International Journal of Agricultural

Science and Research (IJASR)

ISSN(P): 2250-0057; ISSN(E): 2321-0087
Vol. 6, Issue 5, Oct 2016, 135-146
TJPRC Pvt. Ltd

IN VITRO EXPRESSION OF VIGNA MUNGO PROTEASE INHIBITOR GENE

THAT CONFERS RESISTANCE AGAINST LIPAPHISERYSIMI IN
TRANSGENIC MUSTARD
POONAM TIWARI1, PUJA SINGH2, B. C SABAT3 & REKHA KANSAL4
ICAR-National Research Centre on Plant Biotechnology, LBS Building, Pusa Campus, New Delhi
1,2
3

Research Scholar, NRCPB, New Delhi, India

Senior Scientific Officer, Mewar University, India

4

Principal Scientist, NRCPB, New Delhi, India

ABSTRACT

Agriculture continues to play a pivotal role in Indian economy. Crop losses due to insect pests are a
significant factor in limiting food production. Use of agrochemicals imparting crop protection has resulted
in serious environmental hazards. Therefore, the challenge today is to achieve stable crop production with

effective against insect pests like Lipaphis erysimi. Full length protease inhibitor gene from Vigna mungo
was isolated, sequenced, cloned in pENTR-D-TOPO vector, subcloned into an expression vector
(Gateway Destination vector pET301/CT-DEST) and transformed into BL21 DE3 pLysS competent cells of
E. coli for protein expression studies. Artificial diet assay revealed that Vigna mungo protease inhibitor
protein had significant levels of resistance against Lipaphi serysimi when incorporated into artificial diet at

Original Article

safe and eco-friendly strategies. Plants accumulate a set of defense proteins like protease inhibitors that are

0.1% (w/v). Therefore, they can be genetically manipulated to produce agronomically important crop.
Tissue culture techniques are applied to develop high yielding, aphid resistant Brassica juncea harbouring
Vigna mungo protease inhibitor gene was cloned under phloem specific rolC promoter in a binary vector,
mobilized to Agrobacterium tumefaciens and used to transform Brassica juncea cv. varuna using hypocotyls
as explants. The integration of protease inhibitor gene and marker gene was confirmed by molecular
analysis. The developed transgenic Brassica juncea will have more resistance to Lipaphis erysimi and
contributing in economic growth of farmers and the country with enhanced crop production
KEYWORDS: Vigna mungo, Brassica juncea, Lipaphis erysimi & Agrobacterium tumefaciens

Received: Aug 03, 2016; Accepted: Aug 22, 2016; Published: Sep 03 2016; Paper Id.: IJASROCT201617

INTRODUCTION
With the development of genetic engineering, genes encoding insecticidal proteins of plant origin have
been isolated and transferred to crops to enhance insect resistant. Plant protease inhibitors have been well
established to play a potent defensive role in crop protection by interfering with digestive biochemistry of the
insect. Proteases inhibitors are polypeptides that bind to insects mid-gut proteolytic enzymes, causing a reduction
in the availability of amino acids, blocking the growth and development of insect through inhibiting digestive
enzymes (Laskowskiet al., 1980), reducing fecundity, increasing mortality and decreasing weight, thus providing a
www.tjprc.org

editor@tjprc.org

136

Poonam Tiwari, Puja Singh, B. C Sabat & Rekhakansal

natural defense against herbivorous insects (Ryan, 1990; De Leo et al., 1998; 2002; Hilderet al., 1987; 1999; Johnson et al.
1989; Pernas et al., 1999; Gatehouse et al., 1999; Ussuf et al., 2001; Rahbe et al., 2003; Zhu- Salzman et al., 2003).
Protease inhibitors have been used to induce resistance to Lepidopteran, Coleopteran and Hemipteran insect pests in
transgenic plants, due to their small size, abundance, stability and high specificity for a particular class of digestive
enzymes of insects (Ussufet al., 2001; Abdeen et al., 2005; Green et al., 1972;; Koiwa et al., 1998; Mosolov et al., 2001;
Lawrence et al., 2002; Srinivasan et al., 2005). Insect digestive proteases can be classified as serine, cysteine, aspartic and
metallo proteases inhibitors (Richardson, 1977). Protease inhibitors are the product of a single gene and coding regions of
these inhibitors are small, devoid of introns (Wang et al. 2008) that inhibit proteolytic enzymes of insect pest. (Hilder et al.
1993), thus forming an excellent choice for engineering pest-resistance into plants. Further, there is no evidence that
proteinase inhibitors have toxic or deleterious effects on mammals. These advantages make protease inhibitors an ideal
choice to be used in developing transgenic crops resistant to insect pests. cDNA sequences encoding different protease
inhibitors from leguminosae, solanaceae and gramineae family been used for the development of transgenic crop such as
potato, oilseed, rapeseed, tobacco, cereals as a part of integrated pest management programs. (Kuroda et al., 2001; Gruden
et al., 1997; Murdock et al., 1988; Leple et al., 1995; Urwin et al., 1995, 1998; Koiwa et al., 1997; 1998; Schuler et al.,
1998; Lecardonne let al., 1999; Ussuf et al., 2001; Maqbool et al., 2001; Ceci et al., 2003; Macedo et al., 2003). Thus,
insect resistant genetically modified crops will minimize the possible environmental side-effects of the hazardous
pesticides by engineering genes that encode natural biodegradable proteins with no harmful effect to animals and human
beings.

MATERIALS AND METHODS

Cloning of Vigna Mungo Protease Inhibitor Gene in pET Expression System
PCR amplification of (GenBank Accession no.HQ629949) was done using gene specific primers with the addition
of Vigna mungo protease inhibitor CACC at the 5 end of the forward primer as UPIF 5caccatgatatcgtgcatgcctgc3 and
reverse primer as UPIR 5 gtcatcatctttatccatggattt 3 using Phusion DNA polymerase enzyme. The PCR reaction was
denatured at 98C for 30 sec, followed by 30 consecutive cycles of denaturation at 98C for 30 s, annealing for 30 sec at
55C, extension at 72C for 30 sec, and then a final single extension at 72C for 10 min to get the Vigna mungo protease
inhibitorfragment amplified product. The amplified PCR products was analysed on 1% agarose gel electrophoresed at 40
volt for 3 h and visualized using a gel documentation system. Entry clone was generated by ligating amplified Vigna
mungo protease inhibitor with pENTR-D-TOPO vector, followed by transformation in single shot TOPO10 chemically
competent cells. The PCR positive colonies were used to generate the expression clone. LR recombination reaction was
carried out using pET301/CT-DESTC-terminal fusion vector with 6X His-tag and the positive entry clone, followed by
transformation in one shot TOPO10 chemically competent E coli cells. Positive clones were sequenced and transformed
into expression host cell BL21 (DE3) pLysS of E. coli for protein expression studies (Sambrook and Russell, 2001).
The positive colonies with the desired protein were confirmed by colony Blot. The colonies were first placed on
nitrocellulose filter membrane and then on LA plate containing kanamycin (50g/ml) and IPTG (0.25 mM-1mM) and
incubated for 4 hrs at 37 C for induction of protein. The purple color positive colonies were then selected and streaked on
a LA plate with kanamycin (50g/ml) to check the efficacy against lipaphis erysimi.
Expression, Purification and Analysis of Recombinant Proteins
BL21 (DE3) pLysS of E. coli harbouring Vigna mungo protease inhibitor were grown in 5 ml of LB medium
Impact Factor (JCC): 4.8136

NAAS Rating: 3.53

In Vitro Expression of Vigna Mungo Protease Inhibitor Gene that Confers

Resistance against Lipaphis erysimi in Transgenic Mustard

137

containing kanamycin (50 g/ml) and chloramphenicol (35 g/ml) at 37C with shaking at 200 rpm. 3ml of overnight
grown culture was transferred into 30ml of fresh LB medium and allowed to grow till OD600 value reached 0.6, Isopropylb-D-thiogalactopyranoside (IPTG) was added to final concentration of(0.25 mM-1mM)/ L into the culture and the culture
continued growth at 37C for 4 h to induce the expression of the fusion protein. After 4 hours of incubation at 37C with
shaking at 200 rpm, cells were lysed using lysis buffer (1% TriX100, 20mM Tris-HCl, 10mM EDTA, pH7.5) and
incubating at RT for 15 minutes. The cells were harvested by centrifugation 6000 rpm for 20 minutes. The location of the
expressed recombinant protein was examined on 12% SDS-PAGE from the lysed pellet. Ni-NTA Fast Start kit
(QIAexpress) was used to purify the protein. The lysed cell lysate of Vigna mungo protease inhibitor was incubated for
30min on ice and the cells were harvested by centrifugation at 14,000rpm for 10 min. The 6 His-tagged protein lysate was
transferred to a fresh tube and was collected from the Fast Start column containing 5 ml of Ni-NTA resins. The column
was washed several times with wash buffer. Eluted purified protein of Vigna mungo protease inhibitor was assessed on
12%SDS-PAGE along with the E. coli BL21 (DE3) as controls and the concentration was evaluated by the Bradford
method.
Western Blot Analysis of Recombinant Proteins
Western blot analysis was done of the purified proteins of Vigna mungo protease inhibitor. The samples were
subjected to SDS12% PAGE gels. Following electrophoresis, the proteins were transferred onto nitrocellulose membrane
(Amersham) by electro blotting (Towbin et al., 1979). Western Breeze Chromogenic Immunodetection Kit was used for
immunodetection of purified protein. After protein transfer, the membrane was blocked by incubating with blocking
solution for 30 minutes, and was incubated by Primary Antibody Solution at 1:1000 dilutions for 1 hour. Later the
membrane was incubated with alkaline phosphatase conjugated to anti-mouse secondary Antibody Solution for 30 minutes.
The membrane was washed and analyzed with Chromogenic Substrate to develop bands on the membrane.
Artificial Diet Assay
Diet incorporation assays were conducted as described by (Li et al., 1997) for the rearing of aphids. Purified
Vigna mungo protease inhibitor protein was incorporated at 0.1% (w/v). Controls containing no protein and containing no
diet were set up for each trial. The diet solution was incorporated into feeding vessels based on those described by (Hilder
et al., 1995). Petri dishes (90 mm diameter) were lined with water-soaked filter paper. Ten second instar nymphs of
lipaphis erysimi were transferred from the host plant with a moistened camel hair brush and the petri dishes sealed with a
stretched parafilm membrane. An aliquot of 500 l diet was added on the parafilm membrane and the diet was covered
with a layer of stretched parafilm membrane to form a feeding sachet through which the aphids could imbibe the diet.
Three replicates were set up for treatment and controls. The feeding chambers were maintained in greenhouse, illuminated
with a 16/8 h light/ dark at a temperature of 25C. Diets were changed every other day to ensure a fresh nutrient supply.
The number of surviving aphids was recorded every 2 days.
Transformation of Brassica Juncea cv. varuna using Vigna Mungo Protease Inhibitor Gene
Brassica juncea cv. varuna was transformed with Vigna mungo protease inhibitor (GenBank Accession
no.HQ629949) cloned at in binary vector pOREO4 under the control of phloem specific (rolC) promoter by Agrobacterium
mediated transformation according to the method described by (Tiwari et al., 2016). The Agrobacterium culture was grown
to an OD600before used for co-cultivation of hypocotyls as explants. The co-cultivated explants were placed on

www.tjprc.org

editor@tjprc.org

138

Poonam Tiwari, Puja Singh, B. C Sabat & Rekhakansal

co-cultivation medium containing BAP (2g/L), NAA (0.2g/L) and AgNO3 (3.5 g/L), and kept in dark for 2 days at
251C. The shoots were regenerated on selection medium containing MS media augmented with BAP (2g/L), NAA
(0.2g/L), AgNO3 (3.5 g/L), cefotaxime (250 g/L) and kanamycin (30 g/L)) at 25 1C with 16 h light: 8 h
photoperiod. The well-grown shoots (23 cm in length) were excised carefully and then transferred onto rooting medium
containing MS, IBA (2g/L) and kanamycin (30g/L). The rooted plants were acclimatized, hardened and transferred to
pots with autoclaved soil and agropeat in the ratio of 2:1 and then to glasshouse of National Phytotron Facility, IARI, New
Delhi for further growth.
Molecular Analysis
Total genomic DNA was isolated from leaves of the kanamycin- resistant transformed and untransformed control
plants of Brassica juncea cv. varuna. The presence of transgene in putative transgenic plants was detected by PCR method
with gene specific primers UPIF- 5ggtaccatagatatgacatcgtgcatgcctgc3 and UPIR-5cgctcgatatcttagtcatcatctttatcca3. For
amplification of selection marker gene, the forward primer was nptIIF- 5caagccaagcacagaattga3 and reverse primer was
nptIIR- 5gcatctccatgtgtcaccac3. The PCR was performed in a total volume of 25 ml containing containing 1 lDNA, 10
pmol each of primers, 10 mmoldNTPs, 1 PCR buffer, 1 MgCl2 and 0.5 U Taq polymerase (Fermentas life Science).
The PCR reaction was carried out by denaturing the template at 94C for 3 min followed by 35 cycles of amplification
(1 min at 94C, 45 sec at 53C and 1 min at 72C) and by extension at 72C for 10 min as previously described
(Tiwariet al., 2016). Semi-quantitative one-step RT-PCR analysis was done with 2g of total RNA from young leaves of
transgenic plants was used as the template in RT-PCR with the forward primers UPIF and reverse primers UPIR by using
one-step RT-PCR kit (Takara, Dalian, China). The RT-PCR reaction for the house-keeping gene (actin gene) using specific
primers ActinF 5ctcacgctatcctccgtctc 3 and ActinR 5' ttctccaccgaagaactgct 3' was performed as previously described
(Tiwariet al., 2016).
Segregation and Southern Blot Analysis
The seeds obtained from the PCR positive T0 plants of Brassica juncea cv. Varuna were sown on strength MS
medium containing 50 g/L kanamycin to perform segregation analysis. Kanamycin resistant green plantlets were
transferred to soil and grown under greenhouse condition for further development. Stable integration of the Vigna mungo
protease inhibitorgene in the kanamycin resistant plants was demonstrated by Southern blot analysis. Total Genomic DNA
was extracted from the mature leaves of one month old control and transgenic plants of T1 plant and digested with Eco RI,
followed by separation in 0.8% (w/v) agarose gel. The gels were blotted onto positively charged nylon membranes
(Hybond-N+; Amersham Biosciences). Vigna mungo protease inhibitor gene was used for [-32 P] dCTP radiolabel probe
prepared using hexalable DNA labeling kit (MBI, Fermantas). Hybridization was done according to the protocol as
previously described (Tiwariet al., 2016). The membranes were exposed to Kodak X-ray film for seven days at 80C and
then developed in presence of infra-red rays using Kodak developer and fixer.

RESULTS
The pET system allows regulated expression of heterologous genes in E. coli from the T7 promoter (Rosenberg et
al., 1987; Studier & Moffatt, 1986; Studier et al., 1990). The lac operator sequence placed downstream of the T7 promoter
binds to IPTG binds and releases the tetrameric repressor allowing the transcription of genes in the lac operon in BL21
strains.

Impact Factor (JCC): 4.8136

NAAS Rating: 3.53

In Vitro Expression of Vigna Mungo Protease Inhibitor Gene that Confers

Resistance against Lipaphis erysimi in Transgenic Mustard

139

In the present study the primary objective is to clone and express Vigna mungo protease inhibitor gene in the pET
cloning system is to assess the efficacy against lipaphis erysimi and develop a more potent insecticide with broader
activity. Vigna mungo protease inhibitor gene under the control of phloem specific (rolC) promoter is also used for the
development of transgenic Brassica juncea cv. Varuna through Agrobacterium mediated transformation using hypocotyls
as explants against lipaphiserysimi.
Cloning and expression Vigna Mungo Protease Inhibitor Gene
pET expression system was used to clone Vigna mungo protease inhibitor gene to allow regulated expression of
the protease inhibitor gene in E. coli from the T7 promoter. The sequence encoding for Vigna mungo protease inhibitor
gene was amplified by PCR using Phusion DNA polymerase and cloned in pENTR-D-TOPO vector to generate entry
clone, followed by LR recombination reaction with pET301/CT-DESTC-terminal fusion vector through Gateway cloning
system, (Fig.1). The expression clone was then transformed into E. coli BL21 DE3 pLysS cells to drive expression of
Vigna mungo protease inhibitor when induce with 1mM IPTG 4 hours of incubation at 37C. 25 kDa induced protein
bands were assessed on 12%SDS-PAGE, (Fig.2). The protein was then purified using Ni-NTA Fast Start kit (QIAexpress)
and immunudetected using Western Breeze Chromogenic Immunodetection Kit.Immunudetection confirmed the
presence of a single polypeptide of the correct predicted molecular weight of ~25 KDa, (Figure 3).

Figure 1: Cloning of Vigna Mungo Protease Inhibitor Gene in pET Expression System

Figure 2: SDS-PAGE of the Induced Protein Sample of Vigna Mungo Protease

Inhibitor Gene Transformed in BL21DE3 pLysS Cells at 4hrs of Induction
www.tjprc.org

editor@tjprc.org

140

Poonam Tiwari, Puja Singh, B. C Sabat & Rekhakansal

Figure 3: Western Blot Analysis of Vigna mungo Protease Inhibitor Proteins

Artificial Diet Assay
The insecticidal effect of Vigna mungo protease inhibitor against lipaphis erysimi has been tested at 0.1% (w/v) in
a wholly defined artificial diet. Results showed that Vigna mungo protease inhibitor protein had significant levels of
resistance against aphids (Graph 1). All the aphids fed without diet died on day 6. The mean number of aphids fed with diet
containing 0.1% Vigna mungo protease protein was significantly less than that fed only with diet constantly throughout the
assay period with the differences significant at P < 0.05 after day 6, and all the aphids fed with diet containing 0.1% Vigna
mungo protease inhibitor protein in died on day 12.

Graph 1: Artificial Diet Assay of Vigna Mungo Protease Inhibitor Protein against Lipaphiserysimi. No Diet:
Aphids were Fed without Diet. Diet-Protein: Aphids were Fed with Diet Containing No Vigna Mungo
Protease Inhibitor Protein. Diet+Protein: Aphids were Fed with Diet Containing 0.1% (w/v)
Vigna Mungo Protease Inhibitor Protein. The Differences Significant was (p0.5) after 6 days
Transformation of Brassica Juncea cv. Varuna using Vigna Mungo Protease Inhibitor
Vigna mungo protease inhibitor gene was expressed in Brassica juncea by transforming hypocotyls through

Impact Factor (JCC): 4.8136

NAAS Rating: 3.53

In Vitro Expression of Vigna Mungo Protease Inhibitor Gene that Confers

Resistance against Lipaphis erysimi in Transgenic Mustard

141

Agrobacterium tumefaciens strain GV3101using pOREo4 transformation vector in which Vigna mungo protease inhibitor
gene expression was driven by phloem specific (rolC). After co-cultivation with Agrobacterium explants were transferred
to the selection medium and checked for callus induction. Callus was induced from the cut end of the hypocotyls. The
selected callus were successively transferred to the regeneration medium and then to the rooting medium. After 3 weeks,
green plantlets develop white, thick and hairy adventitious roots. Out of the 653 calli co-cultivated, a total of 84kanamycin
resistant plants were regenerated. The efficiency of transformation was estimated to be was calculated to be 18% - 19%
(mean- 13.2 %) by establishing the ratio between the numbers of kanamycin resistant transgenic plants obtained versus the
number of calli co-cultivated. The surviving green plantlets were acclimatized, hardened and transferred to soilrite and
grown under glasshouse conditions in National Phytotron Facility, IARI, New Delhi for further development (Figure 4).

Figure 4: Transformation of Brassica Juncea cv. Varuna using Vigna Mungo Protease
Inhibitor Gene under Phloem Specific (rolC) Promoter

MOLECULAR ANALYSIS
PCR, RT PCR and Southern Analysis
Transgenic plants transformed with the Vigna mungo protease inhibitor gene constructs were analysed by PCR to
verify the presence of the protease inhibitor coding sequence in the Brassica juncea genome and nptII marker genes. PCR
confirmed the presence of protease inhibitor gene integration in transgenics showing positive amplicon of 475bp with gene
specific primers and of 728 bp with nptII specific primers (Fig. 5A&B). No PCR band was observed with the non
transformants (data not shown). The expression of the protease inhibitor gene was examined by semi-quantitative one-step
RT-PCR. The total RNA was subjected to one step RT-PCR amplification using gene specific primers which were
www.tjprc.org

editor@tjprc.org

142

Poonam Tiwari, Puja Singh, B. C Sabat & Rekhakansal

expected to give an amplicon of 475 bp (Figure 5C). Hence the presence of 475 bpamplicon would indicate the expression
of Vigna mungo protease inhibitor gene in the T0 plants. -actin gene was used as internal control.

Figure 5: Molecular Analysis of Putative Transgenics: (A) PCR of T0 Plants with Gene
Specific Primers; (B) PCR with nptII Specific Primers; (C) RT-PCR with
Gene Specific Primers; (M lane - 1kb ladder; +ve control- transgenic
plants; -ve control- non transgenic plants)
The PCR positive were transferred to the greenhouse and seeds were collected for segregation analysis. Plants
showing a 3:1 segregation were further used for the isolation of homozygous lines. Southern blot analysis was performed
by digesting the genomic DNA isolated from T1 transgenic leaves with restriction enzymes EcoRI and allowed to
hybridized with [-32 P] dCTP radiolabel probe of Vigna mungo protease inhibitor, prepared using hexalable DNA labeling
kit (MBI, Fermantas). Southern analysis confirmed the integration of the Vigna mungo protease inhibitor gene in the
genome of UBV7, UBV10, UBV15, and UBV34 transgenic lines (Fig.6A&B). No signal was detected in non
transformants.

Figure 6: Southern Blot Analysis of T1 Transgenic Plants using Vigna Mungo Protease
Inhibitor Gene Probe. Six Transgenic Plants UBV7 (Lane 1), UBV10 (Lane 2),
UBV15 (Lane 3), and UBV34 (Lane 4) showed a Single Locus for Vigna Mungo
Protease Inhibitor Integration in the Host Genome

Impact Factor (JCC): 4.8136

NAAS Rating: 3.53

In Vitro Expression of Vigna Mungo Protease Inhibitor Gene that Confers

Resistance against Lipaphis erysimi in Transgenic Mustard

143

CONCLUSIONS
In summary, Vigna mungo protease inhibitor gene expressed in pET301/CT-DESTC-terminal fusion vector
through Gateway cloning system shown to exhibit resistance against lipaphiserysimi. The expression efficiency of protease
inhibitor gene demonstrated to be effective for engineering resistance to lipaphiserysimi, which is an important observation
from the agronomic point of view. The high level of inhibitory effect of protease inhibitor gene on Aphids in the present
study indicates that protease inhibitor gene is a novel candidate for transgenic engineering against phloem feeding insects.
Thus, protease inhibitor gene expressive transgenic Brassica juncea would certainly reduce yield loss and become
environment friendly crop contributing to integrated pest management programme.

ACKNOWLEDGEMENTS
The authors are grateful to the Indian Council of Agriculture Research, New Delhi, for financial assistance to
Dr. Rekha Kansal under the Networking project on transgenic crops. The authors also thank to Dr. Akahay Talukdar and
Arun Kumar for their support to provide the National Phytotron facilities.
REFERENCES
1.

Abdeen A, Virgos A, Olivella E, Villanueva J, Aviles X, Gabarra R, Prat S (2005) Multiple insect resistance in transgenic
tomato plants over-expressing two families of plant proteinase inhibitors. Plant Molecular Biology 57, 189-202.

2.

Boulter, D. (1993). Insect pest control by copying nature using genetically engineered crops. Biochemistry, vol. 34, p. 14531466.

3.

Ceci L R, Volpicella M, Rahbe Y, Gallerani R, Beekwilder J, Jongsma M A (2003) Selection by phage display of a variant
mustard trypsin inhibitor toxic against aphids. The Plant Journal 33, 557-566.

4.

De Leo, F. and R. Gallerani. (2002). The mustard trypsin inhibitor 2 affects the fertility of Spodopteralittoralislarvae fed on
transgenic plants. Insect Biochem.Mol. Biol. 32: 489- 496.

5.

De Leo, F., M. A. Bonade-Bottino, L. R. Ceci, R. Gallerani, and L. Jouanin. (1998). Opposite effects on spodopteralittoralis
larvae of high expression level of a trypsin proteinase inhibitor in transgenic plants. Plant Physiol. 118: 997-1004.

6.

Gatehouse, A. M. R. (1999). Biotechnological applications of plant genes in the production of insect resistant crops. In S. L.
Clement and S. S. Quisenberry (eds.), Global Plant Genetic Resources for Insect Resistant Crops, London, CRC Press, pp.
263-280.

7.

Green T. R. and Ryan C. A. (1972) Wound-induced protease inhibitors in plant leaves: a possible defence mechanism against
insects. Science, 175, 776-777.

8.

Gruden K, Strukelj B, Ravnikar M, Poljsak-Prijatelj M (1997). Potato cysteine proteinase inhibitor gene family: molecular
cloning, characterisation and immunocytochemicallocalisation studies. Plant Mol. Biol. 34: 317-323.

9.

Hilder V., Powell KS, Gatehouse AMR, Gatehouse JA. (1995). Expression of snowdrop lectin in transgenic tobacco plants
results in added protection against aphids. Transgenic Res; 4:18-25.

10. Hilder VA, Boulter D (1999) Genetic engineering of crop plants for insect resistancea critical review. Crop Prot 18:177
191.
11. Hilder, V. A., A. M. R. Gatehouse, and D. Boulter. (1993). Transgenic plants conferring insect tolerance: protease inhibitor
approach. In S. D. Kung and R. Wu (eds.), Transgenic Plants, vol. 1, Engineering and Utilization. New York: Academic Press,
pp. 317-338.
www.tjprc.org

editor@tjprc.org

144

Poonam Tiwari, Puja Singh, B. C Sabat & Rekhakansal

12. Hilder, V. A., A. M. R. Gatehouse, S. E. Sheerman, F. Barker, and D. Boulter. (1987). A novel mechanism of insect resistance
engineered into tobacco. Nature 330: 160-163.
13. Johnson R., Narraez J., An G. and Ryan C. A. (1989) Expression of protease inhibitors I and II in transgenic tobacco plants:
effects on natural defense against Manducasextalarvae. Proceedings of the National Academy of Sciences of the United States
of America, 86, 9871-9875.
14. Koiwa H., Bressan R. A. and Hasegawa P. M. (1997) Regulation of protease inhibitors and plant defense. Trends in Plant
Science, 2, 379-384.
15. Koiwa K, Shade RE, Zhu-Salzman K, Subramanian L, Murdock LL, Nielsen SS, Bressan RA, Hasegawa PM (1998) Phage
display selection can differentiate insecticidal activity of soybean cystatins. The Plant Journal 14, 371-379.
16. Kuroda M, Kiyosaki T, Matsumoto I, Misaka T, Arai S, Abe K (2001). Molecular cloning, characterization and expression of
wheat cystatins, Biosci. Biotechnol. Biochem., 65: 22-28.
17. Laskowski M. Jr. and Kato, I. (1980) Protein inhibitors of proteinases. Annual Review of Biochemistry, 49, 685-693.
18. Lawrence P. K. and Koundal K. R. (2002) Plant protease inhibitors in control of phytophagous insects. Electronic Journal of
Biotechnology, 5, 93-109.
19. Lecardonnel A., Chauvin L., Jouanin L. O., Beaujean A., Prevost G. and Sangwan- Novrreel B. (1999) Effect of rice cystatin I
expression in transgenic potato on Colorado potato beetle larvae. Plant Science, 140, 71-79.
20. Leple J. C., Bonade M., Bontt S., Augustin G., Pilate V., Dumanoise L. R, Delplanque A., Cornu D. and Jouanin L. (1995)
Toxicity to Chrysomelatremulae(Coleoptera: chrysomelidae) of transgenic polars expressing a cysteine inhibitor. Molecular
Breeding, 1: 319-328.
21. Li L, Gao L, Gao Y. Li. Studies on rearing aphids with artificial nutrition solution. J Shanxi AgricUniv 1997; 17:225-8.
22. Macedo MLR, Andrade LBS, Moraes RA, Xavier-Filho J (1993) Vicilin variants and the resistance of cowpea
(Vignaunguiculata) seeds to the cowpea weevil (Callosobruchusaculatus). Comp. Biochem.Physiol. 105C:89-94.
23. Maqbool SB, Riazzudin S, Loc NT, Gatehouse AMR, Gatehouse JA, Christou P (2001) Expression of multiple insecticidal
genes confers broad resistance against a range of different rice pests. Molecular Breeding 7, 85-93.
24. Mosolov, V. V., L. I. Grigoreva, and T. A. Valueva. 2001. Plant proteinase inhibitors as multifunctional proteins. Appl.
Biochem. Microbiol. (Moscow) 37: 643-650.
25. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant
15:473497.
26. Murdock LL, Shade RE, Pomeroy MA (1988) Effects of E-64, a cysteine proteinase inhibitor, on cowpea weevil growth,
development and fecundity. Environmental Entomology 17, 467-469.
27. Pernas, M. Lopez-Solanilla, E. Sanchez- Monge, R. Salcedo, G. Rodriguez- Palenzuela. (1999). P., Mol. Plant-Microbe
Interact. 12, 624-627.
28. Rahb Y, Deraison C, Bonad-Bottino M, Girard C, Nardon C, Jouanin L (2003) Effects of the cysteine protease inhibitor
oryzacystatin (OC-I) on different aphids and reduced performance of Myzuspersicae on OC-I expressing transgenic oilseed
rape. Plant Sci 164:441450.
29. Richardson M J, (1977). The proteinase inhibitor of plants and microrganisms. Phytochemistry, 16,159-169.
30. Rosenberg, Alan, H. (1987). Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene. 56(1): 125-135.

Impact Factor (JCC): 4.8136

NAAS Rating: 3.53

In Vitro Expression of Vigna Mungo Protease Inhibitor Gene that Confers

Resistance against Lipaphis erysimi in Transgenic Mustard

145

31. Rosenberg, Alan, H. (1987). Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene. 56(1): 125-135.
32. Ryan CA (1990). Protease inhibitors in plants: genes for improving defenses against insects and pathogens. Annu Rev
Phytopathol 28:425449.
33. Sambrook J., Fritsh E. F. and Maniatis T. (1989) Molecular cloning: A laboratory Manual, 2nd ed. Cold Spring Harbor
Laboratory, Cold Springs Houbour, NY.
34. Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor:
Cold Spring Harbor Laboratory Press.
35. Schuler, T. H., G. M. Poppy, B. R. Kerry, and I. Denholm. 1998. Insect-resistant transgenic plants. Trends Biotech. 16: 168175.
36. Srinivasan A, Chougule NP, Giri AP, Gatehouse JA, Gupta VS (2005) Podborer (HelicoverpaarmigeraHubn.) does not show
specific adaptations in gut proteinases to dietary CicerarietinumKunitz proteinase inhibitor. J Insect Physiol 51:12681276.
37. Studier, F. W., & Moffatt, B. A. (1986). Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of
cloned genes. Journal of molecular biology. 189(1): 113-130.
38. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. (1990). Use of T7 RNA polymerase to direct expression of
cloned genes. Methods Enzymol.185: 6089.
39. Tiwari Poonam; Singh Puja; PrajapatRakesh Kumar; Sabatta B. C and KansalRekha. Cloning of Vigna mungo Protease
Inhibitor Gene and its Efficacy against AphidsResearch Journal of Agricultural Sciences 7(2): 382-389.
40. Urwin PE, Lilley CJ, Mcpherson MJ, Atkinson HJ (1997). Resistance to both cyst and rootnot nematodes conferred by
transgenic Arabidopsis expressing a modified plant cystatin. Plant journal, 12(2): 455-461.
41. Ussuf KK, Laxmi NH Mitra R. (2001). Proteinase inhibitors. Plant derived genes of insecticidal protein for developing insectresistant transgenic plants. Current Sci. 80, 7(10): 47-853.
42. Zhu-Salzman K, Ahn J-E, Salzman RA, Koiwa H, Shade H, Balfe S (2003) Fusion of a soybean cysteine protease inhibitor and
a legume lectin enhances anti-insect activity synergistically. Agricultural and Forest Entomology 5, 317-323.

www.tjprc.org

editor@tjprc.org