Sei sulla pagina 1di 266

ANALYSIS OF PHENOLICS FROM CENTELLA ASIATICA

AND VERNONIA AMYGDALINA AND THEIR ROLE AS


ANTIBACTERIAL AND ANTIOXIDANT COMPOUNDS

SUZANNA A/P EDGAR

DISSERTATION SUBMITTED IN FULFILLMENT OF


THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF BIOTECHNOLOGY

INSTITUTE OF BIOLOGICAL SCIENCES


FACULTY OF SCIENCE
UNIVERSITY OF MALAYA
KUALA LUMPUR

2014
ABSTRACT

Six species of Malaysian medicinal plants were selected on the basis of their known

medicinal values. The plants chosen were Aloe vera - leaf and pulp, Azadirachta indica -

leaf, Carica papaya - leaf, Centella asiatica - whole plant, Hymenocallis speciosa - leaf,

tuber and root, Vernonia amygdalina - leaf and stem. Aqueous and ethanolic extract of the

plant tissues were tested for their antimicrobial properties against five test microorganisms.

Of the six plants tested, the aqueous and ethanolic extract of C. asiatica (whole

plant) exhibited highly significant antimicrobial activity against the bacterial strains while

the ethanolic extract of Vernonia amygdalina (leaf) showed distinct inhibition only towards

B. cereus. C. asiatica and V. amygdalina were selected as candidates for further evaluation

of their medicinal properties.

Ammonium sulphate precipitation was conducted to determine if antimicrobial

activity was due to peptides present in the plant. The antimicrobial activity for ethanolic

plant extracts was observed in the supernatant with their pellet showing insignificant

antimicrobial activity. The highest antimicrobial activity was observed in the ammonium

sulphate supernatant of C. asiatica against S. aureus and B. cereus. Since phenolic

compounds are responsible for their antimicrobial and antioxidant properties, they were

investigated in C. asiatica and V. amygdalina.

Total phenolic content (TPC) of plant extracts were determined with Folin-

Coicalteu assay. In C. asiatica, the TPC of the ethanolic extract was the highest 4.006

0.032 mg GAE/g d.w followed by methanolic extracts 3.346 0.029 mg GAE/g d.w and

aqueous extracts 1.120 0.063 mg GAE/g d.w. In V. amygdalina, the TPC was highest in

methanolic extract 1.168 0.101 mg GAE/g d.w, followed by aqueous extract and

ethanolic extract had the lowest TPC.


ii
Abstract

The antioxidant properties of the extracts were determined by DPPH radical

scavenging assay and FRAP. Using the DPPH assay, ethanolic extract of C. asiatica

showed high radical scavenging activity whereas the lowest activity was observed in the

aqueous extracts. All three extracts of V. amygdalina showed weak radical scavenging

activity. Using the FRAP assay, reducing capability of C. asiatica and was observed as

methanol > ethanol > aqueous > ascorbic acid and the reducing capability of V.

amygdalina extracts was observed as methanol > aqueous > ethanol > ascorbic acid.

Protective effect of the plant extracts were tested against hydrogen peroxide induced

haemolysis in vitro. The ethanolic and methanolic extracts of C. asiatica and V.

amygdalina showed strong protective effect against hydrogen peroxide.

Biologically active phenolic compounds present were elucidated with reverse-

phase high performance liquid chromatography (RP-HPLC), liquid chromatography

mass spectroscopy (LC-MS) and fourier transform infrared spectroscopy (FT-IR). RP-

HPLC of C. asiatica methanolic extract presented two major compounds:

chloramphenicol and benzoic acid. The identification of these compounds was

confirmed by FT-IR analysis.

The phenolic compounds in V. amygdalina were not well separated hence LC-

MS was done. Analysis by LC-MS identified thirty eight phenolic compounds in C.

asiatica and forty in V. amygdalina including gallic acid derivatives, hydroxybenzoic

acid, hydroxycinnamic acid, flavonoids, purine alkaloids and phenolic terpenes and

lignins. Amongst them, the presence of phloridzin which is known for its antidiabetic

properties was detected in the methanolic extract of V. amygdalina.

iii
Abstrak

ABSTRAK

Enam spesies tumbuhan perubatan Malaysia telah dipilih berdasarkan nilai-nilai

perubatan mereka yang diketahui. Tumbuh-tumbuhan yang dipilih adalah Aloe vera -

daun dan pulpa, Azadirachta indica - daun, Carica papaya - daun, Centella asiatica

seluruh tumbuhan, Hymenocallis speciosa - daun, ubi dan akar, Vernonia amygdalina -

daun dan batang. Ekstrak berair dan etanol tisu tumbuhan telah diuji untuk aktiviti

antimikrobial mereka terhadap lima mikroorganisma ujian.

Daripada enam tumbuhan yang diuji, ekstrak berair dan etanol C. asiatica

(seluruh tumbuhan) menunjukkan aktiviti antimikrobial yang amat ketara terhadap

semua mikroorganisma yang diuji manakala ekstrak etanol daripada V. amygdalina

(daun) menunjukkan aktiviti yang ketara hanya terhadap B. cereus. C. asiatica dan V.

amygdalina telah dipilih untuk membuat penyilidikan lanjut terhadap ciri-ciri perubatan

mereka.

Presipitasi ammonium sulfat telah dilakukan untuk menentukan samada aktiviti

antimikrobial adalah berdasarkan peptida yang hadir dalam tumbuhan. Didapati bahawa

aktiviti antimikrob adalah dalam supernatan dengan pelet menunjukkan aktiviti yang

tidak jelas bagi kedua-dua ekstrak etanol tumbuhan yang dikaji. Diperhatikan bahawa

aktiviti antimikrobial adalah tertinggi bagi supernatan C. asiatica terhadap S. aureus

dan B. cereus. Tatkala sebatian fenol mempengaruhi kegiatan antimikrob serta

antioksida, ia telah dikaji dalam C. asiatica dan V.amygdalina.

Kandungan fenol keseluruhan dalam ekstrak tumbuhan telah ditentukan dengan

ujian Folin-Coicalteu. Kandungan fenol keseluruhan dalam C. asiatica adalah tertinggi

dalam ekstrak etanol iaitu sebanyak 4.006 0.032 mg GAE/g d.w diikuti oleh ekstrak

methanol sebanyak 3.346 0.029 mg GAE/g d.w dan ekstrak berair 1.120 0.063 mg

GAE/g d.w. Kandungan fenol dalam V. amygdalina pula adalah tertinggi bagi ekstrak

iv
Abstrak

methanol iaitu sebanyak 1.168 0.101 mg GAE /g d.w, diikuti oleh ekstrak berair dan

ekstrak etanol mempunyai kandungan fenol yang terendah.

Ciri-ciri antioksida ektrak tumbuhan telah ditentukan dengan ujian DPPH serta

FRAP. Ekstrak etanol C. asiatica menunjukkan aktiviti memerangkap radikal yang

tinggi manakala aktiviti terendah telah diperhatikan dalam ekstrak berair. Ketiga-tiga

ekstrak V. amygdalina menunjukkan aktiviti memerangkap radikal yang lemah. Dengan

menggunakan ujian FRAP, aktiviti pengurangan bagi ekstrak C. asiatica adalah

diperhatikan seperti berikut methanol > etanol > berair > asid askorbik. Manakala

aktiviti pengurangan bagi ekstrak V. amygdalina adalah diperhatikan seperti berikut

methanol > berair > etanol > asid askorbik. Keupayaan antihemolisis ekstrak

tumbuhan yang dikaji telah ditentukan dengan menggunakan ujian hemolisis in vitro

dengan eritrosit arnab. Ekstrak methanol C. asiatica telah menunjukkan keupayaan

melindungi tertinggi terhadap hidrogen peroksida, ini diikuti dengan ekstrak etanol,

manakala ekstrak berair menunjukkan kesan yang tidak tetap. Bagi Vernonia

amygdalina pula, ekstrak etanol serta methanol telah menunjukkan keupayaan

melindungi yang tinggi terhadap hidrogen peroksida manakala ekstrak berairnya

didapati mempunyai keupayaan melindungi yang terendah.

Sebatian fenol yang hadir dalam ekstrak tumbuhan telah ditentukan dengan

reverse-phase high performance liquid chromatography (RP-HPLC), liquid

chromatography mass spectroscopy (LC-MS) serta fourier transform infrared

spectroscopy (FT-IR). RP-HPLC ekstrak metanol C. asiatica telah membentangkan dua

komponen penting iaitu kloramfenikol serta asid benzoik. mengenalpasti sebatian fenol

yang hadir. Pengenalpastian dua kompoun fenolik ini telah disahkan oleh analisis FT-

IR. Komponen fenol tidak dapat ditentukan bagi V. amygdalina, maka LCMS telah

dijalankan.

v
Abstrak

Analisis dengan LC-MS pula telah mengenalpasti kehadiran tiga puluh lapan

sebatian fenolik serta empat puluh dalam V. amygdalina termasuk derivatif gallic, asid

hydroksibenzoic, asid hydroksicinamik, flavonoid, alkaloid purin, terpen fenolik dan

lignin. Phloridzin yang telah dikesan dalam ekstrak methanol V. amygdalina. memiliki

ciri-ciri antidiabetik.

vi
ACKNOWLEDGEMENTS

Firstly, I would like to praise and thank my Lord Jesus for helping me complete
my thesis and Masters. I want to praise and thank HIM for helping me to overcome
obstacles throughout this research and for His favour in allowing me to meet the right
people to help me with my studies.

Secondly, I want to thank Prof Sekaran Muniandy, the best supervisor for his
constant help and intelligent advice. I cannot thank him enough for his encouragement
and support throughout the period of my research. Prof Sekaran was always there to
meet, proofread and correct my thesis chapter by chapter in spite of his busy schedule.
He thought me how to express my ideas and gave me inspiring advice to approach my
research. My thesis would fail to exist if not for his constant guidance.

Next I want to thank my supervisor, Dr. Koshy Phillip for his support and ideas
throughout my thesis. My special thanks also goes to Dr. Sugumaran Manickam and the
staffs from the Herbarium, Institute of Biological Sciences, UM for helping me voucher
deposit all the medicinal plants used in my study.

Friends are worth more than jewels. I would like to acknowledge my lab mate
Wong Shin Yee for constantly being there for me and helping me out with quotations
for chemicals. Shin Yee also taught me aseptic methods in handling the bacterias used
in the study. I would also like to thank my dear friend Dr. Kadijeh Gholami for her
moral support and help in the lab.

A big thank you to the supporting staff of the Department of Molecular


Medicine, UM : Pn. Zuraini Zubir, Pn. Norazlina Addul Aziz, Pn. Noor Faezah Paizan,
En. Khairy Mohamad Nor, Pn. Puziyah Baharom, En. Joesima Hamid and Pn. Umi
Kalthum Haron for always providing technical assistance of the instruments in the
Depament and other services with a smile.

My sincere gratitudes also go out to the staffs and lab technicians in the
Department of Chemistry, Faculty of Science UM for tirelessly helping me analyse my
plant extracts using the LC-MS, FT-IR, and NMR instrument available in their
department. I would like to thank the staffs in the Department of Biotechnology, Faculty
of Medicine, UM for helping me with the Gel Documentation Instrument and Nanodrop
used in this study.

Last, but not the least I would like to extend my deepest gratitude to my mother,
for her patience, tolerance, emotional support and encouragement throughout my
research. I also want to thank her for the financial support she has given me without any
complains. Her love and never ending sacrifices has brought me so far. I would like to
also dedicate my thesis to my late grandmother who is the driving force behind my
determination to finish my studies. Thanks ama for your constant encouragement and
advice to pursue my studies.

vii
TABLE OF CONTENT

ABSTRACT ...................................................................................................ii
ABSTRAK .................................................................................................... iv
ACKNOWLEDGEMENTS .........................................................................vii
TABLE OF CONTENT ............................................................................. viii
LIST OF FIGURES .................................................................................... xiii
LIST OF TABLES ....................................................................................... xv
LIST OF SYMBOLS AND ABBREVIATIONS ......................................xvii

1.0 INTRODUCTION ................................................................................ 1


1.2 Objectives of the research ................................................................................................. 5

2.0 LITERATURE REVIEW ..................................................................... 6


2.1 Medicinal Plants as Antimicrobial Agents ........................................................................ 6
2.2 Medicinal Plants of Malaysia ............................................................................................ 8
2.3 Plant Derived Antibiotics .................................................................................................. 9
2.3.1 Phytoalexins ........................................................................................................ 10
2.3.2 Phytoanticipins .................................................................................................... 11
2.4 Bioactive Components in Plants ..................................................................................... 12
2.4.1 Phenolic compounds ........................................................................................... 13
2.4.1.1 Simple phenols and phenolic acids ................................................................ 14
2.4.1.2 Coumarins ...................................................................................................... 15
2.4.1.3 Quinones ........................................................................................................ 17
2.4.1.4 Flavones, flavanol and flavanoids .................................................................. 18
2.4.1.5 Tannins ........................................................................................................... 19
2.4.2 Terpenoids and Essential oils .............................................................................. 20
2.4.3 Alkaloids ............................................................................................................. 22
2.4.4 Lectins and Polypeptides..................................................................................... 23
2.5 Antioxidant Activity of Plant Phenols ............................................................................ 24
2.6 Selection of Plant Species for Investigation .................................................................... 26
2.6.1 Aloe vera (L.) Burm. f. (A. vera) ......................................................................... 26
2.6.2 Azadirachta indica A. Juss (A. indica)................................................................ 29
2.6.3 Carica papaya Linn. (C. papaya) ....................................................................... 32

viii
Table of content

2.6.4 Centella asiatica Linn. (C. asiatica) ................................................................... 34


2.6.5 Hymenocallis speciosa (Salisb.) (H. speciosa) ................................................... 36
2.6.6 Vernonia amygdalina Del. (V. amygdalina) ....................................................... 38
2.7 General Extraction of Bioactive Compounds from Plants .............................................. 41
2.7.1 Collection and drying of plant materials ............................................................. 41
2.7.2 Choice of Solvent ................................................................................................ 42
2.7.3 Extraction technique............................................................................................ 43
2.8 Test Microorganism Used in the Study ........................................................................... 45
2.8.1 Bacillus cereus (B. cereus) .................................................................................. 46
2.8.2 Escherichia coli (E. coli)..................................................................................... 48
2.8.3 Pseudomonas aeruginosa (P. aeruginosa).......................................................... 51
2.8.4 Staphylococcus aureus (S. aureus)...................................................................... 53
2.8.5 Streptococcus mutans (S.mutans)........................................................................ 55

3.0. MATERIALS AND METHODS ...................................................... 57


3.1. Selection of Plant Samples .............................................................................................. 58
3.2. Preparation of Plant Materials ......................................................................................... 59
3.2.1. Preparing plant leaf, root and tuber ..................................................................... 59
3.2.2. Preparation of Aloe vera (A. vera) pulp .............................................................. 59
3.3 Extraction Procedure of Plant Samples ........................................................................... 60
3.3.1 Aqueous extraction.............................................................................................. 60
3.3.2 Ethanolic and methanolic extraction. .................................................................. 60
3.3.3 Determination of percentage of yield for plant extracts ...................................... 61
3.4. Authentication of Selected Medicinal Plant with DNA Barcoding Method ................... 62
3.4.1 DNA extraction ................................................................................................... 62
3.4.2 Polymerase Chain Reaction (PCR) amplification ............................................... 63
3.4.3 Agarose gel electrophoresis ................................................................................ 64
3.4.4 PCR product purification .................................................................................... 66
3.4.5 DNA sequencing ................................................................................................. 67
3.5 Antimicrobial Susceptibility Test ................................................................................... 68
3.5.1 Test microorganisms used in the study ............................................................... 68
3.5.2 Preparation of Muller Hinton agar medium ........................................................ 69
3.5.3 Preparation of inoculums .................................................................................... 69
3.5.4 Antimicrobial assay ............................................................................................ 70
3.5.5 Measuring the zone of inhibition ........................................................................ 71
3.5.6 Statistical analysis ............................................................................................... 71
3.6 Saturated Ammonium Sulphate Precipitation of Plant Peptides ..................................... 72
ix
Table of content

3.7 Determination of Total Phenolic Content (TPC). ........................................................... 74


3.7.1 Gallic acid calibration standard preparation........................................................ 74
3.7.2 Sodium carbonate preparation............................................................................. 75
3.7.3 Folin-Ciocalteu assay .......................................................................................... 75
3.7.4 Calculation of total phenolic content of plant samples ....................................... 76
3.7.5 Statistical analysis ............................................................................................... 76
3.8 Antioxidant Assay ........................................................................................................... 77
3.8.1 DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical scavenging activity assay ........ 77
3.8.1.1 Preparing standard, positive control and sample ............................................ 77
3.8.1.2 DPPH assay .................................................................................................... 78
3.8.1.3 Calculation of antioxidant capacity in plant of study ..................................... 79
3.8.2 Ferric Reducing Antioxidant Power (FRAP) Assay ........................................... 80
3.8.2.1 Preparing reagent, standard, positive control and sample .............................. 80
3.8.2.2 FRAP assay .................................................................................................... 81
3.8.2.3 Calculation of antioxidant capacity ................................................................ 82
3.8.3 Investigation of the Protective Effect of the Test Plant Against Hydrogen
Peroxide (H2O2) Induced Red Blood Cell Lysis. ................................................ 83
3.8.3.1 Preparation of rabbit erythrocyte suspension ................................................. 83
3.8.3.2 In vitro anti-haemolysis assay ........................................................................ 83
3.8.3.3 Calculation of anti-haemolytic activity .......................................................... 84
3.9 Correlation between the Phenolic Compounds with the Antimicrobial and
Antioxidant Activity of C. asiatica and V. amygdalina Extracts ................................... 85
3.9.1 Correlation between the Total Phenolic Content (TPC) and Antimicrobial
Activity of C. asiatica and V. amygdalina Extracts. ........................................... 85
3.9.2 Correlation between the Total Phenolic Content (TPC) and Antioxidant
Activity and between Antioxidant Assays of Extracts of C.asiatica and
V.amygdalina ...................................................................................................... 86
3.10 Reverse-Phase High Performance Liquid Chromatography (RP-HPLC) ....................... 87
3.10.1 Preparing the mobile phase ................................................................................. 87
3.10.2 Pre-treatment of plant crude extracts .................................................................. 87
3.10.3 Preparing standards for comparison .................................................................... 87
3.10.4 Instrumentation and analytical conditions........................................................... 88
3.10.5 Identification and Quantitation............................................................................ 89
3.11 Fourier Transform Infrared Spectroscopy (FT-IR) ......................................................... 90
3.12 Liquid Chromatography Mass Spectroscopy (LC-MS) Analysis ................................ 90
3.12.1 Preparing the mobile phase ................................................................................. 90
3.12.2 Pre-treatment of plant crude extracts .................................................................. 90
3.12.3 Instrumentation and analytical conditions........................................................... 91

x
Table of content

4.0 RESULTS ........................................................................................... 92


4.1 Extraction Yield of the Selected Medicinal Plants.......................................................... 92
4.2 Preliminary Screening of Medicinal Plants for Antimicrobial Activity by Well
Diffusion Assay.............................................................................................................. 93
4.3 Authentication of Selected Medicinal Plants by DNA Barcoding .................................. 97
4.4 Extraction Yield and Antimicrobial Activity in Aqueous, Ethanolic and Methanolic
Extracts of C. asiatica and V. amygdalina ..................................................................... 99
4.5 Antimicrobial Activity after Ammonium Sulphate Precipitation of Ethanolic
Extracts. ....................................................................................................................... 103
4.6 Total Phenolic Content (TPC) in C. asiatica and V. amygdalina ................................. 105
4.7 Antioxidant Activity in C. asiatica and V. amygdalina ................................................ 106
4.7.1 DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical scavenging activity ................ 106
4.7.2 Ferric reducing antioxidant power (FRAP) assay ............................................. 108
4.7.3 Protective Effect of Extracts of C. asiatica and V. amygdalina Against
Hydrogen Peroxide (H2O2) Induced Haemolysis. ............................................. 111
4.7.4 Antioxidant capacity of C. asiatica and V. amygdalina extracts ...................... 115
4.8 Relationship between the Phenolic Compounds with the Antimicrobial and
Antioxidant Activity of C. asiatica and V. amygdalina Extracts. ................................ 118
4.8.1 Relationship between the Phenolic Compounds and Antimicrobial Activity
of Plant Extracts ................................................................................................ 118
4.8.2 Relationship between the Phenolic Compounds and Antioxidant Activity and
Relationship between the Antioxidant Assays of the Plant of Study. ............... 122
4.9 Comparison of the Bioactivity in the Aqueous Ethanolic and Methanolic extracts of
C. asiatica and V. amygdalina ..................................................................................... 127
4.10 Reverse Phase High Performance Liquid Chromatography (RP-HPLC) Analysis of
Phenolic Compounds in Extracts of C. asiatica and V. amygdalina............................ 128
4.11 Fourier Transform Infrared Spectroscopy (FT-IR) analysis of major peaks from C.
asiatica. ........................................................................................................................ 132
4.12 Identification of Phenolic Compounds in Methanolic Extract of C. asiatica and V.
amygdalina by Liquid Chromatography-Mass Spectroscopy (LC-MS) ...................... 134

5.0 DISCUSSION ................................................................................... 138


5.1 Choice of Plant Used in the Study ................................................................................ 138
5.2 Extraction Yield and Antimicrobial Activity of the Medicinal Plants Screened .......... 139
5.3 Authentication of the Medicinal Plants in the Study..................................................... 144
5.4 Antimicrobial Activity after Ammonium Sulphate Precipitation of Ethanolic
Extracts ........................................................................................................................ 145
5.5 Total phenolic content (TPC) ........................................................................................ 146
5.6 Antioxidant Activity in the Plant of Study .................................................................... 148
5.6.1 DPPH (2, 2-diphenyl-1-picrylhydrazyl) Radical Scavenging Activity Assay .. 148
xi
Table of content

5.6.2 Ferric Reducing Antioxidant Power (FRAP) Assay ......................................... 150


5.6.3 Protective Effects of the Plant of Study against Hydrogen Peroxide Induced
Red Blood Cell Lysis ........................................................................................ 152
5.7 Relationship between Phenolic Compounds and Bioactivity........................................ 154
5.7.1 Relationship between Phenolic Compounds and Antimicrobial Activity ......... 154
5.7.2 Relationship between Phenolic Compounds and Antioxidant Activity ............ 155
5.8 Bioactivity of Aqueous, Ethanolic and Methanolic extracts of C. asiatica and V.
amygdalina. .................................................................................................................. 157
5.9 Identification of Phenolic Compounds through Reverse Phase High Performance
Liquid Chromatography (RP-HPLC) and Fourier Transform Infrared Spectroscopy
(FT-IR) 158
5.10 Liquid Chromatography-Mass Spectroscopy Analysis of the Plant extracts ................ 161

6.0 CONCLUSION ................................................................................. 163

REFERENCES ........................................................................................... 166

APPENDICES ............................................................................................ 206


Appendix A. Plants Selected in the Study.............................................................................. 206
Appendix B. Voucher Deposit of Selected Plants ................................................................. 207
Appendix C. Well Diffusion Assay ....................................................................................... 209
Appendix D. Antimicrobial Activity of Plant Extracts by Well Diffusion Assay ................. 210
Appendix E. BLAST Query Search from the NCBI Database for the DNA Sequence of
the Selected Medicinal Plants ........................................................................... 214
Appendix F. Total Phenolic Content (TPC) Determination by Folin-Ciocalteu Assay ........ 218
Appendix G. Results of DPPH Radical Scavenging Activity ................................................ 219
Appendix H. Results of FRAP Assay for the Extracts of C. asiatica and V. amygdalina ..... 221
Appendix I. Results for the Protective Effect of C. asiatica and V. amygdalina Extracts
against Hydrogen Peroxide Induced Haemolysis of Rabbit Erythrocytes ........ 223
Appendix J. Homogenous Peak Test of the Methanolic Extract of C. asiatica .................... 227
Appendix K. LC-MS Mass Spectrum of the Extracts of C. asiatica V. amygdalina ............. 228
Appendix L. Protocol and Data Sheet in the Study ............................................................... 242
1. Protocol used for the plant DNA extraction kit ................................................. 242
2. Manual for DNA Purification Kit. .................................................................... 244

xii
LIST OF FIGURES

Figure 1- 1: Examples of plant phytoalexin structures ............................................ 10


Figure 1- 2: Examples of plant antibiotic phytoalexin structures ............................ 11
Figure 1- 3: Examples of simple phenols and phenolic acids .................................. 14
Figure 1- 4: Examples of coumarins ........................................................................ 16
Figure 1- 5: Examples of quinone ............................................................................ 17
Figure 1- 6: Examples flavones, flavonoids and flavonols ...................................... 18
Figure 1- 7: Examples of tannins ............................................................................. 19
Figure 1- 8: Examples terpenoids and essential oils ................................................ 21
Figure 1- 9: Examples of alkaloids .......................................................................... 22
Figure 1- 10: Example of peptide............................................................................... 23
Figure 1- 11: Aloe vera (L.) Burm. f. ......................................................................... 27
Figure 1- 12: Azadirachta indica A. Juss ................................................................... 30
Figure 1- 13: Carica papaya Linn. ............................................................................ 33
Figure 1- 14: Centella asiatica Linn. ......................................................................... 35
Figure 1- 15: Hymenocallis speciosa (Salisb.)........................................................... 37
Figure 1- 16: Vernonia amygdalina Del. ................................................................... 38
Figure 1- 17: Morphology of B. cereus ...................................................................... 46
Figure 1- 18: Morphology of E. coli .......................................................................... 49
Figure 1- 19: Morphology of P. aeruginosa .............................................................. 51
Figure 1- 20: Morphology of S. aureus ...................................................................... 54
Figure 1- 21: Morphology of S. mutans ..................................................................... 55
Figure 3- 1: Flow chart of the research .................................................................... 57
Figure 4-1: Extraction yield for medicinal plants screened in the study................. 92
Figure 4- 2: Agarose gel electrophoresis of PCR products subjected to DNA
barcoding with ITS2 primers................................................................ 97
Figure 4- 3: Sequence alignment of the ITS2 region for C. asiatica ....................... 98
Figure 4- 4: Sequence alignment of the ITS2 region for V. amygdalina. ................ 98
Figure 4- 5: The yield of extract for C. asiatica and V. amygdalina. .................... 100
Figure 4- 6: Antimicrobial activity of pellet and supernatant obtained from
ammonium sulphate precipitation of C. asiatica and V.
amygdalina ethanolic extracts ............................................................ 104

xiii
List of figures

Figure 4- 7 : Total phenolic content of extracts ...................................................... 105


Figure 4- 8: Percentage inhibition of DPPH radical .............................................. 107
Figure 4- 9: Ferric Reducing Antioxidant Power (FRAP) activity in C.
asiatica extracts .................................................................................. 109
Figure 4- 10: Ferric Reducing Antioxidant Power (FRAP) activity in V.
amygdalina extracts............................................................................ 110
Figure 4- 11: In vitro protective effect of C. asiatica against H2O2 induced
haemolysis of rabbit erythrocytes. ..................................................... 113
Figure 4- 12: In vitro protective effects of V. amygdalina against H2O2
induced haemolysis of rabbit erythrocytes. ........................................ 114
Figure 4- 13: Relationship between total phenolic content and antimicrobial
activity of C. asiatica extracts ............................................................ 119
Figure 4- 14: Relationship between total phenolic content and antimicrobial
activity of V. amygdalina extracts ...................................................... 120
Figure 4- 15: Relationship between total phenolic content and antimicrobial
activity of C. asiatica and V. amygdalina ethanolic extract............... 121
Figure 4- 16: Correlation between total phenolic content and antioxidant
capacity and between antioxidant capacities of C. asiatica
extracts. .............................................................................................. 124
Figure 4- 17: Correlation between total phenolic content and antioxidant
capacity and between antioxidant assays of V. amygdalina
extracts. .............................................................................................. 125
Figure 4- 19: Chromatogram of C. asiatica ............................................................. 130
Figure 4- 20: Chromatogram of V. amygdalina ....................................................... 131
Figure 4- 21: FT-IR Spectrum of C. asiatica major peaks ...................................... 133
Figure 4- 22: Total Ion Current (TIC) chromatogram of C. asiatica and V.
amygdalina methanolic extract by LC-ESI-MS analysis ................... 137

xiv
LIST OF TABLES

Table 3- 1: Plant species screened for antimicrobial activity ................................. 58


Table 3- 2: PCR Master Mix................................................................................... 64
Table 3- 3: PCR Thermocycler program ................................................................ 64
Table 3- 4: Test microorganism in study ................................................................ 68
Table 3- 5: Nomogram for ammonium sulphate precipitation ............................... 73
Table 3- 6: Concentration of gallic acid standard in Folin-Ciocalteu assay ........... 74
Table 3- 7: Concentration of sample and positive control in DPPH assay ............. 78
Table 3- 8: Concentration of standard, Trolox in DPPH assay .............................. 78
Table 3- 9: Concentration of ferrous sulphate FeSO4.7H2O in FRAP assay .......... 81
Table 3- 10: Solvent gradient profile in RP-HPLC for C.asiatica ........................... 88
Table 3- 11: Solvent gradient profile in RP-HPLC for V. amygdalina .................... 89
Table 4-1: Antimicrobial Activity of Aqueous Plant Extracts .............................. 95
Table 4- 2: Antimicrobial Activity of Ethanolic Plant Extracts ............................. 96
Table 4- 3: Antimicrobial Activity of C. asiatica................................................. 101
Table 4- 4: Antimicrobial Activity of V. amygdalina ........................................... 102
Table 4- 5: IC50 of DPPH radical scavenging assay ............................................. 106
Table 4- 6: IC50 values of the protective effect of extracts of C. asiatica
and V. amygdalina against H2O2 induced red blood cell lysis. .......... 112
Table 4- 7: Antioxidant Capacity of C. asiatica extracts and controls. ................ 116
Table 4- 8: Antioxidant Capacity of V. amygdalina extracts and controls. .......... 117
Table 4- 9: Correlation coefficient (r) between total phenolic content (TPC)
and antimicrobial activity of C. asiatica and V. amygdalina. ............ 118
Table 4- 10: Correlation coefficient (r) between total phenolic content and
antioxidant capacities and between antioxidant assays of C.
asiatica and V. amygdalina extracts. .................................................. 122
Table 4- 11: Bioactivity of C. asiatica and V. amygdalina extracts. ...................... 127
Table 4- 12: Retention time of standards for phenolic compounds of C.
asiatica ............................................................................................... 128
Table 4- 13: Retention time and concentration of phenolic compounds of
major peaks of C. asiatica methanolic extract ................................... 128
Table 4- 14: IR spectrum data of peak 6 from C. asiatica...................................... 132

xv
List of tables

Table 4- 15: IR spectrum data of peak 7 from C. asiatica...................................... 132


Table 4- 16: Phenolic compounds identified in methanolic extract of C.
asiatica by LC-MS ............................................................................. 135
Table 4- 17: Phenolic compounds identified in methanolic extract of V.
amygdalina by LC-MS ....................................................................... 136

xvi
LIST OF SYMBOLS AND ABBREVIATIONS

AU - absorbance unit
- alpha
ATCC - American Type Culture Collection
AMPs - Antimicrobial peptides
ANOVA - Analysis of variance
bp - base pair
- beta
BHA - butylated hydroxyanisole
BHT - butylated hydroxytoluene
C3 - carbon 3
C6 - carbon 6
cm - centimetres
R2 - coefficient of determinant
r - correlation coefficient
p - correlation coefficient
C - degree Celsius
DNA - deoxyribonucleic acid
DPPH - 2,2-diphenxl-1-picrylhydrazyl
FeCl3.6H2O - ferric (III) chloride
FRAP - Ferric Reducing Antioxidant Power
FeSO4.7H2O - ferrous sulphate
FT-IR - Fourier Transform Infrared Spectroscopy
g/l - gram per litre
HSV-1 - Herpes Simplex Virus-1
FeCl3 - iron (III) chloride haxahydrate
IPB - isotonic phosphate buffer
HCl - hydrochloric acid
H2O2 - hydrogen peroxide
OH - hydroxyl
HIV - Human Immunodeficiency Virus
ITS2 - Internal transcriber spacer 2

xvii
List of symbols and abbreviations

kDa - kiloDalton
LC-MS - Liquid Chromatography-Mass Spectroscopy
m - metres
- micro
ml - millilitre
mg/ml - milligram per millilitre
mM - millimolar
mg GAE/g d.w. - milligram gallic acid equivalent per gram dry weight
mmol AAE/g d.w. - milimole ascorbic acid equivalent per gram dried
weight
mmol Fe2+ /g d.w. - milimole ferrous sulphate per gram dried weight
mmol TE/g d.w. - milimole Trolox equivalent per gram dried weight
MS - mutans streptococci
nm - nanometre
O2- - oxide anion
PCR - Polymerase chain reaction
Tween 80 - Polyoxyethylene sorbitan mono-oleate
TBE-EDTA - Tris-Borate-EDTA
TFA - trifluoroacetic acid
RP-HPLC - Reverse Phase-High Performance Liquid
Chromatography
TMV - Tobacco Mosaic Virus
TPC - Total phenolic content
ROS - reactive oxygen species
RNA - ribonucleic acid
SD - standard deviation
TPTZ - 2,4,6-tri(2-pyridyl)-S-triazine
UTI - urinary tract infection
VZV - Varicella Zoster Virus
v/v - volume to volume
v/w - volume to weight

xviii
1.0 INTRODUCTION

Currently, the emergence of bacterial resistance towards antibiotics has become

a growing problem. Fleming (1929) discovered the first antibiotic, penicillin which was

a mould that was able to lyse Staphylococcus aureus cells. Pharmacological industries

have produced various new antibiotics ever since, but microorganisms have slowly

developed resistance to these drugs because bacteria have the genetic ability to transmit

and acquire resistance to drugs (Cohen, 1992).

Plants have been used to maintain human health because they possess chemical

compounds that are able to prevent and cure diseases (Nascimento et al., 2000).

Furthermore, plant products are a better alternative compared to antibiotics and other

synthetic drugs which display negative side effects such as sensitization reactions, and

disruption of the metabolic processes in the body via interaction with the body system

(Jamil et al., 2007). Hence antimicrobial agents from plants are a more reliable and

effective source to fight these microorganisms without the development of resistance.

Novel antimicrobial agents obtained from traditional medicinal plants can be

used to treat diseases and inhibit microbial infections (Hemaiswarya et al., 2008; Jain,

1994). These natural products exhibit selective toxicity towards pathogenic bacteria and

are generally harmless to host cells (Craig, 1998). The morphological parts of different

medicinal plants such as the leaves, seeds, stem, roots, fruits, sap, or tuber are prepared

as extracts, infusions, decoctions, powders and are utilized to treat various diseases in

humans, plants and animals (Nostro et al., 2000).

In various human cultures around the world, more than 35,000 plant species

have been exploited for medicinal purposes (Lewington, 1993). However, this number

could be inaccurate because knowledge on the indigenous uses of plants are usually not

1
Introduction

well documented and are passed on orally from one generation to another (Jantan,

2004).

Malaysia is covered by tropical rainforest which is home to more than 20,000

species of angiosperms and 600 species of ferns whereby 15% of angiosperms and 13%

of fern species were reported to possess medicinal properties (Puteh, 2005). Some of

these have been commonly used as folk medicine for hundreds of years (Zaidan et al.,

2005). Various compounds are synthesized by biologically and chemically diverse

plants in the tropical rain forest and these compounds act as defence agents against

microorganisms and diseases. Furthermore, knowledge of the medicinal and chemical

properties of these plants products could lead to the design and synthesis of new drugs

(Jantan, 2004).

Antimicrobial agents from plants target and destroy biochemical and

morphological components of microorganisms not found in host cells (Samy &

Gopalakrishnakone, 2010). Researchers are currently investigating natural sources such

as plant extracts for antimicrobial agents including phenolic compounds. Antimicrobial

agents in plants are plant secondary metabolites and are constantly present in active

forms in all plants but in some plants they are activated by plant tissue damage or

microbial infection (Osbourn, 1996). Major secondary metabolites in plants include

alkaloids, flavones (flavonoids, flavonols, quinones), essential oils, lectins,

polypeptides, phenolics, polyphenols, tannins and terpenoids (Samy &

Gopalakrishnakone, 2010).

Phenolic compounds are the largest group of secondary metabolites in plants

ranging from simple structures with one aromatic ring to complex polymers such as

tannins and lignins (Gurib-Fakim, 2006). These compounds serve as defence

metabolites to prevent infection and provide oxidative stability in case of injuries

(etkovi et al., 2007; Croteau et al., 2000). Various studies have established that

2
Introduction

simple phenolic acids are potent antimicrobial agents (Pereira et al., 2007; Kishimoto et

al., 2005; Stoilova et al., 2005; Winkelhausen et al., 2005; Ami et al., 2003).

According to a study conducted by Ami et al. (2003) phenolic compounds also

possess antioxidant properties and act by scavenging free radicals due to the presence of

conjugated ring structures or hydroxyl groups. Therefore it is important to closely study

the antioxidant properties of the plant alongside with their antimicrobial properties.

Antioxidants are substances that inhibit free radical-induced oxidative stress in

biological systems by neutralizing free radicals, quenching singlet and triplet oxygen,

and decomposing peroxides (Thirunavukkarasu et al., 2011; Anderson et al., 2001b).

Antioxidants protect the body against oxidative damage initiated by reactive oxygen

species. Oxidative damage is thought to be linked to diseases such as cancer, diabetes,

shock, arthritis, acceleration of the ageing process and tissue injuries (Shahidi, 1997).

Polyphenols found in medicinal plants are diverse compounds that possess

significant antioxidant capacities (Anderson et al., 2001b). It was deduced that

flavonoids (Pietta, Simonetti, & Mauri, 1998) phenolic acids, and phenolic diterpenes

(Shahidi et al., 1992) are the main phenolic compounds that contribute to the

antioxidant properties of plant extracts.

In this study, six medicinal plants of Malaysia that are common and easily

accessible: Aloe vera (aloe), Azadirachta indica (neem), Carica papaya (papaya),

Centella asiatica (pegaga), Hymenocallis speciosa (green-tinged spiderlily), and

Vernonia amygdalina (bitter leaf) were screened for antimicrobial activity. Plants that

showed significant antimicrobial activity Centella asiatica (C. asiatica) and Vernonia

amygdalina (V. amygdalina) were selected and further studies were conducted to

identify the compound(s) present in the plant responsible for the antimicrobial activities.

3
Introduction

C. asiatica is a member of the Umbelliferae family. This plant is a perennial

creeper, flourishing in moist areas, growing naturally in India, Sri Lanka, Madagascar,

Africa, Australia, China, Indonesia and Malaysia (James & Dubery, 2009). It has been

used in ayurvedic medicine for centuries for the treatment of wound healing, asthma,

ulcers, leprosy, lupus, vein diseases, and in memory enhancement (Orhan et al., 2013;

Hashim et al., 2011; James & Dubery, 2009). Extracts of this plant were found to be

antibacterial and antifungal in properties and also displaced anticancer and antioxidant

properties (Hashim et al., 2011).

V. amygdalina is a perennial shrub of 2 to 5 metres in height. It grows

throughout tropical Africa and is used to treat malaria, diabetes mellitus, gastrointestinal

tract conditions and sexually transmitted diseases. Currently grown in Malaysia, the

leaves are locally used for the treatment of hyperglycaemia in diabetes mellitus and

hypertension (Atangwho et al., 2013). V. amygdalina is a member of the Asteraceae

family. Based on recent studies conducted, extracts of this plant were found to be

antimicrobial, antifungal, anticancer and antidiabetic (Oga et al., 2013; Ijeh & Ejike,

2011). Antioxidant activity and phenolic content were reported in leaf extracts using

different extraction techniques (Atangwho et al., 2013; Fasakin et al., 2011; Salawu et

al., 2011; Anyasor et al., 2010; Owolabi et al., 2008) but bioactive phenolic compounds

responsible for the antioxidant activity were not identified.

The purpose of the research was to identify compound(s) from plant source that

are antimicrobial and to provide further information on the bioactive phenolic

compounds responsible for the antioxidant and antimicrobial activity in both C. asiatica

and V. amygdalina.

4
Introduction

1.2 Objectives of the research

1. To screen six medicinal plants for antimicrobial activity.

2. To evaluate the antioxidant capacity of selected plants that show strong

antimicrobial activity.

3. To identify the polyphenolic compounds present in the selected plants.

4. To evaluate correlations of polyphenolic compounds with the bioactivities.

5
2.0 LITERATURE REVIEW

2.1 Medicinal Plants as Antimicrobial Agents

Microorganisms are evolving and are becoming resistant towards commercially

available antibiotics. Bacteria that are resistant towards antibiotics, antiseptics and

disinfectants cause major health problems. Currently, bacterial resistance has resulted in

nosocomial infections causing serious health problems in the hospitals. Bacterial

resistance may be due to mobile genetic elements such as plasmids, transposons, naked

DNA or bacteriophages (Levy & Marshall, 2004; Marchese & Schito, 2000).

Antibiotics were discovered in the nineteenth century, and administered to

patients routinely. They have successfully solved public health hazards caused by

bacterial infections, but certain antibiotics also cause delirious side effects. These side

effects include adverse immune response, allergic reaction, hypersensitivity, nausea,

depression of the bone marrow, thrombocytopenic purpura, agranulocytosis and other

previously uncommon diseases (Busani et al., 2012; Ghosh et al., 2008; Ahmad et al.,

1998). Antibiotics react with the body system and disrupt important metabolic processes

(Conlon et al., 2003; Hancock, 1997a; Lehrer et al., 1991). Apart from that, the

indiscriminate use of antibiotics in the treatment of infectious disease and the design of

antibiotics with limited chemical scaffolds and few advances since the 1980s, led to the

development of multiple drug resistant bacteria (Talbot et al., 2006; Shah, 2005;

Service, 1995; Davies, 1994). A potential solution to this problem is by using alternative

antimicrobial agents discovered from nature. The extraction of bioactive components

including antimicrobial peptides and phenolic compounds from natural sources like

medicinal plants to treat bacterial infections seem attractive (Conlon et al., 2003;

Hancock, 1997a; Lehrer et al., 1991).

6
Literature review

The knowledge of using plants to naturally alleviate human health has been

around for decades. Around 70,000 plants have the potential to treat various ailments

(Busani et al., 2012; Jamil et al., 2007; Nascimento et al., 2000). With few exceptions,

naturally occurring plant materials have little side effects on the human body when

consumed at the right dosage and are more affordable compared to synthetic alternatives

(Ciocan & Bara, 2007). In fact, 80% of the world population depend on plant based

medicines (Azaizeh et al., 2003).

Although synthetic drugs and antibiotics brought about a revolution in disease

management, medicinal plants serve as a raw material for some important modern

medicine and were used to cure deadly diseases even before synthetic drugs were

discovered. The World Health Organization states that the best sources of a variety of

drugs are from plants (Santos et al., 1995). Medicinal plants serve as a cure for diseases

for millions of people inhabiting remote places in the world, who are unable to gain

access to synthetic drugs and depend on traditional healers (Bhattacharjee, 2000).

Plant drugs are placed in two categories (i) complex mixtures such as infusions,

essential oils, tinctures or extracts and (ii) pure, active compounds from plant extracts.

Pure compound from plant extracts with strong and specific activity and/or a small

therapeutic index requires an accurate and reproducible dosage (Hamburger &

Hostettmann, 1991). Plant extracts are selected as antimicrobial agent after thorough

biological evaluation of the safety and efficacy of the extracts followed by the process

of identifying active compounds, formulating dosage, efficacy and determining the

pharmacokinetic profile of the new drug (Tanaka et al., 2006).

7
Literature review

2.2 Medicinal Plants of Malaysia

The natural vegetation of Malaysia is made up of tropical rainforest which is

home to an estimated 15000 plant species (Lattif et al., 1984). A study by Burkill

(1966), recorded about 1300 plant species were used as traditional medicine in the

Malaysian Peninsula. The tropical rainforest is rich with bioactive compounds which act

as defence agent against pests, diseases and predators. Defensive compounds from the

rainforest have greater diversity compared to those from temperate regions (Coley &

Barone, 1996).

Plant extracts from local plants have been used in the treatment of various health

ailments in Malaysia (Ong et al., 2011; Siti et al., 2009; Ong & Norzalina, 1999). Elliott

and Brimacombe (1986) found that about 25% of the drugs in modern medicine

originated from tropical rainforest plant. Various plants such as tongkat ali (Eurycoma

longifolia), hempedu bumi (Andrographidis paniculata), ginseng (Ginseng baloba),

tumeric (Curcuma domestica) and misai kucing (Orthosiphon stamineus) were

examples used in traditional medicine.

In Malaysia, plant samples are chosen for scientific research based on a random

selection or ethno botanical knowledge of the indigenous usage of plants by traditional

medicine practitioners (Jantan, 2004). Collection of plants in the earlier years of

medicinal plant research in Malaysia was mainly for phytochemical screening. The

beginning of medicinal plant research was started as early as 1954 by Arthur, on the

phytochemical screening of 205 plants in Sabah followed by the screening of 200

species in peninsular Malaysia for alkaloid by Douglas and Kiang (1957). Most

phytochemical screenings were done to isolate bioactive alkaloids because most of the

natural compounds are alkaloids.

8
Literature review

2.3 Plant Derived Antibiotics

Antibiotics function through bacteriostatic or bactericidal actions by accessing

the intracellular targets of bacteria. Gram-positive bacteria do not possess an outer

membrane and are relatively susceptible to antimicrobial agents. Gram-negative bacteria

consist of an outer membrane which is a permeability barrier and is the main

determining factor of antimicrobial resistance in bacteria together with additional

resistance mechanism such as efflux and -lactamases that work together to promote

antimicrobial resistance (Hancock, 1997b; Nikaido, 1994).

Plant derived antibiotics that overcome the outer membrane barrier are effective

as antimicrobial agents. Plants have multiple methods of defence against pathogens

where some defence mechanism are pre-formed while others are triggered after

recognition of pathogen attack (Jones & Dangl, 2006). Two groups of plant antibiotics

that are involved in plant defence mechanism are phytoalexins and phytoanticipins. It is

important to note that the distinction between phytoalexins and phytoanticipins is not

based on the chemical structure but how these compounds are produced in the plant

(VanEtten et al., 1994).

9
Literature review

2.3.1 Phytoalexins

Phytoalexins (Figure 1-1) are plant antibiotics comprising of a variety of small

molecules of 500 Da (Hemaiswarya et al., 2008) and are synthesized de novo after the

exposure of plant towards microbial pathogens (Grayer & Kokubun, 2001). These plant

antibiotics consist of a diverse structural space such as terpenoids, glycosteroids,

flavonoids and polyphenols. Most of these structures have weak antimicrobial activity

compared to bacterial and fungal origin. However plant derived antibiotics have adopted

a different pathway to fight bacteria despite the fact that these antibacterial compounds

have low potency (Hemaiswarya et al., 2008). Upon detection of pathogen in the plant,

phytoalexin production requires transcriptional and/or translational activity. The

mechanism triggered involves trafficking and secretion of antimicrobial compounds to

the infected area (Bednarek & Osbourn, 2009).

An example of phytoalexin in plants is scopoletin, a hydroxycoumarin found in

tobacco plants. This compound displays antimicrobial activity in vitro (Matros & Mock,

2004; Chong et al., 2002; Valle et al., 1997). It was shown that a decrease in scopoletin

and scopolin (glucoside form of scopoletin) levels is linked with decreased resistance

towards Tobacco Mosaic Virus (TMV) infections in tobacco plants (Chong et al.,

2002).

A B

Figure 1- 1: Examples of plant phytoalexin structures


The chemical class of the compound is followed by species common
name in parentheses followed by its scientific name. Scopoletin from
(tobacco) Nicotiana tabacum (A) and camalexin from (thale cress)
Arabidopsis thaliana (B).

10
Literature review

2.3.2 Phytoanticipins

VanEtten et al. (1994) defined phytoanticipin (Figure 1-2) as a low molecular

weight antimicrobial compounds present in the plants before pathogenic attack or are

produced in the plants by pre-existing constituents after infection by pathogen. Some

phytoanticipins are present on plant surfaces while others are sequestered as pre-

existing compounds in vacuoles or organelles and are released after attack by pathogen

through a hydrolysing enzyme (Gonzlez-Lamothe et al., 2009).

An example of a glycosylated phytoanticipin is saponin, found in many plant

species. Saponin comprises of three major groups of compounds such as triterpenoid,

steroid or steroidal glycoalkaloid (Osbourn, 1996). An example of a saponin is avenacin

which was discovered in oat roots (Morrissey & Osbourn, 1999). Avenacin forms

complexes with sterols in fungal membrane resulting in the loss in membrane integrity

due to pore formation. Avenacin A-1, which is the major form of avenacin functions as

a chemical barrier in the epidermal layer of oat root tip cells and in emerging lateral root

(Osbourn et al., 1994), acting as a chemical defence towards pathogen attack

(Papadopoulou et al., 1999).

Figure 1- 2: Examples of plant antibiotic phytoalexin structures


The major oat root saponin avenacin A-1 (A) and the saponin -tomatine from tomato (Solanum
lycopersicum) (B).

11
Literature review

2.4 Bioactive Components in Plants

There are about 100,000 bioactive compounds produced in plants also identified

as the aromatic secondary metabolites. Secondary metabolites are mostly derived from

isoprenoid, phenylpropanoid, alkaloid or fatty acid/polyketide pathways and differ from

plant primary metabolites as they are not involved in intermediary metabolism of the

plant. The numerous secondary metabolites present in plants are a result of plant

evolution towards improved defence against microbes and predators giving plants their

antimicrobial trait (Dixon, 2001). Most secondary metabolites are constitutive in healthy

plants while others may exist as inactive precursors activated by tissue damage or

pathogenic infections (Osbourn, 1996).

Medicinal properties of plants are due to the combinations of secondary

metabolites such as alkaloids, steroids, tannins, and phenolic compounds that are

synthesized and deposited in specific or in all parts of the plant. These medicinal

properties are specific in a plant family, genus and species proving the fact that

combinations of secondary metabolites are distinct between plant taxa (Parekh et al.,

2005; Balandrin et al., 1985). Composition of secondary metabolites varies between (i)

tissues such that the bark, heartwood, roots, branch basses and wound tissues have

higher concentration, (ii) species and (iii) seasons (Gottlieb, 1990).

Medicinal plant extracts and phytochemical constituents present in the plant

tissues with well-known antimicrobial properties play an important role in promoting

human health and are non-toxic to the human body (Sheeba, 2010). Plant extracts work

in synergy with synthetic antibiotics against drug resistant bacteria (Ncube et al., 2008).

The antimicrobial activity is due to the recognition of potential target sites in

microorganisms by plant secondary metabolites which resembles endogenous

12
Literature review

metabolites, ligands, hormones, signal transduction molecules or neurotransmitters

(Parekh et al., 2005).

Bioactive compounds also give plant their odour such as terpenoids whereas

plant pigments are from quinones and tannins. In addition, these compound provide

flavour, for example some herbs and spices used by humans to season their food

(Cowan, 1999). Secondary metabolites are important as active compounds in medicinal

preparation thus it is isolated and identified (Taylor et al., 2001). However, isolating

specific active compounds identified in the plant extracts are tedious because extracts

contain mixtures of structurally related compounds with different degree of bioactivity

and cytotoxicity (Jaki et al., 2008).

2.4.1 Phenolic compounds

Phenolic compounds are compounds that possess at least one aromatic ring with

a hydroxyl group or its substituent. This group of compounds was first discovered in

lignin when it stimulated various physiological responses in plants and animals (Daniel,

2006). Phenolics are synthesized from cinnamic acid that is formed from phenylanine.

The number of constitutive carbon atoms based on the basic phenolic skeleton

distinguishes each phenols such as simple phenols, benzoic acid, phenylpropanoids and

flavonoids (Michalak, 2006). They are classified based on the carbon atom numbers and

biosynthetic pathway each group is derived (Daniel, 2006).

Most of the aromatic secondary metabolites synthesized in plants are phenolics

and their oxygen substituted derivatives (Geissman, 1963). Subclasses in this group

include phenols, phenolic acid, coumarins, flavones, flavonoids, flavonols, quinones

and tannins. These compounds are important antimicrobial agents and serve as the plant

defensive agent against pathogenic bacteria (Das et al., 2010).

13
Literature review

Phenolics are toxic to microorganisms due to the sites and number of hydroxyl

groups on the phenol groups. Past research have revealed that highly oxidized phenols

possesses stronger inhibitory actions towards a microorganism (Urs & Dunleavy, 1975).

The microorganisms are inhibited by phenolic compound via enzyme inhibition through

reaction with sulfydryl group or non-specific protein interactions (Mason &

Wasserman, 1987).

2.4.1.1 Simple phenols and phenolic acids

Simple phenols and phenolic acids consist of a single substituted phenolic ring.

Simple phenols comprises of phenolic alcohols, aldehydes, ketones and their glycosides.

These compounds are colourless (as solids) and are easily oxidised upon exposure to air

and alkaline conditions. Woody plants contain free phenols whereas metabolically

active plants contain glycosylated phenols (Hopkinson, 1969). The number of hydroxyl

groups and their site(s) determine their toxicity towards microorganisms (Scalbert,

1991; Urs & Dunleavy, 1975).

A B

D E

Figure 1- 3: Examples of simple phenols and phenolic acids


Figure displays the molecular structure of caffeic acid (A), rosmaric acid (B) chlorogenic (C), catechol
(D) and pyrogallol (E).

14
Literature review

Phenolic acids comprises of benzoic and cinnamic acids. Common benzoic acid

includes p-hydroxy benzoic, vanillic and syringic acid found in lignin in angiosperms.

Some phenolic acids common in plants are gentisic and protocatechuic acid (Daniel,

2006).

Purified aloe emodin that contains the polyphenols caffeic acid (Figure 1-3A),

rosmaric (Figure 1-3B) and chlorogenic (Figure 1-3C) derivatives inhibits Herpes

simplex virus-1 (HSV-1), Varicella zoster virus (VZV), pseudorabies and influenza

virus (Sydiskis et al., 1991). Analysis on the structure-activity of phenolic groups

indicates that antimicrobial activity is related to the site(s) and number of hydroxyl

groups (Li et al., 2004). This is evident in catechol (Figure 1-3D) which has two

hydroxyl groups and pyrogallol (Figure 1-3E) which has three hydroxyl groups,

whereby both are toxic towards microorganisms. However increase in hydroxylation

results in increase in inhibitory activity of microorganisms (Geissman, 1963). Some

authors also discovered that highly oxidized phenolic compounds are better inhibitors

(Scalbert, 1991; Urs & Dunleavy, 1975).

2.4.1.2 Coumarins

Coumarin (Figure 1-4A) comprises of phenolic substances with fused benzene

and -pyrone rings (O'Kennedy & Thornes, 1997). They are responsible for the

characteristic odour of hay and possess antithrombotic (Thastrup et al., 1985), anti-

inflammatory (Piller, 1975), and vasodilatory (Namba et al., 1988) properties.

Coumarins were found to be toxic towards rodents, however based on recent studies,

they were discovered to have species-dependent metabolism such that in humans

toxic coumarin derivatives are excreted via the urine (Weinmann, 1997).

15
Literature review

Coumarins such as warfarin (Figure 1-4B) have antiviral properties (Berkarda,

1993), and are used as an oral anticoagulant to inhibit HSV-1 that causes cold sores in

humans (Eloff & McGaw, 2006). Based on a study conducted by O'Kennedy and

Thornes (1997), it was discovered that coumarins inhibited Candida albicans in patients

with vaginal candidiasis. Another important compound is calanoid (4-

propyldipyranocoumarins) isolated from Calophyllum lanigerum var. austrocoriaceum

and C. inophyllum, from the tropical rainforest trees of Sarawak, Malaysia (Currens et

al., 1996). Callophylum coumarins, classified as calonoids, inophyllums and

cordatoloids, based on the C-4 substituent on the lactone ring, are natural reverse

transcriptase inhibitors. Calanoid A has potential activity towards HIV-1 reverse

transcriptase, hence it is a novel natural non-nucleotide reverse transcriptase inhibitor

that may be useful when combined with other antiretroviral drugs (Cos et al., 2004).

A B

Figure 1- 4: Examples of coumarins


Figure displays the molecular structure of coumarin (A) and warfarin (B).

16
Literature review

2.4.1.3 Quinones

Quinones (Figure 1-5A) are highly reactive compounds comprising of aromatic

rings with two ketone substitutions. Quinones are coloured compounds responsible for

the browning of cut or injured fruits and vegetables, colour of henna used as dye and an

intermediate in the melanin synthesis pathway of skin (Schmidt, 1988; Fessenden &

Fessenden, 1982). Oxidation and reduction reactions occur easily leading to the switch

between diphenol (hydroquinone) and diketone (quinone), rendering the redox potential

important in biological systems. This is observed through the role of ubiquinone

(coenzyme Q) in mammalian electron transport system. Apart from that, vitamin K, a

naphthoquinone possess antihaemorrhagic activity causing oxidation in body tissues

(Cowan, 1999).

A B

Figure 1- 5: Examples of quinone


Figure displays the molecular structure of quinone (A) and hypericin (B).

Quinones complex irreversibly with nucleophilic amino acids in proteins

resulting in the loss of protein function (Stern et al., 1996). This makes it a potential

antimicrobial compound targeting surface-exposed adhesions, cell wall polypeptides

and membrane bound enzymes in microorganisms. An anthraquinone isolated from a

tree in Pakistan, Cassia italica was discovered to possess bacteriostatic activity against

Bacillus anthracis, Corynebacterium pseudodiphthericum, and Pseudomonas

aeruginosa and bactericidal activity against Pseudomonas pseudomalliae (Kazmi et al.,

1994). An antidepressant antharaquinone also known as hypericin (Figure 1-5B)

17
Literature review

isolated from Hypericum perforatum (St. Johns wort) was reported to possess

antimicrobial activity (Duke, 1985).

2.4.1.4 Flavones, flavanol and flavanoids

Hydroxylated phenolics containing one carbonyl group form flavones (Figure 1-

6A). Flavonol is formed by addition of a 3-hydroxyl group (Fessenden & Fessenden,

1982). Flavonoids are synthesized by plants in response to a microbial infection, and

occur as a C6 - C3 unit linked to an aromatic ring (Dixon et al., 1983). Flavonoids have a

broad spectrum of antimicrobial activity due to their ability to form complexes with

extracellular and soluble proteins and to interfere with bacterial cell walls (De Clercq,

2000). Lipophilic flavonoids disrupt microbial membranes (Tsuchiya et al., 1996) and

flavonoids lacking hydroxyl groups on their -rings are active antimicrobials (Chaurasia

& Vyas, 1977).

The most reduced form of C3 in flavonoids are catechins (Figure 1-6B),

commonly found in oolong green teas. Teas containing a mixture of catechin

compounds have antimicrobial properties (Toda et al., 1989) that inhibit Vibrio

cholerae O1 (Borris, 1996), Streptococcus mutans (Tsuchiya et al., 1996; Batista et al.,

1994; Sakanaka et al., 1992; Sakanaka et al., 1989), Shigella (Vijaya et al., 1995), and

other bacteria and microorganisms (Sakanaka et al., 1992; Thomson & Schultes, 1978).

A B C

Figure 1- 6: Examples flavones, flavonoids and flavonols


Figure displays the molecular structure of flavone (A), catechin (B) and chrysin (C).
18
Literature review

The various antimicrobial activities are (i) galangin, a 3,5,7-trihydrocyflavone

from Helichrysum aureonitens, which inhibits HSV-1 and coxsackie B virus, (ii)

isoquercitrin from Waldstenia fragarioides with anti-HSV activity, and (iii)

swertifrancheside, glycyrrhizin and chrysin (Figure 1-6C) which inhibit HIV (Cos et al.,

2004; Jassim & Naji, 2003). Wogonin is a natural mono flavonoid, with rapid tissue

distribution and prolonged rate of plasma elimination possessing anti-inflammatory,

anticancer, neuroprotective, and antiviral activities (Tai et al., 2005). This compound is

advantageous in the development of antirabies and antiencephalitis therapies.

2.4.1.5 Tannins

Tannins (Figure 1-7A) are a group of polymeric phenolic substances of 500 to

3000 Da, found in the bark, wood, leaves, fruits, and roots of plants (Scalbert, 1991).

They possess astringent property and are responsible in tanning leather and precipitating

gelatine from solutions (Basri & Fan, 2005; Nizet et al., 2001). Tannins are soluble in

water, alcohol and acetone and form precipitates with proteins (Basri & Fan, 2005).

A B

Figure 1- 7: Examples of tannins


Figure displays the molecular structure of tannin (A) and proanthocyanidins (B).

Tannins can be classified as hydrolysable or condensed forms. Hydrolyzable

tannins exist as multiple esters with D-glucose conjugate on gallic acid subunit whereas

condensed tannins (proanthocyanidins Figure 1-7B) are derived from flavonoid


19
Literature review

monomers. Tannins are formed by condensation of flavan derivatives in woody tissues

of plants or by polymerization of quinone units (Geissman, 1963).

Tannins were widely studied when tannin-containing beverages such as red wines

and green teas were found to prevent and cure various illness when consumed over a

period of time (Serafini et al., 1994). Tannins can stimulate phagocytic cells and inhibit

tumours and bacteria by forming complexes with microbial proteins via hydrogen

bonding, hydrophobic effect or covalent bonding (Stern et al., 1996; Haslam, 1996).

Tannins may displayed direct antimicrobial activity by inhibiting germ tubes of

Crinipellis perniciosa at low concentrations (Brownlee et al., 1990). Scalbert (1991)

studied the antimicrobial properties of tannins and found that they were toxic towards

filamentous fungi, yeasts, and bacteria. Methanolic extracts from the bark of Terminalia

alata in Nepal were antibiotic in nature (Taylor et al., 1996). In ripe fruits, antimicrobial

properties of tannins are due to hydrolysis of the ester linkage between gallic acid and

polyols and this serves as a natural defence mechanism (Samy & Gopalakrishnakone,

2010). Traditional medicine practitioners commonly use tannins to treat mouth ulcers,

catarrh, wounds, haemorrhoids and diarrhoea (Ogunleye & Ibitoye, 2003).

2.4.2 Terpenoids and Essential oils

Essential oil or quinta essentia are compounds responsible for the fragrance in

plants. Essential oil comprises of phenolic compounds with a C3 side chain and has a

low level of oxidation state in the absence of oxygen. Oils with enriched isoprene

structure are identified as terpenes (Figure 1-8A), having a general chemical formula of

C10H16. Terpenes exist as di (C20), tri (C30), tetra (C40), hemi (C5) or sesquiterpenes

(C15). Compounds with additional elements, usually oxygen are termed as terpenoids.

20
Literature review

Terpenoids share a common origin with fatty acids but differ from fatty acids

due to extensive branching and they possess cyclic ring structure. They actively inhibit

bacteria (Amaral et al., 1998; Ahmed et al., 1993; Habtemariam et al., 1993), fungi

(Ayafor et al., 1994; Harrigan et al., 1993; Kubo et al., 1993), viruses (Sun et al., 1996;

Xu et al., 1996; Pengsuparp et al., 1994), and protozoa (Ghoshal et al., 1996;

Vishwakarma, 1990). Examples of terpenoids include menthol (Figure 1-8B), camphor

(monoterpenes) and artemisin (sesquiterpenoids) (Cowan, 1999; Ahmed et al., 1993).

A B C

Figure 1- 8: Examples terpenoids and essential oils


Figure displays the molecular structure of limonene (monoterpene), a constituent
of lemon and orange oil (A), menthol (B) and cinnamaldehyde (C).

Artemisin and its derivative -arteether, also known as quinghasu possess

antimalarial properties (Vishwakarma, 1990). Chaurasia and Vyas (1977) reported that

about 60% of essential oil derivatives inhibited fungi whereas about 30% inhibited

bacteria. An example of bioactive component from essential oil with antimicrobial

properties is cinnamaldehyde (Figure1-8C) from Cinnamomum osmophloeum. It

actively inhibited Escherichia coli, Enterococcus faecalis, Staphylococcus aureus

(including methicillin resistant S. aureus) and Vibrio parahaemolyticus.

Cinnamaldehyde also inhibited oral bacteria and was used in antiseptic mouthwashes

(Wallace, 2004). Other bioactive compounds isolated from essential oils includes

thymol, carvacol, camphor and terpinene-4-ol (Acamovic & Brooker, 2005).

An example of the terpenoid constituent is capsaicin, from Capsicum annuum

used in many cuisines across the world (Vishwakarma, 1990). Capsaicin was found to

inhibit Helicobacter pylori and was also reported to be analgesic (Cordell & Araujo,

21
Literature review

1993) as it affects the nervous, cardiovascular and digestive systems in humans (Virus

& Gebhart, 1979).

2.4.3 Alkaloids

Alkaloids are heterocyclic nitrogen compounds such as nicotine derived from

amino acids (Figure 1-9A). Structures of the alkaloid ring includes pyridines, pyrroles,

indoles, pyrrolidines, isoquinolines, and piperidines (Bennett & Wallsgrove, 1994)

Morphine (Figure 1-9B) was the first medically useful alkaloid isolated from the flower

of Papaver somniferum (opium poppy) in 1805 (Fessenden & Fessenden, 1982).

A B

Figure 1- 9: Examples of alkaloids


Figure displays the molecular structure of nicotine (A) and morphine (B).

Pharmacologically active compounds isolated in the early years were mostly

identified as alkaloids (Das et al., 2010) such as (i) diterpenoid isolated from the

Ranunculaceae (buttercup) family which displayed antimicrobial activities (Omulokoli

et al., 1997; Atta & Choudhary, 1995; Jones Jr & Luchsinger, 1979); (ii) solamargine, a

glycoalkaloid from Solanum khasianum berries which inhibits HIV and intestinal

infections associated with AIDS (McDevitt et al., 1996; McMahon et al., 1995); and

(iii) quinine which inhibits malarial parasites (Iwu et al., 1999).

22
Literature review

2.4.4 Lectins and Polypeptides

Antimicrobial peptides (AMPs) are a positively charged group of molecules that

provides fast and effective means of defences against invading pathogens in the

majority of living organisms. The characteristic properties of AMPs include small size

(less than 10kDa), cationic, amphipathic and vary in length, sequence and structure.

AMP provides defence against a wide range of microorganisms such as gram-positive

and gram-negative bacteria, protozoa, yeast, fungi and viruses (Reddy et al., 2004). The

first AMP discovered was from wheat flour in 1942 (Balls et al., 1942).

Figure 1- 10: Example of peptide


Figure displays the molecular structure of
purothionin from Hordeum vulgare (barley).

AMPs are classified into five main groups. The five groups comprises of peptides

(i) that form -helical structure; (ii) -sheet; (iii) rich in cysteine residues; (iv) rich in

regular amino acids (mostly histatin, arginine and proline); and (v) composed of rare

and modified amino acids. Mode of action is by selective destruction of cell membranes

and the amphipathic structural arrangement by the AMPs. Examples of the mode of

action includes the Barrel stave and carpet model (Reddy et al., 2004).

23
Literature review

Various plants have been discovered to possess low molecular mass peptides (Ye

& Ng, 2002; Huynh et al., 1996; Osborn et al., 1995). These peptides are tissue specific

(Price et al., 1987), located in the external layers of plant tissues and act as the first line

of defence against microorganisms (Samy & Gopalakrishnakone, 2010).

Purothionin is an example of peptide isolated from barley and wheat, comprising

of 47 amino acids and is effective against yeast and bacteria (De Caleya et al., 1972).

Another antimicrobial peptide isolated from fava beans, identified as fabatin was found

to inhibit E. coli, P. aeruginosa, and Enterococcus hirae (Zhang & Lewis, 1997).

2.5 Antioxidant Activity of Plant Phenols

The body generates free radicals through metabolic pathways and immune

functions. Apart from that, the level of free radicals is also elevated in the body through

environmental pollution, pesticides, radiation and ageing (Adedapo et al., 2009; Gulcin

et al., 2007). Free radicals are categorized as reactive oxygen species (ROS) which

includes radical super oxide anion (O2-), hydroxyl (OH) and non-radicals such as

hydrogen peroxide (H2O2). ROS target cellular and extracellular components such as

lipids, proteins, enzymes, DNA, and RNA resulting in cell death by necrosis or

apoptosis (Evans, 1993; Ames et al., 1993).

Imbalance between production of ROS in the cell and enzymatic (superoxide

dismutase, glutathione peroxidase, and catalase) and non-enzymatic (ascorbic acid,

vitamin E, glutathione, carotenoids, and flavonoids) antioxidants brings about oxidative

stress (Peuchant et al., 2004; Gilgun-Sherki et al., 2002). Oxidative stress may lead to

degenerative diseases including diabetes, cancer, cardiovascular diseases and

inflammatory diseases (Calir et al., 2009; Que et al., 2007; Sharififar et al., 2007;

Gerber et al., 2002; Anderson et al., 2001a; Shahidi et al., 1992; Cerutti, 1991).

24
Literature review

Antioxidants present in food are able to scavenge ROS and prevent the onset and

progression of degenerative diseases (Knekt et al., 1996). Medicinal plants were found

to possess antioxidant activity due to the content of phenolic components such as

flavonoids (Pietta, Simonetti, Gardana, et al., 1998), phenolic acids, and phenolic

diterpenes (Shahidi et al., 1992) in the plants.

The antioxidant activity of phenolic compounds is attributed to (i) scavenging

free radicals via donating a hydrogen atom to reduce ROS; (ii) their high tendency to

chelate metal ions due to the presence of hydroxyl and carboxyl groups; and (iii) ability

to inhibit enzyme involved in free-radical production (Hensley et al., 2004; Aruoma,

2003; Yang et al., 2001). Antioxidant activity of medicinal plants against hydroxyl

radicals, superoxide anions, singlet oxygen and lipid peroxides have been investigated

(Yen & Chen, 1995; Masaki et al., 1995) and are associated to preventing occurrence of

the above mentioned diseases.

Synthetic antioxidants such as butylated hydroxyanisole (BHA) and butylated

hydroxytoluene (BHT) used in the food industry to prolong shelf life of food may cause

liver damage and carcinogenesis (Wichi, 1988; Witschi, 1986). Therefore antioxidants

from natural sources are preferred to synthetic ones.

25
Literature review

2.6 Selection of Plant Species for Investigation

Plants were selected based on several factors: (i) ethnobotanical approach which

is local traditional folklore medical knowledge information (Anbarashan et al., 2011);

(ii) chemotaxonomic approach where the relatives of plants known to produce useful

compounds were selected; and (iii) by random selection (Jantan, 2004). In the

chemotaxonomic approach, plants are selected based on the correlation between

taxonomy and occurrence of plant secondary metabolites. The same active biological

compounds may be present in related species, genera or families (Eloff & McGaw,

2006). Based on the above criterias Aloe vera, Azadirachta indica, Carica papaya,

Centella asiatica, Hymenocallis speciosa and Vernonia amygdalina were chosen for

investigation.

Traditional medicine practitioners have little knowledge on the scientific

rationale of their medicines and their knowledge is purely based on experience (Gurib-

Fakim, 2006). However, better knowledge on the therapeutic function of medicinal

plants on treatment and prevention of diseases is required for more rational prescription.

2.6.1 Aloe vera (L.) Burm. f. (A. vera)

A. vera is a short-stemmed succulent perennial herb growing at 80 to 100 cm

tall, spreading by offsets and root sprouts. The plant consists of elongated, pointed,

thick and fleshy, green leaves with a serrated margin. The spike which is about 90 cm

tall produces flowers. Each flower pendula has a yellow tubular corolla that is 2 to 3 cm

long. The tissue in the centre of the aloe leaf contains a bitter, yellow latex and a

transparent mucilaginous gel which is responsible for most of the bioactive compounds

in the plant (Kumar et al., 2010; Chow et al., 2005).

26
Literature review

A. vera comprises of over 400 different species and belongs to the Liliaceae

family (Grover et al., 2011) formerly known as the Asphodelaceae family. Another

well-known member of this family is A. ferox. The characteristic medicinal feature of

the genus aloe are polysaccharides, antharanoids and anthraglycosides (aloe-emodin)

that accumulates in the leaves (Gurib-Fakim, 2006).

Figure 1- 11: Aloe vera (L.) Burm. f.


Figure displays the morphology of A. vera where 1- plant habitat; 2- part of
inflorescence; 3- flower in longitudinal section.

Image adapted from de Padua et al. (1999)

27
Literature review

A. vera is native to North Africa, the Mediterranean region of South Europe and

the Canary Islands. Now, it is widely cultivated in West Indies, tropical America and in

tropical regions (Ross, 1999a). A. vera pulp is made up of 98.5% water, whereas the gel

is made up of 99.5% water (Eshun & He, 2004). The remaining percentages of materials

are fat soluble vitamins, minerals, enzymes, polysaccharides, phenolic compounds and

organic acids (Boudreau & Beland, 2006).

This plant has many healing properties such that it relieves burning sensations,

and blisters, heals ulcers, wounds on the skin and gastrointestinal lining through the

release of interleukin-1, interleukin-6, tumour necrosis factor and interferon (Kumar et

al., 2010; Yates et al., 1992; Peng et al., 1991). The fresh leaf juice is used to treat

rashes, vaginal infection, eczema, foot sores, fungus attacks, eye infections and fever

(Anbarashan et al., 2011; Kumar et al., 2010). The leaf sap or juice is applied externally

to treat pimples, blackheads and cuts.

In Indonesia, the locals mix the sap with other ingredients to mask the bitter

taste to cure asthma and cough. In Malaysia, aloe drug jadam is used as an aperient, to

heal wounds and swelling and daubed in the abdomen when fever and after confinement

(de Padua et al., 1999). It also aids digestion, blood circulation and the lymph system

and improves the function of the liver and gall bladder (Kumar et al., 2010). A. vera is

a good absorbent and penetrates into tissues of the skin four times faster than water

making it a good moisturizer, cleanser, exfoliator and it relieves joint and muscle pains

(Lawrence et al., 2009).

The bioactive compound, anthraquinone isolated from A. vera displays

antimicrobial activity against gram-negative and positive bacteria (Habeeb et al., 2007).

It inhibits Shigella flexneri, Streptococcus progenies, Staphylococcus aureus, Klebsiella

pneumoniae, Streptococcus pyogenes, Pseudomonas aeruginosa, Escherichia coli,

Propionibacterium acne, Helicobacter pylori and Salmonella typhi (Ferro et al., 2003;

28
Literature review

Pugh et al., 2001; Lawless & Allan, 2000; Reynolds & Dweck, 1999; Urch, 1999). A.

vera also inhibits oral bacteria which cause gum diseases and therefore it was

incorporated into toothpaste and rubbed on the gums (Kumar et al., 2010).

2.6.2 Azadirachta indica A. Juss (A. indica)

A. indica or better known as neem was discovered more than 2000 years as the

most versatile medicinal plant with an array of biological activities. Every part of the

plant is useful in treating various diseases. Hence it was given the Sanskrit name

arisjtha which means reliever of sicknesses(Biswas et al., 2002). In 1992 this plant

was recognized by the US National Academy of Sciences which published a report

Neem A tree for solving Global Problems (Schmutterer, 1995).

A. indica is a tropical evergreen plant growing up to 25 m high. The bark is

rough, dark brown with flat ridges separating the wide longitudinal fissures. Leaves are

compound and imparipinnate, comprising of 5 to 15 leaflets arranged with the terminal

leaflet in alternate pairs. Each leaf is about 6 cm long and 2 cm wide. Flowers have

oblanceolate petals and are sweet scented with yellow, ellipsoid and gabrus drupes

measuring about 12 to 20 cm long. The sepals are ovate, about 1 cm long. Most flower

panicles are arranged in the leaf axils (Ross, 1999a).

A. indica belongs to the Meliaceae family and is native to East India and Burma.

It is widely distributed in Southeast Asia and West Africa. Recently it was found in the

Caribbean and in South and Central America (Ross, 1999a).

29
Literature review

5
4

1
2

Figure 1- 12: Azadirachta indica A. Juss


Figure displays the morphology of A. indica where 1- plant bark with leaves and fruits clustered
towards ends of branches; 2- flower; 3- twig with flowers; 4- fruit cross section; 5- seed; 6- flower
cross section.
Image source from Kapoor (1990)

Both the crude extracts and fractions of the leaf, root, seed, oil, fruit and bark of

the neem tree display biological activities. In folk medicine, the natives use neem oil,

bark and leaf extracts to treat leprosy, intestinal helminthiasis, respiratory disorders,

constipation and to improve health (Kirtikar & Basu, 1935). The oil is used in skin

30
Literature review

infections and to kill head lice. Mixtures containing bark, leaf, root, flower and fruit

extracts are used to treat blood morbidity, biliary afflictions, itching, skin ulcers,

burning sensations and pthysis (Biswas et al., 2002). Dried flowers are consumed orally

for diabetes and hot water extracts of the dried fruit is used to treat piles, skin diseases

and ulcers (Ross, 1999a). Leaf extracts cure ringworms, eczema and scabies. The bark

is used to cure malarial fever and leaf paste was to sooth mumps (Anbarashan et al.,

2011).

A. indica showed various pharmacological activities such as reported by Murty

et al. (1978 ) where the blood glucose level significantly decreased and adrenaline and

glucose-induced hyperglycaemia was prevented by aqueous extracts of neem leaves.

Another study by El-Hawary and Kholief (1990) revealed that normal rats fed orally

with aqueous leaf extracts developed hypoglycaemia whereas blood glucose level

dropped in diabetes induced rats. Anti-acid secretory and antiulcer activity was

observed in glycosides isolated from aqueous extracts of neem (Biswas et al., 2002).

Bandyopadhyay et al. (2004) revealed that aqueous bark extracts inhibited gastric acid

and pepsin secretion and was effective in healing duodenal ulcer that was both H.

pylori mediated and non- H. pylori mediated with no significant side effects even at

high dosages.

Seed extracts and purified fractions inhibited the growth and development of

malarial parasite P. falciparum (Dhar et al., 1998). Fungi such as Trichophyton,

Epidermophyton, Microsporum, Trichosporon, Geotricum and Candida were inhibited

by leaf, oil and seed extracts (Schmutterer & Ascher, 1983). In vitro application of the

oil extracted from neem leaf, seed and bark inhibited Gram-negative and Gram-positive

bacteria such as Mycobacterium tuberculosis, Mycobacterium pyogenes, Streptococcus

mutans, Streptococcus faecalis, Vibrio cholerae, Klebsiella pneumoniae and

streptomycin resistant strains (Almas, 1999; Satyavati et al., 1976; Chopra et al., 1952).

31
Literature review

2.6.3 Carica papaya Linn. (C. papaya)

C. papaya belongs to the Caricaceae family. It is a perennial herbaceous plant of

10 metres tall. The stem is about 25 cm thick and may be simple or branched above the

middle. Leaves have a cylindrical stalk, clustered around the apex of the stem with

branches that are 25 to 100 cm long. Each leaf blade has lobes and prominent veins.

Flowers are hermaphrodite and the male plant may convert to female once beheaded.

Otherwise male (with drooping peduncles) and female (short stalked) flowers are borne

on separate plants. Flower consist of 5 white petals, are oblong, recurved and emerge

singly or clustered from the main stem among the lower leaf. The fruit comes in

various forms and sizes with a smooth and thin skin, deep yellow to orange colour when

ripe. The flesh is red, juicy and sweet, with a central cavity containing a mucous pulp

which holds numerous black seeds.

C. papaya originated from Southern Mexico and Central America. Currently this

plant is widely cultivated in all tropical and subtropical countries, utilized as a

commercial crop. Parts of the plant that are beneficial to humans are the leaves, fruit,

seed, latex and root (Ross, 1999b). In Burma, the latex is used externally to cure

diphtheria and tapeworms. In China, the pulp is utilized to reduce swelling and

inflammation of the feet (Wiart, 2002). In Malaysia the fresh unripe fruit juice and hot

water extract of flowers are consumed as an emmenagogue (Ross, 1999b). In the

Peninsular the root paste is rubbed on the body during confinement; seeds are consumed

to induce abortion; latex is used to remove patches on skin. The latex of unripe fruit was

used to poison criminals in Kelantan (Wiart, 2002).

32
Literature review

10

2 3

11
5 6 7 8 9

Figure 1- 13: Carica papaya Linn.


Figure displays the morphology of C. papaya where 1- whole plant; 2- flower bud; 3- fruit cross
section; 4- female flower; 5- male reproductive part; 6- male flower; 7- flower; 8- female reproductive
part; 9- seed; 10- fruit; 11- plant stem with leaves clustered around apex of stem.

Image adapted from Wiart (2002) and Duke (1985)

Natural compounds possessing high antitumor and pesticide properties are

produced in the leaf, bark and twig. The tree has an array of natural self-defence

compounds making it highly resistant towards pathogens (Baskaran et al., 2012).

Ahmad et al. (2011) proved that C. papaya leaf extract could cure dengue fever when a

45 year old patient who was bitten by a carrier mosquito was administered with aqueous

leaf extract twice daily for five consecutive days. Based on the patients condition and

blood reports aqueous extracts of C. papaya leaves exhibited activity against dengue

fever.

33
Literature review

Plant latex was applied to the teeth to relieve inflammatory pain (Anbarashan et

al., 2011). Leaf extracts possesses antitumor agents and the juice is consumed to treat

warts, cancer, tumour, and induration of the skin (Hartwell, 1969). Aqueous leaf

extracts inhibited Bacillus subtilis, Escherichia coli, Klebsiella pneumonia,

Pseudomonas aeruginosa and Staphylococcus aureus (Suresh et al., 2008). Ethanolic

extract of the leaf and stem inhibited E. coli, S. flexnert, S. paratyphi A, S. typhi, P.

aeruginosa, M. luteus, P. mirabilis, B. subtilis and S. aureus (Rahman et al., 2011).

This plant is anthelminthic as aqueous extract inhibited Heligmosomoides polygyrus

parasite infection in mice (Satrija et al., 1995).

2.6.4 Centella asiatica Linn. (C. asiatica)

C. asiatica (syn Hydrocotyle asiatica), locally known as pegaga is one of the

miracle elixirs of life, and is an important herb. It is used as a cover crop in tea and

rubber plantations, incorporated into food where locals eat it raw or cooked, in salads or

curries, and leaves are used as a fish poison (Duke, 1985).

C. asiatica belongs to the Apiaceae family, previously known as the

Umbelliferae family, comprising of over 3000 herbaceous species. This family consists

of many of the common spices and herbs used today. Some of the common herbs with

medicinal properties belonging to this family are caraway (Carum carvi) used against

bloats, coriander (Coriander sativum) and fennel (Foeniculum vulgare) used as a

carminative and anis (Pimpinella anisum) (Gurib-Fakim, 2006).

Centella is made up of about 40 species that are found widely growing only in

South Africa. Exception is made for the species C. asiatica which is distributed

throughout South-East Asia and some subtropical regions (Hargono et al., 1999). Parts

34
Literature review

of the plant that are useful to humans are the whole plant, leaves, fruits, root and seed

(Kapoor, 1990).

4
5
3

2
6

Figure 1- 14: Centella asiatica Linn.


Figure displays the morphology of C. asiatica where 1- whole plant; 2- leaf; 3-
stem base with young leaf, flowers and fruits; 4- inflorescence; 5- flowers; 6- fruit.

Image taken from de Padua et al. (1999)

This plant has been around since prehistory to treat a wide range of health

problems in southern-Asia, China and India. In China, this plant is known for its cooling

properties and is used as a tonic. In India it is used as a tonic, to treat dysentery and as a

non-alcoholic anti-epileptic medicine. In Sri Lanka, extracts are taken as galactagogue.

In Vietnam, it is used for the treatment against senility (Hargono et al., 1999). In

Malaysia, according to Azmah (1989), C. asiatica was used to cure dizziness,

hypertension, to improve memory, and relieve indigestion. It is also used to cure malaria

and sore eyes in Kelantan (Sabariah, 1987). And in Sabah it is used to reduce fever, cool

the body and to soothe toothaches (Ajik, 1990; Amandus, 1989).

35
Literature review

This plant is popular amongst traditional medicine practitioners. The whole plant

is used to cure skin related diseases. Plant extracts are used to heal surgical wounds

minor burns, keloids, leg ulcers, slow healing wounds, lupus, scleroderma, leprosy and

cellulitis. Pure extracts accelerate skin grafting and cicatrizing (Hargono et al., 1999).

Seeds were used to cure dysentery, headache and fever. A small quantity of the plant

stimulates appetite, aids indigestion and alleviates bowel trouble in children. Decoctions

of young roots are administered for haemorrhoid (Duke, 2010).

Triteropenoid isolated from C. asiatica such as asiaticosida, madecassoside,

asiatic acid and madecassic acid were identified as biologically active compounds

responsible for the medicinal properties of the plant. Aqueous extracts was discovered

to inhibit Herpes simplex II virus and asiaticosida isolated from the plant accelerated the

recovery of guinea-pigs induced with tuberculosis (Hargono et al., 1999).

2.6.5 Hymenocallis speciosa (Salisb.) (H. speciosa)

H. speciosa is from the Amaryllidaceae family, genus Amaryllis and

monocotyledon order Asparagales. It is a herbaceous, perennial, bulbous flowering

plant (Stevens, 2001; Meerow & Snijman, 1998). The plant has 7 to 9 evergreen,

rosulate leaves that lasts more than a year and are long, broad, elliptic blades with a

distinct petiole. Each plant produces about 7 to 12 white flowers that are wide-spreading

with pedicels of 1 cm long. The stamina cup is funnel shaped, placed between the erect

filaments (Sealy, 1954).

36
Literature review

Figure 1- 15: Hymenocallis speciosa (Salisb.)


Figure displays the morphology of H. speciosa where 1- roots; 2- tuber; 3- leaf
blade; 4- flower buds; 5- flowers; 1,2- parts underground; 3,4,5- parts above the
ground.

Image adapted from Wiart (2002)

Plants belonging to the Amaryllidaceae family were used as folk medicine to

cure various diseases since thousands of years. Many bioactive compounds such as

alkaloids, phenolics, flavonoids and glycosides were isolated from this family. Amongst

these compounds, alkaloids isolated and identified as amaryllidaceae were associated

with the pharmacological effects of the plant (Jin & Xu, 2013). A study by ener et al.

(2003) proved that four groups of amaryllidaceae alkaloids isolated from plant extracts

of Amaryllidaceae plants had antimalarial activity by inhibiting the growth of

Plasmodium falciparum in vitro. In Malaysia the leaves of H. speciosa which were

locally known as pokok demam panas were used to cure jaundice. The leaf extract was

prepared as a decoction and was administered to the patient by bath (Azliza et al.,

2012).

37
Literature review

2.6.6 Vernonia amygdalina Del. (V. amygdalina)

V. amygdalina, also known as bitterleaf belongs to the Asteraceae family,

previously known as the Compositae family. It is a tropical plant growing in warmer

regions, dominating South Africa and is popular as a leafy vegetable amongst the Ibos

clan in Nigeria (Sule & Agbabiaka, 2008). About 35 species are distributed in Malaysia

(Chuakul et al., 1999).

4
4
3

Figure 1- 16: Vernonia amygdalina Del.


Figure displays the morphology of V. amygdalina where 1- branch with leaves and
flowers; 2- leaf; 3- flower; 4- flower head.

Image adapted and redrawn by Iskak Syamsudin

38
Literature review

V. amygdalina is a perennial, evergreen shrub, climbers and small sized trees

growing at 2 to 5 m in height. The petiolate leaves are about 6 mm in diameter, elliptic

with a characteristic odour and bitter taste. Bark is rough with dense black straits (Sule

& Agbabiaka, 2008; Owolabi et al., 2008). Flowers are white or purple coloured,

bisexual with a funnel shaped limb and fused anthers (Chuakul et al., 1999).

The Asteraceae family comprises of 25000 species and 1400 genera, well distributed

in most ecosystems. Some members of this family produce sesquiterpene lactones that

are important bioactive compounds for example Chrysanthemum parthenium and

Arnica montana. Some produce pyrrolizidine alkaloids responsible for hepatotoxic

activity in Senecio species. Others produce diterpene glycoside stevioside which has

intense sweetness (Gurib-Fakim, 2006).

The leaves of V. amygdalina are extremely bitter due to the presence of bioactive

compounds such as alkaloids, saponins, tannins and glycosides. Leaves are added into

the famous bitterleaf soup and the water extract are consumed as a tonic to promote

health (Farombi & Owoeye, 2011). It was also consumed by wild chimpanzees to cure

parasitic infection (Huffman & Seifu, 1989). In Nigeria and other African countries, the

leaf is used to treat fever, emesis, nausea, dysentery, gastrointestinal disorders, diabetes

mellitus and sexually transmitted diseases (Aregheore et al., 1998).

Bioactive compounds isolated from the plant were saponins, sesquiterpene

lactones (vernodalin and vernoamygdalin), flavonoids, tannins and glycosides (Audu et

al., 2012; Igile et al., 1994). Flavonoids were responsible for antioxidant properties in

plant and saponins stimulate antitumor activity in leukaemia cells (Jisaka et al., 1993).

V. amygdalina possess anticancer, antidiabetic, antioxidant, antimalarial and

antimicrobial activities.

39
Literature review

Anticancer activity was observed in the treatment of breast cancer where low

doses of aqueous leaf extracts inactivated the human breast cancer cells (MCF-7) in

vitro (Gresham et al., 2008). Antidiabetic activity was observed by Ekpenyong et al.

(1999) when aqueous leaf extracts of V. amygdalina lowered blood glucose levels in

diabetic induced rabbits. The reduction of blood glucose levels in normal and diabetic

rats were significant when compared to the diabetic drug chlorpropamide (Osinubi,

2008).

Aqueous extracts of the plant exhibited antioxidant activity (Adesanoye &

Farombi, 2010; Iwalokun et al., 2006) due to the presence of flavonoids in the plant

(Igile et al., 1994). Leaf extracts inhibited Plasmodium berghei in mice, with

antimalarial activity (Audu et al., 2012). The plant also possessed amoebicidal activity

in treating amoebic dysentery (Huffman & Seifu, 1989).

Antimicrobial activity of V. amygdalina was detected in the leaf sap against

Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, and

Pseudomonas aeruginosa (Ijeh et al., 1996). Methanolic extract of leaves inhibited

Bacillus subtilis, Klebsiella pneumonia, P. aeruginosa, Proteus vulgaris, Shigella

dysenteriae and S. aureus (Akinpelu, 1999). Erasto et al. (2006) isolated vernolide and

vernodal from V. amygdalina which successfully inhibited Bacillus cereus, S.

epidermidis, S. aureus, Micrococcus kristinae, Streptococcus pyrogens, and Salmonella

pooni. The stems inhibit oral bacteria and are used as chew sticks to treat dental

problems (Ijeh & Ejike, 2011).

40
Literature review

2.7 General Extraction of Bioactive Compounds from Plants

Extraction of plants involves the use of selective solvents and extraction

techniques to isolate biologically active compounds of plant tissue. The solvents diffuse

into the solid plant tissues and solubilize compounds of similar polarity (Green, 2004).

Quality and efficiency of plant extracts depends on plant material (wet or dry), type of

solvent used and extraction technique (Das et al., 2010).

2.7.1 Collection and drying of plant materials

Firstly, plant materials are carefully selected for collection. Leaves that were

infested with insect or fungus are discarded because these contaminants could affect the

chemical composition and biological activity. Underground parts of a plant such as the

roots, tuber, rhizome, and bulb are preferred to isolate bioactive compounds possessing

antimicrobial properties compared to aerial parts of plants.

The source for extraction of secondary metabolites in plant tissues could be

either fresh or dried materials. Dried plant materials were favoured based on several

factors. Firstly, bioactive compounds are more prominent in extracts from dry material

because drying lyses the membranes of plant organelle containing different secondary

metabolites making the extraction more efficient. However, liable compounds may be

destroyed during the drying process (Eloff & McGaw, 2006).

Secondly, traditional medicine practitioners commonly use dried material or

aqueous extracts. Thirdly, fresh plant materials are difficult to work with as there is time

delay between plant collection and processing (Angeh, 2006). Fourthly, during

41
Literature review

separation by liquid-liquid extraction, the solubility will be affected by the differences

in water content making the secondary metabolites unstable (Ncube et al., 2008).

Before extraction, plants are air dried (Baris et al., 2006; Dilika et al., 1997) to a

constant weight or dried in an oven at 40C for 72 hours (Salie et al., 1996). Plant

materials are dried at a low temperature to prevent the loss of volatile bioactive

compounds (Wang et al., 2002). Different drying techniques may produce different

results. An example is the efficiency of antimicrobial activity in Combretum

erythrophyllum leaf extracts. The lowest antibacterial activity was observed in

lyophilized materials because volatile antibacterial compounds were lost. The highest

activity was observed when plant materials were dried slowly at a low temperature

(Martini et al., 2004).

2.7.2 Choice of Solvent

The type of solvent used in extraction of medicinal plants determines the

different bioactive compounds isolated. Solvents are chosen based on the yield of

extracts, rate of extraction, toxicity of the solvents in bioassay, ease of evaporation at

low heat, physiological absorption of extracts, ability to preserve plant materials and

inability to cause the extract to complex or dissociate (Hughes, 2002). Traces of residual

solvent may be present in the final product of extract even after evaporation, thus the

solvent chosen should be non-toxic, non-hazardous to health and should not affect

bioassays used to isolate bioactive compounds (Ncube et al., 2008).

Another important factor in the choice of solvent is the type of bioactive

compound that needs to be isolated from the plant such as phenolic compounds or

antimicrobial compounds. Crude or alcohol extracts are used for the initial screening of

plants for antimicrobial activity which is then followed by organic solvent extraction.

42
Literature review

Aqueous extracts are most commonly used because traditional medicine practitioners

use water to make their concoctions and water is a universal solvent. However, it was

discovered that plant extracts from organic solutions effectively isolated bioactive

compounds and showed higher antimicrobial activity (Parekh et al., 2005). For example

water soluble phenolic compounds such as flavonoids (mainly anthocyanins), failed to

exhibit antimicrobial activity and only exhibited antioxidant activity (Nang et al., 2007;

Yamaji et al., 2005).

Most plant antimicrobial are aromatic/ saturated organic compounds, therefore

the most effective solvents used for preliminary screening of plant antimicrobial activity

are methanol, ethanol and water (Parekh et al., 2006; Rojas et al., 2006; Lourens et al.,

2004; Bisignano et al., 1996; Salie et al., 1996).

2.7.3 Extraction technique

Extraction technique differs by the extraction time, type of solvent, pH of

solvent, temperature, size of the plant tissue particles and the solvent-to-sample ratio.

The most important step in extraction is the wet or dry plant material must be

homogenized to form finer tissue particles to increase the surface area for extraction

thereby increasing the rate of extraction. This will also shorten the extraction time. Eloff

(1998), proved that fine plant particles (10 m diameter) produced higher extraction

yield over a period of 5 minutes compared to coarsely ground materials that were placed

in a shaker for 24 hours. Thus the rate of extraction is increased by grinding plant

materials to finer particles, increasing the time of contact between material and solvent

and shaking the plant material in the solvent (Ncube et al., 2008).

The most commonly used extraction technique is maceration (Basri & Fan,

2005; Parekh et al., 2005; Meyer & Dilika, 1996) whereby wet or dry plant parts are

43
Literature review

homogenized to fine particles, placed in contact with a certain quantity of solvent in a

stoppered bottle for a defined period of time (usually 24 hours) with vigorous shaking

(Handa, 2008). The ideal solvent to sample ratio is 10:1 (v/w) (Green, 2004). The

extract is filtered and the filtrate is dried down under reduced pressure. Then it is re-

dissolved in solvent to a defined concentration. The extract is centrifuged for 30 minutes

for clarification (Cichewicz & Thorpe, 1996; Taylor et al., 1996).

Apart from that, soxhlet extraction technique is used whereby dried plant tissues

are extracted by continually exposing the materials with organic solvent (Kianbakht &

Jahaniani, 2003). This method is suitable for compounds that can withstand high

temperatures, and is not appropriate for thermolabile compounds as continues heating

may lead to degradation of bioactive components (de Paiva et al., 2004).

Serial exhaustive extraction involves continual extraction with solvents of

increasing polarity from non-polar (hexane) to polar solvents (methanol) to ensure that

compounds of all polarity are extracted (Green, 2004). Other methods are used to isolate

particular compounds such as sequential grinding to isolate alkaloids, steroids and

triterpenoids; gradial centrifugation to isolate lectins and polypeptides; and acid

hydrolysis to isolate phenols (Eloff, 1999).

Specific solvent is used for the screening of specific secondary metabolites such

as methanol or ethanol are used to isolate alkaloid; acetone for flavonoids and steroids;

hexane, diethyl ether and chloroform for fat soluble oils, wax, lipids and esters;

dichloromethane for terpenoids; ethyl acetate for esters; ethanol for sterols, polyphenols,

and tannins; and water for the water soluble components such as glycosides,

polysaccharides, polypeptides and lectins (Harborne, 1998).

44
Literature review

2.8 Test Microorganism Used in the Study

Over the years, bacteria have become increasingly resistant towards antibiotics.

Genetically, bacteria are able to transmit and develop resistance towards antimicrobial

drugs (Cohen, 1992). Resistance towards antimicrobial drugs are developed through (i)

reduction in bacteria efficiency to bind with the drug by modification of targeted active

site; (ii) bacteria destructs or modifies the drug by producing enzymes or; (iii) the drug

is efflux from the cell (Sheldon, 2005).

Five test microorganisms were selected in this study: Gram-negative bacteria

(Escherichia coli and Pseudomonas aeruginosa) and Gram-positive bacteria (Bacillus

cereus, Staphylococcus aureus and Streptococcus mutans). Both Gram-positive and

Gram-negative bacteria were chosen because the latter is more resistant to antimicrobial

agents due to the presence of an outer membrane layer (Alberts et al., 2002).

Most plant pathogens belong to the Gram-negative strains which are mostly

resistant to the bioactive compounds isolated from plants. Whereas Gram-positive

bacteria are usually susceptible to plant bioactive compounds suggesting that the

difference in cell wall and outer membrane layer morphology of the two bacteria strains

determine the susceptibility towards plant secondary metabolites (Gonzlez-Lamothe et

al., 2009).

45
Literature review

2.8.1 Bacillus cereus (B. cereus)

B. cereus belongs to the genus Bacillus, is a Gram-positive, motile, spore-

forming rod. It is about 1 - 1.2 m by 3 5 m with square ends. This bacterium has the

ability to grow both aerobically at 37 C and anaerobically at 45 C and exists as spore

and vegetative cells. Spores are the infective agent for the bacterium and are 1 - 1.5 m,

ellipsoidal shaped, formed in aerobic conditions and are able to withstand extreme

environmental conditions, such as heat, freezing, drying and radiation (Jensen et al.,

2003; Davenport & Smith, 1952). Spores germinate when contacted with organic matter

or within a host cell (Arnesen et al., 2008). The vegetative cells contain an outermost

crystalline surface protein (S layer) which is formed during the cell colonization stage

of the bacteria lifecycle (Kotiranta et al., 2000; Kotiranta et al., 1998). They can grow at

optimal temperatures ranging from 25 C 37 C (Drobniewski, 1993).

A B

Figure 1- 17: Morphology of B. cereus


Figure displays the Gram staining of blood culture showing Gram-positive bacilli with rounded ends,
found singly, in pairs and short chains (A) and grey, opaque, granular spreading colonies with irregular
perimeters growing on 5% sheep blood agar at 37C under aerobic conditions. The smaller smooth
colonies admixed among spreading growth (B).

Image retrieved from Bottone (2010)

46
Literature review

B. cereus is known as a soil bacterium and is found in decayed organic matter,

fresh and marine waters, vegetable and the intestinal tracts of invertebrates. It can

germinate, grow and sporulate in the soil contaminating soil and food products causing

infection to the human intestine (Vilain et al., 2006; Jensen et al., 2003; Ghosh, 1978).

B. cereus is commonly associated with two types of food poisoning diseases, the

diarrhoeal and emetic type (Gaur et al., 2001). The diarrhoeal type is caused by

enterotoxins produced by vegetative cells in the small intestine which are ingested.

Protein rich food such as meat, vegetables and milk products are the source. After

ingestion, the incubation time is between 8 to 16 hours or longer, while symptoms such

as abdominal cramps, diarrhoea, nausea and vomiting usually last for 12 to 24 hours or

several days (Kotiranta et al., 2000).

The emetic type is caused by a plasmid encoded cyclic peptide (cerulide)

produced by growing cells in the food before ingestion (Bottone, 2010). Food sources

are starch rich foods such as fried and cooked rice, pasta and noodles. This type was

first identified by (Mortimer & McCann) in 1974 following several outbreaks of the

disease in the United Kingdom. Symptoms such as nausea and vomiting occur 30

minutes to 6 hours after ingestion and may last up to 24 hours (EhlingSchulz et al.,

2004).

B. cereus can be transmitted through food sources that are heat treated because

the spores can withstand high temperatures. Temperature of about 48 C, achieved after

cooking and cooling of food facilitates the germination of spores and with the absence

of other competing flora results in the healthy growth of B. cereus. It is also easily

spread through food sources of plant origin because it is a soil saprophyte (Drobniewski,

1993).

47
Literature review

Non-gastrointestinal diseases related to B. cereus are burns; traumatic or

postsurgical wounds; ocular infections; bacteraemia and septicaemia; infections of the

central nervous system such as meningitis and brain abscesses; and respiratory

infections such as pneumonia, endocarditis and pericarditis (Bottone, 2010;

Drobniewski, 1993).

In the antibiotic resistance test, it was discovered that most B. cereus strains

were susceptible towards aminoglycosides, clindamycin, vancomycin, chloramphenicol,

erythromycin and tetracycline (Drobniewski, 1993). Resistance was also discovered

towards clindamycin, cefazolin, cefotaxime, cephalosporin and penicillin due to the

production of -lactamase (Bottone, 2010; Drobniewski, 1993).

2.8.2 Escherichia coli (E. coli)

E. coli is a Gram-negative bacilli that are approximately 1.0 3.0 m long with

a diameter of 0.5 m. They are non-sporus and a single layer of peptidoglycan is found

in the periplasm. They have peritrichous flagella, making them motile in liquid and the

most abundant facultative anaerobes in nature (Harshey, 1994).

The first E. coli was isolated by Escherich (1885) from the feces of a child in

Austria and was named as the Bacterium coli commune. E. coli colonizes the

gastrointestinal tract of infants within hours after birth and coexists in mutualism with

humans for their entire life as a harmless commensal of the intestinal tract. However,

some strains developed virulence forming pathotypes, adapting to new niches as fecal

contaminant of soil and water causing intestinal and extra-intestinal diseases (Kaper et

al., 2004).

48
Literature review

A B

Figure 1- 18: Morphology of E. coli


Figure displays the Scanning electron microscopy of E. coli, grown in culture and adhered to a cover
slip (A) and E. coli streaked onto Luria agar and incubated at 37C for 24 hours (B).

Image retrieved from: http://en.wikipedia.org/wiki/Image:EscherichiaColi_NIAID.jpg and


http://www.microbelibrary.org/images/atlas_lb/escherichia%20coli%20topview.jpg

Infection of these pathotypes caused three clinical diseases such as enteric or

diarrhoeal disease, urinary tract infection (UTI) and sepsis or meningitis. There are six

types of intestinal pathogens such as enterotoxigenic E. coli (ETEC); enteropathogenic

E. coli (EPEC); enterohaemorrhagic E. coli (EHEC); enteroaggregative E. coli (EAEC);

enteroinvasive E. coli (EIEC) and diffusely adherent E. coli (DAEC). Extraintestinal

types include uropathogenic E. coli (UPEC) and meningitis associated E. coli (MNEC)

(Kaper et al., 2004).

Enterotoxigenic E. coli (ETEC) causes diarrhoea, and usually infects children

under the age of 5. Symptoms of the infection are mild watery diarrhoea or in some

cases severe, cholera-like illness which can rapidly dehydrate the body and may lead to

death (Welch, 2006). Enteropathogenic E. coli (EPEC) is a diarrhoeagenic E. coli strain

that lack Shiga-toxins (verocytoxin). EPEC causes watery diarrhoea with mucus,

vomiting, fever and dehydration which lasts for several days (Welch,

2006).Enterohaemorrhagic E. coli (EHEC) are Shiga-toxic producing bacteria such as

E. coli 0157. The disease is transmitted to humans who consume beef contaminated

with cattle feces. However in cattles this strain is a member for the intestinal microflora
49
Literature review

thus are not harmful to the animals. Pathogenic strains that do not possess enterotoxins

or Shiga-toxins and self-aggregate are known as Enteroaggregative E. coli (EAEC)

(Nataro et al., 1987). Symptoms include chronic watery diarrhoea and abdominal

cramps (Nataro et al., 1995).

Diffusely adherent E. coli (DAEC) causes diarrhoea in infants and is different

from the other pathogenic strains because it possesses a special adhesion phenotype.

Enteroinvasive E. coli (EIEC) are phylogenetically related to Shigella species and infect

the large intestine. Patients infected experience inflammatory colitis, dysentery, bloody

diarrhoea, severe cramps and fever similar to infection caused by Shigella (Goldberg &

Theriot, 1995).

An extraintestinal pathotype of E. coli is the uropathogenic E. coli (UPEC), also

known as the urinary tract and bloodstream E. coli. About 60% of women acquire

urinary tract infection (UTI) in their lifetime (Kunin, 1994), where a large percentage is

associated with infection by UPEC (Haley et al., 1985). Another is the meningitis

associated E. coli (MNEC) which is the most common cause of neonatal meningitis.

New-borns are infected with the strain during birth when passing through the birth canal

which will cross the endothelial surface into the brain through the bloodstream. It is a

severe disease where the infected patient faces death and survivors possibly face long

term neurological problems (Stoll et al., 2002; Unhanand et al., 1993).

E.coli is used as a test microorganism for determining antimicrobial resistance

towards antimicrobial agents because it is easily cultured in clinical laboratories,

biochemically, physiologically and genetically well characterized (Welch, 2006), found

frequently in a wide range of hosts, and acquires resistance easily (Erb et al., 2007).

50
Literature review

2.8.3 Pseudomonas aeruginosa (P. aeruginosa)

P. aeruginosa is a motile, rod-shaped, Gram-negative bacterium from the

Pseudomonadaceae family (Balasubramanian et al., 2013). It comprises of an outermost

slime layer, an outer membrane, peptidoglycan layer and inner cytoplastic membrane.

The bacteria contains pathogenic components such as (i) the cell envelope that controls

adhesion, formation of microcolony, and the transport of antibacterial agents across the

cell (Peterson, 1980), (ii) pili which enables the bacterium to adhere to surfaces and for

conjugation (Weppelman & Brinton, 1971) and (iii) exotoxins (Liu, 1974). Gram-

staining of clinical specimen produces slender Gram-negative bacilli arranged singly, in

pairs or in short chains. The bacterial colony is identified by the presence of a blue-

green pigment with a grape-like odour (Stratton, 1990).

A B

Figure 1- 19: Morphology of P. aeruginosa


Figure displays the Scanning electron microscopy of P. aeruginosa (A) and P. aeruginosa streaked
onto Luria agar and incubated at 37C for 48 hours (B).

Image retrieve from: CDC/ Janice Haney Carr and


http://www.microbelibrary.org/images/atlas_lb/pseudomonas%20aeruginosa%20topview(48).jpg

P. aeruginosa exists widely in nature, thriving in aqueous environments and

moist soil (Stanley, 1947). It is a nosocomial pathogen infecting immune compromised

patients (Balasubramanian et al., 2013). The microorganism infects patients with burn

51
Literature review

wounds, cystic fibrosis (CF), acute immunodeficiency syndrome (AIDS), organ

transplant, acute leukaemia and cancer (Morita et al., 2014; Bodey et al., 1983). It

causes catheter-related bloodstream infection in patients with a device inserted in the

body (Maki et al., 1973) and ventilator-associated pneumonia in patients receiving

mechanical ventilation via an endotracheal tube (Kollef, 2000).

P. aeruginosa also causes urinary tract infection in structurally abnormal urinary

tracts and corneal ulcer through the use of contaminated contact lenses (Wilson et al.,

1981). Intravenous drug abusers are at risk of P. aeruginosa endocarditis infection

(Jackson, 1994). It infects areas in the skin that are constantly exposed to moisture such

as the nails leading to the green nail syndrome where the nails develops greenish

discolouration (Goldman & Fox, 1944).

A common factor amongst patients infected by P. aeruginosa is their host

defence mechanism is disrupted which in some cases may lead to death. However,

recovery from infection depends to the severity of the patients underlying disease

(Bodey et al., 1983). P. aeruginosa is a prominent pathogen because it possesses innate

and acquired resistance towards antimicrobials and disinfectants such as 0.25% acetic

acid, phenolic disinfectant, chlorhexidine, isopropyl alcohol, tetracycline and

chloramphenicol (Morita et al., 2014; Stratton, 1990). The resistant characteristic is due

to the outer membrane barrier, multi drug efflux transporters, endogenous antimicrobial

inactivation and their ability to form biofilm (Poole, 2011; Lewis, 2007; Mah et al.,

2003).

52
Literature review

2.8.4 Staphylococcus aureus (S. aureus)

S. aureus belongs to the Staphylococcaceae family. Its a Gram-positive strain,

with spherical shape of 0.5 1.0 m in diameter, immobile and growing in grape-like

clusters. Colonies formed are yellow, growing on rich nutrient medium (Foster, 1996).

S. aureus are facultative anaerobes and common human commensal, however some

strains are pathogenic. They exist asymptomatically in the nasal cavity of about 30% of

the human population (Kluytmans et al., 1997) and are transmitted through skin-to-skin

contact and contaminated objects (Lowy, 1998).

S. aureus develops the ability to infect humans when the skin barrier is

disrupted, presence of immunodeficiency syndrome and presence of underlying diseases

such as diabetes (Grundmann et al., 2006). The medical problems caused by S. aureus

includes (i) superficial lesion such as boils, abscesses and wound infections; (ii) deep-

seated, nosocomial infections such as osteomyletis, endocarditis, pneumonia, surgical

wound infection and bacteremia; (iii) toxemic syndromes such as toxic shock, scarlet

fever and food poisoning; and (iv) infections associated with indwelling medical

devices such as joint prostheses, cardiovascular devices and artificial heart valves

(Jarraud et al., 2002; Foster, 1996).

An infection by S. aureus starts by the colonization of the bacteria in the anterior

nares which is carried by the host for weeks or months which is then followed by

infection which spreads locally or to the blood. Once in the blood, it moves to distant

organs causing sepsis which could lead to death if left untreated (Archer, 1998).

Virulence factors include surface proteins that colonize tissues; capsule and

immunoglobulin binding protein A that inhibits phagocytosis; and toxins that damages

host tissues and promotes disease symptoms (Foster, 1996).

53
Literature review

S. aureus is an alarming pathogen in the community because it acquires

resistance towards most antibiotics (Chambers & DeLeo, 2009). In 1940s penicillin was

able to treat S. aureus infections. However, the bacteria developed resistance towards

penicillin in 1942 (Rammelkamp & Maxon, 1942). In 1961, methicillin was discovered

to inhibit S. aureus, which later developed resistance forming methicillin resistant S.

aureus (MRSA). MRSA acquired resistance to all -lactam antibiotics (Knight et al.,

2012). S. aureus developed resistance to almost all antimicrobial agent due to its

commensal nature. Hence antibody based vaccines fail to immunize patients (Verkaik et

al., 2010) and this bacterium evolved to escape the host immune system (Daum &

Spellberg, 2012).

A B

Figure 1- 20: Morphology of S. aureus


Figure displays the Scanning electron microscopy of S. aureus (A) and Gram staining of S. aureus (B).

Image retrieved from http://microbewiki.kenyon.edu

54
Literature review

2.8.5 Streptococcus mutans (S.mutans)

The oral S. mutans is a non-motile, negative-catalase, Gram-positive

streptococci that infects the oral cavity (Hamada & Slade, 1980). The first bacterial

species was isolated from carious lesions in 1924 by Clarke. The name Streptococcus

mutans was designated when Gram staining of the bacterium showed oval structures

which appeared to resemble a mutant form of a coccus (Clarke, 1924). Clarke

associated this organism with dental decay. However researchers later failed to isolate

this bacterium. It was rediscovered later in the 1960s in rodents (Carlsson, 1968;

Guggenheim, 1968; Larson & Fitzgerald, 1968).

A B

Figure 1- 21: Morphology of S. mutans


Figure displays the Scanning electron microscopy of S. mutans biofilm present on toothbrush bristles (A)
and Gram staining of S. mutans (B).

Image retrieved from http://www.msi-lab.com/tl_files/msi/images/bacteries.jpg and


http://www.publicdomainfiles.com/show_file.php?id=13528513816662

55
Literature review

Bacterial isolates that exhibited similar characteristic to S. mutans species were

collectively known as mutans streptococci (MS) (Coykendall, 1989). MS that ferment

mannitol, sorbitol and various other sugars and synthesize extracellular water soluble

glucans from sucrose were identified as S. mutans (Hamada & Slade, 1980; Stiles et al.,

1976; Ferretti & Ward, 1976). S. mutans was found to be widely distributed in animals

as it was isolated from Patas monkeys, rhesus monkeys, wild rats, and indian fruit bats

(Dent et al., 1978; Coykendall et al., 1976; Lehner et al., 1975). This microorganism

was known to be the most cariogenic oral Streptococci (Ophori et al., 2013).

The cell wall of S. mutans is made up of four antigenic polymers such as

peptidoglycan; group and type-specific polysaccharides; protein; and teichoic and

lipoteichoic acids in the glycerol form. The virulence factors include the ability of S.

mutans to adhere to smooth surfaces and the acidogenic properties exhibited by the

bacteria. These factors are responsible for the bacteriums cariogenicity in both humans

and animals. Plaque formation by S. mutans is caused by the adherence of the bacterium

to smooth tooth surfaces along with the formation of glucose from the intake of sucrose

in the diet (Hamada & Slade, 1980; Ikeda et al., 1980). Plaque formation due to dietary

intake was supported by scientific findings whereby high dental decay was observed

shortly after sucrose was introduced into the diet (Loesche, 1986).

56
3.0. MATERIALS AND METHODS

Figure 3- 1: Flow chart of the research


Figure displays the flow chart describing the research outline and steps taken
* the choice of plant parts used in the study are discussed in pg 138 and 139

57
Materials and methods

3.1. Selection of Plant Samples

Six medicinal plants commonly found in Malaysia were selected for this study

(Appendix A). The plant samples were collected from the housing area of Seksyen 4

Petaling Jaya, Selangor, Malaysia in May 2012. Plants were chosen based on folklore

medicinal values and were identified by Dr. Sugumaran Manickam of Institute of

Biological Sciences, Faculty of Science, University of Malaya, Malaysia. The voucher

specimens were prepared and deposited at the herbarium of the Institute of Biological

Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia (Table 3-

1, Appendix B).

Table 3- 1: Plant species screened for antimicrobial activity


Part of plant
Scientific name Common name Family Voucher number
used

leaf
Aloe vera Aloe Asphodeloideae 47777
pulp

Azadirachta indica Neem Meliaceae 47778 leaf

Carica papaya Papaya Caricaceae 47779 leaf

Centella asiatica Pegaga Umbeliferae 47781 whole plant

leaf
Hymenocallis spesiosa Lily Amaryllidaceae 47783 root
tuber
Vernonia amygdalina/
leaf
Gymnanthemum Bitterleaf Asteraceae 47784
stem
amygdalinum
Table displays the details of the selected medicinal plants and parts of plant used with voucher deposited
at the Herbarium of University of Malaya.

58
Materials and methods

3.2. Preparation of Plant Materials

3.2.1. Preparing plant leaf, root and tuber

The plant parts were cleaned under tap water and air-dried to a constant weight

(Das et al., 2010) at room temperature away from the exposure to sunlight to prevent

the loss of active components in the plant (Thakare, 2004). Dried plant parts were

pulverized to produce fine homogenous powder using an electrical blender (National,

Panasonic) and sifted to obtain fine powder and then stored in sterile 50 ml centrifuge

tubes at 4 C until required (Rafat et al., 2010).

3.2.2. Preparation of Aloe vera (A. vera) pulp

The outermost whorls of leaves of mature A.vera were selected from the plants,

and washed with distilled water. The yellow liquid was drained off before removing the

rind from the leaves. The leaves were sliced across the width with a sharp knife. The

inner exposed surfaces revealed a transparent gooey pulp without the addition of sap.

The pulp was scooped with a spatula and homogenized using a blender (National

Panasonic). At this stage, the homogenized pulp was lyophilized (Labconco,

UltraScientific Sdn. Bhd.) before being processed and stored at 4 C until required (Ni

& Tizard, 2004).

59
Materials and methods

3.3 Extraction Procedure of Plant Samples

3.3.1 Aqueous extraction

Plant sample powder was weighed and placed in a 100 ml Schott bottle. Double

distilled water was measured and poured into the Schott bottle following a solvent to

dry weight ratio of 10:1 (v/w) (Das et al., 2010). The plant samples were placed on an

orbital shaker (Edmund Bhler, Germany) for 24 hours at room temperature. The

extract was filtered through Whatman no.1 filter paper. The filtrate was lyophilized and

then re-dissolved in distilled water to make up a stock solution of 100 mg/ml

concentration and stored at 4C. Working solution was prepared at a desired

concentration by diluting the stock solution with double distilled water (Busani et al.,

2012).

3.3.2 Ethanolic and methanolic extraction.

Fine plant powder was weighed and placed in a 100 ml Schott bottle. 95%

analytical grade ethanol (Friendemann Schmidt Chemicals, USA) or HPLC grade

methanol (Tedia Company Inc, USA) was measured and poured into the Schott bottles

following a solvent to dry weight ratio of 10:1 (v/w) (Das et al., 2010). The plant

sample was placed on a shaker for 72 hours at room temperature in the dark. The

solution was then filtered through Whatman no. 1 filter paper and evaporated to dryness

using a rotary evaporator (Buchi Rotarvapor, Switzerland) at a temperature between

36 C to 40 C.

A stock solution of 100 mg/ml of the plant extracts was prepared in 5%

Polyoxyethylene sorbitan mono-oleate (Tween 80, Hopkins & Williams, London)

dissolved in isotonic phosphate buffer (IPB) pH 7.4 (bioWorld, USA) and stored at 4 C

60
Materials and methods

until required for experiments. The working solution was made by diluting the stock

solution with IPB (Rafat et al., 2010).

3.3.3 Determination of percentage of yield for plant extracts

The percentages of yield of the extracts were based on dry weight (d.w.) sample

and were calculated as follows:

Yield of extracts (%) = Weight of extracts (g) x 100%


Weight of dry plant powder/
Weight of freeze dried A. vera gel (g)

The percentage of yield for A. vera gel was calculated based on the weight of the

freeze dried gel before extraction. The yield of extract for A. indica (leaf); A. vera (leaf

and gel); C. papaya (leaf); H. spesiosa (leaf, root, and tuber) and V. amygdalina (stem)

was determined with no replicates. The yield of extracts for the selected plants C.

asiatica (whole plant) and V. amygdalina (leaf) was determined in trplicate.

61
Materials and methods

3.4. Authentication of Selected Medicinal Plant with DNA Barcoding Method

Medical plants used in the study, C. asiatica and V. amygdalina were identified

using ITS2 region as a DNA barcode based on the findings of Chen and colleagues

(2010).

3.4.1 DNA extraction

Genomic DNA of plant samples C. asiatica and V. amygdalina was extracted using

a commercially available DNeasy Plant Mini Kit (Qiagen, USA, Appendix L1) as

follows:

The first step was tissue dissociation, where 100 mg of fresh plant leaves were cut

and weighed. Next, the plant sample was ground with pestle and mortar under liquid

nitrogen to obtain a fine powder and then transferred into a 1.5 ml microcentrifuge tube

(Eppendorf GmbH, Germany).

The second step was DNA lysis. AP1 buffer, 400 l and RNase A, 4 l were added

into the sample tube and mixed by vortexing with a vortex machine (Grant-bio,

England). The sample was incubated in a dry bath (Thermoline, Australia) at 65 C for

10 minutes and during incubation, the tubes were inverted 2-3 times. Next, Buffer P3,

130 l was added into the sample and mixed. The tubes were incubated on ice for 5

minutes. The lysate was centrifuged for 5 minutes at 20,000 x g. Then, the lysate was

pipetted into a QIAshredder spin column placed in a 2 ml collection tube and

centrifuged with a refrigerated centrifuge (ThermoScientific Inc, USA) at 20,000 x g for

2 minutes. The flow-through was transferred into a new tube without disturbing the

pellet (if present).

62
Materials and methods

The third step was DNA binding where 1.5 volumes of Buffer AW1 was added to

the tubes and mixed by pipetting. The mixture, 650 l was transferred into a DNeasy

Mini spin column placed in a 2 ml collection tube. The tube was centrifuged at 6000 x

g for 1 min. The flow-through was discarded and this step was repeated for the

remaining samples.

The fourth step was washing. The spin column was placed back into a new 2 ml

collection tube. Buffer AW2, 500 l was added and centrifuged at 6000 x g for 1 min.

The flow-through was discarded and another 500 l Buffer AW2 was added. The tube

was centrifuged at 20,000 x g for 2 minutes.

The fifth and final step was DNA elution. The spin column was transferred into a

new 1.5 ml microcentrifuge tube. The spin column was carefully removed from the

collection tube so that the column did not come into contact with the flow-through.

Finally 100 l of Buffer AE was added for elution. The tube was incubated at room

temperature for 5 minutes and then centrifuged at at 6000 x g for 1 min. The genomic

DNA extracted was kept at -20 C until further analysis.

3.4.2 Polymerase Chain Reaction (PCR) amplification

The concentration of the genomic DNA obtained was checked with nanodrop

(Thermo Scientific, USA). The primers used in the research for ITS2 region were

forward primer (5ATG CGA TAC TTG GTG TGA AT3) and reverse primer (5-

GAC GCT TCT CCA GAC TAC AAT-3) (Chen et al., 2010) supplied by (First BASE

Laboratories, Malaysia). Both the forward and reverse primers, 100 M were diluted to

1.0 M with nuclease-free water (Promega, USA). PCR amplification was conducted in

a 25 l reaction mixtures containing the following:

63
Materials and methods

Table 3- 2: PCR Master Mix


Component Volume (l) Final concentration

PCR Master Mix (Promega , USA), 2X 12.5 1X
Forward primer, 100 M 2.5 1.0 M
Reverse primer, 100 M 2.5 1.0 M
DNA template, 30 ng/ml 5.0 16.39 ng/ml
Nuclease-free water 2.5 -
TOTAL 25.0 -
Table displays the components added into the 0.5 ml microcentrifuge tube for PCR.

Modified from Chen et al. (2010)

Next, the PCR Mastercycler Personal (Eppendorf GmbH, Germany) was set

with the program for 40 cycles as follows:

Table 3- 3: PCR Thermocycler program


Temperature (C) Time
94 5 min
94 30 sec
56 30 min
72 45 min
72 10 min
4 hold
Table displays the thermocycler program followed for 40 cycles for
ITS2 region of plant genomic DNA

Adapted from Chen et al. (2010)

3.4.3 Agarose gel electrophoresis

Firstly, the electrophoresis buffer, 5 X Tris-Borate-EDTA (TBE) buffer was

prepared where 13.5 g of tris (First BASE Laboratories, Malaysia), 6.875 g of boric acid

(Promega, USA) and 5 ml of EDTA were measured and added into a beaker and

distilled water was added up to 250 ml. The mixture was stirred with a stirrer. Then the

5 X TBE buffer was diluted to 0.5 X where 100 ml of 5 X TBE buffer was diluted with

900 ml of distilled water.

64
Materials and methods

Secondly 1% (w/v) agarose gel was prepared for separating the particular size

fragments expected in the DNA sample by dissolving 0.2 g of agarose (First BASE

Laboratories, Malaysia) in 20 ml of 0.5 X TBE buffer. The slurry was heated in a

microwave oven until the agarose dissolved. The molten gel was left to cool on the

bench for about 5 minutes to 60 C. Next, 1 l of 10 mg/ml ethidium bromide (GibcoBrl

Life Technologies, Japan) was added to a final concentration of 0.5 g/ml. The gel

solution was mixed thoroughly by gentle swirling.

Thirdly, the gel was slowly poured into the casting tray preventing the formation

of bubbles. A comb was positioned about 0.5 - 1.0 mm above the casting tray so that a

complete well was formed when the molten agarose was added to the mold. A small

toothed comb allowed 15 l of sample per well. The gel was allowed to set completely

for 30 minutes at room temperature. Once set, the comb was carefully removed and the

gel was mounted into the electrophoresis tank (Bio-Rad, USA). 0.5 X TBE running

buffer was poured into the tank to submerge the gel so that it is completely covered in

buffer.

Next, 1 l of 6 X DNA loading dye (Promega, USA) was pipetted onto the

parafilm. Pipetting one sample at a time, firstly 2 l of DNA sample from the PCR

reaction was mixed with DNA loading dye by resuspending three times with a

micropipette on the parafilm. Next the sample was loaded into the appropriate well

carefully. This step was repeated with 1 l of 100 bp DNA ladder (Promega, USA).

The lid of the gel tank was closed, and the electrical leads were attached so that

the DNA migrated towards the positive anode (red lead). A voltage of 1 5 V/cm

(measured as the distance between the positive and negative electrodes) was applied.

The gel was run at 90 V for 35 minutes until the blue dye migrated to an appropriate

distance (75%) through the gel. When the DNA samples / dyes have migrated to a

sufficient distance through the gel, the power was turned off and the leads and lid were

65
Materials and methods

removed from the gel tank. The gel was examined under ultraviolet (UV) light and

photographed using a Gel Documentation System Biospectrum 410, UVP (Fischer

Scientific, USA). The gels were analysed for presence of a band at 500 bp which was

the ITS2 region.

3.4.4 PCR product purification

The PCR product was purified with MEGAquick-spin Total Fragment DNA

Purification Kit (Intron Biotechnology Inc, Korea, Appendix L2). Firstly, 5 volumes of

BNL Buffer was added to the PCR reaction product and mixed well by vortexing. For

20 l of PCR product, 100 l of BNL Buffer was added to the tube directly. Secondly,

one MEGAquick-spin column was placed in a Collection Tube for each DNA sample.

Thirdly the DNA sample was transferred to the MEGAquick-spin column

assembly and centrifuged at 13,000 rpm for 1 minute to bind the DNA. The flow-

through was discarded and the MEGAquick-spin column was placed back into the

same 2 ml collection tube. Fourthly, 700 l of Washing Buffer was added to the column

and centrifuged at 13,000 rpm for 1 minute. The flow-through was discarded and the

MEGAquick-spin column was placed back into the same 2 ml collection tube and

centrifuged at 13,000 rpm for 1 minute to dry the spin membrane.

Fifthly, the MEGAquick-spin column was placed in a clean 1.5 ml

microcentrifuge tube. Elution Buffer, 30 l was applied directly to the centre of the

column without touching the membrane with the pipette tip and the tube was incubated

at room temperature for 1 minute before it was centrifuged at 13,000 rpm for 1 minute.

Finally the MEGAquick-spin column was discarded and the microcentrifuge tube

containing the eluted purified PCR product was stored at -20 C.

66
Materials and methods

3.4.5 DNA sequencing

The purified PCR product was sent for sequencing to FirstBase Sdn. Bhd.

(Malaysia), and was sequenced in both directions with the same primers used for PCR

amplification. The sequence alignment was conducted with Mega 5.2 software. Firstly

the forward and reverse sequence files were opened with Mega 5.2 software. Next one

of the sequences was converted to reverse complement sequence. Then, the sequences

were aligned by ClustalW. Both ends of the sequences were trimmed to remove the

gaps.

The sequence was then compared with a known sequence in GenBank

(www.ncbi.nlm.nih.gov/BLAST). An unknown sample was identified if the ITS2 region

matched that of a reference species with 99% identity.

67
Materials and methods

3.5 Antimicrobial Susceptibility Test

3.5.1 Test microorganisms used in the study

Antibacterial activity of plant extracts was investigated against five test

microorganisms. Three Gram-positive test bacteria Staphylococcus aureus, Bacillus

cereus and Streptococcus mutans and two Gram-negative bacteria Escherichia coli and

Pseudomonas aeruginosa (Table 3-4) were used. The registered bacterial isolates were

obtained from the American Type Culture Collection (ATCC) maintained in the

Fermentation Laboratory, Microbiology Division, Institute of Biological Sciences,

Faculty of Science, University of Malaya, Malaysia. The test bacteria were cultured on

Nutrient Agar (Difco, USA) at 37 C for 24 hours. The cultures were sub cultured

regularly (every 30 days) and stored at 4 C.

Table 3- 4: Test microorganism in study


Bacteria Name Type Strain
Bacillus cereus Gram positive ATCC 14579
Escherichia coli Gram negative UT189
Pseudomonas aeruginosa Gram negative PA7
Staphylococcus aureus Gram positive RF 122
Streptococcus mutans Gram positive GEJ 11
Table displays the strain for the five test microorganism obtained from the Fermentation Laboratory in the
University of Malaya.

68
Materials and methods

3.5.2 Preparation of Muller Hinton agar medium

Difco Muller Hinton Agar, 38.0 g (Becton, Dickson, USA) medium was

weighed and mixed thoroughly in one litre of distilled water. The dissolved medium

was then autoclaved at 121C for 15 minutes. After autoclaving, the medium was

cooled to about 50 C. Next, the melted, sterile agar was poured into a series of sterile

petri dishes 90 15 mm (Axygen Biotechnology, China) following strict aseptic

conditions. The plates were filled to about one-third capacity of the molten agar that is

about 10 ml per plate. Next, the plates were allowed to cool in the laminar flow (Holten

LaminAir, USA) for about fifteen minutes. The cooled, set agar medium was checked

for contamination and the plates were sealed with parafilm and stored at 4 C until

required.

3.5.3 Preparation of inoculums

Two or three colonies of the test microorganism were picked with a sterilized

wire loop from the original culture plate and introduced into a test tube containing 5 ml

of sterile nutrient broth. Next, the tubes were incubated for 24 hours to produce a

bacterial suspension of moderate cloudiness. After 24 hours, the turbidity of the

suspension was compared to a 0.5 McFarland standard (108 CFU /ml) (bioMrieux Inc,

USA) and the turbidity of this suspension was adjusted by adding more organism if the

suspension was too light or diluting with sterile saline solution 0.85% sodium chloride

(Merck, Germany) if the suspension was too heavy. This suspension was used to

inoculate the Muller Hinton agar within 15 minutes of preparation.

69
Materials and methods

3.5.4 Antimicrobial assay

Antimicrobial assay was carried out using the modified well diffusion assay

method by Perez and team (1990) following an accepted standard (Clinical and

Laboratory Standards Institute, 2007). Firstly, a sterile cotton swab was dipped into the

tube containing the nutrient broth with inoculums. The dried surface of a Muller Hinton

agar plate was inoculated with the test microorganism by streaking evenly on the plate

in three even planes with the swab over the entire agar surface. The plate was rotated

approximately 60 each time the streaking was done to produce an even distribution of

the inoculum. Excess liquid was removed by running the swab along the rim of the agar

plate and the swab was discarded.

Following this, wells with a diameter of 6 mm were bored with a sterile cork

borer (Appendix C, Figure 3a) and filled with 50 l of aqueous, ethanolic and

methanolic plant extracts using four different concentrations (10, 25, 50 and 100

mg/ml), antibiotic tetracycline at a concentration of 2.5 mg/ml (positive control) and

distilled water / IPB (pH 7.4, negative control). Finally the plates were sealed with

parafilm and incubated in an incubator (WTC Binder, Germany) at 37 C. Results were

read after 18 hours of incubation.

70
Materials and methods

3.5.5 Measuring the zone of inhibition

The zone of inhibition was measured using a vernier caliper after 18 hours of

incubation. Measurements were made with the unaided eye while viewing the back of

the petri dish. The petri dish was held a few inches above a black, non-reflecting surface

illuminated with reflected light. The diameter of the zone of inhibition was determined

by measuring the radius of the zone. This was done by measuring the centre of the

antibiotic well to a point on the circumference of the zone where a distinct edge is

present which was multiplied by two (Appendix C, Figure 3b). If individual colonies

were apparent across the plate the test was repeated.

3.5.6 Statistical analysis

Antimicrobial activity of different medicinal plant extracts using well diffusion

assay was measured by mean SD (standard deviation), n = 3. The results were

expressed in mm excluding the 6 mm well diameter. Mean changes between the

samples/positive control were compared to the negative control (IPB/ distilled water) by

one-way ANOVA followed by Dunnetts Multiple Comparison Test. The p value <

0.001 was considered highly significant***. All statistical analysis was performed using

GraphPad Prism 5 software.

71
Materials and methods

3.6 Saturated Ammonium Sulphate Precipitation of Plant Peptides

Firstly, saturated ammonium sulphate solution was prepared by dissolving

anhydrous ammonium sulphate (BDH Limited, England) in distilled water. Secondly,

10 ml of ethanolic extract with a concentration of 100 mg/ml was centrifuged at 30,000

rpm for 20 minutes. The pellet was discarded and the supernatant was added into a 50

ml beaker. Thirdly, 6.97 g of ammonium sulphate to be added was weighed depending

on the volume of the solution which was 10 ml and the percent saturation of the salt

needed which was 100 % according to a nomogram (Table 3-5). The extract was stirred

with a magnetic stirrer (Thermoline Scientific, Australia) and the entire procedure was

performed on ice to maintain 0 C temperature.

Ammonium sulphate was added bit by bit slowly with a spatula into the extract

with constant slow stirring. A small amount of ammonium sulphate was added at a time

and then allowed to dissolve before further addition. When the solution turned cloudy,

the addition of saturated ammonium sulphate solution was paused to allow mixing of

the solution. Rapid addition of saturated ammonium sulphate solution leads to the

formation of precipitate trapped with unwanted soluble peptides. When all the weighed

ammonium sulphate was dissolved, it was maintained on the stirrer for 1 hour to allow

precipitation to occur on ice. Finally the solution was centrifuged at 10,000 g for 15

minutes at 4 C (Thermo Scientific, USA). The supernatant was carefully removed into

a 15 ml centrifuge tube. The pellet containing the precipitated protein was dissolved in

IPB pH 7.4 (Wenk & Fernandis, 2007). Both the pellet and supernatant were stored at -

20 C for further analysis. Antimicrobial susceptibility tests by well diffusion assay

were performed on both the pellet and supernatant.

72
Materials and methods

Results were expressed in mm excluding the 7 mm well diameter and the mean

changes between the samples / positive control were compared to the negative control

(saturated ammonium sulphate solution).

Table 3- 5: Nomogram for ammonium sulphate precipitation at 0 C

Table shows the nomogram for determining the amount of solid ammonium sulphate in grams to be added in 1
litre of solution which will yield the desired percentage saturation at 0 C.

Modified from Kornberg et al. (1955)

73
Materials and methods

3.7 Determination of Total Phenolic Content (TPC).

Total phenolic content of the plant was determined based on the Folin-Ciocalteu

colorimetry assay method as deduced by Waterhouse (2001) using gallic acid as a

standard.

3.7.1 Gallic acid calibration standard preparation

Gallic acid (Sigma Aldrich, Germany), 0.5 g was dissolved in 10 ml of

absolute ethanol and then diluted to 100 ml with distilled water to obtain a concentration

of 5 g/l of gallic acid solution which can be stored at 4 C, up to 2 weeks. Standards (50,

100, 200, 300, 400, and 500 mg/l) concentrations were prepared by diluting the stock

with distilled water (Table 3-6).

Table 3- 6: Concentration of gallic acid standard in Folin-Ciocalteu assay


Concentration Volume of gallic acid stock Volume of distilled water
(mg/l) (l) (l)
50 10 990
100 20 980
200 40 960
300 60 940
400 80 920
500 100 900
Table shows the different concentration of gallic acid standard (50 500 mg/l) prepared from
the stock solution of gallic acid which has a concentration of 5 g/l.

74
Materials and methods

3.7.2 Sodium carbonate preparation

Anhydrous sodium carbonate (Merck, Germany), 20 g was dissolved in 80 ml of

distilled water and was brought to a boil on a hotplate (Thermoline Scientific,

Australia). The solution was left to cool to room temperature and a few crystals of

sodium carbonate were added into the solution and the solution was left at room

temperature for 24 hours. Finally, the sodium carbonate solution was filtered through

Whatman no. 1 filter paper and water was added to make up to 100 ml. The solution

was stored indefinitely at room temperature.

3.7.3 Folin-Ciocalteu assay

Firstly, 20 l of plant sample (2.5 mg/ml), gallic acid standard or blank (distilled

water) were added into a 2 ml plastic cuvette. Secondly, 1.58 ml of distilled water,

followed by 100 l of Folin-Ciocalteus phenol reagent, 2N (Sigma Aldrich, Germany)

was added. The mixture was mixed thoroughly by re-suspending with a micropipette

and was incubated for 1 - 8 minutes. Incubation time should never exceed 8 minutes.

Thirdly, 300 l of sodium carbonate solution was added and the mixture was mixed

thoroughly. Finally, the mixture was left to incubate for 2 hours, at room temperature.

All samples and standards were prepared in trplicate. Next, the absorbance of the

sample, standards and blank were measured at 765 nm with a spectrophotometer

(Varians Carry 50, Agilent Technologies, USA).

75
Materials and methods

3.7.4 Calculation of total phenolic content of plant samples

The absorbance of the blank was subtracted from all the readings and a calibration

curve was plotted with the standard values. The curve was used to determine the

corresponding gallic acid concentration of all the samples. In order to obtain results

based on the correct concentration of the sample, the dilution factor was multiplied. All

determinations were carried out in triplicate, and the results were expressed as

milligrams of gallic acid equivalent per gram of dry weight (mg GAE/g d.w.).

The total phenolic content of the plant was calculated as follows:

C = c x V/ m

Where C = total phenolic content in gallic acid equivalent (mg GAE/g), c =

concentration of gallic acid established from the calibration curve (mg/l), V = volume of

extract (ml) and m = weight of pure plant extract (g).

3.7.5 Statistical analysis

The mean changes between the samples were analysed by one-way ANOVA

followed by Tukeys Multiple Comparison Test. The p value p < 0.05 was considered

statistically significant. The software GraphPad Prism 5 was used to analyse the data.

Results were presented as mean standard deviation, where n = 3.

76
Materials and methods

3.8 Antioxidant Assay

3.8.1 DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical scavenging activity assay

The DPPH radical scavenging activity assay to determine amount of antioxidant

present in the plant was performed based on a method by Razali and colleagues (2008).

Initially, DPPH solution is dark violet in colour, but the colour fades when an

antioxidant added donates hydrogen (Szabo et al., 2007). The change in colour is

measured through absorbance with a spectrophotometer.

3.8.1.1 Preparing standard, positive control and sample

Firstly 100 M 2, 2-diphenyl-1-picrylhydrazyl (DPPH) (Sigma Aldrich,

Germany) was prepared by mixing 0.004 g of DPPH in 100 ml methanol, HPLC grade

(Tedia Company Inc, USA) and was stored in the dark. DPPH was prepared freshly for

the assay and was stored at 4 C. Secondly, the standard, Trolox (Sigma Aldrich,

Germany) was prepared. Thirdly, the positive control ascorbic acid, butylated

hydroxytoluene (BHT) and quercetin (Sigma Aldrich, Germany) were prepared.

The standard, positive controls and the sample were prepared by dissolving in

HPLC grade methanol to obtain a stock solution with a concentration of 1 mg/ml. The

stock solution of the sample and positive control were further dissolved in serial two-

fold dilution in methanol to obtain the desired concentration 15.625 1 000 g/ml

(Table 3-7). The stock solution of the standard was diluted in methanol to obtain a

concentration of 25 500 g/ml (Table 3-8).

77
Materials and methods

Table 3- 7: Concentration of sample and positive control in DPPH assay


Concentration Volume of stock solution Volume of methanol
(g/ml) (l) (l)
1000 200 0
500 100 100
250 100 100
125 100 100
62.5 100 100
31.25 100 100
15.625 100 100
Table shows the serial two-fold dilution of the sample and positive control in
methanol to obtain concentration of (15.625 1 000 g/ml) for DPPH assay.

Table 3- 8: Concentration of standard, Trolox in DPPH assay


Concentration Volume of stock solution Volume of methanol
(g/ml) (l) (l)
25 25 975
50 50 950
75 75 925
100 100 900
200 200 800
300 300 700
400 400 600
500 500 500
Table shows the different concentration (25 500 g/ml) of the standard Trolox
prepared from a stock solution with the concentration of 1 mg/ml for DPPH
assay.

3.8.1.2 DPPH assay

Firstly, 20 l of standard, positive control and sample was added to a 96 well

plate. Secondly, the prepared DPPH reagent was added into the well and was re-

suspended with micro-pipette. The mixture was left in the dark at room temperature for

10 to 20 minutes. The reactions were performed in triplicate and the entire assay was

performed in the dark. The changes in absorbance were measured at 515 nm with a

microplate reader (Bio-Rad, USA).

78
Materials and methods

3.8.1.3 Calculation of antioxidant capacity in plant of study

Percentage of inhibition was calculated as follows:-

% Inhibition = A0 As 100%
A0

Where A0 = absorbance of the blank, As = absorbance of the tested sample, standard or

positive control.

The antioxidant activity of plant extracts, standards and positive controls were

expressed as IC50, which is defined as the concentration in g/ml of plant extracts,

standards, or positive controls required to inhibit the formation of DPPH radicals by

50%. IC50 was determined using a non-linear regression analysis computed using

GraphPad Prism 5.

The antioxidant activity was based on the Trolox standard curve at concentration 25

500 g/ml (Table 3-8) expressed as milimole Trolox equivalent antioxidant capacity

per gram dried weight of plant sample (mmol TE/g d.w.). The assay was conducted in

triplicate and results were presented as mean SD. The mean changes between the

samples for each test were analysed by one-way ANOVA followed by Tukeys Multiple

Comparison Test.

79
Materials and methods

3.8.2 Ferric Reducing Antioxidant Power (FRAP) Assay

Total antioxidant activity was measured by ferric reducing antioxidant power

(FRAP) assay of Benzie and Strain (1996). In the FRAP assay, the

Fe3+/tripyridyltriazine complex is reduced to a ferrous form by plant extracts with an

intense blue colour and absorbance maximum at 593 nm (Benzie & Szeto, 1999).

3.8.2.1 Preparing reagent, standard, positive control and sample

The FRAP reagent consists of 300 mM acetate buffer (pH 3.6), 10 mM 2,4,6-tri

(2-pyridyl)-S-triazine (TPTZ) (Sigma-Aldrich, Germany) and 20 mM ferric (III)

chloride (FeCl3.6H2O) in the ratio of 10:1:1.

Firstly, 300 mM acetate buffer, (pH 3.6) was prepared whereby 0.155 g of

sodium acetate trihydrate (Fischer Scientific, UK) was dissolved in 0.8 ml of 100%

acetic acid (Merck, Germany) and 49.2 ml of double distilled water. Secondly, 10 mM

2,4,6-tri(2-pyridyl)-S-triazine (TPTZ) was prepared by dissolving 0.0156 g of TPTZ in

0.2 ml of 1N hydrochloric acid, HCl (Fischer Scientific, UK) and 4.8 ml of double

distilled water. Thirdly, 20 mM ferric (III) chloride (FeCl3.6H2O) was prepared by

dissolving 0.027 g of iron (III) chloride hexahydrate (FeCl3) (Merck, Germany) in 5 ml

of double distilled water.

The standard used was 10 mM ferrous sulphate (FeSO4.7H2O), and a stock

solution 100 mmole/L consisting of 0.0139 g of ferrous sulphate (Fischer Scientific,

UK) in 5 ml of distilled water was prepared. Six concentrations of standards were

prepared (Table 3-9) for the standard curve. Ascorbic acid and butylated

hydroxytoluene (BHT) (Sigma Aldrich, Germany) were used as positive controls and

80
Materials and methods

were prepared in two concentrations (1 mg/ml and 0.5 mg/ml) by dissolving each

compound in distilled water. Sample was prepared in two concentrations (1mg/ml and

0.5 mg/ml) in distilled water.

Table 3- 9: Concentration of standard, ferrous sulphate FeSO4.7H2O in FRAP assay


Concentration FeSO4.7H2O Double distilled water
(mol/L) (l) (l)
100 100 900
200 200 800
400 400 600
600 600 400
800 800 200
1000 1000 0
Table shows the different concentration (100 1000 mol/L) of the standard ferrous sulphate
FeSO4.7H2O prepared from a stock solution with the concentration of 100 mmol/L for FRAP
assay.

3.8.2.2 FRAP assay

The working solution of the FRAP reagent was freshly prepared by mixing 300

mM acetate buffer (pH 3.6), 10 mM 2,4,6-tri(2-pyridyl)-S-triazine (TPTZ) and 20 mM

ferric (III) chloride (FeCl3.6H2O) in the ratio of 10:1:1 at the time of use. The FRAP

reagent was incubated at 37 C for 5 minutes before the experiment. For the assay, 300

l of FRAP reagent was mixed with 10 l of sample, standard or positive control and

the mixture was vortexed well. A mixture of FRAP reagent with distilled water was

used to zero the machine. The absorbance of the mixture was read at 595 nm at 0

minutes and every 15 seconds for 4 minutes. The assay was carried out in triplicate and

the results were presented as mean SD.

81
Materials and methods

3.8.2.3 Calculation of antioxidant capacity

The antioxidant activity of plant extracts, and positive controls (1 mg/ml) in the

reaction time 0 - 4 minutes were expressed as milimole ferrous sulphate per gram dried

weight (mmol Fe2+/g d.w.) and was determined based on the ferrous sulphate

(FeSO4.7H2O) standard curve. One unit of FRAP is defined as the reduction of 1 mole

of Fe (III) to Fe (II).

Results were presented as mean SD where n = 3. The mean changes between

the samples for each test were analysed by one-way ANOVA followed by Tukeys

Multiple Comparison Test.

82
Materials and methods

3.8.3 Investigation of the Protective Effect of the Test Plant Against Hydrogen
Peroxide (H2O2) Induced Red Blood Cell Lysis.

3.8.3.1 Preparation of rabbit erythrocyte suspension

Blood was withdrawn from the marginal vein of healthy normal white rabbits

using a 27G 1/2 sterile needle (TERUMO, Belgium) and aspirated into silicone

coated blood collection tubes (Vacutainer, Becton Dickson, USA). Next, 5 ml of

defibrinated blood was centrifuged in a 15 ml centrifuge tube at 1000 g in a bench top

clinical centrifuge at 4 C for 20 minutes. The buffy coat and plasma layer were

removed with a pipette and discarded. Cold IPB, 5 ml (pH 7.4, bioWorld, USA) was

added to the packed erythrocytes, mixed gently, and then centrifuged at 2400 rpm for 5

minutes at 4 C. The supernatant was discarded. This step of washing was repeated two

more times as described. After the final wash, the volume of the packed erythrocytes in

the centrifuge tube was noted. A 10% erythrocyte suspension in IPB was prepared

where 1 ml of the pellet of packed erythrocytes was added to 9 ml of IPB. The

suspension was stored at 4 C until required (Rose & Okrend, 1998).

3.8.3.2 In vitro anti-haemolysis assay

The protective effect of the plant leaf extracts on rabbit erythrocyte was

performed according to the procedure described by Ajila and Rao (2008) with slight

modifications. The free radical initiator used in the study was hydrogen peroxide (H2O2)

(Merck, Germany). To evaluate haemolysis induced by plant extracts, the rabbit

erythrocytes were pre-incubated with 50 l of extracts at 1.0 mg/ml concentration for 1

hour to determine effect of extract on haemolysis. Next, 50 l of plant leaf extracts with

different concentrations (0.1-1 mg/ml) were added to 100 l of 10% (v/v) erythrocyte

suspension in IPB. Then, 100 l of 10 mM H2O2 in IPB was added into the samples.

83
Materials and methods

A standard was prepared by replacing the plant extract with ascorbic acid

(Sigma Aldrich, Germany). Complete haemolysis was achieved by treating the

erythrocytes with distilled water (without H2O2 and plant extract). The reaction mixture

was then incubated in a water bath at 37 C for 18 hours. Next, 1 ml of IPB was added

to dilute the reaction mixture and then the mixture was centrifuged at 2000 g for 10

minutes. The absorbance of the supernatant was measured at 540 nm with a

spectrophotometer (Varians Carry 50, Agilent Technologies, USA) to determine

haemolysis. The entire assay was performed in triplicate.

3.8.3.3 Calculation of anti-haemolytic activity

Percentage of haemolysis was based on the 100% haemolysis of distilled water

and was calculated as follows:

% Haemolysis = As A0 100%
Adw A0

Where As = plant sample or standard, Adw = distilled water and A0 = absorbance of

blank. Results were presented as mean SD.

The concentration (mg/ml) of plant extracts and positive control required to

inhibit haemolysis of red blood cells by 50% (IC50), whereby 10 mM and 50 mM H2O2

was used to induce haemolysis was determined by non-linear regression analysis

computed using GraphPad Prism 5. Results were presented as mean SD for three

replicate. The mean changes between the samples against 10 mM and 50 mM were

analysed by one-way ANOVA followed by Tukeys Multiple Comparison Test

separately.

84
Materials and methods

Antioxidant capacity of extracts and positive control were determined by

comparing with ascorbic acid standard curve and expressed as milimole ascorbic acid

equivalent (AAE) per gram dried weight plant sample (mmol AAE/g d.w.). Results

were expressed as mean SD where n = 3. The mean changes between the samples for

each test were analysed by one-way ANOVA followed by Tukeys Multiple

Comparison Test.

3.9 Correlation between the Phenolic Compounds with the Antimicrobial and
Antioxidant Activity of C. asiatica and V. amygdalina Extracts

3.9.1 Correlation between the Total Phenolic Content (TPC) and Antimicrobial
Activity of C. asiatica and V. amygdalina Extracts.

Regression analysis was performed to correlate TPC with antimicrobial activity

in comparison between (i) aqueous, ethanolic and methanolic extracts of each plant and

(ii) ethanolic extracts of both C. asiatica and V. amygdalina. Correlation was performed

separately for each test microorganism in the study which were B. cereus, E. coli, S.

aureus, S. mutans and P. aeruginosa. TPC was determined by Folins Ciocalteu assay,

presented as milligram gallic acid equivalent per gram dry weight (mg GAE/g d.w.).

The antimicrobial activity was presented as diameter of the zone of inhibition (mm).

Statistical significance between correlation coefficient (p value) was determined

by Pearson correlation analysis whereby p < 0.05 was statistically significant. Results

were presented as mean SD where n = 3.

85
Materials and methods

3.9.2 Correlation between the Total Phenolic Content (TPC) and Antioxidant
Activity and between Antioxidant Assays of Extracts of C.asiatica and
V.amygdalina

Regression analysis was performed to correlate TPC with antioxidant capacity

and various antioxidant assays for (i) aqueous, ethanolic and methanolic extracts of each

plant and (ii) both the plants (ethanolic extract). Correlation coefficient (r) between TPC

and DPPH, TPC and FRAP, TPC and anti-haemolysis assay, DPPH and FRAP, DPPH

and anti-haemolysis assay, and FRAP and anti-haemolysis assay was determined.

TPC was determined by Folins Ciocalteu assay, presented as milligram gallic

acid equivalent per gram dry weight (mg GAE/g d.w.). The antioxidant capacity was

determined by (i) DPPH assay presented as milimole Trolox equivalent per gram dried

weight (mmol TE/g d.w.); (ii) FRAP assay presented as milimole ferrous sulphate per

gram dried weight (mmol Fe2+ /g d.w.); and (iii) anti-haemolysis assay presented as

milimole ascorbic acid equivalent per gram dried weight (mmol AAE/g d.w.).

Statistical significant between correlation coefficient (p value) was determined

by Pearson correlation analysis where p < 0.05 was statistically significant. Results were

presented as mean SD where n = 3.

86
Materials and methods

3.10 Reverse-Phase High Performance Liquid Chromatography (RP-HPLC)

3.10.1 Preparing the mobile phase

The mobile phase was a binary solvent system consisting of solvent A and

solvent B. Solvent A was 0.1% of trifluoroacetic acid (TFA) (Sigma Aldrich,

Germany) in Milli-Q grade water (v/v) with pH 2.6 (Sartorius, Germany). Solvent B

was HPLC grade methanol (Tedia Company Inc, USA). Both the solvents were passed

through a vacuum degasser with a 0.45 m pore size membrane filter (Fisher Scientific

(M) Sdn Bhd).

3.10.2 Pre-treatment of plant crude extracts

Stock solution of plant extracts for HPLC analysis was prepared by re-dissolving

the aqueous, ethanolic and methanolic extracts in HPLC grade methanol to obtain a

final extract concentration of 100 mg/ml. Next, the respective extracts were pre-treated

with ISOLUTE C18 SPE Columns (Biotage, Sweden) before injection of samples into

a HPLC system.

3.10.3 Preparing standards for comparison

Gallic acid, caffeic acid, p-coumaric acid, benzoic acid, chlorogenic acid, (+)-

catechin, chloramphenicol, and quercetin were purchased from (Sigma Aldrich,

Germany). Stock solutions of the individual standards were prepared at a concentration

of 1.0 mg/ml in methanol. Prior to injection, all the standard solution were filtered

through a PTFE filter with 0.20 m pore size (Waters, USA).

87
Materials and methods

3.10.4 Instrumentation and analytical conditions

Phenolic compounds were evaluated with a reverse phase-high performance

liquid chromatography (RP-HPLC; Shimadzu LC, Japan) from the Department of

Molecular Medicine, Faculty of Medicine, University of Malaya. Detection and

quantification was carried out with a CBM-20A system controller, a LC-20AD binary

pump, a CTO-10ASvp oven and a SPD-20A ultraviolet detector with 280 nm detection

wavelength. The column fitted was a Jones Chromatography Genesis C18 (150 4.6

mm, 4 m) column (Jones Genesis, UK).

Chromatography for C. asiatica was achieved at 30 C with a flow rate of 1

ml/min following the gradient profile displayed in Table 3-10. Chromatography for V.

amygdalina was achieved at 30 C with a flow rate of 0.5 ml/min, following the

gradient profile displayed in Table 3-11. Injection volume of the samples were 20 l via

a thin layer chromatography syringe (Hamilton, USA). The data was integrated and

analysed with the Shimadzu LCSolution Analysis Report Software system. The well

separated, major peaks were collected manually several times and stored in -20 C for

further analysis.

Table 3- 10: Solvent gradient profile in RP-HPLC for C.asiatica


Time Solvent A concentration Solvent B concentration
(min) (%) (%)
0.01 90 10
10.00 75 25
20.00 40 60
30.00 30 70
45.00 0 100
55.00 90 10
Table shows the solvent gradient that was performed by varying the
proportion of Solvent A (0.1% of trifluoroacetic acid in Milli-Q water v/v) to
Solvent B (methanol) at respective time in minutes.

Method adapted from Mian et al. (2010)

88
Materials and methods

Table 3- 11: Solvent gradient profile in RP-HPLC for V. amygdalina


Time Solvent A Solvent B concentration
(min) concentration (%) (%)
0.01 90 10
10.00 40 60
30.00 35 65
50.00 30 70
55.00 0 100
60.00 100 0
Table shows the solvent gradient that was performed by varying the proportion
of Solvent A (0.1% of trifluoroacetic acid in Milli-Q water v/v) to Solvent B
(methanol) at respective time in minutes.

3.10.5 Identification and Quantitation

Phenolic compounds were identified by comparing the retention times obtained

for the plant extract with pure standards. To further confirm the phenolic compounds

present in the samples, samples were spiked with pure standards. Data was analysed

with Shimadzu LCsolution Software.

Concentration of unknown samples were determined by two methods. Firstly

using response factor (RF) as shown by Ghafoor et al. (2012) as follows:

RF = Area of standard / Concentration of standard

Concentration of sample = sample area / RF.

Results were presented as mg per g dry weight (mg/g d.w.) of sample extract.

Secondly Folin Coicalteus assay was performed on the major peaks collected

and the total phenolic content of the peaks were expressed as mg gallic acid equivalent

per 100g dry weight (mg GAE/100g d.w.).

89
Materials and methods

3.11 Fourier Transform Infrared Spectroscopy (FT-IR)

Major peaks obtained from RP-HPLC of C. asiatica methanol extract were

collected in 1.5 ml microcentrifuge tubes (Eppendorf GmbH, Germany). The peaks

were dried down with a centrifuge concentrator (Labconco, USA) to a powder and

weighed. Next, FT-IR spectra of the peaks were recorded on a Perkin Elmer Spectrum R

x I at the Department of Chemistry, Faculty of Science, University of Malaya. The

spectra of the peaks were scanned at room temperature in the 4000-400 cm-1 spectral

range.

3.12 Liquid Chromatography Mass Spectroscopy (LC-MS) Analysis

3.12.1 Preparing the mobile phase

For LC-MS, the mobile phase was a binary solvent system consisting of solvent

A and solvent B. Solvent A was 0.1% of formic acid (Sigma Aldrich, Germany) in

Milli-Q grade water (v/v). Solvent B was 0.1% of formic acid in acetonitrile (Tedia

Company Inc, USA). Both the solvents were passed through a vacuum degasser with

0.45 m pore size membrane filter (Fisher Scientific (M) Sdn Bhd).

3.12.2 Pre-treatment of plant crude extracts

The stock solution of plant extracts for LC-MS analysis were prepared by re-

dissolving the methanol extract in HPLC grade methanol to obtain a final extract

concentration of 100 mg/ml concentration. Next, the extracts were pre-treated with

ISOLUTE C18 SPE Columns (Biotage, Sweden) and the concentration was adjusted to

about 20 ppm before injection of the samples into the LC-MS system.

90
Materials and methods

3.12.3 Instrumentation and analytical conditions

The separation of phenolic compounds was performed on an Agilent 6530

Accurate-Mass Q-TOF LC-MS system (Agilent Technologies, USA) at the Department

of Chemistry, Faculty of Science, University of Malaya. Mass spectra were acquired

with a TOF/Q-TOF mass spectrometer with gas temperature 250C; gas flow 8 l/min;

and nebulizer 35 psig. The mass spectrometer was operated in both negative and

positive ion modes with a scanning range of 100 to 1000 m/z. Liquid chromatography

separation was performed with a Hardware Kit ZORBAX Eclipse XDB-C18 column

(150 4.6 mm; particle size, 5 m; Agilent Technologies). The gradient profile for LC-

MS was the same as HPLC. Data analysis performed with the Mass Hunter software.

91
4.0 RESULTS

4.1 Extraction Yield of the Selected Medicinal Plants

Extraction yields for the selected medicinal plants A.vera leaf and gel, A.indica

leaf, C. asiatica whole plant, C. papaya leaf, H. speciosa leaf, tuber and root, and V.

amygdalina leaf and stem were determined based on dry weight as described in Section

3.3.3 and presented in Figure 4-1. The ethanolic extract of H. speciosa root had the

highest yield (66.67%) followed by the ethanolic extract of A. vera gel (35.14%). The

lowest yield was observed for ethanolic extract of H. spesiosa tuber (2 %).

70

60
Extraction Yield (%)

50

40

30

20

10

Species
Figure 4-1: Extraction yield in percentage for medicinal plants screened in the study
Yield of in aqueous ( ) and ethanol ( ) extracts were determined based on the dry weight of the
plant parts.

92
Results

4.2 Preliminary Screening of Medicinal Plants for Antimicrobial Activity by


Well Diffusion Assay

In this study, parts of medicinal plants (A. vera - leaf and gel, A. indica - leaf, C.

papaya - leaf, C. asiatica - whole plant, H. spesiosa - leaf, tuber and root, and V.

amygdalina - leaf and stem) were used. For antimicrobial activity, aqueous extracts

(Table 4-1) and ethanolic extracts (Table 4-2) of the selected medicinal plants were

tested against the five test microorganisms namely Bacillus cereus, Escherichia coli,

Pseudomonas aeruginosa, Staphylococcus aureus, and Streptococcus mutans. Assays

were performed in triplicate and each well was filled with 50 l of various

concentrations of plant extracts (10, 25, 50 and 100 milligram extract per millilitre

isotonic phosphate buffer, mg/ml). The positive control was 50 l of antibiotic

tetracycline at 2.5 mg/ml.

Plant extracts showed varying antimicrobial activity towards the test

microorganisms compared to the control tetracycline which showed antimicrobial

activity against test microorganisms except P. aeruginosa at 2.5 mg/ml concentration.

For antimicrobial screening of the aqueous extract (Table 4-1) from the 6 plants studied,

only C. asiatica showed significant antimicrobial activity (p <.05) against all the five

test strains. The antimicrobial activity was in a dose dependent manner whereby the

minimum inhibitory concentration (MIC) of the aqueous extract was 25 mg/ml for B.

cereus, E. coli and S. mutans (3.000.00 mm, 6.000.00 mm, and 3.000.00 mm

respectively). P. aeruginosa and S. aureus were inhibited at MIC 50 mg/ml of aqueous

plant extract (6.330.58 mm and 10.00.00 mm respectively).

Antimicrobial screening of ethanolic extracts (Table 4-2) revealed that all five

test microorganisms exhibited remarkable susceptibility towards C. asiatica. It was

observed that the ethanolic extract of C. asiatica exhibited the highest antimicrobial

activity towards S. aureus at 100 mg/ml concentration (13.00 0.00 mm). The ethanolic

93
Results

extract of V. amygdalina leaf exhibited significant antimicrobial activity (p <.05)

towards B. cereus (4.000.00 mm and 6.670.58 mm at 50 mg/ml and 100 mg/ml

respectively).

Slight antimicrobial activity was observed in ethanolic extract of A. vera leaf

against B. cereus (MIC 25 mg/ml; 2.000.00 mm) and E. coli (MIC 100 mg/ml;

2.000.00 mm). A. vera gel showed insignificant activity (p >.05) towards B. cereus

(3.330.58 mm) and S. aureus (2.000.00 mm). Apart from that, H. spesiosa leaf

showed slight inhibition against B. cereus (2.330.58 mm) and P. aeruginosa (2.00

0.00 mm respectively) which were insignificant (p >.05).

Overall comparison between the antimicrobial activity of aqueous and ethanolic

extracts of the six medicinal plants revealed that ethanolic extracts possessed stronger

antimicrobial activity compared to aqueous extracts. But the aqueous extracts of C.

asiatica exhibited better antimicrobial activity compared to ethanol extract (Appendix

D). Thus C. asiatica and V. amygdalina were selected for further tests based on the

screening for antimicrobial properties.

94
Results

Table 4-1: Antimicrobial Activity of Aqueous Plant Extracts

Concentrati
Plant on
Diameter of the zone of inhibition (mm)a
Sample (mg/ml)
(aqueous) P.
B. cereus E. coli S. aureus S. mutans
aeruginosa
10 NI NI NI NI NI
A. vera
(leaf) 25 NI NI NI NI NI
50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
A. vera 25 NI NI NI NI NI
(gel) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
A. indica 25 NI NI NI NI NI
(leaf) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
C. papaya 25 NI NI NI NI NI
(leaf) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
C. asiatica
25 3.000.00** 6.000.00*** NI NI 3.000.00ns
(whole
plant) 50 5.670.58*** 7.330.58*** 6.330.58*** 10.00.00*** 15.331.15***
100 10.00.00*** 10.00.00*** 8.331.15*** 14.00.00*** 18.001.73***
10 NI NI NI NI NI
H. spesiosa 25 NI NI NI NI NI
(leaf) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
H. spesiosa 25 NI NI NI NI NI
(tuber) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
Speciosa 25 NI NI NI NI NI
(root) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
V.
25 NI NI NI NI NI
amygdalina
(leaf) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
V.
25 NI NI NI NI NI
amygdalina
(stem) 50 NI NI NI NI NI
100 NI NI NI NI NI
Positive 16.670.58 22.330.58 27.331.15 24.670.58
2.5 NI
controlb *** *** *** ***
Negative
- <0.50.00 <0.50.00 <0.50.00 <0.50.00 <0.50.00
controlc

Table displays adiameter of the zone of inhibition (excluding 7 mm well diameter in mm) after 18 hours
of incubation against 5 test microorganism in well diffusion assay. Each well was filled with 50 l of
extract. bPositive control was tetracycline (2.5mg/ml). cNegative control was double distilled water. NI
presents no inhibition zone observed. Assay was performed in trplicate and results were presented as
mean SD. The mean changes between the extracts and positive control compared to the negative
control were analysed by one-way ANOVA followed by Dunnetts Multiple Comparison Test. p < .001
- highly significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant.

95
Results

Table 4- 2: Antimicrobial Activity of Ethanolic Plant Extracts

Plant Concentration Diameter of the zone of inhibition (mm)a


Sample (mg/ml)
(ethanolic) P.
B. cereus E. coli S. aureus S. mutans
aeruginosa
10 NI NI NI NI NI
A. vera
25 2.000.00ns NI NI NI NI
(leaf)
50 3.000.58** NI NI NI NI
100 5.330.58*** 2.000.00ns NI NI NI
10 NI NI NI NI NI
A. vera 25 NI NI NI NI NI
(gel) 50 NI NI NI NI NI
100 3.330.58ns NI NI 2.00.00ns NI
10 NI NI NI NI NI
A. indica 25 NI NI NI NI NI
(leaf) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
C. papaya 25 NI NI NI NI NI
(leaf) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
C. asiatica
25 3.000.00** 4.670.58** 3.000.00* NI 4.000.00**
(whole
50 5.330.58*** 6.331.15*** 6.001.00*** 9.000.00*** 7.000.00***
plant)
100 8.330.58*** 9.330.58*** 8.670.58*** 13.000.00*** 9.671.15***
10 NI NI NI NI NI
H. spesiosa 25 NI NI NI NI NI
(leaf) 50 NI NI NI NI NI
100 2.330.58ns NI 2.000.00ns NI NI
10 NI NI NI NI NI
H. spesiosa 25 NI NI NI NI NI
(tuber) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
H. spesiosa 25 NI NI NI NI NI
(root) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
V.
25 NI NI NI NI NI
amygdalina
50 4.000.00*** NI NI NI NI
(leaf)
100 6.670.58*** NI NI NI NI
10 NI NI NI NI NI
V.
25 NI NI NI NI NI
amygdalina
50 NI NI NI NI NI
(stem)
100 NI NI NI NI NI
Positive 16.670.58 22.330.58 27.331.15 24.670.58
2.5 NI
controlb *** *** *** ***
Negative
- <0.50.00 <0.50.00 <0.50.00 <0.50.00 <0.50.00
controlc

Table displays adiameter of the zone of inhibition (excluding 7 mm well diameter in mm) after 18 hours
of incubation against 5 test microorganisms in well diffusion assay. Each well was filled with 50 l of
extract. bPositive control was 2.5mg/ml of tetracycline. cNegative control was isotonic phosphate buffer,
pH 7.4. NI presents no inhibition zone observed. Assay was performed in trplicate and results were
presented as mean SD. The mean changes between the extracts and positive control compared to the
negative control were analysed by one-way ANOVA followed by Dunnetts Multiple Comparison Test. p
< .001 - highly significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant.

96
Results

4.3 Authentication of Selected Medicinal Plants by DNA Barcoding

Authentication of the selected medicinal plants C. asiatica and V. amygdalina

was performed by DNA barcoding method using the well characterized internal

transcribed spacer 2 (ITS2) region. The primers used in the study for ITS2 region were

forward primer (5ATG CGA TAC TTG GTG TGA AT3) and reverse primer (5-

GAC GCT TCT CCA GAC TAC AAT-3) (Chen et al., 2010).

Agarose gel electrophoresis of the polymerase chain reaction (PCR) amplified

DNA fragment extracted from dried leaf material for both the medicinal plants produced

bands that were about 500 bp long when compared with a standard 100 bp DNA ladder

(Figure 4-2). The numbers of nucleotide after multiple sequence alignment by ClustalW

of the query sequence for CA and VA were 414 bp and 390 bp respectively.

The unknown sequences were BLAST searched with sequences in GenBank and

CA was identified as Centella asiatica accession number AF 272352 (Figure 4-3) with

99% identity and E-value 1e-152 (Appendix E Figure 5a).VA was identified as

Gynthemum amygdalina/Vernonia amygdalina accession number AY 504695 (Figure 4-

4) with 99% identity and E-value 5e-141(Appendix E Figure 5c).

Figure 4- 2: Agarose gel electrophoresis of PCR products subjected to DNA


barcoding with ITS2 primers
Figure illustrates PCR amplified DNA for each of the sample electrophoresed on 2.0%
agarose gels, where 1 - 100 bp DNA ladder marker; 2 ITS2 region of CA; 3 ITS2
region of VA and 4 negative control.

97
Results

CA 1 TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTCGGCCGAGGGCACGTCTGCCTGGG 60
C.asi 322 TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTCGGCCGAGGGCACGTCTGCCTGGG 381

CA 61 CGTCACGCATCGCGTCGcccccccccACCCGTCGACCTCGAAAGGGGTCGGGGCGGAGGG 120
C.asi 382 CGTCACGCATCGCGTCGCCCCCCCC-ACCCGTCGGCCTCGAAAGGGGTCGGGGCGGAGGG 440

CA 121 GCGGAGAATGGCCTCCCGTGCCTCGGGGCGCGGTTGGCCCAAACGTCAGCCCGCGGCGAC 180


C.asi 441 GCGGAGAATGGCCTCCCGTGCCTCGGGGCGCGGTTGGCCCAAACGTCAGCCCGCGGCGAC 500

CA 181 GGACGTCACGACAAGTGGTGGTTTGACAAAGGCCCTCGCATGTTGTCGTGCGGTGATCCG 240


C.asi 501 GGACGTCACGACAAGTGGTGG-TTGTCAAAGGCCCTCGCATGTTGTCGTGCGGTGATCCG 559

CA 241 TCGTCGGCGTGAGCTCGTGCGACCCTGTTGCCACGCCGTGCTCGGCGCGCGCTCCGACCG 300


C.asi 560 TCGTCGGCGTGAGCTCGTGCGACCCTGTTGCCACGCCGTGCTCGGCGCGCGCTCCGACCG 619

CA 301 CGACCCC 307


C.asi 620 CGACCCC 626

Figure 4- 3: Sequence alignment of the ITS2 region for C. asiatica


ClustalW alignment of the ITS2 region for unknown (CA) sequence and sequence from GenBank C.
asiatica (C. asi - AF 272352, BLAST).The ITS2 was PCR amplified with forward primer (5ATG
CGA TAC TTG GTG TGA AT3) and reverse primer (5-GAC GCT TCT CCA GAC TAC AAT-3).
Red alphabets indicate differences in nucleotide.

VA 117 TCGAAGCGTCATCATAAGACGACTCATTAAGGGATTTTTACAAACCTTTCCTTACGGTTA 176


V.amy 645 TCGAAGCGTCATCATAAGACGACTCATTAAGGGATTTTTACAACCTTTCCCTTACGGTTA 586

VA 177 ACGACACACAACTCCAAACGAAGGTCTTGTCAACCACCACTAGTCATGTATCCACCGAAA 236


V.amy 585 ACGACACACAACTCCAAACGAAGGTCTTGTCAACCACCACTAGTCATGTATCCACCGAAA 526

VA 237 GGGAGTTACGTTTAGGCCAACCACACCATCAGCATGGGAGACCAATCTCCGCCCCGAACA 296


V.amy 525 GGGAGTTACGTTTAGGCCAACCACACCATCAGCATGGGAGACCAATCTCCGCCCCGAACA 466

VA 297 ACAAGCCTACTAAGGAAGGAGGCATTGAAGGAGGCGATGCAATGCGTGACGCCCAGGCAG 356


V.amy 465 ACAAGCCTACTAAGGAAGGAGGCATTGAAGGAGGCGATGCAATGCGTGACGCCCAGGCAG 406

VA 357 ACGTGCCCTCGACCAAATGGCTTCGGGCGCAACT 390


V.amy 405 ACGTGCCCTCGACCAAATGGCTTCGGGCGCAACT 372

Figure 4- 4: Sequence alignment of the ITS2 region for V. amygdalina.


ClustalW alignment of the ITS2 region for unknown (VA) sequence and sequence from GenBank V.
amygdalina (V.amy - AY 504695, BLAST).The ITS2 was PCR amplified with forward primer (5ATG
CGA TAC TTG GTG TGA AT3) and reverse primer (5-GAC GCT TCT CCA GAC TAC AAT-3).
Red alphabets indicate differences in nucleotide.

98
Results

4.4 Extraction Yield and Antimicrobial Activity in Aqueous, Ethanolic and


Methanolic Extracts of C. asiatica and V. amygdalina

The extraction yields of aqueous, ethanolic and methanolic extracts of the

selected medicinal plants were compared based on dry weight (Figure 4-5). For the

medicinal plant C. asiatica, the highest yield was observed in aqueous extract (18.31%).

Ethanolic extract and methanolic extracts had similar yields (16.83% and 16.80%

respectively). The yield for V. amygdalina was highest in methanolic extract followed

by ethanolic and aqueous extracts (16.71%, 16.26% and 14.61%) respectively,

nevertheless not significantly different.

Antimicrobial activity in aqueous, ethanolic and methanolic extracts of the

selected medicinal plants C. asiatica (whole plant) and V. amygdalina (leaf) was

compared at various concentrations (10, 25, 50 and 100 mg/ml) against the five test

microorganisms. Each well contained 50 l of each extract.

For C. asiatica, the highest antimicrobial activity was observed in aqueous

extract against S. mutans (18.001.73 mm at 100 mg/ml) while the lowest activity was

observed in the methanolic extract against S. mutans (2.000.00 mm at 25 mg/ml).

Generally aqueous extract showed greater antimicrobial activity against the tested

strains compared ethanolic and methanolic extracts at corresponding concentrations.

Antimicrobial activities for both ethanolic and methanolic extracts were similar for

corresponding concentrations (Table 4-3).

The MIC value of aqueous extract was 25 mg/ml against B. cereus, E. coli, and

S. mutans and 50 mg/ml against P. aeruginosa and S. aureus. For ethanolic extract, the

MIC was 25 mg/ml against B. cereus, E.coli, P. aeruginosa and S. mutans and 50

mg/ml against S. aureus. Methanolic extracts exhibited MIC values of 25 mg/ml

towards B. cereus, E.coli, and S. mutans and 50 mg/ml for P. aeruginosa and S. aureus.

99
Results

Overall, the three extracts of C. asiatica inhibited all the test microorganisms at varying

levels.

Ethanolic and methanolic extracts of V. amygdalina showed significant

antimicrobial activity towards B. cereus. Slight antimicrobial activity was observed

towards S.mutans in methanolic extract (Table 4-4). The highest antimicrobial activity

was recorded in methanolic extract against B. cereus (10.000.00 mm at 100 mg/ml)

whereas the lowest antimicrobial activity was recorded in methanolic extract against S.

mutans (3.00 0.00 mm at 50 mg/ml).

The MIC value for ethanolic extract was 50 mg/ml against B. cereus. For

methanolic extract, the MIC values were 25 mg/ml against B. cereus and 50 mg/ml

against S. mutans. Overall it was observed that antimicrobial activity was present in

ethanolic and methanolic extracts but absent in aqueous extract of V. amygdalina

(Appendix D).

25

a
Extraction Yield (%)

20 a a
a a a
15

10

0
C.asiatica whole V.amaygdalina leaf
Medicinal plants

Figure 4- 5: The yield of extract in percentage for C. asiatica and V. amygdalina.


Yield of in aqueous ( ), ethanol ( ), and methanol ( ) extracts were determined based on the
dry weight of the plant parts. Data was presented as mean SD, n = 3. The mean changes between the
extracts for each plant were analysed by one-way ANOVA followed by Tukeys Multiple Comparison
Test. Samples represented by same alphabet indicated statistical insignificant difference between
samples (p > .05).

100
Results

Table 4- 3: Antimicrobial Activity of C. asiatica using well diffusion assay

Diameter of the zone of inhibition (mm)a


Test Ethanol (mg/ml) Methanol (mg/ml) Aqueous (mg/ml)
microorganism Positive Negative
controlb controlc MICd MICd MICd
10 25 50 100 10 25 50 100 10 25 50 100
(mg/ml) (mg/ml) (mg/ml)
16.670.58 3.000.00 5.330.58 8.330.58 3.670.58 7.330.58 9.000.00 3.000.00 5.670.58 10.00.00
B. cereus <0.50.00 NI 25 NI 25 NI 25
*** ** *** *** ** *** *** ** *** ***
22.330.58 4.670.58 6.331.15 9.330.58 4.000.00 6.000.00 8.000.00 5.670.58 7.330.58 10.00.00
E. coli <0.50.00 NI 25 NI 25 NI 25
*** ** *** *** *** *** *** *** *** ***
3.000.00 6.001.00 8.670.58 5.000.00 6.330.58 6.330.58 8.331.15
P. aeruginosa NI <0.50.00 NI 25 NI NI 50 NI NI 50
* *** *** *** *** *** ***
27.331.15 9.000.00 13.000.00 5.000.00 8.670.58 10.00.00 14.00.00
S. aureus <0.50.00 NI NI 50 NI NI 50 NI NI 50
*** *** *** *** *** *** ***
24.670.58 4.000.00 7.000.00 9.671.15 2.000.00 4.000.00 7.330.58 3.000.00 15.331.15 18.001.73
S. mutans <0.50.00 NI 25 NI 25 NI 25
*** ** *** *** ns *** *** ns *** ***

Table displays the antimicrobial activity of ethanolic, methanolic and aqueous extracts of C. asiatica whole plant against five test microorganism B. cereus, E. coli, P. aeruginosa,
S. aureus, and S. mutans in trplicate at different concentration of sample (10, 25, 50 100 mg/ml) as determined by well diffusion assay. Each well was filled with 50 l of extract.
a
Diameter of the zone of inhibition in exclusion of 6 mm well diameter in mm; bPositive control - 2.5mg/ml tetracycline; cNegative control - isotonic phosphate buffer, pH 7.4 for
ethanol and methanol extract and distilled water for aqueous extract; dMIC Minimum Inhibitory Concentration (mg/ml); NI - no inhibition. Results were presented as mean SD.
n = 3. The mean changes between the extracts and negative control were analysed by one-way ANOVA followed by Dunnetts Multiple Comparison Test.
p < .001 highly significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant.

101
Results

Table 4- 4: Antimicrobial Activity of V. amygdalina using well diffusion assay

Diameter of the zone of inhibition (mm)a


Test Ethanol (mg/ml) Methanol (mg/ml) Aqueous (mg/ml)
microorganism Positive Negative
d d
controlb controlc MIC MIC MICd
10 25 50 100 10 25 50 100 10 25 50 100
(mg/ml) (mg/ml) (mg/ml)
16.670.58 4.000.00 6.670.58 5.000.00 8.330.58 10.000.00
B. cereus <0.50.00 NI NI 50 NI 25 NI NI NI NI -
*** *** *** *** *** ***
22.330.58
E. coli <0.50.00 NI NI NI NI - NI NI NI NI - NI NI NI NI -
***
P. aeruginosa NI <0.50.00 NI NI NI NI - NI NI NI NI - NI NI NI NI -
27.331.15
S. aureus <0.50.00 NI NI NI NI - NI NI NI NI - NI NI NI NI -
***
24.670.58 3.000.00 4.000.00
S. mutans <0.50.00 NI NI NI NI - NI NI 50 NI NI NI NI -
*** ** ***

Table displays the antimicrobial activity of ethanolic, methanolic and aqueous extracts of V. amygdalina leaf against five test microorganism B. cereus, E. coli, P. aeruginosa, S.
aureus, and S. mutans in trplicate at different concentration of sample (10, 25, 50 100 mg/ml) as determined by well diffusion assay. Each well was filled with 50 l of extract.
a
Diameter of the zone of inhibition is presented in exclusion of 6 mm well diameter in mm; bPositive control - 2.5mg/ml tetracycline; c Negative control - isotonic phosphate buffer,
pH 7.4 for ethanol and methanol extract and distilled water for aqueous extract; dMIC Minimum Inhibitory Concentration (mg/ml); NI is no inhibition. Results were presented as
mean SD, n = 3. The mean changes between the extracts and negative control were analysed by one-way ANOVA followed by Dunnetts Multiple Comparison Test.
p < .001 - highly significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant.

102
Results

4.5 Antimicrobial Activity after Ammonium Sulphate Precipitation of


Ethanolic Extracts.

After 100% ammonium sulphate precipitation of ethanolic extracts, the pellet

and supernatant were tested for their antimicrobial activity against the five test

microorganisms (B. cereus, E. coli, S. aureus, P. aeruginosa and S. mutans, Figure 4-6).

Results of the assay indicated that the supernatant for both the tested plant extract

showed various level of antimicrobial activity while ammonium sulphate precipitates

had relatively low or no antimicrobial activity.

For C. asiatica, it was observed that the supernatant showed the highest

antimicrobial activity towards B. cereus (14.001.73 mm) and S. aureus (14.000.00

mm) followed by E.coli (13.331.53 mm), and P. aeruginosa (12.670.58 mm) and no

activity towards S. mutans. It was interesting to note that there was significant

antimicrobial activity (p <.05) of C. asiatica towards P. aeruginosa compared to the

standard antibiotic, tetracycline that had no antimicrobial activity towards P. aeruginosa

at 2.5mg/ml concentration (Figure 4-6A). The pellet showed low activity against E. coli

(4.330.58 mm) followed by P. aeruginosa (3.670.58 mm) and no activity against B.

cereus, S. aureus and S. mutans.

Supernatant of V. amygdalina showed antimicrobial activity towards B. cereus

(5.00 0.00 mm) and pellet showed lower activity against the same test microorganism

(4.670.58 mm). No antimicrobial activity was observed against the other 4 test

microorganisms (Figure 4-6B). Figure 4-3C shows the zone of inhibition for the well

diffusion assay.

103
Results

40 A
***
30 *** ***
Diameter of the zone of inhibition (mm)

20 ***
*** *** *** ***
10 ** **
ns ns ns ns ns
0
B. cereus E. coli P. aeruginosa S. aureus S. mutans
40
B
***
30 *** ***

20 ***

10 ******
ns ns ns ns ns ns ns ns ns
0
B. cereus E. coli P. aeruginosa S. aureus S. mutans
Test microorganism
C

B.cereus E.coli P.aeruginos S.aureus


a
Figure 4- 6: Antimicrobial activity of pellet and supernatant obtained from ammonium sulphate
precipitation by well diffusion assay of C. asiatica (A) and V. amygdalina (B) ethanolic extracts and
their images (C).
Figures A and B displays the antimicrobial activity of pellet and supernatant for the ethanolic extract of
C. asiatica and V. amygdalina against test microorganisms where diameter of the zone of inhibition for
the pellet , supernatant , positive control and negative control excluded 7 mm
well diameter. Each well was filled with 50 l of extract. Positive control - 2.5 mg/ml tetracycline.
Negative control saturated ammonium sulphate solution. Results were presented as mean SD, n = 3.
The mean changes between the samples and negative control were analysed by one-way ANOVA
followed by Dunnetts Multiple Comparison Test (p < .001 - highly significant***; p < .01 -very
significant**; p < .05 significant*; ns - not significant).
Figure C displays the zone of inhibition for the antimicrobial activity of pellet and supernatant of the
selected medicinal plants. +ve Positive control (tetracycline 2.5mg/ml); -ve- Negative control (saturated
ammonium sulphate solution); CP- C. asiatica pellet; CS C. asiatica supernatant; VP V. amygdalina
pellet and VS V. amaygdalina supernatant.

104
Results

4.6 Total Phenolic Content (TPC) in C. asiatica and V. amygdalina

TPC was determined by Folin-Ciocalteus method (Section 3.7) for aqueous,

ethanolic and methanolic extracts of the plant of study by reference to a gallic acid

standard curve (y = 0.0006x + 0.0017, R2 = 0.9961 Appendix F Figure 6). TPC was

expressed as milligrams of gallic acid equivalent per gram of dry weight of extract (mg

GAE/g d.w.).

Significant difference (p < .05) was observed in the TPC of C. asiatica extracted

using different solvents. The ethanolic extract contained the highest amount of

phenolics (4.0060.032 mg GAE/g d.w.) followed by methanolic extract (3.3460.029

mg GAE/g d.w.). The lowest amount of phenol was in aqueous extract (1.1200.063 mg

GAE/g d.w).

The TPC in V. amygdalina was lower than C. asiatica for all the extracts tested.

The highest TPC was in the methanolic extract (1.1680.101 mg GAE/g d.w) while the

lowest TPC was observed in ethanolic and aqueous extract which showed no

significance (p > .05) from each other (Figure 4-7 and Appendix F Table 1).

5.00
Total phenolic content

b
4.00
(mg GAE/g d.w.)

c
3.00

2.00
a de d e
1.00

0.00
Centella asiatica Vernonia amygdalina
Plant extracts

Figure 4- 7 : Total phenolic content of extracts determined by Folin-Coicalteus method


TPC from aqueous ( ), ethanolic ( ) and methanolic ( ) extracts of C. asiatica and V.
amygdalina based on the gallic acid standard curve. TPC was expressed as mg of gallic acid
equivalence per gram dry weight of extract (mg GAE/g d.w). The tested concentration of each plant
extract was 2.5 mg/ml. Data was presented as mean SD, n = 3. The mean changes between the
extracts for each plant were analysed separately by one-way ANOVA followed by Tukeys Multiple
Comparison Test. Samples represented by different alphabets indicated significant different (p < .05).

105
Results

4.7 Antioxidant Activity in C. asiatica and V. amygdalina

4.7.1 DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical scavenging activity

Figure 4-8 (Appendix G Table 2) shows the DPPH radical scavenging activity

in C. asiatica and V. amygdalina extracts compared with standards BHT and ascorbic

acid. Table 4-5 shows the antioxidant activity of the extracts expressed as the

concentration required to inhibit the formation of DPPH radicals by 50% (IC50). Non-

linear regression curve (Appendix G Figure 7b) was plot to determine IC50.

Table 4- 5: IC50 (g/ml) of DPPH radical scavenging assay


Aqueous Ethanol Methanol
Sample extract extract extract Ascorbic acid BHT

C. asiatica 4039.000.03a 122.400.04b 210.700.03c


67.380.10g 1290.000.05h
V. amygdalina 2706.000.15d 1063.000.04e 1049.000.06f
IC50 (g/ml) of C. asiatica and V. amygdalina towards DPPH radicals were determined. Ascorbic acid and
BHT were the standards used for comparison. Results were expressed as mean SD, where n = 3. The
mean changes between the extracts and standards were analysed by one-way ANOVA followed by
Tukeys Multiple Comparison Test. Samples presented by different alphabets were significantly different
(p < .05) from each other.

Figure 4-8A depicts a steady increase in the inhibition of the formation of DPPH

radicals by all the extracts of C. asiatica revealing a dose dependant increase in the

radical scavenging activity. At the dosage of 400 g/ml, the radical scavenging activity

of C. asiatica extracts and standards towards DPPH radical was in the following order:

ascorbic acid (90.490.60%) > ethanolic extract (88.830.23%) > methanolic extract

(73.170.17%) > BHT (26.341.47%) > aqueous extract (8.280.74%) at 400 g/ml

dosage. The IC50 of ethanolic extract was the lowest (122.400.04 g/ml), lower than

standard BHT (1290.000.05 g/ml). The IC50 of the aqueous extract was the highest

(4039.000.03 g/ml Table 4-5).

At the dosage of 400 g/ml, the radical scavenging activity of V. amygdalina

and the standards towards DPPH radical was as follows: ascorbic acid (90.490.60%) >

BHT (26.341.47%) > ethanolic extract (26.075.32%) > methanolic extract

106
Results

(25.974.39%) > aqueous extract (5.951.37%). The aqueous extract showed unstable

scavenging activity towards DPPH radical. Ethanolic and methanolic extracts of V.

amygdalina showed low DPPH radical scavenging activity compared to ethanolic and

methanolic extracts of C. asiatica. The IC50 for all the tested extracts were relatively

high (Table 4-5).

100.00
A
80.00

60.00

40.00

20.00

0.00
0 25 50 75 100 200 300 400
-20.00

35.00
Inhibition of DPPH radical

B
30.00
25.00
20.00
15.00
10.00
5.00
(%)

0.00
-5.00 0 25 50 75 100 200 300 400
100.00
C
80.00

60.00

40.00

20.00

0.00
0 25 50 75 100 200 300 400
-20.00
Concentration of samples g/ml

Figure 4- 8: Percentage inhibition of DPPH radical in C. asiatica (A), V. amygdalina (B) extracts
and positive controls (C).
The percentage inhibition of DPPH radical with varying concentration (0-400g/ml) of aqueous ( ),
ethanolic ( ) and methanolic ( ) extracts of C. asiatica, V. amygdalina and the positive controls
ascorbic acid ( ) and BHT ( ) were analysed by measuring the inhibitory effects on DPPH radical
at 517 nm. Results are presented as mean SD, n = 3.

107
Results

4.7.2 Ferric reducing antioxidant power (FRAP) assay

FRAP assays were conducted on aqueous, ethanolic and methanolic extracts of

C. asiatica and V. amygdalina. All assays were performed simultaneously and ascorbic

acid and BHT were used as the positive controls. Each sample was tested at 0.5 mg/ml

and 1.0 mg/ml (Figure 4-9 and 4-10). In the FRAP assay, reductants antioxidants in the

sample reduces Fe3+/tripyridyltriazine complex to the blue coloured ferrous form, with

an increase in absorbance at 595 nm. The absorbance of the samples and positive

control showed gradual increase and reached a plateau by the fourth minute of

incubation. For all samples and positive control the absorbance doubled at 1 mg/ml

compared to the rate at 0.5 mg/ml (Figure 4-9 and 4-10).

At 1.0 mg/ml concentration, C. asiatica methanol extracts and standards were

able to reduce ferric ions efficiently with absorbance unit (AU) as follows: ascorbic acid

(3.2240.103 AU at 0 seconds to 3.3180.021 AU at 4 minutes) > methanolic extract

(0.4660.012 AU at 0 seconds to 0.5550.012 AU at 4 minutes) > ethanolic extract

(0.4210.011 AU at 0 seconds to 0.5020.014 AU at 4 minutes) > BHT (0.0480.017

AU at 0 seconds to 0.1790.017 AU at 4 minutes) > aqueous extract (0.0410.003 AU

at 0 seconds to 0.0960.006 AU at 4 minutes Figure 4-9).

Figure 4-10 generally depicts that V. amygdalina extracts had lower absorbance

compared to C. asiatica extracts at the same concentration where only methanolic

extracts showed reducing capabilities (0.1420.020 AU at 0 seconds to 0.2220.012

AU at 4 minutes) for the same concentration (1.0 mg/ml). Both ethanolic and aqueous

extract showed low absorbance 0.0930.006 AU at 0 seconds to 0.1370.011 AU at 4

minutes) and (0.0410.003 AU at 0 seconds to 0.0960.006 AU at 4 minutes)

respectively (Appendix H Table 3a and 3b).

108
Results

A
2.3

1.3

0.3

0.25

0.2

0.15

0.1

0.05
Absorbance (595nm)

-0.05 B
3.6

2.6

1.6

0.6

0.5

0.4

0.3

0.2

0.1

0
0 15 30 45 60 90 120 150 180 210 240
Time (seconds)

Figure 4- 9: Ferric Reducing Antioxidant Power (FRAP) activity in 0.5 mg/ml (A) and 1 mg/ml (B)
C. asiatica extracts
Aqueous ( ), ethanol ( ) and methanol ( ) extracts of C. asiatica were tested. The reaction
time was followed every 15 seconds for 4 minutes and the absorbance was recorded at 595 nm. Ascorbic
acid ( ) and BHT ( ) were the standard antioxidant used. Results are an average of 3 readings
standard deviation.

109
Results

2.14

1.14

0.14
0.12
0.1
0.08
0.06
0.04
Absorbance (595 nm)

0.02
0
-0.02
B

2.4

0.4
0.25

0.2

0.15

0.1

0.05

0
0 15 30 45 60 90 120 150 180 210 240
Time (seconds)

Figure 4- 10: Ferric Reducing Antioxidant Power (FRAP) activity in 0.5 mg/ml (A) and 1 mg/ml
(B) V. amygdalina extracts.
Aqueous ( ), ethanol ( ) and methanol ( ) extracts of V. amygdalina were tested. The
reaction time was followed every 15 seconds for 4 minutes and the absorbance was recorded at 595
nm. Ascorbic acid ( ) and BHT ( ) were the standard antioxidant used. Results are an average of
3 readings standard deviation.

110
Results

4.7.3 Protective Effect of Extracts of C. asiatica and V. amygdalina Against


Hydrogen Peroxide (H2O2) Induced Haemolysis.

It was observed that the aqueous, ethanolic and methanolic extracts of C. asiatica

and V. amygdalina thereafter did not exhibit any harmful effect towards the rabbit

erythrocytes after pre-incubation of the extracts with erythrocytes for 1 hour.

Interestingly, it was found that the extracts inhibited haemolysis at various

concentrations (0.1 1.0 mg/ml) through in vitro haemolysis assays. The assays were

conducted for 18 hours to evaluate the protective effects of extracts against H2O2 (10

mM and 50 mM) induced haemolysis.

Table 4-6 shows the concentration (mg/ml) required to inhibit haemolysis of red

blood cells by 50% (IC50), whereby 10 mM and 50 mM H2O2 was used to induce

haemolysis. Non-linear regression curves (Appendix I Figures 9a and 9b) were used to

determine IC50. The percentage of haemolysis was based on 100% haemolysis of

distilled water. The negative control used was isotonic phosphate buffer which

displayed 72.441.04% and 57.130.80% protective effect against 10 mM and 50 mM

H2O2 induced haemolysis respectively.

Inhibition of haemolysis by the extracts of C. asiatica and standards at 1 mg/ml

dosage against 10 mM H2O2 were as follows: methanolic extract (88.140.83%) >

ascorbic acid (86.050.66%) > ethanolic extract (85.121.69%) > aqueous extract

(76.470.79%). Inhibition of the extracts at the same dosage against 50 mM H2O2 was

as follows: methanolic extract (91.810.55%) > ethanolic extract (84.730.65%) >

ascorbic acid (71.970.76%) aqueous extract (71.610.53%; Figure 4-11 and

Appendix J Tables 4a and 4b).

All extracts showed low IC50 values against 10 mM H2O2 and were compatible with

ascorbic acid. IC50 value against 50 mM H202 was lowest for both ethanolic and

111
Results

methanolic extract (0.1 mg/ml) which was comparable with that of ascorbic acid.

However, aqueous extract showed a higher value (0.29 mg/ml Table 4-6).

Table 4- 6: IC50 (mg/ml) values of the protective effect of extracts of C. asiatica and V.
amygdalina against H2O2 induced red blood cell lysis.
IC50 against 10 mM H2O2 IC50 against 50 mM
Sample
(mg/ml) H2O2 (mg/ml)
C. asiatica aqueous extract 0.130.08a 0.290.04cf
C. asiatica ethanolic extract 0.110.04a 0.100.04d
C. asiatica methanolic extract 0.110.03a 0.100.04d
V. amygdalina aqueous extract 0.280.04b 0.310.04ef
V. amygdalina ethanolic extract 0.140.06a 0.110.07d
V. amygdalina methanolic extract 0.220.03ab 0.130.08d
Ascorbic acid 0.110.04a 0.120.08d
IC50 of C. asiatica and V. amygdalina towards 10 mM and 50 mM H2O2 were determined by non-
linear regression curve. Ascorbic acid was the standard used for comparison. Results were presented
as mean SD of three replicates. The mean changes between the extracts and standard were analysed
separately against 10 mM and 50 mM H2O2 by one-way ANOVA followed by Tukeys Multiple
Comparison Test. Values represented by different alphabets within columns indicated significant
differences (p < .05).

Inhibition of haemolysis by the extracts of V. amygdalina and standards at 1 mg/ml

dosage against 10 mM H2O2 were as follows: ascorbic acid (86.050.66%) >

methanolic extract (79.250.64%) > ethanolic extract (78.460.35%) > aqueous extract

(72.920.77%). At the same dosage, inhibition against 50 mM H2O2 were as follows:

methanolic extract (81.770.23%) > ethanolic extract (78.100.26%) > ascorbic acid

(71.970.76%) > aqueous extract (57.551.46% Figure 4-12 and Appendix I Tables 4a

and 4b).

The IC50 against 50 mM H2O2 was lowest for the ethanolic extract (0.110.07

mg/ml) and was comparable with ascorbic acid (0.120.08 mg/ml) whereas the highest

IC50 was recorded in the aqueous extract (0.310.04 mg/ml Table 4-6). Overall, for

increasing concentration of extracts, an increasing pattern was observed in the

protective effect of methanolic and ethanolic extracts whereas aqueous extract showed

varying protective effect (Figure 4-12).

112
Results

100
A
90
80
70
60
50
40
30
Inhibition of haemolysis (%)

20
10
0
0.10 0.25 0.50 0.75 1.00 IPB DW
100
B
90
80
70
60
50
40
30
20
10
0
0.10 0.25 0.50 0.75 1.00 IPB DW
Sample concentration (mg/ml)

Figure 4- 11: In vitro protective effect of C. asiatica against 10 mM (A) and 50 mM (B)
H2O2 induced haemolysis of rabbit erythrocytes.
Aqueous ( ), ethanol ( ) and methanol ( ) extract of C. asiatica and positive control -
ascorbic acid ( ) were tested at (0.1, 0.25, 0.5, 0.75 and 1.0 mg/ml) concentration. Protective
effect of distilled water ( ) and negative control IPB ( ) were displayed. Absorbance was
measured at 540 nm. Percentages of haemolysis were based on 100% haemolysis of water.
Results were presented as mean SD whereby n = 3.

113
Results

100
A
90
80
70
60
50
40
30
Inhibition of haemolysis (%)

20
10
0
0.10 0.25 0.50 0.75 1.00 IPB DW
90
B
80
70
60
50
40
30
20
10
0
0.10 0.25 0.50 0.75 1.00 IPB DW
Sample concentration (mg/ml)

Figure 4- 12: In vitro protective effects of V. amygdalina against 10 mM (A) and 50 Mm (B)
H2O2 induced haemolysis of rabbit erythrocytes.
Aqueous ( ), ethanol ( ) and methanol ( ) extract of V. amygdalina and positive control -
ascorbic acid ( ) were tested at (0.1, 0.25, 0.5, 0.75 and 1.0 mg/ml) concentration. Protective
effect of distilled water ( ) and negative control IPB ( ) were displayed. Absorbance was
measured at 540 nm. Percentages of haemolysis were based on 100% haemolysis of water.
Results were presented as mean SD whereby n = 3.

114
Results

4.7.4 Antioxidant capacity of C. asiatica and V. amygdalina extracts

Antioxidant capacity of extracts and positive control were determined by three

methods. Firstly, using the DPPH assay by comparing with Trolox standard curve

(Appendix G Figure 7a) and expressed as milimole Trolox equivalent (TE) antioxidant

capacity per gram dry weight sample (mmol TE/g d.w.) as described in Section 3.8.1.3.

Secondly, using the FRAP assay by comparing with ferrous sulphate (FeSO4.7H2O)

standard curve in a 0 - 4 minute reaction time (Appendix H Figure 8) and expressed as

milimole ferrous sulphate (Fe2+) per gram of dry weight (mmole Fe2+/g dry weight) as

described in Section 3.8.2.3. Thirdly using anti-haemolysis assay by comparing with

ascorbic acid standard curve (Appendix I Figure 9c) and expressed as milimole

ascorbic acid equivalent (AAE) per gram dry weight plant sample (mmol AAE/g d.w.)

described in Section 3.8.3.3.

The DPPH antioxidant capacity of C. asiatica displayed that ethanolic extract

had the highest antioxidant activity (1.88240.0062 mmol AAE/g d.w.) being more

potent than aqueous extract but had similar potency to methanolic extract. Ethanolic

extract had a higher potency compared to BHT (Table 4-7).

In the FRAP assay, 1 mg/ml of samples and controls were chosen to determine

the antioxidant capacity. The ferric reducing activity in methanolic extract of C. asiatica

was the highest followed by ethanolic extract. The activity was higher compared to

ascorbic acid and lower than BHT (positive controls). Aqueous extract had the lowest

reducing activity (Table 4-7).

115
Results

Results of anti-haemolysis antioxidant capacity in C. asiatica, proved that

methanolic extract possess the strongest activity (13.73160.2052 mmol AAE/g d.w.)

being stronger than the control ascorbic acid (6.37240.2806 mmol AAE/g d.w.). The

weakest activity was observed in aqueous extracts (6.11510.4082 mmol AAE/g d.w.

(Table 4-7).

Table 4- 7: Antioxidant Capacity of C. asiatica extracts and controls.


A B C
DPPH FRAP anti-haemolysis
Samples
(mmol TE/g d.w.) (mmol Fe2+/g d.w.) (mmol AAE/g d.w.)
C. asiatica aqueous extract 0.00000.0000a 0.15670.0285ab 6.11510.4082a
C. asiatica ethanol extract 1.88240.0062b 0.27110.0482ad 11.10760.2394b
C. asiatica methanol extract 1.45820.0192c 0.29670.0731d 13.73160.2052c
Ascorbic acid 7.73640.0329d 0.09220.0367b 6.37240.2806a
BHT 0.18950.0398e 0.43560.0051c -
Table displays the antioxidant activity of aqueous, ethanolic and methanolic extracts. Ascorbic acid and
BHT were standards used for comparison. Results were expressed as mean SD where n = 3. The mean
changes between the samples for each test were analysed separately by one-way ANOVA followed by
Tukeys Multiple Comparison Test. Values represented by different alphabets within columns indicated
significant different (p < .05). ADPPH presented as milimole Trolox equivalent per gram dry weight
(mmol TE/g d.w.). BFRAP presented as milimole ferrous sulphate per gram dry weight (mmol Fe 2+/g
d.w.). CAnti-haemolysis presented as milimole ascorbic acid equivalent per gram dry weight (mmol
AAE/g d.w.).

Studies on the extracts of V. amygdalina through DPPH antioxidant capacity,

revealed that ethanolic and methanolic extracts possess similar antioxidant potency. It

was interesting to note that the antioxidant potency was also similar to that of the BHT.

However, there was no antioxidant activity in aqueous extract (Table 4-8). Overall it

was discovered that the antioxidant activity was lower in V. amygdalina extracts

compared to C. asiatica extracts.

Through the FRAP assay, methanolic extract of V. amygdalina was able to

reduce ferric ions effectively and was higher than ascorbic acid. Aqueous extract had

low reducing capability whereas ethanolic extract had the lowest reducing capacity

(Table 4-8). Overall the methanolic and ethanolic extracts of V. amygdalina had lower

reducing capacity but aqueous extract had higher reducing capacity when compared to

C. asiatica.
116
Results

Antioxidant capacity in anti-haemolysis assay showed that methanolic extract of

V. amygdalina was the most potent extract (10.00810.0845 mmol AAE/g d.w.) in

inhibiting haemolysis. This was followed by the ethanolic extract (8.64540.0980 mmol

AAE/g d.w.), while the lowest potency was observed in aqueous extract (1.02410.5429

mmol AAE/g d.w.), being lower than ascorbic acid (Table 4-8).

Table 4- 8: Antioxidant Capacity of V. amygdalina extracts and controls.


A B C
Samples DPPH FRAP anti-hemolysis
(mmol TE/g d.w.) (mmol Fe2+/g d.w.) (mmol AAE/g d.w.)
V. amygdalina aqueous extract 0.00000.0000abd 0.18220.0255abc 1.02410.5429a
V. amygdalina ethanol extract 0.18230.1441aef 0.14670.0176ae 8.64540.0980b
V. amygdalina methanol extract 0.17970.1189beg 0.26560.0769b 10.00810.0845c
Ascorbic acid 7.73640.0329c 0.09220.0367ce 6.37240.2806d
BHT 0.18950.0398dfg 0.43560.0051d -
Table displays the antioxidant activity of aqueous, ethanolic and methanolic extracts. Ascorbic acid and
BHT were standards used for comparison. Results were expressed as mean SD where n = 3. The mean
changes between the samples for each test were analysed by one-way ANOVA followed by Tukeys
Multiple Comparison Test. Values represented by different alphabets within columns indicated
significantly different (p < .05). ADPPH presented as milimole Trolox equivalent per gram dry weight
(mmol TE/g d.w.). BFRAP presented as milimole ferrous sulphate per gram dy weight (mmol Fe 2+/g
d.w.). CAnti-haemolysis presented as milimole ascorbic acid equivalent per gram dry weight (mmol
AAE/g d.w.).

117
Results

4.8 Relationship between the Phenolic Compounds with the Antimicrobial and
Antioxidant Activity of C. asiatica and V. amygdalina Extracts.

4.8.1 Relationship between the Phenolic Compounds and Antimicrobial Activity


of Plant Extracts

Correlation analysis was performed to compare the relationship between total

phenolic content (TPC) and antimicrobial activities between (i) aqueous, ethanolic and

methanolic extracts of each plant and (ii) ethanolic extract of both the plants in this

study using regression analysis.

Table 4- 9: Correlation coefficient (r) between atotal phenolic content (TPC) and bantimicrobial
activity of C. asiatica and V. amygdalina.
TPC vs Antimicrobial activity
Plant of study
B. cereus E. coli P. aeruginosa S. aureus S. mutans
c
C. asiatica -0.9151*** 0.4978ns -0.0955ns 0.2659ns -0.8876**
c
V. amygdalina 0.4412ns - - - 0.7723*
d
C. asiatica and
0.8720* 0.9967*** 0.9974*** 0.9997*** 0.7994ns
V. amygdalina
Table displays the correlation coefficient, r between TPC and antimicrobial activity of C. asiatica and
V. amygdalina between (i) extracts of each plant and (ii) both plants. Statistical significant between
correlation coefficient was determined by Pearson correlation analysis for two-tailed p value. p < .001 -
highly significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant.
indicated no antimicrobial activity. aTotal phenolic content (TPC) - milligram gallic acid equivalent per
gram dry weight (mg GAE/g d.w.). bAntimicrobial activity Diameter of zone of inhibition (mm).
c
Correlation between aqueous, ethanolic and methanolic extracts of each plant. dCorrelation between C.
asiatica and V. amygdalina ethanolic extract.

C. asiatica displayed weak correlation between the antimicrobial activity and

TPC of the three aqueous, ethanolic and methanolic extracts against each bacteria. The r

values were between 0.4978 and -0.0955 and decreased in the following order: E. coli (r

= 0.4978) > S. aureus (r = 0.2659) > B. cereus (r = -0.9151) > S. mutans (r = -0.8876) >

P. aeruginosa (r = -0.0955). The negative correlation coefficient indicated inverse

relationship between phenolic content and antimicrobial activity whereby extracts with

the highest phenolic content displayed lowest antimicrobial activity (Table 4-9 and

Figure 4-13).

118
Results

Total phenolic content (mg GAE/d.w.)


Total phenolic content (mg GAE/d.w.)
Bacillus cereus Escherichia coli
5 y = -1.533x + 16.79 5 y = -0.809x + 10.12
R2 = 0.8374 R2 = 0.3219
4 4

3 3

2 2

1 1

0 0
7 8 9 10 11 7 8 9 10 11
Inhibition zone diameter (mm) Inhibition zone diameter (mm)

Total phenolic content (mg GAE/d.w.)


Total phenolic content (mg GAE/d.w.)

Pseudomonas aeruginosa Staphylococcus aureus


5 5 y = -0.243x + 5.712
y = -0.153x + 4.015
R2 = 0.02318 R2 = 0.2102
4 4

3 3

2 2

1 1

0 0
5 6 7 8 9 10 6 8 10 12 14 16
Inhibition zone diameter (mm) Inhibition zone diameter (mm)
Total phenolic content (mg GAE/d.w.)

Streptococcus mutans
5
y = -0.234x + 5.55
R2 = 0.7878
4

0
0 5 10 15 20
Inhibition zone diameter (mm)

Figure 4- 13: Relationship between total phenolic content and antimicrobial activity of C. asiatica
extracts
Graph displays the linear correlation between diameter of the zone of inhibition (mm) of the five test
microorganisms (B. cereus, E. coli, P. aeruginosa, S. aureus and S. mutans) and total phenolic content
(milligram gallic acid equivalent per gram dry weight mg GAE/g d.w) of aqueous, ethanolic and
methanolic extracts of C. asiatica. Results were displayed as mean SD, n = 3. Coefficient of
determinant (R2) - measures how well the regression line represents the data.

119
Results

Higher correlation between the antimicrobial activity and TPC was detected in

extracts of V. amygdalina. However, antimicrobial activity was displayed only towards

B. cereus and S. mutans and not towards E. coli, P. aureus and S. aureus. The

correlation coefficients obtained were (r = 0.7723; R2 = 0.5964) and (r = 0.4412; R2 =

0.1946) for S. mutans and B. cereus respectively (Table 4-9 and Figure 4-14).

Total phenolic content (mg GAE/d.w.)


Total phenolic content (mg GAE/d.w.)

Bacillus cereus Streptococcus mutans


1.4 y = 0.011x - 0.9983 1.4
y = 0.041x + 1.003
2 2
1.3 R = 0.1946 1.3 R = 0.5964

1.2 1.2

1.1 1.1

1.0 1.0

0.9 0.9

0.8 0.8
0 5 10 15 0 1 2 3 4 5
Inhibition zone diameter (mm) Inhibition zone diameter (mm)

Figure 4- 14: Relationship between total phenolic content and antimicrobial activity of V.
amygdalina extracts
Graph displays the linear correlation between diameter of the zone of inhibition (mm) of the two test
microorganisms (B. cereus and S. mutans) and total phenolic content (milligram gallic acid equivalent
per gram dry weight mg GAE/g d.w) of aqueous, ethanolic and methanolic extracts of V. amygdalina.
Results were displayed as mean SD, n = 3. Coefficient of determinant (R 2) - measures how well the
regression line represents the data.

Strong correlations were observed between the antimicrobial activity TPC when

compared between ethanolic extract of C. asiatica and V. amygdalina. The r values

obtained were between 0.9997 and 0.7994 and decreased in the following order: S.

aureus (r = 0.9997) > P. aeruginosa (r = 0.9974) > E. coli (r = 0.9967) > B. cereus (r =

0.8720) > S. mutans (r = 0.7794; Table 4-9, Figure 4-15).

120
Results

Total phenolic content (mg GAE/d.w.)

Total phenolic content (mg GAE/d.w.)


Bacillus cereus Escherichia coli
5 5
y = 1.381x - 7.868 y = 0.323x + 0.982
R2 = 0.7604 R2 = 0.9934
4 4

3 3

2 2

1 1

0 0
5 6 7 8 9 10 0 5 10 15
Inhibition zone diameter (mm) Inhibition zone diameter (mm)
Total phenolic content (mg GAE/d.w.)

Total phenolic content (mg GAE/d.w.)


Pseudomonas aeruginosa Staphylococcus aureus
5 y = 0.348x + 0.982 5 y = 0.233x + 0.974
R2 = 0.9947 R2 = 0.9995
4 4

3 3

2 2

1 1

0 0
0 2 4 6 8 10 0 5 10 15
Inhibition zone diameter (mm) Inhibition zone diameter (mm)
Total phenolic content (mg GAE/d.w.)

Streptococcus mutans
5
y = 0.972x - 5.932
R2 = 0.6390
4

0
6 7 8 9 10 11 12
Inhibition zone diameter (mm)

Figure 4- 15: Relationship between total phenolic content and antimicrobial activity of C. asiatica
and V. amygdalina ethanolic extract
Graph displays the linear correlation between diameter of the zone of inhibition (mm) of the five test
microorganisms (B. cereus, E. coli, P. aeruginosa, S. aureus and S. mutans) and total phenolic content
(milligram gallic acid equivalent per gram dry weight mg GAE/g d.w) of ethanolic extract of C.
asiatica and V. amygdalina. Results were displayed as mean SD, n = 3. Coefficient of determinant
(R2) - measures how well the regression line represents the data.

121
Results

4.8.2 Relationship between the Phenolic Compounds and Antioxidant Activity


and Relationship between the Antioxidant Assays of the Plant of Study.

Regression analysis was performed to correlate total phenolic content (TPC)

determined by the Folin-Ciocalteu method with antioxidant capacity determined by

DPPH, FRAP and anti-haemolysis assay in order to correlate antioxidant assays. The

correlation analysis was performed to determine the relationship of the various assays

between aqueous, ethanolic and methanolic extracts of each plant and between ethanolic

extract of both plants.

Significantly high correlations were found between the TPC and antioxidant

capacity of C. asiatica extracts. The strongest positive correlation was observed

between TPC and DPPH radical scavenging activity (r = 0.9996; R2 = 0.9991; p <

0.001) and the lowest correlation was between TPC and FRAP (r = 0.7624; R 2 =

0.5813; p < 0.05). Likewise, significant correlation was observed between various

assays used to determine antioxidant capacity especially between DPPH and anti-

haemolysis assay (r = 0.8435; R2 = 0.7115; p < .01; Table 4-10, Figure 4-16).

Table 4- 10: Correlation coefficient (r) between total phenolic content and antioxidant capacities
and between antioxidant assays of C. asiatica and V. amygdalina extracts.
A TPC vs DPPH vs FRAP vs
TPC vs TPC vs D DPPH vs
Plant of study B C Anti- Anti- Anti-
DPPH FRAP FRAP
haemolysis haemolysis haemolysis
E
C. asiatica 0.9996*** 0.7624* 0.8403** 0.7556* 0.8435** 0.8040**
E
V. amygdalina 0.0665ns 0.4336ns 0.2926ns 0.4311ns 0.6885* 0.2810ns
F
C. asiatica and
0.9968*** 0.9099* 0.9933*** 0.9109* 0.9878*** 0.9211**
V. amygdalina
Table displays the correlation coefficient, r between assays. Statistical significant between correlation
coefficient was determined by Pearson correlation analysis for two-tailed p value. p < .001 - highly
significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant. ATotal phenolic
content (TPC) - milligram gallic acid equivalent per gram dry weight (mg GAE/g d.w.). BAntioxidant
capacity (DPPH) - milimole Trolox equivalent per gram dry weight (mmol TE/g d.w.). CAntioxidant
capacity (FRAP) - milimole ferrous sulphate per gram dry weight (mmol Fe 2+ /g d.w.). DAntioxidant
capacity (anti-haemolysis assay) - milimole ascorbic acid equivalent per gram dry weight (mmol
AAE/g d.w.). ECorrelation between aqueous, ethanolic and methanolic extracts of each plant.
F
Correlation between C. asiatica and V. amygdalina ethanolic extract.

122
Results

V. amygdalina extracts displayed weak correlation between TPC and antioxidant

capacity and between the antioxidant assays. The highest correlation was between

DPPH and anti-haemolysis assay (r = 0.6885, R2 = 0.4740, p < 0.05). The lowest

correlation was observed between TPC and DPPH (r = 0.0665, R2 = 0.0044, p > 0.05;

Table 4-10, Figure 4-17).

Comparison of the correlation of TPC with antioxidant capacity and between

antioxidant assays were was made between ethanolic extract of C. asiatica and V.

amygdalina. The results generally showed strong significant correlation (p < 0.05) with

r values between 0.9968 and 0.9099. The strongest correlation was observed between

TPC and DPPH (r = 0.9968; R2 = 0.9935; p < 0.001) followed by TPC and anti-

haemolysis assay (r = 0.9933; R2 = 0.9867; p < 0.001). The lowest correlation was

displayed between TPC and FRAP (r = 0.9099; R2 = 0.8280; p < 0.05; Table 4-10,

Figure 4-18).

123
Results

A B
2.5 0.4

FRAP (mmol Fe2+/g d.w.)


y = 0.653x - 0.729 y = 0.462x + 0.111
DPPH (mmol TE/g d.w.) 2.0 R2 = 0.9991 R2 = 0.5813
0.3
1.5

1.0 0.2

0.5
0.1
0.0

-0.5 0.0
0 1 2 3 4 5 0 1 2 3 4 5
Total phenolic content (mg GAE/d.w.) Total phenolic content (mg GAE/d.w.)

C D
Anti-haemolysis (mmol AAE/g d.w.)

0.4
15

FRAP (mmol Fe2+/g d.w.)


y = 2.156x + 4.231 y = 0.07x + 0.164
R2 = 0.7061 R2 = 0.5709
0.3
10

0.2

5
0.1

0 0.0
0 1 2 3 4 5 0.0 0.5 1.0 1.5 2.0
Total phenolic content (mg GAE/d.w.) DPPH (mmol TE/g d.w.)

E F
Anti-haemolysis (mmol AAE/g d.w.)
Anti-haemolysis (mmol AAE/g d.w.)

20
15
y = 34.07x + 2.091
y = 3.315x + 6.627
R2 = 0.6464
R2 = 0.7115 15
10
10

5
5

0
0
0.0 0.1 0.2 0.3 0.4
0.0 0.5 1.0 1.5 2.0
DPPH (mmol TE/g d.w.) FRAP (mmol Fe2+/g d.w.)

Figure 4- 16: Correlation between total phenolic content and antioxidant capacity and
between antioxidant capacities of C. asiatica extracts.
Correlation between TPC of C. asiatica extracts and their antioxidant capacity determined by
DPPH assay (A), FRAP assay (B) and anti-haemolysis assay (C) and between antioxidant
capacities DPPH and FRAP (D), DPPH and anti-haemolysis assay (E), and FRAP and anti-
haemolysis assay (F). The total phenolic content (TPC) was determined by Folins Ciocalteu assay,
presented as milligram gallic acid equivalent per gram dry weight (mg GAE/g d.w.). The
antioxidant activity were DPPH presented as milimole Trolox equivalent per gram dry weight
(mmol TE/g d.w.), FRAP assay presented as milimole ferrous sulphate per gram dry weight (mmol
Fe2+ /g d.w.) and anti-haemolysis assay presented as milimole ascorbic acid equivalent per gram
dry weight (mmol AAE/g d.w.). Aqueous, ethanolic and methanolic extracts were used. Results
were presented as mean SD where n = 3. Coefficient of determinant (R 2) - measures how well the
regression line represents the data.

124
Results

A B
0.4 0.4 y = 0.272x - 0.089
y = 0.081x + 0.035

FRAP (mmol Fe2+/g d.w.)


DPPH (mmol TE/g d.w.)
R2 = 0.004415 R2 = 0.1880
0.3 0.3

0.2 0.2

0.1 0.1

0.0 0.0
0.8 0.9 1.0 1.1 1.2 1.3 1.4 0.8 0.9 1.0 1.1 1.2 1.3 1.4
Total phenolic content (mg GAE/d.w.) Total phenolic content (mg GAE/d.w.)

C D
Anti-haemolysis (mmol AAE/g d.w.)

0.4
y = 0.223x + 0.171

FRAP (mmol Fe2+/g d.w.)


15
y = 11.48x - 5.582
R2 = 0.1858
R2 = 0.08564
0.3
10
0.2

5
0.1

0 0.0
0.8 0.9 1.0 1.1 1.2 1.3 1.4 0.0 0.1 0.2 0.3 0.4
Total phenolic content (mg GAE/d.w.) DPPH (mmol TE/g d.w.)

E F
Anti-haemolysis (mmol AAE/g d.w.)

Anti-haemolysis (mmol AAE/g d.w.)

15 y = 22.24x + 3.875 15 y = 17.58x + 3.075


R2 = 0.4740 R2 = 0.07897

10 10

5 5

0 0
0.0 0.1 0.2 0.3 0.4 0.0 0.1 0.2 0.3 0.4
DPPH (mmol TE/g d.w.) FRAP (mmol Fe2+/g d.w.)

Figure 4- 17: Correlation between total phenolic content and antioxidant capacity and between
antioxidant assays of V. amygdalina extracts.
Correlation between TPC of V. amygdalina extracts and their antioxidant capacity determined by
DPPH assay (A), FRAP assay (B) and anti-haemolysis assay (C) and between antioxidant capacities
DPPH and FRAP (D), DPPH and anti-haemolysis assay (E), and FRAP and anti-haemolysis assay (F).
The total phenolic content (TPC) was determined by Folins Ciocalteu assay, presented as milligram
gallic acid equivalent per gram dry weight (mg GAE/g d.w.). The antioxidant activity were DPPH
presented as milimole Trolox equivalent per gram dry weight (mmol TE/g d.w.), FRAP assay
presented as milimole ferrous sulphate per gram dry weight (mmol Fe 2+ /g d.w.) and anti-haemolysis
assay presented as milimole ascorbic acid equivalent per gram dry weight (mmol AAE/g d.w.).
Aqueous, ethanolic and methanolic extracts were used. Results were presented as mean SD where n
= 3. Coefficient of determinant (R2) - measures how well the regression line represents the data.

125
Results

A B
2.0 0.4

FRAP (mmol Fe2+/g d.w.)


y = 0.562 - 0.366 y = 0.041 + 0.106
DPPH (mmol TE/g d.w.)

R2 = 0.9935 R2 = 0.8280
1.5 0.3

1.0 0.2

0.5 0.1

0.0 0.0
0 1 2 3 4 5 0 1 2 3 4 5
Total phenolic content (mg GAE/d.w.) Total phenolic content (mg GAE/d.w.)

C D
Anti-haemolysis (mmol AAE/g d.w.)

12 0.4

FRAP (mmol Fe2+/g d.w.)


y = 0.812 + 7.854 y = 0.074 + 0.133
R2 = 0.9867 R2 = 0.8297
11 0.3

10 0.2

9 0.1

8 0.0
0 1 2 3 4 5 0.0 0.5 1.0 1.5 2.0
Total phenolic content (mg GAE/d.w.) DPPH (mmol TE/g d.w.)

E F
Anti-haemolysis (mmol AAE/g d.w.)

Anti-haemolysis (mmol AAE/g d.w.)

12 13
y = 1.434 + 8.396 y = 16.57 + 6.415
R2 = 0.9758 2
12 R = 0.8485
11

11
10
10

9
9

8 8
0.0 0.5 1.0 1.5 2.0 0.0 0.1 0.2 0.3 0.4
DPPH (mmol TE/g d.w.) FRAP (mmol Fe2+/g d.w.)

Figure 4- 18: Correlation between total phenolic content and antioxidant capacity and between
antioxidant assays of C. asiatica and V. amygdalina ethanolic extract.
Correlation between TPC of C. asiatica and V. amygdalina extracts and their antioxidant capacity
determined by DPPH assay (A), FRAP assay (B) and anti-haemolysis assay (C) and between
antioxidant capacities DPPH and FRAP (D), DPPH and anti-haemolysis assay (E), and FRAP and anti-
haemolysis assay (F). The total phenolic content (TPC) was determined by Folins Ciocalteu assay,
presented as milligram gallic acid equivalent per gram dry weight (mg GAE/g d.w.). The antioxidant
activity were DPPH presented as milimole Trolox equivalent per gram dry weight (mmol TE/g d.w.),
FRAP assay presented as milimole ferrous sulphate per gram dry weight (mmol Fe2+ /g d.w.) and anti-
haemolysis assay presented as milimole ascorbic acid equivalent per gram dry weight (mmol AAE/g
d.w.). Results were presented as mean SD where n = 3. Coefficient of determinant (R 2) - measures
how well the regression line represents the data.

126
Results

4.9 Comparison of the Bioactivity in the Aqueous Ethanolic and Methanolic


extracts of C. asiatica and V. amygdalina

The extracts with the highest bioactivity to the lowest bioactivity for

antimicrobial activity, total phenolic content and antioxidant capacity by DPPH, FRAP,

and anti-haemolysis assays are shown (Table 4-11). It was observed for C. asiatica, the

aqueous extract displayed strong antimicrobial activity whereas the alcoholic extracts

displayed strong phenolic and antioxidant activity. For V. amygdalina, the methanolic

extract showed highest activity for most of the assays tested and the aqueous extract

showed the lowest activity.

Table 4- 11: Bioactivity of C. asiatica and V. amygdalina aqueous, ethanolic and methanolic
extracts.
C. asiatica V. amygdalina
Bioactivity Extract with Extract with Extract with Extract with
highest activity lowest activity highest activity lowest activity
Antimicrobial aqueous ethanol and methanol aqueous
activity methanol

Total phenolic ethanol aqueous methanol ethanol


content

DPPH antioxidant ethanol aqueous ethanol aqueous


capacity
FRAP antioxidant methanol aqueous methanol ethanol
capacity
Anti-haemolysis
assay antioxidant methanol aqueous methanol aqueous
capacity
Table displays the summary of the bioactivity of C. asiatica and V. amygdalina aqueous, ethanolic and
methanolic extracts evaluated by extracts showing the highest and lowest antimicrobial, antioxidant
activity and total phenolic content.

127
Results

4.10 Reverse Phase High Performance Liquid Chromatography (RP-HPLC)


Analysis of Phenolic Compounds in Extracts of C. asiatica and V.
amygdalina

Phenolic compounds present in the medicinal plants studied were separated and

identified by RP-HPLC using a C18 column (280 nm detection wavelength). Methanolic

and ethanolic extracts displayed good separation.

For C. asiatica good separation of peaks were observed and compared with

retention time of eight standards (Table 4-12). The peaks of phenolic compounds were

identified as chloramphenicol (peak 6) and benzoic acid (peak 7; Figure 4-19). The

presence of the detected phenolic compounds was confirmed by spiking the samples

with the appropriate standard (Appendix J).

Table 4- 12: Retention time of standards for phenolic compounds of C. asiatica

Peak Compound RTa Area Height Area (%) Height (%)

1 Gallic acid 4.481 2139145 80255 17.089 10.081


2 Catechin 12.555 540913 29833 4.321 3.748
3 Chlorogenic acid 14.539 1639647 97907 13.098 12.299
4 Caffeic acid 15.990 3013046 206966 24.070 25.999
5 p-coumaric acid nd nd nd nd nd
6 Chloramphenicol 19.965 4232124 294366 33.808 36.978
7 Benzoic acid 21.067 745940 63391 5.959 7.963
8 Quercetin 24.071 19033 2858 0.152 0.359
Table displays the retention time of eight commercially available standards by reverse phase high
performance liquid chromatography (RP-HPLC). aRT - Retention time of standards. nd not detected.

Table 4- 13: Retention time and concentration of phenolic compounds of major peaks of C. asiatica
methanolic extract
Total
phenolic
Concentration
Compound Area Height content
Peak RTa Area Height (mg/100g
identified (%) (%) (mg
d.w.)b
GAE/100g
d.w.)c
6 Chloramphenicol 20.561 7903550 835184 73.871 79.114 46.69 7381.76
7 Benzoic acid 21.751 1288734 104011 12.045 9.853 43.19 940.42
Table displays the peak profile of C. asiatica methanolic extract by reverse phase high performance liquid
chromatography (RP-HPLC). Absorbance was measured at 280 nm. Results were presented as mean
SD. aRetention time of compounds. bConcentration determined by RP-HPLC expressed as mg per g dry
weight of extracts (mg/g d.w.). cTotal phenolic content determined by Folin-Ciocalteus assay expressed
as mg gallic acid equivalent per g dry weight (mg GAE/g d.w.).

128
Results

Quantitation of the major detected peaks of C. asiatica was performed as

described in Section 3.10.5 based on the peak profiles of standards chloramphenicol and

benzoic acid (Table 4-12) and sample (Table 4-13). The concentration of

chloramphenicol and benzoic acid obtained were 46.69 and 43.19 mg/ 100g dry weight

respectively.

The fractions corresponding to the two major peaks obtained were collected and

the total phenolic content was determined with the Folin Coicalteu assay. The

chloramphenicol obtained had total phenolic content of 7.381.76 mg GAE/g d.w. The

benzoic acid obtained had total phenolic content of 0.940.42 mg GAE/g d.w.

Retention time of peaks obtained in chromatography of V. amygdalina

methanolic and ethanolic extract (U1, U2, U3, U4, U5, U6; Figure 4-20B, C) were

compared with eight standards (Figure 4-20A). None of the retention time of the

standards matched that of the sample. The phenolic compounds present in V.

amygdalina could not be identified by RP-HPLC (Figure 4-20).

129
Results

mAU %
500

450 90
A
400 80

350 70
6
300 5 60

250 50
4
200
4 40
8
150 30

1 3
100 20
7
50 2 10

0 0
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 min

mAU %

550
6
B 90
500
80

Solvent B Concentration (%)


450
Absorbance (280nm)

400 70

350 60

300
50
250
40
200

150 7 30

100 20

50
10
0
0
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 27.5 min

mAU %
900

C 6 90
800

80
700

70
600
60
500
50
400
40
300
30
200
7 20
100
10
0
0
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 27.5 min

Time (mins)
Figure 4- 19: Chromatogram of C. asiatica
Chromatogram of external standards (A), C. asiatica ethanol extract (B) and C. asiatica methanol
extract (C) at 280 nm absorbance.1-gallic acid, 2-catechin, 3-chlorogenic acid, 4-caffeic acid, 5-
coumaric acid, 6- chloramphenicol, 7-benzoic acid and 8-quercetin.

130
Results

mAU %
700
5
A
600
6
75.0
500 4

400
8 50.0
300

3
200
25.0
7
100 2
1

0
0.0
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 27.5 30.0 min

mAU %

700 U1
B
600 U2
75.0

Solvent B concentration (%)


Absorbance (280 nm)

500

400
50.0
300 U3
U4
200 U6
U5 25.0
100

0
0.0
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 27.5 30.0 32.5 min

mAU %

U1 U2
600
C

500 75.0

400

U3 50.0
300

U4
200
U6
U5 25.0
100

0
0.0
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 min

Time (mins)
Figure 4- 20: Chromatogram of V. amygdalina
Chromatogram of external standards (A), V. amygdalina ethanol extract (B) and V. amygdalina methanol
extract (C) at 280 nm absorbance.1-gallic acid, 2-catechin, 3- chlorogenic acid, 4-caffeic acid, 5-coumaric
acid, 6-chloramphenicol, 7-benzoic acid and 8-quercetin. (U1, U2, U3, U4, U5, U6) - unknown
compounds.

131
Results

4.11 Fourier Transform Infrared Spectroscopy (FT-IR) analysis of major peaks


from C. asiatica.

Fourier Transform Infrared Spectroscopy (FT-IR) was performed to characterize

the bonds and functional groups present in peak 6 (retention time 20.56 mins) and

peak 7 (retention time 21.75) collected from RP-HPLC analysis of C. asiatica methanol

extract. Table 4-14 and 4-15 shows the wave number and assignment of the main bands

observed in Figure 4-21.

Table 4- 14: IR spectrum data of peak 6 from C. asiatica


Wave number (cm-1) Bond(s) Functional group(s)
3304.45 OH stretch, Hbonded alcohols, phenols
1672.93 C=C aromatic
1065.44 CO phenols
980.70 =CH bend alkenes
858.26 CH oop aromatics, para-disub benzene
Table depicts the main bands obtained by IR spectrum for peak 6 chloramphenicol from RP-HPLC

Table 4- 15: IR spectrum data of peak 7 from C. asiatica


Wave number (cm-1) Bond(s) Functional group(s)
3321.07 OH stretch, Hbonded alcohols, phenols
1671.18 C=O aromatic carboxylic acid
1070.98 CO phenols
980.96 =CH bend alkenes
859.72 CH oop aromatics, para-disub benzene
Table depicts the main bands obtained by IR spectrum for peak 7 benzoic acid from RP-HPLC

The FT-IR of peak 6 consisted of 6 peaks (Figure 4-21A). Of that 5 peaks were

characteristics of chloramphenicol (Table 4-14). The peaks were 3304.45, 1672.93,

1065.44, 980.70 and 858.26cm-1. The FT-IR of peak 7 consisted of 7 peaks (Figure 4-

21B). Of that 5 peaks were characteristics of benzoic acid (Table 4-15). The peaks were

3321.07, 1671.18, 1070.98, 980.96 and 859.72 cm-1.

132
Results

1672.93

3304.45
858.26

980.7
0

523.05
Transmittance

1065.44
(%)

2163.45
1671.18

3321.07

859.72

980.96

527.07

1070.98

Wavenumbers (cm-1)

Figure 4- 21: FT-IR Spectrum of C. asiatica major peaks


Fourier Transform Infrared Spectroscopy (FT-IR) of C. asiatica peak 6 chloramphenicol (A) and peak
7- benzoic acid (B) and their respective molecular structures.

133
Results

4.12 Identification of Phenolic Compounds in Methanolic Extract of C. asiatica and


V. amygdalina by Liquid Chromatography-Mass Spectroscopy (LC-MS)

Liquid chromatography (LC) coupled to negative and positive electrospray

ionization (ESI) mass spectrometry (MS) was used for the identification of phenolic

compounds in the methanolic extract of C. asiatica and V. amygdalina. Table 4-16 and 4-

17 summarizes the acquired time, molecular weight, molecular formula and the mass

spectra with their respective ionization mode of the compounds identified. The total ion

chromatogram (TIC) and the electrospray ionisation-mass spectra in the positive mode

(+ESI-MS) for the major peak are displayed in Figure 4-22. The +ESI-MS and ESI-MS

spectra of all the phenolic compounds identified with their respective molecular structure

are shown in Appendix K.

LC-MS analysis revealed the presence of thirty eight phenolic compounds in the

methanolic extract of C. asiatica. Among them were theobromine, isorhamnetin-3-O-

rutinoside, rhamnetin-O-rutinoside, syringic acid and naringin were. Chloramphenicol and

benzoic acid which had been previously identified by RP-HPLC were also detected by LC-

MS (Table 4-16).

In the methanolic extract of V. amygdalina, forty phenolic compounds were

detected when analysed using LC-MS. Among them were syringic acid, phloridzin,

dicaffeoylquinic acid, rhamnetin-O-rutinoside, feruloylquinic acid and rutin (Table 4-17).

134
Results

Table 4- 16: Phenolic compounds identified in methanolic extract of C. asiatica by LC-MS


Compound Identified RTa MWb ESI-MS m/z Abundancec MFd
(min) (+/) (%)
Gallic acid derivatives
5-galloylquinic acid 0.623 344.3 343.9901 () 14.17 C14H16O10
Hydroxybenzoic acid
Syringic acid 0.315 198.17 197.8091 () 25.16 C9H10O5
Ellagic acid pentoside 1.162 434.0 435.2061 (+) 6.63 C19H14O12
Hydroxybenzoic acid-O-hexoside 30.229 300 301.1415 (+) 20.65 C13H16O8
Protocatechuic acid/
37.822 154.12 153.8673 () 12.73 C7H6O4
3,4-Dihydroxybenzoic acid
Methyl gallate 38.579 184.15 183.9348 () 9.8 C8H8O5
Hydroxycinnamic acid
Caftaric acid 1.126 312.23 313.1412 (+) 5.56 C13H12O9
Sinapic acid 1.262 224.21 223.8468 () 5.63 C11H12O5
Ferulic acid 38.262 194.18 195.1279 (+) 5.04 C10H10O4
Hydroxycinammate quinic esters
Dicaffeoylquinic acid 1.055 516.45 517.9470 (+) 8.55 C25H24O12
Caffeoylquinic acid 1.191 354.31 353.0879 () 5.82 C16H18O9
Coumaroylquinic acid 38.155 338.31 339.3445 (+) 18.91 C16H18O8
Feruloylquinic acid 38.191 368.34 369.2952 (+) 9.89 C17H20O9
Flavan-3-ols
(-)-Gallocatechin 1.333 306.27 305.0695 () 8.82 C15H14O7
(-)-Gallocatechin gallate 38.191 458.37 459.2932 (+) 5.73 C22H18O11
Flavonol and flavonol glycosides
Rutin 0.949 610.52 611.3295 (+) 9.27 C27H30O16
Isorhamnetin-3-O-glucoside 1.126 478.4 479.2369 (+) 8.61 C22H22O12
Isorhamnetin-3-O-rutinoside 1.162 624.54 625.2829 (+) 38.23 C28H32O16
Quercetin-3-O-glucuronide 1.162 478.36 479.2386 (+) 8.28 C21H18O13
Rhamnetin-O-rutinoside 1.162 624.54 625.2829 (+) 38.23 C28H32O16
Cirsimaritin 1.162 314.29 315.1560 (+) 6.52 C17H14O6
()-Taxifolin 1.162 304.25 305.1554 (+) 7.09 C15H12O7
Phloridzin 1.197 436.41 437.2345 (+) 12.99 C21H24O10
Myricetin 1.262 318.24 317.0846 () 13.01 C15H10O8
Acacetin / Methyl apigenin 1.446 284.26 285.2887 (+) 7.11 C16H12O5
Chrysin 1.569 254.24 253.8795 () 6.28 C15H10O4
Kaempferol 15.034 286.24 285.0749 () 5.8 C15H10O6
Apigenin-7-O-glucoside 20.181 432.38 431.1807 () 12.94 C21H20O10
Quercetin 3-O-rhamnoside 28.265 448.38 449.2850 (+) 7.26 C21H20O11
Quercetin-3-O-glucoside 28.159 464.38 465.2626 (+) 9.58 C21H20O12
Isorhamnetin 30.300 316.26 317.1147 (+) 10.5 C16H12O7
Flavanone and flavanone glycosides
Naringin 1.162 580.54 581.2579 (+) 24.9 C27H32O14
Luteolin-7-O-glucoside 28.123 448.38 449.2856 (+) 6.31 C21H20O11
Purine alkaloids
Theobromine 1.131 180.16 181.0716 (+) 53.99 C7H8N4O2
Phenolic terpenes and lignin
Rosmadial 0.481 344.40 343.9946 () 14.69 C20H24O5
Medioresinol 1.162 388.41 389.0855 (+) 13.59 C21H24O7
Others
Chloramphenicol 23.387 323.13 322.2112 () 9.94 C11H12Cl2N2O5
Benzoic acid 35.387 122.12 123.0697 (+) 13.53 C7H6O2
Table displays the phenolic compounds identified in the methanolic extract of C. asiatica analysed by Liquid
Chromatography-Mass Spectroscopy (LC-MS Q-TOF). The analysis was performed with an Electrospray
Ionisation (ESI-MS) source in negative and positive mode. aRT - Retention time; bMW - Molecular weight;
Abundancec - Relative abundance of the major ion and dMF - Molecular formula of the compounds identified.

135
Results

Table 4- 17: Phenolic compounds identified in methanolic extract of V. amygdalina by LC-MS


Compound Identified RTa MWb ESI-MS m/z Abundancec MFd
(min) (+/) (%)
Gallic acid derivatives
5-galloylquinic acid 0.584 344.3 343.9918 () 11.17 C14H16O10
Hydroxybenzoic acid
Syringic acid 0.039 198.17 197.8067 () 100 C9H10O5
Ellagic acid pentoside 1.116 434.0 433.2060 () 9.98 C19H14O12
Methyl gallate 1.589 184.15 183.8496 () 5.42 C8H8O5
Vanillic acid 57.427 168.15 169.0865 (+) 5.30 C8H8O4
Protocatechuic acid/
57.447 154.12 153.8703 () 5.93 C7H6O4
3,4-Dihydroxybenzoic acid
Hydroxycinnamic acid
trans-Cinnamic acid 0.393 148.16 149.9509 (+) 5.19 C9H8O2
Sinapic acid 0.442 224.21 223.8542 () 5.05 C11H12O5
Ferulic acid 0.584 194.18 193.8159 () 5.41 C10H10O4
p-Coumaric acid 0.631 164.16 163.8459 () 11.23 C9H8O3
Caftaric acid 18.828 312.23 311.1666 () 11.59 C13H12O9
Caffeic acid 58.019 180.16 181.1657 (+) 5.7 C9H8O4
Hydroxycinammate quinic esters
Dicaffeoylquinic acid 1.069 516.45 515.1231 () 35.08 C25H24O12
Caffeoylquinic acid 1.234 354.31 353.0885 () 20.17 C16H18O9
Feruloylquinic acid 11.528 368.34 367.0509 () 28.31 C17H20O9
Coumaroylquinic acid 60.953 338.31 339.3429 (+) 8.63 C16H18O8
Flavan-3-ols
(+)-Catechin/()-Epicatechin 1.115 290.27 291.1301 (+) 5.94
(-)-Gallocatechin gallate 1.174 458.37 459.2540 (+) 11.29 C22H18O11
(-)-Gallocatechin 59.214 306.27 307.1580 (+) 5.32 C15H14O7
Flavonol and flavonol glycosides
Quercetin 3-O-rhamnoside 1.104 448.38 447.0979 () 19.15 C21H20O11
Rutin 1.115 610.52 611.3310 (+) 27.15 C27H30O16
()-Taxifolin 1.115 304.25 305.1595 (+) 8.01 C15H12O7
Isorhamnetin-3-O-glucoside 1.115 478.40 479.2425 (+) 9.72 C22H22O12
Isorhamnetin-3-O-rutinoside 1.115 624.54 625.2916 (+) 25.14 C28H32O16
Phloridzin 1.127 436.41 437.2339 (+) 52.84 C21H24O10
Rhamnetin-O-rutinoside 1.174 624.54 625.2845 (+) 34.47 C28H32O16
Cirsimaritin 1.174 314.29 315.1573 (+) 5.01 C17H14O6
Apigenin-7-O-glucoside 1.175 432.38 431.1784 () 13.88 C21H20O10
Chrysin 3.932 254.24 253.8765 () 6.68 C15H10O4
Flavanone and flavanone glycosides
Neohesperidin 1.115 610.56 611.8362 (+) 9.89 C28H34O15
Naringin 1.115 580.54 581.2676 (+) 15.86 C27H32O14
()-Naringenin 1.175 272.25 271.1044 () 17.48 C15H12O5
Luteolin-7-O-glucoside 1.234 448.38 447.0985 () 14.45 C21H20O11
Luteolin 8.759 286.24 285.0799 () 5.22 C15H10O6
Hesperitin 58.681 302.28 303.1537 (+) 5.51 C16H14O6
Resveratrols
trans-Resveratrol/cis-Resveratrol 1.175 228.24 227.0768 () 23.56 C14H12O3
Purine alkaloids
Theobromine 59.545 180.16 181.1695 (+) 7.79 C7H8N4O2
Phenolic terpenes and lignin
Rosmadial 0.607 344.40 343.9953 () 18.7 C20H24O5
Methyl carnosate 61.426 346.46 347.1727 (+) 6.62 C21H30O4
Epirosmanol 62.455 346.42 347.1721 (+) 5.84 C20H26O5
Table displays the phenolic compounds identified in the methanolic extract of V. amygdalina analysed by
Liquid Chromatography-Mass Spectroscopy (LC-MS Q-TOF). The analysis was performed with an
Electrospray Ionisation (ESI-MS) source in negative and positive mode. aRT - Retention time; bMW -
Molecular weight; Abundancec - Relative abundance of the major ion; and dMF - Molecular formula of the
compounds identified.

136
Results

629.31
585.28 37
83 673.34
01

541.26
13
717.36
70
214.08

Counts
91 497.23
52
761.39
20
437.23
42
Counts

393.20 805.41
84 83

845.4132
122.08 284.29
349.18
59 39
26 889.44
04
977.48
18

Mass-to-charge (m/z)

Retention time (min)


B

569.3
206

525.2
932 657.3
731

481.2
Counts

214.0 674 697.3


916 747
741.4

437.2
Counts

398 785.4
236.0 287
738 393.2
129 829.4
547

122.0 340.1
842 873.4
889
804
917.5
305.1 040
961.5
595
312

Mass-to-charge (m/z)

Retention time (min)

Figure 4- 22: Total Ion Current (TIC) chromatogram of C. asiatica (A) and V. amygdalina (B)
methanolic extract by LC-ESI-MS analysis
Figure displays the TIC chromatogram of the phenolic compounds detected in the methanolic extract of C.
asiatica and V. amygdalina by LC-MS Q-TOF with an Electrospray Ionisation (ESI-MS) source in the
positive mode. Inset is the Electrospray ionizationmass spectra (ESI-MS) positive ionization for the major
peak of each extract at retention time 1.138 and 1.115 respectively.

137
5.0 DISCUSSION

5.1 Choice of Plant Used in the Study

Based on traditional folklore medicine (Anbarashan et al., 2011), chemotaxonomic

approach and by random selection (Jantan, 2004), six medicinal plants Aloe vera (leaf and

gel), Azadirachta indica (leaf), Carica papaya (leaf), Centella asiatica (whole plant),

Hymenocallis speciosa (leaf, tuber and root) and Vernonia amygdalina (leaf and stem) were

selected.

These plants and their parts were chosen specifically because (i) A. vera leaf and gel

were reported to possess wound healing properties (Anbarashan et al., 2011; Kumar et al.,

2010).

(ii) A. indica leaf has antibacterial properties (Almas, 1999) and have been used to

cure various skin disorders (Anbarashan et al., 2011).

(iii) The leaf of Carica papaya was proven to treat dengue fever in the tropics

(Ahmad et al., 2011).

(iv) The whole plant of C. asiatica was widely used in folklore medicine and had a

wide range of health benefits such as improving memory, curing skin disorders and in the

wound healing process (Duke, 2010; Hargono et al., 1999). It belongs to the Apiaceae

family which comprises of important medicinal plants such as coriander and fennel (Gurib-

Fakim, 2006), thus the same active biological compounds may be present in C. asiatica

(Eloff & McGaw, 2006).

(v) H. speciosa was selected because it had been used to cure jaundice in Malaysian

folklore medicine (Azliza et al., 2012). Furthermore it belongs to the Amaryllidaceae

family which possess bioactive compounds such as amaryllidaceae alkaloids that display

138
antimalarial activity (ener et al., 2003). The tuber and root were chosen because in

general, underground plant parts were found to possess bioactive compounds with

antimicrobial properties compared to other aerial parts of plants (Das et al., 2010).

Furthermore, these plant parts have not been studied for H. speciosa to the best of our

knowledge and the antimicrobial properties have not been evaluated.

(vi) The leaf and stem of V. amygdalina were selected because it had been reported

to possess high antidiabetic and antimicrobial properties (Akinpelu, 1999; Ekpenyong et

al., 1999). The main purpose for selecting these plants was because of their antimicrobial

trait due to the secondary metabolites in these plants which may be significant in

therapeutic treatments.

5.2 Extraction Yield and Antimicrobial Activity of the Medicinal Plants Screened

The percentage yield was highest for ethanolic extract H. speciosa root because it

was homogenized to a fine powder with the absence of fibre. This was followed by

ethanolic extract of A. vera gel because it has high water content of 99.5% (Eshun & He,

2004). The difference in extraction yield ascribes to the difference in extractable

compounds based on the different bioactive compounds found in the plants and different

types of solvent possess varying extraction capabilities.

The antimicrobial susceptibility test is important to determine efficiency of novel

antimicrobial agent isolated from biological samples against various microorganisms (Das

et al., 2010). In this study, the screening of the selected plants was based on their

antimicrobial property which was determined by well diffusion assay. Both Gram-negative

139
Discussion

bacteria (Escherichia coli and Pseudomonas aeruginosa) and Gram-positive bacteria

(Bacillus cereus, Staphylococcus aureus, and Streptococcus mutans) were selected due to

the following reasons:

(i) Gram-negative bacteria were more resistant to antimicrobials due to the presence

of an additional outer membrane layer (Alberts et al., 2002) and they make up most plant

pathogens. In general, purified plant bioactive compounds display low antimicrobial

activity towards Gram-negative bacteria (Gonzlez-Lamothe et al., 2009).

(ii) E. coli was selected because it is easily cultured in the laboratory, well

characterized, found in a wide range of hosts and acquires resistance to antimicrobial agents

easily (Erb et al., 2007; Welch, 2006).

(iii) P. aeruginosa is resistant to antibiotics due to the lipopolysaccharide layer and

forms biofilm to colonize surfaces. It is a notorious pathogen that may be potentially

inhibited by antimicrobial agents of plant origin (Kim et al., 1995; Iinuma et al., 1994).

(iv) B. cereus is a soil bacterium and can be easily transmitted into food products,

hence infecting the human intestine (Vilain et al., 2006). It is resistant to a wide array of

antimicrobials including clindamycin, cefazolin, cefotaxime, cephalosporin and penicillin

(Bottone, 2010).

(v) S. aureus was chosen because it is a commensal in humans and develops

resistance to antibiotics easily (Rasigade & Vandenesch, 2013).

(vi) The oral bacterium S. mutans was chosen because it invades the oral cavity and

is known to cause dental caries (Loesche, 1986). Some of the medicinal plants in this study

140
Discussion

such as A. vera and A. indica, were known to inhibit oral bacteria that cause gum diseases

(Kumar et al., 2010; Ajik, 1990).

Well diffusion assay with the aqueous extract revealed that C. asiatica significantly

inhibited all the five microbial strains while the other medicinal plants did not inhibit any of

the test microorganisms. However ethanolic extracts displayed stronger antimicrobial

activities. The ethanolic extracts of C. asiatica inhibited all the test microorganism and

ethanolic extract of V. amygdalina leaf significantly inhibited B. cereus. Slight inhibition

was recorded for the ethanolic extracts of A.vera gel against B. cereus and S. aureus; A.vera

leaf against B. cereus and E. coli; and H. speciosa leaf against B. cereus and P. aeruginosa

but the inhibition was insignificant.

Previous studies have reported the inhibition of A. vera gel and leaf extracts against

S. aureus, P. aeruginosa (Agarry et al., 2005), and E.coli (Kaithwas et al., 2008). However

Alemdar and Agaoglu (2009) reported similar results to this study in A. vera juice which

failed to inhibit these microorganism. A. indica extract was reported to inhibit S. mutans

(Biswas et al., 2002), P. aeruginosa, S. aureus and E. coli (Abdullah Al et al., 2011).

Ethanolic extract of Carica papaya leaf was reported to inhibit E. coli, B. cereus, P.

aeruginosa and S. aureus (Baskaran et al., 2012). No antimicrobial activity has been

reported for extracts of H. speciosa.

Dash et al. (2011) reported higher inhibition of C. asiatica ethanolic extract towards

E. coli and S. aureus compared to aqueous extract which was in contrary with the results in

this study and Kannabiran et al. (2009) reported slight inhibition of aqueous extract and no

inhibition with ethanolic extract against P. aeruginosa. The leaf sap of V. amygdalina, was

reported to inhibit S. aureus, E. coli, and P. aeroginosa (Ijeh et al., 1996), while the

141
Discussion

methanolic leaf extract inhibited P. aeruginosa, and S. aureus (Akinpelu, 1999) Vernolide

and vernodalol isolated from the plant was reported to inhibit Bacillus cereus and S. aureus

(Erasto et al., 2006).

The difference in findings between this study and previous studies are difficult to be

compared to because different methodologies such as extract, extraction technique, test

microorganism and choice of antimicrobial test were employed (Weerakkody et al., 2010;

Nostro et al., 2000; Hammer et al., 1999). However, the antimicrobial susceptibility test in

this study followed all the standards of the Clinical and Laboratory Standards Institute

2007). Screening of various plant species confirmed the therapeutic potency of C. asiatica

and V. amygdalina as used in traditional medicine. These findings were the basis for

choosing C. asiatica and V. amygdalina as candidate plant species for the determination of

the bioactive constituents present.

The type of solvent used could greatly affect the antimicrobial activity in the plants.

Most plant antimicrobial are aromatic or saturated organic compounds, therefore the most

effective solvents used for preliminary screening of plant antimicrobial activity are

methanol, ethanol and water (Parekh et al., 2006; Rojas et al., 2006; Lourens et al., 2004;

Bisignano et al., 1996; Salie et al., 1996). For C. asiatica and V. amygdalina, methanol

extraction was also included and the results between extracts were compared. Aqueous

extracts of C. asiatica possess greater zone of inhibition compared to ethanolic and

methanolic extracts. Ethanolic and methanolic extracts exhibited similar inhibition at

corresponding plant extract concentration. Aqueous extraction was chosen because most

traditional medicines used water as solvent to dissolve the traditional preparations (Das et

al., 2010) and this study revealed that aqueous extract of C. asiatica have strong

142
Discussion

antimicrobial activity. This result proved the presence of water soluble bioactive

compounds active against the tested microorganisms in C. asiatica.

C. asiatica plant extracts displayed antimicrobial activity towards both Gram-

positive and Gram-negative bacteria that possess an outer layer making it a strong

antibacterial plant. The most susceptible bacteria amongst the bacterial strains investigated

in this study was S. mutans. Hence this plant may be useful as an oral antibacterial agent

and can be incorporated into mouthwashes and toothpastes. C. asiatica extracts also had

significantly greater levels of inhibition on P. aeruginosa compared to the positive control

tetracycline. P. aeruginosa is a nosocomial pathogen that easily acquires resistance towards

antibacterial agents (Morita et al., 2014). Thus C. asiatica may be an effective agent to

control this nosocomial pathogen. The usage of this plant in wound healing and healing

skin disorders in folklore was shown to be correct since this plant extract possess

antimicrobial compounds which can inhibit pathogens.

The aqueous extracts of V. amygdalina exhibited no antimicrobial activity, however

strong inhibition was observed in ethanolic and methanolic leaf extracts. This finding was

in agreement with previous study by Parekh et al. (2005), whereby organic solvent extracts

provide better antimicrobial activity compared to water extracts. The antimicrobial

compounds from V. amygdalina dissolved in polar solvents. Most plant antimicrobial

compounds are aromatic or saturated organic compounds that are extracted by ethanol or

methanol (Serkedjieva & Manolova, 1992). The methanolic and ethanolic extracts were

more active against Gram-positive microorganisms compared to Gram-negative

microorganisms in agreement with previous studies (Gonzlez-Lamothe et al., 2009;

Alberts et al., 2002). B. cereus, a foodborne pathogen was found to be most susceptible

143
Discussion

towards methanolic leaf extract proving the folklore usage of this plant in treating

gastrointestinal disorders (Aregheore et al., 1998).

The yield of C. asiatica was slightly higher in aqueous extracts and almost similar

between ethanolic and methanolic extracts in agreement with the antimicrobial results that

aqueous extracts showed better inhibitory activity between the three extracts ethanolic and

methanolic extracts display similar inhibition. Similar results were obtained in V.

amygdalina, whereby the methanolic and ethanolic extracts displayed higher yield and

aqueous extract displayed lowest yield in agreement with the antimicrobial results obtained.

This indicated that the solvent used played a major role in extracting the bioactive

compounds such as antimicrobial compounds present in the plant.

5.3 Authentication of the Medicinal Plants in the Study

When utilizing medicinal benefits from plants, it is important that the medicinal

compound is prepared from the correct and authenticated plant species. A rapid and reliable

method used to authenticate plant samples is by DNA barcoding method through sequence

comparison of the ITS2 region (Chen et al., 2010; Shiba et al., 2006; Lau et al., 2001; Zhao

et al., 2001). Variation between species can be distinguished with nucleotide sequencing of

the ITS2 region whereby sequence identities between the unknown plant and the sequence

from the Genbank is capable of identifying species.

BLAST search of the unidentified medicinal plant CA and VA was determined as

Centella asiatica and Vernonia amygdalina respectively when compared with sequences

from the Genbank, each with at least 99% identity.

144
Discussion

5.4 Antimicrobial Activity after Ammonium Sulphate Precipitation of Ethanolic


Extracts

Various studies have shown that plant defence mechanism against pathogen is by

secondary metabolites or antimicrobial peptides (Feng et al., 2003). The antimicrobial

activity reported in the whole plant extract of C. asiatica and leaf extract of V. amygdalina

was tested to determine if it was due to the presence of secondary metabolites or

antimicrobial peptides in the plant by performing 100% ammonium sulphate precipitation

of the plant ethanolic extract.

Based on the result, the supernatant obtained after ammonium sulphate precipitation

of C. asiatica ethanolic extract displayed high antimicrobial activity against B. cereus, E.

coli, P. aeruginosa and S. aureus while no activity was displayed against S. mutans. The

pellet of ammonium sulphate precipitate showed relative insignificant activity against E.

coli and P. aeruginosa, while no activity was observed against B. cereus, S. aureus and S.

mutans.

Similarly, the supernatant of V. amygdalina leaf ethanolic extract after ammonium

sulphate precipitation exhibited antimicrobial activity against B. cereus while the pellet

exhibited insignificant activity against B. cereus. No inhibitory activity was observed for

both the pellet and supernatant against the other test microorganism. Thus this study found

that the antimicrobial activity was prominent in the supernatant for both C. asiatica and V.

amygdalina extracts. Hence, antimicrobial compounds present in the plant were due to

secondary metabolites and not peptides.

145
Discussion

5.5 Total phenolic content (TPC)

Phenolic compounds are secondary metabolites present in all plants. Structurally

phenolic compound comprises of an aromatic ring with one or more hydroxyl groups

(Michalak, 2006). Phenolic compounds contribute towards many biological effects such as

antioxidant, antimicrobial and anti-haemolysis activity (Middleton et al., 2000; Osawa,

1994). In this study, the antimicrobial activities of C. asiatica and V. amygdalina extracts

were attributed to the phenolic compounds present in the plant as reported by Gurjar et al.

(2012) when the supernatant of ammonium sulphate precipitation showed antimicrobial

activity.

Antioxidant activity of phenolic compounds is based on the redox properties that

scavenge free radicals, decompose peroxides and quench singlet and triplet oxygen (Osawa,

1994). The number and configuration of the hydroxyl functional group are the main

features that determine the antioxidant capacity of phenolic compound in medicinal plants

(Pannala et al., 2001; Cao et al., 1997). Therefore, it is crucial to study the TPC in plants as

phenolics with natural antioxidant are potential therapeutic agents of various ailments such

as cancer, neurodegenerative diseases, diabetes, cardiovascular dysfunctions, inflammatory

diseases and aging.

The Folin-Ciocalteu method was used to determine the TPC in the plants. TPC was

expressed as milligram gallic acid equivalent per g dry weight (mg GAE/g d.w). The Folin

reagent produced a blue coloured complex when reacted with phenols which can be

quantified spectrophotometrically (Slinkard & Singleton, 1977). In this study, the highest

amount of polyphenols (4.006 mg GAE/g d.w.) were found in the ethanolic extract of the

whole plant of C. asiatica which was slightly lower than the amount earlier reported by

Andarwulan et al. (2010) (5.82 mg GAE/g d.w.) and much lower than the amount reported
146
Discussion

by Wongsa et al. (2012) (52.5 mg GAE/g d.w.). Previously, the TPC in the whole plant

extracted using methanol reported by Guleria et al. (2013) (27.43 mg GAE/g d.w.) was

much higher than found in the methanolic extracts in this study. However in another study,

Wongsa et al. (2012) reported a much lower TPC (1.4 mg GAE/g d.w.) comparable to this

study. A low amount of phenolic content had been recorded in the aqueous extract which

was consistent with this study (Wongsa et al., 2012).

The three extracts of the leaf of V. amygdalina displayed similar TPC with the

highest of them being the methanolic extract. Previous studies showed similarly low TPC in

ethanolic and aqueous extracts (3.97 and 2.71 mg GAE/g d.w.) respectively (Audu et al.,

2012). However higher TPC value was recorded by Fasakin et al. (2011) in ethanolic (8.2

mg GAE/g d.w.) and methanolic (14.8 mg GAE/g d.w.) extracts contrasting with the results

of this study.

Generally the TPC of V. amygdalina was found to be lower than C. asiatica which

may explain better antimicrobial activity displayed by C. asiatica. C. asiatica had higher

phenolic content compared to methanolic extracts of medicinal plants such as Alpinia

oxyphylla, Asparagus cochinchinensis, Astragalus membranaceus, Atractylodes

macrocephala, Dendrobium nobile, Dioscorea opposite, Lilium brownii, Morinda

officinalis, Ophiopogon japonicas, Polygonatum odoratum and Tremella fuciformis (Wong,

Li, et al., 2006) and ethanolic extracts of vegetables such as Apium graveolens (leaf celery),

Justica gendarussa (willow-leaved justice), Kaempferia galanga (chinese ginger),

Micromelum minutum (lime berry), Morinda elliptica (indian mulberry), Ocimum basilicum

(basil), Vigna sinensis (long beans) and Vigna radiate (mung bean sprout) (Sulaiman et al.,

2011).

147
Discussion

5.6 Antioxidant Activity in the Plant of Study

Antioxidant activity present in the plant must be determined to evaluate if it is

related to the phenolic compounds present in the plant. More than one antioxidant assay

was employed to measure the antioxidant activity present to take into account the different

modes of actions of antioxidants present in the plant extracts related to difference in

chemical structure and complexity of the antioxidants (Huang et al., 2005; Prior & Cao,

1999). In this study DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical scavenging activity

assay, Ferric Reducing Antioxidant Power (FRAP) Assay and hydrogen peroxide (H2O2)

induced haemolysis assay were performed to determine the antioxidant activity in C.

asiatica and V. amygdalina.

5.6.1 DPPH (2, 2-diphenyl-1-picrylhydrazyl) Radical Scavenging Activity Assay

DPPH radical scavenging assay is the most common method used to evaluate

antioxidant activity because it is simple and rapid. The mechanism of radical scavenging

activity employed in this assay is via the hydrogen atom donated by phenolic compounds

with antioxidant activity which binds to the purple coloured DPPH thus reducing DPPH

which turns yellow in colour (Gulcin et al., 2007). Antioxidant activity was measured by

comparing the inhibition of phenols to Trolox and expressed as milimole Trolox equivalent

per gram dry weight sample (mmol TE/g d.w.). The greater scavenging activity of the plant

extracts, higher antioxidant capacity was displayed.

From the experimental data, all extracts of C. asiatica showed scavenging activity

towards DPPH. The highest scavenging activity and antioxidant capacity was observed

with the ethanolic extract which was comparable to ascorbic acid but was much higher than
148
Discussion

with BHT. Ethanolic extract showed the lowest IC50. Antioxidant capacity of methanolic

extract was comparable to ethanolic extract. Aqueous extract displayed the lowest

scavenging activity with little antioxidant capacity. These results were in agreement with

those of Hamid et al. (2002).

However, ethanolic and methanolic extracts of V. amygdalina leaf displayed radical

scavenging activity which was lower compared to that of C. asiatica. The aqueous extract

showed apparently no antioxidant capacity. This result was in agreement with the findings

of Anyasor et al. (2010). The IC50 was very high for all the extracts of V. amygdalina,

displaying the weak antioxidant activity of this plant.

Based on this assay, phenolic compounds with antioxidant activity was better

extracted by ethanol/methanol compared to water for both the plants of study. This property

was also observed by Hamid et al. (2002). A common pattern of inhibition towards DPPH

was observed amongst all the extracts for both the plants where a steady increase in

inhibition was followed by a much slower increase with a levelling off. This general pattern

was found to be common in plant extracts (Razali et al., 2008; Kumaran & Karunakaran,

2007). However, aqueous extracts of V. amygdalina did not follow the same pattern

because it possessed weak radical scavenging activity and higher concentration of this

extract is required to display significant results.

149
Discussion

5.6.2 Ferric Reducing Antioxidant Power (FRAP) Assay

FRAP assay involves the reduction of the almost colourless ferric tripyridyl triazine

(Fe(III)-TPTZ) complex to a blue coloured ferrous (Fe(II)-TPTZ) complex by antioxidants

present in the plant extracts. The assay is by monitoring the change in absorbance at 593

nm. This assay is used to evaluate the reducing power of samples where the greater the

antioxidants present in the plant extract, the greater the intensity of the blue colour

formation and hence higher the absorbance.

The reaction of the samples and standards were measured at an interval of 15

seconds for 4 minutes. The antioxidant capacity of the extracts and standards were

measured by comparison with a ferrous sulphate (FeSO4.7H2O) standard curve and

expressed as milimole ferrous sulphate per gram of dry weight (mmole Fe2+/g dry weight).

A linear pattern was observed for absorbance of the controls and extracts with

regards to time. The absorbance of all the extracts of C. asiatica, V. amygdalina and

standards reached a plateau by the fourth minute of incubation indicating there was no

further increase in the reduction of ferric ions.

At 1.0 mg/ml concentration, methanolic and ethanolic extracts of C. asiatica

showed rapid reaction with high absorbance within the 4 minute reaction time (0.4660.012

AU at 0 seconds to 0.5550.012 AU at 4 minutes) and (0.4210.011 AU at 0 seconds to

0.5020.014 AU at 4 minutes) respectively. Antioxidant capacity was highest in the

methanolic extract. The antioxidant capacity was lower than previous reports by

Malinowska (2013) who showed high antioxidant capacity of C. asiatica extracted from

commercial cosmetic (1.02 mg Fe2+/g d.w) and Guleria et al. (2013) who showed high

antioxidant capacity in 80% methanolic extract (22.5 mg Fe2+/g d.w.). The aqueous extract

in this study displayed low antioxidant activity in agreement with the findings of Wong et
150
Discussion

al. (2006) and Reihani and Azhar (2012). The antioxidant capacities of all extracts were

higher than ascorbic acid, but lower than BHT (Table 4-7).

The methanolic extract of V. amygdalina possesses the highest absorbance

compared to other extracts (0.1420.020 AU at 0 seconds to 0.2220.012 AU at 4 minutes)

at 1.0 mg/ml concentration. The highest antioxidant capacity was recorded for the

methanolic extract while the lowest was for the aqueous extract. All extracts had higher

antioxidant capacity than ascorbic acid but lower than BHT (Table 4-8). Oriakhi et al.

(2014) reported FRAP antioxidant capacity value in the ethanolic extract of V. amygdalina

to be two times higher than in this study. The difference in result could be due to the

extraction technique used or the plant growth conditions met.

Overall the extracts of C. asiatica showed higher FRAP antioxidant capacity

compared to extracts of V. amygdalina suggesting that C. asiatica is a more potent

antioxidant. This study shows methanol was a better extractant of phenolic compounds

possessing antioxidant activity.

The methanolic extract of C. asiatica was shown to possess good reducing

capabilities such that it was able to donate electrons to free radicals. Hence in actual

biological systems, this extract may be useful as a natural remedy in the treatment of free

radical related diseases such as cancer, diabetes, arthritis, and acceleration of the ageing

process (Shahidi, 1997).

151
Discussion

5.6.3 Protective Effects of the Plant of Study against Hydrogen Peroxide Induced
Red Blood Cell Lysis

Hydrogen peroxide (H2O2) a reactive compound formed from superoxide, can

inactivate enzymes in the body. It easily diffuses across the cell membrane and reacts with

Fe2+ or Cu2+ forming the hydroxyl radicals which reacts with macromolecules in the body

resulting in cellular stress which is the root cause of many diseases (Bhatia et al., 2011;

Sebastia et al., 2006). Therefore, it is important to evaluate compounds that can scavenge

the H2O2 and control their accumulation in the cell for the benefit of health and wellbeing.

In this study the erythrocytes cell membranes were used to determine oxidative

damage because they are susceptible to oxidation and are targets of oxidizing agents.

Erythrocytes generate reactive oxygen species because its membrane has a high

concentration of polyunsaturated fatty acids. Furthermore, it contains redox active

haemoglobin molecules involved in the transport of oxygen (Shalini et al., 2009).

Haemoglobin exposed to H2O2 causes degradation of haem, which results in the release of

iron ions forming light yellow colour that can be measured at 540 nm. The greater the

protective effect of the plant extracts, the lower the absorbance measured. Antioxidant

capacity was determined in comparison with ascorbic acid and expressed as milimole

ascorbic acid equivalent per gram dry weight plant sample (mmol AAE/g d.w.).

Firstly it was discovered that extracts of both C. asiatica and V. amygdalina pre-

incubated with erythrocytes did not exhibit any lytic effect on the red blood cells. In fact, it

was discovered that both the plants showed protective effect against H2O2 induced

haemolysis. Maximal protective effect and antioxidant capacity in both C. asiatica and V.

amygdalina was found in methanolic extract which was higher than that of ascorbic acid

indicating that the compounds extracted with methanolic extract are potent anti-haemolytic

agent(s). The protective effect against haemolysis was in a dose dependent pattern for
152
Discussion

methanolic and ethanolic extracts. Aqueous extracts did not follow a dose dependent

pattern and displayed varying protective effects against extract concentration showing it to

be a weak extractant of anti-haemolytic agents in both the plants.

In this study, different concentrations of H2O2 (10 mM and 50 mM) were tested and

in both C. asiatica and V. amygdalina, aqueous extracts against 50 mM H2O2 displayed

lower protective effects than against 10 mM H2O2 and ethanolic extracts showed similar

protective effect against both the concentration of H2O2. However, methanolic extract

displayed higher protective effect against 50 mM H2O2 compared to 10 mM H2O2. Aqueous

extracts were weak antioxidants and displayed lower protective effect. The strongest

antioxidant activity was in the methanolic extract that displayed stronger protective effect

against higher concentration of H2O2.

Previous studies such as on red wine and mango peel showed protective properties

against H2O2 induced erythrocyte haemolysis (Ajila & Rao, 2008; Tedesco et al., 2001).

However some plants such as Allium stracheyi promote haemolysis of erythrocyte due to

the oxidative reaction of phenols (Mukherjee & Rajasekaran, 2010; Bukowska &

Kowalska, 2004). Thus measuring haemolytic activity in plant extracts is important in

toxicological evaluation (Gandhi & Cherian, 2000). From this study, phenolic compound in

both the plants were shown not to cause harmful effects on haemoglobin. C. asiatica and V.

amygdalina possessed compound to effectively scavenge H2O2 before it could affect the

erythrocytes and thus are safe to be utilized as pharmacological applicants. This study is

also the first to report protective effect of C. asiatica whole plant extracts and V.

amygdalina leaf extracts against H2O2 induced haemolysis.

153
Discussion

5.7 Relationship between Phenolic Compounds and Bioactivity

5.7.1 Relationship between Phenolic Compounds and Antimicrobial Activity

Antimicrobial activity in medicinal plants has been attributed to the phenolic

compounds present (Das et al., 2010; Urs & Dunleavy, 1975). Interestingly, this study

revealed that the relationship between the antimicrobial activity and phenolic content of C.

asiatica was generally low for each test microorganisms when compared using the aqueous,

ethanolic and methanolic extracts for each plant. The high negative correlation in C.

asiatica towards B. cereus and S. mutans indicated that the aqueous extract displayed high

antimicrobial activity but low phenolic content and the ethanolic extract possessed high

phenolic content but low antimicrobial activity. This result indicated that water extracted

certain bioactive compounds believed to inhibit B. cereus and S. aureus effectively. This

suggests the presence of other compounds such as organic acids or aldehydes in addition to

the phenolic compounds that may be responsible for the antimicrobial activity. The results

also indicated that phenolic compounds were extracted better in ethanol.

Extracts of V. amygdalina displayed significantly relationship between the

antimicrobial activity and phenolic content towards B. cereus and S. mutans with the later

showing about 0.60 coefficient of determination (R2). This result indicated that phenolic

compounds present in V. amygdalina were responsible for the antimicrobial activity

displayed by the plant extracts.

When comparison was made between both plants using one of the extract (ethanol)

the relationship between antimicrobial activity and total phenolic content was significantly

high in agreement with the findings by Shan et al. (2007) who discovered high correlation

between the antimicrobial activity and total phenolic content of 46 spice and herb extracts.

154
Discussion

This finding suggests that the phenolic compounds significantly contributed to the

antimicrobial activity of many plant extracts including those of C. asiatica and V.

amygdalina.

5.7.2 Relationship between Phenolic Compounds and Antioxidant Activity

Correlation between total phenolic content (TPC) and antioxidant capacity was

determined to evaluate if antioxidant capacity may be attributed to the phenolic compounds

present in C. asiatica and V. amygdalina as reported by previous studies on other plants

(Jahan, 2011; etkovi et al., 2007; Pietta, Simonetti, Gardana, et al., 1998; Shahidi et al.,

1992). Phenolic compounds in plants are composed of one or more aromatic rings which

are bound to hydroxyl group(s) that forms resonance-stabilized phenoxyl radicals by

quenching free radicals giving them their antioxidant properties (Bors & Michel, 2002;

Rice-Evans et al., 1997).

The correlation between TPC with DPPH, FRAP and anti-haemolysis activity of C.

asiatica extracts were significantly high indicating that the phenolic hydroxyl groups were

the major contributors of the free radical scavenging activity, ferric reducing capacities and

protective effect against hydrogen peroxide shown by the plant extracts. Strong correlation

was also observed between the antioxidant capacities determined by DPPH, FRAP and

anti-haemolysis assays indicating that the antioxidants present in the plant extracts possess

strong antioxidant capacities, although they might act through different modes of action

(Huang et al., 2005; Prior & Cao, 1999). Based on the phenolic compounds present in the

plant C. asiatica is a good source of antioxidant.

155
Discussion

The correlation between TPC and antioxidant capacity for V. amygdalina extracts

was generally low for all the antioxidant assays suggesting that the phenolic compounds in

the plant did not display antioxidant potential. Interestingly, the results revealed

significantly high correlation between DPPH and anti-haemolysis assay while the other

antioxidant assays showed non-significant correlations. This is probably because the

phenolic compounds with strong radical scavenging potential also showed strong protective

effect towards hydrogen peroxide, but did not efficiently reduce ferric ions. In general, the

difference in antioxidant capacities between assays may be due to (i) the difference in

stoichiometry between the antioxidants and free radicals; (ii) the different solubility of the

antioxidant compounds in aqueous, ethanol or methanol solvents and (iii) stereo selectivity

of the free radical ions (Khan et al., 2012). V. amygdalina was found to be a weak source of

antioxidant.

Correlation between TPC and antioxidant capacities were significantly higher

between C. asiatica and V. amygdalina (ethanolic extract) compared to the correlation

between the aqueous, ethanolic and methanolic extracts of each plant. These findings

revealed that the presence of phenolic compounds in each plant contributes significantly to

their antioxidant capacity as previously reported (Wong, Leong, et al., 2006; Cai et al.,

2004). A clear correlation was established in C. asiatica but not in V. amygdalina. Thus the

phenolic compounds of C. asiatica possessed stronger antioxidant capacities compared to

V. amygdalina.

156
Discussion

5.8 Bioactivity of Aqueous, Ethanolic and Methanolic extracts of C. asiatica and V.


amygdalina.

When the overall comparison of the bioactivity present in the aqueous, ethanolic

and methanolic extracts of C. asiatica and V. amygdalina were made, it was revealed that

aqueous extract of C. asiatica showed strongest antimicrobial activity. However methanolic

extraction was effective in the isolation of bioactive compounds and the methanolic extract

of V. amygdalina showed higher antimicrobial activity in agreement with Parekh et al.

(2005). The ethanolic and methanolic extracts showed highest TPC compared to aqueous

extract in both plants. This indicates that phenolic compounds are extracted effectively by

ethanol or methanol.

Amongst all the extracts tested, methanolic extract displayed the highest ferric

reducing capabilities and anti-haemolysis activity while ethanolic extract displayed highest

DPPH radical scavenging capacity in both C. asiatica and V. amygdalina. It may be

assumed that methanol extracted most phenolic compounds possessing ferric reducing

capacities and protective effect against hydrogen peroxide and ethanol effectively extracted

phenolic compounds possessing DPPH radical scavenging activity.

Ethanolic extract of C. asiatica displayed significantly higher DPPH radical

scavenging capacity compared to the standard BHT. Synthetic antioxidants such as BHT

have been added in to food product to prolong shelf life by controlling lipid oxidation in

food. However synthetic antioxidants may be hazardous to health (Kahl & Kappus, 1993).

Therefore natural antioxidants especially from medicinal plants are suitable

replacement for the synthetic ones in the food industry. In this study, ethanolic extract of C.

asiatica may be the best replacement for BHT in the food industry as it possessed high

phenolic content and strong antioxidant activity.

157
Discussion

The methanolic extract of both C. asiatica and V. amygdalina displayed

significantly higher ferric reducing capacity and anti-haemolysis capacity compared to

ascorbic acid. Therefore antioxidant agent from methanolic extracts of these plants may be

developed for the management of disorders linked to free radicals such as ageing, cancer,

cardiovascular disease, diabetes, rheumatoid arthritis, epilepsy & degradation of essential

fatty acids (Subedi et al., 2012; Barros et al., 2007; Singh et al., 2007).

5.9 Identification of Phenolic Compounds through Reverse Phase High


Performance Liquid Chromatography (RP-HPLC) and Fourier Transform
Infrared Spectroscopy (FT-IR)

Based on the findings of the current study, it was concluded that phenolic

compounds were present in both the medicinal plants and the antioxidant and antimicrobial

properties displayed in both the plants were attributed to phenolic compounds. RP-HPLC

used for the separation, identification and quantification of phenolic compounds present in

C. asiatica and V. amygdalina same as others, has shown to be a reliable method (Molnar-

Perl & Fuzfai, 2005).

The ethanolic and methanolic extracts of C. asiatica and V. amygdalina showed

high TPC as determined by the Folin-Coicalteu method. Purification of plant extracts was

required prior to injection into HPLC to remove compounds such as chlorophyll, waxes

sterols, etc. which may damage the HPLC column and interfere with the elution of

compounds (Gowniak et al., 1996). SPE (solid phase extraction) method was chosen as the

pretreatment method over the hydrolysis method because pretreatment with SPE columns is

known to give higher recovery of phenolic compounds whereas, pretreatment by hydrolysis

caused decomposition of polyphenols which often led to the loss in recovery of phenolic

158
Discussion

compounds (Kermasha et al., 1995; Hertog et al., 1992). Furthermore the SPE pretreatment

method is highly reproducible and a low volume of sample is required (Gowniak et al.,

1996).

The identity of the phenolic compounds were determined by comparing with the

retention time of standards as established by Bartolom et al. (1993). In this study, the RP-

HPLC analysis of C. asiatica extracts revealed the presence of chloramphenicol and

benzoic acid whereby both ethanolic and methanolic extracts displayed similar

chromatographic patterns. The peaks for chloramphenicol and benzoic acid obtained were

confirmed firstly by spiking with authentic chloramphenicol and benzoic acid standards and

then by FT-IR. Interestingly, this study is the first to report the presence of chloramphenicol

and benzoic acid in C. asiatica which may contribute to the plants antioxidant and

antimicrobial activities.

In this study, chloramphenicol is the major compound in extracts of C. asiatica

whole plant. It is a broad spectrum antibiotic which was first isolated from Streptomyces

venezuelae in 1947. Chloramphenicol inhibits both gram positive and negative bacteria and

is effectively used in the treatment of meningitis, typhoid fever, and cystic fibrosis (Baselt

& Cravey, 1995). This may explain the antimicrobial activity displayed by the plant

extracts. Chloramphenicol was discovered to exist naturally in herbs, grass and in plants

from the Artemisia family (Berendsen et al., 2013; Berendsen et al., 2010).

The other major compound present, benzoic acid is the most widely used

preservative in the food, drug and cosmetic industries (Davidson, 2001). It exists as a white

powder in pure form and is slightly soluble in water. It was found to occur naturally in

blackberries, mushrooms and tomatoes (Abdullah et al., 1994; Marlatt et al., 1992; Humpf

& Schreier, 1991).

159
Discussion

Previous studies reported the presence of triterpenes such as asiatic acid, madecassic

acid, asiaticosside, madecassoside, terminolic acid, 11,12-dehydroursolic acid lactone,

ursolic acid, pomolic acid, 2a ,3a -dihydroxyurs-12-en-28-oic acid, 3-epimaslinic acid,

corosolic acid, 8-acetoxy-1,9-pentadecadiene-4,6-diyn-3-ol, -sitosterol 3-O--

glucopyranoside and asiaticoside-B; and rosmaric acid in the plant (Bonfill et al., 2006;

Yoshida et al., 2005; Schaneberg et al., 2003; Verma et al., 1999; Inamdar et al., 1996).

Quantification of the total phenolic content (TPC) of the two major peaks obtained

was done by (i) Folin-Coicalteu assay; and (ii) comparison with the peak profiles of

commercial standards chloramphenicol and benzoic acid. The TPC of the peaks obtained

by Folin-Coicalteu method was much higher than by comparison of peak profiles to

standards. The difference in the phenolic content obtained by both methods may be due to

the lack of accuracy of the Folin-Coicalteu method, which may be affected by interference

such as sulphur dioxide, ascorbic acid, sugar, aromatic amines, organic acids and other non-

phenolic substances that may react with the assay (Singleton et al., 1999).

The RP-HPLC analysis of V. amygdalina detected six major unknown peaks.

Further analysis by LC-MS and GC-MS was done to identify the phenolic compounds

present. Previous studies of V. amygdalina extracts revealed the presence of caffeoylquinic

acid (Johnson et al., 2011) flavonoids (Igile et al., 1994), steroidal alcohol (Arene, 1972),

steroid glucosides (Igile et al., 1994; Jisaka et al., 1993), fatty acids (Erasto et al., 2007)

and sesquiterpene lactones (vernodalin and vernoamygdalin) (Luo et al., 2011; Erasto et al.,

2006).

160
Discussion

5.10 Liquid Chromatography-Mass Spectroscopy Analysis of the Plant extracts

Currently LC-MS is considered as the best analytical method for identifying

phenolic compounds present in plant extracts (Motilva et al., 2013; Savarese et al., 2007).

Previous studies indicated that the negative ionization mode of the ESI-MS provides better

identification of phenolic compounds with low molecular weight and low concentration

(Abad-Garca et al., 2012; Sun et al., 2007; Charrouf et al., 2007). However in this study,

both the ionization modes (positive and negative) were used to provide certainty of the

molecular mass determination. Identification of phenolic compounds was based on the

accurate molecular mass by search of the literature.

In this study, thirty eight phenolic compounds were identified in the methanolic

extract of C. asiatica. The phenolic compounds were classified into the following groups:

gallic acid derivatives, hydroxybenzoic acid, hydroxycinnamic acid, flavonoids (flavan-3-

ols, flavonol and flavonol glycosides, flavanone and flavanone glycosides), purine alkaloids

and phenolic terpenes and lignin. Other compounds such as chloramphenicol and benzoic

acid which were previously identified by RP-HPLC and FT-IR were also detected by LC-

MS confirming the presence of these compounds in C. asiatica extracts.

The LC-MS analysis showed that the methanolic extract of V. amygdalina contained

forty phenolic compounds ranging from gallic acid derivatives, hydroxybenzoic acid,

hydroxycinnamic acid, flavonoids (flavan-3-ols, flavonol and flavonol glycosides,

flavanone and flavanone glycosides), resveratrols, purine alkaloids and phenolic terpenes

and lignin.

Interestingly, this study is the first to report the presence of the phenolic compound

phloridzin. Phloridzin is characterized as a dihydrochalcone, which is present as a major

phenolic compound in Malus domestica (Gosch et al., 2009). In a recent study conducted

161
Discussion

by Najafian et al. (2012), this compound significantly reduced the blood glucose levels and

improved dyslipidemia in streptozotocin-induced diabetic rats. Phloridzin was discovered

to help reduce diabetes, obesity, stress and hyperglycaemia and is a strong antioxidant

agent (Kobori et al., 2012; Gosch et al., 2010). The leaf extracts of V. amygdalina is known

to possess antidiabetic activity (Osinubi, 2008; Ekpenyong et al., 1999) and this may be

related to the presence of phloridzin.

The combination of phenolic compounds detected in both C. asiatica and V.

amygdalina may work in synergy to exhibit the antimicrobial, antioxidant and anti-

haemolyis properties. Synergy between different constituents of plant extracts has been

shown in Cinchona bark, whereby thirty alkaloids have been detected and the mixtures of

alkaloids have a greater inhibition against Plasmodium falciparumin than any of the

alkaloids used separately (Druilhe et al., 1988). This study is also the first to identify

various phenolic compounds present in C. asiatica and V. amygdalina.

162
6.0 CONCLUSION

Six medicinal plants: Aloe vera (leaf and gel), Azadirachta indica (leaf), Carica

papaya (leaf), Centella asiatica (whole plant), Hymenocallis speciosa (leaf, tuber and root)

and Vernonia amygdalina (leaf and stem) were screened for antimicrobial activity. On the

basis of antimicrobial activity, C. asiatica (whole plant) and V. amygdalina (leaf) were

chosen as candidate plant species for the determination of bioactive constituents present.

The aqueous, ethanolic and methanolic extracts of C. asiatica inhibited B. cereus, E. coli,

P. aeruginosa, S. mutans and S. aureus. Ethanolic extracts of V. amygdalina inhibited B.

cereus while the methanolic extract inhibited B. cereus and S. mutans.

The supernatant obtained from the ammonium sulphate precipitation of the

ethanolic extracts of C. asiatica displayed high antimicrobial activity against B. cereus, E.

coli, P. aeruginosa and S. aureus. The supernatant of the ethanolic extract of V. amygdalina

exhibited antimicrobial activity against B. cereus. Insignificant inhibition was observed for

the ammonium sulphate pellet against the test microorganisms. Hence the antimicrobial

activity of the plant extracts was not attributed to peptides but may be due to phenolic

compounds.

Total phenolic content (TPC) of the extracts were determined. The ethanolic extract

of C. asiatica showed high TPC whereas the TPC in V. amygdalina was similar in the

aqueous, ethanolic and methanolic extracts but lower in amount compared to C. asiatica.

Phenolic compounds have been known to be major contributors of antioxidant activity in

plants. The antioxidant potential of both the plants were evaluated based on DPPH free

radical scavenging activity, FRAP assay and anti-haemolysis activity.

163
Conclusion

The ethanolic extract of C. asiatica showed high scavenging activity towards

DPPH, which was stronger than that of BHT. The methanolic extract displayed high FRAP

antioxidant capacity, which was stronger than that of ascorbic acid. Hence the extracts of

this plant may be useful as a natural antioxidant agent for the management of health

disorders associated with free radicals.

The methanolic and ethanolic extracts of V. amygdalina displayed high scavenging

activity towards the DPPH radical, and the methanolic extract displayed high FRAP

antioxidant capacity. However it was lower than C. asiatica and higher concentrations of

the extract was required to display significant antioxidant activity.

This study also demonstrated for the first time the protective effect of C. asiatica

and V. amygdalina extracts against hydrogen peroxide induced red blood cell lysis. The

protective effect against haemolysis was higher than that of ascorbic acid.

Biologically active phenolic compounds in C. asiatica and V. amygdalina were

identified by RP-HPLC, LC-MS, and FT-IR. RP-HPLC analysis of the methanolic extract

of C. asiatica identified the presence of chloramphenicol and benzoic acid as the major

phenolic compounds in the plant. The identification of these compounds was confirmed by

FT-IR analysis. However RP-HPLC analysis of V. amygdalina extracts detected six major

phenolic compounds which were not identified. Analysis by LC-MS was done to identify

the phenolic compounds present in the plant extracts.

Analysis by LC-MS identified thirty eight and forty different phenolic compounds

in C. asiatica and V. amygdalina respectively including gallic acid derivatives,

hydroxybenzoic acid, hydroxycinnamic acid, flavonoids, purine alkaloids and phenolic

terpenes and lignins. Amongst them, the presence of phloridzin was detected in the

methanolic extract of V. amygdalina. Phloridzin is known to have antidiabetic properties.

164
Conclusion

The results from this study suggests that extracts of the selected medicinal plants C.

asiatica and V. amygdalina possesses phenolic compounds with antimicrobial and

antioxidant properties that can be used as antimicrobial and antioxidant agents in the search

for new drugs. Furthermore the natural plant pheolics could serve as a natural preservative

in the food industry to replace synthetic antioxidant agents.

165
References

REFERENCES

Abad-Garca, B., Garmn-Lobato, S., Berrueta, L. A., Gallo, B., & Vicente, F. (2012).
On line characterization of 58 phenolic compounds in Citrus fruit juices from
Spanish cultivars by high-performance liquid chromatography with photodiode-
array detection coupled to electrospray ionization triple quadrupole mass
spectrometry. Talanta, 99, 213-224. doi:
http://dx.doi.org/10.1016/j.talanta.2012.05.042

Abdullah Al, E., Shahed, S. M., Ahmed, F., Saha, S. K., Das, S. C., & Bachar, S. C.
(2011). Evaluation of Brine shrimp lethality and Antimicrobial activity of
Azadirachta indica leaf extract on some drug resistance bacteria in Bangladesh.
Pharmacognosy Journal, 3(20), 66-71. doi:
http://dx.doi.org/10.5530/pj.2011.20.13

Abdullah, M. I., Young, J. C., & Games, D. E. (1994). Supercritical fluid extraction of
carboxylic and fatty acids from Agaricus spp. mushrooms. Journal of
Agricultural and Food Chemistry, 42(3), 718-722.

Acamovic, T., & Brooker, J. D. (2005). Biochemistry of plant secondary metabolites


and their effects in animals. Proceedings of the Nutrition Society, 64(3), 403-
412.

Adedapo, A. A., Jimoh, F. O., Afolayan, A. J., & Masika, P. J. (2009). Antioxidant
Properties of the Methanol Extracts of the Leaves and Stems of Celtis africana.
Records of Natural Products, 3(1), 23-31.

Adesanoye, O. A., & Farombi, E. O. (2010). Hepatoprotective effects of Vernonia


amygdalina (astereaceae) in rats treated with carbon tetrachloride. Experimental
and Toxicologic Pathology, 62(2), 197-206.

Agarry, O. O., Olaleye, M. T., & Bello-Michael, C. O. (2005). Comparative


antimicrobial activities of Aloe vera gel and leaf. African Journal of
Biotechnology, 4(12), 1413-1414.

Ahmad, I. , Mehmood, Z., & Mohammad, F. (1998). Screening of some Indian


medicinal plants for their antimicrobial properties. Journal of
Ethnopharmacology, 62(2), 183-193. doi: http://dx.doi.org/10.1016/S0378-
8741(98)00055-5

Ahmad, N., Fazal, H., Ayaz, M., Abbasi, B. H., Mohammad, I., & Fazal, L. (2011).
Dengue fever treatment with Carica papaya leaves extracts. Asian Pacific
Journal of Tropical Biomedicine, 1(4), 330-333. doi: 10.1016/s2221-
1691(11)60055-5

166
References

Ahmed, A. A., Mahmoud, A. A., Williams, H. J., Scott, A. I., Reibenspies, J. H., &
Mabry, T. J. (1993). New sesquiterpene -methylene lactones from the Egyptian
plant Jasonia candicans. Journal of Natural Products, 56(8), 1276-1280.

Ajik, M. (1990). Etnobotani Suatu Masyarakat di Bukit Garam, Sandakan, Sabah:


Kajian Kes ke Atas Orang Sungai. Tesis SmSn. Jabatan Botani, Universiti
Kebangsaan Malaysia, Bangi.

Ajila, C. M., & Rao, U. J. S. P. (2008). Protection against hydrogen peroxide induced
oxidative damage in rat erythrocytes by Mangifera indica L. peel extract. Food
Chemistry Toxicology, 46(1), 303-309. doi: 10.1016/j.fct.2007.08.024

Akinpelu, D. A. (1999). Antimicrobial activity of Vernonia amygdalina leaves.


Fitoterapia, 70(4), 432-434.

Alberts, B. , Johnson, A., Lewis, J., Raff, M., Roberts, K. , & Walter, P. (2002).
Molecular Biology of the Cell. New York: Garland Science.

Alemdar, S., & Agaoglu, S. (2009). Investigation of in vitro antimicrobial activity of


Aloe vera juice. Journal of Animal and Veterinary Advances, 8(1), 99-102.

Almas, K. (1999). The antimicrobial effects of extracts of Azadirachta indica (Neem)


and Salvadora persica (Arak) chewing sticks. Indian Journal of Dental
Research, 10(1), 23-26.

Amandus, T. J. V. (1989). Mengenai beberapa nilai tumbuhan di kalangan masyarakat


Kadazan di Sabah: Satu kajian kes di Daerah Papar. Tesis SmSn Kep., Jabatan
Botani, Universiti Kebangsaan Malaysia, Bangi.

Amaral, J. A., Ekins, A., Richards, S. R., & Knowles, R. (1998). Effect of selected
monoterpenes on methane oxidation, denitrification, and aerobic metabolism by
bacteria in pure culture. Applied and Environmental Microbiology, 64(2), 520-
525.

Ames, B. N., Shigenaga, M. K., & Hagen, T. M. (1993). Oxidants, antioxidants, and the
degenerative diseases of aging. Proceedings of the National Academy of
Sciences of the United States of America, 90(17), 7915-7922.

Ami, D. , Davidovi-Ami, D., Belo, D., & Trinajsti, N. (2003). Structure-radical


scavenging activity relationships of flavonoids. Croatica Chemica Acta, 76(1),
55-61.

167
References

Anbarashan, M., Parthasarthy, N., & Padmavathy, A. (2011). Ethno-floristic survey in


sacred groves, Pudukottai district. Tamil Nadu-India. Journal of Medicinal Plant
Research, 5, 439-443.

Andarwulan, N., Batari, R., Sandrasari, D. A., Bolling, B., & Wijaya, H. (2010).
Flavonoid content and antioxidant activity of vegetables from Indonesia. Food
Chemistry, 121(4), 1231-1235.

Anderson, K. J., Teuber, S. S., Gobeille, A., Cremin, P., Waterhouse, A. L., &
Steinberg, F. M. (2001a). Walnut polyphenolics inhibit in vitro human plasma
and LDL oxidation. Journal of Nutrition, 131(11), 2837-2842.

Anderson, K. J., Teuber, S. S., Gobeille, A., Cremin, P., Waterhouse, A. L., &
Steinberg, F. M. (2001b). Walnut polyphenolics inhibit in vitro human plasma
and LDL oxidation. Journal of Nutrition, 131(11), 2837-2842.

Angeh, I. E. (2006). Potentising and application of an extract of Melianthus comosus


against plant fungal pathogens. University of Pretoria.

Anyasor, G. N., Ogunwenmo, K. O., Ogunnowo, A. A., & Alao-Sanni, O. (2010).


Comparative antioxidant, phytochemical and proximate analysis of aqueous and
methanolic extracts of Vernonia amygdalina and Talinum triangulare. Pakistan
Journal of Nutrition, 9(3), 259-264.

Archer, G. L. (1998). Staphylococcus aureus: a well-armed pathogen. Clinical


Infectious Diseases, 26(5), 1179-1181.

Aregheore, E. M., Makkar, H. P. S., & Becker, K. (1998). Feed value of some browse
plants from the central zone of Delta State, Nigeria. Tropical Science, 38, 97-
104.

Arene, E. O. (1972). 7,24 (28)-Stigmastadien-3-ol from Vernonia amygdalina.


Phytochemistry 11, 2886-2887.

Arnesen, L. P. S., Fagerlund, A., & Granum, P. E. (2008). From soil to gut: Bacillus
cereus and its food poisoning toxins. Federation of European Microbiological
Societies Microbiology Reviews, 32(4), 579-606.

Arthur, H. R. (1954). A phytochemical survey of some plants of North Borneo. Journal


of Pharmacy and Pharmacology, 6(1), 66-72.

Aruoma, O. I. (2003). Methodological considerations for characterizing potential


antioxidant actions of bioactive components in plant foods. Mutation
Research/Fundamental and Molecular Mechanisms of Mutagenesis, 523, 9-20.
168
References

Atangwho, I. J., Egbung, G. E., Ahmad, M., Yam, M. F., & Asmawi, M. Z. (2013).
Antioxidant versus anti-diabetic properties of leaves from Vernonia amygdalina
Del. growing in Malaysia. Food Chemistry, 141(4), 3428-3434. doi:
http://dx.doi.org/10.1016/j.foodchem.2013.06.047

Atta, R., & Choudhary, M. I. (1995). Diterpenoid and steroidal alkaloids. Natural
Product Reports, 12(4), 361-379.

Audu, S. A., Taiwo, A. E., & Ojuolape, A. R. (2012). A Study Review of Documented
Phytochemistry of Vernonia amygdalina (Family Asteraceae) as the Basis for
Pharmacologic Activity of Plant Extract. Journal of Natural Sciences Research,
2(7), 1-8.

Ayafor, J. F., Tchuendem, M. H., Nyasse, B., Tillequin, F., & Anke, H. (1994). Novel
bioactive diterpenoids from Aframomum aulacocarpos. Journal of Natural
Products, 57(7), 917-923.

Azaizeh, H., Fulder, S., Khalil, K., & Said, O. (2003). Ethno-medicinal knowledge of
local arad practitinores in the middle east region. Fitoterapia, 14, 98-108.

Azliza, M. A., Ong, H. C., Vikineswary, S., Noorlidah, A., & Haron, N. W. (2012).
Ethno-medicinal Resources Used By the Temuan in Ulu Kuang Village. Studies
on Ethno-Medicine, 6(1), 17-22.

Azmah, M. N. (1989). Nilai Tumbuhan Ubatan di Kalangan Orang Jawa Khusus di


Kampung Sepintas, Sabak Bernam, Selangor. Tesis SmSn. Jabatan Botani,
Universiti Kebangsaan Malaysia, Bangi.

Balandrin, M. F., Klocke, J. A., Wurtele, E. S., & Bollinger, W. H. (1985). Natural plant
chemicals: sources of industrial and medicinal materials. Science, 228(4704),
1154-1160.

Balasubramanian, D., Schneper, L., Kumari, H., & Mathee, K. (2013). A dynamic and
intricate regulatory network determines Pseudomonas aeruginosa virulence.
Nucleic Acids Research, 41(1), 1-20. doi: 10.1093/nar/gks1039

Balls, A. K., Hale, W. S., & Harris, T. H. (1942). A crystalline protein obtained from a
lipoprotein of wheat flour. Cereal Chemistry Journal, 19, 279-288.

Bandyopadhyay, U., Biswas, K., Sengupta, A., Moitra, P., Dutta, P., Sarkar, D.,
Debnath, P., Ganguly, C. K., & Banerjee, R. K. (2004). Clinical studies on the
effect of Neem (Azadirachta indica) bark extract on gastric secretion and
gastroduodenal ulcer. Life Sciences, 75(24), 2867-2878.

169
References

Baris, O., Gulluce, M., Sahin, F., Ozer, H., Kilic, H., Ozkan, H., Sokmen, M., & Ozbek,
T. (2006). Biological activities of the essential oil and methanol extract of
Achillea biebersteinii Afan. (Asteraceae). Turkish Journal of Biology, 30, 65-73.

Barros, L., Ferreira, M., Queirs, B., Ferreira, I. C. F. R., & Baptista, P. (2007). Total
phenols, ascorbic acid, -carotene and lycopene in Portuguese wild edible
mushrooms and their antioxidant activities. Food Chemistry, 103(2), 413-419.
doi: http://dx.doi.org/10.1016/j.foodchem.2006.07.038

Bartolom, B., Bengoechea, M. L., Glvez, M. C., Prez-Ilzarbe, F. J., Hernndez, T.,
Estrella, I., & Gmez-Cordovs, C. (1993). Photodiode array detection for
elucidation of the structure of phenolic compounds. Journal of Chromatography
A, 655(1), 119-125.

Baselt, R. C., & Cravey, R. H. (1995). Disposition of Toxic Drugs and Chemicals in
Man (4 ed.). Chemical Toxicology Institute, Foster City, CA, USA: Biomedical
Publications.

Baskaran, C., Velu, S., & Kumaran, K. (2012). The efficacy of Carica papaya leaf
extract on some bacterial and a fungal strain by well diffusion method. Asian
Pacific Journal of Tropical Disease, 2, 658-662.

Basri, D. F., & Fan, S. H. (2005). The potential of aqueous and acetone extracts of galls
of Quercus infectoria as antibacterial agents. Indian Journal of Pharmacology,
37(1), 26.

Batista, O., Duarte, A., Nascimento, J., Simoes, M. F., de la Torre, M. C., & Rodriguez,
B. (1994). Structure and antimicrobial activity of diterpenes from the roots of
Plectranthus hereroensis. Journal of Natural Products, 57(6), 858-861.

Bednarek, P., & Osbourn, A. (2009). Plant-microbe interactions: chemical diversity in


plant defense. Science, 324(5928), 746-748. doi: 10.1126/science.1171661

Bennett, R. N, & Wallsgrove, R. M. (1994). Tansley Review No. 72. Secondary


metabolites in plant defence mechanisms. New Phytologist, 617-633.

Benzie, I. F. F., & Strain, J. J. (1996). The ferric reducing ability of plasma (FRAP) as a
measure of antioxidant power: the FRAP assay. Analytical Biochemistry,
239(1), 70-76.

Benzie, I. F. F., & Szeto, Y. T. (1999). Total antioxidant capacity of teas by the ferric
reducing/antioxidant power assay. Journal of Agricultural and Food Chemistry,
47(2), 633-636.

170
References

Berendsen, B., Pikkemaat, M., R mkens, P., Wegh, R., van Sisseren, M., Stolker, L., &
Nielen, M. (2013). Occurrence of Chloramphenicol in Crops through Natural
Production by Bacteria in Soil. Journal of Agricultural and Food Chemistry,
61(17), 4004-4010.

Berendsen, B., Stolker, L., de Jong, J., Nielen, M., Tserendorj, E., Sodnomdarjaa, R.,
Cannavan, A., & Elliott, C. (2010). Evidence of natural occurrence of the
banned antibiotic chloramphenicol in herbs and grass. Analytical and
Bioanalytical Chemistry, 397(5), 1955-1963.

Berkarda, B. (1993). Preliminary report: Warfarin for treatment of Herpes simplex.


Journal-Irish Colleges of Physician and Surgeons, 22, 56-58.

Bhatia, L. , Bishnoi, H. , Chauhan, P. , Kinja, K. , & Shailesh, S. (2011). In-vitro


Comparative Antioxidant Activity of Ethanolic Extracts of Glycosmis
pentaphylla and Bauhinia variegata.

Bhattacharjee, S. K. (2000). Handbook of medicinal plants (pp. 504). Jaipur, India:


Aavishkar Publishers.

Bisignano, G., Germano, M. P., Nostro, A., & Sanogo, R. (1996). Drugs used in Africa
as dyes: II. Antimicrobial activities. Phytotheraphy Research, 10, 161-163.

Biswas, K., Chattopadhyay, I., Banerjee, R. K., & Bandyopadhyay, U. (2002).


Biological activities and medicinal properties of neem (Azadirachta indica).
Current Science, 82(11), 1336-1345.

Bodey, G. P., Bolivar, R., Fainstein, V., & Jadeja, L. (1983). Infections Caused by
Pseudomonas aeruginosa. Reviews of Infectious Diseases, 5(2), 279-313. doi:
10.2307/4453009

Bonfill, M., Mangas, S., Cusid, R. M., Osuna, L., Piol, M. T., & Palazn, J. (2006).
Identification of triterpenoid compounds of Centella asiatica by thinlayer
chromatography and mass spectrometry. Biomedical Chromatography, 20(2),
151-153.

Borris, R. P. (1996). Natural products research: perspectives from a major


pharmaceutical company. Journal of Ethnopharmacology, 51(1-3), 29-38.

Bors, W., & Michel, C. (2002). Chemistry of the antioxidant effect of polyphenols.
Annals of the New York Academy of Sciences 957, 57-69.

Bottone, E. J. (2010). Bacillus cereus, a volatile human pathogen. Clinical


Microbiology Reviews, 23(2), 382-398. doi: 10.1128/CMR.00073-09
171
References

Boudreau, M. D., & Beland, F. A. (2006). An evaluation of the biological and


toxicological properties of Aloe barbadensis (miller), Aloe vera. Journal of
Environmental Science and Health. Part C, Environmental Carcinogenesis &
Ecotoxicology Reviews, 24(1), 103-154. doi: 10.1080/10590500600614303

Brownlee, H. E., McEuen, A. R., Hedger, J., & Scott, I. M. (1990). Anti-fungal effects
of cocoa tannin on the witches' broom pathogen Crinipellis perniciosa.
Physiological and Molecular Plant Pathology, 36(1), 39-48.

Bukowska, B., & Kowalska, S. (2004). Phenol and catechol induce prehemolytic and
hemolytic changes in human erythrocytes. Toxicology Letters, 152(1), 73-84.

Burkill, I. H. (1966). A dictionary of the economic products of the Malay Peninsula


(Vol. 2). London: Published on behalf of the governments of the Straits
settlements and Federated Malay states by the Crown agents for the colonies,
1935.

Busani, M., Julius, M. P. , & Voster, M. (2012). Antimicrobial activities of Moringa


oleifera Lam leaf extracts. African Journal of Biotechnology, 11(11), 2797-
2802. doi: 10.5897/ajb10.686

Cai, Y., Luo, Q., Sun, M., & Corke, H. (2004). Antioxidant activity and phenolic
compounds of 112 traditional Chinese medicinal plants associated with
anticancer. Life sciences, 74(17), 2157-2184.

Calir, A., Mavi, A., Kazaz, C., Yildirim, A., & Kufrevioglu, O. I. (2009). Antioxidant
activities of the extracts and components of Teucrium orientale L. var. orientale.
Turkish Journal of Chemistry, 30(4), 483-494.

Cao, G., Sofic, E., & Prior, R. L. (1997). Antioxidant and prooxidant behavior of
flavonoids: structure-activity relationships. Free Radical Biology & Medicine
22(5), 749-760.

Carlsson, J. (1968). A numerical taxonomic study of human oral streptococci. Odontol


Revy, 19(2), 137-160.

Cerutti, P. A. (1991). Oxidant stress and carcinogenesis. European Journal of Clinical


Investigation, 21(1), 1-5.

etkovi, G. S., anadanovi-Brunet, J. M., Djilas, S. M., Tumbas, V. T., Markov, S.


L., & Cvetkovi, D. D. (2007). Antioxidant potential, lipid peroxidation
inhibition and antimicrobial activities of Satureja montana L. subsp. kitaibelii
extracts. International Journal of Molecular Sciences, 8(10), 1013-1027.

172
References

Chambers, H. F., & DeLeo, F. R. (2009). Waves of resistance: Staphylococcus aureus


in the antibiotic era. Nature Reviews Microbiology, 7(9), 629-641.

Charrouf, Z., Hilali, M., Jauregui, O., Soufiaoui, M., & Guillaume, D. (2007).
Separation and characterization of phenolic compounds in argan fruit pulp using
liquid chromatographynegative electrospray ionization tandem mass
spectroscopy. Food Chemistry, 100(4), 1398-1401.

Chaurasia, S. C., & Vyas, K. K. (1977). In vitro effect of some volatile oil against
Phytophthora parasitica var. piperina. Journal of Research and Education in
Indian Medicine, 24-26.

Chen, S., Yao, H., Han, J., Liu, C., Song, J., Shi, L., Zhu, Y., Ma, X., Gao, T., Pang, X.,
Luo, K., Li, Y., Li, X., Jia, X., Lin, Y., & Leon, C. (2010). Validation of the
ITS2 region as a novel DNA barcode for identifying medicinal plant species.
PLoS One, 5(1), 8613. doi: 10.1371/journal.pone.0008613

Chong, J., Baltz, R., Schmitt, C., Beffa, R., Fritig, B., & Saindrenan, P. (2002).
Downregulation of a pathogen-responsive tobacco UDP-Glc:phenylpropanoid
glucosyltransferase reduces scopoletin glucoside accumulation, enhances
oxidative stress, and weakens virus resistance. Plant Cell, 14(5), 1093-1107.

Chopra, I. C., Gupta, K. C., & Nazir, B. N. (1952). Preliminary study of anti-bacterial
substances from Melia azidirachta. Indian Journal of Medical Research, 40(4),
511-515.

Chow, T. N. J., Williamson, D. A., Yates, K. M., & Goux, W. J. (2005). Chemical
characterization of the immunomodulating polysaccharide of Aloe vera L.
Carbohydrate research, 340(6), 1131-1142.

Chuakul, W., Soonthornchareonnon, N., & Saralamp, P. (1999). Plant Resources of


South-East Asia (Vol. 1). Bogor, Indonesia: Prosea Foundation.

Cichewicz, R. H., & Thorpe, P. A. (1996). The antimicrobial properties of chile peppers
(Capsicum species) and their uses in Mayan medicine. Journal of
Ethnopharmacology, 52(2), 61-70.

Ciocan, I. D., & Bara, I. I. (2007). Plant products as antimicrobial agents. Annals of the
"Alexandru Ioan Cuza" University Sect. II a. Genetics and Molecular Biology,
8(1).

Clarke, J. K. (1924). On the bacterial factor in the aetiology of dental caries. British
Journal of Experimental Pathology, 5(3), 141-146.

173
References

Clinical and Laboratory Standards Institute. (2007). Performance Standards for


Antimicrobial Susceptibility Testing: Seventeenth Informational Supplement.
M100-S17. Clinical and Laboratory Standards Institute, 940 West Valley Road,
Suite 1400, Pennyslvania, USA. Wayne, P. A.

Cohen, M. L. (1992). Epidemiology of drug resistance: implications for a post


antimicrobial era. Science, 257(5073), 1050-1055.

Coley, P. D., & Barone, J. A. (1996). Herbivory and plant defenses in tropical forests.
Annual Review of Ecology and Systematics, 27, 305-335. doi: DOI
10.1146/annurev.ecolsys.27.1.305

Conlon, J. M., Sonnevend, A., Patel, M., Davidson, C., Nielsen, P. F., Pal, T., &
Rollins-Smith, L. A. (2003). Isolation of peptides of the brevinin-1 family with
potent candidacidal activity from the skin secretions of the frog Rana boylii.
Journal of Peptide Research, 62(5), 207-213.

Cordell, G. A., & Araujo, O. E. (1993). Capsaicin: identification, nomenclature, and


pharmacotherapy. Annals of Pharmacotherapy, 27(3), 330-336.

Cos, P., Maes, L., Vanden Berghe, D., Hermans, N., Pieters, L., & Vlietinck, A. (2004).
Plant substances as anti-HIV agents selected according to their putative
mechanism of action. Journal of Natural Products, 67(2), 284-293. doi: Doi
10.1021/Np034016p

Cowan, M. M. (1999). Plant products as antimicrobial agents. Clinical Microbiology


Reviews, 12(4), 564-582.

Coykendall, A. L. (1989). Classification and identification of the viridans streptococci.


Clinical Microbiology Reviews, 2(3), 315-328.

Coykendall, A. L., Bratthall, D., O'Connor, K., & Dvarskas, R. A. (1976). Serological
and genetic examination of some nontypical Streptococcus mutans strains.
Infection and Immunity, 14(3), 667-670.

Craig, W. A. (1998). Pharmacokinetic/pharmacodynamic parameters: rationale for


antibacterial dosing of mice and men. Clinical Infectious Diseases, 26(1), 1-10.

Croteau, R., Kutchan, T. M., & Lewis, N. G. (2000). Natural products (secondary
metabolites). In Buchanan, B. B., Gruissem, W. & Jones, R. L. (Eds.),
Biochemistry and Molecular Biology of Plants (Vol. 40, pp. 1250-1318).
Rockville: American Society of Plant Physiologists.

174
References

Currens, M. J., Gulakowski, R. J., Mariner, J. M., Moran, R. A., Buckheit, R. W.,
Gustafson, K. R., McMahon, J. B., & Boyd, M. R. (1996). Antiviral activity and
mechanism of action of calanolide A against the human immunodeficiency virus
type-1. Journal of Pharmacology and Experimental Therapeutics, 279(2), 645-
651.

Daniel, M. (2006). Medicinal plants: chemistry and properties: Science Publishers.

Das, K., Tiwari, R. K. S., & Shrivastava, D. K. (2010). Techniques for evaluation of
medicinal plant products as antimicrobial agent: Current methods and future
trends. Journal of Medicinal Plants Research, 4(2), 104-111.

Dash, B. K., Faruquee, H. M., Biswas, S. K., Alam, M. K., Sisir, S. M., & Prodhan, U.
K. (2011). Antibacterial and Antifungal Activities of Several Extracts of
Centella asiatica L. against Some Human Pathogenic Microbes. Life Sciences
and Medicine Research 1-5.

Daum, R. S., & Spellberg, B. (2012). Progress toward a Staphylococcus aureus vaccine.
Clinical Infectious Diseases, 54(4), 560-567. doi: 10.1093/cid/cir828

Davenport, R., & Smith, C. (1952). Panophthalmitis due to an organism of the Bacillus
subtilis group. British Journal of Ophthalmology 36(7), 389-392.

Davidson, P. M. (2001). Chemical peservatives and natural antimicrobial compounds.


In Doyle, M. P. & Beuchat, L. R. (Eds.), Food Microbiology: Fundamentals and
Frontiers (2 ed., pp. 593). Washington, USA: ASM Press.

Davies, J. (1994). Inactivation of antibiotics and the dissemination of resistance genes.


Science, 264(5157), 375-382.

De Caleya, R. F., Gonzalez-Pascual, B., Garca-Olmedo, F., & Carbonero, P. (1972).


Susceptibility of phytopathogenic bacteria to wheat purothionins in vitro.
Applied Microbiology, 23(5), 998-1000.

De Clercq, E. (2000). Current lead natural products for the chemotherapy of human
immunodeficiency virus (HIV) infection. Medical Research Reviews, 20(5),
323-349.

de Padua, L. S., Bunyapraphatsara, N., & Lemmens, R. H. M. J. (1999). Plant


Resources of South-East Asia (Vol. 1). Bogor, Indonesia: Prosea Foundation.

de Paiva, S. R., Lima, L. A., Figueiredo, M. R., & Kaplan, M. A. C. (2004). Plumbagin
quantification in roots of Plumbago scandens L. obtained by different extraction
techniques. Anais da Academia Brasileira de Cincias, 76(3), 499-504.
175
References

Dent, V. E., Hardie, J. M., & Bowden, G. H. (1978). Streptococci isolated from dental
plaque of animals. Journal of Applied Bacteriology, 44(2), 249-258.

Dhar, R., Zhang, K., Talwar, G. P., Garg, S., & Kumar, N. (1998). Inhibition of the
growth and development of asexual and sexual stages of drug-sensitive and
resistant strains of the human malaria parasite Plasmodium falciparum by Neem
(Azadirachta indica) fractions. Journal of Ethnopharmacology, 61(1), 31-39.

Dilika, F., Afolayan, A. J., & Meyer, J. J. M. (1997). Comparative antibacterial activity
of two Helichrysum species used in male circumcision in South Africa. South
African Journal of Botany, 63(3), 158-159.

Dixon, R. A. (2001). Natural products and plant disease resistance. Nature, 411(6839),
843-847.

Dixon, R. A., Dey, P. M., & Lamb, C. J. (1983). Phytoalexins: enzymology and
molecular biology. Advances in Enzymology and Related Areas of Molecular
Biology, 55, 1-136.

Douglas, B., & Kiang, A. K. (1957). A Phytochemical Survey of the Flora of Malaya. I.
Alkaloids. Malayan Pharmaceutical Journal, 6, 1-16.

Drobniewski, F. A. (1993). Bacillus cereus and related species. Clinical Microbiology


Reviews, 6(4), 324-338.

Druilhe, P., Brandicourt, O., Chongsuphajaisiddhi, T., & Berthe, J. (1988). Activity of a
combination of three cinchona bark alkaloids against Plasmodium falciparum in
vitro. Antimicrobial Agents and Chemotherapy, 32(2), 250-254.

Duke, J. A. (1985). Handbook of medicinal plants. Florida, US: CRC Press Inc.

Duke, J. A. (2010). Handbook of medicinal herbs. Florida, USA: CRC press.

EhlingSchulz, M., Fricker, M., & Scherer, S. . (2004). Bacillus cereus, the causative
agent of an emetic type of foodborne illness. Molecular Nutrition and Food
Research, 48(7), 479-487.

Ekpenyong, M. E., Ukpo, G. E., Odukoya, A., & Coker, H. A. B. (1999).


Antihyperglycemic effect of the leaves of Vernonia amydalina del. on blood
glucose level of normal and diabetic rabbits. Journal of Pharmacy and
Pharmaceutical Sciences, 5(2), 51-54.

176
References

El-Hawary, Z. M., & Kholief, T. S. (1990). Biochemical studies on hypoglycemic


agents (I) effect of Azadirachta indica leaf extract. Archives of Pharmacal
Research, 13(1), 108-112.

Elliott, S., & Brimacombe, J. (1986). Pharmacy needs tropical forests. Manufacturing
Chemist, 57, 31-34.

Eloff, J. N. (1998). Which extractant should be used for the screening and isolation of
antimicrobial components from plants? Journal of Ethnopharmacology, 60(1),
1-8. doi: http://dx.doi.org/10.1016/S0378-8741(97)00123-2

Eloff, J. N. (1999). It is possible to use herbarium specimens to screen for antibacterial


components in some plants. Journal of Ethnopharmacology, 67(3), 355-360.

Eloff, J. N., & McGaw, L. J. (2006). Plant Extracts Used to Manage Bacterial, Fungal,
and Parasitic Infections in South Africa. In Ahmad, I., Aqil, F. & Owais, M.
(Eds.), Modern phytomedicine: Turning medicinal plants into drugs. (pp. 100-
101). Weinham.: WILEY-VCH Verlag Gmbh & Co.

Erasto, P., Grierson, D. S., & Afolayan, A. J. (2006). Bioactive sesquiterpene lactones
from the leaves of Vernonia amygdalina. Journal of Ethnopharmacology,
106(1), 117-120.

Erasto, P., Grierson, D. S., & Afolayan, A. J. (2007). Evaluation of antioxidant activity
and the fatty acid profile of the leaves of Vernonia amygdalina growing in South
Africa. Food Chemistry, 104(2), 636-642.

Erb, A., Sturmer, T., Marre, R., & Brenner, H. (2007). Prevalence of antibiotic
resistance in Escherichia coli: overview of geographical, temporal, and
methodological variations. European Journal of Clinical Microbiology &
Infectious Diseases, 26(2), 83-90. doi: 10.1007/s10096-006-0248-2

Escherich, T. (1885). Die Darmbacterien des Neugeborenen und Suglings. Medicines


from the Earth. McGraw-Hill Book Co., New York, NY, 3, 515-522.

Eshun, K., & He, Q. (2004). Aloe vera: a valuable ingredient for the food,
pharmaceutical and cosmetic industries - a review. Critical Reviews in Food
Science and Nutrition 44(2), 91-96. doi: 10.1080/10408690490424694

Evans, P. H. (1993). Free radicals in brain metabolism and pathology. British Medical
Bulletin, 49(3), 577-587.

177
References

Farombi, E. O., & Owoeye, O. (2011). Antioxidative and Chemopreventive Properties


of Vernonia amygdalina and Garcinia biflavonoid. International Journal of
Environmental Research and Public Health, 8(6), 2533-2555.

Fasakin, C. F., Udenigwe, C. C., & Aluko, R. E. (2011). Antioxidant properties of


chlorophyll-enriched and chlorophyll-depleted polyphenolic fractions from
leaves of Vernonia amygdalina and Gongronema latifolium. Food Research
International, 44(8), 2435-2441.

Feng, J., Yuan, F., Gao, Y., Liang, C., Xu, J., Zhang, C., & He, L. (2003). A novel
antimicrobial protein isolated from potato (Solanum tuberosum) shares
homology with an acid phosphatase. Biochemical Journal, 376(2), 481-487. doi:
10.1042/BJ20030806

Ferretti, J. J., & Ward, M. (1976). Susceptibility of Streptococcus mutans to


antimicrobial agents. Antimicrobial Agents and Chemotherapy, 10(2), 274-276.

Ferro, V. A., Bradbury, F., Cameron, P., Shakir, E., Rahman, S. R., & Stimson, W. H.
(2003). In vitro susceptibilities of Shigella flexneri and Streptococcus pyogenes
to inner gel of Aloe barbadensis Miller. Antimicrobial Agents and
Chemotherapy, 47(3), 1137-1139.

Fessenden, R. J., & Fessenden, J. S. (1982). Organic Chemistry (2nd ed.). Boston: MA:
Willard Grant Press.

Fleming, A. (1929). On the antibacterial action of cultures of a penicillium, with special


reference to their use in the isolation of B. influenzae. British Journal of
Experimental Pathology, 10(3), 226.

Foster, T. (1996). Staphylococcus. In Baron, S. (Ed.), Medical Microbiology 4th


edition. University of Texas Medical Branch at Galveston. Retrieved from
http://www.ncbi.nlm.nih.gov/books/NBK8448/.

Gandhi, V. M., & Cherian, K. M. (2000). Red cell haemolysis test as an in vitro
approach for the assessment of toxicity of karanja oil. Toxicology In Vitro,
14(6), 513-516.

Gaur, A. H., Patrick, C. C., McCullers, J. A., Flynn, P. M., Pearson, T. A., Razzouk, B.
I., Thompson, S. J., & Shenep, J. L. (2001). Bacillus cereus bacteremia and
meningitis in immunocompromised children. Clinical Infectious Diseases,
32(10), 1456-1462.

Geissman, T. A. (1963). Flavonoid compounds, tannins, lignins and related compounds.


. In Florkin M, S. E. (Ed.), Pyrrole Pigments, Isoprenoid Compounds and
Phenolic Plant Constituents. (Vol. 9, pp. 2653). New York: Elsevier.
178
References

Gerber, M., Boutron-Ruault, M. C., Hercberg, S., Riboli, E., Scalbert, A., & Siess, M.
H. (2002). Food and cancer: state of the art about the protective effect of fruits
and vegetables. Bulletin du Cancer, 89(3), 293-312.

Ghafoor, A. O., Qadir, H. K., & Fakhri, N. A. (2012). Analysis of Phenolic Compounds
in Extracts of Ziziphus spina-christi using RP-HPLC method. Journal of
Chemical and Pharmaceutical Research, 4(6), 3158-3163.

Ghosh, A. C. (1978). Prevalence of Bacillus cereus in the faeces of healthy adults.


Journal of Hygeine, 80, 233-236.

Ghosh, A., Das, B. K., Roy, A., Mandal, B., & Chandra, G. (2008). Antibacterial
activity of some medicinal plant extracts. Journal of Natural Medicines, 62(2),
259-262. doi: 10.1007/s11418-007-0216-x

Ghoshal, S., Prasad, B. N., & Lakshmi, V. (1996). Antiamoebic activity of Piper
longum fruits against Entamoeba histolytica in vitro and in vivo. Journal of
Ethnopharmacology, 50(3), 167-170.

Gilgun-Sherki, Y., Rosenbaum, Z., Melamed, E., & Offen, D. (2002). Antioxidant
therapy in acute central nervous system injury: current state. Pharmacological
Reviews, 54(2), 271-284.

Gowniak, K., Zgrka, G., & Kozyra, M. (1996). Solid-phase extraction and reversed-
phase high-performance liquid chromatography of free phenolic acids in some
Echinacea species. Journal of Chromatography A, 730(1), 25-29.

Goldberg, M. B., & Theriot, J. A. (1995). Shigella flexneri surface protein IcsA is
sufficient to direct actin-based motility. Proceedings of the National Academy of
Sciences USA, 92(14), 6572-6576.

Goldman, L., & Fox, H. (1944). Greenish pigmentation of nail plates from Bacillus
pyocyaneus infection: Report of two cases. Archives of Dermatology, 49(2),
136-137.

Gonzlez-Lamothe, R., Mitchell, G., Gattuso, M., Diarra, M., Malouin, F., & Bouarab,
K. (2009). Plant Antimicrobial Agents and Their Effects on Plant and Human
Pathogens. International Journal of Molecular Sciences, 10(8), 3400-3419.

Gosch, C., Halbwirth, H., Kuhn, J. H., Miosic, S., & Stich, K. (2009). Biosynthesis of
phloridzin in apple (Malus domestica Borkh.). Plant Science, 176(2), 223-231.
doi: http://dx.doi.org/10.1016/j.plantsci.2008.10.011

179
References

Gosch, C., Halbwirth, H., & Stich, K. (2010). Phloridzin: Biosynthesis, distribution and
physiological relevance in plants. Phytochemistry, 71(89), 838-843. doi:
http://dx.doi.org/10.1016/j.phytochem.2010.03.003

Gottlieb, O. R. (1990). Phytochemicals: differentiation and function. Phytochemistry,


29(6), 1715-1724.

Grayer, R. J., & Kokubun, T. (2001). Plant--fungal interactions: the search for
phytoalexins and other antifungal compounds from higher plants.
Phytochemistry, 56(3), 253-263.

Green, R. J. (2004). Antioxidant activity of peanut plant tissues. (Degree of Master of


Science), North Carolina State University, Raleigh.

Gresham, L. J., Ross, J., & Izevbigie, E. B. (2008). Vernonia amygdalina: anticancer
activity, authentication, and adulteration detection. International Journal of
Environmental Research and Public Health, 5(5), 342-348.

Grover, A., Bhandari, B. S., & Rai, N. (2011). Antimicrobial activity of medicinal
plants-Azadirachta indica A. Juss, Allium cepa L. and Aloe vera L. International
Journal of PharmTech Research, 3, 1059-1065.

Grundmann, H., Aires-de-Sousa, M., Boyce, J., & Tiemersma, E. (2006). Emergence
and resurgence of meticillin-resistant Staphylococcus aureus as a public-health
threat. Lancet, 368(9538), 874-885. doi: 10.1016/S0140-6736(06)68853-3

Guggenheim, B. (1968). Streptococci of dental plaques. Caries Research, 2(2), 147-


163.

Gulcin, I., Koksal, K., Elmastas, M., & Aboul-Enein, H. Y. (2007). Determination of in
vitro antioxidant and radical scavenging activity of Verbascum oreophilum C.
Koch Var Joannis (Fam. Scrophulariaceae). Research Journal of Biological
Sciences 2(3), 372-382.

Guleria, S., Tiku, A. K., Singh, G., Koul, A., Gupta, S., & Rana, S. (2013). In vitro
antioxidant activity and phenolic contents in methanol extracts from medicinal
plants. Journal of Plant Biochemistry and Biotechnology, 22(1), 9-15.

Gurib-Fakim, A. (2006). Medicinal plants: traditions of yesterday and drugs of


tomorrow. Molecular Aspects of Medicine, 27(1), 1-93. doi:
10.1016/j.mam.2005.07.008

180
References

Gurjar, M. S., Ali, S. , Akhtar, M., & Singh, S. (2012). Efficacy of plant extracts in
plant disease management. Agricultural Sciences, 3(3), 425-433. doi:
10.4236/as.2012.33050

Habeeb, F., Shakir, E., Bradbury, F., Cameron, P., Taravati, M. R., Drummond, A. J.,
Gray, A. I., & Ferro, V. A. (2007). Screening methods used to determine the
anti-microbial properties of Aloe vera inner gel. Methods, 42(4), 315-320. doi:
10.1016/j.ymeth.2007.03.004

Habtemariam, S., Gray, A. I., & Waterman, P. G. (1993). A new antibacterial


sesquiterpene from Premna oligotricha. Journal of Natural Products, 56(1),
140-143.

Haley, R. W., Culver, D. H., White, J. W., Morgan, W. M., Emori, T. G., Munn, V. P.,
& Hooton, T. M. (1985). The efficacy of infection surveillance and control
programs in preventing nosocomial infections in US hospitals. American
Journal of Epidemiology, 121(2), 182-205.

Hamada, S., & Slade, H. D. (1980). Biology, immunology, and cariogenicity of


Streptococcus mutans. Microbiological Reviews, 44(2), 331-384.

Hamburger, M., & Hostettmann, K. (1991). Bioactivity in plants: the link between
phytochemistry and medicine. Phytochemistry, 30(12), 3864-3874. doi:
http://dx.doi.org/10.1016/0031-9422(91)83425-K

Hamid, A., Shah, Z., Muse, R., & Mohamed, S. (2002). Characterisation of
antioxidative activities of various extracts of Centella asiatica (L) Urban. Food
chemistry, 77(4), 465-469.

Hammer, K. A., Carson, C. F., & Riley, T. V. (1999). Antimicrobial activity of essential
oils and other plant extracts. Journal of Applied Microbiology 86(6), 985-990.

Hancock, R. E. (1997a). Peptide antibiotics. Lancet, 349(9049), 418-422. doi:


10.1016/S0140-6736(97)80051-7

Hancock, R. E. W. (1997b). The bacterial outer membrane as a drug barrier. Trends in


Microbiology, 5(1), 37-42. doi: Doi 10.1016/S0966-842x(97)81773-8

Handa, S. S. (2008). An overview of extraction techniques for medicinal and aromatic


plants. In Handa, S. S., Khanuja, S. P. S., Longo, G. & Rakesh, D. D. (Eds.),
Extraction Technologies for Medicinal and Aromatic Plants (pp. 21). Trieste,
Italy: International Centre for Science and High Technology.

181
References

Harborne, J. B. (1998). Phytochemical methods A Guide to modern techniques of plant


analysis. London: Chapman and Hall.

Hargono, D., Lastari, P., Astuti, Y., & van den Bergh, M. H. (1999). Plant Resources of
South-East Asia (Vol. 1). Bogor, Indonesia: Prosea Foundation.

Harrigan, G. G., Ahmad, A., Baj, N., Glass, T. E., Gunatilaka, A. A., & Kingston, D. G.
(1993). Bioactive and other sesquiterpenoids from Porella cordeana. Journal of
Natural Products, 56(6), 921-925.

Harshey, R. M. (1994). Bees aren't the only ones: swarming in gram-negative bacteria.
Molecular Microbiology, 13(3), 389-394.

Hartwell, J. L. (1969). Plants used against cancer. A survey. Lloydia, 32(1), 78-107.

Hashim, P., Sidek, H., Helan, M. H. M., Sabery, A., Palanisamy, U. D., & Ilham, M.
(2011). Triterpene composition and bioactivities of Centella asiatica. Molecules,
16(2), 1310-1322.

Haslam, E. (1996). Natural polyphenols (vegetable tannins) as drugs: possible modes of


action. Journal of Natural Products, 59(2), 205-215. doi: 10.1021/np960040+

Hemaiswarya, S., Kruthiventi, A. K., & Doble, M. (2008). Synergism between natural
products and antibiotics against infectious diseases. Phytomedicine, 15(8), 639-
652. doi: http://dx.doi.org/10.1016/j.phymed.2008.06.008

Hensley, K., Mou, S., Pye, Q. N., Dixon, R. A., Summner, L. W., & Floyd, R. A.
(2004). Chemical versus pharmacological actions of nutraceutical
phytochemicals: antioxidant and anti inflammatory modalities. Current Topics
in Nutraceutical Research, 2(1), 13-26.

Hertog, M. G. L., Hollman, P. C. H., & Venema, D. P. (1992). Optimization of a


quantitative HPLC determination of potentially anticarcinogenic flavonoids in
vegetables and fruits. Journal of Agricultural and Food Chemistry, 40(9), 1591-
1598.

Hopkinson, S. M. (1969). The chemistry and biochemistry of phenolic glycosides.


Quarterly Reviews, Chemical Society, 23(1), 98-124.

Huang, D., Ou, B., & Prior, R. L. (2005). The chemistry behind antioxidant capacity
assays. Journal of Agricultural and Food Chemistry 53(6), 1841-1856. doi:
10.1021/jf030723c

182
References

Huffman, M. A., & Seifu, M. (1989). Observations on the illness and consumption of a
possibly medicinal plant Vernonia amygdalina (Del.), by a wild chimpanzee in
the Mahale Mountains National Park, Tanzania. Primates, 30(1), 51-63.

Hughes, I. . (2002). Isoprenoid compounds and phenolic plant constituents. Elsevier,


New York, N.Y. Sci. Afr. Mag, 9(56).

Humpf, H. U., & Schreier, P. (1991). Bound aroma compounds from the fruit and the
leaves of blackberry (Rubus laciniata L.). Journal of Agricultural and Food
Chemistry, 39(10), 1830-1832.

Huynh, Q. K., Borgmeyer, J. R., Smith, C. E., Bell, L. D., & Shah, D. M. (1996).
Isolation and characterization of a 30 kDa protein with antifungal activity from
leaves of Engelmannia pinnatifida. Biochemical Journal, 316 (3), 723-727.

Igile, G. O., Oleszek, W., Jurzysta, M., Burda, S., Fafunso, M. A., & Fasanmade, A. A.
(1994). Flavonoids from Vernonia amygdalina and their antioxidant activities.
Journal of Agricultural and Food Chemistry, 42(11), 2445-2448.

Iinuma, M., Tsuchiya, H., Sato, M., Yokoyama, J., Ohyama, M., Ohkawa, Y., Tanaka,
T., Fujiwara, S., & Fujii, T. (1994). Flavanones with Potent Antibacterial
Activity against Methicillinresistant Staphylococcus aureus. Journal of
Pharmacy and Pharmacology, 46(11), 892-895.

Ijeh, I. I., & Ejike, C. E. C. C. (2011). Current perspective on the medicinal potential of
Vernonia amygdalina Del. Journal of Medicinal Plants Research, 5, 1051-1061.

Ijeh, I., Nwugo, V. O., & Obidoa, O. (1996). Comparative studies on the nutritive
phytochemical and antimicrobial properties of two varieties of Vernomia
amygdalina. Plant Processing Research Community, 1, 71-75.

Ikeda, T., Otake, S., Hirasawa, M., Williams, K., Kiyoyono, H., McGhee, J. R., &
Shiota, T. (1980). Virulence of Streptococcus mutans: revertants of mutant C4.
Infection and Immunity, 27(1), 25-31.

Inamdar, P. K., Yeole, R. D., Ghogare, A. B., & De Souza, N. J. (1996). Determination
of biologically active constituents in Centella asiatica. Journal of
Chromatography A, 742(1), 127-130.

Iwalokun, B. A., Efedede, B. U., Alabi-Sofunde, J. A., Oduala, T., Magbagbeola, O. A.,
& Akinwande, A. I. (2006). Hepatoprotective and antioxidant activities of
Vernonia amygdalina on acetaminophen-induced hepatic damage in mice.
Journal of Medicinal Food, 9(4), 524-530.

183
References

Iwu, M. W., Duncan, A. R., & Okunji, C. O. (1999). New antimicrobials of plant origin.
Perspectives on New Crops and New Uses, 457-462.

Jackson, G. G. . (1994). Infective endocarditis caused by Pseudomonas aeruginosa. In


Baltch, A. L. & Smith, R. P. (Eds.), Pseudomonas aeruginosa infections and
treatment (pp. 129158). New York: Marcel Dekker, Inc.

Jahan, N. (2011). Correlation Of Polyphenolic Contents Of Indigenous Medicinal


Plants With Their Bioactivities. University of Agriculture.

Jain, S. K. (1994). Ethnobotany and research in medicinal plants in India Ethnobotany


Search New Drugs (Vol. 185, pp. 153-168).

Jaki, B. U., Franzblau, S. G., Chadwick, L. R., Lankin, D. C., Zhang, F., Wang, Y., &
Pauli, G. F. (2008). Purity-activity relationships of natural products: the case of
anti-TB active ursolic acid. Journal of Natural Products, 71(10), 1742-1748.
doi: 10.1021/np800329j

James, J. T., & Dubery, I. A. (2009). Pentacyclic triterpenoids from the medicinal herb,
Centella asiatica (L.) Urban. Molecules, 14(10), 3922-3941.

Jamil, A., Shahid, M., Khan, M. M., & Ashraf, M. (2007). Screening of some medicinal
plants for isolation of antifungal proteins and peptides. Pakistan Journal of
Botany, 39(1), 211-221.

Jantan, I. (2004). Medicinal plant research in Malaysia: scientific interests and


advances. Jurnal Sains Kesihatan Malaysia, 2(2), 27-46.

Jarraud, S., Mougel, C., Thioulouse, J., Lina, G., Meugnier, H., Forey, F., Nesme, X.,
Etienne, J., & Vandenesch, F. (2002). Relationships between Staphylococcus
aureus genetic background, virulence factors, agr groups (alleles), and human
disease. Infection and Immunity, 70(2), 631-641.

Jassim, S. A., & Naji, M. A. (2003). Novel antiviral agents: a medicinal plant
perspective. Journal of Applied Microbiology, 95(3), 412-427.

Jensen, G. B., Hansen, B. M., Eilenberg, J., & Mahillon, J. (2003). The hidden lifestyles
of Bacillus cereus and relatives. Environmental Microbiology, 5(8), 631-640.

Jin, Z., & Xu, X. (2013). Amaryllidaceae Alkaloids Natural Products (pp. 479-522):
Springer.

184
References

Jisaka, M., Ohigashi, H., Takegawa, K., Hirota, M., Irie, R., Huffman, M. A., &
Koshimzu, K. (1993). Steroid glucosides from Vernonia amygdalina, a possible
chimpanzee medicinal plant. Phytochemistry, 34(2), 409-413.

Johnson, C. E., Lin, L., Harnly, J. M., Oladeinde, F. O., Kinyua, A. M., Michelin, R., &
Bronner, Y. (2011). Identification of the Phenolic Components of Vernonia
amygdalina and Russelia equisetiformis. Journal of Natural Products, 4, 57-64.

Jones, J. D., & Dangl, J. L. (2006). The plant immune system. Nature, 444(7117), 323-
329. doi: 10.1038/nature05286

Jones Jr, S. B., & Luchsinger, A. E. (1979). Plant systematics. New York: McGraw-
Hill.

Kahl, R., & Kappus, H. (1993). Toxicology of the synthetic antioxidants BHA and BHT
in comparison with the natural antioxidant vitamin E. Zeitschrift fur
Lebensmittel-Untersuchung und -Forschung,, 196(4), 329-338.

Kaithwas, G., Kumar, A., Pandey, H., Acharya, A. K., Sing, M., Bathia, D., &
Mukerjee, A. (2008). Investigation of comparative antimicrobial activity of Aloe
vera gel and juice. Pharmacologyonline, 1, 239-243.

Kannabiran, K., Kumar, M., & Gunasekar, V. (2009). Evaluation of antimicrobial


activity of saponin isolated from Solanum xanthocarpum and Centella asiatica.
International Journal of Natural and Engineering Sciences, 3(1), 22-25.

Kaper, J. B., Nataro, J. P., & Mobley, H. L. T. (2004). Pathogenic Escherichia coli.
Nature Reviews Microbiology, 2(2), 123-140.

Kapoor, L. D. (1990). Handbook of Ayurvedic medicinal plants: CRC press.

Kazmi, M. H., Malik, A., Hameed, S., Akhtar, N., & Noor Ali, S. (1994). An
anthraquinone derivative from Cassia italica. Phytochemistry, 36(3), 761-763.

Kermasha, S., Goetghebeur, M., & Dumont, J. (1995). Determination of phenolic


compound profiles in maple products by high-performance liquid
chromatography. Journal of Agricultural and Food Chemistry, 43(3), 708-716.

Khan, R. A., Khan, M. R., Sahreen, S., & Ahmed, M. (2012). Evaluation of phenolic
contents and antioxidant activity of various solvent extracts of Sonchus asper
(L.) Hill. Chem Cent J, 6(1), 12. doi: 10.1186/1752-153X-6-12

185
References

Kianbakht, S., & Jahaniani, F. (2003). Evaluation of antibacterial activity of Tribulus


terrestris L. growing in Iran. Iranian Journal of Pharmacology & Therapeutics,
2(1), 22-24.

Kim, H., Park, S. W., Park, J. M., Moon, K. H., & Lee, C. K. (1995). Screening and
isolation of antibiotic resistant inhibitors from herb materials. I. - Resistant
Inhibition of 21 Korean Plants. Natural Product Science (Korea), 1, 50 - 54.

Kirtikar, K. R. , & Basu, B. D. (1935). Indian Medicinal Plants (B., L. M. Ed. 2nd ed.).
Allahabad, India.

Kishimoto, N., Kakino, Y., Iwai, K., Mochida, K., & Fujita, T. (2005). In vitro
antibacterial, antimutagenic and anti-influenza virus activity of caffeic acid
phenethyl esters. Biocontrol Science, 10(4), 155-161.

Kluytmans, J., van Belkum, A., & Verbrugh, H. (1997). Nasal carriage of
Staphylococcus aureus: epidemiology, underlying mechanisms, and associated
risks. Clinical Microbiology Reviews, 10(3), 505-520.

Knekt, P., Jarvinen, R., Reunanen, A., & Maatela, J. (1996). Flavonoid intake and
coronary mortality in Finland: a cohort study. British Medical Journal,
312(7029), 478-481.

Knight, G. M., Budd, E. L., Whitney, L., Thornley, A., Al-Ghusein, H., Planche, T., &
Lindsay, J. A. (2012). Shift in dominant hospital-associated methicillin-resistant
Staphylococcus aureus (HA-MRSA) clones over time. Journal of Antimicrobial
Chemotherapy, 67(10), 2514-2522. doi: 10.1093/jac/dks245

Kobori, M., Masumoto, S., Akimoto, Y., & Oike, H. (2012). Phloridzin reduces blood
glucose levels and alters hepatic gene expression in normal BALB/c mice. Food
and Chemical Toxicology, 50(7), 2547-2553. doi:
http://dx.doi.org/10.1016/j.fct.2012.04.017

Kollef, M. H. (2000). Ventilator-associated pneumonia: the importance of initial


empiric antibiotic selection. Infections in Medicine, 17, 265-268.

Kornberg, A., Colowick, S. P., & Kaplan, N. O. (1955). Methods in Enzymology.


Academic Press, Inc., New York, 1, 323.

Kotiranta, A., Haapasalo, M., Kari, K., Kerosuo, E., Olsen, I., Sorsa, T., Meurman, J.
H., & Lounatmaa, K. (1998). Surface structure, hydrophobicity, phagocytosis,
and adherence to matrix proteins of Bacillus cereus cells with and without the
crystalline surface protein layer. Infection and Immunity, 66(10), 4895-4902.

186
References

Kotiranta, A., Lounatmaa, K., & Haapasalo, M. (2000). Epidemiology and pathogenesis
of Bacillus cereus infections. Microbes and Infection, 2(2), 189-198.

Kubo, I., Muroi, H., & Himejima, M. (1993). Combination effects of antifungal
nagilactones against Candida albicans and two other fungi with
phenylpropanoids. Journal of Natural Products, 56(2), 220-226.

Kumar, K. P. S., Bhowmik, D., Chiranjib, & Biswajit. (2010). Aloe vera : A Potential
Herb and its Medicinal Importance. Journal of Chemical and Pharmaceutical
Research, 2(1), 21-29.

Kumaran, A., & Karunakaran, R. J. (2007). In vitro antioxidant activities of methanol


extracts of five Phyllanthus species from India. LWT - Food Science and
Technology, 40(2), 344-352. doi: http://dx.doi.org/10.1016/j.lwt.2005.09.011

Kunin, C. M. (1994). Urinary tract infections in females. Clinical Infectious Diseases,


18(1), 1-10.

Larson, R. H., & Fitzgerald, R. J. (1968). Caries development in the African white-
tailed rat (Mystromys albicaudatus) infected with a streptococcus of human
origin. Journal of Dental Research, 47(5), 746-749.

Lattif, A. G., Omar, I. M., Said, I. M., & Kadri, A. (1984). A multi-variate approach to
the study of medicinal plants in Malaysia. Journal of the Singapore National
Academy of Science, 13, 101-105.

Lau, D. T., Shaw, P. C., Wang, J., & But, P. P. (2001). Authentication of medicinal
Dendrobium species by the internal transcribed spacer of ribosomal DNA.
Planta Medica, 67(5), 456-460.

Lawless, J., & Allan, J. . (2000). The Clinical Composition of Aloe vera Aloe vera
natural wonder cure. (pp. 161-171). London, United Kingdom.: Thorsons,
Publishing Ltd.

Lawrence, R., Tripathi, P., & Jeyakumar, E. (2009). Isolation, purification and
evaluation of antibacterial agents from Aloe vera. Brazilian Journal of
Microbiology, 40(4), 906-915.

Lehner, T., Challacombe, S. J., & Caldwell, J. (1975). Immunological and


bacteriological basis for vaccination against dental caries in rhesus monkeys.
Nature, 254(5500), 517-520.

187
References

Lehrer, R. I., Rosenman, M., Harwig, S. S. S. L., Jackson, R., & Eisenhauer, P. (1991).
Ultrasensitive assays for endogenous antimicrobial polypeptides. Journal of
Immunological Methods, 137(2), 167-173.

Levy, S. B., & Marshall, B. (2004). Review: Antibacterial resistance worldwide: causes,
challenges and responses. Nature Medicine, 10(12 ), 122-129. doi:
10.1038/nm1145

Lewington, A. (1993). Medicinal plants and plant extracts: A review of their


importation into Europe (pp. 37).

Lewis, K. (2007). Persister cells, dormancy and infectious disease. Nature Reviews.
Microbiology, 5(1), 48-56. doi: 10.1038/nrmicro1557

Li, Y., Ooi, L. S., Wang, H., But, P. P., & Ooi, V. E. (2004). Antiviral activities of
medicinal herbs traditionally used in southern mainland China. Phytotherapy
Research, 18(9), 718-722. doi: 10.1002/ptr.1518

Liu, P. V. (1974). Extracellular toxins of Pseudomonas aeruginosa. The Journal of


Infectious Diseases, 130 94-99.

Loesche, W. J. (1986). Role of Streptococcus mutans in human dental decay.


Microbiological Reviews, 50(4), 353.

Lourens, A. C. U., Reddy, D., Baer, K. H. C., Viljoen, A. M., & Van, V. S. F. (2004).
In vitro biological activity and essential oil composition of four indigenous
South African Helichrysum species. Journal of Ethnopharmacology, 95(2), 253-
258.

Lowy, F. D. (1998). Staphylococcus aureus infections. The New England Journal of


Medicine, 339(8), 520-532. doi: 10.1056/NEJM199808203390806

Luo, X., Jiang, Y., Fronczek, F. R., Lin, C., Izevbigie, E. B., & Lee, K. S. (2011).
Isolation and structure determination of a sesquiterpene lactone (vernodalinol)
from Vernonia amygdalina extracts. Pharm Biol, 49(5), 464-470. doi:
10.3109/13880209.2010.523429

Mah, T. F., Pitts, B., Pellock, B., Walker, G. C., Stewart, P. S., & O'Toole, G. A.
(2003). A genetic basis for Pseudomonas aeruginosa biofilm antibiotic
resistance. Nature, 426(6964), 306-310. doi: 10.1038/nature02122

Maki, D. G., Goldman, D. A., & Rhame, F. S. (1973). Infection control in intravenous
therapy. Annals of Internal Medicine, 79(6), 867-887.

188
References

Malinowska, P. (2013). Effect of flavonoids content on antioxidant activity of


commercial cosmetic plant extracts. Herba Polonica, 59(3), 63-75.

Marchese, A., & Schito, G. C. (2000). Resistance patterns of lower respiratory tract
pathogens in Europe. International Journal of Antimicrobial Agents, 16(1), 25-
29. doi: http://dx.doi.org/10.1016/S0924-8579(00)00302-2

Marlatt, C., Ho, C. T., & Chien, M. (1992). Studies of aroma constituents bound as
glycosides in tomato. Journal of Agricultural and Food Chemistry, 40(2), 249-
252.

Martini, N. D., Katerere, D. R. P., & Eloff, J. N. (2004). Biological activity of five
antibacterial flavonoids from Combretum erythrophyllum (Combretaceae).
Journal of Ethnopharmacology, 93(23), 207-212. doi:
http://dx.doi.org/10.1016/j.jep.2004.02.030

Masaki, H., Sakaki, S., Atsumi, T., & Sakurai, H. (1995). Active-oxygen scavenging
activity of plant extracts. Biological & Pharmaceutical Bulletin, 18(1), 162-166.

Mason, T. L. , & Wasserman, B. P. . (1987). Inactivation of red beet betaglucan


synthase by native oxidized phenolic compounds. . Phytochemistry, 26, 2197
2202.

Matros, A., & Mock, H. (2004). Ectopic expression of a UDP-glucose: phenylpropanoid


glucosyltransferase leads to increased resistance of transgenic tobacco plants
against infection with Potato Virus Y. Plant and Cell Physiology, 45(9), 1185-
1193.

McDevitt, J. T., Schneider, D. M., Katiyar, S. K., & Edlind, T. D. (1996). Berberine: a
candidate for the treatment of diarrhea in AIDS patients, abstr. 175. Paper
presented at the Program and Abstracts of the 36th Interscience Conference on
Antimicrobial Agents and Chemotherapy. American Society for Microbiology,
Washington, DC.

McMahon, J. B., Currens, M. J., Gulakowski, R. J., Buckheit, R. W., Jr., Lackman-
Smith, C., Hallock, Y. F., & Boyd, M. R. (1995). Michellamine B, a novel plant
alkaloid, inhibits human immunodeficiency virus-induced cell killing by at least
two distinct mechanisms. Antimicrobial Agents and Chemotherapy, 39(2), 484-
488.

Meerow, A. W., & Snijman, D. A. (1998). Amaryllidaceae (K., K. Ed.). Berlin:


Springer.

189
References

Meyer, J. J. M., & Dilika, F. (1996). Antibacterial activity of Helichrysum


pedunculatum used in circumcision rites. Journal of Ethnopharmacology, 53(1),
51-54.

Michalak, A. (2006). Phenolic compounds and their antioxidant activity in plants


growing under heavy metal stress. Polish Journal of Environmental Studies,
15(4), 523-530.

Middleton, E., Kandaswami, C., & Theoharides, T. C. (2000). The effects of plant
flavonoids on mammalian cells: implications for inflammation, heart disease,
and cancer. Pharmacological Reviews, 52(4), 673-751.

Mian, A. ., Mimica-Duki, N. M., Mandi, A. I., Saka, M. B., Milovanovi, I. L., &
Sedej, I. J. (2010). Development of a rapid resolution HPLC method for the
separation and determination of 17 phenolic compounds in crude plant extracts.
Central European Journal of Chemistry, 9(1), 133-142. doi: 10.2478/s11532-
010-0126-8

Molnar-Perl, I., & Fuzfai, Z. (2005). Chromatographic, capillary electrophoretic and


capillary electrochromatographic techniques in the analysis of flavonoids.
Journal of Chromatography A, 1073(1-2), 201-227.

Morita, Y., Tomida, J., & Kawamura, Y. (2014). Responses of Pseudomonas


aeruginosa to antimicrobials. Frontiers in Microbiology, 4, 1-8.

Morrissey, J. P., & Osbourn, A. E. (1999). Fungal resistance to plant antibiotics as a


mechanism of pathogenesis. Microbiology and Molecular Biology Reviews,
63(3), 708-724.

Mortimer, P. R., & McCann, G. (1974). Food-poisoning episodes associated with


Bacillus cereus in fried rice. The Lancet, 303(7865), 1043-1045.

Motilva, M., Serra, A., & Maci, A. (2013). Analysis of food polyphenols by ultra high-
performance liquid chromatography coupled to mass spectrometry: An
overview. Journal of Chromatography A, 1292, 66-82. doi:
http://dx.doi.org/10.1016/j.chroma.2013.01.012

Mukherjee, A., & Rajasekaran, C. (2010). In-vitro hemolytic activity of Allium


stracheyi Baker. Journal of Pharmacy Research 3(5), 1160-1162.

Murty, K. S., Rao, D. N. , Rao, D. K. , & Murty, L. B. G. . (1978 ). A preliminary study


on the hypoglycemic and antihyperglycemic effect of Azadirachta indica. .
Indian Journal of Pharmacology 10, 247-250.

190
References

Najafian, M., Jahromi, M. Z., Nowroznejhad, M. J., Khajeaian, P., Kargar, M. M.,
Sadeghi, M., & Arasteh, A. (2012). Phloridzin reduces blood glucose levels and
improves lipids metabolism in streptozotocin-induced diabetic rats. Molecular
Biology Reports, 39(5), 5299-5306. doi: 10.1007/s11033-011-1328-7

Namba, T., Morita, O., Huang, S. L., Goshima, K., Hattori, M., & Kakiuchi, N. (1988).
Studies on Cardio-Active Crude Drugs .1. Effect of Coumarins on Cultured
Myocardial-Cells. Planta Medica(4), 277-282.

Nang, H. L. L., May, C. Y., Ngan, M. A., & Hock, C. C. (2007). Extraction and
Identification of Water-Soluble Compounds in Palm-Pressed Fiber by SC-CO2
and GC-MS. American Journal of Environmental Sciences, 3(2), 54.

Nascimento, G. G. F., Locatelli, J., Freitas, P. C., & Silva, G. L. (2000). Antibacterial
activity of plant extracts and phytochemicals on antibiotic-resistant bacteria.
Brazilian Journal of Microbiology, 31, 247-256.

Nataro, J. P., Deng, Y., Cookson, S., Cravioto, A., Savarino, S. J., Guers, L. D., Levine,
M. M., & Tacket, C. O. (1995). Heterogeneity of enteroaggregative Escherichia
coli virulence demonstrated in volunteers. Journal of Infectious Diseases,
171(2), 465-468.

Nataro, J. P., Kaper, J. B., Robins-Browne, R., Prado, V., Vial, P., & Levine, M. M.
(1987). Patterns of adherence of diarrheagenic Escherichia coli to HEp-2 cells.
Pediatric Infectious Disease Journal, 6(9), 829-831.

Ncube, N. S., Afolayan, A. J., & Okoh, A. I. (2008). Assessment techniques of


antimicrobial properties of natural compounds of plant origin: current methods
and future trends. African Journal of Biotechnology, 7(12), 1797-1806.

Ni, Y., & Tizard, I. R. (2004). Analytical methodology: the gel-analysis of aloe pulp
and its derivatives Aloes: CRC Press.

Nikaido, H. (1994). Prevention of Drug Access to Bacterial Targets - Permeability


Barriers and Active Efflux. Science, 264(5157), 382-388. doi: DOI
10.1126/science.8153625

Nizet, V., Ohtake, T., Lauth, X., Trowbridge, J., Rudisill, J., Dorschner, R. A.,
Pestonjamasp, V., Piraino, J., Huttner, K., & Gallo, R. L. (2001). Innate
antimicrobial peptide protects the skin from invasive bacterial infection. Nature,
414(6862), 454-457.

Nostro, A., Germano, M. P., Dangelo, V., Marino, A., & Cannatelli, M. A. (2000).
Extraction methods and bioautography for evaluation of medicinal plant
antimicrobial activity. Letters in Applied Microbiology, 30(5), 379-384.
191
References

O'Kennedy, R., & Thornes, R. D. (1997). Coumarins: biology, applications, and mode
of action. New York, N.Y.: John Wiley & Sons, Inc.

Oga, E. F., Sekine, S., & Horie, T. (2013). Ex vivo and in vivo investigations of the
effects of extracts of Vernonia amygdalina, Carica papaya and Tapinanthus
sessilifolius on digoxin transport and pharmacokinetics: Assessing the
significance on rat intestinal P-glycoprotein efflux. Drug Metabolism and
Pharmacokinetics, 28(4), 314-329.

Ogunleye, D. S., & Ibitoye, S. F. (2003). Short Communication: Studies of


antimicrobial activity and chemical constituents of Ximenia americana. Tropical
Journal of Pharmaceutical Research, 2(2), 239-241.

Omulokoli, E., Khan, B., & Chhabra, S. C. (1997). Antiplasmodial activity of four
Kenyan medicinal plants. Journal of Ethnopharmacology, 56(2), 133-137.

Ong, H. C., & Norzalina, J. (1999). Malay herbal medicine in Gemencheh, Negri
Sembilan, Malaysia. Fitoterapia, 70(1), 10-14. doi:
http://dx.doi.org/10.1016/S0367-326X(98)00023-9

Ong, H. C., Zuki, R. M., & Milow, P. (2011). Traditional knowledge of medicinal
plants among the Malay villagers in Kampung Mak Kemas, Terengganu,
Malaysia. EthnoMed, 5(3), 175-185.

Ophori, E. A., Eriagbonye, B. N., & Ugbodaga, P. (2013). Antimicrobial activity of


propolis against Streptococcus mutans. African Journal of Biotechnology, 9(31),
4966-4969.

Organization, World Health. (1999). The world health report 1999: making a
difference: World Health Organization.

Orhan, I. E., Atasu, E., Senol, F. S., Ozturk, N., Demirci, B., Das, K., & Sekeroglu, N.
(2013). Comparative studies on Turkish and Indian Centella asiatica (L.) Urban
(gotu kola) samples for their enzyme inhibitory and antioxidant effects and
phytochemical characterization. Industrial Crops and Products, 47, 316-322.
doi: http://dx.doi.org/10.1016/j.indcrop.2013.03.022

Oriakhi, K., Oikeh, E. I., Ezeugwu, N., Anoliefo, O., Aguebor, O., & Omoregie, E. S.
(2014). Comparative Antioxidant Activities of Extracts of Vernonia amygdalina
and Ocimum gratissimum Leaves. Journal of Agricultural Science, 6(1).

Osawa, T. (1994). Novel natural antioxidants for utilization in food and biological
systems. In Uritani, I., Garcia, V. V. & Mendoza, E. M. (Eds.), Postharvest
biochemistry of plant food- materials in the tropics (pp. 241251). Tokyo,
Japan: Japan Scientific Societies Press.
192
References

Osborn, R. W., De Samblanx, G. W., Thevissen, K., Goderis, I., Torrekens, S., Van
Leuven, F., Attenborough, S., Rees, S. B., & Broekaert, W. F. (1995). Isolation
and characterisation of plant defensins from seeds of Asteraceae, Fabaceae,
Hippocastanaceae and Saxifragaceae. Federation of European Biochemical
Societies Letters, 368(2), 257-262.

Osbourn, A. E. (1996). Preformed antimicrobial compounds and plant defense against


fungal attack. The Plant Cell, 8(10), 1821.

Osbourn, A. E., Clarke, B. R., Lunness, P., Scott, P. R., & Daniels, M. J. (1994). An Oat
Species Lacking Avenacin Is Susceptible to Infection by Gaeumannomyces-
Graminis Var Tritici. Physiological and Molecular Plant Pathology, 45(6), 457-
467. doi: Doi 10.1016/S0885-5765(05)80042-6

Osinubi, A. A. (2008). Effects of Vernonia amygdalina and chlorpropamide on blood


glucose. Medical Journal of the Islamic World Academy of Sciences 16, 115-
119.

Owolabi, M. A., Jaja, S. I., Oyekanmi, O. O., & Olatunji, O. J. (2008). Evaluation of the
Antioxidant Activity and Lipid Peroxidation of the Leaves of Vernonia
amygdalina. Journal of Complementary and Integrative Medicine, 5(1).

Pannala, A. S., Chan, T. S., O'Brien, P. J., & Rice-Evans, C. A. (2001). Flavonoid B-
ring chemistry and antioxidant activity: fast reaction kinetics. Biochemical and
Biophysical Research Communications, 282(5), 1161-1168.

Papadopoulou, K., Melton, R. E., Leggett, M., Daniels, M. J., & Osbourn, A. E. (1999).
Compromised disease resistance in saponin-deficient plants. Proceedings of the
National Academy of Sciences of the United States of America, 96(22), 12923-
12928. doi: DOI 10.1073/pnas.96.22.12923

Parekh, J., Jadeja, D., & Chanda, S. (2005). Efficacy of aqueous and methanol extracts
of some medicinal plants for potential antibacterial activity. Turkish Journal of
Biology, 29, 203-210.

Parekh, J., Karathia, N., & Chanda, S. (2006). Screening of some traditionally used
medicinal plants for potential antibacterial activity. Indian Journal of
Pharmaceutical Sciences, 68(6), 832.

Peng, S. Y., Norman, J., Curtin, G., Corrier, D., McDaniel, H. R., & Busbee, D. (1991).
Decreased mortality of Norman murine sarcoma in mice treated with the
immunomodulator, Acemannan. Molecular Biotherapy, 3(2), 79-87.

193
References

Pengsuparp, T., Cai, L., Fong, H. H., Kinghorn, A. D., Pezzuto, J. M., Wani, M. C., &
Wall, M. E. (1994). Pentacyclic triterpenes derived from Maprounea africana
are potent inhibitors of HIV-1 reverse transcriptase. Journal of Natural
Products, 57(3), 415-418.

Pereira, A. P., Ferreira, I. C. F. R., Marcelino, F., Valento, P., Andrade, P. B., Seabra,
R., Estevinho, L., Bento, A., & Pereira, J. A. (2007). Phenolic compounds and
antimicrobial activity of olive (Olea europaea L. Cv. Cobranosa) leaves.
Molecules, 12(5), 1153-1162.

Perez, C., Pauli, M., & Bazevque, P. (1990). An antibiotic assay by the agar well
diffusion method. Acta Biologiae et medicine Experimentalis, 15, 113-115.

Peterson, P. K. (1980). Host defense against Pseudomonas aeruginosa. In Sabath, L. D.


(Ed.), Pseudomonas aeruginosa. International symposium (pp. 103-118).

Peuchant, E., Brun, J., Rigalleau, V., Dubourg, L., Thomas, M. J., Daniel, J., Leng, J., &
Gin, H. (2004). Oxidative and antioxidative status in pregnant women with
either gestational or type 1 diabetes. Clinical Biochemistry, 37(4), 293-298.

Pietta, P. G., Simonetti, P., Gardana, C., Brusamolino, A., Morazzoni, P., &
Bombardelli, E. (1998). Catechin metabolites after intake of green tea infusions.
Biofactors, 8(1-2), 111-118.

Pietta, P., Simonetti, P., & Mauri, P. (1998). Antioxidant Activity of Selected Medicinal
Plants. Journal of Agricultural and Food Chemistry, 46(11), 4487-4490. doi:
10.1021/jf980310p

Piller, N. B. (1975). A comparison of the effectiveness of some anti-inflammatory drugs


on thermal oedema. British Journal of Experimental Pathology, 56(6), 554-560.

Poole, K. (2011). Pseudomonas aeruginosa: resistance to the max. Frontiers in


Microbiology, 2, 65. doi: 10.3389/fmicb.2011.00065

Price, K. R., Johnson, I. T., & Fenwick, G. R. (1987). The chemistry and biological
significance of saponins in foods and feedingstuffs. Critical Reviews in Food
Science and Nutrition 26(1), 27-135. doi: 10.1080/10408398709527461

Prior, R. L., & Cao, G. (1999). In vivo total antioxidant capacity: comparison of
different analytical methods. Free Radical Biology & Medicine 27(11-12), 1173-
1181.

194
References

Pugh, N., Ross, S. A., ElSohly, M. A., & Pasco, D. S. (2001). Characterization of
Aloeride, a new high-molecular-weight polysaccharide from Aloe vera with
potent immunostimulatory activity. Journal of Agricultural and Food Chemistry
49(2), 1030-1034.

Puteh, M. (2005). Penamaan Tumbuhan Ubatan Dan Beraroma (Yaacob, M., Maarof,
M. G. & Puteh, M. Eds.). Malaysia: Malaysian Agricultural Research and
Development Institute (MARDI).

Que, F., Mao, L., & Zheng, X. (2007). In vitro and vivo antioxidant activities of daylily
flowers and the involvement of phenolic compounds. Asia Pacific Journal of
Clinical Nutrition, 16(1), 196-203.

Rafat, A., Philip, K., & Muniandy, S. (2010). Antioxidant potential and content of
phenolic compounds in ethanolic extracts of selected parts of Andrographis
paniculata. Journal of Medicinal Plant Research, 4(3), 197-202.

Rahman, S., Imran, M., Muhammad, N., Hassan, N., Chisthi, A. K., Khan, A. F.,
Sadozai, K. S., & Khan, S. M. (2011). Antibacetial screening of leaves and stem
of Carica papaya. Journal of Medicinal Plants Research, 5(20), 5167-5171.

Rammelkamp, C. H., & Maxon, T. (1942). Resistance of Staphylococcus aureus to the


Action of Penicillin. Paper presented at the Proceedings of the Society for
Experimental Biology and Medicine. Society for Experimental Biology and
Medicine (New York, NY).

Rasigade, J., & Vandenesch, F. (2013). Staphylococcus aureus: A pathogen with still
unresolved issues. Infection, Genetics and Evolution. doi:
http://dx.doi.org/10.1016/j.meegid.2013.08.018

Razali, N., Razab, R., Junit, S. M., & Aziz, A. A. (2008). Radical scavenging and
reducing properties of extracts of cashew shoots (Anacardium occidentale).
Food Chemistry, 111(1), 38-44. doi: 10.1016/j.foodchem.2008.03.024

Reddy, K. V., Yedery, R. D., & Aranha, C. (2004). Antimicrobial peptides: premises
and promises. International Journal of Antimicrobial Agents, 24(6), 536-547.
doi: 10.1016/j.ijantimicag.2004.09.005

Reihani, S. F. S., & Azhar, M. E. (2012). Antioxidant activity and total phenolic content
in aqueous extracts of selected traditional Malay salads (Ulam). International
Food Research Journal, 19(4).

Reynolds, T., & Dweck, A. C. (1999). Aloe vera leaf gel: a review update. Journal of
Ethnopharmacology, 68(1), 3-37.

195
References

Rice-Evans, C. A., Miller, N. J., & Paganga, G. (1997). Antioxidant properties of


phenolic compounds. Trends in Plant Science, 2(4), 152-159. doi:
http://dx.doi.org/10.1016/S1360-1385(97)01018-2

Rojas, J. J., Ochoa, V. J., Ocampo, S. A., & Munoz, J. F. (2006). Screening for
antimicrobial activity of ten medicinal plants used in Colombian folkloric
medicine: a possible alternative in the treatment of non-nosocomial infections.
BMC Complementary and Alternative Medicine, 6, 2. doi: 10.1186/1472-6882-
6-2

Rose, E. B., & Okrend, A. J. G. (1998). Isolation and Identification of Aeromonas


species from Meat and Poultry ProductMicrobiology Laboratory Guidebook (3
ed., Vol. 1, pp. 1-7). Retrieved from
http://www.fsis.usda.gov/ophs/Microlab/Mlgchp7.pdf.

Ross, I. A. (1999a). Medicinal Plants of the World: Chemical Constituents, Traditional


and Modern Medicinal Uses (Vol. 2). Totowa, New Jersey: Humana Press.

Ross, I. A. (1999b). Medicinal Plants of the World: Chemical Constituents, Traditional


and Modern Medicinal Uses (Vol. 1). Totowa, New Jersey: Humana Press.

Sabariah, Z. (1987). Kajian tumbuhan ubatan di daerah Sering, Kota Bharu, Kelantan.
Tesis SmSn. Jabatan Botani, Universiti Kebangsaan Malaysia, Bangi.

Sakanaka, S., Kim, M., Taniguchi, M., & Yamamoto, T. (1989). Antibacterial
substances in Japanese green tea extract against Streptococcus mutans, a
cariogenic bacterium. Agricultural and Biological Chemistry, 53(9), 2307-2311.

Sakanaka, S., Shimura, N., Aizawa, M., Kim, M., & Yamamoto, T. (1992). Preventive
effect of green tea polyphenols against dental caries in conventional rats.
Bioscience, Biotechnology, and Biochemistry, 56(4), 592-594.

Salawu, S. O., Ogundare, A. O., Ola-Salawu, B. B., & Akindahunsi, A. A. (2011).


Antimicrobial activities of phenolic containing extracts of some tropical
vegetables. African Journal of Pharmacy and Pharmacology, 5(4), 486-492.

Salie, F., Eagles, P. F. K., & Leng, H. M. J. (1996). Preliminary antimicrobial screening
of four South African Asteraceae species. Journal of Ethnopharmacology, 52(1),
27-33.

Samy, R. P., & Gopalakrishnakone, P. (2010). Therapeutic Potential of Plants as Anti-


microbials for Drug Discovery. Evidence-based Complementary and Alternative
Medicine, 7(3), 283-294. doi: 10.1093/ecam/nen036

196
References

Santos, P. R. V., Oliveira, A. C. X., & Tomassini, T. C. B. (1995). Controle


microbigico de produtos fitoterpicos. Rev. Farm. Bioqum, 31, 35-38.

Satrija, F., Nansen, P., Murtini, S., & He, S. (1995). Anthelmintic activity of papaya
latex against patent Heligmosomoides polygyrus infections in mice. Journal of
Ethnopharmacology, 48(3), 161-164.

Satyavati, G. V., Raina, M. K., & Sharma, M. (1976). Medicinal plants of India (Vol.
1): Indian council of medical research New Delhi.

Savarese, M., De Marco, E., & Sacchi, R. (2007). Characterization of phenolic extracts
from olives (Olea europaea cv. Pisciottana) by electrospray ionization mass
spectrometry. Food Chemistry, 105(2), 761-770. doi:
http://dx.doi.org/10.1016/j.foodchem.2007.01.037

Scalbert, A. (1991). Antimicrobial properties of tannins. Phytochemistry, 30, 3875


3883.

Schaneberg, B. T., Mikell, J. R., Bedir, E., Khan, I. A., & Nachname, V. (2003). An
improved HPLC method for quantitative determination of six triterpenes in
Centella asiatica extracts and commercial products. Die Pharmazie-An
International Journal of Pharmaceutical Sciences, 58(6), 381-384.

Schmidt, H. . (1988). Phenol oxidase (E.I.14.18.1), a marker enzyme for defense cells.
Progress in histochemistry and cytochemistry (Vol. 17). New York: Gustav
Fischer.

Schmutterer, H. (1995). The neem tree Azadirachta indica A. Juss. and other
meliaceous plants: sources of unique natural products for integrated pest
management, medicine, industry and other purposes. Weinheim, Germany:
VCH Verlagsgesellschaft mbH.

Schmutterer, H., & Ascher, K. R. S. (1983, 25-28 May, 1983). Natural pesticides from
the neem tree (Azadirachta indica A. Juss) and other tropical plants. Paper
presented at the Proceedings of the Second International Neem Conference,
Rauischholzhausen, Federal Republic of Germany.

Sealy, J. R. (1954). Review of the Genus Hymenocallis. Kew Bulletin, 9(2), 201-240.
doi: 10.2307/4114384

Sebastia, J., Pertusa, M., Vilchez, D., Planas, A. M., Verbeek, R., Rodriguez-Farre, E.,
Cristofol, R., & Sanfeliu, C. (2006). Carboxyl-terminal fragment of amyloid
precursor protein and hydrogen peroxide induce neuronal cell death through
different pathways. Journal of Neural Transmission 113(12), 1837-1845. doi:
10.1007/s00702-006-0492-8
197
References

ener, B., Orhan, I. , & Satayavivad, J. (2003). Antimalarial activity screening of some
alkaloids and the plant extracts from Amaryllidaceae. Phytotherapy Research,
17(10), 1220-1223. doi: 10.1002/ptr.1346

Serafini, M., Ghiselli, A., & Ferro-Luzzi, A. (1994). Red wine, tea, and antioxidants.
Lancet, 344(8922), 626.

Serkedjieva, J., & Manolova, N. (1992). Anti-influenza virus effect of some propolis
constituents and their analogues (esters of substituted cinnamic acids). Journal
of Natural Products, 55(3), 294-297.

Service, R. F. (1995). Antibiotics that resist resistance. Science, 270(5237), 724-727.

Shah, P. M. (2005). The need for new therapeutic agents: what is the pipeline? Clinical
Microbiology and Infection 11(3), 36-42.

Shahidi, F. (1997). Natural Antioxidants: An Overview Natural Antioxidants:


Chemistry, Health Effects and Applications. (pp. 1-3). USA: AOCS Press.

Shahidi, F., Janita, P. K., & Wanasundara, P. D. (1992). Phenolic antioxidants. Critical
Reveiws in Food Science and Nutrition, 32(1), 67-103. doi:
10.1080/10408399209527581

Shalini, N., Sasidharan, T. D., & Babu. (2009). Cytotoxic and antioxidant properties of
sterculia species found in Western Ghats of Kerala. Amala Research Bulletin,
29, 145-151.

Shan, B., Cai, Y. Z., Brooks, J. D., & Corke, H. (2007). The in vitro antibacterial
activity of dietary spice and medicinal herb extracts. International Journal of
Food Microbiology, 117(1), 112-119. doi: 10.1016/j.ijfoodmicro.2007.03.003

Sharififar, F., Mozaffarian, V., & Moradkhani, S. (2007). Comparison of antioxidant


and free radical scavenging activities of the essential oils from flowers and fruits
of Otostegia persica Boiss. Pakistan Journal of Biological Sciences, 10(21),
3895-3899.

Sheeba, E. (2010). Antibacterial activity of solanum surattense burm. F. Kathmandu


University Journal of Science, Engineering and Technology, 6(1), 1-4.

Sheldon, A. T. (2005). Antibiotic resistance: a survival strategy. Clinical Laboratory


Science, 18(3), 170-180.

198
References

Shiba, M., Kondo, K., Miki, E., Yamaji, H., Morota, T., Terabayashi, S., Takeda, S.,
Sasaki, H., Miyamoto, K., & Aburada, M. (2006). Identification of medicinal
Atractylodes based on ITS sequences of nrDNA. Biological & Pharmaceutical
Bulletin 29(2), 315-320.

Singh, R., Singh, S., Kumar, S., & Arora, S. (2007). Studies on antioxidant potential of
methanol extract/fractions of Acacia auriculiformis A. Cunn. Food Chemistry,
103(2), 505-511.

Singleton, V. L., Orthofer, R., & Lamuela-Raventos, R. M. (1999). Analysis of total


phenols and other oxidation substrates and antioxidants by means of Folin-
Ciocalteu reagent. Methods in Enzymology, 299, 152-178.

Siti, Z. M., Tahir, A., Farah, A. I., Fazlin, S. M. A., Sondi, S., Azman, A. H.,
Maimunah, A. H., Haniza, M. A., Siti Haslinda, M. D., Zulkarnain, A. K.,
Zakiah, I., & Zaleha, W. C. W. (2009). Use of traditional and complementary
medicine in Malaysia: a baseline study. Complementary Therapies in Medicine,
17(56), 292-299. doi: http://dx.doi.org/10.1016/j.ctim.2009.04.002

Slinkard, K., & Singleton, V. L. (1977). Total phenol analysis: automation and
comparison with manual methods. American Journal of Enology and Viticulture,
28(1), 49-55.

Stanley, M. M. (1947). Infections due to Bacillus pyocyaneous (P. aeruginosa)


treatment with streptomycin. Bulletin of the New England Medical Center, 9(3),
123-130.

Stern, J. L., Hagerman, A. E., Steinberg, P. D., & Mason, P. K. (1996). Phlorotannin-
protein interactions. Journal of Chemical Ecology, 22(10), 1877-1899.

Stevens, P. F. (2001). Angiosperm Phylogeny Website. Version 9, June 2008.

Stiles, H. M., Meyers, R., Brunnelle, J. A., & Wittig, A. B. (1976). Occurrence of
Streptococcus mutans and Streptococcus sanguis in the oral cavity and feces of
young children. Microbial Aspects of Dental Caries, 187, 187-199.

Stoilova, I., Gargova, S., Stoyanova, A., & Ho, I. (2005). Antimicrobial and antioxidant
activity of the polyphenol mangiferin. Herba Polonica, 51, 1-2.

Stoll, B. J., Hansen, N., Fanaroff, A. A., Wright, L. L., Carlo, W. A., Ehrenkranz, R. A.,
Lemons, J. A., Donovan, E. F., Stark, A. R., Tyson, J. E., Oh, W., Bauer, C. R.,
Korones, S. B., Shankaran, S., Laptook, A. R., Stevenson, D. K., Papile, L. A.,
& Poole, W. K. (2002). Changes in pathogens causing early-onset sepsis in very-
low-birth-weight infants. The New England Journal of Medicine, 347(4), 240-
247. doi: 10.1056/NEJMoa012657
199
References

Stratton, C. W. (1990). Pseudomonas aeruginosa Revisited. Infection Control and


Hospital Epidemiology, 11(2), 101-104. doi: 10.2307/30144269

Subedi, A., Amatya, M. P., Shrestha, T. M., Mishra, S. K., & Pokhrel, B. M. (2012).
Antioxidant And Antibacterial Activity Of Methanolic Extract Of Machilus
Odoratissima. Kathmandu University Journal of Science, Engineering and
Technology, 8(1), 73-80.

Sulaiman, S. F., Sajak, A. A. B., Ooi, K. L., & Seow, E. M. (2011). Effect of solvents in
extracting polyphenols and antioxidants of selected raw vegetables. Journal of
Food Composition and Analysis, 24(4), 506-515.

Sule, I. O., & Agbabiaka, T. O. (2008). Antibacterial effect of some plant extracts on
selected Enterobacteriaceae. Ethnobotanical Leaflets, 12(1), 1035-1042.

Sun, H. D., Qiu, S. X., Lin, L. Z., Wang, Z. Y., Lin, Z. W., Pengsuparp, T., Pezzuto, J.
M., Fong, H. H., Cordell, G. A., & Farnsworth, N. R. (1996). Nigranoic acid, a
triterpenoid from Schisandra sphaerandra that inhibits HIV-1 reverse
transcriptase. Journal of Natural Products, 59(5), 525-527. doi:
10.1021/np960149h

Sun, J., Liang, F., Bin, Y., Li, P., & Duan, C. (2007). Screening Non-colored Phenolics
in Red Wines using Liquid Chromatography/Ultraviolet and Mass
Spectrometry/Mass Spectrometry Libraries. Molecules, 12(3), 679-693.

Suresh, K., Deepa, P., Harisaranraj, R., & Vaira, A. V. (2008). Antimicrobial and
Phytochemical Investigation of the Leaves of Carica papaya L., Cynodon
dactylon (L.) Pers., Euphorbia hirta L., Melia azedarach L. and Psidium
guajava L. Ethnobotanical Leaflets, 12(1), 1184-1191.

Sydiskis, R. J., Owen, D. G., Lohr, J. L., Rosler, K. H., & Blomster, R. N. (1991).
Inactivation of enveloped viruses by anthraquinones extracted from plants.
Antimicrobial Agents Chemotherapy, 35(12), 2463-2466.

Szabo, M. R., Idioiu, C., Chambre, D., & Lupea, A. X. (2007). Improved DPPH
determination for antioxidant activity spectrophotometric assay. Chemical
Papers, 61(3), 214-216.

Tai, M. C., Tsang, S. Y., Chang, L. Y., & Xue, H. (2005). Therapeutic potential of
wogonin: a naturally occurring flavonoid. CNS Drug Reviews, 11(2), 141-150.

Talbot, G. H., Bradley, J., Edwards, J. E., Jr., Gilbert, D., Scheld, M., & Bartlett, J. G.
(2006). Bad bugs need drugs: an update on the development pipeline from the
Antimicrobial Availability Task Force of the Infectious Diseases Society of
America. Clinical Infectious Diseases, 42(5), 657-668. doi: 10.1086/499819
200
References

Tanaka, J. C. A., Silva, C. C. , Oliveira, A. J. B. , Nakamura, C. V., & Dias Filho, B. P.


(2006). Antibacterial activity of indole alkaloids from Aspidosperma
ramiflorum. Brazilian Journal of Medical and Biological Research, 39, 387-391.

Taylor, J. L. S., Rabe, T., McGaw, L. J., Jager, A. K., & Van Staden, J. (2001). Towards
the scientific validation of traditional medicinal plants. Plant Growth
Regulation, 34(1), 23-37.

Taylor, R. S. L., Edel, F., Manandhar, N. P., & Towers, G. H. N. . (1996). Antimicrobial
activities of southern Nepalese medicinal plants. Journal of Ethnopharmacology,
50(2), 97-102.

Tedesco, I., Luigi, R. G., Nazzaro, F., Russo, M., & Palumbo, R. (2001). Antioxidant
effect of red wine anthocyanins in normal and catalase-inactive human
erythrocytes. The Journal of Nutritional Biochemistry 12(9), 505-511.

Thakare, M. (2004). Pharmacological screening of some medicinal plants as


antimicrobial and feed additives. (Master of Science), Virginia Polytechnic
Institute and State University, Blackburg, Virginia USA.

Thastrup, O., Knudsen, J. B., Lemmich, J., & Winther, K. (1985). Inhibition of human
platelet aggregation by dihydropyrano- and dihydrofuranocoumarins, a new
class of cAMP-phosphodiesterase inhibitors. Biochemical Pharmacology,
34(12), 2137-2140.

Thirunavukkarasu, P., Ramanathan, T., Shanmugapriya, R., Umamaheswari, G., &


Renugadevi, G. (2011). Antioxidant and free radical scavenging effect of
Acanthus ilicifolius. Research Journal of Applied Sciences, 6(3), 218-222.

Thomson, W. A. R., & Schultes, R. E. (1978). Medicines from the earth: a guide to
healing plants. Maidenhead, United Kingdom: McGraw-Hill Book Co.

Toda, M., Okubo, S., Ohnishi, R., & Shimamura, T. (1989). Antibacterial and
bactericidal activities of Japanese green tea. Nihon Saikingaku Zasshi, 44(4),
669-672.

Tsuchiya, H., Sato, M., Miyazaki, T., Fujiwara, S., Tanigaki, S., Ohyama, M., Tanaka,
T., & Iinuma, M. (1996). Comparative study on the antibacterial activity of
phytochemical flavanones against methicillin-resistant Staphylococcus aureus.
Journal of Ethnopharmacology, 50(1), 27-34.

Unhanand, M., Mustafa, M. M., McCracken, G. H., & Nelson, J. D. (1993). Gram-
negative enteric bacillary meningitis: a twenty-one-year experience. Journal of
Pediatrics 122(1), 15-21.

201
References

Urch, D. (1999). Aloe vera the plant Aloe vera natures gift (pp. 8-17). Bristol, United
Kingdom: Blackdown Publication.

Urs, N. R. R. , & Dunleavy, J. M. (1975). Enhancement of the bactericidal activity of a


peroxidase system by phenolic compounds (Xanthomonas phaseoli var. sojensis,
soybeans). Phytopathology 65, 686690.

Valle, T., Lopez, J. L., Hernandez, J. M., & Corchete, P. (1997). Antifungal activity of
scopoletin and its differential accumulation in Ulmus pumila and Ulmus
campestris cell suspension cultures infected with Ophiostoma ulmi spores. Plant
Science, 125(1), 97-101. doi: Doi 10.1016/S0168-9452(97)00057-5

VanEtten, H. D., Mansfield, J. W., Bailey, J. A., & Farmer, E. E. (1994). Two classes of
plant antibiotics: phytoalexins versus" phytoanticipins". The Plant Cell, 6(9),
1191.

Verkaik, N. J., Lebon, A., de Vogel, C. P., Hooijkaas, H., Verbrugh, H. A., Jaddoe, V.
W., Hofman, A., Moll, H. A., van Belkum, A., & van Wamel, W. J. (2010).
Induction of antibodies by Staphylococcus aureus nasal colonization in young
children. Clinical Microbiology and Infection 16(8), 1312-1317. doi:
10.1111/j.1469-0691.2009.03073.x

Verma, R. K., Bhartariya, K. G., Gupta, M. M., & Kumar, S. (1999). Reverse-phase
high performance liquid chromatography of asiaticoside in Centella asiatica.
Phytochemical analysis, 10(4), 191-193.

Vijaya, K., Ananthan, S., & Nalini, R. (1995). Antibacterial effect of theaflavin,
polyphenon 60 (Camellia sinensis) and Euphorbia hirta on Shigella spp.-a cell
culture study. Journal of Ethnopharmacology, 49(2), 115-118.

Vilain, S., Luo, Y., Hildreth, M. B., & Brzel, V. S. (2006). Analysis of the life cycle of
the soil saprophyte Bacillus cereus in liquid soil extract and in soil. Applied and
Environmental Microbiology, 72(7), 4970-4977.

Virus, R. M., & Gebhart, G. F. (1979). Pharmacologic actions of capsaicin: apparent


involvement of substance P and serotonin. Life Sciences, 25(15), 1273-1283.

Vishwakarma, R. A. (1990). Stereoselective synthesis of -arteether from artemisinin.


Journal of Natural Products, 53(1), 216-217.

Wallace, R. J. (2004). Antimicrobial properties of plant secondary metabolites.


Proceedings of the Nutrition Society, 63(4), 621-629.

202
References

Wang, H., Hui, K. M., Chen, Y., Xu, S., Wong, J. T., & Xue, H. (2002). Structure-
activity relationships of flavonoids, isolated from Scutellaria baicalensis,
binding to benzodiazepine site of GABA(A) receptor complex. Planta Medica-
Natural Products and Medicinal Plant Research, 68(12), 1059-1062. doi:
10.1055/s-2002-36357

Waterhouse, A. L. (2001). Determination of total phenolics. Current Protocols in Food


Analytical Chemistry.

Weerakkody, N. S., Caffin, N., Turner, M. S., & Dykes, G. A. (2010). In vitro
antimicrobial activity of less-utilized spice and herb extracts against selected
food-borne bacteria. Food Control, 21(10), 1408-1414.

Weinmann, I. (1997). History of the development and applications of coumarin and


coumarin-related compounds Coumarins: biology, applications and mode of
action. New York: John Wiley & Sons, Inc.

Welch, R. (2006). The genus Escherichia (3 ed. Vol. 6). Verlag Berlin Heidelberg:
Springer.

Wenk, M. R., & Fernandis, A. Z. (2007). Protein Purification. In Manuals in Biomedical


ResearchA Manual for Biochemistry Protocols (Vol. 3). Retrieved from
http://airdni.lecture.ub.ac.id/files/2012/01/A-Manual-for-Biochemistry-
Protocols.pdf.

Weppelman, R. M., & Brinton, C. C. (1971). The infection of Pseudomonas aeruginosa


by RNA pilus phage PP7: the adsorption organelle and the relationship between
phage sensitivity and the division cycle. Virology, 44(1), 1-17.

Wiart, C. (2002). Medicinal plants of Southeast Asia (pp. 199): Prentice Hall.

Wichi, H. P. (1988). Enhanced tumor development by butylated hydroxyanisole (BHA)


from the prospective of effect on forestomach and oesophageal squamous
epithelium. Food and Chemical Toxicology, 26(8), 717-723.

Wilson, L. A., Schlitzer, R. L., & Ahearn, D. G. (1981). Pseudomonas corneal ulcers
associated with soft contact-lens wear. American Journal of Ophthalmology,
92(4), 546-554.

Winkelhausen, E., Pospiech, R., & Laufenberg, G. (2005). Antifungal activity of


phenolic compounds extracted from dried olive pomace. Bulletin of the Chemists
and Technologists of Macedonia, 24(1), 41-46.

203
References

Witschi, H. P. (1986). Enhanced tumour development by butylated hydroxytoluene


(BHT) in the liver, lung and gastro-intestinal tract. Food and Chemical
Toxicology 24(10-11), 1127-1130.

Wong, C., Li, H., Cheng, K., & Chen, F. (2006). A systematic survey of antioxidant
activity of 30 Chinese medicinal plants using the ferric reducing antioxidant
power assay. Food Chemistry, 97(4), 705-711. doi:
http://dx.doi.org/10.1016/j.foodchem.2005.05.049

Wong, S. P., Leong, L. P., & Koh, J. H. W. (2006). Antioxidant activities of aqueous
extracts of selected plants. Food Chemistry, 99(4), 775-783. doi:
http://dx.doi.org/10.1016/j.foodchem.2005.07.058

Wongsa, P., Chaiwarit, J., & Zamaludien, A. (2012). In vitro screening of phenolic
compounds, potential inhibition against -amylase and -glucosidase of culinary
herbs in Thailand. Food Chemistry, 131(3), 964-971. doi:
http://dx.doi.org/10.1016/j.foodchem.2011.09.088

Xu, H. X., Zeng, F. Q., Wan, M., & Sim, K. Y. (1996). Anti-HIV triterpene acids from
Geum japonicum. Journal of Natural Products, 59(7), 643-645. doi:
10.1021/np960165e

Yamaji, K., Ishimoto, H., Usui, N., & Mori, S. (2005). Organic acids and water-soluble
phenolics produced by Paxillus sp. 60/92 together show antifungal activity
against Pythium vexans under acidic culture conditions. Mycorrhiza, 15(1), 17-
23. doi: 10.1007/s00572-003-0287-9

Yang, B., Kotani, A., Arai, K., & Kusu, F. (2001). Estimation of the antioxidant
activities of flavonoids from their oxidation potentials. Analytical Sciences,
17(5), 599-604.

Yates, K. M., Rosenberg, L. J., Harris, C. K., Bronstad, D. C., King, G. K., Biehle, G.
A., Walker, B., Ford, C. R., Hall, J. E., & Tizard, I. R. (1992). Pilot study of the
effect of acemannan in cats infected with feline immunodeficiency virus.
Veterinary Immunology and Immunopathology 35(1-2), 177-189.

Ye, X. Y., & Ng, T. B. (2002). A new antifungal peptide from rice beans. Journal of
Peptide Research, 60(2), 81-87.

Yen, G. C., & Chen, H. Y. (1995). Antioxidant activity of various tea extracts in
relation to their antimutagenicity. Journal of Agricultural and Food Chemistry,
43(1), 27-32.

204
References

Yoshida, M., Fuchigami, M., Nagao, T., Okabe, H., Matsunaga, K., Takata, J., Karube,
Y., Tsuchihashi, R., Kinjo, J., & Mihashi, K. (2005). Antiproliferative
constituents from Umbelliferae plants VII. Active triterpenes and rosmarinic
acid from Centella asiatica. Biological & Pharmaceutical Bulletin 28(1), 173-
175.

Zaidan, M. R. S., Noor, R. A., Badrul, A. R., Adlin, A., Norazah, A., & Zakiah, I.
(2005). In vitro screening of five local medicinal plants for antibacterial activity
using disc diffusion method. Tropical Biomedicine, 22(2), 165-170.

Zhang, Y., & Lewis, K. (1997). Fabatins: new antimicrobial plant peptides. Federation
of European Microbiological Societies Microbiology Letters, 149(1), 59-64. doi:
http://dx.doi.org/10.1016/S0378-1097(97)00054-2

Zhao, Z. L., Zhou, K. Y., Dong, H., & Xu, L. S. (2001). Characters of nrDNA ITS
region sequences of fruits of Alpinia galanga and their adulterants. Planta
Medica, 67(4), 381-383. doi: 10.1055/s-2001-14311

205
Appendices

APPENDICES

Appendix A. Plants Selected in the Study

A B

C D

E F

Figure 1: Medicinal plants collected for the study


The medicinal plants Azadirachta indica (A), Aloe vera (B), Carica papaya (C), Centella asiatica (D),
Hymenocallis speciosa (E) and Vernonia amygdalina (F) were collected from Seksyen 4, Petaling Jaya,
Selangor
206
Appendices

Appendix B. Voucher Deposit of Selected Plants

A B

C D

Figure 2a: Voucher deposited at the Herbarium of the Institute of Biological Sciences, Faculty of
Science, University of Malaya, Kuala Lumpur, Malaysia.
The voucher was deposited for the six medicinal plants as follows Aloe vera (A), Azadirachta indica (B),
Carica papaya (C), and Centella asiatica (D).

207
Appendices

Appendix B continued.

E F

Figure 2b: Voucher deposited at the Herbarium of the Institute of Biological Sciences, Faculty of
Science, University of Malaya, Kuala Lumpur, Malaysia.
Hymenocallis speciosa (E) and Vernonia amygdalina (F).

208
Appendices

Appendix C. Well Diffusion Assay

Figure 3a: Template for six wells on a 90 x 15mm petri plate


Template was used as a guide to bore six wells onto agar medium of petri plate in a
well diffusion assay.

Measure edge to edge


No zone around
across the zone of
well. Report as 0
inhibition over the centre
mm
of the well

Measure centre of
antibiotic well to a point
on the circumference of
the zone where a
distinct edge is present
and multiply by 2

Figure 3b: Measuring zones of inhibition.


Grey shading represents a confluent lawn of bacterial growth. Black circle represents the well
bored on the agar. The white circle represents no growth of the test organism (zone of inhibition).

209
Appendices

Appendix D. Antimicrobial Activity of Plant Extracts by Well Diffusion Assay

B. cereus E.coli

+ve
CE25 +ve CE25

CE50
CE100 CA25
CA25 CE50 CE100

CA50
CA100 CA50 CA100

P.aeruginosa S.aureus

+ve +ve
CE25 CE25

CE50
CE50
CE100 CE100
CA25

CA25
CA50
CA50
CA100
CA100

S.mutans S.mutans

CE25
+ve +ve CA25

CE100 CA50 CA100


CE50

Figure 4a: Well diffusion assay for C. asiatica ethanolic and aqueous extracts against test microorganisms
+ve Positive control; CE C. asiatica ethanolic extract; CA C. asiatica aqueous extract; at 25, 50 and 100 mg/ml
concentration respectively

210
Appendices

Appendix D continued

B. cereus E.coli

+ve
VL 25 +ve

VL 50
VL 100
AVL 25

AVL 50
AVL 100 AVL 100

B. cereus P.aeruginosa

+ve

+ve

HL 100

HL 100

Figure 4b: Well diffusion assay for A. vera leaf, V. amaygdalina leaf and H. speciosa leaf ethanolic extract
against test microorganisms
+ve Positive control; AVL A. vera leaf; VL V. amygdalina leaf and HL H. speciosa leaf extract; at 25, 50 and
100 mg/ml concentration respectively

211
Appendices

Appendix D continued

B. cereus B. cereus

+ve

CM 50

CM25

CM100

E.coli E.coli

CM 50
+ve +ve

CM25 CM100

P.aeruginosa S.aureus

+ve
+ve CM 50
CM 50

CM100

CM100

Figure 4c: Well diffusion assay for C. asiatica methanolic extract against test microorganisms
+ve Positive control; CM 25 - C. asiatica 25 mg/ml; CM 50 - C. asiatica 50 mg/ml and CM 100 - C. asiatica 100
mg/ml of methanol extract.

212
Appendices

Appendix D continued

S.mutans S.mutans

+ve +ve

CM 50

CM25 CM 100

B. cereus B. cereus

+ve
+ve

VM 25

VM 50

VM 100

S.mutans

+ve

VM 50

VM 100

Figure 4d: Well diffusion assay for C. asiatica and V. amaygdalina methanolic extract against test
microorganisms
+ve Positive control; CM 25 - C. asiatica 25 mg/ml; CM 50 - C. asiatica 50 mg/ml; CM 100 - C. asiatica 100
mg/ml VM 25 V. amygdalina 25 mg/ml; VM 50 - V. amygdalina 50 mg/ml and VM 100 - V. amygdalina 100
mg/ml of methanol extract.

213
Appendices

Appendix E. BLAST Query Search from the NCBI Database for the DNA
Sequence of the Selected Medicinal Plants

Figure 5a: BLAST query search from NCBI database of the 414 nucleotide of the PCR product.
The query results list different sequences. Sequence homology of 99% was obtained for Centella asiatica
( ).

214
Appendices

Appendix E continued

Figure 5b: Detailed information of Centella asiatica (AF272352).


The BLAST query of the ITS2 region with the 99% homology showed Centella asiatica.

215
Appendices

Appendix E continued

Figure 5c: BLAST query search from NCBI database of the 390 nucleotide of the PCR product.
The query results list different sequences. Sequence homology of 99% was obtained for Gymnanthemum
amygdalinnum/Vernonia amygdalina ( ).

216
Appendices

Appendix E continued

Figure 5d: Detailed information of Gymnanthemum amygdalinum (AY504695).


The BLAST query of the ITS2 region with the 99% homology showed Gymnanthemum amygdalinum.

217
Appendices

Appendix F. Total Phenolic Content (TPC) Determination by Folin-Ciocalteu


Assay

Figure 6: Gallic acid standard curve in Folin-Ciocalteu Assay


Graph shows the gallic acid standard curve in Folin-Ciocalteu assay whereby absorbance at 765nm was
plot against concentration of gallic acid in mg/litre for (50-500 mg/l) concentration of gallic acid. Gallic
acid standard was used to estimate the total phenolic content in plant extracts by the Folin-Ciocalteu
colorimetric method. The assay was performed in trplicate and results were presented as mean SD.

Table 1: Total phenolic content of Centella asiatica and Vernonia amygdalina


Medicinal plant of study Total phenolic content (mg GAE/g d.w.)
Aqueous Ethanol Methanol
Centella asiatica 1.1200.063a 4.0060.032b 3.3460.029c
Vernonia amygdalina 1.0310.058de 0.9740.049d 1.1680.101e
Total phenolic content was determined based on Folin-Ciocalteus method for C. asiatica and V.
amygdalina expressed as milligram gallic acid equivalent per gram dry weight (mg GAE/g d.w.). Results
were presented as mean SD; n = 3. The mean changes between the samples were analysed by one-way
ANOVA followed by Tukeys Multiple Comparison Test. Samples represented by different alphabets are
significantly different (p < .05) from each other.

218
Appendices

Appendix G. Results of DPPH Radical Scavenging Activity

Table 2: Percentage inhibition of DPPH radicals by sample/positive control/standard at varying


concentrations (g/ml).
Concentration (g/ml)b
Samplea
25 50 75 100 200 300 400
C. asiatica
-0.301.89 3.520.50 1.851.61 3.490.27 4.642.17 7.151.26 8.280.74
aqueous
C. asiatica
11.390.94 25.281.62 27.501.08 36.720.43 64.580.28 86.440.13 88.830.23
ethanol
C. asiatica
7.333.63 16.353.19 21.822.03 26.560.87 46.490.63 65.590.56 73.170.71
methanol
V.amygdalina
4.937.56 6.565.43 2.211.19 1.480.27 8.178.76 7.724.74 5.951.37
aqueous
V.amygdalina
5.366.85 8.306.28 9.746.10 10.725.12 15.625.37 21.036.58 26.075.32
ethanol
V.amygdalina
7.6010.81 8.538.29 8.588.18 10.767.38 15.947.69 20.886.09 25.974.39
methanol
Ascorbic acid 13.901.97 29.291.02 46.410.71 90.730.30 90.560.29 90.570.32 90.490.69
BHT -7.381.40 -3.581.05 0.190.72 5.432.95 13.101.44 21.380.92 26.341.47
Trolox 23.283.25 39.381.43 49.310.85 60.131.51 90.510.21 90.680.19 90.800.28
Table presents the percentage inhibition of DPPH radicals by samples C. asiatica and V. amygdalina
aqueous, ethanolic and methanolic extracts; positive controls ascorbic acid and BHT; and standard
Trolox.
a
Results were presented as mean SD, where n = 3.
b
Concentration of sample/positive control and standard was (25-400 g/ml)

Figure 7a: Trolox standard curve with DPPH assay


Graph depicts the trolox standard curve in DPPH assay whereby the percentage inhibition of DPPH
radical was plot against concentration (25-200g/ml) of trolox. Trolox standard curve was used to
determine the antioxidant activity of samples, expressed as milimole Trolox equivalent antioxidant
capacity per gram dried weight of plant sample (mmol TE/g d.w.). Results were presented as mean SD,
where n = 3.

219
Appendices

Appendix G continued

Figure 7b: Non-linear regression analysis of C. asiatica (A), V. amygdalina (B)


extracts and positive control (C) used to determine IC50 of DPPH assay
Graph depicts the non-linear regression curve of C. asiatica and V. amygdalina
aqueous ( ), ethanolic ( ) and methanolic ( ) extracts and positive control
ascorbic acid ( ) and BHT ( ) used to determine IC50. The percentage
inhibition of DPPH radical was plot against log concentration (1.3 2.6 g/ml).
Results were presented as mean SD, where n = 3.

220
Appendices

Appendix H. Results of FRAP Assay for the Extracts of C. asiatica and V.


amygdalina

Table 3a: Ferric Reducing Antioxidant Power (FRAP) activity in 1 mg/ml of sample and positive
control
Absorbance 595nma
Time
Centella asiatica Vernonia amygdalina Ascorbic
(s) BHT
aqueous ethanolic methanolic aqueous ethanolic methanolic acid
0 0.0370.004 0.4210.011 0.4660.012 0.0410.003 0.0930.006 0.1420.020 3.2240.103 0.0480.017
15 0.0500.003 0.4470.014 0.4960.009 0.0580.001 0.1040.006 0.1700.007 3.2900.036 0.0510.014
30 0.0570.005 0.4600.014 0.5120.009 0.0670.001 0.1110.006 0.1830.007 3.3100.037 0.0640.011
45 0.0620.005 0.4680.013 0.5210.009 0.0730.002 0.1160.006 0.1920.008 3.3010.021 0.0790.011
60 0.0660.005 0.4770.013 0.5270.010 0.0790.004 0.1210.009 0.1980.009 3.3150.011 0.0950.012
90 0.0680.005 0.4820.012 0.5320.010 0.0820.005 0.1240.010 0.2020.011 3.3160.014 0.1090.013
120 0.0710.006 0.4870.011 0.5380.012 0.0860.005 0.1270.010 0.2070.012 3.3260.009 0.1240.016
150 0.0740.006 0.4900.013 0.5420.013 0.0890.006 0.1300.011 0.2110.012 3.3340.014 0.1380.017
180 0.0790.005 0.4940.012 0.5470.013 0.0920.275 0.1320.011 0.2150.012 3.3020.033 0.1520.017
210 0.0810.005 0.4980.013 0.5500.013 0.0940.006 0.1340.011 0.2180.012 3.3040.011 0.1660.018
240 0.0840.005 0.5020.014 0.5550.012 0.0960.006 0.1370.011 0.2220.012 3.3180.021 0.1790.017
Table depicts Ferric Reducing Antioxidant Power (FRAP) assay of C. asiatica and V. amygdalina
aqueous, ethanolic and methanolic extracts and positive controls ascorbic acid and BHT at 1 mg/ml
concentration. Absorbance was recorded at 595 nm.
a
Assay was performed in trplicate and results presented as mean SD.

Table 3b: Ferric Reducing Antioxidant Power (FRAP) activity in 0.5 mg/ml of sample and positive
control
T Absorbance 595nma
Time Centella asiatica Vernonia amygdalina Ascorbic
BHT
(s) aqueous ethanolic methanolic aqueous ethanolic methanolic acid
0 0.0250.003 0.2110.003 0.2580.012 0.0250.002 0.0450.003 0.0840.008 2.1920.090 0.0070.007
15 0.0340.001 0.2200.002 0.2650.006 0.0350.004 0.0510.001 0.0870.003 2.2420.086 0.0060.004
30 0.0370.003 0.2250.002 0.2720.004 0.0390.005 0.0550.003 0.0920.002 2.2460.086 0.0100.005
45 0.0390.004 0.2280.003 0.2750.005 0.0430.007 0.0560.003 0.0950.001 2.2530.087 0.0160.008
60 0.0410.004 0.2310.003 0.2770.006 0.0440.006 0.0570.003 0.0980.002 2.2510.087 0.0250.010
90 0.0440.003 0.2380.006 0.2840.008 0.0470.001 0.0600.004 0.1030.009 2.2610.095 0.0530.038
120 0.0450.004 0.2400.006 0.2860.007 0.0480.001 0.0610.005 0.1050.009 2.2680.104 0.0620.039
150 0.0460.003 0.2420.006 0.2870.008 0.0490.001 0.0610.005 0.1060.009 2.2740.102 0.0700.039
180 0.0460.003 0.2440.005 0.2880.007 0.0490.002 0.0610.005 0.1080.009 2.2840.099 0.0770.039
210 0.0480.003 0.2460.005 0.2910.007 0.0510.001 0.0620.005 0.1090.009 2.2870.104 0.0840.040
240 0.0490.004 0.2500.005 0.2950.007 0.0530.001 0.0640.006 0.1120.010 2.2950.104 0.0940.044
Table depicts Ferric Reducing Antioxidant Power (FRAP) assay of C. asiatica and V. amygdalina
aqueous, ethanolic and methanolic extracts and positive controls ascorbic acid and BHT at 0.5mg/ml
concentration. Absorbance was recorded at 595 nm.
a
Assay was performed in trplicate and results presented as mean SD.

221
Appendices

Appendix H continued

Table 3c: Ferric Reducing Antioxidant Power (FRAP) activity of standard ferrous sulphate
(FeSO4.7H2O) at varying concentrations
Concentration
100 200 400 600 800 1000
(mol/L)
Absorbance
0.0150.023 0.0550.012 0.1190.036 0.2080.012 0.0890.049 0.0440.025
595nm
Table depicts Ferric Reducing Antioxidant Power (FRAP) activity of standard ferrous sulphate (100-1000
mol/L) at absorbance 595 nm which was used to plot the FeSO4.7H2O standard curve. Results were
presented as mean SD, where n = 3.

0.250 y = 0.0003x
R = 0.9668

0.200
Absorbance 595 nm

0.150

0.100

0.050

0.000
0 100 200 300 400 500 600 700
-0.050
Concentration (mol/L)

Figure 8: Ferrous sulphate (FeSO4.7H2O) standard curve with FRAP assay


Graph depicts the ferrous sulphate (FeSO4.7H2O) standard curve in FRAP assay whereby the absorbance
at 595 nm was plot against concentration (100-600 mol/L) of FeSO4.7H2O. Standard curve was used to
determine the antioxidant activity of samples, expressed as milimole ferrous sulphate per gram dried
weight (mmol Fe2+ /g d.w.). Results were presented as mean SD, where n = 3.

222
Appendices

Appendix I. Results for the Protective Effect of C. asiatica and V. amygdalina


Extracts against Hydrogen Peroxide Induced Haemolysis of Rabbit
Erythrocytes

Table 4a: Percentages of the in vitro protective effect of C. asiatica and V. amygdalina against 10
mM H2O2 induced haemolysis of rabbit erythrocytes.

Concentration (mg/ml)
Samplea
0.1 0.25 0.5 0.75 1.0
C.asiatica aqueous 77.442.28 74.162.01 75.836.76 74.162.01 76.470.79
C.asiatica ethanol 73.222.37 74.301.64 81.031.00 81.191.94 85.121.69
C.asiatica methanol 73.601.27 74.271.36 80.212.05 82.951.14 88.140.83
V. amygdalina aqueous 75.731.23 72.290.54 70.381.06 71.020.52 72.920.77
V. amygdalina ethanol 73.741.82 74.460.61 75.880.52 78.750.41 78.460.35
V. amygdalina methanol 70.230.71 73.300.20 73.391.45 74.270.06 79.250.64
Ascorbic acid 71.400.51 76.690.20 79.690.75 82.690.21 86.050.66
Phosphate buffer 72.441.04
Distilled water 0.000.00
Table depicts in vitro anti-haemolysis assay of C. asiatica and V. amygdalina aqueous, ethanolic and
methanolic extracts and positive control ascorbic acid at (0.1 1.0 mg/ml) concentrations whereby10 mM
H2O2 was used to induce haemolysis. Isotonic phosphate buffer was the standard used. Distilled water
showed 100% haemolysis.
a
Assay was performed in trplicate and results were presented as mean SD.

Table 4b: Percentages of the in vitro protective effect of C. asiatica and V. amygdalina against 50
mM H2O2 induced haemolysis of rabbit erythrocytes.
Concentration (mg/ml)
Samplea
0.1 0.25 0.5 0.75 1.0
C.asiatica aqueous 67.791.11 72.540.88 69.352.03 69.850.40 71.610.53
C.asiatica ethanol 54.931.34 74.531.64 75.690.42 83.270.54 84.730.65
C.asiatica methanol 60.340.98 66.320.62 78.062.23 85.870.40 91.810.55
V. amygdalina aqueous 55.730.34 51.760.80 59.691.62 63.730.51 57.551.46
V. amygdalina ethanol 62.591.16 68.210.39 71.841.90 75.410.63 78.100.26
V. amygdalina methanol 60.850.86 61.280.31 67.220.83 70.510.37 81.770.23
Ascorbic acid 52.701.32 64.630.65 61.711.83 62.740.15 71.970.76
Phosphate buffer 57.130.80
Distilled water 0.000.00
Table depicts in vitro anti-haemolysis assay of C. asiatica and V. amygdalina aqueous, ethanolic and
methanolic extracts and positive control ascorbic acid at (0.1 1.0 mg/ml) concentrations whereby 50
mM H2O2 was used to induce haemolysis. Isotonic phosphate buffer was the standard used. Distilled
water showed 100% haemolysis.
a
Assay was performed in trplicate and results were presented as mean SD.

223
Appendices

Appendix I continued

Figure 9a: Non-linear regression analysis of C. asiatica (A) V. amygdalina (B)


extracts and positive control (C) against 10 mM H2O2 used to determine IC50 of
in vitro haemolysis assay
Graph depicts the non-linear regression curve of C. asiatica and V. amygdalina
aqueous ( ), ethanolic ( ) and methanolic ( ) extracts and positive control
ascorbic acid ( ) used to determine IC50. The percentage inhibition of haemolysis
was plot against log concentration (-1 - 0 mg/ml). Results were presented as mean
SD, where n = 3.

224
Appendices

Appendix I continued

Figure 9b: Non-linear regression analysis of C. asiatica (A) and V. amygdalina


(B) extracts and positive control (C) against 50 mM H2O2 used to determine
IC50 of in vitro haemolysis assay
Graph depicts the non-linear regression curve of C. asiatica and V. amygdalina
aqueous ( ), ethanolic ( ) and methanolic ( ) extracts and positive control
ascorbic acid ( ) used to determine IC50. The percentage inhibition of
haemolysis was plot against log concentration (-1-0 mg/ml). Results were
presented as mean SD, where n = 3.

225
Appendices

Appendix I continued

Table 4c: In vitro anti-haemolysis effect of standard ascorbic acid at varying concentrations
Concentration
0.1 0.25 0.5 0.75 1.0
(mg/ml)

Anti-haemolysis
52.701.32 64.630.65 61.711.83 62.740.15 71.970.76
(%)

Table depicts anti-haemolysis effect of standard ascorbic acid (0.1-1.0 mg/ml) at absorbance 540 nm
which was used to plot the standard curve. Results were presented as mean SD, where n = 3.

Figure 9c: Ascorbic acid standard curve with anti-haemolysis assay


Graph depicts the ascorbic acid standard curve in anti-haemolysis assay whereby the percentage inhibition of
haemolysis was plot against concentration (0.1-1.0 mg/ml) of ascorbic acid. Standard curve was used to
determine the antioxidant activity of samples, expressed as milimole ascorbic acid equivalent per gram of
dried weight (mmole AAE/g dried weight). Results were presented as mean SD, where n = 3.

226
Appendices

Appendix J. Homogenous Peak Test of the Methanolic Extract of C. asiatica

mAU %
60

55 90

50
80
45
70
40

35 60

30
50
25
40
20

15 30

10
20
5
10
0

0
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 27.5 min

Figure 10a: Homogenous peak test of C. asiatica methanolic extract with chloramphenicol
standard.
Chromatogram displays peak obtained by spiking the plant sample with chloramphenicol standard at 280
nm wavelength.

mAU %

9
90
8
80
7
70
6
60
5
50
4

40
3

30
2

1 20

0 10

-1 0
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 min

Figure 10b: Homogenous peak test of C.asiatica methanolic extract with chloramphenicol
standard.
Chromatogram displays peak obtained by spiking the plant sample with benzoic acid standard at 280 nm
wavelength.

227
Appendices

Appendix K. LC-MS Mass Spectrum of the Extracts of C. asiatica V.


amygdalina

343.9 A B
197.8

m/z m/z

C 301.1 D
435.2

m/z m/z

153.9 E 183.9 F

m/z m/z

Figure 11a: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of 5-galloylquinic acid (A); syringic acid
(B); ellagic acid pentoside (C); hydroxybenzoic acid-O-hexoside (D); protocatechuic acid (E); and methyl gallate (F)

228
Appendices

Appendix K continued

A B
313.1
223.8

m/z m/z

C D

195.1 517.9

m/z m/z

E 339.3 F
353.1

m/z m/z

Figure 11b: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of caftaric acid (A); sinapic acid (B); ferulic
acid (C); dicaffeoylquinic acid (D); caffeoylquinic acid (E); and coumaroylquinic acid (F)

229
Appendices

Appendix K continued

369.3 305.1
A B

m/z m/z

459.3 611.3
C D

m/z m/z

479.2 625.3
E F

m/z m/z
Figure 11c: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of feruloylquinic acid (A); (-)-gallocatechin
(B); (-)-gallocatechin gallate (C); rutin (D); isorhamnetin-3-O-glucoside (E); and isorhamnetin-3-O-rutinoside (F)

230
Appendices

Appendix K continued

A 625.3 B
479.2

m/z m/z

315.2 C D
305.2

m/z m/z
E 317.1 F
437.2

m/z m/z
Figure 11d: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of quercetin-3-O-glucuronide (A); rhamnetin-
O-rutinoside (B); cirsimaritin (C); ()-taxifolin (D); phloridzin (E); and myricetin (F)

231
Appendices

Appendix L continued

285.3 A B
253.9

m/z m/z

C D
431.2
285.1

m/z m/z
449.3 E 465.3 F

m/z m/z
Figure 11e: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of acacetin (A); chrysin (B); kaempferol (C);
apigenin-7-O-glucoside (D); quercetin 3-O-rhamnoside (E); and quercetin-3-O-glucoside (F)

232
Appendices

Appendix k continued

A 581.3 B
317.1

m/z m/z

C D
449.3
181.1

m/z m/z
343.9
E 389.1 F

m/z m/z
Figure 11f: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of isorhamnetin (A); naringin (B); luteolin-7-O-
glucoside (C); theobromine (D) rosmadial (E); and medioresinol (F)

233
Appendices

Appendix k continued

322.2
A B
123.1

m/z m/z

Figure 11g: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of chloramphenicol (A); and benzoic acid (B)

234
Appendices

Appendix k continued

A 197.8 B
343.9

m/z m/z

C D
433.2 183.8

m/z m/z
169.1 343.9 153.9
E F

m/z m/z
Figure 12a: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of 5-galloylquinic acid (A); syringic acid
(B); ellagic acid pentoside (C); methyl gallate (D); vanillic acid (E); and protocatechuic acid (F)

235
Appendices

Appendix k continued

149.9 A B
223.8

m/z m/z

193.8 C 163.8 D

m/z m/z

E 181.2 F
311.2

m/z m/z
Figure 12b: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of trans-cinnamic acid (A); sinapic acid (B);
ferulic acid (C); p-coumaric acid (D); caftaric acid (E); and caffeic acid (F)

236
Appendices

Appendix k continued

515.1 A B
353.1

m/z m/z

367.1 C D
339.3

m/z m/z
291.1 459.3
E F

m/z m/z
Figure 12c: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of dicaffeoylquinic acid (A); caffeoylquinic
acid (B); feruloylquinic acid (C); coumaroylquinic acid (D); (+)-catechin/()-epicatechin (E); and (-)-gallocatechin gallate
(F)

237
Appendices

Appendix k continued

307.2 A B
447.1

m/z m/z

611.3 C 305.2 D

m/z m/z

E 625.3 F
479.2

m/z m/z
Figure 12d: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of (-)-gallocatechin (A); quercetin 3-O-
rhamnoside (B); rutin (C); taxifolin (D); isorhamnetin-3-O-glucoside (E); and isorhamnetin-3-O-rutinoside (F)

238
Appendices

Appendix k continued

A B
437.2 625.3

m/z m/z

315.2 C 431.2 D

m/z m/z

253.9 E F

611.8

m/z m/z
Figure 12e: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of phloridzin (A); rhamnetin-O-rutinoside (B);
cirsimaritin (C); apigenin-7-O-glucoside (D); chrysin (E); and neohesperidin (F)

239
Appendices

Appendix k continued

581.3 A B
271.1

m/z m/z

C 285.1 D

447.1

m/z m/z
227.1
E F
303.2

m/z m/z
Figure 12f: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of naringin (A); ()-naringenin (B); luteolin-7-
O-glucoside (C); luteolin (D);hesperitin (E); and trans-resveratrol/cis-resveratrol (F)

240
Appendices

Appendix k continued

181.2 A B
343.9

m/z m/z

347.2 C 347.2 D

m/z m/z
Figure 12g: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of theobromine (A); rosmadial (B); methyl
carnosate (C); and epirosmanol (D)

241
Appendices

Appendix L. Protocol and Data Sheet in the Study

1. Protocol used for the plant DNA extraction kit

242
Appendices

243
Appendices

2. Manual for DNA Purification Kit.

244
Appendices

245
Appendices

246
Appendices

247
Appendices

248

Potrebbero piacerti anche