Rice Science, 2010, 17(4):

Copyright 2010, China National Rice Research Institute.

Published by Elsevier BV. All rights reserved
DOI:

A Simple Method for Preparation of Rice Genomic DNA

SUN Chuan1, 2, #, CHEN Gang1, 2, #, RAO Yu-chun1, ZHANG Guang-heng1, GAO Zhen-yu1, LIU Jian1,
JU Pei-na1, HU Jiang1, GUO Long-biao1, QIAN Qian1, ZENG Da-li 1
(1State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006, China; 2Agricultural College,
Yangzhou University, Yangzhou 225009, China; #These authors contributed equally to this paper)

Abstract: The extraction of DNA is often the most time consuming and laborious step in high-throughput molecular genetic analysis
and marker assisted selection (MAS) programs. A simple method for preparation of rice genomic DNA was developed. A small
amount (150 mg) of leaf tissue of rice seedling, 500 L of extraction buffer, and one steel bead were put into a 2-ml microcentrifuge
tube. After vigorously mashing for 2 min, 5 L of the supernatant was directly applied to PCR amplification. Otherwise, the
supernatant was precipitated with 2-volume of ethanol to obtain high quality genomic DNA. This method is simple, rapid, low cost, and
reliable for PCR analysis. One person can manipulate as many as 96 samples for PCR in 10 min. It is especially suitable for
genotyping of large number of samples.
Key words: DNA extraction; high-throughput PCR; marker assisted selection; gene mapping

PCR-based molecular marker technology has been used

widely in rice gene mapping, gene cloning, marker assisted
selection (MAS) and so on. In rice and most other crops,
PCR-based markers such as simple sequence repeats (SSR or
microsatellites) are preferable for MAS because of their high
levels of polymorphism, reliability, technical simplicity,
requirement for relatively small amounts of DNA and low cost.
Moreover, with the development of biotechnology, the
completion of rice genome sequencing and the increasing
number of functional genes identified, marker-assisted
selection being more and more popular in crop improvement.
The potential advantages of molecular breeding demonstrated
by numerous examples of MAS in rice and other crops have
prompted many rice breeding and research institutes to
establish biotechnology or DNA marker laboratories (Yu et al,
2003; Zhao et al, 2006; Wang et al, 2009).
However, the preparation of DNA from plants is still a
time-consuming, laborious and expensive work because of the
multiple manipulation steps (Steenkamp et al, 1991; Aljanabi
and Martinez, 1997; McCouch et al, 1998). The extracted DNA
is only used in screening and identification, and most of
remained DNA will be discarded as redundant. To overcome
this problem, several DNA extraction protocols for different
crops have been described, based on the use of 96-well
microtiter plates (Dilworth and Frey, 2000; Paris and Carter,
2000; Mace et al, 2003) and the increasing number of relatively
expensive commercial products that are now available [e.g.,
DNeasy 96 Plant Kit (QIAGEN), Wizard Magnetic 96 DNA
Plant System (Promega)]. Nevertheless, a bottleneck still
Received: 22 July 2010; Accepted: 28 September 2010
Corresponding authors: QIAN Qian (qianqian188@hotmail.com);
ZENG Da-li (dalizeng@126.com)

exists.

MATERIALS AND METHODS

Plant materials
Rice varieties such as Nipponbare, TN1, Chunjiang 06,
Zhonghua 11, C-bao, Jaimaica were used in this study. Rice
seeds were germinated in an incubator for 2 to 3 days. After
germinating, the seeds were sowed into paddy fields.
Reagents and chemicals
Solution A: 150 mmol/L sorbitol, 125 mmol/L Tris, 25
mmol/L EDTA-Na2, 500 mmol/L NaCl, 20 mmol/L Na2SO3,
0.8% (w/v) hexadecyl trimethyl ammonium bromide (CTAB),
2% (w/v) sarkosyl, pH 7.5.
Solution B: 100 mmol/L Tris, 500 mmol/L KCl, 18
mmol/L MgCl2, 1% (w/v) Triton X-100, pH 9.0.
Solution C (DNA extraction): Solution A, solution B and
ddH2O at a ratio of 1:2:7, then add 0.2% (v/v)
-mercaptoethanol before using.
Solution D (10PCR buffer): 50 mmol/L Tris, 250
mmol/L KCl, 9 mmol/L MgCl2, 0.5% (w/v) Triton X-100, 10%
(v/v) bovine serum albumin (BSA), pH 9.0.
DNA isolation protocol
The protocol of DNA isolation is as follows:
1) Add 500 L solution C to a 2-mL microcentrifuge tube
containing small pieces of tender leaves (0.01 g rice samples),
then add 200 mL chloroform and one steel bead (diameter
about 5 mm).
2) Grind the samples in the collection microcentrifuge

Rice Science, Vol. 17, No. 4, 2010

tube for 2 min in a cell cracker (TissueLyser II, German) with
28 Hz.
3) Centrifuge the microcentrifuge tube at 8 00010 000
r/min for 46 min at room temperature.
4) Transfer 5 L of supernatant to a new 96-well plate for
PCR amplification.
To gain high quality genomic DNA, the process as
followed should be held on.
5) According to the screening of PCR analysis, 400 L
supernatant from the step (3) was transfer to a new
microcentrifuge tube, then add 400800 L ethanol and shake
gently, incubate for 3060 min at room temperature. Centrifuge
at 8 00010 000 r/min for 1015 min at room temperature, and
then discard supernatant.
6) Wash the pellet with 500 L 70% ethanol, centrifuge at
8 00010 000 r/min for 1015 min at room temperature,
discard supernatant.
7) Dry the pellet, then dissolve the pellet in 200 L ddH2O
and directly use as template for polymerase chain reaction
(PCR) amplification or store at -20C.

10.0 kb
1.5 kb
1.0 kb

Fig. 1. Preparation of genomic DNAs from leaf tissues of rice.

M, Marker; Lanes 1 to 8, Prepared rice genomic DNA.

10 min. Twenty microliters crude genomic DNA from the

supernatant was checked by means of agarose gel
electrophoresis (Fig. 1). It shows that the preparation of
genomic DNA from leaf tissues of rice is reliable, and most
DNA fragments show high-quality and suitable for studies in
which large DNA fragments need to be amplified.
SSR analysis
To determine the reliability and applicability of this
method, 34 pairs of simple sequence repeats (SSR) and
sequence tagged site (STS) markers distributed on different
linkage were selected to PCR amplification (Table 1). The PCR

PCR analysis
PCR was performed with a total volume of 20 L,
containing 5 L crude DNA, 2 L solution D as PCR buffer, 5
nmol/L each of dNTPs, 8 pmol/L primers and 1 U of Taq DNA
polymerase. PCR reactions were run in 96-well thermal cycles
(EASTWIN, Inc) under the following conditions: 1 cycle of 4
min at 94C, 35 cycles of 1 min at 94C, 45 s at 55C and 45 s
at 72C, followed by a final 10 min extension at 72C. The
PCR products were separated by electrophoresis on 3%4%
agarose gels. The gels were stained with ethidium bromide and
detected under UV light.
Assay of DNA yield and purity
Absorbances (A) at 260 nm and 280 nm (and background
absorbance at 320 nm) were measured using a Beckman
Spectrophotometer (Model No: DU800, Beckman Coulter,
Fullerton, California, USA), for determining the yield and
purity of the DNA.

RESULTS
Rapid preparation of genomic DNA
Since little material is needed for DNA extraction,
harvesting can be performed at rice seedlings. To obtain
genomic DNA for PCR amplification, about 0.01 g rice leaf
was sampled into microcentrifuge tubes, and the samples do
not need to be weighed. Add 500 L solution C, 200 mL
chloroform and one steel bead (diameter about 5 mm). The
samples were grinded with the TissueLyser II. The supernatant
can be directly used for PCR amplification after centrifugation.
One person can manipulate as many as 96 samples for PCR in

Table 1. The developed primers used in this study.

Primer
RM3252

Pairs of primer (5-3 )

Size of product
(bp)
153

GGTAACTTTGTTCCCATGCC
GGTCAATCATGCATGCAAGC
RM1247 TTCTCAGCTGCTTGTGCATC
183
CCTCCAAGGTAAAGGGGTTC
NB316
153
ATGTGTGCTTCGGTCGTGAT
TTCTCACATCTGAACCTCTCC
NB478
188
GGGCTGTCATTGTCACGAG
GGCATCGACTCATCAGCC
NB444
187
TCGTCCATCCATTGATGCTAATC
TGCCATTTATCATTTGCCATTC
NB876
147
TTGGAGAGACGAGCGAGAGAG
AGTGTTGGTGAGCATAGCAGTTG
NB231
185
AGAATAGAGTGCATCATCGTC
AACCTGATAGGTGGAAGATGTAC
NB342
128
ACCATGCCTCATGACATGTGG
TGGTTTTGTGTAGCTCTGTCGG
NB558
143
GCTCCACAGAAAAGCAAAGC
TGCAACAGTAGCTGTAGCCG
NB789
206
GAATGGGATTAGACGATTTG
CCATGAGTGACATCAAAAGG
NB678
87
CCTGGTTAGCACTACAGCTC
TAGTTGGCTATGTCCACACC
NB665
126
AAGTCGAAGGAGGAGTTGTC
CACCGAAACTAAAGACGAG
NB442
139
CTTTGTAGACCGTATCATTGTCC
GAAACGTCTGGCGAGTTCC
NB642
131
GCAGGAGTATATACGCAGGG
ACTCAGCGTGCTCAACCTG
NB942
130
ATCAGCAGCAGATTGGTGC
TACCCTTAGTCTCCTATGTGTCC
Other 19 pairs of SSR markers randomly selected from the
Gramene database were RM7581, RM1361, RM3740,RM8213,
RM17713, RM13, RM19234, RM1019,RM5055, RM6356, RM1328,
RM5795, RM217, RM3183, RM5711, RM3819, RM1337, RM7376
and RM493.

SUN Chuan, et al. A Simple Method for Preparation of Rice Genomic DNA
products were separated by electrophoresis on 3%4% agarose
gels and visualized by staining with ethidium bromide and
viewing under UV light (Fig. 2). The results show that the
amplicons from different primers were all clear and intensive,
and the sizes of fragments are reasonable. In addition, the crude
genomic DNAs from different rice varieties and tissues were
used in this study. The PCR amplicons also show specific and
intensive (Fig. 3), which indicates that DNA extracted by this
method is stable and suitable for PCR-based techniques.

Purity and yield

During the screening in PCR analysis, some selected
plants should be extracted high-quality DNA for other using.
The crude genomic DNA is suitable for not only PCR
amplification, but also for refining high-quality DNA with
ethanol. As is shown in Fig 5, the content of DNA from the
stored samples at 4C was precipitated with ethanol. The
amount of DNA is closed to 30 g and free from the storage
term within a week.

PCR analysis for storage term

With this method, screening a large population with
flanking PCR makers is fairly easy to complete within a week,
which significantly save time for select recombinants in a large
mapping population. Thus, the crude genomic DNA do not
need to stored for long term. Thus, the crude DNA from 0.01 g
fresh leaf were halved and stored at 4C and -20C everyday,
respectively. To the 7th day, all samples were used to PCR
amplification. Fig. 4 is the PCR products by agarose gel
electrophoresis, we can clearly see that the PCR amplicons
amplified form the DNA stored at 4C were as clear and
intensive as those from -20C. It indicates that the crude DNA
stored at 4C was reliable for PCR amplification within a week.

Fig. 2. A total of 34 pairs of SSR and STS primers were used for
PCR analysis.

Fig. 3. PCR products of RM3252 with different rice varieties and

tissues.
A, PCR products of RM3252 were from different varieties. Lanes
1 to 6 were Nipponbare, TN1, Chunjiang 06, Zhonghua 11, C-bao and
Jaimaica, respectively. B, PCR products of RM3252 were from
different tissues. Lanes 7 to 12 were young leaf, old leaf, stem, sheath,
panicle and root, respectively.

DISCUSSION
Many methods for plant DNA extractions have been used
for rice (Oryza sativa) including classic SDS method and
CTAB method (Stewart and Via, 1993; Ausubel et al, 1996). In
addition, some simple modified methods were also developed
and used in rice such as modified SDS method (Wang H W et
al, 2002), alkali boiling method (Wang X F et al, 2002),
NaOH-TrisHCl neutralized method (Chen et al, 2005), cutter
and SDS method (Zhao et al, 2006), miniprep extraction
method (Qiu et al, 2006). Nevertheless, the bottleneck still
exists due to the efficiency, the stability to PCR amplification
or costs.
Unlike the above mentioned plant DNA extraction
protocols, the method in this studies mixed the chloroform with
extraction buffer to remove the containing protein during the
tissue grinded. The alteration significantly minimizes time and
the use of laboratory materials. One person can process as
many as 96 samples within 10 min. Secondly, this method does

Fig. 4. PCR products of RM1247 amplified with the template DNA

stored at different temperatures.
A, The template DNA was stored at 4C. B, The template DNA
was stored at -20C.

Fig. 5. The content of nucleic acid extracted with alcohol.

Rice Science, Vol. 17, No. 4, 2010

not include the use of ethanol or isopropanol to precipitate
DNA pellet. It reduces a variety of reagents in the process.
Thirdly, the amount of crude genomic DNA isolated from 0.01
g fresh leaf can be used for more than a hundred PCR
amplifications. It also gains about 30 g high-quality DNA
from fresh leaf via the precipitation with ethanol. Moreover,
since the little material is enough for DNA extraction in this
method, samples can be performed one week later after sowing.
Furthermore, the crude DNA can not only be directly used for
PCR amplification, but also be precipitated with ethanol for
high-quality DNA. Finally, this method can also be used in
other crops.
DNA isolated from plants often contains certain
compounds that inhibit PCR amplification (Kamalay et al, 1990;
John, 1992). In this method, chloroform and -mercaptoethanol
were added in the extraction buffer to get rid of the
contamination such as polysaccharides and the polyphenols in
leaf tissues which are the compounds that can contribute to the
inhibition of DNA amplification during PCR reactions
(Sambrook and Russell, 2002). Additionally, the
chloroform-partition step assures good DNA quality. High
molecular DNA is obtained with relatively low partial
degradation, and could be amplified by PCR. The addition of
BSA in PCR buffer also improves the specificity in PCR
amplification (Silvy et al, 2004). Notwithstanding, RNA was
detected in crude genomic DNA, and no effect on PCR
amplification was found, therefore, an RNAse treatment was
not necessary. The content of DNA precipitated with enthanol
in this method is similar to the CTAB method, and the DNA is
suitable for long-term storage. This method is suitable for
varied rice tissues, such as root, culm, seed etc., and for other
plants as well.

19(6): 561563. (in Chinese with English abstract)

Dilworth E, Frey J E. 2000. A rapid method for high throughput
DNA extraction from plant material for PCR amplification.
Plant Mol Biol Rep, 18: 6164.
John M E. 1992. An efficient method for isolation of RNA and
DNA from plants containing polyphenolics. Nucl Acids Res,
20(9): 2381.
Kamalay J, Tejwani R, Keith R G. 1990. Isolation and analysis of
genomic DNA from single seeds. Crop Sci, 30(5): 10791084.
Mace E S, Buhariwalla H K, Crouch J H. 2003. A high-throughput
DNA extraction protocol for tropical molecular breeding
programs. Plant Mol Biol Rep, 21(4): 459a459h.
McCouch S R, Kochert G, Yu Z H, Wang Z Y, Khush G S, Coffman
W R, Tanksley S D. 1988. Molecular mapping of rice
chromosomes. Theor Appl Genet, 76: 815829.
Paris M, Carter M. 2000. Cereal DNA: A rapid high-throughput
extraction method for marker-assisted selection. Plant Mol Biol
Rep, 18(4): 357360.
Qiu F L, Wang H H, Chen J, Zhuang J Y, Hei L, Cheng S H, Wu J
L. 2006. A rapid DNA miniprep extraction method for
large-scale rice mutant screening. Chin J Rice Sci, 20(3):
329332. (in Chinese with English abstract)
Sambrook J, Russell D. 2002. Molecular CloningA Laboratory
Manual. 3rd edn. Huang P T translated. Beijing: Science Press.
(in Chinese)
Silvy M, Pic G, Gabert J, Picard C. 2004. Improvement of gene
expression analysis by RQ-PCR technology: Addition of BSA.
Leukemia, 18(5): 10221025.
Steenkamp J, Wild I, Lourens A, Helden V P. 1991. Improved
method for DNA extraction from Vitis vinifera. Am J Enol Vit,
45: 102106.
Stewart C N Jr, Via L E. 1993. A rapid CTAB DNA isolation
technique useful for RAPD fingerprinting and other PCR

ACKNOWLEDGMENTS
This work was supported by grants from the Ministry of
Agriculture of China for transgenic research (Grant No.
2008ZX08009-003), the National Natural Science Foundation
of China (Grant Nos. 30710103903 and 30771160) and the
Natural Science Foundation of Zhejiang Province, China
(Grant No. R3090023).

applications. BioTechnique, 14(5): 748750.

Wang H W, Wu C, Zhao X Y, Wang J H, Zhang R Y, Wang Y F.
2002. A rapid method for preparation of PCR template using
SDS. J Hebei Univ: Nat Sci, 22(2): 186188. (in Chinese with
English abstract)
Wang L, Long Y M, Liu Y G. 2009. Amethod for rapid preparation
of plant genomic DNA for PCR analysis. Mol Plant Breeding,
7(2): 425428. (in Chinese with English abstract)
Wang X F, Yang J B, Xiang T H, Li L, Ni D H. 2002. A new
method for PCR reaction from alkali-treated rice leaf tissues.

REFERENCES

Chin J Rice Sci, 16(1): 6770. (in Chinese with English

abstract)

Aljanabi S M, Martinez I. 1997. Universal and rapid salt-extraction

Yu S W, Liu Y B. 2003. Application of molecular marker

of high quality genomic DNA for PCR based techniques. Nucl

techniques in rice genetics and breeding. Acta Agric Univ

Acids Res, 25: 46924693.

Jiangxi, 25(1): 111116. (in Chinese with English abstract)

Ausubel F M, Brent R, Kingston R E. 1996. Phenol/SDS method

Zhao H X, Xie P, Huang Z J, Ju C M, Zhou Y. 2006. An improved

for plant RNA preparation. In: Current Protocols in Molecular

method of extracting rice genomic DNA. J Hubei Univ: Nat Sci,

Biology. vol.1. New York: John Wiley and ssons, Inc.

12(4): 389392. (in Chinese with English abstract)

Chen W Y, Bao J S, Zhou X S, Shu Q Y. 2005. A simplified rice

DNA extraction protocol for PCR analysis. Chin J Rice Sci,