DETECTION OF PIK3CA MUTATIONS IN PLASMA

TUMOR DNA CIRCULATING IN PERIPHERAL

BLOOD OF BREAST CANCER PATIENTS

by
Patricia Lourdes Valda Toro

A thesis submitted to Johns Hopkins University in conformity with the

requirements for the degree of Master of Science in Molecular and Cellular
Biology

Baltimore, Maryland
April, 2014
Abstract
Tumor-specific mutations are used as genetic biomarkers for breast cancer

diagnosis and prognosis. The detection and quantification of mutations in tumor DNA

circulating in peripheral blood offers a non-invasive approach for measuring the presence

of cancer in patients and for evaluating individual responses to targeted therapies. We

studied the feasibility of detecting two common mutations in the phosphatidylinositol-

4,5-bisphosphate 3-kinase, catalytic subunit alpha (PIK3CA) gene, in circulating plasma

tumor DNA (ptDNA) of early stage breast cancer patients. We used two Polymerase

Chain Reaction platforms, BEAMing and droplet digital PCR (ddPCR), and showed that

both platforms detect PIK3CA mutations in ptDNA with high specificity and differential

sensitivity (30% for BEAMing, and 93.3% for ddPCR). Additionally, we showed that the

sensitivity of ddPCR for ptDNA detection decreased in blood stored at room temperature

for one week in tubes that do not prevent blood lysis. Our results provide a novel and

non-invasive alternative for clinically detecting and quantifying breast cancer biomarkers

in blood, and suggest the use of blood collection tubes that prevent lymphocyte lysis for

blood storage and transportation. The method presented herein, can allow physicians to

measure tumor burden in breast cancer patients in response to targeted therapies, and to

make more informed decisions regarding the administration of toxic systemic therapies.

Ben Ho Park, M.D. Ph.D. Robert Horner, Ph.D.

ii
Acknowledgments
I want to thank Dr. Ben Ho Park, my principal investigator and advisor. He has been a
positive influence in my academic, personal and professional development. This project
would not have been possible without his mentorship, constant support, and the
opportunity to join his laboratory. I also want to thank Dr. Julia Beaver for conception of
the project and mentorship. I want to thank the Park Lab members for constant support
and guidance, particularly, David Chu and Hong Yuen Wong for taking the patience and
time to train and assist me in the design of the experimental approach.
I want to express my sincere gratefulness to the Biology Department at The Johns
Hopkins University. I thank Dr. Robert Horner and Dr. Kathryn Tifft for their mentorship
and support.
Finally, I want to thank my family who make every accomplishment possible.

Author Contributions
Conception and design: Julia A. Beaver, MD; Danijela Jelovac, MD; Vered Stearns,
MD; Ben Ho Park, MD, PhD.
Development of methodology: Julia A. Beaver, MD; Danijela Jelovac, MD; Sasidharan
Balukrishna, MD; Rory Cochran; Sarah Croessmann; Daniel J. Zabransky; Hong Yuen
Yong; Paula J. Hurley; Michael L. Samules, PhD; Dianna Maar, PhD; Ben Ho Park, MD,
PhD.
Acquisition and analysis of data: Julia A. Beaver, MD; Danijela Jelovac, MD;
Sasidharan Balukrishna, MD; Rory Cochran; Sarah Croessmann; Daniel J. Zabransky;
Hong Yuen Yong; Justin Cidado; Brian G. Blair, PhD; David Chu; Timothy Burns, MD;
Michaela J. Higgins, MB, BCh, MD; Vered Stearns, MD; Lisa Jacobs MD; Mehran
Habibi MD; Julie Lange MD; Josh Lauring MD, PhD; Dustin VanDenBerg; Jill Kessler;
Stacie Jeter; Michael L. Samules, PhD; Dianna Maar, PhD; Leslies Cope PhD; Ashley
Cimino-Mathews MD; Pedram Argani MD; Ben Ho Park, MD, PhD.

iii
 TABLE OF CONTENTS

Abstract .............................................................................................................................. ii
Acknowledgements and Author Contributions ................................................................. iii
Table of Contents ............................................................................................................... iv
List of Abbreviations ...........................................................................................................v
List of Figures and Tables....................................................................................................v
List of Supplementary Material ...........................................................................................v

1. Introduction .....................................................................................................................1
2. Experimental Methodology .............................................................................................5
2.1 Detection of PIK3CA Mutations in Plasma Tumor DNA .........................................5
2.1.1 Blood and Tissue Collection ...........................................................................6
2.1.2 DNA Processing From Blood Plasma and Tissue ..........................................6
2.1.3 Detection of PIK3CA Mutations .....................................................................7
2.1.3.1 Sanger Sequencing ...........................................................................7
2.1.3.2 BEAMing .........................................................................................7
2.1.3.3 Droplet Digital PCR.........................................................................7
2.2 Blood Collection Tube Study ....................................................................................8
2.2.1 Blood Collection .............................................................................................8
2.2.2 DNA Processing..............................................................................................8
2.2.3 Droplet Digital PCR .......................................................................................8
3. Results .............................................................................................................................9
3.1 Detection of PIK3CA Mutations Using BEAMing ...................................................9
3.2 Detection of PIK3CA Mutations Using ddPCR ......................................................10
3.2.1 Pre-Surgery Plasma .......................................................................................10
3.2.2 Post-Surgery Plasma .....................................................................................10
3.3 Detection of Mutations in BCT Streck and PAXgene Tubes ..................................11
4. Discussion ......................................................................................................................12
5. Figures............................................................................................................................17
6. Supplementary Material .................................................................................................24

Bibliography ......................................................................................................................29
Curriculum Vita ........................................................................................................................... 31

iv
List of Abbreviations

Abbreviation Meaning
TM
BCT Cell-Free DNA BCT collection tube from Streck company
BEAMing Beads, Emulsions, Amplification and Magnetic flow for identification
and quantification of mutations
cfDNA Cell-free DNA
ddPCR Droplet Digital Polymerase Chain Reaction
EDTA Ethylenediamine tetracetic acid. Used to refer to collection tubes with
this composition
E545K Amino acid substitution at position 545 in PIK3CA, from a glutamic
acid (E) to a lysine (K). Used to refer to the mutation in exon 9 of the
PIK3CA gene
FFPE Formalin fixed paraffin embedded
H1047R Amino acid substitution at position 1047 in PIK3CA, from a histidine
(H) to an arginine (R). Used to refer to the mutation in exon 20 of the
PIK3CA gene
gDNA Genomic DNA
PAXgene PAXgene Blood DNA collection tube
PI3K Phosphatidylinositol 3-kinase
PIK3CA Phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
gene
ptDNA Plasma tumor DNA
WT Wild type

List of Figures

Figure 1 Schematic of the experimental approach Page 17

Figure 2 Sanger sequencing of primary breast tissue Page 18
Figure 3 Compared sensitivities of BEAMing, ddPCR and Sanger Sequencing Page 20
Figure 4 Quantification of DNA in blood collection tubes by ddPCR Page 22
Figure 5 Detection of PIK3CA mutations in different collection tubes by ddPCR Page 23
Table 1 Detection of PIK3CA mutations in primary tumors and blood Page 19

List of Supplementary Material

Supp 1 Thermocycling conditions for amplification of PIK3CA loci Page 24

Supp 2 PCR amplification and nested sequencing primers for sequencing Page 24
Supp 3 Primers and Taqman probes for droplet digital PCR Page 24
Supp 4 Thermocycling conditions for droplet digital PCR (Taqman probes) Page 25
Supp 5 Primers and labeled-oligonucleotide probes for ddPCR Page 25
Supp 6 Thermocycling conditions for droplet digital PCR (L-Oligo probes) Page 25
Supp 7 Mutant fractional abundances in different collection tubes Page 26

v
1. Introduction

Breast cancer is the most common cancer and the second leading cause of cancer-

related deaths among women in the United States (1). Prospective studies showed that

60-70% of early stage breast cancer patients are cured with local therapies, such as

surgical removal of the primary tumor lesion (2). However, because imaging and

currently available molecular techniques cannot reliably detect microscopic residual

disease post primary treatment, the current paradigm is to treat patients with adjuvant

systemic therapies, which cause systemic cellular toxicity. Large randomized prospective

trials support the use of systemic therapies to increase the chance of long-term survival

by preventing recurrence (2). However, studies have shown that adjuvant therapies

improve disease free survival and cure rates by only ~ 10% to 20% (3).

A third of breast cancers are caused by somatic mutations in the PIK3CA gene, the

gene encoding the p110 catalytic subunit of the phosphatidylinositol 3-kinase (PI3K)

(4). Somatic mutations in the PIK3CA gene are associated with the disruption of the

normal regulation of cell growth, cell migration and maintenance of tissue morphology

by PI3K (5, 6). E545K within exon 9 of the PIK3CA gene, and H1047R within exon 20

of the PIK3CA gene, are reported as two hotspot mutations in breast cancer (6). The

E545K mutation is associated with the disruption of inhibitory interactions between

p110 catalytic subunit and a PI3K regulatory subunit, while the H1047R mutation

increases the binding affinity of PI3K for its substrate (7). Both mutations lead to PI3K

gain of function, which disrupts the regulation of normal cellular processes and can

consequently cause cancer.

1
 PIK3CA mutations are biomarkers for breast cancer prognosis and diagnosis (8). The

traditional approach for identifying these biomarkers is by removing tumor tissue via

invasive biopsies and/or surgical procedures, followed by Sanger sequencing DNA

extracted from the removed tissue specimens. Biopsies for the removal of tissue are

invasive. Additionally, the DNA obtained from biopsy tissue, which is stored in formalin

paraffin embedded (FFPE) slides is fragmented by formalin (9). The low quality of DNA,

and the difficulty of extracting exclusively tumor DNA in a slide containing both,

cancerous and non-cancerous cells closely situated to each other, increases the chances of

getting false negatives during the detection of biomarkers by Sanger sequencing. In the

present study we present a non-invasive alternative for detecting PIK3CA biomarkers.

Cell-free DNA (cfDNA) circulates in peripheral blood as a result of apoptotic and

necrotic processes in which cells burst and shed DNA into the blood (10-12). It is

hypothesized that cancerous cells shed their DNA into the blood by similar apoptotic

processes, providing circulating cell-free tumor DNA (13-17). Tumor-derived DNA is

currently referred to as plasma tumor DNA (ptDNA) (18-20). Higgins et al showed that

PIK3CA mutations, more specifically, E545K and H1047R mutations, are identified in

ptDNA of patients with metastatic breast cancer using a technique called BEAMing (8).

BEAMing allows the detection of low levels of ptDNA in a large pool of wild type DNA

by compartmentalizing DNA molecules before amplification by Polymerase Chain

Reaction (PCR) (21,22). Compartmentalization of DNA in BEAMing is attained by

attaching individual DNA molecules to magnetic beads in water in oil emulsions. The

molecules are then PCR amplified and the mutational status is determined by hybridizing

2
the DNA with fluorescent allele-specific probes for mutant and wild-type PIK3CA.

Finally, mutations are quantified by flow cytometry (21,22).

We hypothesized that BEAMing is sensitive enough to detect E545K and H1047R

mutations in plasma tumor DNA circulating in the peripheral blood of early stage breast

cancer patients. Cancer patients in early stages have much lower tumor burden compared

to patients in metastasis (24). Consequently, the ratio of tumor to normal DNA in blood is

expected to be low and difficult to detect. Compartmentalization previous to

amplification in BEAMing allows for the detection of a single mutant sequence in 10,000

wild type sequences (8, 23). Thus, we hypothesized that BEAMing would still detect

E545K and H1047R mutations with high specificity in early stage breast cancer patients

despite the patients much lower levels of ptDNA in circulation compared to patients in

metastatic stages. We further hypothesized that a similar novel method called droplet

digital Polymerase Chain Reaction (ddPCR) would detect E545K and H1047R mutations

in ptDNA of patients with early stage breast cancer with high sensitivity and specificity.

Droplet digital PCR similarly detects amplified fluorescently labeled DNA molecules

after compartmentalization in oil emulsions (3). We speculated that the digital

quantification of DNA molecules and superior partition in oil emulsions during ddPCR,

can allow a more precise measurement of ptDNA at a fraction of the time and cost

compared to BEAMing.

Our ultimate goal is to use peripheral blood of early stage breast cancer patients as a

non-invasive liquid biopsy to detect PIK3CA biomarkers. The absolute quantification

of PIK3CA mutations in ptDNA by either BEAMing or ddPCR can serve as a marker for

microscopic residual disease in early stage breast cancer patients, providing physicians

3
with a novel and non-invasive technique to make informed decisions about the necessity

of administering adjuvant systemic therapies. Furthermore, the specificity of fluorescent

probes in BEAMing and ddPCR can reduce false negatives associated with the traditional

approach of Sanger sequencing biopsy tissue specimens.

Additionally, we sought to evaluate pre-analytic sources of error that might

compromise the accuracy of ptDNA measurements. After phlebotomy, lymphocytes in

plasma lyse and release their genomic DNA. Genomic DNA increases the background

noise and decreases the chances of getting positive signal from low levels of ptDNA (25,

29). Recently, the company Streck released a blood collection tube called Cell-Free

DNATM BCT (BCT), which contains a chemical cocktail that stabilizes lymphocytes for

14 days at room temperature after phlebotomy (25, 30). However, due to its price, many

clinical practices use PAXgene Blood DNA collection tube and K3EDTA collection tube

instead.

Previous studies showed that PAXgene tubes are better at maintaining stable levels of

nucleic acid in blood after phlebotomy compared to EDTA tubes (26). The

manufacturers claim that chemicals in PAXgene tubes, in addition to the anticoagulant,

ethylenediamine tetraacetic acid, stabilize nucleic acids in blood left at room temperature

for 14 days after phlebotomy (26 - 28).

We hypothesized that cfDNA levels are more stable in plasma stored in BCT tubes at

room temperature for one week than in plasma stored in PAXgene tubes under the same

conditions. We speculated that the lysis of unstable lymphocytes in PAXgene tubes

4
decrease the sensitivity of detecting PIK3CA mutations by ddPCR by increasing DNA

background noise.

Our results showed that BEAMing and ddPCR detected E545K and H1047R

mutations in ptDNA of early stage breast cancer patients with 100% specificity.

BEAMing detected PIK3CA mutations in ptDNA of early stage breast cancer with 30%

sensitivity while ddPCR detected identical mutations with 93.3% sensitivity.

Furthermore, we found that increases in genomic DNA in plasma stored in PAXgene

tubes at room temperature for seven days decreased the sensitivity of detecting mutations

in ptDNA using ddPCR. Together, our results propose a novel approach to revolutionize

adjuvant system therapies in early stage breast cancer patients and recommend the use of

BCT tubes for blood storage and transport.

2. Experimental Methodology

2.1. Detection of PIK3CA Mutations in Plasma Tumor DNA

Primary tumor tissue from patients with early stage breast cancer was obtained via

surgery and was Sanger sequenced to determine the presence of PIK3CA mutations. The

following mutations were queried: Exon 9 1633G>A E545K and Exon 20 3140A>G

H1047R. The specificity and sensitivity of BEAMing was analyzed by querying E545K

and H1047R mutations in cell-free DNA in blood plasma obtained before surgery, and by

comparing the total number mutations identified by BEAMing to those identified by

Sanger sequencing DNA from tumor tissue. For the following assay, ddPCR was used to

query E545K and H1047R mutations in both, DNA extracted from pre-surgery plasma

and DNA extracted from FFPE tumor tissue. The specificity and sensitivity of ddPCR

5
was calculated by comparing the total number of mutations identified in ptDNA to those

identified in FFPE DNA by ddPCR. Additionally, BEAMing and ddPCR was used to

query E545K and H1047R mutations in DNA from plasma obtained after surgery. The

total number of PIK3CA mutations found in post-surgery plasma was compared to those

identified in pre-surgery plasma and FFPE tissue in order to assess if BEAMing and

ddPCR can detect ptDNA in blood after removal of the primary tumor lesion (Figure 1).

2.1.1. Blood and Tissue Collection: Patients recently diagnosed with early stage (I-III)

breast cancer (n=29) enrolled in an IRB approved prospective repository study at The

Johns Hopkins Sidney Kimmel Comprehensive Cancer Center. Primary tissue was

collected in unstained sectioned formalin-fixed paraffin embedded (FFPE) tissue slides.

Blood was collected via phlebotomy in EDTA tubes; pre-surgery blood was collected for

all patients, and post-surgery blood was collected for 17 patients. Plasma was isolated

within two hours after phlebotomy to prevent DNA degradation.

2.1.2. DNA Processing From Blood Plasma and FFPE Tissue: DNA from tumor cells

in FFPE breast tissue was extracted using Zymo pen and Pinpoint solutions (Zymo

Research), and consequently isolated using QIAamp DNA FFPE tissue kit (Qiagen) per

the manufacturers protocol. DNA from non-cancerous cells was identically obtained,

and used as a negative control. Cell-free DNA was extracted from plasma samples using

QIAamp circulating nucleic acid (CNA) kit (Qiagen) per the manufacturers protocol*.

Quanti-iT Picogreen assay form Life Technologies was used to measure DNA

concentrations*.

* This step was performed by Dr. Julia Beaver, a former member of our lab and other collaborators.

6
2.1.3. Detection of PIK3CA Mutations in Blood Plasma and Tissue

2.1.3.1. Sanger Sequencing: A specific DNA region spanning E545K in exon 9 and

H1047R in exon 20 of the PIK3CA gene were PCR amplified with touchdown thermo-

cycling conditions (Supplement 1) using specific primers (Supplement 2). The purified

DNA product was Sanger sequenced by Macrogen.

2.1.3.2. BEAMing: Exon 9 1633G>A E545K and Exon 20 3140 A>G H1047R

mutations in ptDNA were queried using BEAMing (21)*.

2.1.3.3. Droplet Digital PCR: Mutant and wild type PIK3CA sequences were separately

identified and quantified according to different fluorescent signals using ddPCR. First,

pre-amplified DNA was mixed with amplification primers for exon 9 or exon 20

(Supplement 3), fluorescent probes for DNA query and ddPCRTM Supermix (Bio-Rad).

Then, the mixture was compartmentalized in oil droplets by a droplet generator and PCR

amplified by thermal cycling (Parameters in supplement 4). After amplification, a

Droplet Reader (QX200 Droplet Digital PCR System Bio-Rad) digitally enumerated

mutant PIK3CA sequences, and their corresponding wild type sequences, according to the

fluorescent signal detected for each probe. For this study, Taqman probes with VIC

fluorophores were designed for wild type sequences, and probes with 6-FAM

fluorophores were designed for mutant sequences (Supplement 3). This allowed

simultaneous quantification of each PIK3CA allele (Figure 6). In order to quantify the

percent of ptDNA containing mutant PIK3CA in plasma samples, fractional abundance

was calculated using the QuantaSoft program (Bio-Rad Technologies), which uses the

* This step was performed by Dr. Julia Beaver, a former member of our lab and other collaborators.

7
total number of droplets, with and without DNA, to calculate the number of DNA

molecules as copies/l. The number of mutant DNA molecules was divided by the

number of total DNA molecules, and multiplied by 100 to yield a percentage, taking into

account a Poisson distribution of occupied to unoccupied droplets (25). Additionally, this

program was used to sum droplets in multiple replicates to create a single meta-well for

each sample.

2.2. Blood Collection Tube Study

2.2.1. Blood Collection: Patients diagnosed with metastatic breast cancer (n=10) were

enrolled in an IRB approved repository study at The Johns Hopkins Sidney Kimmel

Comprehensive Cancer Center. All patients were diagnosed with HER2-positive breast

cancer and had unknown PIK3CA mutational status. Five plasma samples were obtained

per patient: three plasma samples processed within 24 hours of phlebotomy, one collected

in EDTA tubes (as basal control), one in PAXgene tubes, and one in BCT tubes; and two

plasma samples processed seven days after phlebotomy, one collected in PAXgene tube

and one in BCT tubes.

2.2.2. DNA Processing: Cell-free DNA was extracted from each five samples per patient

and purified using QIAamp CNA kit, per manufacturers protocol.

2.2.3. Droplet Digital PCR: Mutations were queried using the methodology explained in

2.1.3.3. However, for this study, 6-FAM labeled-oligonucleotides (Integrated DNA

Technologies) were used as fluorescent probes to query Exon 9 1633G>A E545K and

Exon 20 3140A>G H1047R; HEX labeled-oligonucleotides were used as probes to query

the corresponding wild type sequence in exon 9 and exon 20 (Supplement 6). Labeled-

8
oligonucleotides were used in this assay because they contain an additional quencher that

enhances the binding specificity of the florescent probe to the target DNA, according to

the manufacturer. In order to assess if DNA concentrations increased in either PAXgene

or BCT tubes after storage at room temperature for a week, a ratio of total wild type DNA

molecules (in ul of DNA/droplet generated) in plasma stored in for one week after

phlebotomy versus total wild type DNA molecules in plasma processed the same day of

phlebotomy was calculated for either PAXgene or BCT tubes. In addition, to analyze if

increases in DNA concentration in each tube skew the detection of mutations, fraction

abundance of E545K or H1047R mutations was calculated as explained in 2.1.3.3.

Fractional abundances were only calculated in samples with more than 1000 wild type

DNA molecules, which were quantified by the QX200 Droplet Digital PCR software as

HEX-labeled positive droplets. Results were recorded as the summation of eight

replicates, creating a single meta-well for each sample.

3. Results

3.1. Detection of PIK3CA Mutations Using BEAMing: We studied the detection of

PIK3CA mutations in ptDNA using BEAMing. Sanger sequencing of FFPE sample

controls identified 10/29 patients with PIK3CA mutations: seven patients with H1047R

mutations and three patients with E545K mutations. The mutations identified in tumor

tissue were wild type in adjacent non-cancerous cells used as a negative control (Figure

2). No other mutations were identified within the amplified loci. BEAMing showed a

sensitivity of 30% for detecting PIK3CA mutations in ptDNA: of the ten PIK3CA

mutations found in FFPE controls, three were identified by BEAMing in pre-surgery

9
plasma (one H1047R mutation and two E545K mutations) (Figure 3 and Table 1).

BEAMing detected no mutations in post-surgery plasma.

3.2. Detection of PIK3CA Mutations Using ddPCR: We then analyzed the detection of

PIK3CA mutations in ptDNA using ddPCR. For this assay, we used ddPCR instead of

Sanger sequencing to identify PIK3CA mutations in FFPE tissue samples, which were

used as positive controls. The same mutations identified by Sanger sequencing were

found by ddPCR; however, ddPCR identified five additional mutations: two patients with

H1047R, one patient with E545K, and one patient with both H1047R and E545K (Table

1). In summary, ddPCR identified a total of 15 PIK3CA mutations while Sanger

Sequencing identified a total 10 PIK3CA mutations (Figure 3 and Table 1). The fraction

abundance of PIK3CA mutations in FFPE samples according to ddPCR ranged from

13.8% to 55.6% (Table 1).

3.2.1. Pre-Surgery Plasma: Droplet digital PCR identified 14 PIK3CA mutations in

ptDNA extracted from pre-surgery plasma (Figure 3 and Table 1). Given that ddPCR

identified a total of 15 PIK3CA mutations in gDNA of FFPE controls, we calculated the

sensitivity of ddPCR for detecting ptDNA mutations in pre-surgery plasma as 93.3%

(95% confidence interval 75.5% - 93.3%) and the specificity as 100% (95% confidence

interval 78.9% - 96.7%). Four patients presented E545K mutations with fractional

abundances ranging from 0.01% to 0.07% and ten patients presented with H1047R

mutations with fractional abundances ranging from 0.01% to 2.99% (Table 1).

3.2.2. Post-Surgery Plasma: Droplet digital PCR identified five patients with H1047R

mutations in ptDNA extracted from post-surgery plasma (Figure 3 and Table 1). Five

patients who had a PIK3CA mutation in their pre-surgery plasma had wild type loci in

10
their post-surgery plasma. Patient four, who presented both E545K and H1047R

mutations in pre-surgery plasma, showed mutant H1047R, but wild type E545K in post-

op plasma (Table 1).

3.3. Detection of PIK3CA Mutations in BCT and PAXgene Tubes: We analyzed if

BCT and PAXgene tubes prevent the lysis of lymphocytes, and if the release of genomic

DNA into peripheral blood by lysed lymphocytes hampers ptDNA detection by ddPCR.

We found that, on average, the total wild type DNA molecules in plasma stored one week

at room temperature in PAXgene tubes increased by a factor of 42.03 17.3 (95%

confidence interval 2.94, 81.12). This was not true for plasma collected in BCT tubes, for

which the ratio of DNA in plasma stored for one week versus DNA in plasma processed

the same day of phlebotomy was 1.107 0.19 (95% confidence interval 0.67, 1.54)

(Figure 4). We determined the basal level of DNA in each tube by quantifying DNA

molecules in plasma collected in EDTA tubes and processed the same day of phlebotomy

(Figure 4).

We analyzed the fraction abundance of E545K mutations in two patients whose

plasma samples had enough DNA in order to accurately detect mutations by ddPCR

without DNA pre-amplification. Patient four presented 7/1016 E545K mutant droplets

(0.69%) in plasma collected in EDTA tubes. We observed 7/911 (0.77%) mutant droplets

in plasma collected in PAXgene tubes and processed the same day of phlebotomy. The

mutant fraction abundance decreased to 2/1483 (0.13%) in PAXgene tubes stored for one

week at RT. On the other hand, we identified 1/1197 (0.08%) mutant droplets in plasma

collected in BCT tubes and processed the same of phlebotomy and 5/1026 (0.49%) in

plasma stored in BCT for one week at room temperature. The comparisons of mutant

11
fractional abundances across the five tubes were informative given that the total number

of droplets was consistent for all five samples, with an order of magnitude of 90,000

(Supplement 7).

Patient six presented 15/2368 E545K mutant droplets (0.63%) in plasma collected

in EDTA tubes, 4/1616 (0.24%) in plasma collected in PAXgene tubes, and 1/2488 in

plasma collected in BCT tubes (0.04%). The fraction abundance decreased to 2/3546

(0.04%) in plasma stored at room temperature for one week in PAXgene tubes and

increased to 4 /2484 (0.63%) in plasma stored at room temperature for one week in BCT

tubes. The total droplets for each tube were in the same order of magnitude (10,000);

however, the droplets for BCT samples were slightly lower than for PAXgene samples

(Supplement 8).

The rest of the eight patients showed an average mutant fractional abundance of

1/300; therefore, we were not able to conclude with precision if mutant droplets were true

PIK3CA mutations or artifacts. For precise mutation detection, these samples would

undergo pre-amplification of plasma DNA to yield a wild type background of at least

10,000 molecules, followed by repeated testing and analysis for PIK3CA mutations by

ddPCR.

4. Discussions

We showed that droplet digital PCR detects PIK3CA mutations in ptDNA of patients

with early stage breast cancer with high sensitivity and specificity. Higgins et al showed

that BEAMing of ptDNA correlates 100% with mutational status in patients with

metastatic breast cancer (7). BEAMing was not as sensitive with ptDNA from early stage

12
breast cancer patients, which is likely due to the low tumor burden in these patients. We

hypothesize that ddPCR was more sensitive than BEAMing because it has fewer

technical steps, reducing the chances of losing sample and the ability to analyze more

genome equivalents at a fraction of the time and cost compared to BEAMing.

The high sensitivity and specificity of ddPCR for detecting PIK3CA mutations in

ptDNA presents the opportunity of using blood as a liquid biopsy in patients with early

stage breast cancer despite their low levels of tumor burden. The use of blood for

biomarker detection can eliminate the necessity of accessing tumor tissue via invasive

biopsies in order to detect mutations by the traditional approach of Sanger sequencing

DNA from FFPE slides. This novel approach has several clinical implications. First,

blood can be drawn at different time points to monitor the response to therapies based on

varying levels of ptDNA. Persistent ptDNA levels can indicate negative response to

directed therapies and encourage physicians to change the current treatment. As a result,

physicians can make more informed decisions regarding changes in treatment and

consequently design more individualized therapies. Second, the fact that ddPCR detected

PIK3CA mutations in ptDNA circulating in plasma that was collected after surgery,

suggests that ddPCR can identify residual micrometastatic disease. The presence of

ptDNA in blood after local therapies, such as surgical removal of tumor tissue, can

indicate that cancer cells have not been eradicated from the body, and consequently

suggest that the patient would benefit from adjuvant systemic therapies. On the contrary,

the absence of ptDNA after local therapies can prevent the delivery of unnecessary

systemic therapies and the toxicity associated with them.

13
 Furthermore, our results show that due to its high specificity, ddPCR can still detect

mutations in DNA extracted from FFPE samples that would otherwise show as wild type

by Sanger sequencing. It is possible that the additional mutations we found by ddPCR

were false positives. However, this is unlikely given that identical mutations were found

in ptDNA. The higher specificity of ddPCR could become a more precise molecular test

for identifying patients that are candidates for targeted therapies.

Additionally, ddPCR circumvents the hurdles of traditional sequencing of FFPE in

the following aspects. First, phlebotomy to obtain plasma samples is much less invasive

that tissue dissection. Second, the specificity of fluorescent probes can prevent false

negatives by sequencing tumor DNA from FFPE slides that may be contaminated with

normal DNA from adjacent cells. Third, the DNA assayed is not chemically degraded by

formalin, as it is the case for DNA extracted from FFPE slides.

In order to make this method universally accessible, we studied blood collection tubes

in which plasma can be stored and shipped to facilities with access to ddPCR. Our results

showed significant increases in DNA in plasma collected in PAXgene tubes that have

been left at room temperature for one week, which suggests that these tubes do not

prevent lymphocyte lysis under these conditions. We showed that for two patients, the

fraction abundance of mutant DNA detected by ddPCR decreased in plasma stored in

PAXgene tubes for one week at room temperature. This suggests that the significant

increase in background DNA decreases ptDNA signal and hampers the detection of

PIK3CA mutations.

14
 The mutant fraction abundance in plasma collected in BCT tubes was much lower

than that in plasma collected in either EDTA or PAXgene tubes. This decrease cannot be

reliably explained by varying total number of droplets across reactions given that BCT

reactions did not show significant lower droplets compared to EDTA and PAXgene

reactions. Nonetheless, the fraction abundance in BCT after one week at RT increased to

levels comparable to our basal control. This suggests that the use of BCT tubes may be

the most optimal means of storing blood and not losing ptDNA signal.

This section of the study was not a test of sensitivity but rather an analysis of two

tube technologies; thus, we did not push the limits of sensitivity for detecting PIK3CA

mutations by pre-amplifying plasma DNA. Previous studies have suggested that

confident conclusions about the mutational status of a patient require an order of

magnitude of 10,000 wild type molecules as background (25), which was not obtained in

the meta-wells for any of the ten patients assayed in the blood collection tube study. Our

results are consistent with previous data showing that very low levels of cell free DNA

circulate in blood plasma and that pre-amplification may be necessary to confidently

conclude the mutational status of a patient. Future studies with pre-amplification of

ptDNA should be carried out to conclude if contamination of cell free DNA with

genomic DNA from bursting lymphocytes in PAXgene tubes affect mutational analysis

by ddPCR.

We propose that ddPCR is a reliable clinical tool for the detection of cancer

biomarkers. This method can replace the traditional approach of detecting biomarkers in

tissue, reducing the invasive nature of biopsies and/or surgeries to obtain tissue, and

providing more sensitive results that Sanger sequencing of DNA extracted from tissue.

15
We have demonstrated that ddPCR can reliably detect mutations in plasma stored in BCT

blood collection tubes for one week at room temperature. This suggests that blood from

patients at any location could be sent in BCT tubes to facilities with access to ddPCR,

making this novel method universally accessible. We hope that the use of ddPCR will

take clinical oncology a step further towards personalized medicine by providing

physicians with an accurate method of monitoring tumor DNA levels in each patient and

tailoring directed therapies accordingly.

16
5. Figures
Figure 1: Schematic of the experimental approach. Primary tissue was collected for 29
patients via surgery in the form of FFPE slides. Tumor and non-cancerous genomic DNA
was extracted from FFPE slides and Sanger sequenced to determine the mutational status
of each patient. BEAMing was used to query PIK3CA mutations in cell-free DNA in
plasma obtained before and after surgery. Alternatively, droplet digital Polymerase Chain
Reaction (PCR) was used to query identical PIK3CA mutations in pre-surgery plasma,
post-surgery plasma and FFPE genomic DNA.

17
Figure 2: Sanger sequencing of formalin-fixed paraffin embedded primary breast
tissue. Tumor and normal DNA were extracted from primary tissue. DNA regions
spanning E545 and H1047 of the PIK3CA gene was amplified and sequenced. Sanger
sequencing of tissue DNA from one patient with E545K mutation. A) Normal tissue
showing wild type E545 depicted by guanidine at position 1633 in exon 9 of the PIK3CA
gene (control). B) Tumor tissue denoting E545K 1633G>A mutation in exon 9 of the
PIK3CA gene.

18
Table 1: Detection of PIK3CA mutations in primary tumors and blood plasma.
Summary of E545K or H1047R mutations identified in early stage breast cancer patients
(n=29) by Sanger sequence, BEAMing and ddPCR. Percents represent the mutant
fractional abundance determined by ddPCR. WT denotes wild type loci for both E545K
and H1047R.

19
Figure 3: PIK3CA mutations found in FFPE and plasma of early stage breast cancer
patients. ddPCR detected more PIK3CA mutations than BEAMing or Sanger sequencing
A) BEAMing on pre-surgery plasma identified only one of the seven H1047R mutations
identified in tissue by sequencing and two of three E545K mutations found in FFPE
controls. B) ddPCR identified in plasma all ten H1047R identified by Sanger sequencing
of FFPE DNA but only four E545K mutations of five identified in FFPE DNA by
sequencing. C) ddPCR identified a total of fifteen PIK3CA mutations in FFPE DNA
while Sanger sequencing identified a total of ten PIK3CA mutations FFPE DNA.

20
21
Figure 4: Quantification of wild type DNA molecules in plasma collected in
PAXgene and BCT Streck tubes by ddPCR for a single patient. Wild Type DNA
molecules were quantified by the ddPCR software according to the detection of
fluorescent signal from HEX labeled-oligonucleotides querying wild type sequence in
exon 9. Equivalent amounts of DNA were observed in plasma collected in BCT Streck
tubes processed the same day of phlebotomy versus seven days after. In contrast, a
sixteen-fold increase in DNA concentration was observed in blood collected in PAXgene
and left unprocessed at room temperature for seven days. Blood collected in EDTA tubes
and processed the same day of phlebotomy was used as a reference for DNA basal levels.
Water was used as a negative control and the cell line MCF10A was used as a positive
control for DNA detection.

22
Figure 5: Detection of PIK3CA mutations in ptDNA of plasma collected in EDTA,
BCT Streck and PAXgene tubes. ddPCR 1D amplitude plots for exon 9 loci in patient
nine in metastatic cohort. A) Fluorescent droplets for 6-FAM probe for mutant E545K
DNA sequences. B) Fluorescent droplets for HEX probe for wild type exon 9 sequences.
MCF7 cell line was used as a positive control and MCF10A as a negative control for
E545K sequences. Water was used as a negative control.

23
6. Supplementary Material.
Supplement 1: Thermocycling conditions for amplification of PIK3CA loci

Step Temperature (C) Time (sec) Cycles

1 98 10 4
2 64 15 4
3 61 15 4
4 58 15 4
5 72 90 4
6 98 10 30
7 55 15 30
8 72 90 30
9 4 hold 1

Supplement 2: PCR amplification and nested sequencing primers for FFPE sequencing

PIK3CA Exon Size (bp) Forward Primer Reverse Primer Sequencing Primer
locus (5 -3) (5 -3) (5 3)
E545K 9 132 ttacagagtaacagactagc cttacctgtgactccatagaa gctagagacaatgaattaaggg
H1047R 20 132 gatgacattgcatacattcg gtggaagatccaatccattt cgaaagaccctagccttag

Supplement 3: Primers and Taqman probes used for ddPCR

A. FFPE
PIK3CA Size ddPCR Forward ddPCR Reverse Wild Type Probe Sequencing Primer
locus (bp) Primer 5-3 Primer 5-3 (5 3)
E545K 91 tcaaagcaatttctacac ctccattttagcactta VIC- 6FAM-
gagatcct cctgtgac ctctctgaaatcactgag ctctgaaatcactaagcag-
cag-MGB-3 MGB-3

H1047R 98 gcaagaggctttggagt gctgtttaattgtgtgg VIC- 6FAM-

atttcatg aagatccaa ccaccatgatgtgcatc- caccatgacgtgcatc-
MGB-3 MGB-3
B. ptDNA
PIK3CA Size ddPCR Forward ddPCR Reverse Wild Type Probe Sequencing Primer
locus (bp) Primer 5-3 Primer 5-3 (5 3)
E545K 97 aaaatgacaaagaaca acttacctgtgactccata VIC- 6FAM-
gctcaaag gaaaatc tctgaaatcactgagcagg- ctgaaatcactaagcagg-
MGB3 MGB-3
H1047R 80 gagcaagaggctttgg atccaatccatttttgttgtc VIC-ccaccatgatgtgca- 6FAM-
agtattt c MGB-3 ccaccatgacgtgca-
MGB-3

24
Supplement 4: Thermocycling conditions for ddPCR using Taqman probes

Step Temperature (C) Time Cycles

1 95 10 min 1
2 94 30 sec 40
3 58 1 min 40
4 98 10 min 1
5 4 hold 1

Supplement 5: Primers and labeled-oligonucleotide probes used for ddPCR on ptDNA

samples of metastatic patient cohort

PIK3CA Size ddPCR Forward ddPCR Reverse Wild Type Probe Sequencing Primer
locus (bp) Primer 5-3 Primer 5-3 (5 3)
E545K 91 caaagcaatttctacacg ctccattttagcacttacct HEX- 6-FAM-
agatcct gtgact ctctgaaatcactgagcag ctctgaaatcactaagcaggag
gagaaagatt-Iowa aaagattt-Iowa
Black(w/Zen) Black(w/Zen)

HEX- 6-FAM-
H1047R 98 ctgagcaagaggctttg gtggaatccagagtgag tgaatgatgcacatcatgg tgaatgatgcacgtcatggtgg
gag ctt tggct-Iowa ct-Iowa Black(w/Zen)
Black(w/Zen)

Supplement 6: Thermocycling conditions for ddPCR using labeled-oligonucleotide

probes

Step Temperature (C) Time Cycles

1 95 10 min 1
2 94 30 sec 40
3 64 1 min 40
4 98 10 min 1
5 4 hold 1

25
Supplement 7: Mutant droplets detected by ddPCR in 10 patients with metastatic breast
cancer compared to total droplets. Each section represents the summation of eight
multiple replicates for a single meta-well. Due to technical issues a meta-well of four
replicates was done for patient two. Patient four and six were used for assessing the
detection of PIK3CA mutations.

Mutant Fraction Abundance Determined by Droplet Digital PCR

Patient Mutation Tube Mutant Total Positive Total
Droplets Droplets Droplets
EDTA 0 533 100720
PAXgene 2 238 87915
E545K BCT 1 174 143160
PAXgene 1 week 2 1621 100274
BCT 1 week 0 558 74947
1
EDTA 0 221 104013
PAXgene 0 169 109608
H1047R BCT 1 65 61546
PAXgene 1 week 1 10149 98831
BCT 1 week 0 184 98557
EDTA 5 35 56724
PAXgene 8 44 47750
E545K BCT 2 23 44112
PAXgene 1 week 3 26 49122
2 BCT 1 week 5 43 50228
EDTA 0 12 27913
PAXgene 0 18 43076
H1047R BCT 0 26 42117
PAXgene 1 week 0 467 43582
BCT 1 week 1 22 37189
EDTA 6 200 89971
PAXgene 2 250 92095
E545K BCT 2 318 87745
PAXgene 1 week 0 2466 97247
BCT 1 week 2 303 91954
3 EDTA 0 93 77984
PAXgene 0 103 83888
H1047R BCT 0 124 85529
PAXgene 1 week 0 1406 91141
BCT 1 week 6 129 85201

26
 Mutant Fraction Abundance Determined by Droplet Digital PCR
Patient Mutation Tube Mutant Total Positive Total
Droplets Droplets Droplets
EDTA 7 1016 90202
PAXgene 7 911 92602
E545K BCT 1 1197 91060
PAXgene 1 week 2 1483 92770
4 BCT 1 week 5 1026
EDTA 0 398 90534
PAXgene 0 562 95899
H1047R BCT 1 592 95650
PAXgene 1 week 1 1073 94173
BCT 1 week 0 634 87902
EDTA 0 398 91347
PAXgene 0 346 98908
E545K BCT 1 390 92916
PAXgene 1 week 0 5721 90210
5 BCT 1 week 2 289 89833
EDTA 2 194 97026
PAXgene 3 194 109901
H1047R BCT 4 189 86453
PAXgene 1 week 4 4293 99527
BCT 1 week 3 159 95527
EDTA 15 2368 97625
PAXgene 4 1616 107229
E545K BCT 1 2488 99036
PAXgene 1 week 2 3546 100068
6 BCT 1 week 4 2484 94916
EDTA 2 956 103064
PAXgene 6 530 1008294
H1047R BCT 0 720 100717
PAXgene 1 week 0 1016 100659
BCT 1 week 1 545 102741
EDTA 0 201 108778
PAXgene 1 162 109292
E545K BCT 0 326 96233
PAXgene 1 week 0 12976 89797
7 BCT 1 week 0 123 91227
EDTA 2 70 96675
PAXgene 2 59 76701
H1047R BCT 0 67 103580
PAXgene 1 week 1 6696 82242
BCT 1 week 0 60 94210

27
 Mutant Fraction Abundance Determined by Droplet Digital PCR
Patient Mutation Tube Mutant Total Positive Total
Droplets Droplets Droplets
EDTA 0 59 105821
PAXgene 3 84 106403
E545K BCT 0 76 99105
PAXgene 1 week 2 1988 101854
8 BCT 1 week 0 35 92371
EDTA 2 15 103629
PAXgene 2 37 103074
H1047R BCT 1 39 106096
PAXgene 1 week 2 1361 109908
BCT 1 week 0 17 96087
EDTA 0 307 95852
PAXgene 0 301 96658
E545K BCT 1 244 97329
PAXgene 1 week 1 2709 96831
9 BCT 1 week 3 297 96149
EDTA 1 118 103275
PAXgene 3 113 93519
H1047R BCT 0 100 106539
PAXgene 1 week 0 2572 98869
BCT 1 week 2 96 99176
EDTA 0 377 104257
PAXgene 1 154 106526
E545K BCT 0 218 102827
PAXgene 1 week 2 24085 107471
10 BCT 1 week 2 297 105545
EDTA 2 184 103852
PAXgene 1 122 110279
H1047R BCT 0 107 95464
PAXgene 1 week 1 16059 108099
BCT 1 week 0 140 104550

28
Bibliography

(1) U.S. Cancer Statistics Working Group. United States Cancer Statistics: 19992010
Incidence and Mortality Web-based Report. Atlanta (GA): Department of Health and
Human Services, Centers for Disease Control and Prevention, and National Cancer
Institute; 2013. Available at: http://www.cdc.gov/uscs.

(2) Early Breast Cancer Trialists Collaborative Group. Effects of chemotherapy and
hormonal therapy for early breast cancer on recurrence and 15-year survival: an overview
of the randomised trials. Lancet. 2005; 365:1687-717.
(3) Beaver J.A, et al. Detection of Cancer Specific Mutations in Plasma of Early Stage
Breast Cancer Patients. Clin Can Res. 2013; 20:1709-1718

(4) Kalinsky K, et al. PIK3CA Mutation Associates with Improved Outcome in Breast
Cancer. Clin Cancer Res. 2009; 15:5049-5059
(5) Bachman KE, et al. The PIK3CA gene is mutated with high frequency in breast
cancer. Cancer Biology and Therapy. 2004; 3:773-775
(6) Park B, et al. The PIK3CA Gene as a Mutated Target for Cancer Therapy. Curr
Cancer Drug Targets. 2008; 8:733740
(7) Kang S, et al. Mutated PI 3-kinases: cancer targets on a silver platter. Cell Cycle
2005; 4:578-81
(8) Higgins M, et al. Detection of Tumor PIK3CA Status in Metastatic Breast Cancer
Using Peripheral Blood. Clin Cancer Res. 2012; 18:34623269
(9) Aung K.L, et al. Current status and future potential of somatic mutation testing from
circulating free DNA in patients with solid tumours. Hugo J. 2010; 4:1121

(10) Mandel P, et al. Les acides nucliques du plasma sanguine chez l'homme. C R Acad
Sci Paris.1948;142:241243.
(11) Stroun M, et al. About the possible origin and mechanism of circulating DNA
apoptosis and active DNA release. Clin Chim Acta. 2001; 313:139142
(12) Stroun M, et al. The origin and mechanism of circulating DNA. Ann NY Acad Sci
2001; 906:161168
(13) Stroun M, et al. Isolation and characterization of DNA from the plasma of cancer
patients. Eur J Cancer Clin Oncol. 1987; 23:707712
(14) Stroun M, et al. Neoplastic characteristics of the DNA found in the plasma of cancer
patients. Oncology. 1989; 46:318322
(15) Fourni GJ, et al. Plasma DNA as a marker of cancerous cell death. Investigations in
patients suffering from lung cancer and in nude mice bearing human tumours. Cancer
Lett. 1995; 91:221227.

29
(16) Anker P, et al. Detection of circulating tumor DNA in the blood (plasma/serum) of
cancer patients. Cancer Metastasis Rev. 1999;18:6573.
(17) Anker P, et al. Circulating nucleic acids in plasma and serum as a noninvasive
investigation for cancer: Time for large-scale clinical studies. Int J
Cancer. 2003;103:149152.
(18) Gal S, et al. Quantitation of circulating DNA in the serum of breast cancer patients
by real-time PCR. Br J Cancer. 2004; 90:12111215.
(19) Schwarzenbach H, et al. Cell-free nucleic acids as biomarkers in cancer patients. Nat
Rev Cancer. 2001;11:426437.
(20) Kohler C, et al. Cell-free DNA in the circulation as a potential cancer
biomarker. Anticancer Res. 2011;31:26232628.
(21) Dressman D, et al.Transforming single DNA molecules into fluorescent magnetic
particles for detection and enumeration of genetic variations. Proc Natl Acad Sci.
2003;100:881722.

(22) Li M, et al. BEAMing up for detection and quantication of rare sequence variants.
Nat Methods. 2006; 3:9597

(23) Fleischhacker M, et al. Cell-free DNA resuscitated for tumour testing. Nat Med
2008; 14:914915
(24) Andersson Y, et al. Breast Cancer Survival in Relation to the Metastatic Tumor
Burden in Axillary Lymph Nodes. J Clin Oncol. 2010; 28:2868-2873
(25) Norton S. et al. A New Blood Collection Device Minimizes Cellular DNA Release
During Sample Storage and Shipping When Compared to a Standard Device. J Clin Lab
Anal. 2013. 27:305311.
(26) Rainen et al. Stabilization of mRNA Expression in Whole Blood Samples. Clinical
Chemistry. 2002; 48:1883-1890
(27) Rainen L, et al. Performance of the PAXgene Blood DNA Tube for the Collection,
Transport, and Storage of Whole Blood and the Purification of DNA Using the
QIAsymphony Instrument. PreAnalytiX GmbH, 8634
Banfi G, et al, The role of ethylenediamine tetraacetic acid (EDTA) as in vitro
anticoagulant for diagnostic purposes. Clin Chem Lab Med. 2007; 45:56576
29) Norton, et al. A New Blood Collection Device Minimizes Cellular DNA Release
During Sample Storage and Shipping When Compared to a Standard Device. J Clin Lab
Anal. 2013; 27:305311.

30
 PATRICIA L. VALDA TORO
3900 N. Charles St. Apt 916. Baltimore, MD 21218
pvalda1@jhu.edu
Cell phone: 410-336-3292

EDUCATION
Johns Hopkins University Baltimore, MD
Master of Science in Molecular and Cellular Biology Sept 2013 - May 2014
Thesis: Detection of PIK3CA Mutations in Plasma Tumor DNA
Circulating in Peripheral Blood of Breast Cancer Patients

Bachelor of Science in Molecular and Cellular Biology Sept 2009 - May 2013
Science GPA: 3.88, Cumulative GPA: 3.86

HONORS
- Graduated with General Honors and Departmental Honors
- Deans list: Fall (2009) - Spring (2013)
- Commemorated in JHMI Milestone Celebration for being on JHU Deans List (2012).
- TriBeta National Biological Honor Society: membership (2012 - Present).
- The Latino Pre-Health Honor Society of The Johns Hopkins
University: Co Vice President (2012 - Present).
- Golden Key International Honor Society: Diploma and membership: top 15% GPA
range among juniors and seniors at JHU (2011 - Present).
- The National Society of Collegiate Scholars: Academic excellence, diploma and
membership (2010 - present).

Saint Andrews School La Paz, Bolivia

High School Diploma Jan 2005 Nov 2008
Cummulative GPA: 4.0 (4.0 scale).

HONORS
- Best GPA in entire highschool (300 students, 4 years)
- Academic Excellence Diploma Saint Andrews School (12 years).
- National Asociation of Private Schools: best GPA in Saint Andrews School (4 years).
- Municipal Government: academic outstanding among 100 private schools in La Paz (2008).
- The National Society of High School Scholars: certificate academic excellence (2008).
- Global Young Leaders Conference: certificate for acedmic performance and leadership (2008).

PUBLICATIONS AND PRESENTATIONS

- Jelovac D, Beaver J.A., Balukrishna S, Wong H.Y., Valda Toro P, et al. A PIK3CA mutation
detected in plasma from a patient with synchronous primary breast and lung cancers. Human
Pathology. 2013; 45: 880883
- Beaver J.A., Jelovac D, Balukrishna S, Valda Toro P, et al. Detection of of Cancer Specific
Mutations in Plasma of Early Stage Breast Cancer Patients. Clin Can Res. 2013; 20:1709-1718
- Cochran R. Cravero K, Chu D, Valda Toro P., et al. Analysis of BRCA2 loss-of-heterozygosity
in tumor tissue using droplet digital PCR. Human Pathology. 2014. Accepted manuscript.
- Beaver J.A., Valda P, et al. Abstract SY11-01: Plasma tumor DNA: Changing the paradigm for
administering systemic therapies. Cancer Research. 2013; 73: 1538-7445

31
- Beaver J.A., Balukrishna S, Valda Toro P, Sensitivity for Detecting PIK3CA Mutations in Early-
Stage Breast Cancer with Droplet Digital PCR. ASCO. 2013. Abstract Annual Meeting
- Valda Toro P. Plasma tumor DNA identifies cancer specific PIK3CA mutations in early stage
breast cancer through BEAMing. Johns Hopkins University. 2013. Poster presentation in the Tri-
Beta Annual Poster Session

RESEARCH EXPERIENCE
Research Assistant, Laboratory of Ben Ho Park, M.D., Ph.D. Baltimore, MD
The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins June 2012- Present
- Design a novel protocol for selecting genomic rearrangements using DNA pull-down.
- Studied the feasibility and optimization of detecting cancer in the peripheral blood of patients
using digital PCR platforms.
- Assist in the analysis of genetic variances using conventional PCR followed by Sanger
Sequencing and droplet digital PCR.
- Maintain laboratory equipment, monitor inventory supplies and clean working areas.

Research Assistant, Laboratory of Trina Schroer, Ph.D. Baltimore, MD

Biology Department, Johns Hopkins University . July 2011 May 2012
- Studied the binding orientation between subunits of the motor protein dynein and it adaptor.
- Analyzed protein constructs cloned in bacterial expression vectors.
- Attended weekly lab meetings.

TEACHING EXPERIENCE
Teaching Assistant,Biology Department Baltimore, MD
Johns Hopkins University Sept 2013- Present
- Teach hands-on laboratory techniques for biological research to 20 undergraduates weekly.
- Grade assignments, proctor exams and help students understand basic biological concepts.

Tutor, The Learning Den, Baltimore, MD

Johns Hopkins University Jan 2011 April 2013
- Tutored groups of 6 undergraduates in problem-solving in Organic Chemistry and Spanish.

EXTRACURRICULAR ACTIVITIES
Co Vice-President, Lambda Epsilon Mu Baltimore, MD
The Latino Pre-Health Honor Society of Johns Hopkins University April 2013 Present
- Contact physicians and other healthcare representatives for participation in university events.
- Coordinate visits to medical conferences and alocate resources for transportation.

Community Service Chair, Golden Key International Honor Society Baltimore, MD

Johns Hopkins University Chapter Sept 2012 May 2013
- Mobilized funds, recruited volunteers, and contacted representatives for service opportunities.
- Organized a fundraiser with Medlife student group for mobile clinics in South America.

Secretary, Advertising Chair, SALUD Baltimore, MD

Johns Hopkins Latino Hispanic Health Initiative Group April 2011 May 2013
- Managed the email account, outreached to find guest speakers.
- Organized meetings, designed an anual agenda of events, designed advertisements.
- Launched a new tutoring project for children struggling with English as a second language to
accomadate new volunteers.

32
COMMUNITY SERVICE
Volunteer, Hospital del Nio La Paz, Bolivia
Public Pediatric and Adolescent Hospital Dec 2013
- Documented medical histories for diagnosis during clinical rounds.
- Took dictations during outpatient consultations in hospital units.
- Admitted patients and healed wounds/burns in the Emergency Room.

Volunteer, Home Care for a Patient with Multiple Sclerosis Baltimore, MD

- Help with paperwork, email account and schedule. Sept 2013 Present
- Feed the patient and assist her with physical therapy.

Volunteer, Baltimore City Health Department East Carolina Clinic Baltimore, MD

Sexually Transmitted Disease Division March 2010 April 2011
- Served as a Spanish-English translator during outpatient consultations.
- Assisted patients in interpreting test results, organized medical records.

SKILLS
Laboratory: Droplet Digital PCR, Taqman probe/primer/nested primer design, WGA, Sanger
Sequencing, tissue culture, DNA extraction (plasma, FFPE), protein and DNA Magnetic Bead
Pulldown, PCR optimization, digestions, dsDNA fragmentation, Random Hexamer DNA
elongation, clonning, transformations into E. coli, protein purification by affinity
chormatography, gel filtration and sucrose gradient sedimentation, SDS-PAGE, Western Blots.
Systems: Bio-Rad QX100TM ddPCRTM, NCBI Blast, ApE. A Plasmid Editor, CLC Sequence
Viewer 6, Finch TVDNA sequence chromatogram trace viewer, MS Office (Windows/Mac).
Certifications: HIPAA, Lab Assitant: Lab and Fire Safety, Hazard Communication, Compliance
Awareness (Hopkins Medicine).
Language: Fluent in Spanish-English.

33