an English botanist
Wettstein (1862-1931) was an Austrian sys- associated with the British Museum of
tematist who published his classification in Natural History, published Classification of
Handbuch der systematischen botanik (1930, Flowering Plants (1904, 1925), resembling
1935). The classification resembled that of that of Engler in considering monocots more
Engler in considering unisexual flowers primitive than dicots and Amentiferae a
primitive but treated monocots advanced primitive group under dicots. He recognized
over dicots; and considered Helobiae to be three grades in dicots: Monochlamydeae,
primitive and Pandanales advanced. Many Dialapetalae (petals free) and Sympetalae.
Systems of Classification 319
Table 10.8 Outline of the system of classification of flowering plants presented by Hutchinson in
3rd edition of The Families of Flowering Plants (1973).
Phylum I. Gymnospermae
Subphylum I. Dicotyledones
acquired through a particular environ- rate in the members of the same fam-
ment. ily or genus), and the same may be said
6. Perennials are older than biennials, and of epiphytes, saprophytes and para-
from them annuals have been derived. sites.
7. Aquatic Phanerogams are as a rule Relating to the General Structure of
more recent than terrestrial (at any Flowering Plants
Systems of Classification 321
8. Plants with collateral vascular bundles 24. Aggregate fruits are more recent than
arranged in a cylinder (Dicotyledons) single fruits, and as a rule, the cap-
are more primitive in origin than those sule precedes the drupe or berry.
with scattered bundles (Mono-cotyle- Following Bessey, Hutchinson considered
dons), though it does not necessarily flowering plants to be monophyletic, hav-
follow that the latter have been directly ing evolved from the hypothetical cycadeoid
derived from the former. ancestral group which he gave the name of
9. Spiral arrangement of leaves on the Proangiosperms. He recognized a number
stem and of floral leaves precedes that of smaller groups, bound together by a com-
of opposite and whorled types. bination of characters. He established
10. As a rule, simple leaves precede com- Magnoliales as an order distinct from
pound leaves. Ranales, as he considered them to have
Relating to the Flowers and Fruits of evolved on parallel lines. Hutchinson re-
Plants garded Magnoliaceae as the most primitive
11. Bisexual flowers precede unisexual family of the living angiosperms. He consid-
flowers, and the dioecious is probably ered Dicotyledones to be more primitive and
more recent than the monoecious con- placed them (Table 10.8) before
dition. Monocotyledones, giving them a rank of Sub-
12. Solitary flower is more primitive than phylum.
the inflorescence. The groups Polypetalae, Gamopetalae and
13. Spirally imbricate floral parts are more Monochlamydeae were totally abolished; in-
primitive than whorled and valvate. stead Hutchinson recognized two evolution-
14. Many-parted flowers (polymerous) ary lines: division Lignosae (fundamentally
precede, and the type with few parts woody group) and division Herbaceae (fun-
(oligomerous) follow from it, being damentally herbaceous group) within
accompanied by progressive steriliza- Dicotyledones, the former starting with
tion of reproductive parts. Magnoliaceae and ending with
15. Petaliferous flowers precede apetalous Verbenaceae. The Herbaceae started with
ones, the latter being the result of Paeoniaceae and ended with Lamiaceae.
reduction. Within Monocotyledones he recognized
16. Free petals (polypetaly) are more primi- three evolutionary lines: division
tive than connate petals (sympetaly). Calyciferae (calyx bearers), division
17. Actinomorphy of flower is an earlier Corolliferae (corolla-bearers) and division
type than zygomorphy. Glumiflorae (glume-bearers). A total of 411
18. Hypogyny is the primitive structure, families are recognized, 342 in
and from it perigyny and epigyny were Dicotyledones and 69 in Monocotyledones.
derived later. Lignosae includes 54 orders, Herbaceae 29,
19. Free carpels (apocarpy) are more primi- Calyciferae 12, Corolliferae 14 and
tive and from them connate carpels Glumiflorae 3. A diagram (appropriately
resulted. phylogram) showing phylogeny and evolu-
20. Many carpels (polycarpy) precede few tion within Dicotyledones is presented in
carpels (oligocarpy). Figure 10.13
21. The endospermic seed with small Whereas Hutchinson considered the woody
embryo is primitive and the non-endo- habit to be primitive in dicots, in monocots he
spermic seed more recent. considered the herbaceous habit to be primi-
22. In primitive flowers, there are many tive, and the woody forms derived from the her-
stamens; in more advanced flowers few baceous forms. He also considered
stamens. Monocotyledones also to be a monophyletic
23. Separate stamens precede connate group derived from Ranales, Butomales hav-
stamens. ing a link with Helleboraceae and Alismatales
322 Plant Systematics
Figure 10.13 Hutchinsons diagram (phylogram) showing phylogeny and relationships of orders
of Dicotyledones as presented in his 1973 classification.
Figure 10.14 Hutchinsons diagram (phylogram) showing probable phylogeny and relationship of
orders within Monocotyledones.
(andropetals). Early angiosperms have These are further subdivided into subclasses
numerous spirally arranged perianth (ending in -idae, e.g. Rosidae), superorders
of modified bracts. Distinct sepals and (ending in -anae, e.g. Rosanae), orders and
petals are secondary developments. families. Cronquist, however, does not rec-
5. Primitive stamens were broad, ognize superorders. Also, as against 11 and
laminar, 3-veined, not differentiated 6 (8 and 4 in 1987 classification) subclasses
into filament and connective. The com- of dicots and monocots respectively in
mon ancestral type had marginal Takhtajans system, Cronquist recognizes 6
sporangia and later on gave rise to the and 5, respectively. Both systems are devel-
abaxial types (extrorse as in Degeneria) oped based on phylogenetic, as well as phe-
and the adaxial types (introrse as in netic information from every field of study.
Magnolia). However, whereas Cronquist gives more im-
6. Monocolpate pollen grains are primi- portance to phenetic information, Takhtajan
tive, from which arose tricolpate and relies more heavily on phylogenetic data.
then the polycolpate types. These two systems of classification show
7. Primitive carpels are free, unsealed, a general agreement with the other two
conduplicate, containing numerous major classifications of angiosperms, devel-
ovules and with laminar placentation oped by Thorne (1981, 1983, 1992,) and
(as in Degeneria). Fusion is a later Dahlgren (1981, 1983, 1989), although the
development. Fusion of closed carpels recent revisions by Thorne (2000,2003) are
laterally resulted in syncarpous in more agreement with APG classifica-
gynoecium with axile placentation, the tions, in abandoning traditional division into
dissolution of septa subsequently monocots and dicots.
resulting in lysicarpous gynoecium Both Takhtajan and Cronquist prefer the
with free-central placentation. Lateral name Magnoliophyta for angiosperms and
fusion of open conduplicate carpels appropriate names Magnoliopsida and
formed paracarpous gynoecium with Liliopsida for dicots and monocots, respec-
parietal placentation. tively. An outline of the classification (1997
8. Outer integument arose from the version) is presented in Table 10.9.
cupule of ancient gymnospermous As against the classification proposed in
ancestor. Unitegmic ovules arose by 1980, the revision proposed in 1987 had one
fusion of two integuments or abortion subclass each added to Magnoliopsida (only
of one. former superorder Asteranaenow split into
9. Takhtajan (and Cronquist) earlier Asteranae and Campanulanaeretained in
regarded monocotyledons as being of Asteridae, all remaining superorders placed
aquatic origin from Nymphaeales via in a new subclass Lamiidae) and Liliopsida
Alismatales. Later he regarded the (superorder Triuridanae separated from
latter only as a lateral side branch of Liliidae into a new subclass Triurididae). Also
monocotyledons, and proposed that 17 superorders, 56 orders and 96 families
Nymphaeales and Alismatales had a were added to Magnoliopsida and 8 super-
common origin from hypothetical ex- orders, 17 orders and 27 families to Liliopsida.
tinct terrestrial group of Magnoliidae, In his 1997 revision he added three new sub-
the main monocotyledonous stock be- classes Nymphaeidae, Nelumbonidae
ing terrestrial in origin. (separated from Magnoliidae) and Cornidae
Takhtajans classification approaches (separated from Rosidae) to Magnoliopsida and
more closely that of Cronquist (1981, 1988) two Commelinidae (separated from Liliidae)
in naming angiosperms as division and Aridae (separated from Arecidae) to
Magnoliophyta. Dicots and monocots are Liliopsida. He further added 18 superorders,
given the rank of a class and named 47 orders and 29 families in Magnoliopsida
Magnoliopsida and Liliopsida, respectively. and 20 orders and 27 families in Liliopsida.
Systems of Classification 327
Table 10.9 Outline of the system of classification of Angiosperms proposed by Takhtajan in 1997.
Subclasses marked* did not exist in 1987 classification.
Figure 10.16 Bubble diagram of Takhtajan showing the probable relationship between different
subclasses and superorders of dicotyledons (based on Takhtajan, 1987). 1997 clas-
sification does not include a bubble diagram.
Figure 10.17 Bubble diagram of Takhtajan showing the probable relationship between different
subclasses and superorders of monocotyledons (based on Takhtajan, 1987).
1. The system, although very sound and and Polygonaceae under the same or-
highly phylogenetic, is not helpful for der Polygonales.
identification and for adoption in her- 7. Further splitting and increase in the
baria, as it provides classification only number of families to 589 (533 in 1987)
up to the family level. Also, keys to the has resulted in a very narrow circum-
identification of taxa are not provided. scription by the creation of numerous
2. Dahlgren (1980, 1983) and Thorne monotypic families such as
(1983,1992, 2003) consider that the Pottingeriaceae, Barclayaceae,
angiosperms deserve a class rank Hydrastidaceae, Nandinaceae,
equivalent to the main groups of gym- Griseliniaceae, Hypecoaceae, etc., and
nosperms such as Pinopsida, numerous oligotypic ones such as
Cycadopsida etc. Balanophoraceae, Sarraceniaceae,
3. Clifford (1977) by numerical analysis Peganaceae and Agrophyllaceae.
has shown that Arales are closer to 8. Most authors regard the vesselless
Liliales. Dahlgren (1983, 1989) placed family Winteraceae or paleoherb
Arales next to Liliiflorae (Lilianae). The Amborellaceae the most primitive
recent studies have, shown the affini- among living angiosperms, but
ties of Araceae with Alismatales. As Takhtajan regarded Degeneriaceae as
such, the family is included under most primitive, considering
Alismatales in APG II and under Winteraceae as an isolated group and
Alismatidae>Aranae>Arales by placing it in a separate order
Thorne (2003). Winterales. The family Amborellaceae
4. Although the system is based on data finds place under Lauranae.
derived from all sources, in final judg- 9. Takhtajan has made substantial
ment more weightage is given to changes in his scheme of classifica-
cladistic information compared to tion in 1997 over his earlier version of
phenetic information. 1987. Unfortunately, however, he has
5. Ehrendorfer (1983) points out that failed to provide a bubble diagram,
Hamamelididae do not represent an which was a positive feature of his ear-
ancient side branch of Magnoliidae, lier versions and was very useful in
but are remnants of a transition from relating affinities between the groups
Magnoliidae to Dilleniidae-Rosidae- as also to know the relative sizes of the
Asteridae. various groups. This is especially sig-
6. Behnke (1977) and Behnke and nificant, as he has added three new
Barthlott (1983) point out that subclasses under dicots and two new
Caryophyllales have PIII-type plastids under monocots.
whereas Polygonales and 10. Takhtajan suggested that smaller
Plumbaginales have S-type plastids, families are more natural. According
and thus advocate their removal from to Stevens (2003), this is incorrect.
Caryophyllidae to Rosidae, retaining Monophyletic groups that include fewer
only Caryophyllales in the subclass taxaTakhtajans smaller families
Caryophyllidae. Though not agreeing do not necessarily have more
on their removal, Takhtajan (1987, apomorphies, even if all members of
1997) partly incorporated Behnkes such groups are certainly likely to have
suggestion by placing all the three or- more features in general in common.
ders under separate superorders 11. Family Triuridaceae is removed under
Caryophyllanae, Polygonanae and a separate subclass and separate
Plumbaginanae, but within the same superorder, but the evidence from 18S
subclass, Caryophyllidae. Thorne rDNA sequencing (Chase et al., 2000)
(2003, 2006) places Plumbaginaceae justifies its placement under
332 Plant Systematics
Pandanales. Thorne (2003) shifts (monocots). Cronquist includes only six sub-
Triuridaceae under Pandananae, but classes in dicots and recognizes five in
distinct order Triuridales. monocots. In dicotyledons, the Ranunculidae
12. The monocotyledons are placed after of Takhtajan are merged with Magnoliidae
dicotyledons, whereas the recent clas- and Lamiidae are not given a separate rank
sifications place them between primi- at subclass level, but retained in Asteridae.
tive angiosperms and the eudicots. In monocotyledons, Zingiberidae are
13. The Families Winteraceae and treated separate from Liliidae and
Canellaceae, are placed in two sepa- Triuridales kept under Alismatidae. As a
rate orders, whereas the multigene major departure from the systems of
analyses (Soltis et al., 1999; Zanis et Takhtajan, Dahlgren and Thorne, no super-
al., 2002, 2003) have provided 99-100 orders are recognized, the subclasses are di-
per cent bootstrap support in their vided into orders directly. Also, as against
relationship. The two are accordingly 233 orders and 592 families recognized by
placed in the same order in APG II and Takhtajan, Cronquist recognizes 83 orders
APweb, and under the same suborder and 386 families. Cronquist agrees with
in Thorne (2003). The affinities be- Thorne (earlier versions up to 1992) in keep-
tween these two families is also sup- ing the family Winteraceae (and not
ported by morphological studies of Doyle Degeneriaceae as done by Takhtajan) at the
and Endress (2000). beginning of dicotyledons, and included along
with Degeneriaceae, Magnoliaceae,
Arthur Cronquist Annonaceae etc. in the same order
Arthur Cronquist (1919-1992), a leading Magnoliales. Paeoniaceae, unlike other
American taxonomist, associated with the contemporary authors, are not separated by
New York Botanical Garden (Figure 10.18), Cronquist into a distinct order Paeoniales,
produced a broad classification of but instead shifted to the order Dilleniales
Embryobionta along with Takhtajan and under Dilleniidae.
Zimmerman (1966). He produced a detailed Another significant departure from
classification of angiosperms in 1968 in his Takhtajans system is the merger of
book The Evolution and Classification of Flow- Amaryllidaceae with Liliaceae, under the or-
ering Plants. The classification was further der Liliales. Takhtajan places these two
elaborated in 1981 in his book An Integrated families in separate orders Amaryllidales
System of Classification of Flowering Plants. and Liliales, respectively. Unlike most re-
The final revision was published in the sec- cent authors, Cronquist believed in the
ond edition (1988) of The Evolution and Clas- aquatic origin of monocotyledons, from a
sification of Flowering Plants. Some realign- primitive vessel-less ancestor resembling
ments in Dicotyledons were published in present-day Nymphaeales.
Nordic Journal of Botany in 1983. In contrast to Takhtajans system,
The classification is conceptually similar Nelumbonaceae are placed in Nymphaeales
to that of Takhtajans system, but differs in (and not a separate order Nelumbonales),
details. The classification, like that of Typhales in Commelinidae (and not
Takhtajan, is based on evidence derived Arecidae) and sympetalous families of dicoty-
from all sources, but in contrast to Takhtajan ledons placed in a large subclass Asteridae
who gives more importance to cladistics, (and not three subclasses Asteridae,
Cronquist gave more importance to morphol- Cornidae and Lamiidae). Urticales are
ogy (Ehrendorfer, 1983). included along with wind-pollinated families
Following Takhtajan, the angiosperms are under Hamamelididae (and not with its
given the name Magnoliophyta and divided 3related orders Malvales and Euphorbiales),
into Magnoliopsida (dicots) and Liliopsida and Malvales and Euphorbiales are kept in
Systems of Classification 333
Table 10.10 Broad outline of the classification of angiosperms presented by Cronquist (1988).
Division. Magnoliophyta- 2 classes, 11 subclasses, 83 orders and 386 families; 219,300 species
Figure 10.19 Phylogram showing the relationship between various subclasses and orders as
presented by Cronquist (based on Cronquist 1988).
to deserve a class rank, and not that 4. Clifford (1977) on the basis of nu-
of a division. merical studies has shown that
3. Asteridae represent a loose assem- Typhales are better placed in
blage of several diverse sympetalous Arecidae. Cronquist places Typhales
families. in Commelinidae.
336 Plant Systematics
5. Superorder, as a rank above the or- 10. Metcalfe and Chalk (1983), on the
der, is not recognized, thus showing a basis of a unique combination of
significant departure from the con- anatomical features, suggested that
temporary systems of Takhtajan, family Dioncophyllaceae should
Thorne and Dahlgren. occupy an isolated taxonomic position,
6. Ehrendorfer (1983) pointed out that but it was placed by Cronquist in
Hamamelidae do not represent an order Violales before family
ancient side-branch of Magnoliidae Ancistrocladaceae.
but are remnants of a transition from 11. Cronquist (1988) recognized
Magnoliidae to Dilleniidae-Rosidae- Physenaceae as a family under Order
Asteridae. Urticales, but was not sure about its
7. Behnke (1977) and Behnke and exact placement.
Barthlott (1983) advocate that 12. The monocotyledons are placed after
Polygonales and Plumbaginales, dicotyledons, whereas the recent clas-
with S-type plastids, should be re- sifications place them between primi-
moved to Rosidae and only tive angiosperms and the eudicots.
Caryophyllales with PIII-type plastids 13. The family Winteraceae is placed to-
retained in Caryophyllidae. wards the beginning of Magnoliales
8. Urticales are placed in Hamamelidae and Canellaceae towards the end. The
together with wind-pollinated families, multigene analyses (Soltis et al., 1999;
whereas they are close to Malvales Zanis et al., 2002, 2003) have provided
and Euphorbiales (Dahlgren, 99-100 per cent bootstrap support in
1983,1989). Cronquist further sepa- their relationship. The two are accord-
rates Malvales in Dilleniidae and ingly placed in a separate order in APG
Euphorbiales in Rosidae. II and APweb, and under the same
9. Most recent authors do not believe in suborder in Thorne (2003). The affini-
the aquatic ancestry of mono- ties between these two families is also
cotyledons. Kosakai et al., (1970) have supported by morphological studies of
provided ample evidence to refute the Doyle and Endress (2000).
aquatic ancestry of monocotyledons on
the basis of study of primary xylem in
the roots of Nelumbo (Nymphaeales).
Rolf Dahlgren
Cronquist believed that mono- Rolf Dahlgren (1932-87), a Danish botanist
cotyledons arose from vesselless working in Botanical Museum of the Uni-
ancestors resembling presentday versity of Kopenhagen first proposed his sys-
Nymphaeales. Dahlgren et al., (1985) tem and a new method of illustrating phylo-
point out that Nymphaeales and genetic relationships in a text book in Dan-
Alismatales demonstrate a case of ish in 1974. The revised system in English
multiple convergence, and only a few and subsequent revisions were published in
characters (sulcate pollen grains and 1975, 1980, 1981, 1983. A useful detailed
trimerous flowers) are due to shared treatment of Monocotyledons was presented
ancestry. The presence of two cotyle- in a book The families of Monocotyledons
dons, S-type sieve tube plastids, occur- (Dahlgren et al.,) in 1985. His diagram, a
rence of ellagic acid and perispermous cross-section through the top of an imagi-
seeds in Nymphaeales argue strongly nary phylogenetic tree became very popular
against their position as a starting for mapping the distribution of character-
point of monocotyledons, and none of states in various orders of angiosperms, and
these attributes occur in Alismatales. is popularly known as Dahlgrenogram.
Systems of Classification 337
Table 10.11 Outline of the updated Dahlgrens classification of angiosperms as presented by his
wife Gertrud Dahlgren (1989).
Table 10.12 Outline of the system of classification of Angiosperms proposed by Thorne in 2007.
Class Magnoliopsida
12 subclasses, 36 superorders, 85 orders, 485 families ; estimated genera- 13,372,
species-2,53,300
Subclass
1. Chloranthidae 1 superorder, 2 orders , 9 families, 19 genera, 250 species
Superorder 1. Chloranthanae
2. Magnoliidae 1 superorder, 4 orders , 20 families, 276 genera, 8805 species
Superorder 1. Magnolianae
3. Alismatidae 3 superorders, 6 orders , 18 families, 235 genera, 3660 species
Superorder 1. Acoranae
2. Aranae
3. Alismatanae
4. Liliidae 3 superorders, 5 orders ,51 families, 1261 genera, 29085 species
Superorder 1. Pandananae
2. Dioscoreanae
3. Lilianae
5. Commelinidae 2 superorders, 10 orders , 35 families, 1116 genera, 23270 species
Superorder 1. Arecanae
2. Commelinanae
6. Ranunculidae 2 superorders, 8 orders , 17 families, 298 genera, 6350 species
Superorder 1. Proteanae
2. Ranunculanae
7. Hamamelididae 1 superorder, 4 orders , 22 families, 145 genera, 3870 species
Superorder 1. Hamamelidanae
8. Caryophyllidae 5 superorders, 9 orders , 46 families, 889 genera, 13875 species
Superorder 1. Berberidopsidanae
2. Caryophyllanae
3. Dillenianae
4. Santalanae
5. Balanophoranae
9. Rosidae 7 superorders, 12 orders , 83 families, 2258 genera, 48127 species
1. Celastranae
2. Violanae
3. Podostemanae
4. Oxalidanae
5. Geranianae
6. Rosanae
7. Myrtanae
10. Malvidae 5 superorders, 8 orders , 61 families, 1430 genera, 20430 species
Superorder 1. Malvanae
2. Rafflesianae
3. Capparanae
4. Huerteanae
5. Rutanae
11. Asteridae 4 superorders, 13 orders , 78 families, 2677 genera, 44970 species
Superorder 1. Cornanae
2. Ericanae
3. Aralianae
4. Asteranae
12. Lamiidae 2 superorders, 4 orders , 45 families, 2752 genera, 50310 species
Superorder 1. Solananae
2. Lamianae
Four genera (Haptanthus, Heteranthia, Pottingeria and Pteleocarpa) of uncertain position
Systems of Classification 343
Buxaceae and Didymelaceae; (e) Shifting of groups, and focussing those which need fur-
Hamamelidaceae, Saxifragaceae, Vitaceae ther investigation. Salient features of 2007
away from Rosidae to Hamamelididae; (f) version are given in Table 10.12.
placement of Ericaceae and related families
under Asteridae and away Rosidae (and abol- Merits
ished Dilleniidae) and (g) recognition of The classification of Thorne has kept pace
Garryales as distinct order including with recent developments, and is being regu-
Garryaceae, Aucubaceae and larly updated. The system is merited with the
Eucommiaceae. following achievements over the previous
Thorne, in his 2003 version had also in- and contemporary systems of classification:
troduced the concept of assigning the degree 1. It is a highly phylogenetic system, in-
of confidence in hierarchical level, circum- corporating the recent evidence from
scription and alignment of taxa, continued molecular systematics and chemotaxo-
in 2006 and 2007 revisions. A represents nomy, and balancing it with evidence
limited confidence, B for probably correct as- from other sources.
signment and C implies considerable confi- 2. The angiosperms are given a more
dence in assignment. Such an indication is agreeable rank of a class like Dahlgren
very useful for future placements of the and other recent systems.
Systems of Classification 345
3. The system is more exhaustive than 12. Family Winteraceae and Canellaceae
the contemporary systems in that are brought together under the same
families, where necessary have been order. Their affinities are strongly sup-
divided into subfamilies. Similarly ported by morphological studies and
suborders are recognized under sev- multigene analyses.
eral orders. 13. The separation of Brassicaceae and
4. The system, unlike the APG II has Capparaceae has found support from
found a place for all unplaced families chloroplast sequence data (Hall,
of APG. Sytsma and Iltis, 2002), consistent
5. The placement of Amborellaceae, with morphological data.
Chloranthaceae, Austrobaileyaceae, 14. The merger of Budlejaceae in
Nymphaeaceae and Cabombaceae (a Scrophulariaceae is supported by mor-
major shift from 2006 version) at the phological studies of Bremer et al.,
beginning of angiosperms is generally (2001) and molecular (three gene
favoured in the recent cladistic analysis) by Olmstead et al. (2001).
schemes of APG ( and supported by Qui 15. Shifting Triuridaceae and Stemona-
et al, 2000; Soltis et al., 2000). These ceae closer to Pandanaceae is in line
have been placed under an independ- with recent APG schemes. The
ent subclass Chloranthidae. evidence from 18S rDNA sequencing
6. Abolition of traditional groups dicots (Chase et. al., 2000) justifies place-
and monocots, and dividing ment under Pandanales. Triurididae
angiosperms directly into various sub- as an independent subclass is not jus-
classes (with circumscription largely tified as indicated by recent evidence.
paralleling informal groups of APG) is 16. The placement of Cornales and Ericales
in line with the recent phylogenetic together under Asteridae is in line with
thinking. recent thinking of APG.
7. The subclass Magnoliidae placed after 17. Family Liliaceae of Hutchinson and
paleoherb families is in line with APG earlier authors has been split into a
classification. number of monophyletic families such
8. The system is superior over APG II clas- as Liliaceae, Alliaceae, Asphodelaceae,
sification in that formal group names Asparagaceae, etc. in line with the ar-
are given for all supraordinal ranks. rangement in APG classifications.
9. The recognition of superorders with 18. The concept of assigning the degree of
ending anae has resulted in more confidence (A, B or C) in hierarchical
realistic arrangement of the orders level, circumscription and alignment
within subclasses. of taxa is very useful for better under-
10. The monocots families are arranged in standing of phylogenetic affinities.
between primitive angiosperms and 19. The merger of Asclepiadaceae with
more advanced dicots, and not towards Apocynaceae has been supported by
the end of angiosperms, as in previous molecular analyses by Judd et al.,
systems of Takhtajan, Dahlgren and (1994) and Sennblad and Bremer
Cronquist. This treatment is in agree- (1998). Recognition of distinct
ment with Angiosperm Phylogeny Asclepiadaceae would render Apocyna-
Group. ceae as paraphyletic (Judd et al., 2002).
11. Creation of superorder Malvanae and 20. Placement of Ceratophyllaceae under
shifting several families of Rosidae Chloranthidae before monocots is in
here has resulted in more realistic line with recent data. Studies of Zanis
arrangement. et al. (2002) and Whitlock et al. (2002)
346 Plant Systematics
have shown that the family is a sister monocots; 54 orders in dicots and 14 in
group of monocots as indicated by monocots are recognized.
microsporogenesis and structure of
leaf margin. Zheng-Yi Wu
During the last decades Zheng-Yi Wu (b.
Demerits 1916) and his associates have developed a
In spite of several improvements, the follow- system of classification of angiosperms,
ing drawbacks, however, may be pointed out: much different from contemporary systems
1. Although highly phylogenetic the sys- in logic and treatment. Professor Wu , Di-
tem is not very useful for identifica- rector Emeritus, Academician of Chinese
tion and adoption in herbaria since Academy of Sciences is a leading Chinese
identification keys for genera, their taxonomist. He was appointed as a deputy
distribution and description are not director of the Beijing Institute of Botany,
provided. Chinese Academy of Sciences in 1950, be-
2. Thorne places Asteridae before came a member of the Chinese Academy in
Lamiidae, whereas the data from mo- 1955, and the director of the Kunming In-
lecular studies justifies placement of stitute of Botany in from 1974 through 1983.
the group (with circumscription some- In addition to his numerous publications on
what similar to Euasterids II) after
Lamiidae (Comparable to Euasterids I
of APG II)
3. Thorne is not clear about the affini-
ties of four genera of angiosperms.
4. Grewiaceae (former Tiliaceae with
Tilia excluded) is recognized as an in-
dependent family, whereas recent
APG classifications (Judd. et al., APG
II and APweb) place all members of
Tiliaceae, Bombacaceae and
Sterculiaceae under Malvaceae.
5. Thorne separates Cabomba and
Brassenia under Cabombaceae on the
basis of trimerous flowers, with dis-
tinct sepals and petals, 2-3 free car-
pels, and fruit a follicle, whereas the
cladistic analyses support their place-
ment under Nymphaeaceae as done
by APG II, APweb and Judd et al. The
separation of Cabombaceae renders
Nymphaeaceae as paraphyletic.
C. R. de Soo
From Budapest, Hungary, C. R. de Soo pro-
posed (1975) a classification essentially
similar to Takhtajans but preferring the Figure 10.24 Zheng-Yi Wu, a leading Chinese
name Angiospermophyta for angiosperms, Taxonomist who spearheaded
Dicotyledonopsida for dicots and the publication of Flora of China
Monocotyledonopsida for monocots. Five and published his new eightclass
subclasses are included in dicots and 3 in classification of angiosperms.
Systems of Classification 347
many plant families and genera, Professor polytopic. By polyphyletic the authors
Wu is credited for 28 major works in tax- meant that during Early Cretaceous explo-
onomy, vegetation, floristics, biogeography, sion of angiosperms, there were many
Chinese herbals, and diversity. He led or monophyletic groups due to extinction of
joined several botanical expeditions, espe- many ancient species. By polytopic, the au-
cially to Xizang. He described about 300 new thors did not mean that the same group could
species and proposed 11 genera. He has de- have occurred on different continents at the
voted himself to the research of the flora of same time, they rather believed that the
China and East Asia since 1930s. He is the modern inter-continental disjunctive distri-
Chairman of editorial board for the publica- bution patterns of angiosperms can be ex-
tion of Flora of China, which describes all plained only by using plate tectonics and
the diverse species of plants in China, a vicariance biogeography. After their origin
large-scale scientific work projected to cover from Pangaea during Late Triassic to the
80 volumes and 125 issues in Chinese. An Early Jurassic, the pro-angiosperms might
English version has been published under have undergone a process of differentiation,
the co-editorship of Dr. Peter H. Raven, Di- extinction and re-differentiation of several
rector of the Missouri Botanical Garden. dozen million years, and then undergone a
From a global perspective, Dr. Wu has shown great explosive radiation in the Early Creta-
deep involvement with the attempts to pro- ceous. By that time, the major groups of an-
tect natural flora, specially the human-in- giosperms might have appeared, forming 8
duced extinction of plant species and their major lineages at early stage of differentia-
impact on the global environment. His ef- tion of angiosperms. These eight lineages
forts have contributed to the establishment are circumscribed as 8 classes, thus propos-
of national parks and natural reserves in ing a new 8-class system of classification.
China. The system is outlined in Table 10.13
The ideas for this polyphyletic-poly-
chronic-polytypic classification dividing an- Angiosperm Phylogeny Group
giosperms into eight classes, were pre-
sented in two papers of Wu et al. (1998a, (APG)
1998b). The synopsis of classification was First serious attempts towards developing a
published in 2002, and detailed description cladistic classification were made by
of families and genera represented in China Bremer (Figure 10.25) and Wanntorp (1978,
in 2003. 1981), who suggested that angiosperms
The classification has been developed on should be treated as subclass Magnoliidae
the basis of assumption that although an- of class Pinatae (seed plants). They argued
giosperms are monophyletic in their earli- that Monocotyledons and Dicotyledons should
est origin, yet owing to some intrinsic fac- not be recognized because it will make the
tors in plants themselves and different ex- group paraphyletic, suggesting that an-
trinsic factors appearing on the Earth after giosperms should be directly divided into a
the Early Cretaceous explosion of an- number of superorders. The proposal was not
giosperms, some groups might have become taken seriously because monocots and di-
isolated and continued to flourish for many cots as separate groups were recognized in
generations. These groups might have given all major system of classifications up to the
rise to many lineages, just like the situa- last decade of last century.
tion that many branches and leaves may There has been a considerable revival of
sprout from a single shoot. Thus viewed from the cladistic concepts with the utilization of
certain cross section of time, some lineages molecular data and development of powerful
are monophyletic-monochronic-monotopic, tools of data handling. During the last
whereas others are polyphyletic-polychronic- decade, concept has developed into APG
348 Plant Systematics
1. Magnoliopsida
(5 subclasses,11 orders, 17 families) 20. Commelinidae
1. Magnoliidae 21. Juncidae
2. Annonidae 22. Poaoidae
3. Illiciidae 23. Arecidae
4. Ceratophyllidae 6. Ranunculopsida
5. Nymphaeidae (4 subclasses, 9 orders, 17 families)
2. Lauropsida 24. Nelumbonidae
(3 subclasses,4 orders, 9 families) 25. Ranunculidae
6. Lauridae 26. Paeoniidae
7. Calycanthidae 27. Papaveridae
8. Chloranthidae 7. Hamamelidopsida
3. Piperopsida (3 subclasses, 11 orders, 21 families)
(2 subclasses,4 orders, 8 families) 28. Trochodendridae
9. Aristolochidae 29. Hamamelididae
10. Piperidae 30. Betulidae
4. Caryophyllopsida 8. Rosopsida
(3 subclasses,8 orders, 20 families) (10 subclasses, 112 orders, 361 families)
11. Caryophyllidae 31. Dilleniidae
12. Polygonidae 32. Malvidae
13. Plumbaginidae 33. Ericidae
5. Liliopsida 34. Rosidae
(10 subclasses,43 orders, 119 families) 35. Myrtidae
14. Alismatidae 36. Rutidae
15. Triurididae 37. Geraniidae
16. Aridae 38. Cornidae
17. Liliidae 39. Asteridae
18. Bromelidae 40. Lamiidae
19. Zingiberidae
Table 10.14 Broad outline of APG II (2003) classification of Angiosperm Phylogeny Group.
Magnoliophyta
Group Order Group Order
1. Austrobaileyales 6. Rosids
2. Ceratophyllales 1. Crossosomatales
1. Magnoliids 2. Geraniales
1. Canellales 3. Myrtales
2. Laurales 7. Eurosids I
3. Magnoliales 1. Celastrales
4. Piperales 2. Cucurbitales
2. Monocots 3. Fabales
1. Acorales 4. Fagales
2. Alismatales 5. Malpighiales
3. Asparagales 6. Oxalidales
4. Dioscoreales 7. Rosales
5. Liliales 8. Eurosids II
6. Pandanales 1. Brassicales
3. Commelinids 2. Malvales
1. Ericales 3. Sapindales
2. Commelinales 9. Asterids
3. Poales 1. Cornales
4. Zingiberales 2. Ericales
4. Eudicots 10. Euasterids I
1. Proteales 1. Garryales
2. Ranunculales 2. Gentianales
5. Core Eudicots 3. Lamiales
1. Gunnerales 4. Solanales
2. Caryophyllales 11. Euasterids II
3. Santalales 1. Apiales
4. Saxifragales 2. Aquifoliales
3. Asterales
4. Dipsacales
Figure 10.26 Interrelationships of orders and some families presented in APG II classification
(2003), having bootstrap support of more than 50 per cent.
352 Plant Systematics
Table 10.15 Broad outline of APweb (version 7, June 2008) classification of Flowering plants
presented on Angiosperm Phylogeny website of P. F. Stevens.
Magnoliophyta
Group Order Group Order
1. Amborellales 6. Vitales
2. Nymphaeales 6. Rosids
3. Austrobaileyales 1. Geraniales
4. Chloranthales 2. Myrtales
3. Magnoliids 7. Eurosids I
1. Magnoliales 1. Zygophyllales
2. Laurales 2. Celastrales
3. Canellales 3. Oxalidales
4. Piperales 4. Malpighiales
1. Monocots 5. Cucurbitales
1. Acorales 6. Fagales
2. Alismatales 7. Fabales
3. Petrosaviales 8. Rosales
4. Dioscoreales 8. Eurosids II
5. Pandanales 1. Crossosomatales
6. Liliales 2. Picramniales
7. Asparagales 3. Sapindales
2. Commelinids 4. Huerteales
1. Ericales 5. Brassicales
2. Poales 6. Malvales
3. Commelinales
4. Zingiberales 9. Asterids
* Ceratophyllales 1. Cornales
2. Ericales
4. Eudicots 10. Euasterids I
1. Ranunculales 1. Garryales
2. Sabiales 2. Gentianales
3. Proteales 3. Lamiales
4. Trochodendrales 4. Solanales
5. Buxales 11. Euasterids II
6. Gunnerales 1. Aquifoliales
5. Core Eudicots 2. Asterales
1. Berberidopsidales 3. Escalloniales
2. Dilleniales 4. Bruniales
3. Caryophyllales** 5. Apiales
4. Santalales 6. Paracryphiales
5. Saxigragales 7. Dipsacales
Figure 10.28 Main tree showing relationships between various orders of angiosperms and the
informal higher clades presented by Stevens in APweb (version 7, 2008). Tree icons
link to the trees of the respective orders on the web. (Reproduced with permission
from P. F. Stevens)
Systems of Classification 355
Table 10.16 Broad outline of APG classification used by Soltis et al. (2005), based on rearrangements
of APG II.
Angiosperms
Group Order Group Order
1. Austrobaileyales
1. Magnoliids 7. Eurosids I
1. Magnoliales 1. Rosales
2. Laurales 2. Fabales
3. Piperales 3. Cucurbitales
4. Canellales 4. Fagales
2. Monocots 5. Malpighiales
1. Acorales 6. Oxalidales
2. Alismatales 7. Celastrales
3. Petrosaviales 8. Eurosids II
4. Pandanales 1. Brassicales
5. Dioscoreales 2. Sapindales
6. Liliales 3. Malvales
7. Asparagales 9. Other Rosids
3. Commelinid Monocots 1. Myrtales
1. Ericales 2. Geraniales
2. Dasypogonales 3. Crossosomatales
3. Zingiberales 10. Asterids
4. Commelinales 1. Cornales
5. Poales 2. Ericales
4. Eudicots 11. Euasterids I
1. Ranunculales 1. Garryales
2. Proteales 2. Lamiales
5. Core Eudicots 3. Gentianales
1. Gunnerales 4. Solanales
2. Berberidopsidales 12. Euasterids II
3. Saxifragales 1. Aquifoliales
4. Santalales 2. Asterales
6. Caryophyllales 3. Dipsacales
4. Apiales
Unplaced families: In addition to four unplaced families of basal angiosperms listed above
there 1 in commelinid monocots (Dasypogonaceae), 3 in eudicots (Sabiaceae, Buxaceae,
Trochodendraceae), 3 in rosids (Vitaceae, Picramniaceae, Huaceae), 2 in eurosids
I (Zygophyllaceae, Krameriaceae), 1 in eurosids II (Tapisciaceae), 5 in Euasterids
I (Oncothecaceae, Metteniusaceae, Icacinaceae, Boraginaceae, Vahliaceae) and 7 in
Euasterids II (Escalloniaceae, Eremosynaceae, Bruniaceae, Columelliaceae (incl
Desfontainiacea), Polyosmaceae, Tribelaceae, Sphenostemonaceae).
356 Plant Systematics
in recognizing 3 orders Amborellales, Nym- 3. Formal group names have been given
phaeales and Austrobaileyales for basal fam- mostly only up to the level of the order,
ilies now known as ANITA Grade and in- where monophyly of the group has been
cluding Chloranthaceae (although with un- firmly established.
certain placement), shifting Ceratophyllace- 4. The traditional division of angiosperms
ae (although with uncertain position) to the has been abandoned and various
end of Magnoliid complex, recognizing order monocot taxa placed in between primi-
Vitales under Rosid clade (Vitaceae unplaced tive angiosperms and eudicots, thus
in Rosids in APG II), recognizing Zygophylla- overcoming the problem of paraphyly
les as a distinct order under Eurosids I (Zy- in the earlier recognized two groups
gophyllaceae unplaced in Eurosids I in APG monocot and dicots.
II) and shifting the sequence of some orders, 5. Although no formal names have been
recognising 45 orders of Angiosperms. Some given for groups above the rank of or-
informals names have also been introduced: der, there is constant endeavour to
ANITA Grade for early angiosperms, Fabids construct supraordinal monophyletic
for Eurosids I, Malvids for Eurosids II, Sym- clades.
petalae for Asterid Clade, Lamiids for Euas- 6. A number of cladograms are being pre-
terids I and Campanulids for Euasterids II. sented for general affinities between
Perhaps we have broken the jinx of dicot- various groups of angiosperms based
monocot grouping of angiosperms, position on molecular as also on information
of Magnoliid complex, which includes some from other fields.
of the most primitive representatives of an- 7. The families with several primitive
giosperms, also seems to be settled. The po- features are placed towards the begin-
sition of Piperales seems to be more or less ning of angiosperms. The family
stabilized towards the end of Magnoliids, but Amborellaceae, which is unique in
family Ceratophyllaceae has still to find a angiosperms in having granular and
stable position. Judd et al., place the family not tectate ectexine is placed at the
under order Ceratophyllales after Piperales start.
within Magnoliid complex with uncertain po- 8. Although there are four unplaced fami-
sition, APG II place it before monocots, to- lies in APG towards the beginning of
wards the beginning of angiosperms, and the angiosperms, these have been ac-
APweb towards end of Commelinids. commodated under orders in APweb.
9. The number of unplaced families in
Merits various informal groups and uncertain
This newly emerging system of classifica- families towards the end have been
tion, which has undergone dramatic modi- sufficiently reduced in APG II and
fication over the last five years and is fast APweb, finding ordinal places for many
evolving, due to concerted efforts of a group unplaced families of APG (1998).
of dedicated workers has several merits in 10. The merger of Budlejaceae and
APG II (and APweb): Myoporaceae with Scrophulariaceae
1. The system is based on the sound has the support of morphological stud-
phylogenetic principle of constructing ies of Bremer et al., (2001) and molecu-
taxa on the basis of established lar (three gene analysis) by Olmstead
monophyly. et al. (2001).
2. The system is based on a synthesis of 11. Winteraceae and Canellaceae are
information from mainly morphology, brought together under the same or-
anatomy, embryology, phytochemistry der. Their affinities are strongly sup-
and more strongly on molecular stud- ported by morphological studies and
ies. multigene analyses.
Systems of Classification 357
Table 10.17 Comparison of most recent phylogenetic systems of classifications indicating major
groups and the number of unplaced taxa.
** (25 families) ** not listed **(10 families, 5 genera) **(none) **(4 genera)
12. Liliaceae of Hutchinson and earlier karyotype. The placement has been
authors has been split to form several adopted by Judd et al., (2002, 2008),
monophyletic families such as Thorne and APweb.
Liliaceae, Alliaceae, Asparagaceae, 14. Circumscription of Malvaceae has
Asphodelaceae, etc. been broadened to also include
13. Circumscription of Agavaceae has Tiliaceae, Sterculiaceae and Bombaca-
been further strengthened to include ceae, thus forming monophyletic
other genera like Hosta, Camassia and Malvaceae, as supported by morphologi-
Chlorogalum, which also have bimodal cal and molecular evidence.
358 Plant Systematics
15. The merger of Asclepiadaceae with 6. Angiosperms have been given the
Apocynaceae has been strengthened rank of a division, but there are no
by molecular evidence Judd et al., formal taxa between the rank of an
(1994) and Sennblad and Bremer order and division, a rather unusual
(1998). Recognition of distinct phenomena for classification systems.
Asclepiadaceae would render Apocyna- 7. Family Capparaceae has been merged
ceae as paraphyletic (Judd et al., with Brassicaceae, but the Chloroplast
2002, 2008). sequence data points to the separa-
tion of these two families as also
Demerits Cleomacae. Thorne (2006) recognizes
Although the system is still evolving and con- Brassicaceae, Capparaceae and
tinuously improving, and will take a consid- Cleomaceae as distinct families.
erable time before it stabilizes and is tested The developments of the last few years
by various parameters, a few shortcomings have seen clear emergence of a few facts.
are obvious: The angiosperms are no longer to be divided
1. Classification having not proceeded into traditional dicots and monocots.
below the family level, the system is Commelinids are distinct from other mono-
not useful in practice and for adoption cots, and these two, forming the traditional
in herbaria and floras. monocots are better placed between primi-
2. Although a large number of families tive angiosperms and the Eudicots. Primi-
have been assembled into more or tive angiosperms include paleoherbs
less monophyletic orders, there still (Nymphaeaceae, Cabombaceae, Piperaceae,
exists a large number of unplaced Amborellaceae, Ceratophyllaceae, etc.) and
families, and a few unplaced genera true magnoliids (Magnoliales, Laurales, etc.)
in both APG II and APweb. are better placed before monocots. Thorne
3. Although most of the orders have been (1999, 2000, 2003, 2006) has come up with
assembled into informal groups, no a major revision of his classification, bring-
proper names conforming to the Bo- ing it on lines of APG, but maintaining the
tanical Code have been given for hierarchical structure, and finding a place
these groups. almost all families, with only 4 genera re-
4. Although APG II places all presumed maining unplaced. It is also interesting to
primitive families of angiosperms be- note that his eleven subclasses are more or
fore monocots, APweb transfers the less complementary to the eleven informal
Magniliids to a position after monocots groups of APG-II, the relationship somewhat
and commelinids. reversed in Asterids.
Chapter 11
Families of Pteridophytes
Consensus phylogeny representing relationships among ferns (after Smith et al., 2006).
Families of Pteridophytes 361
***************
Figure 11.1 Lycopodiaceae. Lycopodium phlegmaria. A: Pendulous branch with terminal strobili;
B: Vegetative leaf; C: Longitudinal section of strobilus; D: Sporophyll in adaxial view;
E: Same in abaxial view; F: Vertical section of fetile branch of L. lucidulum showing
sporangia in axils of unmodified sporophylls.
Families of Pteridophytes 363
selago). Leaves simple, small and 1-veined flash of light. They were used in early
(microphylls), nonligulate, up to 2 cm long, Chinese fireworks, by magicians and sor-
covering the stem densely, spirally arranged cerers in Middle ages, and as flash in early
or opposite, linear or scale-like, appressed photography, and first photocopying ma-
or spreading, usually entire, rarely serrate chines. Spores have also been used as in-
(Lycopodium serratum). Sporangia large, kid- dustrial lubricants and in surgical gloves and
ney-shaped, sessile or short stalked, singly condomes. Plants of several species were ear-
in axils (adaxial) of sporophylls which are lier gathered for making Christmas wreaths.
similar to foliage leaves (and restricted to
distal end of stem or in alternate sterile and Phylogeny: Although the family is well
fertile zones) or well differentiated (smaller circumscribed, the generic limits have
than foliage leaves and with dentate mar- undergone considerable readjustment. Often
gin) forming a strobilus, homosporous, sub- treated under a single genus Lycopodium, or
globose to reniform, shortly stalked, open- divided to five genera Lycopodium, Huperzia,
ing by transverse slit, sometimes folding Diphasiastrum, Lycopodiella and Phylloglos-
back to expose spores; spores subglobose or sum. Last genus includes a single peculiar
tetrahedral, with a 3-branched scar. Game- species of reduced plants found in Australia
tophyte green when on soil surface, non- New Zealand and Tasmania, but gameto-
green when subterranean, irregularly lobed, phyte morphology and rbcL studies support
often living up to 25 years; antheridia sunk- the inclusion under Huperzia. Diphasias-
en, spermatozoids produced in large num- trum, a genus of nearly 16 species of low gym-
bers, biflagellate. nosperm like plants, and often called as
Ground-pine or Ground-cedar, is better
Economic importance: Family is of little im- placed under Lycopodium. The family is very
portance. The spores of Lycopodium contain old in fossil record, dating back to 380 MYA,
a highly volatile oil and ignite rapidly into a mostly dominated by lycopod trees.
***************
Figure 11.2 Selaginellaceae. Selaginella kraussiana. A: Portion of plant; B: A part of same from
upper view showing arrangement of leaves; C: Vertical section of ligule; D: Portion
of branch of S. pallescens; E: Small portion of same showing one megasporangium
(left) and one microsporangium (right); F: Strobilus of S. watsoni proliferating at
apex into vegetative shoot. S. oregana. G: Vertical section of portion of strobilus; H:
Vertical section of microsporangium; I: Vertical section of megasporangium.
isomorphic (all similar) or dimorphic and 4- spores tetrahedral with prominent triradiate
ranked, with two upper or dorsal rows of small- mark and with characteristic ornamentation.
er leaves and two lower or lateral rows of larg- Gametophyte unisexual, developed within
er leaves. Sporangia borne in axils of well- respective spore walls; spermatozoids biflagel-
differentiated sporophylls, usually on 4-angled late, smallest among vascular plants. Sever-
terminal strobili, heterosporous, microspo- al species especially those growing in dry
rangia and megasporangia occurring on climate can survive long periods of drought
same (with megasporangia in upper part of due to small leaves covered with thick
strobilus, microsporangia in lower part- S. cuticle, and branches curling up into a ball.
helvetica or in two opposite rows- S. oregana) Such plants revive fast with availability of
or different strobili; microsporangium with water and are known as resurrection plants
more than 100 microspores about 20-60 mm S. bryopteris of India- regarded by some as
in diameter; megasporangium with 4 large Sanjeevani booti of Ramayana legend, and
megaspores about 200-600 mm in diameter; S. lepidophylla of Mexico and Texas).
Families of Pteridophytes 365
***************
Salient features: Terrestrial perennial bundles, ligulate with ligule inserted above
herbs of marshy areas, stem short with sporangium, hardened scales and phyllopo-
secondary growth, , leaves simple , long, dia surrounding the leaves; all leaves po-
quill-like, 1-veined, ligulate; sporangia tential sporophylls. Sporangia solitary,
borne singly, sunken at base of leaves, het- borne adaxially embedded in cavity of swol-
erosporous. len base of sporophylls, microsporophylls and
megasporophylls usually borne in alternate
Genera: Single genus Isoetes (150 spe- cycles, sporangium covered partially or com-
cies). pletely on adaxial side by velum; megaspo-
rangium with 50-300 megaspores; mi-
Description: Terrestrial tufted perennial crosporangium with 0.15-1 million mi-
plants usually found in marshy areas, often crospores; microspores elongate, about 45
in periodically inundated pools. Roots firm, long; megaspores 250-900 in diameter;
arising from grooves of lobed stem in radi- spores set free by disintegration of sporan-
ating rows, unbranched or dichotomously gial wall, dehiscence zone not developed. Ga-
branched, containing eccentric vascular metophyte unisexual, developed within re-
strand and surrounding lacuna. Stem short, spective spore walls (endosporic); microga-
erect, cormose (corm-like), rarely rhizoma- metophyte 9-celled, antheridium single,
tous, having secondary growth, protostelic spore wall cracking to release 4 multiflagel-
stele anchor-shaped with upturned lobes late spermatozoids each with terminal ves-
(near base), lobed by a broad basal groove icle; megagametophyte with 1-several
into 2-4 lobes, rough on sides due to slough- archegonia, often with rhizoids, exposed by
ing off of cortical tissue. Leaves simple, lin- cracking of spore wall.
ear, long, quill-like, resembling narrow-
leaved species of Allium , up to 100 cm long, Economic importance: None.
swollen at base, 1-veined (microphylls), con-
taining 4 transversely septate longitudinal Phylogeny: The family with single genus
lacunae, a central collateral vascular strand is well differentiated from Lycopodiaceae in
and frequently several peripheral fibrous ligulate leaves and heterosporous habit.
366 Plant Systematics
Figure 11.3 Isoetaceae. Isoetes engelmanni. A: Plant; B: Corm with attached leaf bases; C: Trans-
verse section of leaf; D: Leaf base with ligule and sporangium; E: Same in vertical
section; F: Megaspore.
***************
aggregated into sporophore, sporangium wall unfolding lengthwise (conduplicate) and not
more than one cell thick, annulus absent, circinate, with branched veins (euphyll or
gametophytes subterranean. macrophyll), venation reticulate (Ophioglos-
sum) or open dichotomous (Botrychium); sin-
Major Genera: Botrychium (45 species), gle fertile branched (Botrychium) or simple
Ophioglossum (25), Cheiroglossa (1), Mankyua (Ophioglossum) sporophore arising from sur-
(1) and Helminthostachys (1). face of leaf (trophophore), more than one
sporophore arising in Cheiroglossa; petiole
Description: Terrestrial perennial plants, fleshy with expanded sheathing base;
very rarely epiphytic. Roots unbranched, stipules present, sheathing, persisting even
adventitious, lacking root hairs. Stem short, after decay of leaves. Sporangia aggregated
tuberous or rhizomatous, aerial portion per- in fertile portion (sporophore), thick walled
ishing after growing season, rarely ever- (eusporangiate-more than one celled thick),
green (Botrychium dissectum, B. multifidum). homosporous, not clustered in sori, separat-
Leaves simple (Ophioglossum) or more or ed (Botrychium) or forming synangia (Ophio-
less palmately compound (and looking like glossum), exposed or embedded in spike-
hand-Cheiroglossa) to many times pinnately like sporophore, annulus absent; spores
compound (Botrychium), up to 50 cm long, thousands per sporangium, chlorophyllous.
368 Plant Systematics
***************
Figure 11.5 Psilotaceae. Psilotum nudum. A: Plant; B: Portion of sterile branch with leaves;
C: Portion of fertile branch with 3-lobed synangia; D: Synangium; E: Synangium in
cross section. Tmesipteris tannensis. F: Plant; G: Sporophyll; with 2-lobed synangium;
H: Longitudinal section of synangium.
***************
370 Plant Systematics
Salient features: Annual or perennial rhi- unbranched or with whorled branches, with
zomatous herbs with jointed ribbed aerial swollen jointed nodes, internodes longitu-
stems, leaves reduced with single vein, spo- dinally ribbed, with ridges and grooved out-
rangia on peltate sporangiophores, homo- side, hollow with central canal, with addi-
sporous, spore wall with elaters, gametophyte tional smaller canals under the ridges;
green, thallus shaped, spermatozoids mul- growth intercalary; outer surface covered
tiflagellate. with silica cells giving plant the texture of
sand paper, hence the name scouring rush.
Genus: Single genus Equisetum (15 species). Leaves small, usually less than 1 cm,
1-veined, whorled and fused into a sheath,
Description: Terrestrial or aquatic annual latter more or less swollen, each leaf corre-
or perennial herbs, sometimes evergreen, sponds to the ridge below, thus the number
with subterranean much-branched rhizome. of leaves at each node as the number of ridg-
Roots slender, arising from horizontal es, the leaves of the successive nodes as well
subterranean rhizome. Stem subterranean as ridges alternating. Sporangia large,
as well as aerial, latter erect, green, lacking annulus, homosporous, hanging
Figure 11.6 Equisetaceae. A: Plant of Equisetum arvense showing rhizome, vegetative branch
and fertile branches. E. telmateia. B: Portion of plant with sterile and fertile branches;
C: Sporangiophore viewed from below; D-E: Spore with coiled elaters; F: Antherozoid.
E. hyemale. G: Node with sheath of leaves; H: Strobilus; I: Sporangium.
Families of Pteridophytes 371
from lower surface of peltate sporangiophore, species, especially E. hyemale, were used for
whorls of sporangiophores aggregated into scouring pots and pans, hence the common
strobilus terminating green branches or un- name scouring rush.
branched nongreen stems arising separately
from rhizome; base of strobilus with collar of Phylogeny: The family is quite distinct in
fused sterile appendages; sporangium with its jointed stems with ridges and grooves and
2-layered wall; sporangiophore with slender hollow within, whorled leaves and peltate
stalk and hexagonal disc at distal end, 5-10 sporangiophores. Earlier the family was con-
sporangia hanging from each disc; spores sidered distinct from ferns, but the molecu-
spherical, many thousand per sporangium, lar data and morphological characters such
green, wrapped by 4-6 straplike elaters aris- as spermatozoids and root structure, support
ing from outer wall, assisting in spore dis- placement with ferns.
persal, wall with four apertures. Gameto- The genus is divided into two subgenera:
phyte pinhead sized, thallus shaped, green, Equisetum (8 species) with branched stem
developing near soil surface; antheridia and and superficial stomata and Hippochaete (7
archegonia developing simultaneously; sper- species) with unbranched stems and sunk-
matozoids multiflagellate. en stomata, sometimes recognized as dis-
tinct genera.
Economic importance: Family is of lesser The family is represented in the fossil
importance. Silica covered stems of several record as early as Devonian 408-360 MYA.
***************
Salient features: Terrestrial plants with xylem strands, latter often conduplicate or
wiry roots, persistent stipe bases, dimorphic twice conduplicate in cross section. Leaves
fronds, pinnate compound sterile fronds, up to 2 m long, spirally arranged, usually
sporangia with many spores, annulus dimorphic with distinct sterile and fertile
shield-like, gametophyte green, developing fronds; sterile fronds green, once- thrice-
on soil surface. pinnate compound, with expanded petiole
base, circinate before unfolding, usually
Genera: Osmunda (10 species), Leptopteris (6) leathery, rarely filmy (Leptopteris hymeno-
and Todea (2). phylloides), usually covered with hairs es-
pecially when young; fertile fronds usually
Description: Terrestrial plants common in brown, much narrower; sometimes sterile
wetlands and lowland forests, sometimes and fertile segments present on same leaf.
tree-like (Leptopteris). Roots wiry, adventi- Sporangia large, shortly stalked, interme-
tious, generally two below each leaf base. diate between eusporangiate and leptospo-
Stem erect to decumbent, branched, mas- rangiate ferns arising from single initial
sive, often covered by persistent leaf bases, (leptosporangiate) or many initials (euspo-
ectophloic siphonostele with ring of discrete rangiate) and archesporial cell tetrahedra
372 Plant Systematics
Figure 11.7 Osmundaceae. Osmunda javanica A: Portion of plant with sterile and fertile fronds;
B: Portion of fertile frond; C: Fertile frond in cross section; D: Portion of fertile pinna
of Todea africana; F: Portion of fertile pinna of Leptopteris hymenophylloides.
***************
Salient features: Aquatic plants with Genera: Marsilea (69 species), Pilularia (5)
floating long-petioled leaves, leaflets and Regnellidium (1).
2 to 4, sori enclosed in hard sporocarp,
heterosporous, sporangia without annulus, Description: Plants perennial, aquatic or
megasporangium with one megaspore, rooted in mud with creeping rhizome, rare-
microsporangium with 16-64 microspores. ly xerophytic and developing underground
Figure 11.8 Marsileaceae. Marsilea quadrifolia. A: Plant with sporocarps; B: Vertical section of
sporocarp; C: Sporocarp in longitudinal section; D: Spore; E: Spermatozoid; F: Por-
tion of plant of M. polycarpa; G: Portion of plant of Regnellidium diphyllum.
374 Plant Systematics
tubers from rhizome (M. hirsuta); land forms gyptiaca) to 20 (M. quadrifolia); sorus with
with short internodes, branched roots, long large megasporangia along the crest and
petiole and stomata on both leaf surfaces; microsporangia along the sides; sporangia
aquatic forms with long internodes, un- without annulus; megasporangium with
branched roots, flexible petiole and stoma- one megaspore; microsporangium with 16-
ta mainly on the upper surface. Roots aris- 64 microspores; sporangia attached to a ge-
ing from creeping rhizome, one or two at latinous ring-like structure called soro-
each node. Stem a slender rhizome, creep- phore, that swells with water.; microspore
ing, growing on soil surface or subterra- small globular, producing 16 spermatozoids,
nean, often with hairs, dichotomously latter multiflagellate and corkscrew shaped
branched. Leaves floating or emergent, with prominent vesicle; megagametophyte
long petioled, blade filiform (Pilularia) or di- producing single archegonium.
vided into 2 (Regnellidium) or 4 clover-like
(Marsilea) leaflets, circinate before unfold- Economic importance: Family is of little im-
ing, leaflets folded together upwards until portance, with Marsilea species often grown
nearly mature, veins dichotomously as curiosity.
branched but often fusing towards tips. Spo-
rangia heterosporous, arranged in sori, lat- Phylogeny: The family is considered sister
ter without indusium, enclosed in hard pea- to leptosporangiate ferns due to presence of
shaped, bean-shaped or subglobose sporo- numerous spores, rudimentary annulus,
carps borne singly on short stalks near or more than one celled thick wall and lack of
at base of petioles, sometimes stalk sorus. This conclusion is also supported by
branched bearing 2-3 sporocarps (M. quadri- evidence rbcL sequence data and long fossil
folia), rarely several sporocarps on one pet- record, dating back to Permian 286-245 MYA.
iole (M. polycarpa); each sporocarp with Regnellidium is exceptional non-flowering
rows of sori along either side, with 2 (M. ae- plant with latex tubes.
***************
Salient features: Aquatic free-floating zag stem (Azolla) or absent and represented
plants, small simple leaf blades, veins by lower third row of leaves which are mod-
branched, sporocarps flattened and soft, spo- ified into root-like structures (Salvinia).
rangia large, heterosporous, gametophyte Stem a rhizome, zigzag, horizontal, dichot-
endosporous. omously branched, protostelic; stem fragile
and readily breaks resulting in proliferous
Genera: Salvinia (10 species) and Azolla (6). vegetative propagation, and in often cover-
ing entire water surface. Leaves simple,
Description: Free-floating aquatic plants sessile, less than 15 mm long, rounded to
growing in lakes and ponds, often forming oblong, entire; in Azolla imbricated in two
dense floating mats, with slender branch- rows harbouring nitrogen-fixing cyanobac-
ing rhizome. Roots hanging down from zig- terium Anabaena azollae in leaf cavities; in
Families of Pteridophytes 375
Figure 11.9 Salviniaceae. Salvinia natans. A: Plant; B: Two floating leaves and a submerged leaf.
C: Sporocarps of S. rotundifolia with a megasporangium and a microsporangium;
D: Vertical section megaspore. Azolla microphylla. E: Plant; F: Microsporocarp split
open to show microsporangia; G: Megaspore.
often used as green manure, owing to the into two distinct families on the basis of
presence of nitrogen-fixing cyanobacterium. absence of roots and sori in distinct sporo-
carps in Salvinia, as against the presence
Phylogeny: The family is sometimes split of roots and absence of sporocarps in Azolla.
***************
Salient features: Tall arborescent palm-like Major Genera: Alsophila (230 species),
ferns with thick trunk, leaves covered with Sphaeropteris (120) and Cyathea (110).
scales, large, pinnate to bipinnate, circinate
before unfolding, homosporous, sporangia in Description: Palm-like ferns with single
sori, annulus continuous. erect arborescent trunk. Stem erect,
Figure 11.10 Cyatheaceae. Cyathea spinulosa. A: Portion of frond with fertile (below) and sterile
(above) pinnules; B: Sterile pinnules enlarged; C: Portion of fertile frond of Cyathea
elegans; D: Portion of fertile frond of C. medullaris.
Families of Pteridophytes 377
***************
Figure 11.11 Pteridaceae. Pteris griffithii. A: Portion of frond; B: Petiole of same; C: Portion of a
pinnule. Pteris patens. D: Portion of fertile frond; E: Portion of pinnule.
***************
Families of Pteridophytes 379
Figure 11.12 Aspleniaceae. A: Plant of Asplenium ensiforme with simple sterile and fertile leaves;
B: Leaf of A. alternans; C: Portion of same enlarged; D: Portion of fertile pinna of
A. bulbiferum; E: Sorus.
380 Plant Systematics
along veins, linear or curved; indusia lin- 10 genera in the family, although large num-
ear, laterally attached; sporangium stalk ber of species fit well under Asplenium. The
with one row of cells; spores bilateral, reni- segregate genera Camptosorus and Loxos-
form, monolete, with winged perine. caphe , Diellia (endemic to Hawaii), Pleuro-
sorus, Phyllitis, Ceterach, and Thamnopteris
Economic importance: Some species of clearly nest within Asplenium s.l. Hymenas-
Asplenium such as A. scolpendrium (hearts- plenium, however, with a different chromo-
tongue fern) are grown as ornamentals. some base number than nearly all of the
other segregates, as well as distinct root
Phylogeny: The family is closely related to characters (Schneider et al., 2004), appears
Blechnaceae, Onocleaceae and Thelypteri- to represent the sister clade to the rest of the
daceae. Some species have variously been species in the family, and this name could be
removed to distinct genera to establish up to adopted as a well-supported segregate genus.
***************
Salient features: Mostly terrestrial, rarely vascular strands arranged in a ring; blade
epiphytic, rhizomes covered with scales to- simple to 5-pinnate, sometimes scaly or
wards apex, leaves all similar, petioles with glandular, rarely hairy; veins pinnate or
persistent scales towards base, sori round, forking, free to variously anastomosing, with
covering the leaf surface, indusia round- or without included veinlets. Sporangia ho-
reniform shaped, sporangium stalk with mosporous, arranged in sori on abaxial sur-
three rows of cells, spores bilateral. face, sori rounded, closely spaced and cover-
ing the leaf surface; indusia round-reniform
Major Genera: Elaphoglossum (500 species), or peltate, rarely absent; sporangium stalk
Polystichum (260), Dryopteris (225) and Cteni- with 3 rows of cells; spore reniform mono-
tis (150). lete, perine winged.
Figure 11.13 Dryopteridaceae. Polystichum auriculatum. A: Plant with fronds; B: Portion of fertile
frond with sori; C: Fertile pinna enlarged; D: Sterile pinna enlarged; E: Portion of
rachis of P. setiferum with fertile pinna; F: Sorus.
nearly always placed in Davalliaceae be- rugulate perispore. Tsutsumi & Kato (2006)
cause of its similar indusia and sori termi- found support for a sister relationship be-
nal on the veins, but it differs from mem- tween Hypodematium and Leucostegia, and
bers of Davalliaceae in the terrestrial hab- also support for these as sister to the re-
it, the more strongly verrucate spores with maining Eupolypods.
***************
382 Plant Systematics
Salient features: Mostly epiphytic, rhizomes usually thick and coriaceous, rarely dimor-
covered with scales, leaves all similar, usu- phic; petioles cleanly abscising near their
ally simple, petioles without scales, sori bases, leaving short phyllopodia; blade mostly
round, indusia absent, sporangium stalk simple to pinnatifid or 1-pinnate; indument
with 1- three rows of cells. lacking or of hairs and scales; veins often
anastomosing or reticulate, sometimes with
Major Genera: Grammitis (400 species), Poly- included veinlets, or veins free. Sporangia ar-
podium (150), Pleopeltis (50) and Campyloneu- ranged in sori; sori abaxial, rarely marginal,
rum (50). round to oblong or elliptic, occasionally elon-
gate, sometimes deeply embedded; indusium
Description: Mostly epiphytic and epipetric, a absent, sori sometimes covered by caducous
few terrestrial. Roots thick, wiry. Stem rep- scales when young (Lepisorus, Pleopeltis);
resented by rhizome, long- to short-creeping, sporangia with 13-rowed, usually long stalks,
dictyostelic, bearing scales and hairs, scales frequently with paraphyses on sporangia or on
often peltate (Pleopeltis). Leaves all similar, receptacle; spores hyaline to yellowish,
Figure 11.14 Polypodiaceae. Polypodium wallii. A: Plant with fronds; B: Portion of fertile frond
with sorus; C: Sorus; D-E: Sporangia in different views. Pleopeltis lanceolata.;
F: Prtion of plant with fertile frond; G: Basal portion of fertile frond; H: Portion of
leaf showing venation; I: Sorus; J: Peltate scale.
Families of Pteridophytes 383
***************
384 Plant Systematics
Chapter 12
Families of Gymnosperms
monotypic Ginkgo have, however been treat- female gametophyte. Early studies consid-
ed differently by various authors. Chamber- ered Gnetales to be more closely related
lain (1935) divided gymnosperms into two (even sister) to angiosperms, making gym-
classes: Cycadophytes (Cycadofilicales, Ben- nosperms paraphyletic. Recent studies
nettitales and Cycadales) and Conifero- based on molecular evidence, however, point
phytes (Cordaitales, Ginkgoales, Coniferales out affinities between Gnetales and conifers.
and Gnetales). Arnold (1948) separated Gn- The monotypic genus Ginkgo (placed in
etalean members under a separate third monotypic Ginkgoales, Ginkgoaceae) is
class, raised to the level of divisions by Pant unique and apparently unrelated to other
(1957) recognizing Cyacadophyta, Chlamy- gymnosperms, and often termed as living
dospermophyta and Coniferophyta. Cron- fossil, retaining several primitive features
quist, Takhtajan and Zimmerman (1966) like dichotomously veined fan-shaped
included gymnosperms under Pinophyta, di- leaves, motile sperms and lack of pollen
vided into three subdivisions: Cycadicae tubes. The genus is also unique in having
(classes Lyginopteridatae, Cycadatae and sex chromosomes: two X chromosomes in
Bennettitatae), Pinicae (classes Ginkgoat- female plants and XY in male plants. Recent
ae and Pinatae) and Gneticae. molecular studies (Qui et al., 2006; Wu et
Gnetales (sometimes treated under three al., 2007) have pointed to close relationship
separate orders: Gnetales, Ephedrales and with Cycadales, with which the genus
Welwitschiales, and then collectively termed shares features like dioecious habit,
as Gnetopsids) are unique among gymno- branched pollen tube growing away from the
sperms in presence of vessels and occur- ovule, motile male gametes with several fla-
rence of double fertilization in Ephedra, gella and cell wall.
wherein one male nucleus fuses with ven- Recent treatments of Gymnosperms fol-
tral canal nucleus producing supernumer- lowing the APG tradition, prefer to treat the
ary embryos (and not endosperm of an- four distinct groups of extant gymnosperms
giosperms); endosperm, however, remaining under distinct orders: Cycadales, Ginkgoal-
haploid. Ephedra also depicts flower-like re- es, Coniferales and Gnetales. The same
productive structures and highly reduced treatment is followed in the present book.
Families of Gymnosperms
Division: Pinophyta
Order: Cycadales
5. Taxaceae
Family: 1. Cycadaceae
2. Zamiaceae Gnetales
Ginkgoales 1. Ephedraceae
1. Ginkgoaceae 2. Gnetaceae
Coniferales 3. Welwitschiaceae
1. Pinaceae
2. Cupressaceae
3. Podocarpaceae
4. Araucariaceae
386 Plant Systematics
Figure 12.1 Cycadaceae. Cycas revoluta. A: Leaf; E: Megasporophyll. C. circinalis. B: Male cone;
C: Microsporophyll; D: Portion of microsporophyll with sori; F: Megasporophyll;
G: Longitudinal section of mature seed; H: Pollen grain..
Families of Gymnosperms 387
sistent leaf bases and scale leaves (cata- shaped, slightly flattened, fleshy, brightly
phylls) in alternate spiral bands; outline coloured: orange or red.
irregular in section, large pith, numerous
small vascular bundles in a ring, a wide Economic importance: Several species no-
cortex; parenchyma cells of cortex and pith tably C. revoluta and C. circinalis are common-
containing a lot of starch; secondary growth ly grown as ornamentals. Sago starch is ob-
initiated very early in life of plant, but pro- tained from stem of C. circinalis and other
duced in small amount (manoxylic); muci- species. Seeds may also be utilized for yield-
lage canals abundant in stem; leaf traces ing starch, but after the removal of toxins.
forming girdle in stem. Leaves large, com- Chamarrow people of Guam who suffer from
pound, forming a crown at the apex of stem, fatal neurological disease apparently con-
circinate when young, pinnate compound, sume frugivorous bats known as flying fox-
spirally arranged, alternately with scale es, who eat Cycas seeds. BMAA (b-methy-
leaves; each leaflet with single mid-vein, lamino-L-alanine), a neurotoxic non-protein
side veins absent and compensated by amino acid, present in the seeds of Cycas,
transfusion tissue; leaf petiole with ome- is produced by nitrogen fixing cyanobacte-
ga-like pattern of vascular bundles. Mi- ria in coralloid roots.
crosporophylls aggregated into compact
large strobilus (cone), arranged spirally, Phylogeny: The family was formerly circum-
hard, wedge-shaped with small sterile pro- scribed to include all genera now removed
jection coiled at tip; microsporangia borne under Zamiaceae. The genus Cycas is dis-
on abaxial surface, in groups of 3-5, sur- tinct from all these genera in circinate young
rounded by hairs; male strobilus terminal leaves, leaflets with midvein and no side
in position, becoming lateral due to lateral veins, leaf-like megasporophylls not aggregat-
bud continuing the stem growth, axis be- ed into strobilus and marginal ovules. Mor-
coming pseudopodial; pollen nonsaccate, phological and molecular studies have strong-
with a single furrow; sperms motile. Me- ly supported Cycas to be sister genus to the
gasporophylls spirally arranged , somewhat rest of cycads. Cycas lineage may already have
leaflike, not forming a strobilus, with 2-8 diverged from Zamiaceae by the Permian at
large ovules (up to 7 cm-largest in plant least 250 million years before present (Herm-
kingdom) along margin; upper sterile por- sen et al. 2006) or as recently as 92 million
tion pinnate (C. revoluta) or reduced and ser- years ago with diversification within the clade
rated (C. circinalis); seeds elliptic or egg occurring ca 36 million years ago (Wink 2006).
***************
Salient features: Fern-like with rhizome or Major Genera: Encephalartos (35 species),
palm-like with unbranched stem, leaves Zamia (35), Macrozamia (12), Ceratozamia (10),
fern-like, pinnately compound, thick, flat or Dioon (10) and Bowenia (3).
conduplicate but not circinate, veins numer-
ous, plants dioecious, megasporophylls re- Description: Fern-like plants with rhizome
duced, forming strobilus, sperms motile. or Palm-like plants with unbranched stem;
388 Plant Systematics
Figure 12.2 Zamiaceae. Zamia floridana. A: Plant with female cone; B: Female cone; C: Megasporo-
phyll; D: Male cone; E: Microsporophyll. Macrozamia. F: Microsporophyll; G: Megasporo-
phyll.
imbricate, each with two ovules; strobili 1- Cycadaceae in presence of lateral veins,
several per plant, globose, ovoid or cylindri- megasporophylls reduced and aggregated into
cal, disintegrating at maturity; seeds large, strobili, absence of circinate vernation, and
1-2 cm long, rounded in cross section, often two reflexed ovules per megasporophyll. Stan-
brightly coloured with fleshy outer layer and geria is unique in the family with buds aris-
hard inner layer; cotyledons 2. ing from roots, absence of scales and with
presence of midvein and dichotomously
Economic importance: Several species are branched lateral veins. It was removed into
commonly grown as ornamentals. Starchy distinct family Stangeriaceae by Johnson
underground rhizome of Zamia pumila of trop- (1959). Bowenia, similarly has bipinnate
ical America were used by early settlers as leaves, shows circinate vernation in leaflets
flour. Seeds of Dioon edule are also ground and removed to Boweniaceae by Stevenson
into meal and eaten. Several species are (1981), on subsequent morphological
also used for the production of sago starch. evidence included it under Stangeriaceae.
Removal of toxic glycosides is however im- Molecular studies, however, include both
perative before consumption. This is easily genera under Zamiaceae (Zgurski et al.,
achieved through boiling. 2008). The relationships of these genera,
and other members of the family, however,
Phylogeny: The family is distinct from are not clear.
***************
Figure 12.3 Ginkgoaceae. Ginkgo biloba. A: Shoot with seeds; B: Shoot with male strobilus; C:
Shoot with paired ovules; D: Microsporophyll with two microsporangia; E: Pollen
grain; F: Pair of ovules; G: Developing seed with aborted ovule near base; H: Longi-
tudinal section of mature seed.
Economic importance: The tree has long The seeds boiled or fried, are delicacy in some
been grown as ornamental near temples and Chinese dishes.
religious institutions in Eastern Asia. Male
plants are commonly grown as they do not pro- Phylogeny: Ginkgo biloba is known in fossil
duce the unpleasant smell unlike female record in Triassic and Jurassic periods, hav-
plants. More recently it has been planted in ing appeared 200 million years ago, and re-
Canada, USA and Europe. It is relatively dis- productive structures seem to have changed
ease resistant and tolerates high air pollution. little at least for last 120 m years, justifying
Families of Gymnosperms 391
its being called as living fossil. It is not closely Ginkgo is unique in having sex chromo-
related to any extant group, but shares motile somes: XY male and XX female. The leaves
sperms with cycads. Absence of pollen tube is resemble Adiantum, the Maidenhair
another primitive feature. The short shoots fern, hence the name Maidenhair tree for
are manoxylic (like Cycadales), whereas the Ginkgo.
long shoots are pycnoxylic (like conifers).
***************
Description: Trees, rarely shrubs, ever- Economic importance: The family is the
green, rarely deciduous (Larix, Pseudolarix), leading source of timber in the world. The
with strong smell from bark and leaves. wood of Pinus (Pines), Pseudotsuga (Douglas
Roots containing ectomycorrhiza. Stem fir), Picea (Spruce), Abies (Fir), Tsuga (Hem-
branched, trunk elongate with whorled or op- lock) and Cedrus (Cedars) is extensively used
posite branches, rarely alternate; resin ca- for timber, fence posts, furniture and paper
nals present in wood and leaves, crown py- pulp. Many of these are also grown as orna-
ramidal or spreading; wood pycnoxylic; p-plas- mentals. Seeds of several species of Pinus
tids in sieve cells. Leaves simple, linear to (pinon pines or pine nuts) particularly P. ger-
needle-like, spiral but often appearing 2- ardiana of W. Himalayas (Chilgoza; Neoza)
ranked by twisting of leaf base to bring leaves are eaten as nuts. Rosin and turpentine are
into one plane, clustered in sheathed fasci- extracted from several species of pines.
cles on short shoots of Pinus; sessile or short
petioled; buds enclosed in bud scales. Plants Phylogeny: Pinaceae is a well defined fam-
monoecious. Male cones small, microsporo- ily. Numerous features such as inverted
phylls papery, spirally arranged; microspo- ovule, winged seed, woody cones, p-plastids
rangia abaxial, two per microsporophyll; pol- in sieve cells, simple linear or acicular
len grains saccate with two saccae (saccae leaves and absence of biflavonoid com-
absent in Larix, Pseudotsuga). Female cone pounds strongly support the monophyly of
392 Plant Systematics
Figure 12.4 Pinaceae. Pinus gerardiana. A: Shoot with leaves in spurs; B: Spur with three needles;
C: Mature female cone. Pinus wallichiana. D: Male cone E: Microsporophyll with two
microsporangia; F: Female cone; G: Megasporophyll with two ovules; H: Microsporo-
phyll in lateral view. Pinus roxburghii. I: Microsporophyll; J: Pollen grain;
K: Microsporophyll with two ovules; L: Microsporophyll with two seeds; M: Seed with
wing. Cedrus deodara. N: Shoot with leaf clusters and mature female cones; O: Male
cone; P: Microsporophyll in lateral view; Q: Microsporophyll in dorsal view.
Families of Gymnosperms 393
family. The family is sister to rest of the Pinus and Pseudotsuga) and Abietoideae
conifers as evidenced by morphological (Abies, Cedrus, Keteleria, Pseudolarix and
(Hart, 1987) and molecular evidence Tsuga). The separation is supported by data
(Quinn et al., 2002). from chloroplast matK, mitochondrial nad5
The family is commonly divided into two and nuclear 4CL genes, although Cedrus is
subfamilies: Pinoideae (Cathaya, Larix, Picea, sister to rest of the family.
***************
Figure 12.5 Cupressaceae. A: Shoot of Cupressus torulosa with female cones; B: Brach of Juniperus
indica with berry-like female cones. Thuja orientalis. C: Curved branch with cone;
D: Megasporophyll in abaxial view with two ovules; E: Megasporophyll in lateral
view; F: Mature male cone; G: Side view of microsporophyll. Sequoiadendron giganteum.
H: Portion of shoot with female cone; I: Microsporophyll; J: Female cone of Taxodium
distichum; K: Megasporophyll of Sequoia sempervirens with several ovules.
more than 2 seeds per scale, shedding of from the paraphyletic assemblage Taxodi-
small branches, wingless pollen grains and aceae which form a basal clade. The genera
clustered archegonia. Eckenwalder (1976) from Northern Hemisphere and Southern
suggested the merger of two on the basis of Hemisphere, however, form two distinct
phenetic evidence. The merger of two fami- clades, cuppresoid clade and callitroid clade,
lies is also supported by molecular evidence respectively. The presence of several teeth
(Quinn et al., 2002; Farjon, 2005). Unified on ovuliferous scales of Cryptomeria is per-
monophyletic Cupressaceae perhaps arose haps reversal to plesiomorphic condition.
***************
Families of Gymnosperms 395
Salient features: Shrubs or trees, leaves Major Genera: Podocarpus (100 species),
linear or broader, persistent, microsporophyll Dacrydium (20), Dacrycarpus (9), Afrocarpus
with two microsporangia, mature ovulifer- (6) and Phyllocladus (5).
ous scale with one ovule, seeds surrounded
by specialized scale called epimatium, bracts Description: Shrubs or trees, rarely para-
juicy, pollen saccate. sitic (Parasitaxus ustus parasitic on roots of
Figure 12.6 Podocarpaceae. Podocarpus spicatus.A: Vegetative shoot; B: Brach with male cones;
C: Single cone showing arrangement of microsporophylls; D: Microsporophyll;
E: Pollen grain; F: Vertical section of ovule; G: Mature seed. Phyllocladus alpinus.
H: Branch with flattened phylloclads; I: Portion of branch with female cones.
396 Plant Systematics
Falcatifolium taxoides, another podocarp), Phylogeny: The family has been considered
slightly resinous. Stem branched, trunk closer to Taxaceae with which it shares
short or long. Leaves simple, entire, thick, features of resinous plants, ovuliferous
persistent, alternate, rarely opposite (Micro- scale with solitary ovule and cone more or
cachrys), variable, scale-like to broadly lin- less fleshy. In two families, however, the
ear (sometimes upto 30 cm long and 5 cm nature of fleshy structure is different. It
broad). Plants monoecious, rarely dioecious. represents ovuliferous scale in Podocar-
Male cones small, cylindical; microsporo- paceae, whereas it represents an aril, an
phylls numerous, spirally arranged, each outgrowth from the base of ovule, in
with 2 microsporangia, pollen grains with 2 Taxaceae (Quinn et al., 2002). Genus
saccae. Female cones with 1-several ovu- Phyllocladus with branches flattened into
liferous scales; each scale with single ovule, phylloclads looking like leaves (leaves re-
modified into juicy structure called epime- duced to scales) and with aril is often sepa-
tium, thus cone appearing like a drupe; seed rated into distinct family Phyllocladaceae.
with 2 cotyledons. Recent rbcL studies, however, point to their
being sister groups (Quinn et al., 2002), or
Economic importance: Species of Podocar- Phyllocladus embedded in Podocarpaceae
pus and Dacrydium are valuable sources of (Wagstaff, 2004), latter conclusion also
timber.. Podocarpus macrophyllus is widely reached based on nuclear gene XDH (Peery
planted as ornamental. et al., 2008).
***************
Salient features: Large trees with naked to elliptic, persistent, shedding on small
buds, highly resinous, leaves needle-like to branches, spiral (Araucaria) or opposite (Ag-
lanceolate, persistent, shedding along with athis). Plants monoecious (Agathis) or dioe-
small branches, pollen grains nonsaccate, cious (Araucaria). Male cones small, cylin-
exine pitted, female cones woody, ovulifer- drical; microsporophylls numerous, spiral-
ous scale with single ovule. ly arranged, each with 4-20 microsporan-
gia, pollen grains nonsaccate, exine pitted;
Major Genera: Araucaria (18 species), Agathis sperms nonmotile. Female cones solitary,
(13) and Wollemia (1). more or less erect, maturing in 2-3 years,
disintegrating on tree, ovuliferous scales
Description: Tall long-lived trees reaching numerous, spirally arranged, flattened, lin-
up to 65 m in height and up to 6 m in diam- ear to peltate, longer than and fused with
eter, highly resinous, usually symmetrical bract scale, each scale with single ovule;
with conical crown, buds naked. Stem ovule free from scale (Araucaria) or fused
branched, trunk stout and thick, small with it (Agathis); seed large, with (Agathis)
branches shedding along with leaves. or without (Araucaria) marginal wings, with
Leaves simple, entire, varying in shape 2 cotyledons sometimes deeply divided and
from awl-shaped, scale-like, linear, oblong appearing 4.
Families of Gymnosperms 397
Figure 12.7 Araucariaceae. Agathis australis. A: Shoot with female cone; B: Megasporophyll;
C: Shoot of Agathis alba with male cones. Araucaria angustifolia. D-E: Microsporo-
phylls in different views; F: Pollen grain.
Economic importance: Species of Araucar- broader leaves, monoecious habit, ovule free
ia mainly A. araucana (Monkey-puzzle tree) from scale, winged seeds and latter with
with spectacular whorled branches and A. spiral linear leaves, dioecious habit, ovule
heterophylla (Norfolk Island pine) of Chile are fused with scale, and wingless seeds. Mono-
prized ornamentals grown as avenue trees phyly of two genera is supported by rbcL
and house plants. Many species mainly Ag- sequence data.
athis australis (Kauri) with massive trees are Wollemia nobilis, discovered only in 1994
utilized for timber. from Wollemi National Park in Australia was
earlier known only from fossil record extend-
Phylogeny: The family is distinct, restrict- ing to 150 MYA. The species is represented
ed to the Southern Hemisphere, fossil by less than 50 trees and has unique dark
record of Araucaria extending to Jurassic. brown and knobbly bark described as bub-
Both genera are, Agathis and Araucaria bling chocolate. It is also multi-trunked
are well separated, former with opposite appearing as clumps of trunks.
***************
398 Plant Systematics
Figure 12.8 Taxaceae. Taxus baccata. A: Shoot with seeds; B: Seed surrounded by aril; C: Portion
of branch with male cone; D: Male cone; E: Peltate microsporophyll with microspo-
rangia; F: Pollen grain.
Families of Gymnosperms 399
2-9 microsporangia radially arranged or on removed to a distict order Taxales. The fam-
abaxial surface; pollen grains nonsaccate, ily, however, shares similar embryology,
sperms nonmotile. Ovules solitary, not form- wood anatomy, leaf and pollen morphology
ing cones, surrounded by fleshy aril, arising with rest of the conifers. The placement
from base, aril brightly coloured at maturity; within Coniferales is supported by evidence
seed with hard seed coat, cotyledons 2. from DNA studies (Chase et al., 1993; Price,
2003) and micromorphology (Anderson and
Economic importance: Various species of Owens, 2003). Two distinct clades are estab-
Taxus, especially T. baccata (English yew) lished within the family: one including Tax-
and T. cuspidata (Oriental yew) are commonly us, Austrotaxus and Pseudotaxus (aril partly
planted as ornamentals. Wood of yew family enclosing ovule, maturing in 6-8 months and
has been popular since Middle Ages for mak- mature seed 5-8 mm long) and the other
ing bows, owing to the presence of extra spi- including Torreya, Cephalotaxus and Ameno-
ral thickenings on the xylem cells. Wood of taxus (aril completely enclosing ovule, ma-
Taxus is used in high grade furniture. The turing in 18-20 months and mature seed 12-
presence of taxol, a highly toxic alkaloid hav- 40 mm long). The two are sometimes placed
ing antimitotic activity makes it potential in distinct families Taxaceae s. s. and Ceph-
agent for anticancer chemotherapeutic alotaxaceae, respectively. There is, howev-
treatment. er, strong molecular evidence to support
their merger into broadly circumscribed
Phylogeny: The family is unique in coni- Taxaceae (Price, 2003; Rai et al., 2008), as
fers in the absence of female cone, and in recognition of Cephalotaxaceae renders it
having solitary ovules, and has often been para- or polyphyletic.
***************
Salient features: shrubs with jointed stems time, but gradually replaced by adventitious
with clustered or whorled branches, vessels roots. Stem much branched, aerial stems
present, leaves scale-like, fused into sheath, arising from spreading rhizome; branches
microsporophylls stalked, pollen furrowed, numerous, whorled or clustered, longitudi-
nonsaccate, each ovule surrounded by pair nally grooved, distinctly jointed with long
of fused bracts, seed covered. internodes, usually green and photosynthet-
ic, horsetail like, wood with vessels. Leaves
Genus: Ephedra (60 species). scale-like, opposite or in whorls of 3-4 leaves,
fused at base into a sheath at each node,
Description: Small shrubs, often trailing, often shedding early, each leaf with two par-
rarely climbing (E. foliata), very rarely al- allel veins; with axillary buds; resin canals
most tree-like reaching 30 cm in diameter absent. Plants usually dioecious, rarely mo-
and height of several metres (E. triandra). noecious. Male strobili (inflorescence) in
Root a tap root in seedling, persisting for long whorls of 1-10 at nodes in axil of scale leaf,
400 Plant Systematics
Figure 12.9 Ephedraceae. Ephedra gerardiana. A: Shoot with strobili; B: Male strobilus; C: Pollen
grain; D: Surface of pollen grain with parallel ridges on exine; E: Female strobilus with
bracts and two ovules; F: Same with seeds.
each with 2-8 successive pairs of cupped around the ovule borne on a stalk (stalk and
bracts, lower one or two pairs of bracts ster- ovule constitute female flower); ovule sin-
ile rest bearing solitary microsporangiate gle or in pairs, with 2 integuments; seeds 1-
shoots (microsporophylls, flowers), each on 2 per strobilus, surrounded by leathery yel-
short secondary axis (microsporangiophore) low to dark brown cup; cotyledons 2.
arising between each pair of fertile bracts
and bearing two opposite scales (perianth) Economic importance: Several species of
and into 2-10 microsporangia (stamens with Ephedra were used as beverage by early
filamented or sessile anthers), dehiscence Mormon settlers, hence the name Mormon
by terminal pores; pollen furrowed, nonsac- tea for the genus. The alkaloid drug ephe-
cate, inaperturate, exine shed on germina- drine used as decongestant, treatment for
tion, pollen becoming naked. Female stro- cough and circulatory problems is obtained
bili opposite or in whorls of 3-4 at branch from several species especially E. sinica (ma
nodes, each with 2-10 successive pairs of huang), which has been used in China ear-
bracts, uppermost fused to form a fleshy cup lier than 2500 B.C.
Families of Gymnosperms 401
Phylogeny: The genus Ephedra shows are sister to a clade including all other seed
superficial resemblance to Equisetum and plants based on studies of rbcL (Seider et
Casuarina, all three exhibiting switch habit, al., 2002) and nuclear genes (Rydin et al.,
owing to sheathed nodes and scale leaves. 2002), rendering gymnosperms as paraphyl-
The presence of vessels, perianth-like etic. The bulk of evidence in recent years,
bracts, extremely reduced gametophytes however, points to gymnosperms being
and the fusion of second male gamete with monophyletic and Gnetales sister to Pina-
venter canal nucleus have been taken as les. The binucleate sperm cells, basic
angiosperm affinities, although the ori- proembryo structure, development of poly-
gin of vessels in two has been separate and embryony, etc., of Ephedra agree with
several primitive angiosperms are vessel- Pinales in general and perhaps Pinaceae
less. It has been suggested that Gnetales in particular.
***************
Salient features: Evergreen lianas, trees or each pair fused to form a cup known as
shrubs, with vessels, leaves opposite, cupule or collar; each bearing several
angiosperm-like, net-veined, microsporo- microsporangiophores (microsporophylls,
phylls stalked, with bracts, pollen spinose, flowers) in 3-6 rings, with one ring of abor-
seeds large, fleshy. tive female flowers or ovules above rings of
male flowers; each microsporangiophore with
Genus: Gnetum (30 species). two bracts (perianth) at base and two mi-
crosporangia (anthers) at top (one microspo-
Description: Usually liana, sometimes rangium in G. gnemonoides); perianth con-
scadent shrubs (G. contractum), rarely trees taining sclereids and latex tubes; pollen not
(G. gnemon). Stem climbing often reaching striate, surface spinose. Female strobili
top of tall trees, rarely erect, sometimes with with a pair of opposite sheathing bracts at
two types of shoots: long shoots and short base, followed by 5-6 whorls of ovules; each
shoots, rarely all shoots similar (G. gnemon), whorl with 4-10 ovules in a single ring above
vessels present, phloem with companion the collar, each ovule with two bracts form-
cells, arising from cambium cells and not ing perianth which persists in seed, a
from mother-cell as in angiosperms. Leaves terminal ovule sometimes present on the
large, entire, oblong, elliptic or strobilus; only few ovules maturing into
lanceolate, subsessile or short petiolate, seeds, others aborting and falling down; unis-
opposite and decussate, net-veined, appear- eriate hairs interspersed among the ovules;
ing like a dicot leaf, appearing only on short ovule with 2 integuments, subtended by
shoots in lianas, often reduced to scales on perianth forming third outer envelope; peri-
long shoots, stipules absent. Plants dioe- anth and outer integument with sclereids
cious, rarely monoecious. Male strobili and laticiferous ducts; seed large, fleshy.
arising in axils of paired and decussate scale
leaves, slender, elongate, with several Economic importance: The tree species
(10-25) pairs of decussate bracts, bracts of G. gnemon from Malaya, is widely cultivated
402 Plant Systematics
Figure 12.10 Gnetaceae. A: Shoot of Gnetum latifolium with opposite leaves and male strobili;
B: Portion of branch with female strobili; C: Portion of female strobilus showing
ovules; D: Portion of female strobilus with two mature seeds; E: Longitudinal sec-
tion of seed; F: Portion of male strobilus of G. ulva; G: Single microsporophyll of
same; H: Microsporophyll of G. gnemon; I: Pollen grain.
as ornamental, and as food, with leaves and reduced gametophytes and presence of
strobili cooked in coconut milk, and fibre for perianth like bracts. Gnetum appears more
making ropes and fishing nets. The kernels like angiosperms with net-veined leaves and
of G. ulva yield an oil used for illumination presence of companion cells, although their
and also as a massage in rheumatism. The origin is quite different. The reaction wood
plant of G. montanum is used as fish poison. in Gnetum consists of gelatinous extra-
xylary (reaction) fibers in the adaxial posi-
Phylogeny: The genus Gnetum along with tioni.e., it is unique among seed plants
other members of Gnetales share an- (Tomlinson, 2003) and is unlike tension
giosperm features of presence of vessels, wood of angiosperms.
***************
Families of Gymnosperms 403
Figure 12.12 Cycadaceae. Cycas circinalis; A: Plant; B: Young circinate leaves; C: Portion of
mature leaf of C. revoluta; Zamiaceae. D: : Macrozamia communis, apex with female
cones; E: Plant with leaves and female cones; F: Plant of Zamia integrifolia;
G: Encephalartos trispinosus, plant; H: Dioon edule, plant.
Families of Gymnosperms 405
Figure 12.13 Ginkgoaceae. Ginkgo biloba. A: Branch with leaves; B: Portion enlarged. Pinaceae.
C: Cedrus deodara, branch with leaves and female cones; D: Portion of bark;
E: Tsuga canadensis, portion of plant with female cones. Cupressaceae. F: Chama-
ecyparis lawsoniana, portion of twig with female cones; G: Sequoia sempervirens, por-
tion of branch enlarged; H: Cryptomeria japonica, portion of branch with female cones.
406 Plant Systematics
for dicots and Liliidae for monocots. However, represents limited confidence, B for probably
Thorne has lately abandoned this distinction correct assignment and C implies
into traditional dicots and monocots, and considerable confidence in assignment. Only
instead used subclass names more or less those with A or B level are indicated here.
comparable to Takhtajan and Cronquist (but Rest belong to level C.
without the super groups dicots and It is not under the scope of the present book
monocots). He has also taken the bold to include all the families of angiosperms, but
decision of separating the primitive dicots in addition to the major families, those which
from the more advanced ones by inserting have been the subject of considerable
monocots in between, thus bringing the phylogenetic interest over the recent years
classification system much nearer to the have been especially chosen for treatment.
Angiosperm Phylogeny Group, but retaining Angiosperms placed under Class
the essence of hierarchical arrangement Magnoliopsida are divided into 12 subclasses,
through consistent use of superorders and 36 superorders, 85 orders and 485 families.
subclasses above the level of order. Thorne Angiosperms are estimated to include13372
from 2003 onwards has also assigned the genera and 253300 species (10760 genera
degree of confidence in hierarchical level, and 196990 species of dicots; 2612 genera and
circumscription and alignment of taxa. A 56310 species of monocots).
Amborellaceaee Pichon
1 genus, with a single species Amborella trichopoda
Endemic to the Island of New Caledonia in South Pacific Ocean.
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
B & H under family Monimiaceae. B & H- Bentham and Hooker 1862-1883; Cronquist, 1988;
Takhtajan, 1997; Dahlgren- G. Dahlgren, 1989; Thorne, 2007; APG II, 2003; APweb, 2008 (Stevens)
410 Plant Systematics
Salient features: Shrubs lacking vessels, primary medullary rays narrow, sieve-tube
with simple alternate leaves, stipules lack- plastids S-type. Leaves evergreen, alternate,
ing, nodes unilacunar, flowers unisexual, spiral to two-ranked, simple, entire to
with multiseriate perianth, stamens nu- pinnately lobed, venation pinnate, stomata
merous, pollen with granulate ektexine, anomocytic, stipules absent, mesophyll with-
carpel incompletely closed, fruit aggregate out ethereal oils. Inflorescence cymose,
of drupes. plants dioecious. Flowers small, unisexual,
hypanthium present. Perianth with 5-13
Major genera: Only genus Amborella with 1 tepals, number more in staminate flowers
species. than pistillate flowers), slightly united at
base, spirally arranged, not differentiated
Description: Sprawling shrub; wood with into sepals and petals. Androecium with 12-
tracheids but no vessels, nodes unilacunar, 22(-100) stamens, free, in 3-5 whorls, outer
Major Families of Angiosperms 411
***********
Salient features: Leaves aromatic, opposite, Major genera: Hedyosmum (25 species),
simple with connate petiole bases, stipules Chloranthus (12), Ascarina ( 3) and
small, flowers small, lacking perianth, Sarcandra (3).
stamens 1-3, connate in a mass, carpel 1,
ovary inferior with a single ovule, fruit a Description: Herbs or evergreen shrubs or
small drupe. trees containing essential oils. Vessels
412 Plant Systematics
***********
Salient features: Climbing shrubs with stamens numerous, laminar, inner modi-
Mopposite leaves, flowers solitary in leaf fied into staminodes, carpels several, free,
axils, bisexual with numerous tepals gradu- partially unsealed with bilobed style.
ally intergrading from sepals to petals,
414 Plant Systematics
Major genera: Single genus with one spe- gitudinal, introrse, pollen grains mono-
cies. Originally, two species Austrobaileya sulcate. Gynoecium with (6)9(12) carpels,
maculata and A. scandens were described, but free, spirally arranged, ovary superior, 814
they have now been combined into a single ovuled, placentation marginal (biseriate),
species under the latter name. ovules collateral, anatropous, bitegmic,
crassinucellate, style partially unsealed,
Description: Large climbing shrubs bearing bilobed. Fruit baccate, seeds with ruminate
essential oils, nodes unilacunar, with two endosperm. Pollination by insects.
traces, vessel end-walls scalariform, sieve-
tube plastids S-type. Leaves evergreen, op- Economic importance: No economic value
posite to sub-opposite, leathery, petiolate, known.
simple, entire, pinnately veined, stipules
intrapetiolar, caducous, small, mesophyll Phylogeny: When first described by C. T.
with spherical etherial oil cells. Inflores- White (1933), it was considered to be belong-
cence with solitary axillary flowers. Flowers ing to Magnoliales, a Placement also followed
bisexual, bracteate, pedicellate, bracteolate. by Cronquist, but due to unique combina-
Perianth with tepals nearly sequentially tion of characters, and for want of a better
intergrading from sepals to petals, (9) place, Hutchinson (1973) placed the family
12(14), free, imbricate. Androecium with in Laurales, near Monimiaceae. According
1225 stamens, maturing centripetally, free, to Thorne (1996), the family Austrobaileya-
outer laminar, petaloid, fertile, inner gradu- ceae is so intermediate between Magno-
ally smaller, innermost reduced to liales and Laurales, that Laurales should not
staminodes, anthers adnate, dehiscence lon- be recognized as a separate order. He,
Major Families of Angiosperms 415
***********
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Trees and shrubs with sclereids. Leaves evergreen, alternate,
simple alternate leaves, stipules lacking, often clustered at tips of branches, some-
nodes unilacunar, flowers solitary with times subverticillate, entire, gland-dotted,
multiseriate perianth, stamens numerous, containing terpenoids, simple with reticu-
carpels free, in a single whorl, fruit a star- late venation, stipules absent. Inflorescence
like aggregate of follicles. with solitary flowers, axillary or supra-axil-
lary, rarely 2-3 together. Flowers usually
Major genera: Only genus Illicium (42 bisexual, actinomorphic, hypogynous. Peri-
species). anth with numerous tepals, in several
whorls, sepals and petals not differentiated,
Description: Shrubs or small trees, contain- outermost somewhat sepal-like, inner
ing aromatic terpenoids and branched gradually becoming smaller and petal-like.
416 Plant Systematics
Figure 13.4 Illiciaceae. Illicium floridanum. A: Fruiting branch; B: Flower; C: Stamens with broad
filaments, left with almost petaloid filament; D: Tricolpate pollen grain; E: Longitudi-
nal section through carpels, all other floral parts removed; F: Two seeds in different
view. G: A dehiscing follicetum of I. anisatum.
Androecium with many stamens, free, is used in flavourings. I. verum (star anis)
spirally arranged, filaments short and thick, and I. anisatum (Japanese star anis)
anthers basifixed, dehiscence longitudinal, are sources of anethole, used in dentistry,
connective extending beyond anther lobes, flavourings and perfumes.
pollen tricolpate. Gynoecium with 5-20 free
ascidiate carpels, in a single whorl, ovary Phylogeny: The family is closely related to
superior with a single ovule, placentation Winteraceae, and although the vessels are
basal, stigma extending down on style. Fruit present, the elements are long, slender, an-
a star-like aggregation of follicles (follice- gular, thin and greatly overlapping end walls
tum), embryo minute, endosperm conspicu- with many scalariform perforation plates.
ous, seeds glossy. Pollination primarily by The fruit is a primitive whorl of single-
flies. Dispersal by elastic opening of folli- seeded follicles. Although the pollen grains
cles, shooting out seeds. are tricolpate, but their corpus morphology
is different from eudicots. Loconte (1996)
Economic importance: The family is impor- considers Illiciales among the most basal lin-
tant for producing aromatic oils. Oil from the eages of angiosperms.
bark of Illicium parviflorum (yellow star anis)
Major Families of Angiosperms 417
The family has been traditionally placed and Schisandraceae through multigene
in the Magnoloid complex under order analyses (Soltis, Soltis, and Chase, 1999;
Illiciales, but has been removed in APG II and Soltis et al., 2000) having received 99 per cent
APweb along with Austrobaileyaceae, bootstrap support. APG II suggests optionally
Schisandraceae and Monimiaceae into a including Illiciaceae under Schisandraceae
separate order Austrobaileyales placed to- (because the latter is a priority name).
wards the beginning of angiosperms without Schisandraceae includes climbing or trail-
any informal superclade. Eames (1961) con- ing shrubs. Thorne includes the two fami-
sidered Schisandraceae to be the closest fam- lies under suborder Illicineae, which was
ily. The family Illiciaceae has been found to earlier (1999) placed under order Magnoliales,
be very closely related to Austrobaileyaceae but now shifted to Canellales.
***********
Salient features: Aquatic herbs, leaves ers bisexual, 3-merous, cyclic, or partially
floating, long-petioled, peltate, flowers large acyclic. Calyx with 3 sepals, petaloid, in one
on long pedicels, stamens numerous, fruit whorl, free. Corolla with 3 petals, in one
spongy with several immersed seeds. whorl, free, yellow, or purple, or white,
clawed, or sessile. Androecium with 36
Major genera: Cabomba (5 species) and (Cabomba) stamens, or 1218 (Brasenia),
Brasenia (1). maturing centripetally, free, filaments
slightly flattened, anthers bithecous, dehis-
Description: Perennial aquatic herbs, cence by longitudinal slits, extrorse, pollen
rhizomatous, secretary cavities present, grains monosulcate, sometimes
vessels absent, sieve-tube plastids S-type. trichotomosulcate. Gynoecium with (2)3
Leaves submerged, or submerged and float- 18 carpels, free, ovary superior, with a lon-
ing, similar (Brasenia), or heterophyllous gitudinal stigmatic surface (Brasenia), or
with dissected submerged leaves and entire apically stigmatic (Cabomba), (1)2(-3)
floating leaves (Cabomba), alternate or op- ovuled, placentation parietal, ovules pen-
posite (submerged leaves of Cabomba), sim- dulous, anatropous, bitegmic,
ple or compound, peltate, stipules absent, crassinucellate, outer integument not con-
without sclerenchymatous idioblasts. Inflo- tributing to the micropyle. Fruit aggregate
rescence with solitary axillary flowers. Flow- of follicles, many seeded spongy berry, some-
418 Plant Systematics
Figure 13.5 Cabombaceae. Cabomba carolinaria. A: Flowering branch with submerged dissected
leaves and broad peltate floating leaves; B: Flower: C: Gynoecium with 3 free carpels;
D: Longitudinal section of carpel; E: Fruit; F: Seed. Brasenia schreberi. G: Portion of
plant with peltate leaves and small flowers; H: Submerged part of plant covered with
thick jelly; I: Flower with three sepals and three petals, essentially similar; J: Two-
seeded panduraeform nut-like fruit; K: Globose seed.
times indehiscent and nut-like (Brasenia primitive lineage among angiosperms. The
schreberi); seeds endospermic, perisperm paleoherb complex is characterized by scat-
present, cotyledons 2. tered vascular bundles, absence of vascular
cambium, leaves alternate, usually
Economic importance: None palmately veined, adventitious root system
and lack of etherial cells. Judd et al., (2002)
Phylogeny: The family is considered to be include genus Cabomba and Brasenia under
more strongly linked to monocots rather than Cabomboideae in Nymphaeaceae (APG II,
Nymphaeaceae. The family has been located optionally), because their separation would
under superorder Nymphaeanae after render Nymphaeaceae paraphyletic. Thorne
Magnolianae but Takhtajan has finally (1999, 2003, 2006, 2007) and Stevens (APweb,
taken it under distinct subclass 2008), separate them under Cabombaceae
Nymphaeidae. During the last decade the on the basis of trimerous flowers, with dis-
family has been identified as a constituent tinct sepals and petals, 2-3 free carpels, and
of Paleoherb complex, forming the most fruit a follicle.
***********
Major Families of Angiosperms 419
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.6 Nymphaeaceae. A: Leaf and flower of Nymphaea coerulea. B: Longitudinal section of
seed of N. alba. C: Transverse section of seed of the same showing plumule lying in
the cavity of one cotyledon. D: Longitudinal section of flower of N. odorata;
E-H: Successively outer to inner stamens. Nuphar sp. I: Flower; J: Longitudinal sec-
tion of flower; K: Gynoecium with stigmatic disc; L: Seed.
Salient features: Aquatic herb, leaves float- Description: Perennial aquatic herbs with
ing, long-petioled, peltate, flowers large on stout creeping rhizome. Stem with scattered
long pedicels, stamens numerous, fruit vascular bundles, numerous air canals and
spongy with several immersed seeds. laticifers. Hairs simple, usually producing
mucilage. Leaves floating (Nymphaea, Vic-
Major genera: Nymphaea (40 species), toria, etc.) or immersed, often very large (up
Nuphar (15), and Victoria (3). to 2 m dia. in Victoria amazonica) usually
420 Plant Systematics
alternate, rarely opposite or whorled, sim- of a child. The seeds of Victoria, Nymphaea
ple, cordate or orbicular, often peltate with and Euryale (Makhana) are often consumed.
long petiole emerging from rhizome, stip-
ules absent or present. Inflorescence of soli- Phylogeny: The family has been a subject
tary axillary flowers. Flowers floating or of considerable discussion, often strongly
raised above water, bisexual, actinomorphic linked with monocots, although traditionally
with spirally arranged stamens, classified with dicots. The family has been
hypogynous. Calyx with 4-12 sepals, free located under superorder Nymphaeanae af-
or connate, often petaloid. Corolla repre- ter Magnolianae but Takhtajan has finally
sented by staminodes, absent or many, free taken it under a distinct subclass
or connate at base, often passing into sta- Nymphaeidae. During the last decade, the
mens. Androecium with many stamens, family has been identified as a constituent
free, spirally arranged, filaments flattened of Paleoherb complex, forming the most
sometimes poorly differentiated from an- primitive lineage among angiosperms. The
thers, sometimes adnate to petaloid paleoherb complex is characterized by scat-
staminodes, pollen grains usually tered vascular bundles, absence of vascular
monosulcate or inaperturate. Gynoecium cambium, leaves alternate, usually
with 3-many free or connate carpels with palmately veined, adventitious root system
several locules and parietal placentation, and lack of etherial cells. The family formerly
unilocular with single or many ovules, stig- also included genus Nelumbo, which has now
mas often elongated and radiating from the been separated under family
disc, often surrounding a central bump, Nelumbonaceae because of distinct
ovary superior (Nuphar), semi-inferior tricolpate pollen grains and absence of
(Nymphaea), or inferior (Euryale). Fruit a laticifers. Takhtajan places it under sepa-
spongy berry, rarely an aggregate of nuts or rate subclass Nelumbonidae, whereas in
pods; seeds usually operculate, arillate, with APG II classification it is removed under
small embryo, endosperm absent but with Tricolpates (Eudicots) clade. APG II (option-
a conspicuous perisperm. Pollination by ally) and Judd. et al., (2002) include genus
beetles, flies and bees. Flowers of Victoria Cabomba and Brasenia under Cabomboideae
and some species Nymphaea have starch- in Nymphaeaceae, because their separa-
filled apical appendages of carpels as insect tion would render Nymphaeaceae
attraction, providing food, heat and charac- paraphyletic. Thorne (2000, 2003, 2006,
teristic smell. The fruit, on maturity, splits 2007) and APweb (2008), separate them un-
to separate individual segments (Nuphar) or der Cabombaceae. Earlier placed after the
ruptures under water so as to release seeds. Magnoloid complex, Thorne has finally
shifted Cabombaceae and Nymphaeaceae in
Economic importance: Species of Nymphaea basal angiosperm clades as suggested by
(water lily), Nuphar (yellow water lily, molecular studies (Qui et al., 2000; Soltis et
spatterdock), and Victoria (Amazon lily) are al., 2000). Wikstrm et al. (2001) suggest an
ornamentals grown in ponds and lakes. The age for the Nymphaeales clade some 171-
leaves of Victoria amazonica (Royal water lily) 153 MYA, with divergence occuring 144-111
are so large that they can support the weight MYA
***********
Major Families of Angiosperms 421
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Submerged aquatic herbs, extrorse, connective prolonged beyond an-
roots absent, leaves whorled, often dichoto- thers into two prominent often coloured
mously dissected, flowers minute, uni- teeth, staminodes absent in female flower;
sexual, perianth with 7-numerous bract-like pollen grains inaperturate, exine reduced,
segments, stamens 10 to numerous, anthers pollen tubes branched. Gynoecium with 1
with prolonged connective, carpel 1, ovary carpel, ovary superior, unilocular with 1
superior, placentation apical, fruit an ovule, placentation apical, ovule pendulous,
achene with 2 or more projections. style continuous with the ovary, stigma ex-
tending along one side of style. Fruit a nut
Major genera: Single genus Ceratophyllum tipped by persistent spine-like style and of-
(6 species). ten with two or more projections; seed with
straight embryo, endosperm absent.
Description: Submerged aquatic herbs often
forming floating masses, rootless but some- Economic importance:. Floating masses
times with colourless root-like branches provide protection to fish fry. The masses
anchoring the plant; stems branched but also support bilharzia-carrying snails and
with never more than one branch at one malaria- or filaria-carrying mosquito larvae.
node, with single vascular strand with cen- Fruits and foliage form food for migratory
tral air canal surrounded by starch-contain- waterfowl. It is sometimes troublesome,
ing cells, with tannins. Leaves whorled, 3- choking waterways.
10 at each node, once to four times dichoto-
mously dissected, ultimate leaf-segments Phylogeny: The phylogeny of the family has
with two rows of minute teeth and tipped by been a matter of great speculation. Bentham
two bristles, stomata and cuticle absent, stip- and Hooker placed this family along with oth-
ules absent. Inflorescence with solitary ax- ers of uncertain affinities under Ordines
illary flowers, usually one flower in a whorl anomali. It is usually considered to be related
of leaves. Flowers unisexual (plants to Nymphaeaceae (Lawrence, 1951; Heywood,
monoecious), male and female flowers usu- 1978both include Nelumbo under
ally on alternate nodes, actinomorphic, very Nymphaeaceae) particularly genus Nelumbo,
small. Perianth with 7 to numerous tepals, which has now been removed to a distinct fam-
linear, bract-like, slightly connate at base. ily Nelumbonaceae. Cronquist (1988) places
Androecium with numerous stamens, fila- all the three families under the same order
ments indistinct, anther oblong-linear, Nymphaeales. G. Dahlgren (1989) includes
bithecous, dehiscence longitudinal, Nelumbonaceae under order Nelumbonales of
422 Plant Systematics
***********
Major Families of Angiosperms 423
Subclass 2. Magnoliidae
Superorder 1. Magnolianae 4. Hernandiaceae
5. Atherospermataceae
Order 1. Magnoliales
6. Gomortegaceae
Family 1. Myristicaceae 7. Siparunaceae
2. Magnoliaceae Order 3. Canellales
3. Degeneriaceae
1. Winteraceae
4. Himantandraceae
2. Canellaceae
5. Eupomatiaceae
6. Annonaceae Order 4. Piperales
1. Aristolochiaceae
Order 2. Laurales
2. Lactoridaceae
1. Calycanthaceae
3. Hydnoraceae
2. Monimiaceae
4. Saururaceae
3. Lauraceae
5 Piperaceae
Salient features: Trees or shrubs with vestured pits, wood parenchyma apotracheal
alternate simple leaves, stipules caducous, (terminal), sieve-tube plastids S-type, or P-
leaving a circular scar at the node, nodes type and S-type; when P-type, subtype I (b).
multilacunar, flowers usually solitary, Leaves evergreen or deciduous, alternate,
bisexual, large, floral parts numerous, spi- spiral, petiolate, simple, dissected (Lirio-den-
rally arranged on elongated thalamus, tepals dron), pinnatifid or entire, pinnately veined,
gradually passing from outer sepals to inner or palmately veined, stipules large, sheath-
petals, stamens laminar, carpels free, seed ing, enclosing the terminal buds, caducous,
often suspended by thread like funiculus. leaving a ring-shaped scar at the node,
stomata paracytic, or anomocytic, minor leaf
Major genera: Magnolia (80 species), Michelia veins without phloem transfer cells (Magno-
(40), Talauma (40) and Liriodendron (2). lia). Inflorescence with usually solitary
terminal, or axillary flowers. Flowers
Description: Trees or shrubs, nodes bracteate (the bracts spathaceous); large,
5-lacunar or multilacunar, vessels-elements regular, bisexual. Perianth with 6-18 tepals,
with scalariform ends, vessels without free, sequentially intergrading from sepals
424 Plant Systematics
Figure 13.8 Magnoliaceae. Magnolia virginiana. A: Flowering branch with single terminal flower;
B: Stamen, laminar and with apical sterile appendage; C: Longitudinal section of
gynoecium, two anatropous ovules in each carpel; D: Seed with fleshy seed coat
removed; E: Longitudinal section of seed showing fleshy seed coat, copious endosperm
and small embryo. M. grandiflora. F: Flower bud; G: Vertical section of flower;
H: Floral receptacle with half of the stamens removed; I: Anther; J: Dehisced fruit
with arillate seeds hanging through thread-like funiculus.
to petals, or petal-like (usually), usually spi- style, but sometimes terminal. Fruit an ag-
rally arranged, rarely 34 whorled, white, or gregation of follicles or indehiscent samaras
cream, or pink, deciduous. Androecium with (Liriodendron), or united into fleshy syncarp
numerous (50200) stamens, maturing cen- (Aromadendron); seeds endospermic,
tripetally, free, spirally arranged, all fertile, endosperm oily, seeds usually large, often
usually laminar (the four paired with long thread-like funiculus. Pollination
microsporangia embedded, the stamens of- primarily by beetles. The fruits are primarily
ten more or less strap-shaped), anthers dispersed by animals, but the samaras of
adnate, dehiscence longitudinal, through Liriodendron are wind dispersed.
slits or valves, extrorse (Liriodendron), or
latrorse to introrse, bithecous, appendaged Economic importance: Various species of
often by prolongation of the connective or Magnolia (M. grandiflora, M. kobus, M. stellata)
unappendaged, pollen grains monosulcate. and Michelia (M. fuscata, M. champaca
Gynoecium with (2) 20200 free carpels, sapu, also source of timber) are grown as
ovary superior, carpel fully or incompletely ornamentals. Liriodendron tulipifera (tulip
closed, 2 (20) ovuled, placentation marginal; tree or yellow poplar) is a valuable timber
ovules funicled, pendulous, biseriate (on the source in USA. Species of Magnolia
ventral suture), anatropous, bitegmic, (M. hypoleuca), and Michelia also constitute
crassinucellate; stigma extending down the sources of timber.
Major Families of Angiosperms 425
Phylogeny: The family was regarded as the The family is considered to be mono-
most primitive of the extant angiosperms for phyletic based on the support from rbcL and
several decades in the classification systems ndhF sequences (Qui et al., 1993, Kim et al.,
of Hallier (1905), Hutchinson (1926, 1973), and 2001). These studies, however, question the
earlier versions of Cronquist and Takhtajan. recognition of Talauma, Michelia and
The view was first challenged by Smith (1945), Manglietia as distinct genera, as it renders
who considered that Magnoliaceae are rela- Magnolia as paraphyletic. Although
tively highly specialized both vegetatively and Liriodendron is quite distinct, all other gen-
florally, casting some doubt on the assump- era have been merged with Magnolia in the
tion of the primitive nature of the family, and recent works. Figlar and Nootebroom (2004)
implying that groups such as Winteraceae, divide the enlarged genus Magnolia into
etc., may be at least as primitive. The status three subgenera: Magnolia, Yulania and
of Magnoliaceae as the most primitive fam- Gynopodium. Two clades are distinguished
ily was strongly challenged by Carlquist within the family one represented by
(1969), Gottsberger (1974) and Thorne (1976), Liriodendron, and the other by rest of the
claiming Winteraceae to be the most primi- genera. Judd et al., (2008), Stevens (2008)
tive family. The primitive features of as such recognize only 2 genera Magnolia
Magnoliaceae include spirally arranged and Liriodendron within the family. Thorne
floral parts, laminar stamens, fruit a follicle, (2003, 2006,2007), places Magnolia and other
longer and narrower vessel elements, 5 genera in subfamily Magnolioideae,
monosulcate pollen grains and beetle whereas Liriodendron is placed in mono-
pollination. generic Liriodendroideae.
***********
Salient features: Trees or shrubs with al- Genus: Single genus Degeneria with 2 spe-
ternate simple leaves, stipules absent, cies, D. vitiensis and D. roseiflora.
nodes 5-lacunar, flowers usually solitary, bi-
sexual, large, sepals and petals distinct, Description: Large trees; bearing essential
sepals 3, petals 12-18, stamens many, oils, nodes 5-lacunar, vessel-elements with
laminar, 3-veined, inner modified into oblique end walls, sieve-tube plastids P-type,
staminodes, carpel single, incompletely pith with diaphragms. Leaves alternate,
sealed, fruit leathery with many seeds. petiolate, non-sheathing, gland-dotted,
426 Plant Systematics
Figure 13.9 Degeneriaceae. Degeneria vitiensis. A: Tree growing in natural habitat in Fiji.; B: A
branch with flowers; C: Stamen, laminar with undifferentiated filament and anther
part; D: Transverse section of carpel; E: Fruit.
aromatic, simple, entire, pinnately veined, placentation marginal, ovules 20-30, in two
exstipulate, stomata paracytic, mesophyll rows, long funicled, with a conspicuous
with spherical etherial oil cells. Inflores- funicular obturator; anatropous, bitegmic,
cence with solitary pendulous flowers, (su- crassinucellate, outer integument not con-
pra) axillary. Flowers medium-sized to large, tributing to the micropyle. Fruit leathery,
regular, polycyclic, thalamus shortly raised, with a hard exocarp, dehiscent, or
sepals and petals distinct. Calyx with 3 se- indehiscent, 2030 seeded; seeds flattened,
pals, 1 whorled, free, persistent. Corolla more or less sculptured, with an orange-red
with 12-18 petals, larger than the sepals, 3 sarcotesta, embryo well differentiated but
5 whorled, free, fleshy, deciduous, sessile. small, cotyledons 3 (4), copiously
Androecium with about 3050 stamens, endospermic, endosperm ruminate, oily.
maturing centripetally, free, 36 whorled, Pollination by beetles.
innermost 310 modified into staminodes;
fertile stamens laminar, flattened, oblong, Economic importance: No economic value
3-veined; anthers bithecous, adnate, de- known.
hiscence longitudinal, with slits or valves,
extrorse, tapetum glandular, pollen grains Phylogeny: The family was earlier included
monosulcate. Gynoecium with single car- under Winteraceae, and was considered
pel, ovary superior, single chambered, car- closer to Zygophyllum by Hutchinson (1973).
pel incompletely closed (largely unsealed at It is now treated to be an independent fam-
anthesis), style absent, stigma running ily, more closely allied to Magnoliaceae and
nearly the entire length of carpel, Himantandraceae. Takhtajan (1987, 1997),
Major Families of Angiosperms 427
***********
Salient features: Trees or shrubs with al- tire, pinnately veined, stipules absent,
ternate distichous leaves, stipules absent, domatia recorded in 3 genera, stomata
leaves glaucous or with metallic sheen, flow- paracytic, secretory cavities containing oil,
ers fragrant, flowers trimerous with numer- mucilage, or resin. Inflorescence with soli-
ous spirally arranged stamens, many car- tary flowers, or racemose. Flowers regular,
pels free, fruit an aggregate of berries, seed cyclic, usually bisexual, rarely unisexual, tha-
with ruminate endosperm. lamus sometimes elongated (Mischogyne)
Calyx usually with 3 sepals, or 6 and 2-
Major genera: Guateria (250 species), Xylopia whorled, free, valvate. Corolla with 3-6 pet-
(150), Uvaria (100), Artabotrys (100), Annona als, 12 whorled, free, imbricate or valvate.
(100), and Polyalthia (100). Androecium with 25100 stamens, matur-
ing centripetally; free, all equal, spirally ar-
Description: Trees, or shrubs, or lianas, bear- ranged, rarely 3-6 whorled, rarely outer form-
ing essential oils, nodes unilacunar, or ing staminodes (e.g. in Uvaria), anthers
bilacunar, vessel end-walls horizontal, sim- bithecous, adnate, dehiscing by longitudinal
ple, vessels without vestured pits, wood dif- slits or valves; extrorse, connective prolonged
fuse porous; partially storied, sieve-tube into appendage, tapetum glandular, pollen
plastids P-type, subtype I (a), pith commonly shed in aggregates (5 genera), or as single
with diaphragms Leaves evergreen, alter- grains; when aggregated, in tetrads (usually),
nate, distichous, non-sheathing, simple, en- or in polyads (octads in Trigynaea). Pollen
428 Plant Systematics
Figure 13.10 Annonaceae. Asimina triloba. A: Flowering branch bearing solitary flowers;
B: Vertical section of flower ; C: Longitudinal section of carpel showing ovules;
D: Pollen grain; E: Fruit. Annona furfuracea. F: Flowering branch; G: Vertical section
of receptacle showing male flowers towards the centre and female flowers towards
the periphery; H: Longitudinal section of carpel showing basal ovule.
grains monosulcate or nonaperturate, or with used in perfumes. The spicy fruits of West
two parallel furrows at the equator, or ulcer- African Xylopia aethiopica are the so-called
ate. Gynoecium with 10100 carpels, usu- Negro pepper used as a condiment, and
ally free, rarely united, placentation of free those of Monodora myristica used as substi-
carpels basal, when syncarpous 1 locular, or tute for nutmeg.
215 locular, parietal, or basal. Ovules 1-50,
apotropous, with ventral raphe, bitegmic, Phylogeny: It is generally agreed upon that
crassinucellate, outer integument not contri- the family is derived from Magnoliaceous
buting to the micropyle. Fruit fleshy, com- stock. Hutchinson placed the family under
monly an aggregate of berries; seeds endo- Annonales after Magnoliales, from which,
spermic, endosperm ruminate, oily. Pollination according to him, they were clearly derived.
mostly by beetles. Dispersal especially of The primitive features include spirally ar-
fleshy fruits by birds, mammals and turtles. ranged numerous stamens and carpels, con-
nective prolonged into an appendage. The
Economic importance: Many species of sepals and petals are more advanced than
Annona are cultivated for their edible fruits: Magnoliaceae. Most of the recent authors
A. squamosa (sweet sop), A. muricata (sour (except Dahlgren and Takhtajan, who place
sop), A. reticulata (custard apple), and it under Annonales), however, include this
A. cherimola (cherimoya). Flowers of Cananga family under Magnoliales (Stevens, 2008;
odorata (ylang-ylang) and Mkilua fragrans are Thorne, 2003, 2006, 2007). The genera with
Major Families of Angiosperms 429
connate carpels and with fleshy berries are fication of Annonaceae may have occured
considered more advanced than those with (84)82-57 mybp (Doyle et al. 2004;
free carpels. It is proposed that the diversi- Scharaschkin & Doyle 2005).
***********
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Shrubs with opposite sim- veins, sequentially intergrading from sepals
ple leaves, stipules absent, flowers with nu- to petals, free, inserted along the rim of
merous spirally arranged tepals, numerous receptacle. Androecium with 1555
stamens along the rim of cup-like recepta- stamens, maturing centripetally, free, spi-
cle, fruit single-seeded achene. rally arranged at the top of the hypanthium,
laminar or linear, bithecous, inner 10-25
Major genera: Calycanthus (3 species), modified into usually nectariferous
Chimonanthus (3), Sinocalycanthus (1) and staminodes, anthers adnate, dehiscence by
Idiospermum (1). longitudinal slits, extrorse, connective
extended into an appendage, pollen grains
Description: Small trees, or shrubs with aro- 2(3) aperturate, sulcate. Gynoecium with
matic bark, bearing essential oils, nodes 545 free carpels, spirally arranged within
unilacunar, vessel-elements with oblique the hypanthium, ovary superior, style
end-walls, sieve-tube plastids P-type, subtype distinct, stigma terminal, ovary 2 ovuled
I (a). Leaves opposite, leathery, petiolate, (upper often abortive), placentation
gland-dotted, simple, entire, pinnately marginal, ovules ascending, apotropous with
veined, stipules absent, stomata paracytic, ventral raphe, anatropous, bitegmic,
hairs unicellular or absent, mesophyll with crassinucellate, or pseudocrassinucellate,
spherical etherial oil cells. Inflorescence outer integument not contributing to the
with solitary terminal flowers on specialized micropyle. Fruit an aggregate of achenes
leafy short-shoots. Flowers medium-sized to enclosed in the fleshy hypanthium; seeds
large, regular, bisexual with spirally ar- nonendospermic, embryo well differentiated
ranged floral parts, markedly perigynous. (large), cotyledons 2, spirally twisted. Polli-
Perianth with 15-30 tepals, each with 3-4 nation by insects, mainly beetles.
430 Plant Systematics
Economic importance: Calycanthus floridus Laurales. Loconte and Stevenson (1991), pro-
(Carolina allspice) and C. occidentalis jected Calycanthaceae as basic angiosperms
are grown as ornamental shrubs. Bark of with a series of vegetative and reproductive
C. fertilis and C. floridus yield medicinal ex- angiosperm plesiomorphies such as shrub
tracts. Chimonanthus praecox (winter sweet) habit, unilacunar two-trace nodes, vessels
is widely cultivated, and is one of the few spe- with scalariform perforations, sieve-tube el-
cies flowering in cold winter with snow around, ements with starch inclusions, opposite
the flowers used in Japan to make perfumes. leaves, strobilar flowers, leaf-like
bracteopetals, poorly differentiated numer-
Phylogeny: The family is closely related to ous spirally arranged tepals, and few ovulate
Magnoliaceae and Annonaceae in its nu- carpels. Food bodies terminating the stamen
merous spirally arranged floral parts and free connectives indicate beetle pollination. It is
carpels. Hutchinson included the family interesting to note that genus Idiospermum
under Rosales primarily because of (which was recognized as new genus based
perigynous flowers and free carpels, a posi- on Calycanthus australiensis by S. T. Blake
tion contested by several authors. Thorne in 1972) was considered as the most primi-
(1996, 2000) regarded it to be closely related tive flowering plant by these authors. Blake
to Monimiaceae and placed under suborder had separated Idiospermum under distinct
Laurineae of Magnoliales, but subsequently family Idiospermaceae, also recognized by
(2003, 2006, 2007) under independent order Hutchinson, as distinct from Calycantha-
Major Families of Angiosperms 431
ceae. Endress (1983) had described In all suggest Calycanthaceae to be basal within
respects, Idiospermum gives the impression Laurels, probably sister to all other Laurales
of a strange living fossil. Molecular studies (Doyle and Endress, 2000).
***********
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
B&H as Laurineae
Salient features: Aromatic trees or shrubs, (14 genera) represented by pits, pockets, or
leaves alternate, perianth small and undif- hair tufts, stomata, paracytic, hairs mostly
ferentiated, stamens in several whorls, fruit unicellular, mesophyll usually with spheri-
single seeded drupe or berry. cal etherial oil cells. Inflorescence cymose,
or racemose, often umbelliform with
Major genera: Litsea (400 species) Ocotea involucral bracts, rarely solitary. Flowers
(350), Cinnamomum (250), Cryptocarya (250), small, often fragrant, regular, bisexual,
Persea (200), Beilschmeidia (150) and Lindera rarely unisexual, usually 3-merous, cyclic,
(100). with well-developed hypanthium. Tepals usu-
ally 6, sometimes 4, free, (1)2(3) whorled,
Description: Aromatic trees and shrubs, similar, sepaloid to petaloid, green, or white,
sometimes parasitic climbers (Cassytha) or cream, or yellow. Androecium with (3)9(
nodes unilacunar with two traces, vessel el- 26) stamens, free, equal, or markedly un-
ements with scalariform or simple end-walls, equal, (1)3(4) whorled, inner sometimes
without vestured pits, wood partially storied, modified into staminodes, somewhat laminar
sieve-tube plastids P-type, or S-type; when P- to petaloid by expansion of the filament and
type, subtype I(b). Leaves nearly always ev- connective, filaments appendaged or not, an-
ergreen, usually alternate and spiral, rarely thers bithecous, basifixed, dehiscence lon-
opposite or whorled, leathery, petiolate, non- gitudinal by valves opening from base to apex,
sheathing, gland-dotted, aromatic, simple, or dehiscing by pores (in Hexapora), usually
entire , sometimes lobed (Sassafras), introrse, sometimes extrorse, tapetum amoe-
pinnately veined, stipules absent, domatia boid (mostly), or glandular (in several genera),
432 Plant Systematics
Figure 13.12 Lauraceae. Litsea doshia. A: Flowering branch with flowers in globose axillary clus-
ters; B: Flower; C: Fruit. Cinnamomum tamala. D: Flowering branch with terminal
paniculate inflorescence; E: Flower; F: Fruit; G: Anther dehiscing by valves. (After
Polunin and Stainton, Flowers of the Himalaya, 1984).
***********
Major Families of Angiosperms 433
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
B & H under family Magnoliaceae * informal clade names, no formal group names given above
order in APG II and Apweb
Figure 13-13 Winteraceae. Drimys winteri. A: Flowering branch of var. punctata; B: Vertical sec-
tion of flower; C: fruits. Tasmannia sp. D: Flower; E: Vertical section of carpel.
434 Plant Systematics
Salient features: Trees and shrubs with tance, used locally in South America as a
simple alternate leaves with glaucous under tonic. It was also used once by mariners for
surface, stipules lacking, nodes trilacunar, scurvy prevention. Some other species also
vessels absent, flower medium sized in have medicinal uses. The fruits and seeds
cymes, stamens numerous with flattened of D. lanceolata (mountain pepper) are used
filament, pollen grains in tetrads, stigma as pepper and allspice substitute.
extending down on style and fruit a follicle.
Phylogeny: The family has gained consider-
Major genera: Tasmannia (40 species), able phylogenetic significance during the last
Bubbia (30), and Drimys (4). three decades and has been regarded as the
most primitive living family of angiosperms,
Description: Trees or shrubs lacking ves- and Drimys (according to Eames, 1961 the
sels and with narrow elongated tracheids, combination of characters suggests Belliolum
nodes trilacunar, sieve-tube plastids S-type. as most primitive genus of the family) as the
Leaves leathery, alternate, aromatic, gland- most primitive genus in the recent classifi-
dotted, containing terpenoids, entire, sim- cations of Thorne (pre-2003 versions) and
ple with reticulate venation, under surface Cronquist. Takhtajan also regarded this as a
glaucous due to waxy coating, stipules ab- very primitive family but considered
sent. Inflorescence cymose or fasciculate, Degeneria (formerly under Winteraceae, but
with medium-sized few flowers, solitary ter- now removed to Degeneriaceae) to be the
minal in Zygogynum. Flowers usually bi- most primitive genus. The primitive position
sexual, rarely polygamous, actinomorphic of Drimys is supported by the absence of ves-
with spirally arranged stamens, hypogynous. sels, narrow elongated tracheids, laminar
Calyx with 2-6 sepals, free or connate at stamens and more primitive beetle pollina-
base (Drimys), valvate, sometimes falling off tion. The fossil records of the family also go
as cap. Corolla with 5 or many petals, 2- or back to 100-140 years. Only Chloranthaceae
more-seriate, mostly conspicuous in bud, is perhaps as old in fossil history of
imbricate. Androecium with many stamens, angiosperms. Thorne (1996) lists other primi-
centrifugal, free, filaments flattened or al- tive features of Drimys as alternate, entire,
most laminar, poorly differentiated from an- exstipulate leaves, pollen grains in tetrads,
thers, anthers bithecous, dehiscing longi- long cambial initials and tracheids, heterog-
tudinally, introrse, connective frequently ex- enous rays, and poorly-organized pinnate ve-
tending beyond anthers, tapetum amoeboid nation, small medium sized flowers in cymes,
or glandular, pollen uniporate, released in style-less carpel, partly sealed stigmatic mar-
tetrads. Gynoecium with 1-many carpels, in gins, and follicle fruit.
a single whorl, usually free, sometimes The position of Winteraceae at the base
slightly connate (Exospermum) or syncarpous of angiosperms, however, has been refuted
(Zygogynum), ovary superior with parietal during the last decade, largely due to emer-
placentation, ovules 1-many, anatropous, gence of the herbaceous origin hypothesis,
bitegmic, crassinucellate, stigma extending and the results of cladistic studies largely
down on style or capitate, carpels sometimes based on molecular data. Young (1981) in-
partially unsealed (Drimys). Fruit an etaerio terpreted neoteny in the family with a se-
of berries or follicles, embryo minute, ries of reversals. It is also suggested that
endosperm conspicuous. Pollination by small the family shares common ancestry with
beetles (Drimys), flies and moths, some spe- Illiciaceae (Doyle and Donoghue, 1993) and
cies wind pollinated (Tasmannia). Dispersal Amborellaceae (Loconte and Stevenson,
especially of berries is by vertebrates. 1991). Loconte (1996), on comparison of vari-
ous hypotheses concluded that the tree based
Economic importance: The bark of Drimys on Winteraceae hypothesis is two steps
winteri (winters bark) is of medicinal impor- longer than one based on Calycanthaceae.
Major Families of Angiosperms 435
The family has recently been placed along al., 2002, 2003). The two are characterised
with Canellaceae in a separate order by apomorphine alkaloids, trilacunar nodes
Canellales (APG II, APweb), not at the begin- and sieve-tube plastids with starch and pro-
ning of angiosperms but after tein crystalloids. Thorne earlier (2003) placed
Amborellaceae, Chloranthaceae and the two families under suborder Canellineae
Austrobaileyaceae. The sister-group rela- of order Canellales, the other suborder be-
tionship of Winteraceae and Canellaceae ing Illiciineae. However, With the shifting
has received bootstrap support of 99 or 100 of latter under Chloranthales, the two fami-
per cent in all recent multigene analyses lies are placed directly under Canellales
(Qui et al., 1999; Soltis et al., 1999; Zanis et (Thorne, 2007).
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.14 Saururaceae. Saururus cernuus. A: Flowering branch with elongated spike. B: Flower
with subtending bract; C: Vertical section of flower; D: Transverse section of fruit.
E: Flowering portion of Anemopsis californica with showy involucre bracts below the
spike, and the plant with basal leaves.
suppression of the system of inflorescence ultimate pair of anthions. Zeng et al. (2002)
axes of gnetopsids and bracts to bring either on the basis of matR gene studies concluded
a single distal and one more proximal pair that 4 genera and six species of Saururaceae
of anthions together above the subtending form a monophyletic group. Circaeocarpus
bract of the secondorder inflorescence axis. saurroides C. Y. Wu earlier placed in
The four carpelled flowers of Saururus and Saururaceae is conspecific with Zippelia
Gymnotheca are the result of the reduction begoniaefolia Blume and belongs to
of an inflorescence axis to a penultimate and Piperaceae.
***********
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herbs, shrubs or climbers mesophyll with spherical etherial oil cells.
with jointed nodes, vascular bundles scat- Inflorescence spadix or spike. Flowers
tered, leaves alternate, petioles sheathing the bracteate; minute to small, usually bisexual,
nodes, flowers small in dense spikes, peri- sometimes unisexual. Perianth absent.
anth absent, stamens 2-6, ovary with single Androecium with 110 stamens, adnate to
ovule, embryo very small. the base of ovary or not, free, often more or
less monadelphous, staminodes often
Major genera: Piper (970 species), Peperomia present, anthers bithecous (monothecous in
(961), Ottonia (70) and Pothomorphe (10). Peperomia), dehiscence by longitudinal slits,
extrorse, tapetum glandular, pollen grains
Description: Herbs, shrubs, or woody climb- monosulcate or nonaperturate. Gynoecium
ers, or small trees bearing essential oils, with 2-4 united carpels, or single carpel
stems conspicuously jointed, nodes 3-lacunar (Peperomia), ovary superior, unilocular, stig-
to multilacunar, vascular bundles scattered, mas 15, placentation basal; ovule, ascend-
vessel-elements with scalariform or simple ing, orthotropous, bitegmic or unitegmic
end-walls, sieve-tube plastids S-type. Leaves (Peperomia), crassinucellate. Fruit fleshy,
alternate, spiral, herbaceous or fleshy, sim- usually a drupe; seeds scantily endospermic,
ple, entire, pinnately or palmately veined, perisperm copious, embryo minute.
petiolate sheathing, stipules intrapetiolar,
adnate to petiole, hydathodes commonly Economic importance: Piper nigrum is the
present, stomata cyclocytic or anisocytic, source of black and white pepper (ripe and
438 Plant Systematics
Figure 13.15 Piperaceae. Piper guineense. A: Fruiting branch with pendulous spike; B: Paired
flowers and their bracts; C: Longitudinal section of female flower. Piper nigrum.
D: Fruiting branch; E: Flower; F: Stamen. G: Peperomia griseo-argenteum, a cluster of
flowering shoots.
***********
Major Families of Angiosperms 439
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Marshy herbs with rhi- Description: Aromatic perennial marshy
zomes, lacking oxalate crystals, inflores- herbs with rhizomes, bearing essential oils,
cence a spadix without spathe, flowers root xylem with vessels with scalariform end-
small, bisexual, tepals 6 in two whorls, sta- walls. Leaves alternate, distichous, flat,
mens in two whorls, carpels 3, united, fruit sessile, sheathing, entire, parallel-veined,
a berry. mesophyll with spherical etherial oil cells,
lacking calcium oxalate crystals. Inflores-
Major genera: Single genus Acorus with 2 cence scapigerous, spadix without spathe.
species. Flowers ebracteate, small, bisexual,
440 Plant Systematics
Figure 13.16 Acoraceae. Acorus calamus. A: Rhizome with basal leaves; B: Spadix with subtend-
ing leaf; C: Flower; D: Gynoecium; E: Transverse section of ovary; F: Longitudinal
section of ovary; G: Stamen.
***********
Major Families of Angiosperms 441
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.17 Araceae. Arum maculatum. A: Plant with flowering spadix; B: Vertical section of
spadix and spathe; C: Spadix; D: Gynoecium; E: Fruit cut to show seeds; F: Seed.
Pistia stratiotes. G: Inflorescence; H: Vertical section of inflorescence; I: Longitudi-
nal section of ovary; J: Longitudinal section of orthotropous ovule with placental
hairs; K: Portion of androecium; L: Seed. Cala palustris. M: Inflorescence;
N: Mature fruits; O: Transverse section of carpel.
The corms of Colocasia esculenta (taro or subclass Aridae; Dahlgren and Cronquist
dasheen), Amorphophallus campanulatus (El- also includes Acoraceae under Arales). APG
ephant-foot yam), Cryptosperma and II and APweb place Acoraceae under separate
Xanthosoma (tanier, yautia) and fruits of order, but include Araceae along with
Monstera (Mexican breadfruit) are used as several others under order Alismatales,
food. Lemnaceae being merged with Araceae.
The family is considered to be a fairly early
Phylogeny: The family is considered to be divergent lineage within monocots and
monophyletic. Hutchinson believed it had sister to remaining families (as
been derived from the tribe Aspidistreae of circumscribed by APG II) of Alismatales.
Liliaceae. The bisexual flowers are Thorne (2003) recognized 7 subfamilies
considered to be more primitive, while those under Araceae: Gymnostachyoideae (1
with unisexual flowers to be more highly genus), Orontioideae (3 genera), Pothoideae
evolved. Most recent classifications place (4 genera), Monsteroideae (12 genera),
this family under the order Arales along with Lasioideae (10 genera), Calloideae (1 genus),
Lemnaceae, Acoraceae having been and Aroideae (73 genera), treating
removed to a separate order Acorales. Arales Lemnaceae as a distinct family. APweb
has also been placed under independent (2003, 2008) also recognises 7 subfamilies
superorder Aranae in these classifications but Monsteroideae is merged with
(Takhtajan shifts Aranae under separate Pothoideae and Lemnoideae (based on
Major Families of Angiosperms 443
Lemnaceae) included instead. Thorne (2006, on the analysis of five plastid genes did not
2007) has followed this change, and included find a clear resolution of affinities within the
two additional subfamilies Philodendroideae family. However, the basal clade
(27 genera) and Schismatoglottidoideae (7 (Gymostachydoideae + Orontioideae)
genera), both segragates from Aroideae remains the same, and Lemnoideae are
(Keating, 2003a,2003b, 2004a, 2004b), thus strongly supported as sister to the rest of the
recognizing nine in all. Mayo et al., (2003) family.
***********
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Aquatic or marsh plants tepals, free, 2 whorled, whorls similar or
with linear triquetrous leaves, inflorescence outer sepaloid and inner petaloid, outer of-
scapigerous, umbellate cymes, perianth in ten tinged with green. Androecium with 9
two whorls, outer tinged green, stamens 9, stamens, 2 whorled (6+3), anthers basifixed,
carpels free, fruit etaerio of follicles. dehiscence by longitudinal slits, latrorse, pol-
Major genera: Butomus (1 species). len grains monosulcate. Gynoecium with 6
carpels, free or connate at base, ovary supe-
Description: Aquatic or marshy plant with rior, carpel incompletely closed, style short,
basal leaves, rhizomatous, secretory cavities with ventral decurrent stigmatic region,
present, with latex, root xylem with vessels ovules 20100, placentation dispersed,
with simple and scalariform end-walls, stem stigma papillate. Fruit an aggregate of folli-
xylem without vessels, sieve-tube plastids cles, seeds nonendospermic, embryo
P-type, subtype II. Leaves emergent, alter- straight (not curved), cotyledon 1.
nate, distichous, petiolate or sessile,
sheathing, simple, entire, linear, tri- Economic importance: Cultivated as an or-
quetrous, parallel-veined, stomata paracytic. namental. The rhizomes are edible when
Inflorescence scapigerous, umbellate baked.
cymes, involucral bracts three. Flowers
medium-sized, on long pedicels, trimerous, Phylogeny: The genus was earlier placed
regular, bisexual, cyclic. Perianth with 6 under the family Alismaceae by Bentham
444 Plant Systematics
Figure 13.18 Butomaceae. Butomus umbellatus. A: Rhizome with basal leaves; B: Umbellate
cymose inflorescence with involucral bracts; C: Vertical section of flower; D: Car-
pels; E: Longitudinal section of carpel showing scattered ovules; F: Stigmas;
G: Seed.
and Hooker. Buchenau in Englers Das Helleboraceae, and the peculiar placentation
Pflanzanreich (1903), recognized the family of the ovules dispersed all over the surface
Butomaceae to include all members of of the carpel more ancient character than
Alismaceae (this original name of the fam- found in any herbaceous dicotyledon except
ily has now been replaced by Alismataceae) in Cabombaceae, which is similar in this
with numerous ovules and parietal respect. Cabombaceae also have trimerous
placentation. Pichon (1946) redefined the flowers and aquatic habit, and Butomaceae
circumscription of these two families to shift is separated only on the basis of a single
all genera with petioled leaves with ex- cotyledon and absence of endosperm. The
panded blades, campylotropous ovules, and recent cladistic studies reveal this family
seeds with curved embryos, to Alismaceae to be closer to Hydrocharitaceae. Accord-
and retaining only genus Butomus under ing to Judd et al., (2002) Butomaceae,
Butomaceae, a treatment followed in most Hydrocharitaceae and Alismataceae form
of the recent publications. According to one aquatic clade of Alismatales, supported
Hutchinson (1973), who retained a broader by the apomorphies of perianth differenti-
circumscription of the family, the ated into sepals and petals, stamens more
gynoecium of Butomaceae represents prob- than six and carpels more than three, and
ably the most ancient type of the the ovules scattered over the inner sur-
monocotyledons, the free carpels recalling face of locules.
***********
Major Families of Angiosperms 445
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Aquatic or marsh plants with 6 stamens, rarely more with branched
with laticifers, leaves petiolate with well- outer stamens, free, anthers bithecous,
developed blade, inflorescence scapigerous, dehiscence by longitudinal slits, extrorse,
perianth in two whorls, differentiated into pollen grains usually 23 aperturate.
sepals and petals, stamens 6 to many, car- Gynoecium with 3 carpels, rarely more, free,
pels 6 to many, free, ovule usually one per ovary superior, 1 ovuled, placentation ba-
carpel, fruit an etaerio of achenes, embryo sal, ovule anatropous, or amphitropous.
curved. Fruit etaerio of achenes, seeds
nonendospermic, cotyledon 1, embryo
Major genera: Echinodorus (35 species), strongly curved.
Sagittaria (25), Alisma (9) and Burnatia (3).
Economic importance: Sagittaria sagittifolia
Description: Aquatic or marshy plant with (arrowhead) is cultivated in China and Ja-
basal leaves, rhizomatous, laticifers present pan for its edible corms. Several species of
with white latex, root xylem with vessels Sagittaria, Alisma (water plantain), and
having scalariform to simple end-walls, ves- Echinodorus (bur-heads) are cultivated as
sels absent in stem and leaves. Leaves sub- poolside plants and used as aquarium plants.
merged and emergent, often heterophyllous,
alternate, petiolate or sessile, sheathing, Phylogeny: The family has been redefined
simple, pinnately, palmately, or parallel- (Pichon, 1946) to shift all genera with
veined, stomata paracytic or tetracytic, ax- laticifers, petioled leaves with expanded
illary scales present. Inflorescence blades, campylotropous ovules, and seeds
scapigerous, paniculate, ultimate branches with curved embryos, including several gen-
cymose or racemose, sometimes umbellate era formerly included under Butomaceae.
or even solitary, with or without involucral According to Judd et al., (2002) Butomaceae,
bracts. Flowers bracteate, bisexual or uni- Hydrocharitaceae and Alismataceae form
sexual and monoecious, or dioecious one aquatic clade of Alismatales, supported
(Burnatia), regular, trimerous, cyclic. Peri- by the apomorphies of perianth differenti-
anth differentiated into calyx and corolla. ated into sepals and petals, stamens more
Sepals 3, free, imbricate. Petals 3, free, than six and carpels more than three, and
white, red, or pink. Androecium usually the ovules scattered over the inner surface
446 Plant Systematics
Figure 13.19 Alismataceae. Alisma plantago-aquatica. A: Basal part of plant with leaves; B: Inflo-
rescence; C: Flower; D: Outer tepal; E: Inner tepal; F: Achene. Sagittaria sagittifolia.
G: Plant with sagittate leaves and basal part of scape; H: Inflorescence; I: Male
flower with petals removed; J: Petal; K: Stamens in different views; L: Achene;
M: Carpel.(After Sharma and Kachroo, Fl. Jammu, vol. 2, 1983)
of locules. The genera with achenes from ancestral condition of six stamens in
(Sagittaria, Alisma, Echinodorus, etc.) may two whorls. According to Hutchinson (1973)
form a monophyletic group (Chase et al., the family reminds of Ranunculaceae and
1993). The family is often regarded as primi- but for solitary cotyledon and lack of
tive due to numerous stamens and carpels. endosperm, the genus Ranalisma might be
The developmental and anatomical studies well be placed in Ranunculaceae. According
have, however, indicated that these numer- to Soros & Les (2002) Echinodorus is
ous stamens are due to secondary increase, polyphyletic and evidently needs splitting.
***********
Major Families of Angiosperms 447
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Aquatic fresh water or with connate filaments, anthers bithecous,
marine herbs, leaves submerged, usually dehiscence by longitudinal slits, innermost
ribbon-like, flowers subtended by paired times modified into staminodes which of-
bracts, male flowers often detaching and ten act as sails (Lagarosiphon), pollen grains
floating on water, carpels united, ovary in- monosulcate or inaperturate, sometimes
ferior with many scattered ovules, fruit a united into thread-like chains (Thalassia,
capsule or berry. Halophila). Gynoecium with 3-6 (rarely 15),
connate carpels, single in Najas, ovary in-
Major genera: Ottelia (32 species), Najas (32), ferior, unilocular, ovules many (1 in Najas),
Elodea (12), Vallisneria (8), Hydrocharis (6), scattered over the surface, placentae often
Halophila (4) and Hydrilla (1). deeply intruded, styles often divided and
twice the number of carpels, stigmas elon-
Description: Aquatic herbs, submerged or gate and papillose. Fruit fleshy berry or dry
partly emergent, rooted in mud or unat- capsule rupturing irregularly, nut in Najas;
tached, in freshwater and marine habitats, seeds without endosperm, embryo straight,
annual or perennial. Leaves alternate cotyledon 1. Pollination in some (Vallisneria,
(Nechamandra), opposite (Elodea some spe- Enhalus) by water, in others (Egeria,
cies) or whorled (Hydrilla, Lagarosiphon), in Limnobium) by insects. Dispersal by water
basal rosettes or cauline, simple, entire or or animals.
serrate, with parallel or palmate venation,
sheathing at base, small scales, at nodes Economic importance: Species of many gen-
inner to leaf base, stipules absent. Inflo- era (Hydrilla, Vallisneria, Elodea, Egeria, etc.)
rescence with solitary flower (female) or are used as aquarium plants. Some species
short cymes (usually male), subtended by like Hydrilla verticillata, Elodea canadensis
two often connate bracts. Flowers bisexual have become troublesome weeds in many
or unisexual, male flowers often discon- parts of the world.
nected and floating on water surface
(Vallisneria, Enhalus, Lagarosiphon). Peri- Phylogeny: The family, along with
anth often with distinct sepals and petals. Butomaceae and Alismataceae, forms a well-
Sepals 3, free, valvate, green. Petals 3, free, defined clade, as indicated by cladistic
usually white, imbricate, sometimes lack- analysis. Although monophyletic (Dahlgren
ing (Thalassia, Halophila). Androecium with and Rasmussen, 1983), the family is mor-
2 to 3 stamens, rarely more (Egeria), free phologically heterogenous and divided into
448 Plant Systematics
Figure 13.20 Hydrocharitaceae. Vallisneria spiralis. A: Plant with creeping stem, strap-shaped
leaves and female flowers on coiled long pedicels; B: Male flower which detaches
and floats on water; C: Female flower; D: Vertical section of female flower; E: Male
inflorescence subtended by two connate bracts; F: Transverse section of ovary with
parietal placentation. Ottelia cordata. G: Plant with leaves and emerging flower bud;
H: Male inflorescence with spathe opened out; I: Female flower; J: Male flower
with perianth removed, showing stamens and pistillodes; K: Transverse section of
ovary.
***********
Major Families of Angiosperms 449
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.21 Potamogetonaceae. Potamogeton perfoliatus. H: Plant with flowering and fruiting
inflorescences; B: Leaves; C: Flower; D: Tepal with attached stamen; E: Carpel;
F: Anther in two different views; G: Fruit; H: Seed enclosed in hard endocarp;
I: Seed. (After Sharma and Kachroo, Fl. Jammu, vol. 2, 1983).
Salient features: Aquatic herbs, leaves sub- Major genera: Potamogeton (83 species),
merged as well as floating, flowers usually Coleogeton (6) and Groelandia (1).
in spikes, bisexual, perianth with 4 free
tepals, stamens 1-4, carpels 4, free, fruit Description: Perennial or rarely annual
etaerio of achenes. fresh water herbs with rhizomes, stems
450 Plant Systematics
mostly submerged, with reduced vascular Phylogeny: The affinities of the family are
bundles in a ring, with air cavities, tannins not clear. The family is sometimes also in-
often present, root xylem with vessels hav- terpreted to include Ruppia and/or
ing scalariform end-walls, stem without ves- Zannichelia. The studies of Les et al., (1997)
sels, sieve-tube plastids P-type, subtype PII. however, have shown that Zannichelia is
Leaves submerged as well as floating, rather weakly embedded in the family, and
sheathing at the base, alternate or opposite the inclusion of Ruppia makes family
(Groenlandia), simple, entire, venation par- biphyletic. Potamogeton itself is considered
allel, submerged leaves thin, without cuti- para- or polyphyletic (Les and Haynes
cle and stomata, floating leaves thick, small 1995). Uhl (1947) had earlier supported the
scales present at nodes inner to the leaf segregation of Zannichelia into separate
sheath. Inflorescence terminal or axillary family by Hutchinson (1934). The tepals are
spike, often carried on a long peduncle, often interpreted variously. Uhl suggested
raised above water surface, peduncle sur- that so-called perianth parts are in fact in-
rounded by sheath at base. Flowers dividual bracts, subtending and adnate to
ebracteate, regular, bisexual, hypogynous, stamens and the flower is fundamentally
cyclic. Perianth with 4 tepal (often inter- an inflorescence with staminate flowers
preted as appendages from connective of the (each represented by a monbracteate peri-
anthers and thus perianth absent), free, anth) and naked female flowers, the view
fleshy, usually clawed. Androecium with 4 first proposed by Kunth (1841) and sup-
stamens, free, adnate to and opposite each ported by Miki (1937). Most of the authors
tepal, anther sessile, dehiscence by longi- (Rendle, 1925; Watson and Dallwitz, 2000;
tudinal slits, pollen grains globose, Judd et al., 2008) consider tepals to repre-
inaperturate. Gynoecium with 4 free carpels, sent appendages from the connective of the
ovary superior with basal to apical anther. As per Hutchinson (1973), these
placentation, ovule 1, campylotropous, are normal perianth-segments on claws of
bitegmic, crassinucellate, style short or which the extrorse anthers are sessile, a
lacking, truncate to capitate. Fruit an view also supported by Heywood (1978) and
etaerio of achenes or drupes, seeds Woodland (1991). Hutchinson stressed that
nonendospermic, with starch, cotyledon 1, in the petaloid monocotyledons the sta-
embryo slightly curved. Pollination by wind, mens are always opposite the perianth-
dispersal by water or animals. segments, and it is not a great step for
those species of Aponogeton with more than
Economic importance: The family is of lit- one perianth-segment to Potamogeton. If the
tle economic importance but biologically an anther were introrse in Potamogeton, then
important source of food for aquatic life. the petal-like organ might be regarded as
Many species of Potamogeton are trouble- an outgrowth from the base of the connec-
some weeds. Fleshy starchy rootstocks are tive, a very unusual feature indeed in any
sometimes used as food. flowering plant.
***********
Major Families of Angiosperms 451
2. Asteliaceae
Subclass 4. Liliidae 3. Hypoxidaceae (B)
Superorder 1. Pandananae 4. Lanariaceae
5. Blandfordiaceae
Order 1. Pandanales 6. Orchidaceae
Family 1. Velloziaceae 3. Iridales
2. Acanthochlamydaceae (B)
Suborder 1. Iridineae
3. Pandanaceae
1. Doryanthaceae
4. Cyclanthaceae
2. Tecophilaeaceae (B)
5. Pentastemonaceae
3. Ixioliriaceae
6. Stemonaceae
4. Iridaceae
7. Triuridaceae
2. Asphodelineae (B)
Superorder 2. Dioscoreanae (B) 1. Xanthorrhoeaceae
Order 1. Dioscoreales (B) 2. Xeronemaceae (B)
1. Dioscoreaceae 3. Asphodelaceae (B)
2. Burmanniaceae 4. Hemerocallidaceae (B)
3. Thismiaceae (B) 5. Johnsoniaceae
Superorder 3. Lilianae (B) 3. Hyacinthineae
Order 1. Liliales (B) 1. Anthericaceae (B)
1. Corsiaceae (B 2. Alliaceae
2. Campynemataceae 3. Hyacinthaceae
3. Melanthiaceae 4. Themidaceae
4. Trilliaceae 5. Behniaceae (B)
5. Petermanniaceae (B) 6. Anemarrhenaceae (B)
6. Luzuriagaceae (B) 7. Herreriaceae (B)
7. Alstroemeriaceae (B) 8. Agavaceae
8. Colchicaceae (B) 4. Asparagineae
9. Riponogaceae 1. Aphyllanthaceae
10. Philesiaceae (B) 2. Laxmanniaceae
11. Smilacaceae 3. Asparagaceae
12. Liliaceae 4. Dracaenaceae
5. Nolinaceae
2. Orchidales (B)
6. Eriospermaceae
1. Boryaceae (B)
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.22 Pandanaceae. Pandanus ceylonicus. A: Plant with leaves and female inflorescence;
B: Portion of leaf showing marginal prickles; C: Male inflorescence; D: Male flower
with apiculate anthers; E: Female spadix split to show arrangement of flowers;
F: Female flower with curved style; G: Longitudinal section of female flower; H: Drupe
tipped by persistent style; I: Seed.(After Dassanayake, Fl. Ceylone, vol. 3, 1981).
***********
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.23 Dioscoreaceae. Dioscorea esculenta. A: Male plant with alternate leaves; B: Male
flower; C: Male flower opened. D. oppositifolia. D: Male plant with opposite leaves
and flowers; E: Female plant with fruits.
Major genera: Dioscorea (375 species), palmate, reticulate, stomata anomocytic, leaf
Rajania (20) and Tamana (5). axils often with bulbils. Inflorescence axil-
lary panicles, racemes or spikes, flowers ar-
Description: Perennial herbaceous or woody ranged singly or in 2-3 flowered clusters. Flow-
climbers with tubers or rhizomes, a few dwarf ers usually unisexual (plants dioecious),
shrubs, usually twining over the support, small, sessile or rarely pedicellate,
stem with vascular bundles in one or two actinomorphic. Perianth with 6 tepals, in two
rings. Leaves usually alternate, sometimes whorls, free or connate at base into tube.
opposite (Dioscorea alata) simple, cordate, Androecium with 6 stamens, in two whorls,
sometimes palmately lobed or compound (D. attached to the base of perianth, 3 sometimes
pentaphylla), petiolate, petiole with pulvinus reduced to staminodes, filaments free or
both at base and above, sometimes with stip- slightly connate, anthers bithecous, connec-
ule like flanges on both sides, sometimes tive sometimes broad; pollen grains
with superficial or internal glands contain- monosulcate or variously porate. Gynoecium
ing nitrogen fixing bacteria, venation with 3 carpels, united, ovary inferior,
Major Families of Angiosperms 455
***********
Placement:
Figure 13.24 Smilacaceae. Smilax aspera. A: Portion of plant with leaves, stipule tendrils and
inflorescence; B: Male flower; C: Tepal with stamen; D: Female flower; E: Trans-
verse section of ovary; F: Infrutescence with berries.
Figure 13.26 Magnoliaceae. Magnolia grandiflora A: Tree in flower; B: Flower; C: Fruit; D: Leaf of
Liriodendron chinense. Degeneriaceae. Degeneria vitiensis E: Plant; F: Fruit; G: Flower.
Lauraceae. H: Laurus nobilis plant in flower; I: Plant of Neolitsea sericea.
Major Families of Angiosperms 459
Figure 13:28 Iridaceae. A: Dietes grandiflora plant; B: Flower enlarged; C: Iris germanica, flower.
Asphodelaceae. D: Kniphofia thomsoni, plant; E: Part of inflorescence.;
F: Asphodelus fistulosus, plant; G: Flower and fruit; Alliaceae. H: Clivia chrysanthifolia,
plant; I: Part of inflorescence; J: Allium cepa, plant; K: Inflorescence enlarged;
L: Agapanthus praecox, inflorescence; M: Basal part with leaves and scapes.
Major Families of Angiosperms 461
Figure 13:29 Hyacinthaceae. Eucomis autumnalis plant with inflorescence; B: E. bicolor, inflores-
cence. Agavaceae. C: Yucca rupicola, plant with inflorescence; D: Part of inflores-
cence; E: Agave parrii, plant; F: A. wightii, inflorescence. Asparagaceae. G: Ophiopogon
planiscaposus, plant; H: Ruscus aculeatus, plant; I: Flower; J: Asparagus racemosus,
fruit. Nolinaceae. K: Nolina recurvata, swollen base; L: N. nelsoni, plant.
462 Plant Systematics
Figure 13:30 Arecaceae. A: Roystonea regia, plant; B: Trunk with leaf scars; C: Parajubaea coccoides,
portion of plant with fruits; D: Caryota urens, plant; E: Inflorescence; F: Part in
Fruit. Musaceae. G: Musa paradisiaca subsp. sapientum, plant with inflorescenc;
H: Inflorescence with fruits. Commelinaceae. I: Tradescantia spathacea, plant;
J: Tradescantia pallida, plant; K: Flower. Cyperaceae. L: Cyperus alternifolius, plant;
M: Part of spike enlaged; N: Scirpoides holoschoenus, plant. Poaceae. O: Triticum
aestivum, plant; P: Spike; Q: Portion of spike of Pennisetum glaucum; R: Avena sativa,
plant with inflorescence; S: Zea mays, male inflorescence.
Major Families of Angiosperms 463
Figure 13.33 Grossulariaceae. A: Ribes menziesii var. leptosmum, plant with fruits; B: Fruit.
C: Ribes sanguineum var glutinosum, fruit. Fagaceae. D: Cyclobalanopsis glauca, por-
tion of trunk; E: Vegetative branches. F: Lithocarpus densiflorus, plant in flower.
Nothofagaceae. G: Nothofagus obliqua, plant with fruits. Betulaceae. Betula utilis.
H: Bark; I: Branch with Fruit; J: Fruiting inflorescence; Branch of Corylus colurna.
466 Plant Systematics
Figure 13.38 Geraniaceae. A: Pelargonium zonale, plant; B: Flower. Rosaceae. C: Prunus campanulata,
plant; D: Chaenomeles vilmoriana, plant; E: Flower; F: Cotoneaster microphyllus, fruit;
G: Fragaria vesca, plant; H: Flower; I: Potentilla fruticosa, plant; J: Rubus trifidus,
flower
Major Families of Angiosperms 471
Figure 13.39 Fabaceae. A: Lupinus arboreus, plant; B: Clitoria ternatea, flower; C: Parkinsonia aculeata,
plant; D: Poinciana pulcherrima, plant; E: Flower; F: Saraca asoka, plant with inflores-
cence; G: Senna candolleana, plant; H: Flower; I: Calliandra haematocephala, plant;
J: Fruit; K: Leucaena leucocephata, plant; L: Fruits.
472 Plant Systematics
stimulant. Young stems and berries are ment under Liliales (Cronquist, 1988; Thorn;
sometimes used as food. APG II; APweb). Cronquist also included gen-
era Luzuriaga, Petermannia and Philesia un-
Phylogeny: Earlier included under Family der the family Smilacaceae, but according to
Liliaceae (Bentham and Hooker; Engler and Chase et al., their inclusion makes
Prantl), it was separated as a distinct family Smilacaceae polyphyletic. The monophyly of
by Hutchinson (1934, 1973), according to the family (including only genera Smilax,
whom, the members are distinct from Heterosmilax and Rhipogonum) is supported by
Liliaceae in habit, dioecious flowers and con- morphological as well as molecular evidence.
fluent anther loculi. He considered APG II and APweb include Rhipogonum un-
Smilacaceae to be considerably advanced der a distinct family Rhipogonaceae (leaves
from the general stock of the Liliaceae. opposite, pollen reticulate), whereas Judd et
Dahlgren et al., (1985) considered the family al. ,(2002) include it (Ripogonum) under
to be related to Dioscoreaceae and included Smilacaceae. Thorne (2003) divided the fam-
it under Dioscoreales. The morphological ily into two subfamilies Smilacoideae and
studies (Conran, 1989) and rbcL sequences Rhipogonoideae, latter has been elevated to
(Chase et al., 1993), however, support place- a distinct family in 2006, 2007 revisions.
***********
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Cronquist also included Amaryllidaceae, Asparagaceae, Alliaceae and several others under
Liliaceae
Salient features: Herbs with alternate or Major genera: Fritillaria (90 species), Gagea
whorled leaves, base sheathing, flowers not (80), Tulipa (80) and Lilium (75).
subtended by spathaceous bracts, flowers
bisexual, trimerous, perianth with 6 petaloid Description: Perennial herbs with under-
tepals, stamens 6, filaments free, carpels ground bulb, generally with contractile roots.
3, united, ovary superior, placentation ax- Leaves mostly basal, alternate or whorled,
ile, fruit a capsule. usually linear or strap shaped, simple,
474 Plant Systematics
entire venation parallel, stipules absent. In- coat not black, small embryo, endosperm
florescence usually racemose (Lilium), copious. Pollination by insects, especially
sometimes solitary (Tulipa) or subumbellate bees, wasps, butterflies. Seeds are dispersed
(Gagea). Flowers showy, bisexual, by water or wind.
actinomorphic, rarely zygomorphic,
trimerous, hypogynous. Perianth with 6 Economic importance: The family is impor-
tepals, in two whorls (outer representing se- tant for its valuable ornamentals such as lily
pals, inner petals), both whorls petaloid, of- (Lilium), tulip (Tulipa) and Fritillaria (Fritil-
ten spotted or with lines, often united into lary).
tube, nectary at the base of tepal.
Androecium with 6 stamens, in 2 whorls, Phylogeny: The circumscription of the
epiphyllous, filaments free. Gynoecium with family has undergone considerable reduction
3 carpels, united, ovary superior, trilocular over the recent years. The genera formerly
with many ovules, placentation axile, styles included under the family have now been
simple with 3-lobed stigma. Fruit a removed to diverse families: Colchicum
loculicidal capsule, rarely a berry; seeds usu- (Colchicaceaewith corm), Trillium (Trillia-
ally flat, with well-developed epidermis, seed ceaerhizome, leaves whorled, perianth
Major Families of Angiosperms 475
with sepals and petals), Allium (Alliaceae bringing about certain changes in circum-
bulb, inflorescence umbellate, with scription (Ruscaceae and Convallariaceae
spathaceous bracts, smell of onion, seeds included under Asparagaceae). In 2006, 2007
black), Asphodelus and Aloe (Asphodela- revisions he has slightly enlarged the
ceaeinflorescence racemose, seeds black, circumscription of family Liliaceae by
leaves succulent, often with coloured sap), merging Tricyrtidaceae and Calochorta-
Asparagus (Asparagaceaefruit a berry, ceae, but has divided the family into four sub-
leaves rudimentary, seeds black), Ruscus families Medeoloideae (1 genus), Lilioideae
(Ruscaceaeleaves scarious, filaments (9 genera), Tricyrtidoideae (4 genera) and
connate), the last four were taken under a Calochortoideae (1 genus). The narrow
separate order Asparagales along with circumscription of the family was first
several other families, in the recent APG II suggested by Dahlgren (1985), and forms a
and APweb classifications. Thorne had monophyletic group as confirmed by the
earlier (1999, 2000) included these four cladistic studies of Chase et al., (1995a,
families (along with other splitters from 1995b). Cronquist, on the other hand, broad-
broadly circumscribed Liliaceae) under order ened the circumscription of the family, also
Orchidales, but has shifted (2003) these including, in addition to the above families,
together with others to order Iridales, also large family Amaryllidaceae within Liliaceae.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.42 Orchidaceae. A: Cymbidium hookeranum with leaves and flowers. B: Eria muscicola,
plant with inflorescences. Oberonia recurva. C: Epiphytic plant with ensiform leaves
and pendulous inflorescence; D: Flower ; E: Floral parts separated showing from
above downwards bract, three sepals, two lateral petals and anterior labellum. Vanda
tessellata. F: Epiphytic plant with inflorescence; G: Floral parts separated; H: Pol-
linia from behind with gland and strap; I: Pollinia from front; J: Operculum from
inside.(After Dassanayake and Fosberg, Fl. Ceylone, vol 2, 1981)
rhizomes, tuberous roots, corms or root- duced to scales, often fleshy, simple, entire,
stock, roots mycorrhizal, with multiseriate sheathing at base, sheath closed and en-
epidermis of dead cells known as velamen. circling stem, venation parallel, stipules ab-
Stems foliate or scapose, base often thick- sent, stomata tetracytic. Inflorescence
ened to form pseudobulb, aerial roots racemose, spicate or paniculate, some-
present. Leaves usually alternate, times with solitary flowers, rarely
distichous, rarely opposite, sometimes re- cleistogamous. Flowers usually bisexual,
Major Families of Angiosperms 477
***********
478 Plant Systematics
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.43 Iridaceae. Iris germanica. A: Rhizome and basal leaves; B: Flower; C: Vertical sec-
tion of flower; D: Capsule dehiscing through valves; E: Longitudinal section of
seed. Crocus vernus. F: Flower and leaves; G: Longitudinal section through entire
plant.
Iridaceous in all the characters except based on rbcL sequence (Chase et al., 1995a).
superior ovary, and hence included here only. The morphological studies, however (Chase
The family is often divided into a number of et. Al., 1995b; Stevenson and Loconte) place
tribes of which Sisyrincheae with free the family within Liliales. The combined
perianth, rhizome and undivided style studies of the two, places the family under
branches is considered to be the most Asparagales. Rudall (2001) included an
primitive (Hutchinson). Gladioleae and inferior ovary as a synapomorphy of the order,
Antholyzeae are more advanced with noting that in higher Asparagales (now
zygomorphic perianth with curved tube and reduced in APG II to only two families Alliaceae
hood-like dorsal lobe. The position of family is and Asparagaceae), there may well be a major
uncertain. Whereas Hutchinson removed it reversal to superior ovaries. Thorne earlier
to a distinct order Iridales, Takhtajan placed (1999, 2000) included Iridaceae under order
it under Orchidales, and Dahlgren and Orchidales but subsequently (2003, 2006,
Cronquist under Liliales. In the recent 2007) shifted it along with several other
classifications of APG, it is placed under a families to Iridales suborder Iridineae,
broadly circumscribed Asparagales primarily restricting Orchidales to just 6 families.
***********
480 Plant Systematics
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Major genera: Aloe (340 species), Haworthia Economic importance: Several genera in-
(55), Kniphofia (50), Bulbine (50) and cluding Aloe, Haworthia, Kniphofia and
Asphodelus (12). Gasteria are grown as ornamentals. Several
species of Aloe are used in cosmetics and as
Description: Rhizomatous herbs (rarely bul- sources of medicine.
bous), shrubs or trees often with anomalous
secondary growth, anthraquinone present. Phylogeny: The members of Asphodelaceae
Leaves in rosettes at base or tips of were earlier included under Liliaceae, but
branches, simple, usually succulent, not fi- now placed separately. Dahlgren et al., (1985)
brous, vascular bundles in a ring around mu- being the authors of first major classifica-
cilaginous parenchyma, phloem with a cap tion to recognize this and several other
of aloine cells containing coloured secre- smaller families as indicated above. They
tions, leaves sheathing at base, venation recognized two subfamilies Asphodeloideae
parallel, stipules absent. Inflorescence ra- and Alooideae. The latter is clearly mono-
ceme, spike or panicle. Flowers usually phyletic as evidenced by apomorphies of
bracteate, bisexual, hypogynous, often leaves with central gelatinous zone with
showy, trimerous. Perianth with 6 tepals, aloine layer and dimorphic karyotype.
free or slightly connate, petaloid, not spot- Asphodeloideae includes Kniphofia, which
ted. Androecium with 6 stamens, free, not lacks aloine layer and has berry fruit,
adnate to tepals, bithecous, basifixed or Bulbine which is closer to Alooideae, and
dorsifixed, dehiscence longitudinal, introrse, Asphodelus. The recognition of Alooideae
pollen grains monosulcate. Gynoecium with renders Asphodeloideae as such
Major Families of Angiosperms 481
paraphyletic (Stevens, 2003). The family is ognizes the two subfamilies under
included commonly under Asparagales Asphodelaceae. Treutlein et al., (2003) on
(Dahlgren, Takhtajan, APG II, Judd et al., the basis of chloroplast DNA sequences (rbcL,
and APweb), but Thorne (2003, 2006, 2007) matK) and from genomic finger-printing
places it under order Iridales under subor- (ISSR) concluded that generic limits around
der Asphodelineae. He like Dahlgren, rec- Aloe are decidedly unsatisfactory.
***********
482 Plant Systematics
Includes five subfamilies: Allioideae (2 genera Allium and Milula; 750 species),
Tulbaghioideae (1 genus, 22 species), Gilliesioideae (10 genera, 75 species;
incl. Nothoscordum), Agapanthoideae (1 genus, 9 species) and Narcissoideae
(Syn: Amaryllidoideae- 66 genera, 730 species). The discussion below includes
first four, Narcissoideae, the largest of all is described separately.
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
B & H, Cronquist under family Liliaceae; B & H placed Amaryllidaceae under Epigynae
Figure 13.45 Alliaceae, Subfamily Allioideae. Allium victorialis. A: Plant with bulb covered with
reticulate fibres, broadly laceolate leaves and scape; B: Upper part of scape with
inflorescence; C: Tepals with stamens; D; Capsule with long style. A. humile.
E: Plant with scape and inflorescence; F: Tepals with stamens; G: Capsule.
H: Tepal and stamens of A. roylei showing 2-toothed inner filaments.
***********
484 Plant Systematics
Figure 13.46 Alliaceae, subfamily Narcissoideae. Crinum asiaticum. A: Plant with inflorescence;
B: Flower with elongated perianth tube without corona. Hymenocallis narcissifolia.
C: Inflorescence with a part of scape; D: Longitudinal section of flower showing
staminal corona. Ixiolirion tataricum (now Ixiliriaceae). E: Inflorescence; F: Dehisc-
ing capsule; G: Seed. H: Vertical section of flower of Narcissus poeticus.
Description: Perennial herbs having bulb spider lily (Hymenocallis) and amaryllis
with contractile roots, stem reduced, vessel- (Hippeastrum).
elements with scalariform perforations,
Leaves mostly basal, alternate, mostly lin- Phylogeny: The group had been tradition-
ear or strap shaped, sometimes petiolate, ally circumscribed to include scapigerous
base sheathing, venation parallel, stipules plants with spathaceous bracts in inflores-
absent. Inflorescence usually scapigerous, cence and inferior ovary and regarded as
cymose, often umbellate clusters or solitary, independent family Amaryllidaceae. Hutch-
flowers often subtended by spathaceous inson had also included genera with supe-
bracts. Flowers bracteate, showy, bisexual, rior ovary (present Allioideae) under
actinomorphic or zygomorphic, epigynous. Amaryllidaceae. Cronquist had subse-
Perianth 6, in two whorls (outer represent- quently (1981, 1988) merged Amaryllida-
ing sepals, inner petals), both whorls petaloid, ceae with Liliaceae. In the recent years a
often united into tube, sometimes with a co- number of distinct families have been seg-
rona on throat of perianth tube. Androecium regated, as indicated above. The clade is
with 6 stamens, in 2 whorls, epiphyllous, fila- closely related to Alliaceae in umbellate in-
ments free, sometimes expanded and florescence subtended by spathaceous
connate forming staminal corona bracts, bulbs, and the presence of scape.
(Hymenocallis, Pancratium). Gynoecium with Monophyly of the clade is supported by infe-
3 united carpels, ovary inferior, trilocular rior ovary, amaryllid alkaloids and rbcL se-
with many ovules, placentation axile, styles quences (Chase et al., 1995a). The recent
simple with 3-lobed stigma, nectaries cladistic analysis has resulted in optionally
present in septa of ovary. Fruit a loculicidal merging all families with umbellate inflo-
capsule, rarely a berry; seeds usually black, rescence (Agapanthaceae, Amaryllidaceae
with small curved embryo, endosperm fleshy. and Alliaceae) and choosing Alliaceae as the
Pollination by insects and birds. Seeds are priority name in APG II and APweb, as indi-
dispersed by wind or water. cated above. Judd et al. (2002) recognize
group as independent family. Thorne (2003)
Economic importance: The subfamily is includes it under Alliaceae in subfamily
important for its valuable ornamentals such Amaryllidoideae, changed to Narcissoideae
as daffodils (Narcissus), swamp lily (Crinum), in 2006, 2007 revisions.
***********
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
B & H Yucca (and others with superior ovary) under Liliaceae (series Coronarieae), Agave (and
others with inferior ovary) under Amaryllidaceae (series Epigynae)
486 Plant Systematics
Figure 13.47 Agavaceae. A: Yucca aloifolia with a number of developing inflorescences. B: Part of
inflorescence of Y. filamentosa. Agave americana. C: Plant with inflorescence;
D: Stamen with versatile anther; E: Vertical section of flower; F: Transverse
section of ovary.
Salient features: Large herbs, shrubs or nate, simple in rosettes, succulent, margin
trees with usually rosettes of leaves, leaves entire or spinose-serrate, tip with sharp
succulent with sharp spine at tip, fibrous, spine, venation parallel, with thick tough
inflorescence paniculate, flowers bisexual, fibres, base sheathing. Inflorescence usu-
perianth 6, free or connate, stamens 6, of- ally terminal raceme or panicle. Flowers
ten adnate to perianth, ovary inferior or su- usually bisexual, actinomorphic, trimerous.
perior, 3-chambered, nectaries in septa of Perianth with 6 tepals, free (Yucca) or
ovary, fruit a capsule or berry, seed coat connate into tube (Agave), petaloid, not spot-
black, bimodal karyotype 5 large and 25 ted, usually white or yellow. Androecium
small chromosomes. with 6 stamens, longer than perianth
(Agave) or shorter (Furcraea), free, anthers
Major genera: Agave (240 species), Yucca bithecous, basifixed (Doryanthes) or
(40), Furcraea (20) and Polianthes (13). dorsifixed (Beschorneria), dehiscence by lon-
gitudinal slits, introrse. Gynoecium with 3
Description: Large rhizomatous herbs, united carpels, ovary superior (Yucca) or in-
shrubs or trees with basal or terminal ro- ferior (Agave), 3-locular with axile
settes of leaves, stems with anomalous sec- placentation; ovules many, anatropous,
ondary growth, calcium oxalate crystals and nectaries in septa of ovary, style short or long,
steroidal saponins present. Leaves alter- stigma minute. Fruit a loculicidal capsule;
Major Families of Angiosperms 487
seeds flat, black. Bimodal karyotype with 5 1988) circumscribed the family Agavaceae
large and 25 small chromosomes. Pollina- more broadly also to include genera which
tion by moths (Yucca by moth Tegeticula), oth- have now been removed to Dracaenaceae,
ers by bats (Agave, some species) or birds Nolinaceae, and Laxmanniaceae (incl.
(Beschornea). Seed dispersal by wind or ani- Lomandraceae). Such a broadly defined fam-
mals. ily is heterogenous, united by woody habit
and clearly polyphyletic (Dahlgren et al.,
Economic importance: Several species such 1985; Rudall et al., 1997). The family is also
as Agave sisalana (sisal hemp), A. characterized by bimodal karyotype, also
heteracantha (Istle fibre or Mexican fibre), A. shared by genera Hosta (placed in Hostaceae;
morrisii (Keratto fibre), are important sources Hesperocallidaceae by Thorne, 1999),
of fibre. A few species of Agave are fermented Camassia and Chlorogalum (both placed un-
to produce tequila and mescal. The species der Hyacinthaceae by Thorne, 1999). Rudall
of both Agave and Yucca are used in the et al., (1997) advocated their transfer to fam-
manufacture of oral contraceptives. Several ily Agavaceae, a suggestion incorporated by
species of Agave, Yucca and Polianthes (P. Judd et al. (2002) and Thorne (2003, 2006,
tuberosa- tube rose) are also used as 2007). Judd et al. have recognized only 2
ornamentals. subfamiliesYuccoideae and Agavoideae.
Thorne recognized 4 subfamilies, adding
Phylogeny: The members of the family were Chlorogaloideae (Camassia, Chlorogalum,
earlier placed in Liliaceae and Hastingia and Schoenolirion) and
Amaryllidaceae and were later removed to a Hesperocallidoideae (Hesperocallis and
separate family to include members with su- Hosta). Monophyly of the family is supported
perior ovary (removed from Liliaceae) and by phenotypic and DNA characters (Bogler
inferior ovary (removed from Amaryllidaceae) and Simpson, 1996). The family is closely
representing advanced tribes in the respec- related to Hyacinthaceae. APweb (2008) rec-
tive families (Hutchinson, 1973), and lack- ognizes 5 groups (generic groups with no for-
ing bulb, having arborescent habit, and in- mal names). This grouping received 100 per
florescence racemose (not an umbel). cent support in three- and four-gene trees
Hutchinson (1973) and Cronquist (1981, (Chase et al., 2000a; Fay et al., 2000).
***********
2. Costaceae 7. Juncales
3. Dasypogonales (B) 1. Thurniaceae
1. Dasypogonaceae 2. Juncaceae
4. Bromeliales (B) 3. Cyperaceae
1. Bromeliaceae 8. Restionales
2. Rapateaceae 2. Anarthriaceae
5. Typhales 3. Restionaceae
1. Typhaceae 4. Hopkinsiaceae (B)
6. Xyridales 5. Lyginiaceae (B)
6. Centrolepidaceae
Suborder 1. Xyridineae
1. Xyridaceae 9.. Poales
2. Hydatellaceae (B) 1. Flagellariaceae
2. Eriocaulineae 2. Joinvilleaceae
3. Ecdeiocoleaceae
1. Eriocaulaceae
4. Poaceae
2. Mayacaceae
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Woody shrubs or trees, (Hyphaene, Nypa), with prominent scars of
trunk with scars of fallen leaves, leaves fallen leaves, sometimes spiny due to modi-
large, fan-shaped or pinnately compound, fied leaves roots or exposed fibres, some-
with sheathing bases, inflorescence times rhizomatous, tannins and polyphenols
paniculate, spathes often present, flowers often present, vascular bundles with hard
small. fibrous sheath, apical bud well protected by
leaf sheaths. Leaves alternate, usually form-
Major genera: Calamus (350 species), Bactris ing a terminal crown, petiolate (petiole of-
(180), Pinanga (120), Licuala (105), ten with a flap called hastula at base), with
Daemonorops (100), Areca (60) and Phoenix pinnate (feather palms) or palmate (fan
(17). palms) segments, sometimes pinnately or
twice pinnately compound, plicate (folded like
Description: Trees or shrubs with a fan), blades rarely entire (Licuala); leaf
unbranched trunk, rarely branched segments folded V-shaped (induplicate) or
Major Families of Angiosperms 489
Economic importance: The family is of great cabbage palm (Sabal). Various species of Ca-
economic importance. Most useful member lamus are source of commercial cane used
is Coconut palm (Cocos nucifera), with almost in furniture and polo sticks.
every part put to use. Mesocarp of the fruit is
the source of coir fibre, the seed endosperm Phylogeny: In spite of being very large and
(copra) yielding coconut oil, and the leaves diverse, and often divided into numerous
used in thatching, basket making and a va- subgroups, the family is distinct, easily rec-
riety of toys and decoration articles. Palm oil ognized and monophyletic. APweb (2005) rec-
is extracted from Elaeis guineensis). Sago, a ognizes 5 subfamilies: Calamoideae,
major source of carbohydrate food is obtained Nypoideae, Coryphoideae, Ceroxyloideae and
from Metroxylon sagu (sago palm) and some Arecoideae. Thorne ( 2007) adds sixth
species of Arenga and Caryota. Palm wine Phytelephoideae segragated from
(toddy) is obtained from species of Borassus Ceroxyloideae. Uhl et al., (1995) carried out
and Caryota. Fibre is also extracted from many cladistic analysis of the family using mor-
species of palms particularly belonging to phological data as well as cpDNA restriction
Raphia (raffia), Caryota (kitul fibre) and site analysis and found support for placement
Leopoldinia (Piassava fibre). Dates are ob- of Nypa (Nypoideae) a sister of rest of the
tained from Date palm (Phoenix dactylifera). palms. More recent studies of Asmussen et
Vegetable ivory is obtained from the seeds of al., (2000) indicated that Nypoideae +
ivory nut palm (Phytelephas macrocarpa) and Calamoideae (strong support) + the rest of
was once used for buttons and as a substi- the family (moderate support) form a basal
tute for real ivory. Waxes are obtained from trichotomy; other characters support these
Copernicia (carnauba wax) and Ceroxylon. Be- general relationships. However, other work
tel nut are obtained from Areca catechu of Af- suggests that details of the relationships of
rica and Southeast Asia. The family also con- Nypoideae and Calamoideae to the rest of
tributes a large number of ornamentals such the family are unclear, and some morpho-
as Royal palm (Roystonea regia), fishtail palm logical groupings are not supported by mo-
(Caryota), Chinese fan palm (Livistona), and lecular data (Hahn 2002).
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herbs with succulent stems, (petals) coloured, flowers bisexual, trimerous,
nodes swollen, leaves with closed basal sheath, in axils of spathaceous bracts, filaments
outer perianth whorl (sepals) green, inner usually hairy, ovary superior, 3-chambered.
Major Families of Angiosperms 491
Fifure 13.49 Commelinaceae. Tradescantia virginiana. A: Plant with flowers; B: Vertical section
of flower; C: Flower with sepals and gynoecium; D: Stamen with hairy filament;
E: Moniliform staminal hair; F: Transverse section of ovary showing one ovule in
each chamber; G: Seed with aril. Commelina paludosa. H: Plant with flowers; I: Flower;
J: Transverse section of ovary. C. kurzii. K: Flower; L: Stamen with large anther in
different views; M: One of the lateral stamens; N: Staminode. (A-E, after Hutchinson,
Fam. Fl. Pl, ed. 3, 1973; H-J, after Polunin and Stainton, Fl. Himal, 1984)
Major genera: Commelina (170 species), (blue, violet or white) free (Tradescantia,) or
Tradescantia (70), Aneilema (65), Murdannia connate into a tube (Cyanotis, Zebrina), per-
(50), Cyanotis (50), Dichorisandra (30) and ishing soon after anthesis, imbricate, crum-
Zebrina (4). pled in bud. Androecium with 6 stamens
(a few often reduced to staminodes), in
Description: Annual or perennial herbs, 2 whorls, filaments free, often hairy with
rarely climbers (Streptolirion) with commonly simple or moniliform hairs, sometimes
succulent stems and swollen nodes, often adnate to petals, connective often flattened,
with mucilage cells or canals containing anthers bithecous, dehiscence by longitu-
raphides. Leaves alternate, simple, entire, dinal slits, rarely by apical pores
flat or folded V-shaped in cross section, leaf (Dichorisanda), pollen grains monosulcate.
sheath closed at base, venation parallel, sto- Gynoecium with 3 carpels, united, ovary
mata tetracytic, stipules absent. Inflores- superior, trilocular with 1-few orthotropous
cence a helicoid cyme at the end of stem in or anatropous ovules, placentation axile,
leaf axil, sometimes solitary, subtended by styles simple with 3-lobed or capitate stigma.
spathaceous bracts. Flowers bisexual (rarely Fruit a loculicidal capsule, rarely a berry;
unisexual) actinomorphic (zygomorphic in seeds with aril, endosperm present, mealy.
Commelina), hypogynous. Perianth 6, in two
whorls, outer representing sepals, inner pet- Economic importance: The family is impor-
als. Sepals green and free. Petals coloured tant for its valuable ornamentals such as
492 Plant Systematics
***********
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Large herbs with Description: Large usually tree-like peren-
pseudostems formed by leaf sheaths, leaves nial herbs with pseudostems formed from
large with thick midrib, parallel venation, overlapping leaf sheaths, with laticifers,
flowers unisexual, inflorescence subtended rhizomatous. Leaves large, spirally ar-
by large spathaceous bracts, corolla 2-lipped, ranged, simple, entire, margin often torn and
stamens 5 (sixth rudimentary), carpels 3, blade appearing pinnate, venation parallel
ovary inferior, 3-locular, ovules numerous, with stout midrib, sheathing at base. Inflo-
fruit fleshy berry with numerous small black rescence a panicle-like cyme with one or
seeds. more spathes, axis arising from basal rhizome
and growing up through pseudostem. Flow-
Major genera: Musa (34 species) and Ensete ers unisexual (plant monoecious), male
(6). within upper bracts, female in clusters
Major Families of Angiosperms 493
Figure 13.50 Musaceae. Musa Paradisiaca. subsp. sapientum (A-C, F, G) A: Plant with inflores-
cence and split old leaves; B: Young plant; C: Apical portion of inflorescence;
D: Male flower of M. rubra; E: Female flower of M. rubra; F: Vertical section through
bisexual flower; G: Fruit partially opened to show edible berry sliced at top. Ensete
edule. H: Bisexual flower; I: Fruit; J: Seed; K: Transverse section of seed showing
pit of hilum.
within lower bracts. Perianth 6 in two whorls, in many tropical countries. Manila hemp or
petaloid. Sepals 3, adnate to 2 petals, narrowly Abaca obtained from fibres of M. textilis is
tubular, soon splitting on one side, variously used in making ropes and cordage. Inset or
toothed at apex. Petals 3, somewhat 2-lipped, Abyssinian banana (Ensete ventricosa) is cul-
2 adnate with sepals, 1 free. Androecium with tivated for its fibre and for food; the stem pulp
5 fertile stamens and 1 forming staminode, and young shoots are eaten cooked. Some
adnate to petals, filaments free, anthers dwarf cultivars of Musa (M. acuminata Dwarf
linear, bithecous, dehiscence by longitudinal Cavendish) are often grown as greenhouse
slits, pollen sticky. Gynoecium with 3 united plants in temperate climates.
carpels, ovary inferior, 3-locular, ovules
many, placentation axile, style filiform, Phylogeny: The family is usually placed in
stigma 3-lobed. Fruit elongated berry Zingiberales (Cronquist, Dahlgren, APG II,
containing numerous seeds, fruits forming APweb) along with Cannaceae, Zingibera-
compact bunches; seed with copious and ceae, Marantaceae and other closely related
small embryo. families. The genus Heliconia, earlier placed
in this family has been removed to a sepa-
Economic importance: Banana (Musa rate family Heliconiaceae (Thorne, APG II,
paradisiaca subsp. sapientum) is a staple food APweb) or placed under Strelitziaceae
494 Plant Systematics
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb
Figure 13.51 Zingiberaceae. Zingiber officinale. A: Plant with inflorescence; B: Flower; C: Rhi-
zome. D: Flower of Roscoea alpina. Aframomum laurentii. E: Inflorescence; F: Leaf.
Alpinia nutans. G: Plant with inflorescence; H: Flower; I: Vertical section of flower;
J: Transverse section of fruit. K: Longitudinal section of seed of Amomum.
Major Families of Angiosperms 495
being Zingibereae). Kress et al., (2001, 2002) adnate to filament and forming tube), and
has redefined the classification of the fam- recognizing two additional subfamilies
ily, recognizing four subfamilies: distribut- Siphonochiloideae (single genus
ing most genera of the three tribes Siphonochilusrhizome fleshy, vertical; in-
(Costoideae has already been removed as florescence a raceme, bracteoles 0) and
distinct family) among two subfamilies Tamijioideae (single monotypic genus
Alpinoideae (rhizome fleshy, lateral stami- Tamijia flagellaris the only species; Rhizome
nodes of outer whorl very small or 0, labellum fibrous; placentation parietal). Two genes
formed by the two staminodes of the inner analyses by these authors indicated strong
whorl alone, fruit usually indehiscent, en- support for Siphonochiloideae being sister
dosperm without starch) and Zingiberoideae to other three, and Tamijioideae to the other
(rhizomes fibrous, lateral staminodes of two Alpinioideae + Zingiberoideae. Thorne
outer whorl also free from labellum, labellum (2006, 2007) and Stevens (2008) follow this .
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herbaceous perennials, distinct midrib containing air canals, alter-
leaves broad, sheathing at base, flowers nate, spirally arranged, simple, venation par-
showy, bisexual, trimerous, perianth allel, petiole sheathing the stem, stipules
petaloid, stamens petaloid, only one fertile, and ligule absent. Inflorescence a terminal
ovary inferior, style flat with marginal raceme, panicle, or spike of commonly 2-flow-
stigma, fruit covered with warts. ered cincinni; axis 3-angled in section with
3-ranked bracts, each bract associated with
Major genera: Single genus Canna (10 spe- each 2-flowered (rarely 1-flowered) cincinnus.
cies) Flowers showy, bisexual, zygomorphic,
epigynous, with a bract and a bracteole. Peri-
Description: Perennial herbs with under- anth 6, in two whorls (outer representing
ground rhizome. Stem with mucilage canals. sepals, inner petals). Sepals 3 free, green or
Leaves large, spirally arranged, broad, with purple, persistent in fruit. Petals 3, connate
Major Families of Angiosperms 497
Figure 13.52 Cannaceae. Canna indica. A: Plant with leaves and inflorescence; B: Open flower
showing petaloid staminodes, half anther and tip of style; C: Fertile stamen with
half petaloid staminode and half anther; D: Transverse section of ovary showing
axile placentation and ovary wall covered with warts; E: Dehiscing capsule covered
with warts; F: Seed.
at base and adnate to staminal column. brids are grown as garden ornamentals. The
Androecium with 6 stamens, in 2 whorls, starch from rhizome of C. edulis (Queensland
connate and adnate to petals, three outer Arrowroot) is used as diet for infants as it is
modified into petaloid imbricate staminodes, easily digestible.
of 3 inner 2 modified into petaloid
staminodes and the third with one anther Phylogeny: The family is closely related
lobe fertile and other modified into petaloid with other families such as Zingiberaceae,
staminode, pollen grains inaperturate. Gyn- Musaceae, Marantaceae and
oecium with 3 united carpels, ovary inferior, Strelitziaceae, usually placed under order
trilocular with many ovules, placentation Zingiberales, differing from Zingiberaceae
axile, styles simple, petaloid with marginal in lacking ligule. Thorne (2003, 2006, 2007)
stigma. Fruit a capsule covered with warts, prefers name Cannales for the order, plac-
dehiscing by collapse of the pericarp; seed ing the family Cannaceae under suborder
spherical, black, with tuft of hairs (modified Cannineae. Takhtajan (1997) has narrowly
aril) with straight embryo, endosperm hard, circumscribed Cannales, to include
perisperm present. Most species self polli- Cannaceae and Marantaceae (suborder
nated. Seeds often dispersed by water. Cannineae of Thorne), Zingiberales re-
stricted to include only Zingiberaceae and
Economic importance: Various species of Costaceae. Lowiaceae is removed to
Canna especially C. indica and various hy- Lowiales and Musaceae together
498 Plant Systematics
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Tufted herbs, leaves small, trimerous. Perianth with 6 tepals, in
grass-like, sometimes reduced to basal two whorls, free, green brown or black, rarely
sheath, perianth 6, in two whorls, stamens scarious, inner sometimes smaller
6, pollen in tetrads, ovary superior, (Marsippospermum). Androecium with usu-
placentation axile, stigmas 3, fruit a capsule. ally 6 stamens, rarely 3 (Voladeria), opposite
the tepals, free, anthers bilocular, basifixed,
Major genera: Juncus (260 species), Luzula dehiscence by longitudinal slits, introrse,
(65), Oxychloe (7) and Distichia (3). pollen in tetrads, monoporate. Gynoecium
with 3 united carpels, ovary superior,
Description: Perennial or annual tufted placentation axile, sometimes parietal
herbs, often with rhizomes, stems cylindri- (Marsippospermum), ovules many, styles 3 or
cal and solid, usually foliate only at base. 1, stigmas 3. Fruit a loculicidal capsule;
Leaves alternate, mostly basal, 3-ranked, seeds spherical or flat, sometimes pointed
rarely distichous (Distichia), cylindrical or and spindle-shaped (Marsippospermum), with
flat, sheathing at base or reduced only to small straight embryo, endosperm present.
sheath, sheath open or closed, blade grass- Wind pollinated.
like, entire, venation parallel, stipules and
ligule absent. Inflorescence with cymes Economic importance: Family is not of
clustered in heads or forming panicles, much commercial use. Split rushes used in
corymbs or even solitary (Andesia). Flowers basket making are taken from stems of
usually bisexual, sometimes unisexual Juncus effusus (soft rush) and J. squarosus
(Distichia) and plants dioecious, rarely (heath rush). Juncio, used in binding, is de-
monoecious (Rostkovia), actinomorphic, very rived from Juncus maritimus (sea rush). A few
Major Families of Angiosperms 499
Figure 13.53 Juncaceae. Juncus articulatus. A: A plant with inflorescences; B: Flower; C: Peri-
anth and stamens; D: Gynoecium; E: Capsule; F: Seeds. Luzula albida. G: Plant
with inflorescence; H: Flower; I: Vertical section of flower; J: Gynoecium; K: De-
hiscing fruit; L: Seed; M: Longitudinal section of seed. N: Flower of Juncus
sphacelatus.
species of Juncus and Luzula are grown as tives of Juncaceae. The family is connected
ornamentals. to Cyperaceae through genus Oreobolus, the
most primitive genus of that family. Muasya
Phylogeny: Juncaceae are closely related et al., (1998) suggest that Oxychloe
to Liliaceae (Hutchinson, 1973; Heywood, (Juncaceae) is sister to Cyperaceae, with
1978) representing reduced forms derived moderate support, other Juncaceae are also
from that stock. Prionium which was earlier basal and paraphyletic, but with poor sup-
considered to be the most primitive genus port, while Prionium is sister to the whole
of the family Juncaceae, linking it to clade, with good support. A study by Plunkett
Liliaceae, has now been removed to a dis- et al., (1995) placed Oxychloe within
tinct family Prioniaceae (Thorne, 1999, Cyperaceae. The relationships of the latter
2003), or under Thurniaceae (APG II; Apweb, genus in particular are still unclear. Accord-
2008; Judd et al., 2008; Thorne, 2006, 2007). ing to the studies of Bremer (2002)
Takhtajan (1997) places Prionium under Thurniaceae (including Prionium) are sister
Juncaceae. Restionaceae, which have be- to Juncaceae plus Cyperaceae, (Oxychloe not
come totally dioecious, form the closest rela- included) with strong support.
***********
500 Plant Systematics
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herbs, stems often 3-an- pous, placentation basal, style with 2-3
gled, solid, leaves 3-ranked, containing branches, stigmas 2 or 3. Fruit a nut (often
silica bodies, sheaths closed, ligule absent, called achene but the latter is strictly de-
glumes present, flower subtended by a sin- rived from a single carpel), sometimes en-
gle bract, lodicules absent, perianth repre- closed in a utricle (Carex), with often per-
sented by bristles, scale or absent, ovary su- sistent style and associated with persistent
perior with single ovule, fruit a nut. perianth bristles, bifacial or trigonous; seed
erect, embryo small, endosperm conspicu-
Major genera: Carex (1800 species), Cyperus ous, mealy or fleshy.
(580), Fimbristylis (290), Scirpus (280),
Rhynchospora (240), Scleria (200) and Economic importance: Various species of
Eleocharis (190). Cyperaceae are useful in different ways.
Stems of Cyperus papyrus (papyrus or paper
Description: Annual or perennial herbs, weed) were much used in ancient times for
usually rhizomatous, stems mostly 3-angled, making paper, and is now commonly grown
solid. Leaves alternate, 3-ranked, often as an ornamental. The stems of Cladium
crowded at the base of stem, simple, grass- effusum (saw grass) are also source of cheap
like, with silica bodies, entire or serrulate, paper. Stems and leaves of Carex brizoides
venation parallel, stipules and ligule absent, and Lepironia mucronata are used for pack-
sheath closed, stomata with dumbbell- ing and basket work. Underground organs of
shaped guard cells. Inflorescence consist- Cyperus esculentus (tigernut, Zulu nut or
ing of small spikes (sometimes called rush nut), Scirpus tuberosus and Eleocharis
spikelet but different from spikelet of tuberosa (matai, Chinese water chest nut)
grasses which has two basal glumes, and are used as food. The stems of Scirpus totara
each floret enclosed in a lemma and a palea) are used for making canoes and rafts and
each often subtended by a bract (prophyll) and those of S. lacustris for basketwork, mats and
bearing (on the axis called rachilla) spirally chair seats.
arranged (Cladium) or distichous (Cyperus)
bracts (glumes) , each subtending one flower; Phylogeny: The family is considered to be
small spikes (spikelets) aggregated in monophyletic, connected to Juncaceae
spikes, panicles or even umbels, the whole through genus Oreobolus, the most primi-
inflorescence subtended by one or more usu- tive genus (Hutchinson, 1973). Muasya et
ally leaf-like involucral bracts. Flowers very al., (1998) suggest that Oxychloe (Juncaceae)
small, bisexual (Cyperus, Scirpus) or uni- is sister to Cyperaceae, with moderate sup-
sexual (Scleria), subtended by bract (glume), port. Plunkett et al. (1995) placed Oxychloe
female flower often with second bract sur- within Cyperaceae. The relationships of the
rounding the pistil and forming sac-like latter genus in particular are still unclear.
perigonium. Perianth represented by bris- According to the studies of Bremer (2002)
tles, sometimes scales (Oreobolus, Thurniaceae (including Prionium) are sister
Lipocarpha), or even absent (Bulbostylis, to Juncaceae plus Cyperaceae, with strong
Scirpus). Androecium with 3 stamens, some- support. He did not include Oxychloe under
times more (6 in Arthrostylis; 12-22 in Cyperaceae. According to him Cyperaceae,
Evandra), free, anthers bithecous, basifixed, Juncaceae and Thurniaceae form a well de-
oblong or linear, dehiscence by longitudinal fined cyperid clade. The family is tradition-
slits, pollen grains uniporate, in pseu- ally divided into 3 subfamilies (Engler):
domonad (out of the four microspores, three Scirpoideae, Rhynchosporoideae and
degenerate and form the part of fourth fer- Caricoideae. Thorne (2006, 2007), however
tile forming pollen grain). Gynoecium with recognizes only two: Mapanioideae and
2 (Kyllinga) or 3 (Cyperus) united carpels, Caricoideae. Hutchinson divided the family
ovary superior, unilocular, ovule 1, anatro- into 8 tribes. Simpson et al., (2003) based on
502 Plant Systematics
the pollen and plastid DNA sequence data 2004, 2006). According to Ford et al. (2006),
concluded that Mapanioideae (tribe Carex itself includes a few other genera, and
Hypolytreae of Hutchinson) are sister to the conventional wisdom in which a highly com-
rest of the family, while Carex, sister to pound inflorescence is the plesiomorphic
Eriophorum is embedded in the other clade. condition for the genus, taxa with simple
Within Caricoideae, especially tribe branches being derived, perhaps several
Cariceae, phylogenetic studies are begin- times, seems the exact opposite of what
ning to resolve relationships (Starr et al. actually happened.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
B & H as Gramineae
Salient features: Herbs or shrubs with Description: Herbs or rarely woody shrubs or
hollow internodes and jointed stems, leaves trees (bamboos), often with rhizomes, stolons
distichous with distinct sheath enclosing or runners, frequently tillering (branching
the stem and linear blade with often a ligule from ground level) to form tufts of stems, stem
at their junction, spikelet with two glumes, (culm) with hollow internodes and jointed
flowers reduced, enclosed in lemma and swollen nodes, with silica bodies. Leaves
palea, perianth represented by lodicules, distichous, alternate, simple, with basal
ovary superior, stigma feathery, fruit sheath surrounding internode and free linear
caryopsis. blade, a ligule often present at the junction
of blade and sheath, margins of sheath
Major genera: Poa (500 species), Panicum overlapping but not fused, sometimes united
(450), Festuca (430), Paspalum (350), Stipa into a tube, venation parallel, leaf margins
(300), Bromus (160), Elymus (150), Sporobolus often rolled especially on drying, stipules
(140), Bambusa (125), Setaria (100), absent. Inflorescence of spikelets arranged
Arundinaria (50) and Chloris (50). in racemes, panicles (Poa, Avena) or spikes
Major Families of Angiosperms 503
Figure 13.55 Poaceae. Zea mays. A: Plant with terminal male inflorescence and axillary female
inflorescence (Cob); B: Vertical section of female spikelet; C: Paired male spikelets;
D: Male spikelet opened to show two fertile florets. Poa annua. E: Plant in flower;
F: Spikelet. Avena sativa. G: Inflorescence; H: Spikelet opened; I: Fertile floret with
awned lemma.
(Triticum, Hordeum). Each spikelet with 2 very rarely 1 (Anomochloa), stigmas often
(rarely 1 as in Monera) glumes enclosing 1 feathery. Fruit a caryopsis, rarely nut berry
(Hordeum, Nardus) or more (Poa, Triticum) or utricle; seed fused with pericarp, embryo
florets borne on an axis called rachilla, straight, endosperm starchy.
usually in 2 rows. Flowers small, reduced
(floret), zygomorphic (due to only 2 lodicules Economic importance: The family is of great
displaced on one side), rarely actinomorphic, economic importance, being a source of
usually bisexual rarely unisexual (Zea), important cereals such as rice (Oryza
hypogynous, enclosed in lemma and palea sativa), wheat (Triticum aestivum) and corn or
(prophyll), lemma often bearing dorsal (Avena), maize (Zea mays). The family also includes
subterminal (Triticum) or terminal (Hordeum) other food crops such as barley (Hordeum
awn, or awn absent (Poa). Perianth absent or vulgare), pearl millet (Pennisetum glaucum),
represented by 2 (rarely 3, as in Bambusa and oats (Avena sativa), rye (Secale cereale) and
Streptochaeta) lodicules. Androecium with sorghum (Sorghum vulgare). Grasses such as
usually 3, sometimes 6 (Oryza) or more Cynodon, Axonopus and Agrostis are
(Arundinaria), rarely 1-2 (Leptureae) stamens, extensively used in lawns and turfs.
filaments free, anthers bithecous, basifixed, Andropogon, Agropyron, and Phleum are major
usually sagittate, dehiscence longitudinal, forage grasses. Sugarcane (Saccharum
pollen grains monoporate. Gynoecium officinarum) is the major source of
variously interpreted as bicarpellary, commercial sugar. Bamboos are employed
tricarpellary (with one reduced style), in big way in construction work, wickerwork
syncarpous or monocarpellary, unilocular and thatching in different parts of the world.
with 1 ovule, placentation basal, styles 2, Young bamboo shoots are used as food and
sometimes 3 (Bamboos and Streptochaeta), often pickled. Lemon grass (Cymbopogon)
504 Plant Systematics
leaves are distilled to yield essential oil for Centostecoideae occupies an isolated
imparting citronella scent. Grains of Coix position although related to both
lacryma-jobi (Jobs tears) are use as necklace Bambusoideae and Panicoideae, and includes
beads. Roots of Vetiveria zizanioides (vetivar broad-leaved herbs with single- to several-
grass) are used for making fragrant cooling flowered spikelets. Studies of Clark et al.,
pads and extraction of vetiver oil. (1995) and Soreng and Davis (1998) suggest
that Arundinoideae, Chloridoideae and
Phylogeny: Although a very large assemblage Panicoideae form a well supported clade (often
Poaceae are easily recognized and form a called PACC clade) based on embryological and
monophyletic group, as supported by DNA data. Arundinoideae as generally defined
morphology (lodicules, spikelets with glumes, are not monophyletic, and many of their
lemma and palea, fruit caryopsis) and DNA members such as Aristida, Phragmites, etc.
characters( rbcL and ndhF sequences). are spread over in other two subfamilies.
Cronquist (1988) places Poaceae and Chloridoideae and Panicoideae are generally
Cyperaceae under the same order Cyperales, found to be monophyletic. Stevens (APWeb,
but similar morphology of two is believed to 2003) and Thorne (2003) listed 12 subfamilies
be due to convergent evolution, Cyperaceae under Poaceae: Anomochlooideae,
being more closely related to Juncaceae (Judd Pharoideae, Puelioideae, Panicoideae,
et al., 1999). The studies of Bremer (2002), Arundinoideae, Centothecoideae, Chlori-
using rbcL and taq analyses found strong doideae, Aristidoideae, Danthonioideae (six
support for Cyperaceae, Juncaceae, and forming PACCAD clade), Bambusoideae,
Thurniaceae forming cyperid clade and Ehrhartoideae, Pooideae (BEP clade).
Poaceae along with other families forming a Subsequently (APWeb 2008, Thorne 2006,
graminoid clade. 2007), however, they have added 13th
The nature of gynoecium in this family has Micrairoideae, probably sister to the whole
been a matter of controversy. Most early clade (Thorne prefers Chondrosoideae to
authors including Haeckel (1883), Rendle Chloridoideae). There is great diversity in
(1930) and Diels (1936) considered it to the morphology and biochemistry of C4
consist of a single carpel terminated by 2-3 photosynthesis in the family (Kellogg, 2000).
branched stigma. Lotsy (1911), Weatherwax Studies based on gene expression (Ambrose
(1929) and Arber (1934) considered that it et al., 2000) indicate that the palea and
represents tricarpellary ovary having evolved perhaps even lemma are calycine in nature
from an ovary with parietal placentation, a and the lodicules are corolline. Clark and
view supported by studies on floral anatomy Triplett (2006) discuss relationships within
(Belk, 1939). Others believe that gynoecium Bambusoideae, previously divided into the
consists of 2-3 carpels (depending on the woody Bambuseae and the herbaceous
number of stigmas visible; Cronquist 1988, Olyreae. However, the woody temperate
Woodland, 1991). bamboo group may be sister to the rest of the
The family is variously classified by family. The duplication of AP1/FUL gene,
different authors. Hutchinson (1973) apparently in stem-group Poaceae, may be
recognized two subfamilies Pooideae (with 24 involved in the evolution of the spikelet
tribes) and Panicoideae (with 3 tribes). (Preston & Kellogg 2006). Malcomber and
Heywood (1978) recognized 6 subfamilies Kellogg (2005) suggest that there has been
(Bambusoideae, Centostecoideae (should be duplication of LOFSEP genes within Poaceae,
Centothecoideae as the genus Centosteca on while there has been a duplication of the
which the name is based is listed neither in whole genome in a clade that includes at
Willis, 1973 nor Hutchinson, 1973), least Zea, Oryza, Hordeum and Sorghum
Arundinoideae, Chloridoideae, Panicoideae (Schlueter et al. 2004). Developmental gene
and Pooideae), further subdivided to include duplication and subsequent functional
50 tribes. Of these subfamilies, divergence seem to have played a very
Major Families of Angiosperms 505
important role in allowing the development there has been very extensive duplication of
of the baroque diversity of inflorescences in genes - API, AG and SEP families - but not in
the family (Malcomber et al. 2006). Indeed, the AP3 lineage (Zahn et al. 2005a).
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Perennial rhizomatous arranged, carpels 5, free, ovules many, fruit
herbs or shrubs, leaves alternate, compound etaerio of follicles.
or lobed, without stipules, flowers large, bi-
sexual, sepals 5, green and leathery, petals Major genera: Single genus Paeonia
5-10, coloured, stamens many, centrifugally (33 species).
506 Plant Systematics
Figure 13.56 Paeoniaceae. Paeonia emodi. A: Branch with flower; B: Flower bud with leafy bracts;
C: Flower magnified to show numerous stamens; D: Petal; E: Stamen; F: Ovary
covered with hairs; G: Follicle splitting; H: Follicle dehisced to expose seeds;
I: Seed with aril.
Description: Perennial herbs or soft shrubs, etaerio of leathery follicles, dehiscing by adax-
with tubers or rhizomes, stem base covered ial suture, seeds globose, with aril, red turn-
with scale-like sheaths. Leaves alternate, ing black at maturity, with prominent
petiolate, pinnately to ternately compound to umbilicus, embryo small, endosperm copious.
highly dissected or lobed, stipules absent.
Inflorescence usually with solitary flowers Economic importance: The family contrib-
with leafy bracts at base. Flowers Large, utes many ornamentals cultivated for attrac-
showy, bisexual, hypogynous, almost globu- tive flowers. The flowers of Paeonia officinalis
lar in appearance. Calyx with 5 sepals, free, may reach 15 cm in diameter.
green, unequal, imbricate, subfoliaceous,
persistent. Corolla with 5 petals, sometimes Phylogeny: The genus Paeonia was once in-
6-10, large, free, orbicular, subequal, imbri- cluded under family Ranunculaceae, from
cate. Androecium with numerous stamens, which, however, it is distinct in having 5 large
centrifugal, attached to fleshy disc present chromosomes, centrifugal (and not centrip-
around the carpels, free, spirally arranged, etal) stamens, persistent sepals, disc and
bithecous, basifixed, dehiscence by longitu- seeds with aril. The separation of the genus
dinal slits, extrorse. Gynoecium with into a distinct family was first advocated by
5 carpels, sometimes upto 2, borne on fleshy Worsdell (1908) on the basis of anatomical
disc, free, fleshy, ovary superior, unilocular, evidence. Corner (1946) considered the cen-
ovule 2-many, placentation marginal, stigma trifugal development of stamens of consider-
sessile, thick, falcate, 2-lipped. Fruit an able importance in phylogeny and advocated
Major Families of Angiosperms 507
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.57 Berberidaceae. Berberis vulgaris. A: Twig with leaves, flowers and spines; B: Flower;
C: Longitudinal section of flower; D: Fruit; E: Seed. B. stenophylla. F: Stamen with
anther dehiscing by two valves; G: Ovary; H: Longitudinal section of ovary (F-H after
Hutchinson, 1973).
longer shoots sometimes modified into style very short, stigma almost sessile,
spines (Berberis), leaves entire or spinose- sometimes 3-lobed. Fruit usually a berry,
serrate, venation pinnate or palmate, reticu- rarely a dehiscent capsule (Jeffersonia), or
late, stipules absent. Inflorescence a ra- an achene (Achlys); seeds with small embryo,
ceme, panicle (Nandina) or even solitary endosperm copious, sometimes with aril.
(Jeffersonia). Flowers bisexual, Pollination by insects. Dispersal by birds or
actinomorphic, hypogynous. Calyx with 3 to animals. Bladder-like capsule of Leontice dis-
6 sepals, free, imbricate, green (Podophyl- persed by wind. In Caulophyllum the fleshy
lum) or petaloid (Berberis), rarely absent blue seeds burst through the ovary wall and
(Achlys). Corolla with 3-6 petals, sometimes develop in completely exposed state.
more, free, inner whorl often in the form of
petaliferous nectaries, rarely absent Economic importance: Many species of Ber-
(Achlys). Androecium with usually 6 sta- beris (B. buxifolia, B. darwinii), Mahonia (M.
mens, opposite the petals, sometimes upto aquifolium) and Nandina (N. domestica) are
18 (Podophyllum) or reduced to 4 (Epimedium), commonly grown as ornamentals. The rhi-
anthers bithecous, dehiscence by longitu- zomes of Podophyllum hexandrum (May apple)
dinal valves opening from base upwards, yield a resin which is used as a purgative,
sometimes by longitudinal slits (Nandina, and incorporated in many laxative pills.
Podophyllum), pollen grains usually
tricolpate. Gynoecium with 1 carpel, ovary Phylogeny: The family includes genera
superior, unilocular with many ovules, which are quite distinct from one another.
sometimes with 1 ovule (Nandina), Chapman (1936) on the basis of carpellary
anatropous, placentation parietal or basal, anatomy proposed that Berberidaceae and
Major Families of Angiosperms 509
Ranunculaceae arose by parallel evolution and included all the 4 families under order
from a proranalian complex, and also doubted Berberidales. The recent classifications
whether any existing families may be treat them under the same family
related as the immediate predecessors of Berberidaceae which is considered to be
Berberidaceae. She also demonstrated that monophyletic as supported by morphology
single carpel of this family arose from and DNA data. The family is placed under
ancestors having 3 carpels with axile order Ranunculales along with
placentation, and that two carpels were Ranunculaceae and other related families
suppressed and their placentae moved in most of the recent systems. Nandina is
towards one side of the ovary, and the locules considered to be sister to rest of the family
lost by compression, resulting in a unilocular and often included under separate subfamily
condition. According to Kim & Jansen (1998) Nandinoideae, and rest of the genera under
the gynoecia of the n = 6 clade alone Berberidoideae. A number of distinct clades
(Epimedium, Podophyllum, Jeffersonia) being are recognized within Berberidoideae
derived from two carpels. Hutchinson (1973) (Loconte, 1993). Leontice, Gymnospermum and
separated the genera included here under Caulophyllum are characterized by
three families: Berberidaceae (including petaliferous nectaries (staminodes), pollen
woody genera Berberis and Mahonia in which with reticulate sculpturing and basal
anthers open by flaps), Nandinaceae (single placentation. Similarly Epimedium,
woody genus with 2-3 times pinnate Vancouveria and Jeffersonia are distinct in
compound leaves and anthers opening by the sense that large fleshy blue seed
slits) and Podophyllaceae (including develops in an exposed condition. Thorne
herbaceous genera). Interestingly, whereas (2003, 2006, 2007) recogniszes 4 subfamilies
former two were included under order under Berberidaceae: Nandinoideae, Berbe-
Berberidales, the last family was included ridoideae, Leonticoideae and Podophylloi-
under Ranales along with Ranunculaceae, deae. APweb (2008) recognizes only two,
Nymphaeaceae, Ceratophyllaceae, etc. monogeneric Nandinoideae and Berberidoi-
Takhtajan also segregated Ranzaniaceae deae including rest of the genera.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.58 Ranunculaceae. Ranunculus muricatus. A: A portion of plant with flowers and fruits;
B: Vertical section of flower; C: Petal with nectary; D: Stamen; E: Achene. Consolida
ajacis. F: A branch with young inflorescence and an expanded inflorescence;
G: Vertical section of flower; H: Stamen; I: Dehiscing follicle.(A-E, after Sharma
and Kachroo, Fl. Jammu, 1983).
Salient features: Herbs, leaves with sheath- (Naravelia). Inflorescence of solitary flowers
ing base, blade often divided, flowers bisexual, (Anemone) or cymose, sometimes racemes
petals with nectary, stamens and carpels nu- (Delphinium) or panicles (Clematis natans).
merous, free and spirally arranged, ovary su- Flowers bracteate (Clematis) or ebracteate
perior, fruit a follicle or achene. (Anemone) bisexual (unisexual in Thalictrum),
actinomorphic (zygomorphic in Delphinium)
Major genera: Ranunculus (400 species), with spirally arranged stamens and carpels,
Clematis (200), Delphinium (250), Aconitum hypogynous. Calyx with 5 (4 in Clematis) or
(245), Anemone (150) and Thalictrum (100). many sepals, free, one (Delphinium) or all five
(Aquilegia) sepals often produced into spur at
Description: Mostly herbs, sometimes woody base. Corolla with 5 or many (Helleborus)
climbers (Clematis), or shrubs (Xanthorhiza). petals, free, often with nectaries or
Stem with scattered or several rings of represented only by nectaries (Delphinium),
vascular bundles. Hairs simple. Leaves sometimes produced into spur which enters
usually alternate (opposite in Clematis), the spur formed by sepal, sometimes
undivided (Caltha) palmately lobed perianth is not differentiated (Anemone,
(Ranunculus) or compound (Clematis), stipules Helleborus) into sepals and petals.
absent (present in Thalictrum). Tendrils for Androecium with many stamens, free,
support may sometimes be formed from spirally arranged, anthers often extrorse,
petiole (Clematis) or terminal leaflet dehiscence longitudinal. Gynoecium with
Major Families of Angiosperms 511
single (Consolida) or many free (Delphinium) tis, with 3-merous perianth, vessels with
carpels (syncarpous in Nigella), unilocular scalariform perforations, ovule with two in-
(multilocular in Nigella) with single teguments, and fleshy follicles occupies a
(Ranunculus) or many (Delphinium) ovules, unique basal position along with
placentation marginal or basal, rarely axile Glaucidium, as evidenced by molecular data.
(Nigella), ovary superior, style 1, sometimes Both these genera were removed by
feathery (Clematis), stigma 1. Fruit an Takhtajan (1997) into distinct families
achene (Ranunculus), follicle (Delphinium), Hydrastidaceae and Glaucidiaceae, under
berry (Actaea) or rarely a capsule (Nigella); Hydrastidales and Glaucidiales, respec-
seed with small embryo, endosperm present. tively. Thorne (2003) includes Glaucidia-
Pollination usually by insects. Clematis and ceae under Paeoniales, but Hydrastidaceae
Anemone, which lack nectaries are near Ranunculaceae under Ranunculales.
pollinated by pollen-gathering insects. Studies based on cpDNA restriction sites
Ranunculus, Delphinium, etc., with nectaries and sequence data (Hoot, 1995) suggest that
by usually bees. Some species of Thalictrum these two genera along with other genera
are wind pollinated. Achenes may be placed in Thalictroideae form basal
provided with hairs for wind dispersal paraphyletic group, thus justifying retain-
(Clematis), with tubercles or hooked spines ing all these genera within Ranunculaceae.
for dispersal by animals (Ranunculus). These basal genera retain plesiomorphies
Berries of Actaea are mainly dispersed by such as presence of berberine, yellow creep-
birds. ing rhizomes, small hairs and small chro-
mosomes, linking them to Berberidaceae.
Economic importance: Delphinium (Lark- The separation of follicle bearing genera
spur), Anemone (windflower), Aquilegia under Helleboraceae by Hutchinson is re-
(columbine), Ranunculus (buttercup), and jected by the evidence from floral anatomy.
Helleborus (hellebore) are grown as The reduction in the number of ovules per
ornamentals. Aconitum napellus yields aco- carpel and the evolution of achenes has oc-
nite, whereas A. ferox is source of bikh poi- curred several times within the family. The
son. Roots of Hydrastis (removed by separation is also negated by nucleotide se-
Takhtajan to Hydrastidaceae) are used for quences (Hoot, 1995). The petals with
stomach ailments. Seeds of Nigella sativa nectary are often considered to represent
(Nigella, black seed, Kalonji) are used as fla- petaliferous nectaries, the petals being ab-
vouring, medicinally to treat asthma, bron- sent. According to Erbar et al., (1999) they
chitis and rheumatism. Thymoquinone ex- are interpreted as being derived from sta-
tracted from the seeds of this species have mens, and that stamens are secondarily
recently been found to be useful in treatment spiral. Thorne (2003, 2006) divides family
of cancer. Ranunculaceae into 3 subfamilies:
Coptidoideae, Isopyroideae (Thalictroideae
Phylogeny: The family is largely considered in 2007 revision) and Ranunculoideae.
to be a monophyletic group as supported by Stevens (APweb, 2006) recognizes 5, adding
morphology and molecular evidence. Hydras- Hydrastidoideae and Glaucidioideae.
***********
512 Plant Systematics
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herb, sap usually milky merous stamens (Papaver), sometimes 4 and
or coloured, flowers bisexual, sepals opposite the petals (Corydalis) or 6 in two bun-
caducous, petals crumpled in bud, stamens dles of 3 each (Dicentra), anthers bithecous,
numerous in several whorls, ovary superior, (in Fumaria of the 6 stamens 2 are with
unilocular, fruit a capsule. bithecous anthers, 4 with monothecous an-
thers) dehiscence longitudinal, pollen grains
Major Genera: Corydalis (380 species), Pa- tricolpate to polyporate. Gynoecium with
paver (100), Fumaria (50), Argemone (30) and usually 2 united carpels, sometimes loosely
Eschscholzia (10). united and becoming free in fruit
(Platystemon), ovary superior, unilocular
Description: Annual or perennial herbs, with parietal placentation, sometimes be-
rarely soft-wooded shrubs (Dendromecon), or coming multilocular due to intrusion of pla-
small trees (Bocconia), vascular bundles of- centae, ovules numerous, sometimes 1
ten in several rings, white or coloured la- (Baccopia), anatropous, stigma discoid or
tex. Hairs simple, sometimes barbellate lobed, sometimes capitate. Fruit a capsule
(Cathcartia). Leaves usually alternate, floral dehiscing by valves or splitting into 1-seeded
leaves sometimes subopposite (Platystemon), segments, sometimes nut (Fumaria); seeds
simple, often much dissected, sometimes small, sometimes with aril, embryo minute,
entire (Dendromecon) or spinose (Argemone), endosperm copious, fleshy or oily. Pollina-
venation reticulate, stipules absent. Inflo- tion usually by insects, rarely wind
rescence usually with solitary flowers, (Bocconia). Seeds are dispersed by explosive
scapigerous in Sanguinaria, racemose in opening of capsules, those with aril often by
Eomecon, paniculate in Bocconia. Flowers ants.
bisexual, actinomorphic, sometimes
zygomorphic (Fumaria, Corydalis). Calyx with Economic importance: Many species of Pa-
2 sepals, sometimes 3, caducous or paver (poppy), Eschscholzia (Californian
calyptrate, free, usually enclosing bud. Co- poppy), Argemone (Prickly poppy), Corydalis
rolla with usually 4 petals, sometimes 6 or (harlequin), Sanguinaria (blood-root) and
even 8-12 (Sanguinaria), free, usually in two Dicentra (Dutchmans breeches, bleeding
whorls, two outer sometimes saccate or heart) are grown as ornamentals. Opium
spurred containing nectary (Fumaria, Cory- poppy (Papaver somniferum) is the most valu-
dalis), inner sometimes connivent at tip able member yielding opium (obtained from
(Fumaria), imbricate, often crumpled in bud, the latex of capsules) and its derivatives
absent in Bocconia. Androecium with nu- heroin, morphine and codeine. Seeds of this
Major Families of Angiosperms 513
Figure 13.59 Papaveraceae. Papaver nudicaule. A: Plant with flowers; B: Fruit with bristly hairs.
P. rhoeas. C: Vertical section of flower; D: Gynoecium with one stamen still at-
tached, others having shed; E: Transverse section of ovary with intruded placentae;
F: Fruit with glabrous surface and broad stigmatic disc. G: Argemone ochroleuca with
flowers and a fruit towards the base with conspicuous style; H: Fruit of A. mexicana
with sessile style; I: Seed of A. mexicana.. (A-B after Polunin and Stainton, Fl.
Himal., 1984).
species do not contain opium and as such sometimes treated under distinct family
are used in baking, and also yield a drying Fumariaceae (Hutchinson, 1926, 1973;
oil. Seeds of Glaucium flavum and Argemone Lawrence, 1951; Cronquist, 1988; Dahlgren,
mexicana also yield oils used in the manu- 1989 and Takhtajan) but morphological and
facture of soaps. nucleotide sequence data supported the
monophyly of the family including these
Phylogeny: The family is considered to be genera, which are better placed under
related backwards to Helleboraceae subfamily Fumarioideae (Thorne, 2003; Judd
(Hutchinson, 1973) but with syncarpous et al., 2002). APG II also optionally include
gynoecium and parietal placentation, and Fumariaceae under Papaveraceae. There is,
very clearly forwards to Brassicaceae, which however, difference of opinion regarding basal
also has parietal placentation but with false genera. Loconte et al., (1995) proposed Platy-
septum. Genera with zygomorphic flowers, stemonoideae (Platystemon and relatives)
and with saccate or spurred petals are with numerous slightly fused carpels and free
514 Plant Systematics
stigmas as the basal clade. Hoot et al., (1997) Papaveroideae, Eschscholzioideae, Chelidon-
on the other hand, on the basis of morphology ioideae, Hypecoideae and Fumarioideae.
and nucleotide sequence, regarded The family was earlier placed closer to
Pteridophyllum as sister to the remaining Brassicaceae and Capparaceae, due to the
genera. This monotypic genus has been parietal placentation, but has now been
removed to a distinct family Pteridophyllaceae shifted closer to (or under) Ranunculales,
by Takhtajan (1997), Thorne ( 2003, 2006, the shift supported by chemical evidence
2007) APG II and APWeb. Thorne (2007) absence of glucosinolates and the presence
divides Papaveraceae into 5 subfamilies: of alkaloid benzylisoquinolene.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Division Magnoliophyta Magnoliophyta
Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida
Subclass Polypetalae Rosidae Rosidae Magnoliidae Hamamelididae
Series+/Superorder Calyciflorae+ Saxifraganae Rosanae Hamamelidanae Core Eudicots*
Order Rosales Rosales Saxifragales Saxifragales Saxifragales Saxifragales
B & H as Saxifrageae
Major Families of Angiosperms 515
Figure 13.60 Saxifragaceae. Bergenia ciliata. A: Plant with basal leaves and corymbose panicle
carried on a long scape; B: Flower with petals distinctly larger than nearly cup-
shaped calyx. Saxifraga flagellaris. C: Plant with thick stolons, small leaves and few
flowers; D: Flower with almost free sepals, both pedicel and sepals glandular.
E: Flower with calyx and gynoecium, petals and stamens removed; F: Stamen;
G: Transverse section of ovary with axile placentation. Astilbe rivularis. H: Portion
of bipinnate leaf and a paniculate inflorescence alongside; I: Flower lacking petals,
with 5 stamens and 2 carpels; J: Seed, tailed at both ends.
Salient features: Perennial herbs, leaves Description: Perennial herbs, vessel ele-
alternate, gland-toothed, stipules absent, ments with simple perforations, often with
flowers actinomorphic, usually perigynous, tannins, sometimes cyanogenic. Leaves
sepals and petals 5 each, stamens 5 to 10, alternate, usually in basal rosette, simple
carpel 2, united, ovary superior, placentation or pinnately or palmately compound, vena-
axile, fruit a capsule. tion pinnate or palmate, reticulate, stipules
absent or represented by expanded margins
Major genera: Saxifraga (310 species), of petiole base. Inflorescence racemose or
Heuchera (50), Chrysoplenium (45), Mitella cymose, rarely with solitary flowers.
(18), Astilbe (18) and Bergenia (6). Flowers bisexual, rarely unisexual, (plants
516 Plant Systematics
***********
Major Families of Angiosperms 517
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II /(APweb)
Salient features: Trees or shrubs with tan- in female flower. Gynoecium with usually 3
nin, leaves alternate, simple, entire or ser- carpels, rarely upto 12, united, ovary infe-
rate, stipules present, inflorescence cymose, rior, locules as many as carpels, placentation
female flowers usually in groups of 1-3, as- axile, ovules 2 in each chamber but only one
sociated with scaly cupule, carpels usually in whole ovary developing, pendulous,
3, ovary inferior, placentation axile, fruit a bitegmic, outer integument vascularized,
nut, closely associated with cupule. styles free, stigmas porose or expanded along
upper side of style, fertilization porogamous.
Major genera: Quercus (430 species), Fruit a nut (acorn) closely associated with
Lithocarpus (280), Castanopsis (100), Casta- and surrounded at base (Quercus) or com-
nea (12) and Fagus (8). pletely (Castanea) with cupule, cupule often
hardened and woody, sometimes spiny (Cas-
Description: Trees or shrubs, deciduous or tanea), indehiscent (Quercus) or dehiscent
evergreen, tannins present, hairs simple or by splitting of cupule like pericarp into
stellate, sometimes glandular. Leaves sim- valves (Castanea); seed single, without
ple, alternate, sometimes lobed, entire or endosperm. Flowers of Fagus and Quercus are
serrate, venation pinnate, reticulate, stip- wind pollinated, those of Castanea and
ules present, early deciduous, often narrowly Castanopsis produce strong odour and are pol-
triangular. Inflorescence cymose, male flow- linated by flies, beetles and bees. Fruits are
ers in slender catkins or spikes, females dispersed by birds and rodents.
flowers solitary or in groups of upto three,
associated with a scaly cupule formed of sev- Economic importance: Species of Castanea
eral imbricate scales, male and female flow- (chestnut) yield nuts which are eaten after
ers sometimes in the same inflorescence roasting, but have a very short shelf life,
(Castanea, Lithocarpus). Flowers small, uni- turning rancid within a few days. Fruits of
sexual (plants monoecious), actinomorphic. some species of Quercus (oak) and Fagus
Perianth with 4-6 tepals, reduced, free or (beech) are also occasionally eaten. Cork is
slightly connate, imbricate. Androecium made from the bark of Quercus suber. Wood
with 4-numerous stamens, filaments free, of several species is a source of timber used
filiform, anthers erect, bithecous, loculi of- for construction, furniture, barrels and
ten contiguous, dehiscence longitudinal, cabinetry. Several species of Quercus, Fagus,
pollen grains usually tricolporate or Castanea and Castanopsis are grown as
tricolpate, staminodes sometimes present ornamentals.
518 Plant Systematics
Figure 13.61 Fagaceae. Quercus robur. A: Branch with lobed leaves and long peduncled female
flower; B: Young shoot with male catkin; C: Male flower; D: Fruit enclosed upto
nearly half by cupule. E: Branch of Castanea sativa with long spikes each bearing
single female flower at base and numerous male flowers above, cupule spiny.
Castanopsis indica. F: Branch with several spikes; G: Fruiting spike. Lithocarpus
pachyphylla. H: Portion of branch with leaves; I: Portion of fruiting branch with nuts
in groups of three.
Phylogeny: The family is closely related to cupule has been a subject of considerable dis-
Betulaceae and the two are usually placed cussion. It is generally regarded to represent
under the same order, although Takhtajan a cymose inflorescence in which outer axes
places only Fagaceae and Nothofagaceae un- of the cyme are modified into cupule valves
der Fagales and separates Betulaceae and which bear scales or spines (Manos et al.,
others under Corylales. The family is mono- 2001). The cupules of Nothofagus (which was
phyletic as supported by morphology, cpDNA earlier placed (Hutchinson, 1973, Cronquist,
restriction sites (Manos et al., 1993) and matK 1981) under Fagaceae but now separated
sequences (Manos and Steele, 1997). Casta- under Nothofagaceae) are composed of clus-
nea, Lithocarpus and Chrysolepis have re- tered bracts and stipules and not homologous
tained numerous plesiomorphic morphologi- with the cupule of Fagaceae. Heywood (1977)
cal characters such as monoecious inflores- recognized three subfamilies under
cences, perianth better developed, exserted Fagaceae: Fagoideae, Quercoideae and
stamens and minute stigmas. The nature of Castanoideae. Fagus is sister to rest of the
Major Families of Angiosperms 519
Fagaceae and placed singly under subfamily Thorne. Thorne had earlier (1999) placed
Fagoideae. Trigonobalanus is considered sis- Betulales under Rosidae>Rosanae but has
ter to the rest of family (excluding Fagus) and subsequently (2003, 2006, 2007) shifted it to
as such removed together with Hamamelididae>Hamamelidanae. APG II
Colombobalanus and Formanodendron under and AP web prefer order name Fagales placed
fourth subfamily Trigonobalanoi-deae by under the clade Eurosids I.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II /(APweb)
Salient features: Trees or shrubs with tan- secondary veins running into serrations,
nin, bark sometimes exfoliating in thin lay- stipules present. Inflorescence a catkin,
ers, leaves alternate, simple, doubly serrate, with separate male and female inflores-
stipules present, inflorescence a catkin, cences but plant monoecious, male inflores-
male and female inflorescences distinct, cence usually pendulous, female short and
tepals 2-4, stamens 2-4, perianth absent in erect, flowers borne singly at each node of
female flower, carpels usually 2, catkin or in cymose cluster of 2-3, adhering
placentation axile, fruit a nut, surrounded to involucre of bracts and bracteoles. In
by fused bract and bracteoles. Alnus, female inflorescence has each
cymose cluster with 2 flowers associated
Major genera: Betula (55 species), Alnus (30), with 1 bract, two secondary bracteoles and 2
Carpinus (28), Corylus (15), Ostrya (10) and tertiary bracteoles all connate into woody per-
Ostryopsis (2). sistent involucre. In Betula, there are 3 fe-
male flowers in the cluster with 1 bract, 2
Description: Trees or shrubs, deciduous, bracteoles, all fused into a 3-lobed bract or
tannins present, bark smooth or scaly, with involucre. Flowers small, unisexual (plants
prominent horizontal lenticels, sometimes monoecious), actinomorphic. Perianth with
exfoliating in thin layers, hairs simple, glan- usually 2-4 tepals, rarely 1 or upto 6, reduced,
dular or peltate. Leaves simple, alternate, free, imbricate, absent in male (Coryloideae)
doubly serrate, venation pinnate, reticulate, or female flower (Betuloideae). Androecium
520 Plant Systematics
Figure 13.62 Betulaceae. Betula utilis. A: Portion of branch with male catkins, appearing before
or along with leaves; B: Branch with female spikes; C: Single stamen (second one
removed) with bracteole and forked filament separating anthers; D: Bract and lat-
eral bracteoles of male flower; E: Fused bract and bracteoles of female flower;
F: Young winged carpel; G: Nut with 2 wings and persistent styles. Alnus nitida.
H: Branch with slender male catkins towards top and ovoid female spikes lower
down; I: Male flower with 4 tepals and 4 stamens; J: Nut with 2 wings. (A-B, after
Polunin and Stainton, Fl. Himal, 1984).
with 2 (Betula) or 4 (Alnus) stamens, rarely 1 times bladder-like (Ostrya); seed solitary pen-
or upto 12 (Coryloideae), sometimes appear- dulous, embryo straight, cotyledons large,
ing many due to close association of three endosperm absent. Flowers are wind polli-
flowers, filaments free or connate at base, nated, and emerge before leaves. Winged
anthers bithecous, loculi distinct or contigu- fruits of Betula and Alnus are dispersed by
ous, dehiscence longitudinal, pollen grains wind. Large nuts of Corylus are dispersed by
usually 2-multiporate, staminodes absent in rodents.
female flower. Gynoecium with 2 united
carpels, ovary inferior, bilocular, Economic importance: Papery bark of Betula
placentation axile, ovules 2 in each cham- utilis (birch) was used as a writing surface
ber but only one in whole ovary developing, (bhojpatra) in place of paper in ancient Vedic
pendulous, unitegmic, styles free, cylindri- manuscripts; also used for roofing and um-
cal, stigma running along adaxial side of brella covers. B. lutea and B. lenta are im-
style, pistillode absent in male flower. Fruit portant hardwoods in North America provid-
a single-seeded nut or 2-winged samara of- ing wood used for plywood, boxes and turn-
ten with persistent styles, involucre of bract ery. Alnus rubra (alder) provides a valuable
and bracteoles deciduous or persistent, scaly timber which is a good imitation of ma-
and woody or enlarged and foliaceous, some- hogany. Nuts such as hazelnuts, filberts
Major Families of Angiosperms 521
from species of Corylus are edible. Many spe- winged samara) and Coryloideae (male flower
cies of Betula, Alnus, Corylus, Ostrya are without perianth, female with perianth, sta-
grown as ornamentals. mens usually more than 3, involucre folia-
ceous, nut not flattened). Nuclear ribosomal
Phylogeny: The family is closely related to ITS and rbcL sequences also support these
Fagaceae and the two are usually placed two subfamilies (Chen et al., 1999).
under the same order, although Takhtajan Hutchinson treated them as distinct fami-
places only Fagaceae and Nothofagaceae lies, also proposing that as the female flow-
under Fagales and has separated ers of Betulaceae lack perianth, the ovary
Betulaceae and others under Corylales. The is superior, and that of Corylaceae with peri-
family is usually divided into two sub- anth and ovary is inferior, a contention not
families: Betuloideae (male flowers with supported by other authors. Both groups are
perianth, female lacking perianth, stamens monophyletic, although monophyly of Ostrya
2 or 4, involucre scaly or woody, fruit 2- and Carpinus is doubtful (Yoo & Wen, 2002).
***********
Salient features: Usually trees with jointed jointed with circular sheath at nodes (switch
stems, appearing like conifers, leaves scale- habit), branches grooved, photosynthetic,
like, whorled at nodes, inflorescence catkin, sometimes aromatic (Allocasuarina), sieve-
flowers unisexual, subtended by bracts, peri- tube plastids S-type, nodes unilacunar, roots
anth absent, stamen 1, carpels 2, united, with nodules containing nitrogen-fixing bac-
ovary superior, fruit a samara, fruits aggre- teria, tannins present . Leaves whorled (4-
gated like cones. 20 in a whorl), scale-like, connate forming
a toothed sheath at each node, stipules ab-
Major genera: Allocasuarina (55 species), sent. Inflorescence forming catkins at tips
Casuarina (25), Gymnostoma (14) and of lateral branches. Flowers small, uni-
Ceuthostoma (2), often combined into single sexual (plants monoecious or dioecious),
genus Casuarina. actinomorphic, solitary in axil of each bract
of inflorescence, associated with
Description: Trees or shrubs with a weep- 2 bracteoles. Perianth absent in female
ing habit due to long slender branches, stems flower, sometimes represented by
522 Plant Systematics
Figure 13.63 Casuarinaceae. Casuarina suberba. A: Branch with male inflorescences; B: Portion
of male inflorescence; C: Male flower with single stamen; D: Portion of branch with
female inflorescences; E: Part of female inflorescence showing 3 flowers; F: Female
flower with bract, 2 small bracteoles and gynoecium with 2 long stylar branches;
G: Fruits; H: Seed with broad wing; I: Longitudinal section of seed.
1-2 vestigial scales in male flower (often in- Economic importance: The wood of several
terpreted as inner bracteoles). Androecium species is extremely hard and valued for fur-
with single stamen, anthers bithecous, niture making. Casuarina equisetifolia (red
incurved in bud, dehiscence longitudinal, beefwood) is most widely cultivated as orna-
pollen grains usually triporate. Gynoecium mental tree.
with 2 united carpels, ovary superior, bilocu-
lar with axile placentation, one often reduced Phylogeny: The family is monophyletic, as
and ovary appearing unilocular, ovules 2 but are the four genera recognized independ-
only one developing, orthotropous, bitegmic, ently or combined into Casuarina. The fam-
crassinucellate, style short with 2 linear ily is considered to be a part of the
branches. Fruits crowded into cones with Hamamelid complex, now included along
persistent bracts, fruit an indehiscent with the broadly circumscribed Rosalean
samara associated with 2 woody bracteoles complex Rosanae (Dahlgren) or Rosidae
which open like a capsule; seed with straight (Thorne, 1999 under order Casuarinales;
embryo, without endosperm. Wind polli- subsequently shifted to Hamamelididae
nated. Fruits are also dispersed by wind. >Hamamelidanae>Betulales in 2003,
Major Families of Angiosperms 523
2006 and 2007). APG II and APweb include derived from Ephedraceae. The studies of
the family under Fagales (under Eurosids), wood anatomy and floral anatomy have
shifting Hamamelidaceae and some other shown that it is sufficiently advanced,
families of the complex to Saxifragales. having undergone considerable reduction
Fagales are the core of the old Englerian, in floral features and vegetative morphol-
Amentiferae which have since been demol- ogy. The genus was split into four genera
ished, several members shifted to otherwise indicated above (Johnson and Wilson, 1993).
entirely unrelated groups within the Eudicots Gymnostoma is sister to the rest of the
(Qiu et al., 1998). The family Casuarinaceae family and has many plesiomorphous
was once considered to be the most primi- features (both carpels fertile, with 2 ovules
tive among dicots (Engler and Prantl) in each carpel).
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.64 Portulacaeae. Portulaca oleracea. A: Portion of plant with flowers; B: Flowers seen
from above; C: Flower enlarged in vertical section; D: Stamen; E: Transverse sec-
tion of ovary with free central placentation;. F: Seed; G: Embryo.
Major Families of Angiosperms 525
Salient features: Usually succulent herbs, (Portulaca oleracea) commonly growing wild
mucilaginous, roots somewhat tuberous, is frequently cultivated as pot herb. Many
leaves simple, flowers in cymes or solitary, species of Montia (Miners lettuce) were used
bisexual, sepals 2, carpels united with unilo- earlier as green salad in America. Root
cular ovary, fruit a capsule, embryo curved. stalks of Lewisia rediviva are also eaten in
America. Rose moss (Portulaca grandiflora),
Major Genera: Calandrinia (120 species), Flame flower (Talinum spp.) and Rock purs-
Portulaca (100), Claytonia (35), and Talinum lane (Calandrinia spp.) are grown as
(30). ornamentals.
Description: Annual or perennial herbs,
Phylogeny: The family Portulaceae has tra-
somewhat succulents, Mucilage cells very
ditionally been considered closely related to
common, containing betalains, often exhib-
Caryophyllaceae and Basellaceae, although
iting CAM metabolism, hairs usually simple.
the presence of betalains has often taken
Stems erect or prostrate, herbaceous. Leaves
this family away from Caryophyllaceae.
alternate or opposite, simple, usually fleshy,
Phylogeny of Portulacaceae has been a mat-
entire, often clustered at ends of branches,
ter of considerable speculation. The separa-
stipules scarious or setose, rarely absent.
tion of Basellaceae and Didiereaceae is sup-
Inflorescence cymose with few or of solitary
ported by morphological data. Cactaceae is
flowers, sometimes racemose. Flowers showy,
considered as more closely related to
bisexual, usually actinomorphic, with short
Cactaceae (although separation is supported
or elongated hypanthium. Calyx of 2 sepals,
by ITS sequence data) and Thorne (2006) has
antero-posterior, green, free or united at
accordingly shifted family under suborder
base. Corolla with usually 5 petals, rarely 4
Cactineae. Applequist and Wallace (2001) on
or 6, free, rerely united at base, imbricate,
the basis analysis of chloroplast gene ndhF
falling early. Androecium with usually as
in Portulacaceae, Basellaceae, Cactaceae,
many stamens as petals, opposite petals, fila-
and Didiereaceae concluded that the group
ments free from petals or epipetalous, dehis-
forms a monophyletic group with two major
cence longitudinal, pollen tricolpate,
clades. The first included Portulaca,
polycolpate or polyporate. Gynoecium with 2
Anacampseros and its relatives, much of
to 3 (rarely more) united carpels, ovary supe-
Talinum, Talinella, and Cactaceae; the sec-
rior or half-inferior, single chambered, with
ond, weakly supported, included the remain-
single basal ovule or several ovules on free-
ing genera of Portulacaceae, Basellaceae,
central placenta attached at the base of ovary,
and Didiereaceae. The separation of these
style simple or split above, stigma minute.
families from Portulaceae renders it
Fruit a loculicidal or circumscissile capsule;
paraphyletic. Subsequent studies of these
seeds lens-shaped, smooth, shining, embryo
authors (2006) resulted in Stevens (2007)
curved, endosperm absent, perisperm
placing only genus Portulaca in the family
present, aril sometimes developed. Pollina-
Portulaceae, separating 10 genera (incl.
tion by insects like bees, flies and beetles,
Montia, Lewisia and Phemeranthus) to
flowers opening briefly in full sunlight. Seeds
Montiaceae and two (Talinum, Talinella) to
with aril dispersed by ants, smaaler ones by
Talinaceae. Thorne who earlier (2003, 2006)
wind or water.
recognized Hectorellaceae as a distinct fam-
Economic importance: The family is of ily has in the latest revision (2007) merged
little economic importance. Purslane it with Portulacaceae.
***********
526 Plant Systematics
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
B & H as Cacteae
Salient features: Succulents, fleshy habit, Androecium with numerous stamens, free
usually spiny herbs or shrubs, spines ar- or adnate to the base of petals, bithecous,
ranged in areoles, flowers solitary, petals dehiscence longitudinal, introrse, pollen
many, stamens numerous, ovary inferior, grains tricolpate to polycolpate or polyporate.
fruit a berry. Gynoecium with 2 to numerous carpels,
united, ovary inferior, rarely semi-inferior
Major Genera: Opuntia (250 species), (Pereskia) or even superior (some species of
Mammillaria (190), Echinopsis (75), Cereus Pereskia), unilocular with numerous ovules,
(55), Rhipsalis (50) and Cleistocactus (50). placentation parietal, sometimes divided by
false septa or nearly basal (Pereskia), stig-
Description: Spiny stem succulents, herbs, mas 2 to numerous, spreading, ovules
sometimes tree-like, rarely non-succulent campylotropous, bitegmic, crassinucellate.
(but with fleshy leaves-Pereskia) or epiphytic Fruit a berry, often covered with spines and/
(Rhipsalis), stem cylindrical or angled, some- or glochids; seeds numerous, immersed in
times flattened, or even jointed, usually pho- pulp, testa often black, endosperm usually
tosynthetic, usually with vessels, some- absent, embryo usually curved. Pollination
times without vessels, usually without by insects, birds or bats. Berries are dis-
laticifers, rarely with laticifers (Coryphantha), persed by animals or birds.
plastids PIII-A type. Leaves usually borne on
long shoots and readily falling, alternate sim- Economic importance: The family is known
ple, entire with pinnate or obscure venation, for large number of ornamentals (cacti) such
leaves sometimes represented by spines, or as Opuntia (prickly pear), Mammillaria (pin-
absent, short shoots (areoles) with clusters cushion cactus), Cereus (hedge cactus),
of spines and tufts of hairs (glochids); stip- Echinopsis (sea-urchin cactus), Epiphyllum
ules absent. Inflorescence with solitary flow- (orchid cactus), Schlumbergera (Christmas
ers, usually sunk at the apex of branch and cactus) and Rhipsalis (mistletoe cactus).
thus appearing axillary, rarely in clusters Fruits of several species of Opuntia are eaten
(Pereskia). Flowers bisexual, usually raw or made into jams or syrups. Spines of
actinomorphic, with short or elongated cacti are often used as gramophone needles.
hypanthium. Perianth sequentially Lophophora contains mescaline alkaloids
intergrading from sepals to petals or all and is hallucinogenic. Cochineal dye is de-
petaloid, spirally arranged, numerous, in- rived from small insects living on members
nermost slightly coherent at base. of this family.
Major Families of Angiosperms 527
Figure 13.65 Cactaceae. Opuntia rafinesqui. A: Portion of plant with flowers and spines; B: Verti-
cal section of flower showing many stamens, inferior ovary and parietal placenta-
tion; C: Ovules with long funiculus; D: Longitudinal section of fruit; E: Longitudi-
nal section of seed. F: Carnegiea gigantea with characteristic branched habit and
ribbed stem.
Phylogeny: The family is unique in com- other two subfamilies form a well-defined
bining unspecialized floral characters with clade with solitary flowers sunken into stem
highly advanced vegetative organs. The fam- apices, inferior ovary and parietal
ily is commonly divided into three sub- placentation. Opuntioideae are mono-
families: Pereskioideae, Opuntioideae and phyletic based on synapomorphies of pres-
Cactoideae (Heywood, 1978). Thorne (1999, ence of glochids on the areoles, seeds coat
2003, 2006, 2007) places the two genera of with bony aril and cpDNA characters.
Pereskoideae under two separate sub- Cactoideae similarly has monophyly sup-
families Pereskioideae (Pereskia) and ported by extreme reduction of leaves and a
Maihuenioideae (Maihuenia), thus recogniz- deletion of the rpoCl intron in chloroplast
ing 4 subfamilies in all. Pereskia retains genome (Wallace and Gibson, 2002). The af-
several plesiomorphic features such as non- finities of Cactaceae have largely remained
succulent stems, well-developed persistent uncertain. It is now considered to be closely
leaves, cymose inflorescence, superior ovary related to Portulacaceae, Phytolaccaceae,
(in some species) with basal placentation, Basellaceae, Halophytaceae, Didiereaceae
and is sister to rest of the Cactaceae. The and Aizoaceae. Phylogenetic relationships
528 Plant Systematics
within Cactaceae are still rather unclear, for the basal Pereskia. The distinctive
with chloroplast and nuclear genes some- Blossfeldia was sister to the other
times suggesting different major clades. A Cactoideae. Edwards et al. (2005) confirm
recent study by Nyffeler (2002) found rather that Pereskia s.l. is probably paraphyletic,
weak support for the subfamilies and per- which allows them to shed new light on the
haps rather distressingly no clear monophyly evolution of the cactus habit
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Swollen nodes, wood to reddish-brown when cut. Roots branched
quickly turning reddish-brown when cut, taprrot, sometimes thick and tuberous
leaves usually opposite, sometimes unequal, (Mirabilis) or fusiform (Boerhavia). Leaves
without stipules, vascular bundles in con- opposite, leaves of a pair equal or unequal,
centric rings, flowers bisexual with con- simple, usually entire, net-veined, without
spicuous bracts, bracts often enlarged, peri- stipules. Inflorescence with usually cymose
anth 5 with long tube, stamens usually 5, clusters, usually dichasial, subsequently
carpel single, ovule single, basal, fruit an monochasial. Flowers bisexual, complete,
achene or nut. actinomorphic, subtended by an involucre of
3 (Bougainvillea) to 5 (Mirabilis) bracts which
Major genera: Neea (80 species), Guapira are often enlarged and coloured
(70), Mirabilis (45), Pisonia (40), Abronia (30), (Bougainvillea), sometimes reduced to small
Boerhavia (20) and Bougainvillea. teeth (Boerhavia), hypogynous, flowers rarely
unisexual (Pisonia). Perianth with 5 united
Description: Herbs (Boerhavia, Mirabilis) of- tepals, campanulate (Boerhavia) or more
ten with swollen nodes, shrubs (Pisonia) or commonly tubular, lower part of tube persist-
woody climbers (Boungainvillea), rarely small ent and surrounding fruit (and known as
trees (Pisonia alba), usually with concentric anthocarp), distal part usually petal-like and
rings of vascular bundles, containing falling off. Androecium with 3-5 (Mirabilis),
betalains and raphide crystals of calcium 5-10 (Bougainvillea) , or more, filaments free
oxalate, woody oxidising, i.e., turning orange or connate, equal or unequal, anthers
Major Families of Angiosperms 529
Figure 13.66 Nyctaginaceae. Bougainvillea glabra A: Portion of plant with flowers; C: Carpel;
B: Longitudinal section of flower of B. spectabilis showing perianth and stamens.
Mirabilis jalapa D: A portion of branch with flowers; E: Longitudinal section of of
ovary with subtending bracts; F: Anthocarp. Boerhavia repens G: Portion of branch
with flowers and fruits; H: Longitudinal section of flower to show perianth,
stamens and ovary; I: Anthocarp.
bithecous, basifixed or dorsifixed, dehiscence linated by bees, butterflies, moths and birds.
longitudinal or by lateral slits, pollen grains Dispersal in species with fleshy perianth
tricolpate or polyporate. Gynoecium with occurs by birds, those with glands and
single carpel, ovary superior, but often ap- hooked hairs by exozoochory.
pearing inferior due to closely associated
persistent part of perianth tube, placentation Economic importance: Species Bougainvillea
basal, ovule single, anatropous or are commonly grown as hedges and for cov-
campylotropous, style long and filiform, ering walls and fences. Species of Mirabilis
stigma capitate, nectar disc present. Fruit (Four OClock) are grown as garden
an achene or nut, usually enclosed in leath- ornamentals. Boerhavia repens is used as
ery or fleshy persistent perianth tube, lat- medicinal plant as a diuretic. Fisonia
ter winged or or ribbed, often covered with aculeata is used as hedge plant.
glandular hairs; seed small with unequal
cotyledons, curved embryo, endosperm ab- Phylogeny: Hiemerl (1934) divided the
sent, replaced by perisperm. Flowers are pol- family into 5 tribes: first four with glabrous
530 Plant Systematics
ovary and stamens connate at base, and the (Aizoaceae) were confirmed by the studies
fifth Leacastereae with hairy ovary and of D. Soltis et al. (2000). Monophyly of the
distinct stamens. Of the first four, Miralileae family found moderate support in the studies
has straight embryo and large cotyledons, of Douglas and Manos (2007). Stevens (2008)
Pisoneae with shrubby habit, Boldoeae with recognises three more or less monophyletic
herbaceous habit and alternate leaves, and groups within the family: Leucasterae (4
Colignoneae with herbaceous habit and genera), Boldoeae (3 genera) and the Rest
opposite leas; all three have curved embryo. (24-25 genera). The South American
The family is closely related to Phytolacca- Leucastereae and Mexican-Central
ceae in anatomical features, and ovary with American Boldoeae are successively sister
single carpel. The close affinities of the two taxa to the remainder of the family, positions
families together with genus Delosperma that have moderate to strong support.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
B & H as Ficoideae
Salient features: Succulent herbs or small from base, sometimes mat-forming, vascu-
shrubs, usually with many stems, leaves lar bundles in concentric rings, with
with large bladder-like cells in epidermis, betalains, alkaloids and raphide crystals of
petals several of staminodal origin, stamens calcium oxalate, usually with CAM metabo-
usually many, carpels 2 or more, united, fruit lism. Leaves alternate or opposite, leaves of
a capsule, embryo curved, surrounded by a pair equal (Sesuvium) or strongly unequal
mealy endosperm. (Trianthema) with branches arising from axil
of smaller leaf, simple, usually entire and
Major genera: Conophytum (250 species), succulent, veins somewhat obscure, stipules
Delosperma (150), Lapranthus (150), scarious or fringed, rarely absent, epidermis
Drosanthemum (100), Antimima (60), Lithops with large bladder-like cells. Inflorescence
(40) Mesembranthemum (30), Trianthema (20), of cymose axillary cymes, in pairs or solitary,
Sesuvium (8), . terminal or axillary. Flowers bisexual, sub-
tended by a pair of laciniate bracts often fused
Description: Succulent herbs or small with calyx tube, regular, with hypanthium.
shrubs, commonly with numerous stems Calyx with 5 connate sepals, imbricate,
Major Families of Angiosperms 531
Figure 13.67 Aizoaceae. Trianthema portulacastrum. A: Portion of plant with flowers; B: Flower
with two bracts and horned calyx lobes; C: Capsule; D: Seed with papilae. Sesuvium
verrucosum E: Portion of plant with flowers F: Flower with horny calyx. G: Seed of
S. maritimum.(A,B after Maheshwari, Fl. Delhi, 1963; D-G after Godfrey & Wooten,
Aq.Wetland Pl. SE US, Vol. 2, 1981).
often with horny protuberance on back below Dorotheanthus and Carpobrotus are grown as
tip, persistent in fruit, margin scarious. Co- garden ornamentals. Some like Lithops
rolla absent, represented by petaloid (stone plant) and Titanopsis are grown as
staminodes, numerous. Androecium with 5 curiosities. Tetragonia is used as vegetable.
to numerous stamens, many outer modified Some species help stabilize sand dunes and
into petaloid staminodes, fertile stamens 5 road banks.
or more, free or with connate filaments, aris-
ing from hypanthium, pollen tricolpate. Phylogeny: The family is monophyletic,
Gynoecium with 2-5 united carpels, ovary represented by distinct clades, often
superior or inferior, 2-5 locular, with axile, recognised as four subfamilies Aizooideae,
parietal or basal placentation, ovules 1 to Mesembranthemoideae, Sesuvioideae and
many, anatropous to campylotropous, disc Ruschioideae (Klak et al., 2004; Stevens,
usually present. Fruit a capsule, loculicidal, 2008; Thorne, 2007). Members with
septicidal, or circumscissile, sometimes numerous petaloid staminodes, placed in
berry, rarely a nut; seed with large curved Mesembryanthemoideae and Ruschioideae
embryo, sometimes with aril, endosperm ab- form a monophyletic group (Hartmann,
sent, replaced by perisperm. Flowers are pol- 1993). Sesuvioideae (Sesuvium and related
linated by bees, wasps, butterflies and bee- genera) probably form a clade based on
tles. Seeds are dispersed by wind or water. circumscissile capsules and arillate seeds.
Genus Mesembryanthemum was previously
Economic importance: Species of circumscribed to include more than 1000
Mesembranthemum (ice plant), Lapranthus, species, but has subsequently been split into
532 Plant Systematics
numerous genera, a bulk of genera shifted to divide the genus further into much
to Ruschioideae. Brown (1920) had originally smaller genera, an attempt that would result
split the genus into more than 100 genera, in many poorly characterized genera. A
a suggestion not incorporated by Pax and detailed phylogenetic analysis of the family
Hoffmann (1934), but subsequently followed by Klak et al. (2007) has resulted in better
by authors as more material became resolution affinities within the the
avalable. There have been further attempts subfamily Mesembryanthemoideae.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herbs or small shrubs usu- unilacunar, vascular bundles in concentric
ally in saline habitats, often covered with rings, included phloem usually present,
white bloom, stipules absent, cuticle waxes sieve-tube plastids PIII-C type, containing
with platelets, flowers small often greenish, betalains instead of anthocyanins, cuticle
bracts and perianth herbaceous, stamens waxes with platelets. Leaves minute to large,
opposite perianth lobes, all fertile and simi- alternate, rarely opposite (Salicornia,
lar, carpels 2, ovary superior, fruit a nut Nitrophila), petiolate to sessile, simple, entire
enclosed in persistent perianth, embryo or variously lobed, sometimes fleshy or re-
curved. duced to scales, stipules absent. Inflores-
cence cymose, spikes or panicles, sometimes
Major genera: Atriplex (300 species), Salsola catkins. Flowers small, greenish, bisexual,
(120), Chemnopodium (105), Suaeda (100) and rarely unisexual and plants dioecious (Grayia)
Salicornia (35). or monoecious, actinomorphic, hypogynous.
Perianth (represented by sepals petals absent)
Descriptiomn: Herbs or small shrubs, rarely with 2-5 united tepals, rarely free (Salsola),
small trees (Haloxylon), usually in saline habi- herbaceous, usually persistent and
tats, sometimes succulent (Salicornia), often accrescent in fruit, and appendaged with tu-
covered with whitish bloom, nodes bercles, spines or wings, sometimes absent.
Major Families of Angiosperms 533
Figure 13.68 Chenopodiaceae. Chenopodium album. A: Portion of plant in flower; B: Flower par-
tially opened with stamens still included; C: Fruit from above; D: Seed. Beta
vulgaris. E: Flower; F: cluster of Fruits. Suaeda maritima. G: Portion of plant in flower;
H: Flower.
Cunoud et al. (2002) found Chenopodiaceae al. (2002), however, consider it sister to
were perhaps monophyletic, but the branch Nyctaginaceae, although with weak support.
collapsed in a strict consensus tree; the Thorne (2003) placed Sarcobataceae near
sampling was moderately good, but only one Nyctaginaceae under suborder Phyto-
gene - matK - was sequenced and analysed. laccineae, whereas Chenopodiaceae along
Sarcobatus has long been acknowledged an with Amaranthaceae placed under Chenopo-
anomalous member of this family, e.g. by diineae. Subsequently (2006) he enlarged the
Bentham and Hooker (1880), who presented latter order by including the third family
it as a monogeneric tribe. Behnke (1997) Achatocarpaceae, earlier included under
proposes raising it to family rank, because monotypic suborder Achatocarpineae. He
sieve-element plastid form supports recent earlier (2006) divided Chenopodiaceae into
chloroplast DNA sequencing studies in four subfamilies: Chenopodioideae, Micro-
portraying it nearer Phytolaccaceae than teoideae, Salicornioideae and Salsoloideae,
Chenopodiaceae. The studies of Cunoud et adding fifth .Suaedoideae in 2007 revision.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II/(APweb)
Salient features: Herbs or small shrubs, nodes unilacunar, vascular bundles in con-
stipules absent, flowers small often green- centric rings, included phloem usually
ish, subtended by scarious or papery bracts, present, sieve-tube plastids PIII-A type, con-
perianth papery, stamens opposite perianth taining betalains instead of anthocyanins.
lobes, slightly connate at base, staminodes Leaves alternate or opposite, herbaceous,
present, carpels 2-3, ovary superior, fruit a sometimes aggregated at base (Ptilotus), peti-
capsule or utricle or nutlet, enclosed in per- olate to sessile, simple, entire, stipules ab-
sistent perianth, embryo curved. sent. Inflorescence cymose, spikes or pani-
cles, with conspicuous persistent bracts and
Major genera: Gomphrena (120 species), bracteoles. Flowers small, greenish, bi-
Alternanthera (100), Iresine (80), Amaranthus sexual (rarely unisexual), actinomorphic,
(60) and Celosia (55). hypogynous, cyclic. Perianth (represented by
sepals petals absent) with 3-5 free or united
Description: Herbs or small shrubs, very tepals, usually persistent, sometimes
rarely climbing, often with swollen nodes, accrescent (Ptilotus) in fruit, usually dry and
Major Families of Angiosperms 535
Figure 13.69 Amaranthaceae. Amaranthus spinosus. A: Part of plant in flower; B: Cymose clus-
ter with one male and several female flowers; C: Female flower with 3 carpels;
D: Mature fruit of same with enlarged persistent perianth; E: Mature utricle devel-
oped from flower with 2 carpels, perianth removed; F: Seed. Achyranthes aspera.
G: Part of plant in flower; H: Flower with bract and perianth removed; I: Androecium
showing stamens and staminodes; J: Bract; K: Bracteoles; L: Utricle with persis-
tent style. (A, G-L, after Sharma and Kachroo, Fl. Jammu, 1983).
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herbs with swollen nodes, (Paronychia), secondary veins often obscure.
leaves opposite, inflorescence usually a Inflorescence typically a dichasial cyme,
dichasial cyme, corolla caryophyllaceous, rarely solitary flowers. Flowers bisexual,
stamens ten or lesser, obdiplostemonous, rarely unisexual (Lychnis alba), actino-
ovary unilocular with free central morphic, hypogynous. Calyx with 5 sepals,
placentation, superior, fruit a capsule open- free (Stellaria) or connate (Dianthus, Silene).
ing by valves or teeth. Corolla with 5 petals, usually differentiated
into a distinct claw and a limb, with an
Major genera: Silene (700 species), Dianthus appendaged joint between the two, often
(300), Arenaria (200), Gypsophila (150), notched or deeply bilobed at tip. Androecium
Minuartia (150), Stellaria (150) and Cerastium with 10 or lesser number of stamens,
(100). obdiplostemonous, free, anthers bithecous,
dehiscence longitudinal, pollen grains
Description: Annual or perennial herbs with tricolpate to polyporate. Gynoecium with 2-5
swollen nodes, anthocyanins present. Leaves (2 Dianthus, 3 Silene, 4 Sagina, 3-5 Stellaria)
opposite, simple, bases of opposite leaves of- united carpels (syncarpous), unilocular with
ten connected, stipules absent or scarious many ovules, placentation free central, ovary
Major Families of Angiosperms 537
Figure 13.70 Caryophyllaceae. Stellaria media. A: A part of plant in flower; B: Flower showing
hairy sepals and deeply bilobed petals; C: Flower with sepals and petals removed
to show stamens and pistil; D: Bilobed petal; E: Mature capsule with persistent
calyx; F: Capsule dehiscing through valves; G: Seed. Silene conoidea. H: A portion
of plant in flower; I: Capsule with half of calyx removed to show dehiscence through
teeth and remnants of petals and stamens; J: Seed. (After Sharma and Kachroo,
Fl. Jammu, 1983).
superior, styles 2-5. Fruit a loculicidal cap- have been the subject of considerable debate,
sule opening by valves or teeth, rarely a utri- several authors (Mabry, 1963) advocating
cle (Paronychia). Seeds many, ornamented on separation of betalain containing families
surface, embryo curved, endosperm absent, into a separate order, and those lacking
often replaced by perisperm. betalains (but containing anthocyanins as
in Caryophyllaceae and Plumbaginaceae)
Economic importance: The family is rep- into another. Ultrastructure studies of sieve
resented by several ornamentals such as tube plastids (Behnke, 1975, 1977, 1983)
carnation, pinks, sweet william (different showed that all members ( those with and
species of Dianthus), babys breath without betalains) contained unique PIII
(Gypsophila) and corn cockle (Agrostemma). plastids, affinity reinforced by studies of
Species of Arenaria, Cerastium and Stellaria DNA/RNA hybridization (Mabry, 1975),
are troublesome weeds. throwing up a compromise of including all
families within the same order, but sepa-
Phylogeny: The family Caryophyllaceae rate suborders, a trend being followed by
along with other members of the order Takhtajan upto 1987 but finally discarded in
Caryophyllales (Centrospermae of Engler) 1997. Thorne (1999, 2003)had established
538 Plant Systematics
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II /(APweb)
Salient features: Mostly herbs with swollen simple, usually entire, venation pinnate, re-
nodes, stipules forming ochrea at nodes, flow- ticulate, stipules connate to form ochrea at
ers in spikes, heads or panicles, perianth node (ochrea absent in Eriogonum). Inflores-
usually petaloid, stamens 3-8, carpels 3, cence in axillary cymose clusters or form-
united, ovule solitary, fruit a nut. ing spikes, heads or panicles. Flowers
bisexual, rarely unisexual (Rumex),
Major genera: Eriogonum (250 species), actinomorphic, hypogynous, showy
Rumex (200), Persicaria (150), Coccoloba (120), (Antigonon) or inconspicuous (Rumex). Peri-
Polygonum (60), Rheum (50) and anth with 6 tepals, in two whorls, usually
Fagopyrum (15). petaloid, sometimes 5 due to fusion of
2 tepals (Polygonum), free or slightly connate,
Description: Annual or perennial herbs, imbricate, persistent, inner whorl often
shrubs, small trees (Triplaris) or climbers enlarged in fruit and tubercled (Rumex) or
with tendrils (Antigonon), with swollen nodes, not (Oxyria), perianth often 4 in two whorls
usually with tannins, without laticifers, (Oxyria). Androecium with usually
nodes pentalacunar or multilacunar, sieve- 6 stamens, 8 in Fagopyrum, 9 in Rheum, fila-
tube plastids S-type. Leaves usually alter- ments free or slightly connate, anthers
nate, rarely opposite (Pterostegia) or whorled bithecous, dehiscence longitudinal, pollen
(Eriogonum), sometimes reduced (Coccoloba) grains tricolpate to polyporate. Gynoecium
Major Families of Angiosperms 539
Figure 13.71 Polygonaceae. Rumex nepalensis. A: Portion of plant in flower; B: Flower with par-
tially emergent anthers; C: Fruit with broad wings and hooked teeth. Polygonum
tortuosum. D: Portion of plant in flowers; E: Flower with included stamens; F: Flower
from top; G: Seed. (After Polunin and Stainton, Fl. Himal., 1984).
with 2-3 united carpels, ovary superior, salad. Species of Coccoloba, Antigonon,
unilocular with 1 ovule, orthotropous, place- Muehlenbeckia, and Polygonum are often cul-
ntation basal, sometimes partially divided by tivated as ornamentals. Fruits of Coccoloba
false septa, styles 2-3, a nectary surround- are often used to make jellies. Leaves of Rumex
ing the base of ovary, or paired glands asso- acetosa and R. crispus are eaten as vegetables.
ciated with filaments. Fruit a trigonous or
bifacial nut; seed with straight or curved Phylogeny: The basic floral pattern of the
embryo, endosperm copious, mealy. Pollina- family according to Laubengayer (1937) is
tion mostly by bees and flies. Fruits are trimerous and whorled and the apparent spi-
usually dispersed by wind or water. ral condition in some members is actually
whorled as shown by anatomical study. In
Economic importance: A few species of the members with 5 tepals, one outer and one
family are of economic importance. Buck- inner tepal are fused. Laubengayer believed
wheat (Fagopyrum) is an important source of the family to be allied and more advanced
food (millets) in some areas. The petioles of than Caryophyllaceae and the seemingly
rhubarb (Rheum rhaponticum) are used as basal placentation of the family is derived
540 Plant Systematics
from free central placentation, the funicu- sheathing ochrea and Eriogonoideae with
lus representing the greatly reduced free opposite leaves and more or less cymose and
central placenta. Studies of Lamb Frye & involucrate inflorescence. Thorne (1999,
Kron (2003) suggest that five petals is basic 2003) recognized third subfamily Coccolo-
condition in the family. boideae characterized by reduced leaves,
The family is easily recognized and clearly stems flattened and photos-ynthetic, for
monophyletic. The family is considered which, however, he subsequently (2006,
closer to Plumbaginaceae and according to 2007) preferred the name Brunnichioideae.
Williams et al., (1994) although no plumbagin The members of Eriogonoideae have
had been reported from the family, other generally 6 tepals and may form a basal
quinones were found. Two subfamilies are paraphyletic complex (Cunoud et al., 2002;
commonly recognized in Polygonaceae: Lamb Frye & Kron 2003), thus justifying
Polygonoideae with spiral leaves with merger with polygonoideae.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.72 Droseraceae. Dionaea muscipula. A: Plant with flowers; B: Leaf with winged petiole
and hinged leaf blade with marginal bristles; C: Flower; D: Ovary cut open to show
ovules; E: Pollen tetrad; F: Seed. Drosera intermedia G: Plant with flowers; H: Leaf
blade with glandular hairs; I: Flower, top view; J: Seed covered with papillae. (After
Godfrey and Wooten, Aq. Wetland Pl SE US, 1981).
inwards, pressing the insect against the leaf in order parietales near Violaceae and
blade. Ochnaceae on the basis of parietal
placentation. Insectivorous habit and
Economic importance: The family is of lit- aquatic habit exhibit homoplasy with fam-
tle ecomic importance. Venus flytrap ily Lentibulariaceae. Earlier the family
(Dionaea muscipula) and various species of also included 4th subwoody genus
Drosera (Sundew) are grown as novelties. Drosophyllum, which has now been sepa-
Leaves of Drosera yield a violet dye, but is rated into a distinct family
no longer of commercial importance. Drosophyllaceae (APG-II, 2003; Thorne,
2006, 2007; APWeb, 2007), being sister to
Phylogeny: The family was earlier in- Dioncophyllaceae + Ancistrocladaceae.
cluded under Sarraceniaceae (Bentham & Within Droseraceae, Dionaea and
Hooker), but is now recognised independ- Aldrovanda with snap-trap leaves and n=6
ently. Wettstein (1907) placed Droseraceae may be sister to rest of taxa.
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II /(APweb)
Salient features: Trees, shrubs or climbers, ovary superior with large fleshy disc at base
leaves simple often leathery, stipules usu- fused with the base of stamens, carpels 2-5,
ally small, falling early or absent, flowers seeds with brightly coloured coat or aril.
small, greenish, pentamerous, in clusters,
544 Plant Systematics
Figure 13.73 Celastraceae. Euonymus hamiltonianus. A: Portion of plant in flower; B: Flower from
above; C: Flower from base; D: Fruit . Celastrus paniculatus. E: Portion of plant in
flower; F: Flower; G: Fruit. (A-D, after Polunin and Stainton, Fl. Himal, 1984).
Major genera: Maytenus (200 species), solitaryor racemose. Flowers small, green-
Salacia (150), Euonymus (130), Hippocratea ish or greenish-white, regular, bisexual or
(120), Cassine (60) and Crossopetalum (50). unisexual, hypogynous pergynous or
epigynous. Calyx with usually 4-5 small se-
Description: Trees, shrubs or climbers pals, distinct or connate at base, rarely 3,
(Hippocratea), stem smooth or with spines, imbricate, rarely valvate. Corolla with 4-5
with or withour laticifers, juice not coloured, free petals, rarely 3, somewhat similar to
nodes unilacunar, vessels with simple or sepals, rarely absent. Androecium with usu-
scalariform end-walls, vestured pits absent. ally 3-5 stamens rarely many (Plagiopteron),
Leaves alternate (Maytenus) or opposite free, often attached at base to enlarged disc,
(Euonymus), simple, usually leathery, ser- rarely connate at base, anthers bithecous,
rate, pinnately veined, stipules small and dehiscence longitudinal, pollen grains
caducous or absent. Inflorescence of flat- aperturate or colporate. Gynoecium with 2-
topped axillary or terminal clusters, rarely 5 united carpels, ovary superior, sometimes
Major Families of Angiosperms 545
inferior (Empleuridium) due to elarged disc, (2003) placed Celastales under superorder Cela-
placentation axile with 2-6 ovules in each stanae of Rosidae. Thorne had earlier placed
chamber, style short, terminal, stigma this superorder as fifth after Rosanae,
stigma capitate or lobed, dry type non-papil- subsequently (2006, 2007) bringing it to the
late. Fruit a berry, drupe, capsule or samara; begining of Rosidae. Celastales of Thorne (2006)
seed usually surrounded by brightly coloured included 4 families Celastaceae, Parnassia-
aril, embryo large and straight, endosperm ceae, Lepidobotryaceae and Huaceae. Zhang &
present. Simmons (2006) found that Huaceae were
sister to Oxalidales, with quite strong support
Economic importance: Economically the fam- (jacknife values over 80%); they suggest that
ily is of lesser importance, a few used as Huaceae should be included in Oxalidales.
ornamentals. Climber Celastrus scandens is Thorne (2007) and Stevens( APWeb, 2008), as
grown for its attractive coloured fruits and such exclude Huaceae from the order
seeds. Various swpecies of Euonymus are Celastrales. Whereas Stevens keeps it un-
grown for their attractive foliage, E. japonicus placed within Eurosids I, Thorne has shifted it
with shiny leathery leaves very popular as under order Oxalidales of superorder
hedge plant along pathways in temperate cli- Oxalidanae. Thorne (2007) recognizes 4 sub-
mate. The toxic alkaloid maytansine (from families with Celastraceae: Celastroideae,
Maytenus), when delivered by antibodies, may Hippocrateoideae, Macgregorioideae and
have application in treating colon cancers. Stackhousioideae (Siphonodontoideae reco-
gnized as 5th subfamily in 2006 version
Phylogeny: The family was earlier placed having been merged with Celastroideae).
closer to Rhamnaceae, latter removed along The family appears to be more uniform with
with a few other families to Rhamnales by the removal of Bhesa to Malpighiales (Zhang
Hutchinson (1973). Dahlgren (1989) placed & Simmons 2006) and Perrottetia to
Stakhousiaceae, Lophopyxidaceae Card- Huerteales (Crossosomatales of Thorne)
iopteridaceae, Corynocarpaceae and Celas- near Tapiscia (M. Simmons in Matthews &
traceae under Celastales under superorder Endress 2005b). Interestingly, the inclusion
Rutaneae. Both Takhtajan (1997) and Thorne of both these genera.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II/ APweb)
Figure 13.74 Violaceae. Viola canescens. A: Plant with flowers; B: Vertical section of flower;
C: Gynoecium; D: Fruit with persistent calyx; E: Seed. V. tricolor. F: Portion of plant
with flowers; G: Vertical section of flower showing spurred lower petal; H: Stamen
with spurred anther; I: Ovary with style and enlarged stigma; J: Transverse section
of ovary with parietal placentation.
Salient features: Herbs, leaves serrate, entire to serrate, venation pinnate or pal-
stipules present, flowers zygomorphic, mate, veins often conspicuous, stipules
bisexual, petals 5, anterior spurred, anthers present, sometimes foliaceous (Viola). Inflo-
with spur-like nectaries, carpels 3, united, rescence usually with solitary axillary flower,
placentation parietal, fruit a loculicidal sometimes in racemes or spikes. Flowers
capsule, seeds large dispersed explosively as bisexual, rarely unisexual, actinomorphic
the fruit wall closes round them and (Rinorea) or zygomorphic (Viola), hypogynous,
squeezes them out. pentamerous, sometimes cleistogamous.
Calyx with 5 sepals, usually free, sometimes
Major genera: Viola (450 species), Rinorea slightly connate to form a ring around ovary,
(280), Hybanthus (110), Anchietia (8) and imbricate, persistent. Corolla with 5 petals,
Leonia (6). free, imbricate or convolute, unequal, ante-
rior usually largest and spurred or saccate.
Description: Herbs (Viola) shrubs (Rinorea) or Androecium with 5 stamens, filaments
trees (Rinorea maingayi), rarely climbers short, free or slightly connate at base, an-
(Anchietia) with often saponins or alkaloids. thers erect, somewhat connivent forming a
Leaves alternate rarely opposite (Hybanthus), ring around ovary, 2 anterior anthers often
mostly basal, simple, sometimes lobed, with spur-like nectaries, connective often
Major Families of Angiosperms 547
with triangular appendage, dehiscence lon- Phylogeny: The family is clearly defined and
gitudinal, introrse, pollen grains usually uniformly placed in most classifications
tricolpate. Gynoecium with 3 united carpels, under Violanae of Dilleniid complex. Hutch-
carpels rarely 2-5 (Melicystus), ovary superior, inson who had largely separated dicotyledons
unilocular with parietal placentation, ovules into woody (Lignosae) and herbaceous
many, anatropous, style 1, stigma often ex- (Herbaceae) lineages, had especially chosen
panded but with small receptive region, some- to justify the position of largely herbaceous
times lobed. Fruit a loculicidal capsule; seeds Viola in the predominantly woody clade, and
with straight embryo, endosperm and aril considered the herbaceous habit in this
present. Pollination by insects, attracted by genus to be derived from woody ancestors.
nectar in the spur. Seeds are often dispersed APG II and APweb, however place this fam-
explosively as the fruit wall closes round them ily in a broadly circumscribed order
and squeezes them out. Ants also disperse Malpighiales. Two tribes are commonly
seeds, attracted by oily aril. recognized: Rinoreae with mainly
actinomorphic flowers and Violeae with
Economic importance: The family is mainly zygomorphic flowers. Although the family is
known for ornamental pansy flowers (Viola) clearly monophyletic, rbcL sequences suggest
and green-violet (Hybanthus). Flowers of Viola that neither tribe is monophyletic. Violaceae
odorata is largely grown in France for essen- are weakly associated with Acharaciaceae
tial oil used in the manufacture of perfumes, (and Goupiaceae, Lacistemataceae and
flavourings and toiletries. The flowers are also Ctenolophonaceae) in Chase et al., (2002).
preserved in sugar (banafsha). Hybanthus Thorne, who had earlier (1999, 2000) placed
ipecacuanha has been used as substitute for Violanae under subclass Dilleniidae has now
true ipecac (Psychotria ipecacuanha) as (2003) shifted it to Rosidae, Dilleniidae hav-
emetic. Roots of Anchietia salutaris are used ing been dismantled. He (2006, 2007) recog-
as an emetic and to treat sore throats and nizes three subfamilies Violoideae,
lymphatic tuberculosis. The roots of Leonioideae and Fusispermoideae under
Corynostylis hybanthus are used as an emetic. Violaceae.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II/ (APweb)
Figure 13.75 Salicaceae. Populus ciliata. A: Portion of a vegetative branch; B: Branch with male
catkins; C: Fruiting female catkin. Salix alba. D: Portion of a shoot with female
catkins; E: Portion of shoot with male catkins; F: Male flower with hairy bract and
2 stamens; G: Female flower with bract and stipitate ovary; H: Longitudinal section
of ovary with basal placentas. S. caroliniana. I: Male flower with bract, 2 nectar
glands and many stamens; J: Transverse section of ovary with parietal placenta-
tion.
Salient features: Deciduous trees and salicoid (vein entering tooth and associated
shrubs, leaves with salicoid teeth, stipules with glandular seta), venation pinnate to
conspicuous, flowers unisexual, inflores- palmate, reticulate, stipules present, some-
cence a catkin, flowers naked, carpels 2, times foliaceous and persistent. Inflores-
ovules many, seeds with hairs. cence erect or pendulous catkins, on short
branches. Flowers unisexual (plants
Major genera: Salix (445 species; incl. dioecious), actinomorphic, reduced, usually
Chosenia) and Populus (40). subtended by hairy bracts. Calyx reduced
to a glandular disc (Populus) or 1 to 2 fringed
Description: Deciduous trees and shrubs nectar gland (Salix). Corolla absent.
containing phenolic heterosides salicin and Androecium with 2 to numerous stamens,
populin, containing tannins. Leaves alter- filaments free or slightly connate at base,
nate, simple, serrate to dentate, teeth anthers bithecous, dehiscence by
Major Families of Angiosperms 549
***********
550 Plant Systematics
Figure 13.76 Cucurbitaceae. Luffa cylindrica. A: Branch with male flowers on peduncle towards
the base and solitary axillary female flowers towards the top; B: Vertical section of
female flower; C: Vertical section of male flower. Coccinia cordifolia. D: Branch with
male flower; E: Branch with female flowers. Stamen types. F: Lagenaria with 3
stamens, 2 with bithecous anthers and 1 with monothecous anther; G: Cucurbita
with anthers united into a column; H: Cyclanthera with anthers united into 2 rings
running around the top; I: Sicyos with filaments as well as anthers united.
Major Families of Angiosperms 551
Salient features: Tendril climbing plants, Economic importance: The family is eco-
leaves palmately veined, flowers unisexual, nomically important for its food plants such
stamens 5, variously united, carpels usually as cucumber (Cucumis sativus), water melon
3, united, ovary inferior, fruit a berry or pepo. (Citrulus vulgaris), loofah (Luffa acutangula,
L. cylindrica), bottle gourd (Lageneria
Major Genera: Cayaponia (60 species), siceraria), melon (Cucumis melo) and red
Momordica (45), Gurania (40), Sicyos (40), pumpkin (Cucurbita maxima). The dried fruit
Cucumis (30) and Cucurbita (27). of Luffa yields bathroom sponge loofah. Spe-
cies of Bryonia, Cucumis, Momordica are of
Description. Climbing annuals with coiled medicinal importance.
tendrils, sometimes trailing (Ecballium),
rarely xerophytic shrubs (Acanthosicyos Phylogeny: The family was earlier
horrida) or even trees (Dendrosicyos), vascu- considered closely related to Passifloraceae
lar bundles usually bicollateral, often in two and included under the same order.
rings. Leaves alternate, simple, palmately Hutchinson (1973) placed them under
veined, lobed or compound, rarely absent separate orders, Cucurbitales derived from
(Acanthosicyos horrida), stipules absent. In- Passiflorales through formation of unisexual
florescence cymose (Bryonia) or flowers soli- flowers, parietal placentation, inferior ovary,
tary axillary (Luffa female flower), rarely in and modification of stamens. The separation
short racemes (Luffa male flowers), plants is followed by Takhtajan, Dahlgren, and APG
monoecious or dioecious. Flowers bracteate group. Cronquist and Thorne preferred to
or ebracteate, unisexual, rarely bisexual retain these and other families under the
(Schizopepon), actinomorphic, epigynous, same order Violales. Thorne (1999) placed
with long hypanthium. Calyx with 5 sepals, Cucurbitaceae along with Begoniaceae and
more or less united, fused to ovary wall. Co- Datiscaceae under a separate suborder
rolla with 5 petals, free (Luffa, Lagenaria, Begoniineae. Subsequently (2003, 2006,
Benincasa) or united (Cucurbita, Cucumis), 2007) he has added Tetramelaceae (earlier
imbricate, commonly yellow or white. included under Datiscaceae). It is interesting
Androecium with 5 stamens, anthers to note that order Cucurbitales of APG II and
monothecous, filaments free (Luffa) or APweb include the same four families along
connate, sometimes 4 of these fused in two with a few more. Cucurbitaceae and
pairs thus two stamens bithecous and third Begoniaceae share the apomorphies of
monothecous giving appearance of 3 sta- inferior ovary, strongly intruded placentae and
mens (Coccinia), rarely all five fused imperfect flowers. Monophyly of Cucurbitales
(Cucurbita), pollen grains with 3 to many fur- is supported by serological data and rbcL
rows. Gynoecium with 3 united carpels sequences. Cucurbitaceae is easily reco-
(syncarpous), unilocular with many ovules, gnized and monophyletic, but of the two sub-
placentation parietal, placentae enlarged families commonly recognized only
intruding and often meeting in centre form- Cucurbitoideae is monophyletic, Nhandiro-
ing pseudo-axile placentation, ovary inferior, boideae (Zanonioideae) being paraphyletic.
styles simple or 3-partite. Fruit a berry, pepo Renner et al., (2002) from the molecular
or capsule; seeds many, embryo straight, studies multiple chloroplast loci. p. 169,
endosperm absent. Pollination mostly by in- concluded that Nhandiroboideae form an
sects. Dispersal by animals, capsules of unresolved basal group.
Echinocystis open explosively.
***********
552 Plant Systematics
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II/ APweb)
Figure 13.77 Clusiaceae. Hypericum calycinum. A: Branch with terminal flower. H. lobbii B: Por-
tion of branch showing one flower; C: Androecium D: Flower with petals and sta-
mens removed; E: Transverse section of ovary. Clusia purpurea. F: Branch with
inflorescence; G: Flower. Garcinia mangostana. H: Branch with fruit; I: flower;
J: Vertical section of flower; K: Fruit with rind from top removed. Hypericum myrtifolium.
L: Portion of branch with flowers; M: Flower top view, enlarged. (L-M, after Goodfrey
and Wooten, Aq. Wetland Pl. SE US, vol. 2, 1981; H-K, after Bailey, Man. Cult. Pl.,
1949)
Pentadesma, etc. The species of Harungana, from the stems of Garcinia (source of gam-
Calophyllum yield hard and durable wood. boge) and Clusia (source of healing gums).
Drugs and cosmetics are obtained from the Species of Vismia, Psorospermum and
leaves of Hypericum spp. and Harungana Harungana yield drugs and dyes from bark.
madagascariensis, and flowers of Mesua Species of Clusia and Hypericum with showy
ferrea. Gums and pigments are extracted flowers are often grown as ornamentals.
554 Plant Systematics
Phylogeny: The family Hypericaceae was sopioideae and Hypericoideae. APG II and
treated as distinct from Guttiferae APweb treat the two as distinct families,
(Clusiaceae) by Bentham and Hooker (1862). latter recognising two subfamilies
Engler and Prantl (1887) combined the two Kielmeyeroideae and Clusioideae (including
families under Clusiaceae, a treatment Calophylloideae) under Clusiaceae. Broadly
followed by Heywood (1978) and Cronquist circumscribed family (under name
(1988). Hutchinson (1973) justified separation Clusiaceae or Hypericaceae) is assumed to
of Hypericaceae on the basis of constantly be monophyletic on the basis of anatomical
bisexual flowers and gland-dotted leaves, as and chemical evidence. The affinities within
against unisexual flowers, close veins and the group are not clearly resolved as
secretary canals. He argued that Hyperica- suggested by the studies of Chase et al.,
ceae is fairly well circumscribed, and there (2002) and Gustafsson et al., (2002). Thorne
seems little to be gained, in these days of (2003, 2006), placed Bonnetiaceae,
smaller family concepts , by including them Hypericaceae, Elatinaceae and Podostem-
in Clusiaceae (Guttiferae), as in Engler and aceae under order Hypericales, prefering
Prantl system. The two are combined in name Podostemales in 2007 revision. The
treatments of Judd et al. (2002, 2008; under monophyly of this clade was not supported by
Clusiaceae) and Thorne (1999, 2000 and 2007 the studies of Savolainen et al., (2000).
as Clusiaceae; 2003, 2006, prefered priority Bonnetiaceae + Clusiaceae + Hypericaceae
name Hypericaceae). Thorne (2007) divides seem to be a distinct group with several
Clusiaceae into five subfamilies Kielmeye- potential synapomorphies, of which some are
roideae, Calophylloideae, Clusioideae, Chry- lost or highly modified in Podostemaceae.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II/ APweb
Salient features: Plants usually with milky Major genera: Euphorbia (2100 species), Cro-
latex, leaves alternate, flowers unisexual, ton (720), Phyllanthus (500), Acalypha (350),
carpels 3, ovary superior, 3-chambered, Glochidion (300), Antidesma (140), Manihot
ovule with a caruncle. (160) and Jatropha (140).
Major Families of Angiosperms 555
Figure 13.78 Euphorbiaceae. Euphorbia milii. A: Branch with umbellate cyathia and spines;
B: Vertical section of cyathium to depict showy scarlet bracts, single female flower
and numerous male flowers, and nectaries along the rim of cyathium. E. hirta.
C: Portion of plant showing opposite leaves and cyathia in heads; D: Cyathium with
female flower protruding out and only 4 nectaries, showy bracts absent; E: Vertical
section of cyathium. Phyllanthus fraternus. F: Portion of plant with flowers; G: Male
flower with monadelphous stamens; H: Female flower; I: Vertical section of female
flower. Croton bonplandianum. J: Portion of plant with flowers and fruits; K: Male
flower with many stamens; L: Female flower; M: Vertical section of female flower.
Huber (1991) for a narrower circumscription, changes may be needed in the groupings rec-
with the biovulate taxa being considered to ognized. Thorne had earlier (2003, 2006) in-
be closer to Linales. Within Euphorbiaceae cluded Euphorbiaceae under superorder
s. str., molecular analyses by Wurdack and Geranianae, but in his latest revision (2007)
Chase (2002), suggest that substantial shifted it under Podostemanae
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II /(APweb)
Salient features: Herbs or shrubs, leaves oles forming phyllodes), leaflets often folding
usually compound, with a sour taste, leaflets in cold or at night, entire, often emarginate,
pulvinate at base, entire, stipules usually with pinnate or palmate reticulate venation,
absent, flowers pentamerous, heterostylus, leaflets often with prominent pulvinus, stip-
petals clawed, stamens united, outer sta- ules small or absent. Inflorescence cymose
mens shorter, styles 5, seeds with conspicu- umbel, rarely solitary. Flowers bisexual,
ous endosperm, arillate. actinomorphic, usually heterostylus, some-
times cleistogamous and apetalous (Oxalis
Major genera: Oxalis (600 species), acetosella). Calyx with 5 sepals, free, green,
Biophytum (70) and Eichleria (2). persistent. Corolla with 5 petals, free or
connate at base, often clawed, usually
Description: Herbs with bulbous tubers or convolute, absent in cleistogamous flowers.
fleshy rhizome, or shrubs, rarely trees, of- Androecium with 10 stamens, usually in two
ten with soluble and crystalline oxalates. whorls, usually connate at base, outer
Leaves alternate or all basal, pinnately filaments usually shorter than inner,
(Biophytum) or palmately compound or anthers bithecous, dehiscence by longitudi-
trifoliate (some species of Oxalis), rarely re- nal slits, pollen grains tricolpate or triporate,
placed by phyllode (Oxalis bupleurifolia, peti- nectar glands at the base of filaments or
558 Plant Systematics
Figure 13.79 Oxalidaceae. Oxalis martiana. A: Plant with trifoliate leaves and umbellate inflores-
cence; B: Flower with calyx and corolla removed; C: Calyx; D: Petal. O. corniculata.
E: Portion of plant rooting at nodes and umbellate inflorescence; F: Flower;
G: Flower with calyx and corolla removed; H: Transverse section of ovary; I: Fruit
with persistent calyx. (A-D, after Sharma and Kachroo, 1983)
alternating with petals. Gynoecium with 5 that of O. crenata boiled and eaten in Peru.
united carpels, rarely free (Biophytum), ovary The leaves of O. acetosella are some-
superior, placentation axile, 1 or more times used as salad. The bulbous stem of
ovules in each loculus, styles 5, free, per- O. pescaprae (Bermuda buttercup) are some-
sistent, stigmas capitate or shortly divided. times used as vegetable in France and North
Fruit a loculicidal capsule or berry, often Africa. Averrhoa carambola (carambola or star
angled; seeds usually with an aril, embryo fruit) is cultivated widely for its edible fruit.
straight, endosperm copious, testa often
elastic turning inside out and ejecting seed. Phylogeny: The family was earlier included
Pollination by insects, heterostyly result- under Geraniaceae (Bentham and Hooker)
ing in outcrossing. Mostly self dispersed by but now separated into a distinct family and
explosive inversion of testa and aril. separable by 5 distinct styles, possession of
arillate seeds and absence of stipules.
Economic importance: The family is of Phylogenetic studies based on rbcL sequences
little importance. The tubers of Oxalis tuberosa (Chase et al., 1993) indicate that Oxalidaceae
(oca) are eaten in Andean South America, and are more closely related to Cunoniaceae and
Major Families of Angiosperms 559
***********
Salient features: Leaves usually opposite, simple or 2-foliate, strongly resinous, leaflets
pinnate compound, stipules paired persist- entire, venation reticulate, pinnate or pal-
ent, flowers with disc, stamen with gland or mate, stipules paired, commonly spiny. In-
appendage at base, ovary 4-5 locular, syle 1. florescence cymose, sometimes reduced to
single flower. Flowers bisexual, rarely uni-
Major genera: Zygophyllum (80 species), sexual (Neoleuderitzia), actinomorphic, rarely
Fagonia (40), Tribulus (20), Balanites (20), zygomorphic, hypogynous, usually
Guaiacum (6), and Larrea (5). pentamerous. Calyx with 5 sepals, rarely 4,
free or slightly connate at base. Corolla with
Description: Herbs (Tribulus), shrubs or trees 5 petals, rarely 4 or absent, free, often clawed,
(Guaiacum) with often jointed nodes, xylem imbricate. Androecium with 10 stamens,
elements arranged in horizontally aligned rarely 15, usually in whorls of 5, outer whorl
tier, with steroidal or triterpenoid saponins opposite the petals, free, each filament with
and alkaloids. Leaves opposite, 2-ranked, a gland or appendage at base, anthers
rarely alternate, usually paripinnate, rarely bithecous, basifixed, dehiscence by longitu-
560 Plant Systematics
Figure 13.80 Zygophyllaceae. Tribulus terrestris. A: Part of plant with flowers and fruits;
B: Flower; C: Vertical section of flower; D: Flower with sepals and petals removed;
E: Ovary covered with hairs, short style and stigma; F: Transverse section of ovary;
G: Fruit; H: One of the cocci enlarged showing sharp spines. (A-B, D-E, after Sharma
and Kachroo, Fl. Jammu, 1983)
dinal slits, pollen grains usually tricolporate. stigma capitate or lobed, nectar disc present
Gynoecium with 5 united carpels, rarely 2- at the base of ovary. Fruit a usually a cap-
6, ovary superior, usually furrowed or winged, sule, septicidal or loculicidal, rarely
placentation axile, locules as many, ovules schizocarpic, berry or drupe, somtimes
one to many in each locule, pendulous, winged; seeds usually with aril, embryo
anatropous or orthotropous, style 1, short, curved or straight, endosperm usually absent
Major Families of Angiosperms 561
or scanty. Pollination by insects. Arillate Phylogeny: The family is usually placed un-
seeds (Guaiacum) are dispersed by wind, der order Geraniales, although more recently
schizocarpic winged fruits by wind and spiny shifted to order Zygophyllales (Takhtajan
fruits (Tribulus) by exozoochory. 1997, Thorne 2007, Stevens 2008). The fam-
ily is considered to be monophyletic after the
Economic importance: The family is of mi- exclusion of a few genera to Peganaceae and
nor economic importance. Wood of Guaiacum Nitrariaceae (Thorne to order Rutales) or
officinale (lignum vitae), being the strong- Nitrariaceae (Sapindales of Eurosids II by
est and heaviest wood, is highly prized tim- APG II, APWeb of Stevens). Monophyly of
ber in tropical Central America and West Zygophyllaceae supported by morphology and
Indies.The tree also yields medicinal resin DNA characters. The family is sister to
guaiacum, once used to treat syphilis. Spe- Krameriaceae as supported by rbcL se-
cies of Bulsenia (B. arborea: Maracaibo lig- quences (Soltis et al., 1998; Savolainen et
num vitae; B. sarmienti: Paraguay lignum al., 2000). The family is divided into 5 sub-
vitae) yield valuable timber and perfume oil. families: Morkillioideae, Tribuloideae,
Seeds of Peganum harmala are the source of Seetzenioideae, Larreoideae and Zygoph-
dye turkey red. Tribulus terrestris is a trou- ylloideae. Balanites is very different from
ble some weed whose spines on fruit are other Zygophyllaceae in floral, vegetative
similar to sharp iron caltrops once used in and seed anatomy, although tentatively
battlefields to stab the feet of men and included under Tribuloideae. Hilu et al.
horses. They also often puncture cycle tyres; (2003) reported Larrea to be weakly associ-
hence the names caltrops, puncture vine ated with Fabaceae in their rbcL analysis;
and goat head for the weed. Species of they note that the possession of anthro-
Zygophyllum are used as spices: buds of quinones is a possible synapomorphy
Z. fabago used in sauces and fruits of between Zygophyllaceae and the N-fixing
Z. coccinium as substitute for black pepper. clade Fabaceae.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.81 Geraniaceae. Geranium rotundifolium. A: Plant with palmately lobed leaves and um-
bellate inflorescence; B: Flower; C: Petal; D: Flower with sepals and petals removed
to show androecium and gynoecium; E: Gynoecium with 5 carpels; F: One segment
of capsule; G: Seed. Erodium cicutarium. H: Plant with pinnate leaves and umbellate
inflorescence; I: Sepal; J: Petal; K: Stamen; L: Staminode; M: Gynoecium; N: One
mericarp with long coiled beak. Monsonia senegalensis. O: Flower having 15 sta-
mens; P: Portion of flower to show stamens with filaments united in groups of 3,
the androecium being pentadelphous.
Salient features: Usually herbs, stems swol- pound, venation palmate, reticulate, stipules
len at nodes, leaves usually deeply lobed, conspicuous. Inflorescence cymose umbel,
stipules conspicuous, flowers pentamerous, rarely solitary. Flowers bisexual,
petals clawed, stamens united, styles 1, fruit actinomorphic, rarely zygomorphic (Pelargo-
with elastic dehiscent schizocarps that curl nium), hypogynous, pentamerous. Calyx with
on the beak, aril absent. 5 sepals, free, green, persistent, sometimes
spurred (Pelargonium). Corolla with 5 petals,
Major genera: Geranium (300 species), Pel- rarely 4 or absent, free, often clawed, imbri-
argonium (250), Erodium (80) and Monsonia cate, nectar glands alternating with petals
(25). or absent. Androecium with 10 (Geranium) or
15 (Monsonia) stamens, rarely 5 (other 5 ster-
Description: Usually herbs, rarely ile- Erodium), usually connate at base, some-
undershrubs, sometimes aromatic (Pelargo- times pentadelphous (Monsonia), rarely free,
nium), stems swollen at nodes, usually with anthers bithecous, dehiscence by longitudi-
stalked glandular hairs. Leaves alternate or nal slits, pollen grains tricolpate or triporate.
opposite, simple or palmately lobed, or com- Gynoecium with 5 united carpels, ovary
Major Families of Angiosperms 563
superior, usually lobed, placentation axile, Phylogeny: The family is consistently placed
ovules usually 2 in each loculus, anatropous under order Geraniales, sometimes along with
or campylotropous, style 1, slender and beak- Oxalidaceae. The recent DNA based studies
like. Fruit a capsular dehiscent schizocarp (Chase et al., 1993), however, suggest that it
with 5 1-seeded segments that separate elas- is related to Crossosomataceae, Staphylea-
tically from central column, and often open- ceae, in a narrowed circumscribed order.
ing to release seeds (Geranium), or Geraniaceae are well-defined monophyletic
indehiscent schizocarp (Biebersteinia); seeds group based on rbcL sequences and loss of
usually without aril, pendulous, embryo intron in the plastid gene rpl16 (Price and
curved, endosperm usually absent or scanty. Palmer, 1993). Hypseocharis, with capsular
Pollination by insects. Mostly self dispersed fruits and formerly placed under Oxalidaceae
by explosive opening of schizocarps throwing is sister to rest of the family. Takhtajan places
seeds several metres away. it under a distinct family Hypseocharitaceae.
APG II optionally include Hypseocharitaceae
Economic importance: The family is known under Geraniaceae. APweb treats Hypseo-
for Pelargonium (often marketed as Gera- charis as distinct group within Geraniaceae.
nium), grown as ornamental in pots and also Thorne who had earlier (1999) included both
for geranium oil extracted from the leaves Geraniaceae and Oxalidaceae adjacent to
and shoots of mainly P. odoratissimum. Spe- each other under Geraniales, has subse-
cies of Geranium (crane-bill) and Erodium quently (2003, 2006, 2007) shifted Oxalida-
(storckbill) are also grown as ornamentals. ceae under distinct superorder Oxalidanae,
The persistent dry style of Erodium, which order Oxalidales. He has also removed
is hygroscopic, is often used to indicate Hypseocharis to a distinct family Hypseo-
changes in humidity. charitaceae, placed next to Geraniaceae.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herbs shrubs or trees, with hypanthium, sepals and petals 5 each,
leaves usually serrate, stipules conspicuous, petals usually clawed, well-developed nectary
flowers actinomorphic, usually perigynous and on hypanthium or base of stamens, stamens
564 Plant Systematics
numerous, carpel single or numerous and free, aggregate (etaerio of achenes in Potentilla,
rarely united, fruit usually fleshy. etaerio of drupes in Rubus); seed with
straight embryo, without endosperm. Pollina-
Major genera: Rubus (750 species), Potentilla tion mainly by insects. Dispersal by birds,
(500), Prunus (430), Crataegus (240), animals or wind.
Cotoneaster (230), Sorbus (230), Rosa (225),
Alchemilla (220), Spiraea (100), Pyrus (60), Economic importance: The family is largely
Malus (55) Geum (40) and Fragaria (15). known for its temperate fruits: apple (Malus
domestica), pear (Pyrus), plums (Prunus-
Description: Herbs (Alchemilla, Fragaria), several species), cherries (Prunus avium,
shrubs (Rosa, Rubus) or trees (Prunus, Malus, P. cerasus) peaches (Prunus persica), almonds
Pyrus), rarely climbing (some species of Rosa), (Prunus dulcis), apricots (Prunus armeniaca),
sometimes with runners (Fragaria), often with strawberry (Fragaria vesca), loquots
prickles and thorns, without latex, nodes (Eriobotrya), raspberries (Rubus), quince
trilacunar, rarely unilacunar. Leaves alter- (Cydonia), etc. Popular ornamentals include
nate, rarely opposite (Rhodotypos), simple species of Rosa, (rose) Rubus (raspberry),
(Malus, Prunus), palmately compound Chaenomeles (flowering quince), Potentilla
(Fragaria) or pinnate compound (Sorbaria), leaf (cinquefoil), Geum (avens), Cotoneaster,
blade often with gland-tipped teeth, usually Crataegus (hawthorn), Pyracantha (firethorn),
serrate, venation pinnate or palmate, reticu- and Sorbus (mountain ash). Flowers of Rosa
late, stipules present, often adnate to peti- damascena are used for extracting attar of
ole. Inflorescence with solitary flowers (some roses. The bark of Quillaja (soap-bark tree)
species of Rosa), racemes (Padus), panicles contains saponin used as substitute for soap
or cymose umbels (Spiraea), sometimes in cleaning textiles, and also yield tannin.
corymbs (Crataegus), rarely catkin-like Bark of Moquilla utilis (pottery tree) of
(Poterium). Flowers bisexual, rarely unisexual Amazon is used in making heat-resistant
(Poterium; plants monoecious or dioecious), pots. The wood of Prunus serotina is used for
actinomorphic, rarely zygomorphic making furniture and cabinets. Several
(Parinarium), usually perigynous with distinct species are also valuable sources of timber.
hypanthium (flat, cup-shaped or cylindrical);
hypanthium free from or adnate to carpels, Phylogeny: In spite of great morphological
often enlarging in fruit, with nectar ring on diversity the family Rosaceae is a well
inside, rarely epigynous (Malus). Calyx usu- recognized group whose monophyly has been
ally with 5 sepals, united at base, sometimes supported by rbcL sequences (Morgan et al.,
with 3-5 epicalyx (Fragaria) on outside, often 1994). More than 27 family names have been
persistent. Corolla usually with 5 petals, free, proposed for groups of different genera taken
often clawed, imbricate. Androecium with out from Rosaceae, but according to
numerous stamens, free , 4 in Sanguisorba, Hutchinson (1973) if one or two tribes of the
2 in Parastemon urophylla, anthers bithecous, family are taken out, at least 18 or 19 should
rarely monothecous (Alchemilla), dehiscence follow suit, and the Rosaceae would be
longitudinal, pollen grains tricolporate. Gyn- reduced to the genus Rosa only. He like most
oecium with 1 (Prunus), 2-3 (Crataegus) to recent authors follows a broader
many carpels (Rosa), usually free, rarely circumscription of the family, but does not
connate (Crataegus, Pyrus), sometimes recognize separation of Chrysobalanaceae
adnate to hypanthium, ovary superior or in- and Neuradaceae (established as distinct in
ferior, usually unilocular, ovules 1,2 or more, 12th edition of the Englers Syllabus published
unitegmic or bitegmic, crassinucellate, in 1964). These two last families have been
placentation basal, lateral or apical, rarely recognized as distinct in all major class-
axile (Pyrus). Fruit a follicle (Spiraea), achene ifications. Cronquist places them together
(Rosa), drupe (Prunus), pome (Malus), or with Rosaceae under Rosales. Dahlgren places
Major Families of Angiosperms 565
Figure 13.82 Rosaceae. Prunus domestica. A: Portion of a flowering twig; B: Flower from above;
C: Vertical section of flower, petals removed. Rubus ellipticus. D: Branch with termi-
nal inflorescence; E: Vertical section of flower with petals removed; F: Petal;
G: Fruit covered with persistent calyx. Duchesnia indica. H: Portion of a branch with
trifoliate leaves and flower; I: Vertical section of flower with petals removed, 3-
lobed bracteoles (epicalyx) present outside calyx; J: Calyx and 5 3-lobed bracteoles.
Rosa pimpinellifolia. K: Branch with fruits; L: Flower and bud; M: Vertical section of
flower showing cup shaped hypanthium and numerous free carpels; N: Fruit (hip)
enclosing achenes and with persistent calyx.
lamina), Rosoideae (fruit achenes or et al., 2002a, b). The position of Dryadeae
drupelets) and Spiraeoideae (follicle or (inc. Cercocarpus, Dryas, Cowania and
capsule). Although Rosoideae and Maloideae Chamaebatia) included in Rosoideae is
are reasonable clades, little can yet be said uncertain, they lack phragmidiaceous rusts;
of larger patterns of relationship in the rest their roots are associated with N-fixing
of the family (Potter et al., 2002). Porteranthus Frankia and their fruits are achenes with
is sister to Maloideae; Gillenia is sister to that hairy styles. They are rather basal (Potter et
whole clade (Potter et al., 2002; Evans al., 2002; Evans et al., 2002).
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
This large family has traditionally been di- for family sensu lato as well as for Papilionoi-
vided into three subfamilies Papilionoideae deae upgraded as family. Leguminosae is the
(Faboideae), Caesalpinioideae and Mimosoi- alternate name only for former whereas
deae. These have been recognized as inde- Papilionaceae is the alternate name for lat-
pendent families Fabaceae (Papilionaceae), ter. Common features of the family include
Caesalpiniaceae and Mimosaceae in several leaves usually compound with pulvinate
recent systems of classification, a trend that base, odd sepal anterior, flowers perigynous,
tends to be reversing in last decade or so. It carpel 1 with marginal placentation and fruit
must be noted that name Fabaceae is valid commonly a pod or lomentum.
Major Families of Angiosperms 567
Figure 13.83 Fabaceae, subfamily Faboideae. Medicago polymorpha. A: Portion of plant with trifo-
liate leaves, laciniate stipules and few flowered axillary clusters on long peduncles;
B: Flower; C: Standard; D: Wing; E: Keel; F: Androecium with diadelphous (1 free, 9
with united filaments) stamens; G: Fruit covered with tubercles; H: Seed. Dalbergia
sissoo. I: Flowering shoot with a fruiting twig; J: Flower; K: Androecium with 9
monadelphous stamens. Sophora mollis. L: Branch with flowers; M: Moniliform pod.
Lathyrus odoratus. N: Portion of a flowering branch, upper leaflets modified into
tendrils; O: Vertical section of flower; P: Diadelphous andoecium; Q: Pod.
568 Plant Systematics
Salient features: Trees, shrubs or herbs, stamens, diadelphous (1 posterior free and
leaves usually pinnate compound with filaments of nine fused into a tube which is
pulvinate base, flowers zygomorphic with open posteriorly), sometimes 5+5 as in
papilionaceous corolla, sepals united, odd Smithia, rarely monadelphous (Ononis), or
sepal anterior, stamens 10, usually free (Sophora, Thermopsis) anthers
diadelphous (1+(9)), carpel 1, ovary superior, bithecous, dehiscence longitudinal. Gyn-
fruit a pod. oecium with a single carpel, unilocular with
many ovules, placentation marginal, ovary
Major genera: Astragalus (2000 species), superior, style single, curved. Fruit a leg-
Indigofera (700), Crotalaria (600), Desmodium ume or pod, rarely a lomentum (Desmodium),
(400), Tephrosia (400), Trifolium (300), sometimes indehiscent (Melilotus), rarely
Dalbergia (200), Lathyrus (150), Lotus (100), spirally coiled (Medicago); seeds 1-many, seed
and Milletia (100). coat hard, endosperm minute or absent, food
reserves in cotyledons. Pollination primarily
Description: Trees (Dalbergia, Erythrina), by insects, mostly bees. Dispersal is com-
shrubs (Tephrosia, Alhagi, Indigofera) or herbs monly by wind, but often exozoochorus
(Medicago, Melilotus), sometimes woody (Medicago), or by mammals (Tamarindus).
climbers (Wisteria), commonly with root nod-
ules. Leaves alternate, pinnately (Pisum, Economic importance: The subfamily is of
Vicia) or palmately compound (Trifolium), major economic importance, ranking sec-
sometimes simple (Alysicarpus, Alhagi), ond to Poaceae. It is the source of several
whole leaf (Lathyrus aphaca) or upper leaf- pulse crops such as kidney bean (Phaseolus
lets (Vicia, Pisum) sometimes modified into vulgaris), green gram (P. aureus), black gram
tendrils, leaf base (sometimes also the base (P. mungo), lentil (Lens esculenta), chick pea
of leaflets) pulvinate, stipules present. Inflo- (Cicer arietinum), pea (Pisum sativum) and pi-
rescence racemose, in racemes, heads (Tri- geon pea (Cajanus cajan). Soybean (Glycine
folium) or spikes (Ononis), sometimes in max) and peanut (Arachis hypogaea) yield oil
clusters (Lotus, Caragana). Flowers bracteate and high-protein food. Indigo dye is obtained
(bracts often caducous), bisexual, from Indigofera tinctoria. The seeds of Abrus
zygomorphic, perigynous. Calyx with 5 se- precatorius are used in necklaces and rosa-
pals, more or less united, usually ries, but are extremely poisonous and can
campanulate, odd sepal anterior. Corolla be fatal if ingested. The important fodder
with 5 petals, free, papilionaceous consist- plants include alfalfa (Medicago sativa) and
ing of a posterior standard or vexillum, two clover (Trifolium). Common ornamentals in-
lateral wings or alae and two anterior petals clude lupin (Lupinus), sweet pea (Lathyrus
fused along margin to form keel or carina odoratus), Wisteria (Wisteria), Laburnum,
which encloses stamens and pistil, poste- coral tree (Erythrina), false acacia (Robinia)
rior petal outermost. Androecium with 10 and broom (Cytisus).
Figure 13.84 Fabaceae, subfamily Caesalpinioideae. Cassia occidentalis. A: Portion of plant with
flowers and paripinnate leaves; B: Flower with sepals and petals removed, showing
gynoecium and stamens of three different sizes; C: A pair of pods. Caesalpinia
decapetala. D: Portion of plant with bipinnate leaves and racemose inflorescence;
E: Flower; F: One of the four large petals; G: Gynoecium; H: Pod; I: Seed.
570 Plant Systematics
Salient features: Trees, shrubs or herbs, bracteate (bracts usually caducous), sessile,
leaves usually pinnate compound with or short-pedicelled, bisexual, actinomorphic,
pulvinate base, flowers actinomorphic, co- perigynous. Calyx with 5 sepals (4 in Mi-
rolla not papilionaceous, petals valvate, se- mosa), connate, odd sepal anterior, usually
pals united, odd sepal anterior, stamens 4- valvate, teeth small. Corolla with 5 petals
many, free or connate, filaments often long (4 in Mimosa), free or united (Acacia, Albizia),
exserted and showy, ovary superior, carpel valvate. Androecium with 4-many (4 in Mi-
1, fruit a pod or lomentum. mosa, 10 in Prosopis, numerous in Acacia and
Albizia) stamens, free (Acacia, Prosopis) or
Major genera: Acacia (1300 species), Mimosa filaments connate (Albizia), anthers
(500), Inga (250), Pithecellobium (170), bithecous, dehiscence longitudinal, fila-
Calliandra (150) and Albizia (150). ments long and anthers usually exserted.
Gynoecium with a single carpel, unilocular
Description: Trees (Acacia, Albizia), shrubs with many ovules, placentation marginal,
(Calliandra) or herbs (Mimosa pudica), rarely ovary superior, style single, curved. Fruit a
climbers (Entada), or aquatic plants legume or lomentum (Mimosa, Acacia); seeds
(Neptunia). Leaves alternate, pinnately or 1-many, seed coat hard, endosperm minute
palmately compound, sometimes simple, or absent.
leaf base (sometimes also the base of leaf-
lets) pulvinate, petiole sometimes modified Economic importance: The subfamily is of
into phyllode (Acacia auriculiformis), stipules lesser economic importance. Sensitive plant
present, sometimes spiny and hollow inside touch-me-not (Mimosa pudica) is grown as a
sheltering ants (Acacia sphaerocephala), curiosity. Various species of Acacia (A.
leaves of Mimosa pudica sensitive to touch senegal, A. stenocarpa) yield gum arabic. The
and showing sleeping movements. Inflores- pods and seeds of mesquite (Prosopis juliflora)
cence racemose, in racemes (Adenanthera) are used as animal feed, wood in cooking
or spikes (Prosopis), sometimes in cymose meats. Wood of Xylia is hard and used in ship
heads (Mimosa, Acacia). Flowers small, building. Calliandra, Dichrostachys are grown
Major Families of Angiosperms 571
Figure 13.85 Fabaceae, subfamily Mimosoideae. Mimosa pudica. A: Branch with inflorescence
heads; B: Lomentum fruits constricted between and splitting into 1-seeded seg-
ments. Acacia nilotica. C: Branch with long spines and inflorescence heads; D: Flower
bud; E: Moniliform pod. A. farnesiana. F: Portion of a branch with spines, leaf and
inflorescence heads; G: Flower with numerous stamens; H: Pod. Albizia julibrissin.
I: Part of a bipinnate leaf; J: Flower with monadelphous stamens; K: Part of a
stamen showing anther.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.86 Myrtaceae. Eucalyptus tereticornis. A: Portion of branch with axillary umbellate
inflorescences; B: Vertical section of flower bud; C: Open flower with cap shed;
D: Transverse section of ovary with 4 axile placentas. Callistemon viminalis. E: Branch
with spike proliferating into vegetative shoot; F: Flower with long exserted numer-
ous stamens; G: Vertical section of flower; H: Stamen with dorsal fixation; I: Trans-
verse section of ovary with 3 axile placentas. Syzygium cuminii. J: Branch with
inflorescences borne on peduncles; K: Vertical section of flower; L: Fruits.
Salient features: Shrubs or trees, bark erating into vegetative shoots, giving appear-
flaky, leaves gland-dotted, entire, inframar- ance of a bottle-brush). Flowers bracteate
ginal venation, stamens numerous, ovary in- (Eugenia) or ebracteate (Eucalyptus), bi-
ferior often united with hypanthium. sexual, actinomorphic, epigynous (some-
times perigynous). Calyx with 4-5 sepals,
Major genera: Eugenia (600 species). Euca- more or less connate into a tube, imbricate,
lyptus (500), Myrcia (300), Syzygium (300), sometimes united into a cap (calyptra or
Psidium (100), Melaleuca (100) and operculum) which drops off as flower opens.
Callistemon (25). Corolla with 4 (Eugenia) to 5 (Psidium) pet-
als, (rarely absent), usually fugacious, free,
Description: Evergreen Shrubs (Myrtus) or rarely united with calyx to form cap like oper-
large trees (Eucalyptus) often with flaky bark, culum (Eucalyptus) that falls off as the flower
terpenes present. Leaves alternate opens. Androecium with many stamens,
(Barringtonia, Callistemon), opposite (Eugenia) filaments free or slightly connate at base
or whorled, simple, entire, gland-dotted, usu- (Callistemon), attached higher up on
ally coriaceous, venation often inframar- hypanthium, anthers bithecous, dehiscence
ginal, stipules absent. Inflorescence cymose longitudinal or by apical pores, pollen grains
(umbellate cyme in Eucalyptus) or racemose usually tricolpate with fused furrows Gyn-
(Barringtonia), flowers sometimes solitary oecium with 2-5 united carpels (syncarpous),
(Psidium), or in spikes (Callistemonprolif- multilocular (locules as many as carpels)
574 Plant Systematics
with 2-many ovules, placentation axile, thors). Monophyly of the family, together
rarely parietal (Rhodamnia) with intruded with the morphological data, is evidenced by
placentae, ovary inferior, or semi-inferior molecular analysis through rbcL (Conti,
(Melaleuca) style long with capitate stigma. 1994), matK (Wilson et. al., 1996), and ndhF
Fruit a fleshy berry (Eugenia), drupe (Sytsma. et al., 1998) sequences. Heteropyxis
(Barringtonia) or capsule (Eucalyptus), rarely and Psiloxylon are basal taxa with perigynous
one-seeded nut (Calycothrix); seeds 1-many, flowers and stamens in two whorls. The fam-
embryo curved or twisted, endosperm absent. ily is considered to be closely related to Ro-
saceae, and probably the order Myrtales is
Economic importance: The family is the derived from Rosales. The family is tradi-
source of important oils such as eucalyptus tionally divided into two subfamilies:
oil (Eucalyptus) used as flavouring and inha- Leptospermoideae (leaves spiral to opposite;
lant, clove oil (Syzygium aromaticum) used as fruit dry, dehiscent) and Myrtoideae
clearing agent and in tooth aches, and oil of (polyhydroxyalkaloids common; leaves oppo-
bay rum (Pimenta racemosa). Callistemon is site; terpenoid-containing glands in the apex
commonly grown as ornamental with its of the connective, stigma dry; fruit fleshy,
beautiful bottlebrush like inflorescence indehiscent). The latter are largely derived.
(hence the name). Guava fruit is obtained Leptospermoideae are basal and paraphyletic
from Psidium guajava. Clove and allspice (Wilson et al., 2001; Salywon et al., 2002) as
(Pimenta dioica) include important spices. evidenced by molecular and morphological
Fruits of Syzygium cuminii (jambolan; jamun) data. Genus Syzygium, sometimes included
are edible and grown in India and China. under Eugenia, represents an independent
acquisition of the fleshy fruit from that in
Phylogeny: The family presents least taxo- Eugenia and the bulk of Myrtoideae. Thorne
nomic conflicts, almost universally placed (2003, 2006, 2007), places the family along
under Myrtales under Rosids (whether rosid with other two in suborder Myrtineae,
clade, Rasanae, or Rosidae depending upon Lythraceae and Onagraceae being placed
the nomenclature followed by different au- under Lythrineae.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.87 Lythraceae. Trapa bispinosa. A: Portion of plant with leaves (showing swollen
petioles) and flowers; B: Flower with front sepals and petals removed; C: Pistil
with disc; D: Fruit. E: Fruit of T. natans. Lythrum salicaria F: Branch with flowers;
G: Flower; H: Vertical section of flower; I: Transverse section of ovary. Ammania
coccinia. J: Branch with flowers and fruits; K: Flower; L: Cluster of fruits at node.
(F-I, after Bailey, Man. Cult. Pl., 1949. J-L, after Godfrey and Wooten, Aq. wetland
Pl. SE US, 1981)
576 Plant Systematics
***********
Major Families of Angiosperms 577
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herbs and shrubs, leaves petaloid, caducous, rarely persistent
simple, flowers usually 4-merous, sepals, (Ludwigia). Corolla with usually 4 petals,
petals and stamens inserted on rim of rarely 2-7, free, sometimes clawed, imbri-
hypanthium, carpels 4, united, placentation cate, convolute or rarely valvate, rarely ab-
axile, ovary inferior. sent. Androecium with usually 4 stamens,
mostly as many as petals, sometimes twice
Major genera: Epilobium (180 species), as many, rarely only one fertile and one
Oenothera (120), Fuchsia (110), Ludwigia (80), staminode (Lopezia), filaments free, inserted
Camisonia (60), Clarkia (45), Gaura (18, some- on inner rim of hypanthium, anthers
times merged with Oenothera), Lopezia (17) bithecous, sometimes with cross partitions,
and Circaea (12). Although Oenothera is the dehiscence logitudinal; pollen grains usually
type genus of the family, the name triporate, sometimes tricolporate or biporate,
Oenotheraceae Warming, 1879 is antedated with paracrystalline beaded outer exine, as-
by Onagraceae, 1829 and adopted by A. L. de sociated with viscin threads, which help pol-
Jussieu. len to adher together. Gynoecium with usu-
ally 4 united carpels, rarely 2 or 5, ovary in-
Description: Usually herbs, sometimes ferior, usually 4 chambered with axile
shrubs (Fuchsia), rarely aquatic herbs placentation, septa sometimes incomplete,
(Jussiaea) or trees (Hauya), raphides present, or with parietal placentation, ovules 1-many
stems with internal phloem, often with epi- in each locule, anatropous, with monosporic
dermal oil cells. Leaves alternate, opposite 4-nucleate megagametophyte (Oenothera-
or whorled , simple, rarely pinnate, entire type), nectary near or at base of hypanthium,
or toothed, sometimes lobed, venation pin- style slender, stigma capitate or 4-lobed.
nate, stipules usually absent, if present Fruit a loculicidal capsule, rarely berry (Fuch-
caducous (Fuchsia, Circaea). Inflorescence sia), bristly 1-2 seeded nutlet (Circaea), or 1-
of solitary flowers in leaf axils, sometimes seeded nut (Gaura); seeds commonly with
spike or raceme, rarely panicle (Fuchsia). hairy tufts (Epilobium) or wings (Hauya),
Flowers bisexual, actinomorphic, rarely rarely smooth, embryo straight, endosperm
zygomorphic (Lopezia), epigynous with well lacking. Pollination by bees, moths, flies and
developed hypanthium often prolonged above birds. Dispersal of winged and hairy-tuft
ovary, . Calyx with usually 4 sepals, rarely seeds by wind, fleshy fruits of Fuchsia by birds,
2-7, free, rarely connate, valvate, sometimes and hooked fruits of Circaea by exozoochory.
578 Plant Systematics
Figure 13.88 Onagraceae. Oenothera rosea. A: Portion of plant with flowers and fruits; B: Flower;
C: Stamen; ; D: Transverse section of ovary; E: Fruit. Ludwigia alternifolia F: Branch
with flowers and fruits; G: Flower from above. L. linearis H: Flower, side view;
I: Fruit. (A-E, after Sharma and Kachroo, Fl. Jammu, 1983. F-I, after Godfrey and
Wooten, Aq. wetland Pl. SE US, 1981).
Epilobium commonly colonises burned areas, Phylogeny: The family is commonly placed
hence the name fireweed. Oenothera flow- under Myrtales although Hutchinson (1973)
ers often open in late afternoon and thus included it under order Lythrales. The
known as Evening primrose. genus Trapa formerly included in this
family was separated to Trapaceae
Economic importance: The family is known (Cronquist, 1988; Dahlgren, 1989;
for showing flowers. Species of Oenothera Takhtajan, 1997), but has now been shifted
(Evening pirmrose) and Clarkia are grown as to Lythraceae (APG-II, 2003; APWeb, 2008;
ornamentals in flower beds. Fuchsia shrubs Thorne, 2006, 2007). Onagraceae and
are grown in greenhouses or in open warm Lythraceae share features of tannins scarce,
regions. soluble oxalate present, wood with vessels
Major Families of Angiosperms 579
in groups, petiole bundle arcuate, inflores- Lythraceae found strong support for
cence racemose and clawed petals. monophyly of Onagraceae, with Ludwigia as
Pentamerous members Decodon and the basal lineage and a sister-taxon relation-
Ludwigia are sister to the respective fami- ship between Megacorax and Lopezia. Most
lies Lythraceae and Onagraceae. Two well relationships within Onagreae are weakly
defined subfamilies, Ludwigioideae (4-5 resolved, suggesting a rapid diversification
merous flowers, hypanthium absent, pollen of this group in western North America. Nei-
in tetrads, stigma capitate) and Onagroideae ther Camissonia nor Oenothera appears to be
(flowers 4-merous, hypanthium long, stigma monophyletic. The study also showed that
divided) are commonly recognised in APWeb the small genus Gongylocarpus previously
(2008), although it is conventional to divide included in tribe Onagreae is strongly sup-
the family into number of tribes. Raimann ported as sister to the rest of Onagreae +
(1893) recognised 8 tribes within the family: Epilobieae, and should be placed in its own
Jussieae, Epilobieae, Hauyeae, Onagreae, tribe, Gongylocarpeae. Subsequent studies
Gaureae, Fuchsieae and Circeae. Gaureae of Levin et al. (2004) on two biggest tribes
is often included under Onagreae. Despite based on DNA sequence data from one
intensive morphological and molecular stud- nuclear region (ITS) and two chloroplast
ies of Onagraceae, relationships within the regions trnL-trnF and rps16 strongly suggest
family are not fully understood. Levin et al. that tribe gongylocarpeae is sister to tribes
(2003) on the basis of parsimony and maxi- Epilobieae + Onagreae, both of which are
mum likelihood analyses with rbcL and ndhF monophyletic. Within Onagreae, Camissonia
sequence data for 24 taxa representing all seems to be broadly paraphyletic, and
17 Onagraceae genera and two outgroup Oenothera is also paraphyletic.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herbs and shrubs with Economic importance: The family is repre-
stellate pubescence, often mucilaginous, sented by several ornamentals such as
leaves palmately veined, stipules prominent, China rose (Hibiscus rosa-sinensis), hollyhock
flowers usually with epicalyx, stamens nu- (Althaea rosea) and rose of Sharon (Hibiscus
merous with united filaments, anthers syriacus), Young fruits of okra (Hibiscus
monothecous, carpels five or more, ovary esculentus; bhindi) are used as vegetable.
superior, placentation axile. Cotton is obtained from different species of
Gossypium. Cocoa (chocolate source) is ob-
Major genera: Hibiscus (300 species), Ster- tained from seeds of Theobroma cacao, Cola
culia (300), Dombeya (300), Sida (200), nitida (both formerly under Sterculiaceae)
Pavonia (200), Abutilon (100), Tilia (50), Adan- yields cola. Seed hairs from Ceiba and
sonia (10), Gossypium (20) and Bombax (8). Bombax (kapok) are used as stuffing. Tilia is
a tree valuable as timber (Basswood). The
Description. Herbs or shrubs, rarely small wood of T. cordata is particularly good for
(Thespesia) or large (Tilia) trees. Plants of- making furniture and musical instruments,
ten mucilaginous. Leaves alternate, simple, also grown as ornamental tree.
sometimes palmately lobed (Gossypium),
palmately veined, pubescence stellate or of Phylogeny: The family has been considered
peltate scales, stipules present. Inflores- quite distinct on the basis of monadelphous
cence cymose (Pavonia) or flowers solitary stamens with monothecous anthers,
axillary. Flowers bracteate (Abutilon) or though it had been considered quite closer
ebracteate (Hibiscus) bisexual, to Tiliaceae, Bombacaceae and
actinomorphic, hypogynous. Calyx with 5 Sterculiaceae by Cronquist (1988) and
sepals, more or less united, often subtended Takhtajan (1997). These families share the
by epicalyx (bracteoles), epicalyx 3 (Malva), features of presence of stellate hairs, mu-
5-8 (Althaea) or absent (Sida). Corolla with 5 cilaginous cells, pericycle strands above
petals, free, imbricate, often adnate at base phloem, similar size and pitting of vessels,
to staminal tube. Androecium with many and the distribution of xylem parenchyma.
stamens, filaments united into a tube According to Judd et. al., (1999, 2002) the
(monadelphous), epipetalous, anthers traditional distinctions between these fami-
monothecous, dehiscence transverse, pollen lies are arbitrary and inconsistent, and the
grains large with spinous exine, triporate or merger of four would form a monophyletic
multiporate, tricolpate in Abutilon. Gyn- Malvaceae. They however, concede that
oecium with 2-many (usually 5) united car- genera such as Grewia, Corchorus,
pels (syncarpous), multilocular (locules as Triumfetta , etc., form a clade which has
many as carpels) with many ovules, lost calyx fusion, also suggesting that
placentation axile, ovary superior, styles Grewioideae and Byttnerioideae form
branched above, stigmas as many as carpels distinct clades within Malvaceae. Tradi-
or twice as many (Malvaviscus). Fruit a tional Tiliaceae was circumscribed by free
loculicidal capsule or schizocarp (Malva), stamens and bithecous anthers. Thorne
follicles (Sterculia), rarely a berry (Malva- (1999, 2000), obviously had kept Tiliaceae
viscus); seeds 1-many, embryo curved, distinct, merging the other two families
endosperm absent. Flowers are insect polli- with Malvaceae. Recent molecular
nated, nectar usually produced by inner evidence (Alverson et al., 1998) suggests
surface of calyx. Dispersal may occur by that half-anthers of the traditional
wind, water, or animals. Large indehiscent Malvaceae are transversely septate
pods of Adansonia are dispersed by large bithecous anthers that are strongly
mammals. connate. Earlier Hutchinson (1973) had pro-
582 Plant Systematics
Figure 13.89 Malvaceae. Malva parviflora. A: Plant in flower; B: Portion of flower with 2 petals
and longitudinally split androecium; C: Gynoecium; D: Fruit with persistent calyx.
Abutilon indicum. E: Plant with flowers and fruits on long peduncles; F: Calyx;
G: Gynoecium with several carpels; H: One fruiting carpel split to show seeds.
***********
Major Families of Angiosperms 583
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II/(APweb)
B & H, Cronquist, Takhtajan, and Dahlgren under family Tiliaceae. APG II and APweb do not
recognize Tiliaceae or Grewiaceae as separate family, merge with Malvaceae. Thorne under suborder
Malvineae
Figure 13.90 Grewiaceae. Grewia tenax. A: Portion of plant with flowers and fruits; B: Flower
with sepals and petals removed; C: Stamen; D: Transverse section of ovary. Corchorus
capsularis. E: Portion of plant with flowers and fruits; F: Flower from above;
G: Fruit. H: Corchorus aestuans, portion of plant with fruit.
584 Plant Systematics
Salient features: Shrubs or trees, leaves placentation axile, ovary superior, style sin-
with asymmetrical base, pubescence of gle, stigma lobed or capitate. Fruit a capsule
branched hairs, stamens numerous with or fleshy. Seeds 1-many, embryo straight,
free or united filaments, anthers bithecous, endosperm present.
carpels five or more, ovary superior,
placentation axile. Economic importance: Jute is obtained from
stem fibres of Corchorus capsularis and C.
Major Genera: Grewia (150 species), olitorius. Leaves of C. olitorius are used for
Triumfetta (70) and Corchorus (50). food in many eastern Mediterranean coun-
tries.
Description: Shrubs or trees, rarely herbs
(Corchorus, Triumfetta). Leaves alternate, sim- Phylogeny: The family has been considered
ple, deciduous, bases asymmetrical, pubes- to be distinct for a long time, with removal
cence of branched hairs, stipules present. of genera of the family Tiliaceae to
Inflorescence cymose, usually in small clus- Flacourtiaceae by Engler and Prantl (1887-
ters in leaf axils. Flowers bisexual, rarely uni- 1915). The family is distinct from now en-
sexual, actinomorphic, hypogynous. Calyx larged Malvaceae in free stamens and
with 3-5 sepals, free or connate, valvate. Co- bithecous anthers. APG classifications (APG
rolla with 3-5 petals, free, imbricate or II, APweb) have merged Tiliaceae with
valvate, sometimes with glandular hairs at Malvaceae. Thorne (1999), treated Tiliaceae
their bases, rarely absent. Androecium with as distinct family (including subfamilies of
many stamens, sometimes only 5 (Triumfetta Malvaceae: Tilioideae and Grewioideae in
pentandra), filaments free or united into APweb). Subsequently (2003) he has merged
groups of 5 or 10 (polyadelphous), adnate to Tilioideae (Tilia and Craigia) with Malvaceae,
base of petals, anthers bithecous, dehiscence recognizing Grewioideae as independent
longitudinal, or by apical pores. Gynoecium new family Grewiaceae (new name neces-
with 2-many united carpels, multilocular sitated due to shifting of Tilia, the type of fam-
(locules as many as carpels) with many ovules, ily Tiliaceae).
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb
Figure 13.91 Dipterocarpaceae. Dipterocarpus trinervis. A: Branch with flower; B: Calyx and co-
rolla; C: Vertical section of flower; D: Longitudinal section of ovary; E: Stamen with
sterile tip above anther; F: Transverse section of ovary. G: Fruit of D. pilosus with
two long wings. H: Fruit of Parashorea stellata with five wings.
Salient features: Small or large trees with bisexual, actinomorphic, often showy,
buttressed bases, leaves evergreen, alter- fragrant, hypogynous. Calyx with 5 sepals,
nate, often with domatia, flowers perigynous free or slightly connate, sometimes enlarged
or epigynous, in racemes or panicles, sepals and winged in fruit. Corolla with 5 petals,
becoming winged in fruit, petals 5, often free or connate at base, spirally twisted,
leathery, anthers with sterile tips, carpels often leathery. Androecium with 5-numer-
3, fruit a winged nut. ous stamens, filaments free or connate at
base, anthers bithecous, dorsifixed (Monotoi-
Major genera: Shorea (150 species), Hopea deae), or basifixed (Dipterocarpoideae),
(110), Dipterocarpus (80), Vatica (60) and dehiscence longitudinal, anthers with
Monotes (26). sterile tip formed by extension of connective,
pollen grains tricolpate or triporate.
Description: Small or large trees, often but- Gynoecium with 3 united carpels, ovary
tressed at the base, trunk very long and superior or partly inferior (Anisoptera),
smooth, branched at top with cauliflower- 3-locular with 2 ovules in each chamber,
shaped crown, usually with special resin placentation axile, ovules pendulus,
canals exuding aromatic dammar from anatropous, bitegmic, crassinucellate, only
wounds, nodes trilacunar or pentalacunar, one ovule develops further. Fruit a single
roots with ectomycorrhiza. Leaves alternate, seeded nut with winged and membranous
distichous, coriaceous, simple, evergreen, calyx; seeds without endosperm, cotyledons
covered with fasciculate or stellate hairs, often twisted, enclosing radicle.
stipules present and frequently containing
domatia housing insects, usually early shed- Economic importance: Many species of
ding. Inflorescence racemose, axillary or Dipterocarpus, Shorea, Hopea and Vatica usu-
terminal racemes or panicles. Flowers ally grow together in tropical rain forests and
586 Plant Systematics
are principal sources of hardwood timber. The clade having plant with secretory canals,
wood is pale in colour and in great demand calyx imbricate, two outer members often
for plywood and block wood. Dammar resin different from the rest, filaments not articu-
obtained from the tree is used for special lated, ovules both anatro-pous and atropous;
varnishes. exotegmen curved inwards in chalazal re-
gion, and there is a strong case for merging
Phylogeny: The family is related to former two in Dipterocarpaceae. Phylogenetic
Ochnaceae, Elaeocarpaceae, Grewiaceae and studies on family Dipterocarpaceae based on
other members of Malvales. Cronquist con- morphological and rbcL sequence data
siders it closer to Guttiferae and Theaceae (Dayanandan et al., 1999) have shown that
in addition to Ochnaceae. The family is usu- Monotoideae and Pakaraimaeoideae are
ally divided into 3 subfamilies: Monotoideae, cladistically basal, representing primitive
Pakaraimaeoideae and Dipterocarpoideae. members of the family. Thorne (2003) had
Molecular studies of Kubitzki & Chase, (2002) earlier included the family (and the order
have shown that Sarcolaenaceae, Cistaceae Malvanae) under superorder Rosanae, but
and Dipterocarpaceae form a well defined subsequently (2006) shifted to Malvanae.
***********
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb
Salient features: Trees and shrubs, leaves Description: Erect or climbing shrubs, trees,
toothed with strong secodary veins, stipu- rarely herbs, sometimes thorny, sometimes
late, flowers perigynous, petals strongly con- associated with nitrogen-fixing
cave, stamens opposite the petals, Actinomycetes bacteria, stems often modi-
hypanthium with nectary inside, ovules on fied into thorns, tendrils or hooks. Leaves
basal placentas. usually opposite, sometimes alternate, sim-
ple, toothed, venation reticulate with strong
Major genera: Rhamnus (150 species), secondary veins, stipules usually present
Phylica (150), Ziziphus (100), Ceanothus (40), and often modifies into spines, leaves some-
Gouania (35), Colubrina (15), Berchemia (10) times rudimentary. Inflorescence axillary
and Sageretica (10). corymb or cymose clusters, rarely solitary.
Major Families of Angiosperms 587
Figure 13.92 Rhamnaceae. Rhamnus purpurea. A: Branch with flowers; B: Flower; C: Vertical
section of flower; D: Transverse section of ovary; E: Fruit. F: Fruiting shoot of
Zizyphus mauritiana. G: Flowering shoot of Z. nummularia. (A, B and E, after Polunin
and Stainton, Fl. Himal., 1984; F and G, after Maheshwari Illus. Fl. Del., 1966).
Flowers small, usually inconspicuous, inferior (Gouania) due to adnation with disc,
actinomorphic, bisexual, rarely unisexual, ovule 1 in each locule on basal placenta,
perigynous, hypanthium present. Calyx pendulus, anatropous, style one, often lobed
with 5 sepals, rarely 4, free or united, lobes or cleft. Fruit a drupe with 1-many
valvate. Corolla with 5 petals, rarely 4, free, endocarps, capsule or samaroid nut; seed
sometimes absent, often concave and hooded large, usually straight, sometimes curved,
(cucullate) over anthers, usually clawed. without or with scanty endosperm.
Androecium with as many as petals and op-
posite them, arising from outside disc that Economic importance: The family yields
lines the rim of hypanthium, anthers important fruits from species of Ziziphus
bithecous, dehiscence longitudinal, anthers (Z. jujuba, the jujube or Chinese date;
with sterile tip formed by extension of con- Z. mauritiana, the Indian jujube; Z. lotus,
nective, pollen grains tricolpate or triporate. lotus fruit), also used to make jelly-like
Gynoecium with 2-4 united carpels, rarely candy. Plants of the family yields dyes
5, locules as many, ovary superior or partly include Rhamnus cathartica (green dye from
588 Plant Systematics
sap), R. tinctoria (yellow dye from fruits), R. Elaeagnaceae, Dirachmaceae and Barbeya-
chlorophora (Chinese green indigo from bark) ceae under Rhamnales, but shifts Vitaceae
obtained from the members of this family to independent order Vitales under Malvanae.
include. Several species are also used me- APG -II includes Vitaceae unplaced in Rosids,
dicinally: fruits of R. cathartica and R. whereas APWeb included it under Vitales but
purshiana are strongly laxative; extract of towards end of Core Eudicots. Takhtajan
Gouania bark are used as woud dressing in (1997) also separated two families under
Africa; Ventilago oblongifolia is used to treat distinct orders. The family Rhamnaceae
cholera in Malaya. Many species of shows affinities with Rosales, under which
Ceanothus (tea bush) with beautiful panicles it is placed in both APG-II and APWeb. There
of blue, pink or white flowers are grown as are three main clades in the family are
ornamentals. Other members used as orna- recognised by APWeb, the rhamnoids, which
mental include Hovenia (raisin tree), include Maesops and Ventilago (three tribes),
Berchemia (supplejack), Poliurus (Jerusalem the ziziphoids (five tribes), which include most
thorn) and Reynosia. of the rest of the family, and the ampelo-
ziziphoids (three tribes). The four families
Phylogeny: Family is often placed closer to included under the order by Thorne (2006)
Vitaceae, in the same order Rhamnales form a well defined clade (Sytsma et al. 2002),
(Rendle, Cronquist, Hutchinson but he also with dense curly hairs on abaxial surface of
included Elaeagnaceae and Heteropyxida- leaf, a possible synapomorphy. Rhamnaceae
ceae). Thorne (2006) retains Rhamnaceae, is sister to this clade.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Trees or shrubs with wa- Major genera: Ulmus (20 species), Zelkova
tery sap, sieve-tube plastids P-type, leaves (6), Phyllostylon (3) and Planera (1).
simple, serrate or biserrate, vascular bun-
dles entering teeth, leaf base oblique, vena- Description: Shrubs or trees without
tion pinnate, flowers often bisexual, fruit a laticifers, often with tannins, cystoliths
winged samara or drupe. present, branching profusely and often
Major Families of Angiosperms 589
Figure 13.93 Ulmaceae. Ulmus chumlia. A: Short shoot, lower surface & corky bark; B: Leaf of
coppice shoot, upper surface; C: Normal adult short shoot, upper surface; D: Leaf
margin; E: Indumentum of midrib portion, lower surface; F: Flowering shoot; G:
Fruiting shoot; H: Flower; I: Slightly older flower; J: Gynoecium; K: Bract; L: Inner
bud scale; M: Mature winged fruit. (After Melville and Heybroek, 1971)
spreading. Leaves alternate, rarely opposite, Perianth with 4-9 tepals, free or connate,
simple, serrate or biserrate, base often ob- representing sepals (petals absent), imbri-
lique, venation pinnate, reticulate, vascu- cate. Androecium with 4-9 stamens, as
lar bundles entering teeth, stipules present many as tepals and opposite them, some-
but falling early. Inflorescence consisting of times adnate to tepals, pollen grains 4-6-
axillary cymose clusters. Flowers small, porate. Gynoecium with 2 united carpels,
actinomorphic, bisexual or unisexual and ovary superior, unilocular, ovule 1,
monoecious, hypogynous or perigynous. placentation apical, stigmas 2, decurrent on
590 Plant Systematics
style. Fruit a nut or samara; seed flat with fruit a samara or nut. The family was earlier
straight embryo, endosperm forming a sin- divided into two subfamilies: Celtidoideae
gle layer and appearing absent. Pollination (drupe-like fruit, three palmate veins, sieve
by wind. Winged fruits are also dispersed by tube plastids S-type; style with single vascu-
wind, nut-like fruits of Planera dispersed by lar bundle, embryo curved) and Ulmoideae
water. (fruit samara, veins pinnate; sieve tube
plastids P-type, style with 3 vascular bundles,
Economic importance: Various species of embryo straight). The former has now been
Ulmus (elm) and Zelkova provide timber used separated as a distinct family Celtidaceae.
for furniture, posts and under water pillings. The family is often placed in order Urticales.
Ulmus americana and other species are grown Cronquist places it under Hamamelid com-
as ornamentals and important shade trees. plex but others including Dahlgren and
Mucilaginous inner bark of U. rubra has me- Thorne place them along with other
dicinal importance. Malvanean groups. Takhtajan also places
them closer to Malvales but under superorder
Phylogeny: The family was earlier included Urticanae. APG classifications place them
under Urticaceae (Bentham and Hooker) but closer to Rosaceae, and Rhamnaceae under
now separated due to veins of leaves running order Rosales, Rosaceae being considered
directly into teeth, flowers often bisexual and sister to rest of the families.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Trees and shrubs with Description: Trees or shrubs, sometimes
milky latex, leaves alternate, flowers uni- lianas, rarely epiphytic in early stage (stran-
sexual, small, carpels usually 2, ovary supe- gling species of Ficus), often with milky la-
rior, single chambered, ovule 1. tex distributed in all parenchymatous tis-
sues, cystoliths present, usually globose,
Major genera: Ficus (600 species), Dorstenia tannins often present. Leaves alternate
(110), Artocarpus (50), Morus (15) Maclura (12) (rarely opposite), usually distichous, simple
and Broussonetia (8). with entire or lobed margin, with pinnate or
Major Families of Angiosperms 591
Figure 13.94 Moraceae. Ficus cunia. A: Branch with leaves; B: Branch bearing figs; C: Longitudi-
nal section of hypanthodium (fig, receptacle); D: Female flower; E: Gynoecium;
F: Male flower with single stamen; G: Stamen. H: Twig of Ficus religiosa. Morus alba.
I: Male branch; J: Female branch; K: Female flower with closely appressed peri-
anth; L: Longitudinal section of female flower; M: Male flower with four tepals and
4 stamens; N: Multiple fruit (Sorosis).
alba, M. nigra), fig (Ficus carica) and bread- being considered sister to rest of the fami-
fruit (Artocarpus altilis). Fruits of Artocarpus lies. Cecropia and related genera earlier in-
heterophyllus (kathal) are cooked as vegeta- cluded under Moraceae (Hutchinson and ear-
ble, whereas those of A. lakoocha (dheon) lier authors), and separated under
are pickled. Leaves of Morus are also used Cecropiaceae by APG (1998), Thorne (1999,
for raring silkworms. Various species of Ficus 2000) and Judd et al. (1999, 2002) are inter-
including F. elastica (Indian rubber tree or mediate between Moraceae and Urticaceae,
rubber plant) are grown as ornamentals. but closer to Urticaceae in restriction of
laticifers to bark, basal ovule, straight em-
Phylogeny: The family was earlier placed bryo and with one carpel aborted (pseudo-
in Urticaceae (Bentham and Hooker) but now monomerous). The family Cecropiaceae has
considered distinct in woody habit with milky appropriately been merged with Urticaceae
latex, 2 carpels, ovary with single apical ovule by APG II (2003), APweb (2003) and Thorne
and usually curved embryo. Cronquist places (2003). The family Moraceae as narrowly cir-
Urticales (including Urticaceae and related cumscribed here is monophyletic as sup-
families) under Hamamelid complex but oth- ported by rbcL sequences (Sytsma et al.,
ers including Dahlgren and Thorne place 1996). The reduction of one carpel is also in-
them along with other Malvanean groups. dicated in slightly or strongly unequal styles
Takhtajan also places them closer to Malvales in Artocarpus, Dorstenia and Ficus. A complete
but under superorder Urticanae. APG classi- loss of one of the two styles probably occurred
fications place them closer to Rosaceae, and in common ancestor of Cecropiaceae
Rhamnaceae under order Rosales, Rosaceae +Urticaceae clade.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Usually herbs with sting- Major genera: Pilea (370 species), Elatostema
ing hairs, leaves with stipules, flowers (170), Boehmeria (80), Urtica (50) Parieteria (30)
small, unisexual, tepals and stamens usu- and Laportea (20).
ally 4 each, carpel 1, style 1, fruit achene or
fleshy drupe. Description: Usually herbs, rarely trees or
Major Families of Angiosperms 593
Figure 13.95 Urticaceae. Urtica hyperborea. A: Plant with axillary clusters of flowers; B: Male
flower with four tepals and four stamens; C: Female flower with unequal tepals;
D: Achene surrounded by persistent perianth. Boehmeria platyphylla. E: Plant with
interrupted spikes; F: Female flower with bristly perianth and hairy style; G: Verti-
cal section of female flower; H: Gynoecium; I: Transverse section of achene.
shrubs, sometimes climbers, with often or opposite, usually distichous, simple with
milky latex restricted to bark or reduced entire or lobed margin, with pinnate or
with clear sap, cystoliths present, usually palmate venation, reticulate, stipules
elongated, tannins often present, hairs present, leaf base cordate or assymetrical.
simple, usually stinging. Leaves alternate Inflorescence cymose or heads, sometimes
594 Plant Systematics
with solitary flowers. Flowers small, uni- elongate cystoliths, laticifers restricted to the
sexual (monoecious or dioecious), bark, with clear sap, incurved stamens,
actinomorphic, hypogynous. Perianth usu- pseudomonomerous gynoecium and basal
ally with 4 tepals (representing sepals, pet- ovule. Thorne (1999) and the APG classifica-
als absent), rarely only 3 or upto 6, free or tions (APG, 1998; Judd et al., 1999, 2002) also
united, imbricate or valvate. Androecium included in Urticaceae the genus Poikilo-
with 4-5 (as many as tepals) stamens, op- spermum, formerly placed in Cecropiaceae.
posite the tepals, filaments free, incurved Cronquist places Urticales (including Urtica-
in bud, reflexed at anthesis, anthers ceae and related families) under Hamamelid
bithecous, dehiscence longitudinal, pollen complex but others including Dahlgren and
grains multiporate or with 2-3 pores. Thorne place them along with other
Gynoecium with single carpel (actually 2 Malvanean groups. Takhtajan also places
but with one reduced: pseudo-monomerous), them closer to Malvales but under superorder
ovary superior, unilocular, ovule 1, Urticanae. APG classifications place them
orthotropous, placentation basal, style 1, closer to Rosaceae, and Rhamnaceae under
stigmas 1 or 2, extending on style or capi- order Rosales, Rosaceae being considered
tate. Fruit usually an achene, embryo sister to rest of the families. Single carpel in
straight, endosperm sometimes lacking. the family has been derived through abortion
of the second carpel, as borne out by the
Economic importance: In addition to being aborted vascular bundles in the ovary of
a noxious weed, Urtica dioica (common sting- Urtica and Laportea. The basal placentation
ing nettle) yields silky bast fibre. Fibre is also has similarly been derived from apical
extracted on the commercial scale from placentation of Moraceae. This is inferred
Boehmeria nivea (ramie or china grass). from the fact that in Boehmeria cylindrica
Species of Pilea and Soleirolia (babys tears) the vascular bundle supplying the ovule
provide important ornamentals. ascends the carpel wall for a short distance
and then reverses direction to enter the
Phylogeny: The family was earlier broadly ovule at the base of the ovary. The family
circumscribed (Bentham and Hooker) to Cecropiaceae, which was formerly recog-
include families which have now been sepa- nized (APG, 1998; Judd et al., 1999,2002;
rated as Moraceae, Ulmaceae, Celtidaceae, Thorne, 1999) as distinct family has finally
etc. The family is now circumscribed to been merged with Urticaceae (Thorne, 2003;
include mainly herbaceous species with APG II, 2003; APweb, 2003).
***********
Major Families of Angiosperms 595
Salient features: Parasitic on stem and roots, with 48 carpels, ovary inferior, unilocular
plant body filamentous like a fungal myc- with 4-14 parietal placentas, or 310(20)
elium, flowers usually unisexual, with fleshy locular by deep intrusion of the placentas
petaloid calyx, stamens in a column, ovary (Rafflesia), ovules 50100 per locule, non-
inferior, carpels fused, placentation parietal, arillate, hemianatropous to anatropous,
fruit fleshy. bitegmic, tenuinucellate, united, style ex-
panded into an often large, complex disk, with
Major genera: Rafflesia (16 species), Sapria stigmatal projections. Fruit usually fleshy
(2) and Rhizanthes (2). berry, seeds endospermic, minute, embryo
rudimentary.
Description: Total parasites on stems and
roots of angiosperms, vegetative part Economic importance: None.
filamentous, like fungal mycelium, rootless,
permeating the host tissues, with only the Phylogeny: The family is closely related to
flowers or the flowering stems emerging from Hydnoraceae, often placed in Magnoloid com-
the host tissue, xylem without vessels. plex under a distinct order Rafflesiales.
Leaves much reduced, present at the bases Cronquist, however, placed this order under
of flowering stems, or beneath the flower, or Rosidae. The family is often considered closer
absent, alternate, opposite, or whorled, of to Aristolochiaceae because of similar peri-
membranous scales, stomata absent. Inflo- anth. The recent cladistic studies, however,
rescence with solitary flowers. Flowers small place Hydnoraceae and Aristolochiaceae un-
to very large (Rafflesia arnoldii, with the larg- der Piperales based on multigene analyses.
est known flowers in angiosperms, up to 1 m The position of Rafflesiaceae still remains
in diameter), regular, usually unisexual, cy- uncertain in APG II and APweb. Nickrent
clic. Perianth with tepal green or petaloid, 4, (2002) considers this family to be closer to
or 5(10), free, or united into tube, usually Malvales. Thorne had earlier (1999) broadly
fleshy, imbricate, rarely valvate. Androecium circumscribed the family Rafflesiaceae, di-
with 5100 stamens, united with the vided into 4 subfamilies: Mitrastemonoideae
gynoecium, free or filaments united into a (Mitrastemon-flowers bisexual and solitary,
tube round the stylar column, 1 whorled, fila- ovary superior), Cytinoideae (Cytinus and
ments slender, or reduced, anthers Bdallophyton-flowers unisexual, in racemes,
monothecous or bithecous, dehiscing by lon- stamens in one ring, ovary inferior with 8-
gitudinal slits, pores, or transversely, pollen 14 placentas), Apodanthoideae (Apodanthes,
grains usually nonaperturate. Gynoecium Pilostyles and Berlinianche- flowers small,
596 Plant Systematics
Figure 13.96 Rafflesiales. Rafflesiaceae (A-C). A: Fully opened flower of Rafflesia speciosa (photo
courtesy Julie Barcelona, Manilla, Philippines). B: Seed of R. arnoldii. C: Partial
section of seed showing undivided embryo. Cytinaceae (D-G). Cytinus hypocistis.
D: Plant in flower; E: Vertical section of male flower; F: Vertical section of female
flower; G: Portion of transverse section of ovary. Apodanthaceae (H-J) Pilostyles
berterii. H: Host twig with flowers of Pilostyles emerging out; I: Vertical section of
male flower; J: A head of stamens.
unisexual, solitary, stamens in 2 or 4 rings, unplaced towards the end of angiosperms, the
ovary inferior with 4 placentas or 1 continu- family placement of Bdallophyton being
ous placenta) and Rafflesioideae (Flowers soli- uncertain. According to Judd et al. (2002),
tary and unisexual, large, stamens in 1 ring, Rafflesiaceae (also Balanophoraceae and
ovary inferior with many irregular chambers). Hydnoraceae) look so different from other
These have now (2003) been recognized as flowering plants that no one has been sure
independent families Mitrastemonaceae, where to place them. Hydnoraceae appear to
Cytinaceae, Apodanthaceae and Rafflesia- belong in Piperales, the other two, according
ceae, respectively. APG II and APweb also to them are apparently dicots, but are no
recognize them as independent families but more precisely placed than that.
***********
Major Families of Angiosperms 597
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.97 Capparaceae. A: Capparis decidua with flowers, leaves absent on branches.
C. sepiaria. B: Portion of flowering branch; C: Small portion of fruiting branch;
D: Flower with numerous stamens. E: Transverse section of ovary with intruded
placentae.
598 Plant Systematics
Salient features: Shrubs or trees, sepals and (dela) is pickled and also given to heart pa-
petals 4 each, free, stamens many, ovary tients. The dried floral buds of C. spinosa are
unilocular with parietal placentation, called capers and are used in seasoning.
superior, sometimes with gynophore, fruit
a capsule or berry. Phylogeny: Heterogeneity of broadly circum-
scribed Capparaceae was long recognized.
Major Genera: Capparis (350 species), Hutchinson (1973), on the basis of extensive
Maerua (100), Boscia (37), Cadaba (30) and studies at Kew concluded that the family
Crataeva (20 species) consisted of two distinct groups which are
not really phylogenetically related. True
Description. Shrubs (Capparis), rarely trees Capparids, according to him are woody plants
(Crataeva) or climbers (Maerua). Leaves al- with indehiscent fruits, without a replum,
ternate, rarely opposite, simple, stipules and fairly closely related to Flacourtiaceae,
present, sometimes reduced to glands or whereas Cleome and its relatives are herbs
spines (Capparis). Inflorescence typically with dehiscent fruits with replum, as in fam-
racemose, corymbose (Crataeva), or in um- ily Brassicaceae. This view was confirmed
bels (Capparis). Flowers bracteate (bracts by morphological studies (Judd et. al., 1994)
often leafy), actinomorphic or zygomorphic and rbcL sequences (Rodman et al., 1993) as
(Capparis), bisexual, rarely unisexual or po- mentioned under Brassicaceae, ultimately
lygamous (Crataeva), hypogynous, thalamus leading to the merger of Capparaceae with
often prolonged into androgynophore. Calyx Brassicaceae in APG classifications. Al-
with 4 sepals, rarely 2-8, free or connate though position was kept up in the APG II,
(Maerua), in two whorls, sometimes in one but was pointed out that resurrection of
whorl. Corolla with 4 petals, cruciform (ar- Capparaceae and Cleomaceae may be appro-
ranged in a cross), rarely 8 or even lacking priate in the future. This change in posi-
(Maerua), clawed. Androecium with 4 or tion has largely been on account of the re-
more stamens, free, often arising from sults of the studies by Hall, Sytsma and Iltis
androphore (lower portion of andro- (2002), who on the basis of chloroplast DNA
gynophore), dehiscence longitudinal, sequence data, concluded that the three form
nectaries often present near base of sta- distinct strongly supported monophyletic
mens. Gynoecium with 2-12 united carpels groups, as is also supported by morphologi-
(syncarpous), unilocular with one-many cal data. According to Puri (1950),
ovules, replum absent, placentation parietal, bicarpellary syncarpous unilocular ovary
ovary superior, often on a gynophore (upper with parietal placentation is derived from
part of androgynophore), style 1, stigma capi- tetracarpellary condition with axile
tate or bilobed. Fruit a berry, capsule, drupe, placentation. Thorne who had earlier (1999)
or nut, often stalked; seeds 1-many, embryo recognized Capparaceae (also including
curved, endosperm usually absent. Cleome and its relatives) and Brassicaceae
as distinct families, has subsequently (2003)
Economic importance: The family contrib- separated Cleome and relatives under dis-
utes a few ornamentals such as Capparis tinct family Cleomaceae, as suggested in
and Crataeva. The fruit of Capparis decidua APG II.
***********
Major Families of Angiosperms 599
Placement:
B&H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.98 Cleomaceae. Cleome gynandra. A: Lower part of the plant with palmately compound
leaves; B: Inflorescence with flowers having conspicuous androgynophore; C: Se-
pal; D: Petal; E: Stamen; F: Gynoecium with distinct gynophore; G: Transverse
section of ovary with parietal placentation; H: Seed.
600 Plant Systematics
Salient features: Herbs, sepals and petals capsule or siliqua, often stalked; seeds
4 each, free, stamens many, ovary unilocu- 1-many, embryo curved, endosperm usually
lar with parietal placentation, superior, absent.
sometimes with gynophore, replum present,
fruit a capsule or follicle. Economic importance: The family contrib-
utes a few ornamentals such as Cleome and
Major Genera: Cleome (200 species), Polanisia. The decoction of Cleome chelidonii
Podandrogyne (10) and Polanisia (7). is used to cure scabies.
Description. Annual or perennial Herbs. Phylogeny: Members of the family are gen-
Leaves alternate, rarely opposite, simple or erally included under family Capparaceae.
palmately compound, stipules present. Hutchinson (1973) on the basis of extensive
Inflorescence typically racemose, corymbose studies at Kew concluded that Cleome and
(Cleome). Flowers bracteate, bracts often its relatives are distinct from capparids. APG
leafy, actinomorphic, bisexual, hypogynous, II classification included Capparaceae (in-
thalamus often prolonged into androgyno- cluding Cleomaceae) under Brassicaceae,
phore. Calyx with 4 sepals, rarely 2-8, free, but was pointed out that resurrection of
in two whorls, sometimes in one whorl. Capparaceae and Cleomaceae may be appro-
Corolla with 4 petals, cruciform (arranged in priate in the future. This change in posi-
a cross), clawed. Androecium with 4 or more tion has largely been on account of the re-
stamens, free, often arising from androphore sults of the studies Hall, Sytsma and Iltis
(lower portion of androgynophore), dehiscence (2002), who on the basis of chloroplast DNA
longitudinal, nectaries often present near sequence data, concluded that the three form
base of stamens. Gynoecium with 2-12 distinct strongly supported monophyletic
united carpels (syncarpous), unilocular groups, as is also supported by morphologi-
(usually bilocular due to false septum and with cal data. Thorne who had earlier (1999) in-
distinct replum) with one -many ovules, cluded this family under Capparaceae, has
placentation parietal, ovary superior, often on subsequently (2003) separated Cleome and
a gynophore (upper part of androgynophore), relatives under distinct family Cleomaceae,
style 1, stigma capitate or bilobed. Fruit a as suggested in APG II.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.99 Brassicaceae. Brassica campestris. A: Upper part of plant with inflorescence;
B: Lower leaf; C: Vertical section of flower; D: Siliqua with persistent style forming
a long beak. Capsella bursa-pastoris. E: Plant with inflorescence; F: Flower; G: Flower
with sepals and petals removed; H: Silicula with apical notch having persistent
style, fruit flattened at right angles to the septum and as such replum appearing as
vertical rim. Coronopus didymus. I: Plant with highly dissected leaves and axillary
racemes; J: Flower from above showing minute petals and 2 stamens; K: Stamen;
L: Silicula, deeply bilobed and prominent replum. M: Silicula of Lobularia maritima
flattened parallel to the false septum and as such replum forming a ring around the
fruit. N: Siliqua of Brassica nigra dehisced with valves separating and seeds attached
to false septum.
602 Plant Systematics
Salient features: Herbs, sap watery, sepals width), at dehiscence valves break away from
and petals 4 each, free, stamens below upward leaving seeds appressed to
tetradynamous, ovary with false septum and false septum, fruit moniliform lomentum on
a thickened placental rim called replum, Raphanus; seed with large embryo,
ovary superior, placentation parietal, fruit a endosperm scant or absent. Pollination by
siliqua or silicula. insects, failure of cross pollination may re-
sult in self pollination. Seeds are usually
Major Genera: Draba (350 species), Erysi- dispersed by wind.
mum (180), Lepidium (170), Cardamine (160),
Arabis (160), Alyssum (150), Sisymbrium (90) Economic importance: The family contrib-
and Brassica (50). utes a number of food plants such as radish
(Raphanus sativus), cabbage (Brassica
Description. Annual, biennial or perennial oleracea var. capitata), cauliflower (B. oleracea
herbs (rarely undershrubs: Farsetia) with var. botrytis), Brussels sprouts (B. oleracea
watery sap, containing glucosinolates (mus- var. gemmifera), kohlrabi (B. oleracea var.
tard oils) and with myrosin cells. Hairs sim- caulorapa) and turnip (B. rapa). Seeds of B.
ple, branched, stellate or peltate. Leaves al- campestris yield cooking oil those of black
ternate or in basal rosettes, simple, often mustard (B. nigra) are used as condiment.
dissected, rarely pinnate compound (Nastur- Woad was formerly used a blue dye obtained
tium officinale) sometimes bearing bulbils in from leaves of Isatis tinctoria. Common
axil (Dentaria bulbifera) or leaf surface ornamentals include stock (Mathiola), candy
(Cardamine pratensis), stipules absent. Inflo- tuft (Iberis amara), alyssum (Alyssum), wall
rescence typically racemose, corymbose ra- flower (Erysimum) and sweet alyssum
ceme, or flat topped corymb (Iberis), (Lobularia).
Cardamine also produces subterranean
cleistogamous flowers. Flowers ebracteate, Phylogeny: The family is regarded as mono-
rarely bracteate (Nasturtium montanum), bi- phyletic, supported by evidence from mor-
sexual, actinomorphic or rarely zygomorphic phology ( gynophore, exserted stamens),
(Iberis), hypogynous (perigynous in Lepidium). glucosinolates, dilated cisternae in endoplas-
Calyx with 4 sepals, free, in two whorls, se- mic reticulum and rbcL sequences. The or-
pals of lateral pair sometimes saccate at der Brassicales (others prefer Capparales)
base, green or slightly petaloid. Corolla with had long been treated as a well defined group,
4 petals, cruciform (arranged in a cross), with Brassicaceae and Capparaceae consid-
clawed, sometimes absent in Coronopus and ered to be fairly close as suggested by evi-
Lepidium. Androecium with 6 stamens (2 in dence from morphology, dilated cisternae,
Coronopus, 4 in Cardamine hirsuta, 16 in but have been treated as distinct largely
Megacarpaea), free, tetradynamous (2 short because of several stamens and very long
4 long), dehiscence longitudinal, nectaries gynophore in Capparaceae.
often present near base of stamens, pollen Judd et al., (1994) on the basis of mor-
grains tricolporate or tricolpate. Gynoecium phological studies, and Rodman et al., (1993)
with two united (thus pistil single) carpels on the basis rbcL sequences, concluded that
(syncarpous), rarely carpels 3 (Lepidium) or out of the traditional Capparaceae,
4 (Tetrapoma), unilocular but becoming Capparoideae and Cleomoideae do not form
bilocular due to false septum that is sur- a monophyletic group, as also concluded ear-
rounded by a thick placental rim called lier by Hutchinson (1973). Capparoideae ac-
replum, ovules many, rarely single ovules, cording to these authors form basal
placentation parietal, ovary superior, paraphyletic group within Brassicaceae.
gynophore distinct, style 1, stigmas 2. Fruit Cleomoideae and Brassicoideae (traditional
a siliqua (long: length thrice width or more) Brassicaceae) form monophyletic group
or silicula (short: length less than thrice based on synapomorphies of herbaceous
Major Families of Angiosperms 603
character, replum in fruit and rbcL se- Soltis et al., (2000) and Hall et al., (2002),
quences. The merger of Capparaceae with Brassicaceae (Brassicoideae) and
Brassicaceae avoids arbitrarily delimited Cleomaceae (Cleomoideae) are more closely
paraphyletic taxa, and thus forms mono- related and form a monophyletic group
phyletic group with broadened circumscrip- based on synapomorphies of herbaceous
tion. The two have been merged in APG II habit, rbcL sequences and presence of
and APweb classifications. APweb recog- replum.
nizes 3 subfamilies under broadly circum- It is interesting to record that although
scribed Brassicaceae: Capparoideae, Hutchinson had indicated heterogeneity
Cleomoideae and Brassicoideae. It is perti- within Capparaceae, and reasoned that
nent to note that Thorne (1999), who has Cleome and its relatives were much closer
been updating his classification in light of to Brassicaceae, he had placed Capparaceae
recent advances, has preferred to retain and Brassicaceae in two distinct orders Cap-
Brassicaceae and Capparaceae as distinct parales (in his diagram he used name Cap-
families, also separating Cleomaceae in paridales) and Brassicales, even further
recent revisions (2003, 2007), thus recog- separating them under Lignosae and Herba-
nizing three subfamilies as independent ceae respectively, as he was obsessed with the
families. According to the recent studies of distinction of woody and herbaceous habits.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.100 Rutaceae. Murraya paniculata. A: Branch with pinnate compound leaves and flow-
ers; B: Vertical section of flower; C: Flower with petals removed showing 10 sta-
mens in 2 whorls; D: Gynoecium with nectary at base. Citrus paradisi. E: Portion of
branch with unifoliate leaf having broadly winged petiole and cluster of flowers
with polyadelphous stamens; F: Fruit. Zanthoxylum armatum. G: Branch with pin-
nate compound leaves, spines and inflorescences; H: Male flower with 6 free sta-
mens and abortive ovary, the sepals are small and petals absent; I: Schizocarpic
fruit splitting into 2 segments. Haplophyllum acutifolium. J: Portion of plant with
flowers; K: Flower with large petals, stamens with flattened filaments; L: Capsule
covered with glands and deeply 5-lobed.
cymose or flowers solitary (Triphasia), rarely sometimes ovaries free (Zanthoxylum) and
racemose (Atlantia). Flowers ebracteate, bi- only styles united, multilocular (locules as
sexual or rarely unisexual (Zanthoxylum) many as carpels) with 1-many ovules,
actinomorphic or rarely zygomorphic placentation axile, rarely parietal (Feronia),
(Dictamus), hypogynous. Calyx with 4-5 se- ovary superior and lobed, style 1, stigma
pals, rarely 3 (Lunasia) free or more or less small. Fruit a berry (Murraya), drupe
united, gland dotted. Corolla with 4-5 pet- (Spathelia), hesperidium (Citrus), samara
als, rarely 3 (Triphasia) free, rarely united (Ptelea), capsule (Ruta) or follicle (Zanthoxy-
(Correa) valvate or imbricate, sometimes lum); seeds 1-many, embryo curved or
absent. Androecium with 8-10 rarely 5 straight, endosperm absent or present. Pol-
(Skimmia), or many (Citrus) stamens, free lination mainly by insects, chiefly bees and
(Murraya), or polyadelphous (Citrus), rarely flies. Dispersal usually by animals, rarely
monadelphous (Atlantia) sometimes birds or even wind (Ptelea).
obdiplostemonous, anthers bithecous, dehis-
cence longitudinal, pollen grains 3-6-colpate. Economic importance: The family is impor-
Gynoecium with 2-5 united carpels tant for its citrus fruits such as lemon (Cit-
(syncarpous), rare monocarpellary (Teclea), rus limon), lime (C. aurantifolia), sweet orange
Major Families of Angiosperms 605
or mousmi (C. sinensis), orange, tangerine ported by data from rbcL and atpB sequences.
or santra (C. reticulata) and grapefruit (C. Subfamilies are characterized by carpel
paradisi). Aegle marmelos (Bel tree), Fortunella number, extent of fusion and fruit type.
(kumquat), and Casimiroa (white zapote) are Whereas Dahlgren (1989) and Takhtajan
grown for fruits. Murraya paniculata is culti- (1997) preferred to separate order Sapindales
vated as an ornamental shrub, whereas from order Rutales, others like Cronquist
M. koenigii is cultivated for its curry leaves. (1988), Thorne (1999, 2003, 2007), and APG
Leaves of Skimmia laureola are burnt in II prefer to merge the two. Cronquist and
order to purify air. Ruta (rue), Zanthoxylum APG II use name Sapindales whereas
(toothache tree), and Casimiroa are medici- Thorne prefers the priority name Rutales.
nal. Boenninghausenia (Pisu-mar-buti) is Thorne, however, places Sapindaceae and
used as an insecticidal. Ravenia spectabilis Rutaceae under separate suborders. Earlier
(Syn: Limonia spectabilis) is grown as orna- Hutchinson (1973) had also separated the
mental shrub. two orders, also separating Meliaceae
under Meliales, and placing between the two
Phylogeny: Although the family presents a orders. The affinities of Meliaceae, Rutaceae
variety of fruit types, it is a well circum- and Sapindaceae have been long recognized.
scribed monophyletic taxon characterized by Thorne (2007) recognizes 3 subfamilies:
oil cavities appearing as pellucid dots, sup- Rutoideae, Aurantioideae and Cneoroideae.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Trees or shrubs contain- Major genera: Aglaia (95 species), Trichilia
ing bitter triterpenoid compounds, leaves (60), Turraea (60), Dysoxylum (58), Guarea
alternate, pinnate compound, flowers uni- (32), Toona (15), Melia (15), Cedrela (6) and
sexual, sepals 4-5, petals 4-5, stamens with Azadirachta (2).
connate filaments, ovary with axile
placentation, stigma capitate, seeds dry and Description: Shrubs or trees, rarely herbs
winged. (Naregamia), commonly producing bitter
606 Plant Systematics
Figure 13.101 Meliaceae. Melia azedarach. A: Bipinnate leaf; B: Inflorescence; C: Flower with
long staminal tube; D: Drupe. Aglaia apiocarpa. E: Fruiting branch with pinnate
compound leaf; F: Portion of male inflorescence; G: Female inflorescence;
H: Vertical section of male flower; I: Vertical section of female flower. Dysoxylum
championii. J: Flowering branch; K: Vertical section of male flower; L: Tetrad of
pollen grains; M: Transverse section of ovary.
triterpenoid compounds, usually with scat- valvate. Androecium with 3 (some species
tered secretary cells, wood sometimes yel- of Amoora), 4-6 (Cedrela), 5 (Aglaia) or upto
low (Chloroxylon) or red (Cedrela), nodes 12 (Melia), free (Walsura) or monadelphous
pentalacunar, vessels with simple end-walls. (Melia), usually inserted on a nectariferous
Leaves alternate, once (Azadirachta) or twice disc, anthers bithecous, dorsifixed or versa-
pinnate (Melia), sometimes trifoliate tile, introrse, dehiscence longitudinal, pol-
(Sandoricum) or unifoliate (Turraea), venation len grains 2- to 5-colporate, sometimes in
pinnate, reticulate, stipules absent. Inflo- tetrads (Dysoxylum championii). Gynoecium
rescence axillary or terminal panicles, usu- with 2-6 united carpels, ovary superior, 2-5
ally cymose. Flowers ebracteate, bisexual or chambered with 1 or 2 (or more in Swietenia)
rarely unisexual (Amoora), actinomorphic, ovules in each loculus, ovule orthotropous
trimerous to pentamerous, cyclic. Calyx or anatropous (Dysoxylum), placentation ax-
with 3 (Amoora), 4 (Dysoxylum) or 5 (Melia, ile, style 1, stigma capitate. Fruit a drupe,
Cedrela) sepals, free or united (Amoora, (Melia azedarach), berry (Walsura), or a cap-
Melia), valvate or imbricate, green. Corolla sule (Amoora); seeds winged or with an aril
with 3-5 petals, usually as many as sepals, (Melioideae), embryo curved or straight, en-
free, rarely united (Munronia), imbricate or dosperm present or absent.
Major Families of Angiosperms 607
Economic importance: The family is highly or Sapindales (Cronquist, APG II, APweb) or
prized for its true mahogany woods: Swietenia narrowly circumscribed Rutales (Takhtajan,
mahogani of the West Indies; Dahlgren). Thorne (1999,2003) combines
Entandrophragm, Khaya and Lovoa of Africa; Rutales with Sapindales but prefers name
Cedrela odorata and Toona of Australia. These Rutales for the broadly circumscribed order.
are renowned for their excellent colour, Hutchinson (1926, 1973) segregated the fam-
working properties and finish. Oils for soap- ily to a distinct order Meliales primarily on
making are extracted from the seeds of the basis of leaves usually not gland-dotted
Trichilia emetica in Uganda. The oil from and stamens connate. The family is distinct
Malayan Chisocheton macrophyllus has been and monophyletic as supported by morphol-
used as an illuminant. The flowers of Aglaia ogy and rbcL sequences (Gadek et al., 1996).
odorata are used in the East for flavouring Two subfamilies are commonly recognized:
tea. Species of Melia, Aglaia, Chisocheton and Melioideae (seeds not winged, naked buds)
Turraea are grown as ornamentals. and Swietenioideae (flattened or winged
Azadirachta indica (neem) from India has seeds, and scaly buds. Thorne had earlier
gained considerable importance in the re- (1999) merged these two under Melioideae
cent years as a bioinsecticide and a compo- and recognized two more Quivisianthoideae
nent of several medicines and also tooth (single genus Quivisiantha) and Capuroni-
pastes. The tree, for a long time, has been anthoideae (single genus Capuronianthus).
grown as a shade tree and twigs used to In subsequent revision (2003) he resur-
brush teeth (datun). rected Swietenioideae, thus recognizing
four subfamilies under the family. The ge-
Phylogeny: The family is generally included nus Cedrela is distinct in its free stamens
closer to Rutaceae in broadly circumscribed and erect petals, included by thorne under
Geraniales (Bentham and Hooker, Bessey) Swietenioideae.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.102 Anacardiaceae. Rhus wallichii. A: Branch with inflorescence; B: Portion of inflo-
rescence in fruit. Mangifera indica C: Branch with inflorescence; D: Flower; E: Ver-
tical section of flower showing conspicuous disc; F: Single stamen. G: Longitudi-
nal section of fruit, reduced view. H: Fruit of Anacardium occidentale. (A-B, after
Polunin and Stainton, Fl. Himal., 1984).
Salient features: Trees or shrubs with resin tissue; resin clear when fresh but drying
canals, alternate exstipulate leaves, flowers black and often causing dermatitis (Toxi-
pentamerous, stamens inserted at the base codendron, some species of Rhus). Leaves
of a disc, ovary unilocular, ovule one, fruit alternate, rarely opposite (Dobinea), usually
commonly a drupe. pinnate compound (Rhus, Schinus), rarely
simple (Mangifera), entire or serrate, vena-
Major genera: Rhus (100 species), tion pinnate, stipules absent or vestigial. In-
semecarpus (50), Lannea (40), Toxicodendron florescence paniculate, axillary or terminal,
(30), Schinus (30) and Mangifera. usually thyrse with cymose branches. Flow-
ers bracteate, bisexual or unisexual due to
Description: Trees, shrubs or lianas, rarely reduction of stamens or carpels, receptacle
perennial herbs, resin canals in bark, big- often swollen and fleshy, actinomorphic,
ger veins of leaves and in parenchymatous small, hypogynous. Calyx with 5 sepals
Major Families of Angiosperms 609
(rarely 3-7), free or connate at base, imbri- of Cotinus (smoke tree), Rhus (Sumac) and
cate, rarely much enlarged (Parishia). Co- Schinus (Brazilian pepper). Commercial sup-
rolla with 5 petals (rarely 3-7), free, imbri- ply of tannins is obtained from quebracho
cate, rarely much enlarged (Swintonia). (Schinopsis lorentzii), Sicilian sumac (Rhus
Androecium with 5-10 stamens, sometimes coriaria) and species of Cotinus and Pistacia.
more or reduced to single fertile stamen The first turpentine used by artists came
(Mangifera, Anacardium), filaments usually from terebinth tree (Pistacia terebinthus).
glabrous, distinct, rarely connate at base,
arising along outer (most genera) or inner Phylogeny: Anacardiaceae is closely related
margin (Mangifera) of rim of the disc, dehis- to Burseraceae (Thorne, 2006 places two
cence longitudinal, pollen grains tricolporate families separately under suborder Anar-
or triporate. Gynoecium with usually 3 car- cardiineae) as supported by rbcL sequences
pels, sometimes 5 (Buchanania) or only 1 (Gadek et al., 1996). The two share resin ca-
(Mangifera), united, rarely free (Buchanania), nals and biflavones. The family is usually
ovary superior, locule usually 1 with basal placed under Sapindales, but shifted by Thorne
or apical placentation, rarely multilocular under Rutales. Two clades (subfamilies) are
with 1 ovule in each locule, styles 1-3, free recognised within the family (Thorne; ApWeb):
or connate, stigma capitate, disc present Anacardioideae and Spondoideae, latter hav-
between stamens and petals. Fruit a drupe ing retained many plesiomorphic features
with resinous mesocarp, rarely berry or nut such as five carpels, multilocular ovary and
(Anacardium), or samara (Loxopterygium); fruit with thick endocarp having lignified and
seed with straight or curved embryo, absent irregularly oriented sclereids, and sister to
or scanty. Pollination by insects, dioecious rest of the family i.e., Anacardioideae (Aguilar-
habit promoting outcrossing. Fruits are dis- Ortigosa & Sosa 2004). Anacardioideae
persed by birds and mammals. clade has 3 carpels, unilocular ovary with
apical placenta and endocarp with regularly
Economic importance: The family contrib- arranged cells. wind-pollinated taxa of this
utes important fruits such as mango subfamily, however, do not form a single group
(Mangifera indica), yellow mombin or Hog (Pell & Mitchell 2007). Buchanania in some
plum (Spondias mombin), Indian Hog plum (S. analyses is quite well supported as sister to
indica), Red mombin or Jamaica apple (S. Anacardioideae (Aguilar-Ortigosa & Sosa
purpurea), Otaheite apple (S. cytherea) and 2004; Wannan, 2007), consistent with its
Kaffir plum (Harpephyllum caffrum). Nuts of chemistry, endocarp anatomy and carpel
Cashew (Anacardium occidentale) and Pista- number. Phylogeny of the family has been
chio (Pistacia vera) are eaten after roasting. studied by Pell (2004) who covers the
Species of Rhus and Toxicodendron cause der- morphology of the whole family and Mitchell
matitis due to the phenolic compound 3-n- et al. (2006), who focus more on Spondoi-
pentadecycatechol and should be touched deae. Rhus and Toxicodendron, are distinct
with care. Lacquer is obtained from Varnish in former having red glandular-pubescent
tree (Toxicodendron vernicifera) and Mastic fruits and latter glabrous greenish or white
tree (Pistacia lentiscus). Important ones. These are often combined, but the
ornamentals are contributed by the species resultant genus wont be monophyletic.
***********
610 Plant Systematics
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.103 Sapindaceae. Dodonaea viscosa. A: Flowering twig of female plant; B: Flowering
twig of male plant; C: Male flower with 5 sepals and 8 stamens, petals absent; D:
Female flower with sepals and gynoecium; E: Gynoecium. F: Fruit with with 2
wings. Acer caesium. G: Portion of a fruiting branch; H: Portion of flowering branch;
I: Flower. Aesculus indica. J: Portion of flowering branch with palmately compound
leaf; K: Flower with long-clawed petals and exserted stamens; L: Capsule opening
by 3 valves.(G-I after Fl. Himal., 1984)
of West Africa are also eaten cooked, tast- Acer saccharum (sugar maple) and some other
ing like scrambled egg, but poisonous if eaten species yield maple sugar.
when unripe. The fruits of different species
of Sapindus (soapberry) are often used as a Phylogeny: Sapindaceae is sometimes
natural soap due to the presence of narrowly circumscribed to exclude Hippo-
saponins. Paullinia cupana is the source of castanaceae and Acerceae (Hutchinson,
drink guarana, popular in Brazil. Schleichera Takhtajan, Cronquist and Dahlgren), but
trijuga is the source of macassar oil, used in their separation leads to paraphyletic
ointments and for illumination. The species Sapindaceae (Judd et al., 1994). The family
of Aesculus have various medicinal uses, and is as such broadly circumscribed to include
extracts from some have been used by North both Aceraceae and Hippocastanaceae
American Indians to stupefy fish. The fam- (Thorne, Judd et al., APG II and APweb).
ily also contributes a number of ornamentals Monophyly of the family is supported by
such as Koelreuteria (goldenrain tree), morphology and rbcL sequences. Xantho-
Cardiospermum (balloon vine), Xanthoceras, ceras, with simply 5-merous, polysymmetric
Acer (maple) and Aesculus (horse chestnut). flowers and complex, golden nectaries borne
The trees of maple are prized for their beau- outside the eight stamens, is sister to rest
tiful foliage and spectacular autumn colours. of Sapindaceae, and the genera included in
612 Plant Systematics
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Mostly shrubs, leaves sim- Iridoids and raphide crystals. Leaves usu-
ple, usually opposite, stipules absent, flow- ally opposite, rarely alternate (Cordiandra),
ers bisexual, sepals often enlarged and simple, sometimes lobed, usually deciduous,
petaloid, ovary inferior or semi-inferior, rarely evergreen (Pileostegia), venation pin-
placentation axile or deeply intruded pari- nate or palmate, reticulate, stipules absent.
etal, nectary present at top of ovary, fruit a Inflorescence terminal racemes, cymes or
capsule. corymbose, rarely solitary flowers. Flowers
usually bisexual, sometimes unisexual
Major genera: Philadelphus (65 species), (Broussaisia, polygamo-dioecious) outer usu-
Deutzia (40), Hydrangea (30), Dichroa (13) and ally sterile with enlarged petaloid sepals,
Fendlera (4). actinomorphic, perigynous or epigynous.
Calyx with 4-5 sepals , united, calyx tube
Description: Herbs (Cordiandra), soft-wooded often adnate to ovary, sepals of outer sterile
shrubs (Hydrangea) or rarely small trees or flowers often large and petaloid. Corolla with
climbers (Decumeria), often with tannins and 4-5 petals, free, imbricate, convolute, rarely
614 Plant Systematics
valvate (Platycrater), usually white. styles free, rarely united (Carpenteria), stig-
Androecium with many stamens, some- mas free, nectar disc usually present at top
times 8-10 (Hydrangea), free or slightly of ovary. Fruit usually a loculicidal
connate at base, anthers bithecous, (Hydrangeae) or septicidal (Philadelpheae)
basifixed or dorsifixed, filaments often lobed capsule, rarely a berry (Dichroa); seeds nu-
or toothed, connective sometimes app- merous, small, sometimes winged, with
endaged at tip (Fendlera), pollen grains fleshy endosperm and straight embryo. Pol-
tricolpate or triporate. Gynoecium with 2-7 lination by insects aided by epigynous disc.
united carpels, ovary semi-inferior (Dichroa, Small seeds are dispersed by wind.
Broussaisia), inferior (Philadelphus, Deutzia,
Hydrangea) or superior (Jamesia), 1-7 locu- Economic importance: The family is known
lar, ovules numerous, placentation axile or for ornamental shrubs with showy flowers
parietal with deeply intruded placentas, including Hydrangea, Decumeria (climbing
Major Families of Angiosperms 615
Figure 13.105 Malvaceae. A: Hibiscus rosasinensis, flowering branch; B: stamens and stigmas;
C: Malvaviscus arboreus, flowering branch; D: Flower; E: Lavatera assurgentiflora,
flowering branch; F: Flower; G: Gossypium hirsutum, flowering branch; H: Flower;
I: Fruit. Rhamnaceae. J: Colletia paradoxa, plant. Moraceae. K: Morus alba, plant
with male catkins; L: Male catkin enlarged; M: Plant with female inflrescences.
N: Ficus religiosa, twig with young hypanthodia.
616 Plant Systematics
Figure 13.107 Rutaceae. A: Citrus limon, flowering branch; B: Fruit; C: Murraya paniculata, flower-
ing branch; D: Flower. E: Citrus medica, flower; F: Ravenia spectabilis, plant in flower;
G: Flower. H: Murraya koenigii, flowering branch; I: Flowers. Anacardiaceae.
J: Mangifera indica, flowering branch; K: Portion of inflorescence enlarged; L: Female
flower. Meliaceae. M: Melia azedarach, flowering branch. N: Flower; O: Fruits.
618 Plant Systematics
Figure 13.108 Sapindaceae. A: Acer japonicum, branch; B: A. griseum, bark; C: Fruit; D: Aesculus
californica, flowering branch; E: Flowers; F: Ungnadia speciosa, fruiting branch;
G: Fruit.
Major Families of Angiosperms 619
Figure 13.110 Ericaceae. A: Colluna vulgaris, flowering branch; B: Erica blanda, flowering branch;
C: Arbutus unedo, flowering branch; D: Fruit; E: Rhododendron giersonianum, flower
cluster; F: R. occidentale, flowering branch. G: Phyllodoce breweri, flowering branch;
H: Adoxaceae. E: Sambucus nigra, flowering branch; I: Viburnum cotinifolium, branch
with young fruits; J: Branch with mature fruits.
Major Families of Angiosperms 621
Figure 13.111 Apiaceae. A: Astrantia major, plant; B: Umbel; C: Eryngium paniculatum, plant with
inflorescences; D: Angelica pachycarpa, inflorescence; E: Foeniculum vulgare, plant;
F: Part of inflorescence; G: Coriandrum sativum, plant; H: Part of inflorescence.
Araliaceae. I: Pseudopanax crassifolium, flowering branch; J: Inflorescence; K: Hedera
helix, plant.
622 Plant Systematics
Figure 13.113 Solanaceae. A: Cestrum elegans, flowering branch; B: flowers; C: Solanum hispidum,
flowering branch; D: Atropa belladonna, flowering branch; E: Datura suaveolens, flow-
ering plant; F: Solanum melanogena, flowering branch; G: Flower; H: Fruit; I: Solanum
nigrum, plant in flower; J: Young fruits. Convolvulaceae. K: Ipomoea cairica, plant
in flower; L: Flower; M: Jacquemontia pentantha, plant in flower; N: Flowers.
Boraginaceae. O: Ehretia laevis, plant; P: Flowers.
624 Plant Systematics
Figure 13.114 Rubiaceae. A: Ixora fulgens, flowering branch; B: Inflorescence C: Hamelia patens,
flowering branch; D: Flowers and young fruits; Apocynaceae E: Plumeria alba,
flowering branch; F: Allamanda catharatica, branch with flowers; G: Catharanthus
roseus, flowering branch; H: Flower; I: Nerium oleander, flowering branch; J: Flower;
K: Asclepias syriaca, flowering plant; L: A. fascicularis, flowering branch;
M: Flowers; N: Calotropis procera, flowering branch..
Major Families of Angiosperms 625
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Mostly shrubs, leaves sim- Major genera: Cornus (65 species) and
ple, usually opposite, stipules absent, flow- Alangium (20).
ers bisexual, sepals often enlarged and
petaloid, ovary inferior or semi-inferior, Description: Trees and shrubs, rarely
placentation axile or deeply intruded pari- stoloniferous subshrubs, glabrous or hairy,
etal, nectary present at top of ovary, fruit a usually with iridoids. Leaves usually oppo-
capsule. site, sometimes alternate or distichous,
628 Plant Systematics
Figure 13.117 Cornaceae. Cornus macrophylla. A: Portion of plant with flowers; B: Flowertop,
view; C: Transverse section of fruit.D: Flower head of C. capitata subtended by
four bracts. C. stolonifera E: Flower; F: Vertical section of flower. (A-D, after Nasir
and Ali, Fl. W. Pak.No. 88, 1975; E-F, Bailey, Man. Cult. Pl., 1949).
simple, entire, venation pinnate, secondary laterally. Gynoecium with 2 united carpels,
veins usually smooth arching towards rarely 1-4, ovary inferior, usually 2-locular,
margin or forming a series of loops, stipules single ovule in each locule, placentation
absent. Inflorescence terminal branched axile, axis lacking vascular bundles and the
cymes or heads, usually subtended by large ovules attached to vascular bundles that
showy bract, often forming involucre in arch over the top of each septum (apical
heads. Flowers usually bisexual, rarely axile placentation), style simple, stigma
unisexual, actinomorphic, epigynous. Calyx capitate or lobed, disc present on top of ovary;
with 4-5 sepals , united, valvate, lobes . Fruit usually a drupe, 1-2 seeded, ridged or
rounded, sometimes represented by small winged; seeds small, endosperm present.
teeth, rarely absent. Corolla with 4-5 Pollination by bees, flies and beetles. Drupes
petals, free, imbricate, imbricate or valvate. are dispersed by birdsand mammals.
Androecium with 4-5 stamens, alternating
with petals, rarely up to 10, filaments free, Economic importance: Species of Cornus
arising from the edge of disc, anthers (Dogwood) and Alangium are grown as orna-
bithecous, basifixed or dorsifixed, dehiscing mental trees and shrubs.
Major Families of Angiosperms 629
Phylogeny: The family has undergone a lot Cornaceae, Alangiaceae, whereas rest of the
realignment in recent years. Bentham and genera are united under Nyssaceae, divided
Hooker placed it under Araliaceae, but sub- into subfamilies Davidioideae, Nyssoideae
sequently recognised as independent family and Mastixioideae. APWeb (2007) united
under Umbelliflorae (Engler and Prantl). Alangiaceae and Cornaceae, thus including
Hutchinson (1948) shifted Cornaceae along two genera under Cornaceae. Analysis of a
with Araliaceae to order Cunoniales on the combined matK and rbcL sequence data set
basis of woody habit and stem anatomy. The by Xiang et al. (1998) established Cornus-
family was earlier broadly circumscribed to Alangium as distinct clade within Cornales,
include 10-15 genera (Hutchinson, 1973; results confirmed by 26S rRNA and combined
Cronquist, 1988), but was split into a number 26S rDNA-matK-rbcL sequence data of Fan
of families (Takhtajan, 1997) such as Davi- and Xiang (2003) establishing Grubbiaceae
diaceae, Nyssaceae, Mastixiaceae, Curtisia- (Grubbia and Curtisia), Cornaceae (Cornus and
ceae, Cornaceae and Alangiaceae. APG- II Alangium) and Nyssaceae (Nyssa, Davidia,
recognises only Curtisiaceae and Cornaceae, Camptotheca, Mastixia and Diplopanax) as dis-
Nyssaceae optionally merged with latter. tinct clades; Hydrangiaceae and Loasaceae
Thorne (2006, 2007) recognizes monogeneric forming indepedent clade.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.118 Balsaminaceae. Impatiens glandulifera. A: Portion of plant with flowers and fruits;
B: Flower, top view; C: Longitudinal section of flower with sepals and petals
removed; D: Lateral sepal; E: anterior petal; F: Lateral fused petals; G: Trans-
verse section of ovary; H: Seed.
spurred, nodding, often resupinate, hypo- many in each locule, anatrpous, pendulous,
gynous, pentamerous, some flowers cleisto- placentation axile, style simple, often very
gamous and self pollinating. Calyx with usu- short, stigmas 1-5. Fruit a fleshy 5-valved
ally 3 sepals , sometimes upto 5, free, capsule, dehiscing explosively, valves coil-
petaloid, imbricate, posterior (lower in ma- ing elastically and on splitting the tension
ture flower) largest and with nectar spur or forcibly distributing the seeds, rarely a berry-
pouch on back. Corolla with 5 petals, free, like drupe; seeds with straight embryo,
or lateral pairs connate and appear as endosperm absent. Pollination by insects.
3 petals, lower pair larger than upper. Andro- Capsules dehiscing explosively by autochory
ecium with 5 stamens, filaments flattened, or when touched slightly, hence the name
short, closely covering the ovary, free below, touch me not.
connate towards top with connate anthers
(syngenesious) forming lid (calyptra) over Economic importance: The family is known
the ovary, anthers bithecous, dehiscence for its ornamental herbs with showy flowers.
longitudinal. Gynoecium with 5 united car- Garden balsam (Impatiens balsamina),
pels, ovary superior, 5-locular, ovules 3- Himalayan balsam (I. glandulifera), Busy
Major Families of Angiosperms 631
lizzie (I. holstii) and several hybrid cultivars et al. (2004). Latter authors concluding that
are widely grown in temperate as well as Balsaminaceae and Marcgraviaceae are sis-
tropical climates. ter taxa, although there are no obvious
synapomorphies. Balsaminaceae show the
Phylogeny: The family was formerly placed combination of leucoanthocyanins and
under Geraniaceae, but differes in raphides, rarely seen in herbs (Fischer,
zygomorphic flowers, spurred sepal and 2004). The family is vegetatively very uni-
connate anthers. It is often allied to form although florally diverse and duplication
Tropaeolaceae, but the spur in latter family and probable subfunctionalisation of the class
is derived from recepacular tissue and not B DEF gene has occured in this clade
calyx as in Balsaminaceae. Balsaminaceae, (Janssens et al. 2006; Geuten et al. 2006).
Marcgraviaceae and Tetrameristaceae form Hydrocera and Impatiens are clearly sister taxa
a well defined clade and probably sister to rest (Yuan et al. 2004; Janssens et al. 2006). Spe-
of Ericales. Monophyly of these three fami- cies of Impatiens with five sepals are scat-
lies is well supported by the studies of Nandi tered through the genus, so that condition is
et al. (1998), Soltis et al. (2000) and Geuten apparently at least sometimes derived.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Mostly herbs, leaves alter- Description: Annual or perennial herbs,
nate, stipules absent, sepals 5, united, pet- rarely shrubs or trees (Cantua) or climbers
als 5, united, stamens 5, epipetalous, carpels (Cobaea), often with glandular hairs, nodes
3, united, placentation axile, ovules many, unilacunar. Leaves usually alternate, rarely
style 1, stigmas 3, fruit a capsule. opposite or whorled (Gymnosteris), usually
simple, sometimes dissected or pinnate
Major genera: Gilia (110 species), Phlox (75), compound (Polemonium), venation reticulate,
Polemonium (40), Limnanthus (40), Ipomopsis stipules absent. Inflorescence terminal or
(25), Collomia (15) and Cantua (12). axillary, often crowded into corymbs or heads,
632 Plant Systematics
Figure 13.119 Polemoniaceae. Polemonium caeruleum. A: Basal part of plant; B: Upper leaves and
inflorescence; C: Flower from above; D: Vertical section of flower; E: Fruit
enclosed in persistent calyx. Phlox nivalis. F: Plant in flower; G: Vertical section of
flower ; H: Seed.
rarely solitary. Flowers bisexual, actino- ous, seed-coat mucilaginous when mois-
morphic, rarely zygomorphic, hypogynous, tened. Pollination mostly by bees and flies.
usually showy. Calyx with 5 sepals, united, Seeds are dispersed aided by mucilaginous
green. Corolla with 5 petals, united, often coat, sometimes by wind or water.
with a narrow tube, lobes plicate or convo-
lute . Androecium with 5 stamens, adnate Economic importance: The family is known
to corolla tube (epipetalous; inserted), alter- for its ornamentals Phlox (P. drummondii be-
nating with lobes, filaments free, anthers ing most popular), Gilia and Polemonium with
bithecous, dehiscence longitudinal, pollen showy flowers.
grains 4-many aperturate, colpate or porate.
Gynoecium with 3 united carpels, rarely 2, Phylogeny: The family is considered to be
ovary superior, seated on a nectary disc, 3- closely related to Hydrophyllaceae, the two
locular, rarely 2-locular, ovules 1 or more, having closer affinities with group consist-
unitegmic, placentation axile, style single, ing of Solanaceae, Nolanaceae and
elongated, branched above, stigmas 3, rarely Convolvulaceae. Hutchinson, who places
2. Fruit a loculicidal capsule; seed with Cuscutaceae under the order Polemoniales,
straight or curved embryo, endosperm copi- considers it to be most highly evolved within
Major Families of Angiosperms 633
the order. Thorne (1999) shifted this family classes, has also placed Polemoniaceae un-
to Dilleniidae (Dillenianae) under separate der Ericales (superorder Ericanae) under
order Polemoniales (in accordance with the Asteridae. Traditionally two subfamilies
findings of DNA sequence studies), retain- Cobaeoideae and Polemonioideae are recog-
ing other families under Lamiidae, order nized. Acanthogilia with dimorphic leaves
Solanales. Takhtajan places all families in- and short shoots has been placed in its own
cluding Polemoniaceae under Lamiidae, su- subfamily (Porter et al., 2000). Thorne (2006,
perorder Solananae, but under separate or- 2007) accordingly recogniszes 3 subfamilies
ders. Judd et al., (1999) had placed Cobaeoideae, Acanthogilioideae and
Polemoniaceae under Solanales because of Polemonioideae. Studies based on
actinomorphic flowers, and united plicate chloroplast gene ndhF (Prather et al., 2000),
corolla. The studies of Porter and Johnson however, indicate that the genus
(1998), based on morphology and DNA se- Acanthogilia may be basal in the Cobaea lin-
quences, however, indicate that the family eage. Studies of Porter and Johnson (1998)
belongs to Ericales. The family has accord- have also indicated that woody tropical gen-
ingly been shifted to Ericales under Aterids era of Cobaeoideae form a paraphyletic ba-
in APG II, Judd et al., (2002) and APweb. sal complex, and the herbaceous genera of
Thorne (2003), who has brought about ma- Polemonioideae mainly Ipomopsis,
jor realignments, and abolished Dilleniidae, Linanthus, Polemonium, Phlox and Gila con-
distributing its members among various sub- stitute a monophyletic group.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Trees and shrubs without Description: Shrubs and trees with black
milky latex, bark blackish, leaves charcoal-like bark, heartwood black, red or
distichous, simple, unisexual flowers, mul- green, lacking milky latex, buds covered
tilocular superior ovary, bitegmic ovules in with adpressed hairs. Leaves alternate,
pairs. distichous, simple, entire, coriaceous, ve-
nation reticulate, lower surface with dark
Major genera: Diospyros (472 species), coloured glands, turning blackish on drying
Euclea (20) and Lissocarpa (8). due to presence of napthoquinones, stipules
634 Plant Systematics
absent. Inflorescence axillary cymes or with united carpels, ovary superior, rarely infe-
solitary flowers; plants usually monoecious, rior (Lissocarpa), locules many, placentation
male flowers in larger numbers. Flowers axile, each locule with usually 2 ovules at-
unisexual, actinomorphic, male flowers with tached from the top but each ovule separated
pistillode, female with staminodes, by partition, thus ovary with twice as many
hypogynous, two bracteoles below flower in chambers and apical-axile placentation,
Lissocarpa. Calyx with 3-7 sepals, united, ovule pendulous, anatropous, integuments
persistent and often enlarged in fruit two, styles anatropous to campylotropous,
(accrescent). Corolla with 3-7 petals, united, styles and stigmas 3-8, styles free or connate
urceolate, lobes imbricate and contorted, at base. Fruit a berry with often enlarged
coriaceous. Androecium with same number calyx; seed with straight embryo, endosperm
of stamens as petals or twice as many, and copious, hard and irregularly grooved or
as many whorls, free or united in pairs, ridged.
epipetalous or free from petals, anthers
bithecous, dehiscence longitudinal, introrse, Economic importance: The family is im-
rarely by apical pores. Gynoecium with 3-8 portant source of durable timber Macassar
Major Families of Angiosperms 635
ebony (Diospyros ebenum) and Black ebony ovary) removed to a distinct unassigned fam-
(D. reticulata). Other species of the genus are ily Lissocarpaceae in APG (1998), has been
sources of common fruits such as Japanese merged with Ebenaceae in APG-II (2003),
persimon (D. kaki), American persimon (D. Thorne (2006, 2007) and APWeb (2007). Lat-
virginiana), and Date plum (D. lotus). ter places it under subfamily Lissocarpoi-
deae, other two genera under Ebenoideae.
Phylogeny: Family is closely related to Savolainen et al. (2000) suggested removal
Sapotaceae but distinct in the absence of of Lissocarpa to Rutaceae, but rbcL studies
milky latex, unisexual flowers, multilocular supported it as sister to Ebenaceae s. str.
superior ovary, ovules in pairs and with 2 (Berry et al. 2001). Euclea and Royena (rec-
integuments. From Styracaceae it is dis- ognised as 4th genus within Ebenaceae by
tinct by unisexual flowers and septate ovary. APWeb) were sister to Diospyros, and within
Lissocarpa (with large bracteoles, corolla latter there were a number of well-supported
with 8-lobed corona, connate filaments, an- clades, although relationships between them
ther with prolonged connective and inferior are unclear (Duangjai et al., 2006a, b).
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Mostly trees with milky (110), Sideroxylon (75), Chrysophyllum (75),
latex, small terminal naked buds with Manilkara (70) and Mimusops (60).
appressed T-shaped hairs, leaves simple,
coriaceous, bisexual flowers, multilocular Description: Mostly trees, rarely shrubs
superior ovary, single ovule in each cham- (Reptonia), with milky latex, with sympodial
ber, unitegmic ovules, seeds with shiny branches or thorns, silica bodies,
testa. triterpenoids and cyanogenic compounds of-
ten present, small naked buds brownish hairs,
Major genera: Pouteria (325 species), latter T-shaped but one branch often reduced.
Palaquium (110), Planchonella (100), Madhuca Leaves alternate, sometimes clustered at
636 Plant Systematics
shoot apices, simple, entire, coriaceous, ve- longitudinal, pollen grains tricolpate or
nation reticulate, stipules usually absent, tetracolpate. Gynoecium with 2-many united
rarely present (Madhuca), fresh petioles bot- carpels, ovary superior, locules many,
tle-shaped. Inflorescence axillary cymes, placentation axile, each locule with 1 ovule,
rarely terminal cymes (Madhuca) or with soli- ovule anatropous with single integument,
tary flowers. Flowers bisexual, ebracteate style single, protruding, stigma capitate or
(Manilkara zapota) or bracteate (Madhuca), lobed. Fruit a berry with often leathery bony
actinomorphic, hypogynous. Calyx with 4- layer; seed with hard shiny testa and large
12 sepals, free or connate at base, sometimes hilum, endosperm usually fleshy, rarely ab-
in two whorls or spirally arranged, imbricate, sent. Pollination by insects. Dispersal of ber-
persistent. Corolla with 4-12, as many as ries by birds and animals.
sepals, united, sometimes with paired
petaloid appendages and as such corolla lobes Economic importance: The family provides
appear 18-24 in number, usually imbricate, several delicious tropical fruits like sapodilla
rarely valvate. Androecium with usually (Manilkara zapota), mamey sapote (Pouteria
8-16 stamens, in two or 3 whorls but only in- sapota), eggfruit or yellow sapote (P.
ner whorl fertile opoosite petals, others re- campechiana) and star apple (Chrysophyllum
duced to staminodes, epipetalous, anthers cainito). Latex of Manilkara zapata provides
bithecous, basifixed or dorsifixed, dehiscence chicle, the elastic substance in chewing
Major Families of Angiosperms 637
gum. Species of Palaquium provide gutta- genera having same number of stamens as
percha, a latex substance used in golf balls corolla lobes constitute a well defined clade,
and submarine telephone cables as insula- those with twice as many stamens form a
tion and in dental stoppings. Several species heterogenous complex, which is probably
are used for timber in Malaya. paraphyletic and basal. Thorne (2006, 2007)
and APWeb (2008) recognise three sub-
Phylogeny: Family is closely related to families in Sapotaceae: Sarcospermatoi-
Ebenaceae but distinct in the presence of deae, Sapotoideae and Chrysophylloideae.
milky latex, bisexual flowers, ovules singly Above three clades are supported by com-
in chambers and with single integument. bined morphological molecular analysis of
The family is closer to Hoplestigmataceae in Swenson and Anderberg (2005). They also
single ovule in chamber and single integu- concluded that the staminodes common in
ment (Lawrence, 1951), but the latter family Chrysophylloideae, but derived within the
has been shifted to Lamiidae by Thorne (2006, clade, are perhaps not immediately compa-
2007), whereas APG-II places Hoplestigma rable with the staminodes of other members
among unplaced genera, and APWeb (2007) of the family; the former are outside the
the family as unplaced eudicot. The studies staminal whorl, the latter in the same whorl
of Pennington (1991) from the study of corolla as the stamens. Sarcosperma is regarded as
lobes and stamens concluded that whereas sister to rest of family.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herbs, leaves opposite or Description: Perennial herbs, usually with
whorled or basal, petals united, ovary supe- sympodial rhizomes (Primula) or tubers
rior, stamens opposite the petals, carpels (Cyclamen) rarely annuals (Anagallis) or
more than 2, seeds numerous. subshrubs, sometimes aquatic (Hottonia),
nodes unilacunar, sieve-tube plastids
Major genera: Primula (500 species), S-type. Leaves opposite, whorled or alternate,
Lysimachia (200), Androsace (90), sometimes all basal, simple, sometimes dis-
Dodecantheon (50), Anagallis (28) and sected (Hottonia), venation reticulate, stipules
Cyclamen (15). absent, rarely present (Coris). Inflorescence
638 Plant Systematics
Figure 13.122 Primulaceae. Primula longiscapa. A: Plant with basal rosette of leaves and
scapigerous inflorescence; B: Vertical section of flower to show long corolla tube
and epipetalous stamens; C: Transverse section of ovary with free-central pla-
centation; D: Fruit dehiscing by recurved apical teeth. Anagallis arvensis. E: Part
of plant with opposite and whorled leaves and axillary flowers; F: Flower from
above; G: Vertical section of flower; H: Fruit with persistent calyx and style;
I: Pyxidium fruit dehiscing by terminal cap; J: Seed.
with solitary axillary flowers (Anagallis), to ecium with 5 stamens (rarely 4 or 6, depend-
paniculate (Lysimachia) or umbellate ing on the number of petals), free, opposite
(Primula), often scapigerous (Primula). Flow- the petals, epipetalous, anthers bithecous, de-
ers bisexual, actinomorphic, rarely zygo- hiscence longitudinal, sometimes with api-
morphic (Coris), hypogynous, rarely partly cal pores, sometimes with staminodes alter-
epigynous (Samolus), usually pentamerous. nating the petals. Gynoecium with 5 united
Calyx with 5 sepals, rarely 6 (Lysimachia) or carpels, ovary superior or half-inferior,
even 9 (Trientalis), united, inflated or tubu- unilocular, ovules many, anatropous to
lar, imbricate or twisted. Corolla with 5 pet- campylotropous, placentation free central,
als, rarely 4 (Centunculus), 6 (Lysimachia) or style simple, stigma capitate or minute,
9 (Trientalis), or absent (Glaux), united, the heterostyly is prevalent in the genus Primula.
tube often short, rotate (Anagallis) or tubular Fruit a capsule, variously dehiscent,
(Primula), lobes imbricate or twisted. Andro- pyxidium in Anagallis, opening by a cap like
Major Families of Angiosperms 639
cover; seeds with straight embryo, endosperm Portulacaceae being a connecting link. Over
present, sometimes with aril. Pollination by the recent years, there have been attempts
various insects. Small seeds are often dis- to shift Anagallis, Lysimachia and other gen-
persed by wind or water, some by ants at- era to Myrsinaceae, separation of Maesa from
tracted by the oily aril. Myrsinaceae into a distinct family Maesa-
ceae and shifting of Samolus from Primula-
Economic importance: The family is impor- ceae to Theophrastaceae (Anderberg et al.,
tant for several ornamental species of 2000, 2001). On the basis of phylogenetic
Primula and Cyclamen. Anagallis arvensis is analysis based on DNA sequences of rbcL and
of medicinal importance. ndhF Kallesjo et al., (2000) concluded that
genera of tribe Lysimachieae (Anagallis,
Phylogeny: The family is well defined and Cyclamen, Gaux, Lysimachia and Trientalis) as
usually placed under Primulales along with also the genera Coris and Ardisiandra should
other groups of Dillenianae or Dilleniidae be placed within expanded Myrsinaceae, re-
(whichever is recognized). In some genera stricting Primulaceae to herbaceous mem-
such as Samolus, there are five staminodes bers with campanulate corolla and capsule
alternating with petals, in addition to 5 nor- fruits, a treatment followed in APweb. Judd
mal stamens opposite the petals, suggest- et al. (2002) and Thorne (2003), however,
ing that antipetalous condition has resulted have followed broader circumscription of fam-
during course of evolution from the loss of ily Primulaceae retaining these genera. Re-
the outer whorl (represented in some gen- cent studies have indicated resemblances
era by staminodes). The family is mostly of the family Primulaceae with Ericalean
placed closer to Myrsinaceae. Hutchinson, complex under Asterids. As such Thorne in
however, advocated that the two are not re- his recent revision (2003, 2006, 2007) has
lated and their free central placentation and shifted Primulales to Asteridae (under
stamens opposite the petals are due to par- Ericanae), and Judd et al., (2002), APG II and
allel evolution. He considers Primulaceae to APweb have placed the family under order
have evolved from Caryophyllaceae with Ericales of Asterids.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.123 Ericaceae. Rhododendron glaucophyllum. A: Portion of plant with flowers; B: Anther;
C: Transverse section of ovary; Vaccinium vacillans D: Branch with flowers;
E: Flower; F: Vertical section of flower; G: Anther. H: Flowering branch of Lyonia
villosa. (A, H, after Polunin and Stainton, Fl. East. Himal., 1984; rest, after Bailey,
Man. Cult. Pl., 1949).
Salient features: Mainly shrubs, leaves al- herbs lacking chlorophyll (Monotropa).
ternate, flowers campanulate to urceolate, trichomes unicellular or multicellular, glan-
stamens twice the number of corolla lobes, dular or scaly, never stellate. Leaves alter-
arising from nectariferous disc, anthers nate, sometimes opposite or whorled, sim-
opening by terminal pores, ovary 4 or more ple, entire or serrate, often coriaceous, per-
chambered. sistent, sometimes reduced to needles or
scales, margin sometimes revolute, vena-
Major genera: Rhododendron (850 species), tion reticulate, usually pinnate, sometimes
Erica (600), Vaccinium (450 incl. Agapetes: 90), palmate, blade sometimes reduced to
Gaultheria (160), Leucopogon (150), mycoparasite, stipules absent. Inflores-
Cavendishia (110), Arctostaphylos (70), cence with solitary axillary flowers, cymes,
Dracophyllum (50), Epacris (45), Pyrola (20), racemes or panicles. Flowers bisexual,
Cassiope (12) and Monotropa (5). rarely unisexual (Empetrum), actinomorphic,
sometimes slightly zygomorphic (Rhododen-
Description: Shrubs, sometimes small, dron), hypogynous, . Calyx with 5 sepals,
rarely lianas, epiphytes or mycoparasitic rarely 4-7, distinct or slightly connate at
Major Families of Angiosperms 641
base, persistent. Corolla with 5 petals, widely grown as ornamentals. Oil of winter-
rarely 4-7, united, corolla tubular, green (methyle salicylate) is obtained from
campanulate or urceolate, lobes short, im- Gaultheria procumbens. Foliage of Gaultheria
bricate or convolute. Androecium with 5 sta- shallon is sold as lemon leaf.
mens sometimes twice the number of co-
rolla lobes, arising from nectar disc, free, Phylogeny: The broadly circumscribed
filaments flattened at base, sometimes Ericaceae includes Empetraceae, Epacrida-
connate at base (Vaccinium), straight or S- ceae, Monotropaceae, Pyrolaceae and
curved, free from corolla or epipetalous, Vacciniaceae, sometimes recognized as in-
anthers bithecous, sometimes with paired dependent families, or included under two
appendages (spurs) near base, dehiscence families Ericaceae (ovary superior, fruit cap-
by apical pores, rarely small slits near tip, sule) and Vacciniaceae (ovary semi-inferior
pollen in tetrads. Gynoecium with 5 united or inferior, fruit a berry). Segregation these
carpels, rarely 2-10, ovary usually superior, families would render Ericaceae as para-
rarely half-inferior (Gaultheria) or inferior phyletic. Monophyly of broadly circumscribed
(Vaccinium), disc present, placentation axile Ericaceae is supported by evidence from
or parietal with deeply intruded placentae, morphology, rbcL and 18S rDNA sequences
unilocular, ovules many, anatropous, style (Kron, 1996; Soltis et al, 1997). Engler and
simple, conical or filiform, rarely split above, Diels (1936) included four subfamilies:
stigma simple. Fruit a capsule, berry Rhododendroideae (septicidal capsule, seed
(Vaccinium, Cavendishia) or drupe (Arctosta- winged or ribbed, anthers without append-
phylos, Styphelia); seeds small, embryo ages), Arbutoideae (fruit berry or loculicidal
straight, endosperm present, seed coat thin. capsule, seed not winged, anthers app-
Pollination mostly by bees and wasps, aided endaged, ovary superior), Vaccinioideae
by nectar. Viscin threads present in Rhodo- (ovary inferior, rest similar to Arbutoideae)
dendron and related genera help insects to and Ericoideae (fruit loculicidal capsule or
pull out pollen tetrads. Capsule fruits are nut, ovary superior, seeds not winged, calyx
dispersed by wind, species with berries or persistented, anthers with apically spread-
drupes are usually dispersed by birds. ing lobes). Thorne (2006) recognized eight
subfamilies, merging Rhododendoideae with
Economic importance: The family provides Ericoideae, and adding Enkianthoideae,
edible fruits blueberry (Vaccinium spp.), cran- Monotropoideae, Cassiopoideae, Styphelioi-
berry (V. macrocarpum) and huckleberry deae and Empetroideae, subsequently (2007)
(Gaylussacia; sometimes included in adding ninth Harrimanelloideae segregated
Vaccinium). Several species of Rhododendron from Cassiopoideae. APWeb (2008) also rec-
(rhododendrons, azaleas), Calluna (heather), ognises 8, but includes Empetroideae under
Kalmia (K. latifolia, mountain laurel), Erica Ericoideae, recognising Harrimanelloideae as
(heath), Oxydendrum (sourwood), Arbutus additional subfamily. Monotropa uniflora has
(madrone) and Leucothoe (fetterbush) are smallest embryo, just two-celled (Olson 1991)
***********
642 Plant Systematics
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.124 Adoxaceae. Viburnum mullaha. A: Branch with inflorescence; B: Flower, top view;
C: Vertical section of flower; D: Transverse section of ovary. Sambucus nigra.
E: Branch with inflorescence; F: Flower, side view; G: Flower, top view; H: Fruit;
I: Seed. (A-B, after Polunin and Stainton, Fl. Himal, 1984)
Major Families of Angiosperms 643
***********
644 Plant Systematics
Figure 13.125 Apiaceae. Coriandrum sativum. A: Upper portion of plant with compound umbels in
flower and fruit; B: Part of lower leaf with broader segments; C: Inner actinomor-
phic flower; D: Outer zygomorphic flower; E: Vertical section of flower; F: Cremocarp
with persistent stylopodium at tip. Foeniculum vulgare. G: Portion of branch with
compound umbels without bracts; H: Flower; I: Vertical section of flower;
J: Cremocarp with forked carpophore separating 2 mericarps. Bupleurum candollii.
K: upper portion of plant with simple entire leaves (rare situation in this family)
and umbels; L: Cremocarp. M: Upper portion of plant of Eryngium biebersteinianum
with spiny leaves and sessile head-like umbels.
Major Families of Angiosperms 645
Salient features: Aromatic herbs with called vittae inside. Seeds with small embryo,
hollow internodes, leaves compound with endosperm oily.
sheathing base, inflorescence umbel,
petals incurved in bud, yellow or white, Economic importance: The family is the
stamens 5, inflexed in bud, ovary inferior, source of food plants, spices and condiments.
fruit a cremocarp with stylopodium at apex. Carrot (Daucus carota) and parsnip (Pastinaca
sativa) are important root crops. Important
Major genera: Eryngium (230 species), Ferula flavouring plants include fennel (Foeniculum
(150), Pimpinella (150), Bupleurum (100), vulgare), coriander (Coriandrum sativum),
Heracleum (60), Sanicula (40), and caraway (Carum carvi), anise (Pimpinella
Chaerophyllum (40). anisum) and celery (Apium graveolens). Cicuta,
Conium (hemlock, which Socrates is said to
Description. Herbs with hollow internodes, have used for suicide) and Oenanthe include
commonly aromatic, rarely shrubs (Eryngium poisonous plants.
giganteum), or even climbers (Pseudocarpum),
sometimes forming huge cushions (Azorella). Phylogeny: Apiaceae and Araliaceae have
Stems often fistular, with secretary canals been considered as closely related families
containing ethereal oils and resins, for a long time, often included in the same
coumarins, and terpenes, plants character- order (Bentham and Hooker, Engler and
istically containing umbelliferose, a trisac- Prantl), a trend continued by almost all re-
charide storage product. Leaves alternate, cent authors, though Hutchinson (1926, 1973)
rarely opposite (Apiastrum), lobed or com- had separated the two under distinct orders,
pound, rarely simple (Bupleurum), petioles and even under different groups Lignosae and
with sheathing base, stipules absent. Inflo- Herbaceae. This separation was arbitrary and
rescence of simple or compound umbels, of- as such in most recent classifications they
ten subtended by involucre of bracts (involu- are placed closer together under Araliales
crebracts of umbel branches and (Dahlgren; Takhtajan, Thorne) or Apiales
involucel bracts of flowers; absent in (Cronquist, APG II, APweb), Monophyly of the
Foeniculum), sometimes like a head family is supported by morphology, secondary
(Eryngium). Flowers small, bracteate or metabolites, rbcL and matK sequences (Judd
ebracteate (Foeniculum), usually pedicelled, et al., 1994; Plunkett et al., 1997). Earlier
rarely sessile (Eryngium) bisexual, rarely uni- studies (Judd et al., 1999) had indicated that
sexual (Echinophora), actinomorphic (rarely Apiaceae are most closely related to
zygomorphic), epigynous. Calyx with 5 sepals, Pittosporaceae, but recent data (APweb;
adnate to ovary, 5-lobed, lobes often very Plunkett, 2001) points to Pittosporaceae be-
small. Corolla with 5 petals, free, valvate or ing sister taxon of the whole group or
slightly imbricate, incurved in bud, notched Pittosporaceae may be embedded in Apiaceae
at tip. Androecium with 5 stamens, free, + Araliaceae + other taxa. The family
inflexed in bud, exserted in open flower, rarely Apiaceae is usually divided into two sub-
included, anthers bithecous, dehiscence lon- families: Saniculoideae (Leaves often broad,
gitudinal, pollen grains usually tricolpate. Gy- with hairy or thorny leaf teeth, stylopodium
noecium with 2 united carpels (syncarpous), separated from style by groove, fruit scaly or
with inferior ovary, bilocular with 1 ovule in spiny, vittae often poorly developed) and
each chamber, placentation axile, style sur- Apioideae ( umbels compound, stylopodium
rounded at base by bilobed nectary, the basal lacking groove, carpophore free, bifid,
portion of style along with nectary persisting mericarps attached at apex). Recent molecu-
in fruit as stylopodium. Fruit schizocarpic lar studies (Downie et al., 2000a, 2000b) have
known as cremocarp splitting at maturity into indicated that traditional division into tribes
two mericarps attached by a common stalk and genera may undergo substantial rear-
carpophore, mericarp containing oil canals rangement. The genera formerly included in
646 Plant Systematics
***********
Placement:
Salient features: Leaves often large, alter- (50), Trachymene (45), Eleutherococcus (38),
nate, compound, leaving large scars on fall- and Hedera (15).
ing, flowers small, actinomorphic, penta-
merous, usually in umbels, ovary inferior, Description. Herbs, shrubs, trees or lianas
each locule with single ovule, fruit a berry. with prickly or stellate hairs, sometimes
palm-like, a few root-climbers (Hedera).
Major genera: Schefflera (650 species), Leaves alternate, rarely opposite or whorled,
Polyscias (150), Hydrocotyle (130), Oreopanax large, lobed or more commonly pinnately or
(85), Dendropanax (70), Aralia (65), Osmoxylon palmately compound, rarely simple, petioles
Major Families of Angiosperms 647
often with sheathing base usually formed by rim. Corolla with 5 petals, rarely 3-10, free,
membranous stipules, leaving large scar on broader at base, arising from disc, valvate,
stem after falling. Inflorescence usually caducous, falling separately or as calyptra-
umbellate, rarely corymbose, racemose or like cap. Androecium with 5 stamens, rarely
panicled, spikes or heads. Flowers small, 3-10, as many as petals and alternating
usually pedicelled, greenish or whitish, bi- them, free, anthers bithecous, dorsifixed,
sexual, rarely unisexual and dioecious, dehiscence longitudinal. Gynoecium with
epigynous, rarely hypogynous, bracts very usually 5 united carpels, sometimes 2-15,
small. Calyx with 5 sepals, adnate to ovary, rarely 1, ovary inferior, locules as many as
lobes reduced to small teeth or seam-like carpels, ovule one in each locule, on apical-
648 Plant Systematics
axile placentas, anatropous, raphe ventral, The genera formerly included in Hydrocotyloi-
styles as many as carpels, free and recurved deae of Apiaceae (including genera Hydro-
or connate into a column or cone (stylopo- cotyle, Centella, etc. ) form a polyphyletic group
dium), rarely absent and stigmas sessile. and as such have been segregated to
Fruit a berry or drupe, rarely schizocarpic Araliaceae (Hydrocotyle) and Mackinlaya-
and splitting into pyrenes or mericarps; seed ceae (Centella, Trachymene, etc.) by Downie
with small embryo at one end, endosperm et al., (2000) and Chandler and Plunkett
copious, sometimes ruminate. (2003; 2004). Stevens (APweb, 2003) points
out that sampling must improve to resolve
Economic importance: The family is known affinities especially with regard to Hydrocotyle
for its ornamental foliage plants such as and Trachymene. Thorne (2003, 2006), has
Schefflera, Fatsia japonica, Eleutherococcus, shifted Centella and 5 other genera to
Aralia and Hedera. Many cultivars of Hedera Mackinlayaceae but placed Hydrocotyle and
helix (Ivy) are used as house plants. Roots of Trachymene in Araliaceae. Judd et al., (1999,
Ginseng plant (Panax ginseng) from China 2002) argued that if Apiaceae and Aralia-
and Korea yield drug Ginseng used medici- ceae, in close to their traditional circumscrip-
nally as stimulant and aphrodisiac. Ameri- tions, were recognized, they would be poorly
can Ginseng (P. quinquefolia) is also being characterized morphologically, and certain
used as substitute for true ginseng. Aralia genera would have no well-supported
cordata and A. racemosa are also used me- familial placement. They accordingly merge
dicinally. Araliaceae and Mackinlayaceae with
Apiaceae, recognizing three subfamilies
Phylogeny: Apiaceae and Araliaceae have Aralioideae, Apioideae and Saniculoideae.
been considered as closely related families Thorne (2003) and APG II (2003) treated all
for a long time, often included in the same the three families as independent, but Thorne
order (Bentham and Hooker, Engler and subsequently (2006, 2007) merged Sani-
Prantl), a trend continued by almost all re- culoideae and Mackinlayaceae with Apiaceae
cent authors, though Hutchinson (1926, and divided Araliaceae into two subfamilies
1973) had separated the two under distinct Aralioideae and Hydrocotyloi-deae. APweb
orders, and even under different groups (2003, 2008) follows the same treatment.
Lignosae and Herbaceae. This separation Basal Araliaceae may well be bicarpellate and
was arbitrary and as such in most recent clas- have simple leaves. Both these are features
sifications they are placed closer together of the herbaceous Hydrocotyloideae, sister to
under Araliales (Dahlgren; Takhtajan, the rest of the family (Chandler & Plunkett
Thorne) or Apiales (Cronquist, APG II, APweb). 2004; Plunkett et al. 2004a).
***********
Major Families of Angiosperms 649
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Usually herbs, lacking ple, sometimes compound (Dahlia, Artemisia),
Iridoids, leaves usually alternate, stipules rarely opposite (Dahlia) or whorled, stipules
absent, inflorescence a capitulum with ray absent. Inflorescence a capitulum with
florets and disc florets (one type or both in a broad receptacle containing disc florets (dis-
head), surrounded by involucre bracts coid head- Ageratum, Vernonia), ray florets
(phyllaries), calyx represented by pappus, (ligulate head- Sonchus, Launaea) or both
anthers united forming a cylinder around type of florets with latter towards the periph-
style, style with two branches, fruit a cypsela ery (radiate head- Helianthus, Aster), all types
(commonly called achene, although typical of heads having florets surrounded by involu-
achene is formed from single carpel and cre bracts (phyllaries), rarely capitulum with
superior ovary), ovary inferior. single floret (Echinops) with capitula ar-
ranged into globose heads. Flowers bisexual
Major genera: Senecio (1470 species), Ver- (usually disc florets and ray florets of a
nonia (1050), Cousinia (600), Eupatorium (590), ligulate head) or unisexual (commonly ray
Centaurea (590), Hieracium (470), Helichrysum florets in a ligulate head, which may even
(460), Saussurea (300), Cirsium (270), Aster be sterile), actinomorphic (usually disc flo-
(240), Bidens (210), Chrysanthemum (200), rets) or zygomorphic (usually ray florets),
Crepis (200), Inula (200), Gnaphalium (140), epigynous. Calyx absent or represented by
Solidago (110), Helianthus (100), Carduus (90), pappus in the form of scales (Helianthus),
Lactuca (90), Taraxacum (80), Tragopogon (70), bristles (Bidens), simple hairs (Sonchus) or
Sonchus (50) and Calendula (30). plumose (Carduus). Corolla with 5 petals,
united, tubular and 5-lobed (disc floret) or
Description: Usually herbs or shrubs, rarely ligulate with 3-5 teeth (ray floret: sometimes
trees (Vernonia arborea; Leucomeris) or lianas also bilabiate). Androecium with 5 stamens
(Vernonia scandens), sometimes producing with free filaments and united anthers
tubers (Dahlia, Helianthus tuberosus), usually (syngenesious) forming a tube around the
storing inulin, laticifers usually present, style, epipetalous, anthers bithecous, dehis-
rarely lacking, terpenoids usually present, cence longitudinal. Gynoecium with 2
usually sesqueterpene lactones, Iridoids united carpels, unilocular a single ovule,
absent. Leaves usually alternate and sim- placentation basal, ovary inferior, style with
650 Plant Systematics
Figure 13.127 Asteraceae. Helianthus annuus. A: Portion of plant with inflorescences, the ca-
pitulum with both ray florets and disc florets (radiate head); B: Vertical section of
ray floret lacking androecium; C: Vertical section of disc floret. Ageratum
houstonianum. D: Portion of plant with capitula in clusters, each with only disc
florets (discoid head); E: Vertical section of disc floret; F: Achene with pappus
consisting of 5 scales. G: Plant of Sonchus oleraceous with auricled leaves and
capitula with only ray florets (ligulate head). H: Plant of Launaea nudicaulis with
ligulate heads. Carthamus lanatus. I: Portion of plant with spinose leaves and
discoid heads; J: Capitulum with spiny involucre bracts. Bidens chinensis.
K: Lower part of plant with pinnate leaves; L: Upper part with one flowering and
one fruiting capitulum; M: Ray floret with three-toothed corolla; N: Disc floret;
O: Disc floret with corolla partly removed to show androecium; P: Achene.
Major Families of Angiosperms 651
two branches. Fruit a cypsela (often called Calyceraceae, Goodeniaceae and their sis-
achene which typically, however, is formed ter group Menyanthaceae form a mono-
from single carpel with superior ovary) usu- phyletic group. All the four families are placed
ally with pappus at tip. Seeds 1, embryo under Asterales by Thorne (1999, 2003). The
straight, endosperm usually absent. relationships between the first three fami-
lies are not very clear. The rbcL and ndhF
Economic importance: Compared to the (Krehed et al., 1999) and ndhF data
number of species included, the family is of (Olmstead et al., 2000) support Asteraceae
lesser economic importance. Common and Calyceraceae as sister families whereas
valuable ornamentals include species of rbcL together with atpB and 18S rDNA (Soltis
Aster, Dahlia, Chrysanthemum, Gerbera, et al., 2000) support Goodeniaceae and
Helichrysum, Tagetus and Zinnia. A few food Calyceraceae as sister taxa. A combination
plants include Lactuca (lettuce), Cynara of morphological data, and rbcL, ndhF and
(artichoke), Helianthus (sunflower oil), and atpB sequences provided a strong support for
Cichorium (chicory, added to coffee). Safflower Calyceraceae and Asteraceae as sister
a red dye is obtained from Carthamus groups (Lundberg and Bremer, 2002). Simi-
tinctorius. Latter is now more commonly lar conclusion was also reached by the analy-
cultivated for its seeds yielding safflower oil, sis of six DNA regions (Bremer et al., 2002).
used in cooking. Chrysanthemum cinerarie- The family Asteraceae is usually divided
folium is the source of natural insecticide into three subfamilies: Barnadesioideae
pyrethrum. (style papillate, stigma lobed; cypsela with
spines; lacks chloroplast DNA inversion
Phylogeny: Interestingly Asteraceae in found in other two subfamilies), Cichorioi-
spite of huge size form a well-defined clade, deae (Latex present, style branches long with
easily recognizable and evidently mono- inner surface stigmatic, acute; those with
phyletic. The family is often considered re- ray florets often separated into a distinct sub-
lated to Rubiaceae, Caprifoliaceae, family Lactucoideae) and Asteroideae (latex
Dipsacaceae, Valerianaceae, Campanul- absent, both disc and ray florets). Thorne
aceae and a few others. The first four are (2006, 2007) recognizes Carduoideae includ-
basically cymose and also differ in biochemi- ing Cichorioideae and Lactucoideae. He sub-
cal features. Stylidiaceae, Goode-niaceae divides these three subfamilies further to
and Brunoniaceae resemble the Asteraceae include a total of 25 tribes in Asteraceae.
in being mostly racemose and in possess- Heywood had earlier (1978) recognized
ing inulin, but differ in biochemical features 17 tribes under two subfamilies Lactu-
of taxonomic significance. Recent molecu- coideae and Asteroideae. APweb (2003)
lar studies (Bremer et al., 2002; Lundberg recognizes 11 subfamilies including one
and Bremer, 2002) indicate that Asteraceae, undefined The Stifftia group.
***********
652 Plant Systematics
3. Tetrachondraceae (B)
Subclass 11. Lamiidae 4. Plocospermataceae (B)
Superorder 1. Solananae 5. Gratiolaceae (B)
6. Calceolariaceae (B)
Order 1. Garryales (B)
7. Gesneriaceae
Family 1. Garryaceae
8. Plantaginaceae (B)
2. Eucommiaceae
9. Pedaliaceae
3. Aucubaceae
10. Linderniaceae
4. Oncothecaceae (B)
11. Byblidaceae
5. Icacinaceae (B)
12. Lamiaceae (B)
2. Solanales 13. Paulowniaceae (B)
Suborder 1. Solanineae 14. Orobanchaceae (B)
1. Solanaceae 15. Phrymaceae
2. Convolvulaceae 16. Nesogenaceae (B)
3. Hydroleaceae (B) 17. Schlegeliaceae (B)
4. Sphenocleaceae 18. Verbenaceae (B)
5. Montiniaceae (B) 19. Martyniaceae
2. Boraginineae 20. Petraeaceae (B)
1. Boraginaceae 21. Trapellaceae (B)
2. Hydrophyllaceae 22. Bignoniaceae
3. Lennoaceae 23. Lentibulariaceae
4. Hoplestigmataceae (B) 24. Acanthaceae
Superorder 2. Lamianae 25. Stilbaceae
Order 1. Rubiales 26. Scrophulariaceae
l. Gentianaceae
2. Loganiaceae Taxa Incertae Sedis
3. Gelsemiaceae Haptanthus Goldberg & Nelson (1). Hondu-
4. Rubiaceae ras.
5. Apocynaceae Heteranthia Nesse & C.Mart. (1) Brazil.
*Pottingeria Prain (1)
2. Lamiales
Pteleocarpa Oliver (1) W. Malesia.
1. Oleaceae
2. Carlemanniaceae (B) * Under Hydrangeales-> Pottingeriaceae
by Takhtajan
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Figure 13.128 Solanaceae. Solanum nigrum. A: Branch with extra-axillary rhipidium infloresences
and fruits; B: Vertical section of flower. Withania somnifera. C: Branch with axillary
cymose clusters of flowers; D: Flower; E: Vertical section of flower with bell-shaped
corolla; F: Fruit enclosed in enlarged urceolate calyx. Datura inoxia. G: Branch with
axillary funnel-shaped flowers; H: Transverse section of ovary, tetralocular due to
false septum; I: Capsule covered with tubercles and basal persistent portion of
calyx. Physalis minima. J: Portion of plant with flowers; K: Flower; L: Vertical sec-
tion of flower; M: Transverse section of ovary with swollen placentae; N: Fruit with
inflated calyx removed from one side; O: Seed; P: Flowering branch of Atropa
belladona.
Salient features: Leaves alternate, stipules (110), Physalis (95), Lycium (90), Capsicum
absent, flowers actinomorphic, stamens 5, (50), Hyoscyamus (25) and Datura (10).
carpels 2, ovary superior, 2-chambered, pla-
centa swollen, septum oblique, ovules nu- Description: Herbs, shrubs (Brunfelsia,
merous, fruit a berry or capsule. Cestrum) or small trees (Solanum verbasci-
folia; Dunalia), rarely lianas, often poison-
Major genera: Solanum (1350 species), ous, sometimes with prickles, underground
Lycianthus (190), Cestrum (160), Nicotiana tubers in Solanum tuberosum (potato),
654 Plant Systematics
vascular bundles with both outer and inner ated in vascular bundles having outer and
phloem. Leaves alternate, simple, rarely inner phloem, actinomorphic flowers and ob-
pinnately compound (potato), stipules absent, lique septum of the ovary. Schizanthus with
paired leaves adjacent on the stem are com- zygomorphic flowers is borderline genus. The
mon. Inflorescence cymose (Solanum) or of family also has close affinities with Convol-
solitary flowers (Datura). Flowers bisexual, vulaceae, Boraginaceae and Gesneriaceae.
actinomorphic, hypogynous. Calyx with 5 Nolanaceae with gynobasic style and lobed
sepals, united, persistent, sometimes en- ovary has been merged with Solanaceae. The
larged and swollen in fruit (Withania, Physa- following 7 subfamilies are recognized
lis). Corolla with 5 petals, united, rotate (Olmstead et al., 1999; APweb, 2003):
(Solanum) or tubular (Cestrum), rarely funnel Schwenckioideae (pericycle fibres present,
shaped (Datura) or bilabiate (Schizanthus). stamens 4, didynamous, or 3 staminodes;
Androecium with 5 stamens epipetalous, embryo straight, short), Schizanthoideae
inserted in corolla tube, filaments free, (pericycle fibres absent, flowers zygomorphic,
bithecous, anthers introrse, dehiscence lon- anterior petals connate, forming a keel, sta-
gitudinal or by apical pores. Gynoecium with mens 2, staminodes 3, embryo curved),
2 carpels, rarely 3-5 (Nicandra), united, ovary Goetzeoideae (Fruit often a drupe, embryo
superior, bilocular, axile placentation, pla- curved: Takhtajan as family Goetzeaceae),
centa swollen, septum oblique, ovary often Cestroideae (pericyclic fibres present, sta-
further divided by false septa, style 1, rarely mens 4 or 5, often didynamous), Petunioideae
gynobasic (Nolana), stigma bilobed, ovary (flowers bisymmetric, embryo slightly curved),
seated on a nectary. Fruit berry or capsule Solanoideae (seeds flattened, embryo curved,
(Datura); seeds many, embryo straight, often coiled), and Nicotianoideae (Cork su-
endosperm present. Pollination mostly by perficial pericyclic fibres present or absent,
insects. Dispersal mostly by birds. stamens 4 or 5, of two lengths, embryo
straight or curved). The grouping (Petunioi-
Economic importance: The family includes deae (Solanoideae + Nicotianoideae)) is well
a number of food plants such as tomato supported, although the relationships be-
(Lycopersicon esculentum), potato (Solanum tween the more basal branches have only
tuberosum), egg plant or brinjal (S. weak support, but Schwenkia is probably sis-
melongena), ground cherry (Physalis peruvi- ter to the rest of the family (Olmstead et al.,
ana). Peppers (Capsicum annuum) are used 1999). Family Sclerophylacaceae has been
both as a food source (young) and spices variously included under Solanaceae
(ripe). Many poisonous species are impor- (Hutchinson, Cronquist, APG II), treated as
tant drug plants such as Atropa belladona distinct family (Takhtajan, Dahlgren), or con-
(atropine), Hyoscyamus niger (henbane-hyp- sidered unplaced (APweb) has been treated
notic drug), Datura stramonium (stramonium) as subfamily Sclerophylacoideae of
and Mandragora officinarum (mandrake). To- Solanaceae by Thorne (2003), who recognizes
bacco (Nicotiana tabacum and N. rustica) con- Browallioideae, Solanoideae and Goetzeoi-
tains toxic alkaloid nicotine and is grown for deae as other three subfamilies In subse-
chewing, smoking and snuff. Some orna- quent revisions in 2006 and 2007, he recog-
mental genera include Brunfelsia (lady-of- nises 7 subfamilies, adding Schizanthoideae,
the-night; yesterday-today-and tomorrow), Petunoideae and Nicotianoideae. APweb
Cestrum (Rat ki Rani; night blooming jessa- (2008) likewise recognises 7 subfamilies, tak-
mine), Petunia, Physalis (ground cherry) and ing out Schwenckioideae doubtfully placed in
Solanum (nightshade). Browallioideae by Thorne, Sclerophylaceae
still unplaced. Olmstead et al. (1999) consid-
Phylogeny: The family is closely related to ered Schwenckia sister to rest of family, but
Scrophulariaceae from which it is differenti- Martins and Barkman (2005) using the
Major Families of Angiosperms 655
nuclear gene SAMT (salicylic acid methyl with Cestroideae. Furthermore, Wu et al.
transferase), found Schizanthus to be sister (2006) found a strongly supported grouping of
to the rest of the family, and with rather [Solanoideae [Petunioideae + Nicotianoi-
strong support, with Schwenkia weakly linked deae].
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Usually twining or climb- base, persistent. Corolla with 5 petals,
ing herbs, commonly with latex, leaves united, funnel-shaped, usually plicate.
alternate, venation palmate, stipules absent, Androecium with 5 stamens, epipetalous,
flowers actinomorphic, corolla funnel-shaped, inserted in corolla tube, often unequal,
stamens 5, carpels 2, ovary superior, 2-cham- filaments free, bithecous, anthers introrse,
bered, , ovules 1 or 2, fruit a capsule. dehiscence longitudinal or by apical pores,
pollen grains tricolpate or multiporate.
Major genera: Ipomoea (550 species), Con- Gynoecium with 2 united carpels, ovary
volvulus (240), Cuscuta (140), Jacquemontia superior, entire or deeply bilobed, bilocular,
(110), Evolvulus (95) and Calystegia (25). axile placentation, style 1, terminal or
gynobasic, stigma bilobed, capitate or linear,
Description: Twining or climbing herbs, of- ovary seated on a nectary. Fruit a capsule;
ten rhizomatous, latex usually present, seeds 1 or 2 in each chamber, embryo
sometimes parasitic (Cuscuta), rarely tree straight or curved, cotyledons folded.
(Humbertia), vascular bundles with both outer Pollination mostly by insects.
and inner phloem, sometimes with alka-
loids, branching usually sympodial. Leaves Economic importance: Ipomoea batatas
alternate, simple, rarely lobed or compound, (sweet potato) is important for its edible
sometimes absent (Cuscuta), venation pal- roots. Important ornamentals include
mate, reticulate, stipules absent. Inflores- Ipomoea (morning glory), Porana (Christmas
cence cymose or with solitary flowers. Flow- vine) and Dichondra (ponyfoot). Roots of
ers bisexual, actinomorphic, rarely Convolvulus scammonia (scammony) and of
zygomorphic (Humbertia), hypogynous. Calyx Ipomoea purga (jalap) yield a drug used
with 5 sepals, free or slightly connate at medicinally as cathartic.
656 Plant Systematics
Figure 13.129 Convolvulaceae. Convolvulus arvensis. A: Branch with flowers and fruits; B: Flower
from above. Ipomoea arachnosperma. C: Branch with flowers; D: Flower. Rivea
hypocrateriformis. E: Portion of plant with leaves; F: Flower; G: Fruit with persis-
tent calyx. H: Flower of Seddera latifolia.
Phylogeny: The family is closely related to Convolvuloideae, but restored in 2006 and
Solanaceae, Boraginaceae and Polemonia- 2007 revisions. APweb recognizes only two
ceae. Cuscutaceae and Dichondraceae, some- Humbertioideae and Convolvuloideae (includ-
times recognized as distinct families, are ing both Cuscutoideae and Dichondroideae).
better placed in Convolvulaceae, their sepa- On the basis of DNA sequences of multiple
ration leading to paraphyly of Convolvulaceae. chloroplast loci, Stefanovic et al., (2002) con-
Monophyly of the family is supported by mor- cluded that Poranae (including Porana, itself
phological characters. Thorne (1999, 2000) polyphyletic) and Erycibeae successively form
recognized 4 subfamilies: Humbertioideae basal clades in Convolvuloideae. The basal
(Humbertia; tree), Dichondroideae (2 genera Poraneae have foliaceous bracts and fruits
Dichondra, Falkia), Convolvuloideae and that are utriculate. Erycibe (Erycibeae) has
Cuscutoideae (Cuscuta; without leaves), sub- sessile stigmas.
sequently (2003) merging Dichondroideae in
***********
Major Families of Angiosperms 657
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Bristly herbs, stems cy- truncate, ovary seated on a nectary. Fruit a
lindrical, leaves alternate, inflorescence drupe with one 4-seeded, two 2-seeded or four
helicoid cymes, flowers pentamerous, 1-seeded pits or schizocarp with four 1-
actinomorphic, carpels 2, ovary 4-lobed, style seeded nutlets; seeds with embryo straight
gynobasic, fruit with 4 nutlets. or curved. Pollination mostly by insects.
Drupaceous fruits are dispersed by birds,
Major genera: Cordia (300 species), whereas corky ones (Argusia, Cordia) are
Heliotropium (250) Tournefortia (240), Onosma carried away by water.
(140), Myosotis (90), Cynoglossum (75) and
Ehretia (75). Economic importance: Several species of
Heliotropium (heliotrope), Mertensia (virgin
Description: Herbs, shrubs or trees (Cordia), bluebells), Myosotis (forget-me-not), Cordia
sometimes lianas, inner phloem lacking, (Geiger tree), Cynoglossum (hounds tongue)
hairs with basal cystolith and often calcified and Pulmonaria (lungwort) are grown as
or silicified and as such plants bristly, rough ornamentals. Several species such as Borago
to touch. Leaves alternate, simple, entire, officinalis (borage), Symphytum officinalis
venation pinnate, reticulate, stipules ab- (comphrey) and Lithospermum spp. (pucoon)
sent. Inflorescence usually of helicoid have been used as medicinal herbs. Alkanna
cymes, rarely scorpioid. Flowers bisexual, tinctoria (alkanet) is a source of red dye used
actinomorphic, rarely zygomorphic (Echium), to stain wood and marble and to colour medi-
hypogynous, pentamerous. Calyx with 5 se- cines, wines and cosmetics.
pals, free or slightly connate at base, per-
sistent. Corolla with 5 petals, united, rotate, Phylogeny: The family is closely related to
tubular or funnel shaped, usually plicate. Solanaceae, Convolvulaceae and Polemonia-
Androecium with 5 stamens, epipetalous, ceae with which it shares alternate leaves
inserted in corolla tube, filaments free, and actinomorphic flowers and mostly in-
bithecous, anthers introrse, dehiscence lon- cluded under Boraginales next to Solanales
gitudinal, pollen grains tricolporate or (Dahlgren) or Solanales, Convolvulales and
multiporate, filaments often with nectar Polemoniales (Takhtajan), or under
discs at base. Gynoecium with 2 united car- Solanales (Thorne). The family also shows
pels, ovary superior, deeply 4-lobed, bilocu- close affinities with Lamiaceae and
lar, axile placentation, becoming 4-locular Verbenaceae in having gynobasic style,
due to false septa, style 1, terminal or 4 lobed ovary becoming 4-locular by false
gynobasic, stigma 1 or bilobed, capitate or septum and usually schizocarpic fruit.
658 Plant Systematics
***********
Major Families of Angiosperms 659
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Mainly shrubs and trees, brightly coloured (Mussaenda). Corolla with
leaves opposite or whorled, often turning 4-5 petals, (rarely 8-10), united, tubular, ro-
blackish when dry, stipules interpetiolar, tate or funnel-shaped, valvate, imbricate or
colleters present in leaf axils, inflorescence twisted. Androecium with 4-5 stamens, free,
cymose, flowers pentamerous, stamens 5, epipetalous, anthers bithecous, dehiscence
ovary inferior. longitudinal, introrse, pollen grains usually
tricolporate. Gynoecium with 2 (rarely
Major genera: Psychotria (1450 species), 1-many) united carpels, ovary inferior, rarely
Galium (410), Ixora (370), Pavetta (360), superior (Pugama) or semi-inferior
Hedyotis (360), Tarenia (350), Randia (240), (Synaptantha), bilocular (rarely 1-many
Gardenia (240) and Mussaenda (190). locules) with 1-many ovules in each cham-
ber, placentation axile (rarely apical or
Description: Trees (Adina, Neolamarckia) or basal), nectar disc usually present above the
shrubs (Ixora, Gardenia), rarely herbs ovary, style slender, stigma capitate or lobed.
(Galium), sometimes climbing (Rubia) with Fruit a berry, capsule, drupe or schizocarp;
hooked hairs, rarely epiphytic (Myrmecodia) seeds 1-many, with small embryo, curved or
with large swellings on roots inhabiting ants, straight, endosperm present or absent.
usually with Iridoids, raphide crystals com-
mon. Leaves opposite, with interpetiolar Economic importance: The family is eco-
stipules which often become as large a nomically important for being the source of
leaves and thus forming whorled arrange- coffee, quinine and a large number of
ment of leaves, simple, entire, often turn- ornamentals. Coffee is obtained from
ing blackish when dry, with colleters in leaf roasted seeds of Coffea arabica and C.
axils. Inflorescence cymose, sometimes canephora. Quinine, a remedy for malaria is
capitate (Adina), or solitary (Gardenia). Flow- derived from several species of Cinchona.
ers bisexual, actinomorphic, rarely Madder (Rubia tinctoria) was formerly culti-
zygomorphic (Posoqueria) epigynous, some- vated for its red dye alizarin. Important
times dimorphic (Randia). Calyx with 4-5 ornamentals include Gardenia, Ixora,
sepals, adnate to ovary, 5-lobed, lobes often Hamelia, Neolamarckia (cadamb tree) and
very small, one sometimes enlarged and Mussaenda.
660 Plant Systematics
Figure 13.131 Rubiaceae. Rubia manjith. A: Portion of plant with axillary inflorescences; B: Flower.
Randia spinosa. C: Twig showing spines and flowers; D: Flower with corolla re-
moved and calyx opened to show gynoecium; E: Corolla opened to show epipetalous
stamens; F: Transverse section of ovary; G: Fruit. Coffea arabica. H: Portion of twig
with fruits; I: Flower. Mitragyna parvifolia. J: Twig with globose inflorescences.
K: Flower with mitraeform (head-gear) stigma; L: Corolla opened to show androecium;
M: Flower with corolla removed to show style and stigma.
Phylogeny: Rubiaceae form a well-defined leaves and 2 carpels. The separation exclu-
group which is clearly monophyletic as sup- sively on the basis of ovary being inferior or
ported by morphology (Bremer and Struwe, superior, is slowly being abandoned as has
1992) and rbcL sequences (Bremer et al., also been done in the case of certain
1995). Affinities of the family lie with monocots such as Alliaceae, Agavaceae and
Gentianales (Dahlgren, APG II, APweb; Amaryllidaceae. The family is commonly di-
Thorne places under Rubiales also contain- vided into three subfamilies (Thorne,
ing Gentianaceae and related families; APweb): Cinchonoideae (mainly woody,
Takhtajan under Rubiales next to Gentia- raphides absent, seeds with endosperm,
nales under Lamiidae>Gentiananae) or heterostyly absent), Ixoroideae (woody,
Dipsacales (Cronquistnext to Dipsacales raphides absent, pollination plunger-mecha-
towards the end of Asteridae, Gentianales nism as in Asteraceae), Rubioideae (mainly
towards the beginning), both having opposite herbaceous, raphides present in leaves,
Major Families of Angiosperms 661
seeds with endosperm, heterostyly common). 2007). Recent molecular studies based on
Molecular data (Fay et al., 2000a) provide trnL-F and cpDNA data (Rova et al., 2002) and
support for including Dialy-petalanthus (for- broadly based molecular data involving
merly placed under Dialy-petalanthaceae- several taxa (Bremer et. al., 1999) suggest
Thorne, 1999) in Rubiaceae, under sub- that Cinchonoideae and Ixoroideae are
family Ixoroideae (Thorne, 2003, 2006, sister taxa.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Herbs shrubs or climbers, latex usually milky, Iridoids often present.
latex milky, leaves opposite or whorled, throat Leaves simple, reduced or absent in some
of corolla tube with scales, pollinia absent, succulent species, opposite (Calotropis,
ovary superior, fruit a follicle, seed with a tuft Catharanthus) or whorled (Nerium), simple,
of hairs (Asclepiadoideae, formerly entire, venation pinnate, reticulate, stipules
Asclepiadaceae separated by pollinia, anthers absent, colleters often present at the base of
adnate to stigmatic disc, stigmas united into petiole. Inflorescence dichasial or
gynostegium). monochasial cyme, racemose or umbellate
(Calotropis), sometimes solitary (Vinca), or ax-
Major genera: Asclepias (220 species), illary cymose pairs (Catharanthus). Flowers
Tabernaemontana (220), Cynanchum (200), bisexual, actinomorphic, hypogynous,
Ceropegia (140), Hoya (140), Rauvolfia (105), pentamerous, often coronate. Calyx with
Ervatamia (80), Allamanda (15) and 5 sepals, distinct or basally connate, imbri-
Catharanthus (5). cate or valvate, often with glands (colleters)
at base. Corolla with 5 united petals, the tube
Description: Perennial herbs (Catharanthus), often short campanulate (Calotropis), salver-
vines (Cryptostegia, Daemia), shrubs shaped (Catharanthus) or funnel-shaped
(Calotropis, Nerium), rarely trees (Alstonia), (Thevetia) and with contorted or valvate lobes.
often fleshy (Hoya) or cactus-like (Stapelia), Corona of usually 5 scales or appendages
662 Plant Systematics
Figure 13.132 Apocynaceae. Catharanthus roseus. A: Portion of plant with flowers and fruits;
B: Flower bud showing twisted corolla with a long tube; C: Vertical section of
flower from corolla throat showing free epipetalous stamens and calyptrate stigma;
D: Anther with dorsal fixation; E: Transverse section of flower passing through
ovary showing sepals, corolla tube 2 lateral nectaries and 2 free ovaries; F: Pair of
follicles; G: Seed. Nerium indicum. H: Branch with whorled leaves and terminal
inflorescence; I: Corolla opened to show corona of scales and anthers with tailed
appendages forming single twisted hairy appendage; J: Pair of follicles. Thevetia
nerifolia. K: Branch with subopposite and alternate leaves and large funnel-shaped
flowers; L: Drupe fruit. Rauvolfia serpentina. M: Portion of plant with inflorescences
in flower and fruit; N: Flower buds with twisted corolla; O: Seed.
arising from corolla throat (corolline corona: nated within the anther sacs to form waxy
Nerium, Cryptostegia), or from stamens pollinia (corpusculum or gland joining to-
(staminal corona: Calotropis, Asclepias), coro- gether two pollinia one each from adjacent
nal appendages nectariferous. Androecium anthers with the help of caudicles to form
with 5 stamens, filaments free (Apocynaceae translator, an adaptation for insect pollina-
sensu str.) or connate (Asclepiadoideae except tion); pollen grain tricolporate or biporate or
Cry-ptostegia) anthers free with separate pol- triporate. Gynoecium bicarpellary of two
len grains (Apocynaceae sensu str.). In apically united carpels, unilocular ovaries,
Asclepiadoideae anthers adherent to the marginal placentation, ovules 2 or more,
stigmatic area forming a 5 angled disc unitegmic, styles 2, stigma 1, calyptrate
gynostegium (gynandrium), pollen aggluti- (Catharanthus), dumb-bell shaped (Nerium), or
Major Families of Angiosperms 663
5 lobed and fused with anthers to form (carrion flower), Plumeria (frangipani) and
gynostegium (Calotropis), carpels sometimes Tabernaemontana are grown as ornamentals.
united by ovaries with axile placentation Nerium and Thevetia are poisonous (can be
(Thevetia, Allamanda, Carissa). Fruit etaerio fatal). Roots of Rauvolfia serpentina yield re-
of 2 follicles (Nerium, Calotropis), sometimes serpine used as tranquillizer for patients suf-
drupe (Thevetia), capsule or berry; seeds usu- fering from schizophrenia and hypertension.
ally numerous, flattened and comose with Catharanthus provides antileukaemic drugs.
long silky hairs. Pollination by insects, helped Latex from Plumeria used for healing tooth-
by special translators in Asclepiadoideae. ache. Low quality down is obtained from seeds
Dispersal mostly by wind, aided by hairs. of several species. Pitcher like leaves and
roots of Dischidia chewed with betel.
Economic importance: Nerium (oleander), Rubbervine (Cryptostegia) is also as caout-
Catharanthus (Madagascar periwinkle), Ascle- chouc or rubber source. Tubers of Ceropegia
pias (milkweed), Hoya (wax plant), Stapelia are edible. Stem fibre of Calotropis and
664 Plant Systematics
Leptadaenia is used for cordage. Asclepias is 5 subfamilies (Thorne, 2000, 2006, 2007):
a livestock poison. Rauvolfioideae (Plumerioideae), Apocynoi-
deae, Periplocoideae, Secamonoideae and
Phylogeny: For a long time Apocynaceae was Asclepiadoideae. The generic limits are not
considered to be closely related but distinct clearly resolved. According to Sennblad and
from Asclepiadaceae, latter with pollinia, Bremer (2002), both Rauvolfioideae and
gynostegium and usually staminal corona Apocynoideae may be quite wildly para-
(Bentham and Hooker, Engler and Prantl, phyletic. The position of the Periplocoideae
Hutchinson, Cronquist, Dahlgren). The as sister to Secamonoideae + Asclepiadoideae
family Asclepiadaceae was merged with is also uncertain (Potgeiter & Albert, 2001;
Apocynaceae by Thorne (1983) and practice Sennblad & Bremer, 2002).
was followed by Takhtajan (1987, 1997), Judd The family is usually placed in Gentianales,
et al., (2002), APG II and APweb. The separa- but Thorne has merged this order with
tion of Asclepiadaceae as distinct family broadly circumscribed Rubiales. Dahlgren
would lead to paraphyletic Apocynaceae (Judd and APG II classification prefer the name
et al., 1994; Endress et al., 1996). The family Gentianales for the broadly circumscribed
Apocynaceae is appropriately divided into order.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Leaves alternate or oppo- (130), Linaria (110), Antirrhinum (40),
site, stipules absent, flowers zygomorphic, Limnophila (32), Globularia (25), Gratiola (20),
stamens 4 or 2, anther opening by 2 distinct Scoparia (20) and Digitalis (20).
slits, anthers more or less sagittate at base,
carpels 2, ovary superior, 2-chambered, Description: Herbs or small shrubs, rarely
many, fruit a capsule. climbers (Antirrhinum cirrhosum), often
with phenolic glycosides and triterpenoid
Major genera: Veronica (350 species), saponins, and sometimes with cardiac
Penstemon (250), Plantago (210), Mimulus glycosides, hairs usually simple, when
Major Families of Angiosperms 665
Figure 13.134 Plantaginaceae. Veronica persica. A: Portion of plant with axillary flowers;
B: Flower with 4 sepals and petals each and 2 stamens; C: Gynoecium; D: Fruit
with persistent calyx and style; E: Seed. Digitalis purpurea. F: Branch with inflo-
rescence; G: Vertical section of flower; H: Transverse section of ovary with axile
placentation; I: Young anther; J: Anther dehisced through 2 slits.
glandular with short discoid head lacking anther bilocular, locules distinct, opening
vertical partitions. Leaves alternate or by two longitudinal slits, pollen sacs diver-
opposite, rarely whorled (Russelia), simple, gent (anther sagittate), pollen grains
entire or dentate, venation pinnate, reticu- tricolporate. Gynoecium with 2 united
late, stipules absent. Inflorescence race- carpels, rarely only 1 carpel developed
mose: racemes or spikes. Flowers bisexual, (Globularia), ovary superior, bilocular, ovules
zygomorphic, hypogynous. Calyx with several in each chamber, rarely 1 or
5 sepals, rarely 4 (Veronica), connate, per- 2 (Globularia) unitegmic, axile placentation,
sistent. Corolla with 5 petals, rarely 4 (due style 1, stigma bilobed, ovary seated on a
to fusion of 2 petals as in Veronica), united, nectary. Fruit a septicidal capsule; seed
usually bilabiate, sometimes with nectar sac angular or winged, with curved or straight
or spur, lower lip sometimes with a bulge embryo, endosperm present. Pollination by
obscuring the throat (personate), lobes insects. Seeds or nutlets dispersed by wind.
imbricate or valvate. Androecium with
usually 4 stamens, didynamous, fifth Economic importance: The family contrib-
stamen sometimes present as a staminode utes a number of ornamentals such as
(Penstemon), rarely 2 (Veronica), epipetalous, Digitalis (Foxglove), Mimulus (monkey flower),
inserted in corolla tube, filaments free, Antirrhinum (snapdragon), Penstemon
666 Plant Systematics
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Plants aromatic, stem 4- chambered, finally 4 chambered due to false
angled, nonglandular hairs multicellular, septum, ovules 4, attached to the sides of
leaves opposite, stipules absent, inflores- false septa, ovary deeply 4-lobed, style usu-
cence with cymose lateral clusters, com- ally gynobasic, forked apically with incon-
monly verticillaster, flowers zygomorphic, spicuous stigmatic region at the tip of each
stamens 2-4, pollen exine not thickened style branch, fruit schizocarpic breaking into
near apertures, carpels 2, ovary superior, 2- 4 nutlets.
Major Families of Angiosperms 667
Figure 13.135 Lamiaceae. Salvia splendens. A: Branch with axillary and terminal inflorescences;
B: Vertical section of flower to show bilabiate corolla and stamen with turn-pipe
mechanism, gynobasic style and nectary below ovary. Ocimum basilicum. C: Portion
of plant with inflorescences; D: Flower with bilabiate corolla and 4 didynamous
stamens; E: Corolla spread out to show epipetalous stamens of 2 sizes; F: Gyno-
ecium with gynobasic style and bifid stigma, nectary below the ovary. G: Lamium
rhomboideum, plant with inflorescences. Clerodendrum viscosum. H: Branch with
terminal spreading inflorescence; I: Fruit with persistent calyx.
Major genera: Salvia (700 species), suckers (Mentha) or stolons (Ajuga), some-
Clerodendrum (400), Thymus (340), times green and assimilatory (Hedeoma),
Plectranthus (300), Scutellaria (300), Stachys usually with glandular hairs, nonglandular
(300), Nepeta (260), Teucrium (200), Calli- hairs when present multicellular. Leaves
carpa (150), Ocimum (150), Lamium (50), opposite (rarely alternate), simple or pinnate
Marrubium (40), Mentha (30), Lavandula (30) compound, usually aromatic, sometimes
and Tectona (3). reduced (Hedeoma), stipules absent. Inflores-
cence verticillaster [two opposite whorls
Description: Aromatic herbs or shrubs (verticels) of cymose clusters initially bipa-
(Rosmarinus, Teucrium), sometimes small rous and subsequently uniparous], arranged
(Hyptis) or large (Tectona) trees, rarely climb- in raceme, spike or panicle. Flowers
ers (Scutellaria), stem 4-angled, often with bracteate (Coleus) or ebracteate (Salvia),
iridoids, phenolic glycosides, sometimes with bisexual, zygomorphic, hypogynous, often
668 Plant Systematics
bilabiate. Calyx with 5 sepals, united, often species of Stachys are edible. Teak (Tectona
bilabiate 1/4 (Ocimum) or 3/2 (Salvia), per- grandis) is valuable timber, known for its hard
sistent. Corolla with 5 petals, united, usu- and durable wood and extensively cultivated
ally bilabiate 4/1 (Ocimum) or 2/3 (Salvia), in India and Burma.
upper lip sometimes absent (Ajuga), rarely
corolla 4-lobed (Pogostemon). Androecium Phylogeny: The family Lamiaceae is gener-
with 2 (Salvia) to 4 (Ocimum) stamens, ally considered to be one of the most highly
epipetalous, usually didynamous, inserted evolved of all dicotyledonous families, and
in corolla tube, sometimes with turn-pipe closely related to Vebenaceae. The circum-
mechanism (lever mechanism) as in Salvia scription of the family has undergone con-
(anther lobes separated by a long connective siderable revision with several genera (nearly
and swinging like a lever, one anther-lobe two-thirds) from older Verbenaceae such as
sterile, another fertile), filaments free, de- Clerodendrum, Callicarpa, Vitex and Tectona
hiscence longitudinal, pollen grains transferred to Lamiaceae (Judd et al., 2002;
tricolpate or 6-colpate. Gynoecium with 2 Thorne, 2000, 2003; APG II, APweb). The fam-
united carpels, ovary superior, bilocular, ily Lamiaceae is distinguished from
ovules 2 in each chamber, finally 4-locular Verbenaceae in cymose lateral whorls, ovules
due to false septa with 1 ovule in each cham- attached on sides of false septa, bilobed style
ber, anatropous, axile placentation, ovules with small stigmatic region, pollen exine not
attached to the sides of the false septa, ovary thickened near apertures, hairs multicellu-
4-lobed, style 1, gynobasic, rarely terminal lar, strongly bilabiate corolla and usually
(Ajuga), forked apically with inconspicuous gynobasic style. According to Wagstaff et al.,
stigmatic region at the tip of each style 1998 the following 5 clades (subfamilies) are
branch, ovary seated on a nectary disc. Fruit distinct: Nepetoideae (pollen trinucleate,
a schizocarp (carcerulus) splitting into 4 hexacolpate, style gynobasic; myxocarpy;
nutlets or a drupe or indehiscent 4-seeded endosperm absent, embryo investing),
pod; seed with straight embryo, endosperm Lamioideae (laballenic acid in seed oils, em-
minute or absent. Pollination by insects, bryo sac with micropylar lobe longer and
lower lip providing landing platform. Disper- broader than chalazal lobe, style gynobasic),
sal by birds, wind or water. Pogostemonoideae (stamens 4, about the
same length), Scutellarioideae (style
Economic importance: The family includes bilabiate, with rounded lips; seeds tubercu-
several plants used in cooking and flavour- late), and Teucrioideae [(inc. Ajugoideae)
ing such as spearmint (Mentha spicata), pep- exine with branched to granular columellae].
permint (M. piperita) thyme (Thymus vulgaris), Bootstrap support for the family as circum-
sweet basil niazbo (Ocimum basilicum), pot scribed is 100 per cent (Wagstaff et al., 1998);
marjoram (Origanum vulgare) and sage (Salvia Congea may be sister to the rest, but some
officinalis). The family is also source of popu- relationships are still in a state of flux. Thorne
lar perfumes such as lavender (Lavandula (2000, 2003, 2007) adds two more subfamilies
angustifolia) and rosemary (Rosmarinus Symphorematoideae (Congea, Sphenodesme,
officinalis). Basil (Ocimum sanctum) is sacred Symphorema) and Prostantheroideae (17 gen-
in India. Common ornamentals include sage era incl. Chloanthoideae, Tectona), establish-
(Salvia), horsemint (Monarda), Molucella, ing Ajugoideae (instead of Teucrioideae) thus
Clerodendrum and Coleus. The tubers of few recognizing a total of seven subfamilies.
***********
Major Families of Angiosperms 669
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Plants aromatic, leaves gitudinal, pollen grains tricolpate, exine
opposite, serrate, stem often angular, non- thickened near apertures. Gynoecium with
glandular hairs if present unicellular, flow- 2 united carpels, ovary superior, bilocular,
ers zygomorphic, in racemes, spikes or heads, ovules 2 in each chamber, finally 4-locular
pollen exine thickened near apertures, style due to false septum with 1 ovule in each
simple with bilobed stigma, stigmatic area chamber, unitegmic, axile placentation,
conspicuously swollen and glandular, ovary ovary not or slightly 4-lobed, style 1, termi-
with four ovules, ovules attached to the nal, style simple with bilobed stigma,
margin of false septa. stigmatic area conspicuously swollen and
glandular, ovary seated on a nectary disc.
Major genera: Verbena (200), Lippia (180) Fruit a drupe with 2 or 4 pits, or schizocarp
Lantana (140), Citharexylum (65), Glandu- splitting into 2 or 4 nutlets; seed with
laria (55), Duranta (28) and Phyla (10). straight embryo , endosperm absent. Polli-
nation by insects. Dispersal by birds, wind
Description: Aromatic herbs (Lippia), shrubs or water.
(Lantana), sometimes trees, rarely lianas,
sometimes with prickles or thorns, stem Economic importance: The family contrib-
usually 4-angled, often with iridoids and phe- utes some ornamentals such as Verbena,
nolic glycosides, usually with glandular Lantana, Duranta, and Glandularia. Lippia
hairs, nonglandular hairs if present unicel- (lemon verbena) and Privea are used as
lular. Leaves opposite, sometimes whorled, herbal teas or yield essential oils. Verbena
simple or sometimes lobed, usually aro- officinalis (vervain) is used for a number of
matic, entire to serrate, stipules absent. In- herbal remedies including treatment of skin
florescence racemose: racemes, spikes or diseases.
heads. Flowers bisexual, zygomorphic,
hypogynous. Calyx with 5 sepals, united, Phylogeny: The family is closely related to
tubular to campanulate, persistent, some- Lamiaceae. The circumscription of the fam-
times enlarged in fruit. Corolla with 5 pet- ily has undergone considerable revision with
als, sometimes appearing 4 due to fusion of several genera (nearly two-thirds) from older
two posterior petals, united, weakly bilabiate, Verbenaceae such as Clerodendrum,
lobes imbricate. Androecium with 4 sta- Callicarpa, Vitex and Tectona transferred to
mens, epipetalous, didynamous, inserted in Lamiaceae (Judd et al., 2002; Thorne, 2000,
corolla tube, filaments free, dehiscence lon- 2003; APG II, APweb). The family is now
670 Plant Systematics
Figure 13.136 Verbenaceae. Lantana camara. A: Branch with ovoid compact inflorescences on
long peduncles; B: Flower with long corolla tube and zygomorphic limb; C: Corolla
spread out to show epipetalous stamens; D: Cluster of fruits; E: Fruit. Verbena
officinalis. F: Plant with terminal spikes; G: Corolla with shorter broader tube and
zygomorphic limb; H: Corolla spread out to show epipetalous stamens; I: Gyno-
ecium; J: Transverse section of ovary with 4 one-seeded chambers. Phyla nodiflora.
K: Portion of plant with pedunculate globose inflorescences; L: Flower with short
broad tube and zygomorphic limb; M: Corolla spread out to show epipetalous sta-
mens; N: Fruit with persistent calyx; O: Longitudinal section of fruit.
***********
Major Families of Angiosperms 671
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Usually woody lianas or epipetalous, inserted in corolla tube, fila-
trees, leaves usually opposite, often com- ments free, anther bithecous, sagittate, de-
pound, sometimes with tendrils, stipules hiscence longitudinal, pollen grains some-
absent, nectaries on leaves, flowers times in tetrads or polyads. Gynoecium with
zygomorphic, showy, stamens 4, carpels 2, 2 united carpels, ovary superior, bilocular
ovary superior, 2-chambered, ovules many, with axile placentation, rarely unilocular
fruit a woody capsule, seeds often winged. with free-central placentation, ovules many,
anatropous, style short, stigma with unequal
Major genera: Tabebuia (100 species), lobes. Fruit a woody capsule, occasionally a
Arrabidaea (70), Adenocalyma (45), Jacaranda berry or pod; seed winged or fringed with
(40), Spathodia (20), Catalpa (11), Campsis (2) hairs, endosperm absent, cotyledons deeply
and Kigelia (1). bilobed. Pollination by insects. Seeds dis-
persed by wind.
Description: Shrubs, trees or lianas
(Bignonia, Campsis), lianas often with char- Economic importance: The family contrib-
acteristic secondary growth resulting in utes several ornamentals such as Spathodia
lobed or furrowed xylem cylinder, usually with (African tulip tree), Kigelia (sausage tree),
iridoids and phenolic glycosides. Leaves usu- Tabebuia (poui, gold tree), Crescentia (cala-
ally opposite or whorled, pinnately or bash tree) and Tecoma. Common climbers
palmately compound, sometimes simple include Bignonia (cross vine), Campsis,
(Catalpa), venation pinnate to palmate, re- Tecomaria (Cape honeysuckle) and Pyrostegia
ticulate, some leaflets often modified into (flame vine). Tabebuia and Catalpa are
tendrils, stipules absent but glands often exploited as timbers, mostly for fence posts.
present at the base of petiole. Inflorescence
cymose, raceme or panicle, rarely solitary. Phylogeny: The family is closely related
Flowers bisexual, zygomorphic, hypogynous, to Scrophulariaceae sharing the features
usually showy. Calyx with 5 sepals, connate. of zygomorphic flowers, pentamerous
Corolla with 5 petals, united, showy, usu- flowers, stamens less than 5, bicarpellate
ally bilabiate, sometimes with sac or spur superior ovary and fruit a capsule. The
on the lower lip, imbricate. Androecium with family is monophyletic as evidenced by
usually 4 stamens, fifth represented by a morphology. Pinnate compound leaves are
staminode, rarely 5 (Oroxylum) or 2 (Catalpa), considered to be ancestral. The genus
672 Plant Systematics
Figure 13.137 Bignoniaceae. Incarvillea emodi. A: Plant with terminal raceme and long linear
capsules; B: Calyx with minute lobes; C: Stamen with arched filaments and spread-
ing villous anther lobes; D: Portion of corolla spread to show stamens; E: Seed,
linear and fibrillate at both ends. Campsis radicans. F: Branch with flowers;
G: Fruit ; H: Winged seed.
Paulownia and Schlegelia often included in respectively by Thorne, APG II and APweb.
Bignoniaceae are intermediate between Paulownia is superficially like Catalpa but
this family and the Scrophulariaceae and it has endosperm and lacks the ovary and
as such treated under distinct families seed anatomy of Bignoniaceae (Armstrong,
Paulowniaceae and Schlegeliaceae 1985; Manning, 2000).
***********
Major Families of Angiosperms 673
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Leaves opposite, stipules equal in size, sometimes one lobe aborted,
absent, flowers zygomorphic, with prominent dehiscence longitudinal, tapetum glandular,
bracts and bracteoles, stamens 2-4, anther pollen grains 2-8 aperturate or colpate. Gyn-
lobes unequal in size, carpels 2, ovary supe- oecium with 2 united carpels, ovary superior,
rior, 2-chambered, ovules 4 or more, fruit a bilocular, ovules 2 in each chamber, axile
capsule, seeds with jaculators. placentation, style 1, stigma bilobed, ovary
seated on a nectary. Fruit a loculicidal cap-
Major genera: Justicia (400), Beloprone (300), sule; seed with jaculator or retinaculum a
Barleria (240), Strobilanthus (230), Ruellia hook-shaped projection of funiculus, embryo
(190), Dicliptera (140), Thunbergia (140) and large, curved or straight, endosperm absent.
Adhatoda (20).
Economic importance: The family includes
Description: Herbs or shrubs (Adhatoda), a large number of ornamentals such as
sometimes small trees (Strobilanthus) or Barleria, Thunbergia, Pachystachys,
lianas (Thunbergia), a rarely aquatic herbs Eranthemum and Acanthus. Extract from
(Cardentha), sometimes spiny (Barleria), usu- Adhatoda vasica is component of some cough
ally with anomalous secondary growth, often syrups. An extract from the boiled leaves of
with Iridoids, alkaloids and diterpenoids, Acanthus ebracteatus (sea holy) is used as a
cystoliths often present, nodes unilacunar, cough medicine in parts of Malaya, whereas
vessels with simple end-walls. Leaves oppo- the roots of A. mollis (bears breech) are used
site, rarely alternate (Nelsonia, Elytraria), to treat diarrhoea in some parts of Europe.
simple, entire or dentate, stipules absent.
Inflorescence cymose, racemose (usually Phylogeny: The family is closely related to
spike) or of solitary flowers (Bontia). Flowers Scrophulariaceae sharing the features of
bisexual, zygomorphic, hypogynous, with zygomorphic flowers, pentamerous flowers,
prominent bracts and bracteoles. Calyx with stamens less than 5, bicarpellate superior
4 (Acanthus) to 5 (Adhatoda) sepals, free or ovary and fruit a capsule. The Acanthaceae
united. Corolla with 5 petals, united, usu- are distinct in absence of endosperm, anthers
ally bilabiate, sometimes nearly regular opening by two slits and the presence of reti-
(Acanthus). Androecium with 2 (Adhatoda) or naculum. Thorne had earlier (1999, 2000)
4 (Acanthus, Ruellia) didynamous stamens, recognized 5 subfamilies: Nelsonioideae,
rarely 5 (Pentstemon), epipetalous, inserted in Thunbergioideae, Mendoncioideae, Acan-
corolla tube, filaments free, anther lobes un- thoideae and Ruellioideae. The first two
674 Plant Systematics
Figure 13.138 Acanthaceae. Adhatoda vasica. A: Branch with flowers in spikes; B: Flower with
bilabiate corolla; C: Longitudinal section of flower showing 2 epipetalous sta-
mens; D: Capsule with persistent calyx. Peristrophe bicalyculata. E: Branch with
flowers; F: Flower with bilabiate corolla; G: Vertical section of flower. Barleria
prionitis. H: portion of branch with spines at nodes and axillary clusters of flowers;
I: Corolla tube opened to show stamens, corolla limb cut away; J: Spiny calyx and
bracteoles; K: Transverse section of ovary. Blepharis maderaspatensis. L: Portion
of branch with flowers; M: Flower; N: Corolla tube opened to show epipetalous
stamens, corolla limb partly cut away; O: Longitudinal section of gynoecium.
include aberrant genera. Nelsonoideae with (2000), the absence of retinacula or cystoliths,
sometimes alternate leaves, presence of descending cochlear aestivation (i.e. the
endosperm and absence of retinacula may adaxial petals overlapping the abaxial petals
represent a paraphyletic basal group within in bud) are likely to be plesiomorphies.
the family. Nelsonioideae have often been Acanthoideae are clearly monophyletic (Scot-
placed in Scrophulariaceae s. l. or considered land, 1990) and characterized by the absence
intermediate between Scrophulariaceae of cystoliths, nodes not swollen, colpate pol-
and Acanthaceae, but they are placed sister len and monothecous anthers. In Mendo-
to rest of Acanthaceae s. l. in Hedren et al., ncioideae, one of the carpels is often aborted,
(1995). According to Scotland and Vollesen fruit is a drupe and style bifid. Mendoncioideae
Major Families of Angiosperms 675
and Ruellioideae have subsequently been McDade, 2002). This placement based on
merged under Thunbergioideae and molecular evidence is also supported by ar-
Acanthoideae, respectively (APweb and ticulated nodes, inflorescence structure, flow-
Thorne, 2003). APweb includes Avicennioi- ers with bract and 2 bracteoles, a reduction
deae as fourth subfamily, stressing that the in number of ovules and absence of en-
position of Avicenniaceae within Acantha- dosperm (Judd et al., 2002). Thorne who had
ceae s.l. is fairly well established; it shows a earlier (2000, 2003) treated Avicenniaceae
rather weakly supported sister group relation- as distinct family has also finally (2007) rel-
ship with Thunbergioideae (Schwarzbach & egated it to the subfamily level like APweb.
***********
Placement:
B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)
Salient features: Leaves alternate or oppo- whorled, simple, entire or dentate, venation
site, stipules absent, flowers zygomorphic, pinnate, reticulate, stipules absent. Inflo-
anther commonly opening by single slit, car- rescence racemose: racemes or spikes.
pels 2, ovary superior, 2-chambered, ovules Flowers bisexual, zygomorphic, or almost
many, fruit a capsule. actinomorphic, hypogynous. Calyx with 3-5
sepals, connate, persistent. Corolla with 4-
Major genera: Verbascum (360 species), 5 petals, united, usually bilabiate, or with
Scrophularia (230), Selago (150), Sutera (140), narrow tube broadening upwards, some-
Budleja (100), Manulea (55) and Nuxia (30). times with nectar sac or spur, imbricate.
Androecium with usually 5 stamens, rarely
Description: Herbs or small shrubs (Budleja), 4 or 2, epipetalous, inserted in corolla tube,
often with Iridoids, hairs usually simple, filaments free, sometimes hairy (Verbascum),
when glandular with short discoid head com- anther bilocular, anther sac confluent and
posed of many cells and with vertical parti- opening by single slit right angles to fila-
tions. Leaves alternate or opposite, rarely ment, anther base not sagittate, pollen
676 Plant Systematics
Figure 13.139 Scrophulariaceae. Scrophularia elatior. A: Portion of plant with terminal inflores-
cence; B: Flower with long-exserted stamens and style. Verbascum chinense.
C: Lower part of plant with basal and lower cauline leaves; D: Upper part of inflo-
rescence; E: Flower; F: Corolla spread to show epipetalous stamens; G: Stamen
with glandular hairy filament; H: Flower after removal of corolla and one lobe of
calyx to show gynoecium; I: Capsule with persistent calyx.
have been variously separated under clade characterised by hairy filaments, en-
Antirrhinaceae (Thorne, 1999, 2000) or dosperm development and distinctive seeds
Plantaginaceae (Judd et al., 2002, APG II and and are sister to rest of genera. Selago and
APweb, Thorne, 2006, 2007). The relatives (former Selaginaceae) form a clade
Budlejaceae and Selaginaceae have been based on uniovulate locules and achene-like
merged with Scrophulariaceae in these sys- fruits. Budleja is very much paraphyletic, but
tems. Monophyly of Scrophulariaceae is several lines of evidence place it here
clearly supported by morphology, rbcL and (Maldonado de Magnano, 1986b); Teedia and
ndhF sequences (Olmstead and Reeves, Oftia have strong support as the sister group
1995). Verbascum and Scrophularia form a to Budleja s. l. (Wallick et al. 2001, 2002).
***********
References
Abrams, L. (1923-1960). An Illustrated Flora of Anderberg, A. A., C.-I. Peng, I. Trift and
the Pacific States. 4 vols Vol. 4 by Roxana M. Kllersj. (2001). The Stimpsonia problem;
Ferris). Stanford Univ. Press, Stanford, CA. evidence from DNA sequences of plastid
Adanson, M. (1763). Familles des plantes, Paris, genes atpB, ndhF and rbcL. Bot. Jahrb. Syst.
2 vols. 123: 369-376.
Aguilar-Ortigoza, C. J. and V. Sosa. 2004. The Anderson, E. (1940). The concept of the genus.
evolution of toxic phenolic compounds in a II. A survey of modern opinion. Bull. Torrey
group of Anacardiaceae genera. Taxon Bot. Club 67: 363-369.
53: 357-364. APG [= Angiosperm Phylogeny Group] II. 2003.
Albach, D. C., P. S. Soltis, D. E. Soltis and An update of the Angiosperm Phylogeny
R. G. Olmstead. (2001). Phylogenetic analy- Group classification for the orders and
sis of Asterids based on sequences of four families of flowering plants: APG II. Bot. J.
genes. Ann. Missouri Bot. Gard. 88: 163-212. Linn. Soc. 141: 399-436.
2001. Applequist, W. L. and R. S. Wallace. (2001).
Albert, V. A., A. Backlund, K. Bremer, M. W. Phylogeny of the Portulacaceous Cohort
Chase, J. R. Manhart, B. D. Mishler and K. Based on ndhF Sequence Data. Syst. Bot.
C. Nixon. (1994). Functional constraints and 26: 406-419.
rbcL evidence for land plant phylogeny. Ann. Applequist, W. L., W. L. Wagner, E. A. Zimmer,
Missouri Bot. Gard. 81: 534-567. and M.Nepokroeff. (2006). Molecular evidence
Alston, R. E. and B. L. Turner. (1963). Natural resolving the systematic position of Hectorella
hybridisation among four species of Baptisia (Portulacaceae). Syst. Bot. 31: 310-319.
( Leguminosae). Amer. J. Bot. 50:159-173. APG [= Angiosperm Phylogeny Group]. 1998. An
Alverson, W. S., B. A. Whitlock, R. Nyffeler, and ordinal classification for the families of
D. A. Baum. (1998). Phylogeny of Core flowering plants. Ann. Missouri Bot. Gard.
Malvales: Evidence from ndhF sequence data. 85: 531-553.
Amer. J. Bot. 86(6) Suppl.: 112. Arber, E. (1934). The Gramineae: a study of cereal,
Ambrose, B. A., D. R. Lerner, P. Ciceri, C. M. bamboo, and grass. Cambridge, England.
Padilla, M. F. Yanofsky and R. J. Schmidt. Arber, E. (1938). Herbals: Their Origin and Evolu-
(2000). Molecular and genetic analyses of the tion (2nd ed.). Cambridge Univ. Press.
Silky1 gene reveal conservation in floral or- Arber, E. and J. Parkins. (1907). On the Origin
gan specification between eudicots and of Angiosperms. Bot. J. Linn. Soc. 38: 29-80.
monocots. Molecular Cell 5: 569-579. Armstrong, J. E. (1985). The delimitation of
Anderberg, A. A., X. Zhang and M. Kllersj. Bignoniaceae and Scrophulariaceae based on
(2000). Maesaceae, a new primuloid family floral anatomy, and the placement of prob-
in the order Ericales s. l. Taxon 49: 183-187. lem genera. Amer. J. Bot. 72: 755-766.
680 Plant Systematics
Arnold, C. A. (1948). Classification of gymno- Bate-Smith, E.C. (1962). The phenolic constitu-
sperms from the point of view of ents of plants and their taxonomic signifi-
Palaeobotany. Bot. Gaz. 110: 2-12. cance. J. Linn. Soc. Bot. 58: 95-173.
Ashlock, P. H. (1971). Monophyly and related Bate-Smith, E.C. (1968). The phenolic constitu-
terms. Syst. Zool. 20: 63-69. ents of plants and their taxonomic signifi-
Ashlock, P. H. (1979). An evolutionary cance. J. Linn. Soc. Bot. 60: 325-383.
Systematitss view of classification. Syst. Bauhin, C. (1596). Phytopinax seu enumeratic
Zool. 28: 441-450. plantarum..... Basel.
Asmussen, C. B., W. J. Baker, and Dransfield. Bauhin, C. (1623). Pinax theatri botanici. Basel.
(2000). Phylogeny of the palm family Baum, B. R. (1977). Oats: Wild and Cultivated. A
(Arecaceae) based on rps16 intron and trnL- Monograph of the Genus Avena L. (Poaceae).
trnF plastid DNA sequences. Pp. 525-535, Minister of Supply and Services, Ottawa.
in K. L. Wilson and D. A. Morrison (Eds.), Baum, H. (1949). Der einheitliche Bauplan der
Monocots: Systematics and Evolution. CSIRO, Angiospermen gynzeen und die Homologie
Collingwood. ihrer fertilen Abschnitte. Bot. Jahrb. Syst.
Axelrod, D. I. (1970). Mesozoic paleogeography Pflanzen. 96: 64-82.
and early angiosperm history. Bot. Rev. 36: Baum, H. and W. Leinfellner. (1953). Die
277-319. Peltationsnomeklatur der Karpelle. Bot.
Babcock, E. B. (1947). The genus Crepis pt. 1. Jahrb. Syst. Pflanzen. 100: 424-426.
The taxonomy, phylogeny distribution and Bayer, C., M. F. Fay, A. Y. De Bruijn, V.
evolution of Crepis. Univ. Calif. Publs. Bot. Savolainen, C. M. Mortan, K. K. Kubitzki,
21: 1-197. W. S. Alverson and M. W. Chang. (1999). Sup-
Bailey, I. W. (1944). The development of vessels port for an expanded family concept of
in angiosperms and its significance in mor- Malvaceae within a recircumscribed order
phological research. Am. J. Bot. 31: 421-428. Malvales: a combined analysis of plastid atpB
Bailey, L.H. (1949). Manual of Cultivated Plants and rbcL DNA sequences. Bot. J. Linn. Soc.
(rev. Ed.). Macmillan, New York. 129: 267-303.
Bailey, I. W. and B. G. L. Swamy. (1951). The Behnke, H. D. (1965). ber das phloem der
conduplicate carpel of dicotyledons and its Dioscoreaceen unter besonderer
initial trend of specialization. Amer. J. Bot. Bercksichtigung ihrer phloembecken. II.
38: 373-379. Mitteilung:Elektronenoptische
Barber, H. N. (1970). Hybridization and evolu- untersuchungen zur feinstruktur des
tion of plants. Taxon 19: 154-160. phloembeckens. Z. Pflanzenphysiol. 53: 214-
Barthlott, W. (1981). Epidermal and seed sur- 244.
face characters of plants: Systematic appli- Behnke, H. D. (1976). Ultrastructure of sieve-
cability and some evolutionary Aspects. Nor- element plastids in Caryophyllales
dic J. Bot. 1: 345-355. (Centrospermae); evidence for the delimita-
Barthlott, W. (1984). Microstructural features of tion and classification of the order. Plant Syst.
seed surfaces. In V. H. Heywood and D. M. Evol. 126: 31-54.
Moore (Eds.). Current concepts in Plant Tax- Behnke, H. D. (1977). Transmission electron
onomy. Systematic Association special microscopy and systematics of flowering
Volume No. 25: 95-105. plants. In: K. Kubitzki. Flowering Plants- Evo-
Barthlott, W. and D. Froelich. (1983). lution and Classification of Higher Categories.
Mikromorphologie und Orientierungsmuster Plant Syst. Evol. Suppl. 1, 155-178.
epicuticularer Wachs-Kristalloide: Ein neues Behnke, H. D. (1997). Sarcobataceae- a new fam-
systematisches Merkmal bei Monocotylen. ily of Caryophyllales. Taxon 46: 495-507.
Pl. Syst. Evol. 142: 171-185. Behnke, H. D. and W. Barthlott (1983). New
Barthlott, W. and G. Voit. (1979). Mikromorpho- Evidence from the ultrastructural and mi-
logie der Samenschalen und Taxonomie der cromorphological fields in Angiosperm clas-
Cactaceae Ein raster-elektronem-microsco- sification. Nordic. J. Bot. 1: 341-460.
pischer uberblick. Pl. Syst. Evol. 132: 205-229. Belfod, H. S. and W. F. Thomson (1979). Single
Bate-Smith, E.C. (1958). Plant phenolics as copy DNA homologies and phylogeny of
taxonomic guides. Proc. Linn. Soc. Lond. 169: Atriplex. Carnegie Inst. Wash Year Book 78:
198-211. 217-223.
References 681
Belk, E. (1939). Studies in the anatomy and mor- Bordet, J. (1899). Sur lagglutination et la disso-
phology of the spikelet and flower of the lution des globules rouges par le serum
Gramineae. Thesis (Ph.D.). Cornell Univ. danimaux injectes de sang defibrin. Ann.
Bell, G. A. (1971). Comparative Biochemistry of Inst. Pasteur 13: 225-250.
non-protein amino acids. In: J. B. Harborne, Boulter, D. (1974). The use of amino acid
D. Boulter and B. L. Turner (Eds.) Chemotax- sequence data in the classification of higher
onomy of Leguminosae. Academic Press, Lon- plants. In: G. Bendz and J. Santesson (Eds.).
don, pp. 179-206. Chemistry and Botanical Classification, Nobel
Bensel, C.R. and B. F. Palser. (1975a). Floral Symposium, 25, pp. 211-216. Acad. Press,
anatomy in the Saxifragaceae sensu lato. II. London/New York.
Saxifragoideae and Iteoideae. Amer. J. Bot. Bramwell, D. (1972). Endemism in the Flora of
62: 661-675. Canary Islands. In D. H. Valentine (ed.) Tax-
Bensel, C.R. and B. F. Palser. (1975b). Floral onomy, Phytogeography and Evolution 141-159.
anatomy in the Saxifragaceae sensu lato. III. Academic Press, London.
Kirengeshomoideae, Hydrangeoideae and Bremer, B. and L. Struwe. (1992). Phylogeny of
Escallonioideae. Amer. J. Bot. 62: 676-687. the Rubiaceae and Loganiaceae: Congruence
Benson, L. (1957). Plant Classification. Oxford and or conflict between morphologican and mo-
IBH Co., New Delhi. lecular data? Amer. J. Bot. 79: 1171-1184.
Bentham, G. (1858). Handbook of British Flora. Bremer, B., K. Andreasen and D. Olsson. (1995).
(7th ed., revised by A. B. Rendle in 1930). Subfamilial and tribal relationships in the
Ashford, Kent. Rubiaceae based on rbcL sequence data. Ann.
Bentham, G. (1863-1878). Flora Australiensis. Missouri Bot. Gard. 82: 383-397.
London, 7 volumes. Bremer, B., R. K. Jansen, B. Oxelman,
Bentham, G. and J. D. Hooker (1862-83). Gen- M. Backlund, H. Lantz, and K. -J Kim. (1999).
era Plantarum. London, 3 vols. More characters or more taxa for a robust
Berry, P. E., V. Savolainen, K. J. Sytsma, J. C. phylogeny-case study from the coffee family
Hall, and M. W. Chase. (2001). Lissocarpa is (Rubiaceae). Syst. Bio. 48: 413-435.
sister to Diospyros (Ebenaceae). Kew Bull. Bremer, B., K. Bremer, N. Heidari, P. Erixon,
56: 725-729. A. A. Anderberg, R. G. Olmstead, M.
Bessey, C. E. (1915). Phylogenetic taxonomy of Kllersj, and E. Barkhordarian (2002).
flowering plants. Ann. Mo. Bot. Gard. Phylogenetics of asterids based on three
2: 109-164. coding and three non-coding chloroplast DNA
Bhandari, M. M. (1978). Flora of the Indian Desert. markers and the utility of non-coding DNA
Sc. Publ., Jodhpur. at higher taxonomic levels. Molecular
Bhattacharya, B. and B. M. Johri. 1998. Flower- Phylogenetics and and Evolution 24: 274-301.
ing Plants: Taxonomy and Phylogeny. Narosa Bremer, K. (2002). Gondwanan evolution of the
Publishing House, New Delhi. grass alliance of families (Poales). Evolution
Blackith, R. E. and R. A. Reyment. (1971). Multi- 56: 1374-1387
variate Morphometrics. Acad. Press, London. Bremer, K. and H. -E. Wanntorp. (1978). Phylo-
Blake, S. F. (1961). Geographical Guide to the Flo- genetic systematics in botany. Taxon 27:
ras of the World. Part II. Misc. Publ. 797. U. 317-329.
S. Dept. Agr., Washington, D. C. Bremer, K. and H. -E. Wanntorp. (1981). The cla-
Blake, S. F. and A. C. Atwood. (1941). Geographi- distic approach to plant classification. In
cal Guide to the Floras of the World. Part I. Advances in Cladistics, 1, V. A. Funk and D.
Misc. Publ. 401. U. S. Dept. Agr., Washing- R. Brroks (eds), 87-94, New York Botanical
ton, D. C. Garden, New York.
Blakeslee, A. F. , A. G. Avery, S. Satina and J. Bremer, K., A. Backlund, B. Sennblad,
Rietsama. (1959). The genus Datura. Ronald U. Swenson, K. Andreasen, M. Hjertson, J.
Press, New York. Lundberg, M. Backlund, and B. Bremer.
Bogler, D. J. and B. B. Simpson. (1996). Phylog- (2001). A phylogenetic analaysis of 100+ gen-
eny of Agavaceae based on ITS rDNA se- era and 50+ families of euasterids based on
quence variation. Amer. J. Bot. 83: 1225-1235. morphological and molecular data with notes
Bonnett, H. T. and E. H. Newcomb. (1965). Polyri- on possible higher level morphological
bosomes and cisternal accumulations in root synapomorphies. Plant Syst. Evol. 229:
cells of radish. J. Cell Biol. 27: 423-432. 137-169.
682 Plant Systematics
Brenner, G. H. and I. Bickoff. (1992). Palynology Caesalpino, A. (1583). De plantis libri. Florentiae.
and age of the Lower Cretaceous basal Cain, A. J. and G. A. Harrison. (1958). An analy-
Kurnub Group from the coastal plain to the sis of the taxonomists judgement of affin-
northern Negev of Israel. Palynology 16: 137- ity. Proc. Zool. Soc. Lond. 131: 85-98.
185. Cain, A. J. and G. A. Harrison. (1960). Phyletic
Brenner, G. J. (1963). Spores and Pollen of weighting. Proc. Zool. Soc. Lond. 135: 1-31.
Potomac Group of Maryland. Maryland Depart- Cameron, K. M. (2002). Intertribal relationships
ment of Geology, Mines, Water Resouces Bulle- within Orchidaceae as inferred from analy-
tin 27:1-215. ses of five plastid genes. P. 116, in Botany
Brenner, G. L. (1996). Evidence for the earliest 2002: Botany in the Curriculum, Abstracts.
stage of angiosperm pollen evolution. A [Madison, Wisconsin.].
paleoequatorial section from Israel. In: D. Cameron, K. M. . (2004). Utility of plastid psaB
W. Taylor and L. J. Hickey (Eds.) Flowering gene sequences for investigating intrafmilial
Plant Origin, Evolution and Phylogeny. relationships within Orchidaceae. Mol. Phyl.
Chapman & Hall Inc., New York, pp. 91-115. Evol. 31: 1157-1180.
Brown, R. (1827). Character and description of Cantino, P. D. (2000). Phylogenetic nomencla-
Kingia, a new genus of plants found on the ture: addressing some concerns. Taxon
southwest coast of New Holland with obser- 49: 85-93.
vations on the structure and its Carlquist, S. (1987). Presence of vessels in
unimpregnated ovulum on female flower of Sarcanda (Chloranthaceae); comments on
Cycadeae and Coniferae in P. P. Kings nar- vessel origin in angiosperms. Amer. J. Bot.
rative of a survey of Intertropical and westerns 64: 1765-1771.
coasts of Australia, performed between 1818 Carlquist, S. (1996). Wood anatomy of primitive
and 1822, p 534-565. John Murray, London. Angiosperms: New perspective and synthe-
Brown, N. E. (1920). New and old species of ses. In: D. W. Taylor and L. J. Hickey (Eds.)
Mesembranthemum, with critical notes. Journ. Flowering Plant Origin, Evolution and Phylog-
Linn. Soc. Bot. 45: 53-140. eny. Chapman & Hall Inc., New York, pp.
Brown, R. W. (1956). Palmlike plants from the 68-90.
Delores Formation (Triassic) in southwest- Carpenter, J. M. (2003). Crique of pure folly. Bot.
ern Colorado. U. S. Geological Survey Profes- Rev. 69(1): 79-92.
sional Paper 274: 205-209. Cataln, P, E. A. Kellogg and R. G. Olmstead.
Brunfels, O. (1530). Herbarium vivae eicones. (1997). Phylogeny of Poaceae subfamily
Argentorati, 3 tomes. Pooideae based on chloroplast ndhF gene
Bruneau, A., F. Forest, P. S. Herendeen, B. B. sequences. Mol. Phylog. Evol. 8: 150-166.
Klitgaard and G. P. Lewis. (2001). Phyloge- Cavalier-Smith, (1981). Eukaryotic kingdoms,
netic relationships in the Caesalpinioideae seven or nine? BioSystems 14: 461-481.
(Leguminosae) as inferred from chloroplast Cavalier-Smith, (1998). A revised six-kingdom
trnL intron sequences. Syst. Bot. 26: 487- system of life. Biol. Rev. 73: 203-266.
514. Cavalier-Smith, (2000).A revised six kingdom
Caddick, L. R. C. A. Furness, P. Wilkons and system of life. Biological Reviews.
M. W. Chase. (2000). Yams and their allies: Cavalier-Smith, . (2004). Only six kingdoms of
Systematics of Dioscoreales. Pp. 475-487, in life. Proceedings of the Royal Society B:
Wilson, K. L., & Morrison, D. A. (eds), Mono- Biological Sciences 271: 251-1262.
cots: Systematics and Evolution. CSIRO, Chamberlain, C. J. (1935). Gymnosperm structure
Collingwood. and evolution. University of Chicago Press,
Caddick, L. R. C. A. Furness, P. Wilkons, T. A. Chicago.
J. Hedderson and M. W. Chase (2002a). Chandra, S. and K. R. Surange. (1976). Cuticular
Phylogenetics of Dioscoreales based on com- studies of the reproductive organs of
bined analyses of morphological and molecu- Glossopteris, Part I: Dictyopteridium
lar data. Bot. J. Linnean Soc. 138: 123-144. feismanteli sp. Nov. attached on Glossopteris
Caddick, L. R. , P. Wilkin,P. J. Rudall, T. A. J. tenuinervis. Palaeontographia B156: 87-102.
Hedderson and M. W. Chase. (2002b). Yams Chandler, G. T, and G. M. Plunkett. (2003). The
reclassified: A recircumscription of phylogenetic placement and evolutionary sig-
Dioscoreaceae and Dioscoreales. Taxon 51: nificance of the polyphyletic subfamily
103-114. Hydrocotyloideae (Apiaceae). P. 75 in Botany
References 683
2003: Aquatic and Wetland Plants: Wet and Clark, P. J. (1952). An extension of the coeffi-
Wild. [Mobile, Alabama.] cient of divergence for use with multiple
Chandler, G. T, and G. M. Plunkett. (2004). Evo- characters. Copeia 2: 61-64.
lution in Apiales: Nuclear and chloroplast Clark, L. G., W. Zhang and J. F. Wendel. (1995).
markers together in (almost) perfect har- A phylogeny of grass family (Poaceae) based
mony. Botanical J. Linnean Soc.(cited in on ndhF sequence data. Syst. Bot. 20: 436-
APweb) 460.
Chapman, M. (1936). Carpel anatomy of Clark, L. G. & J. K. Triplett. (2006). Phylogeny of
Berberidaceae. Amer. J. Bot. 23: 340-348. the Bambusoideae (Poaceae): An update. P.
Chappill, J. A. (1994). Cladistic analysis of 212, in Botany 2006 - Looking to the Future,
Leguminosae. The development of an explicit Conserving the Past. [Abstracts: Botanical So-
hypothesis. In M. D. Crisp and J. J. Doyle ciety of America, etc.]
(Eds.) Advances in legume systematics, part Clifford, H. T. (1977). Quantitative studies of in-
7., 1-9. Royal Botanic Gardens, Kew. ter-relationships amongst the Liliatae. In:
Chase, M. W., D. E. Soltis, R. G. Olmstead et K. Kubitzki. Flowering Plants-Evolution and
al. (1993). Phylogenetics of seed plants: an Classification of Higher categories. Pl. Syst.
analysis of nucleotide sequences from the Evol. Suppl. 1, 77-95.
plastid gene rbcL. Ann. Missourie. Bot. Gdn. Colless, D. H. (1967). An examination of certain
80: 528-580. concepts in phenetic taxonomy. Syst. Zool.
Chase, M. W., M. R. Duvall, H. G. Hills, et al. 16: 6-27.
(1995a). Molecular systematics of Lilianae: Collett, H. (1921). Flora Simlensis, 2nd ed. Thacker,
In M. J. Rudall et al. (Eds.) Monocotyledons: Spink, Calcutta.
Systematics and Evolution, 109-137. Royal Constance, L. (1964). Systematic Botany- an
Botanic Gardens, Kew. unending synthesis. Taxon. 13: 257-273.
Chase, M. W. , D. W. Stevenson, P. Wilkin and Coode, M. J. E. (1967). Revision of Genus
P. Rudall. (1995b). Monocot systematics: A Valerianella in Turkey. Notes Roy. Bot. Gard.
combined analysis. In M. J. Rudall et al. Edinb. 27: 219-256.
(Eds.) Monocotyledons: Systematics and Evo- Copeland, H. F. (1938). The kingdoms of organ-
lution, 685-730. Royal Botanic Gardens, Kew. isms. Quart. Rev. Biol. 13: 383420.
Chase, M. W., D. E. Soltis, P. G. Rudall, M. F. Copeland, (1956). The Classification of Lower Or-
Fay, W. J. Hahn, S. Sullivan, J. Joseph, M. ganisms, Palo Alto: Pacific Books.
Molvray, P. J. Kores, T. J. Givnish, K. J. Core, E. L. (1955). Plant Taxonomy. Prentice-Hall,
Sytsma, and J. C. Pires. (2000). Higher level Englewood Cliffs.
systematics of monocotyledons: An assess- Corner, E. J. H. (1946). Centrifugal Stamens.
ment of current knowledge and a new clas- Journ. Arn. Arbor. 27: 423.
sification. In K. L. Wilson and D. A. Morrison Cornet, B. (1986). Reproductive structures and
(Eds.) Systematics and evolution of monocots. leaf venation of Late Triassic angiosperm,
Proceedings of the 2nd International monocot Sanmiguelia lewisii. Evol. Theory 7: 231-309.
symposium. Melbourne: CSIRO, 3-16. Cornet, B. (1989). Reproductive morphology and
Chase, M. W., S. Zmarzty, M. D. Lled, K. J. biology of Sanmiguelia lewisii and its bearing
Wurdack, S. M. Swensen, and M. F. Fay. on angiosperm evolution in Late Triassic.
(2002). When in doubt, put it in Evol. Trends Plants 3: 25-51.
Flacourtiaceae: A molecular phylogenetic Cornet, B. (1993). Dicot-like leaf and flowers from
analysis based on plastid rbcL DNA se- the Late Triassic tropical Newark Supergroup
quences. Kew Bull. 57: 141-181. rift zone, U. S. A. Modern Geol. 19: 81-99.
Chatton, E. 1937. Titres et travaux scientifiques, Cornet, B. (1996). A New Gnetophyte from the
Sette, Sottano, Italy. Late Carnian (Late Triassic) of Texas and its
Cheadle, V.I. (1953). Independent origin of ves- bearing on the origin of the angiosperm car-
sels in the monocotyledons and dicotyle- pel and stamen. In: D. W. Taylor and L. J.
dons. Phytomorphology 3: 23-44. Hickey (Eds.) Flowering Plant Origin, Evolu-
Chen, Z.-D., S. R. Manchester, & H. -Y. Sun. tion and Phylogeny. Chapman & Hall Inc.,
(1999). Phylogeny and evolution of New York, . pp. 32-67.
Betulaceae as inferred from DNA sequences, Couper, R. A. (1958). British Mesozoic
morphology, and paleobotany. Amer. J. Bot. microspores and pollen grains. Palaeonto-
86: 1168-1181. graphica, Abt. B, 103: 75-179.
684 Plant Systematics
Crane, P. R., E. M. Friis and K. R. Pedersen. Dahlgren, G. (1991). Steps towards a natural
(1995). The origin and early diversification system of the dicotyledons: embryological
of angiosperms. Nature 374: 27-33. characters. Aliso 13 (1): 107-165.
Crawford, D. J. and E. A. Julian. (1976). Seed Dahlgren, R. (1975). A system of classification
protein profiles in the narrow-leaved species of angiosperms to be used to demonstrate
of Chenopodium of the Western United the distribution of characters. Bot. Notiser
States: Taxonomic value and comparison 128: 119-147.
with distribution of flavonoid compounds. Dahlgren, R. (1977). Commentary on a Diagram-
Am. J. Bot. 63: 302-308. matic Presentation of the Angiosperms. In:
Crepet, W. L. (1974). Investigations of North K. Kubitzki (ed.). Flowering Plants: Evolution
American Cycadeoides. The Reproductive bi- and Classification of Higher Categories. Plant
ology of Cycadeoidea Palaeontographia 148: Systematics and Evolution Suppl. 1.
144-169. Springer-Verlag Wien/New York, pp. 253-283.
Crepet, W. L., K. C. Nixon & M. A. Gandolfo. Dahlgren, R. (1980). A revised system of classi-
(2004). Fossil evidence and phylogeny: The fication of angiosperms. Bot. J. Linn. Soc. 80:
age of major angiosperm clades based on 91-124.
mesofossil and macrofossil evidence from Dahlgren, R. (1983). General aspects of an-
Cretaceous deposits. American J. Bot. 91: giosperm evolution and macrosystematics.
1666-1682 Nordic. J. Bot. 3: 119-149
Cronquist, A. (1968). Evolution and Classification Dahlgren, R. and F. N. Rasmussen. (1983). Mono-
of Flowering Plants. Houghton Mifflin, New cotyledon evolution: characters and phyloge-
York. netic estimation. Evol. Biol. 16: 255-395.
Cronquist, A. (1977). On the taxonomic signifi- Dahlgren, R., H. T. Clifford and P. F. Yeo (1985).
cance of secondary metabolites in An- The Families of Monocotyledons. Springer-
giosperms. Plant Syst. Evol., Suppl. 1: 179- Verlag, Berlin.
189. Dahlgren, R., S. Rosendal-Jensen and B. J.
Cronquist, A. (1981). An Integrated System of Clas- Nielsen (1981). A revised classification of
sification of Angiosperms.Columbia Univ. the angiosperms with comments on the cor-
Press, New York. relation between chemical and other char-
Cronquist, A. (1988). Evolution and Classification acters, In: D. A. Young and D. S. Seigler
of Flowering Plants. (2nd ed.). New York Bo- (Eds.). Phytochemistry and Angiosperm
tanical Garden, Bronx, New York. Phylogeny. Praeger, New York, pp. 149-199.
Cronquist, A., A. L. Takhtajan and W. Dahlgren, R. in cooperation with B. Hansen,
Zimmerman (1966). On the higher taxa of K. Jakobsen and K. Larsen. (1974). Angiosper-
Embryobionta. Taxon 15: 129-134. mernes taxonomi, 1. (2 & 3 in 1975, 4 in 1976).
Cunoud, P. (2002). Introduction to expanded In Danish. Kobenhsvn: Akademisk Forlag.
Caryophyllales. pp. 1-4, in Kubitzki, K. (ed.), Darlington, C. D. and A. P. Wylie (1955). Chro-
The Families and Genera of Vascular Plants. mosome Altas of Flowering Plants. Allen and
IV. Flowering Plants. Dicotyledons. Malvales, Unwin, London.
Capparales and Non-betalain Caryophyllales. Darlington, C. D. and E. K. Janaki-Ammal.
Springer, Berlin. (1945). Chromosome Atlas of Cultivated Plants.
Cunoud, P, V. Savolainen, L. W. Chatrou, M. Allen and Unwin, London.
Powell, R. J. Grayer, & M. W. Chase. (2002). Darwin, C. (1859). The Origin of Species. London.
Molecular phylogenetics of Caryophyllales Daugherty, L. H. (1941). The Upper Triassic Flora
based on nuclear 18S rDNA and plastid rbcL, of Arizona with a Discussion on its Geological
atpB, and matK DNA sequences. American J. Occurrence. Contributions to Paleontology
Bot. 89: 132-144. 526, Carnegie Institution of Washington.
Dahlgren, G. (1989). An updated angiosperm Davis, J. I., and R. Soreng. (1993). Phylogenetic
classification. Bot. J. Linn. Soc. 100: 197-203. structure in grass family (Poaceae) as in-
Dahlgren, G. (1989). The last Dahlgrenogram. ferred from chloroplast DNA restriction site
System of classification of dicotyledons, pp. variation. Am. J. Bot. 80: 1444-1454.
249-260. In: K. Tan [ed.]. The Davis and Hedge Davis, P. H. (1960). Materials for the Flora of
Festschrift. Edinburgh Univ. Press, Turkey. IV. Ranunculaceae, II. Notes Roy.
Edinburgh, pp. 249-260. Bot. Gard. Edinburgh, 23: 103-161.
References 685
Davis, P. H. and V. H. Heywood. (1963). Principles lution within the apioid superclade. Canad.
of Angiosperm Taxonomy. Oliver and Boyd, J. Bot. 78: 506-528.
London. Doyle, J. A. (1969). Cretaceous angiosperm pol-
de Candolle, A. P. (1813). Theorie elementaire de len of Atlantic Coastal Plain and its evolu-
la botanique. Paris. tionary significance. J. Arnold Arboretum. 50:
de Candolle, A. P. (1824-73). Prodromus systematis 1-35.
naturalis regni vegetabilis. Paris, 17 vols. Doyle, J. A. (1978). Origin of angiosperms. Ann.
de Jussieu, A. L. (1789). Genera plantarum. Paris. Rev. Ecol. Systematics. 9: 365-392.
de Queiroz, K. and J. Gauthier. (1990). Phyloge- Doyle, J. A. (2001). Significance of molecular
netic taxonomy. Ann. Rev. Ecol. Syst. 23: 449- phylogenetic analyses for paleobotanical in-
480. vestigations on the origin of angiosperms.
de Queiroz, K. and J. Gauthier. (1992). Phylog- Palaeobotanist 50: 167-188.
eny as central principle in taxonomy: Phylo- Doyle, J. A. and Donoghue. (1987). The origin of
genetic definitions of taxon names. Syst. angiosperms: a cladistic approach. In: E. M.
Zool. 39: 307-322. Friis, W. G. Chaloner and P. R. Crane (Eds.).
de Soo, C. R. (1975). A review of new classifica- The Origins of Angiosperms and Their Biologi-
tion system of flowering plants cal Consequences. Cambridge University
(Angiospermatophyta, Magnoliophytina). Press, U. K, pp. 17-49.
Taxon 24(5/6): 585-592. Doyle, J. A. and Donoghue. (1993). Phylogenies
Delavoryas. (1971). Biotic provinces and the Ju- and angiosperm diversification. Paleobiology
rassic-Cretaceous floral transition. Proc. N. 19: 141-167.
Aer. Paleontol. L: 1660-1674. Doyle, J. A., M. Van Campo and B. Lugardon.
Dilcher, D. L. (1979). Early angiosperm repro- (1975). Observations on exine structure of
ductions: An introductory report. Rev. Eucommiidites and Lower Cretaceous an-
Palaeobot. Palynol. 27: 291-328. giosperm pollen. Pollen and Spores 17: 429-
Dilcher, D. L. and P. L. Crane. (1984). An early 486.
Angiosperm from the Western Interior of Doyle, J. A. and P. K. Endress. (2000). Morpho-
North America. Ann. Missouri Bot. Gard. 71: logical phylogenetic analysis of basal an-
380-388 giosperms: comparison and combination
Donoghue, M. J. and J. A. Doyle. (1989). Phylo- with molecular data. International Journal of
genetic analysis of angiosperms and the re- Plant Sciences. 161 (6 suppl.): S121-S153.
lationships Hamamelidae. In: Pr. R. Crane Doyle, J. A., H. Sauquet, T. Scharaschkin & A.
and S. Blackmore (Eds.). Evolution, Systemat- Le Thomas. (2004). Phylogeny, molecular and
ics and Fossil History of the Hamamelidae. fossil dating, and biogeographic history of
Claredon Press, Oxford, pp. 17-45. Annonaceae and Myristicaceae (Magnoliales).
Donoghue, M. J., T. Eriksson, P. A.Reeves and Int. J. Plant Sci. 165(4 Suppl.): S55-S67.
R. G. Olmstead. (2001). Phylogeny and phy- Doyle, J. J. (1994). Phylogeny of legume family:
logenetic taxonomy of Dipsacales, with spe- An approach to understanding the origins of
cial reference to Sinadoxa and Tetradoxa nodulation. Ann. Rev. Ecol. Syst. 25: 325-349.
(Adoxaceae). Harvard Papers Bot. 6: 459-479. Doyle, J. J., J. A. Chappill, C. D. Bailey and T.
Doweld, A. B. (2001). Tentamen Systematis Kajita. (2000). Towards a comprehensive
Plantarum Vascularium (Tracheophytorum). Mos- phylogeny of legumes: Evidence from rbcL
cow: GEOS. sequences and non-molecular data. Pp. 1-
Downie, S, R., D. S. Katz-Downie, and M. F. 20, in Herendeen, P. S., & Bruneau, A. (eds),
Watson, (2000a). A phylogeny of the flower- Advances in Legume Systematics, Part 9. Royal
ing plant family Apiaceae based on chloro- Botanic Gardens, Kew.
plast rpl16 and rpoC1 sequences: Towards a Downie, S. R. , D. S. Katz-Downie and M. F.
suprageneric classification of subfamily Watson. (2000). A phylogeny of the flowering
Apioideae. Amer. J. Bot. 87: 273-292. plant family Apiaceae based on chloroplast
Downie, S. R., M. F. Watson, K. Spalik and D. S. rpl16 and rpoC1 sequences: Towards a
Katz-Downie. (2000b). Molecular systemat- suprageneric classification of subfamily
ics of Old World Apioideae (Apiaceae): Rela- Apioideae. American J. Bot. 87: 273-292.
tionships among some members of tribe Du Rietz. (1930). Fundamental units of biologi-
Peucedaneae sensu lato, the placement of cal taxonomy. Svensk bot. Tidskr. 24: 333-
several island-endemic species, and reso- 428.
686 Plant Systematics
Duangjai, S., B. Wallnoeffer, R. Samuel, F. Engler, A. and Diels, L. (1936). Syllabus der
Munzinger and M. W. Chase, M. W. (2006a). pflanzenfamilien. 11th ed. Berlin.
Phylogenetic relationships and infrafamilial Engler, A. and Prantl, K. (1887-1915). Die
classification of Ebenaceae s.l. based on six naturlichen pflanzenfamilien. Leipzig, 23 vols.
plastid markers. Pp. 218-219, in Botany 2006 Erbar, C., S. Kusma and P. Leins. (1999). De-
- Looking to the Future - Conserving the Past. velopment and interpretation of nectary or-
[Abstracts: Botanical Society of America, etc.] gans in Ranunculaceae. Flora 194: 317-332.
Duangjai, S., B. Wallnoeffer, R. Samuel, F. Erdtman, G. (1948). Did dicotyledonous plants
Munzinger and M. W. Chase, M. W. (2006b). exist in Early Jurrassic time? Geol. Fren.
Generic delimitation and relationships in Stockholm Frh. 70: 265-271.
Ebenaceae sensu lato: Evidence from six Erdtman, G. (1966). Pollen Morphology and Plant
plastid DNA regions. American J. Bot. 93: Taxonomy. Angiosperms. (An Introduction to
1808-1827. Palynology. I.). Hafner Publ. Co., London.
Dykes, W. R. (1913). The Genus Iris. Evans, R. C. and T. A. Dickinson. (2002). How do
Eames, A. J. (1961). Morphology of Angiosperms. studies of comparative ontogeny and mor-
McGraw-Hill Book Co., New York. phology aid in elucidation of relationships
Eckenwalder, J. E. (1976). Re-evaluation of within the Rosaceae? P. 108, in Botany 2002:
Cupressaceae and Taxodiaceae: A proposed Botany in the Curriculum, Abstracts. [Madi-
merger. Madroo 23: 237-256. son, Wisconsin.]
Ehrendorfer, F. (1968). Geographical and ecologi- Evans, R. C., C. Campbell, D. Potter, D. Mor-
cal aspects of infraspecific diiferentiation . gan, T. Eriksson, L. Alice, S. -H Oh, E. Bortiri,
In: V. H. Heywood (ed.). Modern Methods in F. Gao, J. Smedmark and M. Arsenault.
Plant Taxonomy Acad. Press, New York, pp. (2002a). A Rosaceae phylogeny. P. 108, in
261-296. Botany 2002: Botany in the Curriculum, Ab-
Ehrendorfer, F. (1983). Summary Statement. stracts. [Madison, Wisconsin.]
Nord. J. Bot. 3: 151-155. Evans, R. C., T. A. Dickinson, T. A., and C.
Eichler, A. W. (1883). Syllabus der Vorlesungen Campbell. (2002b). The origin of the apple
ber Specielle und Medicinisch-Pharmaceutische subfamily (Maloideae; Rosaceae) is clarified
Botanik. Leipzig. by DNA sequence data from duplicated
Endress, M. E., B. Sennblad, S. Nilsson, L. GBSSI genes. American J. Bot. 89: 1478-1484.
Civeyrel, M. W. Chase, S. Huysmans, E. Fairbrothers, D. E. (1983). Evidence from nucleic
Grafrm and B. Bremer. (1996). A phylogenetic acid and protein chemistry, in particular se-
analysis of of Apocynaceae s. str. And some rology, in angiosperm classification. Nordic.
related taxa in Gentianales: A multidis- J. Bot. 3: 35-41.
ciplinary approach Opera Bot. Belg. 7: 59-102. Farjon, A. (2005). A Monograph of Cupressaceae
Endress, P. K. (1977). Evolutionary Tends in and Sciadopitys. Royal Botanic Gardens, Kew.
Hamamelidales-Fagales-Group. In H. Fan, C. and Q.-Y. Xiang. (2003). Phylogenetic
Kubitzki, Flowering Plants: Evolution and clas- analyses of Cornales based on 26S rRNA and
sification of higher categories. Plant. Syst. Evol. combined 26S rDNA-MATK-RBCL sequence
Suppl. 1, 321-347. data. American J. Botany 90: 1357-1372.
Engler, A. (1892). Syllabus der Pflanzenfamilien. Farr, E. R., J. A. Leussink and F. A. Stafleu (Eds.).
Berlin. (1979). Index Nominum Genericorum (Plantarum).
Engler, A. (ed.). (1900-1953). Das Pflanzenreich. Regnum Veg. 100-102: 1-1896.
Regni vegetabilis conspectus Im Auftrage der Farr, E. R., J. A. Leussink and G. Zijlstra (Eds.).
Preus. Akademie der Wissenschaften, (1986). Index Nominum Genericorum (Plantarum)
Leransgegeben von A. Engler, Berlin. (after Supplementum I. Regnum Veg. 113: 1-126.
Englers death subsequent volumes, continu- Fassett, N. C. (1957). A Manual of Aquatic Plants.
ing upto 1953 were edited by other authors) Univ. Wisconin Press, Madison.
Engler, A. (H. Melchior and E. Werdermann, Faust, W. Z. and S. B. Jones. (1973). The sys-
Eds.). (1954). Syllabus der pflanzen- tematic value of trichome complements in a
familien.12th ed., vol. 1. Gebruder Borntraeger, North American Group of Vernonia
Berlin. (Compositae). Rhodora 75: 517-528.
Engler, A. (H. Melchior, ed.). (1964). Syllabus der Fay, M. F., P. J. Rudall, S. Sullivan, K. L. Stobart,
pflanzenfamilien.12th ed., vol. 2. Gebruder A. Y. de Bruijn, G. Reeves, M. Qamaruz-
Borntraeger, Berlin. Zaman, W.-P. Hong, J. Joseph, W. J. Hahn,
References 687
J. G. Conran, and M. W. Chase. (2000). Phy- Sarcopus abberans Gagnepain. Bull. Soc. Bot.
logenetic studies of Asparagales based on Fr. 94: 182-185.
four plastid DNA regions. Pp. 360-371, in Garcke, A. (1972). Illustrierte Flore von
K. L. Wilson and D. A. Morrison (Eds.), Deutschland und Angrenzende Gebiete,
Monocots: Systematics and Evolution. CSIRO, 23rd ed. (revised by K. von Weihe ed.). Parey,
Collingwood. Berlin.
Fay, M. F., B. Bremer, G. T. Prance, M. van der Garnock-Jones, P. J. and C. J. Webb. (1996). The
Bank, D. Bridson and M. W. Chase. (2000a). requirement to cite authors of plant names
Plastid rbcL sequence data show Dialypeta- in botanical journals. Taxon, 45: 285-286.
lanthus to be member of Rubiaceae. Kew Gaussen, H. (1946). Les Gymnosperms actuelles
Bull. 55: 853-864. et fossiles. Pt. 3. Travaux du Laboratoire
Federov, A. A. (ed.). (1969). Chromosome Numbers Forestier, Toulouse.
of Flowering Plants. Akad. Nauk SSSR, Gershenzon, J. and T. J. Mabry. (1983). Second-
Leningrad. ary metabolites and the higher classification
Fiori, A. and G. Paoletti. (1896). Flora analitica of angiosperms. Nordic J. Bot. 3: 5-34.
dItalia 1: 1-256. Padova. Geuten, K. E. Smets, P. Schols, Y. -M. Yuan, S.
Fishbein, M., C. Hibsch-Jetter, D. E. Soltis and Janssens, P. Kpfer, and N. Pyck. (2004).
L. Hufford. (2001). Phylogeny of Saxifragales Conflicting phylogenies of balsaminoid fami-
(Angiosperms, Eudicots): Analysis of a rapid, lies and the polytomy in Ericales: Combin-
ancient radiation. Syst. Biol. 50: 817-847. ing data in a Bayesian framework. Mol. Phyl.
Fisher, M. J. (1928). Morphology and anatomy of Evol. 31: 711-729.
flowers of Salicaceae. I. Amer. J. Bot. 15: 307- Geuten, K., A. Becker, K. Kaufmann, P. Caris,
326. S. Janssens, T. Viaene, G. Theien and E.
Fisher, R. A. (1930). Genetical Theory of Natural Smets. (2006). Petaloidy and petal identity
Selection. Oxford: Claredon Press. MADS-box genes in the balsaminoid genera
Fischer, E. (2004). Balsaminaceae. Pp. 20-25, in Impatiens and Marcgravia. Plant J. 47: 501-518.
Kubitzki, K. (ed.), The Families and Genera of Gifford, E. M. and A. S. Foster. (1988). Morphol-
Vascular Plants. VI. Flowering Plants. Dicoty- ogy and evolution of vascular plants, 3rd ed.
ledons. Ceslastrales, Oxalidales, Rosales, W. H. Freeman, New York.
Cornales, Ericales. Springer, Berlin. Gleason, H. A. (1963). The New Britton and Brown
Ford, B. A., M. Iranpour,R. F. C. Naczi, J. R. Starr Illustrated Flora. 3 Vols. Hafner, New York.
& C. A. Jerome. (2006). Phylogeny of Carex Gornall, R. J. 1989. Anatomical evidence and the
subg. Vignea (Cyperaceae) based on non- taxonomic position of Darmera (Saxifra-
coding nrDNA sequence data. Syst. Bot. 31: gaceae). Bot. J. Linnean Soc. 100: 173-182.
70-82. Gottsberger, G. (1974). Structure and function
Freudenstein, J. V, and M. W. Chase. (2001). of primitive angiosperm flower-A Discussion.
Analysis of mitochondrial nad1b-c intron se- Acta Bot. Neerl. 23: 461-471.
quences in Orchidaceae: Utility and coding Gower, J. C. (1966). Some distance properties of
of length-change characters. Syst. Bot. 26: latent root and vector methods used in mul-
643-657. tivariate analysis. Biometrika 53: 325-338.
Friedrich, H. C. (1956). Studien ber die Graham, S. W. and R. G. Olmstead. (2000a).
natrliche verwandtschaft der Plumbaginales Evolutionary significance of an unusual
und Centrospermae. Phyton (Austria) 6: 220- chloroplast DNA inversion found in two basal
263. angiosperm lineages. Curr. Genet. 37:
Frodin, D. G. (1984). Guide to the Standard Floras 183-188.
of the World. Cambridge Univ. Press. Graham, S. W. and R. G. Olmstead. (2000b).
Frost, F. H. (1930). Specialization in secondary Utility of 17 chloroplast genes for inferring
xylem in dicotyledons. I. Origin of vessels. the phylogeny of the basal angiosperms.
Botanical Gazette 89: 67-94. American J. Bot. 87: 1712-1730.
Fuse, S. and M. N. Tamura. (2000). A phyloge- Grant, V. (1957). The plant species in theory
netic analysis of the plastid matK gene with and practice. In: E. Mayr (Ed.). The Species
emphasis on Melanthiaceae sensu lato. Plant Problem. Amer. Assoc. Adv. Sci. Washington,
Biology 2: 415-427. D. C., pp. 39-80.
Gagnepain, F. And Boureau. (1947). Nouvelles Grant, V. (1981). Plant Speciation (2nd ed.).
considerations systmatische propos du Columbia Univ. Press, New York.
688 Plant Systematics
Grayum, M. (1987). A summary of evidence and Harris, T. M. (1932). The fossil flora of Scorseby
arguments supporting the removal of Acorus Sound East Greenland. Part 3: Caytoniales
from Araceae. Taxon 36: 723-729. and Bennettitales. Meddelelser om Grnland
Gregory, W. C. (1941). Phylogenetic and cytologi- 85(5): 1-133.
cal studies in the Ranunculaceae. Trans. Am. Hart, J. A. (1987). A cladistic analysis of
Phil. Soc. 3: 443-520. conifers: Preliminary results. J. Arnold
Greuter, W., D. L. Hawksworth, J. Mcneill, Arbor. 68: 269-307.
M. A. Mayo, A. Minelli, P. H. A. Sneath, B. J. Hartl, D. L. and E. W. Jones. (1998). Genetics:
Tindall, P. Trehane, and P. Tubbs. (1998). Principles and Analysis. 4th ed. Jone and
Draft BioCode (1997): the prospective inter- Bartlett Publishers, London.
national rules for the scientific names of Hartmann, H. E. K. (1993). Aizoaceae. In: K.
organisms. Taxon 47: 127-150. Kubitzki, J. G. Rohwer and V. Bittrich (Ed.)
Greuter, W., J. Mcneill, F. R. Barrie, H. M. The Families and Genera of vascular plants,
Burdet, V. Demoulin, T. S. Filgueiras, D. H. Vol. 2, Magnoliid, Hamamelid and Caryophy-
Nicolson, P. C. Silva, J. E. Skog, P. Trehane, llid families, p 37-69. Springer-Verlag, Berlin.
N. J. Turland and D. L. Hawksworth (editors Haszprunar, G. (1987). Vetigastropoda and sys-
& compilers). (2000). International code of tematics of Streptpneuros Gastropoda (Mol-
botanical nomenclature (St Louis Code) lusca). Journal of Zoology 211: 747-770.
adopted by the Sixteenth International Bo- Hawksworth, D.L. (1995). Steps along the road
tanical Congress St. Louis, Missouri, July - to a harmonized bionomenclature. Taxon, 44:
August 1999. Regnum Veg. Vol 138. 447-456.
Greuter, W., R.K. Brummitt, E. Farr, N. Kilian, Hedge, I. C. and J. M. Lamond. (1972).
P. M.Kirk and P.C. Silva. (1993). Names in Umbelliferae. Multi-access key to the Turk-
current use for extant plant genera. Koeltz, ish genera. In: P. H. Davis (ed.). Flora of Tur-
Knigstein, Germany. xxvii + 1464 pp. Regnum key. Edinburgh Univ. Press, Edinburgh, vol.
veg. Vol. 129. 4, pp. 171-177.
Gunderson, A. (1939). Flower buds and phylog- Hedrn, M., M. W. Chase, and R. G. Olmstead.
eny of dicotyledons. Bull. Torrey Bot. Club (1995). Relationships in the Acanthaceae and
66: 287-295. related families as suggested by cladistic
Gustafsson, M. H. G. (2002). Phylogeny of analysis of rbcL nucleotide sequences. Plant
Clusiaceae based on rbcL sequences. Int. Syst. Evol. 194: 93-109.
J. Plant Sci. 163(6): 1045-1054. Hegi, G. (1906-1931). Illustrierte Flora Von
Haeckel, E. 1866. Generelle Morphologie der Mitteleuropa. Ed. I, Munchen.
Organismen. Reimer, Berlin. Heimerl, A. (1934). Nyctaginaceae in Engler and
Haeckel, E. (1887). Echte Grser. Engler and Prantl Prantl, Die naturlichen pflanzenfamilien,
Die natrlichen Pflanzenfamilien, II, 2. ed. 2, Bd. 16c, 86-134.
Hahn, W. J. 2002. A molecular phylogenetic study Henderson, D. M. (1983). International Directory
of the Palmae (Arecaceae) based on atpB, rbcL of Botanical Gardens IV. Koeltz, Koenigstein.
and 18s nrDNA sequences. Syst. Biol. 51: Hennig, W. (1950). Grundzge einer Theorie der
92-112. phylogenetischen Systematik. Deutscher
Hall, D. W. (1981). Microwave: a method to con- Zentralverlag, Berlin.
trol herbarium insects. Taxon, 30: 818-819. Hennig, W. (1957). Systematik und Phylogenese.
Hanelt, P. and J. Schultze-Motel. (1983). Pro- Ber. Hundertjahrfeier Deutsch. Entomol. Ges.,
posal (715) to conserve Triticum aestivum L. pp. 50-70.
(1753) against Triticum hybernum L. (1753) Hennig, W. (1966). Phylogenetic Systematics.
(Gramineae). Taxon 32: 492-498. Translated by D. D. Davies and R. Zangerl.
Hansen, A. (1920). Die Pflanzendecke der Erde. Univ. Illinois Press, Urbana.
Leipzig. Hermsen, E. J., T. N. Taylor, E. L. Taylor and
Harborne, J. B. and B. L. Turner. (1984). Plant D. W. Stevenson. (2006). Cataphylls of the
Chemosystematics. Acad. Press, London. Middle Triassic cycad Antarcticycas schopfii
Harris, J. G. and M. W. Harris. (1994). Plant and new insights into cycad evolution. Ameri-
identification terminology: An illustrated glos- can J. Bot. 93: 724-738.
sary. Spring Lake, Publishing, Spring Lake, Heslop-Harrison, J. (1952). A reconsideration of
UT. plant teratology. Phyton 4: 19-34.
References 689
Heslop-Harrison, J. (1958). The unisexual flower- Pooideae (Poaceae) based on nuclear rDNA
a reply to criticism. Phytomorphology 8: 177- (ITS) sequences. Theor. Appl. Genet. 90: 389-
184. 398.
Heywood, V. H. (ed.). 1978. Flowering Plants of Huber, H. (1991). Angiospermen. Leitfaden durch
the World. Oxford University Press, London. die Ordnungen und Familien der Bedektsamer.
Hibbett, D. and M. J. Donoghue. (1998). Inte- Gustav Fischer, Stuttgart.
grating phylogenetic analysis and classifica- Hughes, N. F. (1961). Further interpretation of
tion in fungi. Mycologia 90: 347-356. Eucommiidites Erdtman, 1948. Palaeontology
Hickey, L. J and D. W. Taylor. (1996). Origin of 4: 292-299.
angiosperm flower. In: D. W. Taylor and L. J. Hufford, L. (1997). A phylogenetic analysis of
Hickey (Eds.) Flowering Plant Origin, Evolu- Hydrangeaceae based on morphological data.
tion and Phylogeny. Chapman & Hall Inc., Int. J. Plant Sci. 158: 652-672.
New York, pp. 176-231. Hufford, L. (2001). Ontogeny and morphology of
Hickey, L. J. and D. W. Taylor. (1992). the fertile flowers of Hydrangea and allied
Paleobiology of early angiosperms: evidence genera of tribe Hydrangeeae
from sedimentological associations in Early (Hydrangeaceae). Bot. J. Linn. Soc. 137: 139-
Cretaceous Potomac Group of eastern U. S. 187.
A. Paleontological Soc. Spec. Publ. 6: 128. Hutchinson, J and J. M. Dalzeil. (1927-1929).
Hickey, L. J. and J. A. Doyle. (1977). Early Cre- Flora of West Tropical Africa. London, 2 vols.
taceous fossil evidence for angiosperm evo- Hutchinson, J. (1946). A Botanist in South Africa.
lution. Bot. Rev. 43: 1-104 London.
Hill, S. R. (1983). Microwave and the herbarium Hutchinson, J. (1948). British Flowering Plants.
specimens: potential dangers. Taxon 32: 614- London.
615. Hutchinson, J. (1964-67). The Genera of Flower-
Hilu, K. , T. Borsch, K. Muller, D. E. Soltis, P. S. ing Plants. Claredon, Oxford, 2 vols.
Soltis, V. Savolainen, M. W. Chase, M. P. Hutchinson, J. (1968). Key to the Families of Flow-
Powell, L. A. Alice, R. Evans, H. Sauquet, C. ering Plants of the World. Clarendon, Oxford,
Neinhuis, T. A. B. Slotta, J. G. Rohwer, C. 117 pp.
S. Campbell, and L. W. Chatrou. (2003). An- Hutchinson, J. (1969). Evolution and Phylogeny
giosperm phylogeny based on matK sequence of Flowering Plants. Acad. Press, London.
information. American J. Bot. 90: 1758-1766. Hutchinson, J. (1973). The Families of Flowering
Hjelmquist, H. (1948). Studies on the floral mor- Plants. (3rd ed.). Oxford Univ. Press. (2nd ed.
phology and phylogeny of the Amentiferae. 1959; Ist ed. 1926, 1934)
Bot. Notiser, Suppl. 2: 1-171. Index Kewensis plantarum phanerogamarum. (1893-
Holmgren, P. K., N. H. Holmgren and L. C. 95), 2 vols. Oxford. 16 supplements up to
Barnett. (1990). Index herbariorum. Part I: 1971.
The Herbaria of the World (8th ed.). Regnum Jaccard, P. (1908). Nouvelles recherches sur la
Veg.120. distribution florale. Bull. Soc. Vaud. Sci. Nat.
Hooker, J. D. (1870). Students Flora of British 44: 223-270.
Isles. Macmillan and Co., London. (3rd ed. Janesen, R. K. and J. D. Palmer. (1987). A chlo-
in 1884). roplast DNA inversionmarks an ancient evo-
Hooker, J. D. (1872-97). Flora of British India.. L. lutionary split in sunflower family
Reeve and Co., London, 7 vols. (Asteraceae). Proc. Nat. Acad. Sc., USA 84:
Hoot, S. B. (1995). Phylogeny of Ranunculaceae 5818-5822.
based on epidermal preliminary atpB, rbcL Janssens, S., K. Geuten, Y. M. Yuan, Y. Song,
and 18S nuclear ribosomal DNAsequence P. Kpfer and E. Smets. (2006). Phylogenetics
data. Plant Syst. Evol. Suppl. 9: 241-251. of Impatiens and Hydrocera (Balsaminaceae)
Hoot, S. B., J. W. Kadereit, F. R. Blattner, K.B. using chloroplast atpB-rbcL spacer
Jork, A. E. Schwarzbach and P. R. Crane. sequences. Syst. Bot. 31: 171-180.
(1998). Data congruence and phylogeny of Jardine, N. and R. Sibson. (1971). Mathematical
the Papaveraceae s.l. based on four data Taxonomy. Wiley, London.
sets: atpB and rbcL sequences, trnK restric- Ji, Q., L. M. Bowe, Y. Liu, & D. W. Taylor. (2004).
tion sites, and morphological characters. Early Cretaceous Archaefructus eoflora sp.
Syst. Bot. 22: 575-590. nov., with bisexual flowers from Beipiao,
Hsiao, C. , N. J. Chatterton, K. H. Asay and K. Western Liaoning, China. Acta Geol. Sinica 78:
B. Jensen. (1994). Molecular phylogeny of 883-896.
690 Plant Systematics
Johnson, B. L. (1972). Seed protein profiles and Keating, R. C. (2004b). Systematic occurrence
the origin of the hexaploid wheats. Amer. J. of raphide crystals in Araceae. Ann. Missouri
Bot. 59: 952-960. Bot. Gard. 91: 495-504.
Johnson, L. A. S. (1959). The Families of Cycads Keller, R. (1996). Identification of tropical woody
and Zamiaceae of Australia. Proc. Linn. Soc. plants in the absence of flowers and fruits: A
84: 64-117. field guide. Birkauser, Basel.
Johnson, L. A. S. and K. L. Wilson. (1993). Keller, R. A., R. N. Boyd & Q. D. Wheeler. (2003).
Casuarinaceae. Pp. 237-242, in Kubitzki, K., Illogical basis of Phylogenetic nomenclature.
Rohwer, J. G. and V. Bittrich. (eds), The Fami- Bot. Rev. 69(1): 93-110.
lies and Genera of Vascular Plants. II. Flower- Kellogg, E. A. 2000. The grasses: A case study in
ing Plants: Dicotyledons, Magnoliid, Hamamelid macroevolution. Ann. Rev. Ecol. Syst. 31: 217-
and Caryophyllid Families. Springer, Berlin. 38.
Jones, S. B. Jr. and A. E. Luchsinger. (1986). Kergulen, M. (1980). Proposal (68) on article 57.2
Plant Systematics, 2nd ed. McGraw-Hill Book to correct the Triticum example. Taxon 29:
Co., New York. 516-517.
Jordan, A. (1873). Remarques sur le fait de Kimura, M. (1968). Evolutionary rate at the mo-
lexistence en socit ltat sauvage des lecular level. Nature 217: 624626.
espces vgtales affines. Bull. Ass. Fr. Kimura, M. (1983). The Neutral Theory of Molecu-
Avanc. Sci. 2, session Lyon. lar Evolution. Cambridge University Press,
Judd, W. S., C. S. Cambell, E. A. Kellogg, P. F. Cambridge.
Stevens and M. J. Donoghue. (2002). Plant Klak, C., A. Khunou, G. Reeves, and T. A. J.
Systematics: A Phylogenetic Approach. 2nd ed. Hedderson. (2003). A phylogenetic hypoth-
Sinauer Associates, Inc., USA (Ist ed., 1999). esis for the Aizoaceae (Caryophyllales) based
Judd, W. S., R. W. Sanders, and M. J. Donoghue. on four plastid DNA regions. American J. Bot.
(1994). Angiosperm family pairs: Preliminary 90: 1433-1445.
cladistic analyses. Harvard Pap. Bot. No. 5: Klak, C., P. V. Bruyns and T. A. J. Hedderson.
1-51. (2007). A phylogeny and new classification
Kallersjo, M., G. Bergqvist & A. A. Anderberg for Mesembryanthemoideae (Aizoaceae).
(2000). Generic realignment in primuloid Taxon 56: 737-756.
families of the Ericales s.l. (Angiosperms): Kluge, A. G. and J. S. Farris. (1969). Quantita-
A phylogenetic analysis based on DNA tive phyletics and the evolution of anurans.
sequences of rbcL and ndhF. American J. Bot. Syst. Zool. 18: 1-32.
87: 1325-1341 Komarov, V. L. And B. K. Shishkin. (1934-1964).
Krehed, J., J. Lundberg, B. Bremer and K. Flora SSSR. AN SSSR Press, Moscow/
Bremer. (1999). Evolution of the Australian Leningrad, 30 vols.
Australasian families Alseuosmiaceae, Kosakai, H., M. F. Moseley and V. I. Cheadle.
Argophyllaceae and Phellinaceae. Systematic (1970). Morphological studies in the
Botany 24: 660-682. Nymphaeaceae. V. Does Nelumbo have ves-
Karp, G. (2002). Cell and Molecular Biology: con- sels?. Amer. J. Bot. 57: 487-494.
cepts and experiments. 3rd ed. John Wiley and Kramer, K. U. and P. S. Green (Eds.). (1990). Vol.
Sons, New York. I, Pteridophytes and Gymnosperms; in K.
Keating, R. C. (2003a). Anatomy of the Monocoty- Kubitzki (ed.) Families and Genera of Vascular
ledons. IX. Acoraceae and Araceae (ed. Gre- Plants. pp. 284-391, Springer-Verlag, Berlin.
gory, M., & Cutler, D. F.). Oxford University Krassilov, V. A. (1977). Contributions to the
Press, Oxford. knowledge of the Caytoniales. Rev. Paleobot.
Keating, R. C. (2003b). Vegetative anatomical data Palynology 24: 155-178.
and its relationship to a revised classifica- Kraus, R. (1897). ber Specifishe Reactionin in
tion of the genera of Araceae. Missouri Bot. Keimfreien Filtraten aus Cholera, Typhus
Gard. Monogr. Syst. Bot. [in press; cited in und Pestbouillon Culturen erzeugt durch
APweb]. homologes Serum. Weiner Klin. Wechenschr.
Keating, R. C. (2004a). Vegetative anatomical 10: 136-138.
data and its relationship to a revised classi- Kron, K. A. (1996). Phylogenetic relationships of
fication of the genera of Araceae. Ann. Mis- Empetraceae, Epacridaceae, Ericaceae,
souri Bot. Gard. 91: 485-494. Monotropaceae and Pyrolaceae. Evidence
References 691
from nucleotide ribosomal 18S sequence Les, D. H. and R. R. Haynes. (1995). Systemat-
data. Ann. Bot. 77: 293-303. ics of subclass Alismatidae: A synthesis of
Kubitzki, K. (ed.) (1993). The Families and Gen- approaches. Pp. 353-377, in Rudall, P. J.,
era of Vascular Plants, Vol. II. Flowering Plants, Cribb, P. J., Cutler, D. F., & Humphries, C.
Dicotyledons: Magnoliid, Hamamelid and J. (Eds.), Monocotyledons: Systematics and
Caryophyllid Families. Springer-Verlag, New Evolution, vol. 2. Royal Botanic Gardens, Kew.
York. Les, D. H., M. A. Cleland, and M. Waycott. (1997).
Kubitzki, K. and M. W. Chase. (2002). Introduc- Phylogenetic studies in Alismatidae, II: Evo-
tion to Malvales. Pp. 12-16, in Kubitzki, K. lution of marine angiosperms (seagrasses)
(ed.), The Families and Genera of Vascular and hydrophily. Syst. Bot. 22: 443-463.
Plants. IV. Flowering Plants. Dicotyledons. Levin, R. A., W. L. Wagner, P. C. Hoch, M.
Malvales, Capparales and Non-betalain Nepokroeff, J. C. Pires, E. A. Zimmer and K.
Caryophallales. Springer, Berlin. J. Sytsma. (2003). Family-level relationships
Lam, H. J. (1961). Reflections on angiosperm of Onagraceae based on rbcL and ndhF data.
phylogeny. I and II. Facts and theories. Amer. J. Bot. 90(1): 107-115.
Koninklijke Akademie van Wetenschappen te Levin, R. A., W. L. Wagner, P. C. Hoch, W. J.
Amsterdam, Afdruunken Natuurkunde, Hahn, A. Rodriguez, D. A. Baum, L. Katinas,
Procesverbaal 64: 251-276. E. A. Zimmer and K. J. Sytsma. (2004).
Lamarck, J. B. P. (1778). Flore Francaise. Paraphyly in Tribe Onagreae: Insights into
Imprimerie Royale, Paris, 3 vols. Phylogenetic Relationships of Onagraceae
Lamarck, J. B. P. (1809). Philosophie Zoologique. Based on Nuclear and Chloroplast Sequence
Paris. Data. Systematic Botany. 29(1): 147-164.
Lamb Frye, A. S. and K. A. Kron. (2003). RbcL Linnaeus, C. (1730). Hortus uplandicus.
phylogeny and character evolution in Stockholm.
Polygonaceae. Syst. Bot. 28: 326-332. Linnaeus, C. (1735). Systema naturae. (2nd ed.).
Lance, G. N. and W. T. Williams. (1967). A gen- Lugduni Batavorum. Stockholm.
eral theory of classificatory sorting strate- Linnaeus, C. (1737). Critica botanica. Leyden.
gies. 1. Hierarchical systems. Computer J. 9: Linnaeus, C. (1737). Flora Lapponica. Amsterdam.
373-380. Linnaeus, C. (1737). Genera plantarum. Lugduni
Lapage, S.P., P.H.A. Sneath, E.F. Lessel, V.B.D. Batavorum.
Skerman, H.P.R. Seeliger, and W.A. Clark Linnaeus, C. (1737). Hortus Cliffortianus.
(Eds.). (1992). International Code of Nomencla- Amsterdam.
ture of Bacteria (Bacteriological Code 1990 Linnaeus, C. (1751). Philosophica botanica.
Revision). Amer. Soc. Microbiol., Washing- Stockholm, 362 pp.
ton, D.C. xlii + 189 pp. Linnaeus, C. (1753). Species plantarum.
Laubengayer, R. A. (1937). Studies in the Stockholm, 2 vols.
anatomy and morphology of the Linnaeus, C. (1762). Fundamenta fructificationis.
polygonaceous flower. Amer. J. Bot. 24: 329- Stockholm.
343. Loconte, H. (1993). Berberidaceae. In K. Kubitzki,
Lawrence, G. H. M. (1951). Taxonomy of Vascular J. G. Rohwer and V. Bittrich (Eds.) The fami-
Plants. Macmillan, New York. lies and Genera of vascular plants, vol. 2,
Lee, T. B. (1979). Illustrated Flora of Korea. Magnoliid, hamamelid and caryophyllid families.
Hyangmunsa, Seoul. 147-152. Springer-Verlag, Berlin.
Lee, Y. S. (1981). Serological investigations in Loconte, H. (1996). Comparison of Alternative
Ambrosia (Compositae: Ambrosieae) and rela- Hypotheses for the Origin of Angiosperms.
tives. Syst. Bot. 6: 113-125. In D. W. Taylor and L. J. Hickey (Eds.) Flow-
Lemesle, R. (1946). Les divers types de fibres a ering Plant Origin, Evolution and Phylogeny,
ponctuations areolees chez les 267-285. Chapman and Hall, Inc, New York.
dicotyledones apocarpiques les plus Loconte, H. and D. W. Stevenson. (1991). Cla-
archaiques et leur role dans la phylogenie. distics of Magnoliidae. Cladistics 7: 267-296.
Ann. Sci. Nat. Bot. et Biol. Vegetal 7: 19-40. Lve, A., D. Lve and R. E. G. Pichi-Sermolli.
Les, D. H., D. K. Garvin and C. F. Wimpee. (1977). Cytotaxonomic Atlas of Pteridophytes.
(1991). Molecular evolutionary history of Cramer, Koenigstein.
ancient aquatic angiosperms. Proc. Nat. Acad. Lundberg, J. (2001). A well resolved and sup-
Sc. USA 88: 10119-10123. ported phylogeny of Euasterids II based on
692 Plant Systematics
a Bayesian inference, with special empha- bers and their taxonomic significance. Bot.
sis on Escalloniaceae and other incertae J. Linn. Soc. (London) 60: 411-417.
sedis. Chapter V, in Lundberg, J. Phyloge- Markham, K. R., L. J. Porter, E. O. Cambell, J.
netic studies in the Euasterids II with particu- Chopin and M. L. Bouillant. (1976). Phy-
lar reference to Asterales and Escalloniaceae. tochemical support for the existence of two
Acta Universitatis Upsaliensis, Uppsala. species in the genus Hymenophyton. Phy-
Lundberg, J. and K. Bremer. (2002). A phyloge- tochemistry 15: 1517-1521.
netic study of the order Asterales using one Martin, W., D. Lydiate, H. Brinkmann, G.
large morphological and three molecular data Forkmann, H. Saedler and R. Cerff. (1993).
sets. International Journal of Plant Sciences. Molecular phylogenies in angiosperm evolu-
Mabberley, D. J. (1997). The Plant Book. Ed. 2. tion. Mol. Biol. Evol. 10: 140-162.
Cambridge University Press, Cambridge. Mason, H. L. (1936). The principles of geographic
Mabry, T. J. (1976). Pigment dichotomy and DNA- distribution as applied to floral analysis.
RNA hybridization data for Centrospermous Madrono 12: 161-169.
families. Pl. Syst. Evol. 126: 79-94. Mason-Gamer, R. J., and E. A. Kellogg. (1996).
Maheshwari, J. K. (1963). Flora of Delhi. CSIR, Chloroplast DNA analysis of the
New Delhi. monogenomic Triticeae: Phylogenetic impli-
Maheshwari, P. (1964). Embryology in relation cations and genome-specific markers. In P.
to taxonomy. In: W. B. Turril (ed.). Vistas in Jauhaur (ed.) Methods of genome analysis in
Botany. Pergamon Press, London, vol. 4, pp. plants: Their merits and pitfalls. 301-325. CRC
55-97. Press, Boca Raton, FL.
Malcomber, S. T., & E. A. Kellogg. (2005). Mason-Gamer, R. J., C. F. Weil and E. A. Kellogg.
SEPALLATA gene diversification: Brave new (1998). Granule bound starch synthase:
whorls. Trends Plant Sci. 10: 427-435. Structure, function and phylogenetic utility.
Malcomber, S. T., J. C. Preston, R. Reinheimer, Mol. Biol. Evol. 15: 1658-1673.
J. Kossuth E. A. & Kellogg. (2006). Develop- Mathew, K. M. (1983). The Flora of the Tamil Nadu
mental gene evolution and the origin of grass Carnatic. The Rapinat Herbarium, St. Josephs
inflorescence diversity. Adv. Bot. Res. 44: College, Tirucherapalli, India, 3 vols.
425-481. Mathews, S. and R. A. Sharrock. (1996). The phy-
Maldonado de Magnano, S. (1986). Estudios tochrome gene family in grasses (Poaceae):
embriologicos en Buddleja (Buddlejaceae) I: A phylogeny and evidence that grasses have
Endosperma y episperma. Darwiniana 27: 225- a subset of loci found in dicot angiosperms.
236. Mol. Biol. Evol. 13: 1141-1150.
Meng, Shao-Wu, Zhi-Duan Chen, De-Zhu Li and Matthews, M. L. and P. K. Endress. (2002). Com-
Han-Xing Liang (2002). Phylogeny of Saururaceae parative floral morphology and systematics
based on mitochondrial matR gene sequence in Oxalidales (Oxalidaceae, Connaraceae,
Data. J. Plant Res. 115:71-76. Brunelliaceae, Cephalotaceae, Cunoniaceae,
Manning, S. D. (2000). The genera of Elaeocarpaceae, Tremandraceae). Bot. J.
Bignoniaceae in the Southeastern United Linn. Soc. 140: 321-381.
States. Harvard Papers Bot. 5: 1-77. Mauseth, J. D. (1998). Botany: An Introduction to
Manos, P. S., K. C. Nixon and J. J. Doyle. (1993). Plant Biology. 2/e multimedia enhanced edi-
Cladistic analysis of restriction site varia- tion. Jones and Bartlett Publishers, Massa-
tion within the chloroplast DNA inverted chusetts.
repeat region of selected Hamamelididae. Mayo, S. J., L. Cabrera, G. Salazar and M. Chase.
Syst. Bot. 18: 551-562. (2003). Aroids and their watery beginnings.
Manos, P. S. and K. P. Steele. (1997). Phyloge- Ms. (cited in APweb)
netic analysis of higher hamamelididae Mayr, E. (1942). Systematics and the Origin of Spe-
based on plastid sequence data. Syst. Bot. cies. Columbia Univ. Press, New York.
84: 1407-1419. Mayr, E. (1957). The Species Problem. Amer.
Manos, P. S. , Z.-K. Zhou, and C. H. Cannon. Assoc. Adv. Sci. Pub. No. 50.
(2001). Systematics of Fagaceae: Phyloge- Mayr, E. (1963). Animal Species and Evolution.
netic tests of reproductive trait evolution. Belknap Press, Harvard Univ. Press, Cam-
Int. J. Plant Sci. 162: 1361-1379. bridge.
Marchant, C. J. (1968). Evolution in Spartina Mayr, E. (1966). The proper spelling of taxonomy.
(Gramineae) III. Species chromosome num- Systematic Zool. 15: 88.
References 693
Mayr, E. (1969). Principles of Systematic Zoology. Mirov, N. T. (1961). Composition of Gum Terpentines
McGraw-Hill, New York. of Pines. U. S. Dept. Agric. Tech. Bull. 1239.
Mayr, E. and P. D. Ashlock (1991). Principles of Mirov, N. T. (1967). The Genus Pinus. Ronald
Systematic Zoology. 2nd. ed. McGraw-Hill, Press, New York.
New York. Mitchell, J. D., D. C. Daly, S. K. Pell, and A.
Mayr, E. (1998). Two empires or three?. Pro- Randrianasolo. (2006). Poupartiopsis gen. nov.
ceedings of the National Academy of Science and its context in Anacardiaceae classifica-
95: 97209723. tion. Syst. Bot. 31: 337-348.
McMillan, C., T. J. Mabry and P. I. Chavez. (1976). Moore, G., K. M. Devos, Z. Wang and M. D. Gale.
Experimental hybridization of Xanthium (1995). Current Opinion Genet. Devel. 5: 737.
strumarium (Compositae) from Asia and Muasya, A. M., D. A. Simpson, M. W. Chase,
America, II.Sesquiterpene lactones of F1 and A. Culham. (1998). An assessment of
hybrids. Amer. J. Bot. 63: 317-323. suprageneric phylogeny in Cyperaceae using
McMinn, H. E. and E. Maino. (1946). Illustrated rbcL DNA sequences. Plant Syst. Evol.
Manual of Pacific Coast Trees, 2nd ed. Univ. 211: 257-271.
of Calif. Press, Berkeley, CA. Muhammad, A. F. and R. Sattler. (1982). Vessel
McNeill, J., Barrie, F. R. et al. (Eds.). (2006). In- structure of Gnetum and the origin of an-
ternational Code of Botanical Nomenclature giosperms. Amer. J. Bot. 69: 1004-1021.
(Vienna Code) 2006. Adopted by the Seven- Mller, K., & T. Borsch. (2005a). Phylogenetics
teenth International Botanical Congress, of Amaranthaceae based on matK/trnK se-
Vienna, Austria, July 2005. Series: Regnum quence data - evidence from parsimony, like-
Vegetabile Vol. 146. 568 pages. Gantner lihood, and Bayesian analysis. Ann. Missouri
Verlag Bot. Gard. 92: 66-102.
Meeuse, A. J. D. (1963). The multiple origins of Mller, K., & T. Borsch. (2005b). Multiple
the angiosperms. Advancing Frontiers of Plant origins of a unique pollen feature: Stellate
Sciences, 1: 105-127. pore ornamentation in Amaranthaceae. Grana
Meeuse, A. J. D. (1972). Facts and fiction in flo- 44: 266-281.
ral morphology with special reference to the Naik, V. N. (1984). Taxonomy of Angiosperms. Tata
Polycarpicae. Acta Bot. Neerl. 21: 113-127, McGraw Hill, New Delhi.
235-252, 351-365. Nandi, O. I. M. W. Chase and P. K. Endress.
Meeuse, A. J. D. (1990). All about Angiosperms. (1998). A combined cladistic analysis of an-
Eburon, Delft. giosperms using rbcL and non-molecular data
Meglitsch, P. A. (1954). On the nature of spe- sets. Ann. Missouri Bot. Gard. 85: 137-212.
cies. Zyst. Zool. 3: 49-65. Neumayer, H. (1924). Die Geschichte der Blte.
Melville, R. (1962). A new theory of the an- Abhandlung Zoologischen Botanische
giosperm flower, I. The gynoecium. Kew Bull. Gesellschaft 14: 1-110.
16: 1-50. Nickrent, D. L. (2002). Orgenes filogenticos de
Melville, R. (1963). A new theory of the an- las plantas parsitas. Pp. 29-56 in Lpez-
giosperm flower, II. Kew Bull. 17: 1-63. Sez, J. A., Cataln & Sez, L. (eds), Plantas
Melville, R. (1983). Glossopteridae, Angiosper- Parsitas de la Pennsula Ibrica e Islas
midae and the evidence of angiosperm ori- Baleares. Mundi-Prensa, Madrid.
gin. Bot. J. Linn. Soc. 86: 279-323. Nicolson, D. H. (1974). Paratautonym, a com-
Melville, R. and H. M. Heybroek. (1971). The Elms ment on proposal 146. Taxon 24: 389-390.
of the Himalayas. Kew Bull. 26(1): 5-28. Nixon, K. C. and J. M. Carpenter. (2000). On
Mrat, F. V. (1821). Nouvelle flore des environs de the other Phylogenetic Systematics. Cla-
Paris ed. 2, 2 Paris, 107 pp. distics 16: 298-318.
Metcalfe, C. R. and L. Chalk. (Eds.) (1983). Nixon, K. C., J. M. Carpenter and D. W.
Anatomy of Dicotyledons.(2nd ed.). Claredon Stevenson. (2003).The PhyloCode is fatally
Press, Oxford. (Takhtajans classification, flawed, and the Linnaean System can be
vol., 2 pp. 258-300). easily fixed. Bot. Rev. 69 (1): 111-120.
Michener, C. D. and R. R. Sokal. (1957). A quan- Nyananyo, B. L and S. I. Mensah. (2004). Distri-
titative approach to a problem in classifica- bution and origins of members of the family
tion. Evolution 11: 130-162. Portulaceae (Centrospermae). Journal of
Miki, S. (1937). The origin of Najas and Applied Sciences & Environmental Management,
Potamogeton. Bot. Mag. Tokyo 51: 290-480. 8 (2): 59-62
694 Plant Systematics
Potter, D., F. Gao, P. E. Bortiri, S. H. Oh and S. Stech, W. Frey, D. Quandt, & C. C. Davis.
Baggett. (2002). Phylogenetic relationships (2006). The deepest divergences in land
in Rosaceae inferred from chloroplast matK plants inferred from phylogenomic evidence.
and trnL-trnF nucleotide sequence data. Plant Proc. National Acad. Sci. U.S.A. 103: 15511-
Syst. evol. 231: 77-89. 15516.
Prat, W. (1960). Vers une classification Quinn, C. J., R. A. Price, and P. A. Gadek. (2002).
naturelles des Gramines. Bull. Soc. Bot. Fr. Familial concepts and relationships in the
107: 32-79. conifers based on rbcL and matK sequence
Prather, C. A., C. J. Ferguson and R. K. Jansen. comparisons. Kew Bull. 57: 513-531.
(2000). Polemoniaceae phylogeny and clas- Radford, A. E. (1986). Fundamentals of Plant Sys-
sification: Implications of sequence data tematics. Harper and Row, New York.
from the chloroplast gene ndhF. Amer. J. Bot. Radford, A. E., W. C. Dickison., J. R. Massey
87: 1300-1308. and C. R. Bell. (1974). Vascular Plant
Pratt, D. B., L. G. Clark and R. S. Wallace. (2001). Systematics. Harper and Row, New York.
A tale of two families: Phylogeny of the Rai, H. S., P. A. Reeves, R. Peakall, R. G.
Chenopodiaceae-Amaranthaceae. P. 135, in Olmstead and S. W. Graham. (2008). Infer-
Botany 2001: Plants and People, Abstracts. ence of higher-order conifer relationships
[Albuquerque.]. from a multi-locus plastid data set. Botany
Preston, J. C., & E. A. Kellogg. (2006). Recon- 86: 658-669.
structing the evolutionary hiistory of Raimann, R. (1893). Onagraceae. in Engler and
paralogous APETALA1?FRUITFULL-like genes Prantl, Die naturlichen Pflanzenfamilien
in Grasses (Poaceae). III(7): 199-223.
Price, R. A. (2003). Generic and familial relation- Ram, Manasi. (1959). Morphological and embryo-
ships of the Taxaceae from rbcL and matK logical studies in the family Santalaceae II.
sequence comparisons. Pp. 235-238, in Mill, Exocarpus, with a discussion on its system-
R. R. (ed.), IV International Conifer Conference. atic position. Phytomorphology 8: 4-19.
[ISIS Acta Horticulturae 615.] Raven, P. H. (1975). The bases of angiosperm
Qui, Y-L, M. W. Chase, D. H. Les and C. R. phylogeny: cytology. Ann. Miss. Bot. Gard.
Parks. (1993). Molecular phylogenetics of the 62: 725-764.
Magnoliidae: Cladistic analyses of nucle- Ray, J. (1682). Methodus plantarum nova.
otide sequences of plastid gene rbcL. Ann. London, 3 vols.
Missouri Bot. Gard. 80: 587-606. Ray, J. (1686-1704). Historia plantarum. London,
Qiu, Y.-L., M. W. Chase, S. B. Hoot, E. Conti, P. 3 vols.
R. Crane, K. J. Sytsma and C. R. Parks. Rechinger, K. H. (1963). Flora Iranica.
(1998). Phylogenetics of the Hamamelidae Reeves, R. G. (1972). Flora of Central Texas.
and their allies: Parsimony analyses of Prestige Press, Ft. Worth, TX, 320 pp.
nucleotide sequences of the plastid gene Rehder, A. (1940). Manual of Cultivated Trees and
rbcL. Int. J. Plant Sci. 159: 891-905. Shrubs Hardy in North America, (2nd ed).
Qui, Y-L, J. Lee, F. Bernasconi-Quadroni, D. E. Macmillan, New York.
Soltis, P. S. Soltis, M. Zanis, E. A. Zimmer, Rendle, A. B. (1904). Classification of flowering
Z. Chen, V. Savolainen and M. W. Chase. plants. Cambridge, England. Vol. 2 1925;
(1999). The earliest angiosperms: evidence 2nd ed. Vol. 1 1930.
from mitochondrial, plastid and nuclear ge- Renner, S. S., A. Weerasooriya and M. E. Olson,
nomes. Nature 402: 404-407. (2002). Phylogeny of Cucurbitaceae inferred
Qui, Y-L, J. Lee, F. Bernasconi-Quadroni, D. E. from multiple chloroplast loci. P. 169, in
Soltis, P. S. Soltis, M. Zanis, E. A. Zimmer, Botany 2002: Botany in the Curriculum,
Z. Chen, V. Savolainen and M. W. Chase. Abstracts. [Madison, Wisconsin.]
(2000). Phylogeny of basal angiosperms: Retallack, G. and D. L. Dilcher. (1981). A coastal
Analyses of five genes from three genomes. hypothesis for the dispersal and rise of domi-
Int. J. Plant Sci. 161(6: suppl.): S3-S27. nance of flowering plants. In: K. J. Niklas
Qiu, Y.-L., L. Li, B. Wang, Z. Chen, V. Knoop, M. (Ed.). Paleobotany, Paleoecology and Evolution.
Groth-Malonek, O. Dombrovska, J. Lee, L. Praeger, New York, Vol 2. Pp. 27-77.
Kent, L., J. S. Rest, G. F. Estabrook, T. A. Riesberg, L. H., B. Sinervo, C. R. Linder, M.
Hendry, D. W. Taylor, C. M. Testa, M. Ungerer and D. M. Arias. (1996). Role of gene
Ambros, B. Crandall-Stotler, R. J. Duff, M. interactionsin hybrid speciation:Evidence
696 Plant Systematics
Scotland, R. W. and K. Volleson. (2000). Classifi- Sneath, P. H. A. and R. R. Sokal. (1973). Numeri-
cation of Acanthaceae. Kew Bull. 55: 513-589. cal Taxonomy. W. H. Freeman and Company,
Sennblad, B and B. Bremer. (2002). Classifica- San Francisco.
tion of Apocynaceae s.l. according to a new Snustad, D. P. and M. J. Simmons. (2000). Prin-
approach combining Linnaean and phyloge- ciples of Genetics. 2nd ed. John Wiley and
netic taxonomy. Syst. Biol. 51: 389-409. Sons, New York.
Seward, A. C. (1925). Arctic vegetation past and Sokal, R. R. (1961). Distance as a measure of
present. J. Hort. Soc. 50, i. taxonomic similarity. Systematic Zool. 10:
Shukla, P. and S. P. Misra. (1979). An introduc- 70-79.
tion to Taxonomy of Angiosperms. Vikas Pub- Sokal, R. R. and C. D. Michener. (1958). A sta-
lishing House, New Delhi. tistical method for evaluating systematic
Simpson, G. G. (1961). Principles of Animal Tax- relationships. Univ. Kansas Sci. Bull. 44:
onomy. New York/London. 467-507.
Simpson, D. A., Furness, C. A., Hodkinson, T. Sokal, R. R. and P. H. A. Sneath. (1963). Prin-
R., Muasya, A. M., and M. W. Chase. (2003). ciples of Numerical Taxonomy. W. H. Freeman
Phylogenetic relationships in Cyperaceae and Company, San Francisco.
subfamily Mapanioideae inferred from pol- Solsbrig, O. T. (1970). Principles and Methods of
len and plastid DNA sequence data. Ameri- Plant Biosystematics. Macmillan, London.
can J. Bot. 90: 1071-1086. Soltis, D. E., D. R. Morgan, A. Grable, P. S. Soltis
Simpson, M. G.. (2006). Plant Systematics. 590 and R. Kuzoff. (1993). Molecular systemat-
pp. Elsevier Academic Press, San Diego, CA. ics of Saxifragaceae sensu stricto. Amer. J.
Singh, G. (1999). Plant Systematics. Science Pub- Bot. 80: 1056-1081.
lishers, New York. Soltis, D. E., P. S. Soltis, D. L. Nickrent, L. A.
Singh, G. (1999). Plant Systematics- Theory and Johnson, W. J. Hahn, S. B. Hoot,J. A.
practice. Oxford & IBH Publishing Co. Pvt. Sweere, R. K. Kuzoff, K. A. Kron,M. W.
Ltd., New Delhi. Chase, S. M. Swensen, E. A. Zimmer, S.-M.
Singh, G., Bimal Misri and P. Kachroo. (1972). Chaw, L. J. Gillespie, W. J. Kresss and K. J.
Achene morphology: An aid to the taxonomy Sytsma. (1997). Angiosperm phylogeny
of Indian Plants.1. Compositae, Liguliflorae. inferred from 18S ribosomal DNA sequences.
J. Indian Bot. Soc. 51(3-4): 235-242. Ann. Missouri Bot. Garden 84: 1-49.
Sinnot, E. W. and I. W. Bailey. (1914). Investiga- Soltis, D. E., P. S. Soltis, M. E. Mort, M. W.
tions on the phylogeny of angiosperms. Part Chase, V. Savolainen, S. B. Hoot, and C. M.
3. Amer. J. Bot. 1: 441-453. Morton. (1998). Inferring complex phylog-
Sinnott, Q. P. (1983). A Solar Thermoconvective enies using parsimony: An empirical
plant drier. Taxon 32: 611-613. approach using three large DNA data sets
Sivarajan, V. V. (1984). Introduction to Principles for angiosperms. Syst. Biol. 47: 32-42.
of Plant Taxonomy. Oxford & IBH, New Delhi. Soltis, D. E., P. S. Soltis, M. W. Chase, M. E.
Smith, A. C. (1970). The Pacific as a key to flower- Mort, D. C. Albach, M. Zanis, V. Savolainen,
ing plant history. Harold L. Lyon Arboretum W. H. Hahn, S. B. Hoot, M. F. Fay, M. Axtell,
Lecture Number 1. S. M. Swensen, L. M. Prince, W. J. Kress, K.
Smith, A. R., M. K. Pryer, E. Schuettpelz, P. C. Nixon and J. A. Farris. (2000). Angiosperm
Korall, Harald Schneider & P. G. Wolf. (2006). phylogeny inferred from 18S rDNA, rbcL, and
Classification of extant Ferns. Taxon 55(3): atpB sequences. Bot. Journ. Linn. Soc. 133:
705-731. 381-461.
Smith, P. M. (1972). Serology and species rela- Soltis, D. E., R. K. Kuzoff, M. E. Mort, M. Zanis,
tionship in annual bromes (Bromus L sect. M. Fishbein, L. Hufford, J. Koontz and
Bromus). Ann. Bot. 36: 1-30. M. Arroyo. (2001). Elucidating deep-level
Smith, P. M. (1983). Protein, mimicry and micro- phylogenetic relationships in Saxifragaceae
evolution in grasses. In: U. Jensen and D. using sequences for six chloroplastic and
E. Fairbrothers (Eds.). Proteins and Nucleic nuclear DNA regions. Ann. Missouri Bot. Gard.
Acids in Plant Systematics. Springer-Verlag, 88: 669-693.
Berlin, pp. 311-323. Soltis, P. S., D. E. Soltis and M. W. Chase.
Sneath, P. H. A. (1957). The application of com- (1999). Angiosperm phylogeny inferred from
puters to taxonomy. J. Gen. Microbiol. 17: multiple genes as a tool for comparative
201-226. biology. Nature 90: 461-470.
698 Plant Systematics
Soltis, P. S., D. E. Soltis , M. J. Zanis and S. Veg. 132 publ. 1995; suppl. 1 (Aa-Ba) Regnum
Kim. (2000). Basal lineages of angiosperms: Veg. 125 publ. 1992).
Relationships and implications for floral evo- Stanier, R. Y. & C. B. van Niel (1962). The
lution. International Journal of Plant Sciences concept of a bacterium. Arch. Microbiol.
161 (6, suppl.): S97-S107. 42: 1735.
Soltis, P. S., D. E. Soltis , M. W. Chase, M. E. Starr, J. R., S. A.Harris & D. A.Simpson. (2004).
Mort, D. C. Albach, M. Zanis, V. Savolainen, Phylogeny of the unispicate taxa in Cypera-
W. H. Hahn, W. H. Hoot, M. F. Fay, M. Axtell, ceae tribe Cariceae I: Generic relationships
S. M. Swensen, L. M. Prince, W. J. Cress, K. and evolutionary scenarios. Syst. Bot.
C. Nixon and J. A. Farris. (2000a). An- 29: 528-544.
giosperm phylogeny inferred from 18S rDNA, Starr, J. R., V. Teoh, E. Roalson, A. M. Muasya
rbcL, and atpB sequences. Bot. J. Linn. Soc. & D. A. Simpson. (2006). Towards a phyloge-
133: 381-461. netic classification of sedges (Cyperaceae):
Soltis, D. E., P. S. Soltis, P. K. Endress, and M. chloroplast (rbcL, matK, NdhF) and nuclear
W. Chase.(2005). Phylogeny and Evolution of (ADC) data. Pp. 258-259, in Botany 2006 -
Angiosperms. 370 pp. Sinauer Associates, Looking to the Future, Conserving the Past. [Ab-
Sunderland, MA. stracts: Botanical Society of America, etc.].
Soreng, R. J. and J. I. Davis. (1998). Phylogenetics Stebbins, G. L. (1950). Variation and Evolution in
and character evolution in the grass family Plants. Columbia Univ. Press, NY.
(Poaceae): Simultaneous analysis of morpho- Stebbins, G. L. (1974). Flowering Plants; Evolu-
logical and chloroplast DNA restriction site tion above the Species Level. The Belknap
character sets. Bot. Rev. 64: 1-85. Press, Harvard Univ. Press, Cambridge.
Soros, C. L. and D. H. Les. (2002). Phylogenetic Steenis, C. G. G. J. van (Ed.). (1948). Flora
relationships in the Alismataceae. P. 152, Malesiana. Series I: Spermatophyta.
in Botany 2002: Botany in the Curriculum, Ab- Groninger, Jakarta.
stracts. [Madison, Wisconsin.] Stefanovic, S., L. Krueger and R. G. Olmstead.
Sosef, M. S. M. (1997). Hierarchical models, (2002). Monophyly of the Convolvulaceae and
reticulate evolution and the inevitability of circumscription of their major lineages based
paraphyletic supraspecific taxa. Taxon 46: on DNA sequences of multiple chloroplast
75-85. loci. American J. Botany 89: 1510-1522.
Speta, F. (1979). Weitere untersuchungen ber Stevens, P. F. (1994). The development of biologi-
proteinkrper in Zellkernen und ichre cal systematics. Columbia University Press,
taxonomische Bedentung. Plant Syst. Evol. New York.
132: 1-126. Stevens, P. F. (1998). What kind of classifica-
Sporne, K. R. (1971). The mysterious origin of flow- tion should the practicing taxonomist use
ering plants. Oxford Biology Readers 3, F. F. to be saved? in Plant diversity in Malesia III,
Head and O. E. Lowenstein (Eds.). Oxford J. Dransfield, M. J. E. Coode and D. A.
Univ. Press, Oxford. Simpson (Eds.) , 295-319. Royal Botanical
Sporne, K. R. (1974). Morphology of Angiosperms. Gardens, Kew.
Hutchinson Univ. Library, London. Stevens, P.F. (2003). Angiosperm Phylogeny
Sporne, K. R. (1976). Character correlation among Website. Version 6, May 2005 [and more or
angiosperms and the importance of fossil less continuously updated since]. http://
evidence in assessing their significance. In: www.mobot.org/MOBOT/research/APweb.
C. B. Beck (Ed.). Origin and Early Evolution of Website developed and maintained by Hilary
Angiosperms. Columbia Univ. Press, New York. Davis (last updation incorcorated 03/04/
Stace, C. A. (1973). Chromosome numbers in 2006).
British Species of Calystegia and Convolvu- Stevenson, D. W. (1981). Observations on ptyxis,
lus. Watsonia 9:363-367. phenology and trichomes in the Cycadales
Stace, C. A. (1980). Plant Taxonomy and Biosys- and their systematic implications. Am. J. Bot.
tematics. Edward Arnold, London. 68: 1104-1114.
Stace, C. A. (1989). Plant Taxonomy and Biosys- Stevenson, D. W. and H. Loconte. (1995). Cla-
tematics. (2nd ed.) Edward Arnold, London. distic analysis on monocot families. In M.
Stafleu, F. A. and E. A. Mennega. (1997). Taxo- J. Rudall et al. (Eds.) Monocotyledons:
nomic literature, 2nd ed., suppl. 4 (Ce-Cz). Systematics and Evolution, 543-578. Royal
Regnum Veg. 134. (suppl. 3 (Br-Ca) Regnum Botanic Gardens, Kew.
References 699
Theophrastus. Enquiry into plants. Translated by Treutlein, J., G. F. Smith, B. -E. van Wyk, and
A. Hort. W. Heinemann, London (1916), M. Wink. (2003). Phylogenetic relationships
2 vols. in Asphodelaceae (subfamily Alooideae)
Thorne, R. F. (1968). Synopsis of a putative phy- inferred from chloroplast DNA sequences
logenetic classification of flowering plants. (rbcL, matK) and from genomic finger-print-
Aliso 6(4): 57-66. ing (ISSR). Taxon 52: 193-207.
Thorne, R. F. (1974). A phylogenetic classifica- Troitsky, A. V., Y. F. Melekhovets, G. M.
tion of Annoniflorae. Aliso 8: 147-209. Rakhimova, V. K. Bobrova, K. M. Valiegoroman
Thorne, R. F. (1976). A phylogenetic classifica- and A. S. Antonov. (1991). Angiosperm ori-
tion of angiosperms. Evol. Biol. 9: 35-106. gin and early stages of seed plant evolution
Thorne, R. F. (1981). Phytochemistry and an- deduced from rRNA sequence comparison.
giosperm phylogeny: A summary statement, J. Molecular Evolution 32: 253-261.
In D. A. Young and D. S. Seigler (Eds.). Phy- Tsutsumi, C. & M. Kato. (2006) Evolution of
tochemistry and Angiosperm Phylogeny. epiphytes in Davalliaceae and related ferns.
Praeger, New York, pp. 233-295. Bot. J. Linn. Soc.
Thorne, R. F. (1983). Proposed new realignments Tucker, S. C. and W. Douglas. (1996). Floral
in angiosperms. Nordic J. Bot. 3:85-117. structure, Development and Relationships
Thorne, R. F. (1992). An updated classification of Paleoherbs: Saruma, Cabomba, Lactoris,
of the flowering plants. Aliso 13: 365-389. and selected Piperales. In: D. W. Taylor and
Thorne, R. F. (1992b). Classification and geogra- L. J. Hickey (Eds.) Flowering Plant Origin, Evo-
phy of the flowering plants. Bot. Rev. 58: 225- lution and Phylogeny 141-175. Chapman and
348. Hall, Inc., New York.
Thorne, R. F. (1996). The least specialized an- Tucker, S. C. (2002). Floral ontogeny of Cercis
giosperms. In: D. W. Taylor and L. J. Hickey (Leguminosae: Caesalpinioideae: Cercideae):
(Eds.). Flowering Plant Origin, Evolution and Does it show convergence with Papilionoids?
Phylogeny. Chapman & Hall Inc., New York, Int. J. Plant Sci. 163: 75-87.)
pp. 286-313. Tutin, T. G. et al. (ed.) (1964-1980). Flora
Thorne, R. F. (1999). An Updated Classification of Europaea.. Cambridge University Press, Cam-
the Class Angiospermae.http:// bridge, 5 vols.
www.inform.umd.edu/PBIO/fam/ Uhl, N. W. (1947) Studies in the floral morphol-
thorneangiosp99.html. Website maintained ogy and anatomy of certain members of Helo-
(with nomenclatural additions) by Dr. J. L. biae. Ph.D. Thesis (Cited by Lawrence, 1951).
Reveal of University of Maryland. Uhl, N. W., J. Dransfield, J. I. Davis, M. A.
Thorne, R. F. (2000). The classification and Luckow, K, H. Nansen and J. J. Doyle.
geography of the monocotyledon subclasses (1995). Phylogenetic relationships among
Alismatidae, Liliidae, and Comelinidae. Pp. palms: Cladistic analysis of morphological
75-124, in Nordenstam, B., El Ghazaly, G., and chloroplast DNA restriction site varia-
& Kassas, M. (Eds.), Plant Systematics for the tion. In: P. J. Rudall, P. J. Cribb., D. F. Cut-
21st Century. Portland, Oregon. ter and C. J. Humphries (Eds.). Monocotyle-
Thorne, R. F. (2000) [2001]. The classification dons: Systematics and Evolution. 623-661.
and geography of flowering plants: Dicotyle- Upchurch, G. R. Jr. and J. A. Wolfe. (1987). Mid-
dons of the class Angiospermae (subclasses Cretaceous to Early Tertiary vegetation and
Magnoliidae, Ranunculidae, Caryophyllidae, climate: evidence from fossil leaves and
Dilleniidae, Rosidae, Asteridae, and woods. In: E. M. Friis, W. G. Chaloner, and
Lamiidae). Bot. Rev. 66: 441-647. P. R. Crane (Eds.). The Origin of Angiosperms
Thorne, R. F. (2003). An Updated Classification of and their Biological Consequences. Cambridge
the Class Angiospermae. www.rsabg.org/pub- Univ. Press, Cambridge, pp. 75-105.
lications/angiosp.htm. Valentine, D. H. and A. Love. (1958). Taxonomic
Tournefort, J. P. de. (1696). Elements de botanique. and biosystematic categories. Brittonia 10:
Paris, 3 vols. 153-166.
Tournefort, J. P. de. (1700). Institutiones rei Vegter, I. H. (1988). Index herbariorum: a guide
herbariae. Imprimerie Royale, Paris, 3 vols. to the location and contents of the worlds
Trehane, P., et al. (1995). International code of public herbaria. Part 2(7). Collectors T-Z.
nomenclature for cultivated plants. Regnum Regnum Veg. 117. (Part 2(6). Collectors S.
Veg. 133. Regnum Veg. 114 publ. 1986).
References 701
Wallace, R. S. and A. C. Gibson. (2002). Evolu- Wiley, E. O. (1978). The evolutionary species con-
tion and systematics. Pp. 1-21 in Nobel, P. cept reconsidered. Syst. Zool. 27: 17-26.
S. (ed.), Cacti: Biology and Uses. University Wiley, E. O. (1981). Phylogenetics-The Theory and
of California Press, Berkeley Practice of Phylogenetic Systematics. John
Wallick, K., W. Elisens, P. Kores and M. Molvray. Wiley and Sons, New York.
(2001). Phylogenetic analysis of trnL-F se- William, W. T., J. M. Lambert and G. N. Lance.
quence variation indicates a monophyletic (1966). Multivariate methods in plant ecol-
Buddlejaceae and a paraphyletic Buddleia. ogy. V. Similarity analyses and information-
Pp. 148-149, in Botany 2001: Plants and analysis. J. Ecol. 54: 427-445.
People, Abstracts. [Albuquerque.] Willis, J. C. (1922). Age and Area. Cambridge.
Wallick, K., W. Elisens, P. Kores and M. Molvray. Willis, J. C. (1973). A. Dictionary of Flowering Plants
(2002). Phylogenetic analysis of trnL-F se- and Ferns, 8th ed. (revised by H. K. Airy-Shaw).
quence variation indicates a monophyletic Cambridge Univ. Press, Cambridge, 1245 pp.
Buddlejaceae and a paraphyletic Buddleia. Wilson, P. G., M. M. OBrien, P. A. Gadek and
Pp. 156-157 in Botany 2002: Botany in the Cur- C. J. Quinn (2001). Myrtaceae revisited: A
riculum, Abstracts. [Madison, Wisconsin.] reassessment of infrafamilial groups. Ameri-
Walters, D. R. and D. J. Keil. (1995). Vascular can J. Bot. 88: 2013-2025.
Plant Taxonomy, 4th ed. Kendall?Hunt, Woese, C. R., W. E. Balch, L. J. Magrum, G. E.
Dubuque, IA. Fox and R. S. Wolfe (1977). An ancient
Wannan, B. S. (2006). Analysis of generic rela- divergence among the bacteria. Journal of
tionships in Anacardiaceae. Blumea 51: 165- Molecular Evolution 9: 305311.
195. Woese, C. R. O. Kandler and M. L. Wheelis
Watson, L. and M. J. Dallwitz. (2000). The fami- (1990). Towards a Natural System of Organ-
lies of flowering plants: Descriptions and isms: Proposal for the Domains Archaea,
illustrations.Website:http:// Bacteria, and Eucarya. Proceedings of the
biodiversity.uno.edu/delta/. National Academy of Sciences 87: 45764579.
Webster, G. L. (1967). The genera of Wojciechowski, M. F., M. Lavin and M. J.
Euphorbiaceae in the southeastern United Sanderson (2003). A phylogeny of legumes
States. J. Arnold Arbor. 48: 303-430. based on sequences of the plastid matK gene,
Webster, G. L. (1994). Classification of the P. 99 in Botany 2003: Aquatic and Wetland
Euphorbiaceae. Ann. Missouri Bot. Gard. 81: Plants: Wet and Wild. Abstracts. [ Mobile,
3-32. 1994. Alabama.]
Wendel, J. F., A. Schnabel and T. Seelanan. Wolfe, K. H., M. Gouy, Y. -W. yang, P. M. Sharp
(1995). An unusual ribosomal DNA dequence and W. -H. Li. (1989). Date of monocot-dicot
from Gossypium gossypioides reveals divergence estimated from Choloroplast DNA
ancient, cryptic, intergenomic, introgression. sequence data. Proc. Nat. Acad. Sci. USA
Mol. Phylog. Evol. 4: 298-313. 86: 6201-6205.
Wettstein, R. R. von. (1907). Handbuch der Woodland, D. W. (1991). Contemporary Plant Sys-
systematischen Botanik (2nd ed.) Franz tematics. Prentice Hall. New Jersey.
Deuticke, Leipzig. Worsdell, W. C. (1908). The affinities of Paeonia.
Williams, S. E., V. A. Albert and M. W. Chase. J. Bot. (London) 46: 114
(1994). Relationships of Droseraceae: A cla- Wu, Z-Y, A. M. Lu, $ Y. C. Tang. (1998a). A Com-
distic analysis of rbcL sequence and morpho- prehensive study of Magnoliidae sensu lato
logical data. American J. Bot. 81: 1027-1037. - with special consideration on possibility and
Whitlock, B. A., J. Lee, O. Dombrovska and Y. L. necessity for proposing a new polyphyletic-
Qiu. (2002). Effects of rate heterogeneity on polychronic-polytopic system of angio-
estimates of the age of angiosperms. P. 158, sperms. In: Zhang, A. I & S. G. Wu (Eds.)
in Botany 2002: Botany in the Curriculum, Floristic Characteristics and Diversity of East
Abstracts. [Madison, Wisconsin.] Asian Plants. Beijing & Berlin: China Higher
Whittaker, R. H. (1969). New concepts of king- Education Press & Springer Verlag, p. 269-334.
doms of organisms. Science 163: 150160. Wu, Z-Y, Y. C. Tang, A. M. Lu et al. (1998b).On
Wieland, G. R. (1906). American fossil cycads. primary subdivisions of the Magnoliophyta-
Carnegie Institute, Washington, D. C. towards a new scheme for an eight-class
Wieland, G. R. (1916). American fossil cycads vol. system of classification of the angiosperms.
II. Carnegie Institute, Washington, D. C. Acta. Phytotax Sinica. 36: 385-402.
702 Plant Systematics
Wu, Z-Y, A. M. Lu, Y-C Tang, Z-D Chen and D-Z Young, D. A. (1981). Are the angiosperms primi-
Li. (2002). Synopsis of a new polyphyletic- tively vesselless? Syst. Bot. 6: 313-330.
polychronic-polytopic system of the an- Young, D. J. and L. Watson. (1970). The classifi-
giosperms. Acta Phytotax. Sinica 40: 289-322. cation of the dicotyledons: A study of the
Wu, Z-Y, A. M. Lu, Y-C Tang, Z-D Chen and D-Z upper levels of hierarchy. Aust. J. Bot. 8: 387-
Li. (2003). The Families and Genera of An- 433.
giosperms in China: A Comparative Analysis. Zahn, L. M., J. H. Leebens-Mack, C. W.
Science Press, Beijing. dePamphilis, H. Ma & G. Theissen. (2005).
Wu, H.-C., H.-J. Su, & J.-M. Hu. (2007). The To B or not to B a flower: The role of
identification of A-, B-, C-, and E-class DEFICIENS and GLOBOSA orthologs in the
MADS-box genes and implications for peri- evolution of the angiosperms. J. Hered. 96:
anth evolution in the basal eudicot 225-240.
Trochodendron aralioides (Trochodendraceae). Zanis, M. J., D. E. Soltis, P. S. Soltis, Y-L Qiu
Internat. J. Plant Sci. 168: 775-799. and E. A. Zimmer. (2003). Phylogenetic analy-
Wurdack, K. J. and M. W. Chase. (2002). ses and perianth evolution in basal an-
Phylogenetics of Euphorbiaceae s. str. giosperms. Ann. Missouri Bot. Gard.
using plastid (rbcL and trnL-F) sequences. Zanis, M. J., D. E. Soltis, P. S. Soltis,Y-L Qiu,
P. 160, in Botany 2002: Botany in the Curricu- S. Mathews, and M J. Donoghue. (2002). The
lum, Abstracts. [Madison, Wisconsin.] root of the angiosperms revisited. Proc. Nat.
Xiang, Q.-Y., D. E. Soltis, and P. S. Soltis. (1998). Acad. Sci. 99: 6848-6853.
Phylogenetic relationships of Cornaceae and Zgurski, J. M., H. S. Rai, Q. M. Fai, D. J. Bogler
close relatives inferred from matK and rbcL and J. Francisco-Ortega. (2008). How well
sequences. Amer. J. Bot. 85: 285-297. do we understand the overall backbone of
Yuan, Y.-M., Y. Song, K. Geuten, E. cycad phylogeny? New insights from a large,
Rahelivololona, S. Wohlhauser, E. Fischer, multigene plastid data set. Mol. Phyl. Evol.
E. Smets, and P. Kpfer. (2004). Phylogeny 47: 1232-1237.
and biogeography of Balsaminaceae inferred Zhou, Z.K., P. M. Barrett, & J. Hilton . (2003).
from ITS sequences. Taxon 53: 391-403. An exceptionally preserved Lower Creta-
Yoo, K.-O. and J. Wen. (2002). Phylogeny and ceous ecosystem. Nature 421: 807-814.
biogeography of Carpinus and subfamily Zomlefer, W. B. (1994). Guide to flowering plant
Coryloideae (Betulaceae). Int. J. Plant Sci. families. University of Carolina Press, Chapel
163: 641-650. Hill.