Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
2014
ABSTRACT
Six species of Malaysian medicinal plants were selected on the basis of their known
medicinal values. The plants chosen were Aloe vera - leaf and pulp, Azadirachta indica -
leaf, Carica papaya - leaf, Centella asiatica - whole plant, Hymenocallis speciosa - leaf,
tuber and root, Vernonia amygdalina - leaf and stem. Aqueous and ethanolic extract of the
plant tissues were tested for their antimicrobial properties against five test microorganisms.
Of the six plants tested, the aqueous and ethanolic extract of C. asiatica (whole
plant) exhibited highly significant antimicrobial activity against the bacterial strains while
the ethanolic extract of Vernonia amygdalina (leaf) showed distinct inhibition only towards
B. cereus. C. asiatica and V. amygdalina were selected as candidates for further evaluation
activity was due to peptides present in the plant. The antimicrobial activity for ethanolic
plant extracts was observed in the supernatant with their pellet showing insignificant
antimicrobial activity. The highest antimicrobial activity was observed in the ammonium
compounds are responsible for their antimicrobial and antioxidant properties, they were
Total phenolic content (TPC) of plant extracts were determined with Folin-
Coicalteu assay. In C. asiatica, the TPC of the ethanolic extract was the highest 4.006
0.032 mg GAE/g d.w followed by methanolic extracts 3.346 0.029 mg GAE/g d.w and
aqueous extracts 1.120 0.063 mg GAE/g d.w. In V. amygdalina, the TPC was highest in
methanolic extract 1.168 0.101 mg GAE/g d.w, followed by aqueous extract and
scavenging assay and FRAP. Using the DPPH assay, ethanolic extract of C. asiatica
showed high radical scavenging activity whereas the lowest activity was observed in the
aqueous extracts. All three extracts of V. amygdalina showed weak radical scavenging
activity. Using the FRAP assay, reducing capability of C. asiatica and was observed as
methanol > ethanol > aqueous > ascorbic acid and the reducing capability of V.
amygdalina extracts was observed as methanol > aqueous > ethanol > ascorbic acid.
Protective effect of the plant extracts were tested against hydrogen peroxide induced
mass spectroscopy (LC-MS) and fourier transform infrared spectroscopy (FT-IR). RP-
The phenolic compounds in V. amygdalina were not well separated hence LC-
acid, hydroxycinnamic acid, flavonoids, purine alkaloids and phenolic terpenes and
lignins. Amongst them, the presence of phloridzin which is known for its antidiabetic
iii
Abstrak
ABSTRAK
perubatan mereka yang diketahui. Tumbuh-tumbuhan yang dipilih adalah Aloe vera -
daun dan pulpa, Azadirachta indica - daun, Carica papaya - daun, Centella asiatica
seluruh tumbuhan, Hymenocallis speciosa - daun, ubi dan akar, Vernonia amygdalina -
daun dan batang. Ekstrak berair dan etanol tisu tumbuhan telah diuji untuk aktiviti
Daripada enam tumbuhan yang diuji, ekstrak berair dan etanol C. asiatica
(daun) menunjukkan aktiviti yang ketara hanya terhadap B. cereus. C. asiatica dan V.
amygdalina telah dipilih untuk membuat penyilidikan lanjut terhadap ciri-ciri perubatan
mereka.
antimikrobial adalah berdasarkan peptida yang hadir dalam tumbuhan. Didapati bahawa
aktiviti antimikrob adalah dalam supernatan dengan pelet menunjukkan aktiviti yang
tidak jelas bagi kedua-dua ekstrak etanol tumbuhan yang dikaji. Diperhatikan bahawa
dalam ekstrak etanol iaitu sebanyak 4.006 0.032 mg GAE/g d.w diikuti oleh ekstrak
methanol sebanyak 3.346 0.029 mg GAE/g d.w dan ekstrak berair 1.120 0.063 mg
GAE/g d.w. Kandungan fenol dalam V. amygdalina pula adalah tertinggi bagi ekstrak
iv
Abstrak
methanol iaitu sebanyak 1.168 0.101 mg GAE /g d.w, diikuti oleh ekstrak berair dan
Ciri-ciri antioksida ektrak tumbuhan telah ditentukan dengan ujian DPPH serta
tinggi manakala aktiviti terendah telah diperhatikan dalam ekstrak berair. Ketiga-tiga
diperhatikan seperti berikut methanol > etanol > berair > asid askorbik. Manakala
methanol > berair > etanol > asid askorbik. Keupayaan antihemolisis ekstrak
tumbuhan yang dikaji telah ditentukan dengan menggunakan ujian hemolisis in vitro
melindungi tertinggi terhadap hidrogen peroksida, ini diikuti dengan ekstrak etanol,
manakala ekstrak berair menunjukkan kesan yang tidak tetap. Bagi Vernonia
Sebatian fenol yang hadir dalam ekstrak tumbuhan telah ditentukan dengan
komponen penting iaitu kloramfenikol serta asid benzoik. mengenalpasti sebatian fenol
yang hadir. Pengenalpastian dua kompoun fenolik ini telah disahkan oleh analisis FT-
IR. Komponen fenol tidak dapat ditentukan bagi V. amygdalina, maka LCMS telah
dijalankan.
v
Abstrak
Analisis dengan LC-MS pula telah mengenalpasti kehadiran tiga puluh lapan
sebatian fenolik serta empat puluh dalam V. amygdalina termasuk derivatif gallic, asid
lignin. Phloridzin yang telah dikesan dalam ekstrak methanol V. amygdalina. memiliki
ciri-ciri antidiabetik.
vi
ACKNOWLEDGEMENTS
Firstly, I would like to praise and thank my Lord Jesus for helping me complete
my thesis and Masters. I want to praise and thank HIM for helping me to overcome
obstacles throughout this research and for His favour in allowing me to meet the right
people to help me with my studies.
Secondly, I want to thank Prof Sekaran Muniandy, the best supervisor for his
constant help and intelligent advice. I cannot thank him enough for his encouragement
and support throughout the period of my research. Prof Sekaran was always there to
meet, proofread and correct my thesis chapter by chapter in spite of his busy schedule.
He thought me how to express my ideas and gave me inspiring advice to approach my
research. My thesis would fail to exist if not for his constant guidance.
Next I want to thank my supervisor, Dr. Koshy Phillip for his support and ideas
throughout my thesis. My special thanks also goes to Dr. Sugumaran Manickam and the
staffs from the Herbarium, Institute of Biological Sciences, UM for helping me voucher
deposit all the medicinal plants used in my study.
Friends are worth more than jewels. I would like to acknowledge my lab mate
Wong Shin Yee for constantly being there for me and helping me out with quotations
for chemicals. Shin Yee also taught me aseptic methods in handling the bacterias used
in the study. I would also like to thank my dear friend Dr. Kadijeh Gholami for her
moral support and help in the lab.
My sincere gratitudes also go out to the staffs and lab technicians in the
Department of Chemistry, Faculty of Science UM for tirelessly helping me analyse my
plant extracts using the LC-MS, FT-IR, and NMR instrument available in their
department. I would like to thank the staffs in the Department of Biotechnology, Faculty
of Medicine, UM for helping me with the Gel Documentation Instrument and Nanodrop
used in this study.
Last, but not the least I would like to extend my deepest gratitude to my mother,
for her patience, tolerance, emotional support and encouragement throughout my
research. I also want to thank her for the financial support she has given me without any
complains. Her love and never ending sacrifices has brought me so far. I would like to
also dedicate my thesis to my late grandmother who is the driving force behind my
determination to finish my studies. Thanks ama for your constant encouragement and
advice to pursue my studies.
vii
TABLE OF CONTENT
ABSTRACT ...................................................................................................ii
ABSTRAK .................................................................................................... iv
ACKNOWLEDGEMENTS .........................................................................vii
TABLE OF CONTENT ............................................................................. viii
LIST OF FIGURES .................................................................................... xiii
LIST OF TABLES ....................................................................................... xv
LIST OF SYMBOLS AND ABBREVIATIONS ......................................xvii
viii
Table of content
x
Table of content
xii
LIST OF FIGURES
xiii
List of figures
xiv
LIST OF TABLES
xv
List of tables
xvi
LIST OF SYMBOLS AND ABBREVIATIONS
AU - absorbance unit
- alpha
ATCC - American Type Culture Collection
AMPs - Antimicrobial peptides
ANOVA - Analysis of variance
bp - base pair
- beta
BHA - butylated hydroxyanisole
BHT - butylated hydroxytoluene
C3 - carbon 3
C6 - carbon 6
cm - centimetres
R2 - coefficient of determinant
r - correlation coefficient
p - correlation coefficient
C - degree Celsius
DNA - deoxyribonucleic acid
DPPH - 2,2-diphenxl-1-picrylhydrazyl
FeCl3.6H2O - ferric (III) chloride
FRAP - Ferric Reducing Antioxidant Power
FeSO4.7H2O - ferrous sulphate
FT-IR - Fourier Transform Infrared Spectroscopy
g/l - gram per litre
HSV-1 - Herpes Simplex Virus-1
FeCl3 - iron (III) chloride haxahydrate
IPB - isotonic phosphate buffer
HCl - hydrochloric acid
H2O2 - hydrogen peroxide
OH - hydroxyl
HIV - Human Immunodeficiency Virus
ITS2 - Internal transcriber spacer 2
xvii
List of symbols and abbreviations
kDa - kiloDalton
LC-MS - Liquid Chromatography-Mass Spectroscopy
m - metres
- micro
ml - millilitre
mg/ml - milligram per millilitre
mM - millimolar
mg GAE/g d.w. - milligram gallic acid equivalent per gram dry weight
mmol AAE/g d.w. - milimole ascorbic acid equivalent per gram dried
weight
mmol Fe2+ /g d.w. - milimole ferrous sulphate per gram dried weight
mmol TE/g d.w. - milimole Trolox equivalent per gram dried weight
MS - mutans streptococci
nm - nanometre
O2- - oxide anion
PCR - Polymerase chain reaction
Tween 80 - Polyoxyethylene sorbitan mono-oleate
TBE-EDTA - Tris-Borate-EDTA
TFA - trifluoroacetic acid
RP-HPLC - Reverse Phase-High Performance Liquid
Chromatography
TMV - Tobacco Mosaic Virus
TPC - Total phenolic content
ROS - reactive oxygen species
RNA - ribonucleic acid
SD - standard deviation
TPTZ - 2,4,6-tri(2-pyridyl)-S-triazine
UTI - urinary tract infection
VZV - Varicella Zoster Virus
v/v - volume to volume
v/w - volume to weight
xviii
1.0 INTRODUCTION
a growing problem. Fleming (1929) discovered the first antibiotic, penicillin which was
a mould that was able to lyse Staphylococcus aureus cells. Pharmacological industries
have produced various new antibiotics ever since, but microorganisms have slowly
developed resistance to these drugs because bacteria have the genetic ability to transmit
Plants have been used to maintain human health because they possess chemical
compounds that are able to prevent and cure diseases (Nascimento et al., 2000).
Furthermore, plant products are a better alternative compared to antibiotics and other
synthetic drugs which display negative side effects such as sensitization reactions, and
disruption of the metabolic processes in the body via interaction with the body system
(Jamil et al., 2007). Hence antimicrobial agents from plants are a more reliable and
used to treat diseases and inhibit microbial infections (Hemaiswarya et al., 2008; Jain,
1994). These natural products exhibit selective toxicity towards pathogenic bacteria and
are generally harmless to host cells (Craig, 1998). The morphological parts of different
medicinal plants such as the leaves, seeds, stem, roots, fruits, sap, or tuber are prepared
as extracts, infusions, decoctions, powders and are utilized to treat various diseases in
In various human cultures around the world, more than 35,000 plant species
have been exploited for medicinal purposes (Lewington, 1993). However, this number
could be inaccurate because knowledge on the indigenous uses of plants are usually not
1
Introduction
well documented and are passed on orally from one generation to another (Jantan,
2004).
species of angiosperms and 600 species of ferns whereby 15% of angiosperms and 13%
of fern species were reported to possess medicinal properties (Puteh, 2005). Some of
these have been commonly used as folk medicine for hundreds of years (Zaidan et al.,
plants in the tropical rain forest and these compounds act as defence agents against
properties of these plants products could lead to the design and synthesis of new drugs
(Jantan, 2004).
agents in plants are plant secondary metabolites and are constantly present in active
forms in all plants but in some plants they are activated by plant tissue damage or
Gopalakrishnakone, 2010).
ranging from simple structures with one aromatic ring to complex polymers such as
(etkovi et al., 2007; Croteau et al., 2000). Various studies have established that
2
Introduction
simple phenolic acids are potent antimicrobial agents (Pereira et al., 2007; Kishimoto et
al., 2005; Stoilova et al., 2005; Winkelhausen et al., 2005; Ami et al., 2003).
possess antioxidant properties and act by scavenging free radicals due to the presence of
the antioxidant properties of the plant alongside with their antimicrobial properties.
biological systems by neutralizing free radicals, quenching singlet and triplet oxygen,
Antioxidants protect the body against oxidative damage initiated by reactive oxygen
shock, arthritis, acceleration of the ageing process and tissue injuries (Shahidi, 1997).
flavonoids (Pietta, Simonetti, & Mauri, 1998) phenolic acids, and phenolic diterpenes
(Shahidi et al., 1992) are the main phenolic compounds that contribute to the
In this study, six medicinal plants of Malaysia that are common and easily
accessible: Aloe vera (aloe), Azadirachta indica (neem), Carica papaya (papaya),
Vernonia amygdalina (bitter leaf) were screened for antimicrobial activity. Plants that
showed significant antimicrobial activity Centella asiatica (C. asiatica) and Vernonia
amygdalina (V. amygdalina) were selected and further studies were conducted to
identify the compound(s) present in the plant responsible for the antimicrobial activities.
3
Introduction
creeper, flourishing in moist areas, growing naturally in India, Sri Lanka, Madagascar,
Africa, Australia, China, Indonesia and Malaysia (James & Dubery, 2009). It has been
used in ayurvedic medicine for centuries for the treatment of wound healing, asthma,
ulcers, leprosy, lupus, vein diseases, and in memory enhancement (Orhan et al., 2013;
Hashim et al., 2011; James & Dubery, 2009). Extracts of this plant were found to be
antibacterial and antifungal in properties and also displaced anticancer and antioxidant
throughout tropical Africa and is used to treat malaria, diabetes mellitus, gastrointestinal
tract conditions and sexually transmitted diseases. Currently grown in Malaysia, the
leaves are locally used for the treatment of hyperglycaemia in diabetes mellitus and
family. Based on recent studies conducted, extracts of this plant were found to be
antimicrobial, antifungal, anticancer and antidiabetic (Oga et al., 2013; Ijeh & Ejike,
2011). Antioxidant activity and phenolic content were reported in leaf extracts using
different extraction techniques (Atangwho et al., 2013; Fasakin et al., 2011; Salawu et
al., 2011; Anyasor et al., 2010; Owolabi et al., 2008) but bioactive phenolic compounds
The purpose of the research was to identify compound(s) from plant source that
compounds responsible for the antioxidant and antimicrobial activity in both C. asiatica
and V. amygdalina.
4
Introduction
antimicrobial activity.
5
2.0 LITERATURE REVIEW
available antibiotics. Bacteria that are resistant towards antibiotics, antiseptics and
disinfectants cause major health problems. Currently, bacterial resistance has resulted in
resistance may be due to mobile genetic elements such as plasmids, transposons, naked
DNA or bacteriophages (Levy & Marshall, 2004; Marchese & Schito, 2000).
patients routinely. They have successfully solved public health hazards caused by
bacterial infections, but certain antibiotics also cause delirious side effects. These side
previously uncommon diseases (Busani et al., 2012; Ghosh et al., 2008; Ahmad et al.,
1998). Antibiotics react with the body system and disrupt important metabolic processes
(Conlon et al., 2003; Hancock, 1997a; Lehrer et al., 1991). Apart from that, the
indiscriminate use of antibiotics in the treatment of infectious disease and the design of
antibiotics with limited chemical scaffolds and few advances since the 1980s, led to the
development of multiple drug resistant bacteria (Talbot et al., 2006; Shah, 2005;
Service, 1995; Davies, 1994). A potential solution to this problem is by using alternative
including antimicrobial peptides and phenolic compounds from natural sources like
medicinal plants to treat bacterial infections seem attractive (Conlon et al., 2003;
6
Literature review
The knowledge of using plants to naturally alleviate human health has been
around for decades. Around 70,000 plants have the potential to treat various ailments
(Busani et al., 2012; Jamil et al., 2007; Nascimento et al., 2000). With few exceptions,
naturally occurring plant materials have little side effects on the human body when
consumed at the right dosage and are more affordable compared to synthetic alternatives
(Ciocan & Bara, 2007). In fact, 80% of the world population depend on plant based
management, medicinal plants serve as a raw material for some important modern
medicine and were used to cure deadly diseases even before synthetic drugs were
discovered. The World Health Organization states that the best sources of a variety of
drugs are from plants (Santos et al., 1995). Medicinal plants serve as a cure for diseases
for millions of people inhabiting remote places in the world, who are unable to gain
Plant drugs are placed in two categories (i) complex mixtures such as infusions,
essential oils, tinctures or extracts and (ii) pure, active compounds from plant extracts.
Pure compound from plant extracts with strong and specific activity and/or a small
Hostettmann, 1991). Plant extracts are selected as antimicrobial agent after thorough
biological evaluation of the safety and efficacy of the extracts followed by the process
7
Literature review
home to an estimated 15000 plant species (Lattif et al., 1984). A study by Burkill
(1966), recorded about 1300 plant species were used as traditional medicine in the
Malaysian Peninsula. The tropical rainforest is rich with bioactive compounds which act
as defence agent against pests, diseases and predators. Defensive compounds from the
rainforest have greater diversity compared to those from temperate regions (Coley &
Barone, 1996).
Plant extracts from local plants have been used in the treatment of various health
ailments in Malaysia (Ong et al., 2011; Siti et al., 2009; Ong & Norzalina, 1999). Elliott
and Brimacombe (1986) found that about 25% of the drugs in modern medicine
originated from tropical rainforest plant. Various plants such as tongkat ali (Eurycoma
In Malaysia, plant samples are chosen for scientific research based on a random
medicinal plant research in Malaysia was mainly for phytochemical screening. The
beginning of medicinal plant research was started as early as 1954 by Arthur, on the
species in peninsular Malaysia for alkaloid by Douglas and Kiang (1957). Most
phytochemical screenings were done to isolate bioactive alkaloids because most of the
8
Literature review
resistance mechanism such as efflux and -lactamases that work together to promote
Plant derived antibiotics that overcome the outer membrane barrier are effective
where some defence mechanism are pre-formed while others are triggered after
recognition of pathogen attack (Jones & Dangl, 2006). Two groups of plant antibiotics
that are involved in plant defence mechanism are phytoalexins and phytoanticipins. It is
important to note that the distinction between phytoalexins and phytoanticipins is not
based on the chemical structure but how these compounds are produced in the plant
9
Literature review
2.3.1 Phytoalexins
molecules of 500 Da (Hemaiswarya et al., 2008) and are synthesized de novo after the
exposure of plant towards microbial pathogens (Grayer & Kokubun, 2001). These plant
flavonoids and polyphenols. Most of these structures have weak antimicrobial activity
compared to bacterial and fungal origin. However plant derived antibiotics have adopted
a different pathway to fight bacteria despite the fact that these antibacterial compounds
have low potency (Hemaiswarya et al., 2008). Upon detection of pathogen in the plant,
tobacco plants. This compound displays antimicrobial activity in vitro (Matros & Mock,
2004; Chong et al., 2002; Valle et al., 1997). It was shown that a decrease in scopoletin
and scopolin (glucoside form of scopoletin) levels is linked with decreased resistance
towards Tobacco Mosaic Virus (TMV) infections in tobacco plants (Chong et al.,
2002).
A B
10
Literature review
2.3.2 Phytoanticipins
weight antimicrobial compounds present in the plants before pathogenic attack or are
phytoanticipins are present on plant surfaces while others are sequestered as pre-
existing compounds in vacuoles or organelles and are released after attack by pathogen
which was discovered in oat roots (Morrissey & Osbourn, 1999). Avenacin forms
complexes with sterols in fungal membrane resulting in the loss in membrane integrity
due to pore formation. Avenacin A-1, which is the major form of avenacin functions as
a chemical barrier in the epidermal layer of oat root tip cells and in emerging lateral root
11
Literature review
There are about 100,000 bioactive compounds produced in plants also identified
as the aromatic secondary metabolites. Secondary metabolites are mostly derived from
plant primary metabolites as they are not involved in intermediary metabolism of the
plant. The numerous secondary metabolites present in plants are a result of plant
evolution towards improved defence against microbes and predators giving plants their
antimicrobial trait (Dixon, 2001). Most secondary metabolites are constitutive in healthy
plants while others may exist as inactive precursors activated by tissue damage or
metabolites such as alkaloids, steroids, tannins, and phenolic compounds that are
synthesized and deposited in specific or in all parts of the plant. These medicinal
properties are specific in a plant family, genus and species proving the fact that
combinations of secondary metabolites are distinct between plant taxa (Parekh et al.,
2005; Balandrin et al., 1985). Composition of secondary metabolites varies between (i)
tissues such that the bark, heartwood, roots, branch basses and wound tissues have
human health and are non-toxic to the human body (Sheeba, 2010). Plant extracts work
in synergy with synthetic antibiotics against drug resistant bacteria (Ncube et al., 2008).
12
Literature review
Bioactive compounds also give plant their odour such as terpenoids whereas
plant pigments are from quinones and tannins. In addition, these compound provide
flavour, for example some herbs and spices used by humans to season their food
preparation thus it is isolated and identified (Taylor et al., 2001). However, isolating
specific active compounds identified in the plant extracts are tedious because extracts
Phenolic compounds are compounds that possess at least one aromatic ring with
a hydroxyl group or its substituent. This group of compounds was first discovered in
lignin when it stimulated various physiological responses in plants and animals (Daniel,
2006). Phenolics are synthesized from cinnamic acid that is formed from phenylanine.
The number of constitutive carbon atoms based on the basic phenolic skeleton
distinguishes each phenols such as simple phenols, benzoic acid, phenylpropanoids and
flavonoids (Michalak, 2006). They are classified based on the carbon atom numbers and
and their oxygen substituted derivatives (Geissman, 1963). Subclasses in this group
and tannins. These compounds are important antimicrobial agents and serve as the plant
13
Literature review
Phenolics are toxic to microorganisms due to the sites and number of hydroxyl
groups on the phenol groups. Past research have revealed that highly oxidized phenols
possesses stronger inhibitory actions towards a microorganism (Urs & Dunleavy, 1975).
The microorganisms are inhibited by phenolic compound via enzyme inhibition through
Wasserman, 1987).
Simple phenols and phenolic acids consist of a single substituted phenolic ring.
Simple phenols comprises of phenolic alcohols, aldehydes, ketones and their glycosides.
These compounds are colourless (as solids) and are easily oxidised upon exposure to air
and alkaline conditions. Woody plants contain free phenols whereas metabolically
active plants contain glycosylated phenols (Hopkinson, 1969). The number of hydroxyl
groups and their site(s) determine their toxicity towards microorganisms (Scalbert,
A B
D E
14
Literature review
Phenolic acids comprises of benzoic and cinnamic acids. Common benzoic acid
includes p-hydroxy benzoic, vanillic and syringic acid found in lignin in angiosperms.
Some phenolic acids common in plants are gentisic and protocatechuic acid (Daniel,
2006).
Purified aloe emodin that contains the polyphenols caffeic acid (Figure 1-3A),
rosmaric (Figure 1-3B) and chlorogenic (Figure 1-3C) derivatives inhibits Herpes
simplex virus-1 (HSV-1), Varicella zoster virus (VZV), pseudorabies and influenza
indicates that antimicrobial activity is related to the site(s) and number of hydroxyl
groups (Li et al., 2004). This is evident in catechol (Figure 1-3D) which has two
hydroxyl groups and pyrogallol (Figure 1-3E) which has three hydroxyl groups,
authors also discovered that highly oxidized phenolic compounds are better inhibitors
2.4.1.2 Coumarins
and -pyrone rings (O'Kennedy & Thornes, 1997). They are responsible for the
characteristic odour of hay and possess antithrombotic (Thastrup et al., 1985), anti-
Coumarins were found to be toxic towards rodents, however based on recent studies,
toxic coumarin derivatives are excreted via the urine (Weinmann, 1997).
15
Literature review
1993), and are used as an oral anticoagulant to inhibit HSV-1 that causes cold sores in
humans (Eloff & McGaw, 2006). Based on a study conducted by O'Kennedy and
Thornes (1997), it was discovered that coumarins inhibited Candida albicans in patients
and C. inophyllum, from the tropical rainforest trees of Sarawak, Malaysia (Currens et
cordatoloids, based on the C-4 substituent on the lactone ring, are natural reverse
that may be useful when combined with other antiretroviral drugs (Cos et al., 2004).
A B
16
Literature review
2.4.1.3 Quinones
rings with two ketone substitutions. Quinones are coloured compounds responsible for
the browning of cut or injured fruits and vegetables, colour of henna used as dye and an
intermediate in the melanin synthesis pathway of skin (Schmidt, 1988; Fessenden &
Fessenden, 1982). Oxidation and reduction reactions occur easily leading to the switch
between diphenol (hydroquinone) and diketone (quinone), rendering the redox potential
(Cowan, 1999).
A B
resulting in the loss of protein function (Stern et al., 1996). This makes it a potential
tree in Pakistan, Cassia italica was discovered to possess bacteriostatic activity against
17
Literature review
isolated from Hypericum perforatum (St. Johns wort) was reported to possess
occur as a C6 - C3 unit linked to an aromatic ring (Dixon et al., 1983). Flavonoids have a
broad spectrum of antimicrobial activity due to their ability to form complexes with
extracellular and soluble proteins and to interfere with bacterial cell walls (De Clercq,
2000). Lipophilic flavonoids disrupt microbial membranes (Tsuchiya et al., 1996) and
flavonoids lacking hydroxyl groups on their -rings are active antimicrobials (Chaurasia
compounds have antimicrobial properties (Toda et al., 1989) that inhibit Vibrio
cholerae O1 (Borris, 1996), Streptococcus mutans (Tsuchiya et al., 1996; Batista et al.,
1994; Sakanaka et al., 1992; Sakanaka et al., 1989), Shigella (Vijaya et al., 1995), and
other bacteria and microorganisms (Sakanaka et al., 1992; Thomson & Schultes, 1978).
A B C
from Helichrysum aureonitens, which inhibits HSV-1 and coxsackie B virus, (ii)
swertifrancheside, glycyrrhizin and chrysin (Figure 1-6C) which inhibit HIV (Cos et al.,
2004; Jassim & Naji, 2003). Wogonin is a natural mono flavonoid, with rapid tissue
anticancer, neuroprotective, and antiviral activities (Tai et al., 2005). This compound is
2.4.1.5 Tannins
3000 Da, found in the bark, wood, leaves, fruits, and roots of plants (Scalbert, 1991).
They possess astringent property and are responsible in tanning leather and precipitating
gelatine from solutions (Basri & Fan, 2005; Nizet et al., 2001). Tannins are soluble in
water, alcohol and acetone and form precipitates with proteins (Basri & Fan, 2005).
A B
tannins exist as multiple esters with D-glucose conjugate on gallic acid subunit whereas
Tannins were widely studied when tannin-containing beverages such as red wines
and green teas were found to prevent and cure various illness when consumed over a
period of time (Serafini et al., 1994). Tannins can stimulate phagocytic cells and inhibit
tumours and bacteria by forming complexes with microbial proteins via hydrogen
bonding, hydrophobic effect or covalent bonding (Stern et al., 1996; Haslam, 1996).
studied the antimicrobial properties of tannins and found that they were toxic towards
filamentous fungi, yeasts, and bacteria. Methanolic extracts from the bark of Terminalia
alata in Nepal were antibiotic in nature (Taylor et al., 1996). In ripe fruits, antimicrobial
properties of tannins are due to hydrolysis of the ester linkage between gallic acid and
polyols and this serves as a natural defence mechanism (Samy & Gopalakrishnakone,
2010). Traditional medicine practitioners commonly use tannins to treat mouth ulcers,
Essential oil or quinta essentia are compounds responsible for the fragrance in
plants. Essential oil comprises of phenolic compounds with a C3 side chain and has a
low level of oxidation state in the absence of oxygen. Oils with enriched isoprene
structure are identified as terpenes (Figure 1-8A), having a general chemical formula of
C10H16. Terpenes exist as di (C20), tri (C30), tetra (C40), hemi (C5) or sesquiterpenes
(C15). Compounds with additional elements, usually oxygen are termed as terpenoids.
20
Literature review
Terpenoids share a common origin with fatty acids but differ from fatty acids
due to extensive branching and they possess cyclic ring structure. They actively inhibit
bacteria (Amaral et al., 1998; Ahmed et al., 1993; Habtemariam et al., 1993), fungi
(Ayafor et al., 1994; Harrigan et al., 1993; Kubo et al., 1993), viruses (Sun et al., 1996;
Xu et al., 1996; Pengsuparp et al., 1994), and protozoa (Ghoshal et al., 1996;
A B C
antimalarial properties (Vishwakarma, 1990). Chaurasia and Vyas (1977) reported that
about 60% of essential oil derivatives inhibited fungi whereas about 30% inhibited
Cinnamaldehyde also inhibited oral bacteria and was used in antiseptic mouthwashes
(Wallace, 2004). Other bioactive compounds isolated from essential oils includes
used in many cuisines across the world (Vishwakarma, 1990). Capsaicin was found to
inhibit Helicobacter pylori and was also reported to be analgesic (Cordell & Araujo,
21
Literature review
1993) as it affects the nervous, cardiovascular and digestive systems in humans (Virus
2.4.3 Alkaloids
amino acids (Figure 1-9A). Structures of the alkaloid ring includes pyridines, pyrroles,
Morphine (Figure 1-9B) was the first medically useful alkaloid isolated from the flower
A B
identified as alkaloids (Das et al., 2010) such as (i) diterpenoid isolated from the
et al., 1997; Atta & Choudhary, 1995; Jones Jr & Luchsinger, 1979); (ii) solamargine, a
glycoalkaloid from Solanum khasianum berries which inhibits HIV and intestinal
infections associated with AIDS (McDevitt et al., 1996; McMahon et al., 1995); and
22
Literature review
provides fast and effective means of defences against invading pathogens in the
majority of living organisms. The characteristic properties of AMPs include small size
(less than 10kDa), cationic, amphipathic and vary in length, sequence and structure.
and gram-negative bacteria, protozoa, yeast, fungi and viruses (Reddy et al., 2004). The
first AMP discovered was from wheat flour in 1942 (Balls et al., 1942).
AMPs are classified into five main groups. The five groups comprises of peptides
(i) that form -helical structure; (ii) -sheet; (iii) rich in cysteine residues; (iv) rich in
regular amino acids (mostly histatin, arginine and proline); and (v) composed of rare
and modified amino acids. Mode of action is by selective destruction of cell membranes
and the amphipathic structural arrangement by the AMPs. Examples of the mode of
action includes the Barrel stave and carpet model (Reddy et al., 2004).
23
Literature review
Various plants have been discovered to possess low molecular mass peptides (Ye
& Ng, 2002; Huynh et al., 1996; Osborn et al., 1995). These peptides are tissue specific
(Price et al., 1987), located in the external layers of plant tissues and act as the first line
of 47 amino acids and is effective against yeast and bacteria (De Caleya et al., 1972).
Another antimicrobial peptide isolated from fava beans, identified as fabatin was found
to inhibit E. coli, P. aeruginosa, and Enterococcus hirae (Zhang & Lewis, 1997).
The body generates free radicals through metabolic pathways and immune
functions. Apart from that, the level of free radicals is also elevated in the body through
environmental pollution, pesticides, radiation and ageing (Adedapo et al., 2009; Gulcin
et al., 2007). Free radicals are categorized as reactive oxygen species (ROS) which
includes radical super oxide anion (O2-), hydroxyl (OH) and non-radicals such as
hydrogen peroxide (H2O2). ROS target cellular and extracellular components such as
lipids, proteins, enzymes, DNA, and RNA resulting in cell death by necrosis or
stress (Peuchant et al., 2004; Gilgun-Sherki et al., 2002). Oxidative stress may lead to
inflammatory diseases (Calir et al., 2009; Que et al., 2007; Sharififar et al., 2007;
Gerber et al., 2002; Anderson et al., 2001a; Shahidi et al., 1992; Cerutti, 1991).
24
Literature review
Antioxidants present in food are able to scavenge ROS and prevent the onset and
progression of degenerative diseases (Knekt et al., 1996). Medicinal plants were found
flavonoids (Pietta, Simonetti, Gardana, et al., 1998), phenolic acids, and phenolic
free radicals via donating a hydrogen atom to reduce ROS; (ii) their high tendency to
chelate metal ions due to the presence of hydroxyl and carboxyl groups; and (iii) ability
2003; Yang et al., 2001). Antioxidant activity of medicinal plants against hydroxyl
radicals, superoxide anions, singlet oxygen and lipid peroxides have been investigated
(Yen & Chen, 1995; Masaki et al., 1995) and are associated to preventing occurrence of
hydroxytoluene (BHT) used in the food industry to prolong shelf life of food may cause
liver damage and carcinogenesis (Wichi, 1988; Witschi, 1986). Therefore antioxidants
25
Literature review
Plants were selected based on several factors: (i) ethnobotanical approach which
(ii) chemotaxonomic approach where the relatives of plants known to produce useful
compounds were selected; and (iii) by random selection (Jantan, 2004). In the
taxonomy and occurrence of plant secondary metabolites. The same active biological
compounds may be present in related species, genera or families (Eloff & McGaw,
2006). Based on the above criterias Aloe vera, Azadirachta indica, Carica papaya,
Centella asiatica, Hymenocallis speciosa and Vernonia amygdalina were chosen for
investigation.
rationale of their medicines and their knowledge is purely based on experience (Gurib-
plants on treatment and prevention of diseases is required for more rational prescription.
tall, spreading by offsets and root sprouts. The plant consists of elongated, pointed,
thick and fleshy, green leaves with a serrated margin. The spike which is about 90 cm
tall produces flowers. Each flower pendula has a yellow tubular corolla that is 2 to 3 cm
long. The tissue in the centre of the aloe leaf contains a bitter, yellow latex and a
transparent mucilaginous gel which is responsible for most of the bioactive compounds
26
Literature review
A. vera comprises of over 400 different species and belongs to the Liliaceae
family (Grover et al., 2011) formerly known as the Asphodelaceae family. Another
27
Literature review
A. vera is native to North Africa, the Mediterranean region of South Europe and
the Canary Islands. Now, it is widely cultivated in West Indies, tropical America and in
tropical regions (Ross, 1999a). A. vera pulp is made up of 98.5% water, whereas the gel
is made up of 99.5% water (Eshun & He, 2004). The remaining percentages of materials
are fat soluble vitamins, minerals, enzymes, polysaccharides, phenolic compounds and
This plant has many healing properties such that it relieves burning sensations,
and blisters, heals ulcers, wounds on the skin and gastrointestinal lining through the
al., 2010; Yates et al., 1992; Peng et al., 1991). The fresh leaf juice is used to treat
rashes, vaginal infection, eczema, foot sores, fungus attacks, eye infections and fever
(Anbarashan et al., 2011; Kumar et al., 2010). The leaf sap or juice is applied externally
In Indonesia, the locals mix the sap with other ingredients to mask the bitter
taste to cure asthma and cough. In Malaysia, aloe drug jadam is used as an aperient, to
heal wounds and swelling and daubed in the abdomen when fever and after confinement
(de Padua et al., 1999). It also aids digestion, blood circulation and the lymph system
and improves the function of the liver and gall bladder (Kumar et al., 2010). A. vera is
a good absorbent and penetrates into tissues of the skin four times faster than water
making it a good moisturizer, cleanser, exfoliator and it relieves joint and muscle pains
antimicrobial activity against gram-negative and positive bacteria (Habeeb et al., 2007).
Propionibacterium acne, Helicobacter pylori and Salmonella typhi (Ferro et al., 2003;
28
Literature review
Pugh et al., 2001; Lawless & Allan, 2000; Reynolds & Dweck, 1999; Urch, 1999). A.
vera also inhibits oral bacteria which cause gum diseases and therefore it was
incorporated into toothpaste and rubbed on the gums (Kumar et al., 2010).
A. indica or better known as neem was discovered more than 2000 years as the
most versatile medicinal plant with an array of biological activities. Every part of the
plant is useful in treating various diseases. Hence it was given the Sanskrit name
arisjtha which means reliever of sicknesses(Biswas et al., 2002). In 1992 this plant
rough, dark brown with flat ridges separating the wide longitudinal fissures. Leaves are
leaflet in alternate pairs. Each leaf is about 6 cm long and 2 cm wide. Flowers have
oblanceolate petals and are sweet scented with yellow, ellipsoid and gabrus drupes
measuring about 12 to 20 cm long. The sepals are ovate, about 1 cm long. Most flower
A. indica belongs to the Meliaceae family and is native to East India and Burma.
It is widely distributed in Southeast Asia and West Africa. Recently it was found in the
29
Literature review
5
4
1
2
Both the crude extracts and fractions of the leaf, root, seed, oil, fruit and bark of
the neem tree display biological activities. In folk medicine, the natives use neem oil,
bark and leaf extracts to treat leprosy, intestinal helminthiasis, respiratory disorders,
constipation and to improve health (Kirtikar & Basu, 1935). The oil is used in skin
30
Literature review
infections and to kill head lice. Mixtures containing bark, leaf, root, flower and fruit
extracts are used to treat blood morbidity, biliary afflictions, itching, skin ulcers,
burning sensations and pthysis (Biswas et al., 2002). Dried flowers are consumed orally
for diabetes and hot water extracts of the dried fruit is used to treat piles, skin diseases
and ulcers (Ross, 1999a). Leaf extracts cure ringworms, eczema and scabies. The bark
is used to cure malarial fever and leaf paste was to sooth mumps (Anbarashan et al.,
2011).
et al. (1978 ) where the blood glucose level significantly decreased and adrenaline and
Another study by El-Hawary and Kholief (1990) revealed that normal rats fed orally
with aqueous leaf extracts developed hypoglycaemia whereas blood glucose level
dropped in diabetes induced rats. Anti-acid secretory and antiulcer activity was
observed in glycosides isolated from aqueous extracts of neem (Biswas et al., 2002).
Bandyopadhyay et al. (2004) revealed that aqueous bark extracts inhibited gastric acid
and pepsin secretion and was effective in healing duodenal ulcer that was both H.
pylori mediated and non- H. pylori mediated with no significant side effects even at
high dosages.
Seed extracts and purified fractions inhibited the growth and development of
by leaf, oil and seed extracts (Schmutterer & Ascher, 1983). In vitro application of the
oil extracted from neem leaf, seed and bark inhibited Gram-negative and Gram-positive
streptomycin resistant strains (Almas, 1999; Satyavati et al., 1976; Chopra et al., 1952).
31
Literature review
10 metres tall. The stem is about 25 cm thick and may be simple or branched above the
middle. Leaves have a cylindrical stalk, clustered around the apex of the stem with
branches that are 25 to 100 cm long. Each leaf blade has lobes and prominent veins.
Flowers are hermaphrodite and the male plant may convert to female once beheaded.
Otherwise male (with drooping peduncles) and female (short stalked) flowers are borne
on separate plants. Flower consist of 5 white petals, are oblong, recurved and emerge
singly or clustered from the main stem among the lower leaf. The fruit comes in
various forms and sizes with a smooth and thin skin, deep yellow to orange colour when
ripe. The flesh is red, juicy and sweet, with a central cavity containing a mucous pulp
C. papaya originated from Southern Mexico and Central America. Currently this
commercial crop. Parts of the plant that are beneficial to humans are the leaves, fruit,
seed, latex and root (Ross, 1999b). In Burma, the latex is used externally to cure
diphtheria and tapeworms. In China, the pulp is utilized to reduce swelling and
inflammation of the feet (Wiart, 2002). In Malaysia the fresh unripe fruit juice and hot
Peninsular the root paste is rubbed on the body during confinement; seeds are consumed
to induce abortion; latex is used to remove patches on skin. The latex of unripe fruit was
32
Literature review
10
2 3
11
5 6 7 8 9
produced in the leaf, bark and twig. The tree has an array of natural self-defence
Ahmad et al. (2011) proved that C. papaya leaf extract could cure dengue fever when a
45 year old patient who was bitten by a carrier mosquito was administered with aqueous
leaf extract twice daily for five consecutive days. Based on the patients condition and
blood reports aqueous extracts of C. papaya leaves exhibited activity against dengue
fever.
33
Literature review
Plant latex was applied to the teeth to relieve inflammatory pain (Anbarashan et
al., 2011). Leaf extracts possesses antitumor agents and the juice is consumed to treat
warts, cancer, tumour, and induration of the skin (Hartwell, 1969). Aqueous leaf
extract of the leaf and stem inhibited E. coli, S. flexnert, S. paratyphi A, S. typhi, P.
miracle elixirs of life, and is an important herb. It is used as a cover crop in tea and
rubber plantations, incorporated into food where locals eat it raw or cooked, in salads or
Umbelliferae family, comprising of over 3000 herbaceous species. This family consists
of many of the common spices and herbs used today. Some of the common herbs with
medicinal properties belonging to this family are caraway (Carum carvi) used against
Centella is made up of about 40 species that are found widely growing only in
South Africa. Exception is made for the species C. asiatica which is distributed
throughout South-East Asia and some subtropical regions (Hargono et al., 1999). Parts
34
Literature review
of the plant that are useful to humans are the whole plant, leaves, fruits, root and seed
(Kapoor, 1990).
4
5
3
2
6
This plant has been around since prehistory to treat a wide range of health
problems in southern-Asia, China and India. In China, this plant is known for its cooling
properties and is used as a tonic. In India it is used as a tonic, to treat dysentery and as a
In Vietnam, it is used for the treatment against senility (Hargono et al., 1999). In
hypertension, to improve memory, and relieve indigestion. It is also used to cure malaria
and sore eyes in Kelantan (Sabariah, 1987). And in Sabah it is used to reduce fever, cool
35
Literature review
This plant is popular amongst traditional medicine practitioners. The whole plant
is used to cure skin related diseases. Plant extracts are used to heal surgical wounds
minor burns, keloids, leg ulcers, slow healing wounds, lupus, scleroderma, leprosy and
cellulitis. Pure extracts accelerate skin grafting and cicatrizing (Hargono et al., 1999).
Seeds were used to cure dysentery, headache and fever. A small quantity of the plant
stimulates appetite, aids indigestion and alleviates bowel trouble in children. Decoctions
asiatic acid and madecassic acid were identified as biologically active compounds
responsible for the medicinal properties of the plant. Aqueous extracts was discovered
to inhibit Herpes simplex II virus and asiaticosida isolated from the plant accelerated the
plant (Stevens, 2001; Meerow & Snijman, 1998). The plant has 7 to 9 evergreen,
rosulate leaves that lasts more than a year and are long, broad, elliptic blades with a
distinct petiole. Each plant produces about 7 to 12 white flowers that are wide-spreading
with pedicels of 1 cm long. The stamina cup is funnel shaped, placed between the erect
36
Literature review
cure various diseases since thousands of years. Many bioactive compounds such as
alkaloids, phenolics, flavonoids and glycosides were isolated from this family. Amongst
with the pharmacological effects of the plant (Jin & Xu, 2013). A study by ener et al.
(2003) proved that four groups of amaryllidaceae alkaloids isolated from plant extracts
locally known as pokok demam panas were used to cure jaundice. The leaf extract was
prepared as a decoction and was administered to the patient by bath (Azliza et al.,
2012).
37
Literature review
regions, dominating South Africa and is popular as a leafy vegetable amongst the Ibos
clan in Nigeria (Sule & Agbabiaka, 2008). About 35 species are distributed in Malaysia
4
4
3
38
Literature review
with a characteristic odour and bitter taste. Bark is rough with dense black straits (Sule
& Agbabiaka, 2008; Owolabi et al., 2008). Flowers are white or purple coloured,
bisexual with a funnel shaped limb and fused anthers (Chuakul et al., 1999).
The Asteraceae family comprises of 25000 species and 1400 genera, well distributed
in most ecosystems. Some members of this family produce sesquiterpene lactones that
activity in Senecio species. Others produce diterpene glycoside stevioside which has
The leaves of V. amygdalina are extremely bitter due to the presence of bioactive
compounds such as alkaloids, saponins, tannins and glycosides. Leaves are added into
the famous bitterleaf soup and the water extract are consumed as a tonic to promote
health (Farombi & Owoeye, 2011). It was also consumed by wild chimpanzees to cure
parasitic infection (Huffman & Seifu, 1989). In Nigeria and other African countries, the
leaf is used to treat fever, emesis, nausea, dysentery, gastrointestinal disorders, diabetes
al., 2012; Igile et al., 1994). Flavonoids were responsible for antioxidant properties in
plant and saponins stimulate antitumor activity in leukaemia cells (Jisaka et al., 1993).
antimicrobial activities.
39
Literature review
Anticancer activity was observed in the treatment of breast cancer where low
doses of aqueous leaf extracts inactivated the human breast cancer cells (MCF-7) in
vitro (Gresham et al., 2008). Antidiabetic activity was observed by Ekpenyong et al.
(1999) when aqueous leaf extracts of V. amygdalina lowered blood glucose levels in
diabetic induced rabbits. The reduction of blood glucose levels in normal and diabetic
rats were significant when compared to the diabetic drug chlorpropamide (Osinubi,
2008).
Farombi, 2010; Iwalokun et al., 2006) due to the presence of flavonoids in the plant
(Igile et al., 1994). Leaf extracts inhibited Plasmodium berghei in mice, with
antimalarial activity (Audu et al., 2012). The plant also possessed amoebicidal activity
dysenteriae and S. aureus (Akinpelu, 1999). Erasto et al. (2006) isolated vernolide and
pooni. The stems inhibit oral bacteria and are used as chew sticks to treat dental
40
Literature review
techniques to isolate biologically active compounds of plant tissue. The solvents diffuse
into the solid plant tissues and solubilize compounds of similar polarity (Green, 2004).
Quality and efficiency of plant extracts depends on plant material (wet or dry), type of
Firstly, plant materials are carefully selected for collection. Leaves that were
infested with insect or fungus are discarded because these contaminants could affect the
chemical composition and biological activity. Underground parts of a plant such as the
roots, tuber, rhizome, and bulb are preferred to isolate bioactive compounds possessing
either fresh or dried materials. Dried plant materials were favoured based on several
factors. Firstly, bioactive compounds are more prominent in extracts from dry material
because drying lyses the membranes of plant organelle containing different secondary
metabolites making the extraction more efficient. However, liable compounds may be
aqueous extracts. Thirdly, fresh plant materials are difficult to work with as there is time
delay between plant collection and processing (Angeh, 2006). Fourthly, during
41
Literature review
in water content making the secondary metabolites unstable (Ncube et al., 2008).
Before extraction, plants are air dried (Baris et al., 2006; Dilika et al., 1997) to a
constant weight or dried in an oven at 40C for 72 hours (Salie et al., 1996). Plant
materials are dried at a low temperature to prevent the loss of volatile bioactive
compounds (Wang et al., 2002). Different drying techniques may produce different
lyophilized materials because volatile antibacterial compounds were lost. The highest
activity was observed when plant materials were dried slowly at a low temperature
different bioactive compounds isolated. Solvents are chosen based on the yield of
low heat, physiological absorption of extracts, ability to preserve plant materials and
inability to cause the extract to complex or dissociate (Hughes, 2002). Traces of residual
solvent may be present in the final product of extract even after evaporation, thus the
solvent chosen should be non-toxic, non-hazardous to health and should not affect
compound that needs to be isolated from the plant such as phenolic compounds or
antimicrobial compounds. Crude or alcohol extracts are used for the initial screening of
plants for antimicrobial activity which is then followed by organic solvent extraction.
42
Literature review
Aqueous extracts are most commonly used because traditional medicine practitioners
use water to make their concoctions and water is a universal solvent. However, it was
discovered that plant extracts from organic solutions effectively isolated bioactive
compounds and showed higher antimicrobial activity (Parekh et al., 2005). For example
exhibit antimicrobial activity and only exhibited antioxidant activity (Nang et al., 2007;
the most effective solvents used for preliminary screening of plant antimicrobial activity
are methanol, ethanol and water (Parekh et al., 2006; Rojas et al., 2006; Lourens et al.,
solvent, temperature, size of the plant tissue particles and the solvent-to-sample ratio.
The most important step in extraction is the wet or dry plant material must be
homogenized to form finer tissue particles to increase the surface area for extraction
thereby increasing the rate of extraction. This will also shorten the extraction time. Eloff
(1998), proved that fine plant particles (10 m diameter) produced higher extraction
yield over a period of 5 minutes compared to coarsely ground materials that were placed
in a shaker for 24 hours. Thus the rate of extraction is increased by grinding plant
materials to finer particles, increasing the time of contact between material and solvent
and shaking the plant material in the solvent (Ncube et al., 2008).
The most commonly used extraction technique is maceration (Basri & Fan,
2005; Parekh et al., 2005; Meyer & Dilika, 1996) whereby wet or dry plant parts are
43
Literature review
stoppered bottle for a defined period of time (usually 24 hours) with vigorous shaking
(Handa, 2008). The ideal solvent to sample ratio is 10:1 (v/w) (Green, 2004). The
extract is filtered and the filtrate is dried down under reduced pressure. Then it is re-
Apart from that, soxhlet extraction technique is used whereby dried plant tissues
are extracted by continually exposing the materials with organic solvent (Kianbakht &
Jahaniani, 2003). This method is suitable for compounds that can withstand high
increasing polarity from non-polar (hexane) to polar solvents (methanol) to ensure that
compounds of all polarity are extracted (Green, 2004). Other methods are used to isolate
Specific solvent is used for the screening of specific secondary metabolites such
as methanol or ethanol are used to isolate alkaloid; acetone for flavonoids and steroids;
hexane, diethyl ether and chloroform for fat soluble oils, wax, lipids and esters;
dichloromethane for terpenoids; ethyl acetate for esters; ethanol for sterols, polyphenols,
and tannins; and water for the water soluble components such as glycosides,
44
Literature review
Over the years, bacteria have become increasingly resistant towards antibiotics.
Genetically, bacteria are able to transmit and develop resistance towards antimicrobial
drugs (Cohen, 1992). Resistance towards antimicrobial drugs are developed through (i)
reduction in bacteria efficiency to bind with the drug by modification of targeted active
site; (ii) bacteria destructs or modifies the drug by producing enzymes or; (iii) the drug
Gram-negative bacteria were chosen because the latter is more resistant to antimicrobial
agents due to the presence of an outer membrane layer (Alberts et al., 2002).
Most plant pathogens belong to the Gram-negative strains which are mostly
bacteria are usually susceptible to plant bioactive compounds suggesting that the
difference in cell wall and outer membrane layer morphology of the two bacteria strains
al., 2009).
45
Literature review
forming rod. It is about 1 - 1.2 m by 3 5 m with square ends. This bacterium has the
and vegetative cells. Spores are the infective agent for the bacterium and are 1 - 1.5 m,
ellipsoidal shaped, formed in aerobic conditions and are able to withstand extreme
environmental conditions, such as heat, freezing, drying and radiation (Jensen et al.,
2003; Davenport & Smith, 1952). Spores germinate when contacted with organic matter
or within a host cell (Arnesen et al., 2008). The vegetative cells contain an outermost
crystalline surface protein (S layer) which is formed during the cell colonization stage
of the bacteria lifecycle (Kotiranta et al., 2000; Kotiranta et al., 1998). They can grow at
A B
46
Literature review
fresh and marine waters, vegetable and the intestinal tracts of invertebrates. It can
germinate, grow and sporulate in the soil contaminating soil and food products causing
infection to the human intestine (Vilain et al., 2006; Jensen et al., 2003; Ghosh, 1978).
B. cereus is commonly associated with two types of food poisoning diseases, the
diarrhoeal and emetic type (Gaur et al., 2001). The diarrhoeal type is caused by
enterotoxins produced by vegetative cells in the small intestine which are ingested.
Protein rich food such as meat, vegetables and milk products are the source. After
ingestion, the incubation time is between 8 to 16 hours or longer, while symptoms such
as abdominal cramps, diarrhoea, nausea and vomiting usually last for 12 to 24 hours or
produced by growing cells in the food before ingestion (Bottone, 2010). Food sources
are starch rich foods such as fried and cooked rice, pasta and noodles. This type was
first identified by (Mortimer & McCann) in 1974 following several outbreaks of the
disease in the United Kingdom. Symptoms such as nausea and vomiting occur 30
minutes to 6 hours after ingestion and may last up to 24 hours (EhlingSchulz et al.,
2004).
B. cereus can be transmitted through food sources that are heat treated because
the spores can withstand high temperatures. Temperature of about 48 C, achieved after
cooking and cooling of food facilitates the germination of spores and with the absence
of other competing flora results in the healthy growth of B. cereus. It is also easily
spread through food sources of plant origin because it is a soil saprophyte (Drobniewski,
1993).
47
Literature review
central nervous system such as meningitis and brain abscesses; and respiratory
Drobniewski, 1993).
In the antibiotic resistance test, it was discovered that most B. cereus strains
E. coli is a Gram-negative bacilli that are approximately 1.0 3.0 m long with
a diameter of 0.5 m. They are non-sporus and a single layer of peptidoglycan is found
in the periplasm. They have peritrichous flagella, making them motile in liquid and the
The first E. coli was isolated by Escherich (1885) from the feces of a child in
Austria and was named as the Bacterium coli commune. E. coli colonizes the
gastrointestinal tract of infants within hours after birth and coexists in mutualism with
humans for their entire life as a harmless commensal of the intestinal tract. However,
some strains developed virulence forming pathotypes, adapting to new niches as fecal
contaminant of soil and water causing intestinal and extra-intestinal diseases (Kaper et
al., 2004).
48
Literature review
A B
diarrhoeal disease, urinary tract infection (UTI) and sepsis or meningitis. There are six
types include uropathogenic E. coli (UPEC) and meningitis associated E. coli (MNEC)
under the age of 5. Symptoms of the infection are mild watery diarrhoea or in some
cases severe, cholera-like illness which can rapidly dehydrate the body and may lead to
that lack Shiga-toxins (verocytoxin). EPEC causes watery diarrhoea with mucus,
vomiting, fever and dehydration which lasts for several days (Welch,
E. coli 0157. The disease is transmitted to humans who consume beef contaminated
with cattle feces. However in cattles this strain is a member for the intestinal microflora
49
Literature review
thus are not harmful to the animals. Pathogenic strains that do not possess enterotoxins
(Nataro et al., 1987). Symptoms include chronic watery diarrhoea and abdominal
from the other pathogenic strains because it possesses a special adhesion phenotype.
Enteroinvasive E. coli (EIEC) are phylogenetically related to Shigella species and infect
the large intestine. Patients infected experience inflammatory colitis, dysentery, bloody
diarrhoea, severe cramps and fever similar to infection caused by Shigella (Goldberg &
Theriot, 1995).
known as the urinary tract and bloodstream E. coli. About 60% of women acquire
urinary tract infection (UTI) in their lifetime (Kunin, 1994), where a large percentage is
associated with infection by UPEC (Haley et al., 1985). Another is the meningitis
associated E. coli (MNEC) which is the most common cause of neonatal meningitis.
New-borns are infected with the strain during birth when passing through the birth canal
which will cross the endothelial surface into the brain through the bloodstream. It is a
severe disease where the infected patient faces death and survivors possibly face long
frequently in a wide range of hosts, and acquires resistance easily (Erb et al., 2007).
50
Literature review
slime layer, an outer membrane, peptidoglycan layer and inner cytoplastic membrane.
The bacteria contains pathogenic components such as (i) the cell envelope that controls
adhesion, formation of microcolony, and the transport of antibacterial agents across the
cell (Peterson, 1980), (ii) pili which enables the bacterium to adhere to surfaces and for
conjugation (Weppelman & Brinton, 1971) and (iii) exotoxins (Liu, 1974). Gram-
pairs or in short chains. The bacterial colony is identified by the presence of a blue-
A B
patients (Balasubramanian et al., 2013). The microorganism infects patients with burn
51
Literature review
transplant, acute leukaemia and cancer (Morita et al., 2014; Bodey et al., 1983). It
tracts and corneal ulcer through the use of contaminated contact lenses (Wilson et al.,
(Jackson, 1994). It infects areas in the skin that are constantly exposed to moisture such
as the nails leading to the green nail syndrome where the nails develops greenish
defence mechanism is disrupted which in some cases may lead to death. However,
recovery from infection depends to the severity of the patients underlying disease
and acquired resistance towards antimicrobials and disinfectants such as 0.25% acetic
chloramphenicol (Morita et al., 2014; Stratton, 1990). The resistant characteristic is due
to the outer membrane barrier, multi drug efflux transporters, endogenous antimicrobial
inactivation and their ability to form biofilm (Poole, 2011; Lewis, 2007; Mah et al.,
2003).
52
Literature review
with spherical shape of 0.5 1.0 m in diameter, immobile and growing in grape-like
clusters. Colonies formed are yellow, growing on rich nutrient medium (Foster, 1996).
S. aureus are facultative anaerobes and common human commensal, however some
strains are pathogenic. They exist asymptomatically in the nasal cavity of about 30% of
the human population (Kluytmans et al., 1997) and are transmitted through skin-to-skin
S. aureus develops the ability to infect humans when the skin barrier is
such as diabetes (Grundmann et al., 2006). The medical problems caused by S. aureus
includes (i) superficial lesion such as boils, abscesses and wound infections; (ii) deep-
wound infection and bacteremia; (iii) toxemic syndromes such as toxic shock, scarlet
fever and food poisoning; and (iv) infections associated with indwelling medical
devices such as joint prostheses, cardiovascular devices and artificial heart valves
nares which is carried by the host for weeks or months which is then followed by
infection which spreads locally or to the blood. Once in the blood, it moves to distant
organs causing sepsis which could lead to death if left untreated (Archer, 1998).
Virulence factors include surface proteins that colonize tissues; capsule and
immunoglobulin binding protein A that inhibits phagocytosis; and toxins that damages
53
Literature review
resistance towards most antibiotics (Chambers & DeLeo, 2009). In 1940s penicillin was
able to treat S. aureus infections. However, the bacteria developed resistance towards
penicillin in 1942 (Rammelkamp & Maxon, 1942). In 1961, methicillin was discovered
aureus (MRSA). MRSA acquired resistance to all -lactam antibiotics (Knight et al.,
2012). S. aureus developed resistance to almost all antimicrobial agent due to its
commensal nature. Hence antibody based vaccines fail to immunize patients (Verkaik et
al., 2010) and this bacterium evolved to escape the host immune system (Daum &
Spellberg, 2012).
A B
54
Literature review
streptococci that infects the oral cavity (Hamada & Slade, 1980). The first bacterial
species was isolated from carious lesions in 1924 by Clarke. The name Streptococcus
mutans was designated when Gram staining of the bacterium showed oval structures
associated this organism with dental decay. However researchers later failed to isolate
this bacterium. It was rediscovered later in the 1960s in rodents (Carlsson, 1968;
A B
55
Literature review
mannitol, sorbitol and various other sugars and synthesize extracellular water soluble
glucans from sucrose were identified as S. mutans (Hamada & Slade, 1980; Stiles et al.,
1976; Ferretti & Ward, 1976). S. mutans was found to be widely distributed in animals
as it was isolated from Patas monkeys, rhesus monkeys, wild rats, and indian fruit bats
(Dent et al., 1978; Coykendall et al., 1976; Lehner et al., 1975). This microorganism
was known to be the most cariogenic oral Streptococci (Ophori et al., 2013).
lipoteichoic acids in the glycerol form. The virulence factors include the ability of S.
mutans to adhere to smooth surfaces and the acidogenic properties exhibited by the
bacteria. These factors are responsible for the bacteriums cariogenicity in both humans
and animals. Plaque formation by S. mutans is caused by the adherence of the bacterium
to smooth tooth surfaces along with the formation of glucose from the intake of sucrose
in the diet (Hamada & Slade, 1980; Ikeda et al., 1980). Plaque formation due to dietary
intake was supported by scientific findings whereby high dental decay was observed
shortly after sucrose was introduced into the diet (Loesche, 1986).
56
3.0. MATERIALS AND METHODS
57
Materials and methods
Six medicinal plants commonly found in Malaysia were selected for this study
(Appendix A). The plant samples were collected from the housing area of Seksyen 4
Petaling Jaya, Selangor, Malaysia in May 2012. Plants were chosen based on folklore
specimens were prepared and deposited at the herbarium of the Institute of Biological
1, Appendix B).
leaf
Aloe vera Aloe Asphodeloideae 47777
pulp
leaf
Hymenocallis spesiosa Lily Amaryllidaceae 47783 root
tuber
Vernonia amygdalina/
leaf
Gymnanthemum Bitterleaf Asteraceae 47784
stem
amygdalinum
Table displays the details of the selected medicinal plants and parts of plant used with voucher deposited
at the Herbarium of University of Malaya.
58
Materials and methods
The plant parts were cleaned under tap water and air-dried to a constant weight
(Das et al., 2010) at room temperature away from the exposure to sunlight to prevent
the loss of active components in the plant (Thakare, 2004). Dried plant parts were
Panasonic) and sifted to obtain fine powder and then stored in sterile 50 ml centrifuge
The outermost whorls of leaves of mature A.vera were selected from the plants,
and washed with distilled water. The yellow liquid was drained off before removing the
rind from the leaves. The leaves were sliced across the width with a sharp knife. The
inner exposed surfaces revealed a transparent gooey pulp without the addition of sap.
The pulp was scooped with a spatula and homogenized using a blender (National
UltraScientific Sdn. Bhd.) before being processed and stored at 4 C until required (Ni
59
Materials and methods
Plant sample powder was weighed and placed in a 100 ml Schott bottle. Double
distilled water was measured and poured into the Schott bottle following a solvent to
dry weight ratio of 10:1 (v/w) (Das et al., 2010). The plant samples were placed on an
orbital shaker (Edmund Bhler, Germany) for 24 hours at room temperature. The
extract was filtered through Whatman no.1 filter paper. The filtrate was lyophilized and
concentration by diluting the stock solution with double distilled water (Busani et al.,
2012).
Fine plant powder was weighed and placed in a 100 ml Schott bottle. 95%
methanol (Tedia Company Inc, USA) was measured and poured into the Schott bottles
following a solvent to dry weight ratio of 10:1 (v/w) (Das et al., 2010). The plant
sample was placed on a shaker for 72 hours at room temperature in the dark. The
solution was then filtered through Whatman no. 1 filter paper and evaporated to dryness
36 C to 40 C.
dissolved in isotonic phosphate buffer (IPB) pH 7.4 (bioWorld, USA) and stored at 4 C
60
Materials and methods
until required for experiments. The working solution was made by diluting the stock
The percentages of yield of the extracts were based on dry weight (d.w.) sample
The percentage of yield for A. vera gel was calculated based on the weight of the
freeze dried gel before extraction. The yield of extract for A. indica (leaf); A. vera (leaf
and gel); C. papaya (leaf); H. spesiosa (leaf, root, and tuber) and V. amygdalina (stem)
was determined with no replicates. The yield of extracts for the selected plants C.
61
Materials and methods
Medical plants used in the study, C. asiatica and V. amygdalina were identified
using ITS2 region as a DNA barcode based on the findings of Chen and colleagues
(2010).
Genomic DNA of plant samples C. asiatica and V. amygdalina was extracted using
a commercially available DNeasy Plant Mini Kit (Qiagen, USA, Appendix L1) as
follows:
The first step was tissue dissociation, where 100 mg of fresh plant leaves were cut
and weighed. Next, the plant sample was ground with pestle and mortar under liquid
nitrogen to obtain a fine powder and then transferred into a 1.5 ml microcentrifuge tube
The second step was DNA lysis. AP1 buffer, 400 l and RNase A, 4 l were added
into the sample tube and mixed by vortexing with a vortex machine (Grant-bio,
England). The sample was incubated in a dry bath (Thermoline, Australia) at 65 C for
10 minutes and during incubation, the tubes were inverted 2-3 times. Next, Buffer P3,
130 l was added into the sample and mixed. The tubes were incubated on ice for 5
minutes. The lysate was centrifuged for 5 minutes at 20,000 x g. Then, the lysate was
2 minutes. The flow-through was transferred into a new tube without disturbing the
62
Materials and methods
The third step was DNA binding where 1.5 volumes of Buffer AW1 was added to
the tubes and mixed by pipetting. The mixture, 650 l was transferred into a DNeasy
Mini spin column placed in a 2 ml collection tube. The tube was centrifuged at 6000 x
g for 1 min. The flow-through was discarded and this step was repeated for the
remaining samples.
The fourth step was washing. The spin column was placed back into a new 2 ml
collection tube. Buffer AW2, 500 l was added and centrifuged at 6000 x g for 1 min.
The flow-through was discarded and another 500 l Buffer AW2 was added. The tube
The fifth and final step was DNA elution. The spin column was transferred into a
new 1.5 ml microcentrifuge tube. The spin column was carefully removed from the
collection tube so that the column did not come into contact with the flow-through.
Finally 100 l of Buffer AE was added for elution. The tube was incubated at room
temperature for 5 minutes and then centrifuged at at 6000 x g for 1 min. The genomic
The concentration of the genomic DNA obtained was checked with nanodrop
(Thermo Scientific, USA). The primers used in the research for ITS2 region were
forward primer (5ATG CGA TAC TTG GTG TGA AT3) and reverse primer (5-
GAC GCT TCT CCA GAC TAC AAT-3) (Chen et al., 2010) supplied by (First BASE
Laboratories, Malaysia). Both the forward and reverse primers, 100 M were diluted to
1.0 M with nuclease-free water (Promega, USA). PCR amplification was conducted in
63
Materials and methods
Next, the PCR Mastercycler Personal (Eppendorf GmbH, Germany) was set
prepared where 13.5 g of tris (First BASE Laboratories, Malaysia), 6.875 g of boric acid
(Promega, USA) and 5 ml of EDTA were measured and added into a beaker and
distilled water was added up to 250 ml. The mixture was stirred with a stirrer. Then the
5 X TBE buffer was diluted to 0.5 X where 100 ml of 5 X TBE buffer was diluted with
64
Materials and methods
Secondly 1% (w/v) agarose gel was prepared for separating the particular size
fragments expected in the DNA sample by dissolving 0.2 g of agarose (First BASE
microwave oven until the agarose dissolved. The molten gel was left to cool on the
Life Technologies, Japan) was added to a final concentration of 0.5 g/ml. The gel
Thirdly, the gel was slowly poured into the casting tray preventing the formation
of bubbles. A comb was positioned about 0.5 - 1.0 mm above the casting tray so that a
complete well was formed when the molten agarose was added to the mold. A small
toothed comb allowed 15 l of sample per well. The gel was allowed to set completely
for 30 minutes at room temperature. Once set, the comb was carefully removed and the
gel was mounted into the electrophoresis tank (Bio-Rad, USA). 0.5 X TBE running
buffer was poured into the tank to submerge the gel so that it is completely covered in
buffer.
Next, 1 l of 6 X DNA loading dye (Promega, USA) was pipetted onto the
parafilm. Pipetting one sample at a time, firstly 2 l of DNA sample from the PCR
reaction was mixed with DNA loading dye by resuspending three times with a
micropipette on the parafilm. Next the sample was loaded into the appropriate well
carefully. This step was repeated with 1 l of 100 bp DNA ladder (Promega, USA).
The lid of the gel tank was closed, and the electrical leads were attached so that
the DNA migrated towards the positive anode (red lead). A voltage of 1 5 V/cm
(measured as the distance between the positive and negative electrodes) was applied.
The gel was run at 90 V for 35 minutes until the blue dye migrated to an appropriate
distance (75%) through the gel. When the DNA samples / dyes have migrated to a
sufficient distance through the gel, the power was turned off and the leads and lid were
65
Materials and methods
removed from the gel tank. The gel was examined under ultraviolet (UV) light and
Scientific, USA). The gels were analysed for presence of a band at 500 bp which was
The PCR product was purified with MEGAquick-spin Total Fragment DNA
Purification Kit (Intron Biotechnology Inc, Korea, Appendix L2). Firstly, 5 volumes of
BNL Buffer was added to the PCR reaction product and mixed well by vortexing. For
20 l of PCR product, 100 l of BNL Buffer was added to the tube directly. Secondly,
one MEGAquick-spin column was placed in a Collection Tube for each DNA sample.
assembly and centrifuged at 13,000 rpm for 1 minute to bind the DNA. The flow-
through was discarded and the MEGAquick-spin column was placed back into the
same 2 ml collection tube. Fourthly, 700 l of Washing Buffer was added to the column
and centrifuged at 13,000 rpm for 1 minute. The flow-through was discarded and the
MEGAquick-spin column was placed back into the same 2 ml collection tube and
microcentrifuge tube. Elution Buffer, 30 l was applied directly to the centre of the
column without touching the membrane with the pipette tip and the tube was incubated
at room temperature for 1 minute before it was centrifuged at 13,000 rpm for 1 minute.
Finally the MEGAquick-spin column was discarded and the microcentrifuge tube
66
Materials and methods
The purified PCR product was sent for sequencing to FirstBase Sdn. Bhd.
(Malaysia), and was sequenced in both directions with the same primers used for PCR
amplification. The sequence alignment was conducted with Mega 5.2 software. Firstly
the forward and reverse sequence files were opened with Mega 5.2 software. Next one
of the sequences was converted to reverse complement sequence. Then, the sequences
were aligned by ClustalW. Both ends of the sequences were trimmed to remove the
gaps.
67
Materials and methods
cereus and Streptococcus mutans and two Gram-negative bacteria Escherichia coli and
Pseudomonas aeruginosa (Table 3-4) were used. The registered bacterial isolates were
obtained from the American Type Culture Collection (ATCC) maintained in the
Faculty of Science, University of Malaya, Malaysia. The test bacteria were cultured on
Nutrient Agar (Difco, USA) at 37 C for 24 hours. The cultures were sub cultured
68
Materials and methods
Difco Muller Hinton Agar, 38.0 g (Becton, Dickson, USA) medium was
weighed and mixed thoroughly in one litre of distilled water. The dissolved medium
was then autoclaved at 121C for 15 minutes. After autoclaving, the medium was
cooled to about 50 C. Next, the melted, sterile agar was poured into a series of sterile
conditions. The plates were filled to about one-third capacity of the molten agar that is
about 10 ml per plate. Next, the plates were allowed to cool in the laminar flow (Holten
LaminAir, USA) for about fifteen minutes. The cooled, set agar medium was checked
for contamination and the plates were sealed with parafilm and stored at 4 C until
required.
Two or three colonies of the test microorganism were picked with a sterilized
wire loop from the original culture plate and introduced into a test tube containing 5 ml
of sterile nutrient broth. Next, the tubes were incubated for 24 hours to produce a
suspension was compared to a 0.5 McFarland standard (108 CFU /ml) (bioMrieux Inc,
USA) and the turbidity of this suspension was adjusted by adding more organism if the
suspension was too light or diluting with sterile saline solution 0.85% sodium chloride
(Merck, Germany) if the suspension was too heavy. This suspension was used to
69
Materials and methods
Antimicrobial assay was carried out using the modified well diffusion assay
method by Perez and team (1990) following an accepted standard (Clinical and
Laboratory Standards Institute, 2007). Firstly, a sterile cotton swab was dipped into the
tube containing the nutrient broth with inoculums. The dried surface of a Muller Hinton
agar plate was inoculated with the test microorganism by streaking evenly on the plate
in three even planes with the swab over the entire agar surface. The plate was rotated
approximately 60 each time the streaking was done to produce an even distribution of
the inoculum. Excess liquid was removed by running the swab along the rim of the agar
Following this, wells with a diameter of 6 mm were bored with a sterile cork
borer (Appendix C, Figure 3a) and filled with 50 l of aqueous, ethanolic and
methanolic plant extracts using four different concentrations (10, 25, 50 and 100
distilled water / IPB (pH 7.4, negative control). Finally the plates were sealed with
70
Materials and methods
The zone of inhibition was measured using a vernier caliper after 18 hours of
incubation. Measurements were made with the unaided eye while viewing the back of
the petri dish. The petri dish was held a few inches above a black, non-reflecting surface
illuminated with reflected light. The diameter of the zone of inhibition was determined
by measuring the radius of the zone. This was done by measuring the centre of the
antibiotic well to a point on the circumference of the zone where a distinct edge is
present which was multiplied by two (Appendix C, Figure 3b). If individual colonies
samples/positive control were compared to the negative control (IPB/ distilled water) by
one-way ANOVA followed by Dunnetts Multiple Comparison Test. The p value <
0.001 was considered highly significant***. All statistical analysis was performed using
71
Materials and methods
rpm for 20 minutes. The pellet was discarded and the supernatant was added into a 50
on the volume of the solution which was 10 ml and the percent saturation of the salt
needed which was 100 % according to a nomogram (Table 3-5). The extract was stirred
with a magnetic stirrer (Thermoline Scientific, Australia) and the entire procedure was
Ammonium sulphate was added bit by bit slowly with a spatula into the extract
with constant slow stirring. A small amount of ammonium sulphate was added at a time
and then allowed to dissolve before further addition. When the solution turned cloudy,
the addition of saturated ammonium sulphate solution was paused to allow mixing of
the solution. Rapid addition of saturated ammonium sulphate solution leads to the
formation of precipitate trapped with unwanted soluble peptides. When all the weighed
ammonium sulphate was dissolved, it was maintained on the stirrer for 1 hour to allow
precipitation to occur on ice. Finally the solution was centrifuged at 10,000 g for 15
minutes at 4 C (Thermo Scientific, USA). The supernatant was carefully removed into
a 15 ml centrifuge tube. The pellet containing the precipitated protein was dissolved in
IPB pH 7.4 (Wenk & Fernandis, 2007). Both the pellet and supernatant were stored at -
72
Materials and methods
Results were expressed in mm excluding the 7 mm well diameter and the mean
changes between the samples / positive control were compared to the negative control
Table shows the nomogram for determining the amount of solid ammonium sulphate in grams to be added in 1
litre of solution which will yield the desired percentage saturation at 0 C.
73
Materials and methods
Total phenolic content of the plant was determined based on the Folin-Ciocalteu
standard.
absolute ethanol and then diluted to 100 ml with distilled water to obtain a concentration
of 5 g/l of gallic acid solution which can be stored at 4 C, up to 2 weeks. Standards (50,
100, 200, 300, 400, and 500 mg/l) concentrations were prepared by diluting the stock
74
Materials and methods
Australia). The solution was left to cool to room temperature and a few crystals of
sodium carbonate were added into the solution and the solution was left at room
temperature for 24 hours. Finally, the sodium carbonate solution was filtered through
Whatman no. 1 filter paper and water was added to make up to 100 ml. The solution
Firstly, 20 l of plant sample (2.5 mg/ml), gallic acid standard or blank (distilled
water) were added into a 2 ml plastic cuvette. Secondly, 1.58 ml of distilled water,
was added. The mixture was mixed thoroughly by re-suspending with a micropipette
and was incubated for 1 - 8 minutes. Incubation time should never exceed 8 minutes.
Thirdly, 300 l of sodium carbonate solution was added and the mixture was mixed
thoroughly. Finally, the mixture was left to incubate for 2 hours, at room temperature.
All samples and standards were prepared in trplicate. Next, the absorbance of the
75
Materials and methods
The absorbance of the blank was subtracted from all the readings and a calibration
curve was plotted with the standard values. The curve was used to determine the
corresponding gallic acid concentration of all the samples. In order to obtain results
based on the correct concentration of the sample, the dilution factor was multiplied. All
determinations were carried out in triplicate, and the results were expressed as
milligrams of gallic acid equivalent per gram of dry weight (mg GAE/g d.w.).
C = c x V/ m
concentration of gallic acid established from the calibration curve (mg/l), V = volume of
The mean changes between the samples were analysed by one-way ANOVA
followed by Tukeys Multiple Comparison Test. The p value p < 0.05 was considered
statistically significant. The software GraphPad Prism 5 was used to analyse the data.
76
Materials and methods
present in the plant was performed based on a method by Razali and colleagues (2008).
Initially, DPPH solution is dark violet in colour, but the colour fades when an
antioxidant added donates hydrogen (Szabo et al., 2007). The change in colour is
Germany) was prepared by mixing 0.004 g of DPPH in 100 ml methanol, HPLC grade
(Tedia Company Inc, USA) and was stored in the dark. DPPH was prepared freshly for
the assay and was stored at 4 C. Secondly, the standard, Trolox (Sigma Aldrich,
Germany) was prepared. Thirdly, the positive control ascorbic acid, butylated
The standard, positive controls and the sample were prepared by dissolving in
HPLC grade methanol to obtain a stock solution with a concentration of 1 mg/ml. The
stock solution of the sample and positive control were further dissolved in serial two-
fold dilution in methanol to obtain the desired concentration 15.625 1 000 g/ml
(Table 3-7). The stock solution of the standard was diluted in methanol to obtain a
77
Materials and methods
plate. Secondly, the prepared DPPH reagent was added into the well and was re-
suspended with micro-pipette. The mixture was left in the dark at room temperature for
10 to 20 minutes. The reactions were performed in triplicate and the entire assay was
performed in the dark. The changes in absorbance were measured at 515 nm with a
78
Materials and methods
% Inhibition = A0 As 100%
A0
positive control.
The antioxidant activity of plant extracts, standards and positive controls were
50%. IC50 was determined using a non-linear regression analysis computed using
GraphPad Prism 5.
The antioxidant activity was based on the Trolox standard curve at concentration 25
500 g/ml (Table 3-8) expressed as milimole Trolox equivalent antioxidant capacity
per gram dried weight of plant sample (mmol TE/g d.w.). The assay was conducted in
triplicate and results were presented as mean SD. The mean changes between the
samples for each test were analysed by one-way ANOVA followed by Tukeys Multiple
Comparison Test.
79
Materials and methods
(FRAP) assay of Benzie and Strain (1996). In the FRAP assay, the
intense blue colour and absorbance maximum at 593 nm (Benzie & Szeto, 1999).
The FRAP reagent consists of 300 mM acetate buffer (pH 3.6), 10 mM 2,4,6-tri
Firstly, 300 mM acetate buffer, (pH 3.6) was prepared whereby 0.155 g of
sodium acetate trihydrate (Fischer Scientific, UK) was dissolved in 0.8 ml of 100%
acetic acid (Merck, Germany) and 49.2 ml of double distilled water. Secondly, 10 mM
0.2 ml of 1N hydrochloric acid, HCl (Fischer Scientific, UK) and 4.8 ml of double
prepared (Table 3-9) for the standard curve. Ascorbic acid and butylated
hydroxytoluene (BHT) (Sigma Aldrich, Germany) were used as positive controls and
80
Materials and methods
were prepared in two concentrations (1 mg/ml and 0.5 mg/ml) by dissolving each
compound in distilled water. Sample was prepared in two concentrations (1mg/ml and
The working solution of the FRAP reagent was freshly prepared by mixing 300
ferric (III) chloride (FeCl3.6H2O) in the ratio of 10:1:1 at the time of use. The FRAP
reagent was incubated at 37 C for 5 minutes before the experiment. For the assay, 300
l of FRAP reagent was mixed with 10 l of sample, standard or positive control and
the mixture was vortexed well. A mixture of FRAP reagent with distilled water was
used to zero the machine. The absorbance of the mixture was read at 595 nm at 0
minutes and every 15 seconds for 4 minutes. The assay was carried out in triplicate and
81
Materials and methods
The antioxidant activity of plant extracts, and positive controls (1 mg/ml) in the
reaction time 0 - 4 minutes were expressed as milimole ferrous sulphate per gram dried
weight (mmol Fe2+/g d.w.) and was determined based on the ferrous sulphate
(FeSO4.7H2O) standard curve. One unit of FRAP is defined as the reduction of 1 mole
of Fe (III) to Fe (II).
the samples for each test were analysed by one-way ANOVA followed by Tukeys
82
Materials and methods
3.8.3 Investigation of the Protective Effect of the Test Plant Against Hydrogen
Peroxide (H2O2) Induced Red Blood Cell Lysis.
Blood was withdrawn from the marginal vein of healthy normal white rabbits
using a 27G 1/2 sterile needle (TERUMO, Belgium) and aspirated into silicone
clinical centrifuge at 4 C for 20 minutes. The buffy coat and plasma layer were
removed with a pipette and discarded. Cold IPB, 5 ml (pH 7.4, bioWorld, USA) was
added to the packed erythrocytes, mixed gently, and then centrifuged at 2400 rpm for 5
minutes at 4 C. The supernatant was discarded. This step of washing was repeated two
more times as described. After the final wash, the volume of the packed erythrocytes in
the centrifuge tube was noted. A 10% erythrocyte suspension in IPB was prepared
The protective effect of the plant leaf extracts on rabbit erythrocyte was
performed according to the procedure described by Ajila and Rao (2008) with slight
modifications. The free radical initiator used in the study was hydrogen peroxide (H2O2)
hour to determine effect of extract on haemolysis. Next, 50 l of plant leaf extracts with
different concentrations (0.1-1 mg/ml) were added to 100 l of 10% (v/v) erythrocyte
suspension in IPB. Then, 100 l of 10 mM H2O2 in IPB was added into the samples.
83
Materials and methods
A standard was prepared by replacing the plant extract with ascorbic acid
erythrocytes with distilled water (without H2O2 and plant extract). The reaction mixture
was then incubated in a water bath at 37 C for 18 hours. Next, 1 ml of IPB was added
to dilute the reaction mixture and then the mixture was centrifuged at 2000 g for 10
% Haemolysis = As A0 100%
Adw A0
inhibit haemolysis of red blood cells by 50% (IC50), whereby 10 mM and 50 mM H2O2
computed using GraphPad Prism 5. Results were presented as mean SD for three
replicate. The mean changes between the samples against 10 mM and 50 mM were
separately.
84
Materials and methods
comparing with ascorbic acid standard curve and expressed as milimole ascorbic acid
equivalent (AAE) per gram dried weight plant sample (mmol AAE/g d.w.). Results
were expressed as mean SD where n = 3. The mean changes between the samples for
Comparison Test.
3.9 Correlation between the Phenolic Compounds with the Antimicrobial and
Antioxidant Activity of C. asiatica and V. amygdalina Extracts
3.9.1 Correlation between the Total Phenolic Content (TPC) and Antimicrobial
Activity of C. asiatica and V. amygdalina Extracts.
in comparison between (i) aqueous, ethanolic and methanolic extracts of each plant and
(ii) ethanolic extracts of both C. asiatica and V. amygdalina. Correlation was performed
separately for each test microorganism in the study which were B. cereus, E. coli, S.
aureus, S. mutans and P. aeruginosa. TPC was determined by Folins Ciocalteu assay,
presented as milligram gallic acid equivalent per gram dry weight (mg GAE/g d.w.).
The antimicrobial activity was presented as diameter of the zone of inhibition (mm).
by Pearson correlation analysis whereby p < 0.05 was statistically significant. Results
85
Materials and methods
3.9.2 Correlation between the Total Phenolic Content (TPC) and Antioxidant
Activity and between Antioxidant Assays of Extracts of C.asiatica and
V.amygdalina
and various antioxidant assays for (i) aqueous, ethanolic and methanolic extracts of each
plant and (ii) both the plants (ethanolic extract). Correlation coefficient (r) between TPC
and DPPH, TPC and FRAP, TPC and anti-haemolysis assay, DPPH and FRAP, DPPH
and anti-haemolysis assay, and FRAP and anti-haemolysis assay was determined.
acid equivalent per gram dry weight (mg GAE/g d.w.). The antioxidant capacity was
determined by (i) DPPH assay presented as milimole Trolox equivalent per gram dried
weight (mmol TE/g d.w.); (ii) FRAP assay presented as milimole ferrous sulphate per
gram dried weight (mmol Fe2+ /g d.w.); and (iii) anti-haemolysis assay presented as
milimole ascorbic acid equivalent per gram dried weight (mmol AAE/g d.w.).
by Pearson correlation analysis where p < 0.05 was statistically significant. Results were
86
Materials and methods
The mobile phase was a binary solvent system consisting of solvent A and
Germany) in Milli-Q grade water (v/v) with pH 2.6 (Sartorius, Germany). Solvent B
was HPLC grade methanol (Tedia Company Inc, USA). Both the solvents were passed
through a vacuum degasser with a 0.45 m pore size membrane filter (Fisher Scientific
Stock solution of plant extracts for HPLC analysis was prepared by re-dissolving
the aqueous, ethanolic and methanolic extracts in HPLC grade methanol to obtain a
final extract concentration of 100 mg/ml. Next, the respective extracts were pre-treated
with ISOLUTE C18 SPE Columns (Biotage, Sweden) before injection of samples into
a HPLC system.
Gallic acid, caffeic acid, p-coumaric acid, benzoic acid, chlorogenic acid, (+)-
of 1.0 mg/ml in methanol. Prior to injection, all the standard solution were filtered
87
Materials and methods
quantification was carried out with a CBM-20A system controller, a LC-20AD binary
pump, a CTO-10ASvp oven and a SPD-20A ultraviolet detector with 280 nm detection
wavelength. The column fitted was a Jones Chromatography Genesis C18 (150 4.6
ml/min following the gradient profile displayed in Table 3-10. Chromatography for V.
amygdalina was achieved at 30 C with a flow rate of 0.5 ml/min, following the
gradient profile displayed in Table 3-11. Injection volume of the samples were 20 l via
a thin layer chromatography syringe (Hamilton, USA). The data was integrated and
analysed with the Shimadzu LCSolution Analysis Report Software system. The well
separated, major peaks were collected manually several times and stored in -20 C for
further analysis.
88
Materials and methods
for the plant extract with pure standards. To further confirm the phenolic compounds
present in the samples, samples were spiked with pure standards. Data was analysed
Results were presented as mg per g dry weight (mg/g d.w.) of sample extract.
Secondly Folin Coicalteus assay was performed on the major peaks collected
and the total phenolic content of the peaks were expressed as mg gallic acid equivalent
89
Materials and methods
were dried down with a centrifuge concentrator (Labconco, USA) to a powder and
weighed. Next, FT-IR spectra of the peaks were recorded on a Perkin Elmer Spectrum R
spectra of the peaks were scanned at room temperature in the 4000-400 cm-1 spectral
range.
For LC-MS, the mobile phase was a binary solvent system consisting of solvent
A and solvent B. Solvent A was 0.1% of formic acid (Sigma Aldrich, Germany) in
Milli-Q grade water (v/v). Solvent B was 0.1% of formic acid in acetonitrile (Tedia
Company Inc, USA). Both the solvents were passed through a vacuum degasser with
0.45 m pore size membrane filter (Fisher Scientific (M) Sdn Bhd).
The stock solution of plant extracts for LC-MS analysis were prepared by re-
dissolving the methanol extract in HPLC grade methanol to obtain a final extract
concentration of 100 mg/ml concentration. Next, the extracts were pre-treated with
ISOLUTE C18 SPE Columns (Biotage, Sweden) and the concentration was adjusted to
about 20 ppm before injection of the samples into the LC-MS system.
90
Materials and methods
with a TOF/Q-TOF mass spectrometer with gas temperature 250C; gas flow 8 l/min;
and nebulizer 35 psig. The mass spectrometer was operated in both negative and
positive ion modes with a scanning range of 100 to 1000 m/z. Liquid chromatography
separation was performed with a Hardware Kit ZORBAX Eclipse XDB-C18 column
(150 4.6 mm; particle size, 5 m; Agilent Technologies). The gradient profile for LC-
MS was the same as HPLC. Data analysis performed with the Mass Hunter software.
91
4.0 RESULTS
Extraction yields for the selected medicinal plants A.vera leaf and gel, A.indica
leaf, C. asiatica whole plant, C. papaya leaf, H. speciosa leaf, tuber and root, and V.
amygdalina leaf and stem were determined based on dry weight as described in Section
3.3.3 and presented in Figure 4-1. The ethanolic extract of H. speciosa root had the
highest yield (66.67%) followed by the ethanolic extract of A. vera gel (35.14%). The
lowest yield was observed for ethanolic extract of H. spesiosa tuber (2 %).
70
60
Extraction Yield (%)
50
40
30
20
10
Species
Figure 4-1: Extraction yield in percentage for medicinal plants screened in the study
Yield of in aqueous ( ) and ethanol ( ) extracts were determined based on the dry weight of the
plant parts.
92
Results
In this study, parts of medicinal plants (A. vera - leaf and gel, A. indica - leaf, C.
papaya - leaf, C. asiatica - whole plant, H. spesiosa - leaf, tuber and root, and V.
amygdalina - leaf and stem) were used. For antimicrobial activity, aqueous extracts
(Table 4-1) and ethanolic extracts (Table 4-2) of the selected medicinal plants were
tested against the five test microorganisms namely Bacillus cereus, Escherichia coli,
were performed in triplicate and each well was filled with 50 l of various
concentrations of plant extracts (10, 25, 50 and 100 milligram extract per millilitre
For antimicrobial screening of the aqueous extract (Table 4-1) from the 6 plants studied,
only C. asiatica showed significant antimicrobial activity (p <.05) against all the five
test strains. The antimicrobial activity was in a dose dependent manner whereby the
minimum inhibitory concentration (MIC) of the aqueous extract was 25 mg/ml for B.
cereus, E. coli and S. mutans (3.000.00 mm, 6.000.00 mm, and 3.000.00 mm
Antimicrobial screening of ethanolic extracts (Table 4-2) revealed that all five
observed that the ethanolic extract of C. asiatica exhibited the highest antimicrobial
activity towards S. aureus at 100 mg/ml concentration (13.00 0.00 mm). The ethanolic
93
Results
respectively).
against B. cereus (MIC 25 mg/ml; 2.000.00 mm) and E. coli (MIC 100 mg/ml;
2.000.00 mm). A. vera gel showed insignificant activity (p >.05) towards B. cereus
(3.330.58 mm) and S. aureus (2.000.00 mm). Apart from that, H. spesiosa leaf
showed slight inhibition against B. cereus (2.330.58 mm) and P. aeruginosa (2.00
extracts of the six medicinal plants revealed that ethanolic extracts possessed stronger
D). Thus C. asiatica and V. amygdalina were selected for further tests based on the
94
Results
Concentrati
Plant on
Diameter of the zone of inhibition (mm)a
Sample (mg/ml)
(aqueous) P.
B. cereus E. coli S. aureus S. mutans
aeruginosa
10 NI NI NI NI NI
A. vera
(leaf) 25 NI NI NI NI NI
50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
A. vera 25 NI NI NI NI NI
(gel) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
A. indica 25 NI NI NI NI NI
(leaf) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
C. papaya 25 NI NI NI NI NI
(leaf) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
C. asiatica
25 3.000.00** 6.000.00*** NI NI 3.000.00ns
(whole
plant) 50 5.670.58*** 7.330.58*** 6.330.58*** 10.00.00*** 15.331.15***
100 10.00.00*** 10.00.00*** 8.331.15*** 14.00.00*** 18.001.73***
10 NI NI NI NI NI
H. spesiosa 25 NI NI NI NI NI
(leaf) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
H. spesiosa 25 NI NI NI NI NI
(tuber) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
Speciosa 25 NI NI NI NI NI
(root) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
V.
25 NI NI NI NI NI
amygdalina
(leaf) 50 NI NI NI NI NI
100 NI NI NI NI NI
10 NI NI NI NI NI
V.
25 NI NI NI NI NI
amygdalina
(stem) 50 NI NI NI NI NI
100 NI NI NI NI NI
Positive 16.670.58 22.330.58 27.331.15 24.670.58
2.5 NI
controlb *** *** *** ***
Negative
- <0.50.00 <0.50.00 <0.50.00 <0.50.00 <0.50.00
controlc
Table displays adiameter of the zone of inhibition (excluding 7 mm well diameter in mm) after 18 hours
of incubation against 5 test microorganism in well diffusion assay. Each well was filled with 50 l of
extract. bPositive control was tetracycline (2.5mg/ml). cNegative control was double distilled water. NI
presents no inhibition zone observed. Assay was performed in trplicate and results were presented as
mean SD. The mean changes between the extracts and positive control compared to the negative
control were analysed by one-way ANOVA followed by Dunnetts Multiple Comparison Test. p < .001
- highly significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant.
95
Results
Table displays adiameter of the zone of inhibition (excluding 7 mm well diameter in mm) after 18 hours
of incubation against 5 test microorganisms in well diffusion assay. Each well was filled with 50 l of
extract. bPositive control was 2.5mg/ml of tetracycline. cNegative control was isotonic phosphate buffer,
pH 7.4. NI presents no inhibition zone observed. Assay was performed in trplicate and results were
presented as mean SD. The mean changes between the extracts and positive control compared to the
negative control were analysed by one-way ANOVA followed by Dunnetts Multiple Comparison Test. p
< .001 - highly significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant.
96
Results
was performed by DNA barcoding method using the well characterized internal
transcribed spacer 2 (ITS2) region. The primers used in the study for ITS2 region were
forward primer (5ATG CGA TAC TTG GTG TGA AT3) and reverse primer (5-
GAC GCT TCT CCA GAC TAC AAT-3) (Chen et al., 2010).
DNA fragment extracted from dried leaf material for both the medicinal plants produced
bands that were about 500 bp long when compared with a standard 100 bp DNA ladder
(Figure 4-2). The numbers of nucleotide after multiple sequence alignment by ClustalW
of the query sequence for CA and VA were 414 bp and 390 bp respectively.
The unknown sequences were BLAST searched with sequences in GenBank and
CA was identified as Centella asiatica accession number AF 272352 (Figure 4-3) with
99% identity and E-value 1e-152 (Appendix E Figure 5a).VA was identified as
97
Results
CA 1 TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTCGGCCGAGGGCACGTCTGCCTGGG 60
C.asi 322 TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTCGGCCGAGGGCACGTCTGCCTGGG 381
CA 61 CGTCACGCATCGCGTCGcccccccccACCCGTCGACCTCGAAAGGGGTCGGGGCGGAGGG 120
C.asi 382 CGTCACGCATCGCGTCGCCCCCCCC-ACCCGTCGGCCTCGAAAGGGGTCGGGGCGGAGGG 440
98
Results
selected medicinal plants were compared based on dry weight (Figure 4-5). For the
medicinal plant C. asiatica, the highest yield was observed in aqueous extract (18.31%).
Ethanolic extract and methanolic extracts had similar yields (16.83% and 16.80%
respectively). The yield for V. amygdalina was highest in methanolic extract followed
selected medicinal plants C. asiatica (whole plant) and V. amygdalina (leaf) was
compared at various concentrations (10, 25, 50 and 100 mg/ml) against the five test
extract against S. mutans (18.001.73 mm at 100 mg/ml) while the lowest activity was
Generally aqueous extract showed greater antimicrobial activity against the tested
Antimicrobial activities for both ethanolic and methanolic extracts were similar for
The MIC value of aqueous extract was 25 mg/ml against B. cereus, E. coli, and
S. mutans and 50 mg/ml against P. aeruginosa and S. aureus. For ethanolic extract, the
MIC was 25 mg/ml against B. cereus, E.coli, P. aeruginosa and S. mutans and 50
towards B. cereus, E.coli, and S. mutans and 50 mg/ml for P. aeruginosa and S. aureus.
99
Results
Overall, the three extracts of C. asiatica inhibited all the test microorganisms at varying
levels.
towards S.mutans in methanolic extract (Table 4-4). The highest antimicrobial activity
whereas the lowest antimicrobial activity was recorded in methanolic extract against S.
The MIC value for ethanolic extract was 50 mg/ml against B. cereus. For
methanolic extract, the MIC values were 25 mg/ml against B. cereus and 50 mg/ml
against S. mutans. Overall it was observed that antimicrobial activity was present in
(Appendix D).
25
a
Extraction Yield (%)
20 a a
a a a
15
10
0
C.asiatica whole V.amaygdalina leaf
Medicinal plants
100
Results
Table displays the antimicrobial activity of ethanolic, methanolic and aqueous extracts of C. asiatica whole plant against five test microorganism B. cereus, E. coli, P. aeruginosa,
S. aureus, and S. mutans in trplicate at different concentration of sample (10, 25, 50 100 mg/ml) as determined by well diffusion assay. Each well was filled with 50 l of extract.
a
Diameter of the zone of inhibition in exclusion of 6 mm well diameter in mm; bPositive control - 2.5mg/ml tetracycline; cNegative control - isotonic phosphate buffer, pH 7.4 for
ethanol and methanol extract and distilled water for aqueous extract; dMIC Minimum Inhibitory Concentration (mg/ml); NI - no inhibition. Results were presented as mean SD.
n = 3. The mean changes between the extracts and negative control were analysed by one-way ANOVA followed by Dunnetts Multiple Comparison Test.
p < .001 highly significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant.
101
Results
Table displays the antimicrobial activity of ethanolic, methanolic and aqueous extracts of V. amygdalina leaf against five test microorganism B. cereus, E. coli, P. aeruginosa, S.
aureus, and S. mutans in trplicate at different concentration of sample (10, 25, 50 100 mg/ml) as determined by well diffusion assay. Each well was filled with 50 l of extract.
a
Diameter of the zone of inhibition is presented in exclusion of 6 mm well diameter in mm; bPositive control - 2.5mg/ml tetracycline; c Negative control - isotonic phosphate buffer,
pH 7.4 for ethanol and methanol extract and distilled water for aqueous extract; dMIC Minimum Inhibitory Concentration (mg/ml); NI is no inhibition. Results were presented as
mean SD, n = 3. The mean changes between the extracts and negative control were analysed by one-way ANOVA followed by Dunnetts Multiple Comparison Test.
p < .001 - highly significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant.
102
Results
and supernatant were tested for their antimicrobial activity against the five test
microorganisms (B. cereus, E. coli, S. aureus, P. aeruginosa and S. mutans, Figure 4-6).
Results of the assay indicated that the supernatant for both the tested plant extract
For C. asiatica, it was observed that the supernatant showed the highest
mm) followed by E.coli (13.331.53 mm), and P. aeruginosa (12.670.58 mm) and no
activity towards S. mutans. It was interesting to note that there was significant
at 2.5mg/ml concentration (Figure 4-6A). The pellet showed low activity against E. coli
(5.00 0.00 mm) and pellet showed lower activity against the same test microorganism
(4.670.58 mm). No antimicrobial activity was observed against the other 4 test
microorganisms (Figure 4-6B). Figure 4-3C shows the zone of inhibition for the well
diffusion assay.
103
Results
40 A
***
30 *** ***
Diameter of the zone of inhibition (mm)
20 ***
*** *** *** ***
10 ** **
ns ns ns ns ns
0
B. cereus E. coli P. aeruginosa S. aureus S. mutans
40
B
***
30 *** ***
20 ***
10 ******
ns ns ns ns ns ns ns ns ns
0
B. cereus E. coli P. aeruginosa S. aureus S. mutans
Test microorganism
C
104
Results
ethanolic and methanolic extracts of the plant of study by reference to a gallic acid
standard curve (y = 0.0006x + 0.0017, R2 = 0.9961 Appendix F Figure 6). TPC was
expressed as milligrams of gallic acid equivalent per gram of dry weight of extract (mg
GAE/g d.w.).
Significant difference (p < .05) was observed in the TPC of C. asiatica extracted
using different solvents. The ethanolic extract contained the highest amount of
mg GAE/g d.w.). The lowest amount of phenol was in aqueous extract (1.1200.063 mg
GAE/g d.w).
The TPC in V. amygdalina was lower than C. asiatica for all the extracts tested.
The highest TPC was in the methanolic extract (1.1680.101 mg GAE/g d.w) while the
lowest TPC was observed in ethanolic and aqueous extract which showed no
significance (p > .05) from each other (Figure 4-7 and Appendix F Table 1).
5.00
Total phenolic content
b
4.00
(mg GAE/g d.w.)
c
3.00
2.00
a de d e
1.00
0.00
Centella asiatica Vernonia amygdalina
Plant extracts
105
Results
Figure 4-8 (Appendix G Table 2) shows the DPPH radical scavenging activity
in C. asiatica and V. amygdalina extracts compared with standards BHT and ascorbic
acid. Table 4-5 shows the antioxidant activity of the extracts expressed as the
concentration required to inhibit the formation of DPPH radicals by 50% (IC50). Non-
linear regression curve (Appendix G Figure 7b) was plot to determine IC50.
Figure 4-8A depicts a steady increase in the inhibition of the formation of DPPH
radicals by all the extracts of C. asiatica revealing a dose dependant increase in the
radical scavenging activity. At the dosage of 400 g/ml, the radical scavenging activity
of C. asiatica extracts and standards towards DPPH radical was in the following order:
ascorbic acid (90.490.60%) > ethanolic extract (88.830.23%) > methanolic extract
(73.170.17%) > BHT (26.341.47%) > aqueous extract (8.280.74%) at 400 g/ml
dosage. The IC50 of ethanolic extract was the lowest (122.400.04 g/ml), lower than
standard BHT (1290.000.05 g/ml). The IC50 of the aqueous extract was the highest
and the standards towards DPPH radical was as follows: ascorbic acid (90.490.60%) >
106
Results
(25.974.39%) > aqueous extract (5.951.37%). The aqueous extract showed unstable
amygdalina showed low DPPH radical scavenging activity compared to ethanolic and
methanolic extracts of C. asiatica. The IC50 for all the tested extracts were relatively
100.00
A
80.00
60.00
40.00
20.00
0.00
0 25 50 75 100 200 300 400
-20.00
35.00
Inhibition of DPPH radical
B
30.00
25.00
20.00
15.00
10.00
5.00
(%)
0.00
-5.00 0 25 50 75 100 200 300 400
100.00
C
80.00
60.00
40.00
20.00
0.00
0 25 50 75 100 200 300 400
-20.00
Concentration of samples g/ml
Figure 4- 8: Percentage inhibition of DPPH radical in C. asiatica (A), V. amygdalina (B) extracts
and positive controls (C).
The percentage inhibition of DPPH radical with varying concentration (0-400g/ml) of aqueous ( ),
ethanolic ( ) and methanolic ( ) extracts of C. asiatica, V. amygdalina and the positive controls
ascorbic acid ( ) and BHT ( ) were analysed by measuring the inhibitory effects on DPPH radical
at 517 nm. Results are presented as mean SD, n = 3.
107
Results
C. asiatica and V. amygdalina. All assays were performed simultaneously and ascorbic
acid and BHT were used as the positive controls. Each sample was tested at 0.5 mg/ml
and 1.0 mg/ml (Figure 4-9 and 4-10). In the FRAP assay, reductants antioxidants in the
sample reduces Fe3+/tripyridyltriazine complex to the blue coloured ferrous form, with
an increase in absorbance at 595 nm. The absorbance of the samples and positive
control showed gradual increase and reached a plateau by the fourth minute of
incubation. For all samples and positive control the absorbance doubled at 1 mg/ml
able to reduce ferric ions efficiently with absorbance unit (AU) as follows: ascorbic acid
Figure 4-10 generally depicts that V. amygdalina extracts had lower absorbance
AU at 4 minutes) for the same concentration (1.0 mg/ml). Both ethanolic and aqueous
108
Results
A
2.3
1.3
0.3
0.25
0.2
0.15
0.1
0.05
Absorbance (595nm)
-0.05 B
3.6
2.6
1.6
0.6
0.5
0.4
0.3
0.2
0.1
0
0 15 30 45 60 90 120 150 180 210 240
Time (seconds)
Figure 4- 9: Ferric Reducing Antioxidant Power (FRAP) activity in 0.5 mg/ml (A) and 1 mg/ml (B)
C. asiatica extracts
Aqueous ( ), ethanol ( ) and methanol ( ) extracts of C. asiatica were tested. The reaction
time was followed every 15 seconds for 4 minutes and the absorbance was recorded at 595 nm. Ascorbic
acid ( ) and BHT ( ) were the standard antioxidant used. Results are an average of 3 readings
standard deviation.
109
Results
2.14
1.14
0.14
0.12
0.1
0.08
0.06
0.04
Absorbance (595 nm)
0.02
0
-0.02
B
2.4
0.4
0.25
0.2
0.15
0.1
0.05
0
0 15 30 45 60 90 120 150 180 210 240
Time (seconds)
Figure 4- 10: Ferric Reducing Antioxidant Power (FRAP) activity in 0.5 mg/ml (A) and 1 mg/ml
(B) V. amygdalina extracts.
Aqueous ( ), ethanol ( ) and methanol ( ) extracts of V. amygdalina were tested. The
reaction time was followed every 15 seconds for 4 minutes and the absorbance was recorded at 595
nm. Ascorbic acid ( ) and BHT ( ) were the standard antioxidant used. Results are an average of
3 readings standard deviation.
110
Results
It was observed that the aqueous, ethanolic and methanolic extracts of C. asiatica
and V. amygdalina thereafter did not exhibit any harmful effect towards the rabbit
concentrations (0.1 1.0 mg/ml) through in vitro haemolysis assays. The assays were
conducted for 18 hours to evaluate the protective effects of extracts against H2O2 (10
Table 4-6 shows the concentration (mg/ml) required to inhibit haemolysis of red
blood cells by 50% (IC50), whereby 10 mM and 50 mM H2O2 was used to induce
haemolysis. Non-linear regression curves (Appendix I Figures 9a and 9b) were used to
distilled water. The negative control used was isotonic phosphate buffer which
ascorbic acid (86.050.66%) > ethanolic extract (85.121.69%) > aqueous extract
(76.470.79%). Inhibition of the extracts at the same dosage against 50 mM H2O2 was
All extracts showed low IC50 values against 10 mM H2O2 and were compatible with
ascorbic acid. IC50 value against 50 mM H202 was lowest for both ethanolic and
111
Results
methanolic extract (0.1 mg/ml) which was comparable with that of ascorbic acid.
However, aqueous extract showed a higher value (0.29 mg/ml Table 4-6).
Table 4- 6: IC50 (mg/ml) values of the protective effect of extracts of C. asiatica and V.
amygdalina against H2O2 induced red blood cell lysis.
IC50 against 10 mM H2O2 IC50 against 50 mM
Sample
(mg/ml) H2O2 (mg/ml)
C. asiatica aqueous extract 0.130.08a 0.290.04cf
C. asiatica ethanolic extract 0.110.04a 0.100.04d
C. asiatica methanolic extract 0.110.03a 0.100.04d
V. amygdalina aqueous extract 0.280.04b 0.310.04ef
V. amygdalina ethanolic extract 0.140.06a 0.110.07d
V. amygdalina methanolic extract 0.220.03ab 0.130.08d
Ascorbic acid 0.110.04a 0.120.08d
IC50 of C. asiatica and V. amygdalina towards 10 mM and 50 mM H2O2 were determined by non-
linear regression curve. Ascorbic acid was the standard used for comparison. Results were presented
as mean SD of three replicates. The mean changes between the extracts and standard were analysed
separately against 10 mM and 50 mM H2O2 by one-way ANOVA followed by Tukeys Multiple
Comparison Test. Values represented by different alphabets within columns indicated significant
differences (p < .05).
methanolic extract (79.250.64%) > ethanolic extract (78.460.35%) > aqueous extract
methanolic extract (81.770.23%) > ethanolic extract (78.100.26%) > ascorbic acid
(71.970.76%) > aqueous extract (57.551.46% Figure 4-12 and Appendix I Tables 4a
and 4b).
The IC50 against 50 mM H2O2 was lowest for the ethanolic extract (0.110.07
mg/ml) and was comparable with ascorbic acid (0.120.08 mg/ml) whereas the highest
IC50 was recorded in the aqueous extract (0.310.04 mg/ml Table 4-6). Overall, for
protective effect of methanolic and ethanolic extracts whereas aqueous extract showed
112
Results
100
A
90
80
70
60
50
40
30
Inhibition of haemolysis (%)
20
10
0
0.10 0.25 0.50 0.75 1.00 IPB DW
100
B
90
80
70
60
50
40
30
20
10
0
0.10 0.25 0.50 0.75 1.00 IPB DW
Sample concentration (mg/ml)
Figure 4- 11: In vitro protective effect of C. asiatica against 10 mM (A) and 50 mM (B)
H2O2 induced haemolysis of rabbit erythrocytes.
Aqueous ( ), ethanol ( ) and methanol ( ) extract of C. asiatica and positive control -
ascorbic acid ( ) were tested at (0.1, 0.25, 0.5, 0.75 and 1.0 mg/ml) concentration. Protective
effect of distilled water ( ) and negative control IPB ( ) were displayed. Absorbance was
measured at 540 nm. Percentages of haemolysis were based on 100% haemolysis of water.
Results were presented as mean SD whereby n = 3.
113
Results
100
A
90
80
70
60
50
40
30
Inhibition of haemolysis (%)
20
10
0
0.10 0.25 0.50 0.75 1.00 IPB DW
90
B
80
70
60
50
40
30
20
10
0
0.10 0.25 0.50 0.75 1.00 IPB DW
Sample concentration (mg/ml)
Figure 4- 12: In vitro protective effects of V. amygdalina against 10 mM (A) and 50 Mm (B)
H2O2 induced haemolysis of rabbit erythrocytes.
Aqueous ( ), ethanol ( ) and methanol ( ) extract of V. amygdalina and positive control -
ascorbic acid ( ) were tested at (0.1, 0.25, 0.5, 0.75 and 1.0 mg/ml) concentration. Protective
effect of distilled water ( ) and negative control IPB ( ) were displayed. Absorbance was
measured at 540 nm. Percentages of haemolysis were based on 100% haemolysis of water.
Results were presented as mean SD whereby n = 3.
114
Results
methods. Firstly, using the DPPH assay by comparing with Trolox standard curve
(Appendix G Figure 7a) and expressed as milimole Trolox equivalent (TE) antioxidant
capacity per gram dry weight sample (mmol TE/g d.w.) as described in Section 3.8.1.3.
Secondly, using the FRAP assay by comparing with ferrous sulphate (FeSO4.7H2O)
milimole ferrous sulphate (Fe2+) per gram of dry weight (mmole Fe2+/g dry weight) as
ascorbic acid standard curve (Appendix I Figure 9c) and expressed as milimole
ascorbic acid equivalent (AAE) per gram dry weight plant sample (mmol AAE/g d.w.)
had the highest antioxidant activity (1.88240.0062 mmol AAE/g d.w.) being more
potent than aqueous extract but had similar potency to methanolic extract. Ethanolic
In the FRAP assay, 1 mg/ml of samples and controls were chosen to determine
the antioxidant capacity. The ferric reducing activity in methanolic extract of C. asiatica
was the highest followed by ethanolic extract. The activity was higher compared to
ascorbic acid and lower than BHT (positive controls). Aqueous extract had the lowest
115
Results
methanolic extract possess the strongest activity (13.73160.2052 mmol AAE/g d.w.)
being stronger than the control ascorbic acid (6.37240.2806 mmol AAE/g d.w.). The
weakest activity was observed in aqueous extracts (6.11510.4082 mmol AAE/g d.w.
(Table 4-7).
revealed that ethanolic and methanolic extracts possess similar antioxidant potency. It
was interesting to note that the antioxidant potency was also similar to that of the BHT.
However, there was no antioxidant activity in aqueous extract (Table 4-8). Overall it
was discovered that the antioxidant activity was lower in V. amygdalina extracts
reduce ferric ions effectively and was higher than ascorbic acid. Aqueous extract had
low reducing capability whereas ethanolic extract had the lowest reducing capacity
(Table 4-8). Overall the methanolic and ethanolic extracts of V. amygdalina had lower
reducing capacity but aqueous extract had higher reducing capacity when compared to
C. asiatica.
116
Results
V. amygdalina was the most potent extract (10.00810.0845 mmol AAE/g d.w.) in
inhibiting haemolysis. This was followed by the ethanolic extract (8.64540.0980 mmol
AAE/g d.w.), while the lowest potency was observed in aqueous extract (1.02410.5429
mmol AAE/g d.w.), being lower than ascorbic acid (Table 4-8).
117
Results
4.8 Relationship between the Phenolic Compounds with the Antimicrobial and
Antioxidant Activity of C. asiatica and V. amygdalina Extracts.
phenolic content (TPC) and antimicrobial activities between (i) aqueous, ethanolic and
methanolic extracts of each plant and (ii) ethanolic extract of both the plants in this
Table 4- 9: Correlation coefficient (r) between atotal phenolic content (TPC) and bantimicrobial
activity of C. asiatica and V. amygdalina.
TPC vs Antimicrobial activity
Plant of study
B. cereus E. coli P. aeruginosa S. aureus S. mutans
c
C. asiatica -0.9151*** 0.4978ns -0.0955ns 0.2659ns -0.8876**
c
V. amygdalina 0.4412ns - - - 0.7723*
d
C. asiatica and
0.8720* 0.9967*** 0.9974*** 0.9997*** 0.7994ns
V. amygdalina
Table displays the correlation coefficient, r between TPC and antimicrobial activity of C. asiatica and
V. amygdalina between (i) extracts of each plant and (ii) both plants. Statistical significant between
correlation coefficient was determined by Pearson correlation analysis for two-tailed p value. p < .001 -
highly significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant.
indicated no antimicrobial activity. aTotal phenolic content (TPC) - milligram gallic acid equivalent per
gram dry weight (mg GAE/g d.w.). bAntimicrobial activity Diameter of zone of inhibition (mm).
c
Correlation between aqueous, ethanolic and methanolic extracts of each plant. dCorrelation between C.
asiatica and V. amygdalina ethanolic extract.
TPC of the three aqueous, ethanolic and methanolic extracts against each bacteria. The r
values were between 0.4978 and -0.0955 and decreased in the following order: E. coli (r
= 0.4978) > S. aureus (r = 0.2659) > B. cereus (r = -0.9151) > S. mutans (r = -0.8876) >
relationship between phenolic content and antimicrobial activity whereby extracts with
the highest phenolic content displayed lowest antimicrobial activity (Table 4-9 and
Figure 4-13).
118
Results
3 3
2 2
1 1
0 0
7 8 9 10 11 7 8 9 10 11
Inhibition zone diameter (mm) Inhibition zone diameter (mm)
3 3
2 2
1 1
0 0
5 6 7 8 9 10 6 8 10 12 14 16
Inhibition zone diameter (mm) Inhibition zone diameter (mm)
Total phenolic content (mg GAE/d.w.)
Streptococcus mutans
5
y = -0.234x + 5.55
R2 = 0.7878
4
0
0 5 10 15 20
Inhibition zone diameter (mm)
Figure 4- 13: Relationship between total phenolic content and antimicrobial activity of C. asiatica
extracts
Graph displays the linear correlation between diameter of the zone of inhibition (mm) of the five test
microorganisms (B. cereus, E. coli, P. aeruginosa, S. aureus and S. mutans) and total phenolic content
(milligram gallic acid equivalent per gram dry weight mg GAE/g d.w) of aqueous, ethanolic and
methanolic extracts of C. asiatica. Results were displayed as mean SD, n = 3. Coefficient of
determinant (R2) - measures how well the regression line represents the data.
119
Results
Higher correlation between the antimicrobial activity and TPC was detected in
B. cereus and S. mutans and not towards E. coli, P. aureus and S. aureus. The
0.1946) for S. mutans and B. cereus respectively (Table 4-9 and Figure 4-14).
1.2 1.2
1.1 1.1
1.0 1.0
0.9 0.9
0.8 0.8
0 5 10 15 0 1 2 3 4 5
Inhibition zone diameter (mm) Inhibition zone diameter (mm)
Figure 4- 14: Relationship between total phenolic content and antimicrobial activity of V.
amygdalina extracts
Graph displays the linear correlation between diameter of the zone of inhibition (mm) of the two test
microorganisms (B. cereus and S. mutans) and total phenolic content (milligram gallic acid equivalent
per gram dry weight mg GAE/g d.w) of aqueous, ethanolic and methanolic extracts of V. amygdalina.
Results were displayed as mean SD, n = 3. Coefficient of determinant (R 2) - measures how well the
regression line represents the data.
Strong correlations were observed between the antimicrobial activity TPC when
obtained were between 0.9997 and 0.7994 and decreased in the following order: S.
aureus (r = 0.9997) > P. aeruginosa (r = 0.9974) > E. coli (r = 0.9967) > B. cereus (r =
120
Results
3 3
2 2
1 1
0 0
5 6 7 8 9 10 0 5 10 15
Inhibition zone diameter (mm) Inhibition zone diameter (mm)
Total phenolic content (mg GAE/d.w.)
3 3
2 2
1 1
0 0
0 2 4 6 8 10 0 5 10 15
Inhibition zone diameter (mm) Inhibition zone diameter (mm)
Total phenolic content (mg GAE/d.w.)
Streptococcus mutans
5
y = 0.972x - 5.932
R2 = 0.6390
4
0
6 7 8 9 10 11 12
Inhibition zone diameter (mm)
Figure 4- 15: Relationship between total phenolic content and antimicrobial activity of C. asiatica
and V. amygdalina ethanolic extract
Graph displays the linear correlation between diameter of the zone of inhibition (mm) of the five test
microorganisms (B. cereus, E. coli, P. aeruginosa, S. aureus and S. mutans) and total phenolic content
(milligram gallic acid equivalent per gram dry weight mg GAE/g d.w) of ethanolic extract of C.
asiatica and V. amygdalina. Results were displayed as mean SD, n = 3. Coefficient of determinant
(R2) - measures how well the regression line represents the data.
121
Results
DPPH, FRAP and anti-haemolysis assay in order to correlate antioxidant assays. The
correlation analysis was performed to determine the relationship of the various assays
between aqueous, ethanolic and methanolic extracts of each plant and between ethanolic
Significantly high correlations were found between the TPC and antioxidant
between TPC and DPPH radical scavenging activity (r = 0.9996; R2 = 0.9991; p <
0.001) and the lowest correlation was between TPC and FRAP (r = 0.7624; R 2 =
0.5813; p < 0.05). Likewise, significant correlation was observed between various
assays used to determine antioxidant capacity especially between DPPH and anti-
haemolysis assay (r = 0.8435; R2 = 0.7115; p < .01; Table 4-10, Figure 4-16).
Table 4- 10: Correlation coefficient (r) between total phenolic content and antioxidant capacities
and between antioxidant assays of C. asiatica and V. amygdalina extracts.
A TPC vs DPPH vs FRAP vs
TPC vs TPC vs D DPPH vs
Plant of study B C Anti- Anti- Anti-
DPPH FRAP FRAP
haemolysis haemolysis haemolysis
E
C. asiatica 0.9996*** 0.7624* 0.8403** 0.7556* 0.8435** 0.8040**
E
V. amygdalina 0.0665ns 0.4336ns 0.2926ns 0.4311ns 0.6885* 0.2810ns
F
C. asiatica and
0.9968*** 0.9099* 0.9933*** 0.9109* 0.9878*** 0.9211**
V. amygdalina
Table displays the correlation coefficient, r between assays. Statistical significant between correlation
coefficient was determined by Pearson correlation analysis for two-tailed p value. p < .001 - highly
significant***; p < .01 -very significant**; p < .05 significant*; ns - not significant. ATotal phenolic
content (TPC) - milligram gallic acid equivalent per gram dry weight (mg GAE/g d.w.). BAntioxidant
capacity (DPPH) - milimole Trolox equivalent per gram dry weight (mmol TE/g d.w.). CAntioxidant
capacity (FRAP) - milimole ferrous sulphate per gram dry weight (mmol Fe 2+ /g d.w.). DAntioxidant
capacity (anti-haemolysis assay) - milimole ascorbic acid equivalent per gram dry weight (mmol
AAE/g d.w.). ECorrelation between aqueous, ethanolic and methanolic extracts of each plant.
F
Correlation between C. asiatica and V. amygdalina ethanolic extract.
122
Results
capacity and between the antioxidant assays. The highest correlation was between
DPPH and anti-haemolysis assay (r = 0.6885, R2 = 0.4740, p < 0.05). The lowest
correlation was observed between TPC and DPPH (r = 0.0665, R2 = 0.0044, p > 0.05;
antioxidant assays were was made between ethanolic extract of C. asiatica and V.
amygdalina. The results generally showed strong significant correlation (p < 0.05) with
r values between 0.9968 and 0.9099. The strongest correlation was observed between
TPC and DPPH (r = 0.9968; R2 = 0.9935; p < 0.001) followed by TPC and anti-
haemolysis assay (r = 0.9933; R2 = 0.9867; p < 0.001). The lowest correlation was
displayed between TPC and FRAP (r = 0.9099; R2 = 0.8280; p < 0.05; Table 4-10,
Figure 4-18).
123
Results
A B
2.5 0.4
1.0 0.2
0.5
0.1
0.0
-0.5 0.0
0 1 2 3 4 5 0 1 2 3 4 5
Total phenolic content (mg GAE/d.w.) Total phenolic content (mg GAE/d.w.)
C D
Anti-haemolysis (mmol AAE/g d.w.)
0.4
15
0.2
5
0.1
0 0.0
0 1 2 3 4 5 0.0 0.5 1.0 1.5 2.0
Total phenolic content (mg GAE/d.w.) DPPH (mmol TE/g d.w.)
E F
Anti-haemolysis (mmol AAE/g d.w.)
Anti-haemolysis (mmol AAE/g d.w.)
20
15
y = 34.07x + 2.091
y = 3.315x + 6.627
R2 = 0.6464
R2 = 0.7115 15
10
10
5
5
0
0
0.0 0.1 0.2 0.3 0.4
0.0 0.5 1.0 1.5 2.0
DPPH (mmol TE/g d.w.) FRAP (mmol Fe2+/g d.w.)
Figure 4- 16: Correlation between total phenolic content and antioxidant capacity and
between antioxidant capacities of C. asiatica extracts.
Correlation between TPC of C. asiatica extracts and their antioxidant capacity determined by
DPPH assay (A), FRAP assay (B) and anti-haemolysis assay (C) and between antioxidant
capacities DPPH and FRAP (D), DPPH and anti-haemolysis assay (E), and FRAP and anti-
haemolysis assay (F). The total phenolic content (TPC) was determined by Folins Ciocalteu assay,
presented as milligram gallic acid equivalent per gram dry weight (mg GAE/g d.w.). The
antioxidant activity were DPPH presented as milimole Trolox equivalent per gram dry weight
(mmol TE/g d.w.), FRAP assay presented as milimole ferrous sulphate per gram dry weight (mmol
Fe2+ /g d.w.) and anti-haemolysis assay presented as milimole ascorbic acid equivalent per gram
dry weight (mmol AAE/g d.w.). Aqueous, ethanolic and methanolic extracts were used. Results
were presented as mean SD where n = 3. Coefficient of determinant (R 2) - measures how well the
regression line represents the data.
124
Results
A B
0.4 0.4 y = 0.272x - 0.089
y = 0.081x + 0.035
0.2 0.2
0.1 0.1
0.0 0.0
0.8 0.9 1.0 1.1 1.2 1.3 1.4 0.8 0.9 1.0 1.1 1.2 1.3 1.4
Total phenolic content (mg GAE/d.w.) Total phenolic content (mg GAE/d.w.)
C D
Anti-haemolysis (mmol AAE/g d.w.)
0.4
y = 0.223x + 0.171
5
0.1
0 0.0
0.8 0.9 1.0 1.1 1.2 1.3 1.4 0.0 0.1 0.2 0.3 0.4
Total phenolic content (mg GAE/d.w.) DPPH (mmol TE/g d.w.)
E F
Anti-haemolysis (mmol AAE/g d.w.)
10 10
5 5
0 0
0.0 0.1 0.2 0.3 0.4 0.0 0.1 0.2 0.3 0.4
DPPH (mmol TE/g d.w.) FRAP (mmol Fe2+/g d.w.)
Figure 4- 17: Correlation between total phenolic content and antioxidant capacity and between
antioxidant assays of V. amygdalina extracts.
Correlation between TPC of V. amygdalina extracts and their antioxidant capacity determined by
DPPH assay (A), FRAP assay (B) and anti-haemolysis assay (C) and between antioxidant capacities
DPPH and FRAP (D), DPPH and anti-haemolysis assay (E), and FRAP and anti-haemolysis assay (F).
The total phenolic content (TPC) was determined by Folins Ciocalteu assay, presented as milligram
gallic acid equivalent per gram dry weight (mg GAE/g d.w.). The antioxidant activity were DPPH
presented as milimole Trolox equivalent per gram dry weight (mmol TE/g d.w.), FRAP assay
presented as milimole ferrous sulphate per gram dry weight (mmol Fe 2+ /g d.w.) and anti-haemolysis
assay presented as milimole ascorbic acid equivalent per gram dry weight (mmol AAE/g d.w.).
Aqueous, ethanolic and methanolic extracts were used. Results were presented as mean SD where n
= 3. Coefficient of determinant (R2) - measures how well the regression line represents the data.
125
Results
A B
2.0 0.4
R2 = 0.9935 R2 = 0.8280
1.5 0.3
1.0 0.2
0.5 0.1
0.0 0.0
0 1 2 3 4 5 0 1 2 3 4 5
Total phenolic content (mg GAE/d.w.) Total phenolic content (mg GAE/d.w.)
C D
Anti-haemolysis (mmol AAE/g d.w.)
12 0.4
10 0.2
9 0.1
8 0.0
0 1 2 3 4 5 0.0 0.5 1.0 1.5 2.0
Total phenolic content (mg GAE/d.w.) DPPH (mmol TE/g d.w.)
E F
Anti-haemolysis (mmol AAE/g d.w.)
12 13
y = 1.434 + 8.396 y = 16.57 + 6.415
R2 = 0.9758 2
12 R = 0.8485
11
11
10
10
9
9
8 8
0.0 0.5 1.0 1.5 2.0 0.0 0.1 0.2 0.3 0.4
DPPH (mmol TE/g d.w.) FRAP (mmol Fe2+/g d.w.)
Figure 4- 18: Correlation between total phenolic content and antioxidant capacity and between
antioxidant assays of C. asiatica and V. amygdalina ethanolic extract.
Correlation between TPC of C. asiatica and V. amygdalina extracts and their antioxidant capacity
determined by DPPH assay (A), FRAP assay (B) and anti-haemolysis assay (C) and between
antioxidant capacities DPPH and FRAP (D), DPPH and anti-haemolysis assay (E), and FRAP and anti-
haemolysis assay (F). The total phenolic content (TPC) was determined by Folins Ciocalteu assay,
presented as milligram gallic acid equivalent per gram dry weight (mg GAE/g d.w.). The antioxidant
activity were DPPH presented as milimole Trolox equivalent per gram dry weight (mmol TE/g d.w.),
FRAP assay presented as milimole ferrous sulphate per gram dry weight (mmol Fe2+ /g d.w.) and anti-
haemolysis assay presented as milimole ascorbic acid equivalent per gram dry weight (mmol AAE/g
d.w.). Results were presented as mean SD where n = 3. Coefficient of determinant (R 2) - measures
how well the regression line represents the data.
126
Results
The extracts with the highest bioactivity to the lowest bioactivity for
antimicrobial activity, total phenolic content and antioxidant capacity by DPPH, FRAP,
and anti-haemolysis assays are shown (Table 4-11). It was observed for C. asiatica, the
aqueous extract displayed strong antimicrobial activity whereas the alcoholic extracts
displayed strong phenolic and antioxidant activity. For V. amygdalina, the methanolic
extract showed highest activity for most of the assays tested and the aqueous extract
Table 4- 11: Bioactivity of C. asiatica and V. amygdalina aqueous, ethanolic and methanolic
extracts.
C. asiatica V. amygdalina
Bioactivity Extract with Extract with Extract with Extract with
highest activity lowest activity highest activity lowest activity
Antimicrobial aqueous ethanol and methanol aqueous
activity methanol
127
Results
Phenolic compounds present in the medicinal plants studied were separated and
For C. asiatica good separation of peaks were observed and compared with
retention time of eight standards (Table 4-12). The peaks of phenolic compounds were
identified as chloramphenicol (peak 6) and benzoic acid (peak 7; Figure 4-19). The
presence of the detected phenolic compounds was confirmed by spiking the samples
Table 4- 13: Retention time and concentration of phenolic compounds of major peaks of C. asiatica
methanolic extract
Total
phenolic
Concentration
Compound Area Height content
Peak RTa Area Height (mg/100g
identified (%) (%) (mg
d.w.)b
GAE/100g
d.w.)c
6 Chloramphenicol 20.561 7903550 835184 73.871 79.114 46.69 7381.76
7 Benzoic acid 21.751 1288734 104011 12.045 9.853 43.19 940.42
Table displays the peak profile of C. asiatica methanolic extract by reverse phase high performance liquid
chromatography (RP-HPLC). Absorbance was measured at 280 nm. Results were presented as mean
SD. aRetention time of compounds. bConcentration determined by RP-HPLC expressed as mg per g dry
weight of extracts (mg/g d.w.). cTotal phenolic content determined by Folin-Ciocalteus assay expressed
as mg gallic acid equivalent per g dry weight (mg GAE/g d.w.).
128
Results
described in Section 3.10.5 based on the peak profiles of standards chloramphenicol and
benzoic acid (Table 4-12) and sample (Table 4-13). The concentration of
chloramphenicol and benzoic acid obtained were 46.69 and 43.19 mg/ 100g dry weight
respectively.
The fractions corresponding to the two major peaks obtained were collected and
the total phenolic content was determined with the Folin Coicalteu assay. The
chloramphenicol obtained had total phenolic content of 7.381.76 mg GAE/g d.w. The
benzoic acid obtained had total phenolic content of 0.940.42 mg GAE/g d.w.
methanolic and ethanolic extract (U1, U2, U3, U4, U5, U6; Figure 4-20B, C) were
compared with eight standards (Figure 4-20A). None of the retention time of the
129
Results
mAU %
500
450 90
A
400 80
350 70
6
300 5 60
250 50
4
200
4 40
8
150 30
1 3
100 20
7
50 2 10
0 0
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 min
mAU %
550
6
B 90
500
80
400 70
350 60
300
50
250
40
200
150 7 30
100 20
50
10
0
0
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 27.5 min
mAU %
900
C 6 90
800
80
700
70
600
60
500
50
400
40
300
30
200
7 20
100
10
0
0
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 27.5 min
Time (mins)
Figure 4- 19: Chromatogram of C. asiatica
Chromatogram of external standards (A), C. asiatica ethanol extract (B) and C. asiatica methanol
extract (C) at 280 nm absorbance.1-gallic acid, 2-catechin, 3-chlorogenic acid, 4-caffeic acid, 5-
coumaric acid, 6- chloramphenicol, 7-benzoic acid and 8-quercetin.
130
Results
mAU %
700
5
A
600
6
75.0
500 4
400
8 50.0
300
3
200
25.0
7
100 2
1
0
0.0
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 27.5 30.0 min
mAU %
700 U1
B
600 U2
75.0
500
400
50.0
300 U3
U4
200 U6
U5 25.0
100
0
0.0
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 27.5 30.0 32.5 min
mAU %
U1 U2
600
C
500 75.0
400
U3 50.0
300
U4
200
U6
U5 25.0
100
0
0.0
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 min
Time (mins)
Figure 4- 20: Chromatogram of V. amygdalina
Chromatogram of external standards (A), V. amygdalina ethanol extract (B) and V. amygdalina methanol
extract (C) at 280 nm absorbance.1-gallic acid, 2-catechin, 3- chlorogenic acid, 4-caffeic acid, 5-coumaric
acid, 6-chloramphenicol, 7-benzoic acid and 8-quercetin. (U1, U2, U3, U4, U5, U6) - unknown
compounds.
131
Results
the bonds and functional groups present in peak 6 (retention time 20.56 mins) and
peak 7 (retention time 21.75) collected from RP-HPLC analysis of C. asiatica methanol
extract. Table 4-14 and 4-15 shows the wave number and assignment of the main bands
The FT-IR of peak 6 consisted of 6 peaks (Figure 4-21A). Of that 5 peaks were
1065.44, 980.70 and 858.26cm-1. The FT-IR of peak 7 consisted of 7 peaks (Figure 4-
21B). Of that 5 peaks were characteristics of benzoic acid (Table 4-15). The peaks were
132
Results
1672.93
3304.45
858.26
980.7
0
523.05
Transmittance
1065.44
(%)
2163.45
1671.18
3321.07
859.72
980.96
527.07
1070.98
Wavenumbers (cm-1)
133
Results
ionization (ESI) mass spectrometry (MS) was used for the identification of phenolic
compounds in the methanolic extract of C. asiatica and V. amygdalina. Table 4-16 and 4-
17 summarizes the acquired time, molecular weight, molecular formula and the mass
spectra with their respective ionization mode of the compounds identified. The total ion
chromatogram (TIC) and the electrospray ionisation-mass spectra in the positive mode
(+ESI-MS) for the major peak are displayed in Figure 4-22. The +ESI-MS and ESI-MS
spectra of all the phenolic compounds identified with their respective molecular structure
LC-MS analysis revealed the presence of thirty eight phenolic compounds in the
benzoic acid which had been previously identified by RP-HPLC were also detected by LC-
MS (Table 4-16).
detected when analysed using LC-MS. Among them were syringic acid, phloridzin,
134
Results
135
Results
136
Results
629.31
585.28 37
83 673.34
01
541.26
13
717.36
70
214.08
Counts
91 497.23
52
761.39
20
437.23
42
Counts
393.20 805.41
84 83
845.4132
122.08 284.29
349.18
59 39
26 889.44
04
977.48
18
Mass-to-charge (m/z)
569.3
206
525.2
932 657.3
731
481.2
Counts
437.2
Counts
398 785.4
236.0 287
738 393.2
129 829.4
547
122.0 340.1
842 873.4
889
804
917.5
305.1 040
961.5
595
312
Mass-to-charge (m/z)
Figure 4- 22: Total Ion Current (TIC) chromatogram of C. asiatica (A) and V. amygdalina (B)
methanolic extract by LC-ESI-MS analysis
Figure displays the TIC chromatogram of the phenolic compounds detected in the methanolic extract of C.
asiatica and V. amygdalina by LC-MS Q-TOF with an Electrospray Ionisation (ESI-MS) source in the
positive mode. Inset is the Electrospray ionizationmass spectra (ESI-MS) positive ionization for the major
peak of each extract at retention time 1.138 and 1.115 respectively.
137
5.0 DISCUSSION
approach and by random selection (Jantan, 2004), six medicinal plants Aloe vera (leaf and
gel), Azadirachta indica (leaf), Carica papaya (leaf), Centella asiatica (whole plant),
Hymenocallis speciosa (leaf, tuber and root) and Vernonia amygdalina (leaf and stem) were
selected.
These plants and their parts were chosen specifically because (i) A. vera leaf and gel
were reported to possess wound healing properties (Anbarashan et al., 2011; Kumar et al.,
2010).
(ii) A. indica leaf has antibacterial properties (Almas, 1999) and have been used to
(iii) The leaf of Carica papaya was proven to treat dengue fever in the tropics
(iv) The whole plant of C. asiatica was widely used in folklore medicine and had a
wide range of health benefits such as improving memory, curing skin disorders and in the
wound healing process (Duke, 2010; Hargono et al., 1999). It belongs to the Apiaceae
family which comprises of important medicinal plants such as coriander and fennel (Gurib-
Fakim, 2006), thus the same active biological compounds may be present in C. asiatica
(v) H. speciosa was selected because it had been used to cure jaundice in Malaysian
family which possess bioactive compounds such as amaryllidaceae alkaloids that display
138
antimalarial activity (ener et al., 2003). The tuber and root were chosen because in
general, underground plant parts were found to possess bioactive compounds with
antimicrobial properties compared to other aerial parts of plants (Das et al., 2010).
Furthermore, these plant parts have not been studied for H. speciosa to the best of our
(vi) The leaf and stem of V. amygdalina were selected because it had been reported
al., 1999). The main purpose for selecting these plants was because of their antimicrobial
trait due to the secondary metabolites in these plants which may be significant in
therapeutic treatments.
5.2 Extraction Yield and Antimicrobial Activity of the Medicinal Plants Screened
The percentage yield was highest for ethanolic extract H. speciosa root because it
was homogenized to a fine powder with the absence of fibre. This was followed by
ethanolic extract of A. vera gel because it has high water content of 99.5% (Eshun & He,
compounds based on the different bioactive compounds found in the plants and different
antimicrobial agent isolated from biological samples against various microorganisms (Das
et al., 2010). In this study, the screening of the selected plants was based on their
antimicrobial property which was determined by well diffusion assay. Both Gram-negative
139
Discussion
(Bacillus cereus, Staphylococcus aureus, and Streptococcus mutans) were selected due to
(i) Gram-negative bacteria were more resistant to antimicrobials due to the presence
of an additional outer membrane layer (Alberts et al., 2002) and they make up most plant
(ii) E. coli was selected because it is easily cultured in the laboratory, well
characterized, found in a wide range of hosts and acquires resistance to antimicrobial agents
inhibited by antimicrobial agents of plant origin (Kim et al., 1995; Iinuma et al., 1994).
(iv) B. cereus is a soil bacterium and can be easily transmitted into food products,
hence infecting the human intestine (Vilain et al., 2006). It is resistant to a wide array of
(Bottone, 2010).
(vi) The oral bacterium S. mutans was chosen because it invades the oral cavity and
is known to cause dental caries (Loesche, 1986). Some of the medicinal plants in this study
140
Discussion
such as A. vera and A. indica, were known to inhibit oral bacteria that cause gum diseases
Well diffusion assay with the aqueous extract revealed that C. asiatica significantly
inhibited all the five microbial strains while the other medicinal plants did not inhibit any of
activities. The ethanolic extracts of C. asiatica inhibited all the test microorganism and
was recorded for the ethanolic extracts of A.vera gel against B. cereus and S. aureus; A.vera
leaf against B. cereus and E. coli; and H. speciosa leaf against B. cereus and P. aeruginosa
Previous studies have reported the inhibition of A. vera gel and leaf extracts against
S. aureus, P. aeruginosa (Agarry et al., 2005), and E.coli (Kaithwas et al., 2008). However
Alemdar and Agaoglu (2009) reported similar results to this study in A. vera juice which
failed to inhibit these microorganism. A. indica extract was reported to inhibit S. mutans
(Biswas et al., 2002), P. aeruginosa, S. aureus and E. coli (Abdullah Al et al., 2011).
Ethanolic extract of Carica papaya leaf was reported to inhibit E. coli, B. cereus, P.
aeruginosa and S. aureus (Baskaran et al., 2012). No antimicrobial activity has been
Dash et al. (2011) reported higher inhibition of C. asiatica ethanolic extract towards
E. coli and S. aureus compared to aqueous extract which was in contrary with the results in
this study and Kannabiran et al. (2009) reported slight inhibition of aqueous extract and no
inhibition with ethanolic extract against P. aeruginosa. The leaf sap of V. amygdalina, was
reported to inhibit S. aureus, E. coli, and P. aeroginosa (Ijeh et al., 1996), while the
141
Discussion
methanolic leaf extract inhibited P. aeruginosa, and S. aureus (Akinpelu, 1999) Vernolide
and vernodalol isolated from the plant was reported to inhibit Bacillus cereus and S. aureus
The difference in findings between this study and previous studies are difficult to be
microorganism and choice of antimicrobial test were employed (Weerakkody et al., 2010;
Nostro et al., 2000; Hammer et al., 1999). However, the antimicrobial susceptibility test in
this study followed all the standards of the Clinical and Laboratory Standards Institute
2007). Screening of various plant species confirmed the therapeutic potency of C. asiatica
and V. amygdalina as used in traditional medicine. These findings were the basis for
choosing C. asiatica and V. amygdalina as candidate plant species for the determination of
The type of solvent used could greatly affect the antimicrobial activity in the plants.
Most plant antimicrobial are aromatic or saturated organic compounds, therefore the most
effective solvents used for preliminary screening of plant antimicrobial activity are
methanol, ethanol and water (Parekh et al., 2006; Rojas et al., 2006; Lourens et al., 2004;
Bisignano et al., 1996; Salie et al., 1996). For C. asiatica and V. amygdalina, methanol
extraction was also included and the results between extracts were compared. Aqueous
corresponding plant extract concentration. Aqueous extraction was chosen because most
traditional medicines used water as solvent to dissolve the traditional preparations (Das et
al., 2010) and this study revealed that aqueous extract of C. asiatica have strong
142
Discussion
antimicrobial activity. This result proved the presence of water soluble bioactive
positive and Gram-negative bacteria that possess an outer layer making it a strong
antibacterial plant. The most susceptible bacteria amongst the bacterial strains investigated
in this study was S. mutans. Hence this plant may be useful as an oral antibacterial agent
and can be incorporated into mouthwashes and toothpastes. C. asiatica extracts also had
antibacterial agents (Morita et al., 2014). Thus C. asiatica may be an effective agent to
control this nosocomial pathogen. The usage of this plant in wound healing and healing
skin disorders in folklore was shown to be correct since this plant extract possess
strong inhibition was observed in ethanolic and methanolic leaf extracts. This finding was
in agreement with previous study by Parekh et al. (2005), whereby organic solvent extracts
compounds are aromatic or saturated organic compounds that are extracted by ethanol or
methanol (Serkedjieva & Manolova, 1992). The methanolic and ethanolic extracts were
Alberts et al., 2002). B. cereus, a foodborne pathogen was found to be most susceptible
143
Discussion
towards methanolic leaf extract proving the folklore usage of this plant in treating
The yield of C. asiatica was slightly higher in aqueous extracts and almost similar
between ethanolic and methanolic extracts in agreement with the antimicrobial results that
aqueous extracts showed better inhibitory activity between the three extracts ethanolic and
amygdalina, whereby the methanolic and ethanolic extracts displayed higher yield and
aqueous extract displayed lowest yield in agreement with the antimicrobial results obtained.
This indicated that the solvent used played a major role in extracting the bioactive
When utilizing medicinal benefits from plants, it is important that the medicinal
compound is prepared from the correct and authenticated plant species. A rapid and reliable
method used to authenticate plant samples is by DNA barcoding method through sequence
comparison of the ITS2 region (Chen et al., 2010; Shiba et al., 2006; Lau et al., 2001; Zhao
et al., 2001). Variation between species can be distinguished with nucleotide sequencing of
the ITS2 region whereby sequence identities between the unknown plant and the sequence
Centella asiatica and Vernonia amygdalina respectively when compared with sequences
144
Discussion
Various studies have shown that plant defence mechanism against pathogen is by
activity reported in the whole plant extract of C. asiatica and leaf extract of V. amygdalina
Based on the result, the supernatant obtained after ammonium sulphate precipitation
coli, P. aeruginosa and S. aureus while no activity was displayed against S. mutans. The
coli and P. aeruginosa, while no activity was observed against B. cereus, S. aureus and S.
mutans.
sulphate precipitation exhibited antimicrobial activity against B. cereus while the pellet
exhibited insignificant activity against B. cereus. No inhibitory activity was observed for
both the pellet and supernatant against the other test microorganism. Thus this study found
that the antimicrobial activity was prominent in the supernatant for both C. asiatica and V.
amygdalina extracts. Hence, antimicrobial compounds present in the plant were due to
145
Discussion
phenolic compound comprises of an aromatic ring with one or more hydroxyl groups
(Michalak, 2006). Phenolic compounds contribute towards many biological effects such as
1994). In this study, the antimicrobial activities of C. asiatica and V. amygdalina extracts
were attributed to the phenolic compounds present in the plant as reported by Gurjar et al.
activity.
scavenge free radicals, decompose peroxides and quench singlet and triplet oxygen (Osawa,
1994). The number and configuration of the hydroxyl functional group are the main
features that determine the antioxidant capacity of phenolic compound in medicinal plants
(Pannala et al., 2001; Cao et al., 1997). Therefore, it is crucial to study the TPC in plants as
phenolics with natural antioxidant are potential therapeutic agents of various ailments such
The Folin-Ciocalteu method was used to determine the TPC in the plants. TPC was
expressed as milligram gallic acid equivalent per g dry weight (mg GAE/g d.w). The Folin
reagent produced a blue coloured complex when reacted with phenols which can be
quantified spectrophotometrically (Slinkard & Singleton, 1977). In this study, the highest
amount of polyphenols (4.006 mg GAE/g d.w.) were found in the ethanolic extract of the
whole plant of C. asiatica which was slightly lower than the amount earlier reported by
Andarwulan et al. (2010) (5.82 mg GAE/g d.w.) and much lower than the amount reported
146
Discussion
by Wongsa et al. (2012) (52.5 mg GAE/g d.w.). Previously, the TPC in the whole plant
extracted using methanol reported by Guleria et al. (2013) (27.43 mg GAE/g d.w.) was
much higher than found in the methanolic extracts in this study. However in another study,
Wongsa et al. (2012) reported a much lower TPC (1.4 mg GAE/g d.w.) comparable to this
study. A low amount of phenolic content had been recorded in the aqueous extract which
The three extracts of the leaf of V. amygdalina displayed similar TPC with the
highest of them being the methanolic extract. Previous studies showed similarly low TPC in
ethanolic and aqueous extracts (3.97 and 2.71 mg GAE/g d.w.) respectively (Audu et al.,
2012). However higher TPC value was recorded by Fasakin et al. (2011) in ethanolic (8.2
mg GAE/g d.w.) and methanolic (14.8 mg GAE/g d.w.) extracts contrasting with the results
of this study.
Generally the TPC of V. amygdalina was found to be lower than C. asiatica which
may explain better antimicrobial activity displayed by C. asiatica. C. asiatica had higher
Li, et al., 2006) and ethanolic extracts of vegetables such as Apium graveolens (leaf celery),
Micromelum minutum (lime berry), Morinda elliptica (indian mulberry), Ocimum basilicum
(basil), Vigna sinensis (long beans) and Vigna radiate (mung bean sprout) (Sulaiman et al.,
2011).
147
Discussion
related to the phenolic compounds present in the plant. More than one antioxidant assay
was employed to measure the antioxidant activity present to take into account the different
chemical structure and complexity of the antioxidants (Huang et al., 2005; Prior & Cao,
assay, Ferric Reducing Antioxidant Power (FRAP) Assay and hydrogen peroxide (H2O2)
DPPH radical scavenging assay is the most common method used to evaluate
antioxidant activity because it is simple and rapid. The mechanism of radical scavenging
activity employed in this assay is via the hydrogen atom donated by phenolic compounds
with antioxidant activity which binds to the purple coloured DPPH thus reducing DPPH
which turns yellow in colour (Gulcin et al., 2007). Antioxidant activity was measured by
comparing the inhibition of phenols to Trolox and expressed as milimole Trolox equivalent
per gram dry weight sample (mmol TE/g d.w.). The greater scavenging activity of the plant
From the experimental data, all extracts of C. asiatica showed scavenging activity
towards DPPH. The highest scavenging activity and antioxidant capacity was observed
with the ethanolic extract which was comparable to ascorbic acid but was much higher than
148
Discussion
with BHT. Ethanolic extract showed the lowest IC50. Antioxidant capacity of methanolic
extract was comparable to ethanolic extract. Aqueous extract displayed the lowest
scavenging activity with little antioxidant capacity. These results were in agreement with
scavenging activity which was lower compared to that of C. asiatica. The aqueous extract
showed apparently no antioxidant capacity. This result was in agreement with the findings
of Anyasor et al. (2010). The IC50 was very high for all the extracts of V. amygdalina,
Based on this assay, phenolic compounds with antioxidant activity was better
extracted by ethanol/methanol compared to water for both the plants of study. This property
was also observed by Hamid et al. (2002). A common pattern of inhibition towards DPPH
was observed amongst all the extracts for both the plants where a steady increase in
inhibition was followed by a much slower increase with a levelling off. This general pattern
was found to be common in plant extracts (Razali et al., 2008; Kumaran & Karunakaran,
2007). However, aqueous extracts of V. amygdalina did not follow the same pattern
because it possessed weak radical scavenging activity and higher concentration of this
149
Discussion
FRAP assay involves the reduction of the almost colourless ferric tripyridyl triazine
present in the plant extracts. The assay is by monitoring the change in absorbance at 593
nm. This assay is used to evaluate the reducing power of samples where the greater the
antioxidants present in the plant extract, the greater the intensity of the blue colour
seconds for 4 minutes. The antioxidant capacity of the extracts and standards were
expressed as milimole ferrous sulphate per gram of dry weight (mmole Fe2+/g dry weight).
A linear pattern was observed for absorbance of the controls and extracts with
regards to time. The absorbance of all the extracts of C. asiatica, V. amygdalina and
standards reached a plateau by the fourth minute of incubation indicating there was no
showed rapid reaction with high absorbance within the 4 minute reaction time (0.4660.012
methanolic extract. The antioxidant capacity was lower than previous reports by
Malinowska (2013) who showed high antioxidant capacity of C. asiatica extracted from
commercial cosmetic (1.02 mg Fe2+/g d.w) and Guleria et al. (2013) who showed high
antioxidant capacity in 80% methanolic extract (22.5 mg Fe2+/g d.w.). The aqueous extract
in this study displayed low antioxidant activity in agreement with the findings of Wong et
150
Discussion
al. (2006) and Reihani and Azhar (2012). The antioxidant capacities of all extracts were
higher than ascorbic acid, but lower than BHT (Table 4-7).
at 1.0 mg/ml concentration. The highest antioxidant capacity was recorded for the
methanolic extract while the lowest was for the aqueous extract. All extracts had higher
antioxidant capacity than ascorbic acid but lower than BHT (Table 4-8). Oriakhi et al.
(2014) reported FRAP antioxidant capacity value in the ethanolic extract of V. amygdalina
to be two times higher than in this study. The difference in result could be due to the
antioxidant. This study shows methanol was a better extractant of phenolic compounds
capabilities such that it was able to donate electrons to free radicals. Hence in actual
biological systems, this extract may be useful as a natural remedy in the treatment of free
radical related diseases such as cancer, diabetes, arthritis, and acceleration of the ageing
151
Discussion
5.6.3 Protective Effects of the Plant of Study against Hydrogen Peroxide Induced
Red Blood Cell Lysis
inactivate enzymes in the body. It easily diffuses across the cell membrane and reacts with
Fe2+ or Cu2+ forming the hydroxyl radicals which reacts with macromolecules in the body
resulting in cellular stress which is the root cause of many diseases (Bhatia et al., 2011;
Sebastia et al., 2006). Therefore, it is important to evaluate compounds that can scavenge
the H2O2 and control their accumulation in the cell for the benefit of health and wellbeing.
In this study the erythrocytes cell membranes were used to determine oxidative
damage because they are susceptible to oxidation and are targets of oxidizing agents.
Erythrocytes generate reactive oxygen species because its membrane has a high
Haemoglobin exposed to H2O2 causes degradation of haem, which results in the release of
iron ions forming light yellow colour that can be measured at 540 nm. The greater the
protective effect of the plant extracts, the lower the absorbance measured. Antioxidant
capacity was determined in comparison with ascorbic acid and expressed as milimole
ascorbic acid equivalent per gram dry weight plant sample (mmol AAE/g d.w.).
Firstly it was discovered that extracts of both C. asiatica and V. amygdalina pre-
incubated with erythrocytes did not exhibit any lytic effect on the red blood cells. In fact, it
was discovered that both the plants showed protective effect against H2O2 induced
haemolysis. Maximal protective effect and antioxidant capacity in both C. asiatica and V.
amygdalina was found in methanolic extract which was higher than that of ascorbic acid
indicating that the compounds extracted with methanolic extract are potent anti-haemolytic
agent(s). The protective effect against haemolysis was in a dose dependent pattern for
152
Discussion
methanolic and ethanolic extracts. Aqueous extracts did not follow a dose dependent
pattern and displayed varying protective effects against extract concentration showing it to
In this study, different concentrations of H2O2 (10 mM and 50 mM) were tested and
lower protective effects than against 10 mM H2O2 and ethanolic extracts showed similar
protective effect against both the concentration of H2O2. However, methanolic extract
extracts were weak antioxidants and displayed lower protective effect. The strongest
antioxidant activity was in the methanolic extract that displayed stronger protective effect
Previous studies such as on red wine and mango peel showed protective properties
against H2O2 induced erythrocyte haemolysis (Ajila & Rao, 2008; Tedesco et al., 2001).
However some plants such as Allium stracheyi promote haemolysis of erythrocyte due to
the oxidative reaction of phenols (Mukherjee & Rajasekaran, 2010; Bukowska &
toxicological evaluation (Gandhi & Cherian, 2000). From this study, phenolic compound in
both the plants were shown not to cause harmful effects on haemoglobin. C. asiatica and V.
amygdalina possessed compound to effectively scavenge H2O2 before it could affect the
erythrocytes and thus are safe to be utilized as pharmacological applicants. This study is
also the first to report protective effect of C. asiatica whole plant extracts and V.
153
Discussion
compounds present (Das et al., 2010; Urs & Dunleavy, 1975). Interestingly, this study
revealed that the relationship between the antimicrobial activity and phenolic content of C.
asiatica was generally low for each test microorganisms when compared using the aqueous,
ethanolic and methanolic extracts for each plant. The high negative correlation in C.
asiatica towards B. cereus and S. mutans indicated that the aqueous extract displayed high
antimicrobial activity but low phenolic content and the ethanolic extract possessed high
phenolic content but low antimicrobial activity. This result indicated that water extracted
certain bioactive compounds believed to inhibit B. cereus and S. aureus effectively. This
suggests the presence of other compounds such as organic acids or aldehydes in addition to
the phenolic compounds that may be responsible for the antimicrobial activity. The results
antimicrobial activity and phenolic content towards B. cereus and S. mutans with the later
showing about 0.60 coefficient of determination (R2). This result indicated that phenolic
When comparison was made between both plants using one of the extract (ethanol)
the relationship between antimicrobial activity and total phenolic content was significantly
high in agreement with the findings by Shan et al. (2007) who discovered high correlation
between the antimicrobial activity and total phenolic content of 46 spice and herb extracts.
154
Discussion
This finding suggests that the phenolic compounds significantly contributed to the
amygdalina.
Correlation between total phenolic content (TPC) and antioxidant capacity was
(Jahan, 2011; etkovi et al., 2007; Pietta, Simonetti, Gardana, et al., 1998; Shahidi et al.,
1992). Phenolic compounds in plants are composed of one or more aromatic rings which
quenching free radicals giving them their antioxidant properties (Bors & Michel, 2002;
The correlation between TPC with DPPH, FRAP and anti-haemolysis activity of C.
asiatica extracts were significantly high indicating that the phenolic hydroxyl groups were
the major contributors of the free radical scavenging activity, ferric reducing capacities and
protective effect against hydrogen peroxide shown by the plant extracts. Strong correlation
was also observed between the antioxidant capacities determined by DPPH, FRAP and
anti-haemolysis assays indicating that the antioxidants present in the plant extracts possess
strong antioxidant capacities, although they might act through different modes of action
(Huang et al., 2005; Prior & Cao, 1999). Based on the phenolic compounds present in the
155
Discussion
The correlation between TPC and antioxidant capacity for V. amygdalina extracts
was generally low for all the antioxidant assays suggesting that the phenolic compounds in
the plant did not display antioxidant potential. Interestingly, the results revealed
significantly high correlation between DPPH and anti-haemolysis assay while the other
phenolic compounds with strong radical scavenging potential also showed strong protective
effect towards hydrogen peroxide, but did not efficiently reduce ferric ions. In general, the
difference in antioxidant capacities between assays may be due to (i) the difference in
stoichiometry between the antioxidants and free radicals; (ii) the different solubility of the
antioxidant compounds in aqueous, ethanol or methanol solvents and (iii) stereo selectivity
of the free radical ions (Khan et al., 2012). V. amygdalina was found to be a weak source of
antioxidant.
between the aqueous, ethanolic and methanolic extracts of each plant. These findings
revealed that the presence of phenolic compounds in each plant contributes significantly to
their antioxidant capacity as previously reported (Wong, Leong, et al., 2006; Cai et al.,
2004). A clear correlation was established in C. asiatica but not in V. amygdalina. Thus the
V. amygdalina.
156
Discussion
When the overall comparison of the bioactivity present in the aqueous, ethanolic
and methanolic extracts of C. asiatica and V. amygdalina were made, it was revealed that
extraction was effective in the isolation of bioactive compounds and the methanolic extract
(2005). The ethanolic and methanolic extracts showed highest TPC compared to aqueous
extract in both plants. This indicates that phenolic compounds are extracted effectively by
ethanol or methanol.
Amongst all the extracts tested, methanolic extract displayed the highest ferric
reducing capabilities and anti-haemolysis activity while ethanolic extract displayed highest
assumed that methanol extracted most phenolic compounds possessing ferric reducing
capacities and protective effect against hydrogen peroxide and ethanol effectively extracted
scavenging capacity compared to the standard BHT. Synthetic antioxidants such as BHT
have been added in to food product to prolong shelf life by controlling lipid oxidation in
food. However synthetic antioxidants may be hazardous to health (Kahl & Kappus, 1993).
replacement for the synthetic ones in the food industry. In this study, ethanolic extract of C.
asiatica may be the best replacement for BHT in the food industry as it possessed high
157
Discussion
ascorbic acid. Therefore antioxidant agent from methanolic extracts of these plants may be
developed for the management of disorders linked to free radicals such as ageing, cancer,
fatty acids (Subedi et al., 2012; Barros et al., 2007; Singh et al., 2007).
Based on the findings of the current study, it was concluded that phenolic
compounds were present in both the medicinal plants and the antioxidant and antimicrobial
properties displayed in both the plants were attributed to phenolic compounds. RP-HPLC
used for the separation, identification and quantification of phenolic compounds present in
C. asiatica and V. amygdalina same as others, has shown to be a reliable method (Molnar-
high TPC as determined by the Folin-Coicalteu method. Purification of plant extracts was
required prior to injection into HPLC to remove compounds such as chlorophyll, waxes
sterols, etc. which may damage the HPLC column and interfere with the elution of
compounds (Gowniak et al., 1996). SPE (solid phase extraction) method was chosen as the
pretreatment method over the hydrolysis method because pretreatment with SPE columns is
caused decomposition of polyphenols which often led to the loss in recovery of phenolic
158
Discussion
compounds (Kermasha et al., 1995; Hertog et al., 1992). Furthermore the SPE pretreatment
method is highly reproducible and a low volume of sample is required (Gowniak et al.,
1996).
The identity of the phenolic compounds were determined by comparing with the
retention time of standards as established by Bartolom et al. (1993). In this study, the RP-
benzoic acid whereby both ethanolic and methanolic extracts displayed similar
chromatographic patterns. The peaks for chloramphenicol and benzoic acid obtained were
confirmed firstly by spiking with authentic chloramphenicol and benzoic acid standards and
then by FT-IR. Interestingly, this study is the first to report the presence of chloramphenicol
and benzoic acid in C. asiatica which may contribute to the plants antioxidant and
antimicrobial activities.
whole plant. It is a broad spectrum antibiotic which was first isolated from Streptomyces
venezuelae in 1947. Chloramphenicol inhibits both gram positive and negative bacteria and
is effectively used in the treatment of meningitis, typhoid fever, and cystic fibrosis (Baselt
& Cravey, 1995). This may explain the antimicrobial activity displayed by the plant
extracts. Chloramphenicol was discovered to exist naturally in herbs, grass and in plants
from the Artemisia family (Berendsen et al., 2013; Berendsen et al., 2010).
The other major compound present, benzoic acid is the most widely used
preservative in the food, drug and cosmetic industries (Davidson, 2001). It exists as a white
powder in pure form and is slightly soluble in water. It was found to occur naturally in
blackberries, mushrooms and tomatoes (Abdullah et al., 1994; Marlatt et al., 1992; Humpf
159
Discussion
Previous studies reported the presence of triterpenes such as asiatic acid, madecassic
glucopyranoside and asiaticoside-B; and rosmaric acid in the plant (Bonfill et al., 2006;
Yoshida et al., 2005; Schaneberg et al., 2003; Verma et al., 1999; Inamdar et al., 1996).
Quantification of the total phenolic content (TPC) of the two major peaks obtained
was done by (i) Folin-Coicalteu assay; and (ii) comparison with the peak profiles of
commercial standards chloramphenicol and benzoic acid. The TPC of the peaks obtained
standards. The difference in the phenolic content obtained by both methods may be due to
the lack of accuracy of the Folin-Coicalteu method, which may be affected by interference
such as sulphur dioxide, ascorbic acid, sugar, aromatic amines, organic acids and other non-
phenolic substances that may react with the assay (Singleton et al., 1999).
Further analysis by LC-MS and GC-MS was done to identify the phenolic compounds
acid (Johnson et al., 2011) flavonoids (Igile et al., 1994), steroidal alcohol (Arene, 1972),
steroid glucosides (Igile et al., 1994; Jisaka et al., 1993), fatty acids (Erasto et al., 2007)
and sesquiterpene lactones (vernodalin and vernoamygdalin) (Luo et al., 2011; Erasto et al.,
2006).
160
Discussion
phenolic compounds present in plant extracts (Motilva et al., 2013; Savarese et al., 2007).
Previous studies indicated that the negative ionization mode of the ESI-MS provides better
identification of phenolic compounds with low molecular weight and low concentration
(Abad-Garca et al., 2012; Sun et al., 2007; Charrouf et al., 2007). However in this study,
both the ionization modes (positive and negative) were used to provide certainty of the
In this study, thirty eight phenolic compounds were identified in the methanolic
extract of C. asiatica. The phenolic compounds were classified into the following groups:
ols, flavonol and flavonol glycosides, flavanone and flavanone glycosides), purine alkaloids
and phenolic terpenes and lignin. Other compounds such as chloramphenicol and benzoic
acid which were previously identified by RP-HPLC and FT-IR were also detected by LC-
The LC-MS analysis showed that the methanolic extract of V. amygdalina contained
forty phenolic compounds ranging from gallic acid derivatives, hydroxybenzoic acid,
flavanone and flavanone glycosides), resveratrols, purine alkaloids and phenolic terpenes
and lignin.
Interestingly, this study is the first to report the presence of the phenolic compound
phenolic compound in Malus domestica (Gosch et al., 2009). In a recent study conducted
161
Discussion
by Najafian et al. (2012), this compound significantly reduced the blood glucose levels and
to help reduce diabetes, obesity, stress and hyperglycaemia and is a strong antioxidant
agent (Kobori et al., 2012; Gosch et al., 2010). The leaf extracts of V. amygdalina is known
to possess antidiabetic activity (Osinubi, 2008; Ekpenyong et al., 1999) and this may be
amygdalina may work in synergy to exhibit the antimicrobial, antioxidant and anti-
haemolyis properties. Synergy between different constituents of plant extracts has been
shown in Cinchona bark, whereby thirty alkaloids have been detected and the mixtures of
alkaloids have a greater inhibition against Plasmodium falciparumin than any of the
alkaloids used separately (Druilhe et al., 1988). This study is also the first to identify
162
6.0 CONCLUSION
Six medicinal plants: Aloe vera (leaf and gel), Azadirachta indica (leaf), Carica
papaya (leaf), Centella asiatica (whole plant), Hymenocallis speciosa (leaf, tuber and root)
and Vernonia amygdalina (leaf and stem) were screened for antimicrobial activity. On the
basis of antimicrobial activity, C. asiatica (whole plant) and V. amygdalina (leaf) were
chosen as candidate plant species for the determination of bioactive constituents present.
The aqueous, ethanolic and methanolic extracts of C. asiatica inhibited B. cereus, E. coli,
coli, P. aeruginosa and S. aureus. The supernatant of the ethanolic extract of V. amygdalina
exhibited antimicrobial activity against B. cereus. Insignificant inhibition was observed for
the ammonium sulphate pellet against the test microorganisms. Hence the antimicrobial
activity of the plant extracts was not attributed to peptides but may be due to phenolic
compounds.
Total phenolic content (TPC) of the extracts were determined. The ethanolic extract
of C. asiatica showed high TPC whereas the TPC in V. amygdalina was similar in the
aqueous, ethanolic and methanolic extracts but lower in amount compared to C. asiatica.
plants. The antioxidant potential of both the plants were evaluated based on DPPH free
163
Conclusion
DPPH, which was stronger than that of BHT. The methanolic extract displayed high FRAP
antioxidant capacity, which was stronger than that of ascorbic acid. Hence the extracts of
this plant may be useful as a natural antioxidant agent for the management of health
activity towards the DPPH radical, and the methanolic extract displayed high FRAP
antioxidant capacity. However it was lower than C. asiatica and higher concentrations of
This study also demonstrated for the first time the protective effect of C. asiatica
and V. amygdalina extracts against hydrogen peroxide induced red blood cell lysis. The
protective effect against haemolysis was higher than that of ascorbic acid.
identified by RP-HPLC, LC-MS, and FT-IR. RP-HPLC analysis of the methanolic extract
of C. asiatica identified the presence of chloramphenicol and benzoic acid as the major
phenolic compounds in the plant. The identification of these compounds was confirmed by
FT-IR analysis. However RP-HPLC analysis of V. amygdalina extracts detected six major
phenolic compounds which were not identified. Analysis by LC-MS was done to identify
Analysis by LC-MS identified thirty eight and forty different phenolic compounds
terpenes and lignins. Amongst them, the presence of phloridzin was detected in the
164
Conclusion
The results from this study suggests that extracts of the selected medicinal plants C.
antioxidant properties that can be used as antimicrobial and antioxidant agents in the search
for new drugs. Furthermore the natural plant pheolics could serve as a natural preservative
165
References
REFERENCES
Abad-Garca, B., Garmn-Lobato, S., Berrueta, L. A., Gallo, B., & Vicente, F. (2012).
On line characterization of 58 phenolic compounds in Citrus fruit juices from
Spanish cultivars by high-performance liquid chromatography with photodiode-
array detection coupled to electrospray ionization triple quadrupole mass
spectrometry. Talanta, 99, 213-224. doi:
http://dx.doi.org/10.1016/j.talanta.2012.05.042
Abdullah Al, E., Shahed, S. M., Ahmed, F., Saha, S. K., Das, S. C., & Bachar, S. C.
(2011). Evaluation of Brine shrimp lethality and Antimicrobial activity of
Azadirachta indica leaf extract on some drug resistance bacteria in Bangladesh.
Pharmacognosy Journal, 3(20), 66-71. doi:
http://dx.doi.org/10.5530/pj.2011.20.13
Abdullah, M. I., Young, J. C., & Games, D. E. (1994). Supercritical fluid extraction of
carboxylic and fatty acids from Agaricus spp. mushrooms. Journal of
Agricultural and Food Chemistry, 42(3), 718-722.
Adedapo, A. A., Jimoh, F. O., Afolayan, A. J., & Masika, P. J. (2009). Antioxidant
Properties of the Methanol Extracts of the Leaves and Stems of Celtis africana.
Records of Natural Products, 3(1), 23-31.
Ahmad, N., Fazal, H., Ayaz, M., Abbasi, B. H., Mohammad, I., & Fazal, L. (2011).
Dengue fever treatment with Carica papaya leaves extracts. Asian Pacific
Journal of Tropical Biomedicine, 1(4), 330-333. doi: 10.1016/s2221-
1691(11)60055-5
166
References
Ahmed, A. A., Mahmoud, A. A., Williams, H. J., Scott, A. I., Reibenspies, J. H., &
Mabry, T. J. (1993). New sesquiterpene -methylene lactones from the Egyptian
plant Jasonia candicans. Journal of Natural Products, 56(8), 1276-1280.
Ajila, C. M., & Rao, U. J. S. P. (2008). Protection against hydrogen peroxide induced
oxidative damage in rat erythrocytes by Mangifera indica L. peel extract. Food
Chemistry Toxicology, 46(1), 303-309. doi: 10.1016/j.fct.2007.08.024
Alberts, B. , Johnson, A., Lewis, J., Raff, M., Roberts, K. , & Walter, P. (2002).
Molecular Biology of the Cell. New York: Garland Science.
Amaral, J. A., Ekins, A., Richards, S. R., & Knowles, R. (1998). Effect of selected
monoterpenes on methane oxidation, denitrification, and aerobic metabolism by
bacteria in pure culture. Applied and Environmental Microbiology, 64(2), 520-
525.
Ames, B. N., Shigenaga, M. K., & Hagen, T. M. (1993). Oxidants, antioxidants, and the
degenerative diseases of aging. Proceedings of the National Academy of
Sciences of the United States of America, 90(17), 7915-7922.
167
References
Andarwulan, N., Batari, R., Sandrasari, D. A., Bolling, B., & Wijaya, H. (2010).
Flavonoid content and antioxidant activity of vegetables from Indonesia. Food
Chemistry, 121(4), 1231-1235.
Anderson, K. J., Teuber, S. S., Gobeille, A., Cremin, P., Waterhouse, A. L., &
Steinberg, F. M. (2001a). Walnut polyphenolics inhibit in vitro human plasma
and LDL oxidation. Journal of Nutrition, 131(11), 2837-2842.
Anderson, K. J., Teuber, S. S., Gobeille, A., Cremin, P., Waterhouse, A. L., &
Steinberg, F. M. (2001b). Walnut polyphenolics inhibit in vitro human plasma
and LDL oxidation. Journal of Nutrition, 131(11), 2837-2842.
Aregheore, E. M., Makkar, H. P. S., & Becker, K. (1998). Feed value of some browse
plants from the central zone of Delta State, Nigeria. Tropical Science, 38, 97-
104.
Arnesen, L. P. S., Fagerlund, A., & Granum, P. E. (2008). From soil to gut: Bacillus
cereus and its food poisoning toxins. Federation of European Microbiological
Societies Microbiology Reviews, 32(4), 579-606.
Atangwho, I. J., Egbung, G. E., Ahmad, M., Yam, M. F., & Asmawi, M. Z. (2013).
Antioxidant versus anti-diabetic properties of leaves from Vernonia amygdalina
Del. growing in Malaysia. Food Chemistry, 141(4), 3428-3434. doi:
http://dx.doi.org/10.1016/j.foodchem.2013.06.047
Atta, R., & Choudhary, M. I. (1995). Diterpenoid and steroidal alkaloids. Natural
Product Reports, 12(4), 361-379.
Audu, S. A., Taiwo, A. E., & Ojuolape, A. R. (2012). A Study Review of Documented
Phytochemistry of Vernonia amygdalina (Family Asteraceae) as the Basis for
Pharmacologic Activity of Plant Extract. Journal of Natural Sciences Research,
2(7), 1-8.
Ayafor, J. F., Tchuendem, M. H., Nyasse, B., Tillequin, F., & Anke, H. (1994). Novel
bioactive diterpenoids from Aframomum aulacocarpos. Journal of Natural
Products, 57(7), 917-923.
Azaizeh, H., Fulder, S., Khalil, K., & Said, O. (2003). Ethno-medicinal knowledge of
local arad practitinores in the middle east region. Fitoterapia, 14, 98-108.
Azliza, M. A., Ong, H. C., Vikineswary, S., Noorlidah, A., & Haron, N. W. (2012).
Ethno-medicinal Resources Used By the Temuan in Ulu Kuang Village. Studies
on Ethno-Medicine, 6(1), 17-22.
Balandrin, M. F., Klocke, J. A., Wurtele, E. S., & Bollinger, W. H. (1985). Natural plant
chemicals: sources of industrial and medicinal materials. Science, 228(4704),
1154-1160.
Balasubramanian, D., Schneper, L., Kumari, H., & Mathee, K. (2013). A dynamic and
intricate regulatory network determines Pseudomonas aeruginosa virulence.
Nucleic Acids Research, 41(1), 1-20. doi: 10.1093/nar/gks1039
Balls, A. K., Hale, W. S., & Harris, T. H. (1942). A crystalline protein obtained from a
lipoprotein of wheat flour. Cereal Chemistry Journal, 19, 279-288.
Bandyopadhyay, U., Biswas, K., Sengupta, A., Moitra, P., Dutta, P., Sarkar, D.,
Debnath, P., Ganguly, C. K., & Banerjee, R. K. (2004). Clinical studies on the
effect of Neem (Azadirachta indica) bark extract on gastric secretion and
gastroduodenal ulcer. Life Sciences, 75(24), 2867-2878.
169
References
Baris, O., Gulluce, M., Sahin, F., Ozer, H., Kilic, H., Ozkan, H., Sokmen, M., & Ozbek,
T. (2006). Biological activities of the essential oil and methanol extract of
Achillea biebersteinii Afan. (Asteraceae). Turkish Journal of Biology, 30, 65-73.
Barros, L., Ferreira, M., Queirs, B., Ferreira, I. C. F. R., & Baptista, P. (2007). Total
phenols, ascorbic acid, -carotene and lycopene in Portuguese wild edible
mushrooms and their antioxidant activities. Food Chemistry, 103(2), 413-419.
doi: http://dx.doi.org/10.1016/j.foodchem.2006.07.038
Bartolom, B., Bengoechea, M. L., Glvez, M. C., Prez-Ilzarbe, F. J., Hernndez, T.,
Estrella, I., & Gmez-Cordovs, C. (1993). Photodiode array detection for
elucidation of the structure of phenolic compounds. Journal of Chromatography
A, 655(1), 119-125.
Baselt, R. C., & Cravey, R. H. (1995). Disposition of Toxic Drugs and Chemicals in
Man (4 ed.). Chemical Toxicology Institute, Foster City, CA, USA: Biomedical
Publications.
Baskaran, C., Velu, S., & Kumaran, K. (2012). The efficacy of Carica papaya leaf
extract on some bacterial and a fungal strain by well diffusion method. Asian
Pacific Journal of Tropical Disease, 2, 658-662.
Basri, D. F., & Fan, S. H. (2005). The potential of aqueous and acetone extracts of galls
of Quercus infectoria as antibacterial agents. Indian Journal of Pharmacology,
37(1), 26.
Batista, O., Duarte, A., Nascimento, J., Simoes, M. F., de la Torre, M. C., & Rodriguez,
B. (1994). Structure and antimicrobial activity of diterpenes from the roots of
Plectranthus hereroensis. Journal of Natural Products, 57(6), 858-861.
Benzie, I. F. F., & Strain, J. J. (1996). The ferric reducing ability of plasma (FRAP) as a
measure of antioxidant power: the FRAP assay. Analytical Biochemistry,
239(1), 70-76.
Benzie, I. F. F., & Szeto, Y. T. (1999). Total antioxidant capacity of teas by the ferric
reducing/antioxidant power assay. Journal of Agricultural and Food Chemistry,
47(2), 633-636.
170
References
Berendsen, B., Pikkemaat, M., R mkens, P., Wegh, R., van Sisseren, M., Stolker, L., &
Nielen, M. (2013). Occurrence of Chloramphenicol in Crops through Natural
Production by Bacteria in Soil. Journal of Agricultural and Food Chemistry,
61(17), 4004-4010.
Berendsen, B., Stolker, L., de Jong, J., Nielen, M., Tserendorj, E., Sodnomdarjaa, R.,
Cannavan, A., & Elliott, C. (2010). Evidence of natural occurrence of the
banned antibiotic chloramphenicol in herbs and grass. Analytical and
Bioanalytical Chemistry, 397(5), 1955-1963.
Bisignano, G., Germano, M. P., Nostro, A., & Sanogo, R. (1996). Drugs used in Africa
as dyes: II. Antimicrobial activities. Phytotheraphy Research, 10, 161-163.
Bodey, G. P., Bolivar, R., Fainstein, V., & Jadeja, L. (1983). Infections Caused by
Pseudomonas aeruginosa. Reviews of Infectious Diseases, 5(2), 279-313. doi:
10.2307/4453009
Bonfill, M., Mangas, S., Cusid, R. M., Osuna, L., Piol, M. T., & Palazn, J. (2006).
Identification of triterpenoid compounds of Centella asiatica by thinlayer
chromatography and mass spectrometry. Biomedical Chromatography, 20(2),
151-153.
Bors, W., & Michel, C. (2002). Chemistry of the antioxidant effect of polyphenols.
Annals of the New York Academy of Sciences 957, 57-69.
Brownlee, H. E., McEuen, A. R., Hedger, J., & Scott, I. M. (1990). Anti-fungal effects
of cocoa tannin on the witches' broom pathogen Crinipellis perniciosa.
Physiological and Molecular Plant Pathology, 36(1), 39-48.
Bukowska, B., & Kowalska, S. (2004). Phenol and catechol induce prehemolytic and
hemolytic changes in human erythrocytes. Toxicology Letters, 152(1), 73-84.
Cai, Y., Luo, Q., Sun, M., & Corke, H. (2004). Antioxidant activity and phenolic
compounds of 112 traditional Chinese medicinal plants associated with
anticancer. Life sciences, 74(17), 2157-2184.
Calir, A., Mavi, A., Kazaz, C., Yildirim, A., & Kufrevioglu, O. I. (2009). Antioxidant
activities of the extracts and components of Teucrium orientale L. var. orientale.
Turkish Journal of Chemistry, 30(4), 483-494.
Cao, G., Sofic, E., & Prior, R. L. (1997). Antioxidant and prooxidant behavior of
flavonoids: structure-activity relationships. Free Radical Biology & Medicine
22(5), 749-760.
172
References
Charrouf, Z., Hilali, M., Jauregui, O., Soufiaoui, M., & Guillaume, D. (2007).
Separation and characterization of phenolic compounds in argan fruit pulp using
liquid chromatographynegative electrospray ionization tandem mass
spectroscopy. Food Chemistry, 100(4), 1398-1401.
Chaurasia, S. C., & Vyas, K. K. (1977). In vitro effect of some volatile oil against
Phytophthora parasitica var. piperina. Journal of Research and Education in
Indian Medicine, 24-26.
Chen, S., Yao, H., Han, J., Liu, C., Song, J., Shi, L., Zhu, Y., Ma, X., Gao, T., Pang, X.,
Luo, K., Li, Y., Li, X., Jia, X., Lin, Y., & Leon, C. (2010). Validation of the
ITS2 region as a novel DNA barcode for identifying medicinal plant species.
PLoS One, 5(1), 8613. doi: 10.1371/journal.pone.0008613
Chong, J., Baltz, R., Schmitt, C., Beffa, R., Fritig, B., & Saindrenan, P. (2002).
Downregulation of a pathogen-responsive tobacco UDP-Glc:phenylpropanoid
glucosyltransferase reduces scopoletin glucoside accumulation, enhances
oxidative stress, and weakens virus resistance. Plant Cell, 14(5), 1093-1107.
Chopra, I. C., Gupta, K. C., & Nazir, B. N. (1952). Preliminary study of anti-bacterial
substances from Melia azidirachta. Indian Journal of Medical Research, 40(4),
511-515.
Chow, T. N. J., Williamson, D. A., Yates, K. M., & Goux, W. J. (2005). Chemical
characterization of the immunomodulating polysaccharide of Aloe vera L.
Carbohydrate research, 340(6), 1131-1142.
Cichewicz, R. H., & Thorpe, P. A. (1996). The antimicrobial properties of chile peppers
(Capsicum species) and their uses in Mayan medicine. Journal of
Ethnopharmacology, 52(2), 61-70.
Ciocan, I. D., & Bara, I. I. (2007). Plant products as antimicrobial agents. Annals of the
"Alexandru Ioan Cuza" University Sect. II a. Genetics and Molecular Biology,
8(1).
Clarke, J. K. (1924). On the bacterial factor in the aetiology of dental caries. British
Journal of Experimental Pathology, 5(3), 141-146.
173
References
Coley, P. D., & Barone, J. A. (1996). Herbivory and plant defenses in tropical forests.
Annual Review of Ecology and Systematics, 27, 305-335. doi: DOI
10.1146/annurev.ecolsys.27.1.305
Conlon, J. M., Sonnevend, A., Patel, M., Davidson, C., Nielsen, P. F., Pal, T., &
Rollins-Smith, L. A. (2003). Isolation of peptides of the brevinin-1 family with
potent candidacidal activity from the skin secretions of the frog Rana boylii.
Journal of Peptide Research, 62(5), 207-213.
Cos, P., Maes, L., Vanden Berghe, D., Hermans, N., Pieters, L., & Vlietinck, A. (2004).
Plant substances as anti-HIV agents selected according to their putative
mechanism of action. Journal of Natural Products, 67(2), 284-293. doi: Doi
10.1021/Np034016p
Coykendall, A. L., Bratthall, D., O'Connor, K., & Dvarskas, R. A. (1976). Serological
and genetic examination of some nontypical Streptococcus mutans strains.
Infection and Immunity, 14(3), 667-670.
Croteau, R., Kutchan, T. M., & Lewis, N. G. (2000). Natural products (secondary
metabolites). In Buchanan, B. B., Gruissem, W. & Jones, R. L. (Eds.),
Biochemistry and Molecular Biology of Plants (Vol. 40, pp. 1250-1318).
Rockville: American Society of Plant Physiologists.
174
References
Currens, M. J., Gulakowski, R. J., Mariner, J. M., Moran, R. A., Buckheit, R. W.,
Gustafson, K. R., McMahon, J. B., & Boyd, M. R. (1996). Antiviral activity and
mechanism of action of calanolide A against the human immunodeficiency virus
type-1. Journal of Pharmacology and Experimental Therapeutics, 279(2), 645-
651.
Das, K., Tiwari, R. K. S., & Shrivastava, D. K. (2010). Techniques for evaluation of
medicinal plant products as antimicrobial agent: Current methods and future
trends. Journal of Medicinal Plants Research, 4(2), 104-111.
Dash, B. K., Faruquee, H. M., Biswas, S. K., Alam, M. K., Sisir, S. M., & Prodhan, U.
K. (2011). Antibacterial and Antifungal Activities of Several Extracts of
Centella asiatica L. against Some Human Pathogenic Microbes. Life Sciences
and Medicine Research 1-5.
Daum, R. S., & Spellberg, B. (2012). Progress toward a Staphylococcus aureus vaccine.
Clinical Infectious Diseases, 54(4), 560-567. doi: 10.1093/cid/cir828
Davenport, R., & Smith, C. (1952). Panophthalmitis due to an organism of the Bacillus
subtilis group. British Journal of Ophthalmology 36(7), 389-392.
De Clercq, E. (2000). Current lead natural products for the chemotherapy of human
immunodeficiency virus (HIV) infection. Medical Research Reviews, 20(5),
323-349.
de Paiva, S. R., Lima, L. A., Figueiredo, M. R., & Kaplan, M. A. C. (2004). Plumbagin
quantification in roots of Plumbago scandens L. obtained by different extraction
techniques. Anais da Academia Brasileira de Cincias, 76(3), 499-504.
175
References
Dent, V. E., Hardie, J. M., & Bowden, G. H. (1978). Streptococci isolated from dental
plaque of animals. Journal of Applied Bacteriology, 44(2), 249-258.
Dhar, R., Zhang, K., Talwar, G. P., Garg, S., & Kumar, N. (1998). Inhibition of the
growth and development of asexual and sexual stages of drug-sensitive and
resistant strains of the human malaria parasite Plasmodium falciparum by Neem
(Azadirachta indica) fractions. Journal of Ethnopharmacology, 61(1), 31-39.
Dilika, F., Afolayan, A. J., & Meyer, J. J. M. (1997). Comparative antibacterial activity
of two Helichrysum species used in male circumcision in South Africa. South
African Journal of Botany, 63(3), 158-159.
Dixon, R. A. (2001). Natural products and plant disease resistance. Nature, 411(6839),
843-847.
Dixon, R. A., Dey, P. M., & Lamb, C. J. (1983). Phytoalexins: enzymology and
molecular biology. Advances in Enzymology and Related Areas of Molecular
Biology, 55, 1-136.
Douglas, B., & Kiang, A. K. (1957). A Phytochemical Survey of the Flora of Malaya. I.
Alkaloids. Malayan Pharmaceutical Journal, 6, 1-16.
Druilhe, P., Brandicourt, O., Chongsuphajaisiddhi, T., & Berthe, J. (1988). Activity of a
combination of three cinchona bark alkaloids against Plasmodium falciparum in
vitro. Antimicrobial Agents and Chemotherapy, 32(2), 250-254.
Duke, J. A. (1985). Handbook of medicinal plants. Florida, US: CRC Press Inc.
EhlingSchulz, M., Fricker, M., & Scherer, S. . (2004). Bacillus cereus, the causative
agent of an emetic type of foodborne illness. Molecular Nutrition and Food
Research, 48(7), 479-487.
176
References
Elliott, S., & Brimacombe, J. (1986). Pharmacy needs tropical forests. Manufacturing
Chemist, 57, 31-34.
Eloff, J. N. (1998). Which extractant should be used for the screening and isolation of
antimicrobial components from plants? Journal of Ethnopharmacology, 60(1),
1-8. doi: http://dx.doi.org/10.1016/S0378-8741(97)00123-2
Eloff, J. N., & McGaw, L. J. (2006). Plant Extracts Used to Manage Bacterial, Fungal,
and Parasitic Infections in South Africa. In Ahmad, I., Aqil, F. & Owais, M.
(Eds.), Modern phytomedicine: Turning medicinal plants into drugs. (pp. 100-
101). Weinham.: WILEY-VCH Verlag Gmbh & Co.
Erasto, P., Grierson, D. S., & Afolayan, A. J. (2006). Bioactive sesquiterpene lactones
from the leaves of Vernonia amygdalina. Journal of Ethnopharmacology,
106(1), 117-120.
Erasto, P., Grierson, D. S., & Afolayan, A. J. (2007). Evaluation of antioxidant activity
and the fatty acid profile of the leaves of Vernonia amygdalina growing in South
Africa. Food Chemistry, 104(2), 636-642.
Erb, A., Sturmer, T., Marre, R., & Brenner, H. (2007). Prevalence of antibiotic
resistance in Escherichia coli: overview of geographical, temporal, and
methodological variations. European Journal of Clinical Microbiology &
Infectious Diseases, 26(2), 83-90. doi: 10.1007/s10096-006-0248-2
Eshun, K., & He, Q. (2004). Aloe vera: a valuable ingredient for the food,
pharmaceutical and cosmetic industries - a review. Critical Reviews in Food
Science and Nutrition 44(2), 91-96. doi: 10.1080/10408690490424694
Evans, P. H. (1993). Free radicals in brain metabolism and pathology. British Medical
Bulletin, 49(3), 577-587.
177
References
Feng, J., Yuan, F., Gao, Y., Liang, C., Xu, J., Zhang, C., & He, L. (2003). A novel
antimicrobial protein isolated from potato (Solanum tuberosum) shares
homology with an acid phosphatase. Biochemical Journal, 376(2), 481-487. doi:
10.1042/BJ20030806
Ferro, V. A., Bradbury, F., Cameron, P., Shakir, E., Rahman, S. R., & Stimson, W. H.
(2003). In vitro susceptibilities of Shigella flexneri and Streptococcus pyogenes
to inner gel of Aloe barbadensis Miller. Antimicrobial Agents and
Chemotherapy, 47(3), 1137-1139.
Fessenden, R. J., & Fessenden, J. S. (1982). Organic Chemistry (2nd ed.). Boston: MA:
Willard Grant Press.
Gandhi, V. M., & Cherian, K. M. (2000). Red cell haemolysis test as an in vitro
approach for the assessment of toxicity of karanja oil. Toxicology In Vitro,
14(6), 513-516.
Gaur, A. H., Patrick, C. C., McCullers, J. A., Flynn, P. M., Pearson, T. A., Razzouk, B.
I., Thompson, S. J., & Shenep, J. L. (2001). Bacillus cereus bacteremia and
meningitis in immunocompromised children. Clinical Infectious Diseases,
32(10), 1456-1462.
Gerber, M., Boutron-Ruault, M. C., Hercberg, S., Riboli, E., Scalbert, A., & Siess, M.
H. (2002). Food and cancer: state of the art about the protective effect of fruits
and vegetables. Bulletin du Cancer, 89(3), 293-312.
Ghafoor, A. O., Qadir, H. K., & Fakhri, N. A. (2012). Analysis of Phenolic Compounds
in Extracts of Ziziphus spina-christi using RP-HPLC method. Journal of
Chemical and Pharmaceutical Research, 4(6), 3158-3163.
Ghosh, A., Das, B. K., Roy, A., Mandal, B., & Chandra, G. (2008). Antibacterial
activity of some medicinal plant extracts. Journal of Natural Medicines, 62(2),
259-262. doi: 10.1007/s11418-007-0216-x
Ghoshal, S., Prasad, B. N., & Lakshmi, V. (1996). Antiamoebic activity of Piper
longum fruits against Entamoeba histolytica in vitro and in vivo. Journal of
Ethnopharmacology, 50(3), 167-170.
Gilgun-Sherki, Y., Rosenbaum, Z., Melamed, E., & Offen, D. (2002). Antioxidant
therapy in acute central nervous system injury: current state. Pharmacological
Reviews, 54(2), 271-284.
Gowniak, K., Zgrka, G., & Kozyra, M. (1996). Solid-phase extraction and reversed-
phase high-performance liquid chromatography of free phenolic acids in some
Echinacea species. Journal of Chromatography A, 730(1), 25-29.
Goldberg, M. B., & Theriot, J. A. (1995). Shigella flexneri surface protein IcsA is
sufficient to direct actin-based motility. Proceedings of the National Academy of
Sciences USA, 92(14), 6572-6576.
Goldman, L., & Fox, H. (1944). Greenish pigmentation of nail plates from Bacillus
pyocyaneus infection: Report of two cases. Archives of Dermatology, 49(2),
136-137.
Gonzlez-Lamothe, R., Mitchell, G., Gattuso, M., Diarra, M., Malouin, F., & Bouarab,
K. (2009). Plant Antimicrobial Agents and Their Effects on Plant and Human
Pathogens. International Journal of Molecular Sciences, 10(8), 3400-3419.
Gosch, C., Halbwirth, H., Kuhn, J. H., Miosic, S., & Stich, K. (2009). Biosynthesis of
phloridzin in apple (Malus domestica Borkh.). Plant Science, 176(2), 223-231.
doi: http://dx.doi.org/10.1016/j.plantsci.2008.10.011
179
References
Gosch, C., Halbwirth, H., & Stich, K. (2010). Phloridzin: Biosynthesis, distribution and
physiological relevance in plants. Phytochemistry, 71(89), 838-843. doi:
http://dx.doi.org/10.1016/j.phytochem.2010.03.003
Grayer, R. J., & Kokubun, T. (2001). Plant--fungal interactions: the search for
phytoalexins and other antifungal compounds from higher plants.
Phytochemistry, 56(3), 253-263.
Gresham, L. J., Ross, J., & Izevbigie, E. B. (2008). Vernonia amygdalina: anticancer
activity, authentication, and adulteration detection. International Journal of
Environmental Research and Public Health, 5(5), 342-348.
Grover, A., Bhandari, B. S., & Rai, N. (2011). Antimicrobial activity of medicinal
plants-Azadirachta indica A. Juss, Allium cepa L. and Aloe vera L. International
Journal of PharmTech Research, 3, 1059-1065.
Grundmann, H., Aires-de-Sousa, M., Boyce, J., & Tiemersma, E. (2006). Emergence
and resurgence of meticillin-resistant Staphylococcus aureus as a public-health
threat. Lancet, 368(9538), 874-885. doi: 10.1016/S0140-6736(06)68853-3
Gulcin, I., Koksal, K., Elmastas, M., & Aboul-Enein, H. Y. (2007). Determination of in
vitro antioxidant and radical scavenging activity of Verbascum oreophilum C.
Koch Var Joannis (Fam. Scrophulariaceae). Research Journal of Biological
Sciences 2(3), 372-382.
Guleria, S., Tiku, A. K., Singh, G., Koul, A., Gupta, S., & Rana, S. (2013). In vitro
antioxidant activity and phenolic contents in methanol extracts from medicinal
plants. Journal of Plant Biochemistry and Biotechnology, 22(1), 9-15.
180
References
Gurjar, M. S., Ali, S. , Akhtar, M., & Singh, S. (2012). Efficacy of plant extracts in
plant disease management. Agricultural Sciences, 3(3), 425-433. doi:
10.4236/as.2012.33050
Habeeb, F., Shakir, E., Bradbury, F., Cameron, P., Taravati, M. R., Drummond, A. J.,
Gray, A. I., & Ferro, V. A. (2007). Screening methods used to determine the
anti-microbial properties of Aloe vera inner gel. Methods, 42(4), 315-320. doi:
10.1016/j.ymeth.2007.03.004
Haley, R. W., Culver, D. H., White, J. W., Morgan, W. M., Emori, T. G., Munn, V. P.,
& Hooton, T. M. (1985). The efficacy of infection surveillance and control
programs in preventing nosocomial infections in US hospitals. American
Journal of Epidemiology, 121(2), 182-205.
Hamburger, M., & Hostettmann, K. (1991). Bioactivity in plants: the link between
phytochemistry and medicine. Phytochemistry, 30(12), 3864-3874. doi:
http://dx.doi.org/10.1016/0031-9422(91)83425-K
Hamid, A., Shah, Z., Muse, R., & Mohamed, S. (2002). Characterisation of
antioxidative activities of various extracts of Centella asiatica (L) Urban. Food
chemistry, 77(4), 465-469.
Hammer, K. A., Carson, C. F., & Riley, T. V. (1999). Antimicrobial activity of essential
oils and other plant extracts. Journal of Applied Microbiology 86(6), 985-990.
181
References
Hargono, D., Lastari, P., Astuti, Y., & van den Bergh, M. H. (1999). Plant Resources of
South-East Asia (Vol. 1). Bogor, Indonesia: Prosea Foundation.
Harrigan, G. G., Ahmad, A., Baj, N., Glass, T. E., Gunatilaka, A. A., & Kingston, D. G.
(1993). Bioactive and other sesquiterpenoids from Porella cordeana. Journal of
Natural Products, 56(6), 921-925.
Harshey, R. M. (1994). Bees aren't the only ones: swarming in gram-negative bacteria.
Molecular Microbiology, 13(3), 389-394.
Hartwell, J. L. (1969). Plants used against cancer. A survey. Lloydia, 32(1), 78-107.
Hashim, P., Sidek, H., Helan, M. H. M., Sabery, A., Palanisamy, U. D., & Ilham, M.
(2011). Triterpene composition and bioactivities of Centella asiatica. Molecules,
16(2), 1310-1322.
Hemaiswarya, S., Kruthiventi, A. K., & Doble, M. (2008). Synergism between natural
products and antibiotics against infectious diseases. Phytomedicine, 15(8), 639-
652. doi: http://dx.doi.org/10.1016/j.phymed.2008.06.008
Hensley, K., Mou, S., Pye, Q. N., Dixon, R. A., Summner, L. W., & Floyd, R. A.
(2004). Chemical versus pharmacological actions of nutraceutical
phytochemicals: antioxidant and anti inflammatory modalities. Current Topics
in Nutraceutical Research, 2(1), 13-26.
Huang, D., Ou, B., & Prior, R. L. (2005). The chemistry behind antioxidant capacity
assays. Journal of Agricultural and Food Chemistry 53(6), 1841-1856. doi:
10.1021/jf030723c
182
References
Huffman, M. A., & Seifu, M. (1989). Observations on the illness and consumption of a
possibly medicinal plant Vernonia amygdalina (Del.), by a wild chimpanzee in
the Mahale Mountains National Park, Tanzania. Primates, 30(1), 51-63.
Humpf, H. U., & Schreier, P. (1991). Bound aroma compounds from the fruit and the
leaves of blackberry (Rubus laciniata L.). Journal of Agricultural and Food
Chemistry, 39(10), 1830-1832.
Huynh, Q. K., Borgmeyer, J. R., Smith, C. E., Bell, L. D., & Shah, D. M. (1996).
Isolation and characterization of a 30 kDa protein with antifungal activity from
leaves of Engelmannia pinnatifida. Biochemical Journal, 316 (3), 723-727.
Igile, G. O., Oleszek, W., Jurzysta, M., Burda, S., Fafunso, M. A., & Fasanmade, A. A.
(1994). Flavonoids from Vernonia amygdalina and their antioxidant activities.
Journal of Agricultural and Food Chemistry, 42(11), 2445-2448.
Iinuma, M., Tsuchiya, H., Sato, M., Yokoyama, J., Ohyama, M., Ohkawa, Y., Tanaka,
T., Fujiwara, S., & Fujii, T. (1994). Flavanones with Potent Antibacterial
Activity against Methicillinresistant Staphylococcus aureus. Journal of
Pharmacy and Pharmacology, 46(11), 892-895.
Ijeh, I. I., & Ejike, C. E. C. C. (2011). Current perspective on the medicinal potential of
Vernonia amygdalina Del. Journal of Medicinal Plants Research, 5, 1051-1061.
Ijeh, I., Nwugo, V. O., & Obidoa, O. (1996). Comparative studies on the nutritive
phytochemical and antimicrobial properties of two varieties of Vernomia
amygdalina. Plant Processing Research Community, 1, 71-75.
Ikeda, T., Otake, S., Hirasawa, M., Williams, K., Kiyoyono, H., McGhee, J. R., &
Shiota, T. (1980). Virulence of Streptococcus mutans: revertants of mutant C4.
Infection and Immunity, 27(1), 25-31.
Inamdar, P. K., Yeole, R. D., Ghogare, A. B., & De Souza, N. J. (1996). Determination
of biologically active constituents in Centella asiatica. Journal of
Chromatography A, 742(1), 127-130.
Iwalokun, B. A., Efedede, B. U., Alabi-Sofunde, J. A., Oduala, T., Magbagbeola, O. A.,
& Akinwande, A. I. (2006). Hepatoprotective and antioxidant activities of
Vernonia amygdalina on acetaminophen-induced hepatic damage in mice.
Journal of Medicinal Food, 9(4), 524-530.
183
References
Iwu, M. W., Duncan, A. R., & Okunji, C. O. (1999). New antimicrobials of plant origin.
Perspectives on New Crops and New Uses, 457-462.
Jaki, B. U., Franzblau, S. G., Chadwick, L. R., Lankin, D. C., Zhang, F., Wang, Y., &
Pauli, G. F. (2008). Purity-activity relationships of natural products: the case of
anti-TB active ursolic acid. Journal of Natural Products, 71(10), 1742-1748.
doi: 10.1021/np800329j
James, J. T., & Dubery, I. A. (2009). Pentacyclic triterpenoids from the medicinal herb,
Centella asiatica (L.) Urban. Molecules, 14(10), 3922-3941.
Jamil, A., Shahid, M., Khan, M. M., & Ashraf, M. (2007). Screening of some medicinal
plants for isolation of antifungal proteins and peptides. Pakistan Journal of
Botany, 39(1), 211-221.
Jarraud, S., Mougel, C., Thioulouse, J., Lina, G., Meugnier, H., Forey, F., Nesme, X.,
Etienne, J., & Vandenesch, F. (2002). Relationships between Staphylococcus
aureus genetic background, virulence factors, agr groups (alleles), and human
disease. Infection and Immunity, 70(2), 631-641.
Jassim, S. A., & Naji, M. A. (2003). Novel antiviral agents: a medicinal plant
perspective. Journal of Applied Microbiology, 95(3), 412-427.
Jensen, G. B., Hansen, B. M., Eilenberg, J., & Mahillon, J. (2003). The hidden lifestyles
of Bacillus cereus and relatives. Environmental Microbiology, 5(8), 631-640.
Jin, Z., & Xu, X. (2013). Amaryllidaceae Alkaloids Natural Products (pp. 479-522):
Springer.
184
References
Jisaka, M., Ohigashi, H., Takegawa, K., Hirota, M., Irie, R., Huffman, M. A., &
Koshimzu, K. (1993). Steroid glucosides from Vernonia amygdalina, a possible
chimpanzee medicinal plant. Phytochemistry, 34(2), 409-413.
Johnson, C. E., Lin, L., Harnly, J. M., Oladeinde, F. O., Kinyua, A. M., Michelin, R., &
Bronner, Y. (2011). Identification of the Phenolic Components of Vernonia
amygdalina and Russelia equisetiformis. Journal of Natural Products, 4, 57-64.
Jones, J. D., & Dangl, J. L. (2006). The plant immune system. Nature, 444(7117), 323-
329. doi: 10.1038/nature05286
Jones Jr, S. B., & Luchsinger, A. E. (1979). Plant systematics. New York: McGraw-
Hill.
Kahl, R., & Kappus, H. (1993). Toxicology of the synthetic antioxidants BHA and BHT
in comparison with the natural antioxidant vitamin E. Zeitschrift fur
Lebensmittel-Untersuchung und -Forschung,, 196(4), 329-338.
Kaithwas, G., Kumar, A., Pandey, H., Acharya, A. K., Sing, M., Bathia, D., &
Mukerjee, A. (2008). Investigation of comparative antimicrobial activity of Aloe
vera gel and juice. Pharmacologyonline, 1, 239-243.
Kaper, J. B., Nataro, J. P., & Mobley, H. L. T. (2004). Pathogenic Escherichia coli.
Nature Reviews Microbiology, 2(2), 123-140.
Kazmi, M. H., Malik, A., Hameed, S., Akhtar, N., & Noor Ali, S. (1994). An
anthraquinone derivative from Cassia italica. Phytochemistry, 36(3), 761-763.
Khan, R. A., Khan, M. R., Sahreen, S., & Ahmed, M. (2012). Evaluation of phenolic
contents and antioxidant activity of various solvent extracts of Sonchus asper
(L.) Hill. Chem Cent J, 6(1), 12. doi: 10.1186/1752-153X-6-12
185
References
Kim, H., Park, S. W., Park, J. M., Moon, K. H., & Lee, C. K. (1995). Screening and
isolation of antibiotic resistant inhibitors from herb materials. I. - Resistant
Inhibition of 21 Korean Plants. Natural Product Science (Korea), 1, 50 - 54.
Kirtikar, K. R. , & Basu, B. D. (1935). Indian Medicinal Plants (B., L. M. Ed. 2nd ed.).
Allahabad, India.
Kishimoto, N., Kakino, Y., Iwai, K., Mochida, K., & Fujita, T. (2005). In vitro
antibacterial, antimutagenic and anti-influenza virus activity of caffeic acid
phenethyl esters. Biocontrol Science, 10(4), 155-161.
Kluytmans, J., van Belkum, A., & Verbrugh, H. (1997). Nasal carriage of
Staphylococcus aureus: epidemiology, underlying mechanisms, and associated
risks. Clinical Microbiology Reviews, 10(3), 505-520.
Knekt, P., Jarvinen, R., Reunanen, A., & Maatela, J. (1996). Flavonoid intake and
coronary mortality in Finland: a cohort study. British Medical Journal,
312(7029), 478-481.
Knight, G. M., Budd, E. L., Whitney, L., Thornley, A., Al-Ghusein, H., Planche, T., &
Lindsay, J. A. (2012). Shift in dominant hospital-associated methicillin-resistant
Staphylococcus aureus (HA-MRSA) clones over time. Journal of Antimicrobial
Chemotherapy, 67(10), 2514-2522. doi: 10.1093/jac/dks245
Kobori, M., Masumoto, S., Akimoto, Y., & Oike, H. (2012). Phloridzin reduces blood
glucose levels and alters hepatic gene expression in normal BALB/c mice. Food
and Chemical Toxicology, 50(7), 2547-2553. doi:
http://dx.doi.org/10.1016/j.fct.2012.04.017
Kotiranta, A., Haapasalo, M., Kari, K., Kerosuo, E., Olsen, I., Sorsa, T., Meurman, J.
H., & Lounatmaa, K. (1998). Surface structure, hydrophobicity, phagocytosis,
and adherence to matrix proteins of Bacillus cereus cells with and without the
crystalline surface protein layer. Infection and Immunity, 66(10), 4895-4902.
186
References
Kotiranta, A., Lounatmaa, K., & Haapasalo, M. (2000). Epidemiology and pathogenesis
of Bacillus cereus infections. Microbes and Infection, 2(2), 189-198.
Kubo, I., Muroi, H., & Himejima, M. (1993). Combination effects of antifungal
nagilactones against Candida albicans and two other fungi with
phenylpropanoids. Journal of Natural Products, 56(2), 220-226.
Kumar, K. P. S., Bhowmik, D., Chiranjib, & Biswajit. (2010). Aloe vera : A Potential
Herb and its Medicinal Importance. Journal of Chemical and Pharmaceutical
Research, 2(1), 21-29.
Larson, R. H., & Fitzgerald, R. J. (1968). Caries development in the African white-
tailed rat (Mystromys albicaudatus) infected with a streptococcus of human
origin. Journal of Dental Research, 47(5), 746-749.
Lattif, A. G., Omar, I. M., Said, I. M., & Kadri, A. (1984). A multi-variate approach to
the study of medicinal plants in Malaysia. Journal of the Singapore National
Academy of Science, 13, 101-105.
Lau, D. T., Shaw, P. C., Wang, J., & But, P. P. (2001). Authentication of medicinal
Dendrobium species by the internal transcribed spacer of ribosomal DNA.
Planta Medica, 67(5), 456-460.
Lawless, J., & Allan, J. . (2000). The Clinical Composition of Aloe vera Aloe vera
natural wonder cure. (pp. 161-171). London, United Kingdom.: Thorsons,
Publishing Ltd.
Lawrence, R., Tripathi, P., & Jeyakumar, E. (2009). Isolation, purification and
evaluation of antibacterial agents from Aloe vera. Brazilian Journal of
Microbiology, 40(4), 906-915.
187
References
Lehrer, R. I., Rosenman, M., Harwig, S. S. S. L., Jackson, R., & Eisenhauer, P. (1991).
Ultrasensitive assays for endogenous antimicrobial polypeptides. Journal of
Immunological Methods, 137(2), 167-173.
Levy, S. B., & Marshall, B. (2004). Review: Antibacterial resistance worldwide: causes,
challenges and responses. Nature Medicine, 10(12 ), 122-129. doi:
10.1038/nm1145
Lewis, K. (2007). Persister cells, dormancy and infectious disease. Nature Reviews.
Microbiology, 5(1), 48-56. doi: 10.1038/nrmicro1557
Li, Y., Ooi, L. S., Wang, H., But, P. P., & Ooi, V. E. (2004). Antiviral activities of
medicinal herbs traditionally used in southern mainland China. Phytotherapy
Research, 18(9), 718-722. doi: 10.1002/ptr.1518
Lourens, A. C. U., Reddy, D., Baer, K. H. C., Viljoen, A. M., & Van, V. S. F. (2004).
In vitro biological activity and essential oil composition of four indigenous
South African Helichrysum species. Journal of Ethnopharmacology, 95(2), 253-
258.
Luo, X., Jiang, Y., Fronczek, F. R., Lin, C., Izevbigie, E. B., & Lee, K. S. (2011).
Isolation and structure determination of a sesquiterpene lactone (vernodalinol)
from Vernonia amygdalina extracts. Pharm Biol, 49(5), 464-470. doi:
10.3109/13880209.2010.523429
Mah, T. F., Pitts, B., Pellock, B., Walker, G. C., Stewart, P. S., & O'Toole, G. A.
(2003). A genetic basis for Pseudomonas aeruginosa biofilm antibiotic
resistance. Nature, 426(6964), 306-310. doi: 10.1038/nature02122
Maki, D. G., Goldman, D. A., & Rhame, F. S. (1973). Infection control in intravenous
therapy. Annals of Internal Medicine, 79(6), 867-887.
188
References
Marchese, A., & Schito, G. C. (2000). Resistance patterns of lower respiratory tract
pathogens in Europe. International Journal of Antimicrobial Agents, 16(1), 25-
29. doi: http://dx.doi.org/10.1016/S0924-8579(00)00302-2
Marlatt, C., Ho, C. T., & Chien, M. (1992). Studies of aroma constituents bound as
glycosides in tomato. Journal of Agricultural and Food Chemistry, 40(2), 249-
252.
Martini, N. D., Katerere, D. R. P., & Eloff, J. N. (2004). Biological activity of five
antibacterial flavonoids from Combretum erythrophyllum (Combretaceae).
Journal of Ethnopharmacology, 93(23), 207-212. doi:
http://dx.doi.org/10.1016/j.jep.2004.02.030
Masaki, H., Sakaki, S., Atsumi, T., & Sakurai, H. (1995). Active-oxygen scavenging
activity of plant extracts. Biological & Pharmaceutical Bulletin, 18(1), 162-166.
McDevitt, J. T., Schneider, D. M., Katiyar, S. K., & Edlind, T. D. (1996). Berberine: a
candidate for the treatment of diarrhea in AIDS patients, abstr. 175. Paper
presented at the Program and Abstracts of the 36th Interscience Conference on
Antimicrobial Agents and Chemotherapy. American Society for Microbiology,
Washington, DC.
McMahon, J. B., Currens, M. J., Gulakowski, R. J., Buckheit, R. W., Jr., Lackman-
Smith, C., Hallock, Y. F., & Boyd, M. R. (1995). Michellamine B, a novel plant
alkaloid, inhibits human immunodeficiency virus-induced cell killing by at least
two distinct mechanisms. Antimicrobial Agents and Chemotherapy, 39(2), 484-
488.
189
References
Middleton, E., Kandaswami, C., & Theoharides, T. C. (2000). The effects of plant
flavonoids on mammalian cells: implications for inflammation, heart disease,
and cancer. Pharmacological Reviews, 52(4), 673-751.
Mian, A. ., Mimica-Duki, N. M., Mandi, A. I., Saka, M. B., Milovanovi, I. L., &
Sedej, I. J. (2010). Development of a rapid resolution HPLC method for the
separation and determination of 17 phenolic compounds in crude plant extracts.
Central European Journal of Chemistry, 9(1), 133-142. doi: 10.2478/s11532-
010-0126-8
Motilva, M., Serra, A., & Maci, A. (2013). Analysis of food polyphenols by ultra high-
performance liquid chromatography coupled to mass spectrometry: An
overview. Journal of Chromatography A, 1292, 66-82. doi:
http://dx.doi.org/10.1016/j.chroma.2013.01.012
190
References
Najafian, M., Jahromi, M. Z., Nowroznejhad, M. J., Khajeaian, P., Kargar, M. M.,
Sadeghi, M., & Arasteh, A. (2012). Phloridzin reduces blood glucose levels and
improves lipids metabolism in streptozotocin-induced diabetic rats. Molecular
Biology Reports, 39(5), 5299-5306. doi: 10.1007/s11033-011-1328-7
Namba, T., Morita, O., Huang, S. L., Goshima, K., Hattori, M., & Kakiuchi, N. (1988).
Studies on Cardio-Active Crude Drugs .1. Effect of Coumarins on Cultured
Myocardial-Cells. Planta Medica(4), 277-282.
Nang, H. L. L., May, C. Y., Ngan, M. A., & Hock, C. C. (2007). Extraction and
Identification of Water-Soluble Compounds in Palm-Pressed Fiber by SC-CO2
and GC-MS. American Journal of Environmental Sciences, 3(2), 54.
Nascimento, G. G. F., Locatelli, J., Freitas, P. C., & Silva, G. L. (2000). Antibacterial
activity of plant extracts and phytochemicals on antibiotic-resistant bacteria.
Brazilian Journal of Microbiology, 31, 247-256.
Nataro, J. P., Deng, Y., Cookson, S., Cravioto, A., Savarino, S. J., Guers, L. D., Levine,
M. M., & Tacket, C. O. (1995). Heterogeneity of enteroaggregative Escherichia
coli virulence demonstrated in volunteers. Journal of Infectious Diseases,
171(2), 465-468.
Nataro, J. P., Kaper, J. B., Robins-Browne, R., Prado, V., Vial, P., & Levine, M. M.
(1987). Patterns of adherence of diarrheagenic Escherichia coli to HEp-2 cells.
Pediatric Infectious Disease Journal, 6(9), 829-831.
Ni, Y., & Tizard, I. R. (2004). Analytical methodology: the gel-analysis of aloe pulp
and its derivatives Aloes: CRC Press.
Nizet, V., Ohtake, T., Lauth, X., Trowbridge, J., Rudisill, J., Dorschner, R. A.,
Pestonjamasp, V., Piraino, J., Huttner, K., & Gallo, R. L. (2001). Innate
antimicrobial peptide protects the skin from invasive bacterial infection. Nature,
414(6862), 454-457.
Nostro, A., Germano, M. P., Dangelo, V., Marino, A., & Cannatelli, M. A. (2000).
Extraction methods and bioautography for evaluation of medicinal plant
antimicrobial activity. Letters in Applied Microbiology, 30(5), 379-384.
191
References
O'Kennedy, R., & Thornes, R. D. (1997). Coumarins: biology, applications, and mode
of action. New York, N.Y.: John Wiley & Sons, Inc.
Oga, E. F., Sekine, S., & Horie, T. (2013). Ex vivo and in vivo investigations of the
effects of extracts of Vernonia amygdalina, Carica papaya and Tapinanthus
sessilifolius on digoxin transport and pharmacokinetics: Assessing the
significance on rat intestinal P-glycoprotein efflux. Drug Metabolism and
Pharmacokinetics, 28(4), 314-329.
Omulokoli, E., Khan, B., & Chhabra, S. C. (1997). Antiplasmodial activity of four
Kenyan medicinal plants. Journal of Ethnopharmacology, 56(2), 133-137.
Ong, H. C., & Norzalina, J. (1999). Malay herbal medicine in Gemencheh, Negri
Sembilan, Malaysia. Fitoterapia, 70(1), 10-14. doi:
http://dx.doi.org/10.1016/S0367-326X(98)00023-9
Ong, H. C., Zuki, R. M., & Milow, P. (2011). Traditional knowledge of medicinal
plants among the Malay villagers in Kampung Mak Kemas, Terengganu,
Malaysia. EthnoMed, 5(3), 175-185.
Organization, World Health. (1999). The world health report 1999: making a
difference: World Health Organization.
Orhan, I. E., Atasu, E., Senol, F. S., Ozturk, N., Demirci, B., Das, K., & Sekeroglu, N.
(2013). Comparative studies on Turkish and Indian Centella asiatica (L.) Urban
(gotu kola) samples for their enzyme inhibitory and antioxidant effects and
phytochemical characterization. Industrial Crops and Products, 47, 316-322.
doi: http://dx.doi.org/10.1016/j.indcrop.2013.03.022
Oriakhi, K., Oikeh, E. I., Ezeugwu, N., Anoliefo, O., Aguebor, O., & Omoregie, E. S.
(2014). Comparative Antioxidant Activities of Extracts of Vernonia amygdalina
and Ocimum gratissimum Leaves. Journal of Agricultural Science, 6(1).
Osawa, T. (1994). Novel natural antioxidants for utilization in food and biological
systems. In Uritani, I., Garcia, V. V. & Mendoza, E. M. (Eds.), Postharvest
biochemistry of plant food- materials in the tropics (pp. 241251). Tokyo,
Japan: Japan Scientific Societies Press.
192
References
Osborn, R. W., De Samblanx, G. W., Thevissen, K., Goderis, I., Torrekens, S., Van
Leuven, F., Attenborough, S., Rees, S. B., & Broekaert, W. F. (1995). Isolation
and characterisation of plant defensins from seeds of Asteraceae, Fabaceae,
Hippocastanaceae and Saxifragaceae. Federation of European Biochemical
Societies Letters, 368(2), 257-262.
Osbourn, A. E., Clarke, B. R., Lunness, P., Scott, P. R., & Daniels, M. J. (1994). An Oat
Species Lacking Avenacin Is Susceptible to Infection by Gaeumannomyces-
Graminis Var Tritici. Physiological and Molecular Plant Pathology, 45(6), 457-
467. doi: Doi 10.1016/S0885-5765(05)80042-6
Owolabi, M. A., Jaja, S. I., Oyekanmi, O. O., & Olatunji, O. J. (2008). Evaluation of the
Antioxidant Activity and Lipid Peroxidation of the Leaves of Vernonia
amygdalina. Journal of Complementary and Integrative Medicine, 5(1).
Pannala, A. S., Chan, T. S., O'Brien, P. J., & Rice-Evans, C. A. (2001). Flavonoid B-
ring chemistry and antioxidant activity: fast reaction kinetics. Biochemical and
Biophysical Research Communications, 282(5), 1161-1168.
Papadopoulou, K., Melton, R. E., Leggett, M., Daniels, M. J., & Osbourn, A. E. (1999).
Compromised disease resistance in saponin-deficient plants. Proceedings of the
National Academy of Sciences of the United States of America, 96(22), 12923-
12928. doi: DOI 10.1073/pnas.96.22.12923
Parekh, J., Jadeja, D., & Chanda, S. (2005). Efficacy of aqueous and methanol extracts
of some medicinal plants for potential antibacterial activity. Turkish Journal of
Biology, 29, 203-210.
Parekh, J., Karathia, N., & Chanda, S. (2006). Screening of some traditionally used
medicinal plants for potential antibacterial activity. Indian Journal of
Pharmaceutical Sciences, 68(6), 832.
Peng, S. Y., Norman, J., Curtin, G., Corrier, D., McDaniel, H. R., & Busbee, D. (1991).
Decreased mortality of Norman murine sarcoma in mice treated with the
immunomodulator, Acemannan. Molecular Biotherapy, 3(2), 79-87.
193
References
Pengsuparp, T., Cai, L., Fong, H. H., Kinghorn, A. D., Pezzuto, J. M., Wani, M. C., &
Wall, M. E. (1994). Pentacyclic triterpenes derived from Maprounea africana
are potent inhibitors of HIV-1 reverse transcriptase. Journal of Natural
Products, 57(3), 415-418.
Pereira, A. P., Ferreira, I. C. F. R., Marcelino, F., Valento, P., Andrade, P. B., Seabra,
R., Estevinho, L., Bento, A., & Pereira, J. A. (2007). Phenolic compounds and
antimicrobial activity of olive (Olea europaea L. Cv. Cobranosa) leaves.
Molecules, 12(5), 1153-1162.
Perez, C., Pauli, M., & Bazevque, P. (1990). An antibiotic assay by the agar well
diffusion method. Acta Biologiae et medicine Experimentalis, 15, 113-115.
Peuchant, E., Brun, J., Rigalleau, V., Dubourg, L., Thomas, M. J., Daniel, J., Leng, J., &
Gin, H. (2004). Oxidative and antioxidative status in pregnant women with
either gestational or type 1 diabetes. Clinical Biochemistry, 37(4), 293-298.
Pietta, P. G., Simonetti, P., Gardana, C., Brusamolino, A., Morazzoni, P., &
Bombardelli, E. (1998). Catechin metabolites after intake of green tea infusions.
Biofactors, 8(1-2), 111-118.
Pietta, P., Simonetti, P., & Mauri, P. (1998). Antioxidant Activity of Selected Medicinal
Plants. Journal of Agricultural and Food Chemistry, 46(11), 4487-4490. doi:
10.1021/jf980310p
Price, K. R., Johnson, I. T., & Fenwick, G. R. (1987). The chemistry and biological
significance of saponins in foods and feedingstuffs. Critical Reviews in Food
Science and Nutrition 26(1), 27-135. doi: 10.1080/10408398709527461
Prior, R. L., & Cao, G. (1999). In vivo total antioxidant capacity: comparison of
different analytical methods. Free Radical Biology & Medicine 27(11-12), 1173-
1181.
194
References
Pugh, N., Ross, S. A., ElSohly, M. A., & Pasco, D. S. (2001). Characterization of
Aloeride, a new high-molecular-weight polysaccharide from Aloe vera with
potent immunostimulatory activity. Journal of Agricultural and Food Chemistry
49(2), 1030-1034.
Puteh, M. (2005). Penamaan Tumbuhan Ubatan Dan Beraroma (Yaacob, M., Maarof,
M. G. & Puteh, M. Eds.). Malaysia: Malaysian Agricultural Research and
Development Institute (MARDI).
Que, F., Mao, L., & Zheng, X. (2007). In vitro and vivo antioxidant activities of daylily
flowers and the involvement of phenolic compounds. Asia Pacific Journal of
Clinical Nutrition, 16(1), 196-203.
Rafat, A., Philip, K., & Muniandy, S. (2010). Antioxidant potential and content of
phenolic compounds in ethanolic extracts of selected parts of Andrographis
paniculata. Journal of Medicinal Plant Research, 4(3), 197-202.
Rahman, S., Imran, M., Muhammad, N., Hassan, N., Chisthi, A. K., Khan, A. F.,
Sadozai, K. S., & Khan, S. M. (2011). Antibacetial screening of leaves and stem
of Carica papaya. Journal of Medicinal Plants Research, 5(20), 5167-5171.
Rasigade, J., & Vandenesch, F. (2013). Staphylococcus aureus: A pathogen with still
unresolved issues. Infection, Genetics and Evolution. doi:
http://dx.doi.org/10.1016/j.meegid.2013.08.018
Razali, N., Razab, R., Junit, S. M., & Aziz, A. A. (2008). Radical scavenging and
reducing properties of extracts of cashew shoots (Anacardium occidentale).
Food Chemistry, 111(1), 38-44. doi: 10.1016/j.foodchem.2008.03.024
Reddy, K. V., Yedery, R. D., & Aranha, C. (2004). Antimicrobial peptides: premises
and promises. International Journal of Antimicrobial Agents, 24(6), 536-547.
doi: 10.1016/j.ijantimicag.2004.09.005
Reihani, S. F. S., & Azhar, M. E. (2012). Antioxidant activity and total phenolic content
in aqueous extracts of selected traditional Malay salads (Ulam). International
Food Research Journal, 19(4).
Reynolds, T., & Dweck, A. C. (1999). Aloe vera leaf gel: a review update. Journal of
Ethnopharmacology, 68(1), 3-37.
195
References
Rojas, J. J., Ochoa, V. J., Ocampo, S. A., & Munoz, J. F. (2006). Screening for
antimicrobial activity of ten medicinal plants used in Colombian folkloric
medicine: a possible alternative in the treatment of non-nosocomial infections.
BMC Complementary and Alternative Medicine, 6, 2. doi: 10.1186/1472-6882-
6-2
Sabariah, Z. (1987). Kajian tumbuhan ubatan di daerah Sering, Kota Bharu, Kelantan.
Tesis SmSn. Jabatan Botani, Universiti Kebangsaan Malaysia, Bangi.
Sakanaka, S., Kim, M., Taniguchi, M., & Yamamoto, T. (1989). Antibacterial
substances in Japanese green tea extract against Streptococcus mutans, a
cariogenic bacterium. Agricultural and Biological Chemistry, 53(9), 2307-2311.
Sakanaka, S., Shimura, N., Aizawa, M., Kim, M., & Yamamoto, T. (1992). Preventive
effect of green tea polyphenols against dental caries in conventional rats.
Bioscience, Biotechnology, and Biochemistry, 56(4), 592-594.
Salie, F., Eagles, P. F. K., & Leng, H. M. J. (1996). Preliminary antimicrobial screening
of four South African Asteraceae species. Journal of Ethnopharmacology, 52(1),
27-33.
196
References
Satrija, F., Nansen, P., Murtini, S., & He, S. (1995). Anthelmintic activity of papaya
latex against patent Heligmosomoides polygyrus infections in mice. Journal of
Ethnopharmacology, 48(3), 161-164.
Satyavati, G. V., Raina, M. K., & Sharma, M. (1976). Medicinal plants of India (Vol.
1): Indian council of medical research New Delhi.
Savarese, M., De Marco, E., & Sacchi, R. (2007). Characterization of phenolic extracts
from olives (Olea europaea cv. Pisciottana) by electrospray ionization mass
spectrometry. Food Chemistry, 105(2), 761-770. doi:
http://dx.doi.org/10.1016/j.foodchem.2007.01.037
Schaneberg, B. T., Mikell, J. R., Bedir, E., Khan, I. A., & Nachname, V. (2003). An
improved HPLC method for quantitative determination of six triterpenes in
Centella asiatica extracts and commercial products. Die Pharmazie-An
International Journal of Pharmaceutical Sciences, 58(6), 381-384.
Schmidt, H. . (1988). Phenol oxidase (E.I.14.18.1), a marker enzyme for defense cells.
Progress in histochemistry and cytochemistry (Vol. 17). New York: Gustav
Fischer.
Schmutterer, H. (1995). The neem tree Azadirachta indica A. Juss. and other
meliaceous plants: sources of unique natural products for integrated pest
management, medicine, industry and other purposes. Weinheim, Germany:
VCH Verlagsgesellschaft mbH.
Schmutterer, H., & Ascher, K. R. S. (1983, 25-28 May, 1983). Natural pesticides from
the neem tree (Azadirachta indica A. Juss) and other tropical plants. Paper
presented at the Proceedings of the Second International Neem Conference,
Rauischholzhausen, Federal Republic of Germany.
Sealy, J. R. (1954). Review of the Genus Hymenocallis. Kew Bulletin, 9(2), 201-240.
doi: 10.2307/4114384
Sebastia, J., Pertusa, M., Vilchez, D., Planas, A. M., Verbeek, R., Rodriguez-Farre, E.,
Cristofol, R., & Sanfeliu, C. (2006). Carboxyl-terminal fragment of amyloid
precursor protein and hydrogen peroxide induce neuronal cell death through
different pathways. Journal of Neural Transmission 113(12), 1837-1845. doi:
10.1007/s00702-006-0492-8
197
References
ener, B., Orhan, I. , & Satayavivad, J. (2003). Antimalarial activity screening of some
alkaloids and the plant extracts from Amaryllidaceae. Phytotherapy Research,
17(10), 1220-1223. doi: 10.1002/ptr.1346
Serafini, M., Ghiselli, A., & Ferro-Luzzi, A. (1994). Red wine, tea, and antioxidants.
Lancet, 344(8922), 626.
Serkedjieva, J., & Manolova, N. (1992). Anti-influenza virus effect of some propolis
constituents and their analogues (esters of substituted cinnamic acids). Journal
of Natural Products, 55(3), 294-297.
Shah, P. M. (2005). The need for new therapeutic agents: what is the pipeline? Clinical
Microbiology and Infection 11(3), 36-42.
Shahidi, F., Janita, P. K., & Wanasundara, P. D. (1992). Phenolic antioxidants. Critical
Reveiws in Food Science and Nutrition, 32(1), 67-103. doi:
10.1080/10408399209527581
Shalini, N., Sasidharan, T. D., & Babu. (2009). Cytotoxic and antioxidant properties of
sterculia species found in Western Ghats of Kerala. Amala Research Bulletin,
29, 145-151.
Shan, B., Cai, Y. Z., Brooks, J. D., & Corke, H. (2007). The in vitro antibacterial
activity of dietary spice and medicinal herb extracts. International Journal of
Food Microbiology, 117(1), 112-119. doi: 10.1016/j.ijfoodmicro.2007.03.003
198
References
Shiba, M., Kondo, K., Miki, E., Yamaji, H., Morota, T., Terabayashi, S., Takeda, S.,
Sasaki, H., Miyamoto, K., & Aburada, M. (2006). Identification of medicinal
Atractylodes based on ITS sequences of nrDNA. Biological & Pharmaceutical
Bulletin 29(2), 315-320.
Singh, R., Singh, S., Kumar, S., & Arora, S. (2007). Studies on antioxidant potential of
methanol extract/fractions of Acacia auriculiformis A. Cunn. Food Chemistry,
103(2), 505-511.
Siti, Z. M., Tahir, A., Farah, A. I., Fazlin, S. M. A., Sondi, S., Azman, A. H.,
Maimunah, A. H., Haniza, M. A., Siti Haslinda, M. D., Zulkarnain, A. K.,
Zakiah, I., & Zaleha, W. C. W. (2009). Use of traditional and complementary
medicine in Malaysia: a baseline study. Complementary Therapies in Medicine,
17(56), 292-299. doi: http://dx.doi.org/10.1016/j.ctim.2009.04.002
Slinkard, K., & Singleton, V. L. (1977). Total phenol analysis: automation and
comparison with manual methods. American Journal of Enology and Viticulture,
28(1), 49-55.
Stern, J. L., Hagerman, A. E., Steinberg, P. D., & Mason, P. K. (1996). Phlorotannin-
protein interactions. Journal of Chemical Ecology, 22(10), 1877-1899.
Stiles, H. M., Meyers, R., Brunnelle, J. A., & Wittig, A. B. (1976). Occurrence of
Streptococcus mutans and Streptococcus sanguis in the oral cavity and feces of
young children. Microbial Aspects of Dental Caries, 187, 187-199.
Stoilova, I., Gargova, S., Stoyanova, A., & Ho, I. (2005). Antimicrobial and antioxidant
activity of the polyphenol mangiferin. Herba Polonica, 51, 1-2.
Stoll, B. J., Hansen, N., Fanaroff, A. A., Wright, L. L., Carlo, W. A., Ehrenkranz, R. A.,
Lemons, J. A., Donovan, E. F., Stark, A. R., Tyson, J. E., Oh, W., Bauer, C. R.,
Korones, S. B., Shankaran, S., Laptook, A. R., Stevenson, D. K., Papile, L. A.,
& Poole, W. K. (2002). Changes in pathogens causing early-onset sepsis in very-
low-birth-weight infants. The New England Journal of Medicine, 347(4), 240-
247. doi: 10.1056/NEJMoa012657
199
References
Subedi, A., Amatya, M. P., Shrestha, T. M., Mishra, S. K., & Pokhrel, B. M. (2012).
Antioxidant And Antibacterial Activity Of Methanolic Extract Of Machilus
Odoratissima. Kathmandu University Journal of Science, Engineering and
Technology, 8(1), 73-80.
Sulaiman, S. F., Sajak, A. A. B., Ooi, K. L., & Seow, E. M. (2011). Effect of solvents in
extracting polyphenols and antioxidants of selected raw vegetables. Journal of
Food Composition and Analysis, 24(4), 506-515.
Sule, I. O., & Agbabiaka, T. O. (2008). Antibacterial effect of some plant extracts on
selected Enterobacteriaceae. Ethnobotanical Leaflets, 12(1), 1035-1042.
Sun, H. D., Qiu, S. X., Lin, L. Z., Wang, Z. Y., Lin, Z. W., Pengsuparp, T., Pezzuto, J.
M., Fong, H. H., Cordell, G. A., & Farnsworth, N. R. (1996). Nigranoic acid, a
triterpenoid from Schisandra sphaerandra that inhibits HIV-1 reverse
transcriptase. Journal of Natural Products, 59(5), 525-527. doi:
10.1021/np960149h
Sun, J., Liang, F., Bin, Y., Li, P., & Duan, C. (2007). Screening Non-colored Phenolics
in Red Wines using Liquid Chromatography/Ultraviolet and Mass
Spectrometry/Mass Spectrometry Libraries. Molecules, 12(3), 679-693.
Suresh, K., Deepa, P., Harisaranraj, R., & Vaira, A. V. (2008). Antimicrobial and
Phytochemical Investigation of the Leaves of Carica papaya L., Cynodon
dactylon (L.) Pers., Euphorbia hirta L., Melia azedarach L. and Psidium
guajava L. Ethnobotanical Leaflets, 12(1), 1184-1191.
Sydiskis, R. J., Owen, D. G., Lohr, J. L., Rosler, K. H., & Blomster, R. N. (1991).
Inactivation of enveloped viruses by anthraquinones extracted from plants.
Antimicrobial Agents Chemotherapy, 35(12), 2463-2466.
Szabo, M. R., Idioiu, C., Chambre, D., & Lupea, A. X. (2007). Improved DPPH
determination for antioxidant activity spectrophotometric assay. Chemical
Papers, 61(3), 214-216.
Tai, M. C., Tsang, S. Y., Chang, L. Y., & Xue, H. (2005). Therapeutic potential of
wogonin: a naturally occurring flavonoid. CNS Drug Reviews, 11(2), 141-150.
Talbot, G. H., Bradley, J., Edwards, J. E., Jr., Gilbert, D., Scheld, M., & Bartlett, J. G.
(2006). Bad bugs need drugs: an update on the development pipeline from the
Antimicrobial Availability Task Force of the Infectious Diseases Society of
America. Clinical Infectious Diseases, 42(5), 657-668. doi: 10.1086/499819
200
References
Taylor, J. L. S., Rabe, T., McGaw, L. J., Jager, A. K., & Van Staden, J. (2001). Towards
the scientific validation of traditional medicinal plants. Plant Growth
Regulation, 34(1), 23-37.
Taylor, R. S. L., Edel, F., Manandhar, N. P., & Towers, G. H. N. . (1996). Antimicrobial
activities of southern Nepalese medicinal plants. Journal of Ethnopharmacology,
50(2), 97-102.
Tedesco, I., Luigi, R. G., Nazzaro, F., Russo, M., & Palumbo, R. (2001). Antioxidant
effect of red wine anthocyanins in normal and catalase-inactive human
erythrocytes. The Journal of Nutritional Biochemistry 12(9), 505-511.
Thastrup, O., Knudsen, J. B., Lemmich, J., & Winther, K. (1985). Inhibition of human
platelet aggregation by dihydropyrano- and dihydrofuranocoumarins, a new
class of cAMP-phosphodiesterase inhibitors. Biochemical Pharmacology,
34(12), 2137-2140.
Thomson, W. A. R., & Schultes, R. E. (1978). Medicines from the earth: a guide to
healing plants. Maidenhead, United Kingdom: McGraw-Hill Book Co.
Toda, M., Okubo, S., Ohnishi, R., & Shimamura, T. (1989). Antibacterial and
bactericidal activities of Japanese green tea. Nihon Saikingaku Zasshi, 44(4),
669-672.
Tsuchiya, H., Sato, M., Miyazaki, T., Fujiwara, S., Tanigaki, S., Ohyama, M., Tanaka,
T., & Iinuma, M. (1996). Comparative study on the antibacterial activity of
phytochemical flavanones against methicillin-resistant Staphylococcus aureus.
Journal of Ethnopharmacology, 50(1), 27-34.
Unhanand, M., Mustafa, M. M., McCracken, G. H., & Nelson, J. D. (1993). Gram-
negative enteric bacillary meningitis: a twenty-one-year experience. Journal of
Pediatrics 122(1), 15-21.
201
References
Urch, D. (1999). Aloe vera the plant Aloe vera natures gift (pp. 8-17). Bristol, United
Kingdom: Blackdown Publication.
Valle, T., Lopez, J. L., Hernandez, J. M., & Corchete, P. (1997). Antifungal activity of
scopoletin and its differential accumulation in Ulmus pumila and Ulmus
campestris cell suspension cultures infected with Ophiostoma ulmi spores. Plant
Science, 125(1), 97-101. doi: Doi 10.1016/S0168-9452(97)00057-5
VanEtten, H. D., Mansfield, J. W., Bailey, J. A., & Farmer, E. E. (1994). Two classes of
plant antibiotics: phytoalexins versus" phytoanticipins". The Plant Cell, 6(9),
1191.
Verkaik, N. J., Lebon, A., de Vogel, C. P., Hooijkaas, H., Verbrugh, H. A., Jaddoe, V.
W., Hofman, A., Moll, H. A., van Belkum, A., & van Wamel, W. J. (2010).
Induction of antibodies by Staphylococcus aureus nasal colonization in young
children. Clinical Microbiology and Infection 16(8), 1312-1317. doi:
10.1111/j.1469-0691.2009.03073.x
Verma, R. K., Bhartariya, K. G., Gupta, M. M., & Kumar, S. (1999). Reverse-phase
high performance liquid chromatography of asiaticoside in Centella asiatica.
Phytochemical analysis, 10(4), 191-193.
Vijaya, K., Ananthan, S., & Nalini, R. (1995). Antibacterial effect of theaflavin,
polyphenon 60 (Camellia sinensis) and Euphorbia hirta on Shigella spp.-a cell
culture study. Journal of Ethnopharmacology, 49(2), 115-118.
Vilain, S., Luo, Y., Hildreth, M. B., & Brzel, V. S. (2006). Analysis of the life cycle of
the soil saprophyte Bacillus cereus in liquid soil extract and in soil. Applied and
Environmental Microbiology, 72(7), 4970-4977.
202
References
Wang, H., Hui, K. M., Chen, Y., Xu, S., Wong, J. T., & Xue, H. (2002). Structure-
activity relationships of flavonoids, isolated from Scutellaria baicalensis,
binding to benzodiazepine site of GABA(A) receptor complex. Planta Medica-
Natural Products and Medicinal Plant Research, 68(12), 1059-1062. doi:
10.1055/s-2002-36357
Weerakkody, N. S., Caffin, N., Turner, M. S., & Dykes, G. A. (2010). In vitro
antimicrobial activity of less-utilized spice and herb extracts against selected
food-borne bacteria. Food Control, 21(10), 1408-1414.
Welch, R. (2006). The genus Escherichia (3 ed. Vol. 6). Verlag Berlin Heidelberg:
Springer.
Wiart, C. (2002). Medicinal plants of Southeast Asia (pp. 199): Prentice Hall.
Wilson, L. A., Schlitzer, R. L., & Ahearn, D. G. (1981). Pseudomonas corneal ulcers
associated with soft contact-lens wear. American Journal of Ophthalmology,
92(4), 546-554.
203
References
Wong, C., Li, H., Cheng, K., & Chen, F. (2006). A systematic survey of antioxidant
activity of 30 Chinese medicinal plants using the ferric reducing antioxidant
power assay. Food Chemistry, 97(4), 705-711. doi:
http://dx.doi.org/10.1016/j.foodchem.2005.05.049
Wong, S. P., Leong, L. P., & Koh, J. H. W. (2006). Antioxidant activities of aqueous
extracts of selected plants. Food Chemistry, 99(4), 775-783. doi:
http://dx.doi.org/10.1016/j.foodchem.2005.07.058
Wongsa, P., Chaiwarit, J., & Zamaludien, A. (2012). In vitro screening of phenolic
compounds, potential inhibition against -amylase and -glucosidase of culinary
herbs in Thailand. Food Chemistry, 131(3), 964-971. doi:
http://dx.doi.org/10.1016/j.foodchem.2011.09.088
Xu, H. X., Zeng, F. Q., Wan, M., & Sim, K. Y. (1996). Anti-HIV triterpene acids from
Geum japonicum. Journal of Natural Products, 59(7), 643-645. doi:
10.1021/np960165e
Yamaji, K., Ishimoto, H., Usui, N., & Mori, S. (2005). Organic acids and water-soluble
phenolics produced by Paxillus sp. 60/92 together show antifungal activity
against Pythium vexans under acidic culture conditions. Mycorrhiza, 15(1), 17-
23. doi: 10.1007/s00572-003-0287-9
Yang, B., Kotani, A., Arai, K., & Kusu, F. (2001). Estimation of the antioxidant
activities of flavonoids from their oxidation potentials. Analytical Sciences,
17(5), 599-604.
Yates, K. M., Rosenberg, L. J., Harris, C. K., Bronstad, D. C., King, G. K., Biehle, G.
A., Walker, B., Ford, C. R., Hall, J. E., & Tizard, I. R. (1992). Pilot study of the
effect of acemannan in cats infected with feline immunodeficiency virus.
Veterinary Immunology and Immunopathology 35(1-2), 177-189.
Ye, X. Y., & Ng, T. B. (2002). A new antifungal peptide from rice beans. Journal of
Peptide Research, 60(2), 81-87.
Yen, G. C., & Chen, H. Y. (1995). Antioxidant activity of various tea extracts in
relation to their antimutagenicity. Journal of Agricultural and Food Chemistry,
43(1), 27-32.
204
References
Yoshida, M., Fuchigami, M., Nagao, T., Okabe, H., Matsunaga, K., Takata, J., Karube,
Y., Tsuchihashi, R., Kinjo, J., & Mihashi, K. (2005). Antiproliferative
constituents from Umbelliferae plants VII. Active triterpenes and rosmarinic
acid from Centella asiatica. Biological & Pharmaceutical Bulletin 28(1), 173-
175.
Zaidan, M. R. S., Noor, R. A., Badrul, A. R., Adlin, A., Norazah, A., & Zakiah, I.
(2005). In vitro screening of five local medicinal plants for antibacterial activity
using disc diffusion method. Tropical Biomedicine, 22(2), 165-170.
Zhang, Y., & Lewis, K. (1997). Fabatins: new antimicrobial plant peptides. Federation
of European Microbiological Societies Microbiology Letters, 149(1), 59-64. doi:
http://dx.doi.org/10.1016/S0378-1097(97)00054-2
Zhao, Z. L., Zhou, K. Y., Dong, H., & Xu, L. S. (2001). Characters of nrDNA ITS
region sequences of fruits of Alpinia galanga and their adulterants. Planta
Medica, 67(4), 381-383. doi: 10.1055/s-2001-14311
205
Appendices
APPENDICES
A B
C D
E F
A B
C D
Figure 2a: Voucher deposited at the Herbarium of the Institute of Biological Sciences, Faculty of
Science, University of Malaya, Kuala Lumpur, Malaysia.
The voucher was deposited for the six medicinal plants as follows Aloe vera (A), Azadirachta indica (B),
Carica papaya (C), and Centella asiatica (D).
207
Appendices
Appendix B continued.
E F
Figure 2b: Voucher deposited at the Herbarium of the Institute of Biological Sciences, Faculty of
Science, University of Malaya, Kuala Lumpur, Malaysia.
Hymenocallis speciosa (E) and Vernonia amygdalina (F).
208
Appendices
Measure centre of
antibiotic well to a point
on the circumference of
the zone where a
distinct edge is present
and multiply by 2
209
Appendices
B. cereus E.coli
+ve
CE25 +ve CE25
CE50
CE100 CA25
CA25 CE50 CE100
CA50
CA100 CA50 CA100
P.aeruginosa S.aureus
+ve +ve
CE25 CE25
CE50
CE50
CE100 CE100
CA25
CA25
CA50
CA50
CA100
CA100
S.mutans S.mutans
CE25
+ve +ve CA25
Figure 4a: Well diffusion assay for C. asiatica ethanolic and aqueous extracts against test microorganisms
+ve Positive control; CE C. asiatica ethanolic extract; CA C. asiatica aqueous extract; at 25, 50 and 100 mg/ml
concentration respectively
210
Appendices
Appendix D continued
B. cereus E.coli
+ve
VL 25 +ve
VL 50
VL 100
AVL 25
AVL 50
AVL 100 AVL 100
B. cereus P.aeruginosa
+ve
+ve
HL 100
HL 100
Figure 4b: Well diffusion assay for A. vera leaf, V. amaygdalina leaf and H. speciosa leaf ethanolic extract
against test microorganisms
+ve Positive control; AVL A. vera leaf; VL V. amygdalina leaf and HL H. speciosa leaf extract; at 25, 50 and
100 mg/ml concentration respectively
211
Appendices
Appendix D continued
B. cereus B. cereus
+ve
CM 50
CM25
CM100
E.coli E.coli
CM 50
+ve +ve
CM25 CM100
P.aeruginosa S.aureus
+ve
+ve CM 50
CM 50
CM100
CM100
Figure 4c: Well diffusion assay for C. asiatica methanolic extract against test microorganisms
+ve Positive control; CM 25 - C. asiatica 25 mg/ml; CM 50 - C. asiatica 50 mg/ml and CM 100 - C. asiatica 100
mg/ml of methanol extract.
212
Appendices
Appendix D continued
S.mutans S.mutans
+ve +ve
CM 50
CM25 CM 100
B. cereus B. cereus
+ve
+ve
VM 25
VM 50
VM 100
S.mutans
+ve
VM 50
VM 100
Figure 4d: Well diffusion assay for C. asiatica and V. amaygdalina methanolic extract against test
microorganisms
+ve Positive control; CM 25 - C. asiatica 25 mg/ml; CM 50 - C. asiatica 50 mg/ml; CM 100 - C. asiatica 100
mg/ml VM 25 V. amygdalina 25 mg/ml; VM 50 - V. amygdalina 50 mg/ml and VM 100 - V. amygdalina 100
mg/ml of methanol extract.
213
Appendices
Appendix E. BLAST Query Search from the NCBI Database for the DNA
Sequence of the Selected Medicinal Plants
Figure 5a: BLAST query search from NCBI database of the 414 nucleotide of the PCR product.
The query results list different sequences. Sequence homology of 99% was obtained for Centella asiatica
( ).
214
Appendices
Appendix E continued
215
Appendices
Appendix E continued
Figure 5c: BLAST query search from NCBI database of the 390 nucleotide of the PCR product.
The query results list different sequences. Sequence homology of 99% was obtained for Gymnanthemum
amygdalinnum/Vernonia amygdalina ( ).
216
Appendices
Appendix E continued
217
Appendices
218
Appendices
219
Appendices
Appendix G continued
220
Appendices
Table 3a: Ferric Reducing Antioxidant Power (FRAP) activity in 1 mg/ml of sample and positive
control
Absorbance 595nma
Time
Centella asiatica Vernonia amygdalina Ascorbic
(s) BHT
aqueous ethanolic methanolic aqueous ethanolic methanolic acid
0 0.0370.004 0.4210.011 0.4660.012 0.0410.003 0.0930.006 0.1420.020 3.2240.103 0.0480.017
15 0.0500.003 0.4470.014 0.4960.009 0.0580.001 0.1040.006 0.1700.007 3.2900.036 0.0510.014
30 0.0570.005 0.4600.014 0.5120.009 0.0670.001 0.1110.006 0.1830.007 3.3100.037 0.0640.011
45 0.0620.005 0.4680.013 0.5210.009 0.0730.002 0.1160.006 0.1920.008 3.3010.021 0.0790.011
60 0.0660.005 0.4770.013 0.5270.010 0.0790.004 0.1210.009 0.1980.009 3.3150.011 0.0950.012
90 0.0680.005 0.4820.012 0.5320.010 0.0820.005 0.1240.010 0.2020.011 3.3160.014 0.1090.013
120 0.0710.006 0.4870.011 0.5380.012 0.0860.005 0.1270.010 0.2070.012 3.3260.009 0.1240.016
150 0.0740.006 0.4900.013 0.5420.013 0.0890.006 0.1300.011 0.2110.012 3.3340.014 0.1380.017
180 0.0790.005 0.4940.012 0.5470.013 0.0920.275 0.1320.011 0.2150.012 3.3020.033 0.1520.017
210 0.0810.005 0.4980.013 0.5500.013 0.0940.006 0.1340.011 0.2180.012 3.3040.011 0.1660.018
240 0.0840.005 0.5020.014 0.5550.012 0.0960.006 0.1370.011 0.2220.012 3.3180.021 0.1790.017
Table depicts Ferric Reducing Antioxidant Power (FRAP) assay of C. asiatica and V. amygdalina
aqueous, ethanolic and methanolic extracts and positive controls ascorbic acid and BHT at 1 mg/ml
concentration. Absorbance was recorded at 595 nm.
a
Assay was performed in trplicate and results presented as mean SD.
Table 3b: Ferric Reducing Antioxidant Power (FRAP) activity in 0.5 mg/ml of sample and positive
control
T Absorbance 595nma
Time Centella asiatica Vernonia amygdalina Ascorbic
BHT
(s) aqueous ethanolic methanolic aqueous ethanolic methanolic acid
0 0.0250.003 0.2110.003 0.2580.012 0.0250.002 0.0450.003 0.0840.008 2.1920.090 0.0070.007
15 0.0340.001 0.2200.002 0.2650.006 0.0350.004 0.0510.001 0.0870.003 2.2420.086 0.0060.004
30 0.0370.003 0.2250.002 0.2720.004 0.0390.005 0.0550.003 0.0920.002 2.2460.086 0.0100.005
45 0.0390.004 0.2280.003 0.2750.005 0.0430.007 0.0560.003 0.0950.001 2.2530.087 0.0160.008
60 0.0410.004 0.2310.003 0.2770.006 0.0440.006 0.0570.003 0.0980.002 2.2510.087 0.0250.010
90 0.0440.003 0.2380.006 0.2840.008 0.0470.001 0.0600.004 0.1030.009 2.2610.095 0.0530.038
120 0.0450.004 0.2400.006 0.2860.007 0.0480.001 0.0610.005 0.1050.009 2.2680.104 0.0620.039
150 0.0460.003 0.2420.006 0.2870.008 0.0490.001 0.0610.005 0.1060.009 2.2740.102 0.0700.039
180 0.0460.003 0.2440.005 0.2880.007 0.0490.002 0.0610.005 0.1080.009 2.2840.099 0.0770.039
210 0.0480.003 0.2460.005 0.2910.007 0.0510.001 0.0620.005 0.1090.009 2.2870.104 0.0840.040
240 0.0490.004 0.2500.005 0.2950.007 0.0530.001 0.0640.006 0.1120.010 2.2950.104 0.0940.044
Table depicts Ferric Reducing Antioxidant Power (FRAP) assay of C. asiatica and V. amygdalina
aqueous, ethanolic and methanolic extracts and positive controls ascorbic acid and BHT at 0.5mg/ml
concentration. Absorbance was recorded at 595 nm.
a
Assay was performed in trplicate and results presented as mean SD.
221
Appendices
Appendix H continued
Table 3c: Ferric Reducing Antioxidant Power (FRAP) activity of standard ferrous sulphate
(FeSO4.7H2O) at varying concentrations
Concentration
100 200 400 600 800 1000
(mol/L)
Absorbance
0.0150.023 0.0550.012 0.1190.036 0.2080.012 0.0890.049 0.0440.025
595nm
Table depicts Ferric Reducing Antioxidant Power (FRAP) activity of standard ferrous sulphate (100-1000
mol/L) at absorbance 595 nm which was used to plot the FeSO4.7H2O standard curve. Results were
presented as mean SD, where n = 3.
0.250 y = 0.0003x
R = 0.9668
0.200
Absorbance 595 nm
0.150
0.100
0.050
0.000
0 100 200 300 400 500 600 700
-0.050
Concentration (mol/L)
222
Appendices
Table 4a: Percentages of the in vitro protective effect of C. asiatica and V. amygdalina against 10
mM H2O2 induced haemolysis of rabbit erythrocytes.
Concentration (mg/ml)
Samplea
0.1 0.25 0.5 0.75 1.0
C.asiatica aqueous 77.442.28 74.162.01 75.836.76 74.162.01 76.470.79
C.asiatica ethanol 73.222.37 74.301.64 81.031.00 81.191.94 85.121.69
C.asiatica methanol 73.601.27 74.271.36 80.212.05 82.951.14 88.140.83
V. amygdalina aqueous 75.731.23 72.290.54 70.381.06 71.020.52 72.920.77
V. amygdalina ethanol 73.741.82 74.460.61 75.880.52 78.750.41 78.460.35
V. amygdalina methanol 70.230.71 73.300.20 73.391.45 74.270.06 79.250.64
Ascorbic acid 71.400.51 76.690.20 79.690.75 82.690.21 86.050.66
Phosphate buffer 72.441.04
Distilled water 0.000.00
Table depicts in vitro anti-haemolysis assay of C. asiatica and V. amygdalina aqueous, ethanolic and
methanolic extracts and positive control ascorbic acid at (0.1 1.0 mg/ml) concentrations whereby10 mM
H2O2 was used to induce haemolysis. Isotonic phosphate buffer was the standard used. Distilled water
showed 100% haemolysis.
a
Assay was performed in trplicate and results were presented as mean SD.
Table 4b: Percentages of the in vitro protective effect of C. asiatica and V. amygdalina against 50
mM H2O2 induced haemolysis of rabbit erythrocytes.
Concentration (mg/ml)
Samplea
0.1 0.25 0.5 0.75 1.0
C.asiatica aqueous 67.791.11 72.540.88 69.352.03 69.850.40 71.610.53
C.asiatica ethanol 54.931.34 74.531.64 75.690.42 83.270.54 84.730.65
C.asiatica methanol 60.340.98 66.320.62 78.062.23 85.870.40 91.810.55
V. amygdalina aqueous 55.730.34 51.760.80 59.691.62 63.730.51 57.551.46
V. amygdalina ethanol 62.591.16 68.210.39 71.841.90 75.410.63 78.100.26
V. amygdalina methanol 60.850.86 61.280.31 67.220.83 70.510.37 81.770.23
Ascorbic acid 52.701.32 64.630.65 61.711.83 62.740.15 71.970.76
Phosphate buffer 57.130.80
Distilled water 0.000.00
Table depicts in vitro anti-haemolysis assay of C. asiatica and V. amygdalina aqueous, ethanolic and
methanolic extracts and positive control ascorbic acid at (0.1 1.0 mg/ml) concentrations whereby 50
mM H2O2 was used to induce haemolysis. Isotonic phosphate buffer was the standard used. Distilled
water showed 100% haemolysis.
a
Assay was performed in trplicate and results were presented as mean SD.
223
Appendices
Appendix I continued
224
Appendices
Appendix I continued
225
Appendices
Appendix I continued
Table 4c: In vitro anti-haemolysis effect of standard ascorbic acid at varying concentrations
Concentration
0.1 0.25 0.5 0.75 1.0
(mg/ml)
Anti-haemolysis
52.701.32 64.630.65 61.711.83 62.740.15 71.970.76
(%)
Table depicts anti-haemolysis effect of standard ascorbic acid (0.1-1.0 mg/ml) at absorbance 540 nm
which was used to plot the standard curve. Results were presented as mean SD, where n = 3.
226
Appendices
mAU %
60
55 90
50
80
45
70
40
35 60
30
50
25
40
20
15 30
10
20
5
10
0
0
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 27.5 min
Figure 10a: Homogenous peak test of C. asiatica methanolic extract with chloramphenicol
standard.
Chromatogram displays peak obtained by spiking the plant sample with chloramphenicol standard at 280
nm wavelength.
mAU %
9
90
8
80
7
70
6
60
5
50
4
40
3
30
2
1 20
0 10
-1 0
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 min
Figure 10b: Homogenous peak test of C.asiatica methanolic extract with chloramphenicol
standard.
Chromatogram displays peak obtained by spiking the plant sample with benzoic acid standard at 280 nm
wavelength.
227
Appendices
343.9 A B
197.8
m/z m/z
C 301.1 D
435.2
m/z m/z
153.9 E 183.9 F
m/z m/z
Figure 11a: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of 5-galloylquinic acid (A); syringic acid
(B); ellagic acid pentoside (C); hydroxybenzoic acid-O-hexoside (D); protocatechuic acid (E); and methyl gallate (F)
228
Appendices
Appendix K continued
A B
313.1
223.8
m/z m/z
C D
195.1 517.9
m/z m/z
E 339.3 F
353.1
m/z m/z
Figure 11b: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of caftaric acid (A); sinapic acid (B); ferulic
acid (C); dicaffeoylquinic acid (D); caffeoylquinic acid (E); and coumaroylquinic acid (F)
229
Appendices
Appendix K continued
369.3 305.1
A B
m/z m/z
459.3 611.3
C D
m/z m/z
479.2 625.3
E F
m/z m/z
Figure 11c: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of feruloylquinic acid (A); (-)-gallocatechin
(B); (-)-gallocatechin gallate (C); rutin (D); isorhamnetin-3-O-glucoside (E); and isorhamnetin-3-O-rutinoside (F)
230
Appendices
Appendix K continued
A 625.3 B
479.2
m/z m/z
315.2 C D
305.2
m/z m/z
E 317.1 F
437.2
m/z m/z
Figure 11d: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of quercetin-3-O-glucuronide (A); rhamnetin-
O-rutinoside (B); cirsimaritin (C); ()-taxifolin (D); phloridzin (E); and myricetin (F)
231
Appendices
Appendix L continued
285.3 A B
253.9
m/z m/z
C D
431.2
285.1
m/z m/z
449.3 E 465.3 F
m/z m/z
Figure 11e: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of acacetin (A); chrysin (B); kaempferol (C);
apigenin-7-O-glucoside (D); quercetin 3-O-rhamnoside (E); and quercetin-3-O-glucoside (F)
232
Appendices
Appendix k continued
A 581.3 B
317.1
m/z m/z
C D
449.3
181.1
m/z m/z
343.9
E 389.1 F
m/z m/z
Figure 11f: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of isorhamnetin (A); naringin (B); luteolin-7-O-
glucoside (C); theobromine (D) rosmadial (E); and medioresinol (F)
233
Appendices
Appendix k continued
322.2
A B
123.1
m/z m/z
Figure 11g: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of C.asiatica methanolic extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of chloramphenicol (A); and benzoic acid (B)
234
Appendices
Appendix k continued
A 197.8 B
343.9
m/z m/z
C D
433.2 183.8
m/z m/z
169.1 343.9 153.9
E F
m/z m/z
Figure 12a: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of 5-galloylquinic acid (A); syringic acid
(B); ellagic acid pentoside (C); methyl gallate (D); vanillic acid (E); and protocatechuic acid (F)
235
Appendices
Appendix k continued
149.9 A B
223.8
m/z m/z
193.8 C 163.8 D
m/z m/z
E 181.2 F
311.2
m/z m/z
Figure 12b: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of trans-cinnamic acid (A); sinapic acid (B);
ferulic acid (C); p-coumaric acid (D); caftaric acid (E); and caffeic acid (F)
236
Appendices
Appendix k continued
515.1 A B
353.1
m/z m/z
367.1 C D
339.3
m/z m/z
291.1 459.3
E F
m/z m/z
Figure 12c: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of dicaffeoylquinic acid (A); caffeoylquinic
acid (B); feruloylquinic acid (C); coumaroylquinic acid (D); (+)-catechin/()-epicatechin (E); and (-)-gallocatechin gallate
(F)
237
Appendices
Appendix k continued
307.2 A B
447.1
m/z m/z
611.3 C 305.2 D
m/z m/z
E 625.3 F
479.2
m/z m/z
Figure 12d: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of (-)-gallocatechin (A); quercetin 3-O-
rhamnoside (B); rutin (C); taxifolin (D); isorhamnetin-3-O-glucoside (E); and isorhamnetin-3-O-rutinoside (F)
238
Appendices
Appendix k continued
A B
437.2 625.3
m/z m/z
315.2 C 431.2 D
m/z m/z
253.9 E F
611.8
m/z m/z
Figure 12e: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of phloridzin (A); rhamnetin-O-rutinoside (B);
cirsimaritin (C); apigenin-7-O-glucoside (D); chrysin (E); and neohesperidin (F)
239
Appendices
Appendix k continued
581.3 A B
271.1
m/z m/z
C 285.1 D
447.1
m/z m/z
227.1
E F
303.2
m/z m/z
Figure 12f: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of naringin (A); ()-naringenin (B); luteolin-7-
O-glucoside (C); luteolin (D);hesperitin (E); and trans-resveratrol/cis-resveratrol (F)
240
Appendices
Appendix k continued
181.2 A B
343.9
m/z m/z
347.2 C 347.2 D
m/z m/z
Figure 12g: Liquid Chromatography Mass Spectroscopy (LC-MS) mass spectrum of V. amygdalina methanolic
extract.
Mass spectra from full scan analysis by LC-MS and their molecular structure of theobromine (A); rosmadial (B); methyl
carnosate (C); and epirosmanol (D)
241
Appendices
242
Appendices
243
Appendices
244
Appendices
245
Appendices
246
Appendices
247
Appendices
248