General Biology Lab Manual - F2016 PDF

GENERAL BIOLOGY LABORATORY MANUAL
FOR LIFE 1010 FALL 2016

UNIVERSITY OF WYOMING
TABLE OF CONTENTS
LAB 1: INTRODUCTION TO LAB
P.1
LAB 2: SCIENTIFIC INQUIRY
P.3
LAB 3: MEMBRANES
P.11
LAB 4: MICROSCOPES & CELLS
P.19
LAB 5: MACROMOLECULES & ENZYMES
P.31
LAB 6: FERMENTATION
P.39
LAB 7: PHOTOSYNTHESIS & PLANT PIGMENTS
P.53
LAB 8: DNA
P.61
LAB 9: MITOSIS & MEIOSIS
P.69
LAB 10: GENETICS
P.75
LAB 11: EVOLUTION & NATURAL SELECTION
P.87
APPENDICES
LAB NOTEBOOK GUIDELINES
P.97
LAB REPORT GUIDELINES
P.101
EXAMPLE LAB REPORT
P.105
LAB REPORT RUBRIC
P.111
GENERAL BIOLOGY LAB MANUAL LAB 1: INTRODUCTION TO LAB
LAB 1: INTRODUCTION TO LAB

During the first lab period, you will meet your lab instructor and classmates. You will also go over
the lab syllabus and schedule, and take an assessment survey.
Before the next lab, make sure you have a bound (non-spiral) laboratory notebook, and read the
syllabus and pre-lab reading for LAB 2: SCIENTIFIC INQUIRY. Both documents will be covered on
your first lab quiz.
GENERAL BIOLOGY LAB MANUAL LAB 2: SCIENTIFIC INQUIRY
LAB 2: SCIENTIFIC INQUIRY

Learning Objectives
1. Develop alternative and null hypotheses that are testable and correctly address the dependent
and independent variables of an experimental question.
2. Design an experiment with a control group and replication to test hypotheses about a factor
that might affect plant growth.
3. At the end of a multi-week experiment, demonstrate an understanding of the experiment and
the scientific method by preparing an individual lab report with primary literature used for
support.
4. Practice unit conversions.
Pre-lab Reading
From Textbook (Freeman et al. 2014): Section 1.5

Science as a Process: The Purpose of Lab
In general biology laboratory you will get a chance to explore concepts introduced in lecture in
more detail, and get hands on training with scientific tools and procedures. You will also engage in
scientific inquiry by developing hypotheses and experiments, collecting data, and arriving at
conclusions based on this data. The goal of scientific inquiry, or investigation, is to better understand
the world around us. By engaging in inquiry, you are doing science.
At its root, science is a process that uses observation and reason to investigate and explore the
physical world. This contrasts with the popular definition that considers science to be the organized
body of knowledge about nature and the universe that is, a collections of facts. In reality, science
encompasses both definitions it is both knowledge and process. In lab we will emphasize the ways
in which we make observations and use reason to produce knowledge (i.e. the process of science).
But to do so requires an understanding of what has already been discovered, so we will also explore
the foundations of biology, and reinforce what you learn in lecture.
Science proceeds by building upon previous findings, which are published in peer-reviewed journal
articles, called primary literature because they present original ideas and new findings (textbooks
and other material that summarize and synthesize primary literature are considered secondary
literature). Peer-reviewed journal articles can be difficult to read, and becoming proficient at doing
so takes a good deal of practice. As a science major, you will be expected to use peer-reviewed
literature to support assertions you make in written work, including the lab report you will write for
this lab. We will show you how to find peer-reviewed articles and discuss how to read these articles.
Any good scientific research project begins with a question why or how does a particular
phenomenon occur? Questions may arise from observations, literature, or discussion with other
scientists. Once a question has been selected, we develop hypotheses, which propose potential
answers to our question. Hypotheses are educated guesses, based on what we already know, and a
good scientific hypothesis is both specific and testable. Hypotheses are the starting point for further
investigation, and it is important that they are testable so that they can be evaluated by
experimentation and careful observation.
Once hypotheses have been formed, experimental or observational studies are designed to test
the hypotheses. Well-designed studies attempt to keep conditions as constant as possible, include
control groups, and use replication. Experiments or observations are then conducted, and data is
carefully recorded.
3

Frequently experiments and studies do not proceed as we expect the first time, and must be
redone. For example, we might find that the instrument or technique we planned to use does not
work as expected. Much science is carried out by trial and error. After all, if we knew what we were
doing, it wouldnt be research!
When data have been successfully collected, they are used to evaluate hypotheses. Scientists
usually analyze data with statistical tests, which help us decide if our hypotheses are supported or
not. Statistical tests can reveal, for example, whether observed differences we see between control
groups and experimental groups are likely to be real or merely the result of coincidence. Statistical
tests are scientific tools as important as microscopes, spectrophotometers, and pipettes. This
semester, to introduce you to statistical tests and their usefulness, we will show you how to perform
and evaluate one of the most common and simple statistical test used by scientists, the t-test. In
future science classes you will learn about other tests used for different types of data, and you may
be required to take a statistics class for your major.
After hypotheses have been evaluated and data has been interpreted, we must communicate
findings. Remember, science builds on previous work to advance our knowledge we must share
our findings with others so they can build on our work. Scientific findings are shared through peerreviewed journal articles. In fact, the production of articles is one of the main ways in which the
success of a scientist is measured. Your professors and teaching assistants, as professional scientists,
are expected to publish in scientific journals. The lab report you will write in this class mimics a
scientific journal article, and will help you learn to read and write scientifically. We will assemble a
lab report in pieces and provide you with constructive feedback at each step.
Variables, Hypotheses, and Predictions
When we design an experiment or observational study, we are interested in measuring the effect of
an independent variable (sometimes a set of independent variables) on a dependent variable. The
independent variable is a variable that is changed or manipulated in an experiment, and different
levels of an independent variable are called treatments. The dependent variable, also called the
response variable, is the variable that is measured. One way to remember the difference is that,
hypothetically, the value of the dependent variable depends on the value of the independent variable.
For example, consider an experiment designed to address the question: How do omega-3 fatty
acid supplements effect blood cholesterol levels? In this experiment a researcher would measure the
blood cholesterol levels of the subjects, give the subjects an omega-3 fatty acid supplement each day
over a two-week period, and then measure blood cholesterol levels of the subjects again. The
independent variable would be the amount of omega-3 fatty acids given, and treatments would be
the different doses of omega-3 fatty acids, such as 50 mg/day, 100 mg/day, and 200 mg/day. The
dependent variable would be the change in the blood cholesterol levels of the subjects over the twoweek period.
Hypotheses are potential answers to scientific questions. In the context of an experiment, they
suggest possible outcomes. This semester we will develop an alternative hypothesis and a null
hypothesis for each experiment we perform. The use of the two types of hypotheses may seem a bit
odd at first, but they are used because they facilitate the use of statistical tests.
The alternative hypothesis (sometimes called the research hypothesis) states that the
independent variable has an effect on the dependent variable. For the example above, the alternative
hypothesis (often noted as Ha) would be that the amount of omega-3 fatty acids taken has an effect
on blood cholesterol levels.
The null hypothesis states that the independent variable has no effect on the dependent variable.
For the example above, the null hypothesis (often noted as Ho) would be that the amount of omega3 fatty acids taken has no effect on blood cholesterol levels.
4

Note that the alternative hypothesis says nothing about the nature of the effect of the independent
variable on the dependent variable. For example, taking more omega-3 fatty acids might decrease
blood cholesterol levels or increase blood cholesterol levels (or might have no effect on blood
cholesterol levels). We can make a prediction to state what we results we expect to see based on
what we already know. For example, if it has previously been found that diets high in omega-3 fatty
acids, such as those rich in fish and nuts, are correlated with high levels of cholesterol, we might
predict that taking more omega-3 fatty acids will increase blood cholesterol levels.
Pre-lab Questions
Each week, you will begin lab by taking a group quiz and answering starting questions with your
classmates. You should read and consider the questions below before lab so you are better prepared.
1. Can you outline the scientific process as presented above?
2. If given an experimental question, could you identify the dependent and independent
variables? Could you identify treatments?
3. If given an experimental question, could you develop alternative and null hypotheses?
4. If given an experimental question, could you make a prediction?
5. When designing an experiment, what are some important considerations? Come up with
some general guidelines for experimental design.
Exercise A: Begin Plant Growth Experiment

During the next five weeks you will design and carry out an experiment that will form the basis for
your lab report and other assignments throughout the semester.
Question: How does the addition of nutrients affect plant growth?
Your goal is to investigate how some factor or treatment affects plant growth. Plant growth can be
measured in a variety of ways. For this experiment we will measure plant height and count leaves
each week, and measure plant mass at the end of the experiment. You may work in groups of 4 or
more, and each student may plant two pots.
Starting Questions
Discuss the following questions with your group and record your responses in you lab notebook.
1. What are some factors you think might affect plant growth? Come up with at least three
factors.
2. Pick one of the factors you came up with that might affect plant growth. In an experiment to
test the effect of this factor on plant growth, what is your independent variable? How about
your dependent variable?
3. Write an alternative hypothesis and a null hypothesis for an experiment that tests the effect
of your chosen factor on plant growth.
Available Materials
Light banks
Pots and trays
Bins (2 per section, control & treatment)
Seeds for various plants
Sand
Potting soil
Sieves to rinse sand to remove salts
Measuring cups
Perlite
Vermiculite
Coffee filters (4 cup basket style)

Osmocote slow release fertilizer
Nitrogen/Phosphorous/Potassium
Scales
Weighboats
Spatulas/forceps
Plant tags
Sharpies
Large beakers for watering
Experimental Design
After you have decided on an experiment to perform, record the following in your lab
notebook: Objective, Variables, Hypotheses, Prediction, Control and Treatment groups, and
Procedure. Refer to the lab notebook guidelines (pages 97 99).

Basic Planting Procedure
You may choose to alter this basic procedure for your group experiment. If so, be consistent and
record any alterations you made.
Planting (Fig. 1):
1. Line a pot with two coffee filters. The coffee filters hold sand in the pot.
2. Rinse 250 mL of sand per pot for 1 minute. This is done to remove salts that might inhibit
plant growth. What size sieve did you use to rinse sand?
3. Fill the pot half-way with sand (~125 mL).
4. Add 2.5 g of Osmocote slow release fertilizer.
If you are preparing a pot for a treatment group in which you are manipulating nutrients, add
the extra nutrients now too. How much extra nutrient did you add to treatment pots?
5. Fill the pot the rest of the way (to the bottom of pot rim) with sand.
6. Make a small divot (~0.5 cm deep) with your thumb. Place two seeds in the divot.
7. Cover the seeds and pot surface with a thin layer of vermiculite
8. Place a plant label in your pot. See Fig. 2 for labeling instructions.
9. Place pot a tray for your lab section under a growth light. How many pots did you prepare for each
group?
Fig. 1. Diagrammatic planting methodology for Plant Growth experiment. Use coffee filters
in place of fabric. Nutrient addition is only required if preparing a pot for the treatment
group.
Fig. 2. Example of a plant label. Your plant label should include your lab section (circled please),
treatment (phosphorous addition in example), and your last name.
Table 1. Schedule for Plant Growth Experiment and Lab Report Preparation.
Week
12 16 Sep
19 23 Sep
26 30 Sep
3 7 Oct
10 14 Oct
17 21 Oct
Plant Growth Experiment

- Design experiment
- Plant seeds
- Thin pots if necessary
- Take plant measurements if possible
- Thin pots if necessary
- Take plant measurements
- Harvest and dry biomass
- Weigh dried biomass
Lab Report Preparation

HW 1: Methods
HW 3: Scientific Literature
HW 4: Introduction
HW 5: Data Analysis & Results
31 Oct 4 Nov
HW 6: Discussion
14 18 Nov
HW 8: Peer Review
28 Nov 2 Dec
Lab Report due
Exercise B: Unit Conversions

Quantitative skills are essential for biologists. Statistics and mathematical models are important
tools scientists use to describe and understand biological systems. To develop your ability to
understand and use such approaches, we do calculations and other quantitative exercises in lab.
Conversion of units are everyday tasks for many individuals in biological fields. For example, a
nurse or doctor may need to calculate the volume of medicine a patient should receive based on the
concentration of that medicine. Failure to make such a conversion correctly could have dire
consequences.
Unit conversions are used to convert the some quantity from one unit of measurement to another. To
avoid errors during conversions it is best to use the method demonstrated in the following example.
This method allows you to carefully cancel units out so that you are left with your starting quantity (2
days in this example) expressed in the units you want (seconds in this example).
For example, convert 2 days to seconds:
1. Write your starting quantity, then multiply it by conversion factors to arrive at your desired
unit. Conversion factor can be inverted (
; with this in mind, set-up
conversions so that units cancel out:
2. Once youve cancelled units you should be left with only the desired unit(s), in this case
seconds:
3. Now simply multiply the numbers:
Conversions factors work because you are simply multiplying your starting quantity by one,
without actually changing the quantity. For example, the conversion factor
is equivalent to 1:

With your group, perform the following unit conversions. Record your work in your lab
notebook. You must show all of your work to receive full credit.
1.
2.
3.
4.
5.
6.
Convert 0.12 m into mm

Convert 800 L to mL
Convert 3.5 in to cm
Convert 0.5 m2 to cm2
Convert 2.0 miles per hour to m/s
Convert 0.2 g/mL to g/L
Clean-up
Before you leave lab:
Make sure your plants are well-labeled and placed in the tray for your lab section.
Return any items at your table to their place on the lab benches.
Wipe down tables and benches as necessary to remove sand and soil.
Homework Assignment 1: Methods

This week you will prepare a methods section based on the experiment you setup today and
submit it to WyoCourses. Refer to the lab report guidelines, example lab report, and lab report
rubric (pages 101 112) as you prepare your methods section and other homework assignments.
This methods section, with some modifications and additions, will be incorporated into you final lab
report.
Acknowledgments
This lab was designed by Trace Martyn and Chris North. Tim Aston and other graduate teaching
assistants have provided expertise and suggestions.
10
GENERAL BIOLOGY LAB MANUAL LAB 3: MEMBRANES
LAB 3: MEMBRANES
Learning Objectives
1. Compare and contrast the processes of diffusion and osmosis.
2. Design an experiment to test the effects of solute concentration and other variables on
osmosis across a model membrane.
3. Understand and apply the terms for osmotic concentration.
4. Consider the utility of models in science.
Pre-lab Reading
From Textbook (Freeman et al. 2014): Sections 6.1 6.3

The movement of small and large molecules into and out of cells and their organelles is regulated
by selectively permeable membranes. These membranes are an essential part of a cells structure,
allowing the cell to maintain homeostasis within its environment.
The Selectively Permeable Membrane
Every cell is surrounded by a thin boundary layer that separates the cell from its environment and
maintains its individuality. However, to stay alive, the cell must communicate with its surroundings
by allowing energy, matter and information to pass through the boundary layer. To maintain
homeostasis, the cell requires the intake of nutrients and gases from the environment, and the
export of cellular waste products and compounds destined for other cells. A selectively permeable
membrane facilitates these activities.
The unique structure of the cell membrane is directly related to its function. The current model
for a biological membrane is the fluid-mosaic model. This model describes a fluid state
phospholipid bilayer, interspersed with proteins and carbohydrates. The hydrophobic ends of the
phospholipids face the interior of the membrane, and the proteins and hydrophilic ends of the
phospholipids are free to interact with the intra- and extra-cellular environments.
The biological membranes specific molecular architecture results in selective permeability to
different molecules; some substances cross the membrane more easily than others. Not all molecules
pass through at the same rate, depending on size, charge and chemical composition.
Movement of molecules
In any system, molecules tend toward a state of entropy, or disorder. In a biological system,
molecules tend to move toward a state of equilibrium as entropy increases. For example, if a drop of
perfume is released into a room, the molecules of the perfume will tend to move outward from the
original drop until they are equally dispersed about the room. The molecules have moved from a
state of relative order (all in one small drop) to disorder (randomly scattered throughout the room).
Thus, molecules tend to move spontaneously down a concentration gradient, from higher to lower
concentrations (towards an equal distribution). This spontaneous movement of molecules is called
diffusion. The energy for this process comes from the intrinsic kinetic energy (also called thermal
motion or heat) of the molecules.
We often categorize movement of molecules across the cell membrane into two basic categories
those types of movement which require cellular energy to allow movement from one side of the
membrane to another, and those processes which require no cellular energy.
11

Those forms of movement requiring energy are known as active transport and must be used to
move molecules up (or against) a concentration gradient across a membrane. In active transport,
the molecules to be transported across the membrane combine specifically with a transporting
structure. This interaction must also be coupled to an energy-yielding chemical reaction or flow.
As with other processes which require cellular energy, ATP (adenosine triphosphate) supplies the
energy for most active transport. ATP releases free energy when its high energy phosphate bonds
are hydrolyzed. It is an essential common currency form of energy that an organism can use to
drive cellular reactions.
Diffusion
Two forms of passive transport are diffusion (also known as simple diffusion) and facilitated
diffusion. Passive transport requires no ATP, but does require that molecules move down a
concentration gradient, from higher to lower concentration as they cross the membrane. Molecules
move through the membrane structure in diffusion by random molecular motion after dissolving in
the membrane material or moving through small pores or channels. As its name suggests,
facilitated diffusion requires that molecules combine with specific transporter proteins
(facilitating, or helping the movement of molecules) which provide a pathway through the
membrane for the molecules.
Osmosis
Water is considered a nearly universal solvent in biological systems and plays a critical role in
biological processes. A special case of passive transport is the diffusion of water across a selectively
permeable membrane, known as osmosis. Like other substances, water tends to move down a
gradient from a higher concentration of water to a lower concentration of water.
Osmotic Concentration
The osmotic concentration of a solution refers to its solute concentration, or the concentration of
substances dissolved in a solution. It does not refer directly to the quantity of water molecules.
Rather, it is an indirect indication of a higher or lower concentration of water molecules; in any
solution, as the concentration of solute increases, the concentration of water molecules in that
solution will decrease. The terms for osmotic concentrations are relative, that is, they only have
meaning in a comparative sense: hypotonic, isotonic, and hypertonic. (Hyper- and hypo- mean
more or less respectively, and iso- means same.) A hypotonic solution has a lower solute
concentration in comparison to another solution; the hypertonic solution has a higher solute
concentration than the solution to which it is compared. Isotonic solutions have equal
concentrations of solutes, though the composition of solutes need not be the same in both
solutions. A cell in your body is isotonic to the solutions surrounding it, even though the ions in the
cell and in solution may be different.
Tap water is ____________________to distilled water.
Distilled water is ____________________to sea water.
Tap water is ____________________to sea water.
12

Scientific Models
Scientific models are representations of features in the natural world, just as a model airplane is a
representation of an actual airplane. They are used to better understand, study, or simulate the
feature they represent.
One conceptual model already mentioned is the fluid mosaic model, which describes the cell
membrane in a way that allows us to better conceptualize a feature of living organism that is difficult
to see.
Models may also be quantitative and use mathematical equations to represent natural processes.
For example, the exponential growth equation (Nt = N0ert) is a model that represents how
populations of organisms, even people, may multiply at an increasing rate.
Model organisms are well-characterized organisms amenable to experimental manipulation that are
studied to provide insights on other species. For example, mice are often used to represent humans
in drug trials. Brassica rapa, which you are familiar with as broccoli, kale, cabbage and other
vegetables, is a model organism that can represent plants in general. Another well-known model
organism is the fruit fly. Many model organisms grow and reproduce quickly.
A model may also be a physical representation of an object that shares some features with another
object. In todays lab you will be using bags made of dialysis tubing to represent the cell membrane.
Usually made of cellulose, and semi-permeable like cell membranes, dialysis tubing is used in a
variety of settings to separate molecules by size.
Pre-lab Questions
You should read and consider the questions below before lab so you are better prepared.
1. Can you compare and contrast passive and active transport?
2. How is osmosis different from diffusion?
3. If two solutions were described to you, could your compare them in terms of osmotic
concentration?
4. What is the main type of macromolecules are the main component of cellular membranes?
5. Can you describe the fluid mosaic model?
6. What factors are likely to affect the rate of diffusion of a substance?
13
Exercise A: Osmosis Across a Selectively Permeable Membrane

Osmosis of water across a selectively permeable membrane will depend on the concentration of
solutes and water on either side of the membrane. Remember that water follows its own
concentration gradient, which is opposite of that of the solute concentration gradient.
In this exercise you will generate a hypothesis relating to the movement of a solute (sugar) across a
model membrane, and then run an experiment to test that hypothesis. Your instructor will describe
the materials available to your group. Write a hypothesis about osmosis across your model
membrane (dialysis bag). Then design and run an experiment to test your hypothesis and analyze
your results. Assume that the sugar in the sucrose solutions will not cross the membrane.)
Available Materials
Dialysis tubing
P-5000 micropipettes and tips
Unwaxed floss
Weigh boats
Scissors
20, 40, and 60% sucrose colutions

Digital scales
6 250 mL beakers per group
1 400 mL beaker per group
Water bath and ice, for heating and cooling
Methodology
1. Soften the dialysis tubing by soaking the pieces in a 400 mL beaker of distilled water for
about 5 minutes
2. Fold one end over about 1/2 and cinch with a piece of floss. Tie a square knot tightly, so
that the bag will not leak (see Fig. 1). This will be the bottom of each bag.
3. Number the six 250 mL beakers: #1, #2, #3, #4, #5, #6 with lab tape and a sharpie. Do
not forget to include at least one control. Also place a small numbered tape flag on the
top tie of each bag which corresponds to the beaker (sample) number.
4. Carefully pipet 5 mL of solution into each dialysis bag, filling each bag approximately 1/2
full. Fold over the top of each bag, and tie the bag shut tightly with floss. The bags should
be limp and filled with about equal amounts of liquid.
5. Record the initial mass of the bag on the balance. Record the initial masses in a wellorganized table with space to record masses for each bag every 15 minutes
6. Wait to place your bags in the beakers until the rest of the class is ready. When the
class is ready, place bags in beakers, thus starting the experiment.
7. Mass each bag every 15 minutes. Before massing the bag, blot it gently with a Kimwipe.
8. By reading and recording the mass of each bag at specific intervals, you can determine the
rate of diffusion for each treatment.
9. After the last mass data are recorded, analyze and graph your data.
First, calculate the percent mass change for each dialysis bag over time. To do this,
subtract the initial mass of each dialysis bag (mass @ time = 0 minutes) from the mass for
the same dialysis bag at times = 15, 30, 45, and 60 minutes, and divide these values by the
initial mass of the dialysis bag. To make this a percentage, multiply by 100
14

For example, if the initial mass of the bag is 80 grams at 0 minutes, and the mass at 30
minutes is 90 grams, then the percent mass change is calculated as follows:
Fig. 1. Dialysis bag setup.

Experimental Design
After you have decided on an experiment to perform as a group and received instructor approval,
record the following in your lab notebook: Objective, Variables, Hypotheses, Prediction, Control
and Treatment groups, and Procedure. . Refer to the lab notebook guidelines (pages 97 99). You
will also want to record your data in a well-organized table, which should include times and recorded
masses for each bag.
15
Exercise B: Dilution Problems

Diluting stock solutions to produce solutions of different concentrations is often necessary in the
lab. For example, to make the standard curve (Fig. 2), six standards were prepared from a 150 mg/L
starch solution. To perform dilutions we use the following formula:
C1 V1 = C2 V2
where C1 is the concentration of the initial solution, V1 is the volume of initial solution, C2 is the
concentration of the final solution, and V2 is the volume of the final solution. Concentration may be
expressed in various units, including g/L, %, and molarity (M). Volumes can also be in a variety of
units. The important things is to use the same units for both concentration variables, and the same
units for both volume variables. The variables for concentration and volume do not have to match
we can use mg/L for concentration and mL volume without converting mL to L, as in the example
below.
Example: To calculate the amount of 150 mg/L starch solution needed to make 5 mL of a 30
mg/L starch standard, we would do the following:
1. Figure out which variable (C1, C2, V1, or V2) you are solving for and reorganize the equation
to isolate that variable. Here, we want to know how much initial solution is needed (V1):
V1 = C2 V2 / C1
2. Next, replace all the known quantities with their values. We know the concentration of the
stock solution (150 mg/L), how much standard we want to make (5 mL), and what standard
concentration we want (30 mg/L):
V1 = (30 mg/L) (5 mL) / (150 mg/L)

3. As with conversion problems, we can cancel out units and solve the equation:
V1 = (30 * 5 / 150) mL
V1 = 1 mL
4. To actually create the standard we would dilute the calculated initial volume to the final
volume by adding solvent. In this case, we would add 4 mL of deionized water (our solvent)
to 1 mL of 150 mg/L starch solution to produce 5 mL of 30 mg/L starch solution.
16

With your group, solve the following dilution problems. Record your work in your lab notebook.
You must show all of your work to receive full credit for this assignment.
1. How much 150 mg/L starch solution do you need to prepare 3 mL of 60 mg/L starch
solution? How much water would you need?
2. If you dilute 15 mL of 200 g/L sugar solution by adding 35 mL of water, what will the
concentration of the resulting solution be?
3. If you dilute 175 mL of a 20% sugar solution to 1L by adding H2O, what is the final
concentration of the solution?
Clean-up
Dialysis bags can be disposed of in the trash.
Rinse all glassware three times. Return all items to the tray on your table.
Make sure you clean your table before you leave. Wipe down as necessary.
Homework Assignment 2: Figure

This week you will prepare a figure to represent the data you collected today and submit it to
WyoCourses. Refer to the lab report guidelines, example lab report, and lab report rubric (page 101
112), and see the assignment description on WyoCourses for more information.
Acknowledgements
This lab was written by Diane Gorski and modified by Chris North
.
17
GENERAL BIOLOGY LAB MANUAL LAB 4: MICROSCOPES & CELLS
LAB 4: MICROSCOPES & CELLS

Learning Objectives
1.
2.
3.
4.
5.
6.
Learn to use compound and dissecting microscopes correctly, and name and explain the
functions of the parts of these microscopes
Calculate magnification properly
Estimate the size of objects viewed under the microscope
Prepare wet mount slides of living cells to view with the compound microscope
Compare and contrast prokaryotic and eukaryotic cells.
Compare and contrast plant and animal cells.
Pre-lab Reading
From Textbook (Freeman et al. 2014): Sections 7.1 & 7.2

The cell is the basic structural and functional unit of all living organisms, whether they are singlecelled or multicellular. Learning about cell structure will help you to understand the complexity of
cell functions. Microscopes remain an invaluable tool for studying the structure and function of
cells and organisms. They are historically important in allowing many advances in science. In this
lab you will use two types of light microscopes, the compound light microscope and the dissecting
(or stereoscopic) microscope, to examine the structure of different cell types.
Cells: Characteristics and Types
All organisms are composed of cells. Some organisms, such as bacteria and protists, are composed
of a single cell. Other organisms are multi-cellular and may be composed of trillions of cells! It has
been estimated that the human body contains between 15 and 70 trillion cells. At the most
fundamental level, there are two types of cells: prokaryotes and eukaryotes. The word prokaryote
means before kernel, and refers to the fact that prokaryotic cells lack a nucleus (the kernel or
karyon). Organisms from two of the three domains of life, Bacteria and Archaea, are prokaryotes.
On the other hand, eukaryotes (true kernel) are organisms whose cells contain a nucleus, which
contains the chromosomes (bundles of DNA) of eukaryotic cells. Eukaryotes include protists (a
variety of single-celled organisms with nuclei) and multicellular animals, plants, and fungi. All
eukaryotes belong to the domain Eukarya (sometimes called Eukaryota).
Aside from the presence or absence of a nucleus, prokaryotes and eukaryotes differ in a number of
other ways. One of the first differences you will notice as you examine cells under the microscope is
that most eukaryotic cells (5 100 m in diameter) are much larger than prokaryotic cells (1 10 m
in diameter). Another difference is that, in addition to the nucleus, eukaryotic cells contain
membrane-bound organelles while the vast majority of prokaryotic cells do not (until recently, it
was thought that no prokaryotes had organelles). Membrane-bound organelles are small internal
compartments within cells that perform specialized functions. Examples include mitochondria and
chloroplasts.
During this lab, you will compare prokaryotic cells to eukaryotic cells. You will also compare cells
from two different types of eukaryotes, plants and animals. Two major differences between plant
and animal cells that you should be able to observe with the microscope are the cell wall and
chloroplasts. Plant cells and almost all prokaryotic cells possess tough exterior cell walls composed
of carbohydrates that protect and support cells, while animals lack cell walls. Chloroplasts are
organelles possessed by plants (and eukaryotic algae) that allow these organisms to collect light
19

energy from sunlight and store this energy chemically in sugars. Along with mitochondria (another
type of organelle), chloroplasts are believed to have originated by endosymbiosis, the incorporation
of once free-living bacteria into the eukaryotic cell. One piece of evidence that supports
endosymbiosis theory is the fact that chloroplasts and mitochondria each contain their own circular
chromosome, like prokaryotes. On the other hand, the nucleus of eukaryotic cells contains multiple,
tightly-coiled, long strands of DNA. The chromosomes of eukaryotes become visible under the
microscope during cellular division, a process we will observe later in the semester.
Anatomy of the Microscope: The Compound Microscope
Before lab, familiarize yourself with the anatomy and use of the microscope.
Fig. 1. Basic anatomy of a compound microscope. Descriptions of each component on the

following page.
20

Base: The base supports the microscope.
Lamp (Illuminator): The source of the light that passes through the specimen.
Rheostat: The Rheostat dims or brightens light from the lamp.
Coarse Adjustment (Focus) Knob: The coarse focus knob moves the stage up and down. This
adjustment is used only with the low power objective lens (4.
Fine Adjustment (Focus) Knob: The fine focus knob moves the stage up and down to precisely
focus the specimen. This is the only knob you should to focus with the high power objective lenses
(10 and 40).
Stage: The stage supports the slide, which is held in place by stage clips, and/or a mechanical stage
apparatus.
Condenser Lens: The condenser lens is located under the stage and focuses the light on the
specimen. It should remain at the highest position close to the stage.
Objective Lenses: The objective lenses forms the first magnified image of the specimen. The
amount of magnification is marked on the side of each lens. Always use the lenses in order, from
low to high power, to avoid crushing the specimen and find objects most easily. Lenses are made of
very high quality glass, and should be cleaned carefully. During this lab, we will not use the 100 oil
immersion objective lens.
Nosepiece: Holds the objective lenses.
Body Tube: Joins the nosepiece to the eyepiece (ocular).
Arm: Supports the body tube. Always have one hand on the arm when carrying the microscope.
Ocular Lenses (eyepiece): further enlarges the image that is magnified by the objective lens. The
ocular lenses on the microscope you are using magnify 10X, and are binocular (two eyepieces) as
opposed to those with one eyepiece (monocular).
21

Understanding the Microscope
Setup and Storage: Turn the rheostat all the way down before turning the light on or off to extend
the life of the light bulb. If the cord is wrapped around the base, fully unwind it before use. The
cord should never be wrapped around the base while the microscope is in use. Using the
microscope while the cord is wrapped around the base can damage the gears within that allow the
stage to move up and down to focus. Before leaving, make sure the lenses and stage are clean
(remove any slides). The low power objective should be in place. If your laboratory instructor
instructs you to do so, wrap the cord around the base, cover the microscope with the plastic cover,
and put it in its numbered position in the microscope cabinet.
Magnification: Magnification of a specimen makes it appear larger than actual or life size. The
amount of magnification is designated by a number followed by an , which stands for times life
size. To determine the total magnification of an object, multiply the magnification of the objective
lens by that of the ocular. For example, a 40 objective used in conjunction with a 10 ocular lens
yields a total magnification of 400.
Resolution: Resolution is the amount of detail that can be seen in a specimen. Magnifying an object
and enhancing the contrast of the specimen (often by staining or manipulating the light passing
through the specimen) increase the amount of observable detail. In addition, the care with which a
specimen is prepared, and the quality and alignment of the microscope lenses affect the resolution of
detail. Generally, the condenser should be in the highest position (close to the stage) with the iris
almost completely open for optimal resolution. Partial closure of the iris may at times increase
contrast, but if it is closed too much, the image deteriorates.
Illumination: The compound and dissecting microscopes require adequate light to create an image
of the specimen. To regulate the amount of light, use the rheostat in the compound microscope, and
the lamp and mirrors in the dissecting microscope. Do not change the condenser height of the iris
opening (this will reduce image quality). To prevent the bulb from burning out, the rheostat must
be turned down before the lamp switch is turned off.
Viewing: Adjust the distance between the binocular eyepieces as necessary. Objects must be
mounted on clean glass slides and usually are covered with (disposable) glass cover slips. The cover
slip protects the objective lens, and protects the specimen.
Focusing: Always focus first with the low power lens (4) on the compound microscopes, using the
coarse focus knob before the fine focus adjustment. Then, the high power objectives (10 and
40) may be positioned and focused, using only the fine focus knob. We will not use the 100 oil
immersion objective in this class.
Cleaning: Use only lens paper or other materials specifically provided by your instructor to clean the
ocular and objective lenses. Do not use facial tissues, paper towels, or your fingers. If necessary,
clean the stage with Kimwipes and 70% ethanol.
22
Exercise A: Anatomy and Use of Light Microscopes

In this lab you will be use a compound microscope for higher magnifications and a dissecting
microscope for lower magnifications to examine a variety of biological specimens. As you work
through this exercise, draw what you view through the microscope and record answers to
questions in your lab notebook.
For Drawings, be sure to include the total magnification, a title, labels, and notes as appropriate.
Always remove microscopes from the cabinets carefully by holding the arm of the scope with one
hand, resting its base on your other hand. Keep the microscope upright as you carry it to your table.
Before you turn on your compound microscope, identify its parts using the diagram (Figure
1) and descriptions above.
Use of the Compound Microscope
1.
2.
3.
4.
5.
Obtain a letter e microscope slide. Use stage clips to hold the

slide in place on the stage. Use the knobs below the stage to move the clipped slide so
that the e is centered over the opening.
With the lowest power objective lens in place, use the coarse
focus to move the stage up so that the objective is close to the slide (1-2 mm).
Look through the microscope and adjust the iris so that the field
of view is sufficiently bright (iris almost completely open for optimal resolution), and
adjust light further using the rheostat. Do not adjust coarse/fine focus at this time.
Look at the microscope from the side, turn the coarse focus
knob until the low power objective lens is just above the slide. The stage will move up
and down; the objective lenses are stationary within the vertical plane. Note which way
you turned the knob to lower the lens - (towards or away from you).
Look through the ocular and turn the coarse focus knob in the
opposite direction so that the stage (slide) moves away from the objective lens. Continue
until the e is in focus. Use the fine focus knob to precisely focus the e.
CAUTION: Many microscopes have parfocal lenses, which means that as you
switch from one lens to another very little focusing is required after the new lens is in
place. If a microscope is not parfocal, as you move from one lens to another the new
lens may not have enough room above the specimen and may crash into the
specimen as the lens is moved into place, damaging the lens and/or specimen.
When working with a microscope that is not parfocal it is important to lower the
stage slightly before moving from a lower to a higher magnification and watch
carefully from the side as you move the higher magnification lens into place. Raise
the lens further, if necessary, to allow the lens to swing into place without contacting
the specimen.
6.
To observe the e at a higher power of magnification (with the

10 objective lens), you will first have to center the specimen in the field of view. This is
important because your field of view decreases as you change to a higher power. You
may have to adjust the fine focus slightly. If you do not see the e after you have
23

switched to the next highest power, return to low power, make sure the image is centered,
and try again.
7.
In your lab notebook, draw the letter e as it appears when
you look at the slide from the side, not through the ocular. In another drawing, depict the
letter e as it appears when viewed through the ocular at a total magnification of 100.
8.
Move the slide away from you with the knobs below the stage
while observing the e through the microscope. Which way does the e move (up or
down)? Move the slide to the right while observing it through the microscope. Which way
does the e move (left or right)? Record your answers in your lab notebook.
9.
What are the total magnifications available on the compound
microscope you are using? Record your answer in your lab notebook.
Use of the Dissecting Microscope
The dissecting microscope has lower overall magnification than the compound microscope. Like
the compound microscope, the dissecting microscope uses ocular and objective lenses to create a
magnified image of the specimen. Carry the dissecting microscope as you carried the compound
microscope - with one hand supporting the base and the other holding the microscope by the arm.
Examine the dissecting microscope and identify the following parts: eyepieces, magnification knob,
focusing knob, arm, base, stage, objective housing and mirror. Note that illumination for the
dissecting microscope comes from an external light source. Operation of the dissecting microscope
is relatively simple compared with the compound microscope use the magnification knob on the
top of the microscope to set magnification, the focus knob to bring the specimen into sharp focus
and the external light source to provide illumination of the specimen.
10.
11.
12.
13.
14.
What are the total magnifications available on the dissecting

microscope you are using? Record your answer in your lab notebook.
Place the letter e slide under your dissecting microscope at a
magnification of 30X. In your lab notebook, draw the letter e as it appears when you
look at the slide from the side, not through the ocular. In another drawing, depict the
letter e as it appears when viewed through the ocular of the dissecting microscope.
Move the slide away from you while observing it through the
microscope. Which way does the e move (up or down)? Move the slide to the right while
observing it through the microscope. Which way does the e move (left or right)? Record
your answers in your lab notebook.
Compare and contrast the dissecting and compound
microscopes. How are they alike? How are they different? Record your answers in your
lab notebook.
Review the differences between the two types of microscopes.
Consider the basic differences in form and function to consider advantages and
disadvantages for each kind of microscope when using these microscopes as a scientific
tool. What kind of work or uses may be better suited to the compound microscope?
Why? What kind of work or uses may be better suited to the dissecting microscope?
Why? Record your answers in your lab notebook.
24

Estimating cell size
One way of estimating the size of cells or other objects under the microscope is to use the
(approximate) diameter of field for each lens. In the example below (Fig. 2), if the diameter of field
for the 40X objective is 480 m, what is the approximate size of each cell?
Fig. 2. View of cells at 400X
Table 1. The approximate diameter of field for the general biology microscopes with different
objective lenses.
Objective lens
4X
10X
40X
100X
Leitz
4800 m
1920 m
480 m
190 m
25
Olympus
4500 m
1800 m
450 m
180 m
Exercise B: Prokaryotic and Eukaryotic Cells

In this exercise you will look at prokaryotic and eukaryotic cells under the compound microscope,
and view some distinguishing characteristics. You will also examine basic characteristics that
differentiate plant cells from animal cells.
Prokaryotic Cells
Prokaryotes are single-celled organisms that include the bacteria and archaea. You will observe
Nostoc, a photosynthetic bacteria (also known as a cyanobacteria or blue-green algae). Nostoc cells are
smaller than eukaryotic cells, with diameters ranging from 1 to 10m.
1. Obtain a prepared slide of a Nostoc. Focus it under low power, then move to a higher power
lens (40). You will not use the 100 oil immersion lens during this lab.
2. Once you have identified the Nostoc cells, draw what you see in your lab notebook and
answer the following questions: What do you see in the cytoplasm? Can you see a nucleus
or any membrane bound organelles? On your drawing, label the cell wall and cytoplasm of a
cell.
3. Colonies of Nostoc, which occur in long strings, often contain differentiated cells called
heterocysts (literally different cells). Heterocysts fix nitrogen, effectively pulling nitrogen
out of the air for the cells to use - most other cells must obtain nitrogen from food or
through absorption from solution. If you drew a heterocyst, identify it with a label.
Eukaryotic Cells
Animal Cells: Human Cheek (Epithelial) Cells
Make a wet mount of your own cheek cells:
4. Place a small drop of distilled water on a clean slide.
5. Gently scrape the inside of one of your cheeks with the blunt end of a flat toothpick, and stir
the cells into the distilled water on the slide.
6. Add a small drop of methylene blue stain, and a cover slip. Slowly lower the coverslip over
the mounting solution and specimen. If necessary, gently tap on the surface of the coverslip
to remove air bubbles.
7. Focus the cells under low power, then high power.
8. Sketch and describe the cells in your lab notebook. Label the cell membrane, nucleus,
and cytoplasm.
9. Using Table 1, estimate the size of your cheek cells and add this to your drawing.
10. Can you see small dots or rods in the area surrounding the cells or speckled over the cell
surface? What might these small structures be? Record your answers in your lab
notebook.
Plant cells: Elodea (an aquatic plant)
11. Remove one of the smaller leaves from the tip of an Elodea sprig in the aquarium, and
prepare a wet mount.
12. Focus the leaf under the compound microscope and examine one of its cells. Draw the
Elodea cells in your lab notebook, and label the cell wall, cell membrane, nucleus,
cytoplasm, and vacuole(s) of one of the cells.
13. What are the small, roundish, green organelles? What is their function? Label them in your
drawing. Record your answers in your lab notebook.
26

14. Using Table 1, estimate the size of an Elodea cell and add this to your drawing.
15. Next, prepare two more Elodea wet mounts. To one, add a few drops of 9% salt solution. To
the other, add a few drops of distilled water. Before looking at the Elodea cells on each slide,
predict what you expect to see. Think back to last week. Now look at the cells. What do you
observe? Record your answer in your lab notebook.
27
Exercise C: Viewing Aquatic Organisms

Freshwater ponds and streams, and aquariums often have an abundance of interesting and diverse
single-celled and multicellular organisms. You may not be able to distinguish subcellular
components, but you can try identifying some of the more common organisms found in the local
waters.
Prepare wet mounts from the sample water(s). Your instructor may offer hints for finding
organisms within each sample. Many of the organisms are visible swimming about in the water.
Other good places for finding a diversity of organisms is near any plant material in the sample or
along any bottom material in the sample. If you dont find much on your first attempt, try making
another slide, but sample from a different part of the jar.
You should use both the compound and the dissection microscopes to examine the water sample
organisms. Wet mounts with coverslips must be used for samples examined under the compound
microscope, but you may use wet mounts, depression slides or culture dishes for examining
specimens under the dissecting microscope. As the specimens in this exercise are not stained,
different methods for improving contrast in the specimen will be employed. Experiment with
adjusting the light passing through the specimen by slowly closing down the iris or adjusting the
rheostat.
Focus on low power and examine the organisms. Move up to higher power objectives if you wish.
If the organisms are moving too quickly, move to a clean slide and add a drop of Proto-slo to slow
them down.
As directed by your instructor, sketch some of the organisms. With your sketches, include the
magnification of your image and any additional notes on movement, color, shape, structures,
interesting features and identification of your organism(s).
28
Clean-Up
Make sure you clean your table before you leave.
Remove any slides from the stage. Return depression slides, and prepared Nostoc and letter e
slides, to where they came from.
Place used coverslips and any broken microscope slides in the Glass Disposal or Sharps
Disposal containers do NOT place these items in the trash cans.
Wash and rinse the microscope slides you used for wet mounts. These can be reused.
Put the lowest power objective lens in place on your compound microscope, turn the
rheostat to its lowest setting, and turn off the light.
Homework Assignment 3: Scientific Literature 1

This week you will find a peer-reviewed scientific journal article, learn how to cite it properly, and
practice paraphrasing. See the assignment description on WyoCourses for more information. Your
submission will contain two files: (1) A pdf copy of the article you found, and (2) a second file with
your citations and paraphrasing.
Acknowledgements
This lab was written by Diane Gorski and modified by Chris North.
29
GENERAL BIOLOGY LAB MANUAL LAB 5: MACROMOLECULES & ENZYMES
LAB 5: MACROMOLECULES & ENZYMES

Learning Objectives
1. Understand the difference between quantitative and qualitative methods to compare and
measure the concentration of a solution with colorimetric techniques.
2. Know how a spectrophotometer is used to make quantitative measurements
3. Gain experience working with solutions
4. Apply colorimetric techniques to assess the function of an enzyme (amylase) under control
and treatment conditions.
5. Learn how to prepare an introduction for a scientific paper.
6. Practice dilution problems.
Pre-lab Reading
From Textbook (Freeman et al. 2014):
Bioskill 3 Reading Graphs (black-edged pages)

Sections 8.1 and 8.3
Macromolecules and Enzymes

In lecture, you have discussed the four major classes of organic molecules: proteins, nucleic acids,
carbohydrates, and lipids. In this lab we will work with a carbohydrate (starch) and a protein (the
enzyme amylase).
Carbohydrates are molecules composed of the elements carbon (C), hydrogen (H), and oxygen
(O). You can remember this because the hydrate part of carbohydrates refers to water (H20), and
many carbohydrates are actually composed of some multiple of CH2O. For example, the molecular
formula of sugar (glucose), a molecule we will encounter in this lab and throughout the semester, is
C6H12O6 (6 CH2O). Carbohydrate molecules play important structural roles (cellulose is the main
component in wood), and they are also used by cells to identify one another. Many carbohydrate
molecules, such as starch in plants and glycogen in animals, are important for energy storage as they
can be broken down into sugar for quick use. Today, we are going to do just that: break starch in to
its constituent sugar molecules.
But just how are we going to break down starch? Chemical reactions may occur spontaneously,
some with dramatic effect, but many occur slowly or do not occur at all without help. In biological
systems, help comes in the form of enzymes. Although proteins may have other functions, and are
also important for tasks such as defense and movement, enzymes are arguably the most important
form proteins take.
An enzyme is a catalyst, which means it speeds up (or catalyzes) a specific chemical reaction. For
example, amylase breaks down starch and is found in the saliva of many animals. Enzymes are
usually easy to identify from their name, as they often end in ase. Usually the name also tells you
something about the particular enzymes function. Starch is actually composed of two components,
amylose and amylopectin, so it makes sense that amylase works on starch. The material that is
worked on by the enzyme, starch in this example, is called the substrate. Enzymes work by helping
to speed up (catalyze) reactions in two ways: (1) they bring substrates together, and (2) they lower
activation energy.
Enzymes are proteins, often have complex shapes, and are great examples of how form and
function are connected in biology. Enzymes have special regions called active sites that can bind to
specific substrates. These active site function to bring substrates together, or expose substrates to
31

conditions which allow the substrates to break down more easily. Reactions require a certain amount
of energy to get started, which is termed the activation energy of the reaction. By changing form
when attached to substrates, enzymes can produce conditions under which the reaction requires less
activation energy. When less activation energy is required, reactions occur more readily and quickly.
Because enzymes have very specific functions, they also tend to work best under specific
conditions. For example, pepsin (a protease which breaks down proteins in the stomach) in the
stomach (which is fairly acidic) works best in low pH environments. When enzymes are exposed to
conditions that are less optimal they function more slowly or may not function at all. This occurs
because proteins start losing their form in a process called denaturation when conditions cause
molecular bonds to break.
The Spectrophotometer and Colorimetry
A common tool used in biology and chemistry to analyze the transmission or absorbance of light
through materials is the spectrophotometer (Fig. 1). Spectrophotometers are composed of two
main components: (1) A light source that can be set to a specific wave length, and (2) a device that
can measure the amount of light. The first component, the spectra part, usually consists of a light
bulb, a prism, and a slit. By moving the slit or the prism, the wavelength of the light can be selected.
The amount of light of the selected wavelength that passes through the sample is measured by a
light detector, the photometer part.
Fig. 1. Diagrammatic representation of the main components of a spectrophotometer.

Visible light is the part of the electromagnetic spectrum with wavelengths of between 400 and 700
nanometer (nm = 10-9 m). Different colors of light have different wavelengths; red light has a
wavelength of about 700 nm, while blue light is closer to 400 nm. When light hits an object, it is
either absorbed, transmitted, or reflected. The reflected light is the color we see. For example, when
sunlight hits a leaf, green light is reflected, while blue and red light are absorbed by chlorophyll.
One of the most common uses for a spectrophotometer is to measure the concentration of a
substance dissolved in a solution. This is possible because all substances absorb some light, and if
the substance is more concentrated then more light is absorbed, and less light is transmitted through
the sample. Sometimes chemicals (called color reagents) can be added to solutions to produce
colored compounds when they react with a particular substance. The more of that substance that
there is in the solution, the deeper the developed color will be. Methods which use color reagents are
referred to as colorimetric techniques.
During this lab, you will be using a color reagent called Lugols solution (I2KI). Sometimes simply
referred to as iodine, Lugols solution is used as an antiseptic in medicine and an emergency
disinfectant for drinking water. I2KI can also be used to detect the presence of starch because it
reacts with starch to produce a dark blue color. The more starch there is in a solution, the darker
blue it will turn when iodine is added. When we use a substance like Lugols solutions to detect a
32

substance, or to compare the relative concentration of a substance in different solutions we are using
qualitative methods.
However, in science we often want to assign a specific values to measurements. For example, we
might want to know how much more starch is in solution A than solution B. With a
spectrophotometer and a standard curve we can estimate the concentration of solutions. By using
this this method, we might find that solution A has a starch concentration of 113 mg/L, while
solution B has a starch concentration of 76 mg/L. Techniques that produce numeric data like this
are called quantitative methods.
Fig. 2. Standard curve for starch concentration. Absorbance was measured at 580 nm after 2 drops
of Lugols solution were added to starch standards.
To estimate the concentration of starch in a solution by measuring the absorbance of light with
the spectrophotometer, we must first create a standard curve (Fig. 2). A standard curve is created
by measuring the absorbance of standards, which are solutions of known concentration. We can
compare absorbance values measured from unknown solutions to the standard curve to get an
estimate of the concentration of the unknown solution.
During this lab, you will use a standard curve and the spectrophotometer to estimate the starch
concentration of three unknown solutions. Then you will design and conduct an experiment to
assess the effects of some treatment on the activity of amylase. You will also practice dilution
calculations.
Pre-lab Questions
You should read and consider the questions below before lab so you are better prepared.
1. What enzyme will we be working with today, and what is its function?
2. How do enzymes work to speed up chemical reactions?
3. What factors might affect enzyme activity and the rate of chemical reactions?
4. Do you understand the difference between transmission, reflection, and absorbance of light?
5. Can you differentiate between qualitative and quantitative methods?
6. Given an absorbance value, for example 1.002, can you estimate the starch concentration by
using the standard curve represented by Fig.2?
33
Exercise A: Measuring Concentration with the Spectrophotometer

Estimate starch concentrations of the unknown solutions X, Y, and Z. In a well-organized table,
record the following in your lab notebook: unknown solution, absorbance measured, estimated
starch.
Working with Solutions
Solutions are homogenous mixtures of a solute (that which is dissolved) and a solvent (that which
dissolves the solute). The concentration of a solution is described as the amount of solute over the
amount of solvent. Today, you will be working with starch solutions in units of mg/L, in which
starch is the solute and H2O is the solvent.
When working with solutions, follow these guidelines:
1. Always agitate solutions before sampling from them to insure proper mixing.
2. Use a new pipette tip for each solution you sample. You may use the same tip repeatedly
with one solution before changing the tip. Plan accordingly.
3. Draw liquid slowly and carefully with the pipette
Methodology
To measure the absorbance of a solution with a spectrophotometer, use these directions. With all
methodological directions, it is wise to read through the entire process before starting.
1. Turn on the spectrophotometer (spec) and allow it to warm up for a few minutes.
2. Set the spec to 580 nm.
3. Run a blank. A blank is a solution which does not contain the compound that is being
estimated, but contains all other components of the experimental solution. We are estimating
the concentration of starch.
4. Remove the blank.
5. Obtain 5 mL of an unknown solution.
6. Add 2 drops of I2KI to develop color. Cover and invert to insure the solution is well mixed.
7. Record the absorbance of the unknown.
With the standard curve (Fig. 2), estimate the concentration of starch by adding the color reagent
(I2KI).
34
Exercise B: Enzyme Experiment

Question: How does some factor affect the enzyme activity of amylase?
During this experiment, you will design and carry out an experiment at your table. Your objective
is to investigate how some factor affects the rate at which amylase breaks down starch in solution. A
rate expresses change over time, and in this case you will examine the rate of decrease in starch as it
is converted to sugar by amylase under different conditions. To do this, you will perform a pair of
time series experiment.
When amylase is added to starch solution it immediately begins breaking down the starch. The
addition of iodine stops the reaction because iodine reacts with the starch, preventing its further
break down by amylase. By adding amylase first, then adding iodine after various time intervals, you
can estimate the rate at which starch is broken down. This reaction happens quickly, and a
maximum time interval of 120 seconds is appropriate for this experiment.
Starting Questions
Discuss the following questions with your group. You may want to record your responses on a
white board.
1. What are some factors you think might affect the rate at which amylase breaks down starch?
Select one of these factors to investigate.
2. What are the dependent and independent variables for your experiment? What are your
hypotheses?
3. What will your blank be for this experiment? Will you need different blanks for your control
and treatment series? Examine the Methodology on the next page.
4. If you dont use an experimental solution in your treatment series, what should you put in its
place?
5. Design an experiment to test these hypotheses. Get approval from your lab instructor before
starting the experiment.
Available Materials
Starch solution (150 mg/L)
Amylase solution (0.5 g/L)
Lugols solution (I2KI)
Spectrophotometer
Test tubes and test tube rack

Micropipette and pipette tips (P-1000; 100-1000 L)
Water bath and ice, for heating and cooling
Acid and base solutions, for adjusting pH
35

Methodology
To measure the effect of some factor on the enzyme activity of amylase, you will perform a timeseries experiment with a control series and a treatment series. Here is a basic methodology that you
will alter for your own experiment
1. Prepare a blank and blank the spec.
2. Prepare a series of control tubes. For a basic setup, include the following in each tube:
- 2 mL starch solution (150 mg/L)
- 2 mL deionized H2O
- 0.5 mL experimental solution (optional acid or base solution)
3. One tube at a time, add 0.5 mL of amylase (start reaction), wait a predetermined amount of
time, then add 2 drops of I2KI (stop reaction).
4. Record the absorbance for each control tube.
5. Repeat for the treatment series.
Fig. 3. Diagrammatic representation of an enzyme time series. Amylase is added to start the
reaction, then 2 drops of I2KI are added to end the reaction. However, for the 0 s time, I2KI should
be added first, so that amylase cannot react with the starch. Blank tubes have purposely been left
empty what should be included in blanks for each series?
36

Experimental Design
and Treatment groups, and Procedure. Refer to the lab notebook guidelines (pages 97 99). You
will also want to record your data in a well-organized table, which should include times and
measured absorbance for control and treatment series.
37
Clean-Up
Turn of the spectrophotometer. Make sure you have not left a sample in the
spectrophotometer.
Empty your test tubes, triple rinse them, and return them to your test tube rack upside down
so they can dry. Place a paper towel under the tube rack.
Dispose of used pipet tips in the glass waste bin.
Clean the whiteboard if you used one.
Tidy up anything else at your table as necessary.
Homework Assignment 4: Introduction

This week you will prepare an Introduction for your lab report on the plant growth experiment.
When providing background information, you will need to reference some of the scientific papers
you and your classmates located. As you do this remember to paraphrase and cite papers
appropriately (see lab report guidelines). See the assignment description on WyoCourses for more
information.
Acknowledgements
This lab was adapted from a series of labs presented in:
Jordan, C.N., and C.A. North. 2014. Life 1010 General Biology Lab Manual. Hayden-McNeil,
Plymouth, MI.
38
GENERAL BIOLOGY LAB MANUAL LAB 6: FERMENTATION
LAB 6: FERMENTATION
Learning Objectives
1. Understand the process of fermentation.
2. Design and conduct an experiment to test how some factor may affect the rate of
fermentation by yeast.
3. Evaluate and interpret data collected from a single treatment experiment with a t-test.
Pre-lab Reading

Cellular Respiration and Fermentation
All cells require energy to perform the chemical reactions that allow them to maintain homeostasis
(control internal conditions), grow, and reproduce in essence, live. Cells use energy in the form of
adenosine triphosphate (ATP) to fuel these chemical reactions. ATP has high potential energy
and is unstable, so it is produced by the cell continuously from other molecules, especially the sugar
glucose (C6H12O6). This is accomplished by cells through two main processes, cellular respiration
and fermentation.
Cellular respiration is a set of controlled chemical reactions that oxidizes glucose to release energy,
which is in turn used to produce ATP from adenosine diphosphate (ADP) by adding a phosphate
group. This occurs in four main steps (glycolysis, pyruvate processing, citric acid cycle, and electron
transport and oxidative phosphorylation see Fig. 9.2 in Freeman), and produces approximately 29
ATP per glucose molecule, as well as carbon dioxide and water. However, cellular respiration
requires a final electron acceptor, usually oxygen. When the final electron acceptor is not available,
many cells use fermentation instead to continue producing ATP.
You are likely familiar with fermentation as the process by which yeast (a fungus) is used to
produce alcoholic beverages such as beer and wine. The production of carbon dioxide by yeast
during fermentation is also used to leaven bread. You might also know that fermentation during
anaerobic activity, when lack of oxygen begins to limit respiration by your cells, produces lactic acid
which can cause cramps and nausea during intense exercise. Although we often associate
fermentation with alcohol, lactic acid, and carbon dioxide, these are by-products the main function
of fermentation is to regenerate NAD+ (an electron acceptor) from NADH so that glycolysis can
continue.
Glycolysis, the first step of cellular respiration, produces 2 ATP from glucose and requires
NAD+. Glycolysis also produces pyruvate, which is further processed during cellular respiration to
generate more ATP. However, when an electron acceptor such as oxygen is lacking, cellular
respiration cannot continue. Instead, fermentation regenerates NAD+ so that glycolysis can continue
to produce ATP. Glycolysis occurs in the cytosol, the fluid within a cell but outside of the
membrane-bound organelles, while the other three steps of respiration occur within the
mitochondria.
During lab today you will design and perform an experiment to test how some factor may affect
the rate of fermentation by yeast (Exercise A).
39

Data Analysis in Biology
For many scientific experiments and observational studies, the goal is to compare groups (such as
control and treatment groups) and determine if there are differences between these groups. If an
experiment is well-designed, we can attribute differences to our manipulation. For example, if our
plant experiment shows differences in growth between our control and treatment group, we have
good reason to suspect that our treatment (e.g. nutrient addition) had an effect.
How do we determine if there are differences between groups? This lab presents some of the basic
tools biologists and other scientists use to see if differences exist between groups, and provides an
exercise to practice using these tools. Scientists often use averages and standard deviations to
describe measurements from different groups, and use statistical tests, such as the t-test, to detect
differences among two groups. Exercise B demonstrates how to use Excel to calculate averages,
standard deviations, and perform t-tests. The exercise also provides several examples to practice
calculating and interpreting these basic statistics.
Averages and Standard Deviations
The most basic way to compare groups is to calculate averages for each set of measurements or
observations. For example, let us consider the following hypothetical data from two similar, but
independent, experiments (Table 1). We will compare plant height (in cm) data from each of the
separate experiments which are similar to the plant growth experiments that form the basis for your
semester lab report.
Table 1. Hypothetical plant height (cm) data for two independent experiments to illustrate
interpretation of data with averages and standard deviation.
Experiment 1
Control Treatment
5.6
6.7
4.4
7.9
5.5
8.5
4.9
7.3
5.3
8.2
Experiment 2
Control Treatment
4.6
7.7
4.4
7.9
9.5
8.5
2.9
4.3
4.3
10.2
If we calculate the average for each group, we find that in both experiments plants in the
treatment group are taller than plants in the control group (treatment average = 7.7, control average
= 5.1 cm). Therefore, at first glance we might conclude that our treatments resulted in taller plants
in both experiments. However, we must remember that we have only sampled a handful of plants (n
=5), and random factors may have contributed to these differences - for example, maybe the
controls were planted poorly, or we happened to choose better seeds for our treatment groups.
Another way to compare data is to look at the variability in the data. Standard deviation is one
measure we can use to look at variability. Standard deviation essentially measures the dispersion of
data around the average in other words, how close are data points to the average? If standard
deviation is low then data points are close to the average, and random factors probably had less of
an effect. If standard deviation is large then data points are further from the average, and random
factors probably had a greater impact. If we calculate the standard deviation for each group in our
hypothetical experiments (Table 1), we discover that data from Experiment 2 is more variable (Table
2).
40

Table 2. Averages and standard deviations of plant height (cm) for a set of hypothetical
experiments.
Experiment 1
Experiment 2
Control Treatment Control Treatment
Average
5.1
7.7
5.1
7.7
SD
0.5
0.7
2.5
2.1
The greater variation in experiment 2 suggests that random factors have a bigger impact on our
results. As a result we might be less inclined to believe that the difference in averages among groups
represent a real effect of the treatment. One way to look at this data is to plot the averages with
standard deviations (Fig. 1).
Figure 1. Averages and standard deviations (n= 5) for control and treatment groups from two
different hypothetical experiments (experiments 1 and 2).
Remember, standard deviations are a measure of variance around the average. To compare
standard deviations between groups visually, we often add error bars to that represent the average
standard deviation. For experiment 1, the standard deviations for the control and treatment groups
do not overlap, so we might conclude that the difference in averages is a result of our treatment (Fig.
1). For experiment 2, the standard deviations do overlap, which suggests that the difference in
averages are more likely a result of random factors (Fig. 1).
41

Introduction to Statistics: The t-test
What is statistics? Broadly speaking, statistics is the study of techniques for analyzing data. The
various statistical techniques available to researchers are often called tests or models. In general, the
goal of a statistical test is to determine the probability (or chance) that differences detected in data
are the result of random chance, and do not represent real effects.
What is a t-test? The t-test is one of the simplest statistical tests. It is used for comparing
averages between two groups (such as a control group and a treatment group) to determine if they a
different.
How does a t-test work? A t-test essentially compares the averages and variability of two groups
of measurements. The major output of a t-test (and many other statistical tests) is a p-value. You do
not need to worry about how this is computed at the moment you will likely take a statistics class
at some point during your college career and learn about the underlying math in more depth.
What is a p-value? A p-value is a number between 0 and 1 that represents the calculated
probability that a difference between samples is due to random chance. If the probability that an
observed difference is due to chance is large (i.e. a larger p-value), then we cannot be confident that
the difference is real. If the probability that an observed difference is due to chance is low (i.e. a
smaller p-value), then we can be more confident that an observed difference is due to a real
treatment effect.
How are p-values interpreted? Our choice of a cut-off for a p-value is somewhat arbitrary.
However, most scientist use a p-value of 0.05 as their cut-off (this arbitrary cutoff is called the alpha
level). Essentially this means that were willing to accept a 5% probability that a difference is due to
random chance and doesnt represent a real difference. A p 0.05 is interpreted as a statistically
significant difference.
In terms of null and alternative hypotheses, if we find a significant difference (p 0.05)
between our control and treatment groups, we can reject the null hypothesis and accept the
alternative. We conclude that our independent variable did have an effect on our dependent variable.
If we dont find a significant difference (p > 0.05), we cannot reject the null hypothesis. We
therefore conclude that our independent variable has no effect on the dependent variable.
How are t-tests performed? A t-test can be performed by hand, but nowadays people use
computer software packages to conduct statistical tests. There are also many web-based statistical
tools. We will use Excel, as it is fairly simple to perform a t-test in Excel, and it is available to all
students in the University computer labs.
42

Pre-lab Questions
You should read and consider the questions below before lab so you are better prepared. You do
not need to record your answers in your lab notebook, but you may find it useful.
1. What are the four steps of cellular respiration? Where does each step occur within the cell?
2. Which step of cellular respiration also occurs during fermentation?
3. How many ATP molecules are produced from a single molecule of glucose during cellular
respiration? During fermentation?
4. What are the reactants and products of fermentation by yeast?
5. What are some factors that you think may affect the rate of fermentation by yeast?
6. How is a t-test used to determine if a statistically significant difference exists between
groups?
43
Exercise A: Fermentation Experiment

In your table groups, design and perform an experiment to test how some factor may affect the
rate of fermentation by yeast. To measure fermentation you will use an apparatus consisting of a 50
mL centrifuge tube with a Luer lock in the cap. A 25 cc syringe is screwed to the Luer lock. Each
group will receive four fermentation apparatuses. You will add 25 mL of yeast solution, prepared by
your lab instructor, to each experimental tube. You may also add any of several available substrates
(e.g. glucose, corn starch, table sugar, and soy isolate). A typical amount of substrate to use is 0.5 g,
but you may adjust this. For each treatment or control group you should have at least 3 replicate
measurements. Each replicate should run for 20-30 minutes.
Starting Questions
Discuss the following questions with your group. You do not need to record your answer in you
lab notebook, but you may want to record your responses on a white board.
1. How will you measure fermentation with the apparatuses provided to you? (Hint: Think
about the reactants and products of fermentation)
2. What are some factors that could affect the rate of fermentation?
3. For this experiment you might want both a negative and positive control. If you were to
decide to test the efficiency of a substrate, such as corn starch, what would you use for
negative and positive controls?
4. Design an experiment to test one factor with the materials provided. Be sure to consider
controls and replication. Get approval from you lab instructor before proceeding.
Available Materials
Fermentation apparatus (four per group)
Digital balances and weigh boats
Yeast solution
Water bath (~ 40 C) and ice, for heating and cooling
Beakers and graduated cylinders

Digital timers
Substrates
Methodology
10. Obtain approximately 100 mL of prepared yeast solution from your lab instructor. Add 25
mL of yeast solution to each tube.
11. Add substrate to the centrifuge tubes as required for your experiment.
12. Screw on a lid without a Luer lock and syringe to each tube and vortex until well-mixed.
13. Carefully remove the first lid (some pressure will have formed) and clean the lip of the tube
with a Kimwipe so the tube will form a tight seal with the second lid with a syringe attached.
14. Before screwing on the lid with the syringe, pull out the syringe slightly so that it is set at 1
mL. This will allow the piston to move more easily as gas is produced.
15. When you screw on the lid with the syringe, be careful to handle only the lid and not the
syringe so as to not break the epoxy seal. You also should not overtighten the lid. This
begins the experimental times.
16. Record the volume of gas in the syringe every 5 minutes.
17. Repeat as necessary to produce enough replicates. Rinse tubes thoroughly between
replicates.
44

Experimental Design
and Treatment groups, and Procedure. Refer to the lab notebook guideline, and record your data in
a well-organized table.
Once you have started your experiment, begin to work on Exercise B in pairs.
45
Exercise B: Statistical Analysis with the t-test
This exercise explains how to perform a t-test in Excel and provides some example exercises. You
may use your own laptop or one of the lab laptops to complete this exercise in pairs.
How to calculate averages and standard deviation, and performs a t-test, with Excel
1. Enter your data into two different columns, one for your control and the other for your
treatment. For this example well use the data from our 1st hypothetical plant experiment
(Table 1). Add labels to identify where averages and standard deviations will be calculated,
and where you will perform a t-test (calculate a p-value).
2. In the cell next to the label Average, type =AVERAGE(. The equal sign tells Excel that you
want it to perform a calculation (use a function). Next, highlight the first column, then close
the ). Excel will return the average.
46

Next, calculate the standard deviation using the =STDEV() function. Again, highlight the first
column of data (but not the average). Calculate averages and standard deviations for both groups.
3. To perform a t-test, well use the function =TTEST().Anytime you start typing a function,
Excel will show you what the required fields are. For a TTEST, you need to identify array1
and array2 (which are the two groups you wish to compare), define the number of tails, and
the type of t-test. To fill the array fields, highlight the data you wish to use as before. Type a
comma after selecting the first array, and before selecting the second array. For our
purposes, use a 2-tailed t-test (so, enter 2 for the tails field), and enter 3 for the type.*
* t-tests may be one-tailed or two-tailed, and refer to the extremes of a normal (bell curve) distribution. One-tailed tests
are used when we consider differences between groups only possible in one direction (group A must be greater than
group B), whereas two-tailed tests are used when either direction is possible (A may be larger or smaller than B).
Excel can perform three different types of t-tests: paired (type 1), equal variance (type 2), and unequal variance (type 3).
Paired t-tests are used with experimental designs that include paired sampling, such as when an individual is measured
before and after some treatment. To determine if variance is equal or not additional statistical tests are required. Without
performing these tests it is safer to assume that variances are unequal because the type 3 test is more conservative (less
likely to produce false significant results). Similarly, two-tailed tests are more conservative than one-tailed tests.
Feel free to adjust the tails and type to see how this affects the p-value.
47

4. Once you have filled all the fields and hit enter, Excel will return a p-value. In this case, our
p-value is 0.0003, which is less than 0.05. Therefore, we can conclude that the groups are
significantly different. In other words, our alternative hypothesis that our treatment did have
an effect on plant growth is supported; the treatment made plants grow taller.
Practice Problems
Use Excel to calculate averages and standard deviations, and perform t-tests. Record answers to
the questions below in your lab notebook.
1. Perform a t-test for Experiment 2 (Table 1). What is the p-value you get? How would you
interpret this result?
2. In fall 2012, students in lab section 21 had an average height of 66.6 inches, while the
average height in lab section 17 was 64.6 inches. Here are the data:
Student Height (inches)
Section 21: 69, 70, 66, 63, 68, 70, 69, 67, 62, 63, 76, 59, 62, 62, 75, 62, 72, 63
Section 17: 68, 62, 67, 68, 69, 67, 61, 59, 62, 61, 69, 66, 62, 62, 61, 70
* Example adapted from the Handbook of Biological Statistics
a.
b.
What are the null and alternative hypotheses for this comparison?
Perform a t-test on this data. Are the average heights of the two sections
significantly different? Explain.
48

3. A researcher suspects that the lateral habenula, part of the vertebrate brain, is involved in
appetite suppression. She predicts that electrical stimulation of the lateral habenula will result
in decreased food intake in rats. To test this idea, electrodes are implanted in the brains of 20
rats. Following a ten-day recovery period, the rats were randomly divided into two groups
and offered chocolate chips during a ten minute feeding period. The treatment group
received electrical stimulation during the feeding period, while the control group received no
stimulation. Here are the data:
Chocolate chips consumed by experimental rats
Treatment
Control
group
group
9
12
7
9
3
7
5
14
8
8
5
7
4
12
7
6
7
5
4
8
a.
b.
c.
d.
What are the dependent and independent variables for this experiment?
What are the null and alternative hypotheses for this experiment?
What is the average and standard deviation for each group?
Perform a t-test on this data. Based on the outcome of your t-test, and the values you
calculated for c, what is your interpretation of the results of this experiment?
4. Once you have completed your fermentation experiment, calculate averages and standard
deviations, and perform a t-test to compare the amount of CO2 produced in control tubes
and treatment tubes if you have multiple treatments, use only one for this comparison.
Once you have done calculations and performed a t-test, fill in the blanks in the paragraph
on the next page, which demonstrates how a results section might be written.
49

Results
On average, control tubes produced _____ _____ cc of CO2 over _____ min (n = _____ ),
while tubes in the _______________ treatment group produced _____ _____ cc of CO2 over the
same period of time (n = _____ ) (Fig. 1). A t-test comparing the control and treatment groups
indicated that _______________________________ (p = _____ ).
A figure representing
fermentation data
Fig. 1. Production of CO2 by fermentation in control (n = _____ ) and _______________

treatment tubes (n = _____ ) over _____ min. Carbon dioxide production was
______________________________________________________ (p = _____ )
50
Homework Assignment 5: Data Analysis and Results

This week you will prepare a Results section for your lab report on the plant growth experiment.
Before writing your results section you should analyze your data for significant differences between
your control and treatment groups with a t-test. Your Results section should include both visual (i.e.
figures) and written representations of your results. See the assignment description on WyoCourses
for more information, and refer to the lab report guidelines, example lab report, and lab report
rubric (pages 101 112).
Clean-up
1. Wash centrifuge tubes and any glassware you dirtied (e.g. graduated cylinders). Dry and
return tubes to your table and glassware to wherever you got it.
2. Return syringes to the side shelf unless they have been dirtied. Dirty syringes can be
discarded.
3. Wipe up any spilled yeast solution with a sponge or wet paper towel.
Acknowledgements
This lab was written by Chris North.
51
GENERAL BIOLOGY LAB MANUAL LAB 7: PHOTOSYNTHESIS & PLANT PIGMENTS
LAB 7: PHOTOSYNTHESIS & PLANT PIGMENTS

Learning Objectives
1. Understand the reactants and products of the light dependent and independent reactions of
photosynthesis.
2. Use a spectrophotometer to characterize the absorption spectra of plant pigments.
3. Graph these data to prepare an absorption spectrum for each solution.
4. List and describe the principle classes of plant pigments.
Pre-Lab Reading
From Textbook (Freeman et al. 2014): Chapter 10 (p. 176-191)

Photosynthesis
Photosynthesis is a series of endergonic reactions in which plant and algae collect energy from
sunlight and store it as chemical energy. The process of photosynthesis in eukaryotes occurs in
organelles called chloroplasts, and is typically regarded as occurring in two steps: the light dependent
reactions and the light independent reactions.
During the light dependent reactions (the photo- part of photosynthesis) pigments, especially
chlorophyll, capture energy from photons, which is used to generate ATP and NADPH. During
this process water is split to provide electrons for reduction of NADP+ to NADPH, and to produce
a proton gradient for ATP synthase. Oxygen (O2) is released as a byproduct. The light dependent
reactions occur in thylakoids, sac-like structures within chloroplasts.
The light independent reactions (the synthesis part of photosynthesis) are sometimes called the
dark reactions, but they actually occur during light conditions in most plants, at the same time as the
light dependent reactions. During this part of photosynthesis, ATP and NADPH produced by the
light reactions are used to reduce carbon dioxide to sugars for energy storage, a process known as
carbon fixation. ATP and NADPH are oxidized to ADP and NADP+ and returned to the light
dependent reactions. The specific set of reactions that make up the light independent reactions are
called the Calvin cycle. The Calvin cycle occurs in the stroma, the space inside the chloroplast, but
outside the thylakoids. The enzyme ribulose-1,5-bisphosphate carboxylase/oxygenase (commonly
called RuBisCO) is a key player in the Calvin Cycle and serves to capture carbon dioxide in the first
step. Sugars produced by photosynthesis are used by plants for various purposes, and provide
energy to animals that consume them. Ultimately, almost all energy in biological systems is derived
from sunlight via photosynthesis.
Plant Pigments
Plants possess distinctively colored substances known as pigments. Most substances absorb
certain wavelengths of visible light (Table 1) more than other wavelengths, and reflect what is not
absorbed. For example, if a substance is placed in visible light and absorbs all wavelengths except
yellow, then the yellow light is either reflected off of the substance or is transmitted through it. This
substance appears yellow to us, as we see the wavelengths of light which are not absorbed by the
material.
The types and functions of pigments in organisms are diverse. Some pigments are important for
the wavelengths of light which they absorb. For example, photosynthetic pigments in plants such as
chlorophyll absorb energy from sunlight. In animals, the skin pigment melanin absorbs light and
protects other tissues from damage by high energy wavelengths (i.e. ultraviolet light). Other
pigments are important for the wavelengths which they do not absorb. These pigments reflect or
53

transmit certain wavelengths and give organisms specific visible colors (Table 1). These pigments
may be critical in finding a mate, hiding from a predator, or attracting a pollinator or seed disperser.
Table 1. Colors and associated wavelengths of the visible spectrum.
Color
violet
blue
green
yellow
orange
red
Wavelength (nm)
380-450
450-495
495-570
570-590
590-620
620-750
In this lab you will use the spectrophotometer to gather absorbance data on plant pigments across
a series of wavelengths to produce an absorbance spectrum for three different samples (Table 2).
First you will need to extract the pigment from your sample. The solvent used to extract pigment
will depend on the pigment of interest (Table 2).
Table 2. Extracted sample used in the Photosynthesis and Plant Pigments lab, solvent for
extracted sample, and wavelength for initial dilution check. If absorbance is above 2.0 for
check, sample must be diluted.
Pigments to be extracted
Chlorophylls
(green and greenish-yellow)
Anthocyanins
(red, purple, blue)
Carotenoids
(red, orange, and yellow)
Solvent
Acetone
Dilution Check
440 nm
Water
380 nm
Ethanol
400 nm
Pre-lab Questions
1. What are the reactants and products of photosynthesis? What is the purpose of
photosynthesis?
2. What are the two main sets of reactions that occur during photosynthesis? How are they
linked?
3. What are some of the various ways that organisms use pigments?
4. If an object appears to be red, what wavelengths are being reflected? Which are likely being
absorbed? How about an object that appears green?
5. If you are extracting red pigments from a flower, what solvent should you use? At what
wavelength should you do a dilution check? See Table 2.
54
Exercise A: Photosynthesis Study Exercise

Work with your group to answer the following questions. Record your answers in you lab
notebook.
1. What is the equation for photosynthesis? Identify the following components in the equation
with labels: source of carbon and oxygen, source of electrons and hydrogen, source of
energy for photosynthesis, product of photosynthesis that stores energy, gas produced by
splitting of water.
2. Copy and fill in the following table:
Stage of
Location in
Photosynthesis
Chloroplast
Light Dependent
Reactions
Reactant
Molecules
Product
Molecules
Summary of
Stage
Light
Independent
Reactions
(Calvin Cycle)
3. Explain what is accomplished by photosynthesis.
4. Draw a diagram that illustrates the processes of photosynthesis (i.e. a road map of
photosynthesis).
55
Exercise B: Absorbance Spectrum of Spinach

In this exercise you will obtain a spinach extract sample from your lab instructor. With this
sample, you will measure the absorbance of spinach at 20 nm intervals from 380 nm to 720 nm. The
primary pigment in spinach leaves is chlorophyll a, which absorbs light during photosynthesis and
gives leaves their green color. Record the wavelength and absorbance readings in a wellorganized table in your lab notebook.
Methodology
1. Turn on the spectrophotometer and allow it to warm-up for 5-10 minutes. The display
should have an A on the right edge. If it does not, press the [A/T/C] button until the A
is displayed. The spectrophotometer is now set to display absorbance for all readings.
2. Your instructor will provide each table with a test tube with 5 mL of spinach extract and a
second tube with 5 mL of acetone. Do NOT open either of these test tubes. The first test
tube is labeled S (spinach), and the second tube is labeled BA (blank acetone).
3. Perform an initial absorbance check on your spinach solution at 440nm:
a. Adjust the wavelength to 440nm
b. Place the blank in the sample chamber
c. Press the [0 ABS] button to blank the spectrophotometer
d. Remove the blank
e. Place the spinach sample into the spectrophotometer
f. If the absorbance reading is above 2.0, notify your instructor. Samples with absorbance
values above 2.0 must be diluted.
4. Take absorbance readings every 20 nm from 380 nm to 720 nm (i.e. 380, 400, 420, etc.) The
spectrophotometer must be blanked each time you change to a new wavelength. The steps
to take a reading are:
a. Adjust the wavelength
b. Place the blank in the sample chamber
c. Press the [0 ABS] button to set the blank
d. Remove the blank
e. Place the spinach sample into the spectrophotometer
56
Exercise D: Absorbance Spectrum of Red Cabbage

Prepare a red cabbage extract and measure its absorbance at the same wavelengths as you did for
spinach. The primary pigments in red cabbage are anthocyanins (water-soluble red, purple, and blue
pigments) that are prized by nutritionists for their antioxidant qualities.
Preparation of Red Cabbage Extract: Obtain approximately 15 g of red cabbage record the
exact amount in your lab notebook. Place the cabbage into a mortar, add 25 mL deionized water,
and thoroughly grind the cabbage with the pestle for 3 min. Decant (pour off) the liquid into a clean
50 mL beaker and then pour 10 mL of this solution into a labeled 15 mL centrifuge tube. Bring this
to your lab instructor so that the raw extract can be further purified by centrifugation.
What is the concentration of the extract you prepared? Record your calculations and answer in
your lab notebook.
Methodology
Put 5 mL of the purified cabbage extract in one test tube and label it. Put 5 mL of deionized water
in another test tube use as a blank. Follow the same methodology used in Exercise A. If the
absorbance is above 2.0, dilute the extract until the absorbance at 380 nm is less than 2.0. Record
any dilutions and your data in a well-organized table.
57
Exercise E: Absorbance Spectrum of a Selected Sample

Obtain one of the various samples available to you and prepare an extract with water or ethanol
(see Table 2 to determine which solvent to use). Available samples include various flowers and
produce. During the fall semester available samples may also include fall leaves. Measure the
absorbance of your extract at the same wavelengths as you did during the previous two exercises.
The primary pigments that produce yellow, orange, and red colors in plants are carotenoids, while
darker reds, purples, and blues are usually produced by anthocyanins, as in cabage. Carotenoids are
sometimes accessory pigments that help chlorophyll collect light energy while also protecting
chlorophyll from damage caused by excessive light.
What is the concentration of the extract you prepared? Did you have to perform any dilutions?
Record any calculations you perform and your data in your lab notebook.
Exercise F: Plot Your Data

Plot the data you collected in Exercises A C, either by hand in your notebook or with Excel. If
you use Excel, send a copy to your lab instructor. You may plot three separate graphs, or you may
plot all the data on a single figure. Be sure to include a figure legend or figure legends (if you create
multiple figures) a caption that explains what the figure shows.
Answer the following questions in your lab notebook:
1. What pigments did you examine today? Based on the absorption spectra you plotted, what
colors does each pigment absorb and reflect (refer to Table 1)?
2. What function does each type of plant pigment perform?
58
Homework Assignment 6: Discussion

This week you will prepare a discussion section for your lab report on the plant growth
experiment. Refer to the lab report guidelines, example lab report, and lab report rubric (pages 1010
112). Be sure that you cite references to support you interpretation of your results, to make
comparisons to other studies, or to suggest modifications. See the assignment description on
WyoCourses for more information.
Clean-up
1. Return the spinach extract and acetone blank to your lab instructor if you havent yet.
2. Ground produce and flowers can be discard in waste bins. Water and ethanol-based extracts
and blanks can be dumped in the sink.
3. Rinse any glassware you used thrice (e.g. mortar and pestle, beakers, tubes, etc). Dry and
return to your table. Remove any labels.
4. Make sure spectrophotometers are turned off.
5. Do any additional cleaning that is necessary.
Acknowledgements
This lab was designed by Diane Gorski and modified by Chris North. Exercise A was adapted
from a study sheet produced by Pearson Education.
59
GENERAL BIOLOGY LAB MANUAL LAB 8: DNA
LAB 8: DNA
Learning Objectives
1. Understand how polymerase chain reaction is used to amplify DNA
2. Learn how gel electrophoresis is used to analyze DNA samples
3. Use DNA gel electrophoresis to solve a murder mystery
Pre-Lab Reading
Bioskill 9 Separating and Visualizing Molecules (black-edged pages)

Section 15.3
Restriction Enzymes
Restriction enzymes were discovered by Werner Arber, Hamilton Smith and Daniel Nathans in
the mid- 1970s. Their discovery revolutionized biochemistry and molecular biology. Most
prokaryotes possess protective enzymes that chop the DNA of invading viruses into fragments.
The cells own DNA is not cut by its restriction enzymes because the cell protects the recognition
sites on its DNA by camouflaging them with methyl groups. The restriction enzymes therefore do
not recognize these sites on the host cells DNA. However, foreign DNA lacks the protective
methyl groups on the recognition sites, and thus the bacterias restriction enzymes can cut the
foreign DNA.
Restriction enzymes are highly specific specialized molecular scissors they cut DNA very
precisely at sites with specific base pair arrangements (Fig. 1). Molecular biologists take advantage of
these enzymes to cut DNA at specific locations for a variety of purposes. For example, scientists can
take a piece of DNA from one organism and insert it into the DNA of another organism using
restriction enzymes and ligases to cut and paste, respectively.
When DNA is digested (cut into pieces) by one or more restriction enzymes, scientists can use
information gathered about the sizes of the different pieces to learn about the original piece of
DNA. Sometimes the information confirms that a recombinant molecule has been correctly
constructed, other times the sizes of DNA fragments from different sources are used to determine if
these sources are similar or related.
Fig. 1. Sample restriction enzyme recognition sites.

61

Gel Electrophoesis
DNA that has been cut into pieces with restriction enzymes can be separate by size using gel
electrophoresis. During gel electrophoresis, DNA is loaded into wells in an agarose gel, then
subjected to an electric field. Because DNA has an overall negative charge it will move towards the
positive electrode (cathode), and away from the negative electrode (anode). The smallest pieces
travel the greatest distance from the starting point. Pieces of the same size travel the same distance.
If enough strands of the same size fragment of DNA are present, this group of fragments will show
up as a band when the gel is viewed.
DNA ladders are collections of DNA fragments of known sizes which are used to determine the
size of unknown fragments. The unit used to measure the size of DNA fragments is base pairs
(bp) the number of paired nucleic bases that make up the fragment. Another common unit, used
for larger DNA fragments, is the kilobase (kb = 1000 bp). In this lab we will use a DNA ladder (Fig.
2) as a standard to estimate the size of DNA bands in a set of samples to solve a murder mystery.
Fig. 2. DNA ladder used in general biology DNA mystery lab.

(MassRuler Express Reverse DNA Ladder Mix)
62

The Biology of a Murder: The Mysterious Case of the LIFE 1010 Murder
On Tuesday, all of the TAs and professors spent the night grading the last exam, and Mr. North
(the lab coordinator) stayed late to input the exam grades into his computer. Little did he know that
he would spend his last moments entering grades. The next morning Mr. North was found stabbed
to death on the floor of his office. He had been stabbed 15 times in the neck with a P-1000
micropipettor, and the killer had left the murder weapon in his victim. An autopsy later revealed
dried skin and blood underneath Mr. Norths fingernails, suggesting he had fought his assailant.
On that same fateful morning, one of the LIFE 1010 professors, Dr. Willford, was found lying on
the floor in the lobby of the STEM building, injured and in shock. In the days that followed, Dr.
Willford was interviewed by police at his hospital bedside. He told officers that he suspected Mr.
North had been killed by another professor, Dr. Currano, who he had seen leaving the labs as he
was returning from the grocery store. He said Dr. Currano had pushed him down the stairs, and that
he had been knocked out tumbled. He had laid helpless on the ground until one of the graduate
students found him in the morning. Dr. Willford had suffered a severe concussion, a badly bruised
right hip, and abrasions to his legs and right arm from the assault.
There had been a spate of attempted professor slayings around campus thought to be motivated
by the stress of midterms, and Dr. Currano was also.a suspect in those cases. In the room where the
grading and murder took place, police found no signs of forced entry and nothing of value had been
taken. When forensic teams searched the room, they found evidence that blood had been wiped
from a cabinet handle and that Mr. Norths body had been moved. Furthermore, the team noticed
that someone had saved a copy of the exam grades one hour after the approximated time of death.
The UW Police departments computer forensics team was able to extract the last auto-saved copy
of the file and compared it to the final copy. They noticed that several grades had been changed.
Police soon questioned Dr. Willford's story. Several people reported that theyd witnessed Dr.
Willford and Mr. North arguing loudly about Pokemon, and the Dr. Willford had threatened to
make him pay. Also, Dr. Willford had claimed to have been at the grocery store getting snacks for
the poor, starving graduate students at the time of the murder. But, although it had snowed that
night, a police officer noticed the ground under Dr. Willford's car was still dry. Dr. Willford quickly
became a suspect. But there was a problem with that theory Stuck in his office for ten years, Dr.
Willford had little time for exercise. Police thought it doubtful that such a feeble man could
overpower Mr. North, who had a black belt in Krav Maga.
A few days later, police apprehended Dr. Currano Police extracted DNA from blood samples
collected from each suspect (Drs. Willford and Currano).
63
Exercise A: Gel Loading Practice

To examine and analyze the DNA samples collected from the two suspects, you will run the DNA
in an agarose gel. Agarose is a highly purified seaweed extract. Each gel has a series of holes, called
wells, along one edge of the gel, which serve as a loading site for the DNA samples. The gel is
submerged in buffer in the electrophoresis device, which sets up the electric field. The electrical field
pulls the DNA through the gel, separating out the migrating fragments of DNA based on size.
Starting Questions
Discuss the following questions with your group. Record your answers in your lab notebook.
1. What is the overall charge of DNA molecules?
2. Will DNA travel from the negative electrode to the positive electrode, or vice versa?
3. Will shorter or longer fragments travel faster? Will shorter or longer fragments be closer to
the loading wells?
Successfully loading the DNA samples into the tiny wells in an agarose gel takes some practice.
You will first practice with small pieces of gels made of non-nutrient agar. These gels are similar
to the gels you will use for gel electrophoresis, but do not contain the chemicals necessary for
running and viewing DNA samples.
At your table you will find materials for this practice session: petri dishes, pipets, loading dye
tubes, and a beaker for tap water. The loading dye is a mixture of bromophenol blue dye and
glycerol, which are also mixed with DNA to load a sample into a gels. The loading dye serves two
important functions glycerol is denser than water and helps the sample sink into the wells, and the
blue dye allows us to monitor the DNA samples progress through the gel in the electrophoresis
unit.
Methodology
To practice loading samples into the wells of a gel, follow these instructions:
1. Place a dry practice gel into a petri dish and practice loading the blue loading dye into the
wells. Place the end of the pipet near the bottom of the well and fill the well slowly from
the bottom up.
2. Next practice with the gel submerged in tap water: Place the gel in the petri dish and cover
the gel with tap water. Once again, practice carefully filling the well from the bottom up.
Try not to introduce any air bubbles into the well as you add the loading dye. Remove
the pipet carefully, keeping the plunger depressed so as to not remove or disturb the
loading dye.
3. When finished with your practice gels, place the used gels in the labelled waste container at
the sink in the back of the room, rinse out the petri dishes and beakers, and return the
practice gel supplies to the tray on your table.
64
Exercise B: Gel Electrophoresis of DNA Samples

Your TA will provide your group with four 0.6 mL microcentrifuge tubes, each containing 0.7 L
of either a DNA ladder or the DNA samples collected from the suspects (X = Currano, Y =
Willford) and the evidence collected from underneath Mr. Norths fingernails (E). Each piece of
evidence was amplified at two different loci (plural of locus, a location or place on a chromosome),
labelled 1 and 2.
Wear nitrile or vinyl gloves when loading the DNA samples and handling the buffer or agarose
gel, or any items which may have come in contact with the gel or buffer. The agarose gels contain
ethidium bromide, a mutagen. Small amounts of ethidium bromide can also dissolve into the
buffer from the gel, so do not touch the buffer solution without gloves. If you spill the buffer in
your electrophoresis unit your TA will help to safely dispose of the spilled solution and refill the
buffer to the correct level.
Your TA will place the gel in the electrophoresis unit. The gel should be oriented so the wells are
to the right (the negative electrode side of the electrophoresis unit). Use the P-20 micropipettor to
load the DNA samples (7 L each) into wells. Use a fresh, sterile tip to load each sample.
In your lab notebook, record which sample is loaded into each well by drawing a diagram.
Make this drawing large enough that you can also record the band patterns you observe when you
view the gel. You should also record the voltage and amount of time used to run the gel. When the
gel is done running, use the ladder (Fig. 2) to estimate the DNA fragment size for each band.
65
Exercise C: PCR Group Activity

To obtain large amounts of DNA for use in gel electrophoresis and other applications, DNA must
be amplified (or multiplied). Polymerase Chain Reaction (PCR) is a laboratory technique which
allows researchers to amplify DNA. Amplification may be general or very specific. When amplifying
a specific sequence to isolate DNA from a particular loci or gene, specific DNA primers, which bind
at both the 5 end and the 3 end of the gene, are added to the PCR mix. These primers define the
region to be amplified.
The DNA amplification process consists of three steps: (1) Denaturation of DNA: high heat is
used to separate the DNA strands; (2) Annealing: temperature is adjusted to allow the primers to
bind to the DNA template; (3) Elongation: temperature is adjusted again so that new DNA
molecules can be polymerized on the template DNA. These three steps are repeated numerous
(20+) times in a thermal cycler (or thermocyler), a machine which adjusts the temperature in a predetermined time sequence. Each time, the DNA is further amplified.
Answer the following questions on this sheet.
1. For the DNA molecule below, which primer locations (A, B, C, or D) would need to be selected
in order to amplify the highlighted gene?
5
3
ATCGTATGTGCAGGGTCGATTTGCGTAACGTTGCAGTTGCAGTTTGACGAGTA
A
TAGCATACACGTCCCAGCTAAACGCATTGCAACGTCAACGTCAAACTGCTCAT
3
5
2. Write the 5 to 3 sequence for both of the primers which would be required to amplify this gene
via PCR.
3. Compared to the DNA replication process within a cell, the denaturation step achieves the
activity of which enzyme(s)?
4. Compared to the DNA replication process within a cell, the primer annealing step achieves the
activity of which enzyme(s)?
66

5. What enzymes and other materials need to be include in the PCR mix in order for amplification to
occur?
6. Diagram 3 cycles of PCR amplification for the gene shown above using the selected primers:
67
Clean-up
1. Dispose of any practice gels at your table in the waste container at the back sink.
2. Discard your gloves in the indicate waster container.
3. Wash your hands before leaving the lab.
TA clean-up:
1. Dispose of ethidium bromide gels in the container in the hood
2. Return the spatula and gel transport trays to the viewing stations
3. Wipe down viewers and leave open to dry
Homework Assignment 7: Scientific Literature 2

For your homework this week, you will read a scientific article chosen by your instructors, and
write a 1-page synopsis. We will form groups and discuss the article during a lab period. We have
you write the synopsis before lab so that you read and try to understand the paper ahead of our
discussion. The article and instructions on how to write your synopsis are provided on WyoCourses.
Acknowledgments
This lab was written by Diane Gorski and modified by Chris North. The PCR group activity
(Exercise C) was contributed by John Willford.
68
GENERAL BIOLOGY LAB MANUAL LAB 9: MITOSIS & MEIOSIS
LAB 9: MITOSIS AND MEIOSIS

Learning Objectives
4. Diagram and describe the major similarities and differences in the processes of mitosis and
meiosis.
5. Understand the functions of mitosis and meiosis in organisms.
6. Compare and contrast mitosis in animal and plant cells by examining microscope slides.
7. Relate the process of meiosis to genetics.
Pre-Lab Reading
Sections 12.1, 12.2, and 13.1

Bring your textbook to lab this week, you will find it helpful.
Cell Division
One of the tenets of cell theory is that all cells come from pre-existing cells. How does this occur?
In all organisms, cells are produced by cell division, during which a parent cell divides into two or
more daughter cells. Cell division is the final step of what is known as the cell cycle, essentially the
lifetime of a cell. During the cell cycle, cells grow and accumulate resources during a series of gap
phases (G1 and G2). Cells also duplicate their DNA during the synthesis phase (S) in preparation
for cell division when all of their resources, including genetic information, will be divided among
daughter cells.
In prokaryotes, cell division is accomplished by binary fission, which produces two identical cells.
Because prokaryotes usually only have a single, circular chromosome, during binary fission the cell
simply pulls one copy of the chromosome (which was replicated during S phase) to either side of the
cell before splitting. Cell division in eukaryotes is more complicated because genetic material
contained in DNA is packaged into a number of chromosomes (for example, your cells each contain
46 chromosomes), which must be carefully sorted and divided. Depending on the function of cell
division, eukaryotic cells divide either by the process of mitosis or by the process of meiosis.
Mitosis and Meiosis
Eukaryotes produce new cells through two types of cell division: mitosis and meiosis. Mitosis
produces two genetically identical daughter cells, while meiosis produces four genetically different
daughter cells. Mitosis produces diploid cells, like most of the cells in your body, which contain two
sets (2n) of homologous chromosomes. A pair of homologous chromosomes each has the same
set of genes, although they may have different variants of these genes, and one homolog is inherited
from each of your parents. On the other hand, meiosis produces haploid cells, which contain only
one set (n) of chromosomes. In humans, diploid somatic cells contain 46 chromosomes, while
haploid gamete cells contain 23 chromosomes. Before cell division occurs, chromosomes are
replicated during the S phase to produce two identical sister chromatids which are separated during
division.
Diploid somatic (body) cells are created by mitosis. Through the production of somatic cells by
mitosis, organisms can grow, heal wounds, or replace old cells. In single-celled eukaryotes, mitosis
can also be used for asexual reproduction to make exact copies, or clones, of parent cells. Haploid
cells produced by meiosis are the sex cells, called gametes or germ cells. In animals, gametes are
eggs and sperm. When two gamete cells fuse during fertilization, they produce a new diploid cell.
69

This new diploid cell divides via mitosis, and grows to produce a new organism. Meiosis produces
genetically different cells because of independent assortment of chromosomes and crossing over,
which will be discussed more during the genetics lab. Because gametes produced by meiosis are each
unique and are combined randomly during fertilization, sexual reproduction leads to organisms
that are different from their parents.
Pre-lab Questions
1. To insure that daughter cells produced by cell division have the same chromosome
complement as the parent cell, what must occur before division starts?
2. What are the five phases of mitosis presented in the textbook? What are the important
features of each phase?
3. What is reduction division?
4. How do the products of meiosis differ from the products of mitosis?
70
Exercise A: Mitosis & Meiosis on the Table

To better understand the processes of meiosis and mitosis, and the similarities and differences
between these two types of cell division, you will model the key stages in each process on your desk.
Once you have arrived at the correct model, record your diagram on to the summary sheet at the
end of this lab.
For this exercise, you will model an organism with 2 chromosomes in its haploid state (n = 2), and
4 chromosomes in its diploid state. Note that this is a simplification because most multicellular
organisms contain many more chromosomes. For example, you have 46 chromosomes in your
somatic cells. Also, you will not represent crossing over during meiosis in your model.
Materials
Inventory materials before and after this exercise and let your instructor know if you are missing
any pieces or have extras. Do not take apart the paired sister chromatids.
4 lg single chromosomes (3 cm), blue
4 lg single chromosomes (3 cm), red
4 sm single chromosomes (2 cm), blue
4 sm single chromosomes (2 cm), red
4 lg sister chromatid pairs (3 cm with bead), blue
4 lg sister chromatid pairs (3 cm with bead), red
4 sm sister chromatid pairs (2 cm with bead), blue
4 sm sister chromatid pairs (2 cm with bead), red
1 mitosis outline sheet
2 meiosis outline sheets
Procedure
1. If you have not already, make sure you have all of the pieces listed above. If you are missing
any, or have extras, let your instructor know.
2. Arrange the pieces on the mitosis sheet to show the arrangement of chromosomes and
sister chromatids at each stage. When done, raise your hand to have your instructor check
your arrangement. For mitosis, you will not need all of the pieces
3. If your instructor tells you that you have the correct arrangement, copy it onto the summary
sheet at the end of this lab.
4. Remove the pieces from the mitosis sheet.
5. Arrange the pieces on the meiosis sheet to show the arrangement of chromosomes and
sister chromatids at each stage. In your model, you will produce only sperm or eggs, not
both. You may choose which to produce. For meiosis, you will need all of the pieces.
6. If you have the correct arrangement, copy it onto the summary sheet at the end of this lab.
7. Return the pieces to their container, making sure they are all there.
8. Now you may help others by giving hints, but do not show them the correct arrangement.
71

Follow-up Questions
Answer the following questions in your lab notebook:
1. During which stage of the cell cycle does DNA replication occur?
2. Does crossing over occur during mitosis or meiosis?
3. During which stage does crossing over occur?
4. Does mitosis produce somatic cells or gametes? How about meiosis?
5. Most human cells contain a total of 46 chromosomes how many chromosomes are in
haploid cells? How many are in diploid cells?
6. Before going through meiosis, a cell has 12 chromosomes. How many chromosomes do the
resulting daughter cells have?
7. Fill in the following table:
Mitosis
Number of divisions
Stage during which
homologous chromosomes
separate
Stage during which sister
chromatids separate
Number of daughter cells
produced
Gametes produced
72
Meiosis
Exercise B: Mitosis and Meiosis in Animal and Plant Cells

Examine the following slides, and make drawings and answer questions in your lab
notebook. Remember to label your drawings and include magnification.
Onion Mitosis Slide
View a prepared slide of onion (Allium) root tip mitosis under a low-power objective to identify
the general shape of cells in this area. The meristematic, dividing tissue is just above the tip of the
root. Draw the root tip under low power. At higher magnification, find and draw examples of cells
in each stage of mitosis: prophase, metaphase, anaphase and telophase.
Fish Mitosis Slide
Obtain a slide of mitosis in a whitefish blastula (an embryonic stage). Find examples of metaphase
and telophase. Draw these stages and label the structures that differ from those of dividing plant
cells (onion mitosis).
Lily Anther and Grasshopper Testis Slides
When observing meiosis in plants (anthers of Lilium) and in animals (grasshopper testis) keep in
mind that meiosis results in four products, while mitosis results in only two. Locate cells that are in
the stages of metaphase I or metaphase II in one of these organisms and draw them. How can you
tell if cells are in the metaphase I or metaphase II stage?
73
Clean-up
1. Make sure all of the materials from Exercise A have been returned to their container.
2. Return slides to their place, lower the stage of your microscope, set it to the low power
objective, and turn off the light after turning down the rheostat.
Homework Assignment 8: Peer Review

Your homework this week will be to review the discussion section a classmate. Your lab instructor
will assign you a discussion section to review. You will use the lab report rubric to grade your
classmates discussion, and provide comments and suggestions for improvement.
Use the lab report guidelines, example lab report, and lab report rubric (pages 101 112) to guide
your comments. Does the Discussion section include all of the necessary components? Is each
component adequately developed? Is the writing clear and concise? Be sure to give yourself time to
complete this task, which must be done before lab.
Acknowledgments
This lab was written by Diane Gorski and modified by Chris North. Exercise A is based on an
exercise developed by Larry Flammer, who created the mitosis, meiosis, and summary sheets.
74
GENERAL BIOLOGY LAB MANUAL LAB 10: GENETICS
LAB 10: GENETICS

Learning Objectives
1. Explore how meiosis and sexual reproduction are connected with genetics.
2. Examine case studies of different types of inheritance and learn how to use Punnett squares
to predict the potential outcomes of a cross.
3. Perform a simulation of artificial selection (dog breeding) to investigate heredity and the roll
of chance.
4. Develop a pedigree for the results of the dog breeding simulation to better understand the
information portrayed by pedigrees.
Pre-Lab Reading
Chapter 14
Bring your textbook to lab this week, you will find it helpful.
Genetics
Genetics is a rapidly growing and changing scientific field. The information that previously filled
the genetics chapters of biology texts is now a mere scratch on the surface. In this lab you will
explore fundamental concepts of Mendelian inheritance.
In the nineteenth century, Gregor Mendel established the foundation of genetics with his historic
experiments on garden peas. He studied characteristics that varied among individual plants that he
carefully bred and followed through many successive generations. Mendel examined characteristics
that clearly differed between plants for example, he looked at purple vs. white flower color, round
vs. wrinkled seed coats, and yellow vs. green pods. He also used true breeding individuals that
is, his plants with purple flowers had come from plants with a history of purple flowers. Mendels
studies led him and others to recognize the following:
1. A characteristic or trait, such as flower color, is a heritable feature. (We now call this a
gene.)
2. Variations of characteristics occur, for example, purple vs. white flowers. (These
variations are now known as alleles.)
3. In individual organisms, alleles occur in pairs; one member of each pair has been inherited
from each parent.
75
Exercise A: Meiosis and Genetics

Answer these questions in your lab notebook.
1. A gene is a segment of DNA which codes for a particular trait. Genes come in varieties, one
inherited from each parent. What are these varieties called?
2. What does dominant mean when referring to gene varieties? What does recessive mean?
3. Recall that chromosomes are strands of DNA found in cells. Each chromosome contains many
genes. In your lab notebook, draw a circle to represent a eukaryotic cell from a pea plant. Label this
circle Figure 1.
a) Inside the circle, draw a pair of homologous chromosomes. A single homologous
chromosome is called a homolog.
b) Next, draw four genes on each chromosome. In this example, the first gene is homozygous,
composed of two identical dominant alleles, represented by capital letters. The second gene is
homozygous recessive, represented by two lowercase letters. The last two genes are heterozygous,
each composed of two different alleles, Rr and Tt. Label each allele (P, g, R, r, T or t). You may
use different colors and/or patterns to identify different alleles. If you do, be sure to include a
legend. Fig.1 shows one possible way to illustrate these chromosomes:
Fig. 1. A pair of homologous chromosomes with alleles for genes P, G, R and T shown.
4. Gene P, which is homozygous dominant, codes for flower color and results in purple flowers.
Gene G, which is homozygous recessive, codes for pea color. Green is dominant, yellow is
recessive. What color are the peas that grow on the plant from which this cell came?
5. Gene R codes for pea shape, which can be either round or wrinkled. Gene T codes for plant
height, which can be tall (dominant) or dwarf (recessive). What shape are the peas from our example
plant? Is our pea plant tall or dwarf?
6. Peas contain seeds. Seeds are produced when a sperm cell (male gamete) and an egg (female
gamete) merge during fertilization. Which type of cell division produces gametes?
76

7. Before cells enter mitosis or meiosis they replicate DNA during S phase. In your lab notebook,
draw another circle, labeled Figure 2. In this circle, draw the homologous chromosome pair
represented in Fig. 1. Remember to include the alleles described in Question 3. Then, draw an
identical sister chromatid for each homolog.
8. Recall that chromosomal crossover results in the exchange of genetic material between
chromosomes. In your lab notebook, draw another circle, labeled Figure 3, which represents the
same cell following crossing over, during Metaphase I (Refer to Figure 13.7 in Freeman and your
notes from the Mitosis and Meiosis lab). Remember to include the alleles.
9. At the end of meiosis four gametes are produced, each with half the complement of
chromosomes of the diploid organism (Fig. 1) contains. In your lab notebook, draw 4 circles to
represent the gametes produced by the division of the cell pictured in Fig. 3. Remember to include
the alleles.
10. Describe how meiosis is responsible for the Principles of Segregation and Independent
Assortment.
77
Exercise B: Punnett Squares and Types of Inheritance

Punnett squares provide a convenient method for predicting the results (i.e. expected proportions
of offspring by phenotype and genotype) of various crosses. In this exercise, well consider various
heritable human traits and diseases, and will use Punnett squares to explore different types of
inheritance. First, lets examine Cystic Fibrosis. Cystic Fibrosis (CF) is an inherited disease in
humans that causes the production of abnormally thick mucus linings, affecting the respiratory and
digestive systems of inflicted individuals, sometimes leading to deadly lung infections. Cystic fibrosis
affects people who are homozygous recessive; individuals with only one recessive allele are referred
to as carriers. Homozygous dominant individuals are neither carriers, nor affected by the disease. In
this example use F to represent the dominant allele, and f to represent the recessive allele.
Answer the following question in your lab notebook:
1. Define the terms genotype and phenotype.
2. A man and a woman are considering having a child. Genetic screening indicates that they are
both heterozygous for CF. What are the genotype and phenotype for the couple?
3. Construct a Punnett square. What is the probability that the couples child would have CF?
If you do not have experience with Punnett squares, see the instructions on p. 262 of your
textbook (Freeman et al. 2014).
4. Another couple is also planning on having a child. The man has CF, but his wife is not a
carrier. What are the genotypes and phenotypes of the man and woman, respectively? Use a
Punnett square to determine (a) the probability that their child would have CF, and (b) the
probability that their child would be a carrier.
Weve just examined a typical autosomal monogenic trait, which means the gene involved occurs
on an autosome (non-sex chromosome), and involves only a single gene locus (location). Many traits
exhibit this type of inheritance, but a number of other types of inheritance are common.
Case Studies
There are six case studies on the next three pages. Discuss each example with your group and
determine how to best represent the type of inheritance with a Punnett square. You may find it
helpful to use the white boards to work through problems, but you should record the Punnett
squares and answers to any questions for each case study in your lab notebook.
78

A. Color Blindness
Red-green color blindness is surprisingly common among human males, with 7-10% of men
exhibiting color blindness. In women, however, colorblindness is nearly non-existent.
Before you consider the genetics involved, lets examine the mechanism resulting in color
blindness. In the human eye there are two basic types of cells that detect light, rod cells and cone
cells. Rod cells are sensitive to low light levels, and contribute to peripheral and night vision. Cone
cells come in three varieties (blue, green, and red receptors) which are sensitive to different
wavelengths of light, and therefore allow us to perceive color. Color blindness occurs when any one
of these three types of cone cells are defective. Deuteranomalous red-green color blindness, the
most common type of color blindness by far, occurs when the spectral sensitivity of green receptors
are altered, such that they are more sensitive to red light than green. When this occurs afflicted
individuals have difficulty distinguishing red and green.
Such defects are caused by production of faulty proteins in cone cells that detect light. Proteins, as
you know, are coded for by genes. It turns out that many of the genes that code for these cone
proteins are located on the X chromosome, including those found in green cone cells. In fact, redgreen color blindness is known as a recessive X-linked trait for this reason.
When working with X-linked traits, we represent Punnett square crosses between sex
chromosomes. In most mammals, and some insects and plants, males carry a Y chromosome and an
X chromosome, while females carry two X chromosomes other organisms have different systems
for sex chromosome systems. Typically, we represent X-linked traits by adding superscripts to the X
chromosomes in our Punnett squares. For example, Xb could represent the recessive allele that
causes color-blindness, while XB could represent the dominant allele.
Consider the following: Sally and Tom are planning to have kids. Sallys father, John, is red-green
color blind, but Sally has normal color vision, as does Tom.
1. What can you conclude about Sally and Toms genotypes?
2. Use a Punnett square to determine the probability that the couples kids will be color blind.
3. How could does X-linked inheritance explain the differences in the occurrence of color
blindness in men and women?
B. Eye Color
Blue eye color was long believed to be a simple recessive trait controlled by a single gene that is,
an individual with blue eyes must have received a recessive allele from each parent. As a result it was
inferred that a child whose parents are both blue-eyed must also have blue eyes. This occasionally
led to the erroneous claim that a child with brown or green eyes born to a couple with blue eyes
must indicate adultery.
We now know that although blue eyes are commonly passed down and all people with blue eyes
probably share a common ancestor (Eiberg et al. 2008), eye color is controlled by at least 15
different genes. As a result of this complexity, almost any eye color may result from a pairing of two
blue-eyed individuals.
Many, probably most, traits are polygenic (controlled by multiple genes) like eye color. Here, for
simplicitys sake, we will consider two important genes leading to blue eyes, the B locus and T
locus. Dominance at either locus will result in blue eyes. However, individuals that are homozygous
recessive for both genes display brown eyes.
79

1. Use a dihybrid Punnett square cross (see Fig. 14.5 in Freeman et al. 2014) to demonstrate
how a couple with blue eyes (both heterozygous for both loci) might produce a child with
brown eyes. What is the probability that this couple could have a brown-eyed child?
Eiberg, H, J Troelsen, M Nielsen, A Mikkelsen, J Mengel-From, KW Kjaer, and L Hansen. 2008. Blue eye color in humans may be caused by a
perfectly associated founder mutation in a regulatory element located within the HERC2 gene inhibiting OCA2 expression. Human
Genetics 123:177-187.
C. Hair Type
Jane is the only person in her immediate family with curly hair. Her parents both have wavy hair,
while her two brothers have straight hair. Jane has heard that hair type (curly, wavy, or straight) is
inherited and cant figure out how her type fits in with the rest of her family. Janes friend Tori, also
has curly hair, but this isnt surprising because her mother does too. Toris father and brother both
have wavy hair. Tori has heard that hair type genetics are a bit unusual and display something called
incomplete dominance, but neither her nor Jane know exactly what this means.
1. What is incomplete dominance? See page 272 of Freeman et al. (2014).
2. Draw two Punnett squares that show how hair type is inherited in each family (Janes and
Toris)
3. Explain why Jane has curly hair when nobody else in her family does.
D. Blood type I
Blood types (A, B, & O) in humans are determined by a set of three different alleles of one
gene; one individual can have only two of the three possibilities. Two of the alleles are
codominant.
The codominant alleles are IA, which is responsible for the production of an A antigen, and IB,
which is responsible for the production of a B antigen. These antigens are carbohydrates that are
found on the surfaces of red blood cells. The third allele is recessive to both IA and IB and
consequently it is designed with a lower case i. The red blood cells of individuals with two i alleles
have no antigens on their red blood cells and have type O blood. The phenotypes and genotypes of
the four human blood types are summarized below.
Type A
IAIA or IAi
Type B
IBIB or IBi
Type AB
IAIB
Type O
ii
1. What does this mean, to say that two alleles are codominant?
2. Susie, who has type A blood, and whose biological mother has type B blood, plans to marry
Frank, who has type O blood. Give the phenotype and genotype of Frank, Susie, Susies
mother, and possible offspring of Susie and Frank. What can you determine about the blood
type of Susies biological father? Explain your inferences using Punnett squares.
80

E. Blood type II
Mary has type A blood and her biological father, Mike, has type B blood. Jill, Marys biological
mother, is not certain of her blood type. She thinks she needs to have blood work done to ascertain
her blood type.
1. Does Jill need blood work to figure out what type of blood she has? Can her blood type be
deduced from the knowledge of Marys and Mikes? Explain and illustrate your response
using Punnett squares.
F. Sickle-cell disease
Sickle cell disease (SCD, sometimes called sickle cell anemia) exemplifies two genetic concepts:
pleiotrophy and heterozygous advantage.
Sickle cell disease occurs in people that are homozygous recessive for a gene that produces the
blood protein -hemoglobin. This causes red blood cells, which carry oxygen to different parts of
the body, to become misshapen (sickle-shaped rather than disc-shaped as normal blood cells) when
oxygen concentrations are low. This shape-change, caused by a single gene, can affect many
different traits. The ability of a gene to affect several traits is called pleiotropy. Persons with SCD
may suffer any number of chronic or acute conditions, including those that lead to kidney, bone and
heart damage, as well as sudden death from various causes.
Sickle-cell disease is highly deleterious that is, it often kills people suffering from it at young ages
and should be heavily selected against. However, the allele which causes SCD is more common in
areas where malaria occurs, and in people whose ancestors came from these places, than might be
expected given the severity of SCD. Malaria is caused by a protozoan parasite transmitted by
mosquitoes, and killed more than 650,000 people worldwide in 2010. As it turns out, people who are
heterozygous for SCD are more resistant to malaria than either otherwise healthy homozygous
dominant individuals or homozygous recessive individuals, who suffer from SCD. This condition,
where heterozygous individuals have higher fitness than those with either homozygous phenotype, is
called heterozygous advantage.
1. Draw a Punnett square that shows how a single-gene for -hemoglobin can cause sickle-cell
disease (an example of pleiotropy) and confer heterozygous advantage. Use this drawing
to explain the two bold terms.
81
Exercise C: Probability and Dog Breeding

In the previous exercise we examined the use of Punnett squares to predict the outcome of genetic
crosses. However, these predictions only represent the probability, or predicted chance, that an
offspring will possess a particular trait. In practice, predictions rarely match reality. Answer the
following questions in your lab notebook:
1. Consider a gene in dogs that controls tail length. The dominant allele (T) codes for a long
tail, while the recessive allele (t) codes for a short tail. Draw a Punnett to predict the ratio of
offspring expected to have long tails and short tails given a cross between two heterozygous
(Tt) dogs. What proportion of puppies do you expect to have short tails based on your
Punnet square?
2. In this exercise, we will use pennies to simulate actual crosses. In each cross you will
determine the contribution of each parent randomly by flipping a coin. An outcome of heads
indicates the contribution of the dominant allele, while tails indicates the recessive allele. You
will perform 20 simulated crosses (i.e. produce 20 simulated puppies). How many of the 20
puppies do you expect will have short tails?
3. Perform the simulation 20 times by flipping a penny twice for each cross. Record the results
in your lab note book.
4. How do the results of your simulation compare with your prediction?
Historically, much of our understanding of genetics comes from examining breeding in domestic
animals and plants. For example, Mendels groundbreaking work was performed with pea plants.
Nowadays, though, breeders can use knowledge of genetics to improve their results. Of course,
random chance still plays an important role. In this final part of this exercise, you and your partner
will simulate breeding dogs to better understand the implications of probability in genetic crosses.
5. Choose the traits that you wish to select for each gene (refer to Table 1 on the next page for
traits and varieties). For example, you may want produce a long-haired dog breed, with a
black coat, upright ears, a short tail, and pale eyes. Record the traits you want in Table 2 in
the row labelled Goal Dog.
6. Select one of the starter dogs from your TA. What dog did you choose and why?
7. Now enter the information for your starter dog into Gen 1 as mother or father on Table 2.
8. Find a dog belonging to one of your classmates that you can breed with your dog and fill in
that dogs information in Gen 1 as well. Using pennies as you did earlier to determine which
allele is inherited, produce 3 offspring from your Gen 1 pairing, and record the genotypes of
these offspring in Gen 2.
9. After you have produced three offspring, pick one of the offspring to breed. For the
purpose of this exercise, consider hemophilia deleterious (a trait that significantly reduces
an organisms ability to reproduce successfully) - hemophiliac dogs (XhY, or XhXh) cannot
be used in the next generation. As before, find a mate for your dog among your classmates,
this time from the second (F1) generation. Continue this for 3 generations, filling in the table
at each step.
10. Once you have filled in the entire table, assess your results. How successful were you in
producing the breed you set out to create? Why or why werent you successful?
82

Table 1. Traits modeled during a dog breeding simulation.
Trait
Phenotypes
Locus (or
Expression
Loci)
Size
Small, medium,
A, B
Locus A is a growth inhibitor, and dogs dominant
or large
for this gene but not locus B are small. Locus B is a
growth stimulator, and dogs dominant for this gene
but not locus A will be large. Dogs dominant or
recessive for both loci are medium.
A_bb = small
A_B_ or aabb = medium
aaB_ = large
Ears
Hair
Length
Coat
Color
Floppy, or
upright
Short, or long
Black, red,
brown, or yellow
F
L
An underscore indicates that either allele may be

present.
Floppy ears (FF or Ff) are dominant over upright
ears (ff).
Short hair (LL or Ll) is dominant over long hair (ll).
D, E
Tail
Long, or short
Eye
Color
Pale, grey, or
dark
D_E_ = black
ddE_ = red
D_ee = brown
ddee = yellow
An underscore indicates that either allele may be
present.
Long tails (TT or Tt) are dominant over short tails
(tt).
Incomplete dominance:
PP = pale
Pp = grey
pp = dark
83
84
Offspring 3
Offspring 2
Offspring 1
Father
Mother
Gen 2
Offspring 3
Offspring 2
Offspring 1
Father
Mother
Gen 1
Dog Name
Dog Name
Table 2. Dog Worksheet
phenotype
genotype
phenotype
genotype
phenotype
genotype
phenotype
genotype
phenotype
genotype
Goal Dog:
phenotype
genotype
phenotype
genotype
phenotype
genotype
phenotype
genotype
phenotype
genotype
Expression
N/A
Locus
A_bb = small
A_B_ = medium
aaB_ = large
Size
F
Ears
L
Hair
Length
D
Coat Color
T
Tail
P
Eye
Color
D_E_ = black
Floppy ears
ddE_ = red
Incomplete
Short hair
Long tails
(F) are
D_ee = brown
dominance:
(L) is
(T) are
Hemophilia is a
dominant
ddee = yellow
dominant
cominant
recessive Xover
PP = pale
An underscore indicates
over long
over short
linked trait,
upright
Pp = grey
that either allele may be
hair (l)
tails (t)
represented here
ears (f)
pp = dark
present.
present
with X H or X h
XX = female
XY = male
Gender
Trait
85
Offspring 3
Offspring 2
Offspring 1
Father
Mother
Gen 4
Offspring 3
Offspring 2
Offspring 1
Father
Mother
Gen 3
Dog Name
Dog Name
phenotype
genotype
phenotype
genotype
phenotype
genotype
phenotype
genotype
phenotype
genotype
phenotype
genotype
phenotype
genotype
phenotype
genotype
phenotype
genotype
phenotype
genotype
Expression
N/A
Locus
A_bb = small
A_B_ = medium
aaB_ = large
Size
F
Ears
L
Hair
Length
D
Coat Color
T
Tail
P
Eye
Color
D_E_ = black
Floppy ears
ddE_ = red
Incomplete
Short hair
Long tails
(F) are
D_ee = brown
dominance:
(L) is
(T) are
Hemophilia is a
dominant
ddee = yellow
dominant
cominant
recessive Xover
PP = pale
over long
over short
linked trait,
upright
Pp = grey
hair (l)
tails (t)
represented here
ears (f)
pp = dark
present.
present
with X H or X h
XX = female
XY = male
Gender
Trait
Exercise D: Pedigrees
With the information you recorded in Table 2, produce pedigrees for TWO of the target traits you
selected (see your answer to Exercise B, question 5). Include all of your dogs on each pedigree.
Represent males with squares, females with circles, and use shading to represent dogs that show the
trait in question. Make sure you indicate what trait you are diagramming in each pedigree, and
include names for each dog. See section 14.6 of Freeman et al. (2014) for example pedigrees. Write
a brief discussion of what each pedigree conveys about the trait it represents. Refer to figures
14.22 and 14.23 in Freeman.
Clean-up
1. Return dog cards and pennies to you lab instructor.
Acknowledgements
This lab was developed and written by Chris North.
86
GENERAL BIOLOGY LAB MANUAL LAB 11: EVOLUTION & NATURAL SELECTION
LAB 11: EVOLUTION & NATURAL SELECTION

Learning Objectives
1. Understand and use histograms to represent three modes of natural selection: directional
selection, stabilizing selection, and disruptive selection.
2. Design and conduct an experiment to evaluate a hypothesis about the relationship between
variation in traits in a population of isopods and natural selection by a simulated predator.
3. Analyze and interpret experimental data from a natural selection experiment conducted in
class with histograms.
Pre-lab Reading

Evolution & Natural Selection
Evolution is one of the defining characteristics of life. In everyday speech, evolution is used to
mean change. In biology, evolution has a more specific meaning: change in the genetic
characteristics (allele frequencies) of a population over time. A population is a group of individuals
of a particular species living in a given time and place. We observe evolution occurring in natural
populations, plant and animal breeding, and the development of antibiotic resistance. Through the
fossil record, the shared genetic similarities among organisms, and our observations of evolution, we
understand that species are related by common ancestry.
In his famous book On the Origin of Species, Charles Darwin proposed that natural selection is the
main process by which populations evolve. Darwin described evolution by natural selection as the
consequence of heritable variation in populations and the fact that not all individuals survive and
reproduce. The individuals that are most likely to survive and reproduce are those best adapted to
their environment effectively, well-adapted individuals are selected by nature. As a result, natural
selection leads to more individuals in a population with certain heritable characteristics.
Although Darwin was very interested in heredity, he did not understand genetics. In fact, the
words gene and genetics were not even coined until 20 years after his death. However, given our
current understanding of genetics, we can describe the requirements for natural selection in the
following manner:
1. Individuals have variable phenotypes. In other words, there is variation in a trait within a
population.
2. At least some of that variation in phenotype is due to genotype (alleles). Note that other
factors, such as environment, may also affect phenotype.
3. Some phenotypes (individual with certain traits) are more likely to reproduce than others.
Phenotypes that are more likely to reproduce have higher fitness. In the biological sense,
fitness is equivalent to the ability to reproduce.
If these three requirements are met, the allele frequencies of a population will change over time
evolution will occur. While biologists generally accept that natural selection is the primary driver of
evolution, other processes may lead populations to evolve. These processes include genetic drift,
gene flow, and mutation.
When natural selection occurs it may have one of several effects on the distributions of traits in a
population. Many traits within a population approximate a normal distribution (bell-shaped curve).
For example, consider the distribution of fur color in a mouse population (Fig. 1). Most mice are
87
gray, while only a few mice are very light or very dark. Different types of selection may change the
distribution of a trait within a population in different ways.
Fig. 1. The distribution of a trait, fur color, in a population of mice. Fur color follows a normal
distribution. The vertical line in the center indicates the mean value for the trait.
Three types of selection are directional selection, stabilizing selection, and disruptive selection.
When individuals with traits at one end of the distribution have the highest fitness, directional
selection may occur. When individuals with traits in the middle of the distribution have the highest
fitness, stabilizing selection may occur. When individuals at both ends of the distribution have
higher fitness than individuals in the middle, disruptive selection may occur.
Histograms
Histograms are figures that are used to illustrate distribution data (see example Fig. 2). Usually the
number of individuals, frequency, or percentage is plotted on the y-axis against some continuous
variable on the x-axis. Individual samples or measurements are counted and binned into groups. A
bin is a range of values. A well-designed histogram has bins that are (1) adjacent, (2) nonoverlapping, and (3) equal in size. The number of bins used can reveal different features of the data,
and is dependent on the number of data points (n). Although there is no set way to decide how
many bins to use, one method is square-root choice method in which the number of bins (k) is a
function of the sample size (n), where k = n. However, deciding how many bins to use may require
other considerations.
88
Consider the example data below for mouse fur color (Table 1). How would we select bins for this
data? If we use the square-root choice method we would make 7 bins (46 = 6.8), but because our
data has values between 1 and 16, 8 bins is a better choice (16 is not divisible by 7). Therefore, it is
important to consider the range and values of the data in addition to the number of data points
when selecting bin sizes. If we use 8 bins for the mouse fur color data, we end up with the
histogram shown in Fig. 2.
Table 1. Fur color of individual mice (n =46) collected from an abandoned farm field. Color values
are on a 16-bit grayscale, where 1 = white and 16 = black.
fur color
(16-bit grayscale)
11
4
7
12
5
6
10
12
8
10
11
11
10
9
16
3
10
15
8
5
8
2
8
6
5
3
13
9
9
13
6
5
7
9
4
4
12
8
14
14
7
9
10
9
8
7
89
Fig. 2. An example histogram that shows the distribution of fur color among mice (n =46). Color
values are on a 16-bit grayscale, where 1 = white and 16 = black. Notice that the histogram above
approximates a normal distribution, and that bins are adjacent, non-overlapping, and of equal size.
Isopods
This week in lab you will carry out a natural selection experiment with isopods. Animals that
belong to the Order Isopoda can live in aquatic and terrestrial environments, and may be better
known to you as roly-polies (also called wood lice and pill bugs). Terrestrial isopods are often found
under decomposing logs and leaves. Isopods belong to the Class Crustacea, and like their marine
relatives such as shrimp and crabs, isopods breathe through gills. As a result, they must live in humid
environments and do not tolerate desiccation (drying) well. When we work with the isopods in the
lab it will be important to keep them moist.
We will work with the species Armadillidium vulgare. In nature, A. vulgare play an important role as
detritivores - organisms that consume decomposing plants and animals. They are also prey for a
variety of predators, including spiders, birds, and frogs. You will investigate natural selection by
simulating predation of isopods and measuring and plotting the distribution of some trait before and
after predation.
Pre-lab Questions
1. How could you rewrite or paraphrase the requirements for natural selection to occur?
2. Can you draw how the distribution of fur color in mice might change from that shown in
Fig. 1 with directional, stabilizing, and disruptive selection? Section 26.3 of Freeman has
good examples of these three types of selection.
3. How are bins selected for a well-designed histogram?
90
Exercise A: Histograms and Types of Selection

Your lab instructor will assign your table group one of the three example data sets below. Each
data set contains measurement from a population of organisms before and after natural selection.
To analyze the data, produce two histograms in your lab notebooks, one for the original
population and one for the population following natural selection. You may want to combine both
sets of data into a single figure, but be sure you can distinguish between the data sets. Remember to
follow the guidelines in the pre-lab reading as you prepare your histograms. Your task is to examine
the data to determine what type of selection has occurred and present your findings to your
classmates on your white board.
Data Set 1
Guppies (Poecilia reticulate) are small, tropical freshwater fish that thrive in many habitats. The total
length data below (Table 2) came from a guppy population in a small Bolivian headwater (mountain)
stream before and after the introduction of a larger, predatory fish.
Table 2. Total length (mm) of Bolivian guppies before and after the introduction of pike minnows.
total length (mm)
before selection
44
42
27
16
31
32
22
15
41
35
42
37
21
29
35
24
30
34
36
25
33
25
36
44
19
23
32
28
30
21
33
39
33
30
26
26
47
41
31
28
26
38
40
39
total length (mm)

after selection
17
16
24
19
22
29
43
46
39
49
25
48
46
15
22
17
49
40
45
27
24
20
46
26
34
42
44
20
45
18
20
47
21
30
33
18
22
16
15
47
18
44
36
42
91
Data Set 2
American robins (Turdus migratorius) often lay several broods of eggs a year, and each clutch may
consist of 2-6 eggs. A group of ornithologists (scientists who study birds) counted eggs in robin
nests on a small wooded property in Virginia over the course of several decades. During this time
the surrounding countryside was converted from forest to farmland. Table 3 contains clutch sizes
recorded in 1983, before agricultural conversion, and data from 2007 after most of the surrounding
land became kale farms.
Table 3. Clutch size of American robin nests in Floyd County, VA.
clutch size (# eggs)
1983
5
3
6
6
6
3
2
3
3
4
4
5
3
2
6
3
5
5
5
5
6
2
5
2
2
3
3
4
4
4
6
4
4
4
4
2
clutch size (# eggs)

2007
3
5
4
2
4
3
4
5
2
2
4
4
3
4
4
4
4
4
4
5
5
4
4
4
3
4
3
6
3
4
3
2
6
5
6
4
92
Data Set 3
Plants and pollinators often co-evolve (evolve together). Many moth pollinators use tongue-like
proboscises to access flower nectar, and in turn help plants reproduce by moving pollen (male
gametes) between flowers. The following data (Table 4) on the length of sphinx moth proboscises
were collected during two different years (2010 and 2014).
Table 4. Proboscis lengths of sphinx moths collected in southwestern Colorado in late July 2010
and 2014.
proboscis length (mm)
2010
11
6
6
8
8
6
8
6
8
9
9
9
8
9
7
10
5
7
10
10
8
9
10
9
8
8
7
8
11
7
8
8
7
10
proboscis length (mm)

2014
8
9
10
9
8
6
13
6
8
11
7
11
8
10
7
10
12
12
9
11
10
10
9
12
7
10
7
11
11
11
8
9
10
10
93
Exercise B: Isopod Natural Selection Experiment

For this experiment, you will explore the natural selection with a population of Armadillidium
vulgare isopods. We will play the role of predator and compare measurements of an isopod trait
(either length, mass, or color) from the whole population to measurements from the survivors after
the simulated predation event. Isopod predators include birds and shrews (modeled with forceps),
frogs and lizards (modeled with a sticky rod), and spiders and foxes (modeled with a fork).
Pick an isopod trait to examine, and a predator to simulate. What kind of selection do you predict
will occur, if any?
Experimental Design
record the following in your lab notebook: Objective, Variables, Hypotheses, and Prediction.
Refer to pages 6-7 of the lab syllabus. You will also want to record your data in a well-organized
table, and produce histograms to interpret your data.
ISOPOD CARE
Isopods are living organisms and we want to be careful and considerate when working with live animals to avoid
unnecessary harm. Additionally, we will use these isopods throughout the week, so it is important to keep our isopods
healthy for other lab sections. Be gentle and try to avoid hurting the isopods you may want to use paintbrushes to
move isopods. Also, because isopods are crustaceans that breathe through gills they should be kept moist use the
Isopod Water spray bottle to wet the soil and paper towel in their container, and avoid leaving isopods under lights
for any amount of time.
Methodology
After selecting a trait, predator, and forming hypotheses and predictions:
1. Get a container of isopods and carefully count them into a large culture dish to insure that
you have 40 isopods. Replace any missing isopods from the extras container, or return extras
you might have.
2. Get a tool for your simulated predator - forceps for birds and shrews, a glass rod with tape
for frogs and lizards, or a fork for spiders and foxes.
3. Setup the simulation arena. Each arena should have four refuges (coffee filter sections), one
in each corner, and a ring in the center.
4. Recruit a nave hunter a classmate who does not know which trait you are examining.
5. Place all 40 isopods in the ring, then release them. Allow the isopods 60 seconds to scatter
before beginning the hunt.
6. The nave hunter now has 5 minutes to eat half of your isopods (20). Be careful not to
hurt the isopods only use the sticky rod on the backs of isopods so they dont lose legs,
and use the fork to scoop, not stab. Also, isopods that make it to the refuges (under coffee
filter sections) are considered safe and cannot be captured.
7. Place the eaten animals in a labeled small culture dish.
8. After the hunt, find all remaining survivor isopods and place them in a labeled small
culture dish.
94
9. Give the eaten and survivor culture dishes to your lab instructor. He or she will re-label
them.
10. Take measurement from both groups. After completing measurements, have your lab
instructor identify the two groups.
11. Create a histogram which compares the whole population of isopods (all 40 you started
with) to the survivor group.
Follow-up Questions
After producing histograms of your data, discuss the following questions with your group. Record
your answers in you lab notebook.
1. What type of selection, if any, did your observe in your experiment?
2. What is the relationship between variation and selection? For example, the number of dorsal
plates on isopods does not vary within species how do you predict selection might impact
this trait?
3. If predation and other selection pressures reduce variation, why does variation persist in
nature?
Clean-up
4. Return isopods, soil, and paper towels to their container. Return containers to the back
bench.
5. Rinse and dry the large and small culture dishes.
6. Return rulers, paintbrushes and any other materials you used.
Acknowledgements
This lab was adapted by Chris North from a series of labs presented in Jordan & North (2014),
originally based on Berkelhamer (1998):
Jordan, C.N., and C.A. North. 2014. Life 1010 General Biology Lab Manual. Hayden-McNeil,
Plymouth, MI.
Berkelhamer, R. 1998. Variability and selection in natural populations of wood lice. Proceeding of
the Association for Biology Laboratory Education 19:245-254.
95
GENERAL BIOLOGY LAB MANUAL APPENDICES
LAB NOTEBOOK GUIDELINES

Lab and field notebooks are essential for all scientists. Your notebook is a record of experiments,
data, observations, and even ideas and questions you may come up with while performing an
experiment. A well-maintained notebook helps keep data organized and is invaluable when you need
to recall what you did. In some disciplines, such as medical research, keeping an accurate laboratory
notebook also protects proprietary data and is an important tool for preventing fraud.
At several times during the semester you will provide your lab instructor with your lab notebook
so he or she can check to make sure you are recording all pertinent information correctly.
Completeness will be the most important factor. The following guidelines will help you take good
notes.
General Rules
1. On the front cover of your lab notebook include the following: your name, your lab
section, course and semester.
2. Dedicate the first page to a Table of Contents (see Organization and Contents below).
3. Because lab notebooks are permanent (and sometimes legal) records of work done, always
use a pen.
4. If you make a mistake, draw a thin line through the word or number. Do not obscure the
original entry. Sometimes these mistakes prove to be important.
5. Similarly, never remove a page from your notebook.
6. Write legibly!
7. Always include appropriate units with all data, and in all figures and tables.
Organization and Contents

1. Enter the page number, lab title, and date in the Table of Contents at the beginning of each
lab period.
2. Write the page number, your name, the date, and the lab title at the top of each page.
3. For labs during which you perform an experiment, record all pertinent information as
outlined below.
4. For some labs you will be asked to answer Starting and/or Follow-up Questions. Include
these and any other information you are asked to include in your lab notebook.
97
Experimental Information
Objective
A brief (one or two sentence) explanation of the purpose of the experiment. What question do
you want to address?
For example, your objective might be to test the effectiveness of a new fertilizer on the production
of tomatoes by a tomato plant.
Variables
The independent variable is the variable you change or manipulate in an experiment. Groups
within the independent variable are referred to as treatments. The dependent variable is the effect
you measure. It is sometimes also called the response variable.
For example, you might want to measure the effect of fertilizer (independent variable) on the
tomato production (dependent variable). Your specific independent variables (or treatments) might
be the amount or type of fertilizer used, and you specific dependent variable might be number or
mass of tomatoes produced.
Include both the independent and dependent variables for each experiment.
Hypotheses
The null hypothesis is the hypothesis that the independent variable has no effect on the
dependent variable e.g. adding the new fertilizer does not affect tomato production.
The alternative hypothesis, on the other hand, is the hypothesis that the independent variable
has an effect on the dependent variable e.g. adding fertilizer affects tomato production. Note that
the alternative hypothesis does not speculate as to the nature of the effect this is the role of your
prediction.
Include both the null hypothesis and alternative hypothesis for each experiment.
Prediction
If there is an effect of your treatment (e.g. addition of the new fertilizer), what do you expect it to
be?
For the tomato example, you would probably predict that the addition of fertilizer will increase the
production of tomatoes. But you could also predict a decrease in the production of tomatoes.
98

Control group(s)
A control group is an experimental group to compare against your treatment group(s). Whenever
possible, scientists aim to compare experimental treatments to both a negative control and a positive
control.
A negative control is an experimental group for which no effect is expected. In the tomato
experiment example, a negative control might be a group to which no fertilizer is added, or a
substitute that should have no effect (inert glass beads, for example) is added in place of fertilizer.
Without a negative control to provide a baseline, it is not possible to determine whether the new
fertilizer actually increases tomato production.
A positive control is an experimental group for which an effect is expected. In the tomato
experiment example, a positive control might be a group to which a proven fertilizer is added (that
is, a fertilizer we know should increase tomato production over baseline). If the positive control
doesnt show an effect this suggest something else is wrong with the experiment for example, we
may not have added enough water and for this reason none of the plants did well.
It is not always possible to design negative and positive controls positive controls in particular
can be difficult. Imagine, for instance, an experiment to test the effect of temperature on tomato
production. No positive and negative controls are readily apparent. Instead, we might simply have a
control group at room temperature (if the experiment is performed in the lab). Our experimental
groups could then be tomato plants grown under heated and/or cooled conditions, and tomato
production in the experimental groups could be compared to the room temperature control group.
Procedure
Your procedure should be described with sufficient detail that another person could perform
your experiment based on these notes alone. You will also use your procedures as the basis for the
Methods sections of lab reports, so you want to be sure to include all important information,
including sample sizes and replication. It is easiest to record your procedure as a list, and leave
spaces between entries so you can make notes or edits as necessary.
It is not necessary to copy the entire methodology presented in lab handouts. However, you will
want to refer to these methodologies and make note of any change you made.
Data
You should record data in organized tables with all units clearly indicated. You may also be
asked to sketch figures of your data on occasion. Plotting data in a figure can be a good way to
visualize interesting trends or relationships between variables.
99
LAB REPORT GUIDELINES
You will produce an individual lab report based on an experiment you carry out as a class over
multiple weeks. Lab Reports mimic the style scientists use when publishing the results of their work
in peer-reviewed journals. We have you write a lab report to help you:
1. Develop a better understanding of the scientific process which is synthesized in scientific
articles.
2. Become acquainted with methods for analyzing and interpreting data
3. Become familiar with the style in which scientific findings are reported.
4. Improve your ability to write clearly and concisely
Below you will find helpful guidelines for preparing your lab report. You should also regularly
refer to the lab report rubric as you complete homework assignments and prepare your lab report.
An example lab report is also provided.
Parts of a Research Paper

Title
Titles should be informative with both the independent and dependent variable given.
Abstract
Note: You are not asked to include an abstract for your lab report, but you should be aware that
they are important elements of most research papers.
Abstracts provide:
1. An overview of the entire project/paper
2. One to two sentences each of introduction, methods, results, and conclusions
3. Do not refer to literature, statistics, or tables/graphs
4. Should be the last section written
Introduction
1. Background Information
o A review of prior literature that is relevant to understanding the rest of the paper
Highly audience specific
Must cite sources in-text (see below)
2. Purpose Statement and Hypotheses
o Explain why the research was conducted
o Give research question and objective
o State the null and alternative hypotheses.
o Provide a prediction of expected outcomes
101

Methods
1. Written in past-tense (work has already been performed), and not in second person (i.e.
you)
2. Include the following in methods
o study area/organisms used
o study design, including
description of controls
sample size
replication
o sampling and measurements used
o statistics used
3. Often divided into subsections to aid in organization
4. Report details in a logical topic based manner not in order conducted
5. Do not give a list of procedures (step-by-step instructions)
Results
1. State the outcomes of the research without interpretations in at least one paragraph of text.
2. Refer to statistical significance only if statistical tests (t-tests, ANOVA, etc.) were conducted.
3. Place statistical values (e.g. p-values) in parentheses after stating a result was significant.
4. Refer to tables and figures in parentheses at the end of sentences that reference these results.
Discussion
1. State if your alternative hypothesis was supported or not supported
o accept or reject the null hypotheses
o usually incorporated into a paragraph for each set of hypothesis (if you tested more
than one set) with a restatement of significant results and a discussion of prior
research.
2. Refer to prior research with proper citations
o How do your results compare to past research?
o Use in-text citations for literature (see below)
3. Issues with the research methods
o Explain what may have biased results
o Give ways these problems could be reduced if the experiment were conducted again
4. Significance of the research
o What new information has been gained by this project?
o What overall conclusions can be made? (put the work into a broader context)
o What implications does this research have for the field (e.g. management of
resources, new laws that should be introduced, recommendations to policy makers or
stakeholders)?
o What are some follow-up questions arising from this work?
o How might you investigate these follow-up questions?
102

Tables
1. Tables need to be easy to understand (convey data as simply as possible)
2. Do not present raw data (i.e. data as you collected it) instead, present summarized data
(e.g. means with standard error)
3. Be sure to include units
4. Tables require captions (above the table) that describe the data contained within.
o e.g. Table 1. The mean diameter (cm) of pine trees along a mountain slope.
5. Gridlines are not usually included in tables
6. Make a single table for all related data
o Do not separate data by treatment, location, etc. unless necessary
Figures
1. Figures need to be easy to understand (convey data as simply and clearly as possible)
2. Do not present raw data (i.e. data as you collected it) instead, present summarized data
(e.g. means with standard error)
3. Be sure to include units
4. Figures include graphs, diagrams, flow charts, art work, photographs, etc. essentially any
graphic that is not a table.
5. Figures require figure legends (below the figure) that describe the data represented
o e.g. Fig. 1. The mean diameter (cm) of pine trees at three slope locations.
Acknowledgements
Acknowledgements are used to give credit to individuals that helped with the research, but are not
authors of the paper. This might include technicians, reviewers, those who provided advice, etc.
Funding sources are recognized and any permits that were required to do the research are reported.
Literature Cited
1. Sometime title References or Works Cited.
2. Lists in alphabetical order all sources cited in the text (check the reference list to the
internal citations prior to printing/turning in your work)
3. Formatting is critical use the format provided below.
4. Be consistent with formatting
5. Use initials for first and middle names (when given) of authors
6. References should always have hanging indents
103
Citations
The primary literature used in scientific writing are peer-reviewed journal articles. For your lab
reports, you will be expected to find such articles to support statements you make in your
introduction and discussion, to compare with your findings, and to suggest further work. You may
also use books as references. With few exceptions, websites are not considered reputable sources for
scientific articles, and should not be used in lab reports. For this reason we have not provided
guidelines for citing internet sources.
In-text citations in scientific literature consists of the last name(s) of the author(s), and the year of
publication. Do not report page numbers. If citing multiple sources in-text to support a single
statement, list references in order by date.
Examples:
One author: (Jones 1999)
Two authors: (Jones & Smith 2008)
More than two authors: (Jones et al. 2011) et al. means and others
Multiple sources: (Jones 1999, Jones & Smith 2008)
Literature Cited sections should use the format shown below. List references alphabetically with
hanging indents. If citing multiple works by the same author, list these in order by date.
Journal article example, single author:
Alexander, R.D. 1974. The evolution of social behavior. Annual Review of Ecology
and Systematics 5:325383.
Journal article example, multiple authors:
Hanggi, P., P. Talkner, and M. Borkovec. 1990. Reaction-rate theory: fifty years
after Kramers. Reviews of Modern Physics 62:251341.
Book example:
Brooker, R., E. Widmaier, L. Graham, and P. Stiling. 2014. Biology, 3rd ed.
McGraw-Hill, New York, New York.
Book chapter example:
Sargent, J.R., and K.J. Whittle. 1981. Lipids and hydrocarbons in the marine food web.
Pages 491-533 in Analysis of Marine Ecosystems, A. Longhurst (editor). Academic Press,
London, UK.
104
EXAMPLE LAB REPORT

Chris North
LIFE 1010 lab section 34
8 Nov 2015
A comparison of the rate of fermentation of corn and cane sugar by bakers

yeast (Saccharomyces cerevisiae)
Introduction
Many organisms can carry out fermentation, a process that allows cells to produce adenosine
triphosphate (ATP) even when they cannot perform cellular respiration due to lack of a final
electron receptor, such as oxygen (Freeman et al. 2014). Fermentation occurs in animal cells during
anaerobic exercise and is performed by many single-celled organisms in anaerobic environments
(Freeman et al. 2014). Like cellular respiration, fermentation produces carbon dioxide (CO2) as a
byproduct during the catabolic breakdown of glucose to release energy (Freeman et al. 2014).
Fermentation also produces other byproducts, such as lactic acid in humans and ethanol in some
yeast (Freeman et al. 2014).
One species of yeast that can produce ethanol is bakers yeast (Saccharomyces cerevisiae) (Legras et al.
2007, Hageman & Pikur 2015). Bakers yeast has been used by humans to produce ethanol for
consumption for millennia (Legras et al. 2007). More recently, people have explored the possibility
of using ethanol produced by fermentation as an alternative to fossil fuels. Such biofuels can be
produced from a variety of different materials or substrates, including cane sugar and corn (Groom
et al. 2008).
105

Our question was: Does S. cerevisiae ferment corn and cane sugar at the same rate? To address this
question, we measured the rate of CO2 production by yeast given either cane sugar or corn as a
substrate. Our null hypothesis was that the substrate used will not affect the rate of CO2 production
by fermentation. Our alternative hypothesis was that the substrate used will affect the rate of CO2
production by fermentation. We predicted that cane sugar would be fermented at a faster rate than
corn.
Methods
To estimate the rate of fermentation of cane sugar and corn by yeast, we measured CO2
production in fermentation apparatuses over 40 minutes. Fermentation apparatuses consisted of a
50 mL centrifuge tubes with a 20 mL syringe attached to the lid by a Luer lock. A yeast solution was
prepared by adding 35 g of dry bakers yeast and 1 g NaCl to 1 L of water at 40 C and agitating for
5 minutes. To each tube, we added 15 mL of the yeast solution and 1 g of substrate. We then
secured lids, with syringes fully depressed, to the tubes. Every 10 minutes for 40 minutes, we
recorded the displacement of the syringe which indicated how much gas had been produced in the
fermentation apparatus.
For the cane sugar treatment group we used Sugar in the Raw and for the corn treatment group
we used corn meal. In addition to our two treatment groups (cane sugar and corn), we also had a
negative control group to which no substrate was added and a positive control group to which we
added 1 g of glucose. We performed three replicates in each experimental group.
For each replicate, we calculated the rate of CO2 production over the 40 minute experiment.
Averages and standard deviations (SD) were calculated for CO2 produced and rate of CO2
production for each experimental group. The rate of CO2 production was compared between the
two treatment groups by a t-test performed with Microsoft Excel.
106
Results
Over 40 minutes, the positive control group produced the most CO2 (20.3 0.6 mL, n = 3), while
the negative control group produced the least (0.2 0.1 mL, n= 3) (Fig. 1). In the same amount of
time, the corn treatment group produced 4.9 0.3 mL CO2 (n = 3) while the cane sugar treatment
group produced 13.1 0.3 mL CO2 (n = 3)( Fig. 1). The rate of CO2 production in the cane sugar
treatment group (0.33 0.1 mL/min, n = 3) was significantly higher (t-test, p < 0.001) than the rate
of CO2 production in the corn treatment group (0.12 0.1 ml/min, n =3) (Fig. 2).
Fig. 1. CO2 production by yeast (Saccharomyces cerevisiae) in fermentation apparatuses with different
substrates over 40 minutes. Each 50 mL apparatus received 15 mL of yeast solution and 1 g of
substrate. The negative control group received no substrate, while the positive control group
received glucose. Each point on the figure represents the average of three replicates.
107
Fig. 2. The average rate of CO2 production by yeast (Saccharomyces cerevisiae) in fermentation
apparatuses when given cane sugar or corn as a substrate (n = 3). Each 50 mL apparatus received 15
mL of yeast solution and 1 g of substrate. The rate of CO2 for each replicate was calculated over 40
minutes. Carbon dioxide was produced at a significantly higher rate when cane sugar was the
substrate than when corn was used (t-test, p < 0.001).
Discussion
We found that S. cerevisiae produced CO2 at a higher rate when given cane sugar as a substrate than
when given corn (0.33 0.1 mL/min versus 0.12 0.1 ml/min, p < 0.001; Fig. 2). We also
observed that the production of CO2 was higher in the cane sugar treatment group over the entire
experimental period of 40 minutes (Fig. 1). These results support our alternative hypothesis that the
substrate used affects the rate of fermentation by yeast and allow us to reject the null hypothesis that
that the substrate used has no affect the rate of fermentation by yeast. Furthermore, our results
support our prediction that cane sugar would be fermented more quickly than corn. Our findings
108

agree with other work which found that sugarcane yields more ethanol per capita than corn or sugar
beets due to its higher glucose concentration (Renouf et al. 2008).
Several potential sources of error exist with this study. For one, we discovered that gas was leaking
from some of our fermentation apparatuses because the seal between the lid of the centrifuge tube
and the tube was not airtight. Although we were able to use Teflon tape to prevent most leaks, it is
possible that some tubes were still leaky, which could have biased our results. If we were to perform
this experiment again we would use tubes with O-rings. Another potential source of error is that we
did not completely fill our tubes with yeast solution. As a result, oxygen in the headspace may have
resulted in cellular respiration by the yeast, which would affect our measurements of fermentation
since respiration also produces CO2. However, when glucose is available S. cerevisiae still performs
fermentation in favor of respiration even under aerobic conditions (Hageman and Pikur 2015), so
this may not be an issue.
Other potential substrates might also be effective for production of ethanol for biofuel use. For
example, sugar beets are used in the United Kingdom (Renouf et al. 2008) and other food crops
might be good candidates. It would be interesting to perform this experiment with different
substrates. Also, fermentation of corn may have been lower than fermentation of cane sugar because
some carbohydrates in corn are stored as starch and not glucose could adding amylase, an enzyme
that converts starch to glucose, result in fermentation rates of corn comparable to those of cane
sugar? Could other factors, such as heat or pH, be manipulated to increase the rate of fermentation,
and improve the yield of ethanol when corn is used as a substrate? Further studies need to be
performed to determine if corn is a viable source of biofuel.
109
Literature Cited
Freeman, S., K. Quillin, and L. Allison. 2014. Biological Science, 5th ed. Benjamin Cummings, San
Francisco, California.
Groom, M.J., E.M. Gray, and P.A. Townsend. 2008. Biofuels and biodiversity: principles for
creating better policies for biofuel production. Conservation Biology 22:602-609.
Hageman, A., and J. Pikur. 2015. A study of the fundamental mechanism and the
evolutionary driving forces behind aerobic fermentation in yeast. PLoS ONE
10: e0116942.
Legras, J.L., D. Merdinoglu, J.M. Cornuet, and F. Karst. 2007. Bread, beer and wine:
Saccharomyces cervisiae diversity reflects human history. Molecular Ecology 16:2019-2102.
Renouf, M.A., M.K. Wegener, and L.K. Nielsen. 2008. An environmental life cycle assessment
comparing Australian sugarcane with US corn and UK sugar beet as producers for
fermentation. Biomass and Bioenergy 32:1144-1155.
110
LAB REPORT RUBRIC

Student: ____________________________
Late Penalty (10% per day, up to 72 hours): _____%
Total Score:
=
_____%
_____ / 50
Title & Introduction (20%)

____ (2) Title is descriptive and represents experimental question and/or findings.
____ (4) Relevant background information is included
____ (4) Literature citations are included to support background information where appropriate.
____ (4) Purpose and experimental question are clearly stated.
____ (4) Null and alternative hypotheses are both clearly stated.
____ (2) Prediction of outcome is given.
____ (20) Total
Methods (20%)
____ (4) Methods are clear
____ (4) Methods are complete
____ (4) Methods provide enough detail that the study could be duplicated.
____ (4) Descriptions of controls, sample size, and replication are included.
____ (4) Written in past tense and in paragraph form.
____ (20) Total
Results (20%)
____ (6) All results are clearly described in writing.
____ (2) Any trends, outliers, or interesting relationships are identified
but not interpreted.
____ (2) Figures and/or tables are referred to in the text with figure/table
numbers.
____ (3) All figures and/or tables clearly and correctly represent data.
____ (3) Figure axes are correctly labeled and include proper units and/or
columns and rows in tables are clearly labeled with proper units.
____ (4) Each figure and/or table has a descriptive caption (called a figure or table
legend) that provides enough information for a reader to understand and
interpret the figure or table without referring to the written report. In other
words, figures and tables are standalone.
____ (20) Total
111
Discussion (20%)
____ (4) Results are summarized and interpreted in light of the original experimental question and
background information.
____ (4) Hypotheses (both null and experimental) are accepted or rejected with explanation.
____ (4) Literature is cited (at least two sources) to help explain data or conclusions, for
comparison, or to suggest At lemodifications.
____ (4) Potential sources of error or bias are identified and their impact on the results are
discussed.
____ (4) Relevant additional research questions arising from results are posed and further studies
suggested.
____ (20) Total
Writing & Citations (20%)

____ (8) Lab report is clear, concise, and easy to read with complete sentences and few spelling or
grammatical errors. Paper has been proofread and edited.
____ (2) Lab report includes section titles (i.e., Introduction, Methods, etc.), and is double-spaced.
____ (2) Scientific species names are properly given (e.g. Homo sapiens), and any abbreviations used
are appropriate and clearly defined
____ (2) At least 3 peer-review journal articles are cited.
____ (2) Each in-text citation is included in the literature cited section and vice versa.
____ (2) Correct format (as described below) is used for both in-text citations and literature cited
section.
____ (2) No direct quotes are used.
____ (20) Total
General Comments:
112

General Biology Lab Manual - F2016 PDF

Caricato da

Informazioni sul documento

Titolo originale

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

General Biology Lab Manual - F2016 PDF

Caricato da

Copyright:

Formati disponibili

GENERAL BIOLOGY LABORATORY MANUAL

FOR LIFE 1010 FALL 2016

LAB 2: SCIENTIFIC INQUIRY

LAB 4: MICROSCOPES & CELLS

LAB 5: MACROMOLECULES & ENZYMES

LAB 7: PHOTOSYNTHESIS & PLANT PIGMENTS

LAB 9: MITOSIS & MEIOSIS

LAB 10: GENETICS

LAB 11: EVOLUTION & NATURAL SELECTION

LAB REPORT GUIDELINES

EXAMPLE LAB REPORT

LAB REPORT RUBRIC

GENERAL BIOLOGY LAB MANUAL LAB 1: INTRODUCTION TO LAB

LAB 1: INTRODUCTION TO LAB

GENERAL BIOLOGY LAB MANUAL LAB 2: SCIENTIFIC INQUIRY

LAB 2: SCIENTIFIC INQUIRY

From Textbook (Freeman et al. 2014): Section 1.5

GENERAL BIOLOGY LAB MANUAL LAB 2: SCIENTIFIC INQUIRY

GENERAL BIOLOGY LAB MANUAL LAB 2: SCIENTIFIC INQUIRY

GENERAL BIOLOGY LAB MANUAL LAB 2: SCIENTIFIC INQUIRY

Exercise A: Begin Plant Growth Experiment

Coffee filters (4 cup basket style)

GENERAL BIOLOGY LAB MANUAL LAB 2: SCIENTIFIC INQUIRY

GENERAL BIOLOGY LAB MANUAL LAB 2: SCIENTIFIC INQUIRY

Plant Growth Experiment

Lab Report Preparation

Lab Report due

GENERAL BIOLOGY LAB MANUAL LAB 2: SCIENTIFIC INQUIRY

Exercise B: Unit Conversions

; with this in mind, set-up

conversions so that units cancel out:

3. Now simply multiply the numbers:

GENERAL BIOLOGY LAB MANUAL LAB 2: SCIENTIFIC INQUIRY

Convert 0.12 m into mm

Homework Assignment 1: Methods

GENERAL BIOLOGY LAB MANUAL LAB 3: MEMBRANES

From Textbook (Freeman et al. 2014): Sections 6.1 6.3

GENERAL BIOLOGY LAB MANUAL LAB 3: MEMBRANES

GENERAL BIOLOGY LAB MANUAL LAB 3: MEMBRANES

GENERAL BIOLOGY LAB MANUAL LAB 3: MEMBRANES

Exercise A: Osmosis Across a Selectively Permeable Membrane

20, 40, and 60% sucrose colutions

GENERAL BIOLOGY LAB MANUAL LAB 3: MEMBRANES

Fig. 1. Dialysis bag setup.

GENERAL BIOLOGY LAB MANUAL LAB 3: MEMBRANES

Exercise B: Dilution Problems

V1 = (30 mg/L) (5 mL) / (150 mg/L)

GENERAL BIOLOGY LAB MANUAL LAB 3: MEMBRANES

Homework Assignment 2: Figure

GENERAL BIOLOGY LAB MANUAL LAB 4: MICROSCOPES & CELLS

LAB 4: MICROSCOPES & CELLS

From Textbook (Freeman et al. 2014): Sections 7.1 & 7.2

GENERAL BIOLOGY LAB MANUAL LAB 4: MICROSCOPES & CELLS

Fig. 1. Basic anatomy of a compound microscope. Descriptions of each component on the

GENERAL BIOLOGY LAB MANUAL LAB 4: MICROSCOPES & CELLS

GENERAL BIOLOGY LAB MANUAL LAB 4: MICROSCOPES & CELLS

GENERAL BIOLOGY LAB MANUAL LAB 4: MICROSCOPES & CELLS

Exercise A: Anatomy and Use of Light Microscopes

Obtain a letter e microscope slide. Use stage clips to hold the

To observe the e at a higher power of magnification (with the

GENERAL BIOLOGY LAB MANUAL LAB 4: MICROSCOPES & CELLS

What are the total magnifications available on the dissecting

GENERAL BIOLOGY LAB MANUAL LAB 4: MICROSCOPES & CELLS

Fig. 1. Production of CO2 by fermentation in control (n = _ ) and ___________