Data Evaluation and Reporting

BB2803

Elena Chiriac
1420549

HCV Case Study

INTRODUCTION
According to WHO, HCV infects 150 million individuals worldwide,
accounting for 15-20% of cases of acute hepatitis. Following acute
infection, approximately 50-80% of HCV patients will succumb to chronic
infection. In 20% of chronic hepatitis C infection (CHC) cases, affected
individuals develop cirrhosis and a further of 4-5% will develop
hepatocellular carcinoma at a yearly rate. Furthermore, HCV is also
associated with a range of extrahepatic events including type 2 diabetes
mellitus, insulin resistance, glomerulopathies, etc. and are at a high risk of
developing liver fibrosis and steatosis. {{45 Li,H.C. 2015;}} About 15-45
% of people will experience spontaneous clearance of the virus within 6
months of infection, associated with polymorphisms of the IL28B gene as
well as other genetic host factors. {{46 Rau,M. 2012;}}
WHO classifies HCV as a blood borne virus with a high incidence rate
amongst injecting drug users. It can also be transmitted via improper
sterilization of medical equipment or unscreened blood transfusions.
HCV is a RNA virus belonging to the Flaviviridae family, hepacivirus genus.
It is spherical, presenting a lipid bilayer envelope; heterogeneous in size,
ranging from 40-100 nm, with spike-like projections, represented by viral
glycoproteins E1 and E2. {{48 Catanese,M.T. 2013;}} It has a single,
positive-sense RNA strand, packaged by core proteins, approximately 9,6
kb in length that codes for a 3000 bases polyprotein. This polyprotein is
processed cotranslationally and/or posttranslationally by viral and cellular
proteases into 10 mature viral proteins. {{48 Catanese,M.T. 2013;}}
The long open frame of the HCV genomic RNA is framed by untranslated
regions. The 5 UTR contains the internal ribosomal entry site that directly
binds the 40S ribosomal subunit and initiates HCV polyprotein translation.
{{49 Penin,F. 2004;}} The 3 UTR is a short sequence that is mainly
involved in minus-strand priming during HCV replication. {{45 Li,H.C.
2015;}} Both untranslated regions have highly conserved sequences,
essential for genome replication and polyprotein translation, which makes
them preferred targets for HCV genome detection across different
genotypes. {{49 Penin,F. 2004;}} The HCV polyprotein precursor is
processed at the endoplasmatic reticulum level into three structural
proteins separated by the pore forming p7 from the non-structural (NS)
ones in the order NH2-C-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5BCOOH.The structural proteins include the core protein (C) that forms the
nucleocapsid; and envelope proteins E1 and E2, non-covalent
heterodimers, essential for host-cell entry and inducing fusion with the cell

membrane. {{49 Penin,F. 2004;}} The non-structural proteins form the

replicon complex. The NS5A plays an important role in the regulation of
viral replication and NS5B is a RNA-dependent RNA polymerase. {{50
Scheel,T.K.H. 2013;}} NS2 and NS3 are viral proteases with NS3 also
presenting NTP-ase/RNA helicase activity. The NS4B membrane protein
shapes the membranous web that supports HCV replication. {{50
Scheel,T.K.H. 2013;}} Viral replication takes place in the cytoplasm and
its assembly and further release is associated with secretory pathways
that are coupled to lipoprotein biogenesis. {{50 Scheel,T.K.H. 2013;}}
HCV presents a large genetic heterogeneity, grouped into seven
genotypes (1-7, that present around a 30% sequence divergence amongst
themselves) and various number of sub-types (a,b,c, etc that present
around a 20% divergence amongst different isolates) {{50 Scheel,T.K.H.
2013;}}. Genotype 1 is the most prevalent worldwide (46%) followed by
genotype 3 and 2.{{45 Li,H.C. 2015;}} While the disease association of
the HCV genotypes is largely similar, there are differences in infectivity
rates, pathogenicity as well as disease progression and response to
interferon therapies. {{52 Chayama,K. 2011;}}
HCV is a non-cytopathic virus that induces cell necrosis of the liver cells by
various mechanisms including auto-immune mediated lysis as well as
phenomena such as oxidative stress, insulin resistance and steatosis.
{{53 Irshad,M. 2013;}}
The standard of chronic HCV infection treatment is a combination therapy
of Plegyated Interferon (PEG-Ifn) and Ribavirin for a duration of 24-48
weeks depending on HCV genotype. This combination treatment
reportedly attains a sustained virological response (SVR) characterized as
aviremia 24 weeks after the end of treatment. HCV genotype 1 attains
SVR in 45% of cases, whereas genotypes 2 and 3 in 80% of cases.{{54
Nishikawa,H. 2012;}}

Results
The patient was a 45 year old Caucasian male that reported a history of
drug abuse. At the initial screening he reported malaise that had
aggravated in recent months. During the physical examination, he showed
signs of mild jaundice and an initial diagnosis of hepatitis was made. His
laboratory analysis at the time of diagnosis showed a mild liver injury
profile with all liver injury markers (Bilirubin and ALT) above normal as
shown in table 2.1. The patient was screened for anti-HCV antibodies and
presented a positive result. The diagnosis of active HCV infection was
confirmed by a molecular assay to detect the presence of HCV RNA using
real time polymerase chain reaction and the HCV RNA IU quantification
was at 10^5 IU/ml. The initial laboratory investigations invalidated the
presence of hepatitis A or hepatitis B infection through Anti-HAV and
HBsAG testing negative. The primary investigation also showed no signs
of the patient suffering from an autoimmune disorder since antinuclear
antibody and anti-mitochondrial antibody testing presented negative
results.

2.1: Lab investigations of the patient X at the

time of his first visit to his physician.
Total Bilirubin: 3.9 mg/dl (normal: 0.3 to 1.9 mg/dL)
ALT: 136 U/L (normal: 7 to 56 units per liter)
Anti HCV antibody titer: 1/80 dilution (cut-off 1/20 dilution)
HCV RNA: 10^5 RNA IU/ml (cut-off 200 IU/ml)
by SmartCycler II Real-time PCR
Anti-HAV: negative
HBsAg: negative
Antinuclear antibody: negative
Anti-mitochondrial antibody: negative
2.1 Initial Laboratory investigations show hepatic damage and the presence of HCV
infection
The genotype of HCV was assayed using RT-PCR and identified as belonging to an
E2 hypervariable sequence of the HCV1 strain as shown in Annex 1.
The patient was administered antiviral treatment (Plegyated Interferon and
Ribavirin) and his serum viral load was monitored over time as shown in table
2.2. It showed a favorable logarithmic decline within the first 6 weeks and it

resulted in an undetectable HCV load starting with week 24 that continued for
the next 18 weeks that were monitored. The standard treatment course for HCV
genotype 1 using Plegyated Interferon and Ribavirin is 48 weeks. The patient
showed a high likelihood of attaining SVR since serum viral load became
undetectable at week 24 {{55 Palumbo,E. 2011;}} but decided to discontinue
treatment 2 weeks short of the recommended course.

2.2: Effect of pegylated interferon and ribavirin on serum viral load in

the patient X (detection limit for HCV RNA is 100 IU/ml)
Time
after
treatment
start
0 weeks
4 weeks
6 weeks
12 weeks
18 weeks
24 weeks
30 weeks
36 weeks
42 weeks

HCV
IU/ml

RNA

550,000
33,000
1204
510
190
44
12
11
10

Table 2.2: Patient showed good response to antiviral treatment with a high likelihood of
attaining SVR
The patient was admitted two years later in a local hospital showing signs of
jaundice, ascites and splenomegaly, serious indicators of liver dysfunction.
Jaundice is a result of unconjugated Bilirubin in the blood, indicative of loss of
liver function. Ascites and splenomegaly are indicative of portal hypertension,
possibly due to liver fibrosis. A liver biopsy was taken and the histopathological
report suggested chronic hepatitis with cirrhosis as shown in figure 2.3. The
histology slide shows regenerative nodules surrounded by thick bands of fibrous
tissue characteristic of liver cirrhosis. The medical signs and confirmation via
histopathologic slide may indicate decompensated liver cirrhosis.

Figure 2.3: Histopathologic slide using trichrome staining of a liver biopsy presenting a cirrhotic
regenerative nodule surrounded by thick bands of mature fibrous tissue
The patient was treated with Plegyated Interferon and Ribavirin but his
symptoms did not improve and he did not show any response to treatment. Over
the next 28 months, the patients HCV viral load and ALT levels were
continuously monitored as shown in graph 2.4. The graph indicates chronic
hepatitis C with constantly high viremia quantification ranging from 10^5 and
10^6 IU/ml. The patient also presented moderately elevated ALT levels
fluctuating between 120 and 160 IU/L. Long term elevated levels of ALT have
been correlated to histological inflammation of the liver and were considered a
primary indication of persistent HCV infection.
Chart 2.4: Constantly elevated ALT level and persistent viremia characteristic of Chronic Hepatitis C

180

160

140

120
ALT (IU/L)

100

80

60

ALT

HCV RNA Log10(IU/ml)

HCV RNA

40

20
0

0
36 40 42 44 46 48 50 52 56 60 64

Months after initial diagnosis

The patients HCV genotype was reexamined by sequencing the HVR1 region of
the envelope 2 gene of the virus and the data for three of the clones is available
in the appendix. The clones sequenced in the assay were detected as a HCV
genotype 3a isolate sequence of the E2 gene, indicating a change from the
original screened HCV 1 genotype.
The patient was screened for anti-HCV antibodies since his initial diagnosis at
various time points as seen in table 2.5. The anti-HCV antibody titre shows a
constant increase over the monitored period. A hypervariable region on the E2
glycoprotein has been suggested as the target for neutralizing antibodies and
studies into the evolution of HVR heterogeneity suggest that antibodies exert
pressure for the variation of this region. Furthermore, neutralizing antibodies

increase in titer and in breadth, exhibiting crossreactivity for multiple HCV strains
once chronic infection has set in. {{64 Rehermann,Barbara 2009;}}

2.5: Anti hepatitis C

antibody titre in
patient X
Time after
initial
diagnosis
0 months
6 months
9 months
36 months
48 months
64 months

Anti HCV titre

80
260
360
420
518
630

Discussion
HCV manages a rapid escape from cellular or humoral immune responses
due to its high replication rate and lack of proofreading capacity.
In patients with working immune systems, the pattern of HCV infection
consists in reactive bile duct changes, the infiltration of parenchymal
tissue by lymphocytes and the presence of lymphoid follicles in portal
areas. The follicles consist of a germinal central structure with activated
clonally restrictive B cells surrounded by follicular dendritic cells and an
outer T cell zone. {{63 Murakami,J. 1999;}} Recent in vitro studies have
shown that B cells bound to HCV virus infect hepatoma cells more readily
than extracellular virions. {{64 Rehermann,Barbara 2009;}}
High expression of TNF receptor 1, CD95 and TNF-related apoptosisinducing ligand and the absence of sufficient growth factors contribute to
a high turnover of T cells that recognize HCV. Their continous recruitment
and death and the lysis of some of the HCV infected hepatocytes as well
as the recruitment of profibrotic and inflammatory cytokines activate
stellate cells that build thin layers of of collagen fiber extensions between
layers of hepatocytes, surrounding the portal area. With disease
progression, fibrous bridges bind adjacent portal areas and cirrhosis
develops. {{64 Rehermann,Barbara 2009;}}

The driving force behind this study is the case of a patient chronically
infected with Hepatitis C that developed decompensated cirrhosis after a
discontinued antiviral treatment of Plegyated Interferon and Ribavirin.
Moreover, the patients HCV infecting strain changed from HCV 1 to
genotype 3a. Considering the patients history in drug use, which was the
most probable route of acquisition of the initial infection, and that his risk
behavior was not monitored before the second hospitalization, it is very
likely that he exposed himself to reinfection with a different HCV strain.
We can likely rule out coinfection or superinfection since the initial
genomic assays only detected one strain of HCV. There are several studies
{{67 Grady,B.P. 2013; 66 van de Laar,T.J. 2009;}} that suggest that HCV
reinfection has a high incidence rate amongst injecting drug users, even
after successful antiviral therapy. These studies, along with chimpanzee
studies {{58 Farci,P. 1992;}} show controversial evidence that the initial
clearance of an HCV infection would offer immune protection against a
subsequent infection with a heterologous strain. There are epidemiological
studies that indicate low incidence of reinfection among patients who
underwent treatment. {{69 Mehta, Shruti H 2002;}} but comparable rates
of reinfection versus incidence have also been reported. {{71 Micallef, JM
2007;}} However, these conflicting results are likely due to differences in
age, risk behavior, frequency of testing and a lack of viral sequencing.
{{67 Grady,B.P. 2013;}} This case study underlines the importance of
educating chronic hepatitis C patients of the importance of avoiding risky
behaviors, especially within the injecting drug user (IDU) cohort since this
population is most exposed with 60-80% of IDUs testing positive for antiHCV antibodies, {{59 Nelson,Paul K. 2011;}} even in countries with
developed strategies for preventing drug equipment sharing.
In the decompensated cirrhosis population, for patients that are
unresponsive to interferon based therapy, DAA therapy (daclatasvir with
sofosbuvir and ribavirin) is recommended. However, death and the need
for liver transplantation were observed in the treatment studies,
suggesting that not everyone benefits from DAA therapy. {{65 Poordad,F.
2016;}}

Conclusion
In conclusion, the present case study suggests an ineffective protective
immunity in HCV infection and suggests protection from HCV re-exposure
in patients with chronic hepatitis C, even after clearance of the virus
following antiviral treatment.
Appendix

1. Sequence data (first screen)

1gaggtgcagctgctcgagtcgggcccaggactggtgaagccttcacagaccctgtccctc
61acctgcactgtctctggtgcctccattagtagtgatagttactactacaactggatccgg
121cagcccgccgggaagggactggagtggattgggcgtatctataccagtgggagcaccaac
181tacaacccctccctcaagggtcgactcaccatttcggtagacacgtccaagaaccagttc
241tccctgaaactgacctctgtgaccgccgcagacacggccgtctattactgtgcgagaact
301ggccgatttttggagtggtttccaaactacggtatggacgtctggggccaagggagcacg
361gtcatcgtctcctcg

2. Sequence data (second screen, clone 1)

1cacacatacatcaccggtagtaatatagctcataataccagagggctcgctagcctcttc
61acctcgggcgccaagcagaagttgcagctggtcaacaccaacggctcgtggcacatcaac
121agtactgccctgaactgcaatgactctttaaacaccgggttcctagctgggttgctttat
181caccataagttcaactccactggatgtcctcaaaggctcagcagttgtaagcccctcgcc
241ttcttcaggcaggggtggggctccttgacagatgctaacatcaccggcccatctaatgat
301agaccgtactgctggcactacgcacctaggccttgtggcatcgtcccggctttaaacgtc
361tgcggtcctgtgtactgctt

3. Sequence data (second screen, clone 2)

1gtcacacacaccgtcggtggcagtgtagctcgtagtaccagctcgctcactagcctcctt
61agtccgggcgccagccagaacctgcagctgatcaataccaatggctcgtggcacatcaac
121cgtactgccctgaactgcaatgattccataaacaccgggttcatagctgggttgatttat
181cgttataggttcaactccaccggttgtcctagtatgctcagcagctgcaagcccatcact
241ttcttcaaccaggggtggggtcccttgacagatggcaatatcagcggtccctctgatgac
301aaaccgtattgctggcactacgcgcctagatcttgtagtactgtcccggcatcaagtgtc
361tgcggccctgtgtactgctt

4. Sequence data (second screen, clone 3)

1cagacacaccccaccggcagtagtatagcttatagtaccagagggctcactagcctcttc
61acctcgggcgccaagcagtggttgcagctggtcaacaccaacggctcgtggcacatcaac
121agtactgccctgaactgcaatgactctttaaacaccgggttcctagctgggttgctttat
181caccataagttcaactccactggatgtcctcaaaggctcagcagttgtaagcccctcgct
241ttcttcaggcagggatggggctccttgacagatgctaacatcaccggcccatctaatgat
301agaccgtactgctggcactacgcacctagaccttgtggcatcgtcccggctttaaacgtc
361tgcggtcctgtgtactgctt